text
stringlengths
1
3.78M
meta
dict
The Warlords of the Wasteland Battle Path has begun! The time has come – the Warlords of the Wasteland campaign is here and now it’s your turn to prove that you are the ultimate warlord out there by mastering all the main modes of Armored Warfare. Between December 14, 2018, and April 11, 2019, you will have the opportunity to participate in the greatest Armored Warfare campaign to date and win exclusive prizes, including the coveted Altay Tier 10 Premium Main Battle Tank and Commander Alisa Korhonen with her unique Mysterious Stranger ability! You can find more information about the Battle Path campaign in our dedicated article or by visiting the Battle Path tab that is now available in your Garage. In order to join the Battle Path campaign, please enter the game and click on the Warlords of the Wasteland icon on the upper bar. From there, you can simply purchase the Battle Path access (either for currency or for Gold). Important: starting early pays off – today and today only, the Battle Path access will be available with 10% discount! The following options are available: Wayfarer Pack, containing: Battle Path access Player title: “Explorer” Decal: “Power” Additionally, for the players who want to start with an extra boost, we have the following bundle available: Warrior Pack, containing: Battle Path access Player title: “Explorer” Decal: “Power” Battle Coins: 10.472 (enough to boost your progress to Level 15) Please note that there might be a delay of up to 10 minutes between the purchase and the access to the event. Two mission descriptions are incorrect: The mission that states you are required to destroy 8000 targets with a missile in reality only requires you to deal 8000 damage The mission that states you are required to hit 15 UAVs in reality requires you to destroy them These issues will be addressed in the near future. Frequently Asked Questions (Click to Open) How does it all work? Simply put, you earn Battle Coins by completing missions and then spend them to raise your Battle Path level while earning Wasteland Loot Crates, camouflages, player avatar, decals and other goodies, including an exclusive reward tank with Premium status, the Tier 10 Altay. You can also get other Premium vehicles as well as two Altay skins. What do I have to do? The Battle Path campaign is divided into four paths (mission chains), each with its set of many missions. By completing the missions, you will receive Battle Coins, which are used to increase your level. Other rewards for completing the missions include Gold, various Loot Crates and Credits. How many levels are there and why should I care? There are 100 levels in total. For reaching Level 50, you will an exclusive reward tank with Premium status, the Tier 10 Altay along with a “Bronze” skin for it. For reaching Level 100, you will receive another, “Gold” skin for the Altay. Along with these prizes, various other rewards await you for every level you reach. Their list can be found on the Battle Path progress bar in the game. How can I start a mission chain (path)? In order to start a mission chain, you need a Token. You will receive a free Token on Level 1, 7 and 13 – you decide which chain you wish to unlock and when. In order to unlock the access to the fourth chain (the “Dire Wolf” missions), you need to complete all the three previous chains first. What are the Battle Coins? The Battle Coins are a unique currency, required to advance through Battle Path levels. You can also spend Battle Coins on completing difficult missions without having to actually complete their requirements in the game. On the Battle Path screen, you can see your Battle Coin balance in the upper right corner. How can I obtain Battle Coins? There are several ways of obtaining them: By completing missions – each completed mission will award you with a certain amount of Battle Coins By purchasing them or winning them in an official Armored Warfare event By just playing Regarding the last point, for each minute you spend alive in battle (with the exclusion of downtime such as waiting for a respawn), you will receive 1 to 3 Battle Coins. Furthermore, winning increases this income by 25 percent in PvE (including Special Operations) and by 50 percent in PvP and GLOPS. Additionally, the best players of the team by Experience obtained will receive an additional bonus – extra 4 Battle Coins for being first in PvE or Spec Ops, extra 5 Battle Coins for ending up in Top 3 in PvP and, last but not least, extra 10 Battle Coins for ending up in Top 3 in GLOPS match. How long will the campaign be available? The Battle Path missions will be available between December 14, 2018, and March 14, 2019. The remaining time can be seen in the Battle Path window in the game. What unique prizes can I look forward to for completing the Battle Path missions? Apart from the Altay, the unique prizes include: T-55 Enigma Scorpion Kastet M1A1 Storm Commander Alisa Korhonen We have, of course, many other prizes for you as well. How do I unlock a mission chain (Path)? You can unlock it by using a Token. A Token can be obtained by reaching Level 1, 7 and 13 respectively. Can I complete the missions within a chain in any order? No. You need to complete them in the order specified by each chain, one after another. It is, however, possible to complete a mission by spending extra Battle Coins (the cost is 2.100 Battle Coins per one mission for the first three chains and 4.150 Battle Coins per one “Dire Wolf” mission). You can see which mission is currently active by visiting the Mission tab of the Battle Path window. The completed missions are marked with a green ticker and the missions that are yet to be unlocked are marked with a lock icon. Can I see the progress of my missions in the game? Yes, in the Battle Path window. Can I complete more missions at the same time, or the next one only starts after the previous one is finished? The next one only starts after the previous one is finished. You need to pick up your mission reward manually in the Battle Path window in order to activate the next mission. However, if you earn more than one Token and unlock multiple chains at the same time, it is theoretically possible to have two or even three missions active simultaneously and to complete them all in one battle (if their requirements do not prohibit you from doing so). How do I know what vehicles to use and what modes to enter when completing a mission? Mission requirements are stated in each mission’s description. They can be restricted by: Mode (for example, “Random Battles” - missions marked as PvP (any) can be completed in both GLOPS and Random Battles) Vehicle class (for example, “LT”) Vehicle tier The fourth chain “Dire Wolf” missions can only be completed in a Tier 9 or Tier 10 vehicle. Do I also need a Token for the Dire Wolf mission chain? No, it is unlocked automatically once you complete all three previous Paths (mission chains). When do I receive a prize that I win, for example by advancing by a level? You will receive it automatically, within 30 minutes of you receiving it. If I didn’t receive the reward I won fair and square, what do I do? Please contact our support service. Can you tell me more about the Wasteland Loot Crates? The Wasteland Loot Crates are obtainable for gaining levels and for purchasing. They are stored in the Inventory tab of your Garage, where you can open them. For more information about the Wasteland Loot Crates, please visit our dedicated article. I can see that some missions require acquiring a certain number of Commendations of various kinds. What are Commendations? Commendations are badges awarded directly in battle for accomplishing any of the following actions: Killing an Enemy (Slayer) Assisting a Kill (Wingman - awarded to the top 3 damage dealers and the active spotter) Damaging an Enemy (Bruiser) Assisting Damage (Facilitator) Designated Damage (Tactician - you designate a target with the AFV or LT ability and the damage to it will count towards this commendation) Spotting an Enemy (Scout) Spotting Damage (Instigator) Allies Hidden By Smoke Shells/Grenades (Blinder) Destroying Enemy Modules (Saboteur - it's worth mentioning that this only is awarded twice per battle) Base Defense (Defender - awarded on removing any amount of base capture progress from an enemy) Completing an Objective (Operative - this is for standard PvE mostly, awarded on completing primary or secondary objectives) The goal of these commendations is to provide real-time visual feedback to players in order to notify them whenever they've earn some rewards. Commendations themselves do not provide additional rewards. Please note that the commendations may be disabled in the UI. In order to make sure they are enabled, please follow these steps: Open the Settings window by pressing the Escape key in the Garage and clicking the Settings button
{ "pile_set_name": "Pile-CC" }
Thank you for supporting Public Advocate of the United States. It's vital we mobilize millions of Americans to prove we are serious about defending our families -- and to prove the Radical Homosexuals wrong. You can help Public Advocate of the United States defend against the damage the Radical Homosexuals will do by making a secure donation today. For the Family, Hon. Eugene Delgaudio President, Public Advocate of the U.S.
{ "pile_set_name": "OpenWebText2" }
Nikolai Zubarev Nikolai (Nikolay) Zubarev (10 January 1894 – January 1951) was a Russian chess master. During World War I, he won ahead of Peter Yurdansky at Moscow 1915, and tied for 4-5th at Moscow 1916. After the war, he won twice Moscow City Chess Championship in 1927 and 1930. He also took 5th in 1919/20 (Alexander Alekhine won), took 3rd in 1920 (Josef Cukierman won), shared 6th in 1922/23 (Nikolai Grigoriev won), tied for 12-13th in 1925 (Aleksandr Sergeyev won), took 2nd behind Abram Rabinovich in 1926, tied for 5-6th in 1928 (Boris Verlinsky won), shared 6th in 1929 (Vasily Panov won), all in Moscow-ch, and took 21st in the Moscow 1925 chess tournament (Efim Bogoljubow won). He participated several times in USSR Chess Championship; tied for 11-12th at Moscow 1920 (Alekhine won), took 10th at Petrograd 1923 (Peter Romanovsky won), tied for 11-13th at Leningrad 1925 (Bogoljubov won), took 4th at Odessa 1929 (quarter final), and took 18th at Leningrad 1933 (Mikhail Botvinnik won). Awarded the International Arbiter title in 1951. References Category:1894 births Category:1951 deaths Category:Russian chess players Category:20th-century chess players
{ "pile_set_name": "Wikipedia (en)" }
Information-seeking behaviors of women with breast cancer. To explore the information-seeking behaviors of women with breast cancer. Sequential, between-methods triangulation. Community-based. 156 women with breast cancer took part in a mailed survey, and 30 women with breast cancer participated in three focus group discussions (n = 11, 12, and 7). Women with breast cancer completed the Miller Behavioral Style Scale (MBSS). Other women with breast cancer participated in one of three age-stratified focus group discussions. Information-seeking behaviors of women with breast cancer. The information-seeking behaviors of women with breast cancer, as measured by the monitoring subscale of MBSS, were not significantly associated with their demographic (e.g., age, socioeconomic class) and illness-related characteristics (e.g., months since diagnosis, surgery, therapeutic regimens). The focus group discussions suggested that the information-seeking behaviors of women with breast cancer were highly individualistic. Although some women actively sought information, others avoided information. In addition, women sometimes fluctuated between seeking and avoiding information. Women sought information to cope with breast cancer, regain a sense of control, increase their feelings of confidence, and help facilitate the decision-making process. Women avoided information to escape from worry, fear, and feelings of negativity and depression. The information-seeking behaviors of women with breast cancer are highly individualistic and are not related to demographic or disease-related characteristics. Breast-care nurses need to be sensitive to the information-seeking behaviors of women with breast cancer. Information seekers should be given maximum information, and information avoiders should be given minimum information. In addition, more research needs to be conducted into the information-seeking behaviors of women with the disease.
{ "pile_set_name": "PubMed Abstracts" }
We have talked extensively on the blog about how society has constructed a gender binary system of male and female, we are each expected to fit the roles of our biological sex. For the majority of people this is a non-issue and they conform well or closely to their aligned role. Some people who are intersexual do not have a clear biological sex, they are to some degree male and female internally, externally or both, and this can pose a dilemna for how they self-identify with regards to gender identity. The other group of people are transgender, they are biologically male or female but their identity does not match their body parts and so they seek to bring harmony between their mind and body through either living as or having elective surgery/hormones to bring their mind/body closer to their gender identity. This brings us to the subject of Genderqueer AKA Third Gendered/Intergender, which has been gaining steam as a movement but also as an alternative label for self-identification. These are individuals who don't want to self-identify as male or female. Some identify more with one gender than the other but live a line of blurred gender. For example a muscular biological male who is athletic but feels comfortable putting make up on, would be an example of someone who is blurring the gender roles, or a womyn who seeks to wear a dress yet also take testosterone to develop more masculine features. Individuals who self-identify as gender queer may consider themselves to be both male and female, androgynous, being neither male or female, or falling completely outside of the gender binary spectrum. Queer is a broad terminology that encompasses different identities and thus genderqueer can be a range of different gender identities in which people experience. How do I deal with someone who is Genderqueer? Please never presuppose someones gender if you are uncertain, it is better to ask how they feel comfortable with you referring to them as opposed to you putting a label on them. It can be a simple question of asking name and what pronouns they feel comfortable with. Genderqueer Pronouns Some genderqueer people may feel more comfortable being referred to by a more prominent gender role they seek such as he/his/him, or she/her, hers. Others however may prefer a gender neutral terminology such as "ze", "per", "zir", "sie" and "hir", "zhe", "hir", "zes" or singular "they" instead of her/his. Other individuals feel comfortable alternating between the masculine/feminine pronouns. There is not one clear cut answer since genderqueers as a group comprise of several gender identities and each person has their own unique variation. What is their sexual orientation? This is a common question. First, its important to note that sexual orientation and gender identity are completely seperate. You can be a butch female and be heterosexual, or an adrogynous bisexual. The way we express our gender is seperate from our sexual orientation, ex: take Ru Paul a famous drag queen who self-identifies as heterosexual. Intergender people may be straight, gay, lesbian, bisexual, queer, or asexual. Some genderqueer people prefer to see themselves as pansexuals which means they are open to all genders sexually. Thus someone who is pansexual would have no problem being in a relationship with someone who is male, female, genderqueer, or transgender. Thank you for your openness on gender variant people and please seek to spread knowledge and love on the subject matter and on other issues of importance to the broader Queer community. Below are some helpful links on/for the Genderqueer community: http://www.genderqueerrevolution.com/ http://unitedgenders.org/ http://androgyne.0catch.com/ http://www.t-vox.org/index.php?title=Main_Page Some YouTube videos on the subject:
{ "pile_set_name": "OpenWebText2" }
Mystery group blankets Michigan seeking ballots from 2016 election Beth LeBlanc | The Detroit News Clerks around the state are getting blanketed with requests to turn over every ballot cast in the 2016 election, as they try to recover from record turnouts in the August primary and prepare for November. The new challenge comes compliments of a woman named "Emily" with no last name. Nearly every clerk in Michigan has received Freedom of Information Act requests signed by Emily asking for copies of every ballot cast in the 2016 presidential election — whether at the polls or by absentee ballot. Voter signature cards have even been sought. “It’s unnerved a lot of the clerks, rightfully so,” Michigan Director of Elections Sally Williams said Friday. Ballots do not contain identifying information and, as such, are subject to disclosure under a public records request, Williams said. The Michigan Secretary of State's office has cautioned the numerous clerks who have called for advice to obtain a deposit for the request and to make sure the check doesn’t bounce, Williams said. The requests, originally reported by the subscription news service Michigan Information and Research Services, were sent from an Astoria, New York, post office box from the “United Impact Group.” The group did not respond to a call and email seeking comment. The requests ask for all election day, absentee and provisional ballots from the 2016 presidential election; ballots that were not counted and the reason they weren’t counted; and accompanying materials such as the envelopes in which the absentee ballots were sent. Some precincts were asked for the polling books listing the names of those who voted, Williams said. President Donald Trump won Michigan by 10,704 votes over Democrat Hillary Clinton in an election in which about 4.8 million votes were cast. The courts ended up stopping a recount requested by Green Party presidential candidate Jill Stein since she had no shot of winning and thus wasn't an aggrieved candidate under state law. Williams said, to her knowledge, Michigan is the only state to have received the recent ballot requests. Ballot retention requirement State law requires local clerks to keep their ballots on hand for 22 months after an election — a retention schedule that would expire in September, Williams said. She has advised clerks to keep the ballots even after that date because of Emily's public records requests. The pending expiration of the retention period may be what's driving the timing of the sudden record request onslaught, said Mark Grebner, an attorney at Practical Political Consulting in East Lansing. In the past 40 years, Grebner has filed more than 10,000 public records requests and litigated dozens of cases resulting from those requests in an effort to collect, collate and analyze voter information for clients. The records request from the United Impact Group, he said, is "ham-handed" and could cost the group millions of dollars to complete. "You could actually do this and have it be more usable for much less money," Grebner said. A couple of teams could travel from city to city with scanners to make digital copies, or the requester could make an arrangement with clerks to just take the ballots before they're scheduled for the shredder in September, he noted. Grebner guessed the requester could be a conspiracy theorist who felt the 2016 election was stolen, Nonetheless, he said, such a request could provide interesting information about voter behavior — whether someone votes only for women or only for people with Irish names or votes a straight Democratic ticket until it comes to judicial picks. "By actually looking at the individual markings on the ballot, you could find out a lot about the patterns by which people vote," Grebner said. "That could be very useful politically.” Requests carry large costs The city of Detroit estimates it would take about a year to process the request, given the city’s hundreds of precincts and the fact that the ballot two years ago was two pages long, said Clerk Janice Winfrey. The city’s lawyers are reviewing the request. “It would be very, very costly to the city of Detroit,” Winfrey said. The request sent to Lansing asked for 11 items and will take roughly 275 hours of staff time to complete, Clerk Chris Swope said. He estimated the request would cost roughly $12,000 and the city wouldn’t be able to complete it until January. “It’s a pretty expansive request,” Swope said, noting he’s never received a public records request similar to the one he received Monday. “I’m trying to figure out exactly what their goal is,” he said. The Pontiac clerk’s office is in the process of calculating how much it would cost to process the request, “but we are nowhere near done,” election specialist Annette Wesley said. The Pontiac clerk’s office has never have received such a request before, noting the request asked for signatures for all of the voters and information on the voters’ information cards. “Everything about the request was unusual,” Wesley said. In the west Michigan community of Kentwood, Clerk Dan Kasunic responded to the United Impact Group request Friday by asking for a deposit of roughly half of the estimated $7,500 cost and for clarification on the request. He asked whether the group would be satisfied with a report on how many absentee ballots were requested and returned rather than the actual ballots, which would have some information in need of redaction. Kasunic said he can't remember ever receiving a request "so onerous." "I’m not sure what they're trying to figure out," Kasunic said. "It's not going to change the results.” eleblanc@detroitnews.com (517) 371-3661
{ "pile_set_name": "OpenWebText2" }
Q: How can I make the await subscribe block complete before executing next line of code? I am subscribing to Google Maps API to pull in coordinates based on an address. My understanding is that by awaiting the subscribe line, it should wait for that code block to finish before moving onto the following lines. async getCoordinates(address) { let url = 'https://maps.googleapis.com/maps/api/geocode/json?address=' + encodeURIComponent(address) + '&key=' + environment.geocodeKey; let lat; let lng; let coord: Coordinate; await this.http.get(url).subscribe(data => { let map = data.json() as Results; lat = map.results[0].geometry.location.lat; lng = map.results[0].geometry.location.lng; console.log("inner lat is: " + lat) }); console.log("outer lat is: " + lat) coord = new Coordinate(lat, lng); console.log("coord lat is: "+ coord.latitude) return coord; } However when I run the app, I see this in the console: outer lat is: undefined coord lat is: undefined inner lat is: 38.912799 That is indicating to me that the code inside the await block is executing last. I have the same results without the async/await. How can I get the subscribe code to execute first and make the other code wait until my lat and lng have a value? Right now they only have values inside the subscribe block, but I can't put a return line inside like this answer suggests. I have read that await/async in Angular is essentially the same thing as a promise and callback. I am treating the result of this async getCoordinates function as a promise already by using .then(): service.getCoordinates(this.address).then( (val) => this.coordinates = val, (err) => console.log(err) ); A: Angular's http service returns an Observable. You can convert this to a promise by using the rxjs toPromise operator: import 'rxjs/add/operator/toPromise'; await this.http.get(url).toPromise().then() ...
{ "pile_set_name": "StackExchange" }
Q: Kotlin: How can a child constructor use its parent's secondary constructor? For example, we have this parent: open class Parent(val id: Int, val name: String?) { constructor() : this(-1, null) } And a child, which must have both a two-param constructor and an empty constructor, like the parent: class Child(id: Int, name: String?) : Parent(id, name) { constructor() : super() // syntax error } How can a child constructor use its parent's secondary constructor? I am aware that I can implement a child constructor passing in the same values as the parent, but this not only seems redundant but also often times my childs have extra parameters for its primary constructor, but don't require intermediary constructors (constructors with params that don't include all the extra params). Here's an example child implementing it that way, in case I wasn't clear: class Child(id: Int, name: String?) : Parent(id, name) { constructor() : this(-1, null) // no syntax error, but redundant } A: The best way to achieve this is imho using default parameters for your constructor class Child(id: Int = -1, name: String? = null) : Parent(id, name) Depending on how much influence you've got on the Parent class, maybe even class Parent(val id: Int = -1, val name: String? = null) This has one "drawback", though: you'll technically get three different constructors. But I can't see how this could be a problem, since you have to handle the id=-1 and name=null cases anyway. Additionally, I don't think your solution class Child(id: Int, name: String?) : Parent(id, name) { constructor() : this(-1, null) } is bad, or "redundant" in any way - on the contrary: it's highly expressive and explicit, so the reader knows exactly what your intention was. A: First, you can't extends the Parent class since it is not opened. Secondly, if a class has declared a primary constructor, you can't call the constructor of the superclass via super keyword. On the other hand, if you want to call the superlcass's constructor by the keyword super. you need make the primary constructor to the secondary constructor, for example: class Child : Parent { constructor(id: Int, name: String?) : super(id, name) constructor() : super() } Another option is let the secondary constructor call the primary constructor by this keyword, but I think it is unnecessary and duplicated parameters with superclass's secondary constructor: class Child(id: Int, name: String?) : Parent(id, name) { constructor() : this(-1, null); }
{ "pile_set_name": "StackExchange" }
--- abstract: 'Standard analyses of the reionization history of the universe from Planck cosmic microwave background (CMB) polarization measurements consider only the overall optical depth to electron scattering ($\tau$), and further assume a step-like reionization history. However, the polarization data contain information beyond the overall optical depth, and the assumption of a step-like function may miss high redshift contributions to the optical depth and lead to biased $\tau$ constraints. Accounting for its full reionization information content, we reconsider the interpretation of Planck 2015 Low Frequency Instrument (LFI) polarization data using simple, yet physically-motivated reionization models. We show that these measurements still, in fact, allow a non-negligible contribution from metal-free (Pop-III) stars forming in mini-halos of mass $M \sim 10^5-10^6 M_\odot$ at $z \gtrsim 15$, provided this mode of star formation is fairly inefficient. Our best fit model includes an early, self-regulated phase of Pop-III star formation in which the reionization history has a gradual, plateau feature. In this model, $\sim$20% of the volume of the universe is ionized by $z \sim 20$, yet it nevertheless provides a good match to the Planck LFI measurements. Although preferred when the full information content of the data is incorporated, this model would spuriously be disfavored in the standard analysis. This preference is driven mostly by excess power from E-mode polarization at multipoles of $10 \lesssim \ell \lesssim 20$, which may reflect remaining systematic errors in the data, a statistical fluctuation, or signatures of the first stars. Measurements from the Planck High Frequency Instrument (HFI) should be able to confirm or refute this hint and future cosmic-variance limited E-mode polarization surveys can provide substantially more information on these signatures.' author: - | Vinicius Miranda,$^{1}$[^1] Adam Lidz,$^{1}$ Chen He Heinrich$^{2}$ and Wayne Hu$^{2,3}$\ $^{1}$Center for Particle Cosmology, Department of Physics and Astronomy, University of Pennsylvania, Philadelphia, PA 19104\ $^{2}$Kavli Institute for Cosmological Physics, Enrico Fermi Institute, University of Chicago, Chicago IL 60637\ $^{3}$Department of Astronomy & Astrophysics, University of Chicago, Chicago IL 60637 bibliography: - 'ReiPopIII.bib' date: 'Accepted XXX. Received YYY; in original form ZZZ' title: 'Signatures of metal-free star formation in Planck 2015 Polarization Data' --- \[firstpage\] reionization – cosmic background radiation – star formation Introduction {#sec:intro} ============ Measurements of the CMB polarization on large angular scales probe the probability that CMB photons scatter off of free electrons produced during the Epoch of Reionization (EoR) [@1982RSPTA.307...97H; @1987MNRAS.227P..33E; @1997PhRvD..55.1822Z]. The EoR is the time period during which the first stars, galaxies, and accreting black holes formed, emitted ultraviolet photons, and ionized surrounding hydrogen and helium gas [@Loeb13]. Recent measurements from the Planck LFI and HFI suggest lower values for the optical depth to electron scattering than implied by earlier Wilkinson Microwave Anisotropy Probe (WMAP) observations [@2015arXiv150201589P; @2016arXiv160503507P; @2013ApJS..208...19H]. These new measurements have important implications for our understanding of the EoR, and have been studied extensively in the literature [e.g. @2015ApJ...802L..19R; @2015MNRAS.454L..76M; @Becker:2015lua; @2016MNRAS.460..417S; @2016arXiv160505374G]. In general, previous theoretical studies have emphasized the lower values of the optical depth preferred by Planck. This is in broad agreement with direct censuses of high redshift galaxy populations – which suggest fairly low ionizing emissivities – and other reionization observables [@2015ApJ...802L..19R]. However, it is still plausible that reionization is a very extended process, and that a small fraction of the volume of the intergalactic medium (IGM) remains ionized out to rather high redshift. In this context, it is important to make use of the full information content of the CMB E-mode polarization power spectrum, which cannot be reduced to a single number quantifying the overall optical depth. It is also important to ensure that CMB E-mode inferences on the overall optical depth are not biased by implicit assumptions on the reionization history itself. Toward this end, we further consider the analysis of Planck LFI data in [@2016arXiv160904788H]. These authors use a principal component (PC) analysis methodology, in which any given reionization history between $6 < z < 30$ is characterized by five numbers. These eigenmode amplitudes completely capture the impact of reionization in this redshift range on the CMB polarization power spectrum observables [@Hu:2003gh; @Mortonson:2007hq; @Mortonson:2008rx]. Interestingly, that study finds a two sigma preference for a contribution to the optical depth from $z \geq 15$ in the LFI data. This result is intriguing because it may indicate the existence of ionizing sources at very high redshift, and this runs somewhat counter to the current conventional wisdom that Planck requires late reionization. For example, this high redshift $\tau$ contribution may arise from metal-free (Pop-III) stars forming in minhalos ($M \sim 10^5-10^6 M_\odot$) at $z \sim 20$ [@2009Natur.459...49B]. In fact, previous work suggested that Planck data may be used to detect such signatures [@2012ApJ...756L..16A], following-up in part on earlier work from e.g. [@2003ApJ...595....1H] that considered the high $\tau$ indicated by early WMAP data, but this possibility has not yet been investigated with the actual Planck data. The Pop-III mode of star formation at high redshift must be fairly inefficient, otherwise these sources would rapidly reionize the universe and overproduce the observed optical depth [@Visbal15], but a small fraction of the gas in these early halos may nevertheless be converted into massive metal-free stars. To explore this scenario, we use the fast likelihood technique developed and tested in [@2016arXiv160904788H] to constrain simple reionization models. Although the PC methodology can not be used to reconstruct the reionization history directly, it is ideal for forward-modeling. This paper hence provides an illustrative example of how the PC technique can be used to constrain the parameters of reionization models. Software implementing the fast likelihood calculations of [@2016arXiv160904788H] is available upon request, and should provide a useful tool for reionization modelers. Reionization Models {#sec:popII_popIII} =================== In the reionization models considered here, we assume that metal-free stars form exclusively in mini-halos that rely on molecular hydrogen for cooling, while we suppose that normal (Pop-II) star formation occurs in more massive halos where the gas cools by atomic line emission [e.g. @Haiman06]. The rationale for this split is that atomic cooling halos likely have one or more mini-halo progenitors that formed Pop-III stars. Supernovae from these short-lived stars subsequently enrich the surrounding gas with heavy elements and this shuts off the Pop-III star-formation mode before the atomic cooling “descendent” halos collapse. The redshift evolution of the average fraction of ionized hydrogen, ${\ensuremath{\langle x_i \rangle}}$, is determined by the following “photon-counting” equation [@Shapiro87; @Madau99; @Loeb13]: $$\begin{aligned} \label{eq:dxdt} \frac{d{\ensuremath{\langle x_i \rangle}}}{dt} = & \frac{d}{dt} \left( \zeta_{\rm II} f_{c,{\rm II}} + \zeta_{\rm III} f_{c,{\rm III}}\right) - \frac{{\ensuremath{\langle x_i \rangle}}}{\bar{t}_{\rm rec}(z)}. \end{aligned}$$ The first two terms describe the rate at which Pop-II and Pop-III stars ionize surrounding hydrogen atoms, while the final term accounts for recombinations. In our model, the ionizing photon production in each population of stars traces the rate at which matter collapses into their respective dark matter host halos. Hence, $f_{c,{\rm II}}$ denotes the collapse fraction in halos above the minimum mass required to host Pop-II stars $M_{\rm min,II}$, while $f_{c,{\rm III}}$ denotes the collapse fraction in the lower mass halos between $M_{\rm min,{\rm III}} \leq M \leq M_{\rm min,II}$ in which Pop-III stars reside. To compute these collapse fractions, we adopt the halo mass function of [@Sheth:1999su]. The recombination term depends on the average time required for ionized hydrogen to recombine, $\bar{t}_{\rm rec}(z)$. This in turn depends on the temperature and the clumpiness of the ionized gas that resides in the intergalactic medium, wth $\bar{t}_{\rm rec} = C/[\alpha_B(T) \bar{n}_e(z)]$. Here $C$ is the clumping factor of the ionized gas, $\alpha_B(T)$ is the recombination coefficient for gas at temperature $T$ and $\bar{n}_e(z)$ is the average electron number density at redshift $z$. We assume case-B recombination and evaluate $\alpha_B$ at a redshift independent temperature of $T=2 \times 10^4$K [@Hui:1997dp]. We choose a redshift-independent clumping factor of $C=2$, in agreement with recent simulations that find small values for the clumping factor [@Pawlik:2008mr; @McQuinn:2011aa]. The minimum mass of the source host halos is set such that Pop-III stars form only in halos where molecular hydrogen cooling is efficient, while normal star formation is assumed to take place in atomic cooling halos. On this basis, we follow [@Haiman06] and assume that metal-free stars form in halos with virial temperatures between $400 \,{\rm K} < T_{\rm vir} < 10^4$K, while Pop-II stars form in halos with virial temperature above $10^4$K. The lower virial temperature is an optimistic value for efficient molecular hydrogen cooling and so we subsequently test the impact of raising the minimum host virial temperature to $10^3$K [@2003ApJ...592..645Y] (see §\[likelihood\]). These considerations set the redshift-dependent values of the minimum host halo masses, $M_{\rm min,III}$, $M_{\rm min,II}$. The ionizing efficiency parameters $\zeta_{\text{II}}$ and $\zeta_{\text{III}}$ can each be written as the product of several uncertain factors, with $\zeta = A_{\text{He}} \times N_\gamma \times f_{\ast} \times f_{\text{esc}}$ [@Loeb13]. Here, $N_\gamma$ is the number of ionizing photons produced per baryon converted into stars, $f_\ast$ is the star-formation efficiency – i.e., it is the fraction of halo baryons that are converted into stars, while $f_{\text{esc}}$ is the fraction of ionizing photons that escape the host halo and ionize atoms in the IGM. Furthermore, $A_{\text{He}} = 4/(4 - 3Y_p)$ is a rescaling factor to account for (singly-ionized) helium and $Y_p$ is the primordial helium mass fraction. Here we assume that metal-free stars have large masses and high surface temperatures, and so produce copious numbers of ionizing photons: our fiducial Pop-III star model adopts $A_{\text{He}} \times N_{\gamma,\text{III}} = 40,000$ [@Bromm01; @Schaerer02]. Note that the expected yield of ionizing photons depends on the Initial Mass Function for this mode of star formation [@2000ApJ...528L..65T], which is still uncertain. In addition, numerical simulations of Pop-III star formation suggest that a high fraction of ionizing photons are able to escape from their host halos and ionize atoms in the IGM [@2006ApJ...639..621A]. Our model therefore takes $f_{\text{esc}, \text{III}}=0.5$. Finally, we vary the Pop-III star-formation efficiency over a broad range of values from $10^{-4} < f_{\ast,\text{III}} < 0.1$. ![Reionization history in the various models from fits to the Planck 2015 data with parameters from Tab. \[tab:models\]. In order of increasing high redshift ionization contributions these are: step-like Tanh model (black solid line), model with only Pop-II stars (purple dot-short-dashed line), model with additional Pop-III contributions (red long-dashed line) and where those contributions are self-regulated (with $x_{\text{max}}=0.2$, green dot-dashed line). A broad range of ionization histories remain consistent with the Planck 2015 data. []{data-label="fig:xe"}](5.pdf){width="0.95\linewidth"} In the case of Pop-II stars in atomic cooling halos, the expected efficiency parameters take rather different values. In this case, typical values considered in the literature are $N_{\gamma,\text{II}} \sim 4,000$, $f_{\text{esc},\text{II}}=0.1$, $f_{\ast,\text{II}} = 0.1$, corresponding to $\zeta_{\text{II}} \sim 50$ [@Lidz16]. Here, we conservatively allow the Pop-II star-formation efficiency coefficient to vary over the range of $5 < \zeta_{\text{II}} < 500$. In Fig. \[fig:xe\] we show an example of a Pop-II dominated ionization model and one where the Pop-III contribution dominates at high redshift. We also compare this history to the step-like Tanh reionization history that is assumed in the standard Planck analysis. As we shall see in the next section, the parameters of these models are chosen to best fit the Planck 2015 data and are listed in Tab. \[tab:models\]. The Tanh history has no ionization at high redshift by assumption of form whereas the Pop-III model has a broader tail than the Pop-II model though both have a sharp decline with redshift. Model $\tau$ $\zeta_{\text{II}}$ $ f_{\ast,\text{III}}$ $ \chi_\text{model}^2-\chi_\text{Pop-II}^2 $ ------------------- -------- --------------------- ------------------------ ----------------------------------------------- Tanh 0.079 – – 0.97 Pop-II 0.081 19.6 – 0 Pop-III 0.089 6.91 $0.00045 $ -1.0 Pop-III self-reg. 0.010 12.1 $0.0011$ -$2.2$ : Model Parameters and Fits \[tab:models\] The sharp decline of the Pop-III contribution is itself dependent on our model assumptions. The Pop-III star formation mode is likely fragile, and disrupted by a range of feedback effects including that from dissociating ultraviolet radiation, photo-ionization feedback, supernova feedback, and chemical enrichment [e.g. @2009Natur.459...49B and references therein]. In our fiducial Pop-III model, we assume that the impact of feedback is roughly encapsulated in the efficiency parameter, $\zeta_{\text{III}}$. While an overall efficiency parameter may capture internal feedback, “external feedback” from surrounding sources is likely important as well; this should impact the overall progression of reionization, and is unlikely adequately captured by our single efficiency parameter. A detailed modeling of feedback is well beyond the scope of this paper, but to explore its plausible impact we consider a second Pop-III model in which we multiply the Pop-III term in Equation \[eq:dxdt\] by $(1 -{\ensuremath{\langle x_i \rangle}}/x_{\text{max}})$ if ${\ensuremath{\langle x_i \rangle}} \leq x_{\text{max}}$, while we set this to zero when ${\ensuremath{\langle x_i \rangle}} > x_{\text{max}}$. This form is meant to mimic that Pop-III star formation may be “self-regulating” [@2012ApJ...756L..16A]. Here metal-free star formation is allowed to continue only in neutral regions, with an increasing suppression factor, while it is suppressed completely when the average ionization fraction exceeds a threshold value of $x_{\text{max}}$. The suppression is meant to roughly capture two separate feedback effects. First, Pop-III star formation will be truncated or less efficient in ionized regions where the gas is photo-heated and unable to collapse into mini-halos. Next, and more important, is that early Pop-III stars will produce a dissociating ultraviolet radiation background that will prevent or suppress molecular hydrogen cooling and the formation of additional stars in mini-halos [@1997ApJ...476..458H]. Although this is only a toy model, we find that $x_{\text{max}}=0.2$ produces a plateau-feature in the reionization history similar to that seen in the simulations of [@2012ApJ...756L..16A], although our plateau is slightly more pronounced. In this model, we also boost the ionizing efficiency factor to start reionization as early as possible to $A_{\text{He}} \times N_{\gamma,\text{III}} \times f_{\text{esc,III}} = 10^5$, although this is of course degenerate with $f_{\ast,\text{III}}$. We show an example self-regulated Pop-III model in Fig. \[fig:xe\]. If the reader prefers to compare models at fixed $A_{\text{He}} \times N_{\gamma,\text{III}} \times f_{\text{esc,III}} $ one can rescale the self-regulated star formation efficiency, $f_{\ast,\text{III}}$ upwards by a factor of five. We show below that this model is a marginally better fit to the Planck LFI data. We can further consider the plausibility of our model value, $x_{\text{max}} \sim 0.2$, by calculating the average specific intensity of the dissociating ultraviolet background at the redshifts and ionized fractions of interest. Ultraviolet photons in the portion of the Lyman-Werner band between $11.2\,{\rm eV} \le h\nu \le 13.6\,{\rm eV}$ can dissociate molecular hydrogen, while even the pre-reionization IGM is largely transparent to such photons, since they lie beneath the hydrogen photoionization edge. However, below the ionization edge photons can still be absorbed out of the dissociating background in Lyman series lines from neutral hydrogen atoms: this imprints a sawtooth feature on the spectrum of the dissociating background [@1997ApJ...476..458H]. A rough estimate of the average specific intensity of dissociating ultraviolet radiation in the Lyman-Werner band, $J_{\text{LW}}$, in our model can be made according to [e.g. @Visbal15]: $$\begin{aligned} J_{\text{LW}}(z) = \frac{c}{4\pi} \frac{\bar{\rho}_b(z)}{m_p} f_{\ast,\text{III}} \frac{N_\text{LW} h \nu_\text{LW}}{\Delta \nu_{\text{LW}}} & \left[f_{c,\text{III}}(z) - f_{c,\text{III}}(z_{\text{hor}})\right]. \label{eq:jlw} \end{aligned}$$ Here $c$ is the speed of light, $\bar{\rho}_b(z)/m_p$ is the baryonic number density at redshift $z$, and $f_{\ast,\text{III}}$ is the Pop-III star formation efficiency, while $N_{\text{LW}}$ is the number of dissociating Lyman-Werner photons per baryon converted into stars, $h \nu_{\text{LW}}$ is their typical energy, and $\Delta \nu_{\text{LW}}$ is the bandwidth of such photons. As in [@Visbal15], we assume that the Lyman-Werner background at redshift $z$ is set by sources out to $z_{\text{hor}} = 1.015 z$. This “Lyman-Werner (LW) horizon” redshift, $z_\text{hor}$, reflects the typical distance a Lyman-Werner photon travels before redshifting into a Lyman series line and being absorbed out of the background. Equation \[eq:jlw\] therefore ignores any absorption between $z$ and $z_\text{hor}$ and neglects any contribution from sources beyond this horizon; it is intended to capture an average suppression from the Lyman series absorption without tracking the full sawtooth effect. In this estimate, we have ignored the model truncation of Pop-III sources in ionized regions and from the build-up of dissociating radiation. We have also neglected any Pop-II contribution, which should be a good approximation for present purposes. We adopt $N_{\text{LW}}=3400$ and $\nu/\Delta \nu_{\text{LW}} = 4.9$ following [@2014MNRAS.445..107V]. According to the estimate of Equation \[eq:jlw\], the intensity of dissociating radiation reaches values of $J_{\text{LW}}/J_{21} \sim 0.1-0.2$ – where $J_{21}$ is the specific intensity in units of $10^{-21}$ ergs cm$^{-2}$ s$^{-1}$ Hz$^{-1}$ str$^{-1}$ – at $z \sim 25$ for $f_{\ast,\text{III}} =10^{-3}$. For this redshift and efficiency factor, ${\ensuremath{\langle x_i \rangle}} \sim 0.1$. Since the contribution of Pop-III stars is suppressed in our self-regulated model by a factor of $1 - {\ensuremath{\langle x_i \rangle}}/x_\text{max}$, this amounts to a factor of two at this redshift and stage of reionization. In other words, our model reduces the contribution of Pop-III stars by a factor of two at $J_\text{LW}/J_{21}\sim 0.1-0.2 $. Note that although $J_\text{LW}$ at a given redshift depends on $f_{\ast,\text{III}}$, the intensity at a given ${\ensuremath{\langle x_i \rangle}}$ is insensitive to the star-formation efficiency since both $J_\text{LW}$ and ${\ensuremath{\langle x_i \rangle}}$ scale in proportion to $f_{\ast,\text{III}}$. This is a bit on the high side of the threshold specific intensities at which previous studies suggest that Lyman-Werner background photons will largely suppress molecular hydrogen cooling: for example, [@2012ApJ...756L..16A] quote plausible threshold values of $J_{\text{LW,th}}/J_{21}= 0.01-0.1$ (see also the references in that work). This may partly reflect that Equation \[eq:jlw\] only provides a rough estimate: [@2012ApJ...756L..16A] find a broadly similar plateau feature at a comparable ionized fraction, although they adopt a lower dissociation threshold. In any case, it is likely that any ionization plateau is less well-defined than in our toy model. For one, larger mass halos will generally contain more molecular gas and more intense ultraviolet radiation should therefore be required to suppress cooling in such halos. For example, in the analytic model of @Visbal15, the authors self-consistently model the build-up of the average Lyman-Werner background along with the ionization history, while incorporating a halo-mass dependent ultraviolet background threshold (above which cooling is completely suppressed). Their model ionization histories do not include a plateau feature, in contrast to the study of [@2012ApJ...756L..16A], which adopts a mass-independent threshold. In addition, some halos will turn around early and be largely self-shielded before the ultraviolet background is intense enough to dissociate molecular hydrogen, while the ultraviolet background will itself be somewhat inhomogeneous.[^2] The mass dependence and inhomogeneities may act to soften any plateau feature. Significantly more detailed models than considered here will be required to understand these issues better. ![The effective $\chi^2$ of various Pop-III models to the Planck LFI data relative to $\chi_\text{Pop-II}^2$ for the best fit model with Pop-II stars only. The red dashed line shows $\chi^2$ as a function of the Pop-III star formation efficiency parameter $f_{\ast,\text{III}}$ for the fiducial model after minimization with respect to the Pop-II efficiency parameter. The green dot-dashed line shows the same for our self-regulated Pop-III model.[]{data-label="fig:posterior"}](1_top.pdf){width="0.95\linewidth"} Planck 2015 Analysis {#likelihood} ==================== In order to compare these models with Planck 2015 data, we use the complete analysis of the reionization information from [@2016arXiv160904788H]. Each reionization history is projected onto a basis of principal components $S_a(z)$ of a cosmic variance limited polarization measurement around some fixed but otherwise arbitrary fiducial ionization history $\langle x^{\text{fix}}_i\rangle(z)$. Only modes $a=1,\ldots, 5$ are needed to specify the entire information content of the E-mode polarization power spectrum for $6 < z < 30$ [@Hu:2003gh]. For any given ionization history, ${\ensuremath{\langle x_i \rangle}}(z)$, the amplitude of each mode is determined according to: $$m_{a}= \frac{1}{24} \int _{6}^{30} dz\, {S_{a}(z) [\langle x_i \rangle(z)-\langle x^{\text{fix}}_i\rangle(z)]}. \label{eq:xetommu}$$ We assume that $\langle x_i \rangle(z)=\langle x^{\text{fix}}_i\rangle(z)$ outside of the range of the integral. The fixed ionization history is specified in [@2016arXiv160904788H] such that hydrogen is fully ionized and that helium is singly ionized at $z \le 6$ and helium is fully ionized at $z \lesssim 3.5$. At $z\ge 30$, the ionization history returns to that given by recombination. Given $m_a$, the 5 principal component amplitudes of a model, we evaluate the effective likelihood ${\cal L}(m_a)$ of that model using the technique of [@2016arXiv160904788H]. Here we interpret this as an effective $\chi^2 = -2\ln {\cal L}$. In order to set the baseline values for comparison, we first minimize $\chi^2$ without any Pop-III contribution to find $\chi^2_{\text{Pop-II}}$. This model is specified as “Pop-II” in Tab. \[tab:models\] and is itself a better fit than the best fit Tanh model. Likewise, for each Pop-III model parameterized by the Pop-III star formation efficiency parameter $f_{\ast,\text{III}}$, we minimize $\chi^2$ over the Pop-II efficiency parameter, $\zeta_\text{II}$. Note that this minimization is equivalent to marginalization over $\zeta_\text{II}$ if the joint posterior probability distribution is a multivariate Gaussian. ![Cumulative optical depth $\tau(z,30)$ in the Planck 2015 analysis. Blue shaded regions are the $68\%$ and $95\%$ constraints from the complete PC analysis. This is compared with the best fit models from Tab. \[tab:models\]: Tanh (black solid line), Pop-II only (purple dot-short-dashed line), additional Pop-III fiducial (red long-dashed line), additional Pop-III self-regulated (green dot-dashed line) models.[]{data-label="fig:cum_tau"}](3b.pdf){width="0.95\linewidth"} In Fig. \[fig:posterior\], we show the difference $\chi^2_{\rm model} - \chi^2_{\text{Pop-II}}$ as a function of $f_{\ast,\text{III}}$ (with $A_{\text{He}} \times N_\gamma \times f_{\text{esc}}=2 \times 10^4$ in the “Pop-III” fiducial model and $A_{\text{He}} \times N_\gamma \times f_{\text{esc}}=10^5$ in the “Pop-III, self-regulated” model). The model at the minimum of this curve for each case is given in Tab. \[tab:models\]. Let us consider first the fiducial model (red dashed line, Figure \[fig:posterior\]). This shows that including Pop-III stars in our fiducial model with low efficiency, $f_{\ast,{\rm III}} \sim$ a few $\times$ $10^{-4}$ only slightly improves the fit to the Planck data, with $\Delta \chi^2\approx1$. Furthermore, in qualitative agreement with previous work [@Visbal15; @2016MNRAS.460..417S], if Pop-III stars form with too great an efficiency they overproduce the E-mode polarization power and so the Planck data imply an interesting upper limit on the efficiency of metal-free star formation in minhalos. However, our fiducial model assumes a redshift-independent efficiency factor which is too simplistic, as we discussed previously. In our self-regulated Pop-III model, including metal-free star formation improves the fit further with $\Delta \chi^2 =2.2$ compared to the best-fit model with no Pop-III component (see the green dot-dashed line in the figure). In this case, the preferred efficiency factor is $f_{\ast,{\rm III}} \sim 10^{-3}$ which corresponds to roughly one $\sim 100 M_\odot$ star per halo of mass $M \sim 6 \times 10^5 M_\odot$ (fairly typical of the mini-halos), before this mode of star-formation is shutoff (completely at ${\ensuremath{\langle x_i \rangle}} =0.2$ in this model).[^3] Although the preference for a Pop-III contribution is weak – and we are not claiming that the Planck data demand these sources – the more important point here is that models with significant high redshift contributions to the ionization history are still viable. The ionization history for these best fit models are shown in Figure \[fig:xe\]. In the self-regulated Pop-III model the extended ionization plateau at ${\ensuremath{\langle x_i \rangle}} \sim 0.2$ near $z \sim 20$ is strikingly different than the best fit Pop-II model, in which the ionization fraction is negligible at such high redshifts. Furthermore even the Pop-II only model has a more extended high redshift tail than the Tanh model upon which the standard Planck analysis of the overall optical depth $\tau$ is based. Tab. \[tab:models\] also gives $\tau$ for the various models which are higher for those with high redshift contributions. ![Impact of incorrectly or incompletely assessing the reionization information content of Planck 2015 LFI data. Effective $\chi^2$ as in Fig. \[fig:posterior\] for the self-regulated Pop-III model but employing the likelihood from: i) the standard Tanh $\tau$ constraint (black dotted line), which is incorrect in the Pop-III context; ii) the overall $\tau$ constraint from the PC analysis (blue dashed line), which is incomplete; iii) the full PC analysis from Fig. \[fig:posterior\] (green dot-dashed line) which reveals the preference for the model. []{data-label="fig:posterior2"}](1_bottom.pdf){width="0.95\linewidth"} In order to interpret these changes in the overall optical depth, it is useful to compute the cumulative optical depth between redshift $z$ and $30$, $\tau(z,30)$. Rather than directly compute this from $\langle x_i \rangle(z)$ and cosmological parameters, we sum over contributions from each component $\tau^a(z,30)$ $$\tau(z,30) = \tau^{\rm fix}(z,30) + \sum_{a=1}^{5} m_a \tau^a(z,30).$$ This provides a smoothed representation of the cumulative optical depth that can be compared directly to the constraints derived in [@2016arXiv160904788H]. To evaluate $\tau^a(z,30)$ and the contribution from the fixed ionization history $\tau^{\rm fix}(z,30)$, we take the cosmological parameters ${\Omega_b h^2}=0.02224$, ${\Omega_m h^2}=0.1426$, and ${Y}_p=0.24534$. In Figure \[fig:cum\_tau\], we compare the best fit models to the constraints on the cumulative optical depth from [@2016arXiv160904788H]. This gives some intuition as to what is driving the slight preference in the Planck LFI data for high redshift contributions from, for example, Pop-III stars. As discussed in [@2016arXiv160904788H], the data favor a non-negligible contribution to $\tau(15, 30)=0.033\pm 0.016$. The reionization histories are not extended enough in the Tanh or the Pop-II only models to match the central value. In the case of the Pop-II only model, one needs to wait until lower redshift for the atomic cooling halos to collapse. If one supposes that the efficiency is extremely high in the atomic cooling halos, one can get a slightly earlier start in these models, but in this case reionization generally completes too early and one overproduces $\tau$. On the other hand, the Pop-III contribution helps extend reionization out to higher redshift since the molecular hydrogen cooling mini-halos collapse at higher redshift. In our redshift-independent Pop-III efficiency model, this contribution only helps slightly, however. In the self-regulated model, one gets a larger early contribution from Pop-III stars – since the formation of these sources is truncated early, the ones that form early can do so at higher – yet still reasonable – efficiency without overproducing $\tau$. In the self-regulated model with $x_{\text{max}}=0.2$, the model $\tau(z,30)$ always lies within the $68\%$ confidence band preferred by the Planck data. In principle, the Pop-II component could be more extended than in our model, which assumes a redshift independent efficiency factor, but the atomic cooling halos are rare at high redshifts and the efficiency factor would need to be uncomfortably large for these sources to have a non-negligible impact at $z \sim 20$, for example. Figure \[fig:cum\_tau\] also illustrates a final important point. Note that the constraint on the overall optical depth $\tau(0,30)=0.092\pm 0.015$ is shifted upwards from that inferred assuming the Tanh reionization history $\tau=0.079\pm 0.017$ [@2016arXiv160904788H]. The latter does not correspond to the overall optical depth in these Pop-III models and so applying this constraint would spuriously disfavor such models. This point is made explicit in Figure \[fig:posterior2\], which shows the likelihood for the Pop-III component using the Tanh $\tau$ constraint, rather than our PC methodology. Clearly this would disfavor our best-fit model (at $\sim$1-$\sigma$) and rule-out many other viable Pop-III models. Using the overall $\tau(z=0,z_{\rm max})$ from the PC analysis restores compatibility but the small preference for the self-regulated model is only revealed in the full PC analysis (green dot-dashed line). Correspondingly only when one makes use of the full information content of the Planck 2015 data is the hint for high redshift ionization apparent. Incorporating the full PC analysis, the best fit self-regulated model has a notably better $\chi^2$ than expected for the same model using the Tanh $\tau$ constraint: the fit improves by $\Delta \chi^2 \sim 3.2$. Although this improvement does not represent a detection given the number of additional parameters, the best fit Pop-III models are clearly still allowed. ![E-mode polarization power spectra, $C_{\ell}^{\text{EE}}$, of the various best fit models as in Fig. \[fig:cum\_tau\]. The black solid line and gray shaded regions show the Tanh model, along with the $68\%$ and $95\%$ confidence regions expected in the cosmic variance (CV) limit. In particular the two Pop-III models should be clearly distinguishable from the step-like Tanh model for a CV limited measurement.[]{data-label="fig:clee"}](2b.pdf){width="0.95\linewidth"} The origin of these different inferences can be traced back to the E-mode power spectrum. In Figure \[fig:clee\], we show the power spectra of the best fit models. The most striking difference between the model power spectra is the excess power in the self-regulated Pop-III model at $10 \lesssim \ell \lesssim 20$ when compared to the other models. This is the main feature of the Planck 2015 LFI data that drives the preference for this model. If one tries to generate excess power in a step-like Tanh model at $10 \lesssim \ell \lesssim 20$, one will overproduce the power at lower multipoles and so high redshift contributions to the ionization history are effectively hidden from the usual constraints [@2016arXiv160904788H]. This excess may reflect remaining systematic errors in the Planck 2015 LFI data from, for example, residual foregrounds. Alternatively, it may be an interesting signature of Pop-III star formation or other high redshift sources of ionization. Ultimately, if systematics are under control, the low $\ell$ polarization can be measured to the cosmic variance (CV) limit. The shaded regions in Figure \[fig:clee\] show that if the true model is the Tanh one, CV limited measurements would test the Pop-III models at high significance. This may be of interest for future space-based polarization missions such as the Cosmic Origins Explore (COrE) satellite [@2011arXiv1102.2181T]. Finally, we briefly comment on the sensitivity of our results to some of our model assumptions. First, we also explored self-regulated Pop-III models where we raised the minimum host virial temperature to $T_\text{vir}=10^3$K. After maximizing over the efficiency parameters in this model, the resulting ionization history looks nearly identical to the best fit in Figure \[fig:xe\], which adopts $T_\text{vir}=400$K. However, the best-fit star formation efficiency goes up to $f_{\ast,\text{III}} = 0.0023 $: in this model, the higher star formation efficiency compensates for the boosted minimum host mass. Note also that we have ignored the effect pointed out in [@2010PhRvD..82h3520T]: while this should lead to interesting spatial variations, recent studies suggest a fairly small average suppression for star formation in mini-halos [@2012MNRAS.424.1335F], and this may be compensated again by boosting our star formation efficiency parameter. Lastly, we investigated a range of values of $x_\text{max}$. While slightly lower values of $x_\text{max}$ still match the data, the star formation efficiency needs to be increased in this case since the Pop-III phase is briefer in these models. Discussion {#sec:discussion} ========== We have given an example illustrating how one may reach qualitatively different conclusions regarding the reionization history of the universe and the nature of the ionizing sources, when one accounts for the full information content of the Planck 2015 LFI data, rather than assuming a step-like ionization history. For example, our best fit ionization history has ${\ensuremath{\langle x_i \rangle}}=0.2$ at $z \sim 20$: contrary to conventional wisdom, that data still allow an extended tail of ionization out to high redshift and a non-negligible contribution from metal-free stars in minihalos. It will be interesting to see if the hint for high redshift contributions to $\tau$ is sharpened by future CMB polarization data. We eagerly await upcoming results from the new Planck HFI large scale polarization data – which is still proprietary – to see if these observations strengthen the hint seen in the LFI data. Alternatively, these may reflect remaining systematics in the LFI data that do not also apply to the HFI data. Based on Figure \[fig:clee\], we expect that a future cosmic-variance limited experiment should be able to confirm or refute the high redshift contribution to $\tau$, although we postpone a more detailed investigation of these prospects to future work. It will be extremely challenging to test the hint for non-negligible ionization fractions at $z \gtrsim 15$ by other means. The best alternative is likely redshifted 21 cm surveys but these face challenges at high redshift owing to the bright galactic emission at the frequencies of interest. However, these surveys may find that the average neutral fraction rises more slowly towards high redshift than expected in models with Pop-II stars alone (see Figure \[fig:xe\]). There may be differences in the sizes of the ionized regions in these scenarios as well, which may provide a potential signature [@2016arXiv160904400K]. However, the possibility of a significant contribution from Pop-III stars at high redshift may also somewhat complicate the interpretation of the 21 cm power spectrum measurements [e.g. @2013MNRAS.432.2909F]. Another possibility may be to extract signatures of early phases of patchy reionization using the Kinetic Sunyaev-Zel’dovich effect, but these will have to push to smaller angular scales which is challenging given foreground contamination. An extended self-regulated phase likely evades current constraints [@2012ApJ...756...65Z; @2015ApJ...799..177G] on the duration of reionization [@2013ApJ...769...93P]. Finally, it is worth commenting on the implications of our findings for the goal of determining $\tau$ from the ionization history inferred from redshifted 21 cm observations [@2016PhRvD..93d3013L]. This is an appealing idea, because the optical depth is an important nuisance parameter that can limit, for instance, inferences regarding the sum of the neutrino masses from upcoming CMB lensing measurements. However, this prospect becomes difficult if there are significant high redshift contributions to the optical depth, as hinted at in the Planck LFI data, which will be hard to extract from upcoming redshifted 21 cm surveys. We hope that this work will encourage reionization modelers to adopt this PC analysis methodology of [@Hu:2003gh] and effective likelihood of [@2016arXiv160904788H]. Here we have considered rather simple models for the ionization history in an effort to explore the broad-brush implications of the Planck data, but it would be interesting to explore more detailed reionization models and to combine the full information content of the CMB data with other reionization observables. It will also be interesting to explore whether dark matter annihilations [@2015arXiv151200526K] or early accreting black holes [@2004MNRAS.352..547R] provide interesting alternative sources of high redshift ionization to the Pop-III stars considered here. [*Acknowledgments*]{}: We thank Tom Abel, James Aguirre, and Kyungjin Ahn for useful discussions. WH thanks the Aspen Center for Physics, which is supported by National Science Foundation grant PHY-1066293, where part of this work was completed. CH and WH were supported by NASA ATP NNX15AK22G, U.S. Dept. of Energy contract DE-FG02-13ER41958, and the Kavli Institute for Cosmological Physics at the University of Chicago through grants NSF PHY-0114422 and NSF PHY-0551142. Computing resources were provided by the University of Chicago Research Computing Center. VM was supported in part by the Charles E. Kaufman Foundation, a supporting organization of the Pittsburgh Foundation. \[lastpage\] [^1]: E-mail: vinim@sas.upenn.edu [^2]: Note, however, that the study of [@2012ApJ...756L..16A] does model inhomogeneities in the Lyman-Werner background. [^3]: Note again that we assume a higher ionizing efficiency in the self-regulated model. If one prefers the lower efficiency assumed in our fiducial model, one can rescale the star-formation efficiency in the self-regulated model upwards by a factor of five.
{ "pile_set_name": "ArXiv" }
An Infiniti G37S Coupe has just joined our long-term test fleet and over the next 12 months, we'll put it through the ultimate test – everyday life. Associate editor Roger Stansfield picked up the car from Infiniti today. I have just become only the 10th person in Britain to take delivery of an Infiniti. Beat that for exclusivity. Perhaps I should point out that Infiniti, the posh division of Nissan, has only just started trading in the UK, and another 12 customers are signed up and simply waiting for their cars to arrive from Japan. Still, it's nice to be in on the ground floor. To be able to get our car so quickly, we've opted to take an ex-demonstrator with 1600 miles on the clock rather than order a bespoke car that would take three or four months to be built and shipped. With Infiniti, you're not just another customer to be put through the sausage machine. In fact, you're treated pretty much like royalty. When I arrived at the company's sole (for the moment) UK dealership in Reading (0118 907 1333), I was greeted by my 'personal consultant', Nigel Spragg, who will be my first point of contact for anything to do with the car. Coffee and formalities over, I was ushered into the delivery room, which sounds like something out of a maternity hospital, to be given a 185-point check sheet detailing everything that had been done to the car during the pre-delivery inspection. Then I was led through the door into the customer delivery bay, where my car emerged from under a Japanese imperial purple dust sheet. The next half-hour or so was taken up with an explanation of the car's controls and switches, although Nigel says customers are invited back for a second handover after a week or two to make sure there's nothing they're struggling with. Getting to know each otherFinally, I was away into the sort of weather that encouraged Noah to get into the boat-building business, to start getting to know my car. I'll spend the next few days prodding and pushing things and driving on different roads, and then I'll report back. First signs are that I'm going to be entertained equally as much as I've so far been pampered.
{ "pile_set_name": "Pile-CC" }
The drive along the Pacific coast is one of the most scenic in the U.S., but that's of little comfort to Los Angeles drivers stuck in traffic. The average rush hour delay per 30-minute journey is 24 minutes. That adds up to 92 extra hours behind the wheel each year due to jams. L.A. is the worst U.S. city on TomTom's list of top 100 for rush hour traffic, followed by Seattle (18), Houston (27), San Francisco (28) and New York (62).
{ "pile_set_name": "OpenWebText2" }
import Cocoa class EditorTemplateCellView: NSTableCellView { static let identifier = NSUserInterfaceItemIdentifier("EditorTemplateCellView") @IBOutlet weak var titleTextField: NSTextField! }
{ "pile_set_name": "Github" }
Successful treatment of severe endometriosis in two premenopausal women with an aromatase inhibitor. To treat severe endometriosis in premenopausal women with an aromatase inhibitor and to document the efficacy and side effects of this new treatment. Case report. Clinical practice setting. Patients were premenopausal endometriosis cases confirmed by prior laparoscopy. Oral administration of the aromatase inhibitor anastrozole with the addition of 200-mg oral progesterone (P) capsules once daily, hs, and calcitriol 0.5 microg oral capsules twice daily. All three medications were given daily for 21 days followed by 7 days off, for a 28-day treatment cycle. Additionally, rofecoxib 12.5 mg was administered once a day continuously for the 28-day cycle. The dose could be increased to 25-50 mg daily as needed for increased pain. Six repeat 28-day cycles were planned for the treatment course depending on patient tolerance and response. Reduction of symptoms, elimination of endometrial implants, and improvement in fertility potential in the future. Monitoring for ovarian hyperstimulation as a side effect of aromatase inhibitor therapy. Documentation of potential symptoms or side effects when an aromatase inhibitor is used in menstruating women. Treatment resulted in a rapid, progressive reduction in symptoms over 3 months with the maintenance of remission of symptoms for over 24 months after treatment in both cases. There was confirmation of absence of disease in one case by follow-up laparoscopy 15 months after treatment. Pregnancy was achieved in both cases after 24 months. This is the first case report of successful treatment of severe endometriosis in premenopausal women with the aromatase inhibitor anastrozole combined with P, rofecoxib, and calcitriol. Treatment resulted in a rapid elimination of symptoms and was well tolerated in both cases.
{ "pile_set_name": "PubMed Abstracts" }
Real Music, Real Artists, Real Opinions Menu Category Archives: Reissue The songwriter stepped outside the Dream Syndicate mothership for his first two solo albums, originally released in the early ‘90s, which now get the expanded reissue treatment courtesy the archival maestros at Omnivore. (Watch a Wynn concert from 1992 following the text.) BY MICHAEL TOLAND In the late eighties, Steve Wynn was best known as leader of the mighty Dream Syndicate, and as such was associated with a certain sound. Though the band had begun to cross its own boundaries before its final record Ghost Stories, the Syndicate was still thought of as one thing: a semi-crazed guitar band that crossed the Velvet Underground with Crazy Horse. But Wynn was more ambitious in his vision, so it was only natural that he would put his latest batch of songs in different settings on Kerosene Man and Dazzling Display, his first solo albums. Originally released on Rhino Records in 1990, Kerosene Man opens up Wynn’s sound with colorful arrangements and thick, even lush instrumentation. Producer Joe Chiccarelli encouraged Wynn to look outside of his circle of friends and consider session cats. It’s a move that might be construed as an attempt to make Wynn’s songs commercial, but that’s not in and of itself a bad thing. Wynn’s writing has always been fairly straightforward – verses, choruses, melodies, hooks – and giving them production that, while hardly slick, wouldn’t sound out of place on the evolving Adult Album Alternative format would hopefully increase his audience. The single “Carolyn,” a tune that went back to the early Syndicate days, goes alt.country before alt.country was cool, while “Something to Remember Me By” enhances its dirty rock with female backup vocals (courtesy an overdubbed Julie Christensen of Divine Horsemen/Leonard Cohen infamy). “Conspiracy of the Heart” (a co-write and duet with Concrete Blonde’s Johnette Napolitano) and “Here On Earth As Well” essay gorgeous balladry with easy grace, unleashing a new facet of Wynn’s talent. With its jangling 12-string, crunchy solo and rousing chorus, opener “Tears Won’t Help” posits Wynn as the classic rocker that was always hiding under the Syndicate’s wall of feedback. None of that’s to say Wynn doesn’t work his more eccentric mojo. “The Blue Drifter” indulges in his Lou Reed side, complete with saxophone coda, “Under the Weather” waits under the streetlight at midnight for a cool slice of noir rock, and the title track rollicks like a great bar band trying to cover Bob Dylan and “Crazy Little Thing Called Love” at the same time. The gnarled “Younger” – guest-starring Giant Sand’s Howe Gelb and future Continental Drifter Robert Mache duking it out on guitar – sounds more like an unused Dream Syndicate track than Nü-Steve. But the overall feel of Kerosene Man is smoother and more radio-ready than Wynn’s previous work, though it’s a sheen motivated more by a desire to get a set of strong songs in the vicinity of friendly ears than it is shifting units. The Omnivore edition comes with a half-dozen bonus tracks, all recorded either in clubs or on the radio with his band at the time. A mix of originals and covers, the bonus cuts boast aggressive takes on Creedence Clearwater Revival’s “Graveyard Train” and Bob Dylan’s “The Groom’s Still Waiting At the Altar” and an absolutely molten version of “Younger.” Wynn quickly followed up Kerosene Man with Dazzling Display, made with the same core team and originally issued in 1992. With a bigger budget, extra musicians and a year’s worth of experience on the road as a solo artist, Wynn was able to make what’s probably the most diverse and colorful record of his career. The first two cuts tell it: alongside the same studio band as on the last record, the bright, groovy pop of “Drag” features Three O’Clock/Mary’s Danish guitarist Louis Gutierrez, a horn section and a small army of backing vocalists, while the frisky folk/pop of “Tuesday” includes Gutierrez, Peter Buck, John Wesley Harding, string players and, on backing vocals, Flo & Eddie (the Turtles’ Howard Kaylan and Mark Volman) and the Psycho Sisters (the Bangles’ Vicki Peterson and the Cowsills’ Susan Cowsill – soon to join Wynn guitarist Robert Mache and bassist Mark Walton in the Continental Drifters). It looks excessive on the page, but by the grace of Wynn’s tasteful and efficient writing, his contagious enthusiasm for taking advantage of the studio environment and the skill of the players themselves, these top-heavy creations don’t fall on their faces. Though the number of musicians on the rest of the tracks rarely reaches the same levels, they’re still presented in busier arrangements and shinier production than even Kerosene Man. But that works like a charm, suiting this particular set of Wynn songs well. The glittery pop of “Dandy in Disguise” and “When She Comes Around,” propulsive psychedelia of “Grace” and angry rock of “405” and the title track find their melodies buttressed by the arrangements, rather than obscured, and Wynn sounds confident and engaged amidst all the industry. Above all, it sounds like a natural evolution from the debut. Hardcore fans of The Days of Wine and Roses might blanch at first, but anyone following the road from 1982 to 1992 will be satisfied. As with Kerosene Man, the Omnivore version includes six in-concert bonus cuts, recorded with Wynn’s touring band. The mini-set boasts a lovely “Conspiracy of the Heart,” with Johnette Napolitano reprising her studio role, and a hard-rocking version of Paul Simon’s “Boy in the Bubble” as highlights. Wynn continued exploring this pop-friendly direction in later records, but it’s on these long out-of-print gems that he truly signaled his desire to never be hemmed in by expectations, his own or others. Kerosene Man and Dazzling Display are well worth rediscovery. Album: Music Is the Answer: The Complete Collection Artist: God's Children Label: Minky The Upshot: Sweet sunshine pop, Latino rock, and psychedelic-tinged soul from the age of Aquarius. BY FRED MILLS You gotta love an archival project like this one, and not just because it is a true across-the-board labor of love. There’s a freshness and optimism suffusing the music, and while it is definitely “of a time”—specifically, late ‘60s/early ‘70s—the tunes have also stood the test of time, their seamless blend of sweet sunshine pop, Latino rock, and psychedelic-tinged soul as fine an ambassador to the era as you’ll find. The group was co-founded by Little Willie G and Lil’ Ray (that would be misters Garcia and Jimenez, respectively), late of East L.A. Chicano rockers Thee Midniters, and had a kind of streamlined Sly & the Family Stone-meets-Fifth Dimension sound thanks in no small part to three female vocalists joining the par at the mic, notably one Lydia Amescua (described as “a teenage girl with a big voice”) and an Aquarian-age vibe. As detailed in the exhaustive liner notes penned by author/journalist (and Blurt alumnus) Denise Sullivan, once the project got off the ground the musicians hooked up with local entrepreneur Eddie Davis, who helped them land a deal with the UNI label and put them in the studio with the legendary Wrecking Crew to up their studio game several notches. As these things often turn out, however, UNI wasn’t sure how to market and promote the band, and with other pressures coming to bear—the musical culture was rapidly changing as well, away from vocal groups and in the direction of rock bands and singer-songwriters—the group fell into disarray. Two singles for UNI, and that was that. The music they left behind, however, deserves to be heard. From the richly soulful midtempo ballad “Dream” (sung by Little Willie G) and the percolating, organ-powered garage pop of “It Don’t Make No Difference” (somewhat reminiscent of ? and the Mysterians, featuring Lil’ Ray on lead), to the lush, orchestral, almost Lee Hazelwood-esque “Hey, Does Somebody Care” (which was also the theme song to television series Matt Lincoln) and sinewy, wah-wah/congas-powered rocker “Music Is the Answer” (available here in both vocal and instrumental versions), there’s plenty to tuck into. A cover of pop schmaltzer “Put Your Head On My Shoulder” may inadvertently have telegraphed how the group was growing out of step with the times, but a gorgeous, inspiring version of Billy Preston’s “That’s the Way God Planned It” more than redeems matters. Incidentally, in addition to CD, Music Is the Answer also was released on limited edition brown vinyl for this year’s Record Store Day, and as of this writing you can still find reasonably priced copies at Discogs.com. Grab it while you can. DOWNLOAD: “That’s the Way God Planned It,” “It Don’t Make No Difference,” “Music Is the Answer” Album: Undertow + Before Ever After (2LP reissues) Artist: Blind Idiot God Label: Indivisible Music The Upshot: The monstrous Bill Laswell-approved NYC outfit embarks upon a tantalizing colored-vinyl reissue program, including 1989’s Undertow and 2015’s comeback album Before Ever After. The former now comes in a deluxe gatefold sleeve and is pressed on brilliant tan/copper wax, while the latter goes even further with a trifold sleeve and luminescent green vinyl. BY MICHAEL TOLAND & FRED MILLS As Dr. Toland pointed out in his “Throwing Horns” metal roundup recently, ”the New York trio’s second LP found its patented blend of thrashing doom and jazzy dub in almost bifurcated form, with neither side of the band’s coin rubbing up against the other. Undertow has the deep-dub hallmarks of a Bill Laswell production, and it also features a couple of the extended Laswell family intimates, Henry Rollins (vocals on two tracks) and John Zorn (sax on one of them). Yet guitarist Andy Hawkins, bassist Gabe Katz, and drummer Ted Epstein never surrender their stage in terms of their blistering jazz/skronk/hardcore approach to music making. Whether serving up a Bad Brains-worthy thrash epistle (“Atomic Whip”), a luminous meditation in the key of the aforementioned dub (“Watch Yer Step”), an improv-powered wall of noise (“Wailing Wall,” which justifies its title), or even a quick jazz-sax freakout (Zorn’s 2-minute appearance, “Purged Specimen,” may be brief, but it’s brutal), Blind Idiot God makes the most of its four vinyl sides. And if you’re looking for some good old fashioned late-period Black Flag-meets-Rollins-Band, uh, boogie (term used loosely), there’s a long and a short version of the appropriately titled “Freaked,” from the Alex Winter film. Hank, we love the spoken word, but seriously, your rock audience needs you, and Blind Idiot God would be the guys to help you deliver the goods once again. Sigh. 1989 was such a different time. At any rate, this 2017 remaster for double vinyl is essential uneasy listening. Grab it on sight. (—Fred Mills) *** A baker’s dozen years since its last platter Cyclotron, Blind Idiot God came stomping back in 2015 with Before Ever After, a double LP that displayed the NYC instrumental trio at its BIGgest. On the album, although joined by a new rhythm section, guitarist Andy Hawkins stays the course of the past three decades of his singular career, keeping one foot in amp-melting doom and the other in airplane-hangar dub. As Hawkins terrifies his amp and bass/drums bash and crash, “Earthmover,” “Strung” and the appropriately-titled “Under the Weight” rumble like a Brontosaurus across the rubble of a fallen city, crushing debris underfoot as its stomach growls. On the other side of the bent coin, “Ramshackle,” “Shutdown” and “High and Mighty” skank through the dust as it settles, letting a little sunlight echo through the destructive aftermath. Not everything is quite so direct, however. “Voice of the Structure” alternates between spacy swirl and heavy pound, while “Barrage” fractures its rhythm in a manner not dissimilar to postpunk. “Fub” takes the band to the next level of development, its light-on-its-feet feel full of jazzy lightning and improv thunder. Brandishing its weaponry with power and grace, Before Ever After both reclaims the legacy of Blind Idiot God and paves the way for its next epoch. (—Michael Toland) Album: U-Men Box (3LP) Artist: U-Men Label: Sub Pop The Upshot: Crucial pre-history of the Northwest alt-rock scene, and a fascinating snapshot of an underrated but powerful, noisy, charismatic band. Warning: no grunge here. BY FRED MILLS Before Sub Pop Records launched, before Nirvana made “grunge” a household word, before Eddie Vedder made flannel shirts and Doc Martens chic, before the major labels descended upon Seattle in a feeding frenzy, before silly national acts like Third Eye Blind and Matchbox 20 turned the term “alternative rock” into a punchline—there were the U-Men, whose tenure spanned the ‘80s and spawned one full-length and a handful of singles, EPs, and compilation appearances. And while one hesitates to label the noisily primal, skronk-powered Seattle quartet along lines of “wildly influential,” it’s likely that the proverbial Velvet Underground Effect, whereby people who happened to see the U-Men perform back in the day or bought their records (issued by labels both well-known, such as Homestead and Amphetamine Reptile, and justifiably obscure, like Bomb Shelter and Black Label) went on to eventually form their own bands, was operative at least to a small degree. (Go HERE to read a lengthy testimonial from Mudhoney’s Mark Arm, who calls them “the undisputed kings of the Seattle underground.) U-Men is a sprawling 3LP box set (or 2CD should you not be a wax fetishist) that collects everything the band released along with five unreleased tracks, and as an artifact from Before The Dawn Of Grunge, it’s absolutely essential. And I say that as a ground zero U-Men fan, so to speak, as I either purchased or was gifted with, promo copy-wise, the bulk of the group’s original output, duly reviewing them for some of the fanzines I was scribbling for at the time. They were an irresistible draw, from the Gun Club-goes-thrash rev-a-rama of “Clubs” (off the 1985 12” EP Stop Spinning), to the unbridled, possibly improvised, dissonance-rawk of the subsequent “Solid Action” / “Dig It A Hole” 45 (it sports two of unhinged singer John Bigley’s gruffest, most extemporaneous vocals ever), to the dark, swampy blooze of “Whistlin’ Pete” in which the U-Men solidified their rep as America’s answer to the Birthday Party (it appeared on the group’s lone album, 1988’s John Nelson-produced Step on a Bug, a collaboration that yielded a relatively expansive, dynamics-rich sound). The vinyl set is gorgeous, smartly graphically designed, with a thick outer box housing an inner slip-box that contains the three heavyweight LPs in their individual sleeves. Both the LP and CD versions have a thick booklet with full track annotations and interviews from the members—who would go on to bands like Gas Huffer, the Crows, and Love Battery—arranged oral history style, and it’s a colorful history, to say the least. Fun Fact #1: the group got its name from the bohemian section of Seattle the members came out of, the U-District. Fun Fact #2: for a short stretch, there was a U-Woman too, a female bassist named Robin. Fun Fact #3: the U-Men mounted three national tours, although we should use that term somewhat lightly; at least one of those tours consisted of something like five shows in three months plus a month-long sabbatical in Austin hanging out with fellow sonic discombobulators the Butthole Surfers. Ultimately, it’s a crucial pre-history of the Northwest alt-rock scene, and a fascinating snapshot of an underrated but powerful, charismatic band. Album: La Vie Electronique 1.0 (2LP) Artist: Klaus Schulze Label: One Way Static/Light In The Attic The Upshot: Electronica maven and godfather’s trawl through his early-‘70s archives now gets a vinyl rollout. Synth pioneer Klaus Schulze, one of the godfathers of modern electronic music and a major influence on the ambient artists who emerged during the ‘90s, first came to the public’s attention as the drummer for early Tangerine Dream. He only lasted for one year and one album before moving on to form Ash Ra Tempel with Manuel Gottsching, but that, too, would be short-lived, as the restless compower/multiinstrumentalist soon embarked upon a long, fruitful solo career that also included scoring a number of thriller and horror films. His 1972 debut Irrlicht remains a Krautrock touchstone, and he’s been consistently intriguing over the years, although his music can admittedly come across at times as a bit too new age-y for some tastes. (Fun fact: Schulze also was part of the early ‘70s ad hoc Krautrock “supergroup” the Cosmic Jokers. Look ‘em up.) La Vie Electronique compiles extremely rare and unreleased early material, some of which he and coproducer/archivist Klaus Mueller came across in musty old tape boxes that were so haphazardly labeled that they typically had to come up with songtitles after the fact. In 2009 the duo began releasing the material on CD, and since then they’ve delivered no less than 16 volumes (the 16th one, from 2015, was a whopping 5CD set). T The series is now being rolled out on vinyl, and part one of the original 3CD La Vie Electronique, here titled, 1.0 is both mesmerizing and meditative. The lengthy, three-part “I Was Dreaming I Was Awake And Then I Woke Up And Found Myself Asleep”—which is broken up into “I Was Dreaming I Was Awake,” “And Then I Woke Up,” and “And Found Myself Asleep”—in particular is rewarding, with waves of synths initially ebbing and flowing like ocean currents gently rocking the boat, then gradually growing more forceful and direct, ultimately culminating in a pulsing, throbbing, unsettling crescendo. The 14-minute “Dynamo” is also fascinating to absorb, an electronic approximation of piloting across the galaxy and being sucked slowly into a black hole. The album ends in a brief (24-seconds) Schulze interview which, since it’s in German, serves as a fittingly inscrutable coda. A must-own for Schulze fanatics. This set, then, is the first in the Schulze vinyl series that One Way Static/Light In The Attic has initiated; the second installment of the first volume, La Vie Electronique 1.1, arrived on March 23, and it will be interesting to see if they get to the 16th volume, particularly if you consider that a 5CD set would probably require between 10 and 15 LPs to cover all of the music. Each title is a pressing of 1000, with 700 on standard black vinyl and 300 on white. And as with most LITA productions, always a trademark of quality, you get a healthy dose of detailed liner notes along with an Obi strip wrapped around the album jacket—the latter a nice touch for folks browsing in a record store who want to know more about the release. Whenever a label goes the extra mile for collectors, it should be applauded. Originally released in 1991 by esteemed indie label Frontier (and distributed via RCA), the Cali outfit’s fifth studio album may not have sold bucketloads, but it was still filled to the brim with powerful, tuneful rock subversion and resilient emotional fortitude. With a key reissue program now underway for the guitar band, now is an apt time to examine what made Thin White Rope so special—and, for many of us out here in the Amerindie-rock hinterlands, so beloved. BY JONATHAN LEVITT In 1991 Thin White Rope set about to record their critically acclaimed album The Ruby Sea, which would subsequently be released on Frontier Records. Hailing from Davis, California, the band were able to hone their unique blend, of punk, country and rock into a deeply satisfying record that at times has a ferocious intensity, punctuated by a stark and lonely widescreen sentimentality. The album feels like the equivalent of driving all day, looking for accommodations in a tiny two-horse town and then hitting the local roadhouse for a cold beer. With a Miller in hand, you and the three other patrons witness a band play a show so devastating that you feel as if you’ve stumbled upon America’s best kept secret. I’ve spent the last quarter century evangelizing to friends about how they need to own a copy of The Ruby Sea. I’m gearing up for the next 25. I’m from the Southwest—the starry sky, the sunsets, and the panoramas ‘round each bend permeate my dreams and have worked their way into my DNA. What Thin White Rope accomplished on this album was to create an aural roadmap of their world. Guy Kyser’s vocals are part-crazed gold rush preacher, the other part a tortured balladeer. I’ll say this, though: No one conveys the American west quite like he does. Listening to the stormy swirls his voice creates, you can feel the sand stripping the enamel on your teeth, which makes for quite a harrowing journey. Meanwhile, Roger Kunkel’s deft guitar playing is both gritty and full of nuanced layers. The album had critical hosannas thrown at it from certain sectors of the British press as well as the likes of CMJ, not to mention the Amerindie fanzine underground. It proved to be an antidote of sorts to the laughable haircuts and poor song-smithery that plagued “alternative music” at the time. All one has to do is listen to opener “The Ruby Sea,” where the muscular drums and angular, aggression laced guitar work is cut with Kyser’s haunted vocals, to get a sense that you’re heading to a place riddled with emotional potholes. Cherry-picking my way through the album, “Puppet Dog” has the feeling of making several wrong turns in some rural backwater unable to find your way to civilization; the beginning of the song, with its childlike dreaminess, quickly turns troubled, the key then changes, and Kyser sings “Puppet dog, whoever made you years ago, knew how bad I’d needa friend. Puppet dog, your felt red mouth and bells for eyes, scare the devils off again.” It’s an amazing track that threads the listener through the needle into another person’s world. “The Lady Vanishes” is an evocative number that, in the space of two brief minutes, transports us deeper into Kyser’s haunted world. “Hunter’s Moon” is the album’s centerpiece, a story of longing, pursuit and ultimately redemption, that by its end of it will either have you stomping your foot or waving your fist in the air. “Christmas Skies” is a wistful country ballad that tells the story of a ghost who’s recalling Christmas as a child. I recall being drawn into the song’s orbit late one night in my Fudan University dorm room, where it transported me a million miles away from my Chinese reality to somewhere familiar and friendly, and it’s these distilled yet brief moments, punctuated throughout the record, that make it such an immense pleasure to listen to. Then there’s “The Fish Song,” which is hands down one of the most kickass songs ever laid down by the band. Its menacing vocals, stretched over a relentless pounding rhythm, is cinematic in scope and a one two punch to the cranium. Once you hear this song you feel like you can take on the world. “The Clown Song”, which closes the record, is another brief, yet very powerful, song. Kyser sings, “Seems I have been a clown more than a friend/ A clockwork response to tokens you spend/ And when you stop and when I run down/ I’m frozen and cannot escape from the clown.” The album takes the listener on a tense, turmoil-filled journey, its emotional heft being one of the reasons why it has never left my side. I find myself still unable to completely comprehend the power of The Ruby Sea—which is why I’m hooked. While I mourn the fact that the band no longer exists, I believe that their musical catalog will only continue to add new legions of fans as people discover their immense talent. I managed to hunt down lead singer/guitarist Guy Kyser and guitarist Roger Kunkel to give BLURT readers the skinny on the making of the album. Guy, in an email to me, said they answered my questions “Rashomon Style” (Kurosawa fans please take note). Roger has also offered BLURT an exclusive link to hear the band’s demo from November 21, 1982 which until now has never been released; the four songs on the demo, originally preserved on cassette and recorded by the late Scott Miller of Game Theory/Loud Family fame, are “Not Your Fault,” “Macy’s Window,” “Soundtrack,” and “Black Rose.” In my quest for extra archival material, I got in touch with Frontier Records head honcho Lisa Fancher, who offered up her own perspective on the album as well as an exclusive track for Blurt readers from the forthcoming remastered release of The Ruby Sea. So please check out the interviews that follow, and while you’re at it, chew on this bit of news: Frontier Records has announced that the band’s first five albums will be reissued on heavy-weight 180-gram colored vinyl. (Which should only worsen my editor’s very public vinyl porn addiction.) (Ya got that right, brutha. Just put in my orders, in fact. —Vinyl Ed.) The first two LPs, 1985’s Exploring the Axis and 1987’s Moonhead, are already out, with the rest to follow later this year. Click the link for details; note that ordering the vinyl—including special edition mail-order-only editions—also gets you an immediate digital download. Each title will also be available to order on CD or as a download. *** (Below: screen shots from a video of the band performing in 1992 at the Roskilde Fest) THIN WHITE ROPE—THE 2018 INTERVIEW, WITH GUY KYSER AND ROGER KUNKEL BLURT: Where and when was The Ruby Sea(TRS), recorded? Roger Kunkel: Fidelity Studios, Studio City, CA which is near Universal Studios, east end of Ventura Blvd. We’d worked in that area before at a different studio for the Moonhead and Spanish Cave records. Who produced and mixed the record? RK: The producer was Bill Noland of Wall of Voodoo and Human Hands. The engineer’s name was Dave Lopez. This was in May of 1991. Interesting side note: Originally, Butch Vig wanted to produce the record. It was before he was hired to produce Nirvana’s Nevermind. He wanted us to come to his studio in Madison, but we weren’t keen on spending a few weeks in Wisconsin, and we decided to do it in LA where we knew people and could have a good time while being there. By the time we were in LA, we’d heard that Butch was doing the Nirvana record in LA at the same time. Since they’d been signed to Geffen and had a big budget, they flew him out. It happened that we were friends with their manager, John Silva, so he introduced us and even suggested we make guest appearances on each other’s albums. That didn’t happen because neither group was excited about the idea. We did go out to a Butthole Surfers show and got quite drunk together. Remember, at this time they were just another indie band. Months later that changed quickly. What were you guys listening to back then? Any of those bands influence your direction on this record? Guy Kyser: I must’ve been listening to a lot of Wire. I don’t recall trying to sound like them but looking back I can really hear the influence. Roger introduced me to a lot of country music over time, so there’s that. And of course, we had that Velvet Underground trying to sneak in there. RK: We always had a wide breadth of influences largely older stuff from the blues, country worlds. Marty Robbins, Lefty Frizzell, Slim Harpo (One of Guy’s favorites). Also, the classic late 60’s rock stuff: Stooges, Big Brother and the Holding Company, Velvet Underground, Can, Sabbath. Newer bands: Pixies, the Fall, Wire. This record I think was focused on Guy’s poetic visions of landscapes and loss. The Country influence is fully uncloaked, at least on a couple of tracks, but mostly I feel the record was just twr without conscious outside influences. What do you recall about the recording sessions, was it a smooth process, or were there debates about the direction of some of the songs? GK: The songs were pretty much complete, but we hadn’t had a chance yet to listen to some of the details from the outside, so to speak… so sometimes during the recording we’d discover things that didn’t work. For example, there was one place in “Up To Midnight” where our guitars seemed to be in conflict, rhythmically, and we had to isolate the tracks and figure out who was throwing things off (it was me, hah!). RK: Most songs were pretty well worked out beforehand. We had our preferred methods of recording by this time. We knew we wanted a more polished end result this time around. There were some debates about drums. Matt wanted huge sounding drums. I like drums to sound natural and more 60’s where they sit in the mix instead of summon the ​Valkyries with thunder, so I wasn’t happy with that. What was the hardest song to nail for the record? GK: For me it was “Bartender’s Rag” or “Christmas Skies”. Those are simple country-style songs but very difficult to get an authentic feel out of them. I had trouble playing with just the right amount of swing. RK: Honestly, it’s hard to remember, but I think Hunter’s Moon took some time. It was one that wasn’t fully baked arrangement wise. The build of it started to become apparent and we worked from there to create a steady build that, I think imparts the idea of inevitability. Can you guys speak to how you went about recording the record, were things worked out in the studio or did you have skeletons of ideas ready? GK: We always had limited studio time when recording, so we did most of the arranging beforehand. Depending on what instruments and effects the studio might have available, we would add things just for the hell of it. Like, there’s a piano here – let’s use it on the break in “The Fish Song”. Or the producer knows where to rent a guitarrón – might be a good sound for “Christmas Skies”. RK: Guy reserved a few tunes to do in a way that would set them apart. Christmas Skies and Dinosaur. I don’t think we’d worked on them much as a band before the recording. And The Clown Song he did solo. Guy, did you have lyrics worked out in advance or was this something you altered as the song took shape in the studio? Where were you pulling from emotionally when you created some of these songs? GK: The lyrics were all written beforehand, except “The Clown Song” which was composed during the recording session. I wrote several of the songs & lyrics during a short road trip I took to get away from work, the band, and everything. I got good and lonesome, wandered the hills by night, and somehow got poison oak on my privates. But came home with songs. How many songs were recorded for the album and if any were left off what became of them? GK: All the songs we recorded for the album went onto the album. We may have recorded a couple extras for a later EP, but there were also a couple of EP-only recording sessions around that time and I don’t remember which track came out of which session. RK: We did a couple other tracks in this studio with Bill Noland, but I think it was a separate session. One was “Burn the Flames” for a Roky Erickson tribute album. And two tracks for a Byrds tribute album. Was there a concept for the album before you all started to record it? GK: Not really, except that “The Ruby Sea” and “The Fish Song” were both kind of water-related… we did joke around that this might help counteract our desert image. There’s a wonderful western vibe that permeates the record, can you guys talk about how where you’re from has influenced the music on TRS? GK: For me, a lot of it comes down to movies. Geography predisposed me to like Westerns, so I got infatuated with Morricone’s scores. [I] also was a big fan of Marty Robbins’ Outlaw Ballads. Onearlier albums, not so much on Ruby Sea, we went through phases of trying to create the ultimate Western Tune. This was fun, but we got a reputation as a ‘desert band’ which came to seem like a millstone sometimes. RK: That was pretty much always part of the band’s DNA. It didn’t always show up, but Guy, our original bassist, Steve Tesluk, and myself were all classic country and blues fans. Were all of the songs written specifically for the record or had some been around during other records and you decided to finally include them on this album? GK: All the songs were written just for this album. Except, kind of, “Tina and Glen”… that song was an idea I’d been kicking around for about 10 years, but I could never make it work until I decided to throw out most of the lyrics and make it an instrumental. What’s the oldest song in terms of when it was written that was on the record? GK: See [previous question]. “Tina and Glen” was based on a time when my motorcycle broke down on Highway 99 in central California and I had to spend the night in a farm shed. The host family had two kids whose names were… wait for it… Who came up with the running order for the album? GK:I remember that as a collaborative effort. I did want to have “Fish” & “Clown” last, though. How long did the recording of the album take? GK: I think it was 4 or 5 days recording, maybe 3 days mixing. RK: I believe it was two weeks, which was typical for us. When the album was finally in the can, what was the feeling when you guys finally heard the finished work? GK: Hard to describe. I had a deep feeling of accomplishment and was very happy with the album, but there was some sadness mixed in because it felt like an ending. I also had a dawning realization that neither this album nor any other we were likely to make was going to see enough success to make us a self-sustaining band. Maybe that is partly hindsight. RK: A little mixed. It’s also hard to accept that a work is done and is what it’s going to be. When you’re working in a high-end studio and your listening off of two-inch tape through the world’s greatest monitors, things sound so impressive that you can lose a little perspective. Did you hold a record release party to celebrate? GK: I think we all went home and slept for a week. RK: Nothing real formal that I remember. We just started a long tour, as usual. Who created the cover art? GK: Our friend Clay Babcock, an artist who lives in LA. He grew up in the same desert town I did, and I’ve known him since second grade or so. The album was released on LP, cassette and CD on Frontier Records. What about in Europe? Was the album licensed to any labels and did they press up their own editions? Was there a special mix done for the Frontier LP edition? RK: I don’t think any special mixes or masters were made. Frontier had a distribution deal with BMG at that time, so I think the European product was the same as the US. Earlier records were produced by Demon Records (UK) and distributed by Rough Trade in Europe. How did the album sell in the US and in Europe? RK: I don’t know the numbers. I know it wasn’t enough to get us into the black and making money. Did you record any of the shows you did touring the record? GK: I don’t remember recording any shows during the official Ruby Sea tour, but we did a final tour the following year and recorded & released the entire final show (The One That Got Away). I was really proud of that recording, a 2-hour-show, it sounded pretty tight. RK: Of course, there’s the final concert which became The One that Got Away. That was a very good multitrack recording of our last ever show in Ghent, Belgium. It may actually be my favorite twr recording. Set-list ise, did you play all of the songs at one point or another live or were there some that you never played at all in a live setting? GK: I don’t think we ever performed “Bartender’s Rag” or “Christmas Skies”. “Dinosaur” was too quiet and too dependent on sound processing. We might have done “The Lady Vanishes” and “Up to Midnight” once or twice, when we could get a guest vocalist. RK: Some were never played (I think): Dinosaur, Christmas Skies (maybe). What were the core songs from this album that were played in almost every set at the time? I recall reading a glowing review in Melody Maker at the time and wondered given that this was at the height of the Manchester movement, how did audiences react to your music? GK: I don’t think anyone was comparing us with the Smiths… I think we were considered rustic headbangers from an uncivilized part of the world, not particularly stylish or trendy. But most of our shows in north-central English cities were well-attended and enthusiastic. RK: We had a steadily growing following in England, I really enjoyed touring there. We played the Reading Festival on our last trip. On a blog written by Michael Compton he mentions that, “One of the three weekly music newspapers in England, Melody Maker, took a strong liking to us, but because of that, the other two, Sounds and New Musical Express, decided that we weren’t to be bothered with.” What was it like being in that situation for the band, and how did it affect Demon records ability to promote you guys? Any anecdotes you wish to add regarding the petulant British press? GK: I don’t know how it affected Demon, but it was kind of a roller coaster for us. The British scene had a lot of infighting, a lot of bands currying favor with this or that fanzine. And we’d get an interview with someone from one of the “other” papers, the interview would go great, and then the piece would be printed with a negative slant. One guy in particular, who was kind of a trendsetter, would mention us only so that he could go on to talk about bands he liked better. Usually American Music Club. For which I bear them no ill will. RK: I guess on the first couple of trips there we were a kind of secret cool band that MM would write about. We had a few packed shows in small venues that were a lot of fun. NME did a spread with a picture at Stonehenge, so they didn’t ignore us. I don’t recall any bad reviews, but maybe I was oblivious to them. Who did you guys tour with in Europe for TRS shows? GK: I’m fuzzy on the timelines – may have been for earlier albums – but we did several shows with the Pixies (mostly Netherlands), the Walkabouts (Germany), and Babes in Toyland (Austria). On our last two tours we played festivals (Reading 1991, Roskilde 1992) with lineups including Iggy Pop, Nirvana, and lots of other acts. RK: We seldom did shows in support of another band, at least not a string of shows. We had a great show with the Pixies in Rotterdam. We play the Reading and the Roskilde festivals, with so many great bands: Nirvana, Blur, Sonic Youth, American Music Club, even Townes Van Zandt. Tell me how “Hunter’s Moon” came about. I can only imagine that this song must’ve detonated the room when it was played live. Was this song a fixture of your sets back then? GK: Yes, this was one of our standards. This song is a very literal transcript from my road trip. I like how simple it is, and there’s something sort of backwards about the chord sequence. The “Fish Song” hits hard with a biblical one-two punch to the gut. What was the genesis (no pun intended) of this song? GK: TFS is based on a short, near-miss relationship. I turned it into a kind of Moby Dick story, minus the wooden leg. Since Thin White Rope, what have the two of you been doing musically? GK: After TWR I was in a band called Mummydogs with my wife and other Davis musicians. We made one album but didn’t tour. One track was used in the Las Vegas campaign for “What happens in Vegas stays in Vegas”. Then I played banjo in bluegrass bands with Roger and others, doing the farmers market circuit. RK: In the 90s I had an eclectic instrumental band called the Acme Rocket Quartet. We made 3 CDs but didn’t tour. (Own those records as wel! -Archival Ed.) I sometimes still hear it as transition music on NPR. I got into bluegrass and old time playing mandolin, fiddle and guitar. Guy and I had a gigging bluegrass band going for a while called Doc Holler. I studied computer science in college. Currently, I play telecaster in a honkytonk, classic country band called Mike Blanchard and the Californios. I’m also occasionally in a band called Toadmortons. We are currently working on a new album. I have a casual acoustic duo called the Smoke Shovelers. I’m interested in solo guitar lately and I’m hoping to record that and make my first solo album this year. What do you guys do for day jobs? GK: During the day I am a specialist with UC Davis Department of Plant Sciences, doing research on management of invasive plants in rangeland and natural areas. GK: I haven’t thought too much about the back catalog, but I’m glad to see Moonhead rereleased because for some reason I didn’t have a copy. The oldest songs sound pretty adolescent to me – I’m glad they’re out there but it’s like they were written by a different person. RK : My favorite TWR recordings have been Moonhead, Sackful, and the covers we did. However, they all have their endearing qualities. I went a long time not listening to any. I’m hearing that the remasters are really good, so I’m looking forward to getting reacquainted with them. What place does The Ruby Sea hold for you guys when considering your whole discography? GK: The best songs on Ruby Sea are my favorites from the whole band’s career, but there are some weak spots too. Any possibility that you guys would ever pull the band back together for some one-off shows or even a new record? GK: I would feel pretty uncomfortable trying to revisit stuff I was doing in my twenties… Lisa Fancher: I founded Frontier Records in 1980 and I still own the label and run it with the indispensable Julie Masi. How did The Ruby Sea sell? LF: Not terribly well, none of their records sold particularly well compared to the Frontier punk titles, but TWR is my legacy band and I’m desperately interested in the entire world discovering their greatness. How many pressings have there been of the vinyl? LF: The LP was pressed once when I was with BMG, I never made more. Were there differences between the Frontier edition and European pressings? LF: There were no differences between US and UK editions, no. What’s your opinion of the record in relation to their entire catalog? LF: I can find no fault in anything that TWR ever did, so I can’t really be objective where it stands. It was the further evolution of Guy’s songwriting, trying to branch out more musically, and also signaling the end of his desire to be in band, and to live a life in one place with Johanna. That’s what I get from it… I’m just sad because it’s TWR last studio album! Did Frontier finance the recording? LF: Yes. The only record paid not paid for by me was Sack Full of Silver, I did a licensing deal with RCA Records. What was your reaction the first time you heard the finished recording? LF: I was there most of the time while they recorded [The] Ruby Sea and much of the time when Noland mixed it. I was giddy with awe, still am. What’s your favorite and least favorite track on the record? LF: I have no least favorite track, but “The Fish Song” is probably my favorite. When the album came out what was the general reaction you were getting? LF: It’s hard to remember if there was a negative reaction, I don’t think so. TWR had their fervent journalist fans but had a hard time taking it to the next level of “success”, whatever that is. Decades later the critics all jerk off to the Black Angels and Floorian etc., [who] owe so much to TWR sonically. I think the response would have been more shrill in terms of SUPPORT THIS BAND, DAMN YOU if writers knew that it was their last album, TWR’s greatness was very much taken fo granted. Was there a difference between how the British press reacted to the album versus the US music press? LF: The US press was not terribly enthusiastic overall though the band did have strong support in the fanzine and Alternative Press-size magazine world. SPIN was an early backer, but then when it got super corporate, they turned their backs. I could have spent a billion advertising dollars but writers either got the band or they didn’t. In the UK, there’s not this pressure for pay to play, so there was always unabashed raves in Melody Maker and Sounds and large, crazed audiences. When Guy appeared on the cover of Melody Maker, I thought I would die from pride! NME didn’t have much time for TWR because the other two papers loved them, but that’s okay. They never did a Peel session either, it’s time I got over these things. I know that a remastered edition is slated to come out; who’s doing the remastering? Will there be any expanded liner notes and or art used on the remastered release? LF: Exploring the Axis and Moonhead were re-released on 3/9/18 and the other three studio records will come out in the coming months. If these reissues do okay, then I’ll consider a definitive odd and ends record and remastering the double live LP. Paul duGré does all my remastering, he’s an absolute shaman with guitar-based rock. When you hear the re-releases, you’ll know what I’m talking about, it’s possible to hear things on these versions that were inaudible on the previous versions. No, they are not expanded versions in terms of art or notes because I tried to keep them at the original price, so people would buy them without hesitation. Changing packaging and added booklets, etc., make the price go up by many dollars. We did put Guy’s lyrics in the LPs, they were previously only available as a booklet to fan club members. Is the band involved with the remastering? LF: They were not. (Below, original 1991 Frontier press release for the album.) Any anecdotes good or bad related to this record that you care to share? LF: I will save those memories for when I write my book. All of [them] drank excessively after the sessions but they were total pros in [the] studio, no matter how hungover. I tried to get Kurt Cobain to play guitar on a song or sing on “The Fish Song” as the band was making Nevermind in the valley, but it was vetoed by his people even though he was a big fan. I think perhaps a few more people would have bought [The]Ruby Sea if it was sanctioned by Kurt! Any future TWR projects slated for release on Frontier? LF: I’ll have to wait and see how the reissues go as I need funds to do more, but I certainly hope so– now or anywhere in the future. Guy knows that I’d have a stroke if he ever wrote a new TWR song and/or if he formed a new band of any kind. (He briefly had a bluegrass band with Roger and I drove up to SF alone the instant that I heard they were playing!) My most fervent dream in life is that Guy will return to music, but mostly I want him to be happy in life whether it includes writing or playing music. It’s just that I’d like for Guy and Roger to finally get their due, something Guy could care less about, I’m sure! Album: Calm Before... Artist: Rising Storm Label: Sundazed The Upshot: Incalculably rare, this mid 1960s album by a bunch of upper class northeastern schoolboys is better than you might think. Ace covers and surprisingly sturdy original tunes, now available on back-to-vinyl. BY BILL KOPP A bunch of prep school boys put together a rock band in 1965. Big deal, right? American teens (mostly but not exclusively males) did that all over the USA in the mid-sixties. The influences of the Beatles, the Rolling Stones and the Yardbirds was widespread, and American affluence (for some, at least) meant that instruments and amps were within the budget of many teenagers. And sometimes they made good – even great – music. Crate diggers have made a fetish of discovering some of those rare recordings. Calling themselves Green Fuz, a band from near Fort Worth Texas cut a song of the same name, often described as a no-fi classic. Copies of that 45 go for top dollar these days. Even rarer is the sole LP from those Andover Academy teens. They called themselves the Rising Storm, and their album Calm Before… is one of the most sought-after obscure LPs of the rock era. Acclaimed music journalist Richie Unterberger wrote about the Rising Storm and their record in his essential tome, Unknown Legends of Rock ‘n’ Roll. And the record got a legitimate CD reissue in the 1990s. Now in 2018, Sundazed Records has reissued the album again, this time returning it to its native format of vinyl LP. The most remarkable quality about the album is the band’s impeccable taste in material The songs they chose the record are a fascinating assortment of well-chosen covers and surprisingly strong original material. The record opens with a cover of the Remains’ “Don’t Look Back.” The vocals are a bit smoother than Barry Tashian’s original, but the harmonies are tight, and the instrumentation is pretty top-notch, especially for a bunch of teens. And they play the damn thing fast. Even the title “To L.N. / Who Doesn’t Know” betrays a kind of coffee-house sophistication, and the moody, folk rock original is musically appealing. “I’m Coming Home” is a simple enough garage rocker, but the arrangement is ambitious by garage-rock standard. And keyboardist Charlie Rockwell is fleet-fingered on his combo organ. Arthur Lee’s “A Message to Pretty” wasn’t especially well-known on the east coast in 1967, but these students discovered it. The Rising Storm’s reading of the Love classic is a bit subdued and fragile, but perhaps that’s the vibe they were going for. The harmonica solo is pretty solid in a folky way. We’ll excuse the inclusion of “In the Midnight Hour,” because every band did it back then. To be fair, the Rising Storm does better than average on the Wilson Pickett chestnut. By far the weirdest tune on Calm Before… is “Frozen Laughter.” Unterberger spends a good bit of time discussing the track in his book. It really has to be heard to be believed. If it sounds like anything else, it’s perhaps a bit reminiscent of early Velvet Underground. The haunting spoken-word clip that opens the track adds a deeply unsettling air, as does the faraway, funereal organ. (Listen to it at the provided link, below.) Another original, “She Loved Me” shows that the Rising Storm could fuzz-rock as well as any. The vocals on the chorus of “Mr. Wind” are wince-inducing; it’s the weakest track here, but it’s still not a total disaster. “Big Boss Man” opens as a slow blues but shifts gears into what sounds like an upper-class white boy’s rethink of Northern soul…an uncharacteristically good one. “Bright Lit Blue Skies” is a strong original number with some sunny harmonies applied to a melancholy melody and lyric. And like all of the tunes here, it’s performed with great attention to detail, and admirable musical skill. The last original on the record, “The Rain Falls Down” is a shimmering, moody and contemplative number with reasonably mature lyrics. The record closes with another well-worn tune, “Baby Please Don’t Go.” The band plays it at breakneck speed, as if they were just told that there was two minutes and 48 seconds left on the tape. They make the most of it, and seem to be having a great deal of fun in the process. The 2018 Sundazed reissue features the recording in glorious mono, housed in a lovely gatefold sleeve (with rare photos inside). And the translucent yellow vinyl is a nice added touch. Jamaican pianist Alexander has a bright, flowing and lyrical approach to his instrument. Originally released in 1971, Here Comes the Sun was Alexander’s sixth album. Working with three other musicians (bass, drums and percussion), the pianist is at the center of the arrangements on all seven of the album’s tracks. His style often sounds like it’s the result of overdubs; his left hand plays rhythm, as expected, but his right hand is so busy that it sounds like two hands in and of itself. But yet the approach never feels busy. There’s a lively and exuberant to Alexander’s playing that can leave the listener nearly breathless. He and his sidemen sound as if they’re having the time of their lives here; the opening cut “Montevideo” is quite uptempo, but Here Comes the Sun explores a variety of textures; you’re not likely to mistake any one of these tunes for another; such is the level of originality on display here. Be warned, however, that the titular Beatles classic is transformed beyond recognition. MPS does its by now expected top-flight job of repackaging and reissuing another timeless classic from nearly a half century ago. Richie “Dick” Garcia – A Message from Garcia (Modern Harmonic) Though he doesn’t receive prominent billing on this 1956 album from jazz guitarist Dick Garcia, pianist Bill Evans is all over this album. Garcia is out front, but it’s Evans’ crystalline and meditative piano that holds things together. The band explores a variety of tempos and textures, but at its heart, A Message From Garcia is fairly consistent in its musical approach: the guitarist plays single-note melodic runs while the band provides subtle support. Garcia does engage in the occasional musical dialogue with Evans on cuts like “Ev’ry Night About This Time,” but there’s little doubt whose show this is. When he does take the spotlight, Bill Evans sounds as if he’s enjoying himself. The Modern Harmonic reissue of this relative rarity features top-notch sleeve reproduction and colored vinyl. Barney Kessel – Live at the Jazz Mill 1954, Vol. 2 (Modern Harmonic) Acclaimed jazz guitarist Barney Kessel only began his career as a band leader around 1953. By that time he had made quite a name for himself thanks to his work on recordings featuring Billie Holiday, Benny Carter and others. And he’d continue to provide supple six-string support to some of the biggest names in jazz and pop, including Sonny Rollins, Sam Cooke and Chet Baker. Those who don’t know better could easily mistake Live at the Jazz Mill 1954, Vol. 2 for a reissue of a record from years past. In fact it’s not: a young fan taped Kessel (backed by the Jazz Millers), and the tapes were only recently discovered. This second volume (the first was released a couple of years ago) features surprisingly good audio quality. And everything about the package – the cover art, the jacket’s liner notes – is note-perfect. Volker Kriegel – Spectrum (MPS) I first – and quite belatedly – discovered the work of Volker Kriegel via a 2014 archival release from the now more-or-less defunct SWR/Jazzhaus label. The German guitarist worked in a number of musical idioms including soul jazz and jazz-rock fusion. This 1971 album – Kriegel’s second – is (in places) much closer to rock than anything else I’ve heard from him. With a nasty fuzztone, percussion that may remind some of Low Spark of High Heeled Boys-era Traffic and a kinetic bottom end (featuring acoustic and electric bass as well as cello), Spectrum is a scorcher. John Taylor plays what’s noted as “electra-piano.” The rest of us would know it as a Hohner Pianet or maybe (but probably not) a Fender Rhodes. The opening track “Zoom” finds Kriegel doubling his fuzztone leads on sitar, and it’s not even a little gimmicky. Two years later Kriegel would form a band named after this LP. A tasty treat for those who dig the most accessibly tuneful end of jazz rock, Spectrum is adventurous, too: “More About D” is almost Zappaesque in its weirdness, albeit still rooted in jazz traditions. The album is newly reissued from MPS and is enthusiastically recommended. Herbie Mann – It’s a Funky Thing: The Very Best of Herbie Mann (Varese Sarabande) One could say that Herbie Mann was the Rodney Dangerfield of jazz: he got no respect. Part of that was his own doing; he resolutely refused to be boxed in with regard to what is and is not jazz. His work is wonderfully accessible and irresistibly catchy. It’s also, on occasion, a bit schlocky, and some of his work has a distinct air of bandwagon jumping (or at least musical dilettantism) about it. How else to explain disco outings like “Hijack,” a big hit in the disco era? But for listeners who can put all that baggage aside and simply dig, Herbie Mann’s music is supremely diggable. Truth be known, he was at the forefront of the world music movement, though few will afford him the credit he deserves for it. And anybody hip enough to hire Larry Coryell and Sonny Sharrock is okay by me. This collection – annotated by my pal, the esteemed author and esteemed music journalist Pat Thomas – is a lot of fun. The tracks here are featured in their single edits, most making their first appearance on digital media of any kind. Jay Saunders – Nice!: Jay Saunders Best of the Two (North Texas Jazz) The University of North Texas has a storied and vibrant Division of Jazz Studies, one that goes back some 70 years. And its North Texas Jazz label has released a sizable catalog of music, featuring instructors, students and alumni. Trumpeter and band leader Jay Saunders recently retired from his position at UNT, where he taught classes and directed bands. This new 2CD collection is subtitled Best of the Two, as in the Two O’Clock Lab. It draws from six earlier releases by the ever-shifting ensemble. The big-band music is a nice mix of standards, ambitious pieces and jazz readings of pop tunes; it’s classic and modern all at once, deliberately all over the map in a way that shows the timeless nature of jazz when it’s done right. “I 8 Da Whole Half Thing” sounds like Lalo Schifrin-style 1970s movie music, and that’s meant in the best possible way. Various Artists – Jazz for Hi-Fi Lovers (Modern Harmonic) This time capsule in the form of a colored vinyl LP is a true delight. Originally released in 1958 on the Dawn label, Jazz for Hi-Fi Lovers is a various artists collection presented in wonderful hi-fi (read: monaural). Zoot Sims is among the biggest names featured here, and he’s performing Thelonious Monk’s “Bye Ya.” Paul Quinichette provides the opening cut, the aptly named “Start Here.” Paulette Girard’s original liner notes are presented intact, and they too are a kind of trip back in time: they include three lengthy paragraphs under the heading “about the sound and the equipment,” full of info to satisfy the keen high fidelity enthusiast in your mid-century modern household. The cover art is a gas, too. Come for the packaging, and stay for the music. On March 23rd, keeper-of-the-krautrock-flame Groenland will be releasing Cinema, an overview of Holger Czukay’s solo work and collaboration. Included will be Canaxis 5 (1969), Movies (1979), On The Way To The Peak Of Normal (1981), Full Circle (1982), Der Osten Ist Rot (1984), Rome Remains Rome (1987) and Radio Wave Surfer (1991). This five-LP set features a 36-page booklet, DVD of a movie starring Czukay for which he also made the soundtrack as well as a “vinyl video.” It ain’t cheap – $135. (Peak of Normal was reissued on vinyl not long ago, incidentally.) But to have all of this under one cover isn’t a bad way to get your springtime record collecting off to a nice start…. Time to go fishin’ for the Blues with BLURT, along with our sister retail business, Schoolkids Records of Raleigh/Durham/Chapel Hill. Herewith, find some shopping and collecting tips for aficionados and newbies alike—many of the titles mentioned below (and others as well) are available at the Schoolkids site. And tune in next month for our next installment of our new series, “Build Your Record Collection.” BY FRED MILLS True story: One afternoon, not all that long ago, I was behind the counter of my job at the time, Schoolkids Records in Raleigh, North Carolina, when a father and son strode purposefully into the store. The father was probably in his late forties or early fifties, the son in his mid-teens. They asked me where our Blues section was, and I duly steered them over to the new vinyl, additionally telling the kid that we also had a lot of new indie rock on the front rack. Because, you know, teenagers. “I’m just looking for some Blues,” he replied, adding, “I’ve been listening to a lot of my dad’s old vinyl and really getting into the Blues.” I had the strangest feeling that, right before my eyes, I was witnessing a torch being passed from one generation to the next. I sneaked a glance over at the father, and he had a knowing, proud smile on his face. A little later, when they brought their purchases up to the counter, he and I easily slipped into an earnest conversation about mutual favorite Blues albums—classic titles like Muddy Waters’ Electric Mud, Taj Mahal’s The Natch’l Blues, Albert King’s Live Wire/Blues Power, Howlin’ Wolf’s Moanin’ In the Moonlight (he was pretty impressed that I had met Wolf’s guitarist, Hubert Sumlin, one time and shared a flask of whiskey with him), pretty much everything by John Mayall, along with a very special personal hero of mine, Rory Gallagher. The kid soaked it all in, tentatively throwing out a few titles of his own. When I told the father that his son had good taste, he just grinned, then explained that, thanks to the younger man pulling his battered turntable out from the basement along with several boxes of his old record collection, his own passion for vinyl had been rekindled. Who’s passing who the torch here, I thought to myself, grinning back at him. The Blues is like that—it brings people together, bridges economic, social, and generational gaps, and in general just makes you feel good because what’s being expressed in the sounds and the words are universal emotions. When someone is singing about having lost their one true love, you can feel it in their voice—hell, you can feel it in the weeping guitar lines as well. It’s like having a friend there in front of you, opening up, feeling vulnerable, and just needing to have someone listen to them and understand them. Patti Smith once told me that a key role artists play is that they offer us a shoulder to lean on when we need the support, and while she wasn’t specifically referring to the Blues, I can’t think of a better description of what the Blues brings to the table. *** As I mentioned, that was a couple of years ago when I was working at Schoolkids, which now has stores in Durham and Chapel Hill in addition to Raleigh. There’s a 40+ years Schoolkids legacy that I’m proud to be a part of—BLURT is also the indie retail chain’s sister business, as we are owned by the same guy, so even though I no longer live in Raleigh I’m in touch with the crew there on a weekly basis—and I have no doubt that a lot of torches similar to the scenario I just outlined have been passed along in the Schoolkids aisles. This month they’re emphasizing the stores’ selections of classic Blues titles, both on LP and CD, so it should prove an excellent opportunity to either discover some of those classics, if you are a relative newbie, or rediscover them, particularly if you’re someone like the father above. And since I’ve frequently gone on the record as being increasingly militant about people supporting brick-and-mortar stores and not the impersonal likes of Amazon, Barnes & Noble, or Target, I’m not reluctant here to suggest you pop into a Schoolkids or your own local indie store, and if poor proximity makes that not an option, you can search for the titles on Schoolkidsrecords.com and then link to purchase. My old employer also has a web sales fulfillment deal arranged with national indie distributor AEC, so even if a title you’re looking for isn’t in stock at one of the stores, AEC will ship it to you if they have it—digital downloads as well. *** In 2018, building a Blues collection is not a difficult task because there are enough universally acknowledged classics to give you a solid foundation, even if you’re on a limited budget. In addition, the Blues is remarkably stable and consistent; unlike some genres, EDM for example, you’re not going to have someone reinventing how it’s constructed and/or performed every other week. There will always be intriguing new wrinkles from time to time in the Blues, but even younger artists looking to make a name for themselves tend to approach the genre with respect and reverence while still trying to keep their music fresh-sounding. (Think, for example, of a jam band, which one moment is flying off on a Phish-inspired cosmic tangent, and the next plowing into a down ‘n’ dirty Blues groove as taught to them by the Allman Brothers.) I could go on for hours about my favorite Blues records, but for the sake of sanity, here’s just a select few. Don’t think I’m offering my version of Blues For Dummies, however—there are plenty of well-documented reasons for why all of these are considered timeless classics. *** Howlin’ Wolf is probably my favorite old-school Blues artist, having been a constant presence on the scene starting in the late ‘50s until his death in 1976, and his impact upon the artform continues to be felt to the present day. His 1966 album The Real Folk Blues was originally issued by legendary Chicago label Chess Records as part of their album series of the same name, which also featured Muddy Waters, John Lee Hooker, Memphis Slim, and Sonny Boy Williamson II. Everything in the series is essential, with Wolf’s contributions (including More Real Folk Blues) musical templates for Chicago-style Blues at its most primal—it’s downright hypnotic when Wolf and his band, which included the brilliant guitarist Hubert Sumlin mentioned above, slip into one of their signature low-slung grooves. Wolf’s vocals should be singled out as well, a raspy-yet-tuneful growl/moan that is impossible to mistake; put into a larger cultural context, there would be no Captain Beefheart and no Tom Waits had Wolf not come before them. Hold that thought: Without Robert Johnson, the most important bluesman ever, the Blues would not have unfolded and evolved the way it did. All paths lead back to Johnson. Born in 1911, he’s the guy from whom all those stories about bluesmen going down to the crossroads in Mississippi (to sell their soul to the devil in exchange for success, natch) are derived. Relatively speaking, he only recorded a handful of sides, but those sides, the core songs originally collected in 1961 long after his death as King of the Delta Blues Singers, exerted an outsized influence on pretty much every serious Blues artist who came after him. You can still hear echoes of “Cross Road Blues,” “32-20 Blues,” “Walkin’ Blues,” and “If I Had Possession Over Judgement Day” in contemporary Blues songs, both acoustic (which was how Johnson performed) and electric. God help the archivist who attempts to list every cover version of a Johnson song. And in the feral, keening howl that is Johnson’s vocal style, one hears the existential agony consistently coursing through all classic Blues music. King… has been reissued countless times over the years, both on vinyl and on CD, including in the mid/late ‘80s as an expanded CD box set that not only introduced Johnson to a broader (and younger) audience, it also played a key role in making box sets commercially viable for the record industry. Everybody has heard of Muddy Waters, arguably the second most important bluesman ever. There’s not a Blues band on the planet that doesn’t have at least one or two of McKinley Morganfield’s—Muddy’s—songs in their repertoire. My first direct exposure to him came with 1968’s Electric Mud, most likely because it was billed as his “psychedelic album” and at that point a teenage me was soaking in a near-100% diet of psychedelia. It was kind of an experiment on the part of Chess Records to try to get Muddy’s music into the hands of kids like me, with his regular backing band temporarily replaced by the younger musicians of Rotary Connection, and for good measure they even did a kind of electric gospel/soul/psych cover of the Rolling Stones’ “Let’s Spend the Night Together.” And with more traditional Muddy fare like “I Just Want to Make Love to You,” “Hoochie Coochie Man,” and “Mannish Boy” semi-reworked for then-contemporary times, the album is wildly accessible without compromising Muddy’s core vision. While the artist himself was reportedly not enamored of the record, and purist American music critics didn’t take much of a shine to it either, it became the first Muddy album to land on both the Billboard and Cashbox album charts. Further proof of Electric Mud’s staying power? It has been sampled by Cypress Hill, Natas, and Gorillaz, and as Wikipedia informs us, Martin Scorcese’s documentary series The Blues contains scenes of the recording band for Electric Mud performing with Public Enemy’s Chuck D and members of The Roots. Meanwhile, since we’ve been talking about torches being passed, consider John Mayall & the Bluesbreakers, white men from England whose deep appreciation of black American legends led them to bring the Blues to the British marketplace. That singer/harp player Mayall recruited high-profile sidemen like John McVie and Peter Green (who would go on to Fleetwood Mac after their Mayall tenure) and Some Guy Named Eric Clapton, fresh from the Yardbirds, was testimony to his artistic prescience. The 1966 album BluesbreakersWith Eric Clapton, which not so coincidentally gave that same Some Guy near-co-billing with Mayall on the cover, has seven of its 12 tracks written by earlier Blues artists—among them, Robert Johnson, Mose Allison, Otis Rush, and Freddie King. The latter’s “Hideaway” is a textbook example of a Texas-Chicago Blues hybrid, and Clapton’s signature riffing is instantly identifiable to anyone even remotely familiar with his work in Cream and as a solo artist. The album as a whole is a perfect example of how British musicians were able to adapt the Americans’ music and carve out a unique piece of turf in the Blues for themselves. Which brings us to Rory Gallagher. The fiery Irish guitarist, who passed away, sadly, in 1995, at the age of 47, earned an early rep fronting power trio Taste, which put its own unique spin on electric blues much as Clapton and Cream were doing at the same time in England. Following the group’s breakup in 1970, Gallagher embarked upon a prolific solo career, soon adding a keyboard player to round out the guitar-bass-drums ensemble. Yours truly was fortunate enough to see him several times during his heyday, most notably as an unannounced early-a.m. act at the Peachtree Celebration festival in tiny Rockingham, NC, in 1972. Coming on after headliner Alice Cooper had finished, the flannel-shirted guitarist seemed oblivious to the fact that much of the audience had already begun streaming out, and put forth a hi-nrg set that left those of us who stuck around scraping our jaws from the festival grounds. Check out 1974’s Irish Tour ’74, whose setlist draws extensively from his superb Blueprint and Tattoo studio albums, additionally serving up classic Blues standards from Muddy Waters (“I Wonder Who”), J.B. Hutto (“Too Much Alcohol”), and, on the 40th anniversary box set, Junior Wells (“Messin’ With the Kid”) and Big Bill Broonzy (“Banker’s Blues”). Part of Gallagher’s genius was the way his original material was clearly derived from the Blues but also injected with strong doses of irresistible pop melodies and outright anthemism. Plus, he could play slide guitar like nobody’s business. At least two of the album’s tracks should be on any self-respecting rock ‘n’ roll playlist, “Tattoo’d Lady” and “A Million Miles Away” —the latter a 10-minute tour de force in concert, rife with dynamic shifts and myriad tonal textures all jostling amid a fairly straightforward 12-bar blues chord progression. Irish Tour ’74 makes for a stellar introduction to Gallagher’s oeuvre while also serving as a tutorial on how a lot of white electric bluesmen in the late ‘60s and ‘70s were able to adapt the Blues and make them commercially viable. (Below: Check out a choice live version of “Million Miles Away” from the Rockpalast German TV show in 1979.) As I already indicated, I could keep going, but maybe I’ll save that for another column. I will, however, leave you with a list of artists well-worth checking out, whether you’re in student mode or simply revisiting old favorites—names like Albert King, BB King, Freddie King (what, no Queens? no Aces?), Elmore James, John Lee Hooker, Taj Mahal, Leadbelly, Lightning Hopkins, the Paul Butterfield Blues Band, Stevie Ray Vaughan, Robert Cray, KoKo Taylor, Willie Dixon, Albert Collins… True Story: Albert King passed away in 1992, but I was fortunate enough to interview him in the early ’90s when I was the music editor of an alternative weekly paper. He was scheduled to be headlining a local all-day Blues festival, and for some reason we were able to pull enough strings to land a quickie (like, 12 minutes) phone interview with him for a preview piece in the paper. After some perfunctory comments about The Blues And Its Significance, King and I somehow shifted/devolved into a conversation about, of all things, fishing. I’d heard he was an avid fisher and figured that was a fair topic to broach, so I mentioned to him that I knew a couple of choice spots in the area where one could drop a line, including a pond owned by my family. I harbor no illusions that King eagerly scribbled down my suggestions, but he was gracious enough to take the ball and run with it, talking briefly about why he loved fishing so much. We subsequently turned back to the upcoming event, and soon, sensing my time was about up, I decided to close out with the stock “So, what’s next for you after this?” question. THE BLURT JAZZ DESK ESSENTIAL READING FOR JAZZ FANS! Join Bill “Musoscribe” Kopp for a look at the jazz world – past, present, and yet-to-come, via interviews, essays, and reviews of new releases and archival titles.GO HEREfor full details, along with direct links to this exclusive content. Most recently: #12, five late ’18 and early ’19 releases, including Jeff Goldblum, Tony Bennett/Diana Krall, & more. MUSIC FOR THE EARS / MOVIES FOR THE EYES MOVIE THOUGHTSJoin our man in the balcony, Daniel Matti, who knows of what he views.Go HEREto read the latest reviews and updates. Most recently: Top 10 Films of 2017, including The Disaster Artist, Good Time, and The Killing of a Sacred Deer.
{ "pile_set_name": "Pile-CC" }
Q: getListItems from SharePoint List dosen't work I have a Website-Collection with this url: https://directv2.altran.com/com/buhb/ (Lists are located here:) https://directv2.altran.com/com/buhb/Lists/ and a script wich I want to put into a ContentWebEditor-WebPart on the default.aspx in this WebSite-Collection: <script src="js/jquery-1.9.1.js"></script> <script src="js/jquery.ui.core.js"></script> <script src="js/jquery.ui.effect.js"></script> <script src="js/jquery.SPServices-2013.01.js"></script> <ul id="tasksUL"> <li>First Item</li> </ul> <script type="text/javascript"> $(document).ready(function() { $().SPServices({ operation: "GetListItems", webURL: "Lists/", listName: "Announcements", async: true, completefunc: function (xData, Status) { console.log($(xData.responseXML)); $(xData.responseXML).SPFilterNode("z:row").each(function() { var liHtml = "<li>" + $(this).attr("ows_Title") + "</li>"; $("#tasksUL").append(liHtml); }); } }); }); </script> My problem is, that I don't get any Items from this List. First I thought, that my webURL isn't correct. But I think its ok. This is what the FireFox-Console is telling me regarding this topic: [10:50:36.567] GET https://directv2.altran.com/com/buhb/default.aspx [HTTP/1.1 200 OK 996ms] [10:50:37.274] GET https://directv2.altran.com/_layouts/1033/styles/core.css?rev=5msmprmeONfN6lJ3wtbAlA%3D%3D [HTTP/1.1 304 Not Modified 186ms] [10:50:37.275] GET https://directv2.altran.com/_layouts/1033/init.js?rev=SKi7C%2FTrsh1U%2FCnIwkB9Ag%3D%3D [HTTP/1.1 401 Unauthorized 296ms] [10:50:37.276] GET https://directv2.altran.com/_layouts/portal.js?rev=cRI8b5r5N%2BkLhIuWR03ICg%3D%3D [HTTP/1.1 304 Not Modified 287ms] [10:50:37.278] GET https://directv2.altran.com/_layouts/1033/non_ie.js?rev=yfNry4hY0Gwa%2FPDNGrqXVg%3D%3D [HTTP/1.1 304 Not Modified 250ms] [10:50:37.280] GET https://directv2.altran.com/WebResource.axd?d=xIUuOuE98ByfhEVw86s2-wsvSC23O-MG2j2RCiSYrBW3eENvird3FGtTl7n5Ey8MA6YczOwHqe-nF_MjkubOu-Fs9YM1&t=634208849469717278 [HTTP/1.1 304 Not Modified 437ms] [10:50:37.281] GET https://directv2.altran.com/WebResource.axd?d=coyRyDekjahDPLQl45NQFykt1JFYYy3biV8NJQ0qsgkE-xbjFHLfY0XzXI4lou9RbTZ-LhJvLTejwoR3UsTN9S3AWkk1&t=634208849469717278 [HTTP/1.1 304 Not Modified 438ms] [10:50:37.478] GET https://directv2.altran.com/com/buhb/js/jquery-1.9.1.js [HTTP/1.1 304 Not Modified 222ms] [10:50:37.480] GET https://directv2.altran.com/com/buhb/js/jquery.ui.core.js [HTTP/1.1 304 Not Modified 232ms] [10:50:37.481] GET https://directv2.altran.com/com/buhb/js/jquery.ui.effect.js [HTTP/1.1 304 Not Modified 230ms] [10:50:37.482] GET https://directv2.altran.com/com/buhb/js/jquery.SPServices-2013.01.js [HTTP/1.1 401 Unauthorized 240ms] [10:50:37.593] GET https://directv2.altran.com/_layouts/1033/init.js?rev=SKi7C%2FTrsh1U%2FCnIwkB9Ag%3D%3D [HTTP/1.1 401 Unauthorized 324ms] [10:50:37.597] GET https://directv2.altran.com/_layouts/1033/core.js?rev=mHKsOQ0iU3Q5jdm9OZNDdg%3D%3D [HTTP/1.1 401 Unauthorized 799ms] [10:50:37.599] GET https://directv2.altran.com/_layouts/1033/search.js?rev=yqBjpvg%2Foi3KG5XVf%2FStmA%3D%3D [HTTP/1.1 304 Not Modified 798ms] [10:50:37.782] GET https://directv2.altran.com/com/buhb/js/jquery.SPServices-2013.01.js [HTTP/1.1 401 Unauthorized 617ms] [10:50:37.919] GET https://directv2.altran.com/_layouts/1033/init.js?rev=SKi7C%2FTrsh1U%2FCnIwkB9Ag%3D%3D [HTTP/1.1 304 Not Modified 475ms] [10:50:38.493] GET https://directv2.altran.com/com/buhb/js/jquery.SPServices-2013.01.js [HTTP/1.1 304 Not Modified 655ms] [10:50:38.494] GET https://directv2.altran.com/_layouts/1033/core.js?rev=mHKsOQ0iU3Q5jdm9OZNDdg%3D%3D [HTTP/1.1 401 Unauthorized 649ms] [10:50:38.495] GET https://ssl.google-analytics.com/ga.js [HTTP/1.1 304 Not Modified 533ms] [10:50:38.495] GET https://directv2.altran.com/_layouts/images/blank.gif [HTTP/1.1 304 Not Modified 538ms] [10:50:38.495] GET https://directv2.altran.com/_layouts/images/menudark.gif [HTTP/1.1 304 Not Modified 536ms] [10:50:38.496] GET https://directv2.altran.com/_layouts/images/helpicon.gif [HTTP/1.1 304 Not Modified 536ms] [10:50:38.496] GET https://directv2.altran.com/com/buhb/FormServerTemplates/logo_altran.png [HTTP/1.1 304 Not Modified 539ms] [10:50:38.497] GET https://directv2.altran.com/_layouts/images/gosearch.gif [HTTP/1.1 304 Not Modified 830ms] [10:50:38.497] GET https://directv2.altran.com/_layouts/images/whitearrow.gif [HTTP/1.1 304 Not Modified 870ms] [10:50:38.498] GET https://directv2.altran.com/_layouts/images/recycbin.gif [HTTP/1.1 304 Not Modified 880ms] [10:50:38.499] GET https://directv2.altran.com/_layouts/images/siteTitleBKGD.gif [HTTP/1.1 304 Not Modified 881ms] [10:50:38.499] GET https://directv2.altran.com/_layouts/images/topnavselected.gif [HTTP/1.1 304 Not Modified 902ms] [10:50:38.500] GET https://directv2.altran.com/_layouts/images/topnavunselected.gif [HTTP/1.1 304 Not Modified 1008ms] [10:50:38.500] GET https://directv2.altran.com/_layouts/images/siteactionsmenugrad.gif [HTTP/1.1 304 Not Modified 1021ms] [10:50:38.501] GET https://directv2.altran.com/_layouts/images/pageTitleBKGD.gif [HTTP/1.1 304 Not Modified 1021ms] [10:50:38.501] GET https://directv2.altran.com/_layouts/images/topshape.jpg [HTTP/1.1 304 Not Modified 1039ms] [10:50:38.502] GET https://directv2.altran.com/_layouts/images/navshape.jpg [HTTP/1.1 304 Not Modified 1039ms] [10:50:38.502] GET https://directv2.altran.com/_layouts/images/quickLaunchHeader.gif [HTTP/1.1 304 Not Modified 1128ms] [10:50:39.121] GET https://directv2.altran.com/_layouts/1033/core.js?rev=mHKsOQ0iU3Q5jdm9OZNDdg%3D%3D [HTTP/1.1 304 Not Modified 345ms] [10:50:39.167] GET https://ssl.google-analytics.com/__utm.gif?utmwv=5.4.3&utms=4&utmn=1908043118&utmhn=directv2.altran.com&utmcs=UTF-8&utmsr=1600x900&utmvp=1600x412&utmsc=24-bit&utmul=de-de&utmje=1&utmfl=11.7%20r700&utmdt=Home%20-%20BU%20Holger%20Bartels&utmhid=1021575290&utmr=-&utmp=%2Fcom%2Fbuhb%2Fdefault.aspx&utmht=1373446239026&utmac=UA-27185626-1&utmcc=__utma%3D124039967.1382262210.1373437685.1373437685.1373446038.2%3B%2B__utmz%3D124039967.1373437685.1.1.utmcsr%3D(direct)%7Cutmccn%3D(direct)%7Cutmcmd%3D(none)%3B&utmu=q~ [HTTP/1.1 200 OK 285ms] [10:50:39.168] GET https://directv2.altran.com/_layouts/images/Menu1.gif [HTTP/1.1 304 Not Modified 450ms] [10:50:39.168] GET https://directv2.altran.com/com/buhb/js/jquery-1.9.1.js [HTTP/1.1 304 Not Modified 311ms] [10:50:39.169] GET https://directv2.altran.com/com/buhb/icons/icons.png [HTTP/1.1 304 Not Modified 500ms] [10:50:39.591] GET https://directv2.altran.com/com/buhb/js/jquery.ui.core.js [HTTP/1.1 304 Not Modified 144ms] [10:50:39.736] GET https://directv2.altran.com/com/buhb/js/jquery.ui.effect.js [HTTP/1.1 304 Not Modified 165ms] [10:50:39.939] GET https://directv2.altran.com/com/buhb/js/jquery.SPServices-2013.01.js [HTTP/1.1 304 Not Modified 562ms] [10:50:40.686] GET https://directv2.altran.com/_layouts/images/pagebackgrad.gif [HTTP/1.1 304 Not Modified 752ms] [10:50:40.686] POST https://directv2.altran.com/com/buhb/Lists/_vti_bin/Lists.asmx [HTTP/1.1 404 Not Found 765ms] [10:50:41.401] [object Object] Can anyone help? A: Have you tried upgrading to SPServices version 2014.01? 2013.01 gave me a ton of issues and forced me to drop back to v0.7.2. Upgrading today to 2014.01 worked like a charm. http://spservices.codeplex.com/releases/view/116626 Also - have you tried putting your fully qualified URL into the webURL field instead of just the relative URL?
{ "pile_set_name": "StackExchange" }
1 SHARES Share Tweet NAIROBI, Kenya, Jun 16 – Pangani Police Station has become the centre of activity for the past 48 hours after lawmakers were detained there in an ongoing hate speech probe. On Wednesday morning, Esther Muthama arrived at the police station at 6am oblivious of the fact that she may not be able to see her brother, Machakos Senator Johnson Muthama. “I left this place at 2am last night and by 6am, I was here,” a teary Esther told Capital FM News. It is only the spouses, security detail and lawyers to the six CORD and Jubilee lawmakers who were given access to the cells, while the rest – Esther included – waited outside the police station, metres away from their loved ones. “The condition of that place is horrible and no one is being allowed to give them anything, not even food or something to keep them warm,” a visibly angry Esther said. After pausing for a few minutes, “they are just the way they were after Milimani (Courts). They have not even changed clothes,” she added. To her, ‘special treatment’ should be given to the six legislators since, “they are leaders and they belong to people. They must be taken care of.” Since Monday, Muthama’s family and that of other leaders have been preparing special food for them but ended taking it back home. An aide to one of the leaders confirmed to Capital FM News that they are using one cell with other suspects of various crimes. Advertisement. Scroll to continue reading. “Hawa watu ni bure kabisa (These people are fake), they have put them in there with other suspects,” the aide said. He however pointed out that “the (rival) leaders have been talking. You see, they are in one cell, so they have to talk.” Another relative of one of the Jubilee leaders shared Esther’s sentiments, saying, “The leaders need to be taken care of.” The relatives displayed a rare sense of unity; the purpose being to ‘secure’ the freedom of the leaders. Their bodyguards were seen taking tea and bread inside the expensive cars of their bosses, a luxury that the legislators cannot afford, in their current state. “I have to be here though my boss is locked inside there,” one of the bodyguards said. CORD leaders Raila Odinga, Moses Wetangula and Kalonzo Musyoka, who visited the station were not spared either. They left without seeing the leaders.
{ "pile_set_name": "OpenWebText2" }
Bioré® Skincare Self Heating One Minute Mask: In just one minute, this thermal mask warms to open pores, draws out and dissolves 2.5 times more dirt, oil, and surface toxins than a basic cleanser, and rinses them clean away with an invigorating cooling sensation. Infused with natural charcoal, this breakthrough mask melts dirt and oil better than the leading competitive mask. So clean your pores from the dirt, oil and makeup of the past and clear the problem. Available at select food, drug and mass merchant stores. For more information, visit www.biore.com
{ "pile_set_name": "Pile-CC" }
French Jews increasingly question their future By Hugh Schofield BBC News, Paris Published duration 9 March 2015 image copyright AFP image caption Tombstones were vandalised in a Jewish cemetery last month "From your holy dwelling-place, look with kindness on this our country, the French Republic. And bless the French people. Amen." Every Saturday in synagogues across France these words are intoned - in French or in Hebrew - as part of the Shabbat service. The Prayer for the French Republic goes back to 1808, when the Jewish community was formally recognised by Napoleon as one of France's three official religions. It enshrines in holy language the special debt that French Jews have always felt to France, as the first country in Europe in which they were proclaimed full citizens. Today that special link is once again under terrible strain, as more and more French Jews question where their future lies. Anti-Semitism has rich roots in France. Twice in little over a century - first in the Dreyfus affair (when a Jewish officer was wrongly accused of treason) and then under Vichy in World War Two - Jews have been victims of a national quest for ideological or ethnic purity. Today anti-Jewishness is back, but in a different guise. And many Jews feel betrayed by the slowness of the French response. They feel that for more than a decade the source of most anti-Jewish violence has been deliberately masked in order not to antagonise French Muslims. image copyright AP image caption Jewish sites received military protection after the January attacks Instead of saying explicitly that the new anti-Semitism came from elements in the Muslim community, it was more expedient for politicians and journalists to lump it all together as part of a historical phenomenon for which the whole of France could be held responsible. So goes the argument. Thus when Mohamed Merah began his murder spree in Toulouse in 2012, the theory that it was a far-rightist who was killing soldiers was nurtured in the media far longer than was plausible. "We have been saying this for years, and only now have people begun to listen: the danger to Jews here no longer comes from the far-right," says Michel Zerbib, editor-in-chief at the Jewish radio station RadioJ. Old prejudices Vestiges of old European anti-Semitism remain. Last month, former Socialist foreign minister Roland Dumas used language straight from the 1930s when he said that Prime Minister Manuel Valls was probably "under the influence" of his Jewish wife. And the recent vandalism at a Jewish cemetery in Alsace was the work of local yobs, with some inarticulate folk-memory giving edge to their teenage destructive urges. Jews in France: France has a Jewish population of 600,000. It is the third largest community after Israel and the United States. The number of Muslims in France is estimated at around 6,000,000. Most French Jews are Sephardi Jews whose families emigrated from North Africa when Algeria, Tunisia and Morocco won independence. In 2014 more than 7,000 French Jews emigrated to Israel. For the first time France led the table of countries contributing to aliyah. The Representative Council of Jewish Institutions in France (CRIF) reported 851 anti-Semitic acts in 2014, up from 423 in 2013. But after the attacks in Paris and Copenhagen, obfuscation is no longer an option. The real threat to Jews - the mortal threat - is the Islamist one. Many French Jews hope that the outpouring of national unity that followed the January attacks at Charlie-Hebdo and Hyper Cacher will now act as a bulwark. "The legacy of these terrible events could be to end the feeling of solitude among French Jews," says Sacha Reingewitz, head of the Union of Jewish Students. "Up till now the political and national mobilisation against anti-Semitic violence has been very weak. No way would there have been so many people demonstrating on 11 January, had the Jewish supermarket been the only target of the attacks." Today the French state is indeed mobilised like never before in defence of the Jewish community, with hard-hitting pronouncements from President Hollande and soldiers posted at Jewish schools, community centres and places of worship. For some Jews, it is still not enough. Last year saw a big increase in the numbers emigrating to Israel - more than 7,000 - and 2015 will probably see the trend continue. "Today it is an act of heroism just to wear a kippah on the street or to send your children to a Jewish school. This in Paris in the 21st Century! It really hurts," says Paris rabbi Mikael Journo. Growing insecurity According to Roger Cukierman, who heads the Representative Council of Jewish Institutions in France (CRIF), the increase in aliyah from France is directly attributable to the growing insecurity. "Jews have had the feeling they are the pariahs of the nation," he says. In Jewish households across the country, there has been the same conversation. It is one that Jews have had many times in history. How to react to the violence? Is it safe? Should we leave? But just as it is undeniable that more French Jews today are susceptible to the call to emigrate, it is equally true that the vast majority are not. Many Jewish leaders - especially those of a left-wing tendency - are angry with Israel's prime minister Benjamin Netanyahu for (as they see it) playing up their insecurity and implying that France cannot protect them. image copyright Reuters image caption Mohamed Merah murdered seven people in south-west France They also accuse him of cynically encouraging the notion of their dual allegiance (to France and to Israel) - even though he knows this feeds into anti-Semitism. Like Jews everywhere, French Jews do feel a strong attachment to Israel. But they also have a strong attachment to France - and the vast majority have no intention of leaving. In the vandalised Jewish cemetery at Sarre-Union in Alsace, one of the grave-stones that was overturned was nearly two centuries old. It belonged to a Jewish "grognard", one of the die-hard soldiers who followed Napoleon through his European campaigns. "That says it all," says Alain Jakobowitz, Jewish head of the anti-racist group LICRA. "Jews have a future here, because they have a past."
{ "pile_set_name": "OpenWebText2" }
Yet Another Paypal Block For Indian Users As you may have noticed, apart from Amit and me, some other authors are currently contributing content for this site. Some being from India, some are also from outside India as well. The problem I am going to talk about here is what I noticed a few weeks back when I was trying to post a reply to a tweet. The story goes like this. Some guy posted a tweet about how happy he was with that day’s (USD=INR) PayPal conversion rate. I was hoping to post my frustration with a reply stating the credit card withdrawal rate which is always higher the other way i.e when you withdraw (say) USD100 to your bank, you’ll receive somewhat around INR 4400 to INR 4450. Whereas when you need to add the same amount (USD100) to your Paypal account using your credit card you’ll have to add almost INR 4550 to INR 4670. And so with the new rule that you (if Indian) cannot buy online using any amount received via Paypal, you have to withdraw the money to your bank and then again use the same with higher rates to spend online. So as I went to PayPal looking for the day’s conversion rate (INR=USD), I simply tried sending a small amount to my other PayPal account. And bang, I was suddenly seeing a message that I need to confirm my credit card first. I was totally surprised as my card was already verified and I had already used it on several occasions to pay online with PayPal. I tried contacting PayPal and then in turn some of my blogger buddies. All but one was experiencing the same problem while paying his Indian authors. All the others were either not using Paypal to pay or simply haven’t faced such problems yet. Then came the long awaited reply from PayPal. Here is what is says, Now as it is clear from their statement that the problem was due to some temporary internal error. I waited for the problem to get solved as I was requested. Days passed and nothing changed and the payment day for all our authors as well our hosting provider was getting closer. Last night I was again checking if the problem got sorted out and it still persisted. So I tried looking out for some alternate ways to make the payment. I generated an invoice from the Amit’s PayPal account and sent it to our blog’s primary PayPal. Next what I did was eventually try to pay the invoice with my credit card linked to the blog’s primary Paypal account. And now came the moment of truth. I got the following message, So as it seems, domestic payments using credit card (from within PayPal) isn’t possible for Indian users. In easy English, you cannot make a payment from one PayPal account to another if both of them are owned by Indian users using credit card. Why I didn’t realize this earlier? Since now we were using our PayPal funds (that we received from other sources) to make any payment. After the PayPal ban (that you can’t use your received amount) effective from March 1, 2011, we started making payments with credit card. But we pay all our Indian authors by NEFT (National Electronic Fund Transfer) or via online banking portals. And as I faced the problem and was going through it, all the time I was trying to send a payment to my and then Amit’s PayPal account, both of which are Indian accounts. Now that I had figured it out, I tried sending a payment to one of our writers from outside India and it did work fine. I think this issue has been there for quite long, apparently without getting noticed. What really pissed me off was the negligence from PayPal end. After almost a series of emails and even a pretty long survey (that I completed in desperation to solve this issue) no one even bothered to look into the matter and work it out. So once again, PayPal found a way to screw Indian users. What’s next?
{ "pile_set_name": "Pile-CC" }
Q: Howto make gnumake behave as if default options in command line were passed? I am using a makefile in which if I pass options in the command line like make OPT1=opt1 OPT1=2 I get a different behavior than if I edit Makefile and write there OPT1=opt1 OPT2=opt2 and then then run make on the command line. The behavior I want is the one where I use the options in the command line.Right now I am using an alias but I am interested in knowing if this can be done purely with the Makefile alone. Thanks. A: The way I end up solving this was the following: mv Makefile Makefile.aux then create a now Makefile with the contents OPT1=true OPT2=false DEFAULT_OPTS=--no-print-directory OPT1=$(OPT1) OPT2=$(OPT2) .PHONY : $(MAKECMDGOALS) $(MAKECMDGOALS): $(MAKE) -f Makefile.aux $(DEFAULT_OPTS) $(MAKEFLAGS) $(MAKECMDGOALS) .PHONY: all all: $(MAKE) -f Makefile.aux $(DEFAULT_OPTS) $(MAKEFLAGS) $(MAKECMDGOALS) The reason I use --no-print-directory is because if I use this method without this option it will print an extra message in the beggining and in the end of the compilation.
{ "pile_set_name": "StackExchange" }
A study of labor resources in northeast Asia. "This paper will discuss questions such as the tapping, utilization and rational distribution (international migration) of labor resources that have already begun and will continue to expand in the regional economic and technological cooperation of Northeast Asia.... In the broad sense, Northeast Asia refers to the Soviet Far Eastern Economic Division and the Siberian Economic Division; the Northeast, North, and Northwest of China; Mongolia; Korea, South Korea and Japan; its area being 17.5 million square kilometers, or 40% of the Asian land area. Its population is 580 million, or 20% of the total population of Asia."
{ "pile_set_name": "PubMed Abstracts" }
**What was known?** FDH is a rare genetic disorder with developmental anomalies of, cutaneous skeletal, dental, and ocular systems, and facial dysmorphism. Introduction {#sec1-1} ============ Focal dermal hypoplasia (FDH) is a rare mesoectodermal disorder inherited by an X-linked dominant gene, which is lethal in homozygous males. Goltz syndrome was first described by Leibermann as *atrophoderma linearis maculosa et papillomatosis congenitalis*.\[[@ref1]\] Subsequently in 1962, Goltz *et al*. reported three cases of FDH and distinguished them as separate entities.\[[@ref2]\] There are several 100 cases described in the literature but only a few cases from India. We describe a rare case of Goltz syndrome along with the unusual feature of the presence of an atrial septal defect and supernumerary nipples which has not been reported earlier in the literature. Case Report {#sec1-2} =========== An eight-month-old term female child, born of non-consanguineous marriage presented with multiple hypopigmented skin lesions on the trunk and extremities from birth. They appeared as linear erosions at birth that healed gradually within a few days, leaving behind hypopigmentation interspersed with hyperpigmentation at the periphery. Perinatal history was uneventful. She had abnormalities of limbs and nails from birth. Her developmental milestones were delayed. Past history was remarkable for exomphalos minor that was operated and atrial septal defect at birth that had undergone spontaneous closure after three months of age. None of the siblings or family members of the child had similar symptoms. General examination revealed microcephaly, hypertelorism, megalopinna, low-set ears, a broad nasal bridge, and a pointed chin. Cutaneous examination revealed multiple hypopigmented atrophic linear streaks, and macules of varying sizes present on the forehead, neck, trunk, thighs, gluteal region, genitalia, and upper and lower limbs along the lines of blaschko \[Figures [1](#F1){ref-type="fig"} and [2](#F2){ref-type="fig"}\]. There was syndactyly of left foot and lobster claw deformity (ectrodactyly) of right foot \[[Figure 3](#F3){ref-type="fig"}\]. She had supernumerary nipples \[[Figure 4](#F4){ref-type="fig"}\]. A few skin-colored growths were present over the proximal nail fold of the right middle finger and right foot. Nails were dystrophic. Hairs and oral mucosa were normal. Systemic examination was normal. ![Multiple hypopigmented atrophic macules present linearly and in reticulate grouping on the trunk along the lines of blaschko](IJD-60-106b-g001){#F1} ![Multiple hypopigmented atrophic macules on the lower limbs along the lines of blaschko](IJD-60-106b-g002){#F2} ![Syndactyly of left foot and ectrodactyly of right foot with changes in nails](IJD-60-106b-g003){#F3} ![Presence of supernumerary nipples](IJD-60-106b-g004){#F4} Complete hemogram and serum chemistry profile were normal. Skin biopsy on the trunk showed focal spongiosis, occasional dyskeratotic keratinocytes, mild papillary edema, and focal papillary dermal fibrosis with superficial perivascular lymphocytic infiltrate \[[Figure 5](#F5){ref-type="fig"}\]. Ophthalmological examination and computed tomography scan of brain were normal. X-ray of long bones was normal. Based on the clinical presentation and characteristic skeletal abnormalities, a diagnosis of Goltz syndrome was made. ![The epidermis shows parakeratosis with occasional dyskeratotic cells with papillary edema and superficial perivascular lymphocytic infiltrate in the dermis (H and E, ×40)](IJD-60-106b-g005){#F5} Discussion {#sec1-3} ========== Goltz syndrome (FDH) is a rare inherited disorder characterized by developmental defects of the skin in conjunction with ocular, dental, and skeletal abnormalities. Ninety percent of the reported cases are females, suggesting an X-linked dominant mode of inheritance.\[[@ref3]\] When the disorder occurs in males, it probably represents a mosaic condition. The variation in severity among affected females is due to the mosaicism as a consequence of the Lyon hypothesis.\[[@ref4]\] Mosaicism for mutations in the PORCN gene on chromosome Xp11.23 has been implicated as the genetic basis for FDH. Paller hypothesized that the distribution pattern indicates that Wnt proteins stimulate epidermal-dermal signals to induce changes in the dermis.\[[@ref5]\] The hallmark of FDH is thinning of the dermis, which results in depressed linear lesions and soft, reddish-yellow outpouchings of the skin caused by herniation of subcutaneous fat. At birth, the lesions may present as blisters or erosions that leave behind typical atrophic scars that can mimic incontinentia pigmenti. Red, hypopigmented, or depigmented atrophic macules, arranged in a linear or blaschkoid pattern or in a reticulate grouping can be found on any part of the body, but typically involve the thighs, buttocks, and trunk.\[[@ref6]\] Telangiectasias are commonly seen interspersed between the atrophic plaques. Multiple soft pinkish yellow to brown nodules can be present from birth particularly in the popliteal and cubital fossae.\[[@ref6]\] Another characteristic feature is the development of raspberry-like papillomas around the lips, anus, and genitalia, and on the end of the digits. Other cutaneous changes reported are dryness associated with pruritus, photosensitivity, hyperkeratosis of palms and soles, sweating abnormalities, and dermatoglyphic changes.\[[@ref7]\] The second most common extracutaneous abnormality is skeletal defects seen in 60-70% of the patients. These include syndactyly, polydactyly, ectrodactyly, hypoplasia of the digits, and vertebral abnormalities like scoliosis, kyphosis, vertebral body fusions, and spina bifida. Lobster claw deformity (split hand or split foot) is a major distinct feature of this condition.\[[@ref7]\] In 20% of the cases, there is osteopathia striata, which are longitudinal linear striations in the metaphyses of the long bones seen on radiography. Associated ocular abnormalities are colobomas, microphthalmia, microcornea, and ectopia lentis.\[[@ref6][@ref7]\] Patients with FDH have a typical facial appearance with asymmetry, pointed chin, maxillary hypoplasia, broad nasal tip with a narrow bridge, and notching of alae nasi. Other associated abnormalities include enamel defects, sparse and brittle hair, nail dystrophy, short stature, mental retardation, hearing loss, microcephaly, cleft lip and palate, duodenal atresia, intestinal malrotation, umbilical, inguinal, epigastric, or diaphragmatic hernia, horseshoe kidneys, bicornuate uterus, and cardiac defects like patent ductus arteriosus, ventricular septal defect, and hypoplasia of lungs. Rare cases of absent nipples are also reported.\[[@ref8]\] In our case, the child had supernumerary nipples. Skin biopsy of an atrophic lesion showed a normal or thinned epidermis overlying a severely hypoplastic dermis with adipose tissue impinging on the epidermis. Electron microscopy revealed loosely arranged abnormally scattered collagen bundles.\[[@ref9]\] Gene sequence analysis for detection of the PORCN gene mutation could also be carried out. The most common differential diagnosis for FDH is incontinentia pigmenti, Rothmund-Thomson syndrome, and MIDAS (MIDAS: Microphthalmia, dermal aplasia, and sclerocornea syndrome). The linear pattern, stages of pigmentary changes, eosinophilic spongiosis, and absence of fat herniation rules out incontinentia pigmenti. Other differential diagnosis to be considered is epidermal nevus, Bart syndrome, Adams-Oliver syndrome, ectodermal dysplasia, and congenital erosive and vesicular dermatoses.\[[@ref10]\] There is no effective treatment for this disease and it requires a multidisciplinary approach. Patients have a normal life span. Surgical correction of deformities can be considered, and genetic counseling should be given to parents. Involvement of the skin with skeletal abnormalities supports a clinical diagnosis of FDH and is thus present in all reported cases. In our case, the child had typical features of Goltz syndrome, but the rare association with atrial septal defect and supernumerary nipples has not been described in previous reports. **What is new?** The association of atrial septal defect and supernumerary nipples with FDH was an unusual feature of our case. **Source of support:** Nil **Conflict of Interest:** Nil.
{ "pile_set_name": "PubMed Central" }
There are growing concerns over a controversial sentencing for sexual assault. David Becker, 18, was sentenced to two years of probation last week for sexually assaulting two women sleeping at a Massachusetts house party. Becker said he didn’t know one of the women was asleep during the April assault and denied having physical contact with the other. Becker was originally charged with two counts of rape, but a judge decided to give him two years of probation, reports CBS News correspondent Michelle Miller. In court during a plea deal, Becker’s attorney argued that the teenager had already suffered from the consequences of his actions. Earlier this month, his attorney had painted Becker as a good kid. “He’s been a model citizen. He’s a great student,” the attorney said. According to court documents, the victims said they slept in a bed with Becker after a night of drinking and that Becker sexually assaulted them without their consent. One victim told authorities that when she awoke, “David had pulled her pants and underwear down to her thighs.” Shortly after the incident, Becker texted the victim multiple times to apologize. “Just wanted you to know that I really am sorry,” he said in one of the messages. The victim replied, “Don’t even worry about it it’s all good.” She later told investigators she “did not know what else to say.” While the prosecution recommended Becker serve two years in jail, at least one of the victims said she didn’t want Becker to be incarcerated. “The victim’s wishes are very, very powerful,” CBS News legal analyst Rikki Klieman said. “If you have a victim that says she does not want to see a defendant do jail time, we shouldn’t think that sexual assault equals jail time,” Klieman added. “Does the punishment fit the crime?” Miller asked Becker’s former classmate, Karla Martin. “No, it doesn’t,” Martin said. “This whole sentencing shows other people, other victims of sexual assault that if they say something, no justice is going to happen.” Earlier this month, a Colorado judge gave Austin James Wilkerson a two-year work leave jail sentence for sexually assaulting a drunk woman at a party. In June, former Stanford swimmer Brock Turner received a six-month sentence for assaulting a woman behind a dumpster outside a party on the university’s campus. “There are no two sexual assault cases that are in fact the same. So it’s easy for us to say that these three cases are exactly alike when they’re really not,” Klieman said. If Becker completes his probation, he will not be registered as a lifelong sex offender. The 18-year-old was accepted to the University of Dayton for college. The school tells us that he will not be attending this year.
{ "pile_set_name": "OpenWebText2" }
53851357df0689a5b799dac03a8d80a8425906ebc5b5aab26337ee1b7bb8ffb331f2939fc38881dff33baa859502ebb3c4f59ad4db49d6392818835c53cd697e
{ "pile_set_name": "Github" }
Q: Why does gcc produce different compiled binaries for programs that use different forms of integer literals? I was wondering what the difference between: int a = 0b00000100; int a = 0x04; int a = 4; When compiled with gcc. I seem to get a different binary when compiling with what seems to be the same number, just in different notations. When I run objdump on it however, there doesn't seem to be any differences. Could somebody tell me what's going on? This is my output: marshall@dont.even.try.to.h4ck.me:[~]: cat testbin.c && echo && cat testbin2.c #include "stdio.h" int main () { int a = 0b00000100; int b = 0x05; int c = 6; printf("%d - %d - %d\n", a, b, c); return (0); } #include "stdio.h" int main () { int a = 4; int b = 5; int c = 6; printf("%d - %d - %d\n", a, b, c); return (0); } marshall@dont.even.try.to.h4ck.me:[~]: gcc testbin.c -o testbin marshall@dont.even.try.to.h4ck.me:[~]: gcc testbin2.c -o testbin2 marshall@dont.even.try.to.h4ck.me:[~]: md5sum testbin testbin2 fd6aaa31bdf685ea9444e1edc209565e testbin 3a3fc241bfc2917ee29999b5befecd2a testbin2 marshall@dont.even.try.to.h4ck.me:[~]: objdump -d testbin > testbin.obj && objdump -d testbin2 > testbin2.obj marshall@dont.even.try.to.h4ck.me:[~]: diff testbin.obj testbin2.obj 2c2 < testbin: file format elf64-x86-64 --- > testbin2: file format elf64-x86-64 marshall@dont.even.try.to.h4ck.me:[~]: gcc -v Using built-in specs. COLLECT_GCC=gcc COLLECT_LTO_WRAPPER=/usr/lib/gcc/x86_64-linux-gnu/6/lto-wrapper Target: x86_64-linux-gnu Configured with: ../src/configure -v --with-pkgversion='Debian 6.3.0-18' --with-bugurl=file:///usr/share/doc/gcc-6/README.Bugs --enable-languages=c,ada,c++,java,go,d,fortran,objc,obj-c++ --prefix=/usr --program-suffix=-6 --program-prefix=x86_64-linux-gnu- --enable-shared --enable-linker-build-id --libexecdir=/usr/lib --without-included-gettext --enable-threads=posix --libdir=/usr/lib --enable-nls --with-sysroot=/ --enable-clocale=gnu --enable-libstdcxx-debug --enable-libstdcxx-time=yes --with-default-libstdcxx-abi=new --enable-gnu-unique-object --disable-vtable-verify --enable-libmpx --enable-plugin --enable-default-pie --with-system-zlib --disable-browser-plugin --enable-java-awt=gtk --enable-gtk-cairo --with-java-home=/usr/lib/jvm/java-1.5.0-gcj-6-amd64/jre --enable-java-home --with-jvm-root-dir=/usr/lib/jvm/java-1.5.0-gcj-6-amd64 --with-jvm-jar-dir=/usr/lib/jvm-exports/java-1.5.0-gcj-6-amd64 --with-arch-directory=amd64 --with-ecj-jar=/usr/share/java/eclipse-ecj.jar --with-target-system-zlib --enable-objc-gc=auto --enable-multiarch --with-arch-32=i686 --with-abi=m64 --with-multilib-list=m32,m64,mx32 --enable-multilib --with-tune=generic --enable-checking=release --build=x86_64-linux-gnu --host=x86_64-linux-gnu --target=x86_64-linux-gnu Thread model: posix gcc version 6.3.0 20170516 (Debian 6.3.0-18) marshall@dont.even.try.to.h4ck.me:[~]: Notice that the executables are different, they have different hashes, but objdump -d doesn't show anything different. A: I think that the issue has nothing to do with the integer formats and everything to do with the filenames. I compiled the following program twice, first using the filename FIRST_PROG.c and executable name COMPILED_1 and the second time using the filename SECOND_PROC.c and executable name COMPILED_2 using gcc with no other flags set: int main() { return 0; } If you hd the contents of the generated executable, at a certain offset you see this: 00001720 66 72 61 6d 65 5f 64 75 6d 6d 79 5f 69 6e 69 74 |frame_dummy_init| 00001730 5f 61 72 72 61 79 5f 65 6e 74 72 79 00 46 49 52 |_array_entry.FIR| 00001740 53 54 5f 50 52 4f 47 2e 63 00 5f 5f 46 52 41 4d |ST_PROG.c.__FRAM| Notice that the name of the source file, FIRST_PROG.c, is embedded into the generated executable. Looking at the same location in the second file shows this: 00001720 66 72 61 6d 65 5f 64 75 6d 6d 79 5f 69 6e 69 74 |frame_dummy_init| 00001730 5f 61 72 72 61 79 5f 65 6e 74 72 79 00 53 45 43 |_array_entry.SEC| 00001740 4f 4e 44 5f 50 52 4f 47 2e 63 00 5f 5f 46 52 41 |OND_PROG.c.__FRA| You can see SECOND_PROG.c is embedded into the binary as well. Dumping both executables with objdump -s doesn't show this anywhere, which matches the clean diff you had from your programs. However, using readelf -a to list the contents of the executable that's generated does show this: Symbol table '.symtab' contains 66 entries: Num: Value Size Type Bind Vis Ndx Name 0: 0000000000000000 0 NOTYPE LOCAL DEFAULT UND 1: 0000000000400238 0 SECTION LOCAL DEFAULT 1 2: 0000000000400254 0 SECTION LOCAL DEFAULT 2 3: 0000000000400274 0 SECTION LOCAL DEFAULT 3 4: 0000000000400298 0 SECTION LOCAL DEFAULT 4 5: 00000000004002b8 0 SECTION LOCAL DEFAULT 5 6: 0000000000400300 0 SECTION LOCAL DEFAULT 6 7: 0000000000400338 0 SECTION LOCAL DEFAULT 7 8: 0000000000400340 0 SECTION LOCAL DEFAULT 8 9: 0000000000400360 0 SECTION LOCAL DEFAULT 9 10: 0000000000400378 0 SECTION LOCAL DEFAULT 10 11: 0000000000400390 0 SECTION LOCAL DEFAULT 11 12: 00000000004003b0 0 SECTION LOCAL DEFAULT 12 13: 00000000004003d0 0 SECTION LOCAL DEFAULT 13 14: 00000000004003e0 0 SECTION LOCAL DEFAULT 14 15: 0000000000400564 0 SECTION LOCAL DEFAULT 15 16: 0000000000400570 0 SECTION LOCAL DEFAULT 16 17: 0000000000400574 0 SECTION LOCAL DEFAULT 17 18: 00000000004005a8 0 SECTION LOCAL DEFAULT 18 19: 0000000000600e10 0 SECTION LOCAL DEFAULT 19 20: 0000000000600e18 0 SECTION LOCAL DEFAULT 20 21: 0000000000600e20 0 SECTION LOCAL DEFAULT 21 22: 0000000000600e28 0 SECTION LOCAL DEFAULT 22 23: 0000000000600ff8 0 SECTION LOCAL DEFAULT 23 24: 0000000000601000 0 SECTION LOCAL DEFAULT 24 25: 0000000000601020 0 SECTION LOCAL DEFAULT 25 26: 0000000000601030 0 SECTION LOCAL DEFAULT 26 27: 0000000000000000 0 SECTION LOCAL DEFAULT 27 28: 0000000000000000 0 FILE LOCAL DEFAULT ABS crtstuff.c 29: 0000000000600e20 0 OBJECT LOCAL DEFAULT 21 __JCR_LIST__ 30: 0000000000400410 0 FUNC LOCAL DEFAULT 14 deregister_tm_clones 31: 0000000000400450 0 FUNC LOCAL DEFAULT 14 register_tm_clones 32: 0000000000400490 0 FUNC LOCAL DEFAULT 14 __do_global_dtors_aux 33: 0000000000601030 1 OBJECT LOCAL DEFAULT 26 completed.7585 34: 0000000000600e18 0 OBJECT LOCAL DEFAULT 20 __do_global_dtors_aux_fin 35: 00000000004004b0 0 FUNC LOCAL DEFAULT 14 frame_dummy 36: 0000000000600e10 0 OBJECT LOCAL DEFAULT 19 __frame_dummy_init_array_ 37: 0000000000000000 0 FILE LOCAL DEFAULT ABS FIRST_PROG.c 38: 0000000000000000 0 FILE LOCAL DEFAULT ABS crtstuff.c 39: 0000000000400698 0 OBJECT LOCAL DEFAULT 18 __FRAME_END__ 40: 0000000000600e20 0 OBJECT LOCAL DEFAULT 21 __JCR_END__ 41: 0000000000000000 0 FILE LOCAL DEFAULT ABS 42: 0000000000600e18 0 NOTYPE LOCAL DEFAULT 19 __init_array_end 43: 0000000000600e28 0 OBJECT LOCAL DEFAULT 22 _DYNAMIC 44: 0000000000600e10 0 NOTYPE LOCAL DEFAULT 19 __init_array_start 45: 0000000000400574 0 NOTYPE LOCAL DEFAULT 17 __GNU_EH_FRAME_HDR 46: 0000000000601000 0 OBJECT LOCAL DEFAULT 24 _GLOBAL_OFFSET_TABLE_ 47: 0000000000400560 2 FUNC GLOBAL DEFAULT 14 __libc_csu_fini 48: 0000000000000000 0 NOTYPE WEAK DEFAULT UND _ITM_deregisterTMCloneTab 49: 0000000000601020 0 NOTYPE WEAK DEFAULT 25 data_start 50: 0000000000601030 0 NOTYPE GLOBAL DEFAULT 25 _edata 51: 0000000000400564 0 FUNC GLOBAL DEFAULT 15 _fini 52: 0000000000000000 0 FUNC GLOBAL DEFAULT UND __libc_start_main@@GLIBC_ 53: 0000000000601020 0 NOTYPE GLOBAL DEFAULT 25 __data_start 54: 0000000000000000 0 NOTYPE WEAK DEFAULT UND __gmon_start__ 55: 0000000000601028 0 OBJECT GLOBAL HIDDEN 25 __dso_handle 56: 0000000000400570 4 OBJECT GLOBAL DEFAULT 16 _IO_stdin_used 57: 00000000004004f0 101 FUNC GLOBAL DEFAULT 14 __libc_csu_init 58: 0000000000601038 0 NOTYPE GLOBAL DEFAULT 26 _end 59: 00000000004003e0 42 FUNC GLOBAL DEFAULT 14 _start 60: 0000000000601030 0 NOTYPE GLOBAL DEFAULT 26 __bss_start 61: 00000000004004d6 11 FUNC GLOBAL DEFAULT 14 main 62: 0000000000000000 0 NOTYPE WEAK DEFAULT UND _Jv_RegisterClasses 63: 0000000000601030 0 OBJECT GLOBAL HIDDEN 25 __TMC_END__ 64: 0000000000000000 0 NOTYPE WEAK DEFAULT UND _ITM_registerTMCloneTable 65: 0000000000400390 0 FUNC GLOBAL DEFAULT 11 _init Notice that entry 37 contains the name of the source file. If you try diffing the output of readelf -a, you do get some pretty helpful information: 81c81 < [28] .shstrtab STRTAB 0000000000000000 0000189f --- > [28] .shstrtab STRTAB 0000000000000000 000018a0 86c86 < 0000000000000207 0000000000000000 0 0 1 --- > 0000000000000208 0000000000000000 0 0 1 211c211 < 37: 0000000000000000 0 FILE LOCAL DEFAULT ABS FIRST_PROG.c --- > 37: 0000000000000000 0 FILE LOCAL DEFAULT ABS SECOND_PROG.c 258c258 < Build ID: 2c64961288049002e34a1f14e55d6c80dd96816c --- > Build ID: 5425dec81aae53bd30e85fe94659d320bb774dcc It seems like many of these differences boil down to just having a different name for the source file. So my official answer is "this has nothing whatsoever to do with integer literals and is purely a function of compiling files with different names."
{ "pile_set_name": "StackExchange" }
IN THE COURT OF CRIMINAL APPEALS OF TENNESSEE AT NASHVILLE October 19, 2016 Session STATE OF TENNESSEE v. JAMES E. FERRELL Appeal from the Circuit Court for Warren County No. 15-CR-772 Larry B. Stanley, Jr., Judge ___________________________________ No. M2016-01157-CCA-R3-CD – Filed January 11, 2017 ___________________________________ The Defendant, James E. Ferrell, was issued a citation for operating a vehicle while unrestrained by a safety belt, a Class C misdemeanor. He was found guilty and assessed a fine for the violation in General Sessions Court, and he appealed to the Circuit Court, which imposed a judgment of conviction and a fine. The Defendant alleges in this appeal that the Circuit Court did not have jurisdiction over the offense because there was no warrant issued in the case. We conclude that the Circuit Court had jurisdiction based upon the issued citation and affirm the conviction. Tenn. R. App. P. 3 Appeal as of Right; Judgment of the Circuit Court Affirmed JOHN EVERETT WILLIAMS, J., delivered the opinion of the court, in which NORMA MCGEE OGLE and ROBERT W. WEDEMEYER, JJ., joined. James E. Ferrell, Morrison, Tennessee, pro se. Herbert H. Slatery III, Attorney General and Reporter; Clark B. Thornton, Assistant Attorney General; Lisa S. Zavogiannis, District Attorney General; and Justin Walling, Assistant District Attorney General, for the appellee, State of Tennessee. OPINION On July 25, 2015, the Defendant1 was issued a citation for failing to use a safety belt while operating a vehicle, in violation of Tennessee Code Annotated section 55-9- 1 Although the Defendant styles himself a “Third Party Intervener,” he comes to this court as a defendant accused of failure to abide by the laws of this State, and we accordingly refer to him as “the Defendant” in this opinion. 603(a)(1) (2015). The Defendant attempted to seek monetary damages against the State in a “counterclaim,” which was dismissed in General Sessions Court as barred by sovereign immunity. The Defendant was found guilty and fined ten dollars in General Sessions Court. The Defendant timely appealed to the Circuit Court and moved to dismiss the charge on the basis that the Circuit Court lacked subject matter jurisdiction. The Circuit Court held a hearing at which Trooper Josh Sparkman testified that he observed the Defendant driving on the highway in Warren County not wearing a seatbelt, stopped the Defendant, and issued him a citation. The record reveals that the Defendant was driving a Ford Ranger. The Circuit Court found beyond a reasonable doubt that the Defendant had violated the seatbelt law, and it imposed a ten-dollar fine on the Defendant. See State v. Kirk, 392 S.W.3d 622, 624 (Tenn. Crim. App. 2011) (holding that an appeal from a general sessions court to a circuit court abrogates the judgment of the general sessions court and requires a new judgment after an independent review). The Defendant appeals his Circuit Court conviction, arguing that the trial court did not have jurisdiction because there was no warrant in the record. “Subject matter jurisdiction involves the court’s lawful authority to adjudicate a controversy brought before it.” Johnson v. Hopkins, 432 S.W.3d 840, 843 (Tenn. 2013). We review a question of jurisdiction de novo. Id. at 844. Circuit courts have original jurisdiction of crimes unless otherwise provided by statute. T.C.A. §§ 16-10-102, 40-1- 108. The Defendant was convicted by the Circuit Court of a misdemeanor offense under Tennessee Code Annotated section 55-9-603(a)(1) (2015), which makes it an offense to operate a passenger motor vehicle in forward motion when not restrained by a safety belt. The Defendant cites to Tennessee Code Annotated section 55-10-305 to support his argument that the trial court had no jurisdiction without a warrant. The statute provides: No judge shall try any case except upon warrant duly prepared in the form required by law, which shall be preserved with the other papers pertaining to the judge’s office, and no such judge shall collect any fine or cost imposed in any case involving a violation of chapters 8 and 9 of this title, parts 1-5 of this chapter and § 55-12-139, until that judge has completed the entries pertaining to the case in a docket kept for the making of the judge’s records. T.C.A. § 55-10-305. An arrest generally requires a warrant supported by an affidavit of complaint which is in writing, made on oath before a magistrate, and alleges the essential facts constituting the offense. See Tenn. R. Crim. P. 3; Tenn. R. Crim. P. 4; State v. -2- Harris, 280 S.W.3d 832, 839 (Tenn. Crim. App. 2008); State v. Burtis, 664 S.W.2d 305, 308 (Tenn. Crim. App. 1983); State v. Morgan, 598 S.W.2d 796, 797 (Tenn. Crim. App. 1979). A prosecution may also be commenced on an affidavit of complaint. Tenn. R. Crim. P. 5(a)(2) (“An affidavit of complaint shall be filed promptly when a person, arrested without a warrant, is brought before a magistrate.”); State v. Ferrante, 269 S.W.3d 908, 912 (Tenn. 2008) (noting that the Rule clearly contemplates that an arrestee may be taken before a magistrate to initiate charges through the filing of an affidavit of complaint); State v. Best, 614 S.W.2d 791, 795 (Tenn. 1981) (holding that when a person is arrested without a warrant, he must be taken before a magistrate so that “formal charges can be lodged … by the filing of an affidavit of complaint”). The Defendant was not arrested for violating the seatbelt law but was merely issued a citation. Under the statute mandating the use of seatbelts, “[a] law enforcement officer observing a violation of this section shall issue a citation to the violator, but shall not arrest or take into custody any person solely for a violation of this section.” T.C.A. § 55-9-603(f)(1). Accordingly, the Defendant’s traffic offense is governed by Tennessee Code Annotated section 55-10-207, which regulates traffic citations. A traffic citation is “a written citation or an electronic citation prepared by a law enforcement officer … with the intent the citation shall be filed, electronically or otherwise, with a court having jurisdiction over the alleged offense.” T.C.A. § 55-10-207(a); see also T.C.A. § 40-7-118 (governing citations). For certain offenses, including a violation of the seatbelt law, the statute requires the issuance of a citation in lieu of arrest. T.C.A. § 55-10-207 (b)(1). Pursuant to the statute: Whenever a traffic citation has been prepared, accepted, and the original citation delivered to the court as provided herein, the original citation delivered to the court shall constitute a complaint to which the person cited must answer and the officer issuing the citation shall not be required to file any other affidavit of complaint with the court. T.C.A. § 55-10-207(d) (emphasis added). Accordingly, the Defendant’s traffic arrest did not require the trial court to proceed upon a separate warrant; instead the citation itself was sufficient as an affidavit of complaint in the form required by law. See T.C.A. § 55- 10-305. The State correctly notes that the Defendant has unsuccessfully raised this same issue appealing a previous seatbelt violation. See State v. James Everett Ferrell, No. M2011-00870-CCA-R3-CD, 2012 WL 2411903, at *1 (Tenn. Crim. App. June 27, 2012). In his previous appeal, the Defendant received a traffic citation for failure to wear his safety belt, and he raised the same argument on appeal. Id. This court concluded that the Defendant failed to provide an adequate appellate record or adequate citations to -3- authority, but that, “in any event,” no warrant was required under the statute governing traffic citations. Id. at *1-2. We come to the same conclusion that the citation issued dispensed with the warrant requirement. CONCLUSION The trial court had jurisdiction to enter the judgment of conviction, and we affirm the judgment of the trial court. ____________________________________ JOHN EVERETT WILLIAMS, JUDGE -4-
{ "pile_set_name": "FreeLaw" }
VAUXHALL MOTORS Vauxhall Motors ( registered name General Motors UK Limited) is a British automotive manufacturing company headquartered in Luton, United Kingdom and a subsidiary of German Adam Opel AG, itself a wholly owned subsidiary of the American General Motors (GM). It was founded in 1857 as a pump and marine engine manufacturer, began manufacturing cars in 1903 and was acquired by GM in 1925. It has been the second-largest selling car brand in the UK for over two decades.
{ "pile_set_name": "Pile-CC" }
using System.Linq; using Bogus.Extensions; using FluentAssertions; using Xunit; namespace Bogus.Tests.GitHubIssues { public class Issue178 : SeededTest { [Fact] public void weighted_null_check() { var f = new Faker(); var mostlyNull = Enumerable.Range(1, 100) .Select(n => (int?)n.OrNull(f, 0.9f)) .Count( n => !n.HasValue); mostlyNull.Should().BeGreaterThan(80); var mostlyNotNull = Enumerable.Range(1, 100) .Select(n => (int?)n.OrNull(f, 0.1f)) .Count(n => !n.HasValue); mostlyNotNull.Should().BeLessThan(20); } [Fact] public void weighted_default_check() { var f = new Faker(); var mostlyDefault = Enumerable.Range(1, 100) .Select(n => n.OrDefault(f, 0.9f)) .Count(n => n == default); mostlyDefault.Should().BeGreaterThan(80); var mostlyNotDefault = Enumerable.Range(1, 100) .Select(n => n.OrDefault(f, 0.1f)) .Count(n => n == default); mostlyNotDefault.Should().BeLessThan(20); var mostlyNotDefaultObject = Enumerable.Range(1, 100) .Select( n => new object()) .Select(s => s.OrDefault(f, 0.1f)) .Count(s => s == null); mostlyNotDefaultObject.Should().BeLessThan(20); } } }
{ "pile_set_name": "Github" }
Clansayes Clansayes is a commune in the Drôme department in southeastern France. Population See also Communes of the Drôme department References INSEE Category:Communes of Drôme
{ "pile_set_name": "Wikipedia (en)" }
[Growth hormone secretion following administration of growth hormone releasing hormone in constitutional short stature and idiopathic growth hormone deficiency]. A stimulation test using 1 microgram growth-hormone-releasing factor (GRF 1-29 X NH2)/kg bodyweight was performed in children with familial short stature and in children with constitutional delay of growth and development. The GH secretion induced by this means was not different in these groups, but there was a difference in the response between normal children and children with idiopathic growth hormone deficiency (GHD). GH secretion after GRF administration was significantly lower in the GHD group than in the other groups. However, 6 of 24 patients with GHD responded to the test with a normal increase in GH (greater than 10 ng/ml), and 11 with an intermediate response (2-10 ng/ml). Thus, the test does not differentiate individual patients with defective growth hormone secretion from normal short children.
{ "pile_set_name": "PubMed Abstracts" }
The impact of the global economic crisis on HIV and AIDS programmes directed at women and children in Zambia. This investigation sought to ascertain the extent to which the global economic crisis of 2008-2009 affected the delivery of HIV/AIDS-related services directed at pregnant and lactating mothers, children living with HIV and children orphaned through HIV in Zambia. Using a combined macroeconomic analysis and a multiple case study approach, the authors found that from mid-2008 to mid-2009 the Zambian economy was indeed buffeted by the global economic crisis. During that period the case study subjects experienced challenges with respect to the funding, delivery and effectiveness of services that were clearly attributable, directly or indirectly, to the global economic crisis. The source of funding most often compromised was external private flows. The services most often compromised were non-medical services (such as the delivery of assistance to orphans and counselling to HIV-positive mothers) while the more strictly medical services (such as antiretroviral therapy) were protected from funding cuts and service interruptions. Impairments to service effectiveness were experienced relatively equally by (HIV-positive) pregnant women and lactating mothers and children orphaned through HIV. Children living with AIDS were least affected because of the primacy of ARV therapy in their care.
{ "pile_set_name": "PubMed Abstracts" }
<?xml version="1.0" encoding="UTF-8"?> <!-- MIT License Copyright (c) 2010-2020 The Waffle Project Contributors: https://github.com/Waffle/waffle/graphs/contributors Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. --> <!DOCTYPE Format> <Format> <!-- Dummy format file --> </Format>
{ "pile_set_name": "Github" }
--- deprecations: - The V8 Federation driver interface is deprecated in favor of the V9 Federation driver interface. Support for the V8 Federation driver interface is planned to be removed in the 'O' release of OpenStack.
{ "pile_set_name": "Github" }
1. Field of the Invention The present invention relates generally to computer-implemented representations of processes and more specifically to a system and method for conversion from graphical business process representations having certain types of node-connection configurations to structural text-based business process representations. 2. Description of the Related Art A business process includes a defined set of actions taken in the course of conducting business. Through the use of computer systems, business processes can be automated. An automated business process typically requires input and generates output. A business process may be a single task or a complicated procedure such as a procedure for building a product. An example of a more complicated business process is a computer-implemented business transaction (carried out against a database) for the purchase of goods on the Internet. The term “business process” also includes other processes that are related to a business context in a broad sense. For example, a process used to manage donor lists for a charity is referred to as a “business” process although it relates to a charitable activity and not a business activity as narrowly defined. For all business processes, but in particular for automated business processes, it is potentially advantageous to document the processes using a computer-implemented representation. Often business processes are graphically represented in a computer-implemented system using a visual representation. Computer software such as the WebSphere™ Studio Application Developer Integration Edition (WSADIE) process tool distributed by IBM Corporation allows users to visually represent a business process as a graph having node, terminal and connection elements. Connection elements connect nodes as in a directed graph and provide a flow that is apparent in the visual representation and which is intended to represent the relationships between activities in business processes. In a graphical representation that is used to control a business process, control over the process is transferred from node to node as the connection elements are followed. Alternatively, business processes may be represented in a computer system textually using a structural computer language, such as Business Process Execution Language for Web Services (BPEL4WS). BPEL4WS is used to describe business processes and is based on Extensible Markup Language (XML) specifications. BPEL4WS allows for text-based business process representations having a structure of hierarchical nested elements. It is desirable to convert between graphical and text-based representations of business processes. However, the complex structure of many business processes renders such conversion difficult. In a business process represented in a graphical system, control dependency of one node or activity on another is defined by the flow of the control connections between the nodes. In a simple process, the control dependency follows a single path; when a first activity finishes, control is passed from that node to the next node following the control connection, and the next activity represented by the next node is executed. However, for a complex process, there is typically no single path defining control dependency. Certain configurations of control connections and nodes in graphical representations present difficulties in the conversion to a structural text-based representation. One such configuration is the graphical representation of a “cross-over” process, in which a first node is connected to more than one subsequent node, and the execution of one of those subsequent nodes depends on receipt of output from that first node as well as output from another node which may be executed concurrently with the first. Another configuration presenting conversion difficulties is a conditional process that depends on an event or a fault: control is passed to one of many potentially nodes via one of many control connections, depending on the output from a previous node. For such configurations, there may be a number of solutions by which the business process represented in the graphical representation may be converted to a structural text-based representation. Each of these text-based representations may be valid, in that the process represented provides the same result as the business process represented graphically. However, these possible solutions may not be consistent or easily derived. Further, they may not all necessarily reflect the correct semantics and relationships among the elements of the process. The cross-over and conditional processes create difficulties in the graph-to-text conversion because there is no directly translatable structure provided in the available text languages which provide hierarchies of nested elements. To determine a correct conversion, graphical analysis may be undertaken to obtain a better semantic understanding of the process represented by the original graph. Because there are no direct equivalents in the structural text-based representations for these types of node-connection configurations, there are a number of possible solutions that may be chosen in converting a graph-based representation of a business process to a structural text-based representation. This potential set of conversion possibilities creates problems with consistency of conversion as well as potential documentation problems, since some solutions are more difficult to document than others. It is known, for example, to transform data published during the execution of a business process into a standard format such as XML, as mentioned in U.S. Patent Application No. 2002/0116362 (Li et al.). The business process representation may be constructed using a graphical process tool. However, Li et al. does not disclose a method or system for transforming the graphical representation of the business process itself to another format. It is therefore desirable to provide a system and method for converting graphical representations of business processes containing cross-over and/or conditional processes to structural, text-based representations in a consistent manner that can be implemented automatically without requiring extensive semantic graphical analysis.
{ "pile_set_name": "USPTO Backgrounds" }
Subacute primary Candida lung abscess. A case of primary subacute Candida lung abscess is described. The most reliable way to diagnose a rare pulmonary disease is to perform an open lung biopsy. A review of the literature suggests that the diagnosis of a primary subacute abscess due to Candida albicans in vivo is unique.
{ "pile_set_name": "PubMed Abstracts" }
Save an extra 55% coupon code + 5% clip coupon on BassPal Portable Bluetooth Speakers, Small True Wireless Stereo (TWS) Speaker with Radio, IPX5 Waterproof, HD Sound & Enhanced Bass, Mini Pocket Size for Home Travel Shower Pool Beach Outdoor-2 Pack with this coupon code. This coupon code valid through October 7, 2019 or while supplies last on Amazon. Discount applies at checkout. Coupon Price : $11.99 TRUE WIRELESS STEREO (TWS) Feel the true meaning of stereo sound COMPATIBILITY ALL BLUETOOTH DEVICE Use independently, or pair as a stereo system PARTY FREELY Let music integrated into your daily life crash the party or dancing ACTIVE LIFESTYLE amazing sound in the palm of your hand designed for outdoor IPX5 WATERPROOF Easily resist water spray & splash EFFORTLESS CONNECTIVITY Bluetooth 4.2, wide range up to 33 ft
{ "pile_set_name": "OpenWebText2" }
Prevalence of Obesity in Children and Adolescents in Brazil: A Meta-analysis of Cross-sectional Studies. Obesity in children/adolescents is a major public health problem worldwide. In Brazil there is great variability in published data on the prevalence of obesity among children/adolescents. To show a systematic review with meta-analysis of cross-sectional studies, conducted in Brazil between 2008 and 2014. A systematic review and meta-analysis was conducted the outcome of which was obesity (Body Mass Index ≥ 95th percentile for sex/age). A graphical presentation was done separately (Forest plot) for the results. Global and dichotomous outcomes were presented by employing, respectively the gross rates of prevalence and prevalence ratio (PR) and its confidence intervals at 95% (95% CI). The degree of heterogeneity was calculated employing the Q Cochran, while the I² test was used to describe the variation between studies. Twenty-one studies with a sample of 18,463 children/adolescents were included; the overall prevalence of obesity was 14.1%. Among boys it was 16.1% and in girls it was 14.95%. There was no difference in obesity prevalence between sexes (PR 1.06; 95%CI: 0.81 to 1.40; p>0.05). The prevalence of obesity among children and adolescents in Brazil is high and urgently needs measures to prevent consequences associated with the disease, as well as measures to reduce the impact, in the short term, the overweight and childhood obesity.
{ "pile_set_name": "PubMed Abstracts" }
Q: Setting initial value in Custom inspector I would like to set the initial value to the Level from the inspector. I'm using the following Model class. public class Sample : MonoBehaviour { public float Level { get; set; } } In my editor class, this is how I'm accessing the model. sampleScript.Level = EditorGUILayout.FloatField(sampleScript.Level); How do I set the initial value of the level to 1 in the inspector? A: public class Sample : MonoBehaviour { [SerializeField] private float level = 1; // initial value public float Level { get => level; set => level = value; } } In Unity you should expose the private field as [SerializeField]. This way it will be visible in the Inspector. You can also use public fields, but I'd recommend you to always use property with a serialized private backing field. EDIT: You can't expose properties in the Inspector. The properties are just methods to the Inspector. You can find or make your own custom editor script to serialize auto-properties, but using full properties with a serialized backking field is the best IMO (and really simple).
{ "pile_set_name": "StackExchange" }
Is Social Work Still Racist? A Content Analysis of Recent Literature. Addressing systems of oppression that disproportionately affect racial and ethnic minoritized groups appears to be of marginal interest in social work's professional literature. This article describes the content analysis of articles on Asian Pacific Islander (API) Americans, African Americans, Latinx or Hispanic Americans, and Native or Indigenous Americans in four major social work journals published between 2005 and 2015. (The analysis serves to update a 1992 article by Anthony McMahon and Paula Allen-Meares that examined literature between 1980 and 1989.) Of the 1,690 articles published in Child Welfare, Research on Social Work Practice, Social Service Review, and Social Work over an 11-year period, only 123 met the criteria for inclusion. Findings suggest that social work researchers are still failing to address institutional racism and are relying heavily on micro-level interventions when working with minoritized groups. Social workers need to increase efforts to dismantle institutional racism.
{ "pile_set_name": "PubMed Abstracts" }
Q: Make portions of input value read only If the value of my input is a date 03/22/2012 and I want the numbers to be editable but not the /, can I make that portion of the input read only? I would like to be able to accomplish this without plugins. A: I might do something like this, using CSS only: div#dateInput{ border:1px solid #999; width:100px; margin:1em; } div#dateInput input{ border:0; width:20px; outline:0; } div#dateInput input:nth-last-child(1){ border:0; width:35px; outline:0; }​ HTML <div id="dateInput"> <input type="text" /> / <input type="text" /> / <input type="text" /> </div>​ Example: http://jsfiddle.net/Qy6BG/ Basically, I am removing the border and the outline from three input fields and "hiding" those fields in a div that I style to look like one input.
{ "pile_set_name": "StackExchange" }
ActiveAdmin.register Country do permit_params :name, :information end
{ "pile_set_name": "Github" }
Bevacizumab increases the risk of infections in cancer patients: A systematic review and pooled analysis of 41 randomized controlled trials. Bevacizumab, a recombinant humanized monoclonal antibody that targets the vascular endothelial growth factor, has been approved for use in a variety of malignancies. There have been reports of infections associated with the use of bevacizumab. We performed this meta-analysis to determine the overall incidence and risk of infections associated with bevacizumab in cancer patients. Pubmed and oncology conference proceedings were searched for relevant studies from January 2000 to June 2014. Studies were limited to phase II and phase III randomized controlled trials (RCTs) of bevacizumab in cancer patients with adequate safety profiles. Summary incidences, relative risks (RRs), and 95% confidence intervals (95%CIs) were calculated by using either random effects or fixed effect models according to the heterogeneity of included studies. In total 33,526 patients from 41 RCTs were included. The use of bevacizumab significantly increased the risk of developing all-grade (RR 1.45, 95%CI: 1.27-1.66, p<0.001) and high-grade (RR 1.59, 95%CI: 1.42-1.79, p<0.001) infections in cancer patients. Sensitivity analysis indicated that the significance estimate of pooled RRs was not significantly influenced by omitting any single study. On subgroup analysis, the risk of developing high-grade infection varied significantly with concomitant drugs (p=0.008). When stratified according to specific infectious events, the use of bevacizumab significantly increased the risk of developing severe febrile neutropenia (RR 1.57, 95%CI: 1.34-1.84; p<0.001) and fistulae/abscesses (RR 2.13, 95%CI: 1.06-4.27; p=0.033). No evidence of publication bias was observed. Bevacizumab treatment significantly increases the risk of infectious events developing in cancer patients. The risk may vary with concomitant drugs. Clinicians should be aware of the risks of infections with the administration of this drug in cancer patients.
{ "pile_set_name": "PubMed Abstracts" }
2000 Ford Freda Camper Van Seller: RDS Car SalesContact: 07765 105 360Payment: Cash, Building Society Draft, Bank Draft, Personal & Company Cheque's, Bank Internet Transfer, any vehicle paid for with a personal or company cheque will be held until funds are cleared.
{ "pile_set_name": "Pile-CC" }
629, 927, 1205, 1457, 1677, 1859, 1997? 2085 What comes next: 13, 109, 361, 847, 1645? 2833 What is the next term in -666, -675, -698, -741, -810? -911 What comes next: 80, 108, 184, 332, 576, 940, 1448, 2124? 2992 What is the next term in 4185, 8371, 12557? 16743 What is next in 70, 139, 204, 265, 322, 375? 424 What is the next term in -18, 30, 144, 324, 570? 882 What is the next term in 113, 239, 435, 707, 1061, 1503, 2039, 2675? 3417 What is the next term in -18, -43, -98, -195, -346? -563 What comes next: 308, 563, 818, 1073, 1328? 1583 What comes next: 71, 285, 649, 1169, 1851, 2701, 3725? 4929 What comes next: -1741, -1753, -1779, -1825, -1897? -2001 What is next in -51, -109, -171, -237, -307, -381, -459? -541 What is the next term in 1723, 1728, 1745, 1780, 1839, 1928, 2053, 2220? 2435 What is the next term in 1714, 3426, 5138, 6850, 8562? 10274 What is next in -30, -22, -14, -6? 2 What comes next: 284, 1209, 2750, 4907, 7680, 11069, 15074? 19695 What is the next term in 60, 50, 34, 12, -16, -50, -90? -136 What is next in 84, 879, 3040, 7251, 14196, 24559? 39024 What is next in -69, -100, -127, -150, -169, -184, -195? -202 What comes next: 12, -4, -52, -150, -316, -568, -924? -1402 What is next in -3, 36, 109, 216, 357? 532 What is the next term in -130, -505, -1128, -1999? -3118 What is the next term in -341, -649, -967, -1301, -1657, -2041, -2459? -2917 What is next in -2, 24, 88, 208, 402, 688? 1084 What comes next: -372, -744, -1116, -1488? -1860 What is the next term in -284, -1119, -2510, -4457, -6960, -10019? -13634 What is the next term in -648, -2581, -5810, -10341, -16180? -23333 What is the next term in 7, 25, 69, 151, 283, 477, 745? 1099 What comes next: 129, 100, 29, -102, -311, -616, -1035? -1586 What is the next term in 1872, 1874, 1876, 1878, 1880, 1882? 1884 What is the next term in 247, 269, 319, 403, 527, 697, 919, 1199? 1543 What comes next: -7516, -7518, -7520, -7522, -7524? -7526 What is the next term in 677, 678, 679, 680? 681 What is the next term in -20, -12, 2, 22, 48, 80? 118 What is the next term in -340, -1349, -3030, -5383, -8408, -12105? -16474 What is next in -6, -7, 2, 27, 74, 149? 258 What comes next: 351, 699, 1047, 1395? 1743 What is the next term in -182, -1417, -4756, -11249, -21946, -37897, -60152, -89761? -127774 What comes next: -26, -44, -84, -158, -278, -456? -704 What comes next: -223, -440, -659, -880? -1103 What is the next term in -114, -107, -100? -93 What is the next term in -3036, -3031, -3016, -2985, -2932, -2851, -2736? -2581 What comes next: -491, -490, -489, -488, -487? -486 What is the next term in -877, -874, -869, -862, -853? -842 What comes next: -697, -2772, -6231, -11074, -17301, -24912, -33907? -44286 What comes next: 164, 346, 538, 746, 976, 1234? 1526 What is the next term in 60, 82, 118, 168? 232 What is next in 18, 14, 0, -30, -82, -162? -276 What comes next: 19, 77, 167, 283, 419, 569? 727 What is next in 136, 255, 374, 493? 612 What is next in 31, 64, 97, 130? 163 What is next in -57, -63, -69, -75, -81, -87? -93 What is next in -51, -85, -95, -69, 5, 139? 345 What comes next: -1773, -3544, -5315, -7086, -8857, -10628? -12399 What is next in -9, 20, 87, 210, 407, 696, 1095, 1622? 2295 What comes next: 29, 34, 39, 44? 49 What is next in 352, 736, 1120, 1504, 1888, 2272? 2656 What is the next term in 5, 49, 117, 203, 301, 405, 509, 607? 693 What comes next: 11, 25, 39, 53, 67? 81 What is next in -17, -52, -97, -158, -241, -352, -497, -682? -913 What comes next: -84, -216, -398, -636, -936, -1304, -1746? -2268 What comes next: -58, -163, -318, -523, -778, -1083, -1438? -1843 What is the next term in 151, 268, 385, 502? 619 What is the next term in -75, -308, -697, -1242, -1943? -2800 What comes next: -64, -68, -82, -112, -164? -244 What comes next: 228, 238, 252, 270, 292, 318? 348 What is the next term in 491, 533, 607, 719, 875? 1081 What is next in 41, 268, 869, 2030, 3937, 6776, 10733? 15994 What comes next: 27, 104, 225, 384, 575, 792, 1029? 1280 What comes next: -15921, -15922, -15923, -15924, -15925, -15926? -15927 What is next in 11, 20, 31, 44? 59 What comes next: 3964, 3957, 3940, 3907, 3852? 3769 What is next in 972, 975, 978, 981, 984? 987 What is next in 7872, 7870, 7868, 7866, 7864, 7862? 7860 What comes next: 11143, 22285, 33427, 44569, 55711, 66853? 77995 What is next in 500, 483, 452, 401, 324? 215 What comes next: 2749, 2747, 2745, 2743? 2741 What comes next: 5, 80, 205, 380, 605, 880? 1205 What is the next term in -1750, -1728, -1692, -1642, -1578, -1500? -1408 What is the next term in -31, -73, -129, -205, -307, -441, -613? -829 What is next in -197, -404, -621, -854, -1109, -1392, -1709, -2066? -2469 What comes next: -24, -46, -80, -132, -208? -314 What is next in -14, -54, -124, -224? -354 What is next in -2, 13, 28, 43, 58? 73 What is next in 1573, 1576, 1581, 1588, 1597, 1608, 1621? 1636 What is the next term in -11, 5, 49, 133, 269? 469 What is next in -2, 4, 0, -26, -86? -192 What comes next: 9, -18, -93, -240, -483? -846 What is the next term in -2, 15, 46, 85, 126, 163, 190, 201? 190 What is the next term in -478, -936, -1394? -1852 What is next in -19, -30, -37, -40, -39, -34? -25 What is next in 153, 318, 485, 654? 825 What is the next term in 212, 190, 168, 146? 124 What is next in -5, -3, -9, -23, -45? -75 What comes next: 3481, 3491, 3513, 3553, 3617, 3711, 3841, 4013? 4233 What is next in -5, -11, -13, -5, 19, 65, 139? 247 What is the next term in -102, -387, -860, -1521, -2370, -3407? -4632 What comes next: 52, 55, 56, 55, 52? 47 What is next in -137, -156, -181, -212, -249, -292? -341 What is next in 165, 224, 321, 456, 629? 840 What is the next term in 21, 70, 151, 264, 409? 586 What comes next: -574, -582, -596, -616, -642, -674? -712 What is the next term in -41, -89, -137, -185? -233 What comes next: -211, -265, -327, -403, -499? -621 What is the next term in 44, 41, 36, 29, 20? 9 What comes next: -66, -62, -58, -54? -50 What is next in 5210, 10422, 15634, 20846? 26058 What is next in 2156, 4312, 6468? 8624 What is next in 362, 724, 1086, 1448? 1810 What comes next: -6870, -6878, -6896, -6930, -6986, -7070? -7188 What is next in 81, 368, 837, 1482, 2297, 3276? 4413 What comes next: -71, -74, -77, -80, -83, -86? -89 What is next in -124, -276, -436, -610, -804, -1024? -1276 What comes next: 78, 160, 242, 324, 406, 488? 570 What is next in -44169, -44168, -44167, -44166, -44165, -44164? -44163 What is the next term in -56, -46, -28, -2, 32, 74, 124? 182 What comes next: 29, 52, 75, 98, 121, 144? 167 What is next in -258, -514, -768, -1020, -1270, -1518? -1764 What is the next term in 974, 1060, 1158, 1274, 1414, 1584, 1790? 2038 What is the next term in 25, 1, -71, -215, -455? -815 What is next in -761, -771, -791, -821, -861, -911, -971? -1041 What is the next term in 633, 1279, 1947, 2643, 3373? 4143 What comes next: 6, 21, 52, 105, 186, 301? 456 What comes next: 23, 38, 75, 146, 263, 438? 683 What is the next term in 97, 397, 897, 1597, 2497, 3597, 4897? 6397 What comes next: 360, 719, 1076, 1431, 1784? 2135 What comes next: 16995, 16994, 16993? 16992 What comes next: 19, 82, 217, 448, 799, 1294, 1957, 2812? 3883 What is the next term in -76, -145, -214? -283 What comes next: 151, 304, 457, 610, 763? 916 What comes next: -29, -60, -85, -98, -93, -64, -5? 90 What is the next term in -1862, -1864, -1866, -1868? -1870 What is next in -34, -64, -92, -118, -142? -164 What is next in -26, -48, -80, -122, -174? -236 What is next in 747, 1510, 2273, 3036? 3799 What is the next term in -875, -1761, -2647, -3533? -4419 What is the next term in -12, -48, -106, -186, -288? -412 What comes next: 106, 114, 122, 130, 138, 146? 154 What is next in -40, -53, -66? -79 What comes next: -801, -1603, -2405? -3207 What is next in 18, 46, 78, 114? 154 What is next in 32, 67, 100, 131, 160, 187? 212 What is next in 11, 16, 25, 38? 55 What is next in 113, 220, 415, 704, 1093, 1588, 2195? 2920 What is the next term in 97, 93, 85, 73, 57, 37? 13 What is the next term in -33, -33, -31, -27, -21, -13, -3? 9 What comes next: -21, -43, -65, -87, -109? -131 What comes next: -641, -642, -643? -644 What is the next term in -73, -147, -221? -295 What is next in
{ "pile_set_name": "DM Mathematics" }
There have been a lot of disappointing news recently revolving around Dreamworks' animation division. First, PDI in Redwood City has been completely shut down with many artists having to find new jobs and more recently is the Glendale campus having to sell off part of their location and then leaseback. Thus it is imperative that their next movie, Home, does well. Luckily I was able to go see an early screening of Home! Home was.....nice. It wasn't a bad movie but it would be hard for me to say it was a spectacular stand out movie. It was a good movie but it felt that it was playing very safe. I hope that I haven't grown cynical from watching and analyzing too many movies. What made the movie felt very safe was that it followed many tropes ,and with an expected / supposed target demographic, the plot felt predictable and there weren't many surprises. There were still good story elements and the ones that were intentionally made to tug on heartstrings worked and many tears were shed. One thing that I found surprising was the small cast. There was Jim Parsons (Oh), Rihanna (Tip), Steve Martin (Captain Smeck), Jennifer Lopez (Lucy), and Matt Jones (Kyle), followed by an equally short list of additional cast. That was it. The movie meanwhile was beautifully populated with thousands of characters that I did not suspect was largely handled by a mere nine people. The animation was delightful, particularly of the Boov aliens with their tentacle horn things and their many feet. A particular favorite is how the Boov change colors depending on their emotions. I found the art style very simplistic and to the point, and thus very effective but also leaving me with a desire for a bit more. The art returns back to the basics of shape language with circle, squares, and triangles. Circles are safe and nice; squares and sturdy and strong; triangles are sharp and scary. The Boov function largely with circles and spirals from their horn tentacles normally being a spiral to all their technology being spheres. The only Boov that was different is Captain Smeck who has his tentacle horns pointed up and out thus foreshadowing his less than positive contribution to the plot. The humans, Tip and Lucy all have very round heads and features, further hammering in that they are the protagonists. On the other side is the Gorg and it is clearly just made out of triangles to emphasize it as the big scary antagonist that the protagonists must resolve by the end of the movie. In front of Home, Dreamworks has included another short. This time hailing from the Kung Fu Panda franchise is Panda Paws. Again, it was......nice. The short was fun and funny but it largely read as a commercial for the upcoming planned Kung Fu Panda 3 movie. I suppose that's what Dreamworks wants to do though since they had a Home short in front of Mr. Peabody and Sherman. My issues is just that it blatantly read as a commercial. Honestly, I hope the film does well as Dreamworks is in dire need of some good news. Advertising does need to step up though as I knew the movie was being released sometime this year but I hadn't even known it was this soon. I was only notified about the screening a few days before through e-mail and otherwise I had seen no news about Home. This is way long overdue. I originally watched Big Hero 6 back when it first came out but life was hectic and I never got to talk about it. Today I was planning on going to see Selma since I got an early screening pass but the theater filled up before I could get in. I wasn't too bummed out since I saw that Big Hero 6 was still playing at the theater and I was way more excited to see that again. I had almost forgotten that Feast played in front of Big Hero 6 so I got really excited when it came on. I had already seen a rough cut prior to the full release and then once again the first time I saw Big Hero 6. When I saw it in front of the movie, for some reason I had felt that Feast played somewhat faster, as in a shot or two might have been cut, than what I originally saw. It was mainly in the beginning when the man and the woman gradually fall out of their relationship. Now that I saw it again I didn't feel that as much, particularly as I was able to focus on what was going on in the background instead of Winston, the dog, and his food. Other things that I really enjoyed was the visual storytelling. The color green was used so well as it being associated the woman and unwanted foods, but then turns around at the end with the baby on a green chair. I loved the shot with Winston opening his mouth wide and we get a shot down his throat during the football game and is then mimicked again when the baby drops the meatball. Big Hero 6. I loved it the first time. It was hilarious and also so sad. All the feels! I felt them all again watching it this second time around. During the scene where Hiro is first introduced to Baymax and had to say "I am satisfied with my care" I already lost it and was crying. I am also currently obsessed with finding a San Fransokyo hat like the one that Tadashi has. If anyone knows where I can get one, let me know! The skin texture/shading/material is so interesting that I kept looking at it throughout the movie. They're stylized and simplistic and different than what I'm used to doing. The skin is smooth and there's some beautiful color variations with blush and lights and darks which makes it interesting to look at but not overly detailed. Generally for skin I've always had to use a speckle in the specular map and a noise in the bump to give it that skin texture with pores look. Lighting. Disney has their new Hyperion render engine and I've read a few articles about it and it sounds awesome. More importantly though is that some seem to claim that with Hyperion only a primary light source is needed to light the entire scene of Big Hero 6 and then everything else is left to the render engine to calculate global illumination. I'm not quite sure how true that is as there were a lot of light sources in each scene in and there were clearly primary and secondary lights; otherwise it wouldn't be possible to have both a specular highlight in the eye and a rim light coming from behind. It would probably be more accurate to say that the amount of lights necessary to light a shot has dramatically been decreased and more calculations are handled by the render engine which in turn also decreases some inconsistency of light and color between shots. Generally I cringe at the thought of sequels but I really want to see a sequel to Big Hero 6! Coming all the way from Texas, Reel FX brings us a new movie after Free Birds. The general consensus that I got about the movie was that the movie was good, can be a bit corny, but a good movie. Hearing that I was looking forward to Book of Life, especially seeing how pretty the Land of the Remembered is from trailers. The movie starts off as triangle love story where two boys/men fall in love with a girl and vie for her attention and hand in marriage. The catch is that the gods of the afterlife, La Muerte and Xibalba, have a wager going on of who wins the girl, and the prize being the one who gets to rule over the Land of the Remembered, which is far more appealing than the Land of the Forgotten. The story quickly becomes a whole lot more of growing up, becoming who you are, and creating your own life. The movie itself is told through an interesting way as the main plot is told as a story to a group of kids by a museum tour guide. I find it an odd choice as I did not feel the "present" world contributed a lot significantly to the plot and the movie could have probably just been told through the main story alone. The method does explain the artistic direction and stylized approach to why everything looks like wood figures but an art director could have just as easily said "I want the film to look this way and this is how it will be" without the whole preamble of being a story within a story. I don't know a lot about the holiday Dia de la Muerte other than it is a Mexican holiday to celebrate/remember the dead. I took the characters and the representation of culture at face value. Now that I have the time to do some research, I've found that La Muerte is actually the figure Catrina popular in modern Dia de la Muerte and Xibalba is actually a place from Mayan mythology and not a figure at all. I haven't heard anyone become horribly offended and cry bloody murder for misappropriation of culture so all seems to be fine. La Muerte was beautiful and my favorite character. Xibalba was interesting with his skull eyes however I found him to be slightly too comedic for my tastes. I prefer my villains to be cold and haughty, like Maleficient, but Xibalba read more like Hades from Hercules. I am extremely iffy about the Candlemaker. I love the textures and shading on him as he looks amazing but there is already a large cast of characters and the Candlemaker character doesn't feel like he contributes anything significant. His character could have been cut out and the movie would have moved along fine without him. During the movie I had assumed that it might be because the Candlemaker was a central figure to the holiday but I could not seem to find anything about such a mythological figure. The animation and humor involved a lot of slapstick. I generally enjoy a good pun but some of the comedy got me laughing. However what was somewhat disappointing though was that the only ones laughing seemed mainly to be the older audience, such as those who I went with. There were quite a number of children in the audience but they seemed to be generally silent through the movie. Maybe it's the Sunday morning crowd but most of the time I didn't hear them laughing and usually kids love slapstick. Pixar had a Dia de la Muerte movie in the works but any news of it seems to have fallen silent. I don't know if it's still in the works or not as Inside Out and Good Dinosaur seems to be their current main focus or if it has fallen to the wayside and may end up similar to Newt that was ultimately cut and then got taken by Blue Sky to be remade into Rio. This was going to be about the Animation Show of Shows since I was planning on going to that but I had a last minute invitation to see The Boxtrolls, hosted by ASIFA, and there was a great Q&A with the directors, Graham Annable and Anthony Stacchi, and producer/animator Travis Knight after. Loved it! The animation was ridiculously amazing and the movie itself was deep yet with all the right elements of comedy. The Boxtrolls is a heartfelt story about finding out who you are and making yourself to be who you are. Amid all that is an adventure of Egg saving his family and stopping the villain, Snatcher, from obtaining power all for the sake of cheese. From the trailer, the original beginning seemed to be about The Boxtrolls finding an unwanted child in the trash but that's changed somewhat and I really like the change as it gives the characters more association and relation with each other. The animation is ridiculous. In stop motion, everything that moves have to be manually moved frame by frame by an animator. There were a lot of little inflection in the face and auxiliary acting choices which just means more frames that the animator would have to animate through. Just as impressive is that animators are assigned to scenes instead of characters so there is a whole ballroom dance sequence that was done by a single animator. There is a giant robot with detailed pistons and cogs that all had to be animated on top of having a character giving a full performance. Loved the artistic style of the film. It was interesting to hear that various oil painting artists such as Lucian Freud. They really liked the various contrasting colors that would be used on skin. One thing that I would be interested in if Laika could develop is accurate specular highlights on eyes. Currently the eyes are doll-like with everything painted on instead of having an actual cornea to catch the highlight on. It may be strange, as the shape of a cornea and the iris may look strange in certain angles and unlike in CG a bump map can't just be used to cheat the effect. The Q&A after was great. There was getting to know about the behind the scenes process which was neat but I loved hearing about how Laika is evolving their workflow and keeping up with the current technology. Rapid prototyping has been used since Coraline but the way it's used has evolved. First of all, rapid prototyping is typically used for quick concepts that someone can print out, look at, and throw away; however, Laika is using it to print their thousands of faces to create the facial replacement animation. Back in Coraline, the faces were printed to be plain gray and an artist would have to go and paint each one. In Paranorman, Laika was able to get color into the prints. Now in Boxtrolls, not only were they able to advance the colors but they found out, through an accident, that they could print on top of prints and create what would look like a classic 2D animated smear frame. Also, make sure to keep a close eye on the ballroom sequence as Laika was able to get a capillary system under the face so the characters actually blush! Make sure to stay through the credits. As per usual, there's a small sequence at the end as the movie makes a nod towards animators and stop motion animation. It really gives an idea to how stop motion is "an obscene way to make a film" as every little movement has to be created manually from hand gestures to a single blink and since the movie was shot in stereoscope the vfx artists would have to paint out rigs and facial seams twice. Thanks to Gofobo I got tickets to an early screening of Teenage Mutant Ninja Turtles! This wasn't a movie that I was particularly excited for or was planning to go see in the theaters but hey, if I'm getting free tickets why not. I don't have any real attachment to TMNT as I've never read the comics, watched the TV show, or seen any of the previous movies. I only know of them through popular culture and I watched the very first episode of the new Nickelodeon version once as I was curious to what the CG style looks like. Which is good in a way, I suppose, as I can go into the movie with no preconception and can judge this movie by in itself. The movie starts and I immediately cringe. It starts off with a shaky cam which I felt was unmotivated and looked terrible. Additionally, maybe because I had just put on my 3D glasses so my eyes haven't adjusted, but the stereoscope also felt off and it was really difficult to focus on anything on screen along with the shaky cam. I know people like to hate on Megan Fox ever since Transformers, and were all up in a rage when she was cast as April O'Neil but I didn't really mind her in the role. What I did have a problem with is the blatant female objectification sexism repeated throughout the movie and Vernon (Will Arnett) continuously being a creeper. It felt really tiring. Another thing that people like to hate on in this movie are those turtle faces. I don't like them much either as I find them unappealing. There's a flashback in the movie to the turtles when they were children but unfortunately I don't find those appealing either and just as creepy. What I do enjoy though is that their head shapes are all different and reflect quite well upon their personalities, such as Donatello having a larger forehead and Mikey with a wider face. In the above image, their face masks are quite bright and colorful but in the movie they were a bit more darker and dirtier, which makes sense since they live in a sewer, but I would have still liked the colors to be a bit more vibrant for easier differentiation, particularly in the battle scenes. I don't particularly care for the Chinese characters/Kanji that shows up on their headbands though as it reminds me of bad tattoos that people get thinking that it looks cool but instead reads "idiot" or "chicken noodle soup". There was some extremely blatant product placement in the movie which made me roll my eyes. From the very beginning we have a video call and a Skype logo branded across the phone's screen. Then there's Mikey's very specific Orange Crush Soda and I believe I saw some Dre Beats headphones on Donatello. The plot though. At first I thought the movie wasn't too bad but then I just felt it slipping as the movie went on as there were various discrepancies. I felt that there was a lot of pointless dialogue that happens throughout the movie. They were probably inserted to get a laugh out of the audience but at least half the time the theater was indifferent with no reaction. One of the main ones that I didn't understand is how Splinter knew of the entire history between Sachs and Shredder when he has been a rat living in the sewers all the years. In this storyline, Splinter is a rat who mutated and not a human who mutated into a rat so it makes no sense of how he would have this knowledge. I found it extremely confusing as to the relationship between characters, such as Sachs and Shredder. Shredder is Sachs sensei so they would have a pretty close relationship but it felt extremely odd that Shredder would speak in Japanese but Sachs would reply back in English; being fluently bilingual if someone speaks to me in Chinese I would reply back in kind and not in a different language. Young April's actions were extremely confusing. First, why was she in her father's lab all the time? April's father works in a top security research lab on a private project and I doubt one would just bring your daughter to work repeatedly. The fire that happened was just as confusing. Why was April even at the company at that time to be able to save the animals? She was in the lab with the fire, did she not see her father at all as he was supposedly there and killed? Then, April's action of dumping the animals into a sewer was just as baffling. I assume Splinter was also injected with the Mutant-Gen same as the turtles although it was never explicitly mentioned. However, if that's the case why does Shredder go so far as to nearly killing Splinter and not attempting to capture him? Instead, the Foot Clan only takes the turtles. If that's not the case then how did Splinter even mutate in the first place? Do they have to be alive for the Mutant-Gen to be extracted? The Foot Clan assumed Raphael died so they just leave him even though he still has perfectly good blood but they just leave him behind. The Foot Clan captures the turtles and begins extracting the Mutant-Gen. What gets me is that they then immediately begin their plan to poison the entire city. They haven't even finished extracting the Mutant-Gen yet and they are jumping the gun. They don't know if they have enough, if the Mutant-Gen is the antidote in it's raw form are has to be further processed, or if they are able to successfully duplicated it. Not to mention, the Foot Clan didn't even inoculate themselves first. While I was watching the movie I saw the characters 家門 which is explained to mean family in Japanese and it struck me as very odd. First, to me the characters read "house door" and the term I'm familiar with is "kazoku" or 家族. According to Google Translate the characters can mean family or clan and is more probably to be "kamon" which means house crest or emblem. Still odd and especially strange that the turtles would leave behind evidence that they've been somewhere since they are trying to keep themselves as a secret, and even more so since there was no explanation as to why they would tag with those characters. So many cliches in the movie. For example, there is the "no I'm not crying, it's just dusty", awkward elevator scene, or April shouting for no apparent reason other than to notify Shredder that she's in the vicinity. Some people laughed but I more or less just rolled my eyes. Maybe it's from watching to much CinemaSins. I don't know too much about medical technology but I don't think blood transfusion machines have an option to inject adrenaline. Even more ridiculous is not only do the turtles know that the machine they are hooked up to is able to inject them with adrenaline but also that there is also a giant button on the screen on the machine for April to push. When this scene happened with the button the theater erupted in laughter at how ridiculous it was. Also, it does not seem safe to inject adrenaline to get their blood pumping while being hooked up to a machine which is drawing out their blood. While on the topic of blood drawing, it also makes no sense that Sachs wants to drain the turtles dry in one go. To me it would make more sense to draw as much as possible without killing the turtles, let them recover, and repeat. That way Sachs would have an unlimited supply of Mutant-Gen and not a one time deal. I did not understand how the turtles survived the fall towards the end. They fell from the top of a building and tumbled all the way down. The camera does a closeup on the turtles and they just somehow magically survived the fall. Yay mutant powers and being main characters I guess? CG and VFX wise were great. I loved the details on the turtles with their dirt and grim and the various nicks and cuts. The lighting and rendering were beautiful and spot-on. While I didn't particularly care for the scene with the turtles waiting awkwardly in an elevator, I did enjoy it visually as the turtles are all shown in light and there were some nice reflections going on in the elevator's metal walls. Shredder's suit was badass. The snow was amazing. The animation was really well done, particularly liked the fighting scenes and how Splinter used his tail. I do find it curious though as to why Leonardo has a separate cast for the character and voice actor while all the other turtles had just a single actor. I wish that the movie would have referenced the Ninja Turtles opening song somewhere in the movie, such as towards the end when the turtles pull up in their new car, or at least in the credits. Unfortunately not. I went into the movie with no real attachment to TMNT and left the theater still feeling the same. It wasn't a waste though since I got to see some nice CG and VFX work. In order to promote the movie, Guardians of the Galaxy was giving out free tickets to a special 17 minute preview on their Facebook page and I was able to snag one. I was slightly hesitant about going to see a preview since I didn't want to ruin the movie but I really want the special poster. I was not disappointed in what I saw and it was beautiful in 3D IMAX. The 17 minute preview consisted of a small foreward, a section of the movie, and a new extended trailer. What was really great of watching the preview was that we get to see characters other than Peter Quill/Starlord (Chris Pratt) talk and we really got a sense of their characters as they never had any dialogue in the trailer (at least the first one which is the only one that I watched). Rocket Racoon (Bradley Cooper) is hilarious and I can't wait to watch the full movie to see more of him. Rocket Racoon looks amazing; great job to Tippett Studios, but most amazing is Groot (Vin Diesel). Groot doesn't say much but there was a nice fight scene in the preview and we see why he is Rocket's muscle. Groot is able to change/grow his body like a real tree either creating a massive shield of vines and branches or extending his arms out to whip at his foes. Interestingly we don't see much of Drax (Dave Bautista). He doesn't show up until later in the preview during the fight scene unlike the trailer where we see the four main characters all lined up together. He doesn't talk much and if I hadn't watched the initial trailer at all I would not know his backstory at all. I wish Gamora (Zoe Saldana) was more visually interesting as she mainly just looks like a green person. She does have some silver markings on her face but they tend to be unnoticeable from a distance and especially when her hair is down and loose. I do love the green tone, particularly how light and shadow falls across it and interacts to sculpt her face. I was initially apathetic towards this movie as just another Marvel superhero movie (come on DC, time to step up!) and after X-Men the only other movie that I was really looking forward to anytime soon was Laika's Boxtrolls in September but I will most likely be putting on Guardians of the Galaxy on my to watch list! It's always great to see what other countries are producing in the animated feature film department and while they don't tend to become a huge blockbuster in the US, they tend to garner moderate success and respectable recognition in the animation industry, such as Zambezia and Monster in Paris. Hailing from Belgium and France, House of Magic has been on my to watch list for awhile and I finally got my hands on an English copy of the movie. House of Magic is about an abandoned cat named Thunder who wanders his way into the house of a magician and befriends the inhabitants, with the exceptions of Jack the rabbit and Maggie the mouse. The magician is well on into his years and the magician's nephew, a real estate agent, seeks to take the house to be sold for a profit. While the magician is incapacitated from an accident, the nephew makes his move and so Thunder and the other inhabitants of the house must work together and learn to get along to save the house. Plot-wise, the story doesn't do anything extremely innovative or evokes deep provocative thoughts, reminds me somewhat of Home Alone or Night at the Museum, but otherwise is decently solid, funny, and I found the movie as a whole was quite enjoyable. There were only two parts that I felt were somewhat off and the first was at the very beginning of the film. While it does set up some backstory of Thunder being abandoned by his previous owners in the middle of a move, the first ten minutes of the movie was a bunch of running and racing around with yells and yelps and the Thunder was never given an identity until the magician finds him and bestows a new one on him. The second part is towards the end of the film when Jack was stuck in the doggy door. We get an change in Maggie when she is saved by Thunder and thinks of him differently but Jack never experiences any event with Thunder that would make him decide to change his mind and like the cat. What drew me to this movie was the character designs, particularly that of Thunder. I like cats and he is adorable. I wonder if more movies could make appealing animal characters with animalistic eyes instead of humanizing them with all the eyewhite. Animals don't tend to show eyewhite. The few movies that do animalistic eyes unfortunately aren't consistent with it either, such as Puss has nice eyes but Donkey from Shrek has humanized eyes and some of the characters in Rango also go humanized, too. I felt that the animation was quite strong. The only part that had me questioning was when Thunder walks. I watch documentaries on tigers for fun and the most recent one that I saw was Tigers About the House and I noticed that when tigers walk they turn their front paws inward before planting on the ground. I had already known that animals plant their toes first than their heels, which is what allows them to move so quietly, but not the part of turning the paw inward. Curious to see if domestic cats also have this behaviour I turned to Youtube. Unfortunately the videos were inconclusive as the cats seemed to turn the paws inward sometimes but sometimes not, and when they do it was very slight. The movie had various scenes made specifically for stereoscope and is apparent with camera moves and action happening directly at the screen but as I didn't watch it in stereoscope it just felt somewhat awkward to me. As stated previously, I like stereoscope but particularly when it is used to create atmosphere and environment, but not as a gimmick to pretend that the audience is on a rollercoaster or have things coming out of the screen. Even though I watched this movie dubbed in English, I didn't have any real issues with the facial animation. The words seem to match up decently well with the mouthshapes and the voice acting fit so I wasn't cringing as if I would when watching dubbed Japanese anime. The textures were all really pretty and detailed but I loved Thunder's fur, particularly how well it responds to animation. Thunder can look soft, smooth, and cuddly or when he hunches up his back you can see the hair standing up just like on an actual cat. The backscattering on the animal ears were really nice. Somewhat awkward that it always seems to be there as if there's a light shinning through their ears all the time, but really pretty. When I first learned storytelling I learned it through Brandon Clements' 6 step Pixar prompt. Now we have Emma Coats tweeting 22 rules of storytelling that further builds and polishes a story in the midst of creation. Thanks to Tea Time Animation, I got some passes to see an early screening of How To Train Your Dragon 2! This may have been my number one anticipated movie this year and I was not disappointed. The movie was a lot of fun and perfect in time for Father's Day. Spoilers ahead! I'm personally one of those people who don't mind spoilers and sometimes even likes them as they give me something to look forward to. Instead of thinking that the movie is completely ruined, I go "hey, that's awesome, I really want to see such and such part for myself!" There seems to be quite a few main plot points going on around this sequel. One of them that I picked out is that the movie is about Hiccup growing up and becoming an adult and learning about the responsibilities that he will have to shoulder, namely being an adult and a leader means that he must protect those he holds dear. Another is that you win friends and their loyalty through trust and respect, not fear and domination. The third one I would say is that everyone, although different and in this case dragons and humans, can live in harmony and peace. The main selling point of this movie would be the dragons and they were magnificent. We get the ones from the first movie along with some great new ones such as Valka's Stormcutter dragon, Cloudjumper, and the alpha Bewilderbeast dragons. Loved the animation on them and how they heavily referenced real animals and really showcases well Toothless and Cloudjumper's personalities. Toothless was interesting in that it feels that his personality changed. In the first movie he was more panther and cat like as he's more wary and just getting to know Hiccup but now Toothless is more doglike and playful. Meanwhile Cloudjumper seems to be referencing cats and owls and is a lot more regal and is not having any of Toothless' shenanigans. The human characters I'm not quite as sure of. There are times where I felt they were a bit over animated with lots of gesturing and head movements while talking. What made it very interesting though is that the movie points it out itself and makes fun of it through Astrid's teasing of Hiccup on how he talks. Since we already have an established romance aspect of Hiccup and Astrid from the first movie, this time around we have a more comedic approach to it through Snotlout and Fishlegs fighting over Ruffnut who then in turn crushes on Eret. The dynamic between the crazy four way romancing was hilarious and had the entire theater laughing, particularly the parts where Ruffnut attempts to flirt with Eret and we get closeups of Eret's bulging biceps. There were some plot points that didn't quite make as much sense. Toothless has an entire contraption on him to make the tail work so that he could fly properly and in the first movie we see Hiccup going through a lot of experimentation and training to get it right. Hiccup even makes the claim that Toothless can't fly properly without a rider so when Drago decides to commandeer Toothless I would think that it would not work since Dragon wouldn't know how to make all the mechanisms function correctly. Nope, Drago somehow flies Toothless perfectly and gets to Berk without any issues. Drago has a dragon hiding underwater and through Fishleg we are set up to expect some amazing dragon such as a Leviathorgan. Unfortunately when the dragon is revealed, it is just another Bewilderbeast. At least since it was able to survive submerged deep underwater I would have expected it to look slightly different other than coloring and have different abilities but unfortunately no, it was just a dark version of the while Bewilderbeast with the same ice breath powers. While on the subject of the Bewilderbeasts, I wish that there would have been more to the Bewilderbeasts' battle. Instead there were just a lot of bashing up against each other as if they were two rhinos. I expected at least a couple of ice breathes to the face! Toothless getting a second set of dorsal fins was somewhat interesting but slightly weird that Toothless seems to have never known about them. They're on his body and seemingly an integral part of how he moves and flies. It would be like a person never knowing that he/she has knees and walked around back and forth without ever bending them. Loved the texture work. The dragons' scales were especially spectacular with all the little nuances of different amounts here and there, more prominent ones in certain areas, the coloring, and spikes in all the right areas. The hair work is amazing once again and I especially liked Stoic's beard with all the different layers and striations. I didn't know until the credits but Eret is voiced by Kit Harrington, or more popularly known as Jon Snow from Game of Thrones. If I were to watch the movie again, all that would go through my mind when Eret argues with Hiccup over dragons now would be "You know nothing Eret son of Eret". It'll be interesting to see what DreamWorks comes up after this as I expect more sequels to come. I really hope that the series doesn't get overworked and leads to its death. It is quite unfortunately that DreamWorks has apparently decided not only to ceased to create original works but has also cut funding in their animation division with focus on putting out sequels that they can depend on to sell well. Personally I don't want to see any sequels past three and a series shouldn't have more than two spinoffs. Once its at that point then its overkill and when I see another title that comes out trying to milk that series I just roll my eyes and put it in a corner to be further considered at a later time. Here's to hope for the next few originals that DreamWorks had already planned and in development to do well to show that people do want and like new things so that more can come our way!.
{ "pile_set_name": "Pile-CC" }
Black Lives Matter Attempts to Ban Ohio Open Carry from Public Protest Beavercreek, OH (TFC) — The truth is that this story is not some satirical take on true events. It is in fact true, and it should outrage any supporter of open carry in this country. It saddens me to even write it because, as a journalist, I have been deeply involved in supporting the black community through reporting on police brutality and racially motivated police abuse. However, the bigotry of the organization Black Lives Matter, and specifically its Ohio chapter, has prompted me to rethink my support for them. A number of events have taken place in the last few months that have prompted me to question the sanity of the Black Lives Matter organizers, and the level of disconnect they are experiencing from the general public. First was an event organized by some of the Greene County Black Lives Matter group, which was scheduled in downtown Dayton, Ohio. It’s unfortunate that I did not take screenshots of the flyers and announcements posted on Facebook by the organizers, but in essence there were posts made on Facebook which basically stated in no uncertain terms, “whites not allowed.” Now you may think this is a joke or some perverted sense of payback or justice, but it was not, especially since the posts were removed shortly after public outcry, and white supporters pointing out the bigotry of such statements. Then there is the video shot at a Black Lives Matter event that allegedly took place in Cleveland, where a white journalist, who showed up in support of BLM, was assaulted, cursed at and forced to virtually run away simply due to his skin color alone! You can watch the video here and make up your own mind. This kind of bigoted and outright racist behavior is completely unacceptable and as a journalist I cannot tolerate it or ignore it. In the video, an individual, who appears to be a BLM organizer, is heard stating that the meeting is only for people of African descent. As the white journalist is making his way out of the crowd, many people are heard screaming, “stop filming,” proceed to surround him, grab his camera, push him and assault him. When asked about the racist and bigoted remarks, the organizers defended the behavior by claiming this was a “private” meeting, however the meeting is clearly out in public on what appears to be public property. Not only that, but the journalist was clearly in the process of leaving, as he was asked to do, when he was assaulted and threatened. To top it all off, now we have Black Lives Matter attempting to ban Americans from carrying firearms on public property! BLM is organizing a protest at the Beavercreek Walmart on August 5, 2015, on the same day and time as Ohio Open Carry’s open carry demonstration, and is ludicrously attempting to intimidate OOC attendees into not bringing firearms or open carrying on public property! In what cannot be called anything other that ridiculous, Cheryl Smith, one of the organizers of the event made the following post on Facebook stating, The August 5th Action at Walmart is a weapons free demonstration. Please read the Rules of conduct on the BLM FB page so that we are in united solidarity. We are requesting that 1) Everyone Wear Black 2) Bring a flower of your choice. This demonstration will take on a Silent Reverence to commemorate John Crawford III. Outside of the fact that “weapons free” does not mean what Cheryl thinks it means, note that she is not kindly and politely asking people what to do on public property. She is in fact telling people what to do, how to behave, and what to wear…and especially that no guns are allowed! The discourse under this post quickly descended into name-calling and further demands from the organizers claiming that white people, in essence, owe obedience to the organizers. Essentially, anything else short of meeting these demands is disrespectful, in spite of the fact that Ohio Open Carry has participated in numerous open carry walks and demonstrations in the exact same location, and has planned on doing so on the one year anniversary of the shooting, namely on Wednesday, August 5. Again, let me remind you one last time that these demonstrations and protests are taking place on public property and sidewalks surrounding the Walmart property. These sidewalks have been used at least once a month by members of the Ohio Open Carry and Cop Block since August 2014 for protests against Beavercreek police policies, which have allowed a peaceful man open carrying a toy rifle to be shot and killed. In fact, Ohio Open Carry was the very first organization to schedule and participate in an open carry walk after the shooting in order to show solidarity and support for the Crawford family. The Beavercreek PD has a history of harassing open carriers, which is why the issue of open carry in this instance is so critical to the discourse and indeed, why this shooting is, in fact, as much an open carry issue as it is a racial and police brutality issue. It is clear that Black Lives Matter is attempting to hijack the discourse, and the actual narrative of the incident and the shooting of John Crawford, in order to further their anti-gun political agenda, with no concern to the actual facts behind the shooting and the history of Beavercreek PD. Unfortunately, due to the political posturing, the blatant racism and bigoted attitude against white people, and anti-gun agenda, I can no longer support Black Lives Matter in any way shape or form, and I call on the black community to condemn their behavior, statements and attitude in clear an unequivocal terms. As a last reminder, Ohio Open Carry will be there, regardless of what color our skin is, carrying our pistols, rifles and arms to remind the public that open carry is legal and that the killing of John Crawford was senseless and criminal. Virgil Vaduva is a Libertarian security professional, journalist, photographer and overall liberty freak. He spent most of his life in Communist Romania and participated in the 1989 street protests which led to the collapse of the Ceausescu regime. He can be reached at vvaduva at truthvoice.com. Search The Fifth Column Get updates on Facebook Sections This website uses cookies to improve your experience. We'll assume you're ok with this, but you can opt-out if you wish.AcceptRejectRead More Privacy & Cookies Policy The Fifth Column is a participant in the Amazon Services LLC Associates Program, an affiliate advertising program designed to provide a means for sites to earn advertising fees by advertising and linking to Amazon.com.
{ "pile_set_name": "Pile-CC" }
Learn about this topic in these articles: Portuguese literature His Dispersão (1914; “Dispersion”) features exuberant images, an obsession with verbal constructions and metaphors, and experimentation with graphic design and fonts. The most versatile figure of Portuguese Modernism is José de Almada Negreiros, a poet, novelist, caricaturist, dancer, and actor who provoked scandal with his Manifesto…
{ "pile_set_name": "Pile-CC" }
Massachusetts Institute of Technology professor Tod Machover smiles during an interview on Thursday, Nov. 19, 2015, in Detroit. The DSO has teamed up with the international composer to create an original musical work designed to answer the question: “What does Detroit sound like?” The result is “Symphony in D,” a blend of melodies played by traditional orchestral instruments combined with everyday Detroit sounds collected, digitized, and translated into music via software developed by Machover. (AP Photo/Carlos Osorio) Massachusetts Institute of Technology professor Tod Machover smiles during an interview on Thursday, Nov. 19, 2015, in Detroit. The DSO has teamed up with the international composer to create an original musical work designed to answer the question: “What does Detroit sound like?” The result is “Symphony in D,” a blend of melodies played by traditional orchestral instruments combined with everyday Detroit sounds collected, digitized, and translated into music via software developed by Machover. (AP Photo/Carlos Osorio) PHILADELPHIA (AP) — A symphony debuting this week both captures and celebrates the distinctive sounds and sizzle of Philadelphia, from veteran radio announcer Merrill Reese’s call of the Eagles’ Super Bowl victory to a cook chopping steak on the grill at one of this city’s iconic cheesesteak joints. Composer Tod Machover listened to hundreds of hours of recordings and used about a third of all the sounds he received. He selected those he said had “strong personalities” and conveyed some important aspect of the city. Screaming is even a part of the vocal material. ADVERTISEMENT The Philadelphia Orchestra , accompanied by a 250-person choir, will perform “Philadelphia Voices” on Thursday, Friday and Saturday at its main performance hall and on April 10 at New York’s Carnegie Hall. Music director Yannick Nezet-Seguin said it’s “a large-scale work that pairs The Philadelphia Orchestra with all of the talent of the city — of various origins, ages, and backgrounds.” This is Machover’s sixth city symphony and the second to feature an American city. He recorded the sounds of Detroit in 2015, creating a symphony that included the sound of Henry Ford’s first engine. The project was detailed in the documentary “Symphony in D.” “I definitely want to celebrate the cities I go into,” said Machover, an MIT professor and electronic music innovator who was a finalist for the 2012 Pulitzer Prize in Music. “For me, the real interest in doing this project is to get ordinary people thinking about something they care about and everybody cares about where they live.” This is the first of his symphonies to focus on and incorporate voice. Often the instruments, choruses and city sounds are interwoven, sometimes blending together and other times clashing. There were certain iconic places (like Love Park and inside the giant, walk-through model heart at The Franklin Institute) and themes (the nation’s founding in Philadelphia, its status as the city of brotherly love and sisterly affection) that Machover felt obliged to represent in the work. The 30-minute-long symphony’s two prominent sound solos were also an easy fit: a “cheesesteak interlude” drawn from the kitchen of Pat’s King of Steaks, with percussion accompaniment, and a collage of Reese’s announcement of the final seconds of the Super Bowl. “With the steaks sizzling and the chopping and the spatula moving and the chef talking about how many cheesesteaks people ate per day, how many people (who work) there ate per day and what cheesesteaks mean to Philadelphia, it’s just a great combination of sounds everybody will recognize,” Machover said. After getting the NFL’s permission to use Eagles’ announcer Reese’s triumphant end-of-game call, Machover wrote a loud chord for the orchestra to play as the rival New England Patriots’ tried to score a final time. “Then the orchestra stops, the chorus stops, and it’s just the game,” Machover said. “It goes into Merrill Reese screaming, all by itself, and it’s kind of special.” Reese has been the Eagles play-by-play announcer for over 40 years, and his voice is instantly recognizable to any city sports fan. For a full 30 seconds, he is heard shouting: “The game is over! The Philadelphia Eagles are Super Bowl champions! Eagles fans everywhere, this is for you! Let the celebration begin!” Machover asked some students what words defined Philadelphia and teenage writers their thoughts on democracy. He recorded lively bird songs at the Philadelphia Zoo and a music historian talking about jazz saxophonist John Coltrane. A trip to the Museum of the American Revolution resulted in the sounds of children training on drums and shouting “Huzzah!” At the National Constitution Center, newly sworn-in citizens were asked their thoughts on the state of the country. Philadelphia resident and poet Jacob Winterstein helped connect Machover with other local artists. He also took Machover on a bike tour through Center City, which was recorded for the project. “He tried to go deeper than the classical things Philadelphia is associated with — American history, sports teams, sandwiches — and beyond the most easy narrative of Philadelphia,” Winterstein said. His Philadelphia-inspired poem “Block Party” is featured in the symphony. These individual neighborhood celebrations happen in all corners of the city, wealthy and struggling, and are enjoyed by residents of all colors and beliefs. “Even in our separateness, the fact that we do something in a similar way shows our collectiveness,” he said.
{ "pile_set_name": "OpenWebText2" }
t is the hundred thousands digit of 8174967? 1 What is the thousands digit of 3510524? 0 What is the tens digit of 5748396? 9 What is the thousands digit of 22759? 2 What is the thousands digit of 5441444? 1 What is the thousands digit of 346008? 6 What is the hundreds digit of 582505? 5 What is the millions digit of 7212237? 7 What is the ten thousands digit of 167045? 6 What is the tens digit of 627928? 2 What is the hundred thousands digit of 214888? 2 What is the hundred thousands digit of 150333? 1 What is the hundreds digit of 5605972? 9 What is the hundreds digit of 1712393? 3 What is the units digit of 386975? 5 What is the hundreds digit of 19856? 8 What is the hundred thousands digit of 1014742? 0 What is the hundred thousands digit of 8932571? 9 What is the hundred thousands digit of 20977523? 9 What is the hundreds digit of 94236? 2 What is the thousands digit of 29771335? 1 What is the ten thousands digit of 57715? 5 What is the ten millions digit of 13777123? 1 What is the units digit of 837206? 6 What is the thousands digit of 1601845? 1 What is the thousands digit of 1218855? 8 What is the units digit of 2869292? 2 What is the ten millions digit of 14178341? 1 What is the hundreds digit of 86992? 9 What is the hundreds digit of 1436052? 0 What is the tens digit of 29647979? 7 What is the tens digit of 14605607? 0 What is the thousands digit of 103350? 3 What is the ten thousands digit of 16682244? 8 What is the thousands digit of 147063? 7 What is the ten thousands digit of 206761? 0 What is the ten thousands digit of 332913? 3 What is the units digit of 22500? 0 What is the tens digit of 560951? 5 What is the millions digit of 1022770? 1 What is the hundreds digit of 13357700? 7 What is the hundred thousands digit of 1057526? 0 What is the ten thousands digit of 82801? 8 What is the tens digit of 6391523? 2 What is the millions digit of 1474738? 1 What is the millions digit of 8868997? 8 What is the hundreds digit of 1882889? 8 What is the hundred thousands digit of 554034? 5 What is the units digit of 2118796? 6 What is the tens digit of 27559? 5 What is the thousands digit of 278057? 8 What is the hundred thousands digit of 1253647? 2 What is the units digit of 310689? 9 What is the units digit of 191060? 0 What is the tens digit of 41166? 6 What is the ten thousands digit of 4447202? 4 What is the tens digit of 2601406? 0 What is the ten thousands digit of 77629? 7 What is the ten thousands digit of 1630243? 3 What is the hundreds digit of 1501222? 2 What is the hundreds digit of 17137957? 9 What is the thousands digit of 1860932? 0 What is the tens digit of 3329375? 7 What is the hundred thousands digit of 6719014? 7 What is the hundreds digit of 1014618? 6 What is the ten thousands digit of 272359? 7 What is the millions digit of 6333150? 6 What is the ten thousands digit of 299387? 9 What is the units digit of 3586600? 0 What is the units digit of 3114985? 5 What is the ten thousands digit of 547035? 4 What is the millions digit of 2422561? 2 What is the units digit of 30207? 7 What is the tens digit of 153173? 7 What is the thousands digit of 597567? 7 What is the hundreds digit of 354222? 2 What is the millions digit of 6388879? 6 What is the hundreds digit of 11318997? 9 What is the hundred thousands digit of 124609? 1 What is the hundred thousands digit of 201442? 2 What is the hundred thousands digit of 9150891? 1 What is the tens digit of 39444? 4 What is the units digit of 163610? 0 What is the hundreds digit of 214560? 5 What is the ten thousands digit of 88334? 8 What is the units digit of 3188649? 9 What is the ten thousands digit of 641045? 4 What is the units digit of 13613746? 6 What is the millions digit of 10678277? 0 What is the units digit of 526945? 5 What is the millions digit of 1989529? 1 What is the ten thousands digit of 2353632? 5 What is the tens digit of 23441756? 5 What is the thousands digit of 452276? 2 What is the ten thousands digit of 138999? 3 What is the ten thousands digit of 2671187? 7 What is the ten thousands digit of 2549493? 4 What is the tens digit of 2987944? 4 What is the units digit of 12952127? 7 What is the ten thousands digit of 976302? 7 What is the units digit of 7108526? 6 What is the hundred thousands digit of 1802390? 8 What is the units digit of 56610? 0 What is the hundreds digit of 6503309? 3 What is the ten thousands digit of 3176272? 7 What is the hundred thousands digit of 474310? 4 What is the hundred thousands digit of 7171296? 1 What is the tens digit of 385779? 7 What is the units digit of 2286646? 6 What is the millions digit of 3912360? 3 What is the units digit of 988065? 5 What is the tens digit of 310259? 5 What is the thousands digit of 5547093? 7 What is the hundreds digit of 155355? 3 What is the thousands digit of 1059992? 9 What is the tens digit of 240840? 4 What is the hundreds digit of 1390293? 2 What is the hundreds digit of 1362044? 0 What is the hundreds digit of 1118671? 6 What is the ten thousands digit of 588252? 8 What is the ten thousands digit of 2941985? 4 What is the units digit of 905897? 7 What is the millions digit of 1008914? 1 What is the units digit of 2597143? 3 What is the hundreds digit of 1933396? 3 What is the ten thousands digit of 218741? 1 What is the millions digit of 4285470? 4 What is the thousands digit of 2290174? 0 What is the hundred thousands digit of 1357300? 3 What is the units digit of 2036680? 0 What is the tens digit of 43130? 3 What is the hundreds digit of 1623182? 1 What is the thousands digit of 81152? 1 What is the ten thousands digit of 1012878? 1 What is the thousands digit of 3311? 3 What is the units digit of 2061097? 7 What is the thousands digit of 2139976? 9 What is the ten thousands digit of 186631? 8 What is the tens digit of 5448426? 2 What is the tens digit of 7010121? 2 What is the thousands digit of 1121761? 1 What is the ten millions digit of 10298417? 1 What is the thousands digit of 3552016? 2 What is the thousands digit of 7613296? 3 What is the ten millions digit of 21090641? 2 What is the hundreds digit of 1063109? 1 What is the units digit of 1780496? 6 What is the thousands digit of 3488512? 8 What is the ten millions digit of 21027312? 2 What is the tens digit of 430174? 7 What is the thousands digit of 4234457? 4 What is the hundred thousands digit of 467489? 4 What is the tens digit of 1068232? 3 What is the thousands digit of 404463? 4 What is the hundred thousands digit of 1242439? 2 What is the tens digit of 696144? 4 What is the millions digit of 20484782? 0 What is the thousands digit of 220452? 0 What is the ten thousands digit of 1298930? 9 What is the tens digit of 799121? 2 What is the tens digit of 111551? 5 What is the ten thousands digit of 20237453? 3 What is the tens digit of 2256114? 1 What is the ten thousands digit of 46637? 4 What is the thousands digit of 31608? 1 What is the ten millions digit of 18215900? 1 What is the millions digit of 1769931? 1 What is the tens digit of 36124765? 6 What is the units digit of 3468120? 0 What is the hundreds digit of 2656229? 2 What is the millions digit of 3288863? 3 What is the hundreds digit of 6666689? 6 What is the ten thousands digit of 395744? 9 What is the ten thousands digit of 90768? 9 What is the tens digit of 16932064? 6 What is the hundreds digit of 10157497? 4 What is the ten thousands digit of 1477048? 7 What is the hundreds digit of 9115783? 7 What is the hundreds digit of 8089089? 0 What is the millions digit of 6271497? 6 What is the hundred thousands digit of 198308? 1 What is the hundreds digit of 202904? 9 What is the thousands digit of 73764? 3 What is the thousands digit of 1559779? 9 What is the hundred thousands digit of 1803694? 8 What is the thousands digit of 155490? 5 What is the hundreds digit of 550049? 0 What is the millions digit of 1709652? 1 What is the hundreds digit of 18613? 6 What is the units digit of 265087? 7 What is the hundred thousands digit of 15318188? 3 What is the tens digit of 236598? 9 What is the thousands digit of 88638? 8 What is the units digit of 9998657? 7 What is the hundreds digit of 2259646? 6 What is the tens digit of 33654? 5 What is the thousands digit of 1643
{ "pile_set_name": "DM Mathematics" }
*Cldn4* : *claudin 4* ESC : embryonic stem cell FS : functional state GIP : insulinotropic polypeptide GLP1 : glucagon‐like peptide‐1 TJ : tight junction A large array of critical regulatory molecules such as transcription factors [1](#feb412735-bib-0001){ref-type="ref"} have been well documented to regulate functional state (FS) of pancreatic endocrine islets of Langerhans that sustain normal glucose homeostasis of the body, mainly via hormones from insulin‐secreting β cells and glucagon‐secreting α cells. To regulate this FS, the islets have evolved to have many unique features including being structurally spread throughout the exocrine pancreas. They do not have their own basement membrane [2](#feb412735-bib-0002){ref-type="ref"} but are closely in contact with that of intra‐islet capillaries [3](#feb412735-bib-0003){ref-type="ref"}, [4](#feb412735-bib-0004){ref-type="ref"}. In viewing the unique structural arrangement of the pancreatic endocrine tissue, we hypothesize that undiscovered structural molecules are important in regulating islet FS. This study aims to study such molecules. We have previously demonstrated that functional genes can be identified with the effective bioinformatics analyses of transcriptomic data sets [5](#feb412735-bib-0005){ref-type="ref"}, [6](#feb412735-bib-0006){ref-type="ref"}. Using the transcriptome data sets and other approaches, we demonstrated the involvement of previously understudied claudin (*Cldn*) family genes of tight junctions (TJs) in the islets. TJs between neighbouring epithelial cells have important biochemical and physiological roles in multiple organs by selective and critical permeability to important compounds, in addition to working as a structural barrier by forming strands against unrestricted paracellular passaging [7](#feb412735-bib-0007){ref-type="ref"}. Surprisingly, the expression and function of TJ molecules in the islets of Langerhans are largely unknown. Cldn family molecules are the tetraspan transmembrane proteins of TJs, forming a structural barrier between the apical and basal portions of epithelial cellular sheets [8](#feb412735-bib-0008){ref-type="ref"}. This family consists of at least 28 members in mice and humans. Cldns are classically expressed in epithelium and are categorized as cation‐selective, anion‐selective and water‐permeable channels, and charge‐selective barriers. The distribution of Cldns varies from one tissue type to another [9](#feb412735-bib-0009){ref-type="ref"}: for example, Cldn1 regulates permeability in the epidermis [10](#feb412735-bib-0010){ref-type="ref"}, Cldn5 does so in the blood--brain barrier [11](#feb412735-bib-0011){ref-type="ref"}, Cldn11 in the myelin and Sertoli cells [12](#feb412735-bib-0012){ref-type="ref"}, Cldn14 in inner ears [13](#feb412735-bib-0013){ref-type="ref"} and Cldn18 in the stomach [14](#feb412735-bib-0014){ref-type="ref"}. Cldn4 is a member of charge‐selective Cldns, usually partnering with Cldn8 and Cldn12 [9](#feb412735-bib-0009){ref-type="ref"}. Cldn4 is prominently expressed in the lung, intestinal and kidney‐collecting tubular epithelia [8](#feb412735-bib-0008){ref-type="ref"}, the urinary bladder and skin [15](#feb412735-bib-0015){ref-type="ref"} and the atypical and nonpolarized epithelial cells such as thymic epithelial cells [16](#feb412735-bib-0016){ref-type="ref"}, [17](#feb412735-bib-0017){ref-type="ref"}. Though highly expressed, Cldn4 seems not to play a major role on the physiology of the lung [18](#feb412735-bib-0018){ref-type="ref"}. Cldn4 is functionally involved in the generation of thymus CD4/CD8 single positive T lymphocytes [19](#feb412735-bib-0019){ref-type="ref"}. Gene knockout experiments demonstrate that *Cldn4* is critical for renal chloride (Cl^−^) reabsorption and blood pressure regulation [20](#feb412735-bib-0020){ref-type="ref"}, [21](#feb412735-bib-0021){ref-type="ref"}. Cldn4 was previously detected by immunofluorescence in the rat pancreatic tissue as well as in the islets of Langerhans [22](#feb412735-bib-0022){ref-type="ref"}. However, no major pathophysiological effect on energy metabolism has been documented on any *Cldn* gene. Here, we show with a number of approaches that Cldn4 in the mouse pancreatic islets is associated with regulating FS of the islets, implicating in translational research for better diabetes therapies. Materials and methods {#feb412735-sec-0002} ===================== Mouse lines {#feb412735-sec-0003} ----------- The *Cldn4*‐deleted, floxed *Cldn4* and CAG‐Cre mice [23](#feb412735-bib-0023){ref-type="ref"} were bred onto a C57BL/6 background for at least 10 generations. PCR‐based genotyping for Cldn4^+/−^ and Cldn4^−/−^ mouse lines was described elsewhere [23](#feb412735-bib-0023){ref-type="ref"}. Cldn4^−/−^, Cldn4^+/−^, floxed *Cldn4* and CAG‐Cre (the latter two lines along with the C57BL/6 designated as Cldn4^+/+^) mouse lines and the type 2 diabetes model db/db mice provided by Jackson Laboratory (Mount Desert Island, ME, USA) were maintained in a 22 ± 1 °C, 12:12 light/dark cycle environment with free access to food and water and used at 8--12 weeks of age. Compliance with Ethical Standards {#feb412735-sec-0004} --------------------------------- All applicable international, national and/or institutional guidelines for the care and use of animals were followed, namely the Animal Ethics Committees of the University of Western Australia, Australia and Kyoto University, Japan, approved the use of experimental animals. MIN6 cells {#feb412735-sec-0005} ---------- Culture, maintenance and passage of MIN6 cells were described previously [24](#feb412735-bib-0024){ref-type="ref"}. Isolation of adult islets {#feb412735-sec-0006} ------------------------- Islets of Langerhans were isolated from euthanized (cervical dislocation) 8‐ to 12‐week‐old C57BL/6 mice, 12‐week db/^+^ mice and db/db diabetic mice as described recently [5](#feb412735-bib-0005){ref-type="ref"}. Briefly, the pancreas was injected via the bile duct with collagenase P solution (Sigma, Melbourne, Vic., Australia, 1.2 mg·mL^−1^ dissolved in Hanks' balanced salt solution containing 2 m[m]{.smallcaps} Ca^2+^ and 20 m[m]{.smallcaps} HEPES). Islets and exocrine layers were isolated by density gradient Histopaque (Sigma) centrifugation, washed and hand‐picked islets for RNA. Glucose‐stimulated insulin secretion assay {#feb412735-sec-0007} ------------------------------------------ Glucose‐stimulated insulin secretion assay was performed essentially as described [25](#feb412735-bib-0025){ref-type="ref"}. Briefly, the indicated passaged MIN6 cells were washed twice with warm PBS. After pre‐incubation with the Krebs--Ringer buffer at 37 °C for 90 min, the cells were incubated at 37 °C for 60 min with basal D‐glucose (2.75 m[m]{.smallcaps}) or stimulus D‐glucose (27.5 m[m]{.smallcaps}). Then, each conditioned medium was collected to determine the insulin concentration using a mouse insulin ELISA kit (Mercodia AB, Uppsala, Sweden). Subsequently, the culture was trypsinized and the number of MIN6 cells was determined with a haemocytometer. Oral glucose tolerance test and serum incretin concentrations {#feb412735-sec-0008} ------------------------------------------------------------- After overnight fasting, mice were orally administered 10% glucose (2 g·kg^−1^ body weight) and blood glucose levels were measured with tail vein blood using OneTouch UltraVue (Johnson & Johnson K.K., Nishikanda Chiyoda‐Ku, Japan). Serum glucose‐dependent insulinotropic polypeptide (GIP) and glucagon‐like peptide‐1 (GLP1) concentrations were determined with Bio‐Plex (Bio‐Rad, Shinagawa‐ku, Tokyo, Japan), according to the manufacturer\'s instruction. Generation of endodermal cells {#feb412735-sec-0009} ------------------------------ Endodermal cells were generated from directed differentiation of undifferentiated mouse embryonic stem cell (ESC) W9.5 line as we described previously [6](#feb412735-bib-0006){ref-type="ref"}. Bioinformatics analyses {#feb412735-sec-0010} ----------------------- Bioinformatics analyses of transcriptome data sets were performed on published data sets generated from ESCs and isolated adult mouse islets and during differentiation of islet progenitors [25](#feb412735-bib-0025){ref-type="ref"}. Gene mining was performed as described previously [6](#feb412735-bib-0006){ref-type="ref"}, [26](#feb412735-bib-0026){ref-type="ref"}. Briefly, the differential expression of genes (*P* ≤ 0.05; −1 ≤ log~2 ~≥ 1) based on bioinformatics contrast between ESC and islet data sets and other contrasts were analysed using the Limma package in the '[r]{.smallcaps}' environment (<http://bioinf.wehi.edu.au/limma>). We will provide the data sets on request. Indirect immunofluorescence {#feb412735-sec-0011} --------------------------- Rat anti‐claudin 4 antibodies were purchased from Millipore (Castle Hill, NSW, Australia) and Abcam (Cambridge, UK), respectively. Biotinylated anti‐human insulin and rabbit anti‐glucagon antibodies were purchased from R&D Systems (Minneapolis, MN, USA). The antibody sources and staining procedures for laminin and nidogen 1 were described previously [2](#feb412735-bib-0002){ref-type="ref"}. Cells and pancreases from all genotypes were fixed in 4% paraformaldehyde and the latter processed for histological sections. After dewaxing and rehydration, tissue sections along with cell preparations were stained with primary antibodies and reacted with streptavidin FITC (BD, Bergen County, NJ, USA) and Texas Red anti‐human, anti‐rat or anti‐mouse (Vector Labs, Burlingame, CA, USA) as we described previously [27](#feb412735-bib-0027){ref-type="ref"}. Slides were observed and microphotographed with the inverse IX71 Olympus fluorescence microscope (Olympus, Tokyo, Japan). Gene expression analyses by qRT‐PCR {#feb412735-sec-0012} ----------------------------------- Total RNA was extracted from the epididymal fat, liver, kidney and skeletal muscles in euthanized (cervical dislocation) adult C57BL/6 mice and other indicated cells with RNeasy Plus Mini Kit (Qiagen Science, Melbourne, Vic., Australia) or the TRIzol‐based method and quantified by a NanoDrop ND‐1000 Spectrophotometer (Australian Biolab group, Melbourne, Vic., Australia) as described previously [26](#feb412735-bib-0026){ref-type="ref"}. RNA (200--400 ng) was reverse‐transcribed with reverse transcriptase to cDNA in 40 μL, 1 μL of which (5--10 ng RNA/reaction, without reverse transcriptase as a negative control) was amplified by qRT‐PCR analysis essentially as we described [26](#feb412735-bib-0026){ref-type="ref"}. Primer sequences are presented in Table [1](#feb412735-tbl-0001){ref-type="table"}. ###### Sequences for qRT‐PCR primers. +----------+--------------------------+-----------------------------+----------------------------+--------------+ | Gene | Forward primer | Reverse primer | Annealing temperature (°C) | Product (bp) | | | | | | | | | 5′ → 3′ | 5′ → 3′ | | | +==========+==========================+=============================+============================+==============+ | *Acta1* | `caatcgtgctgtggttgcag` | `ggagcaaaacagaatggctgg` | 60 | 191 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Cldn3* | `ggagtgcttttcctgttggc` | `cgtagtccttgcggtcgtag` | 60 | 295 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Cldn4* | `ccaagtcatggtgtgctgag` | `cactgggctgcttctaggtc` | 60 | 217 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Fev* | `cggcgtctactcttccctgt` | `catctccgacgggatctggc` | 60 | 191 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *FoxO1* | `agccgcgcaagaccag` | `ttgaattcttccagcccgcc` | 60 | 195 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Hnf4a* | `ggatatggccgactacagcg` | `agatggggacgtgtcattgc` | 60 | 100 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *IA1* | `gccacccgtctgagaataga` | `ggagtcacagcgagaagacc` | 60 | 231 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Lama1* | `cggcgcgtaaagatttccag` | `ctcctgggtcttgcttccag` | 60 | 290 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Lamb1* | `gccgtcctaatgtggttgga` | `agctgggaaagccccaatac` | 60 | 210 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Isl1* | `cccgggggccactatttg` | `cgggcacgcatcacgaa` | 60 | 397 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *MafA* | `atcatcactctgcccaccat` | `agtcggatgacctcctcctt` | 60 | 208 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Mmp2* | `ggctctgtcctcctctgtag` | `tgccctcctaagccagtct` | 60 | 296 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Mycl1* | `gagaacggctggagagagtg` | `ttcaccttcagaatcgctggg` | 60 | 200 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *NeuroD* | `cttggccaagaactacatctgg` | `ggagtagggatgcaccgggaa` | 60 | 228 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Nid1* | `atcagcaccatccctgaaac` | `tcaataccgctgaactgctg` | 60 | 206 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Pax4* | `ccacctctctgcctgaagac` | `cccacagcatagctgacaga` | 60 | 236 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Pou3f4* | `gctgcctcgaatccctacag` | `cagttgcagatcttcgcgtc` | 60 | 261 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Rfx6* | `gcttgctggtctaccctgag` | `catcatctgcgtgatgctct` | 60 | 233 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Rps18* | `tgtggtgttgaggaaagcag` | `tcccatccttcacatccttc` | 60 | 155 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Snail1* | `agttgactaccgaccttgcg` | `tgcagctcgctatagttggg` | 60 | 128 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ | *Snail2* | `ggaccgttatccgcccg` | `tatggggaaataataactgtgtgtg` | 60 | 130 | +----------+--------------------------+-----------------------------+----------------------------+--------------+ John Wiley & Sons, Ltd The power SYBR Green PCR Master Mix‐based protocol was utilized, and all quantifications were normalized to the internal 18s rRNA level, as described recently [5](#feb412735-bib-0005){ref-type="ref"}. Briefly, cDNA was amplified with PCR: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The number of cycles of threshold (*C* ~t~) was measured with an ABI Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA) or a Rotor‐Gene RG‐3000 (Corbett Research, Sydney, NSW, Australia). Statistical analysis {#feb412735-sec-0013} -------------------- Experiments were performed in at least three biological repeats. Data are expressed as mean ± standard deviation (SD). Statistical differences between groups are analysed with nonparametric, unpaired Mann--Whitney *U* tests or Student\'s *t* tests in samples with numerous biological repeats. Results {#feb412735-sec-0014} ======= Bioinformatics analyses identified unique pancreatic islet genes {#feb412735-sec-0015} ---------------------------------------------------------------- To identify structural molecules that may regulate islet FS, we first conducted bioinformatics analyses to survey unique genes in adult pancreatic islets on the published global transcriptional data sets [6](#feb412735-bib-0006){ref-type="ref"}, [25](#feb412735-bib-0025){ref-type="ref"}. A bioinformatics contrast of the data sets generated from isolated functional islets to undifferentiated pluripotent ESCs (as a baseline) showed that there were 1618 and 1630 genes negatively and positively enriched (Log~2~ scale), respectively (Fig. [1](#feb412735-fig-0001){ref-type="fig"}A). Here, we only focused our analyses on genes that encode structural molecules for TJs, the basement membrane and mesenchymal tissue. Genes for the latter were analysed as the adult pancreatic islets are reported to have mesenchymal features [28](#feb412735-bib-0028){ref-type="ref"}. ![*Claudin 4* is highly expressed in adult functional islet cells. (A) Scheme depicted of the process of analysing transcriptomic data sets. Analyses of transcriptomic data sets generated from RNA extracted from ESCs and isolated adult islets. (B) Bioinformatics contrast analyses of the TJ claudin (Cldn) family genes with *Cldn4* bolded and enlarged. (C) Differential contrast analyses of the TJ‐associated genes of occludin family. (D) qRT‐PCR analysis of adult islet *Cldn3* and *Cldn4*. RNA was extracted from the pancreatic exocrine tissue (a epithelial tissue), the isolated adult islets and lymph nodes (a mesenchymal tissue). Data presented as mean ± SD, *n* = 3, \*\**P* \< 0.01 compared to exocrine or lymph node (Mann--Whitney *U* tests). (E) qRT‐PCR analysis of *Cldn3* and *Cldn4* in selected metabolic tissues. RNA was extracted from fat, renal tissue, the liver and skeletal muscle. Data presented as mean ± SD, *n* = 3, \*\**P* \< 0.01 compared to fat or the liver; ^\#\#^ *P* \< 0.01 compared to all other tissues (Mann--Whitney *U* tests). (F) *Claudin 4* (bolded and enlarged) is predominantly up‐regulated during functional maturation of islet β cells. Bioinformatics analyses of the claudin (Cldn) family genes in global gene expression data sets [25](#feb412735-bib-0025){ref-type="ref"} during *in vitro* differentiation of islet progenitors for 0 (Day 0, namely undifferentiated islet progenitors)‐, 1 (Day 1, namely 1‐day differentiation of islet progenitors)‐ and 4 (Day 4, namely 4‐day differentiation of islet progenitors)‐day differentiation and using adult islets (islet) as the reference.](FEB4-10-28-g001){#feb412735-fig-0001} Tight junction *claudin 4* gene was highly enriched in adult functional islets {#feb412735-sec-0016} ------------------------------------------------------------------------------ In the bioinformatics contrast, there were 22 single exon TJ *Cldn* genes. Whereas majority of *Cldn* genes (*Cldn1*,*Cldn5*,*Cldns7‐9* and *Cldns12‐18*) were undetectable, *Cldn6* was strikingly negatively enriched (Fig. [1](#feb412735-fig-0001){ref-type="fig"}B). Interestingly, we revealed that several TJ genes *Cldn3* and *Cldn19* and in particular *Cldn4* were significantly enriched (Fig. [1](#feb412735-fig-0001){ref-type="fig"}B). *MarvelD3*, the TJ‐associated member of occludin family, was also enriched (Fig. [1](#feb412735-fig-0001){ref-type="fig"}C), but not essential for the formation of the TJs [29](#feb412735-bib-0029){ref-type="ref"}. To confirm the high enrichment of *Cldn4* in functional islets, qRT‐PCR analyses were conducted with RNA extracted from adult islets compared to that from pancreatic exocrine cells, a typical epithelial tissue and from the lymph nodes, a mesenchymal tissue. *Cldn4* in adult islets was indeed highly enriched by approximately 75‐fold, whereas *Cldn3* only twofold to threefold (Fig. [1](#feb412735-fig-0001){ref-type="fig"}D), compared to the exocrine cells. We also surveyed their expression in peripheral glucose metabolic tissues such as fat, liver and skeletal muscle using the renal tissue as the positive control [8](#feb412735-bib-0008){ref-type="ref"}. *Cldn4* expression was approximately 20‐fold to 30‐fold higher in the islets than in the kidney and the skeletal muscle (Fig. [1](#feb412735-fig-0001){ref-type="fig"}D,E); *Cldn3* was, however, mainly expressed in the liver, whereas both genes were not detected in fat (Fig. [1](#feb412735-fig-0001){ref-type="fig"}E). *Claudin 4* was highly expressed in adult functional islets {#feb412735-sec-0017} ----------------------------------------------------------- To determine at what developmental stage *Cldn4* is highly enriched, we performed bioinformatics contrasts of published transcriptome data sets generated from *in vitro* differentiation of purified mouse islet progenitors into immature insulin‐secreting cells and from isolated adult islets [25](#feb412735-bib-0025){ref-type="ref"}. Indeed, we demonstrated that *Cldn4* and to a less extent *Cldn3* and *Cldn23* were significantly enriched during functional maturation of islet cells (Fig. [1](#feb412735-fig-0001){ref-type="fig"}F). Taken together, we conclude that Cldn4 is the highly expressed TJ molecule amongst the Cldn family in adult islets. Claudin 4 was down‐regulated in functionally compromised dedifferentiated β cells {#feb412735-sec-0018} --------------------------------------------------------------------------------- If the Cldn4 molecule is a critical regulator, we hypothesized that reduction of its expression or genetic deletion will compromise the FS of adult pancreatic islets. We first investigated the dynamic changes of Cldn4 expression in a characterized cellular model of dedifferentiation, the passaged MIN6 β cells [24](#feb412735-bib-0024){ref-type="ref"}. β‐cell dedifferentiation is broadly defined as becoming insulin‐negative cells, losing function of GSIS, re‐expressing markers of islet progenitors and even transdifferentiating to other islet cell types [24](#feb412735-bib-0024){ref-type="ref"}, [30](#feb412735-bib-0030){ref-type="ref"}. The expression of Cldn4 molecule was progressively and significantly (*P* \< 0.001) down‐regulated at mRNA (Fig. [2](#feb412735-fig-0002){ref-type="fig"}A) but not clearly reduced at protein (Fig. [2](#feb412735-fig-0002){ref-type="fig"}B) levels in dedifferentiating MIN6 cells [24](#feb412735-bib-0024){ref-type="ref"}, whereas *Cldn3* was significantly up‐regulated in dedifferentiating MIN6 cells (*P* \< 0.001). The significance of different expression profiles between *Cldn3* and *Cldn4* deserves further investigation. To shed mechanistic lights, we investigated dynamic changes of many progenitor and functional transcription factor genes. The functional transcription factor genes *Hnf4a*,*FoxO1*,*NeuroD*,*Pax4* and *Pou3f4* (also known as *Brn4*) expression was significantly (*P* \< 0.001) down‐regulated at early dedifferentiating stage. The expression of islet progenitor transcription factor genes *Fev* and *Isl1* was progressively (*P* \< 0.001) up‐regulated, whereas *IA1* (also known as *Insm1*), *Mycl1* and *Rfx6* was unchanged (Fig. [2](#feb412735-fig-0002){ref-type="fig"}C). We also confirmed that dedifferentiated MIN6 cells significantly lost their glucose‐stimulated insulin secretion (Fig. [2](#feb412735-fig-0002){ref-type="fig"}D), consistent with previous report [24](#feb412735-bib-0024){ref-type="ref"}. ![*Claudin 4* is down‐regulated during dedifferentiation of functional βcells. (A) qRT‐PCR analysis of *Cldn3* and *Cldn4*. RNA was extracted from MIN6 cells at passages 34, 48, 68 and 82. (A, B) Data presented as mean ± SD, *n* = 3, \*\**P* \< 0.01 compared to all other passages (Mann--Whitney *U* tests). (B) Immunofluorescence analysis. MIN6 cells at passages 34 and 84 were stained with anti‐Cldn4 (red) and the DNA dye DAPI (blue). Scale bar = 20 μm. (C) Glucose‐stimulated insulin secretion analysis. Indicated passaged MIN6 cells were exposed to basal glucose (2.75 m[m]{.smallcaps}) or stimulus glucose (27.5 m[m]{.smallcaps}) for the determination of insulin concentrations. Data presented as mean ± SD, *n* = 3, \*\**P* \< 0.01 compared to the basal glucose condition (Mann--Whitney *U* tests). (D) qRT‐PCR analysis of selected transcription factor genes associated with islet function and differentiation. RNA was extracted from MIN6 cells at passages 36, 48, 69 and 80. Data presented as mean ± SD, *n* = 3, \*\**P* \< 0.01 compared to all other passages (except *FoxO1* and *NeuroD* not vs passage 80) (Mann--Whitney *U* tests). (E) qRT‐PCR analysis of *Cldn3* (grey bars) and *Cldn4* (black bars). RNA was extracted from isolated db/+ and db/db diabetic islets. Data presented as mean ± SD, *n* = 3, \*\**P* \< 0.01 compared to db/db diabetic islets (Mann--Whitney *U* tests).](FEB4-10-28-g002){#feb412735-fig-0002} To provide evidence whether the down‐regulation of *Cldn4* takes place in the dedifferentiated primary β cells, islets were isolated and analysed from the well‐characterized type 2 diabetes model db/db mice that have dedifferentiated β cells [24](#feb412735-bib-0024){ref-type="ref"}, [31](#feb412735-bib-0031){ref-type="ref"}. We showed that *Cldn4* was down‐regulated approximately 60% in dedifferentiated db/db islets (Fig. [2](#feb412735-fig-0002){ref-type="fig"}E). Collectively, these data suggested that Cldn4 involves in regulating FS in mature β cells and reduction of which could mark the dedifferentiation of β cells. *Claudin 4* deletion compromised glucose tolerance {#feb412735-sec-0019} -------------------------------------------------- We hypothesized that if the dynamic changes of Cldn4 expression were the consequence of β‐cell maturation or dedifferentiation, *Cldn4* deletion will not compromise the islet FS. To test this hypothesis, we analysed the well‐established genetic mouse model in which *Cldn4* was globally removed [23](#feb412735-bib-0023){ref-type="ref"}, diagrammatically depicted in Fig. [3](#feb412735-fig-0003){ref-type="fig"}A. The global knockout model was used because the effect of *Cldn4* in liver, fat and skeletal muscles was negligible as its expression was undetectable in liver and fat and approximately 30‐fold lower than in the islets (Fig. [1](#feb412735-fig-0001){ref-type="fig"}D,E). Both Cldn4^+/−^ and Cldn4^−/−^ mice were born in a normal Mendelian ratio and developed physically indistinguishable from Cldn4^+/+^ mice. The deletion of *Cldn4* was previously confirmed by Southern plot analysis in Cldn4^−/−^ mouse ESCs [23](#feb412735-bib-0023){ref-type="ref"}. We here also showed that the expression of Cldn4 protein was undetectable or dramatically reduced in *Cldn4‐*deleted β cells by immunofluorescence analysis (Fig. [3](#feb412735-fig-0003){ref-type="fig"}B), indicating that *Cldn4* was effectively inactivated in the mutant islets. ![*Cldn4* deletion compromises glucose tolerance. (A) Schema showing the *Cldn4* deletion strategy. The chicken β‐actin promoter/enhancer coupled with the cytomegalovirus immediate‐early enhancer (CAG) driving Cre‐mediated deletion of the floxed *Cldn4*. (B) Immunofluorescence analysis. Pancreas sections from Cldn4^+/+^, Cldn4^+/−^ and Cldn4^−/−^ mice were stained with anti‐Cldn4 (green) and anti‐insulin (Ins, red), and the DNA dye DAPI (blue). Microphotographs were taken under a microscope. Scale bar = 50 μm. (C) Oral glucose tolerance test (OGTT) in males. Cldn4^+/+^ (*n* = 9) and Cldn4^−/−^ (*n* = 8) adult mice were examined. Blood glucose concentrations were determined in the tail vein using an OneTouch UltraVue glucose metre. (D) AUC analysis of OGTT in (C). (E) OGTT in females. Cldn4^+/+^ (*n* = 12) and Cldn4^−/−^ (*n* = 13) adult mice were examined. Blood glucose concentrations were determined as in (C). (F) AUC analysis of OGTT in (E). (F) Serum glucose‐dependent GIP concentrations. Adult male Cldn4^+/+^ (*n* = 4) and Cldn4^−/−^ (*n* = 4) mice were used. (G) GIP concentrations were determined with Bio‐Plex assays. (H) Serum glucagon‐like polypeptide‐1 (GLP1) concentrations. Adult male Cldn4^+/+^ (*n* = 3) and Cldn4^−/−^ (*n* = 3) mice were tested. GLP1 concentrations were determined with Bio‐Plex assays. (C--H) Data presented as mean ± SD, \**P* \< 0.05 and \*\**P* \< 0.001 compared to Cldn4^+/+^ (Student\'s *t* tests).](FEB4-10-28-g003){#feb412735-fig-0003} We then performed oral glucose tolerance test, as the enteroendocrine cells express a high level of Cldn4 [32](#feb412735-bib-0032){ref-type="ref"} and secrete incretins that are also modulators of glucose homeostasis in Cldn4^+/+^ mice [33](#feb412735-bib-0033){ref-type="ref"}. After overnight fasting, Cldn4^−/−^ mice were administered oral glucose at 2.0 g·kg^−1^ and glucose concentrations measured. The Cldn4^−/−^ mice showed a sex difference in responding to glucose challenge. Cldn4^−/−^ males had modest but significantly (*P* \< 0.05) higher blood glucose concentrations at 30 and 90 min (Fig. [3](#feb412735-fig-0003){ref-type="fig"}C). This was confirmed by a highly significantly (*P* \< 0.01) increase of the area under the curve (AUC) in Cldn4^−/−^ males compared to Cldn4^+/+^ males (Fig. [3](#feb412735-fig-0003){ref-type="fig"}D). Surprisingly Cldn4^−/−^ females were modest but significantly (*P* \< 0.05) more sensitive to glucose metabolism 10 and 20 min after the glucose challenge (Fig. [3](#feb412735-fig-0003){ref-type="fig"}E). This was confirmed by a significantly (*P* \< 0.05) decrease of the area under the curve (AUC) in Cldn4^−/−^ females compared to Cldn4^+/+^ females (Fig. [3](#feb412735-fig-0003){ref-type="fig"}F). Hereafter, we only described phenotypes from male Cldn4^−/−^ mice. We hypothesized, if abnormal blood glucose concentrations in these mice are caused by abnormal function of enteroendocrine cells, that the blood concentrations of key gut hormones will be abnormal due to the deficiency of *Cldn4* in these cells [32](#feb412735-bib-0032){ref-type="ref"}. Nevertheless, the concentrations of glucose‐dependent insulinotropic polypeptide (also known as gastric inhibitory polypeptide, GIP, Fig. [3](#feb412735-fig-0003){ref-type="fig"}G) and glucagon‐like polypeptide‐1 (GLP1, Fig. [3](#feb412735-fig-0003){ref-type="fig"}H) were similar between Cldn4^+/+^ and Cldn4^−/−^ mice, suggesting that the deficiency of *Cldn4* does not affect the secretion of these enteroendocrine hormones. Taken together, these data show that Cldn4 deletion in adult male islets is associated with the glucose intolerance and compromised islet FS observed. *Claudin 4* deletion did not affect islet architecture {#feb412735-sec-0020} ------------------------------------------------------ Cldn4 is a key member of the TJ family molecules, deletion of which in male pancreas may disrupt the islet architecture and lead to an inadequate cellular distribution, that could impair the FS of adult islets [34](#feb412735-bib-0034){ref-type="ref"}, [35](#feb412735-bib-0035){ref-type="ref"}. We thus performed morphological and immunofluorescence analyses in adult male *Cldn4*‐deleted pancreases. Interestingly, pancreas morphology and the islet architecture were similar and apparently unchanged in Cldn4^+/−^ and Cldn4^−/−^ compared to Cldn4^+/+^ mice (Fig. [4](#feb412735-fig-0004){ref-type="fig"}A). Furthermore, the cellular distribution was also apparently similar amongst Cldn4^+/+^, Cldn4^+/−^ and Cldn4^−/−^ islets with β cells at the core and α cells at the mantle (Fig. [4](#feb412735-fig-0004){ref-type="fig"}B). Combining with the observations that Cldn4 is up‐regulated during maturation and down‐regulated during dedifferentiation of β cells, we suggest that *Cldn4* deletion compromised islet FS. Finally, we examined whether basement membrane and mesenchymal genes are also involved in sustaining islet FS. ![*Claudin 4* deletion appears not affecting islet architecture. (A) Histological analyses. Pancreas sections from adult Cldn4^+/+^, Cldn4^+/−^ and Cldn4^−/−^ mice were stained with haematoxylin and eosin (H&E). Scale bar = 50 μm. (B) Immunofluorescence analysis. Pancreas sections from Cldn4^+/+^, Cldn4^+/−^ and Cldn4^−/−^ mice were stained with anti‐insulin (Ins, red) and anti‐glucagon (Gcg, green) and the DNA dye DAPI (blue). Representative microphotographs were taken under a microscope. Scale bar = 50 μm.](FEB4-10-28-g004){#feb412735-fig-0004} Basement membrane genes were absent in adult islets {#feb412735-sec-0021} --------------------------------------------------- Encoding important structural proteins surrounding the islet cells, basement membrane genes were also analysed. Bioinformatics analyses showed that several laminin chain genes *Lama1*,*Lamb1* and *Lamc1*, and key linkage genes *Fbln1*,*Fbln2*,*Nid1* and *Nid2* were all negatively enriched in mouse islet cells compared to that of ESCs (Fig. [5](#feb412735-fig-0005){ref-type="fig"}A). Supportively, qRT‐PCR did not detect meaningful expression of *Lama1*,*Lamb1* and *Nid1* in isolated mouse islets (Fig. [5](#feb412735-fig-0005){ref-type="fig"}B). Immunofluorescence analyses verified that laminin and laminin linking molecule nidogen 1 proteins were undetectable around islet cells, though present in a variety of endo‐ and epithelial basement membranes (Fig. [5](#feb412735-fig-0005){ref-type="fig"}C--E). Taken together, no basement membrane molecule was likely to play a role in sustaining islet FS. ![Basement membrane genes are undetectable in adult islets. (A) Differential contrast expression of selective basement membrane genes in the transcriptomic data sets between the ESCs and adult islets. (B) qRT‐PCR analysis for *Lama1*,*Lamb1* and *Nid1*. RNA was extracted from isolated adult islets and ESC‐derived endodermal cells, the latter were used as a positive control. Data presented as mean ± SD, *n* = 3, \*\**P* \< 0.01 compared to endodermal cells (Mann--Whitney *U* tests). (C--E) Immunofluorescence analyses from the adult mouse pancreas and kidney were stained for laminin (Lm, C) and nidogen 1 (Nid1, D--E). Scale bar = 50 μm. a: the acinar cell basement membrane; d: the ductal epithelial basement membrane, e: the endothelial basement membrane, g: the kidney glomerular basement membrane and i: islet.](FEB4-10-28-g005){#feb412735-fig-0005} Fewer mesenchymal genes expressed in adult islets {#feb412735-sec-0022} ------------------------------------------------- Amongst a selective cohort of 21 mesenchymal genes [36](#feb412735-bib-0036){ref-type="ref"}, the expression of the mesenchymal transcription factor genes *Snail3* and *Twist2* and several others *Col5a1*,*Pmp2* and *Vim* was negatively enriched though *Acta1*,*Dcn*,*Ovol2* and *Pmp22* were positively enriched over twofold in adult functional islets compared to that of ESCs (Fig. [6](#feb412735-fig-0006){ref-type="fig"}A). qRT‐PCR analysis confirmed that the expression of *Acta1* and *Snail1* was significantly higher in islets than in the exocrine tissue (Fig. [6](#feb412735-fig-0006){ref-type="fig"}B). Collectively, the modest enrichment of several mesenchymal genes in the adult islets did not clearly support the notion that these genes play a role in regulating islet FS. ![Fewer mesenchymal genes are detectable in adult islets. (A) Differential contrast expression of selective mesenchymal genes in the transcriptomic data sets between the ESCs and adult islets. (B) qRT‐PCR analysis for *Acta1*,*Mmp2*,*Snail1* and *Snail2*. RNA was extracted from the pancreatic exocrine (an epithelial tissue), the isolated adult islets and lymph nodes (a mesenchymal tissue). Data presented as mean ± SD, *n* = 3, \*\**P* \< 0.01 compared to exocrine or islets (Mann--Whitney *U* tests).](FEB4-10-28-g006){#feb412735-fig-0006} Discussion {#feb412735-sec-0023} ========== We provided multiple pieces of evidence for the first time that the highly expressed TJ molecule Cldn4 may be involved in regulating the FS of the pancreatic insulin‐secreting β cells with implications in translational research for better diabetes therapies. First, we showed that *Cldn4* is mostly up‐regulated during which differentiated β cells are functionally maturated. Second, the expression of *Cldn4* is down‐regulated when β cells are functionally compromised and undergo dedifferentiation. Third, the expression of Cldn4 is also down‐regulated when type 2 diabetic db/db islets have a overtly impaired FS. Fourth, a modest but significantly impaired FS is detected when *Cldn4* is genetically deleted in mice without clearly disrupting islet architecture and cellular distributions. Finally, the impaired FS in *Cldn4*‐deleted mice was apparently not associated with the incretin metabolism as GIP and GLP1 plasma concentrations were unaffected. The absence of meaningful expression of basement membrane genes in purified adult mouse islets supports our previous report [2](#feb412735-bib-0002){ref-type="ref"}. In and around mature pancreatic islets, the observed laminin is located at the endothelial basement membrane, consistent with our previous report [2](#feb412735-bib-0002){ref-type="ref"} and produced from endothelial cells and fibroblasts [37](#feb412735-bib-0037){ref-type="ref"}. In summary, the above data collectively suggest that the developmental up‐regulation of Cldn4 involves in islet FS, whereas pathological down‐regulation or genetic deletion of Cldn4 compromises it (Fig. [7](#feb412735-fig-0007){ref-type="fig"}). ![Summary of Cldn4 function. Claudin 4 (Cldn4) is developmentally up‐regulated in developing pancreatic islet cells, is involved in sustaining the FS in mature islets and is pathologically down‐regulated to compromise the FS in diabetic β cells.](FEB4-10-28-g007){#feb412735-fig-0007} However, unlike the kidney‐collecting duct [20](#feb412735-bib-0020){ref-type="ref"}, islet Cldn4 does not structurally partner with its typical partners, *Cldn8* and *Cldn12* [9](#feb412735-bib-0009){ref-type="ref"}, as the latter are undetectable in the functional endocrine pancreas. We speculate that islet Cldn4 also acts as selective and critical physiological ion channels [9](#feb412735-bib-0009){ref-type="ref"}. As reported [38](#feb412735-bib-0038){ref-type="ref"}, β‐cell Cldn4 may interact with the Cldn4 of adjacent β cells for a coordinated signalling. TJs can receive and convert signals from the cell interior to regulate junction assembly and transduce signals to the cell interior to regulate gene expression and cell response [39](#feb412735-bib-0039){ref-type="ref"}. A previous study demonstrated that serum Ca^+2^ concentration in the *Cldn4* null mice was significantly decreased, potentially due to the increased excretion of Ca^+2^ and Cl^−^ in the urine [23](#feb412735-bib-0023){ref-type="ref"}. If a similar Ca^+2^ metabolic disorder compromises β‐cell function, glucose intolerance should occur in both sexes of Cldn4^−/−^ mice, but in this case, glucose intolerance was only detected in males. Future definitive experiments including pancreas‐ or β‐cell‐specific deletion of *Cldn4* are required to confirm or refute the observation that Cldn4 involves in regulating the islet FS. Our study suggests a possibility that the highly up‐regulated TJ Cldn4 molecule works as a maturation biomarker of postnatal insulin‐secreting β cells. Using the biomarker, the fully matured insulin‐secreting cells given rise from pluripotent stem cells would be enriched for a regenerative therapy to high‐risk type 1 diabetic sufferers [40](#feb412735-bib-0040){ref-type="ref"}. A monoclonal antibody targeted the extracellular loop of Cldn4 has indeed enabled the enrichment of mouse enteroendocrine cells [32](#feb412735-bib-0032){ref-type="ref"}. The β‐cell hormone urocortin 3 [41](#feb412735-bib-0041){ref-type="ref"} has been demonstrated to be a β‐cell maturation marker [42](#feb412735-bib-0042){ref-type="ref"} but is difficult to be utilized for the enrichment of matured insulin‐secreting cells. Data presented point to the possibility that the declining expression of Cldn4 works as a novel biomarker of β‐cell dedifferentiation. β‐cell dedifferentiation has been demonstrated to play a critical role in the development of mouse [31](#feb412735-bib-0031){ref-type="ref"} and human [43](#feb412735-bib-0043){ref-type="ref"} type 2 diabetes, which affects 425 million people worldwide. Identification of such biomarkers would facilitate the investigations of molecular mechanisms of β‐cell dedifferentiation and of therapeutic approaches of the dedifferentiation prevention and of redifferentiation. Dedifferentiated β cells in diabetes have abnormally expressed the mitochondrial enzyme aldehyde dehydrogenase 1 isoform 3A [44](#feb412735-bib-0044){ref-type="ref"} or re‐expressed the fetal islet hormone gastrin [45](#feb412735-bib-0045){ref-type="ref"}. β‐cell dedifferentiation can be induced by the genetic deletion of *FoxO1* [31](#feb412735-bib-0031){ref-type="ref"} or *Pax6* [46](#feb412735-bib-0046){ref-type="ref"}, [47](#feb412735-bib-0047){ref-type="ref"} transcription factor genes. We here showed that when β cells undergo dedifferentiation, *Cldn4* expression is down‐regulated, associated with activation of several islet progenitor transcription factor genes including *Fev* and *Isl1*. Dedifferentiated β cells also progressively lose protein content but increase mRNA of the nuclear receptor Vdr expression and treatment with Vdr agonists is able to prevent β‐cell dedifferentiation [48](#feb412735-bib-0048){ref-type="ref"}. Research is underway to understand how the declined expression of functional transcription factor genes such as *Hnf4a* and *Pax4* and/or the increased expression of progenitor transcription factor genes *Fev* and *Isl1* contribute to the decreasing expression of Cldn4 in dedifferentiated β cells. We noted that *Cldn3* was down‐regulated approximately 50% in db/db islets, but significantly up‐regulated in late dedifferentiating MIN6 cells. Its significance on β‐cell dedifferentiation requires further studies. In summary, our study suggested that the previously unappreciated TJ molecule Cldn4 is involved in regulating islet FS in adult ß cells and may act as a biomarker of β‐cell maturation. This may be of significance for translational research in establishing stem cell therapy for the diabetes sufferers [49](#feb412735-bib-0049){ref-type="ref"}. This report also suggested that a reduction in Cldn4 expression in ß cells is associated with their dedifferentiation. Biomarkers of β‐cell dedifferentiation would impact the translational research for redifferentation therapies of the pandemic type 2 diabetes. Conflict of interest {#feb412735-sec-0025} ==================== The authors declare no conflict of interest. Author contributions {#feb412735-sec-0026} ==================== F‐XJ conceived, designed and performed the research and wrote the manuscript; HL, ANJ and TN performed the research and YH partially designed the research and reviewed the manuscript. The authors would like to thank Ms Caroline Rudnicka for technical assistance. This study was supported in part by the Juvenile Diabetes Research Foundation (4‐2006‐1025), Diabetes Australia Research Trust, Diabetes Research Foundation of Western Australia, Medical Research Foundation of Royal Perth Hospital and Telethon Perth Children\'s Hospital Research Fund (TPCHRF) Grant (to F‐XJ).
{ "pile_set_name": "PubMed Central" }
Hydrophobic sequences can substitute for the wild-type N-terminal sequence of cystatin A (stefin A) in tight binding to cysteine proteinases selection of high-affinity N-terminal region variants by phage display. A phage-display library of the cysteine-proteinase inhibitor, cystatin A, was constructed in which variants with the four N-terminal amino acids randomly mutated were expressed on the surface of filamenteous phage. Screening of this library for binding to papain gave predominantly variants with a glycine residue in position 4. This finding is in agreement with previous conclusions that glycine in this position is essential for tight binding of cystatin A to cysteine proteinases by allowing optimal interaction of the N-terminal region of the inhibitor with the enzyme. In contrast, the first three residues of the variants obtained by the screening were more variable. Two variants were identified with similar affinities for papain as the wild-type inhibitor, but with these residues, Val-Phe-Thr- or Ile-Leu-Leu, differing appreciably from those of the wild-type, Met-Ile-Pro. Other sequences of the N-terminal region, presumably mainly hydrophobic, can thus substitute for the wild-type sequence and contribute similar energy to the inhibitor-proteinase interaction. The two variants binding tightly to papain differed in their affinity for cathepsin B, demonstrating that cystatin variants with increased selectivity for a particular target cysteine proteinase can be obtained by phage-display technology.
{ "pile_set_name": "PubMed Abstracts" }
‘The Book of Mormon’ is still good Touring production continues to mine the laughs Aaron R. Conklin by Aaron R. Conklin Copyright 2019 Julieta Cervantes/Courtesy of Overture Center for the Arts Joseph Smith did what?!? Elder Cunningham (Jordan Matthew Brown) embellishes the story in ‘The Book of Mormon." “The Book of Mormon” began its life eight years ago as a crass gate-crasher, a gleeful and profane foray by a couple of arrested-development auteurs into a medium that was ripe for a good pantsing. Nearly a decade later, it’s entered the rarified air of “Broadway Shows That Can Reliably Tour Every Couple of Years,” a running list that includes “The Lion King,” “Wicked,” and, the world’s most slam-dunk automatic bid, “Hamilton,” Overture Center for the Arts’ November tour offering. And while Trey Parker, Matt Stone and Robert Lopez’s broad-as-the African-desert satire isn’t nearly as subversive as it was in 2011, the current touring production (playing through this weekend in the Overture Center) is still extraordinarily funny. As the pair of mismatched, but eager, Mormon Elders who get dispatched to the villages of Uganda, there to baptize the natives into the wonders of Mormonism, Liam Tobin and Jordan Matthew Brown do a great job of embodying their odd-couple vibe as Elder Price and Elder Cunningham. Tobin’s got the chiseled-chin confidence to own “You and Me (But Mostly Me),” his early show vanity vehicle. Brown rocks the nebbish vibe in ways both big and small, and it’s fun to see him shake off his shyness and use his catalogue of pop culture references to, um, inspire the villagers. His scenes with Alyah Chanelle Scott’s Nabulungi are sweet and affecting—in ‘Baptize Me,” you almost have to believe that the double entendre could lead somewhere. This production relies far more on malapropisms, props and strong singing and dancing to win the audience than fancy pyrotechnics and elaborate set pieces—with the exception, naturally, of “Spooky Mormon Hell Dream,” which thrusts us into the only Broadway dance number set in what looks like a fiery human intestine. On the heels of a show like “Anastasia,” that leaned heavily on CGI and projection effects, the meat-and-potatoes approach feels almost like callback to another era—even if that era still exists within this decade. The group of actual Mormons camped outside the Overture Center, politely handing out capital-B books and answering questions (look, ma, no doorbell ringing!) brought to mind last spring’s disastrous Overture touring production of “Miss Saigon,” which also featured people standing outside the building trying to give the audience some perspective. Although, ironically, “The Book of Mormon’s” biggest sin remains its borderline racist portrayal of Africans, not its skewering of the starched-white-shirt and-black-tie crowd. And honestly, it’s still impossible not to lose it when Tobin’s Elder Brice belts out that he believes the Garden of Eden is in Jackson County, Missouri. Underneath all the f-bombs and scatological souffle, “The Book of Mormon’s” message still resonates, and its central point—that religion tends to ask its followers to believe in some ridiculous and illogical things, but if it inspires them to become better people and doesn’t hurt anyone. It’s okay—is still difficult to refute. COPYRIGHT 2020 BY MADISON MAGAZINE. ALL RIGHTS RESERVED. THIS MATERIAL MAY NOT BE PUBLISHED, BROADCAST, REWRITTEN OR REDISTRIBUTED.
{ "pile_set_name": "OpenWebText2" }
The present invention relates to a weather strip to be attached to a door panel of an automobile by an attaching means except for a retainer. Referring to FIGS. 1 to 3, related arts are explained below. A full door type door panel 20 of an automobile usually comprising an outer panel 22 and inner panel 21. On the inner panel 21, there is provided a retainer 53 for attaching a weather strip 50 to the inner panel 21. At a connecting portion of both panels, and also at a connecting portion of the inner panel 21 with the retainer 53, a sealant 54 is coated for prevention of rust as shown in FIG. 1. However, according to the above-described technique, the following problems may be encountered. Since the rust prevention sealant 54 is coated as described above, the weather strip 50 attached to the door panel 20 interferes with this rust prevention sealant 54. Therefore, it is impossible to obtain a stable sealability between the weather strip 50 and the door panel 20. In order to ensure a stable sealability of the entire weather strip, it is necessary to strongly fasten the weather strip 50 with the retainer 53 so that the weather strip 50 can be fixed. However, since the weather strip 50 is incorporated into the retainer in a state of simple insertion, the weather strip 50 slips when the door is opened and closed, which possibly deteriorates the sealability. Further, at an end portion of the retainer 53, a step portion, the height of which corresponds to the wall thickness of the retainer 53, is created between the retainer 53 and the inner panel 21. Accordingly, the sealability is damaged at this step portion. For the above reasons, when consideration is given to ensuring the sealability between the weather strip 50 and the door panel 20, it is preferable not to provide the retainer 53. As shown in FIG. 3, in the case of a weather strip 50 having no retainers 53, it is proposed a means for ensuring the sealability of the door panel 20 by providing a small lip 52 which protrudes from an upper end portion of the base portion 51 and comes into elastic contact with the inner panel 21. However, the thus composed small lip 52 gets on a small arc portion 25 formed on the inner panel 21, so that the stable sealability can not be ensured. The reason why the stable sealability can not be ensured is described as follows. When the small lip 52 gets on the small arc portion 25, the sealability in this portion is lowered, and further the small lip 52 which has gotten on the small arc portion 25 does not sufficiently give a elastically contacting force by which a lower face of the base portion 51 of the weather strip 50 comes into elastic contact with the inner panel 21. For the above reasons, even when a highly expanded sponge member 17 or an adhesive double coated tape is provided on the lower face of the base portion 51, it is difficult to obtain a stable sealability. In this case, specific gravity of the highly expanded sponge member is usually in a range from 0.1 to 0.3. Furthermore, when an adhesive tape is used, it needs an additional step of peeling off a mold releasing paper of the adhesive tape, taking undesirable time and a labor. Thus, concerning the weather strip 50 attached to the retainer 53 provided on a conventional full door type door panel 20 of an automobile, it is difficult to stably ensure the sealability between the weather strip and the door panel 20. Further, since the small strip 52 provided at an upper end portion of the base portion 51 gets on the small arc portion 25 on the door panel 20, the sealability between the weather strip and the door panel 20 is deteriorated. Accordingly, an object of the present invention is to solve the above-described problems and to provide a retainerless weather strip capable of providing stable sealability thorough the entire length thereof. Another object of the present invention is to provide an attaching structure of a door weather strip by which the weight and cost of the weather strip can be reduced and further the time and labor to attach the weather strip can be reduced. Other objects and effects of the present invention will become apparent from the following description. The above-described objects of the present invention have been achieved by providing the following weather strips and weather strip assemblies. (1) A retainerless weather strip attached to a full door type door panel of an automobile by an attaching means except for a retainer, which comprises: a base portion to be fixed to an attaching portion of the door panel by at least one of a clip and an adhesive double coated tape; a hollow seal portion provided on an automobile interior side of the base portion so as to come into elastic contact with an automobile body; a seal lip portion provided on an automobile exterior side of the base portion, the seal lip portion comprising an upper end portion and an intermediate portion, so that the upper end portion of the seal lip portion comes into elastic contact with an automobile body and that the intermediate portion of the seal lip portion comes into elastic contact with a door panel; an end edge portion protruded from a lower end portion of the base portion on the automobile exterior side; and a neck portion formed in a connecting portion of the base portion with the seal lip portion on the automobile exterior side. (2) The retainerless weather strip according to the above item (1), wherein the end edge portion is a small lip which obliquely and upwardly comes into elastic contact with a flat portion of the door panel. (3) The retainerless weather strip according to the above item (2), further comprising a highly expanded sponge member provided on a lower face of the base portion on the automobile exterior side. (4) The retainerless weather strip according to the above item (1), wherein the end edge portion comprises a portion made of a highly expanded sponge material. (5) The retainerless weather strip according to the above item (4), wherein the end edge portion is made of a highly expanded sponge material. (6) The retainerless weather strip according to the above item (4), wherein an upper half of the end edge portion is made of the same material as that of the main body of the weather strip and has a lip or protrusion provided thereon, and a lower half thereof is made of a highly expanded sponge material. (7) The retainerless weather strip according to the above item (4), wherein an upper half of the end edge portion is made of a highly expanded sponge material, and a lower half thereof is made of the same material as that of the main body of the weather strip. (8) A retainerless weather strip assembly comprising: a retainerless weather strip according to the above item (4); and an inner panel having an engaging recess for holding the end edge portion of the retainerless weather strip, wherein the size of the end edge portion of the retainerless weather strip is larger than that of the engaging recess of the inner panel, and the end edge portion is press-fitted into the engaging recess. (9) The retainerless weather strip assembly according to the above item (8), wherein the inner panel has a small drain groove on a bottom face of the engaging recess. (10) The retainerless weather strip assembly according to the above item (8), wherein the end edge portion is made of a highly expanded sponge material. (11) The retainerless weather strip assembly according to the above item (8), wherein an upper half of the end edge portion is made of the same material as that of the main body of the weather strip and has a lip or protrusion provided thereon, and a lower half thereof is made of a highly expanded sponge material. (12) The retainerless weather strip assembly according to the above item (8), wherein an upper half of the end edge portion is made of a highly expanded sponge material, and a lower half thereof is made of the same material as that of the main body of the weather strip.
{ "pile_set_name": "USPTO Backgrounds" }
According to a new study by Pew Research, religiously unaffiliated adults now outnumber Catholics by two percent in the United States. The study also found that the number of adults who describe themselves as Christians has dropped nearly eight percent over the past seven years. What could cause such a drop in the Christian population of the US? The study suggests: The drop in the Christian share of the population has been driven mainly by declines among mainline Protestants and Catholics. Each of those large religious traditions has shrunk by approximately three percentage points since 2007. The evangelical Protestant share of the U.S. population also has dipped, but at a slower rate, falling by about one percentage point since 2007. As for Catholics, they have remained somewhat steady for past seven years but have seen a drop of almost three million Americans since 2007. But since 2007, religiously unaffiliated adults has grown by 19 million (a 19.2 percent increase), bring their estimates totals to 56 million Americans, as compared to 51 million Catholic adults. With many factors coming into play to account for the drop in Christian numbers and the rise of the non-religious, Pew says: As the Millennial generation enters adulthood, its members display much lower levels of religious affiliation, including less connection with Christian churches, than older generations. Fully 36% of young Millennials (those between the ages of 18 and 24) are religiously unaffiliated, as are 34% of older Millennials (ages 25-33). And fewer than six-in-ten Millennials identify with any branch of Christianity, compared with seven-in-ten or more among older generations, including Baby Boomers and Gen-Xers. Just 16% of Millennials are Catholic, and only 11% identify with mainline Protestantism. Roughly one-in-five are evangelical Protestants. Now, atheists reading this should not jump with immediate joy that there are now 56 million atheists in the US, though as of 2007 roughly 25% of “nones” identified as atheist and now the study shows those numbers have increased to 31% showing that the trend is definitely moving in that direction. The religiously unaffiliated have historically still claimed to believe in some form of God, but it cause for celebration because there is a bigger trend of non-religious (or “nones”) to identify with a more secular government and often find religion to be harmful to society. The study also showed that nearly 18 percent of “nones” were raised in a religious household and left that religion as they entered adulthood, or even more common, after graduating college. “The percentage of college graduates who identify with Christianity has declined by nine percentage points since 2007 (from 73% to 64%),” the study highlights. Yet the study did show that non-religiously affiliated adults share a common problem with the atheist community in general and that is diversity, but while white males continue to dominate both spheres, there are signs of change. Whites continue to be more likely than both blacks and Hispanics to identify as religiously unaffiliated; 24% of whites say they have no religion, compared with 20% of Hispanics and 18% of blacks. But the religiously unaffiliated have grown (and Christians have declined) as a share of the population within all three of these racial and ethnic groups. … More than a quarter of men (27%) now describe themselves as religiously unaffiliated, up from 20% in 2007. Fewer women are religious “nones,” but the religiously unaffiliated are growing among women at about the same rate as among men. Nearly one-in-five women (19%) now describe themselves as religiously unaffiliated, up from 13% in 2007. The tides are slowly turning in the US. While Christians are without a doubt the majority in the US, roughly seven-in-ten still identify as Christian, they are losing important ground and single religions that held a massive majority is slipping with only Evangelical Christians holding the top spot above “nones.” (Image: Gerry Dincher / Flickr / Creative Commons)
{ "pile_set_name": "OpenWebText2" }
Sled Scoot - Snowmobile Dolly The Sled Scoot snowmobile mover provides ease of movement for your snowmobile. Simply slide the sled scoot under your snowmobile, push down on the bar and then lift the back of the snowmobile up onto the extension bar. You will love how easy it is to move your snowmobile with the Sled Scoot! 6' Aluminum Picnic Tables Our 6' heavy duty aluminum picnic tables are lightweight and easy to assemble / disassemble. You can take comfort knowing this heavy duty picnic table is made of 100% recycled and recyclable materials and comes with a 10 year limited warranty! 8' Aluminum Picnic Tables (Wheelchair Accessible) Our heavy duty, wheelchair-accessible aluminum picnic tables comes in an 8' length. It might be a little bit longer, but it is still lightweight and easy to assemble / disassemble. You can take comfort in knowing this wheelchair accessible picnic table is heavy duty and made of 100% recycled and recyclable materials backed by a 10 year limited warranty! 6' Aluminum Park Benches Our heavy duty aluminum park benches are lightweight and easy to assemble / disassemble. You can take comfort in knowing this heavy duty park bench is made out of 100% recycled and recyclable materials and comes with a 10 year limited warranty! 6' Aluminum Mall Benches Our heavy duty aluminum mall benches are lightweight and easy to assemble / disassemble. You can take comfort in knowing this heavy duty mall bench is made out of 100% recycled and recyclable materials and comes with a 10 year limited warranty! Sled Scoot (Snowmobile Dolly) Availability: In stock $249.95 * Due to high demand, factory lead time is 2 weeks The FYX Sled Scoot is a revolutionary product that will allow you to move your snowmobile around in the garage and outdoors with ease. All you have to do is slide our Sled Scoot under your snowmobile, push down on the leverage arm and then lift the back of your snowmobile onto the arm. From there, just lock the bar into place and move your snowmobile around with ease! You can see it in action if you watch our video - we are sure you will love it!
{ "pile_set_name": "Pile-CC" }
Destination Salvador: Tourists Explore the Local Cultures A city of rich folklore, Salvador has maintained an ambience of archaic mystery that lures many a marveling visitor. The state of Bahia has kept a firm grip on its strong African, Brazilian, and European roots it has acquired throughout 500 years of existence. It is with such African and indigenous background that Salvador is provided with the authentic, mythical appeal it holds today. Through its ability to successfully balance tradition with modernity, Salvador has been able to produce some of the richest Brazilian art forms: capoeira, samba de roda, and afoxe – an African rhythm that influenced many Carnaval groups. The city has been crowned "the land of happiness," and not without reason. Thirty miles of gorgeous beach area and an immeasurable amount of partying radiate from the city. Salvador was the first capital of Brazil, and is currently the capital of the state of Bahia. Amerigo Vespucci – the same man who discovered America – arrived here on November 1st, 1501, sailing under the Portuguese flag. With November 1st being the day of all saints, Vespucci decided to name the place of arrival the Bay of All Saints. The Portuguese crown soon came to profit immensely from the "white gold" that thrived in the Northeast: sugar. Salvador became the center of the immense slave market that provided the labor demanded to upkeep the sugar cane field plantations. The 5 million West African slaves that arrived at the edges of the city provided much more than just labor – they helped form the culture that is now known as Bahian. The African Candomble religion has its strongest roots and its active followers here. Bahian cuisine is known for its distinct and delicious flavor that emerged from the use of such African cooking products as dende oil and coconut milk. Salvador actually ended up dividing into two planes of existence as a result of its topography. As it sits on the Bay of All Saints, the city becomes a series of hills and valleys. The upper city, Cidade Alta, and lower city, Cidade Baixa, are connected through the famous Elevador Lacerda. Before this elevator, the only connection between the "two cities" were steep and jagged streets. The main neighborhoods tend to sit on top of the heights, providing magnificent views. While at sea level, a wide variety of Brazilian arts and crafts can be found at the Mercado Modelo Market, along with traditional Bahian acarajes and sweets being served by the Bahiana women in traditional white. Lodging options are divided by area as well: the Barra district along the coast offers new, hip luxury hotels, while Pelourinho holds the more antiquated hotels and pousadas, with wooden interiors and decorated facades. Pelourinho (Pelo, by the locals) is the historic, colonial area that has been nominated a UNESCO World Heritage site for its large collection of Baroque colonial architecture – the largest in Latin America. Restored in the early 1990's, Pelo has become a famous attraction for visitors and locals alike, with its history, beauty, famous Baroque churches, and a thriving nightlife that divides itself between the many restaurants, bars, clubs and music venues. Due to the dips and turns of the city streets, first-time visitors can easily become confused as streets end abruptly and often change names seemingly without warning. Good maps of Salvador are available at the Bahiatursa Tourist Office in Pelourinho. Many tours of the city are offered as well, of the historic Pelourinho, important museums, the history of Capoeira and practices, and many more! These will help you penetrate the Salvador and the Bahian culture much more deeply. And last, though definitely not least, there is the magnificent Carnaval in Salvador. This celebration has become quite the sensation, as well as a competitor to the original in Rio. The essential difference between the two is that in Salvador everyone participates. Salvador's Carnival has people dancing and singing right alongside the many parading blocos, while in Rio the activities are more observational. There are also many distinctly Salvadorian festivals held throughout the year, helping to form the opinion that in Bahia, even the smallest religious ceremony can be turned into a day-and-night-long celebration! Which, with the food and the laughter and the merriment, isn't anything to complain about.
{ "pile_set_name": "Pile-CC" }
VeriME Gets a Boost By Becoming Official Identity Verification Method for Maritime Bank One of the more useful applications of blockchain technology is its potential ability to help realize decentralized identity authenticators. This application would be a huge benefit to many businesses, especially those in in the financial sector that are subject to burdensome and expensive KYC and anti-money laundering laws. Civic is a big name in this regard, as it has made a name for itself in the cryptosphere as one of the more interesting projects for leveraging blockchain tech to create a platform that allows for smooth and seamless identity verification. VeriME Partners with Vietnam-Based Bank Now, another name is looking to throw its hat into the blockchain-based verification ring (so to speak): VeriME. The Singapore-based startup already has a lot to brag about as it just recently partnered with Maritime Bank -- one of the largest banks in all of Vietnam. The bank plans to leverage VeriME’s D-KYC (KYC) & D-SECURE (Payment Authentication) services in order to enhance its digital banking and checkout experience for customers. Furthermore, Maritime Bank isn’t even the first bank to partner with VeriME. Indeed, Maritime Bank is the 3rd financial institution to form a partnership with the blockchain startup -- demonstrating a unique appeal to banks within the country. VeriME: Securing Identity with Blockchain Tech Sanjeev Kumar, co-founder of VeriME comments on the original motivations for creating VeriME. “The rising KYC challenges and its costs, which companies as well as customers were facing made us think of a better solution. A solution which will not only automate the whole process but will also make the complete KYC and due diligence process faster, seamless and efficient, and that’s when the idea of VeriME was conceptualised.” VeriME was launched in the beginning of 2017 in Singapore as Verification-as-a-Service (VaaS) blockchain platform. It was created mostly with the financial sector in mind, as the team behind VeriME hoped to streamline identity authentication in order alleviate the cost of complying to KYC laws and the like. It’s also hoping to provide a transparent way of complying with KYC laws using blockchain, given its nature as a publicly accessible ledger. Additionally, VeriME is partnered with 30+ partners globally encompassing more than 300,000 online merchants and their consumers. VeriME’s Products: D-SECURE and D-KYC VeriME has two main products that it offers to its enterprise customers: D-SECURE and D-KYC. Both fundamentally have to do with identity verification, with the differences being in what aspects of authentication they deal with and what specific problems they solve. D-KYC is a feature of the VeriME platform that fulfills the function of ensuring KYC identity requirements -- in seconds. This makes its more cost effective than the current way of doing KYC, there’s natural privacy protections through encryption, no face-to-face interaction, and no third party dependency. There’s also D-SECURE, which is another feature of the platform that gives merchants payment authentication abilities via a blockchain-based platform. The benefits would include 100% chargeback protection, quick authentication (within milliseconds), and incentives for each transaction made. Disclaimer. This article is paid and provided by a third-party source and should not be viewed as an endorsement by CoinIdol. Readers should do their own research before investing funds in any company. CoinIdol shall not be responsible or liable, directly or indirectly, for any damage or loss caused or alleged to be caused by or in connection with the use of or reliance on any such content, goods or services mentioned in this article. Related Stories Forks can be of great importance to the crypto industry if they add desired qualities to the underlying cryptos. But in most cases, these forks don't cause anything good, they just create conflicts and worsen the situation. Cryptos that involve themselves in fighting should be discriminated against while those that mind their business but with small market caps have to be amassed. In this case, it's necessary to sell off both Bitcoin Cash (BCH) forks, and YOYO gets much attention. Some analysts from Bloomberg Intelligence (BI) anticipate that Bitcoin (BTC) will "fall further," as reported by Bloomberg. Various crypto sector pundits have already started calling this the cryptocurrency winter. Popular blockchain and crypto enthusiast hasn’t lost faith in financial technology and digital currencies, such as bitcoin, ripple, and ethereum. He is confident in the suggestion that cryptos will replace fiat currency in its primary position during 2020-2030.
{ "pile_set_name": "Pile-CC" }
In section 2.4 we'll talk about using statistical graphs to organize and present data. We can see how data is divided among different categories, or we can see how data changes over time. The statistical graph you're probably most familiar with is a pie chart. It gives a good visual image of what portion of the population falls into each category. This is the 12,500 people surveyed and asked what's the greatest source of your happiness, and here again we see that family and partner was the answer given by 65% of those surveyed. Over half of those surveyed, and the smallest slice of that pie was sports. Only 3% of people said that sports gave them more happiness than anything else. Now in the homework you have to ask some questions to interpret a pie chart. They're similar to these. First of the 12,500 people surveyed, how many people gave sports or leisure as their greatest source of happiness? Well 3 people said that sports was their greatest source of happiness, and it looks like 8% of people said leisure was their greatest source of happiness, so that's 11% total said either sports or leisure was their greatest source of happiness, but we weren't asked what percent. We were asked how many people gave sports or leisure as their greatest source of happiness. So we need to find 11% of 12,500, and remember to find that we just multiply .11 times 12,500. .11 times 12,500 is 1,375. Now it just happens to turn out in this problem that ends up being a whole number, but certainly if I had multiplied something else times 12,500 we are very likely to have not gotten a whole number there. It only makes sense that, that answer needs to be a whole number. The question is how many people, and it doesn't make sense to say 25.7 people so in the case that we would've ended up with a decimal we would've rounded to the nearest whole person. In the B part, if this sample is representative of the adult population of the U.S. in 2013 (approximately 250,000,000), how many could be expected to cite friends as their greatest source of happiness? Well if we were asked how many of the sample cited friends as their greatest source of happiness then we'd be finding this 11% of 12,500. We're not trying to find the number of people in the sample. We're trying to find the number of people in the population. So I need to multiply that 11% or .11 times 250,000,000. .11 times 250,000,000 is 275... Hmmm...That answer doesn't make sense. I think the calculator took my decimal on the .11. Actually I think my calculator battery is about to die. Uhm... .11 times 250,000,000 gives me 27,500. That's a much more reasonable answer. 27,500. No I'm sorry I'm not reading that correct 27,500,000. 27,500,000. That makes sense because 10% of 250,000,000 would be 25,000,000. This is just a little over 25,000,000.
{ "pile_set_name": "YoutubeSubtitles" }
When a person has an issue with a product, the person often calls a call center that is associated with the enterprise that sold the product. These call centers are often reached by dialing a toll-free “1-800” number. When the call center answers the call, the caller is usually presented with a menu of choices such as “Press 1 for English or press 2 for Spanish.” After the caller makes his or her choice, the caller is, after some wait, connected to a call-center agent. All too often the caller is kept on hold for an extended period of time. This usually only serves to aggravate the caller and tie up bandwidth for the call-center. Often, after waiting on hold for an extended period of time, the caller is connected with a call-center agent who is unable to assist the caller with his or her problem. This only creates further frustration for the caller as the caller is then placed on hold again to wait for a call-center agent who can assist the caller with his or her problem.
{ "pile_set_name": "USPTO Backgrounds" }
Pages out of my life and adventures, narrated and captioned by yours truly. Tag Archives: Neon Hitch Alright, I hate running. But being in the military- it’s kind of essential. Especially since the way the military is now, you fail a PT test and you’re probably getting discharged. So it’s pretty imperative to stay in shape, and be able to run- since 50% of your PT score is your run. In Basic Training I got a 90% on my PT test by a hair. I think if I had run a few seconds slower it would’ve dropped my score. So lucky me, that meant I only had to PT test once a year, so my next one isn’t until the end of March. Since there’s a giant ass gym at my disposal, I decided it would probably be smart to use it- because I definitely don’t want to be a PT fail, but I also want to get back in shape. Trust me, Tech School will kill your weight and PT scores. I promise. So last night while sitting in the community room someone came up to me and recognized me as “that girl that’s always in the gym” hah. But yes, we happened to run into each other at the gym almost every day. Their compliment? I always looked like I was working my ass off. Ok. Sometimes I cut my run a little short, and sometimes I’m too lazy to do that extra rep. But that got me thinking, other people are noticing- they think I’m giving 100%. So why aren’t I? Oh motivation, how rare you are. So this morning, despite being a Saturday, I woke up got breakfast, got dressed, and headed to the gym. While sitting in the parking lot doing my mental prep of – you’re already here so just go work out you lazy ass – I made a workout playlist on my phone. Holy shit. I mean, I always listen to music when I work out, but this playlist was pretty much perfect. I ran two miles, maxed out on situps, then lifted for around 20 minutes. And I ws pumped the whole time. Music really is the key to motivation. So in honor of my new found go-to playlist, I’ll post the songs that kept me running and giving it my all. 1. Alone Together- Fall Out Boy 2. Bugatti – Ace Hoods 3. Hello – Karmin 4. I Need Your Love – Calvin Harris Ft. Ellie Goulding 5. Radioactive – Imagine Dragons 6. Rat a Tat – Fall Out Boy 7. Ritual – Ellie Goulding 8. Runnin’ – Adam Lambert 9. Sexy Back – Justin Timberlake 10. Low – Flo Rida 11. Sugar – Kerli 12. Supermassive Black Hole – Muse 13. Sweet Nothing – Calvin Harris ft. Florence Welch 14. Fuck You Betta – Neon Hitch 15. I’m Gonna Getcha Good – Shania Twain There we go. But if anyone has any other songs they jam out to while they’re working out- post them and let me know!
{ "pile_set_name": "Pile-CC" }
Q: GWT Deploying to Google has encountered a fault Got an error I can't fix. Looks like a memory issue but the stack trace is kind of looping as if the is an infinite loop in the compilation? Running Eclipse Juno Working with Google App engine. I get an error when I try to deploy one app to GAE however another Google App Engine app works. Errors I see: GWT compilation failed The site.xml file downloaded from the update site does not contain any elements with an id of 'com.google.appengine.eclipse.sdkbundle.e42.feature'. Unable to determine if there are updates available. eclipse.buildId=M20120914-1800 java.version=1.7.0_01 java.vendor=Oracle Corporation BootLoader constants: OS=win32, ARCH=x86_64, WS=win32, NL=en_US Framework arguments: -product org.eclipse.epp.package.jee.product -product org.eclipse.epp.package.jee.product Command-line arguments: -os win32 -ws win32 -arch x86_64 -product org.eclipse.epp.package.jee.product -data C:\Users\myuser\workspacejuno -product org.eclipse.epp.package.jee.product [ERROR] Failure in unit cache map load. And the complete stack dump/trace: [ERROR] Failure in unit cache map load. java.util.concurrent.ExecutionException: java.lang.StackOverflowError at java.util.concurrent.FutureTask$Sync.innerGet(Unknown Source) at java.util.concurrent.FutureTask.get(Unknown Source) at com.google.gwt.dev.javac.PersistentUnitCache.awaitUnitCacheMapLoad(PersistentUnitCache.java:466) at com.google.gwt.dev.javac.PersistentUnitCache.find(PersistentUnitCache.java:391) at com.google.gwt.dev.javac.CompilationStateBuilder.addArchive(CompilationStateBuilder.java:365) at com.google.gwt.dev.ArchivePreloader.preloadArchives(ArchivePreloader.java:65) at com.google.gwt.dev.Precompile.precompile(Precompile.java:243) at com.google.gwt.dev.Precompile.precompile(Precompile.java:229) at com.google.gwt.dev.Precompile.precompile(Precompile.java:141) at com.google.gwt.dev.Compiler.run(Compiler.java:232) at com.google.gwt.dev.Compiler.run(Compiler.java:198) at com.google.gwt.dev.Compiler$1.run(Compiler.java:170) at com.google.gwt.dev.CompileTaskRunner.doRun(CompileTaskRunner.java:88) at com.google.gwt.dev.CompileTaskRunner.runWithAppropriateLogger(CompileTaskRunner.java:82) at com.google.gwt.dev.Compiler.main(Compiler.java:177) Caused by: java.lang.StackOverflowError at java.io.ObjectInputStream$PeekInputStream.peek(Unknown Source) at java.io.ObjectInputStream$BlockDataInputStream.readBlockHeader(Unknown Source) at java.io.ObjectInputStream$BlockDataInputStream.refill(Unknown Source) at java.io.ObjectInputStream$BlockDataInputStream.read(Unknown Source) at java.io.ObjectInputStream.read(Unknown Source) at java.io.InputStream.read(Unknown Source) at com.google.gwt.dev.util.DiskCache.transferFromStream(DiskCache.java:159) at com.google.gwt.dev.util.DiskCacheToken.readObject(DiskCacheToken.java:87) at sun.reflect.GeneratedMethodAccessor17.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) com.google.gwt.dev.javac.CachedCompilationUnit.readObject(CachedCompilationUnit.java:204) [loops this a few time, sorry could not post it all, its too long. at sun.reflect.GeneratedMethodAccessor19.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at java.io.ObjectStreamClass.invokeReadObject(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.skipCustomData(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.defaultReadFields(Unknown Source) at java.io.ObjectInputStream.defaultReadObject(Unknown Source) at com.google.gwt.dev.javac.CachedCompilationUnit.readObject(CachedCompilationUnit.java:204) at sun.reflect.GeneratedMethodAccessor19.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at java.io.ObjectStreamClass.invokeReadObject(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.skipCustomData(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.defaultReadFields(Unknown Source) at java.io.ObjectInputStream.defaultReadObject(Unknown Source) at com.google.gwt.dev.javac.CachedCompilationUnit.readObject(CachedCompilationUnit.java:204) at sun.reflect.GeneratedMethodAccessor19.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at java.io.ObjectStreamClass.invokeReadObject(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.skipCustomData(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.defaultReadFields(Unknown Source) at java.io.ObjectInputStream.defaultReadObject(Unknown Source) at com.google.gwt.dev.javac.CachedCompilationUnit.readObject(CachedCompilationUnit.java:204) at sun.reflect.GeneratedMethodAccessor19.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at java.io.ObjectStreamClass.invokeReadObject(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.skipCustomData(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.defaultReadFields(Unknown Source) at java.io.ObjectInputStream.defaultReadObject(Unknown Source) at com.google.gwt.dev.javac.CachedCompilationUnit.readObject(CachedCompilationUnit.java:204) at sun.reflect.GeneratedMethodAccessor19.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at java.io.ObjectStreamClass.invokeReadObject(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.skipCustomData(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.defaultReadFields(Unknown Source) at java.io.ObjectInputStream.defaultReadObject(Unknown Source) at com.google.gwt.dev.javac.CachedCompilationUnit.readObject(CachedCompilationUnit.java:204) at sun.reflect.GeneratedMethodAccessor19.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at java.io.ObjectStreamClass.invokeReadObject(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.skipCustomData(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.defaultReadFields(Unknown Source) at java.io.ObjectInputStream.defaultReadObject(Unknown Source) at com.google.gwt.dev.javac.CachedCompilationUnit.readObject(CachedCompilationUnit.java:204) at sun.reflect.GeneratedMethodAccessor19.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at java.io.ObjectStreamClass.invokeReadObject(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.skipCustomData(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.defaultReadFields(Unknown Source) at java.io.ObjectInputStream.defaultReadObject(Unknown Source) at com.google.gwt.dev.javac.CachedCompilationUnit.readObject(CachedCompilationUnit.java:204) at sun.reflect.GeneratedMethodAccessor19.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at java.io.ObjectStreamClass.invokeReadObject(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.skipCustomData(Unknown Source) at java.io.ObjectInputStream.readSerialData(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.defaultReadFields(Unknown Source) at java.io.ObjectInputStream.defaultReadObject(Unknown Source) at com.google.gwt.dev.javac.CachedCompilationUnit.readObject(CachedCompilationUnit.java:204) at sun.reflect.GeneratedMethodAccessor19.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at java.io.ObjectStreamClass.invokeReadObject(Unknown Source) onStateBuilder.java:466) at com.google.gwt.dev.javac.CompilationStateBuilder.buildFrom(CompilationStateBuilder.java:388) at com.google.gwt.dev.cfg.ModuleDef.getCompilationState(ModuleDef.java:373) at com.google.gwt.dev.Precompile.precompile(Precompile.java:246) at com.google.gwt.dev.Precompile.precompile(Precompile.java:229) at com.google.gwt.dev.Precompile.precompile(Precompile.java:141) at com.google.gwt.dev.Compiler.run(Compiler.java:232) at com.google.gwt.dev.Compiler.run(Compiler.java:198) at com.google.gwt.dev.Compiler$1.run(Compiler.java:170) at com.google.gwt.dev.CompileTaskRunner.doRun(CompileTaskRunner.java:88) at com.google.gwt.dev.CompileTaskRunner.runWithAppropriateLogger(CompileTaskRunner.java:82) at com.google.gwt.dev.Compiler.main(Compiler.java:177) A: It's possibly related to a corrupted cache. Delete your gwt-UnitCache folder. If that doesn't work, delete your AppData\Local\Temp files as well (if under Windows) since there are many gwt-generated files there.
{ "pile_set_name": "StackExchange" }
Please split the following deals into their respective pre and post bankruptcy desks: Counterparty Name Trades Terminated Early Termination Date AES Eastern Energy LP 775220, 814567, 821656, 821666, 842776, 842777, 857752 12/11/2001 Thanks, Stacey
{ "pile_set_name": "Enron Emails" }
Q: Cannot open Spatialite db from OpenStreetMap in QGIS I am new to QGIS, OpenStreetmap and Spatialite. I'm trying to get the (OSM) map data into a (SQLite) compact form I can eventually use for realtime reverse geocoding in a vehicle. Quantum is just for exploring the data, at this point. I've downloaded the Saskatchewan highway layer from CloudMade (http://downloads.cloudmade.com/americas/northern_america/canada/saskatchewan) and converted it to Spatialite using spatialite_osm_raw -o saskatchewan.highway.osm -d SK_Hi.sqlite and spatialite_osm_net -o saskatchewan.highway.osm -d SK_hi_net.sqlite -T Roads Both processes run to completion, although there are lots of unresolved nodes while building the network. Neither map layer can be opened in QGis. In either case I am getting a "Failure exploring tables from: Z:/GIS/OpenStreetMap/SK/sk_hi_net.sqlite. no such column: type" when I try to connect to the database. I am able to browse the db using the Quantum DB Manager, and I see that a number of the tables are empty. Specifically "geometry_columns_field_infos" all of the views_geometry tables and virts_geometry tables. Is this a problem with the datasource, the toolchain, or my understanding (in increasing order of likelihood)? A: Try looking at the data with spatialite_gui. There were some issues that spatialite support in QGIS is a bit behind the capabilities the current version of spatialite is offering. According to Bug report #6196, the spatialite database should be added with Add Vector Layer..., selecting ALL Formats, or SQLite [OGR] driver. Then choose the layers you want, e.g. ln_highway, and set the CRS manually to EPSG:4326. Alternatively, you can use GDAL with ogr2ogr -f SQLite <filename>.sqlite <filename>.osm.pbf and add the database the same way as above. The OGR driver produces only one layer for every geometry type.
{ "pile_set_name": "StackExchange" }
Amir Williams had 12 points, nine rebounds and six blocks in Ohio State's 86-48 pounding of the Bryant Bulldogs. After the game, Williams was asked to tell viewers what's been most responsible for his great play of late and he almost said "coach Matta, he's been on my dick." What he actually said was "coach Matta, he's been on my di—on my uhhhhhhh, back every day in practice uhhhh..." His face, when he catches himself, oh man. Priceless. But he did catch it and actually composed himself so that he could finish the thought without just cascading into a string of shit, I just said dick. Shit, I said shit, too expletives. Good on Williams for being just a little bit more mature than the rest of us.
{ "pile_set_name": "Pile-CC" }
var constants = require('constants') var origCwd = process.cwd var cwd = null var platform = process.env.GRACEFUL_FS_PLATFORM || process.platform process.cwd = function() { if (!cwd) cwd = origCwd.call(process) return cwd } try { process.cwd() } catch (er) {} var chdir = process.chdir process.chdir = function(d) { cwd = null chdir.call(process, d) } module.exports = patch function patch (fs) { // (re-)implement some things that are known busted or missing. // lchmod, broken prior to 0.6.2 // back-port the fix here. if (constants.hasOwnProperty('O_SYMLINK') && process.version.match(/^v0\.6\.[0-2]|^v0\.5\./)) { patchLchmod(fs) } // lutimes implementation, or no-op if (!fs.lutimes) { patchLutimes(fs) } // https://github.com/isaacs/node-graceful-fs/issues/4 // Chown should not fail on einval or eperm if non-root. // It should not fail on enosys ever, as this just indicates // that a fs doesn't support the intended operation. fs.chown = chownFix(fs.chown) fs.fchown = chownFix(fs.fchown) fs.lchown = chownFix(fs.lchown) fs.chmod = chmodFix(fs.chmod) fs.fchmod = chmodFix(fs.fchmod) fs.lchmod = chmodFix(fs.lchmod) fs.chownSync = chownFixSync(fs.chownSync) fs.fchownSync = chownFixSync(fs.fchownSync) fs.lchownSync = chownFixSync(fs.lchownSync) fs.chmodSync = chmodFixSync(fs.chmodSync) fs.fchmodSync = chmodFixSync(fs.fchmodSync) fs.lchmodSync = chmodFixSync(fs.lchmodSync) fs.stat = statFix(fs.stat) fs.fstat = statFix(fs.fstat) fs.lstat = statFix(fs.lstat) fs.statSync = statFixSync(fs.statSync) fs.fstatSync = statFixSync(fs.fstatSync) fs.lstatSync = statFixSync(fs.lstatSync) // if lchmod/lchown do not exist, then make them no-ops if (!fs.lchmod) { fs.lchmod = function (path, mode, cb) { if (cb) process.nextTick(cb) } fs.lchmodSync = function () {} } if (!fs.lchown) { fs.lchown = function (path, uid, gid, cb) { if (cb) process.nextTick(cb) } fs.lchownSync = function () {} } // on Windows, A/V software can lock the directory, causing this // to fail with an EACCES or EPERM if the directory contains newly // created files. Try again on failure, for up to 60 seconds. // Set the timeout this long because some Windows Anti-Virus, such as Parity // bit9, may lock files for up to a minute, causing npm package install // failures. Also, take care to yield the scheduler. Windows scheduling gives // CPU to a busy looping process, which can cause the program causing the lock // contention to be starved of CPU by node, so the contention doesn't resolve. if (platform === "win32") { fs.rename = (function (fs$rename) { return function (from, to, cb) { var start = Date.now() var backoff = 0; fs$rename(from, to, function CB (er) { if (er && (er.code === "EACCES" || er.code === "EPERM") && Date.now() - start < 60000) { setTimeout(function() { fs.stat(to, function (stater, st) { if (stater && stater.code === "ENOENT") fs$rename(from, to, CB); else cb(er) }) }, backoff) if (backoff < 100) backoff += 10; return; } if (cb) cb(er) }) }})(fs.rename) } // if read() returns EAGAIN, then just try it again. fs.read = (function (fs$read) { function read (fd, buffer, offset, length, position, callback_) { var callback if (callback_ && typeof callback_ === 'function') { var eagCounter = 0 callback = function (er, _, __) { if (er && er.code === 'EAGAIN' && eagCounter < 10) { eagCounter ++ return fs$read.call(fs, fd, buffer, offset, length, position, callback) } callback_.apply(this, arguments) } } return fs$read.call(fs, fd, buffer, offset, length, position, callback) } // This ensures `util.promisify` works as it does for native `fs.read`. read.__proto__ = fs$read return read })(fs.read) fs.readSync = (function (fs$readSync) { return function (fd, buffer, offset, length, position) { var eagCounter = 0 while (true) { try { return fs$readSync.call(fs, fd, buffer, offset, length, position) } catch (er) { if (er.code === 'EAGAIN' && eagCounter < 10) { eagCounter ++ continue } throw er } } }})(fs.readSync) function patchLchmod (fs) { fs.lchmod = function (path, mode, callback) { fs.open( path , constants.O_WRONLY | constants.O_SYMLINK , mode , function (err, fd) { if (err) { if (callback) callback(err) return } // prefer to return the chmod error, if one occurs, // but still try to close, and report closing errors if they occur. fs.fchmod(fd, mode, function (err) { fs.close(fd, function(err2) { if (callback) callback(err || err2) }) }) }) } fs.lchmodSync = function (path, mode) { var fd = fs.openSync(path, constants.O_WRONLY | constants.O_SYMLINK, mode) // prefer to return the chmod error, if one occurs, // but still try to close, and report closing errors if they occur. var threw = true var ret try { ret = fs.fchmodSync(fd, mode) threw = false } finally { if (threw) { try { fs.closeSync(fd) } catch (er) {} } else { fs.closeSync(fd) } } return ret } } function patchLutimes (fs) { if (constants.hasOwnProperty("O_SYMLINK")) { fs.lutimes = function (path, at, mt, cb) { fs.open(path, constants.O_SYMLINK, function (er, fd) { if (er) { if (cb) cb(er) return } fs.futimes(fd, at, mt, function (er) { fs.close(fd, function (er2) { if (cb) cb(er || er2) }) }) }) } fs.lutimesSync = function (path, at, mt) { var fd = fs.openSync(path, constants.O_SYMLINK) var ret var threw = true try { ret = fs.futimesSync(fd, at, mt) threw = false } finally { if (threw) { try { fs.closeSync(fd) } catch (er) {} } else { fs.closeSync(fd) } } return ret } } else { fs.lutimes = function (_a, _b, _c, cb) { if (cb) process.nextTick(cb) } fs.lutimesSync = function () {} } } function chmodFix (orig) { if (!orig) return orig return function (target, mode, cb) { return orig.call(fs, target, mode, function (er) { if (chownErOk(er)) er = null if (cb) cb.apply(this, arguments) }) } } function chmodFixSync (orig) { if (!orig) return orig return function (target, mode) { try { return orig.call(fs, target, mode) } catch (er) { if (!chownErOk(er)) throw er } } } function chownFix (orig) { if (!orig) return orig return function (target, uid, gid, cb) { return orig.call(fs, target, uid, gid, function (er) { if (chownErOk(er)) er = null if (cb) cb.apply(this, arguments) }) } } function chownFixSync (orig) { if (!orig) return orig return function (target, uid, gid) { try { return orig.call(fs, target, uid, gid) } catch (er) { if (!chownErOk(er)) throw er } } } function statFix (orig) { if (!orig) return orig // Older versions of Node erroneously returned signed integers for // uid + gid. return function (target, options, cb) { if (typeof options === 'function') { cb = options options = null } function callback (er, stats) { if (stats) { if (stats.uid < 0) stats.uid += 0x100000000 if (stats.gid < 0) stats.gid += 0x100000000 } if (cb) cb.apply(this, arguments) } return options ? orig.call(fs, target, options, callback) : orig.call(fs, target, callback) } } function statFixSync (orig) { if (!orig) return orig // Older versions of Node erroneously returned signed integers for // uid + gid. return function (target, options) { var stats = options ? orig.call(fs, target, options) : orig.call(fs, target) if (stats.uid < 0) stats.uid += 0x100000000 if (stats.gid < 0) stats.gid += 0x100000000 return stats; } } // ENOSYS means that the fs doesn't support the op. Just ignore // that, because it doesn't matter. // // if there's no getuid, or if getuid() is something other // than 0, and the error is EINVAL or EPERM, then just ignore // it. // // This specific case is a silent failure in cp, install, tar, // and most other unix tools that manage permissions. // // When running as root, or if other types of errors are // encountered, then it's strict. function chownErOk (er) { if (!er) return true if (er.code === "ENOSYS") return true var nonroot = !process.getuid || process.getuid() !== 0 if (nonroot) { if (er.code === "EINVAL" || er.code === "EPERM") return true } return false } }
{ "pile_set_name": "Github" }
Delta Force, the U.S. Army’s elite counter-terrorism unit, have killed a top ISIS commander in an unprecedented hand-to-hand combat fight in Syria. The commando-style raid occurred behind ISIS lines in Syria which resulted in the death of Abu Sayyaf, ISIL’s top finance chief in charge of the illegal oil and gas production that funds the group’s activities. The destruction of ISIS’ main source of income comes just days after ISIS leader, Abu Bakr Al-Baghdadi, was captured on day one of airstrikes ordered by President Trump. Conservativetribune.com reports: The Delta Force operators left at least a dozen dead radical Islamic terrorists in a combination of an intense firefight, culminating with a hand-to-hand combat situation that left no chance of victory for the terrorists. All Delta Force personnel were reportedly able to insert behind enemy lines, complete their mission and get out without incident, indicating just how amazing this group truly is. Fox News foreign correspondent John Cuddy reported that along with killing Sayyaf, the Delta Force team was able to capture his wife, Umm Sayyaf. She was widely believed to be in charge of a human trafficking ring that brought in another source of revenue for their terrorist organization (H/T BizPac Review). The members of Delta Force are the U.S. Army’s most elite soldiers — often being recruited out of Army Special Forces and in some cases, the Army Rangers. The grueling process to become a Delta Force operator is only completed by a slim percentage of men, but the results are epic. Though the militants of the Islamic State were clamoring for a fight with U.S. troops, after this deadly encounter, we’re betting that they’re not exactly lining up for round two.
{ "pile_set_name": "OpenWebText2" }
Revenue Finder Identify sales process shortcomings by discovering bottlenecks and pipeline leakage. See exactly where you are losing revenue and use data to understand how to fix it. MoData enables you to realize the full potential of your sales team with the people and resources you already have. Examine Stalled Deals Easily rank your stalled deals on their close potential and take sales-ready action. Understand your leading causes of stalled deals and how to seal the cracks in your pipeline. Reduce Deal Slippage 60% of sales managers reported that unexpected deal slippage is the #1 problem they face. MoData helps to alleviate this issue with crystal clear analytical breakdowns that show exactly where risk lies so that you can focus efforts where they mean the most. +15% Deal closure +10% Average deal size +20% Sales velocity Identify Sales Velocity Roadblock Instantly calculate and compare your sales velocity across any perspective from lead source to individual sales rep. See which factors are slowing you down and gain a clear understanding of what the impact is and how to improve them. Measure MQL Evaluate quality of MQL by measuring success patterns across multiple reps and multiple regions. Allow the data to be your guide in the decision making processes. And allow us to provide the data. Seal Pipeline Leakage Not only does MoData show you were your pipeline is leaking but it gives you all tools you need to fix it NOW. Seal up the cracks and watch your win rate soar. Compare & Share Compare any perspective side by side. Implement your insights into your workflow with a single click Ready to move your sales to the next level? Request your demo now. Mo-Data's AI-powered sales intelligence software provides you with actionable insights, predictions and prescriptions to help you grow revenue, faster.
{ "pile_set_name": "Pile-CC" }
Q: How to programatically check the available space on Google Drive from an Android app I am trying to upload a file from my Android app which I am able to. But before that I want to check the available space on my Google Drive. I am using Google Drive API (version 2). I tried multiple option but wasn't able to find that information. Can someone tell me how to fetch the Google Drive free space. A: have a look at this great sample: Documentation private static void printAbout(Drive service) { try { About about = service.about().get().execute(); System.out.println("Current user name: " + about.getName()); System.out.println("Root folder ID: " + about.getRootFolderId()); System.out.println("Total quota (bytes): " + about.getQuotaBytesTotal()); System.out.println("Used quota (bytes): " + about.getQuotaBytesUsed()); // TOTAL - USED = FREE SPACE } catch (IOException e) { System.out.println("An error occurred: " + e); } }
{ "pile_set_name": "StackExchange" }
Antifungal Prophylaxis in Lung Transplant Recipients. Invasive fungal infection remains a serious postoperative complication in lung transplant recipients and is associated with significant morbidity and mortality. Although most lung transplant centers use antifungal prophylaxis, consensus on the strategy, choice of antifungal agent(s), route of administration, and duration of prophylaxis have not been established. This review provides an overview of the epidemiology and risk factors for common fungal infections seen in lung transplant recipients, evaluates the clinical efficacy and toxicity of the various antifungal agents used to prevent infection, and offers recommendations and opportunities for future research. Currently available data evaluating the efficacy of antifungal prophylaxis strategies is limited by a lack of prospective, randomized clinical trial data and variability in patient populations, prophylactic and immunosuppressive strategies, dosing, durations of use of antifungal agents, and definitions of invasive infection. There is controversy regarding significant risk factors for invasive fungal infection, which has limited the development and validation of targeted prophylactic strategies. Inhaled formulations of amphotericin B remain the most widely studied option for universal prophylaxis and have been shown to be effective in reducing the incidence of invasive Aspergillosis as compared with no prophylaxis. Concern over early postoperative extrapulmonary infection may suggest a benefit of initial prophylaxis with a systemic azole. Long-term use of systemic antifungals is not optimal due to emerging evidence of long-term toxicities. Multicenter, randomized trials are needed to ascertain the optimal prophylactic strategy in lung transplant recipients. New agents and delivery mechanisms may offer additional opportunities for comparative research.
{ "pile_set_name": "PubMed Abstracts" }
Orally administered 4-aminopyridine improves clinical signs in multiple sclerosis. 4-Aminopyridine (4-AP), a potassium channel blocker, restores conduction in blocked, demyelinated animal nerve. Its administration to multiple sclerosis (MS) patients produces transient neurological improvements. Vision improves after either oral or intravenous administration, whereas motor function improvement has been reported only with the latter. To assess further its potential as a practical symptomatic treatment, we studied the efficacy of single, oral doses of 4-AP on both visual and motor signs in MS. Twenty temperature-sensitive male MS patients were given either 10 to 25 mg of 4-AP or identically appearing lactose placebo capsules. Static quantitative perimetry, critical flicker-fusion, visual acuity, visual evoked potentials, and videotaped neurological examinations were monitored. All of 15 MS patients given 4-AP mildly to markedly improved. Motor functions (power, coordination, gait) improved in 9 of 13 involved, vision in 11 of 13, and oculomotor functions in 1 of 2. Improvements developed gradually at doses as low as 10 mg, usually beginning within 60 minutes after drug administration, and reversed gradually over 4 to 7 hours. No serious adverse effects occurred. No significant changes were observed in 5 MS patients given placebo. We conclude that orally administered 4-AP produces clinically important improvements in multiple, chronic deficits in MS. Further studies are warranted to assess efficacy and safety of prolonged administration.
{ "pile_set_name": "PubMed Abstracts" }
Voiding cystourethrography in boys. Does the presence of the catheter during voiding alter the evaluation of the urethra? We determined whether the presence of the catheter during the voiding phase of voiding cystourethrography alters the evaluation of the urethra concerning the normal structures as well as pathological findings, especially posterior urethral valves. A total of 123 males 3 days to 16 years old (median age 2.6 months) underwent voiding cystourethrography. Urethral catheterization was performed in all cases. Four views were taken during the voiding phase with and without the catheter in place. Only 80 patients had available results. These examinations were studied with special attention to the normal structures and pathological findings. A total of 36 examinations (45%) were normal. Pathological findings were observed in 44 patients (55%), with abnormal vesical findings and/or vesicoureteral reflux in 33 (41.25%). In 11 patients (13.75%) 12 urethral abnormalities were found (posterior urethral valves 3, hypospadias 4, prostatic utricle 1, verumontanum polyp 1, prune belly syndrome with urethral dilatation 1, imperforate anus with urethral fistula 1 and urethral duplication 1). In all cases excluding those involving hypospadias there was no difference between the views with and without the catheter. However, concerning the normal structures, the verumontanum and fossa navicularis were better delineated without the catheter in 27% and 33% of cases, respectively. Our study shows that a urethral catheter does not alter the diagnosis of abnormalities of the posterior urethra but may hamper the observation of normal structures or abnormalities of the anterior urethra.
{ "pile_set_name": "PubMed Abstracts" }
#ident "@(#) NEC mode542x.h 1.3 95/07/05 13:10:57" /*++ Copyright (c) 1992 Microsoft Corporation Module Name: Mode542x.h Abstract: This module contains all the global data used by the Cirrus Logic CL-542x driver. Environment: Kernel mode Revision History: --*/ // // The next set of tables are for the CL542x // Note: all resolutions supported // // // 640x480 16-color mode (BIOS mode 12) set command string for CL 542x. // USHORT CL542x_640x480[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, GRAPH_ADDRESS_PORT, 3, 0x0009, 0x000a, 0x000b, // no banking in 640x480 mode EOD }; // // 800x600 16-color (60Hz refresh) mode set command string for CL 542x. // USHORT CL542x_800x600[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, GRAPH_ADDRESS_PORT, 3, 0x0009, 0x000a, 0x000b, // no banking in 800x600 mode EOD }; // // 1024x768 16-color (60Hz refresh) mode set command string for CL 542x. // USHORT CL542x_1024x768[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, GRAPH_ADDRESS_PORT, 3, #if ONE_64K_BANK 0x0009, 0x000a, 0x000b, #endif #if TWO_32K_BANKS 0x0009, 0x000a, 0x010b, #endif OB, DAC_PIXEL_MASK_PORT, 0xFF, EOD }; //----------------------------- // standard VGA text modes here // 80x25 at 640x350 // //----------------------------- // // 80x25 text mode set command string for CL 542x. // (720x400 pixel resolution; 9x16 character cell.) // USHORT CL542x_80x25Text[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, GRAPH_ADDRESS_PORT, 3, 0x0009, 0x000a, 0x000b, // no banking in text mode EOD }; // // 80x25 text mode set command string for CL 542x. // (640x350 pixel resolution; 8x14 character cell.) // USHORT CL542x_80x25_14_Text[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, GRAPH_ADDRESS_PORT, 3, 0x0009, 0x000a, 0x000b, // no banking in text mode EOD }; // // 1280x1024 16-color mode (BIOS mode 0x6C) set command string for CL 542x. // USHORT CL542x_1280x1024[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, GRAPH_ADDRESS_PORT, 3, #if ONE_64K_BANK 0x0009, 0x000a, 0x000b, #endif #if TWO_32K_BANKS 0x0009, 0x000a, 0x010b, #endif EOD }; // // 640x480 64k-color mode (BIOS mode 0x64) set command string for CL 542x. // USHORT CL542x_640x480_64k[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, GRAPH_ADDRESS_PORT, 4, 0x0506, // Some BIOS's set Chain Odd maps bit #if ONE_64K_BANK 0x0009, 0x000a, 0x000b, #endif #if TWO_32K_BANKS 0x0009, 0x000a, 0x010b, #endif EOD }; #ifdef _X86_ // // 640x480 256-color mode (BIOS mode 0x5F) set command string for CL 542x. // USHORT CL542x_640x480_256[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, GRAPH_ADDRESS_PORT, 3, #if ONE_64K_BANK 0x0009, 0x000a, 0x000b, #endif #if TWO_32K_BANKS 0x0009, 0x000a, 0x010b, #endif EOD }; // // 800x600 256-color mode (BIOS mode 0x5C) set command string for CL 542x. // USHORT CL542x_800x600_256[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, GRAPH_ADDRESS_PORT, 3, #if ONE_64K_BANK 0x0009, 0x000a, 0x000b, #endif #if TWO_32K_BANKS 0x0009, 0x000a, 0x010b, #endif EOD }; #else // // NOTE(DBCS) : Update 94/09/12 - NEC Corporation // // - Add mode set command string for NEC MIPS machine. // // - 640x480 256 color 72Hz // - 800x600 256 color 56 / 60Hz // - 1024x768 256 color 70 / 45Hz // #if defined(DBCS) && defined(_MIPS_) // // For MIPS NEC machine only // // // 640x480 256-color 60Hz mode (BIOS mode 0x5F) set command string for // CL 542x. // USHORT CL542x_640x480_256_60[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, // begin setmode SEQ_ADDRESS_PORT, 15, // count 0x100, // start sync reset 0x0101,0x0F02,0x0003,0x0E04, // program up sequencer // // the Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed Liner addressing. // (LA_MASK << 12 | 0x0107), 0x0008, 0x4A0B,0x5B0C,0x450D,0x7E0E, 0x2B1B,0x2F1C,0x301D,0x331E, OB, // point sequencer index to ff SEQ_ADDRESS_PORT, 0x0F, METAOUT+MASKOUT, // masked out. SEQ_DATA_PORT, 0xDF,0x20, // and mask, xor mask OB, // misc. register MISC_OUTPUT_REG_WRITE_PORT, 0xE3, OW, // text/graphics bit GRAPH_ADDRESS_PORT, 0x506, OW, // end sync reset SEQ_ADDRESS_PORT, 0x300, OW, // unprotect crtc 0-7 CRTC_ADDRESS_PORT_COLOR, 0x2011, METAOUT+INDXOUT, // program crtc registers CRTC_ADDRESS_PORT_COLOR, 28,0, // count, startindex // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0x5D, 0x4F, 0x50, 0x82, 0x53, 0x9F, 0x00, 0x3E, 0x00, 0x40, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0xE1, 0x83, 0xDF, 0x50, 0x00, 0xE7, 0x04, 0xE3, 0xFF, 0x00, 0x00, 0x22, #else 0x5f, 0x4f, 0x50, 0x82, 0x54, 0x80, 0x0b, 0x3e, 0x00, 0x40, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0xea, 0x8c, 0xdf, 0x50, 0x00, 0xe7, 0x04, 0xe3, 0xff, 0x00, 0x00, 0x22, #endif // defined(DBCS) && defined(_MIPS_) METAOUT+INDXOUT, // program gdc registers GRAPH_ADDRESS_PORT, 9,0, // count, startindex 0x00, 0x00, 0x00, 0x00, 0x00, 0x40, 0x05, 0x0F, 0xFF, IB, // prepare atc for writing INPUT_STATUS_1_COLOR, METAOUT+ATCOUT, // program atc registers ATT_ADDRESS_PORT, 21,0, // count, startindex 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0A, 0x0B, 0x0C, 0x0D, 0x0E, 0x0F, 0x41, 0x00, 0x0F, 0x00, 0x00, OB, // turn video on. ATT_ADDRESS_PORT, 0x20, OB, DAC_PIXEL_MASK_PORT, 0xFF, OWM, GRAPH_ADDRESS_PORT, 3, // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed it for Liner addressing. // 0x0009, 0x000a, 0x000b, EOD }; // // 640x480 256-color 72Hz mode (BIOS mode 0x5F) set command string for // CL 542x. // USHORT CL542x_640x480_256_72[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, // begin setmode SEQ_ADDRESS_PORT, 15, // count 0x100, // start sync reset 0x0101,0x0F02,0x0003,0x0E04, // program up sequencer // // the Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed Liner addressing. // (LA_MASK << 12 | 0x0107), 0x0008, 0x4A0B,0x5B0C,0x450D,0x420E, 0x2B1B,0x2F1C,0x301D,0x1F1E, OB, // point sequencer index to ff SEQ_ADDRESS_PORT, 0x0F, METAOUT+MASKOUT, // masked out. SEQ_DATA_PORT, 0xDF,0x20, // and mask, xor mask OB, // misc. register MISC_OUTPUT_REG_WRITE_PORT, 0xEF, OW, // text/graphics bit GRAPH_ADDRESS_PORT, 0x506, OW, // end sync reset SEQ_ADDRESS_PORT, 0x300, OW, // unprotect crtc 0-7 CRTC_ADDRESS_PORT_COLOR, 0x2011, METAOUT+INDXOUT, // program crtc registers CRTC_ADDRESS_PORT_COLOR, 28,0, // count, startindex // // NOTE(DBCS) : Update 95/06/30 - NEC Corporation (same as cirrus\mode542x.h) // // - Set Mode Type is VESA compatible. (Old Miss match) // #if defined(DBCS) && defined(_MIPS_) 0x61, 0x4F, 0x50, 0x82, 0x54, 0x99, 0xF6, 0x1F, 0x00, 0x40, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0xE0, 0x03, 0xDF, 0x50, 0x00, 0xE7, 0x04, 0xE3, 0xFF, 0x00, 0x00, 0x22, // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // // 0x63, 0x4F, 0x50, 0x82, 0x55, 0x9A, thase parameter not match // 0x06, 0x3E, 0x00, 0x40, 0x00, 0x00, VESA Mode. // 0x00, 0x00, 0x00, 0x00, 0xE8, 0x8B, // 0xDF, 0x50, 0x00, 0xE7, 0x04, 0xE3, // 0xFF, 0x00, 0x00, 0x22, #else 0x5f, 0x4f, 0x50, 0x82, 0x54, 0x80, 0x0b, 0x3e, 0x00, 0x40, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0xea, 0x8c, 0xdf, 0x50, 0x00, 0xe7, 0x04, 0xe3, 0xff, 0x00, 0x00, 0x22, #endif // defined(DBCS) && defined(_MIPS_) METAOUT+INDXOUT, // program gdc registers GRAPH_ADDRESS_PORT, 9,0, // count, startindex 0x00, 0x00, 0x00, 0x00, 0x00, 0x40, 0x05, 0x0F, 0xFF, IB, // prepare atc for writing INPUT_STATUS_1_COLOR, METAOUT+ATCOUT, // program atc registers ATT_ADDRESS_PORT, 21,0, // count, startindex 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0A, 0x0B, 0x0C, 0x0D, 0x0E, 0x0F, 0x41, 0x00, 0x0F, 0x00, 0x00, OB, // turn video on. ATT_ADDRESS_PORT, 0x20, OB, DAC_PIXEL_MASK_PORT, 0xFF, OWM, GRAPH_ADDRESS_PORT, 3, // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed it for Liner addressing. // 0x0009, 0x000a, 0x000b, EOD }; // // 800x600 256-color 56Hz mode (BIOS mode 0x5C) set command string for // CL 542x. // USHORT CL542x_800x600_256_56[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, // begin setmode SEQ_ADDRESS_PORT, 15, // count 0x100, // start sync reset 0x0101,0x0F02,0x0003,0x0E04, // program up sequencer // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed Liner addressing. // (LA_MASK << 12 | 0x0107), 0x0008, 0x4A0B,0x5B0C,0x450D,0x7E0E, 0x2B1B,0x2F1C,0x301D,0x331E, OB, // point sequencer index to ff SEQ_ADDRESS_PORT, 0x0F, METAOUT+MASKOUT, // masked out. SEQ_DATA_PORT, 0xDF,0x20, // and mask, xor mask OB, // misc. register MISC_OUTPUT_REG_WRITE_PORT, 0xEF, OW, // text/graphics bit GRAPH_ADDRESS_PORT, 0x506, OW, // end sync reset SEQ_ADDRESS_PORT, 0x300, OW, // unprotect crtc 0-7 CRTC_ADDRESS_PORT_COLOR, 0x2011, METAOUT+INDXOUT, // program crtc registers CRTC_ADDRESS_PORT_COLOR, 28,0, // count, startindex // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0x7B, 0x63, 0x64, 0x80, 0x69, 0x12, 0x6F, 0xF0, 0x00, 0x60, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x58, 0x8A, 0x57, 0x64, 0x00, 0x5F, 0x91, 0xE3, 0xFF, 0x00, 0x00, 0x22, #else 0x7D, 0x63, 0x64, 0x80, 0x6D, 0x1C, 0x98, 0xF0, 0x00, 0x60, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x7B, 0x80, 0x57, 0x64, 0x00, 0x5F, 0x91, 0xe3, 0xff, 0x00, 0x00, 0x22, #endif // defined(DBCS) && defined(_MIPS_) METAOUT+INDXOUT, // program gdc registers GRAPH_ADDRESS_PORT, 9,0, // count, startindex 0x00, 0x00, 0x00, 0x00, 0x00, 0x40, 0x05, 0x0F, 0xFF, IB, // prepare atc for writing INPUT_STATUS_1_COLOR, METAOUT+ATCOUT, // program atc registers ATT_ADDRESS_PORT, 21,0, // count, startindex 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0A, 0x0B, 0x0C, 0x0D, 0x0E, 0x0F, 0x41, 0x00, 0x0F, 0x00, 0x00, OB, // turn video on. ATT_ADDRESS_PORT, 0x20, OB, DAC_PIXEL_MASK_PORT, 0xFF, OWM, GRAPH_ADDRESS_PORT, 3, // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed it for Liner addressing. // 0x0009, 0x000a, 0x000b, EOD }; // // 800x600 256-color 60Hz mode (BIOS mode 0x5C) set command string for // CL 542x. // USHORT CL542x_800x600_256_60[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, // begin setmode SEQ_ADDRESS_PORT, 15, // count 0x100, // start sync reset 0x0101,0x0F02,0x0003,0x0E04, // program up sequencer // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed Liner addressing. // (LA_MASK << 12 | 0x0107), 0x0008, 0x4A0B,0x5B0C,0x450D,0x510E, 0x2B1B,0x2F1C,0x301D,0x3A1E, OB, // point sequencer index to ff SEQ_ADDRESS_PORT, 0x0F, METAOUT+MASKOUT, // masked out. SEQ_DATA_PORT, 0xDF,0x20, // and mask, xor mask OB, // misc. register MISC_OUTPUT_REG_WRITE_PORT, // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0xEF, #else 0x2F, #endif // defined(DBCS) && defined(_MIPS_) OW, // text/graphics bit GRAPH_ADDRESS_PORT, 0x506, OW, // end sync reset SEQ_ADDRESS_PORT, 0x300, OW, // unprotect crtc 0-7 CRTC_ADDRESS_PORT_COLOR, 0x2011, METAOUT+INDXOUT, // program crtc registers CRTC_ADDRESS_PORT_COLOR, 28,0, // count, startindex // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0x7F, 0x63, 0x64, 0x80, 0x6B, 0x1B, 0x72, 0xF0, 0x00, 0x60, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x58, 0x8C, 0x57, 0x64, 0x00, 0x5F, 0x91, 0xE3, 0xFF, 0x00, 0x00, 0x22, #else 0x7D, 0x63, 0x64, 0x80, 0x6D, 0x1C, 0x98, 0xF0, 0x00, 0x60, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x7B, 0x80, 0x57, 0x64, 0x00, 0x5F, 0x91, 0xe3, 0xff, 0x00, 0x00, 0x22, #endif // defined(DBCS) && defined(_MIPS_) METAOUT+INDXOUT, // program gdc registers GRAPH_ADDRESS_PORT, 9,0, // count, startindex 0x00, 0x00, 0x00, 0x00, 0x00, 0x40, 0x05, 0x0F, 0xFF, IB, // prepare atc for writing INPUT_STATUS_1_COLOR, METAOUT+ATCOUT, // program atc registers ATT_ADDRESS_PORT, 21,0, // count, startindex 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0A, 0x0B, 0x0C, 0x0D, 0x0E, 0x0F, 0x41, 0x00, 0x0F, 0x00, 0x00, OB, // turn video on. ATT_ADDRESS_PORT, 0x20, OB, DAC_PIXEL_MASK_PORT, 0xFF, OWM, GRAPH_ADDRESS_PORT, 3, // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed it for Liner addressing. // 0x0009, 0x000a, 0x000b, EOD }; // // 800x600 256-color 72Hz mode (BIOS mode 0x5C) set command string for // CL 542x. // USHORT CL542x_800x600_256_72[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, // begin setmode SEQ_ADDRESS_PORT, 15, // count 0x100, // start sync reset 0x0101,0x0F02,0x0003,0x0E04, // program up sequencer // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed Liner addressing. // (LA_MASK << 12 | 0x0107), 0x0008, // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0x4A0B,0x5B0C,0x450D,0x650E, #else 0x4A0B,0x5B0C,0x450D,0x640E, #endif // defined(DBCS) && defined(_MIPS_) 0x2B1B,0x2F1C,0x301D,0x3A1E, OB, // point sequencer index to ff SEQ_ADDRESS_PORT, 0x0F, METAOUT+MASKOUT, // masked out. SEQ_DATA_PORT, 0xDF,0x20, // and mask, xor mask OB, // misc. register MISC_OUTPUT_REG_WRITE_PORT, // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0xEF, #else 0x2F, #endif // defined(DBCS) && defined(_MIPS_) OW, // text/graphics bit GRAPH_ADDRESS_PORT, 0x506, OW, // end sync reset SEQ_ADDRESS_PORT, 0x300, OW, // unprotect crtc 0-7 CRTC_ADDRESS_PORT_COLOR, 0x2011, METAOUT+INDXOUT, // program crtc registers CRTC_ADDRESS_PORT_COLOR, 28,0, // count, startindex // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0x7D, 0x63, 0x64, 0x80, 0x6D, 0x1C, 0x96, 0xF0, 0x00, 0x60, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x7B, 0x81, 0x57, 0x64, 0x00, 0x5F, 0x91, 0xE3, 0xFF, 0x00, 0x00, 0x22, #else 0x7D, 0x63, 0x64, 0x80, 0x6D, 0x1C, 0x98, 0xF0, 0x00, 0x60, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x7B, 0x80, 0x57, 0x64, 0x00, 0x5F, 0x91, 0xe3, 0xff, 0x00, 0x00, 0x22, #endif // defined(DBCS) && defined(_MIPS_) METAOUT+INDXOUT, // program gdc registers GRAPH_ADDRESS_PORT, 9,0, // count, startindex 0x00, 0x00, 0x00, 0x00, 0x00, 0x40, 0x05, 0x0F, 0xFF, IB, // prepare atc for writing INPUT_STATUS_1_COLOR, METAOUT+ATCOUT, // program atc registers ATT_ADDRESS_PORT, 21,0, // count, startindex 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0A, 0x0B, 0x0C, 0x0D, 0x0E, 0x0F, 0x41, 0x00, 0x0F, 0x00, 0x00, OB, // turn video on. ATT_ADDRESS_PORT, 0x20, OB, DAC_PIXEL_MASK_PORT, 0xFF, OWM, GRAPH_ADDRESS_PORT, 3, // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed it for Liner addressing. // 0x0009, 0x000a, 0x000b, EOD }; // // 1024x768 256-color 60Hz mode (BIOS mode 0x60) set command string for // CL 542x. // USHORT CL542x_1024x768_256_60[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, // begin setmode SEQ_ADDRESS_PORT, 15, // count 0x100, // start sync reset 0x0101,0x0F02,0x0003,0x0E04, // program up sequencer // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed Liner addressing. // (LA_MASK << 12 | 0x0107), 0x0008, // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0x4A0B, 0x5B0C, 0x450D, 0x760E, 0x2B1B, 0x2F1C, 0x301D, 0x341E, #else 0x4A0B, 0x5B0C, 0x450D, 0x3B0E, 0x2B1B, 0x2F1C, 0x301D, 0x1A1E, #endif // defined(DBCS) && defined(_MIPS_) OB, // point sequencer index to ff SEQ_ADDRESS_PORT, 0x0F, METAOUT+MASKOUT, // masked out. SEQ_DATA_PORT, 0xDF,0x20, // and mask, xor mask OB, // misc. register MISC_OUTPUT_REG_WRITE_PORT, 0xEF, OW, // text/graphics bit GRAPH_ADDRESS_PORT, 0x506, OW, // end sync reset SEQ_ADDRESS_PORT, 0x300, OW, // unprotect crtc 0-7 CRTC_ADDRESS_PORT_COLOR, 0x2011, METAOUT+INDXOUT, // program crtc registers CRTC_ADDRESS_PORT_COLOR, 28,0, // count, startindex // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0xA3, 0x7F, 0x80, 0x86, 0x85, 0x96, 0x24, 0xFD, 0x00, 0x60, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x02, 0x88, 0xFF, 0x80, 0x00, 0x00, 0x24, 0xE3, 0xFF, 0x4A, 0x00, 0x22, #else 0xA3, 0x7F, 0x80, 0x86, 0x85, 0x96, 0x24, 0xFD, 0x00, 0x60, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x02, 0x88, 0xFF, 0x80, 0x00, 0x00, 0x24, 0xe3, 0xff, 0x4A, 0x00, 0x22, #endif // defined(DBCS) && defined(_MIPS_) METAOUT+INDXOUT, // program gdc registers GRAPH_ADDRESS_PORT, 9,0, // count, startindex 0x00, 0x00, 0x00, 0x00, 0x00, 0x40, 0x05, 0x0F, 0xFF, IB, // prepare atc for writing INPUT_STATUS_1_COLOR, METAOUT+ATCOUT, // program atc registers ATT_ADDRESS_PORT, 21,0, // count, startindex 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0A, 0x0B, 0x0C, 0x0D, 0x0E, 0x0F, 0x41, 0x00, 0x0F, 0x00, 0x00, OB, // turn video on. ATT_ADDRESS_PORT, 0x20, OB, DAC_PIXEL_MASK_PORT, 0xFF, OWM, GRAPH_ADDRESS_PORT, 3, // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed it for Liner addressing. // 0x0009, 0x000a, 0x000b, EOD }; // // 1024x768 256-color 70Hz mode (BIOS mode 0x60) set command string for // CL 542x. // USHORT CL542x_1024x768_256_70[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, // begin setmode SEQ_ADDRESS_PORT, 15, // count 0x100, // start sync reset 0x0101,0x0F02,0x0003,0x0E04, // program up sequencer // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed Liner addressing. // (LA_MASK << 12 | 0x0107), 0x0008, 0x4A0B, 0x5B0C, 0x450D, 0x6E0E, 0x2B1B, 0x2F1C, 0x301D, 0x2A1E, OB, // point sequencer index to ff SEQ_ADDRESS_PORT, 0x0F, METAOUT+MASKOUT, // masked out. SEQ_DATA_PORT, 0xDF,0x20, // and mask, xor mask OB, // misc. register MISC_OUTPUT_REG_WRITE_PORT, 0xEF, OW, // text/graphics bit GRAPH_ADDRESS_PORT, 0x506, OW, // end sync reset SEQ_ADDRESS_PORT, 0x300, OW, // unprotect crtc 0-7 CRTC_ADDRESS_PORT_COLOR, 0x2011, METAOUT+INDXOUT, // program crtc registers CRTC_ADDRESS_PORT_COLOR, 28,0, // count, startindex // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0xA1, 0x7F, 0x80, 0x86, 0x85, 0x96, 0x24, 0xFD, 0x00, 0x60, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x02, 0x88, 0xFF, 0x80, 0x00, 0x00, 0x24, 0xE3, 0xFF, 0x4A, 0x00, 0x22, #else 0xA3, 0x7F, 0x80, 0x86, 0x85, 0x96, 0x24, 0xFD, 0x00, 0x60, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x02, 0x88, 0xFF, 0x80, 0x00, 0x00, 0x24, 0xe3, 0xff, 0x4A, 0x00, 0x22, #endif // defined(DBCS) && defined(_MIPS_) METAOUT+INDXOUT, // program gdc registers GRAPH_ADDRESS_PORT, 9,0, // count, startindex 0x00, 0x00, 0x00, 0x00, 0x00, 0x40, 0x05, 0x0F, 0xFF, IB, // prepare atc for writing INPUT_STATUS_1_COLOR, METAOUT+ATCOUT, // program atc registers ATT_ADDRESS_PORT, 21,0, // count, startindex 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0A, 0x0B, 0x0C, 0x0D, 0x0E, 0x0F, 0x41, 0x00, 0x0F, 0x00, 0x00, OB, // turn video on. ATT_ADDRESS_PORT, 0x20, OB, DAC_PIXEL_MASK_PORT, 0xFF, OWM, GRAPH_ADDRESS_PORT, 3, // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed it for Liner addressing. // 0x0009, 0x000a, 0x000b, EOD }; // // 1024x768 256-color 87Hz mode (BIOS mode 0x60) set command string for // CL 542x. (Interlaced) // USHORT CL542x_1024x768_256_87[] = { OWM, // begin setmode SEQ_ADDRESS_PORT, 2, // count 0x1206, // enable extensions 0x0012, OWM, // begin setmode SEQ_ADDRESS_PORT, 15, // count 0x100, // start sync reset 0x0101,0x0F02,0x0003,0x0E04, // program up sequencer // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed Liner addressing. // (LA_MASK << 12 | 0x0107), 0x0008, 0x4A0B, 0x5B0C, 0x450D, 0x550E, 0x2B1B, 0x2F1C, 0x301D, 0x361E, OB, // point sequencer index to ff SEQ_ADDRESS_PORT, 0x0F, METAOUT+MASKOUT, // masked out. SEQ_DATA_PORT, 0xDF,0x20, // and mask, xor mask OB, // misc. register MISC_OUTPUT_REG_WRITE_PORT, // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0xEF, #else 0x2F, #endif // defined(DBCS) && defined(_MIPS_) OW, // text/graphics bit GRAPH_ADDRESS_PORT, 0x506, OW, // end sync reset SEQ_ADDRESS_PORT, 0x300, OW, // unprotect crtc 0-7 CRTC_ADDRESS_PORT_COLOR, 0x2011, METAOUT+INDXOUT, // program crtc registers CRTC_ADDRESS_PORT_COLOR, 28,0, // count, startindex // // NOTE(DBCS) : Update 94/10/26 - NEC Corporation // // - Set Mode Type is VESA compatible. // #if defined(DBCS) && defined(_MIPS_) 0x99, 0x7F, 0x80, 0x86, 0x83, 0x99, 0x96, 0x1F, 0x00, 0x40, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x7F, 0x83, 0x7F, 0x80, 0x00, 0x7F, 0x12, 0xE3, 0xff, 0x4A, 0x01, 0x22, #else 0xA3, 0x7F, 0x80, 0x86, 0x85, 0x96, 0xBE, 0x1F, 0x00, 0x40, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x81, 0x84, 0x7F, 0x80, 0x00, 0x80, 0x12, 0xE3, 0xff, 0x4A, 0x01, 0x22, #endif // defined(DBCS) && defined(_MIPS_) METAOUT+INDXOUT, // program gdc registers GRAPH_ADDRESS_PORT, 9,0, // count, startindex 0x00, 0x00, 0x00, 0x00, 0x00, 0x40, 0x05, 0x0F, 0xFF, IB, // prepare atc for writing INPUT_STATUS_1_COLOR, METAOUT+ATCOUT, // program atc registers ATT_ADDRESS_PORT, 21,0, // count, startindex 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0A, 0x0B, 0x0C, 0x0D, 0x0E, 0x0F, 0x41, 0x00, 0x0F, 0x00, 0x00, OB, // turn video on. ATT_ADDRESS_PORT, 0x20, OB, DAC_PIXEL_MASK_PORT, 0xFF, OWM, GRAPH_ADDRESS_PORT, 3, // // The Miniport Driver for R96 machine is Liner addressing mode. // This set command was changed it for Liner addressing. // 0x0009, 0x000a, 0x000b, EOD }; #endif // defined(DBCS) && defined(_MIPS_) #endif
{ "pile_set_name": "Github" }
Sheridan Russell Sheridan Russell (1900-1991) was a cellist, medical doctor, and patron of the arts. He was Head Almoner at the National Hospital for Neurology and Neurosurgery and founded the Paintings in Hospitals charity. He appeared as a "castaway" on the BBC Radio programme Desert Island Discs on 4 April 1970. Russell was known as Britain's first male almoner. Russell did not speak until he was three years old. At five years of age, he began to learn the cello. As a child in Paris, he was frequently taken to lunch with Claude Debussy. It was Debussy who diagnosed Russell as being partially deaf. During World War II, Russell worked for British Intelligence in Italy. References Category:1900 births Category:Place of birth missing Category:1991 deaths Category:Place of death missing Category:Almoners Category:British cellists Category:20th-century British medical doctors Category:20th-century British musicians
{ "pile_set_name": "Wikipedia (en)" }
1. Field of the Invention The present invention relates to an apparatus for evaluating a degree of recovery of a living subject from a surgical operation. 2. Related Art Statement A living subject who has undergone a surgical operation is monitored, in, e.g., a recovery room, with respect to blood pressure, heart rate, blood oxygen saturation, etc. Based on the blood pressure, heart rate, and/or blood oxygen saturation being monitored, a doctor judges, from his or her experience, whether the subject has recovered from the surgical operation and, if it is judged that the subject has recovered, then the subject is moved to a general ward. The judgment made in this manner about the degree of recovery of the subject from the operation is more or less unclear, but it is not problematic so long as the subject is kept in hospital. Meanwhile, recently, a day operation has become popular. The day operation means that in a single day a patient undergoes a surgical operation and goes home. If a judgment made by a doctor about a postoperative condition of a patient who has undergone a day operation is unclear, then the condition of the patient may become worse after the patient goes home. After the patient goes home, the doctor cannot do a quick treatment on the patient. Thus, it has been needed to objectively or quantitatively evaluate a postoperative condition of a living subject. It is therefore an object of the present invention to provide an apparatus which can objectively and accurately evaluate a degree of recovery of a living subject from a surgical operation. To this end, the Inventors have carried out an extensive study and have found that information relating to the circulatory organ of a living subject who has undergone a surgical operation largely and randomly changes from its values before the operation, because of anesthesia or physical stimuli administered or applied to the subject during the operation. However, after the operation, the circulatory-organ-relating information will change toward its values before the operation. The Inventors have found such a phenomenon that the circulatory-organ-relating information obtained after the operation will become stable around a certain saturation value, and such a fact that the change of circulatory-organ-relating information obtained after the operation is closely related to the degree of recovery of the subject from the operation. The present invention has been developed based on those findings. The above object has been achieved by the present invention. According to the present invention, there is provided an apparatus for evaluating a degree of recovery of a living subject from a surgical operation which the subject has undergone, the apparatus comprising a circulatory-organ-relating-information obtaining means for iteratively obtaining, after the operation, a piece of circulatory-organ-relating information relating to a circulatory organ of the subject; and a recovery-degree evaluating means for evaluating the degree of recovery of the subject, based on at least one piece of circulatory-organ-relating information obtained by the circulatory-organ-relating-information obtaining means. In the present apparatus, the circulatory-organ-relating-information obtaining means iteratively obtains, after the surgical operation, a piece of circulatory-organ-relating information relating to the circulatory organ of the living subject, and the recovery-degree evaluating means evaluates the degree of recovery of the subject, based on one or more pieces of circulatory-organ-relating information obtained by the circulatory-organ-relating-information obtaining means. Thus, present apparatus can objectively and accurately evaluate the degree of recovery of the subject from the operation which the subject has undergone. Peferably, the recovery-degree evaluating means comprises means for evaluating the degree of recovery of the subject, by judging whether a change of a plurality of pieces of circulatory-organ-relating information iteratively obtained by the circulatory-organ-relating-information obtaining means is smaller than a reference value and accordingly is stable. There is a phenomenon that the pieces of circulatory-organ-relating information iteratively obtained from the postoperative subject by the circulatory-organ-relating-information obtaining means change toward a saturation value and become stable around the same. Since the recovery-degree evaluating means evaluates the degree of recovery of the subject, by judging whether a change of the pieces of circulatory-organ-relating information is smaller than a reference value and accordingly is stable, the present apparatus can objectively and accurately evaluate the degree of recovery of the subject from the operation. Preferably, the circulatory-organ-relating-information obtaining means comprises means for iteratively obtaining, as a piece of circulatory-organ-relating information, one selected from the group consisting of a blood pressure Value, a heart rate value, a magnitude of a fluctuation of blood pressure values, and a magnitude of a fluctuation of heart rate values. There is a phenomenon that the blood pressure values, heart rate values, magnitudes of fluctuation of blood pressure values, or magnitudes of fluctuation of heart rate values, iteratively obtained from the postoperative subject by the circulatory-organ-relating-information obtaining means change toward a saturation value and become stable around the same. Thus, the present apparatus can evaluate, based on a change of those values, the degree of recovery of the subject from the operation. Preferably, the recovery-degree evaluating means comprises means for determining a saturation value based on a time-wise change of a plurality of pieces of circulatory-organ-relating information iteratively obtained by the circulatory-organ-relating-information obtaining means, means for determining, based on the saturation value, a reference value smaller than the saturation value, and means for evaluating the degree of recovery of the subject, by judging whether a piece of circulatory-organ-relating information obtained by the circulatory-organ-relating-information obtaining means is greater than the reference value. The pieces of circulatory-organ-relating information iteratively obtained from the postoperative subject by the circulatory-organ-relating-information obtaining means have a nature to change along a logarithmic curve, and accordingly can be expressed by a logarithmic function. Therefore, a saturation value of the information can be determined, for each living subject, based on a time-wise change of the information. Since the recovery-degree evaluating means evaluates the degree of recovery of the subject, by judging whether an actual piece of circulatory-organ-relating information is greater than the reference value lower than the saturation value, the present apparatus can accurately evaluate the degree of recovery of the subject, independent of individual differences of living subjects. Preferably, the circulatory-organ-relating-information obtaining means comprises means for iteratively obtaining, as a piece of circulatory-organ-relating information, one selected from the group consisting of a magnitude of a low-frequency fluctuation of blood pressure values, and a ratio of one of a magnitude of a low-frequency fluctuation of heart rate values and a magnitude of a high-frequency fluctuation of the heart rate values to the other of the magnitude of low-frequency fluctuation of heart rate values and the magnitude of high-frequency fluctuation of heart rate values, and the recovery-degree evaluating means comprises means for evaluating the degree of recovery of the subject, by judging whether the one selected from the group is greater than a reference value. It is speculated that the magnitude of low-frequency fluctuation of blood pressure values of the subject, or the ratio of one of the magnitude of low-frequency fluctuation of heart rate values and the magnitude of high-frequency fluctuation of the heart rate values to the other of the magnitude of low-frequency fluctuation of heart rate values and the magnitude of high-frequency fluctuation of heart rate values faithfully reflects the activity of the sympathetic nerve system of the subject. Since the recovery-degree evaluating means evaluates the degree of recovery of the subject, by judging whether a blood pressure value or the ratio is greater than a reference value, the present apparatus can objectively and accurately evaluate the degree of recovery of the subject from the operation. Preferably, the circulatory-organ-relating-information obtaining means comprises means for iteratively obtaining, as a piece of circulatory-organ-relating information, one selected from the group consisting of a frequency distribution of fluctuations of blood pressure values, and a frequency distribution of fluctuations of heart rate values, and means for determining a degree of sharpness of the one selected from the group, and the recovery-degree evaluating means comprises means for evaluating the degree of recovery of the subject, by judging whether the determined degree of sharpness is greater than a reference value. The sharpness-degree values of the frequency distribution of fluctuations of blood pressure values or the frequency distribution of fluctuations of heart rate values, iteratively obtained from the postoperative subject change toward a value before the operation. Since the recovery-degree evaluating means evaluates the degree of recovery of the subject, by judging whether a sharpness degree of the frequency distribution is greater than a reference value, the present apparatus can objectively and accurately evaluate the degree of recovery of the subject. Preferably, the circulatory-organ-relating-information obtaining means comprises means for iteratively obtaining, as a piece of circulatory-organ-relating information, one selected from the group consisting of a frequency spectrum of fluctuations of blood pressure values, and a frequency spectrum of fluctuations of heart rate values, and means for determining a proportion of an interval fluctuation magnitude of the one selected from the group in a prescribed frequency interval, with respect to a whole fluctuation magnitude of the one selected from the group in a whole frequency range, and the recovery-degree evaluating means comprises means for evaluating the degree of recovery of the subject, by judging whether the determined proportion is greater than a reference value. The proportion of interval fluctuation magnitude of the frequency spectrum of fluctuations of blood pressure values or the frequency spectrum of fluctuations of heart rate values, iteratively obtained from the postoperative subject, change toward a value before the operation. Since the recovery-degree evaluating means evaluates the degree of recovery of the subject, by judging whether a proportion of interval fluctuation magnitude of the frequency spectrum is greater than a reference value, the present apparatus can objectively and accurately evaluate the degree of recovery of the subject.
{ "pile_set_name": "USPTO Backgrounds" }
She triumphed in the U15 girls 800m at the England Athletics U15 / U17 / U20 Indoor Championships, held at the NIA in Birmingham. Fresh from her victory in January at the Northern Indoor Championships, she became yet another athlete from the club’s middle distance training group to medal at a major championships. With no obvious hot favourite within the race, based on personal best times, it was clearly going to be a close one. Niamh again ran an intelligent race over the four laps, letting others take the pace for the first two laps and running just wide enough to keep out of trouble. Sitting on the shoulder of the leader during the second half, she made her move with 150m to go, taking the lead, and then, as others challenged she found enough to kick again to win by a clear margin. Another major medal success was Alexandra Turner, 21, who was successful in winning bronze in the women’s 800m at the British Universities and College’s (BUCS) athletic championships in Sheffield. Alex is a student at Nottingham Trent University. Trending 85-year-old woman dies in horror market place crash REVEALED: The most expensive streets to buy a house in Derbyshire Mum 'shamed' for using disabled Meadowhall toilets with her baby and pram
{ "pile_set_name": "Pile-CC" }
Tresa Baldas Detroit Free Press Curled up on a bunk in his broken-down truck, waiting three hours for help in sub-zero temperatures, Detroiter Alphonse Maddin feared death was near. He had zero feeling in his feet. His torso was going numb. And a burning feeling took over as he started to fade in the 14-below meat truck. Maddin said he could have died that night but one man didn’t care: U.S. Supreme Court nominee Neil Gorsuch, a federal judge who ruled against Maddin in a legal case that has landed the Detroit man at the vortex of a debate about whether Gorsuch is a man of the people or big business as he is poised to be appointed to the nation's highest court. In an interview with the Free Press, Maddin, an avid trumpet player and skilled artist who grew up on the city's west side and once designed products for the Detroit Three automakers, said Gorsuch is out of touch with working-class people and shouldn't sit on the high court after ruling against him last year. Gorsuch sided with the employer who fired Maddin for abandoning his trailer so that he could get to safety. Read more: Senate's top Democrat opposes Supreme Court nominee Neil Gorsuch Neil Gorsuch sails through Supreme Court confirmation hearing The trucking company has long argued that it did nothing wrong, disputing claims that the truck's heater didn’t work and noting that Maddin filed an initial complaint with the Occupational Safety and Health Administration, but that the agency ruled against him. Yet out of seven judges who had heard the case over the years, Gorsuch was the only judge to rule in favor of the trucking company. And how he did it was numbing, said Maddin. “He referred to me simply as a trucker,” Maddin said. “I’m a human being who has a name … but he followed the company’s argument to get the world to ignore the magnitude of the circumstances, to forget that a man was about to freeze to death.” And that man, he stressed, is a lot more than a trucker. Maddin, 48, is a proud Detroiter who overcame the hurdle of growing up without a father, who was shot to death when Maddin was 5. Maddin's refuge became music, art and drawing. He took up the trumpet in third grade and earned a scholarship to study jazz at Langston University in Oklahoma. He would go on to earn two college degrees and make a living designing products for the automotive industry until the 2008 recession hit, landing him in the truck driving business. But Gorsuch couldn't identify with a man like him, Maddin said. To the judge, he said, he was only a trucker. “The general sentiment that’s out there right now … that he has a propensity to favor the corporate world versus the people – I think it’s valid,” Maddin said. A look at the case It has been eight years since Maddin was fired from his truck driving job, though he didn't get closure until last year. After years of administrative hearings and legal feuding, the 10th Circuit U.S. Court of Appeals last year ruled 2-1 in his favor and ordered the trucking company to rehire Maddin, who instead took back pay. The judge who ruled against him was Gorsuch, though Maddin wouldn't read his dissent until months later, when President Donald Trump announced his nominee to the Supreme Court, and before long, the case about the Michigan truck driver who almost froze to death made national news. Maddin discovered all the buzz while Googling his name. He was applying for a job one day and decided to search his name on the Internet. Articles popped up linking his name to Trump, Gorsuch and the U.S. Supreme Court. He opened up the stories and discovered all the controversy: Gorsuch was getting drilled for ruling against him. So he decided to read the full dissent for himself. "I was like, '"Whoa! ... Wait a minute, he said all this stuff?" recalled Maddin. In writing his opinion, Gorsuch stressed that he had to determine whether the employer's decision to fire Maddin was legal, not "wise or kind." Maddin had sued under a law known as the Surface Transportation Assistance Act, which prohibits companies from firing a driver who "refuses to operate" an unsafe truck. Gorsuch concluded that the law didn't apply to Maddin because — he reasoned — he didn't refuse to operate the truck, but rather drove off in it. "A trucker was stranded on the side of the road, late at night, in cold weather, and his trailer brakes were stuck," Gorsuch wrote in his dissent. "He called his company for help and someone there gave him two options. He could drag the trailer carrying the company's goods to its destination (an illegal and maybe sarcastically offered option). Or he could sit and wait for help to arrive (a legal if unpleasant option). The trucker chose None of the Above, deciding instead to unhook the trailer and drive his truck to a gas station. In response, his employer, TransAm, fired him for disobeying orders and abandoning its trailer and goods." The dissent has since dogged Gorsuch, who has maintained that he followed the law. "My job is to apply the law as written," Gorsuch said during Senate confirmation hearings, while being grilled by U.S. Sen. Dick Durbin, D-Ill. "The law said he would be protected if he refused to operate. By any plain understanding, he operated the vehicle. And if Congress wishes to revise the law — I wrote this: I said it was an unkind decision, it might have been a wrong decision, a bad decision, but my job isn't to write the law ... it's to apply the law." In a March 22 editorial, the Chicago Tribune supported Gorsuch. "Some of Gorsuch's critics think judges should be creative and expansive depending on the political climate — to treat laws differently on a cold night than a warm one. Those critics suggest that they fear Gorsuch won't follow the law, but the opposite is more true: They fear he will. Gorsuch should be confirmed." He's not 'folksy' Attorney Robert Fetter, who represented Maddin in his lawsuit, said Gorsuch's "folksy" and "pleasant" demeanor in the confirmation hearings contrast sharply to the judge he saw on the bench. "I did not detect any of this pleasant disposition or folksiness. He was hostile. As a matter of fact, he was quite hostile," said Fetter, claiming Gorsuch went out of his way to "cherry-pick" the law to uphold firing Maddin. "He went quite a length, in my opinion, to find a way to rule against him," Fetter said. "It shows something about his judicial philosophy or perhaps his bias being pro business or pro corporation. It's just bias." Maddin agrees, though he still can't fathom why or how a judge could rule against him given what he went through. Here, according to his account, is what happened: Maddin was hauling a truck of meat across the country when he noticed he was running low on fuel, so he pulled over on a toll road in Illinois to call his company and ask what station he should fill up at, as was protocol. When he pulled over, his brakes froze up, so he called roadside service for help. While stranded, he decided to lay down in a bunk and wait. He presumed help would arrive within an hour. Three hours later, his cell phone rang and woke him up. It was a relative checking on him. Maddin could barely talk. His feet and torso were numb. He struggled to breathe. The temperature gauge read minus 14. "I felt myself fading, and at a rapid pace.That's when I realized I could possibly die," Maddin said. "I thought about me arriving back home in a casket, and I was thinking, 'that's not going to happen without me fighting for my life.' " Maddin called the company's roadside service again. They told him to wait, 'just try to hang in there,' " he recalled. Instead, Maddin put on his boots and climbed out of the truck to unhitch the trailer. It was the only thing keeping him from getting to safety. "I remember thinking that if I fell, that would probably be it. I wouldn't have the strength to stand back up," he recalled. But he managed. He unhitched the 50-foot-long trailer, drove to a station and warmed up and fueled up. Eventually, he drove back to the trailer, which got repaired, hooked it back up and made his meat deliveries, as required. When he returned to the company's headquarters in Kansas, three people were sitting in a room waiting for him. "They fired me," he recalled. And then they blackballed him, he said, claiming his employer notified the trucking industry through a reporting system that Maddin had broken a cardinal sin: he abandoned a truck on the side of the road,even though staying meant he could die. He would later discover that the truck was not rated to produce heat in the frigid temps that he was in. Today, Maddin is unemployed, living with family and friends until he can land on his feet. He's somewhat optimistic. While his case played out in the courts, he took the initiative to go back to school, earning a bachelor's of applied science from the University of Michigan in Dearborn and then a master's degree in 2016. He walked across the stage in April. Four months later came the favorable court ruling. He had finally won his case with the trucking company. It was an emotional win for Maddin, especially because of where he came from. When he first went to trucking school, he said, he felt stigmatized because he was from Detroit, noting he heard snide remarks about Detroiters during training. That weighed heavily on his mind, he said, especially when he got fired. "I felt like I wasn't only standing up for myself, but I felt like I was standing up for my city," Maddin said. "I was hell-bent on winning." Contact Tresa Baldas: tbaldas@freepress.com
{ "pile_set_name": "OpenWebText2" }
Q: How do I load an (unpacked) Chrome extension without any manfest.json file? I created Chrome extensions in the past and always used a manifest.json to handle init. Now I wanted to to some open-source dev on https://github.com/manastungare/google-calendar-crx but how do I start a dev environment? When I want to load it in Chrome it complains about a missing manifest.json. A: The manifest.json file is within src directory of repository. Download the repository and select the src directory after clicking "Load unpacked extension...".
{ "pile_set_name": "StackExchange" }
Autoimmunity and pulmonary hypertension: a perspective. The association between autoimmunity and pulmonary arterial hypertension (PAH) has been appreciated for >40 yrs, but how autoimmune injury might contribute to the pathogenesis of this disease has only been examined in a case-specific manner. It is becoming increasingly clear that a variety of diverse clinical diseases, ranging from viral infections to connective tissue disorders, can culminate in pulmonary vascular pathology that is indistinguishable. Is there a hitherto unappreciated biology that unites these seemingly unrelated conditions? The answer to this question may come from the increasing body of evidence concerned with the central importance of regulatory T-cells in preventing inappropriate B-cell activity. Two striking similarities between conditions associated with severe angioproliferative pulmonary hypertension are a defect in the CD4 T-cell compartment and auto-antibody production. Pathogenic auto-antibodies targeting endothelial cells are capable of inducing vascular endothelial apoptosis and may initiate the development of PAH. The present review will focus on what is known about autoimmune phenomena in pulmonary arterial hypertension patients, in order to better consider whether an early loss of self-tolerance followed by autoimmune injury could influence the early development of severe angioproliferative pulmonary hypertension.
{ "pile_set_name": "PubMed Abstracts" }
Nebraska Supreme Court Online Library www.nebraska.gov/apps-courts-epub/ 04/10/2020 08:07 AM CDT - 279 - Nebraska Supreme Court Advance Sheets 305 Nebraska Reports IN RE INTEREST OF TAESON D. Cite as 305 Neb. 279 In re Interest of Taeson D., a child under 18 years of age. State of Nebraska, appellee, v. Samuel T., appellant. ___ N.W.2d ___ Filed March 13, 2020. No. S-19-382. 1. Parental Rights: Due Process. Whether a parent who is incarcerated or otherwise confined in custody has been afforded procedural due proc­ess for a hearing to terminate parental rights is within the discre- tion of the trial court, whose decision on appeal will be upheld in the absence of an abuse of discretion. 2. Juvenile Courts: Appeal and Error. Juvenile cases are reviewed de novo on the record, and an appellate court is required to reach a conclu- sion independent of the juvenile court’s findings. 3. Parental Rights: Due Process. An incarcerated parent’s physical pres- ence is not necessary at a hearing to terminate parental rights, provided that the parent has been afforded procedural due process. 4. ____: ____. The initiative is properly placed on the parent or the par- ent’s attorney to notify the court of the parent’s incarceration and to request to appear telephonically at the hearing to terminate paren- tal rights. 5. Juvenile Courts: Parental Rights: Due Process. The juvenile court has discretion to determine how an incarcerated parent may meaning- fully participate in the hearing on the termination of his or her parental rights consistent with due process. Appeal from the Separate Juvenile Court of Lancaster County: Reggie L. Ryder, Judge. Affirmed. Troy J. Bird, of Hoppe Law Firm, L.L.C., for appellant. - 280 - Nebraska Supreme Court Advance Sheets 305 Nebraska Reports IN RE INTEREST OF TAESON D. Cite as 305 Neb. 279 Pat Condon, Lancaster County Attorney, Mary Norrie, and Danielle M. Kerr for appellee. Heavican, C.J., Miller-Lerman, Cassel, Stacy, Funke, Papik, and Freudenberg, JJ. Miller-Lerman, J. NATURE OF CASE Samuel T. appeals the termination of his parental rights to his minor child, Taeson D. During the pendency of these proceedings, Samuel became incarcerated in South Carolina, serving a 30-year sentence. Following a termination hearing at which Samuel was represented by counsel but not present, the separate juvenile court of Lancaster County determined that (1) Samuel substantially neglected to give Taeson neces- sary parental care; (2) Taeson was a juvenile as described by Neb. Rev. Stat. § 43-247(3)(a) (Reissue 2016) and reasonable efforts have failed to correct conditions; (3) Taeson was in an out-of-home placement for 15 or more months of the most recent 22 months; (4) it was in the best interests of Taeson to terminate Samuel’s parental rights; and (5) Samuel was unfit to parent Taeson. The juvenile court terminated Samuel’s parental rights to Taeson on three statutory bases as more fully described below. Samuel appeals. He claims that his proce- dural due process rights were violated and that the juvenile court erred when it terminated his parental rights to Taeson. We affirm. FACTS Taeson was born in July 2017. The Nebraska Department of Health and Human Services (DHHS) took custody of Taeson at the hospital shortly after his birth because his biological mother had admitted to methamphetamine use during pregnancy and the meconium fluid had tested positive for methamphetamine. Taeson’s biological mother relinquished her parental rights in late 2018. Taeson was placed with Lachrisha T., Samuel’s adult daughter, who has cared for Taeson since birth. - 281 - Nebraska Supreme Court Advance Sheets 305 Nebraska Reports IN RE INTEREST OF TAESON D. Cite as 305 Neb. 279 Samuel was present at the hospital for Taeson’s birth. Samuel and the child apparently had almost no further contact after this point. Samuel became incarcerated in November 2017 on what the record suggests was a drug-related offense. In December 2017, a paternity test showed that Samuel was the biological father of Taeson. Candace Sturgeon, a caseworker with DHHS, unsuccessfully attempted to contact Samuel through Lachrisha and other means. Sturgeon eventu- ally located Samuel through a DHHS computer system search and visited him at the jail in Saline County, Nebraska, in June 2018. She testified at the termination hearing that she informed Samuel that the result of the paternity test he had taken showed he was Taeson’s biological father. According to Sturgeon, Samuel stated that he had assumed he probably was Taeson’s father, that he was aware Taeson was living with Lachrisha, and that he had personally recommended that Taeson be placed with her after the child was removed from his biological mother’s care. According to Sturgeon, Samuel had indicated he sup- ported Lachrisha’s potentially adopting Taeson. According to Sturgeon, Samuel stated “something to the effect of well I obviously am not an option since I’m going to be in prison for 30 years, so I understand that.” Sturgeon testified that she advised Samuel that he needed to keep her updated on his whereabouts, because it would be very difficult for her to know where he was if he was transferred. Samuel asked Lachrisha to bring the child to county jail one time, but before arrangements could be made, Samuel was transferred to federal prison in South Carolina on a 30-year sentence. After the transfer, Samuel did not communicate with Sturgeon or DHHS to update them on his whereabouts or to contact Taeson. Sturgeon testified that she made largely unsuc- cessful efforts to contact Samuel multiple ways at least once a month. Turner attended a paternity hearing on June 6, 2018, at which he was declared Taeson’s legal father. In October 2018, - 282 - Nebraska Supreme Court Advance Sheets 305 Nebraska Reports IN RE INTEREST OF TAESON D. Cite as 305 Neb. 279 the State moved to terminate Samuel’s and the biological mother’s parental rights. The motion to terminate alleged three grounds under Neb. Rev. Stat. § 43-292 (Reissue 2016), which states: The court may terminate all parental rights between the parents or the mother of a juvenile born out of wed- lock and such juvenile when the court finds such action to be in the best interests of the juvenile and it appears by the evidence that one or more of the following condi- tions exist: .... (2) The parents have substantially and continuously or repeatedly neglected and refused to give the juvenile or a sibling of the juvenile necessary parental care and protection; .... (6) Following a determination that the juvenile is one as described in subdivision (3)(a) of section 43-247, reasonable efforts to preserve and reunify the family if required under section 43-283.01, under the direction of the court, have failed to correct the conditions leading to the determination; (7) The juvenile has been in an out-of-home placement for fifteen or more months of the most recent twenty-two months. On November 19, 2018, Samuel was served in prison in South Carolina with a copy of the motion to terminate his parental rights and a summons to appear before the court for a hearing on the matter. In December, Samuel denied the allega- tions in the motion to terminate and the termination hearing was continued. In December 2018, Sturgeon left a message with a case- worker at the South Carolina prison and Samuel called her back. During that telephone call, Sturgeon explained to Samuel that the State was moving to terminate his parental rights. Samuel stated that he did not want his parental rights - 283 - Nebraska Supreme Court Advance Sheets 305 Nebraska Reports IN RE INTEREST OF TAESON D. Cite as 305 Neb. 279 terminated and that he no longer approved of Taeson’s being placed with Lachrisha. He explained that Lachrisha was not “put[ting] any money on his books” and had stopped commu- nicating with him. Samuel stated that he hoped he would be successful in the appeal of his criminal conviction and that his intent was to win his appeal and parent Taeson. Sturgeon testified that Samuel did not make further contact with DHHS after December 2018. At the time of the termina- tion hearing in March 2019, Samuel had been in prison in South Carolina for 8 months. Taken as a whole, the testimony showed that Samuel had not attempted to be involved in Taeson’s life either before or after his incarceration. Samuel had not requested photographs of Taeson and had not contacted him after his birth. Sturgeon explained that the service DHHS typically offers to parents who are incarcerated is visitation with the child; however, it is very difficult to offer services if someone is placed out of state and it is impossible to offer serv­ices to someone that DHHS is unable to contact. She testi- fied that, in her view, Samuel’s parental rights should be termi- nated even if he wins his appeal on his criminal case because it is unclear how long it would take him to work through a case with DHHS and ensure he could care for a child. The termination hearing was held on March 13, 2019. The child was represented by a guardian ad litem, and counsel appeared for the State. Samuel was represented throughout the termination hearing by an attorney. Samuel did not appear physically or telephoni- cally. The juvenile court recognized that Samuel denied the allegations in the motion to terminate. Samuel’s counsel was asked to address Samuel’s nonappearance, and Samuel’s coun- sel stated as follows: Well, Your Honor, he’s incarcerated in North [sic] Carolina penitentiary system. I’ve had communication with him be [sic] email on and off throughout the last six weeks or so. I know that he does object to what — having his rights terminated. I’ve also tried to communicate with - 284 - Nebraska Supreme Court Advance Sheets 305 Nebraska Reports IN RE INTEREST OF TAESON D. Cite as 305 Neb. 279 him regarding relinquishment, which he’s been unable to or unwilling to sign a relinquishment, and so you know, I can’t imagine the Court is going to continue this out for 30 years ’til he can put himself in a place where he can parent, so I see no other alternative but moving for- ward today. Following the hearing, the juvenile court filed an order which found that the allegations of the motion for termina- tion of parental rights were true by clear and convincing evi- dence. The court enumerated its findings that (1) regarding § 43-292(2), Samuel substantially neglected to give Taeson necessary parental care; (2) regarding § 43-292(6), Taeson was a juvenile as described by § 43-247(3)(a) and reason- able efforts have failed to correct conditions; (3) regarding § 43-292(7), Taeson was in an out-of-home placement for 15 or more months of the most recent 22 months; (4) it was in the best interests of Taeson to terminate Samuel’s parental rights; and (5) Samuel was unfit to parent Taeson now and in the future. The juvenile court terminated Samuel’s parental rights to Taeson. Samuel appeals. ASSIGNMENTS OF ERROR On appeal, Samuel claims, summarized and restated, that (1) he was denied procedural due process rights at the termina- tion hearing and (2) the juvenile court erred when it terminated his parental rights because DHHS had failed to make reason- able efforts to reunite him and Taeson. STANDARDS OF REVIEW [1] Whether a parent who is incarcerated or otherwise con- fined in custody has been afforded procedural due process for a hearing to terminate parental rights is within the discretion of the trial court, whose decision on appeal will be upheld in the absence of an abuse of discretion. See In re Interest of Mainor T. & Estela T., 267 Neb. 232, 674 N.W.2d 442 (2004). - 285 - Nebraska Supreme Court Advance Sheets 305 Nebraska Reports IN RE INTEREST OF TAESON D. Cite as 305 Neb. 279 [2] Juvenile cases are reviewed de novo on the record, and an appellate court is required to reach a conclusion indepen- dent of the juvenile court’s findings. See In re Interest of Zoie H., 304 Neb. 868, 937 N.W.2d 801 (2020). ANALYSIS Due Process. Samuel, who was incarcerated in South Carolina, had his parental rights to Taeson terminated at a hearing at which he was represented by counsel; he was not physically present nor did he participate telephonically. In Samuel’s brief, he contends that he was denied due process generally because he did not appear “in some fashion,” brief for appellant at 12, and, in par- ticular, he was denied a “telephonic or video hearing,” brief for appellant at 9. We determine that under the facts of this case, Samuel was not denied due process. [3] It is settled in Nebraska, and Samuel agrees, that an incarcerated parent’s physical presence is not necessary at a hearing to terminate parental rights, provided that the parent has been afforded procedural due process. See, In re Interest of Mainor T. & Estela T., supra; In re Interest of L.V., 240 Neb. 404, 482 N.W.2d 250 (1992). The fundamental requirement of due process is the opportunity to be heard “‘at a meaningful time and in a meaningful manner.’” Mathews v. Eldridge, 424 U.S. 319, 333, 96 S. Ct. 893, 47 L. Ed. 2d 18 (1976). We have explained that a juvenile court must consider several factors in determining whether to allow a parent’s attendance, which fac- tors are as follows: the delay resulting from prospective parental attendance, the need for disposition of the proceeding within the immediate future, the elapsed time during which the proceeding has been pending before the juvenile court, the expense to the State if the State will be required to provide transportation for the parent, the inconvenience or detriment to parties or witnesses, the potential danger or security risk which may occur as a result of the parent’s - 286 - Nebraska Supreme Court Advance Sheets 305 Nebraska Reports IN RE INTEREST OF TAESON D. Cite as 305 Neb. 279 release from custody or confinement to attend the hear- ing, the reasonable availability of the parent’s testimony through a means other than parental attendance at the hearing, and the best interests of the parent’s child or children in reference to the parent’s prospective physical attendance at the termination hearing. In re Interest of L.V., 240 Neb. at 416, 482 N.W.2d at 258-59. [4] With respect to the participation of the incarcerated par- ent, we have stated that in most situations, in order to trigger the requirements of In re Interest of L.V., the initiative is prop- erly placed on the parent or the parent’s attorney to notify the court of the parent’s incarceration and to request attendance. See In re Interest of Mainor T. & Estela T., supra. We logi- cally apply this principle to an incarcerated parent’s request to appear telephonically. In the present case, no such request was made and, to the contrary as seen in the material quoted above, such appearance was waived. [5] We are aware of jurisdictions which require juvenile courts to either give incarcerated parents the opportunity to participate by telephone in the entire hearing, e.g., In Interest of M.D., 921 N.W.2d 229 (Iowa 2018) (amended Mar. 5, 2019), or offer an alternative procedure by which the incarcerated parent may review a transcript of the record of the evidence presented against him or her and testify later at a bifurcated hearing. See, E.J.S. v. Dept. of Health & Soc. Serv., 754 P.2d 749 (Alaska 1988); In re Randy Scott B., 511 A.2d 450 (Me. 1986). However, in light of a juvenile court’s relative inabil- ity to compel an out-of-state correctional facility to allow an incarcerated parent to participate in an entire hearing, we decline to require juvenile courts to follow a rigid procedure of telephonic participation for the entire hearing in all cases. Like several other jurisdictions that have thoroughly considered the issue, we leave it to the juvenile courts’ discretion to determine how an incarcerated parent may meaningfully participate in the hearing on the termination of his or her parental rights consist­ ent with due process. See, In re C.G., 954 N.E.2d 910 (Ind. - 287 - Nebraska Supreme Court Advance Sheets 305 Nebraska Reports IN RE INTEREST OF TAESON D. Cite as 305 Neb. 279 2011) (cases collected); In re D.C.S.H.C., 733 N.W.2d 902 (N.D. 2007); State ex rel. Jeanette H. v. Pancake, 207 W. Va. 154, 529 S.E.2d 865 (2000). In this case, Samuel was aware that Taeson was adjudicated as a juvenile under § 43-247(3)(a). Samuel received notice of the termination hearing, filed a pleading denying the allega- tions, and was represented by counsel throughout the termi- nation proceeding. Compare In re Interest of Davonest D. et al., 19 Neb. App. 543, 809 N.W.2d 819 (2012) (concluding due process violated for inmate who was neither present nor represented by counsel at termination hearing). The record shows that Samuel had been communicating with counsel and that Samuel’s counsel cross-examined the witness and had the opportunity to present evidence, which he declined. Samuel did not request to be present or telephonically participate at the ter- mination hearing and did not request a continuance. The hear- ing on parental termination had already been continued twice, and the juvenile court properly exercised its discretion when it conducted the hearing with Samuel’s interests represented by counsel. Samuel was not denied procedural due process under the circumstances. Termination. Samuel contends that the juvenile court erred when it termi- nated his parental rights under § 43-292(6) because the State did not make reasonable efforts to reunite him with Taeson. See Neb. Rev. Stat. § 43-283.01 (Cum. Supp. 2018) and § 43-292(6). We reject this assignment of error. The juvenile court found sufficient evidence existed under § 43-292(2), (6), and (7) to support a termination of Samuel’s parental rights. We have held that any one of the bases for ter- mination of parental rights codified by § 43-292 can serve as the basis for the termination of parental rights when coupled with evidence that termination is in the best interests of the child. In re Interest of Sir Messiah T. et al., 279 Neb. 900, 782 N.W.2d 320 (2010). - 288 - Nebraska Supreme Court Advance Sheets 305 Nebraska Reports IN RE INTEREST OF TAESON D. Cite as 305 Neb. 279 Samuel has not raised a challenge to the sufficiency of the evidence establishing that under § 43-292(2), he substantially and continuously or repeatedly neglected and refused to give Taeson necessary parental care and protection, or that under § 43-292(7), Taeson had been in an out-of-home placement for 15 or more months of the most recent 22 months. Each of these subsections is a statutory basis for termination. See In re Interest of Sir Messiah T. et al., supra. We find support in the record establishing grounds for termination under § 43-292(2) and (7). In addition, the evidence demonstrates that termination of Samuel’s parental rights is in the best interests of Taeson. At the time of the proceedings, Samuel had virtually no relation- ship with Taeson and there was no evidence that Samuel had taken steps to establish a relationship. Samuel was sentenced on a drug-related offense to be incarcerated for the entirety of Taeson’s juvenile years. Further, the juvenile court’s finding that Samuel was unfit was supported by the record. Because the State needed to prove only one basis for termi- nation, and did so here, we need not further analyze Samuel’s claim that the State made insufficient efforts to preserve and reunify the family under § 42-292(6). See In re Interest of Sir Messiah T. et al., supra. CONCLUSION The juvenile court did not deny Samuel procedural due process, and it did not err when it determined that terminat- ing Samuel’s parental rights to Taeson was appropriate under § 43-292(2) and (7) and was in the best interests of Taeson. Accordingly, we affirm. Affirmed.
{ "pile_set_name": "FreeLaw" }
Bicortical screw fixation provides superior biomechanical stability but devastating failure modes in periprosthetic femur fracture care using locking plates. The incidence of periprosthetic fractures is inevitably increasing. Sufficient stabilisation and proper screw placement next to large-volume implants remains difficult. Modern locking plates allow polyaxial, thus bicortical, screw placement around a prosthetic stem. This study analysed the biomechanical properties of different screw configurations in a locking plate construct of a periprosthetic femoral fracture model. A total of 20 Sawbones were used to stabilise a Vancouver-B1 femoral fracture with a locking plate using either four monocortical screws or three bicortical screws for proximal fixation. These were loaded with an increasing axial compression until failure. Bicortical screw purchase was significantly superior to monocortical regarding load to failure (1,510 N ± 284 N versus 2,350 N ± 212 N, p < 0.001) and maximal number of cycles (6803 ± 760 versus 4041 ± 923, p < 0.001). However, the mode of failure in the bicortical group was a severe comminuted fracture pattern as opposed to the monocortical group in which a pull-out of the screws without further damage to the bone was observed. Bicortical screw placement enhances the primary stability in treating periprosthetic femoral fractures. Notably, the mode of failure may limit the salvage options in case of revision surgery.
{ "pile_set_name": "PubMed Abstracts" }
politics Spotted: Shark on the Prowl at City Hall SPOTTED BY: City councillors Mike Layton (left) and Shelley Carroll (right) WHERE: City Hall council chamber WHEN: 2:20 p.m. WHAT: Glenn de Baeremaeker (Ward 38, Scarborough Centre) is known for his creative approach to debating at City Hall. There was that one time he showed up with the toilet, for instance. And that other time, with the showering. These are nice breaks in what are often tedious days, and today, perhaps topping all previous showings, de Baeremaeker did not disappoint. As council was about to start debating a proposed ban on shark fins in Toronto: behold the radio shark, high above! (Debate is ongoing, though this particular shark has since been dispensed with.) UPDATE: October 25, 5:15 p.m. 680 News reports that council voted in favour of the ban. Spotted features interesting things our readers discover in their journeys across Toronto. If you spot something interesting, send a photo and pertinent details to [email protected].
{ "pile_set_name": "OpenWebText2" }
Q: Перенос сведений из полей в ячейки таблицы Как сделать перенос общих сведений, вводимых в заполняемые поля, в нужные ячейки таблицы? И подсчитать количество вхождений символа «&» в текстовую таблицу? A: Не совсем понятна первая часть вопроса: если таблица TStringGrid, то у него в свойстве Options есть настройка goEditing, её нужно поставить True, и в сетку можно вводить данные с клавиатуры. Вторая часть: Заводим переменные: кол-во символов, счётчик строк, счётчик столбцов, длина строки, индекс элемента строки (все переменные целые); кол-во символов = 0; Мотаем цикл от 0 до кол-во строк-1; Мотаем цикл от 0 до кол-во столбцов-1; Берём из ячейки строку; Присваиваем её длину переменной; Затем мотаем цикл от 1 до длины строки; Если символ = "&", то кол-во символов = кол-во символов + 1. Выводим результат. Вот как-то так. Первая часть задания: можно посмотреть здесь, если, конечно, это поможет.
{ "pile_set_name": "StackExchange" }
Q: How to generalize this calculation with a pandas DataFrame to any number of columns? I have a file with some data that looks like 1 2 3 4 2 3 4 5 3 4 5 6 4 5 6 7 I can process this data and do math on it just fine: import sys import numpy as np import pandas as pd def main(): if(len(sys.argv) != 2): print "Takes one filename as argument" sys.exit() file_name = sys.argv[1] data = pd.read_csv(file_name, sep=" ", header=None) data.columns = ["timestep", "mux", "muy", "muz"] t = data["timestep"].count() c = np.zeros(t) for i in range(0,t): for j in range(0,i+1): c[i-j] += data["mux"][i-j] * data["mux"][i] c[i-j] += data["muy"][i-j] * data["muy"][i] c[i-j] += data["muz"][i-j] * data["muz"][i] for i in range(t): print c[i]/(t-i) The expected result for my sample input above is 42.5 62.0 84.5 110.0 This math is finding the time correlation function for my data, which is the time-average of all permutations of the pairs of products in each column. I would like to generalize this program to work on n number of columns (in the i/j loop for example), and be able to read in the column names from the file, so as to not have them hard-coded in Which numpy or pandas methods can I use to accomplish this? A: We can reduce it to one loop, as we would make use of array-slicing and use sum ufunc to operate along the rows of the dataframe and thus in the process make it generic to cover any number of columns, like so - a = data.values t = data["timestep"].count() c = np.zeros(t) for i in range(t): c[:i+1] += (a[:i+1,1:]*a[i,1:]).sum(axis=1) Explanation 1) a[:i+1,1:] is the slice of all rows until the i+1-th row and all columns starting from the second column, i.e mux, muy and so on. 2) Similarly, for [i,1:], that's the i-th row and all columns from second column onwards. To keep it "pandas-way", simply replace a[ with data.iloc[.
{ "pile_set_name": "StackExchange" }
Daniel Davari Daniel Davari (; born 6 January 1988) is a football goalkeeper for Rot-Weiß Oberhausen. Born in Germany of Iranian and Polish descent, he represented the Iranian national team at international level. Club career Eintracht Braunschweig Daniel Davari began his career with the reserve side of 1. FSV Mainz 05, before moving to Eintracht Braunschweig in 2009. Originally the club's back-up keeper, he became a starter for Eintracht Braunschweig when Marjan Petković had an injury early during the 2011–12 season. Although Petković returned from his injury a few weeks later, Davari kept the starting spot for the rest of the season, eventually leading Braunschweig to reach promotion to the Bundesliga. On 13 August 2013, Davari played his first Bundesliga match against Borussia Dortmund in the 2013–14 Bundesliga season and earned a 1 rating from Kicker (based on a scale of 1 to 6, with 1 being the highest). Davari was voted the best Braunschweig player at the midpoint of the Bundesliga season. He was named the man of the match against Freiburg on 12 April 2014. On 10 May, Davari provided an assist to Jan Hochscheidt against Hoffenheim. Grasshopper Club Zürich On 29 May 2014, Daniel Davari signed a contract with Swiss Super League side Grasshopper Club Zürich, joining the club on 1 July after the 2014 FIFA World Cup. On 30 July, he made his Champions League debut against Lille. Arminia Bielefeld On 11 June 2015, Davari joined Arminia Bielefeld in the German 2.Bundesliga on a two-year deal. He made his debut on 8 May 2016 and kept a clean sheet in a match against Union Berlin. Davari kept a clean sheet on 17 March 2017 in a 2–0 win against Kaiserslautern to lift Arminia out of a direct relegation spot. MSV Duisburg He signed for MSV Duisburg for the 2017–18 season. Rot-Weiß Oberhausen On 26 January 2019, he moved to Rot-Weiß Oberhausen. International career On 21 January 2013, it was confirmed that Daniel Davari was invited to the Iranian national football team by manager Carlos Queiroz. Davari, who was born in Gießen, Germany to a Polish-German mother and an Iranian father, is eligible to play for Germany, Poland and Iran. However, Davari declined Iran's invitation for the Asian Cup qualifier against Lebanon as the date coincided with a crucial club match, stating that he would accept an invitation for Iran's next match. Davari made his debut for Team Melli against Thailand on 15 November, keeping a clean sheet in a 3–0 Asian Cup qualifier win. On 1 June 2014, Davari was called into Iran's 2014 FIFA World Cup squad by Carlos Queiroz. He was an unused substitute with Alireza Haghighi starting all three matches for Iran. Personal life Davari was brought up as a Catholic from an Iranian father and a Polish mother. On 28 September 2014, Davari's wife Kristina gave birth to a son named Eliah. Career statistics See also German-Iranians References External links Category:1988 births Category:Living people Category:People from Giessen Category:Footballers from Hesse Category:German footballers Category:Iranian footballers Category:Iran international footballers Category:German people of Iranian descent Category:1. FSV Mainz 05 II players Category:Eintracht Braunschweig players Category:Eintracht Braunschweig II players Category:Arminia Bielefeld players Category:Association football goalkeepers Category:Bundesliga players Category:2. Bundesliga players Category:3. Liga players Category:Regionalliga players Category:2014 FIFA World Cup players Category:Iranian Roman Catholics Category:German people of Polish descent Category:Polish people of Iranian descent Category:Iranian people of Polish descent Category:Polish expatriate sportspeople in Switzerland Category:Iranian expatriate sportspeople in Switzerland Category:German expatriate sportspeople in Switzerland Category:Swiss Super League players Category:Grasshopper Club Zürich players Category:MSV Duisburg players Category:Rot-Weiß Oberhausen players Category:Expatriate footballers in Switzerland Category:Mazandarani people Category:German Roman Catholics Category:Sportspeople of Iranian descent
{ "pile_set_name": "Wikipedia (en)" }
Confocal scanning optical microscope using single-mode fiber for signal detection. A single-mode fiber is employed as a detector in a confocal scanning optical microscope (CSOM) instead of a pinhole and its optical property is studied. The optical system is always coherent, which is fundamentally different from the CSOM with a finite-sized pinhole. The coherent transfer function and the axial response are calculated. Experimentally, the coherent image is taken and the axial response is also measured.
{ "pile_set_name": "PubMed Abstracts" }
A popular narrative today is that we live in a country which is deeply divided. And the Democratic Party, we are told, is nearly as split as the nation itself. But chatter in the press and social media may overlook some fundamental points of agreement about changes we need to make in our economy. That’s the premise behind a new pledge, the “Agenda for Good Jobs, Sustainable Prosperity, and Economic Justice,” that has been signed by more than 70 prominent progressives. It declares “both major political parties have allowed the wealthy and the giant corporations to exercise far too much influence in American life” before laying out an 11-point agenda to rebuild a human-centered economy, and remove the corrupting influence of big money from the political process. “Resistance” to Donald Trump is a vital effort. But resistance is reactive; it only defines what we’re against. If today’s resistance is to become a lasting movement, we must decide what we’re for. Otherwise, the Resistance will fail to motivate the 38 percent of Americans who didn’t vote in the last election. Run the Numbers In what may be a chilling portent of things to come in November, the latest Politico/Morning Consult poll shows the “generic Republican” congressional candidate edging ahead of the generic Democrat for the first time since April of last year. All signs indicate that it will be hard for Democrats to win in November without a clear and positive agenda, and all but impossible for them to claim a real mandate if and when they do. The agenda’s 11 points address: Jobs for all, with an emphasis on rebuilding U.S. infrastructure; Build a green economy by retooling the U.S. energy system; Reduce inequality through worker empowerment and labor rights, with better wages and benefits and an end to perverse CEO incentives and compensation; Complement full-employment initiatives with targeted support for communities and populations harmed by racism and sexism; Free public education from pre-K through tuition-free public colleges and universities, together with cancellation of all currently outstanding student debt; Medicare For All, and a strengthening of our social insurance safety net; Fairer tax rates for the wealthy individuals and corporations that have reaped the benefits of recent growth; An end to Wall Street exploitation — by breaking up the big banks, levying a speculation tax, protecting working families, and using the post office system to provide a safe and inexpensive alternative to current banking services; And, an end to oligarchy politics through publicly-financed elections, bans on corporate and big-donor campaign funding, and other electoral reform; and, a change in party nominating processes to ensure that outsider candidates get a fair chance. What Voters Want These are the kind of reforms rank-and-file Democrats want, according to polling data. In a recent Harvard-Harris poll, Democratic base voters were asked: “Do you support or oppose movements within the Democratic Party to take it even further to the left and oppose the current Democratic leaders?” 52 percent of those polled said they support them. In a telling sign for the party’s future, 69 percent of voters aged 18 to 34 agreed. As we wrote in October 2017, this desire is not limited to the “Bernie Bro” stereotype promoted by political insiders. This position has greater support among female voters (55 percent), Hispanic voters (65 percent), and African-American voters (55 percent) than it does among whites (46 percent) and men (49 percent). But support for this agenda is not limited to Democratic voters. 75 percent of Americans support more federal spending on infrastructure, according to Gallup, while 73 percent want the US to place more emphasis on alternative energy. in another poll, 75 percent of Trump voters supported “taking action to accelerate the development and use of clean energy” by funding community upgrades and community renewable projects. Other polls show strong support for labor unions, increasing the minimum wage, reducing inequality, getting big money out of politics, and other key elements of this agenda – and that’s without advocacy and support from either political party. The report’s agenda is also buttressed by a recent economic growth from the Levy Institute showing that the cancellation of all student debt in this country would lead to significant growth and the creation of more than 1 million jobs. Working for Change If the resistance remains focused on Trump to the exclusion of other issues, Trump will continue to dominate the media conversation as he has done for the past year. The debate also needs to address people’s lives and needs. Otherwise, voters may believe Democrats are uninterested in stagnating wages, soaring out-of-pocket health care costs, or the grim reality that the American majority – 80 percent, according to one survey – lives paycheck to paycheck. Voters want leaders who will work for change. While this agenda was not designed as a litmus test, it certainly represents a platform that activists can use to assess political candidates. Conversely, candidates can use it to drum up support, knowing that it is backed by strong policy analysis and good politics. It’s also backed by an impressive and diverse group of initial signers. It includes leading activists like Nina Turner, Jane Fonda, James Zogby, and Gloria Steinem; labor leaders like Larry Cohen, Randi Weingarten, and Leo Gerard; environmentalists Annie Leonard and Bill McKibben; political thinkers like Naomi Klein and Zephyr Teachout; and leading economic thinkers like Robert Reich, James K. Galbraith, and Dean Baker. (I genuinely regret not listing them all, since I’ve had to leave out so many terrific people. You can see them all here.) There are many ways to look at this agenda: as a political statement, as an organizing tool, and as a unifying statement. I also think of it as “11 ways we can make our own lives better” — as individuals, as members of our communities, and as citizens. You can read it in full, and sign your own name to it, here.
{ "pile_set_name": "OpenWebText2" }
Q: Overriding RootViewController.xib in UISplitViewController In a UISplitViewController setup on iPad, RootViewController is a UIViewController class with a XIB file (not a UITableViewController.) My App has several targets. Depending on the target selected (and via #ifdef ... in the code), I'd like to specify a different XIB file for RootViewController. I guess the changes have to be made in application:didFinishLaunchingWithOptions - (BOOL)application:(UIApplication *)application didFinishLaunchingWithOptions:(NSDictionary *)launchOptions { // Add the split view controller's view to the window and display. self.window.rootViewController = self.splitViewController; [self.window makeKeyAndVisible]; return YES; } == EDIT == I deleted all controllers from MainWindow.xib, then added the following lines in the AppDelegate. RootViewController is launched with the appropriate XIB, but the mechanics between RootVC and DetailsVC in SplitViewController does not work; ie. when hitting a button in RootVC that should trigger a change in DefaultVC, nothing happens. I am obviously missing something. splitViewController = [[UISplitViewController alloc] init]; #ifdef OPTION1 rootViewController = [[RootViewController alloc] initWithNibName:@"RootViewController_1" bundle:nil]; #elif OPTION2 rootViewController = [[RootViewController alloc] initWithNibName:@"RootViewController_2" bundle:nil]; #endif defaultViewController = [[[DefaultViewController alloc] init] autorelease]; UINavigationController *rootNav = [[[UINavigationController alloc] initWithRootViewController:rootViewController] autorelease]; UINavigationController *defaultNav = [[[UINavigationController alloc] initWithRootViewController:defaultViewController] autorelease]; splitViewController.viewControllers = [NSArray arrayWithObjects:rootNav, defaultNav, nil]; splitViewController.delegate = defaultViewController; self.window.rootViewController = self.splitViewController; [self.window makeKeyAndVisible]; // Add the split view controller's view to the window and display. self.window.rootViewController = self.splitViewController; [self.window makeKeyAndVisible]; A: You code example seems like a really hard and confusing way to do a split view controller, so I'll just address the more general question: My App has several targets. Depending on the target selected (and via #ifdef ... in the code), I'd like to specify a different XIB file for RootViewController. If you have multiple targets defined in your project, you don't need #ifdefs to do this. It's much simpler to use the target mechanism of the build process. Lets say you have two resources, both called "MyFunResource", but one you'd like to use in a target called "blue", the other you'd like to use in one called "red". Add both resources to your project. But in the file inspector (View > Utilities > Show File Inspector) note the section called "Target Membership". Note that all your targets are listed there with checkboxes next to them. When building a given target, a selected resource will only be copied into the bundle when it has that target's name checked here. So select the "MyFunResource" that you want to be used in the "red" target, and makes sure "red" is the only thing with a checkmark next to it in "Target Memberships". Then select the one you want for "blue" and make sure only "blue" is checked. Now when you build the red target, the build system will only copy the red-related resource into the bundle, so magically, the red resource is what will get used at runtime. And vice-versa with the blue. No code or '#ifdef's required.
{ "pile_set_name": "StackExchange" }
There Is A Gundam, Ultraman, And Kamen Rider Crossover Game For PSP Too PSP owners, don’t feel left out because Lost Heroes is for the 3DS. Namco Bandai is making a crossover game with Gundam, Ultraman, and Kamen Rider for PSP too. Great Battle Full Blast is a different kind of game, though; it’s an action game. You start by picking three heroes out of this list: Freedom Gundam, Gundam, Kamen Rider Decade, Kamen Rider #1, Ultraman or Ultra Mebius. Then… you pick background music. Great Battle Full Blast lets players select character, stage, and boss songs. And then, it’s time to fight! Each hero in Great Battle Full Blast has a different moves and you can change characters at any time by pressing L or R. In addition to six main characters, there are 36 assist character (12 from each series), which you can call during stages. Great Battle Full Blast comes out on March 1. Pick up the limited edition and you’ll get Battle Dodgeball 3 as a bonus. It’s dodgeball with the characters from Great Battle Full Blast. As of now, Namco Bandai have not announced any plans to sell Battle Dodgeball 3 outside of the two game bundle.
{ "pile_set_name": "Pile-CC" }
From Give and Take to Give and Get: A CFO’s Journey “The best way to Get is by Giving. God has given us two hands, one to receive with and the other to give with. The more the hand that gives is busy, the more will you be blessed and will get in abundance.”- My Dad's last message to me hours before he passed away Warmth. This is the sensation that fills your heart with immense joy when you decide to do something for the larger good. Such is the joy of giving. It is the feeling you get when you are the reason behind someone’s smile, the sentiment you experience when what you did relieves or reduces someone’s misery and the notion that your action somewhat has given one a renewed perspective towards one’s life. And it gives you as much as it gives the receiver, if not more. My own journey of giving found its roots in my life as a CFO. Money doing good The key question I ask on anything that is brought in front of me for approval is: What is the ROI for this? It is the most critical question to ask whenever you are spending—or indeed, not spending. If it is spending, is that the best way to spend it? If I refrain from spending, then is that saving just there for security or is it way more than what is needed for security and can be spent on something more worthwhile. In a nutshell: is that money doing good? This forms the core philosophy I follow—not just in my professional capacity but also as an individual. Whatever you spend, wherever you invest, it should be the best use of that money, whether it is for you, your company, your people or the community. So when I look at spending, these are the four parameters I look at—I look for whether there is a balance in my spending among them and whether I am getting the best ROI. And the best ROI for money is money doing good. For me personally, Life is precious and precedes everything and no child should die due to lack of funds for treatment and there can be no better ROI supporting these children in need and giving life a chance. Where the heart beats In my personal and professional journeys, I have realised that life is not about wealth accumulation. It’s about living a good life. In my experience, a good life is about maintaining a balance—in everything, including spending and saving. When you spend, choose carefully where you spend. There are needs and wants to be addressed. Beyond that, what is it that you care about—a cause that matters to you, a way that you want to make a difference to society. Be associated with that cause, so that you can go beyond chequebook philanthropy. Often those who are inclined to do good get stuck at trying to figure out which charity to contribute towards- time or money. I believe it has to be something close to your heart, where you think you can make the maximum impact- maximise ROI. And if you still can’t make up your mind, look at your role models and peers and see where they are putting in their efforts. That way you can add your muscle to their work. That is what I did. I saw Prema Sagar and the tireless work she is doing at Genesis Foundation (GF) and decided to add might, energy and legs to her efforts. For those who don’t know, Genesis Foundation supports the treatment of critically ill under-privileged children with Congenital Heart Defects (CHD). It’s mission is simple—Save Little Hearts. GF believes that life is precious, and no child should die due to lack of funds or medical treatment. We envision an India devoid of deaths caused due to CHD because of lack of awareness, diagnosis or resources. Touching the lives of children from tribal areas to metro cities, GF has supported over 1650 children till date. I volunteer with GF to support in fund raising for child surgery, whether it is in the form of CSR partnerships or in terms of getting sponsors for its fund-raising events. Getting more than giving What started as a way of supporting Prema’s work became something far more personal—it became my own cause, my purpose of life, my own journey, my own source of immense satisfaction. The shift happened when I realised that the beneficiaries of the Foundation and their families were not the only ones getting something out of this. I was getting a lot too. An individual is rich in his or her truest sense when they participate in the act of giving. To support others makes you look beyond yourself. It dawns upon you the trivial nature of your problems and gives you a glimpse of the bigger picture. This is how the act of giving begins—by keeping your worries at bay and empathising with the outside world and identifying who needs your aid. This was really brought home to me recently after my father passed away. In the depths of my grief, I happened to visit one of the children GF supports. Interacting with the child, who was cheerful and smiling even though she had just gone through surgery and must have been in pain, I was reminded that there is a lot to be thankful for in my life and that there is a lot to be done. It gave me both, a reason to smile and a purpose to channel my energies towards. To all those reading this, I urge you to give ‘giving’ a chance. Identify a cause, and if that’s confusing, why not support something where you know the people involved—like Prema in the communications industry. Or find something close to your heart. No matter how big or small, no matter whether it’s in monetary form or your time and expertise, your contribution matters. And when you see the impact of your actions without expecting anything in return, you will realize what you have missed so far and the sheer contentment your soul gets by a single act of kindness. My dad a great influence in my life and my mentor always said, "The purpose of life is to serve, to give, to be useful, to be honourable, to be compassionate, to have it make some difference that you have lived and lived well.” I agree with dad and urge all to Save Little Hearts, Spread Joy, Make a difference, that's a life lived well!
{ "pile_set_name": "Pile-CC" }
New customer not impressed! on ‎03-04-201722:07 I have recently joined virgin from sky and I have to say I am not impressed. In the last few days I have had to restart my TiVo box everyday sometimes twice as I keep getting either error 319 or c501 when I want to watch on demand services! Re: New customer not impressed! Sorry...but get use to it... Tivo is crap in comparison to Sky. Just start counting the days till you can leave. I have to disagree, moved to Sky last year and currently counting down the days till I can move back, the SkyQ box is missing so many features that the TiVo has. Would you mind highlighting the features TiVo has which are missing on the SkyQ box. This is a genuine question... I have been with Virgin Media and its predecessors for almost 25 years... but I am so fed up with the faults, glitches and service I have been experiencing the last 6 months or so, that I am starting to look at other options (not just Sky). Re: New customer not impressed! Sorry...but get use to it... Tivo is crap in comparison to Sky. Just start counting the days till you can leave. I have to disagree, moved to Sky last year and currently counting down the days till I can move back, the SkyQ box is missing so many features that the TiVo has. Would you mind highlighting the features TiVo has which are missing on the SkyQ box. This is a genuine question... I have been with Virgin Media and its predecessors for almost 25 years... but I am so fed up with the faults, glitches and service I have been experiencing the last 6 months or so, that I am starting to look at other options (not just Sky). So any info/feedback would be appreciated. Many thanks.... The biggest annoyance is that Sky does not remember series links when a series ends, which is incredibly annoying as it means you have to keep scanning the schedules for re-starting series (bad enough for the main channels and even worse if it's a program that's tucked away on an obscure channel). Beyond that; Wishlists, Suggestions, multi-channel buffering, auto-scheduling of recordings, very limited control over series links (basically you just pick a showing and it will record that one each week\day, but it won't pick up other showings), the TV guide only goes one week into the future and you also can't check scheduled and recorded shows from the app (unless you pay for multi-screen, for some reason) You also don't get the Series Link+ functionality that pulls stuff in from Netflix etc. (if that's of interest). Only thing I've found better about it is the speed, but that's in comparison to the old TiVo not the V6. edit - Oh, and it's got an annoying thing that to exit a recording you press the "Back" button, which takes you back to that program within the menu but then to get back from there to the main menu you have to use the "Left" button, if you press back again it just drops you out into live TV and you have to then navigate back to the menu. Re: New customer not impressed! Sorry...but get use to it... Tivo is crap in comparison to Sky. Just start counting the days till you can leave. I have to disagree, moved to Sky last year and currently counting down the days till I can move back, the SkyQ box is missing so many features that the TiVo has. Would you mind highlighting the features TiVo has which are missing on the SkyQ box. This is a genuine question... I have been with Virgin Media and its predecessors for almost 25 years... but I am so fed up with the faults, glitches and service I have been experiencing the last 6 months or so, that I am starting to look at other options (not just Sky). So any info/feedback would be appreciated. Many thanks.... The biggest annoyance is that Sky does not remember series links when a series ends, which is incredibly annoying as it means you have to keep scanning the schedules for re-starting series (bad enough for the main channels and even worse if it's a program that's tucked away on an obscure channel). Beyond that; Wishlists, Suggestions, multi-channel buffering, auto-scheduling of recordings, very limited control over series links (basically you just pick a showing and it will record that one each week\day, but it won't pick up other showings), the TV guide only goes one week into the future and you also can't check scheduled and recorded shows from the app (unless you pay for multi-screen, for some reason) You also don't get the Series Link+ functionality that pulls stuff in from Netflix etc. (if that's of interest). Only thing I've found better about it is the speed, but that's in comparison to the old TiVo not the V6. edit - Oh, and it's got an annoying thing that to exit a recording you press the "Back" button, which takes you back to that program within the menu but then to get back from there to the main menu you have to use the "Left" button, if you press back again it just drops you out into live TV and you have to then navigate back to the menu. That's really useful... thank you. It's amazing that what seems like little things, can be a real pain when you'd think this kind of functionality should be simple and just work! As I mentioned in my original post, I've had cable TV for yonks... so it would be a big change for me to move elsewhere. I think I will wait for an upgrade to the V6 and see how that all goes. Thanks again... Re: New customer not impressed! on ‎05-04-201717:41 I really hope you havent recently been given a TIVO box? they are too old and can't seem to keep up with the graphics and data demands of the system, I have two of them and they have ground to a virtual halt over the last 2 years. Re: New customer not impressed! on ‎07-04-201700:51 Understand it is a personal preference ultimately, but can't think of any Tivo feature I would miss. I hate ...and I mean hate using the user interface, waiting 30sec+ for the user guide to load. Slow and clunky menus, pixelation on programs frequently. Navigation of box sets or movies is horrendous. Randomly recording programs that I have no interest in. I could go on...but think you get the message. The current Tivo box (not the V6 which they want to charge me 100quid plus to get something that almost works) is just crap. I've had Tivo for a few months, so my initial disappointment has mellowed into just plain loathing. I watch far less TV than I ever have. I now use my smart TV features - BBC Iplayer or Netflix - trying to use that on the Tivo box is a complete joke...it takes minutes to load...and I mean several minutes!
{ "pile_set_name": "Pile-CC" }
Maniac Films Covid-19 Virus UpdateManiac Films are still operating our camera hire service and will continue to do so until advised otherwise by the Government. As a precaution we have increased our hygeine practises including the careful cleaning of any equipment returned to us Our next day courier APC are still delivering, although drivers are taking precautions such as minimal contact with recipients Please note: Due to courier restictions we are unable to ship out any orders on the same day as your order is placed. All orders will need to be completed by 4:30pm on the day before shipping. Thank you for your understanding. Miscellaneous These are articles that do not fall into a specific category. They cover work that we have carried out for our clients that are outside of our usual projects, or are extras that we have carried out as part of a larger project. If you require photography or web services as part of your project, just let us know and we will do our best to accommodate your needs. We have been busy editing a range of new product photos taken for www.genesissurfshop.com. We were photographing a new line of t-shirts from popular mens brand 'Old Guys Rule' which will be sold on the Genesis online store. The t-shirts were modelled by Robin, the owner of the s... Over the weekend of the 20-22nd April 2018, North Devon played host to the glitz & glamour of the 2018 Ilfracombe Film Festival. The festival played host to a wide range of both blockbuster and indie films and even saw the town being invaded by zombies on Friday night! As part of t... We have been working with local store Lambland in Ilfracombe, photographing the spring/summer product ranges for their online store. The products have ranged from leather handbags & holdalls, to sheepskin mocassins and sheepskin rugs. We photographed most of the products in our s... On Saturday, Stu met up with local celebrity dog Ragamuffin Lewis at the re-launch launch event for the Larkstone Cafe in Ilfracombe. Already the star of his own YouTube TV series - The Adventures Of Ragamuffin Lewis, Ragamuffin had been asked to attend the event, to meet the customers ... We have delivered photos to Genesis Surf shop for their summer clothing & accessories rage - which will appear on www.genesissurfshop.com. The products ranged from t-shirts to wallets and all were photographed in our studio. Smaller items were photographed in our light tent. M... Today our studio took on a new, hollywood feel as we welcomed back our canine model with a number of costumes to wear. Stu was conducting another photo shoot with Ragamuffin Lewis in the lead up to the launch of his new YouTube TV series - The Adventures Of Ragamuffin Lewis. The aim of ... Our studio became a doggy paradise today, as it was full of bones, dog toys, sausages, bacon, dog biscuits and more! Stu was conducting a photo shoot with Ragamuffin Lewis in the lead up to the launch of his new YouTube TV series - The Adventures Of Ragamuffin Lewis. The aim of the shoo... Something a little different today. Stu has just finished a studio photoshoot with Ragamuffin Lewis. Ragamuffin the faithful canine companion of Fiona Lewis, and she has set-up Facebook & Twitter accounts where people can follow Ragamuffins adventures. The photoshoot, which was set ... It's been a busy month for website design at Maniac. Today the brand new Abbeymead Safety Training has gone live to the public. The new site replaces an older one, which was very basic and out of date. Abbeymead Safety Training specialise in workplace safety training courses... We have been working hard to bring the Genesis Surf Shop online store to mobile devices and the site is now live. This has meant a lot of work to modify the heavily customised online store in order to optimise it for mobile phones - adding a responsive feel that changes for mobile phone... Today the new responsive mobile website for Cozy Comforts went live to the public. We have been developing this web site alongside a new mobile friendly website for local surf shop Genesis which should go live later this week. We plan to gradually add extra features to the site over ... Stu has spent the morning photographing at a health & safety training session with Abbeymead Safety Training. The photos will form part of a complete re-design and relaunch of their current website, which is quite outdated and was inherited from the previous business owner. The ... We have been working to build a brand new online store for new company CozyComforts.co.uk, a website which offers quality sheepskin and leather clothing and household goods. The website is still being updated, with new products being added all of the time. We were under a deadline as the ... Stu has been taking photographs down at the new North Devon Wake Park based at The Milky Way near Clovelly with some of their top riders which will be used alongside a new promo film we are filming. Stu really enjoyed the shoot, it was a beautiful day and he got to spend most of it wadi... Over the last couple of months we have been completely re-designing and re-vamping the website for ECombat, worldwide suppliers of laser tag gaming equipment. The website had to reflect their brand, stepping away from the old design which was cluttered and difficult to navigate. A ... Our IT apprentice Barnaby has been working on a major update to the Trail Ferret website that he designed and built earlier this year. Having been pleased with the original website, owner Ben came up with some new ideas that he would like to incorporate - adding new features to the exitin... We have just completed a major website facelift for Ilfracombe based online surf store Genesis Surf Shop. The site was looking dated and cluttered so the owners asked us to create a new layout. Users should instantly find the site easier. The old layout used side columns full of adverts... Our IT apprentice Barnaby has completed his first full project since starting work with us in February! Trail Ferret is a website for local man Ben, who arranges training and trail running events in the local area. Ben asked us to build him a site to promote his business, a site that al...
{ "pile_set_name": "Pile-CC" }
Most of the lesbian, gay, bisexual, transgender, and questioning (LGBTQ) youth we saw on the news in 2011 were dead. Last fall, media outlets around the country reported on the death of Rutgers University student Tyler Clementi. After that, it seemed like everywhere we looked, another teenager was making headlines for ending his or her life. Just this week, we lost another, 19-year-old filmmaker and activist Eric James Borges. The New York Times reported on five known suicides by LGBTQ youth in September 2011 alone. The number of these stories far outpaces any other representation of these youth in broader circulation. This focus on the contemporary scourge of teen suicides belies a troubling truth: it is far easier to talk about the tragedy of LGBTQ youth suicide than it is to find ways to comprehend and address the complexity of their lives and identities. By most accounts, it is tremendously difficult to be a gender-nonconforming or queer young person today. A 2010 study piloted by the Family Acceptance Project at San Francisco State University concluded that the persistent bullying and harassment experienced by students perceived by their peers to be LGBTQ (many of who may not even identify with those labels) led directly to lower levels of life satisfaction and higher rates of depression in young adulthood. A 2009 article in the journal Pediatrics reported that lesbian, gay, and bisexual (LGB) young adults who experienced high levels of rejection from family members were 8.4 times more likely to attempt suicide. They were also more likely to experience depression and to attempt to self-medicate with alcohol and illegal drugs. And rejection isn't only verbal and physical abuse; it even includes hearing family members make disparaging comments about other LGBT people, being asked to remain silent about their identities, or being blamed for the bullying and harassment they receive from peers. In short, all the things adults say or do not say affect how these kids feel about themselves and what they believe their chances are for living a happy life. Where are the stories of the youth who face these damaging threats on a daily basis and the culpability of adults in their suffering? LGBTQ youth also face pernicious structural and institutional forms of violence. Yale sociologists Katherine Himmelstein and Hannah Bruckner use surveys from the National Longitudinal Study of Adolescent Health to demonstrate that nonheterosexual youth are no more likely than heterosexual youth to engage in violent behavior. They are, however, far more likely to be detained and arrested by police, more likely to be convicted of crimes, and are, each year, expelled from school in greater numbers. Individual-level prejudice translates into systematic deprivations of liberty and a persistent sense that there are few adults in whom they can trust. Where are the stories of these injustices? Where is our collective outrage at the systems that perpetuate them? These stories make neglect by school administrators, parents, and peers seem like universal reactions to sexual and gender difference in youth. They aren't. The Family Acceptance Project research also shows that youth with supportive family members do better in school, feel more content with their lives, make better decisions, and have healthier bodies and minds. Support means more than merely "tolerating" difference. Parents must show affection and love, even if their child's identity makes them uncomfortable. They must intervene and prevent other adults and children from victimizing their child. And they must provide their child with connections to other LGBTQ youth and adults. They must actively foster positive, healthy, and accessible queer role models. Wouldn't it be great if the media did the same? Don't get me wrong: LGBTQ teen suicide is a very serious problem. The Suicide Prevention Resource Center estimates that between 30 and 40 percent of LGB youth attempt suicide -- roughly 4 times the rate of their heterosexual peers. There's no question, given these statistics, that the struggles and recent deaths of so many youth deserve our attention, discussion, and deep grief. We need to hear these stories and acknowledge these losses. However the media's singular focus on them, to the exclusion of any positive coverage of LGBTQ youth, creates a deadly echo chamber. The repetitive tale about the inevitability of our collective failure to address the pain felt by many LGBTQ youth may translate into high readership rates, but it doesn't translate into inspiration for the kids who are still here. More than 50 research studies show that persistent and prominent news coverage of suicides can lead to an increase in the likelihood that other vulnerable individuals might attempt it themselves. Given the unrelenting discrimination they face, LGBTQ youth may be particularly vulnerable to this phenomenon, called suicide contagion, or so says Christopher Gandin Le, a former staff member of the National Suicide Prevention Hotline who founded a company that promotes mental health through online social networks. "These youth need the media to create messages of resilience, not messages of desperation," he says. The frequency and ardor with which we report on LGBTQ suicide has begun to make it seem as if these deaths are unavoidable, even normative responses to homophobia in our culture. They aren't. In the face of tremendous overt hostility and covert neglect, still, most LGBTQ teenagers do not wish to end their lives. The Trevor Project, a national crisis and suicide prevention hotline for LGBTQ youth, has fielded over 200,000 calls since its inception in 2008, calls from youth reaching out for affirmation and support. They survived. Some of them even thrived. Where are their stories? In August, 14-year-old Jonah Mowry posted a video on YouTube describing on a series of written notecards the daily harassment he faces as a gay youth. With tears rolling down his face, he tells us that suicide was an option for him many times. In the end, he takes a deep breath and displays his final cards. He says, "I'm not going anywhere, because I'm STRONGER than that... and... I have a million reasons to be here." As it turns out, Mowry has 7.6 million reasons to be here -- that's how many people have viewed his video in the handful of months it has been online. Since then, he has appeared on television with his family. Some of the bullies who initially targeted him have apologized. He says a weight has been lifted off his shoulders. "I'm more confident, and I feel stronger every day." To put this in perspective, the 2,000 videos submitted to Dan Savage's It Gets Better campaign have received, collectively, about 10 million views from around the world. Knowing that a positive life as an adult awaits them does precious little for the youth who remain trapped in the immediacy of their need. They need stories of teenagers just like them who are safe and happy now. They need images of peers like Johnny Robinson, a 17-year-old, gay homecoming king from Limerick, Pa., who made his own video for Jonah, to reassure him that there are others just like him who survived experiences of bullying, who thrived. In it, he smiles into the camera and holds up his own set of note cards, which read, "Being different... is what helps you stand out. It's what makes you you. Love who you are... because we believe in you." He tells Jonah, "You have already changed the world."
{ "pile_set_name": "OpenWebText2" }
Digital gastrointestinal imaging: the effect of pixel size on detection of subtle mucosal abnormalities. Five radiographs of double-contrast colon examinations demonstrating subtle mucosal changes of inflammatory bowel disease and five radiographs of healthy colonic mucosa were selected and digitized to four levels of resolution. Pixel sizes of 0.1 mm, 0.2 mm, 0.4 mm, and 0.8 mm were used. Ten radiologists interpreted the images, which were displayed on laser-printed film. Analysis of variance with repeated measures was performed and receiver operator characteristic curves were determined. The results demonstrate that the sensitivity in detecting subtle mucosal abnormalities improved as the resolution improved, with the best sensitivity at the highest resolution; more experienced readers detected details well even at the poorer levels of resolution; the resolution necessary for successfully evaluating the colonic mucosa was lower than expected; and given low noise levels, the matrix size used in conventional television fluoroscopy would be adequate for mucosal evaluation.
{ "pile_set_name": "PubMed Abstracts" }
Such unmanned aircraft, remotely controlled from the ground station, such as for example quadcopters, are used to take panoramic aerial images. For this purpose, in known aircraft usually multiple camera devices are arranged on a frame of the aircraft, wherein the camera devices, if possible, are arranged in such a way that fields of vision of the camera devices overlap one another at a distance to the aircraft, in order to allow for the imaging of the entire surroundings of the aircraft. In addition, it must be ensured that no components of the aircraft are located within the fields of vision of the camera devices, in order to not impair the panoramic image around the aircraft. In order to achieve this, the camera devices are usually, if possible, arranged as far to the outside on the aircraft as possible, so that the remaining components of the aircraft are possibly arranged behind the respective camera device. The aircraft known from the prior art having camera devices for capturing the entire surroundings of the aircraft are best suited to create panoramic images of the environment from greater distances to the aircraft. The nearer the objects to be imaged in the environment come closer to the aircraft, the more difficult the imaging with the aircraft known from the prior art, as the different fields of vision of the camera devices intersect with one another only at a considerable distance to the aircraft, due to the spaced arrangement of the camera devices to one another, and form a visual area surrounding the entire aircraft in which all of the objects can be entirely imaged. Capturing and creation of panoramic images of the environment can however exclusively occur at the distance to the aircraft, in which the surroundings are entirely imaged and in which therefore, the fields of vision of the various camera devices in each case intersect one another. For this reason, aircraft known from the prior art are not suited to capture and create panoramic images, for example in case of a closer fly-by to a building, in a fly-through among buildings or for example also through forests or the like, as in such imaging, the objects to be captured are regularly found outside the field of vision of the camera, so that these objects can each only partially be imaged, and the capture of a complete panoramic image of the entire surroundings of the aircraft at every point in time of the fly-by is not possible or only possible to a limited extent. The field of vision of a camera device refers to the area or the volume of the object space or of the surroundings of the aircraft which can be captured with the camera device. When using a camera device with a rectangular photo sensor, the field of vision of the camera device is shaped like a truncated pyramid, wherein a tip of the pyramid is located in the focal point of the camera device on the objective side. It is considered the object of the invention to further develop the aircraft known from prior art in such a way that as complete as possible depictions of the environment or panoramic images are also possible in the case of fly-bys as close to objects as possible.
{ "pile_set_name": "USPTO Backgrounds" }
No comments yet. Ruby Violence posted to Blue Blood VIP in a set by Brett Nelson called Tribal Lust. Interested in being a Blue Blood model, writer, illustrator, or photographer? Contact us: BlueBloodPhoto.com
{ "pile_set_name": "OpenWebText2" }
Determination of Short-Chain Fatty Acids in Mouse Feces by High-Performance Liquid Chromatography Using 2-Nitrophenylhydrazine as a Labeling Reagent. It has been suggested that imbalances in gut microbiota are related to diseases associated with metabolism, the central nervous system, etc. Therefore, analysis of short-chain fatty acids (SCFAs) produced by gut microbiota is very important as an indicator of causation, demonstrating the effects on the host due to changes in the gut microbiota. We developed a HPLC method for the determination of SCFAs in mouse feces. After homogenization, the SCFAs in mouse feces and 2-ethylbutyric acid (internal standard) were derivatized with 2-nitrophenylhydrazine (2-NPH) in the presence of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide. The 2-NPH derivatives of SCFAs and the internal standard were separated on a reversed-phase column (octadecyl silyl column) by gradient elution using phosphoric acid (pH 2.5)-acetonitrile at 50°C and detected by absorbance measurement at 400 nm. The recovery of the method was 90-115%, with a precision (relative standard deviation) of 1.3-7.7%. The determination of SCFAs by the present method can provide useful information for biological and clinical research.
{ "pile_set_name": "PubMed Abstracts" }
Q: Processing \Animation in NetSuite I have this client script which copies the line number entered in Copy line# and creates new lines from number of lines entered in Copy #Times. This thing takes time when you increase the number of lines you require to copy. So can we give any processing animation till all the lines are set so user dont have to worry? I have tried giving dialog.create but it didnt work. I want the animation to stay until script is executing and after that stop. var options = { title: 'Alert', message: 'Processing. Please wait.', buttons: [{ label: 'OKK...', value: 1 }, ] }; dialog.create(options).then(success) return (true); success is a function I am calling. A: The N/ui/dialog module is intended for showing dismissable messages, and won't really work for progress bars as you cannot hide the buttons, nor close it via code. I would recommend looking at a third party library. A very popular one is SweetAlert2, and there is some sample code on the NetSuite Professionals site for using it with NetSuite. If you just want a quick hack, you could just used the Ext.js library that NetSuite includes by default on all pages. However I would highly recommend not doing so for any production code because NetSuite could update or remove it at any time in a future upgrade. var messageBox = Ext.MessageBox.show({ title: 'Lines are being copied...', msg: 'This may take a couple minutes', wait: true, width: 250 }); // your work here messageBox.hide()
{ "pile_set_name": "StackExchange" }
Knowledge-based engineering Knowledge-based engineering (KBE) is the application of knowledge-based systems technology to the domain of manufacturing design and production. The design process is inherently a knowledge-intensive activity, so a great deal of the emphasis for KBE is on the use of knowledge-based technology to support computer-aided design (CAD) however knowledge-based techniques (e.g. knowledge management) can be applied to the entire product lifecycle. The CAD domain has always been an early adopter of software-engineering techniques used in knowledge-based systems, such as object-orientation and rules. Knowledge-based engineering integrates these technologies with CAD and other traditional engineering software tools. Benefits of KBE include improved collaboration of the design team due to knowledge management, improved re-use of design artifacts, and automation of major parts of the product lifecycle. Overview KBE is essentially engineering on the basis of knowledge models. A knowledge model uses knowledge representation to represent the artifacts of the design process (as well as the process itself) rather than or in addition to conventional programming and database techniques. The advantages to using knowledge representation to model industrial engineering tasks and artifacts are: Improved integration. In traditional CAD and industrial systems each application often has its own slightly different model. Having a standardized knowledge model makes integration easier across different systems and applications. More re-use. A knowledge model facilitates storing and tagging design artifacts so that they can easily be found again and re-used. Also, knowledge models are themselves more re-usable by virtue of using formalism such as IS-A relations (classes and subclasses in the object-oriented paradigm). With subclassing it can be very easy to create new types of artifacts and processes by starting with an existing class and adding a new subclass that inherits all the default properties and behaviors of its parents and then can be adapted as needed. Better maintenance. Class hierarchies not only facilitate re-use they also facilitate maintenance of systems. By having one definition of a class that is shared by multiple systems, issues of change control and consistency are greatly simplified. More automation. Expert system rules can capture and automate decision making that is left to human experts with most conventional systems. KBE can have a wide scope that covers the full range of activities related to Product Lifecycle Management and Multidisciplinary design optimization. KBE's scope includes design, analysis (computer-aided engineering – CAE), manufacturing, and support. In this inclusive role, KBE has to cover a large multi-disciplinary role related to many computer-aided technologies (CAx). There are two primary ways that KBE can be implemented: Build knowledge models from the ground up using knowledge-based technology Layer knowledge-based technology on top of existing CAD, simulation, and other engineering applications An early example of the first approach was the Simkit tool developed by Intellicorp in the 1980s. Simkit was developed on top of Intellicorp's Knowledge Engineering Environment (KEE). KEE was a very powerful knowledge-based systems development environment. KEE started on Lisp and added frames, objects, and rules, as well as powerful additional tools, such as hypothetical reasoning and truth maintenance. Simkit added stochastic simulation capabilities to the KEE environment. These capabilities included an event model, random distribution generators, simulation visualization, and more. The Simkit tool was an early example of KBE. It could define a simulation in terms of class models and rules and then run the simulation as a conventional simulation would. Along the way, the simulation could continue to invoke rules, demons, and object methods, providing the potential for much richer simulation as well as analysis than conventional simulation tools. One of the issues that Simkit faced was a common issue for most early KBE systems developed with this method: The Lisp knowledge-based environments provide very powerful knowledge representation and reasoning capabilities; however, they did so at the cost of massive requirements for memory and processing that stretched the limits of the computers of the time. Simkit could run simulations with thousands of objects and do very sophisticated analysis on those objects. However, industrial simulations often required tens or hundreds of thousands of objects, and Simkit had difficulty scaling up to such levels. The second alternative to developing KBE is illustrated by the CATIA product suite. CATIA started with products for CAD and other traditional industrial engineering applications and added knowledge-based capabilities on to them; for example, their KnowledgeWare module. History KBE developed in the 1980s. It was part of the initial wave of investment in Artificial Intelligence for business that fueled expert systems. Like expert systems, it relied on what at the time were leading edge advances in corporate information technology such as PCs, workstations, and client-server architectures. These same technologies were also facilitating the growth of CAx and CAD software. CAD tended to drive leading edge technologies and even push them past their current limits. The best example of this was object-oriented programming and database technology, which were adapted by CAD when most corporate information technology shops were dominated by relational databases and procedural programming. As with expert systems, KBE suffered a downturn during the AI Winter. Also, as with expert systems and artificial intelligence technology in general, there was renewed interest with the Internet. In the case of KBE, the interest was perhaps strongest in the business-to-business type of electronic commerce and technologies that facilitate the definition of industry standard vocabularies and ontologies for manufactured products. The semantic web is the vision of Tim Berners Lee for the next generation of the Internet. This will be a knowledge-based Internet built on ontologies, objects, and frame technologies that were also enabling technologies for KBE. Important technologies for the semantic web are XML, RDF, and OWL. The semantic web has excellent potential for KBE, and KBE ontologies and projects are a strong area for current research. KBE and product lifecycle management Product Lifecycle Management (PLM) is the management of the manufacturing process of any industry that produces goods. It can span the full product lifecycle from idea generation to implementation, delivery, and disposal. KBE at this level will deal with product issues of a more generic nature than it will with CAx. A natural area of emphasis is on the production process; however, lifecycle management can cover many more issues such as business planning, marketing, etc. An advantage of using KBE is getting the automated reasoning and knowledge management services of a knowledge-based environment integrated with the many diverse but related needs of lifecycle management. KBE supports the decision processes involved with configuration, trades, control, management, and a number of other areas, such as optimization. KBE and CAx CAx refers to the domain of computer-aided tools for analysis and design. CAx spans multiple domains. Examples are computer-aided design of manufactured parts, software, the architecture of buildings, etc. Although each specific domain of CAx will have very different kinds of problems and artifacts, they all share common issues as well such as having to manage collaboration of sophisticated knowledge workers, design and re-use of complex artifacts, etc. Essentially KBE extends, builds on, and integrates with the CAx domain typically referred to as Computer Aided Design (CAD). In this sense KBE is analogous to Knowledge-Based Software Engineering, which extended the domain of Computer Aided Software Engineering with knowledge-based tools and technology. What KBSE was to software and CASE, KBE is to manufactured products and CAD. An example can be taken from Boeing's experience. The 777 Program took on the challenge of having a digitally-defined plane. That required an investment in large-scale systems, databases, and workstations for design and analytical engineering work. Given the magnitude of the computing work that was required, KBE got its toe in the door, so to speak, through a "pay as you go plan." Essentially, this technique was to show benefits and then to obtain more work (think agile engineering) thereby. In the case of the 777, the project got to where influences to changes in the early part of the design/build stream (loads) could be recomputed over a weekend to allow evaluation by downstream processes. As required, engineers were in the loop to finish and sign off on work. At the same time, CAx allowed tighter tolerances to be met. With the 777, KBE was so successful that subsequent programs applied it in more areas. Over time, KBE facilities were integrated into the CAx platform and are a normal part of the operation. KBE and knowledge management One of the most important knowledge-based technologies for KBE is knowledge management. Knowledge management tools support a wide spectrum repository, i.e., a repository that can support all different types of work artifacts: informal drawings and notes, large database tables, multimedia and hypertext objects, etc. Knowledge management provides the various group support tools to help diverse stake holders collaborate on the design and implementation of products. It also provides tools to automate the design process (e.g., rules) and to facilitate re-use. KBE methodology The development of KBE applications concerns the requirements to identify, capture, structure, formalize, and finally implement knowledge. Many different so-called KBE platforms support only the implementation step, which is not always the main bottleneck in the KBE development process. In order to limit the risk associated with the development and maintenance of KBE application, there is a need to rely on an appropriate methodology for managing the knowledge and maintaining it up to date. As example of such KBE methodology, the EU project MOKA, "Methodology and tools Oriented to Knowledge based Applications," proposes solutions which focus on the structuring and formalization steps as well as links to the implementation. An alternative to MOKA is to use general knowledge engineering methods that have been developed for expert systems across all industries or to use general software development methodologies such as the Rational Unified Process or Agile methods. Languages for KBE Two critical issues for the languages and formalisms used for KBE are: Knowledge-based vs. procedural programming Standardization vs. proprietary Knowledge-based vs. procedural programming A fundamental trade-off identified with knowledge representation in artificial intelligence is between expressive power and computability. As Levesque demonstrated in his classic paper on the topic, the more powerful a knowledge-representation formalism one designs, the closer the formalism will come to the expressive power of first order logic. As Levesque also demonstrated, the closer a language is to First Order Logic, the more probable that it will allow expressions that are undecidable or require exponential processing power to complete. In the implementation of KBE systems, this trade off is reflected in the choice to use powerful knowledge-based environments or more conventional procedural and object-oriented programming environments. Standardization vs. proprietary There is a trade off between using standards such as STEM and vendor- or business-specific proprietary languages. Standardization facilitates knowledge sharing, integration, and re-use. Proprietary formats (such as CATIA) can provide competitive advantage and powerful features beyond current standardization. Genworks GDL, a commercial product whose core is based on the AGPL-licensed Gendl Project, addresses the issue of application longevity by providing a high-level declarative language kernel which is a superset of a standard dialect of the Lisp programming language (ANSI Common Lisp, or CL). Gendl/GDL itself is proposed as a de facto standard for ANSI CL-based KBE languages. In 2006, the Object Management Group released a KBE services RFP document and requested feedback. To date, no OMG specification for KBE exists; however, there is an OMG standard for CAD services. An example of a system-independent language for the development of machine-readable ontologies that is in the KBE domain is Gellish English. KBE in Academia Knowledge-based engineering at the Norwegian University of Science and Technology (NTNU) Aircraft Design & Design Methodologies department at the Faculty of Aerospace Engineering of the Delft University of Technology See Webliography for AI in Design hosted by Worcester Polytechnic Institute and the NSF Report "Research Opportunities in Engineering Design." Knowledge-based engineering lab at Birmingham City University Implementations The following KBE development packages are commercially available: For CAD CADECWorks Solidworks Certified Gold Partner by Mark Design Solutions Pvt Ltd India Mark Design Solutions CADECEdge KBE tool for SolidEdge by Mark Design Solutions Pvt Ltd India Mark Design Solutions Adaptive Modeling Language from TechnoSoft Inc. DriveWorks A SolidWorks Certified Gold Partner The Gendl Project Genworks GDL from Genworks International Kadviser from NIMTOTH previously edited by Kade-Tech KBEWorks by VisionKBE Knowledge Fusion from Siemens PLM Software Rulestream from Siemens PLM Software Knowledgeware from Dassault Systemes ICAD from Dassault Systemes (no longer available) PTC Creo previously PRO/Engineer from Parametric Technology Corporation SmartAssembly for Pro/ENGINEER from Sigmaxim Inc Tacton Interactive Design Automation for SOLIDWORKS, Autodesk Inventor, and PTC Creo. A SOLIDWORKS Certified Gold Product , Autodesk Certified Application , and PTC Technology Partner. YVE - Your Variant Engineer from tecneos software-engineering KBMax Product Configurator Software Genus Designer by Genus Software, Inc. Design++ from Design Power For general-purpose development of web-deployed applications The Gendl Project Genworks GDL from Genworks International For analysis, design and engineering processes Adaptive Modeling Language from TechnoSoft Inc. Enventive by Enventive Engineering, Inc. the Gendl Project Genworks GDL from Genworks International Pacelab Suite by PACE Aerospace Engineering and Information Technology GmbH PCPACK by Tacit Connexions ParaPy by ParaPy Quaestor by Maritime Research Institute Netherlands See also Knowledge-based systems Knowledge engineering Knowledge management Multidisciplinary design optimization References External links Practical issues of AI (1994) - Switlik, J.M. (based upon ICAD project) McGoey, Paul (2011) A Hitch-hikers Guide to: Knowledge Based Engineering in Aerospace (& other industries) Alcyon Engineering: Introduction to Knowledge Based Engineering A KBE System for the Design of Wind Tunnel Models Using Reusable Knowledge Components ASME Newsletter ASME celebrates 125th Anniversary COE Newsnet 02/07 How Paradigms of Computing Might Relate to KBE COE Newsnet KBE Best Practices - Discussion Forum KE-works knowledge engineering - a company introducing KBE applications to industry - KBE explanatory video Keys to Success with Knowledge-Based Techniques - SAE Paper Number 2008-01-2262 Knowledge Based Engineering across Product Realization - A whitepaper presented on KBE in PLM domain. Knowledge Technologies - a free e-book by Nick Milton that has a chapter describing KBE (Chapter 3, co-authored with G. La Rocca from TU Delft) Category:Computer-aided design Category:Knowledge engineering Category:Product lifecycle management Category:Knowledge management
{ "pile_set_name": "Wikipedia (en)" }
Demarcating the dirty work: Canadian Fertility professionals' use of boundary-work in contentious egg donation. The potential medical risks to egg donors, in addition to the concern over the commodification of life, has led to debates surrounding the ethics of paying donors. In Canada, payment for eggs is prohibited by law; however, what is considered payment is contentious and has yet to be defined. The lack of legislative clarity coupled with increased ethical concerns over paying a donor has shifted egg donation from a medically-controlled procedure to a legal and social endeavor involving multiple professionals. Through semi-structured interviews with 52 medical and non-medical fertility practitioners, I show how medical practitioners use boundary-work to remove their practice from the ethical and legal debates surrounding egg donation, the "dirty work". I examine how the medical profession relies on discourses of "practicing science" to present their work as favorable and removed from current debates and potential legal ramifications. In showing how medical practitioners rely on boundary-work to distinguish their work from non-scientific and non-medical activities, I expand Gieryn's original conceptualization of boundary-work to demonstrate how medical practitioners can selectively draw on their practice of science to remove their work from ethically and legally contentious issues, the dirty work.
{ "pile_set_name": "PubMed Abstracts" }
Device-associated infection rates and extra length of stay in an intensive care unit of a university hospital in Wroclaw, Poland: International Nosocomial Infection Control Consortium's (INICC) findings. The aim of this study was to determine device-associated health care-associated infections (DA-HAI) rates, microbiologic profile, bacterial resistance, and length of stay in one intensive care unit (ICU) of a hospital member of the International Nosocomial Infection Control Consortium (INICC) in Poland. A prospective DA-HAI surveillance study was conducted on an adult ICU from January 2007 to May 2010. Data were collected by implementing the methodology developed by INICC and applying the definitions of DA-HAI provided by the National Healthcare Safety Network at the US Centers for Disease Control and Prevention. A total of 847 patients hospitalized for 9386 days acquired 206 DA-HAIs, an overall rate of 24.3% (95% confidence interval [CI], 21.5-27.4), and 21.9 (95% CI, 19.0-25.1) DA-HAIs per 1000 ICU-days. Central line-associated bloodstream infection rate was 4.01 (95% CI, 2.8-5.6) per 1000 catheter-days, ventilator-associated pneumonia rate was 18.2 (95% CI, 15.5-21.6) per 1000 ventilator-days, and catheter-associated urinary tract infection rate was 4.8 (95% CI, 3.5-6.5) per 1000 catheter-days. Length of stay was 6.9 days for those patients without DA-HAI, 10.0 days for those with central line-associated bloodstream infection, 15.5 days for those with ventilator-associated pneumonia, and 15.0 for those with catheter-associated urinary tract infection. Most DA-HAI rates are lower in Poland than in INICC, but higher than in the National Healthcare Safety Network, expressing the feasibility of lowering infection rates and increasing patient safety.
{ "pile_set_name": "PubMed Abstracts" }