text
stringlengths
1
3.78M
meta
dict
.\" Copyright (c) 2006,2008 Joseph Koshy. All rights reserved. .\" .\" Redistribution and use in source and binary forms, with or without .\" modification, are permitted provided that the following conditions .\" are met: .\" 1. Redistributions of source code must retain the above copyright .\" notice, this list of conditions and the following disclaimer. .\" 2. Redistributions in binary form must reproduce the above copyright .\" notice, this list of conditions and the following disclaimer in the .\" documentation and/or other materials provided with the distribution. .\" .\" This software is provided by Joseph Koshy ``as is'' and .\" any express or implied warranties, including, but not limited to, the .\" implied warranties of merchantability and fitness for a particular purpose .\" are disclaimed. in no event shall Joseph Koshy be liable .\" for any direct, indirect, incidental, special, exemplary, or consequential .\" damages (including, but not limited to, procurement of substitute goods .\" or services; loss of use, data, or profits; or business interruption) .\" however caused and on any theory of liability, whether in contract, strict .\" liability, or tort (including negligence or otherwise) arising in any way .\" out of the use of this software, even if advised of the possibility of .\" such damage. .\" .\" $Id: gelf_getsym.3 3734 2019-04-22 14:10:49Z jkoshy $ .\" .Dd April 22, 2019 .Dt GELF_GETSYM 3 .Os .Sh NAME .Nm gelf_getsym , .Nm gelf_update_sym .Nd read and update symbol information .Sh LIBRARY .Lb libelf .Sh SYNOPSIS .In gelf.h .Ft "GElf_Sym *" .Fn gelf_getsym "Elf_Data *data" "int ndx" "GElf_Sym *sym" .Ft int .Fn gelf_update_sym "Elf_Data *data" "int ndx" "GElf_Sym *sym" .Sh DESCRIPTION These convenience functions are used to retrieve and update class-dependent .Vt Elf32_Sym and .Vt Elf64_Sym structures in an ELF object. .Pp Argument .Ar data is an .Vt Elf_Data descriptor associated with a section of type .Dv SHT_SYMTAB , .Dv SHT_DYNSYM or .Dv SHT_GNU_versym . Argument .Ar ndx is the index of the symbol being retrieved or updated. The class-independent .Vt GElf_Sym structure is described in .Xr gelf 3 . .Pp Function .Fn gelf_getsym retrieves class-dependent symbol information at index .Ar ndx in data buffer .Ar data and copies it to the destination pointed to by argument .Ar sym after translation to class-independent form. .Pp Function .Fn gelf_update_sym converts the class-independent symbol information pointed to by argument .Ar sym to class-dependent form, and writes it to the symbol entry at index .Ar ndx in the data buffer described by argument .Ar data . Function .Fn gelf_update_sym signals an error if any of the values in the class-independent representation exceeds the representable limits of the target type. .Sh RETURN VALUES Function .Fn gelf_getsym returns the value of argument .Ar sym if successful, or NULL in case of an error. Function .Fn gelf_update_sym returns a non-zero value if successful, or zero in case of an error. .Sh ERRORS These functions may fail with the following errors: .Bl -tag -width "[ELF_E_RESOURCE]" .It Bq Er ELF_E_ARGUMENT Arguments .Ar data or .Ar sym were NULL. .It Bq Er ELF_E_ARGUMENT Argument .Ar ndx was less than zero or larger than the number of symbols in the data descriptor. .It Bq Er ELF_E_ARGUMENT Data descriptor .Ar data was not associated with a section containing symbol information. .It Bq Er ELF_E_RANGE A value was not representable in the target type. .It Bq Er ELF_E_VERSION The .Vt Elf_Data descriptor denoted by argument .Ar data is associated with an ELF object with an unsupported version. .El .Sh SEE ALSO .Xr elf 3 , .Xr elf_getdata 3 , .Xr elf_getscn 3 , .Xr gelf 3 , .Xr gelf_getsyminfo 3 , .Xr gelf_update_syminfo 3
{ "pile_set_name": "Github" }
A modular computer system for the nuclear medicine/ultrasound laboratory. Computer-controlled graphic displays are a necessity in many nuclear medicine studies. The authors propose using a set-up consisting of three modules: (a) a display system based on television technology; (b) an instrument interface employing list mode and having a low information loss rate; and (c) flexible modular software which can easily be tailored to the needs of both radiologists and technicians. The authors consider a mini-computer system with broad, flexible applications to be a valuable tool, particularly for those function studies which can only be done by means of nuclear medicine techniques.
{ "pile_set_name": "PubMed Abstracts" }
Forty kilometres west of Australia's hottest town of Marble Bar is the North Pole... the North Pole Dome to be precise. It's a rocky area that attracts scientists and geologists from around the world as they search not only for ancient rocks but early forms of life on Earth. Stromatolites and micobacteria fossils have been found, but a more recent discovery is even more exciting. Dr David Wacey of University of West Australia is part of an international team that's found an ecosystem of single celled bacteria that has pushed back the age of life to 3.5 billion years old. "What we've found may be the earliest evidence of life on earth," Dr Wacey says. "It's hard to get your head around that it's 3.5 billion years old. It's just a crazy number." The discovery is also helpful to the search for life on other planets, because the traces left by these primitive cells can be seen with the naked eye. Thus the Mars Rover for example could send back pictures of the ecosystem which could be compared to the microbial ecosystem found in the Pilbara. Dr Wacey says the world was a tough place to survive in, no oxygen, lots of methane, and oceans at 70 degrees.
{ "pile_set_name": "Pile-CC" }
World With wildfires continuing to rage in Russia and the situation worsening in flood-hit Pakistan, the European Union is once again being criticized for its uncoordinated approach to international crisis management. Critics say the EU needs a unified response to disasters After the earthquake which hit Haiti in January this year, a number of European officials called on the EU to create a European emergency force to react as a single body to international crisis situations. The EU came under fire for its lack of cohesion with critics lamenting the missed opportunity for the bloc to show its solidarity and project its image as a major player on the world stage. Eight months on from Haiti, the EU has yet to create a single emergency reaction force or aid fund and as such is running the risk of being labelled weak and inefficient again. Over the weekend, French President Nicolas Sarkozy called for the establishment of an EU disasters rapid reaction force in a letter to EU Commission President Jose Manuel Barroso. Sarkozy said that amid such natural catastrophes as the Russian wildfires and the Pakistan floods, "we must take the necessary measures and build a real EU reaction force ... that draws on the resources of the member states." Creation of single EU body at the mercy of national interests "There has been a discussion about creating a European civilian response body for emergency situations but it all comes down to the national members states," Fabrice Pothier, European bureau chief for the Carnegie Endowment for International Peace, told Deutsche Welle. It's difficult to get member states to rally round the EU flag "So far they have failed to find a way to bring all the necessary personnel together - such as police, fire fighters and the judiciary. Europe has this capability but you have to start at the national level when coordinating this. Of course, when it doesn't happen, it's all the fault of Brussels." "The problem, firstly, is one of political will," he added. "It's a hard sell for national governments to ask their people to provide resources for Brussels. There's also a problem arising from the fact that each member state has its own strategies and they want to put their own flag in the ground, not that of the EU." "The Lisbon Treaty requires the EU to 'promote consistency in international civil-protection work'," Dr. Sven Grimm from the German Development Institute told Deutsche Welle. "I am not sure that this requires a single body. While a clear setting would facilitate speedy coordination, the rapidness of response - and the scope of it - is ultimately a question of political will and priorities, not so much of whether or not to have a single body." The current EU crisis response tool, the Community Mechanism for Civil Protection, organised through the Monitoring and Information Center of the European Commission's aid directorate, acts as a coordinating body for the many individual relief efforts launched by EU member states. The mission statement for the Community Mechanism for Civil Protection states that EU assistance will be provided on request of the country affected by the emergency and that the primary responsibility for dealing with the immediate effects of the disaster lies with the country where it has occurred. EU says efforts on hold until Russia asks for help Individual EU states have sent help to fire-ravaged Russia In Russia's case, the EU says that the mechanism hasn't been triggered because Moscow has not asked for Europe's help. The Kremlin has been committed to showing that it can handle the wildfire situation on its own, even though its efforts to date have led to scathing criticism from within Russia itself. "The EU needs to get smarter when it comes to cooperation," Pothier said. "It shouldn't strive to replace national initiatives and emergency crisis teams but it should get better at connecting them." In contrast to the Russian stance, Pakistan, however, has asked for help in dealing with the deteriorating situation brought on by severe flooding in north western and central regions of the country.
{ "pile_set_name": "Pile-CC" }
In cancer, normal epigenetic silencing and cytosine methylation are disrupted. Dietary intake of methyl donors can directly affect epigenetic mechanisms through cytosine methylation. Our longterm goal is to understand how the risk of human disease, cancer in particular, is affected by epigenetics and diet. We use A10-vy (obese yellow) mice, a model that exhibits a highly variable phenotype of obesity, tumors, and type II diabetes;the expression of the syndrome is under epigenetic control. The epigenetic state of the A-vy allele can be inherited, indicating that the epigenetic marks determining the behavior of the allele are maintained in the germline. Supplementation of the maternal A-vy diet with methyl donors during gestation alters phenotypes in offspring. We hypothesize that continuous supplementation of the maternal diet with methyl donors will produce a cumulative increase in methylation of the A-vy allele, resulting in a multigenerational trend toward suppression of the obese yellow phenotype, and denser methylation of the allele. The changes may persist after supplementation is withdrawn. Our specific aims are: 1. Investigate the effects of continuous methyl donor supplementation on inheritance of the obese yellow phenotype in A-vy mice. Continuous feeding of methyl donors to A-vy mothers may produce changes in phenotype that increase with more generations. 2. Ask if the effects of methyl donor supplementation persist for generations when supplementation is withdrawn. Changes induced by methyl donors may be maintained in the germline, resulting in epigenetic "memory" that persists for one or more generations. 3. Investigate effects of methyl donor supplementation on CpG methylation of the A-vy allele We will use bisulphite allelic sequencing to obtain a detailed picture of the methylation status of the allele in mice bred for Aims 1 and 2.
{ "pile_set_name": "NIH ExPorter" }
YANGON (Reuters) - More than 2,000 people have been forced to flee from their homes, and 19 have been killed, since fighting broke out between government troops and ethnic minority insurgents in northern Myanmar last week, government officials said Wednesday. The escalation in hostilities in Myanmar’s fractured north is another setback for civilian leader Aung San Suu Kyi’s bid to bring peace amid a stuttering transition from full military rule. The people displaced in the latest fighting are sheltering in monasteries around Lashio town in the north of Shan State, and are depending on aid groups and the government for their supplies, aid workers said. “We are providing basic rescue materials as well as cash to displaced people in the camps, the injured people and also to family members of those who got killed,” Soe Naing, director of the Department of Disaster Management in Shan State, told Reuters. Aid would be delivered as long as people needed to stay in the camps, he said. Tension in the region has risen since Thursday, when a coalition of anti-government insurgent groups known as the Northern Alliance staged attacks including on an elite army college that killed more than a dozen people, mostly security forces personnel. Nobel laureate Suu Kyi came to power following a landslide election win in late 2016, vowing to prioritize peace talks between ethnic minority guerrilla groups, the military and civilian government. But conflict has escalated in Kachin State in the north and in Shan State, as the western Rakhine region on the border with Bangladesh.
{ "pile_set_name": "OpenWebText2" }
Q: How to translate jsoup to Objective-C? How to translate jsoup to Objective-C? I'm a newbie and much unfamiliar with Java. Recently I'd like to use jsoup in my iOS project by j2objc, but it seems hard for me. When I execute cd /path/to/jsoup-master j2objc -sourcepath ./src/main/java -classpath /Users/wildcat/Downloads/j2objc-0.9.5/lib/javax.inject-1.jar -d ./src/main/ojbc ./src/main/java/org/jsoup/*/*.java There are many packages not found, such as org.w3c.dom . I downloaded these files about org.w3c.dom but there are so many packages not found that it's difficult to handle it. They maybe belong to the standard libs of Java such as javax.net , how could I finished the translation of jsoup? Is that possible? Thanks! A: You can try RoboVM, which AFAIK supports the full JRE API. It doesn't generate Objective C, though, but instead compiles Java files directly to .o files (like clang does for C/C++/Obj-C files).
{ "pile_set_name": "StackExchange" }
SAN DIEGO, California, November 28, 2016 (LifeSiteNews) — San Diego Bishop Robert McElroy is calling on his city's priests to embrace "LGBT families," and to allow divorced and remarried Catholics to receive Communion in certain cases. Following a much-hyped diocesan synod on the family last month, Bishop McElroy encouraged priests to publish a diocesan notice in their bulletins saying the Church will "assist those who are divorced and remarried and cannot receive an annulment to utilize the internal forum of conscience in order to discern if God is calling them to return to the Eucharist." "The Synod proposed a spirituality of family life which is deeply inclusive," and embraces "LBGT families," the statement went on to say. "During the coming months Bishop McElroy will be working with a committee of synod delegates who will focus on the implementation of these goals." The statement, which multiple sources confirmed the bishop sent to priests of the diocese, has appeared in at least three San Diego parish bulletins and is one of the most liberal interpretations by a U.S. bishop of the pope's controversial exhortation Amoris Laetitia. The “internal forum” is the process by which a “remarried” couple living in a state the Church considers adultery may “discern,” usually with the help of a priest, whether they may receive Holy Communion. This is at odds with the Church’s perennial teaching on sexual morality and the Sacraments, which stipulates that only the divorced and remarried who live abstinently as “brother and sister” may be admitted to the Sacraments. The notion that couples who are in sexual relationships with individuals other than their valid spouse--adultery--may decide they are eligible to receive the Sacraments anyway has long been condemned by the Church, including by Pope St. John Paul II in his apostolic exhortation Familiaris Consortio. In the wake of Amoris Laetitia, it has again been condemned by numerous Church experts, including a renowned philosopher and close friend of Pope St. John Paul II as "completely inappropriate" and a potential “pastoral catastrophe." Cardinals, bishops, theologians, and other prelates have raised questions about how Amoris Laetitia should be interpreted, reiterating that the "internal forum" could lead to sacrilege and scandal. The Catholic Church teaches that the Eucharist is the literal body, blood, soul, and divinity of Jesus Christ and therefore in principle only allows Catholics who have repented of and confessed serious sins (Catholics in a "state of grace") to receive Holy Communion. The Diocese of San Diego's full statement is below: On the weekend of October 30-31, the diocese of San Diego held the first diocesan synod in the nation of the theme of marriage and family life outlined in Pope Francis' encyclical on The Joy of Love. A synod brings together representatives of the entire Catholic community in a diocese for dialogue, deliberation, prayer and decision making. For our synod here in San Diego, every parish had a delegate, as well as the university communities, theological faculties and members of the diocesan pastoral staff. These delegates included priests, religious sisters, mothers, fathers, deacons, and young adults of every culture and language. The deliberations at the synod pointed to the need for renewed dedication of married couples toward embracing the depth, permanence, sanctity and sacrifice which lie at the heart of the Catholic conception of marriage. The discussions emphasized the need to make a spirituality of marriage and family life more available to our parishioners, especially to young couples who often find it less automatic to bring prayer and the Gospel into their marriage and role as parents. The Synod pointed to the need to invite young couples lovingly, non-judgmentally and energetically into Catholic marriage and to provide mentors for them. The delegates spoke movingly to the need for the Church to reach out to divorced men and women at every moment of their journey, to support them spiritually and pastorally, to help them move through the annulment process, and to assist those who are divorced and remarried and cannot receive an annulment to utilize the internal forum of conscience in order to discern if God is calling them to return to the Eucharist. Finally, the Synod proposed a spirituality of family life which is deeply inclusive: embracing mothers and fathers beautifully bonded in their married love and the love of their children, as well as single parents, those who are widowed, our many military families where deployment brings great stress, LBGT families, families which deportation has split and families with members who have special needs. During the coming months Bishop McElroy will be working with a committee of synod delegates who will focus on the implementation of these goals. It is our hope that through this initiative the grace of married and family life will be profoundly deepened. The synod recommended that in providing “authentic pastoral support for those who are divorced,” the diocese “provide formation in the areas of conscience formation and the Internal Forum, not only to implement the pathway to sacramental participation outlined in the Joy of Love but even more fundamentally to illuminate a core element of Christian discipleship itself.” IMPORTANT: To respectfully express your support for the 4 cardinals' letter to Pope Francis asking for clarity on Amoris Laetitia, sign the petition. Click here. Of Holy Communion for the divorced and civilly remarried, Pope St. John Paul II wrote in his exhortation Familiaris Consortio: …the Church reaffirms her practice, which is based upon Sacred Scripture, of not admitting to Eucharistic Communion divorced persons who have remarried. They are unable to be admitted thereto from the fact that their state and condition of life objectively contradict that union of love between Christ and the Church which is signified and effected by the Eucharist. Besides this, there is another special pastoral reason: if these people were admitted to the Eucharist, the faithful would be led into error and confusion regarding the Church's teaching about the indissolubility of marriage. Reconciliation in the sacrament of Penance which would open the way to the Eucharist, can only be granted to those who, repenting of having broken the sign of the Covenant and of fidelity to Christ, are sincerely ready to undertake a way of life that is no longer in contradiction to the indissolubility of marriage. This means, in practice, that when, for serious reasons, such as for example the children's upbringing, a man and a woman cannot satisfy the obligation to separate, they "take on themselves the duty to live in complete continence, that is, by abstinence from the acts proper to married couples." Footnote 351 of Amoris Laetitia has caused confusion about whether the pope is intending to allow divorced and "remarried" Catholics to receive Holy Communion. Different prelates, theologians, and philosophers have interpreted the exhortation in different ways. Four cardinals asked Pope Francis to clarify whether Amoris Laetitia is at odds with Catholic moral teaching, but he has yet to respond. 'LGBT families' The use of the term "LGBT families" is unusual for a Catholic bishop, as the Catechism of the Catholic Church teaches, "A man and a woman united in marriage, together with their children, form a family" (CCC 2202) and family "is the natural society in which husband and wife are called to give themselves in love and in the gift of life" (CCC 2207). The Catechism of the Catholic Church also teaches that sexual acts between members of the same sex are "intrinsically disordered," "contrary to the natural law," and "under no circumstances can they be approved" (CCC 2357). McElroy has previously called the Catechism's language "very destructive." The synod also recommended the creation of a diocesan office that will specialize in outreach to the “LGBT” population, that he hire a senior level marriage and family staffer whose sole job will be to focus “on all stages of separation and divorce,” and that the diocese provide “formation” on the “internal forum” that is referenced in Amoris Laetitia. In interviews with local media, McElroy stressed, “Our notion of family is an inclusive notion” and individual “conscience” is the “real core of Catholic teaching.” ‘Internal forum’ to be incorporated into adult catechesis? San Diego synod participants recommended the diocese: “Provide forums on conscience formation for pastoral leadership: priests, deacons, religious, and lay leaders” “Evaluate current programs of faith formation for children, youth, and adults regarding conscience formation” “Identify and develop resources including print, web-based, video, and other media on conscience formation” “Incorporate catechesis on [the] external forum and internal forum in programs of adult faith formation” The proposed diocesan office for “family spirituality” would “develop resources for parishes to minister to families (i.e divorced, single-parent, widowed, deployed, deported, special needs, multigenerational households, LGBT),” according to the synod’s recommendations. This reconfiguration of the Marriage and Family Life office would “serve the separated, divorced, and remarried populations.” McElroy said “judgmentalism or stigmas” surrounding divorce must be “cast aside” and that “large numbers of people” are divorced and remarried “through no fault of their own or some fault of their own.” In the synod report, there are no mentions of sin or the Church’s teaching that those with same-sex attractions are called to chastity. It make allusions to the Church’s teaching on the indissolubility of marriage in its suggestions that the diocese “provide education, based on canon law, on the annulment process and remarriage” and “provide guidance on the annulment process in collaboration with the Tribunal.” The San Diego Union Tribune reported: “McElroy said all parishes need to welcome LGBT worshippers. Some — the bishop cited Hillcrest’s St. John the Evangelist — have developed a reputation where LGBT worshippers ‘feel particularly welcome. And that’s a very good thing.’” In a National Catholic Reporter video, synod attendees praised the diocese’s “positive energy…around what it means renew our approach to marriage and family” and said McElroy is a “spiritual” man. RELATED: Who are these four cardinals who wrote the ‘dubia’ to the Pope?
{ "pile_set_name": "OpenWebText2" }
/* Generated by camel build tools - do NOT edit this file! */ package org.apache.camel.component.aws.ec2; import java.util.Map; import org.apache.camel.CamelContext; import org.apache.camel.spi.GeneratedPropertyConfigurer; import org.apache.camel.spi.PropertyConfigurerGetter; import org.apache.camel.util.CaseInsensitiveMap; import org.apache.camel.support.component.PropertyConfigurerSupport; /** * Generated by camel build tools - do NOT edit this file! */ @SuppressWarnings("unchecked") public class EC2EndpointConfigurer extends PropertyConfigurerSupport implements GeneratedPropertyConfigurer, PropertyConfigurerGetter { @Override public boolean configure(CamelContext camelContext, Object obj, String name, Object value, boolean ignoreCase) { EC2Endpoint target = (EC2Endpoint) obj; switch (ignoreCase ? name.toLowerCase() : name) { case "accesskey": case "accessKey": target.getConfiguration().setAccessKey(property(camelContext, java.lang.String.class, value)); return true; case "amazonec2client": case "amazonEc2Client": target.getConfiguration().setAmazonEc2Client(property(camelContext, com.amazonaws.services.ec2.AmazonEC2.class, value)); return true; case "autodiscoverclient": case "autoDiscoverClient": target.getConfiguration().setAutoDiscoverClient(property(camelContext, boolean.class, value)); return true; case "basicpropertybinding": case "basicPropertyBinding": target.setBasicPropertyBinding(property(camelContext, boolean.class, value)); return true; case "lazystartproducer": case "lazyStartProducer": target.setLazyStartProducer(property(camelContext, boolean.class, value)); return true; case "operation": target.getConfiguration().setOperation(property(camelContext, org.apache.camel.component.aws.ec2.EC2Operations.class, value)); return true; case "proxyhost": case "proxyHost": target.getConfiguration().setProxyHost(property(camelContext, java.lang.String.class, value)); return true; case "proxyport": case "proxyPort": target.getConfiguration().setProxyPort(property(camelContext, java.lang.Integer.class, value)); return true; case "proxyprotocol": case "proxyProtocol": target.getConfiguration().setProxyProtocol(property(camelContext, com.amazonaws.Protocol.class, value)); return true; case "region": target.getConfiguration().setRegion(property(camelContext, java.lang.String.class, value)); return true; case "secretkey": case "secretKey": target.getConfiguration().setSecretKey(property(camelContext, java.lang.String.class, value)); return true; case "synchronous": target.setSynchronous(property(camelContext, boolean.class, value)); return true; default: return false; } } @Override public Map<String, Object> getAllOptions(Object target) { Map<String, Object> answer = new CaseInsensitiveMap(); answer.put("accessKey", java.lang.String.class); answer.put("amazonEc2Client", com.amazonaws.services.ec2.AmazonEC2.class); answer.put("autoDiscoverClient", boolean.class); answer.put("basicPropertyBinding", boolean.class); answer.put("lazyStartProducer", boolean.class); answer.put("operation", org.apache.camel.component.aws.ec2.EC2Operations.class); answer.put("proxyHost", java.lang.String.class); answer.put("proxyPort", java.lang.Integer.class); answer.put("proxyProtocol", com.amazonaws.Protocol.class); answer.put("region", java.lang.String.class); answer.put("secretKey", java.lang.String.class); answer.put("synchronous", boolean.class); return answer; } @Override public Object getOptionValue(Object obj, String name, boolean ignoreCase) { EC2Endpoint target = (EC2Endpoint) obj; switch (ignoreCase ? name.toLowerCase() : name) { case "accesskey": case "accessKey": return target.getConfiguration().getAccessKey(); case "amazonec2client": case "amazonEc2Client": return target.getConfiguration().getAmazonEc2Client(); case "autodiscoverclient": case "autoDiscoverClient": return target.getConfiguration().isAutoDiscoverClient(); case "basicpropertybinding": case "basicPropertyBinding": return target.isBasicPropertyBinding(); case "lazystartproducer": case "lazyStartProducer": return target.isLazyStartProducer(); case "operation": return target.getConfiguration().getOperation(); case "proxyhost": case "proxyHost": return target.getConfiguration().getProxyHost(); case "proxyport": case "proxyPort": return target.getConfiguration().getProxyPort(); case "proxyprotocol": case "proxyProtocol": return target.getConfiguration().getProxyProtocol(); case "region": return target.getConfiguration().getRegion(); case "secretkey": case "secretKey": return target.getConfiguration().getSecretKey(); case "synchronous": return target.isSynchronous(); default: return null; } } }
{ "pile_set_name": "Github" }
Introduction {#S1} ============ Understanding the endogenous pathways that regulate inflammatory responses is of critical importance for the development of novel therapies for chronic inflammatory disease. Recent approaches for the treatment of inflammatory diseases have focussed around blocking specific inflammatory mediators such as the cytokines TNF-α, IL-1β, and IL-6 ([@B1]--[@B3]). Whilst such approaches have been very effective for certain diseases \[e.g., anti-TNF-α monoclonal antibodies for the treatment of rheumatoid arthritis (RA)\] a large percentage of patients either do not respond to treatment or become refractory to therapeutic antibody treatment ([@B4], [@B5]). It is known that cytokines play a central role in shaping the immune response to invading pathogens and in the context of chronic inflammation. It is now appreciated that there exists a plethora of lipid mediators as well as other immune modulating proteins and peptides that play important roles during both the onset as well as the resolution of inflammation ([@B6]--[@B8]). Annexin-A1 and its N-terminal peptide ac2-26 have been demonstrated to exert potent pro-resolution properties in multiple inflammatory disease models ([@B8], [@B9]). Similarly, a number of lipid mediators including the resolvins, lipoxins, maresins, and protectins have been more recently come to the fore ([@B7], [@B8]). These novel immune modulatory mediators and others may represent new avenues to explore for the treatment of chronic inflammatory disease. Murine chemerin is a 16 kDa protein produced and secreted as an inactive precursor, pro-chemerin, predominantly by hepatocytes and adipocytes ([@B10]). Pro-chemerin is present in the liver, spleen, skin, and plasma ([@B11], [@B12]). During an inflammatory response, inflammatory proteases produced locally by granulocytes and the coagulation cascade, cleave the carboxyl terminus of pro-chemerin to generate active chemerin isoforms at sites of inflammation ([@B13], [@B14]). Chemerin has been implicated in the pathology of a range of inflammatory diseases including RA, inflammatory bowel disease, psoriasis, diabetes, and cardiovascular disease ([@B15]--[@B19]). However, the exact role played by chemerin and its receptors in inflammatory disease remains unclear. Our group and others have demonstrated that active chemerin, once generated, is a potent chemoattractant for macrophages, immature dendritic cells (DCs), plasmacytoid dendritic cells (pDCs), and NK cells ([@B20]--[@B23]). Chemerin binds to three G protein-coupled receptors (GPCRs) with high affinity; CMKLR1, GPR1, and CCRL2 ([@B24]). Murine GPR1 is expressed in white adipose tissue, skin, muscle, and in the central nervous system ([@B25]). Although chemerin binding to GPR1 has been reported to induce downstream signalling, chemerin is thought to act as a partial agonist at GPR1 whilst chemerin acts as a full agonist at CMKLR1 ([@B26], [@B27]). CMKLR1 is expressed on various immune cells including macrophages, DCs, NK cells, and pDCs ([@B12]). It is also expressed on endothelial cells and adipocytes ([@B28], [@B29]). *Cmklr1* mediates the chemotactic effects of chemerin, and its activation has been reported to lead to rapid downstream signalling cascades, which are G~i/0~ coupled ([@B23], [@B26]). The Chemerin/*Cmklr1* axis has been implicated in driving the recruitment of immature DCs, pDCs, and NK cells to local sites of inflammation in a number of inflammatory diseases ([@B22], [@B30]--[@B32]). Interestingly, *Cmklr1* has also been reported to play an anti-inflammatory role in a number of inflammatory disease models, although these have predominantly been allergic inflammatory models ([@B12], [@B33]). In addition, our group and others have reported anti-inflammatory effects of synthetic chemerin-derived peptides in a number of inflammation models and these effects seem to be dependent on CMKLR1 ([@B34]--[@B36]). CCRL2 is a seven transmembrane receptor that lacks the DRYLAIV intracellular motif required for classical downstream signalling by GPCRs ([@B37]). It binds chemerin but does not induce classical downstream signalling nor does it internalise chemerin ([@B20], [@B37], [@B38]). CCRL2 is expressed on a range of cell types including macrophages, DCs, endothelial cells, and epithelial cells amongst others ([@B38], [@B39]). Expression of CCRL2 is upregulated in response to inflammatory stimuli but the function of CCRL2 during inflammation remains incompletely understood ([@B39], [@B40]). Zabel et al. have proposed a model in which CCRL2 binds to the non-signalling N-terminus of chemerin and then presents it to other cells expressing CMKLR1. In this way, CCRL2 could function to concentrate chemerin at local sites to augment chemerin signalling during inflammation ([@B38]). The aim of this study was to further explore the role of the non-signalling chemerin receptor CCRL2 during a self-resolving model of acute inflammation. We report, for the first time, that animals lacking the chemerin receptor CCRL2 displayed exaggerated neutrophil and inflammatory monocyte recruitment in models of acute inflammation. These effects were due in part to increased levels of chemerin, which augmented production of the neutrophil chemoattractant CXCL1, resulting in increased neutrophil recruitment. Materials and Methods {#S2} ===================== Animals {#S2-1} ------- B6.129-*Ccrl2^tm1Dgen^*/J mice were obtained from Jackson Laboratories (Bar Harbour, ME, USA). These mice, originally produced by Deltagen (San Mateo, CA, USA), were backcrossed for 12 generations onto the C57BL/6J background. All animal studies were conducted with ethical approval from the Dunn School of Pathology Local Ethical Review Committee and in accordance with the UK Home Office regulations (Guidance on the Operation of Animals, Scientific Procedures Act, 1986). Reagents {#S2-2} -------- Recombinant murine chemerin (aa17--156) was reconstituted in PBS supplemented with 0.1% BSA. Neutralising anti-chemerin antibody and goat IgG control were reconstituted in PBS. Both chemerin and antibodies were purchased from R&D Systems (Abingdon, UK). Zymosan was purchased from Sigma-Aldrich (Dorset, UK). Recombinant CCL5 was purchased from Peprotech (London, UK). Bio-gel P100 (45--90 µm) fine polyacrylamide beads were obtained from BIO-RAD Laboratories, Hemel Hempstead, Hertfordshire, UK. Murine Bone Marrow-Derived Macrophages (BMDMs) {#S2-3} ---------------------------------------------- Bone marrow-derived macrophages were generated as previously described ([@B41]). Briefly, fresh bone marrow cells from tibiae and femurs of C57BL/6J mice (8--12 weeks) were isolated and cultured in DMEM media supplemented with 10% heat inactivated fetal bovine serum, 10% L929 cell-conditioned media as a source of macrophage colony-stimulating factor, 100 U/ml penicillin, and 100 µg/ml streptomycin for 7 days. A total of 4 × 10^6^ bone marrow cells were seeded into 10 ml of medium in 100 mm Petri dishes (Sterilin, Abergoed, UK.) and on day 3 an additional 5 ml of medium was added. Cells were harvested by gentle agitation to lift cells off surface. Human Umbilical Vein Endothelial Cells (HUVEC) {#S2-4} ---------------------------------------------- Human umbilical vein endothelial cells were isolated as previously described ([@B42]) and frozen for storage in liquid N~2~. HUVEC were thawed and resuspended in endothelial cell growth medium with supplement mix C (PromoCell, Germany), 100 U/ml penicillin, and 100 µg/ml streptomycin and cultured in pre-coated 0.5% gelatin (Sigma) flask/dishes in a 37°C 5% CO~2~ incubator. Cell Activation Assays {#S2-5} ---------------------- Cells were seeded into 6-well plates at a concentration of 1 × 10^6^/ml. They were then exposed to TLR ligands and cytokines for 16 h in a 37°C 5% CO~2~ incubator as described previously. The TLR ligands and cytokines were added to cells at a final concentration of: LPS 100 µg/ml, IFNγ 20 ng/ml, Poly I:C 10 µg/ml, zymosan 10 µg/ml, flagellin 500 ng/ml, IL-4 20 ng/ml, and IL-13 20 ng/ml. RNA Isolation and Reverse Transcription and RT-PCR {#S2-6} -------------------------------------------------- Total RNA was extracted using the QIAGEN RNeasy Mini kit as instructed by the manufacturer as described previously ([@B43]). RNA concentration and purity was determined using ND-1000 spectrophotometer (Nanodrop, Thermo Scientific) at 260/280 and 260/230 nm. cDNA was synthesised from 500 to 800 ng of total RNA using QuantiTect Reverse Transcription kit following the manufacturer's instructions. cDNA was amplified for 15 min at 42°C and then 3 min at 95°C. Real-time quantitative PCR was performed using Sybr Select Master Mix (Applied Biosystems, Life Technologies) in the Step One Plus Real-time PCR System (Applied Biosystems). All primers were from QuantiTect Primer Assay (Qiagen). The thermal profile included an initiation step for 2 min at 50 and 95°C followed by 40× cycles of 15 s at 95°C and 1 min at 60°C. Cycle threshold values were determined by the StepOne software v2.3 and the mRNA content of samples was inferred by normalising to the housekeeping β-actin gene. Relative expression results were plotted as mRNA expression over actin, normalised to basal samples ([@B44]). Zymosan or Thioglycollate Induced Peritonitis {#S2-7} --------------------------------------------- Male *Ccrl2*^−^*^/^*^−^ or littermate controls were injected i.p. (0.5 ml) with 100 µg zymosan resuspended in PBS, or 1 ml of 4% thioglycollate (Thioglycollate brewers yeast; Sigma-Aldrich, Dorset, UK) prepared as described previously ([@B45]). Mice were sacrificed at specified time points and peritoneal cavities were lavaged with 5 ml ice-cold PBS supplemented with 2 mM EDTA. Blood was collected from the hepatic portal vein into EDTA-coated vacutainers and centrifuged at 2,000 × *g* for 20 min at 4°C to obtain plasma. Modulation of Chemerin Levels *In Vivo* {#S2-8} --------------------------------------- C57BL/6J mice were treated with either recombinant murine chemerin (4 µg) or PBS i.p. for 1 h before zymosan challenge for 4 h. Animals were sacrificed and peritoneal lavage was collected as before. *Ccrl2*^−^*^/^*^−^ mice were pretreated for 24 h with either 100 ng of isotype control IgG antibody or 100 ng of anti-chemerin polyclonal antibody i.p. This was followed by a second injection of isotype control IgG or anti-chemerin antibody 1 h before challenge with zymosan. Mice were sacrificed 4 h later and peritoneal lavage fluid was collected as before. Flow Cytometry {#S2-9} -------------- Peritoneal exudate cells (PECs) were resuspended in fluorescence-activated cell sorting (FACS) buffer (PBS; 2% FCS, 25 mM HEPES, 5 mM EDTA) containing CD16/CD32 FCγIIR blocking antibody (eBioscience). Specific staining with the following antibodies was performed with appropriate isotype controls; F4/80 (AbD Serotec, clone CI:A3-1), Ly6B.2 (AbDSerotec, Clone 7/4), Ly6 G (BioLegend, clone 1A8), CD11b (BioLegend, clone M1/70), CD115 (BioLegend, clone AFS98), CD4 (BioLegend, clone RM4-5), CD3 (BioLegend, clone 17A2), B220 (eBioscience, clone RA3-6B2), CD8 (BD Pharminogen, clone 53-6.7), and analysed by flow cytometry. Cells were counted using CountBright Absolute Counting Beads (Life Technologies). Cells were analysed with a Dako Cyan ADP flow cytometer (Beckman Coulter Ltd., High Wycombe, UK) and FlowJo software V10 (Tree Star Incorporation, Ashland, OR, USA). Monocytes and neutrophils in the peritoneum were defined as CD45^+^, 7/4^+^, Ly6G^−^ and CD45^+^, 7/4^+^, Ly6G^+^, respectively ([@B46], [@B47]). Blood was collected *via* hepatic portal vein into EDTA-coated vacutainers. Blood was treated in the same manner as the PECs, but red blood cells were lysed after antibody staining using BD FACS Lysing Solution (Buffered solution with \<15% formaldehyde and \<50% diethylene glycol) before fixation. Ly6C^hi^ blood monocytes were defined as CD45^+^, CD11b^+^, CD115^+^, Ly6C^hi^. Ly6C^lo^ monocytes were defined as CD45^+^, CD11b^+^, CD115^+^, Ly6C^lo^ ([@B48], [@B49]). Fluorescence-Activated Cell Sorting {#S2-10} ----------------------------------- Male C57BL/6J mice were injected i.p. (0.5 ml) with 100 µg zymosan resuspended in PBS. Steady state and zymosan challenged mice were sacrificed 4 h later, and peritoneal cavities were lavaged with 5 ml ice-cold PBS supplemented with 2 mM EDTA. PECs were stained for flow cytometry as described previously. Peritoneal macrophages, monocytes, and neutrophils were FACS sorted using a Beckman Astrios cell sorter directly into RLT buffer for RNA isolation using the QIAGEN RNeasy Mini kit. Detection of Secreted Protein by ELISA and Luminex {#S2-11} -------------------------------------------------- CXCL1, CCL2, IL-6, and chemerin in peritoneal exudate fluid and plasma were detected using ELISA (R&D Systems, Abingdon, UK). Sandwich ELISAs for chemerin, IL-6, CCL2, and CXCL1 were performed according to manufacturer's instructions. Custom multiplex polyacrylamide bead assays were purchased from R&D Systems to determine levels of CCL3, CCL4, IL-10, CXCL10, and MMP9 in peritoneal exudate fluid. Briefly, colour-coded beads were pre-coated with antibodies against the targets of interest. Biotinylated detection antibodies specific for each analyte were added, followed by phycoerythrin (PE)-conjugated streptavidin. Samples were read using a laser detection system, which quantifies the amount of PE present for each analyte. The 96-well plates were read on a Bio-Rad Bioanalyser with Bio-Plex Manager software (Hemel Hempstead, Hertfordshire, UK). ACEA xCELLigence Chemotaxis Assay {#S2-12} --------------------------------- 8- to 10-week-old male *Ccrl2*^−^*^/^*^−^ or littermate controls were injected i.p. with 1 ml 2% Bio-gel (P100 Fine, 45--90 µm). PECs (mixture of inflammatory macrophages and neutrophils) were isolated by peritoneal lavage with ice-cold PBS supplemented with 2 mM EDTA 4 days later. Real-time chemotaxis assays were performed using the ACEA RTCA-DP instrument as described previously ([@B50], [@B51]). Briefly, vehicle, chemerin, or recombinant murine CCL5 (160 µl) at 5 nM final concentration was added to the lower chamber of a CIM-16 plate. The upper chamber was attached, and 50 µl of prewarmed chemotaxis buffer added to each of the upper chambers. Following equilibration for 30 min, the plate was transferred into the RTCA-DP system. Bio-gel elicited PECs (50 µl---4 × 10^5^ cells/well), were then added to all upper wells. Cell index (CI) measurements were then taken every 5 s over the 3--4 h assay period. Chemotactic responses were assessed by quantifying the slope of the curve in the first 40 min and by the maximum CI minus minimum CI (Max--Min) values of the curve over the entire experiment. CMKLR1 β-Arrestin Recruitment Assays {#S2-13} ------------------------------------ Recruitment of β-Arrestin to Cmklr1 was measured using the Discoverx PathHunter^®^ eXpress β-Arrestin GPCR Assay following the manufacturer's protocol. Briefly, CHO-K1 cells stably expressing murine Cmklr1 were seeded into 1/2 area 96-well plates (15,000 cells/well) and incubated at 37°C, 5% CO~2~ for 48 h. Cells were then treated with either vehicle (Cell assay reagent) or indicated concentrations of anti-chemerin antibody for 45 min at 37°C, 5% CO~2~ before stimulation with vehicle or recombinant chemerin (20 nM) for 90 min at 37°C, 5% CO~2~. Cells were lysed and detection of total recruited β-arrestin was determined following the manufacturers protocol and as previously described ([@B51]). Luminescence measurements were taken using a PHERAstar microplate reader (BMG Labtech). Statistical Analysis {#S2-14} -------------------- All quantitative data are reported as mean ± SEM of *n* independent biological replicates. Statistical significance was assessed using a Student's unpaired *t*-test, one-way or two-way analysis of variance (ANOVA) with Dunnett's multiple comparison *post hoc* test (Prism 6 GraphPad Software, San Diego, CA, USA), *P* \< 0.05 was taken to be statistically significant. Results {#S3} ======= Chemerin Levels and *Ccrl2* Expression Are Increased during Acute Inflammation {#S3-1} ------------------------------------------------------------------------------ We and others have previously demonstrated that i.p. challenge with zymosan induces robust inflammatory mediator production in the peritoneum as well as inflammatory cell recruitment ([@B47]). Injection of 100 µg zymosan resulted in robust inflammatory cell recruitment with neutrophils peaking at 4 h post zymosan challenge and monocytes peaking at 8 h (Figure [1](#F1){ref-type="fig"}A). The role played by chemerin during inflammation remains incompletely understood. To interrogate this in our model of acute inflammation, we quantified total chemerin levels in the peritoneum during this acute inflammatory response and found that levels were significantly increased compared with naïve mice 4 h following zymosan challenge (2.5 ± 0.4 ng/ml at 4 h compared with 1.2 ± 0.3 ng/ml in naïve mice) (Figure [1](#F1){ref-type="fig"}B). One caveat using an ELISA to measure chemerin levels is that it is a quantification of total chemerin levels, including inactive pro-chemerin and potentially shorter bioactive chemerin isoforms generated during inflammation. To investigate chemerin bioactivity during this acute inflammatory response, we compared the ability of the peritoneal exudate fluid from animals injected with zymosan at different time points to activate the CMKLR1 chemerin receptor on CMKLR1 transfected CHO-K1 cells (Figure [1](#F1){ref-type="fig"}C). Using this bioassay, chemerin bioactivity progressively increased after zymosan injection peaking at 8 h and decreasing to baseline levels by 96 h (Figure [1](#F1){ref-type="fig"}C). These data suggest that although total chemerin levels as measured by ELISA peaked at 4 h and decreased rapidly by 8 h, chemerin bioactivity continued to increase up to 8 h and remained increased up to 72 h post zymosan injection. ![Chemerin bioactivity and *Ccrl2* expression are increased during inflammation. C57BL/6J male mice were injected i.p. with 100 µg zymosan. Animals were sacrificed at indicated time points, and peritoneal cavities were lavaged with ice-cold PBS supplemented with 2 mM EDTA. **(A)** Total neutrophils (black broken line) and inflammatory monocytes/macrophages (grey line) at indicated time points. **(B)** Total chemerin levels from the peritoneal exudate fluid were measured by ELISA at the indicated time points. **(C)** Chemerin bioactivity at the *Cmklr1* receptor was measured in the peritoneal exudate fluid using CHO-K1 cells stably transfected with murine Cmklr1. Cmklr1 activity was assessed by quantification of β-arrestin recruitment to Cmklr1 as measured by luminescence. Dashed line represents background luminance. RLU, relative light units. Error bars represent SEM. *n* = 4--15 mice per time point and *n* = 4 independent experiments. Statistical significance was assessed using one-way analysis of variance (ANOVA) with Dunnett's multiple comparison *post hoc* test. **(D)** C57BL/6J male mice were injected i.p. with 100 µg zymosan, and 4 h later steady state or zymosan challenged mice were sacrificed, and peritoneal cavities were lavaged with ice-cold PBS supplemented with 2 mM EDTA. Resident peritoneal macrophages from steady state mice and recruited neutrophils and monocytes were sorted by fluorescence-activated cell sorting into RLT buffer, and *Ccrl2* mRNA expression was assessed by qPCR. Error bars represent SEM of *n* = 3 mice/group. **(E,F)** mRNA expression of *Ccrl2* receptor was analysed by qPCR on bone marrow-derived macrophages (BMDMs) and human umbilical vein endothelial cells (HUVECs) following exposure to TLR ligands and cytokines for 16 h. Error bars represent SEM of *n* = 2 separate experiments. Statistical significance was assessed using one-way ANOVA with Dunnett's multiple comparison *post hoc* test. \**P* ≤ 0.05, \*\**P* ≤ 0.01, \*\*\**P* ≤ 0.001, \*\*\*\**P* ≤ 0.0001.](fimmu-08-01621-g001){#F1} The function of CCRL2 during inflammation remains to be fully elucidated, but the expression of CCRL2 has been reported to be increased during inflammation ([@B39]). To confirm and extend this observation, we FACS sorted resident peritoneal macrophages as well as recruited peritoneal neutrophils and monocytes from wild-type (WT) C57BL/6J mice following a 4 h zymosan challenge. We found that *Ccrl2* was expressed on three cell types but expression was highest on recruited neutrophils following zymosan challenge (Figure [1](#F1){ref-type="fig"}D). In addition, we cultured BMDMs and HUVECs and challenged them with a range of inflammatory stimuli (Figures [1](#F1){ref-type="fig"}E,F). Addition of zymosan, LPS, interferon-γ, poly I:C all increased BMDM expression of *Ccrl2* with the combination of LPS and interferon-γ resulting in the largest increase in expression (\~235-fold increase compared with vehicle) (Figure [1](#F1){ref-type="fig"}E). Zymosan and LPS also increased *Ccrl2* expression in HUVECs (Figure [1](#F1){ref-type="fig"}F). These results are in agreement with the published literature, indicating that *Ccrl2* expression is indeed rapidly upregulated on a number of cells during acute inflammation ([@B39], [@B40]). *Ccrl2*^−*/*−^ Mice Displayed Increased Monocyte and Neutrophil Recruitment to the Inflamed Peritoneum {#S3-2} ------------------------------------------------------------------------------------------------------ To investigate the potential functional consequence of upregulation of Ccrl2 during acute inflammation *in vivo*, we challenged WT mice or *Ccrl2*^−/−^ mice with 100 µg zymosan for 4 h and quantified inflammatory cell recruitment and mobilisation. Zymosan challenge resulted in significantly more total cells recruited to the peritoneum of *Ccrl2*^−^*^/^*^−^ mice compared with WT after 4 h (Figure [2](#F2){ref-type="fig"}B). There was also a striking increase in monocyte recruitment (0.4 ± 0.05 × 10^6^ in *Ccrl2*^−/−^ mice compared with 0.2 ± 0.03 × 10^6^ in WT mice) and neutrophil recruitment (6.2 ± 0.52 × 10^6^ in *Ccrl2*^−/−^ mice compared with 3.1 ± 0.35 × 10^6^ in WT mice) to the peritoneum of *Ccrl2*^−^*^/^*^−^ mice (Figures [2](#F2){ref-type="fig"}A--D). Other cell populations including CD4 T cells, CD8 T cells and B cells were also quantified but no significant differences were observed between the two genotypes (data not shown). ![Deletion of *Ccrl2* increased neutrophil mobilisation and recruitment to local sites of inflammation. 8- to 10-week-old male *Ccrl2*^−^*^/^*^−^ or age-matched littermate controls were injected with zymosan i.p. (100 µg/animal), and 4 h later, zymosan injected animals or steady state animals were sacrificed. Peritoneal cavities were lavaged with 5 ml ice-cold PBS supplemented with 2 mM EDTA. Cells were quantified using counting beads, and cell populations were analysed using flow cytometry. **(A)** Representative flow cytometry plots of the peritoneal cavities of wild-type (WT) and *Ccrl2*^−^*^/^*^−^ steady state mice or mice challenged with zymosan. Monocytes were defined as Ly6B.2 (7/4)^hi^, Ly6G^lo^ and neutrophils were defined as Ly6B.2 (7/4)^hi^, Ly6G^hi^. WT animals are presented on the left and *Ccrl2*^−/−^ animals are presented on the right. **(B--D)** Total peritoneal cell counts from steady state animals or from animals 4 h post zymosan challenge. Error bars represent SEM of *n* = 4--13 animals/group and *n* = 2 independent experiments. **(E--G)** Blood cell counts in WT and *Ccrl2*^−^*^/^*^−^ mice. Error bars represent SEM. *n* = 4--9 animals/group and *n* = 2 independent experiments. **(H--J)** Quantified bone marrow cells. Error bars represent SEM. *n* = 4--9 animals/group from *n* = 2 independent experiments. Statistical significance was assessed using a two-way analysis of variance with Dunnett's *post hoc* multiple comparisons test \**P* ≤ 0.05, \*\**P* ≤ 0.01, \*\*\**P* ≤ 0.001, \*\*\*\**P* ≤ 0.0001.](fimmu-08-01621-g002){#F2} We next examined the blood from these animals 4 h post zymosan challenge to investigate whether the increased monocyte and neutrophil recruitment we observed at the site of inflammation was mirrored in the blood, indicating increased mobilisation of innate immune cells from bone marrow and spleen. Similarly to the peritoneum, there was a twofold increase in blood neutrophils in *Ccrl2*^−^*^/^*^−^ mice challenged with zymosan compared with WT (Figure [2](#F2){ref-type="fig"}E). There was also an increase in Ly6C^hi^ monocytes, although this was not significant (Figure [2](#F2){ref-type="fig"}F). In agreement with the results from the peritoneum, there were no differences in circulating B cells, CD4 T cells or CD8 T cells between these genotypes (data not shown). Since we observed increased neutrophil and monocyte numbers in the peritoneum and blood of *Ccrl2*^−^*^/^*^−^ mice following zymosan challenge, we investigated if the increased numbers of systemic leucocytes was associated with differences in levels in the bone marrow (Figures [2](#F2){ref-type="fig"}H--J). *Ccrl2*^−^*^/^*^−^ did not display any significant differences in total bone marrow neutrophils (Figure [2](#F2){ref-type="fig"}H) monocytes (Figure [2](#F2){ref-type="fig"}I) or B cells (Figure [2](#F2){ref-type="fig"}J). Collectively, our results suggest that the elevated neutrophil levels observed in the peritoneum are the result of increased initial systemic inflammatory responses of *Ccrl2*^−^*^/^*^−^ mice. Intriguingly, Ccrl2 appears to be primarily important in the initial stages of the acute inflammatory response. When we investigated later time points following zymosan challenge (48 h), we found no significant differences in neutrophil or monocyte numbers in the peritoneum or blood between *Ccrl2*^−/−^ mice and WT mice (Figures S2B,C,E,F in Supplementary Material). In addition, there were no significant differences in local or systemic chemerin levels at this late time point (Figures S2D,G in Supplementary Material). Steady State *Ccrl2*^−*/*−^ Mice Displayed No Obvious Alterations in Resident Leucocyte Populations in Any Tissues Examined {#S3-3} --------------------------------------------------------------------------------------------------------------------------- To establish whether the increased inflammatory cell recruitment observed in *Ccrl2*^−^*^/^*^−^ mice during zymosan challenge could be explained by increased circulating myeloid cells under resting conditions, we undertook a phenotypic analysis of the peritoneum, blood, bone marrow and spleen of unchallenged WT and *Ccrl2*^−^*^/^*^−^ mice (Figure [2](#F2){ref-type="fig"}). We found no differences in neutrophils or monocytes between the two groups (Figures [2](#F2){ref-type="fig"}C,D). There were no differences in Ly6C^hi^ monocytes, Ly6C^lo^ monocytes or neutrophils in the blood between the two groups (Figures [2](#F2){ref-type="fig"}E--G). Similarly, there were no differences in monocytes, neutrophils or B cells in the bone marrow (Figures [2](#F2){ref-type="fig"}H--J). Nor were there obvious differences in the spleens under homeostatic conditions (data not shown). Finally, we endeavoured to assay basal levels of CXCL1 and IL-6 in the peritoneal lavage fluid of these mice, but all samples tested were below the limit of detection (set at 15 pg/ml) of the assays (data not shown). These results indicate that the increased neutrophil and monocyte recruitment to the peritoneum seen following zymosan challenge were due to differences in initial inflammatory responses rather than a constitutive increase in circulating neutrophil and monocyte numbers. *Ccrl2*^−*/*−^ Mice Displayed Increased CXCL1 and Chemerin Levels at Early Time Points following Zymosan Challenge {#S3-4} ------------------------------------------------------------------------------------------------------------------ Having shown that mice lacking the CCRL2 chemerin receptor displayed exaggerated acute inflammatory responses following zymosan challenge, we next investigated if the increased monocyte and neutrophil recruitment was due to elevated chemokine or inflammatory mediator levels. There were no significant differences in mediator levels between the two genotypes at the 4 h time point (Table [1](#T1){ref-type="table"}). However, a number of mediators including CXCL1 (an important neutrophil chemoattractant) and IL-6 displayed rapid induction following zymosan challenge peaking at 2 h (Figures [3](#F3){ref-type="fig"}A,B). ###### Local mediators (pg/ml) produced in peritoneal exudate cell fluid following 4 h challenge with 100 µg zymosan i.p. as measured by Luminex. IL-6 CCL2 CCL3 CCL4 CXCL1 CXCL2 CXCL10 -------------- ----------- ------------ ------------- ------------ ------------ ----------- ---------- Wild type 759 ± 123 1,218 ± 81 34.50 ± 5.3 744.3 ± 41 78.6 ± 6.4 506 ± 166 620 ± 50 *Ccrl2*^−/−^ 705 ± 83 1,013 ± 21 26.40 ± 2.1 736.8 ± 32 127.8 ± 28 400 ± 148 525 ± 24 *Data are presented as mean ± SEM of n = 8 animals*. *Statistical significance was assessed by a Student's unpaired t-test, ns = P \> 0.05*. ![Increased neutrophil recruitment in *Ccrl2*^−^*^/^*^−^ mice was associated with increased CXCL1 and chemerin levels at early time points. **(A--C)** 8- to 10-week-old male C57BL/6J wild-type (WT) mice were injected with zymosan i.p. (100 µg/animal), and animals were sacrificed at indicated time points. Peritoneal cavities were lavaged with ice-cold PBS supplemented with 2 mM EDTA. Mediator levels were quantified by ELISA. Error bars represent SEM. *n* = 4--15 mice per time point and *n* = 2 independent experiments. Statistical significance was assessed using one-way analysis of variance with Dunnett's multiple comparisons *post hoc* test. **(D--L)** 8- to 10-week-old male *Ccrl2*^−^*^/^*^−^ or age-matched littermate control mice were injected with zymosan i.p. (100 µg/animal), and animals were sacrificed 2 h later. Cells were quantified using counting beads, and cell populations were analysed using flow cytometry. **(D,E)** Total peritoneal cell counts following 2 h zymosan challenge. **(F)** CXCL1 and chemerin **(G)** levels in the peritoneum of *Ccrl2*^−^*^/^*^−^ and WT mice quantified by ELISA. **(H,I)** Blood neutrophils and monocytes in WT and *Ccrl2*^−^*^/^*^−^ mice. **(J,K)** Plasma levels of CXCL1 and chemerin quantified by ELISA. Data are presented as mean ± SEM. *n* = 8 animals/group and *n* = 2 independent experiments. Statistical significance was assessed using a Student's unpaired *t*-test. \**P* ≤ 0.05, \*\**P* ≤ 0.01.](fimmu-08-01621-g003){#F3} Since CXCL1 and IL-6 levels peaked rapidly following zymosan insult, we challenged both *Ccrl2*^−/−^ mice and littermate controls with zymosan for 2 h and assessed the resulting inflammatory responses. Similar to the 4 h time point, we observed significantly more neutrophils recruited to the peritoneum in the *Ccrl2*^−^*^/^*^−^ mice compared with WT (Figure [3](#F3){ref-type="fig"}E). There were very few if any monocytes recruited to the peritoneum at this early time point (Figure [1](#F1){ref-type="fig"}B). We observed a twofold increase in CXCL1 levels in the peritoneum of these animals as well as significantly elevated chemerin levels (Figures [3](#F3){ref-type="fig"}F,G). Whilst we observed no obvious differences in monocyte or neutrophil numbers in the blood (Figures [2](#F2){ref-type="fig"}H,I), there was a threefold increase in CXCL1 plasma levels (Figure [3](#F3){ref-type="fig"}K). Chemerin levels were also significantly elevated in the blood of the *Ccrl2*^−/−^ mice compared with WT at the 2 h time point (Figure [3](#F3){ref-type="fig"}L). *Ccrl2*^−/−^ Mice Displayed Increased Neutrophil Numbers in the Peritoneum after Thioglycollate Challenge {#S3-5} --------------------------------------------------------------------------------------------------------- To explore if the increased neutrophil recruitment observed in the *Ccrl2*^−^*^/^*^−^ mice was also evident with other inflammatory stimuli, we challenged these mice i.p. with thioglycollate. Thioglycollate is a well-established inflammatory stimulus used to elicit inflammatory macrophages (after 4--5 days) ([@B45], [@B52]). However, it can also be used to interrogate neutrophil recruitment in the initial stages of inflammation. Following a 1 h challenge with 4% thioglycollate, we observed a small but distinct population of neutrophils recruited to the peritoneum (Figure [4](#F4){ref-type="fig"}A). We chose this time point because it represents an early stage of neutrophil recruitment in response to thioglycollate. *Ccrl2*^−^*^/^*^−^ mice displayed a twofold increase in neutrophil recruitment to the peritoneum compared with WT controls (0.07 ± 0.01 × 10^6^ neutrophils in WT compared with 0.13 ± 0.01 × 10^6^ neutrophils in *Ccrl2*^−/−^ mice) (Figure [4](#F4){ref-type="fig"}C). There were also significantly higher CXCL1 and chemerin levels in the peritoneum of the *Ccrl2*^−^*^/^*^−^ mice compared with WT mice at this early time point (Figures [4](#F4){ref-type="fig"}D,E). ![Mice lacking *Ccrl2* displayed exaggerated neutrophil recruitment during acute inflammation independently of stimulus. 8- to 10-week-old male *Ccrl2*^−^*^/^*^−^ mice or age-matched littermate controls were injected with 4% thioglycollate, and 1 h later, animals were sacrificed. Peritoneal cavities were lavaged with ice-cold PBS supplemented with 2 mM EDTA. Cells were quantified using counting beads, and cell populations were analysed using flow cytometry. **(A)** Representative flow cytometry plots of the peritoneal cavities of wild-type (WT) and *Ccrl2*^−^*^/^*^−^ mice treated with thioglycollate. Neutrophils were defined as Ly6B.2 (7/4)^hi^ and Ly6G^hi^ **(B,C)** Total peritoneal cell counts following 1-h thioglycollate challenge. **(D)** CXCL1 and chemerin **(E)** levels in the peritoneum of *Ccrl2*^−^*^/^*^−^ and WT mice quantified by ELISA. Total blood leucocytes **(F)** and neutrophils **(G)** in WT and *Ccrl2*^−^*^/^*^−^ mice. **(H)** Plasma CXCL1 and chemerin **(I)** levels in *Ccrl2*^−^*^/^*^−^ and WT quantified by ELISA. Mean ± SEM. *n* = 5 animals/group and *n* = 1 experiment. Statistical significance was assessed using a Student's unpaired *t*-test. \**P* ≤ 0.05.](fimmu-08-01621-g004){#F4} When we examined the blood of these mice, there was no difference in neutrophil numbers between *Ccrl2*^−^*^/^*^−^ mice and WT controls (Figures [4](#F4){ref-type="fig"}F,G). This is perhaps not surprising given the early time point tested. There were, however, elevated chemerin levels in the blood of the *Ccrl2*^−^*^/^*^−^ mice compared with WT controls (Figure [4](#F4){ref-type="fig"}I). As we did not observe any differences in neutrophil numbers in the blood of these animals, it seems unlikely there would be changes in the bone marrow at this early time point but this was not assessed ([@B53]). Collectively, these observations demonstrate that mice lacking *Ccrl2* display exaggerated neutrophil recruitment to local sites of inflammation as well as elevated chemerin and CXCL1 levels irrespective of the stimulus used to elicit the response. Neutralisation of Endogenous Chemerin in *Ccrl2*^−*/*−^ Mice Abrogated the Exaggerated Inflammatory Phenotype {#S3-6} ------------------------------------------------------------------------------------------------------------- From our previous experiments, *Ccrl2*^−^*^/^*^−^ mice displayed increased myeloid cell recruitment in short-term models of acute inflammation. This was associated with elevated CXCL1 and chemerin levels. Given our group and others have identified the CCRL2 ligand chemerin, as an important modulator of inflammation and chemotaxis, it seemed plausible that the elevated levels of chemerin during acute inflammation in *Ccrl2*^−^*^/^*^−^ mice was responsible for the increased myeloid cell recruitment ([@B20], [@B21], [@B23]). To test this hypothesis, we used a blocking anti-chemerin antibody to neutralise endogenous chemerin levels in the *Ccrl2*^−^*^/^*^−^ mice before zymosan challenge (Figure [5](#F5){ref-type="fig"}). We first confirmed that this antibody could indeed block signalling at the Cmklr1 receptor. Using Cmklr1 transfected CHO-K1 cells, we demonstrated that preincubation with the antibody efficiently blocked chemerin induced β-arrestin recruitment to Cmklr1 (Figure [5](#F5){ref-type="fig"}A). We also tested the antibody in primary cells and confirmed that it effectively blocked chemerin-induced chemotaxis of biogel-elicited macrophages in a real-time chemotaxis system (Figure [5](#F5){ref-type="fig"}B). Following a 24 h pretreatment with isotype control or anti-chemerin antibody, *Ccrl2*^−/−^ mice were challenged for 4 h with zymosan as before (Figure [5](#F5){ref-type="fig"}C). Animals that received the anti-chemerin antibody displayed significantly less total leucocyte and neutrophil recruitment to the peritoneum compared with mice that received the isotype control (Figures [5](#F5){ref-type="fig"}D,E; Figure S1 in Supplementary Material). There was no significant effect on monocyte recruitment (Figure [5](#F5){ref-type="fig"}F). When we measured mediator levels in the peritoneum of these mice, we observed a twofold reduction in CXCL1 levels in the anti-chemerin treated mice compared with isotype control treated mice and no differences in IL-6 levels between the groups (Figures [5](#F5){ref-type="fig"}G,H). These results indicate that the elevated chemerin levels observed in *Ccrl2*^−^*^/^*^−^ mice contribute to the exaggerated leucocyte recruitment as well as the elevated CXCL1 levels observed in these mice during acute inflammation. ![Treatment with an anti-chemerin blocking antibody attenuated the exaggerated inflammatory responses observed in *Ccrl2*^−^*^/^*^−^ mice. **(A)** CHO-K1 cells stably transfected with murine Cmklr1 were plated out in a 96-well plate for 48 h before stimulation. Cells were challenged with indicated concentrations of anti-chemerin antibody or isotype control before challenge with 20 nM murine chemerin. *Cmklr1* activity was assessed by quantification of β-arrestin recruitment to Cmklr1 as measured by luminescence. RLU, relative light units. Error bars = SD of three technical replicates of one experiment. **(B)** Representative real-time chemotaxis trace of biogel-elicited peritoneal exudate cells (PECs). 8- to 10-week-old male C57BL/6J mice were injected i.p. with 2% Bio-gel (polyacrylamide beads) and sacrificed 4 days later. Peritoneal cavities were lavaged with ice-cold PBS supplemented with 2 mM EDTA. Cells were pretreated with vehicle or anti-chemerin antibody (ab) for 45 min. A gradient of 5 nM of the 5 nM chemerin was allowed to form, and chemotaxis was measured of 4 × 10^5^ cells (400,000 cells/well) for 3 h. **(C)** Schematic of *in vivo* experimental design. **(D--G)** 8- to 10-week-old male *Ccrl2*^−^*^/^*^−^ mice were pretreated with 100 ng of anti-chemerin blocking antibody or isotype control IgG antibody i.p. for 24 h before challenge with zymosan for 4 h. Animals were sacrificed, and peritoneal cavities were lavaged with ice-cold PBS supplemented with 2 mM EDTA. Cells were quantified using counting beads, and cell populations were analysed using flow cytometry **(D)** Total cells. **(E)** Total neutrophils. **(F)**. Total monocytes. Levels of CXCL1 **(G)** and IL-6 **(H)** in the peritoneum of indicated groups were quantified by ELISA. Mean ± SEM. *n* = 2--8 mice/group. Statistical significance was assessed using a Student's unpaired *t*-test. \**P* ≤ 0.05, \*\**P* ≤ 0.01.](fimmu-08-01621-g005){#F5} Chemerin, the Ligand for CCRL2, Increased Neutrophil Recruitment in WT Mice {#S3-7} --------------------------------------------------------------------------- Chemerin has previously been reported to induce the expression of various inflammatory cytokines and chemokines (including CXCL1 and CCL2) in epithelial and endothelial cells ([@B54], [@B55]). This provides a possible mechanism by which the higher chemerin levels in *Ccrl2*^−/−^ mice could cause increased CXCL1 levels during an inflammatory response. To further investigate the role of chemerin in exacerbating inflammation in our model, we pretreated WT mice with recombinant murine chemerin (4 µg/mouse) for 1 h before zymosan challenge (Figures [6](#F6){ref-type="fig"}A,B). Mice that received chemerin pretreatment displayed increased total cell recruitment to the peritoneum compared with mice that received PBS (4.5 × 10^6^ leucocytes in PBS treated animals compared with 7.5 × 10^6^ leucocytes in chemerin pretreated) (Figure [6](#F6){ref-type="fig"}C). Chemerin pretreated mice also displayed increased neutrophil recruitment to the peritoneum compared with PBS pretreated mice (2.5 ± 0.5 × 10^6^ neutrophils in zymosan alone compared with 4.5 ± 0.7 × 10^6^ in chemerin pretreated) (Figure [6](#F6){ref-type="fig"}D). We did not observe any differences in monocyte recruitment between the groups (Figure [6](#F6){ref-type="fig"}E). Importantly, injection of chemerin alone did not result in any neutrophil or monocyte recruitment (Figures [6](#F6){ref-type="fig"}B--E). When we analysed the inflammatory exudate from these mice, we found that chemerin pretreated mice had significantly higher levels of CXCL1 and IL-6 (Figures [6](#F6){ref-type="fig"}F,G). Mice that were treated with chemerin displayed a 2-fold and 2.6-fold increase in CXCL1 and IL-6 levels, respectively. We also observed similar effects using a lower dose of 0.5 µg chemerin per mouse as a pretreatment before zymosan challenge (data not shown). ![Recombinant chemerin pretreatment increased inflammatory cell recruitment in mice during acute inflammation. **(A)** 8- to 10-week-old male C57BL/6J mice were pretreated (i.p.) with recombinant murine chemerin (4 µg/mouse) or PBS for 1 h before challenge with zymosan i.p. (100 μg/mouse). 4 h later, mice were sacrificed, and peritoneal cavities were lavaged with ice-cold PBS supplemented with 2 mM EDTA. Cells were quantified using counting beads, and cell populations were analysed using flow cytometry. **(B)** Representative flow cytometry plots of the peritoneal cavities of wild-type and *Ccrl2*^−^*^/^*^−^ mice challenged with indicated treatments. Monocytes were defined as Ly6B.2 (7/4)^hi^, Ly6G^lo^ and neutrophils were defined as Ly6B.2 (7/4)^hi^, Ly6G^hi^. **(C)** Total CD45^+^ leucocytes recruited to the peritoneum of indicated groups following zymosan challenge. **(D)** Total neutrophils recruited to the peritoneum of indicated groups following zymosan challenge. **(E)** Total monocytes recruited to the peritoneum of indicated groups following zymosan challenge. Error bars represent SEM. *n* = 3--7 mice/group and *n* = 2 independent experiments. Levels of CXCL1 **(F)** and IL-6 **(G)** in the peritoneum of indicated groups. Mean ± SEM. *n* = 6--7 mice/group. Statistical significance was assessed using a Student's unpaired *t*-test. \**P* ≤ 0.05, \*\**P* ≤ 0.01.](fimmu-08-01621-g006){#F6} Increased Recruitment of Neutrophils and Monocytes in *Ccrl2*^−*/*−^ Mice Was Not due to a Direct Effect of CCRL2 on Chemerin Induced Chemotaxis {#S3-8} ------------------------------------------------------------------------------------------------------------------------------------------------ One possible explanation for the observed differences in inflammatory cell recruitment was that lack of Ccrl2 may in someway alter the migratory behaviour of inflammatory cells in response to chemerin or other chemotactic ligands. To test this, we used Bio-gel elicited PECs, which we recently demonstrated to be a mixture of inflammatory macrophages and neutrophils ([@B50], [@B51]). We first demonstrated that Bio-gel elicited neutrophils do not express the chemerin Cmklr1 receptor (Figure [7](#F7){ref-type="fig"}A). Using the real-time chemotaxis platform, we demonstrated that deletion of CCRL2 had no appreciable effect on PEC migration towards chemerin, CCL5, CXCL1, or C5a, ruling out any direct effect of CCRL2 on cell migration (Figures [7](#F7){ref-type="fig"}B--E). ![Absence of *Ccrl2* had no effect on the migratory behaviour of leucocytes towards macrophage or neutrophil chemoattractants. 8- to 10-week-old male *Ccrl2*^−^*^/^*^−^ mice and age-matched littermate controls were injected i.p. with 2% Bio-gel (polyacrylamide beads) and sacrificed 4 days later. Peritoneal cavities were lavaged with ice-cold PBS supplemented with 2 mM EDTA. **(A)** Representative histogram cytometry plots displaying Cmklr1 expression on biogel elicited macrophages and neutrophils. Macrophages were defined as F4/80^hi^, Ly6B.2 (7/4)^lo^, Ly6G^lo^, neutrophils were defined as Ly6B.2 (7/4)^hi^, Ly6G^hi^. **(B,E)** A gradient of 5 nM of the indicated chemoattractant was allowed to form, and chemotaxis was measured of 4 × 10^5^ cells (400,000 cells/well) for 3 h. Representative chemotaxis traces of wild type and *Ccrl2*^−^*^/^*^−^ peritoneal exudate cell chemotaxis to 5 nM chemerin **(B)** or 5 nM C5a. **(C)**. **(D)** Max--Min analysis and **(E)** slope analysis. Error bars are SEM of four experiments with independent macrophage preparations. Significance was assessed using two-way analysis of variance with Sidak's multiple comparison test. ns = *P* \> 0.05.](fimmu-08-01621-g007){#F7} Discussion {#S4} ========== In this study, we have demonstrated for the first time that Ccrl2 plays a non-redundant role in dampening the recruitment of myeloid cells to local sites of acute inflammation. We report that Ccrl2 is expressed on resident peritoneal macrophages as well as recruited monocytes and neutrophils following zymosan challenge (Figure [1](#F1){ref-type="fig"}D). Interestingly, the highest levels of expression appear to be on recruited neutrophils and this is in agreement with a recent report by Del Prete et al. ([@B56]). In addition, *Ccrl2* expression on macrophages and endothelial cells is increased after exposure to inflammatory stimuli. This is in agreement with published reports (Figures [1](#F1){ref-type="fig"}E,F) ([@B39], [@B40]). After 4 h of zymosan challenge we observed that mice lacking expression of the Ccrl2 chemerin receptor displayed a twofold increase in monocyte and neutrophil recruitment to the peritoneum (Figures [2](#F2){ref-type="fig"}B,C). These effects of Ccrl2 were not localised only to the site of inflammation, as we also observed increased neutrophil numbers in the blood, suggesting more systemic effect (Figure [2](#F2){ref-type="fig"}E). These systemic effects were predominantly associated with neutrophil recruitment as we did not observe significant differences in monocyte numbers in the blood or bone marrow (Figures [2](#F2){ref-type="fig"}F,I). The fact that there were significant differences only in local monocyte numbers but not in systemic numbers may be a feature of the early time point evaluated here, as we know from our kinetic studies that monocyte numbers peak later (Figure [1](#F1){ref-type="fig"}B). Importantly, at an earlier time point (2 h) in which we could more easily evaluate cytokine and chemokine levels, we observed that mice lacking Ccrl2 displayed higher levels of CXCL1 in the peritoneum (Figure [3](#F3){ref-type="fig"}F). The elevated levels of CXCL1 both locally and systemically would explain why the majority of differences we observe in the *Ccrl2*^−/−^ mice were in the context of neutrophil migration. This phenotype was consistently associated with higher endogenous levels of chemerin in *Ccrl2*^−/−^ mice and was abrogated after blocking chemerin activity with an anti-chemerin antibody (Figure [5](#F5){ref-type="fig"}). Furthermore, this phenotype was recapitulated in WT mice by injection of recombinant murine chemerin, further indicating a role for chemerin in driving this exaggerated neutrophil recruitment (Figure [6](#F6){ref-type="fig"}). Finally, this exaggerated inflammatory phenotype of *Ccrl2*^−/−^ mice appears to be predominantly associated with the initial stages of acute inflammatory responses. Absence of Ccrl2 did not appear to affect neutrophil or monocyte numbers locally or systemically at later time points (Figure S2 in Supplementary Material). Ccrl2 is one of the less studied chemerin receptors and arguably performs the least obvious function. It binds chemerin but there is no reported downstream signalling upon receptor ligation in primary cells ([@B38], [@B39]). Whilst it was initially thought to serve a similar function to the decoy receptors ACKR1 (or DARC) and ACKR2 (or D6), which dampen inflammation by binding and internalising inflammatory chemokines, Ccrl2 does not internalise chemerin or any other chemokines ([@B38], [@B57]). Whilst the exact role of Ccrl2 during inflammation has yet to be fully elucidated, its expression has been documented by a number of groups including in this report (Figures [1](#F1){ref-type="fig"}E,F) to be rapidly upregulated during inflammation, suggesting a conserved function required during inflammatory responses ([@B39], [@B40]). Several studies have endeavoured to clarify the role played by Ccrl2 *in vivo* but there have been conflicting results in different experimental models. Zabel et al. demonstrated that mice lacking Ccrl2 displayed reduced ear swelling and leucocyte influx in a mast cell dependent model of atopic allergy. The exact mechanism by which Ccrl2 modulated these responses was not clear. However, cells expressing Ccrl2 were shown to bind and concentrate chemerin locally *in vitro*. When these cells were incubated with *Cmklr1* transfected cells, they induced calcium flux, indicating a possible role for Ccrl2 in chemerin presentation ([@B38]). In the *in vitro* model, Ccrl2 expressing cells were capable of binding chemerin and presenting it to Cmklr1 expressing cells when in close proximity. It was postulated this mode of action played a role in mast cell responses to low dose IgE challenge. However, this seems unlikely to be the case in our model of acute inflammation. Administration of recombinant bioactive chemerin to WT mice exacerbated the acute inflammatory response (Figure [6](#F6){ref-type="fig"}). If Ccrl2 were functioning to increase chemerin signalling, which appears to be pro-inflammatory here, one would expect to observe reduced inflammation following zymosan challenge in *Ccrl2*^−/−^ mice. Yet in Figures [2](#F2){ref-type="fig"} and [3](#F3){ref-type="fig"}, we observed the converse. An alternative hypothesis, therefore, is that *in vivo*, increased expression of Ccrl2 on other cell types during inflammation such as vascular endothelial cells may enable binding of free chemerin, which in turn reduces systemic levels of chemerin ([@B39]). This would thereby decrease the chemerin available to interact with Cmklr1 expressing cells and therefore dampen the ensuing pro-inflammatory responses elicited by chemerin as described by Neves et al. ([@B55]). Mazzon et al. reported that mice lacking Ccrl2 displayed exacerbated disease in a model of experimental autoimmune encephalitis (EAE) as well as increased *Ccrl2* expression on mononuclear cells in WT mice during EAE ([@B58]). The authors reported that in mice lacking Ccrl2, T cells, and macrophages were further polarised towards an inflammatory phenotype during disease, but the mechanism by which deletion of the *Ccrl2* gene enhanced disease remained unexplained ([@B58]). At the time of writing, the same group more recently reported a new study in which mice lacking Ccrl2 were protected in two murine models of arthritis in contrast to their previous study using the EAE model, highlighting the complexity of the chemerin/Ccrl2 axis ([@B56], [@B58]). Importantly, the authors report that the protective effect of deletion of *Ccrl2* in these models was due to defects in neutrophil recruitment and trafficking due to CXCR2 heterodimersastion with Ccrl2. These results seem to be at odds with our current findings but possibly reflect differences in the disease models used to interrogate this biology. The kinetics and disease pathology differ significantly between the acute models of inflammation used in our study and the more chronic disease models used by Del Prete et al. in their most recent report ([@B56]). Clearly, further studies will be necessary to clarify the exact role played by Ccrl2 during inflammation but it seems likely to be disease and even tissue specific ([@B59]). In agreement with an earlier study by Monnier et al. who reported higher chemerin levels in the blood of *Ccrl2*^−/−^ mice following intranasal administration of LPS, we observed elevated chemerin levels in the blood of *Ccrl2*^−/−^ animals following zymosan and thioglycollate challenge (Figures [3](#F3){ref-type="fig"} and [4](#F4){ref-type="fig"}) ([@B39]). In addition, using BMDMs from WT animals and HUVECs, we observed increased expression of *Ccrl2* mRNA after stimulation with inflammatory stimuli (up to \~230-fold increase on BMDMs) (Figure [1](#F1){ref-type="fig"}E). We also report increased neutrophil recruitment and CXCL1 levels both locally and systemically (Figures [2](#F2){ref-type="fig"} and [3](#F3){ref-type="fig"}) in *Ccrl2*^−^*^/^*^−^ mice challenged with 100 µg zymosan. To the best of our knowledge, this is the first report of such an observation. The increased neutrophil recruitment during acute inflammation in these mice can be at least partly explained by increased CXCL1 and chemerin levels. Previous studies from our lab and others have not detected the chemotactic chemerin receptor Cmklr1 on murine neutrophils ([@B23], [@B56], [@B60]). There has since been one report of murine neutrophils expressing Cmklr1; however, we failed to detect any Cmklr1 expression on murine neutrophils (Figure [7](#F7){ref-type="fig"}A) ([@B35]). It seems unlikely, therefore, that the increased neutrophil recruitment we observed in our model is due to any direct chemotactic effects of chemerin on neutrophils. We did not observe any differences in migration between WT and *Ccrl2*^−/−^ cells in response any mediators tested in agreement with Del Prete et al. (Figures [7](#F7){ref-type="fig"}C,D) ([@B56]). Importantly, the phenotype observed in *Ccrl2*^−^*^/^*^−^ mice is not related to the receptors that detect zymosan (dectin-1, TLR2/6) as we observed a similar phenotype with thioglycollate challenge, which is a more severe inflammatory insult ([@B61]). Our results support the hypothesis that Ccrl2 is important for regulating both local and systemic chemerin levels during an acute inflammatory response. This exacerbated inflammatory response was not simply a feature of increased basal myeloid cell numbers, as we observed no differences in leucocyte populations between the two groups in any tissue tested under steady state conditions (Figure [2](#F2){ref-type="fig"}). Rather, the increased myeloid cell recruitment in *Ccrl2*^−^*^/^*^−^ mice was associated with increased chemerin and CXCL1 levels both locally and systemically. Chemerin has previously been reported to induce pro-inflammatory signalling in microvascular endothelial and smooth muscle cells ([@B55]). Chemerin treatment increased mRNA expression of a number of pro-inflammatory mediators including CCL2, TNF-α, and VCAM-1 ([@B55]). Another study by Lin et al. demonstrated that chemerin administration to WT mice induced more severe inflammation in a model of DSS-induced colitis, which was characterised by increased inflammatory cytokines and an inhibition of M2 polarisation of resident macrophages ([@B62]). Taken together, these reports support our hypothesis that increased chemerin levels observed in the *Ccrl2*^−^*^/^*^−^ mice were responsible for increased myeloid cell recruitment *via* the increased production of inflammatory mediators such as CXCL1 during sterile peritonitis. We confirmed the importance of chemerin in the phenotype of *Ccrl2*^−^*^/^*^−^ mice using an anti-chemerin polyclonal blocking antibody to inhibit chemerin signalling in these animals before zymosan challenge (Figure [5](#F5){ref-type="fig"}). Neutralisation of endogenous chemerin in the *Ccrl2*^−^*^/^*^−^ mice decreased the total leucocytes and neutrophils recruited to the peritoneum compared with isotype controls, indicating that elevated chemerin levels did indeed play a role in the exaggerated neutrophil recruitment observed in these animals (Figures [5](#F5){ref-type="fig"}C,D). We previously observed that blockade of endogenous chemerin in WT mice resulted in increased neutrophil and monocyte recruitment to the peritoneum of WT mice following challenge with 10 µg zymosan ([@B34]). In our current study, we did not interrogate chemerin blockade in WT mice but when chemerin activity was blocked in *Ccrl2*^−/−^ mice during 100 µg zymosan challenge, we observed decreased neutrophil recruitment compared with isotype control treated *Ccrl2*^−/−^ mice. These data highlight further differences in chemerin behaviour depending on the intensity of inflammatory insult and genetic backgrounds used. From the results in our current study, it is plausible that chemerin may be more important for driving neutrophil rather than monocyte recruitment in this acute model of inflammation, as chemerin blockade had no significant effect on monocyte numbers. However, it is known that neutrophils are important for the recruitment of monocytes during an inflammatory response and are capable of secreting a number of monocyte chemoattractants ([@B63], [@B64]). Chemerin bioactivity may not have been completely blocked in these animals, hence although we observed a significant decrease in neutrophil recruitment, this may not been sufficiently blunted to in turn appreciably decrease monocyte recruitment at this time point. When we interrogated mediator levels, we observed a significant decrease in local levels of CXCL1 but no change in IL-6 following blockade of endogenous chemerin (Figures [5](#F5){ref-type="fig"}F,G). CXCL1 and IL-6 were evaluated as CXCL1 is a key driver of neutrophil recruitment and IL-6 is a systemic marker of inflammation ([@B65]--[@B68]). As predicted from our results using chemerin blocking antibodies, chemerin pretreatment of WT mice before zymosan challenge increased total cell and neutrophil recruitment to the peritoneum as well as elevated levels of inflammatory chemokines and cytokines, similar to what we observed in the *Ccrl2*^−^*^/^*^−^ mice (Figure [6](#F6){ref-type="fig"}). Importantly, injection of chemerin alone did not induce any neutrophil recruitment after 4 h at the dose used (Figures [6](#F6){ref-type="fig"}B--E). We demonstrate here that full-length bioactive chemerin can increase neutrophil recruitment when administered before an inflammatory stimulus but previous studies from our laboratory have reported that a synthetic chemerin-derived peptide called C15 has anti-inflammatory effects in a similar model (albeit using 10-fold lower dose of zymosan as an inflammatory stimulus) ([@B34]). The most likely explanation for this apparent discrepancy is differences in the pharmacology and downstream signalling between the full-length chemerin protein and the 15 amino acid chemerin peptide. The signalling cascades that are activated at the murine Cmklr1 receptor upon chemerin binding for example, are relatively well characterised (involving the MAP kinase, RhoA, ROCK, MEK1/2, and P38 proteins amongst others) ([@B23], [@B26]). However, very little if anything is known about the signalling pathways induced by the C15 peptide. Whilst chemerin is known to act as a potent chemoattactant for macrophages, DCs, and NK cells, C15 does not exhibit similar effects on any cell types investigated thus far ([@B20], [@B22], [@B23], [@B30], [@B50]). Clearly, the full-length protein and the smaller peptide elicit quite different intracellular signalling pathways downstream of the Cmklr1 chemerin receptor and this would suggest they play quite different roles *in vivo*. We have endeavoured to confirm the requirement for CXCL1 in the exaggerated neutrophil recruitment in *Ccrl2*^−/−^ mice by pretreating WT and *Ccrl2*^−/−^ mice with a blocking anti-CXCL1 antibody before zymosan challenge. However, we did not observe significant decreases in neutrophil recruitment in either group despite previous reports (data not shown) ([@B65]). However, these results are perhaps not surprising given the high affinity of these chemokines for their receptors as well as the functional redundancy in the system ([@B69]). Hence, we have demonstrated that chemerin is elevated in *Ccrl2*^−/−^ mice and that elevated chemerin is capable of driving the exaggerated neutrophil recruitment and increased levels of CXCL1 during acute inflammation. However, we cannot exclude the possibility that other mediators or pathways are also involved. Further studies will be required to fully clarify this. In summary, we have demonstrated that the non-signalling chemerin receptor Ccrl2 serves a non-redundant role in dampening acute inflammatory responses *in vivo*. The absence of Ccrl2 resulted in exaggerated acute inflammatory responses as well as elevated CXCL1 and chemerin levels. Blockade of endogenous chemerin in *Ccrl2*^−^*^/^*^−^ mice abrogated the elevated neutrophil recruitment. We observed that administration of recombinant murine chemerin to WT mice induced similar exaggerated inflammatory responses to those seen in *Ccrl2*^−^*^/^*^−^ mice. Importantly, deletion of the *Ccrl2* gene did not have any direct effect on myeloid cell chemotaxis towards chemerin or other chemokines. Our data are consistent with a model in which Ccrl2 serves to bind and maintain chemerin levels below a pathological threshold during acute inflammation and the more severe inflammatory responses observed in *Ccrl2*^−^*^/^*^−^ mice are due to significantly elevated free chemerin levels. The increased chemerin signalling in turn induces higher production of inflammatory chemokines such as CXCL1, which results in elevated myeloid cell recruitment and more severe inflammation. Our experiments suggest that chemerin could be a therapeutic target in the treatment of inflammatory diseases, particularly RA, in which chemerin has consistently been implicated in the pathology of this disease ([@B16], [@B19], [@B54], [@B70]). Ethics Statement {#S5} ================ All animal studies were conducted with ethical approval from the Dunn School of Pathology Local Ethical Review Committee and in accordance with the UK Home Office regulations (Guidance on the Operation of Animals, Scientific Procedures Act, 1986). Author Contributions {#S6} ==================== DR-K, SV, CR, LT, TK, DG, and AI performed experiments; DR-K, SV, and AI analysed results and made the figures; DR-K, SV, AI, and DG designed the research and wrote the paper. All the authors provided critical revision of the manuscript. Conflict of Interest Statement {#S7} ============================== The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The authors thank Linda Randall and Nicky Hamp for excellent technical assistance. **Funding.** This work was supported by British Heart Foundation grants (FS/11/82/29332, PG/10/6028496, RE/13/1/30181) and MRC Industrial CASE Studentship (MR/K017160/1). Supplementary Material {#S8} ====================== The Supplementary Material for this article can be found online at <http://www.frontiersin.org/article/10.3389/fimmu.2017.01621/full#supplementary-material>. ###### Click here for additional data file. ###### Click here for additional data file. [^1]: Edited by: Fulvio D'Acquisto, Queen Mary University of London, United Kingdom [^2]: Reviewed by: Francesco Maione, University of Naples Federico II, Italy; Vily Panoutsakopoulou, Biomedical Research Foundation of the Academy of Athens, Greece [^3]: ^†^These authors share first authorship. [^4]: ^‡^These authors share senior authorship. [^5]: Specialty section: This article was submitted to Inflammation, a section of the journal Frontiers in Immunology
{ "pile_set_name": "PubMed Central" }
INTRODUCTION {#sec1-1} ============ *Gynura* genus belongs to the family Asteraceae, consisting of 12 species in China.\[[@CIT1]\] Many species are edible medicinal plants and the leaves are also used as a vegetable by the locals in Southwestern China.\[[@CIT2]\] *G. divaricata* is a traditional Chinese medicinal plant, which is called "Bai Bei San Qi" in Chinese. It has a long history of use for treatment of diabetes in the folk medicine. The ethanol extract of aerial parts of *G. divaricata* was reported to demonstrate hypoglycemic activity in vivo, the flavonoid compounds were the active constituents.\[[@CIT3][@CIT4]\] It also has been reported that many constituents with antiproliferation activity exist in *G. divaricata*.\[[@CIT5][@CIT6]\] The chemical constituents of *G. divaricata* include flavonols, phenolic acids, cerebrosides, polysaccharides, alkaloids, terpenoids, and sterols.\[[@CIT5]--[@CIT10]\] Flavonols were the principal constituents of the plant, 4 flavonol compounds, including quercetin, isoquercitrin, rutin, and kaempferol-3-O-rutinoside, have been isolated and identified from the aerial parts of the plant.\[[@CIT9]\] This article herein describes the isolation and structure elucidation of the flavonol and phenolic acid compounds from the ethanol extract of *G. divaricata* DC. leaves by NMR and high-performance liquid chromatography-diode array detector-electrospray ionization-mass spectrometry (HPLC-DAD-ESI-MS) methods. MATERIALS AND METHODS {#sec1-2} ===================== General {#sec2-1} ------- The^1^H-NMR and^13^C-NMR spectra were measured with a Bruker Avance-600 FT-NMR spectrometer (Bruker, Coventry, Germany), with TMS internal standard. HPLC-DAD-ESI-MS were recorded on Waters 2995 Series LC and ZQ-4000 Mass spectrometer (Waters Corporation, Milford, MA, USA). Column chromatography was carried out with Silica gel (Qingdao Marine Chemistry Co. Ltd., 200-300 mesh, Qingdao, China), Sephadex LH-20, and Reverse phase octadecylsilyl (RP-ODS) (Pharmacia Co. Ltd., Minnesota, USA). Thin layer chromatography (TLC) was carried out with Silica gel GF~254~ (Qingdao Marine Chemistry Co. Ltd., Qingdao, China), and the compounds were prepared either by spraying with 10% sulfuric acid ethanol or under UV lamp at 254 nm. HPLC-grade acetonitrile was purchased from Merck Company (Merck, Darmstadt, Germany), other solvents were analytical grade from Sinopharm Chemical Reagent Co. Ltd. (Shanghai, China). Plant material {#sec2-2} -------------- The *Gynura divaricata* plant was obtained in 2009 from Guangdong province, China. A voucher specimen (201001) was deposited at the Department of Chemistry, Nanchang University. The leaves of *G. divaricata* were dried at 40°C in an air oven and finely powdered. Extraction and isolation {#sec2-3} ------------------------ The weighed portion of the crude drug 5 kg was extracted twice with 60% ethanol (v/v) under reflux at 90°C. The extract was evaporated to dryness *in vacuo*. Extract yield with respect to the dried herb was 25%. The dry extract was suspended in water and subjected to sequential liquid-liquid extraction with chloroform, ethyl acetate (EA), and *n*-butanol, the yield of those 3 extracts were 31.2, 56.5, and 89.5 g, respectively. The EA fraction was chromatographed using flash column on a Silica gel eluted with chloroform-methanol step-gradient (starting with 100:0 to 4:1), eluted fractions were combined on their TLC pattern to yield 8 fractions. The chloroform-methanol fraction (10:1) was chromatographed on a Sephadex LH-20 column eluted with chloroform-methanol (1:1) to yield compounds 1 and 2. The chloroform-methanol fraction (6:1) chromatographed on a Sephadex LH-20 column eluted with methanol and further chromatographed on an RP-ODS column gradient eluted with methanol-water (40%-60%, v/v) gave compounds 3 and 7. The chloroform-methanol fraction (4:1) chromatographed on a Sephadex LH-20 column eluted with methanol yields compound 4 \[[Figure 1](#F0001){ref-type="fig"}\]. ![The procedure of extraction and isolation phenolic compounds from *G. divaricata* extracts. (a) Silica gel chromatograph eluted with a mixture of chloroform and methanol (from 100:0 to 4:1); (b) Sephadex LH-20 chromatograph eluted with a mixture of chloroform and methanol (1:1); (c) Sephadex LH-20 column eluted with methanol coupled with RP-ODS column gradient eluted with methanol-water (from 40% to 60%, v/v); (d) Sephadex LH-20 column eluted with methanol, (e) RP-ODS column gradient eluted with methanol-water (from 10% to 50%, v/v) coupled with RP-ODS column and isocratic eluted with methanol-water (18%, v/v)](PM-7-101-g001){#F0001} The *n*-butanol fraction was chromatographed using flash RP-ODS column gradient eluted with methanol-water (10%-50%, v/v), and the eluted fractions were combined on their HPLC pattern to yield 4 fractions. The methanol-water fraction (25%, v/v) was further chromatographed using flash RP-ODS column and isocratic eluted with methanol-water (18%, v/v) gave compounds 5 and 6. The other minor constituents of *n*-butanol extracts were separated and identified by HPLC-DAD-ESI-MS method. HPLC-MS instrument and conditions {#sec2-4} --------------------------------- The HPLC-DAD-ESI-MS system consists of a Waters 2995 Series LC and ZQ-4000 Mass spectrometer (Waters, USA), equipped with a vacuum degasser, a quaternary pump, an autosampler, a thermostatted column compartment, a diode array detector (DAD), and an ion-trap mass spectrometer with electrospray ionization interface, controlled by Waters 2995 Series LC/ZQ-4000 Trap Software. Shimadzu shimpack VP-ODS (150 mm × 4.6 mm i.d., 5 μm particle size) was used for separation. Solvents for the mobile phase were water-0.1% acetic acid (A) and acetonitrile (B). The gradient elution was 0-30 min, linear gradient 10%-30% B; 30-40 min, linear gradient 30%-100% B. The flow rate was 0.8 mL/min and the column was operated at 30°C. Peaks were detected with the DAD at 254 nm. The ESI negative and positive ionization (NI and PI) total ion current (TIC) modes were used for MS detection. The *m/z* values of the monitored ions were from 100 to 800. The other parameters were as follows: capillary voltage, 3.5 kV; cone voltage, 30 V; extraction voltage, 5 V; RF voltage, 0.5 V; source temperature, 90°C; nitrogen gas flow for desolvation, 300 L/h; and temperature of the nitrogen gas for desolvation, 350°C. Samples for assay were dissolved in 45% MeOH as 3 mg/mL solutions and centrifuged at 12,000 rpm (Beckman, USA) for 15 min to remove particles before injection. RESULTS AND DISCUSSION {#sec1-3} ====================== The compounds were identified using UV, ESI-MS, and NMR spectral data, and determined as quercetin,\[[@CIT11][@CIT12]\] kaempferol,\[[@CIT13][@CIT14]\] kaempferol-3-O-*β*-D-glucopyranoside,\[[@CIT15]\] quercetin-3-O-rutinoside,\[[@CIT15]\] kaempferol-3-O-rutinoside-7-O-*β*-D-glucopyranoside,\[[@CIT16][@CIT17]\] kaempferol-3,7-di-O-*β*-D-glucopyranoside,\[[@CIT16]\] and 3,5-Dicaffeoylquinic acid.\[[@CIT18]\] Compound 1 was obtained as a yellow powder, the ESI-MS yielded a quasi-molecular ion peak \[M-H\]^-^ at *m/z* 301 and \[M+H\]^+^ at *m/z* 303. The UV spectrum showed λ~max~ at 256 and 370 nm. The^1^H-NMR spectrum showed 2 peaks at δ 6.18 (1H, d, *J* = 2.0 Hz) and 6.40 ppm (1H, d, *J* = 2.0 Hz) consistent with the meta protons H-6 and H-8 on A-ring and an ABX system at 7.68 (1H, d, *J* = 2.2 Hz, H-2'), 7.54 (1H, dd, *J* = 2.0 Hz, 8.4 Hz, H-6'), and 6.88 (1H, d, *J* = 8.4 Hz, H-5') corresponding to the catechol protons on B-ring. The^13^C-NMR spectrum indicated the presence of 15 carbon atoms, the signal at δ 177.9 was attributed to a carbonyl carbon placed at C-4, and the other signals were compatible with those literatures\[[@CIT11][@CIT12]\] on quercetin. Compound 2 was obtained as a yellow powder, the ESI-MS yielded a quasi-molecular ion peak \[M-H\]^-^ at *m/z* 285 and \[M+H\]^+^ at *m/z* 287. The UV spectrum showed λ~max~ at 265 and 366 nm. The^1^H-NMR spectrum showed 2 peaks at δ 6.17 (1H, d, *J* = 1.8 Hz) and 6.42 ppm (1H, d, *J* = 1.8 Hz) consistent with the meta protons H-6 and H-8 on A-ring and an AA'BB' system at 8.04 (2H, d, *J* = 8.9 Hz, H-2', 6') and 6.93 (2H, d, *J* = 8.9 Hz, H-3', 5') corresponding to the protons on B-ring. The MS and^1^ H-NMR data were compatible with the literatures\[[@CIT13][@CIT14]\] of kaempferol. Compound 3 was obtained as a faint yellow powder, the ESI-MS yielded a quasi-molecular ion peak \[M-H\]^-^ at *m/z* 447 and \[M+H\]^+^ at *m/z* 449. The UV spectrum showed λ~max~ at 265 and 346 nm. The^1^ H-NMR spectrum showed 2 peaks at δ 6.21 (1H, d, *J* =1.8 Hz) and 6.44 ppm (1H, d, *J* =1.8 Hz) consistent with the meta protons H-6 and H-8 on A-ring and an AA'BB' system at 8.04 (2H, d, *J* =8.9 Hz, H-2', 6') and 6.89 (2H, d, *J* =8.9 Hz, H-3', 5') corresponding to the protons on B-ring. Compound 3 presented the same aglycone signal patterns of compound 2, but the signal at 5.47 (1H, d, *J* =7.2 Hz) followed by other characteristic additional signals indicates the presence of a sugar moiety in compound 3. The hexose was determined to be a glucopyranosyl unit bound to the C-3 position of the aglycone by comparison of proton and carbon upfield shift values with the literature data.\[[@CIT15]\] Therefore, compound 3 was identified as kaempferol-3-O-*β*-D-glucopyranoside. Compound 4 was obtained as a faint yellow powder, the ESI-MS yielded a quasi-molecular ion peak \[M-H\]^-^ at *m/z* 609 and \[M+H\]^+^ at *m/z* 611. The UV spectrum showed λ~max~ at 258 and 356 nm. The^1^H-NMR spectrum showed 2 peaks at δ 6.20 (1H, d, *J* = 2.0 Hz) and 6.40 ppm (1H, d, *J* = 2.0 Hz) consistent with the meta protons H-6 and H-8 on A-ring and an ABX system at 7.54 (1H, d, *J* = 2.2 Hz, H-2'), 7.59 (1H, dd, *J* = 2.0 Hz, 9.0 Hz, H-6') and 6.85 (1H, d, *J* = 9.0 Hz, H-5') corresponding to the catechol protons on B-ring. Compound 4 presented the same aglycone signal patterns of compound 1, two anomeric proton signals at 5.32 (1H, d, *J* =7.2 Hz) and 4.39 (1H, d, *J* = 1.6 Hz) were assignable to H-1 of a *β*-glucosyl proton and to the H-1 of an *α*-rhamnosyl proton, respectively. A methyl signal 0.99 (3H, d, *J* =6.2 Hz) in the high-field region was assigned to rhamnose. In the^13^C-NMR of compound 4, the C-6 signal (68.5) of glucose showed a downfield shift of 7.3 ppm in comparison with the corresponding C-6 signal (61.2) of quercetin-3-O-*β*-D-glucopyranoside,\[[@CIT15]\] indicating a 1-6 linkage between the glucose and the rhamnose. Therefore, compound 4 was identified as rutin. Compound 5 was obtained as a faint yellow powder, the molecular formula C~27~H~30~O~16~ was suggested by a mass spectrum with a quasi-molecular ion peak \[M-H\]^-^ at *m/z* 609, further confirmed by the positive mode mass spectral ions: 611 \[M+H\]^+^, 449 \[M+H-162\]^+^, 287 \[M+H-162-162\]^+^. The UV spectrum showed λ~max~ at 264 and 347 nm typical of a kaempferol glycoside derivative.\[[@CIT15][@CIT16][@CIT19]\] In the aromatic region of the^1^ H-NMR spectrum an AA'BB' system, appearing as two doublets at δ 8.06 (2H, d, *J* = 8.9 Hz, H-2', 6') and 6.90 (2H, d, *J* = 8.9 Hz, H-3', 5'), and two meta coupled doublet protons at δ 6.78 and 6.44 were evident. In the saccharide region of the spectrum two anomeric proton signals were present as large doublets at δ 5.48 and 5.08. The coupling constant (*J* = 7.2 Hz) of the two anomeric protons characteristic for *β*-configuration. The downfield shift of the H-6 and H-8 proton, as well as downfield shift of the corresponding carbons at δ 99.8 and δ 94.9, with respect to the corresponding signals of aglycone, suggested the linkage with the sugar moiety across the oxygen of the C(7)-OH group.\[[@CIT17]\] The chemical shift (δ 5.48) suggested that the other sugar moiety is directly attached to the C(3)-OH group, further confirmed by the upfield shift of the signal assigned to C-3 (133.9).\[[@CIT15][@CIT16]\] Acid hydrolysis of compound 5 afforded kaempferol and glucose comparison with the authentic samples on TLC. From the above data, compound 5 was identified as kaempferol-3,7-di-O-*β*-D-glucopyranoside. Compound 6 was obtained as a faint yellow powder, the molecular formula C~33~H~40~O~20~ was suggested by a mass spectrum with a quasi-molecular ion peak \[M-H\]^-^ at *m/z* 755. The UV and^1^ H-NMR spectrum of compound 6 was similar to that of 5, suggesting that compound 6 also was a kaempferol glycoside derivative, the only difference being the presence of a methyl signal (δ 0.99) in the high-field region, which was assigned to rhamnose, further confirmed by the doublet proton at δ 4.44, was assigned to the anomeric proton of rhamnose with a coupling constant (*J* = 1.6 Hz) characteristic for *α*-linked rhamnose. The^13^C-NMR spectrum of 6 confirms that compound 6 is a triglycoside of kaempferol \[[Table 1](#T0001){ref-type="table"}\]. Careful examination of the^13^C-NMR spectrum of 6 showed that the signal assigned to the glucose C-6 \[[Table 1](#T0001){ref-type="table"}\] was shifted downfield by appropriately 6 ppm (from 61.3 to 67.3) confirming that the rhamnose moiety linkage to the glucose C-6.\[[@CIT17]\] From the above data, compound 6 was identified as kaempferol-3-O-rutinoside-7-O-*β*-D-glucopyranoside. ###### The 1H-NMR and 13C-NMR spectrum data of kaempferol-3,7-di-O-*β*-d-glucopyranoside and kaempferol-3-O-rutinoside-7-O-*β*-d-glucopyranoside (DMSO-d6) Atom Kaempferol-3,7-di-O-*β*-d-glucoside Kaempferol-3-O-rutinoside-7-O-*β*-d-glucoside ---------------- ------------------------------------- ----------------------------------------------- ------- -------- ----- ------- 2 156.5 156.5 3 133.9 140.0 4 178.1 178.1 4a 105.9 161.4 5 161.3 106.1 6 6.44 d 2.0 99.8 6.45 d 2.0 99.8 7 163.3 163.4 8 6.78 d 2.0 94.9 6.76 d 2.0 95.1 8a 157.3 157.8 1' 121.1 121.2 2' 8.06 d 8.6 131.4 8.01 d 8.8 131.5 3' 6.90 d 8.6 115.6 6.90 d 8.8 115.6 4' 160.6 160.6 5' 115.6 115.6 6' 131.4 131.5 3-O-Rutinoside G1 5.48 d 7.2 101.2 5.35 d 7.2 101.7 G2 74.6 74.7 G3 76.9 76.9 G4 70.4 70.4 G5 78 77.7 G6 61.3 67.3 R1 4.44 d 1.6 101.2 R2 70.8 R3 71.1 R4 72.3 R5 68.7 R6 0.99 d 6.2 18.2 7-O-Glucoside G'1 5.08 d 7.2 100.2 5.08 d 7.2 100.3 G'2 73.5 73.6 G'3 76.9 76.3 G'4 70.0 70.1 G'5 77.6 76.9 G'6 61.1 61.1 Compound 7 was obtained as amorphous powder, the ESI-MS yielded a quasi-molecular ion peak \[M-H\]^-^ at *m/z* 515 and \[M+H\]^+^ at *m/z* 517. The UV spectrum showed λ~max~ 327, 294 (sh), and 248 nm (sh), which were characteristic of caffeic acid derivatives. In the^1^ H-NMR spectrum, two caffeoyl groups were presented at δ 7.50 (1H, d, *J*=16.0 Hz, H-7'), 7.43 (1H, d, *J*=16.0 Hz, H-7"), 7.05 (2H, brs, H-2', 2"), 7.01 (2H, brd, *J*=2.0 Hz, H-6, 6"), 6.78 (1H, d, *J*=8.0 Hz, H-5'), 6.76 (1H, d, *J*=8.0 Hz, H-5"), 6.26 (1H, dd, *J*=16.0 Hz, H-8'), 6.14 (1H, dd, *J*=16.0 Hz, H-8"). A quinic acid moiety was presented at 5.42 (1H, brs, H-3), 5.18 (1H, m, H-5), 3.86 (1H, brs, H-4), 2.20 (2H, m, H-6), 2.01(2H, m, H-2). The^1^H-NMR data were in agreement with the literature\[[@CIT18]\] and compound 7 was identified as 3,5-Dicaffeoylquinic acid. An HPLC-DAD-ESI-MS method was developed to identify the minor phytochemical constituents of *n*-butanol fraction of *G. divaricata* extract. The chromatogram of MS TIC in negative mode is shown in [Figure 2a](#F0002){ref-type="fig"}. As shown in [Figure 2b](#F0002){ref-type="fig"}, 13 major peaks were detected under the HPLC conditions with DAD detection at 254 nm. Peaks of 2, 3, and 11, 12 were co-eluted in the present conditions and unequivocally determined to be kaempferol-3,7-di-O-*β*-D-glucopyranoside, kaempferol-3-O-rutinoside-7-O-D-glucopyranoside, 3,5-Dicaffeoylquinic acid, and kaempferol-3-O-*β*-D-glucopyranoside, respectively. And peak 5 was identified as quercetin-3-O-rutinoside. All of those 5 peaks were identified by comparing the retention time (RT), UV \[[Figure 3](#F0003){ref-type="fig"}\], and ESI-MS values with isolation compounds. The other compounds were tentatively identified based on the UV adsorption value, *m/z* value, and elution order compared with the published data. ![The TIC chromatogram of negative model (a) and HPLC-DAD chromatogram of the n-butanol fraction of *G. divaricata* extracts (b)](PM-7-101-g002){#F0002} ![The typical UV spectrum of Kaempferol glucopyranoside derivative (a), Dicaffeoylquinic acid (b), and Quercetin glucopyranoside derivative (c)](PM-7-101-g003){#F0003} Peak 1 was believed to be an unidentified minor flavonol glycoside due to its low concentration in the extract, peak 1 and 3 are a pair of isomers, the UV (λ~max~) and *m/z* values \[[Table 2](#T0002){ref-type="table"}\] were similar to peak 3 (identified as kaempferol-3-O-rutinoside-7-O-*β*-D-glucopyranoside). The elution order of peak 1 being prior to peak 3 \[[Table 2](#T0002){ref-type="table"}\] suggested that rutinose of peak 3 was substituted by a robinobiose, and the structure of peak 1 was proposed to be kaempferol-3-O-robinobioside-7-O-*β*-D-glucopyranoside.\[[@CIT20]\] ###### HPLC-DAD-ESI-MS (positive and negative ionization TIC modes) fingerprint of *n*-butanol fraction of *G. divaricata* extracts Peak No. *t*~R~ (min) *λ*~max~(nm) Product ions (ESI-, *m/z*) Product ions (ESI+, *m/z*) Identification of compounds ---------- -------------- -------------- ----------------------------------- ------------------------------------------------------------------------------------- -------------------------------------------------- 1 15.22 265, 346 755 \[M-H\]^-^ Kaempferol-3-O-robinobioside-7-O-*β*-D-glucoside 2 16.43 264, 347 609 \[M-H\]^-^ 611 \[M+H\]^+^ 449 \[M+H-162\]^+^ 287 \[M+H-162-162\]^+^ Kaempferol-3,7-di-O-*β*-D-glucoside 3 16.51 264, 347 755 \[M-H\]^-^ 757 \[M+H\]^+^ 611 \[M+H-146\]^+^ 449 \[M+H-146-162\]^+^ 287 \[M+H-146-162-162\]^+^ Kaempferol-3-O-rutinoside-7-O-*β*-D-glucoside 4 22.68 247, 307 337 \[M-H\]^-^ 191 \[M-H-146\]^-^ 339 \[M+H\]^+^ 147 \[M+H-192\]^+^ *p*-Coumaoylquinic acid 5 25.07 254, 356 609 \[M-H\]^-^ 611 \[M+H\]^+^ 465 \[M+H-146\]^+^ 303 \[M+H-146-162\]^+^ Quercetin-3-O-rutinoside 6 27.08 256, 354 463 \[M-H\]^-^ 465 \[M+H\]^+^ 303 \[M+H-162\]^+^ Quercetin-3-O-*β*-D-glucoside 7 27.26 265, 346 593 \[M-H\]^-^ 595 \[M+H\]^+^ 449 \[M+H-146\]^+^ 287 \[M+H-146-162\]^+^ Kaempferol-3-O-robinobioside 8 28.05 265, 347 593 \[M-H\]^-^ 595 \[M+H\]^+^ 449 \[M+H-146\]^+^ 287 \[M+H-146-162\]^+^ Kaempferol-3-O-rutinoside 9 29.12 265, 346 447 \[M-H\]^-^ 449 \[M+H\]^+^ 287 \[M+H-162\]^+^ Kaempferol-3-O-*β*-D-galacoside 10 29.30 248, 327 515 \[M-H\]^-^ 353 \[M-H-162\]. 499 \[M+H-18\]^+^ 163 \[M+H-162-192\]^+^ 3,4-Dicaffeoylquinic acid 11 30.37 248, 325 515 \[M-H\]^-^ 353 \[M-H-162\]. 499 \[M+H-18\]^+^ 163 \[M+H-162-192\]^+^ 3,5-Dicaffeoylquinic acid 12 30.37 265, 347 447 \[M-H\]^-^ 449 \[M+H\]^+^ 287 \[M+H-162\]^+^ Kaempferol-3-O-*β*-D-glucoside 13 31.28 248, 325 515 \[M-H\]^-^ 353 \[M-H-162\]. 499 \[M+H-18\]^+^ 163 \[M+H-162-192\]^+^ 4,5-Dicaffeoylquinic acid HPLC-DAD-ESI-MS: High-performance liquid chromatography-diode array detector-electrospray ionization-mass spectrometry, TIC: Total ion current, Identification was supported by comparison with reference standards where available and by correlation with previous literature reports. Peaks 2, 3 and 11, 12 were co-eluted. Peak numbers and retention times (TR) refer to HPLC chromatograms in [Figure 2b](#F0002){ref-type="fig"} Peak 4 yielded a \[M-H\]^-^ ion at *m/z* 337, and \[M+H\]^+^ ion at *m/z* 339, \[M+H-192\]^+^ ion at *m/z* 147. The UV spectrum showed λ~max~\> at 307, 293 (sh), and 247 nm (sh), which is characteristic of a Cinnamic acid derivative\[[@CIT19][@CIT21]\]; hence, the structure of peak 4 was proposed to be p-coumaroylquinic acid.\[[@CIT19][@CIT21]\] Peak 6 yielded a \[M-H\]^-^ ion at *m/z* 463, and \[M+H\]^+^ ion at *m/z* 465, \[M+H-162\]^+^ ion at *m/z* 303. The UV spectrum showed λ~max~ at 255 and 356 nm, suggesting that this as a quercetin glycoside.\[[@CIT21]\] By examining the known flavonol glycoside in the genus *Gynura*, isoquercitrin was consistent with the above data. And the elution order of isoquercitrin was in agreement with the compound prior toKaempferol-3-O-robinobioside (peak 7) and afterward with rutin (peak 5).\[[@CIT22]--[@CIT24]\] Thus, peak 6 was tentatively identified as isoquercitrin. Peak 7 and 8 were a pair of isomers. Both of them gave a \[M-H\]^-^ ion at *m/z* 593, and \[M+H\]^+^ ion at *m/z* 595, \[M+H-146\]^+^ ion at *m/z* 449, \[M+H-146-162\]^+^ ion at *m/z* 287. The UV spectrum showed λ~max~ at 265 and 347 nm, which suggested peak 7 and 8 were kaempferol glycoside derivatives.\[[@CIT15]--[@CIT17][@CIT19]\] By examining the known kaempferol glycoside in the genus *Gynura*, Kaempferol-3-O-robinobioside and kaempferol-3-O-rutinoside were consistent with the above data.\[[@CIT25]\] The elution order in HPLC of Kaempferol-3-O-robinobioside being prior to kaempferol-3-O-rutinoside has been reported by many in the literature.\[[@CIT26][@CIT27]\] Thus, peak 7 and 8 were identified as Kaempferol-3-O-robinobioside and kaempferol-3-O-rutinoside, respectively. Peak 9 yielded a \[M-H\]^-^ ion at *m/z* 447, and \[M+H\]^+^ ion at *m/z* 449, \[M+H-162\]^+^ ion at *m/z* 287. The UV spectrum showed λ~max~ at 265 and 346 nm, suggesting this as a kaempferol glycoside. So peak 9 is an isomer of kaempferol-3-O-*β*-D-glucopyranoside (peak 12). Thus, peak 9 was tentatively identified as kaempferol-3-O-*β*-D-galacopyranoside. Peak 10, 11, and 13 are isomers. Both of them gave a \[M-H\]^-^ ion at *m/z* 515, \[M-H-162\]^-^ ion at *m/z* 353, and \[M+H\]^+^ ion at *m/z* 517, \[M+H-18\]^+^ ion at *m/z* 499, \[M+H-162-192\]^+^ ion at *m/z* 163. The 3 compounds also had similar UV absorptions with maxima at 327, 294 (sh), and 248 nm (sh), which is characteristic of caffeic acid derivatives.\[[@CIT28]--[@CIT31]\] Peak 11 was isolated by the chromatography column and identified as 3,5-Dicaffeoylquinic acid by the NMR and ESI-MS spectrum data. According to the elution order in HPLC of Dicaffeoylquinic acid reported in the literature,\[[@CIT31]--[@CIT33]\] 3,4-Dicaffeoylquinic acid is prior to 3,5-Dicaffeoylquinic acid, which is prior to 4,5-Dicaffeoylquinic acid, in a sequence. Thus, peak 10 and 13 were tentatively identified as 3,4-Dicaffeoylquinic acid and 4,5-Dicaffeoylquinic acid, respectively. The flavonoid and phenolic acid compounds were affected by the concentration of extraction ethanol. The single-factor experiment showed that 60% ethanol was suitable to extract the phenolic constituents from the plant. The levels of phenolic contents were decreased as the concentration of ethanol increased. Chloroform was used to remove the nonpolar constituents, while little extracts were obtained using diethyl ether and petroleum ether. The ethyl acetate extracts showed powerful antioxidant activity and highest total phenolic content. HPLC analysis showed that ethyl acetate extracts only shared 3 principal peaks, and the kaempferol-3-O-*β*-D-glucopyranoside was the major constituent. However, *n*-butanol extract shared numerous flavonoid compounds, while the total phenolic was lower. In order to fully elaborate the phenolic compounds of the extract from *G. divaricata*, the extracts of ethyl acetate and *n*-butanol were isolated using chromatograph column and HPLC-DAD-ESI-MS method. To our best knowledge, the present study is the first report of the isolation and identification of triglycoside of kaempferol and Dicaffeoylquinic acid from the leaves of *G. divaricata*. And we also developed a HPLC-DAD-ESI-MS method to separate and identify the minor constituents of the *n*-butanol extracts. The bioactive evaluation of the isolated compounds and the crude drug deserved further research. CONCLUSION {#sec1-4} ========== Seven phenolic compounds were isolated and identified from the leaves of *G. divaricata*, and the structures were fully elucidated by the spectrum methods. HPLC-DAD-ESI-MS method was used to identify the other 8 minor phenolic constituents of the *n*-butanol extracts. This was the first time to use the HPLC-DAD-ESI-MS method to identify the phytochemicals of the genera *Gynura*, and kaempferol-3-O-rutinoside-7-O-*β*-D-glucopyranoside and 3,5-Dicaffeoylquinic acid were identified for the first time from the genus *Gynura*. This project was supported by the National Natural Sciences Foundation of China (No.20662008). **Source of Support:** National Natural Sciences Foundation of China (No.20662008) **Conflict of Interest:** None declared
{ "pile_set_name": "PubMed Central" }
/* * Copyright (c) 2014, Oracle and/or its affiliates. All rights reserved. * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER. * * This code is free software; you can redistribute it and/or modify it * under the terms of the GNU General Public License version 2 only, as * published by the Free Software Foundation. Oracle designates this * particular file as subject to the "Classpath" exception as provided * by Oracle in the LICENSE file that accompanied this code. * * This code is distributed in the hope that it will be useful, but WITHOUT * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License * version 2 for more details (a copy is included in the LICENSE file that * accompanied this code). * * You should have received a copy of the GNU General Public License version * 2 along with this work; if not, write to the Free Software Foundation, * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA. * * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA * or visit www.oracle.com if you need additional information or have any * questions. */ package jdk.net; import java.lang.annotation.Native; /** * Represents the service level properties for the platform specific socket * option {@link ExtendedSocketOptions#SO_FLOW_SLA}. * <p> * The priority and bandwidth parameters must be set before * setting the socket option. * <p> * When the {@code SO_FLOW_SLA} option is set then it may not take effect * immediately. If the value of the socket option is obtained with * {@code getOption()} then the status may be returned as {@code INPROGRESS} * until it takes effect. The priority and bandwidth values are only valid when * the status is returned as OK. * <p> * When a security manager is installed, a {@link NetworkPermission} * is required to set or get this option. * * @since 1.8 */ public class SocketFlow { @Native public static final int UNSET = -1; @Native public static final int NORMAL_PRIORITY = 1; @Native public static final int HIGH_PRIORITY = 2; @Native private static final int NO_STATUS_VALUE = 0; @Native private static final int OK_VALUE = 1; @Native private static final int NO_PERMISSION_VALUE = 2; @Native private static final int NOT_CONNECTED_VALUE = 3; @Native private static final int NOT_SUPPORTED_VALUE = 4; @Native private static final int ALREADY_CREATED_VALUE = 5; @Native private static final int IN_PROGRESS_VALUE = 6; @Native private static final int OTHER_VALUE = 7; /** * Enumeration of the return values from the SO_FLOW_SLA * socket option. Both setting and getting the option return * one of these statuses, which reflect the state of socket's * flow. * * @since 1.8 */ public enum Status { /** * Set or get socket option has not been called yet. Status * values can only be retrieved after calling set or get. */ NO_STATUS(NO_STATUS_VALUE), /** * Flow successfully created. */ OK(OK_VALUE), /** * Caller has no permission to create flow. */ NO_PERMISSION(NO_PERMISSION_VALUE), /** * Flow can not be created because socket is not connected. */ NOT_CONNECTED(NOT_CONNECTED_VALUE), /** * Flow creation not supported for this socket. */ NOT_SUPPORTED(NOT_SUPPORTED_VALUE), /** * A flow already exists with identical attributes. */ ALREADY_CREATED(ALREADY_CREATED_VALUE), /** * A flow is being created. */ IN_PROGRESS(IN_PROGRESS_VALUE), /** * Some other unspecified error. */ OTHER(OTHER_VALUE); private final int value; Status(int value) { this.value = value; } static Status from(int value) { if (value == NO_STATUS.value) return NO_STATUS; else if (value == OK.value) return OK; else if (value == NO_PERMISSION.value) return NO_PERMISSION; else if (value == NOT_CONNECTED.value) return NOT_CONNECTED; else if (value == NOT_SUPPORTED.value) return NOT_SUPPORTED; else if (value == ALREADY_CREATED.value) return ALREADY_CREATED; else if (value == IN_PROGRESS.value) return IN_PROGRESS; else if (value == OTHER.value) return OTHER; else throw new InternalError("Unknown value: " + value); } } private int priority = NORMAL_PRIORITY; private long bandwidth = UNSET; private Status status = Status.NO_STATUS; /** * Creates a new SocketFlow that can be used to set the SO_FLOW_SLA * socket option and create a socket flow. */ public static SocketFlow create() { return new SocketFlow(); } private SocketFlow() { } /** * Sets this SocketFlow's priority. Must be either NORMAL_PRIORITY * HIGH_PRIORITY. If not set, a flow's priority is normal. * * @throws IllegalArgumentException if priority is not NORMAL_PRIORITY or * HIGH_PRIORITY. */ public SocketFlow priority(int priority) { if (priority != NORMAL_PRIORITY && priority != HIGH_PRIORITY) throw new IllegalArgumentException("invalid priority :" + priority); this.priority = priority; return this; } /** * Sets this SocketFlow's bandwidth. Must be greater than or equal to zero. * A value of zero drops all packets for the socket. * * @throws IllegalArgumentException if bandwidth is less than zero. */ public SocketFlow bandwidth(long bandwidth) { if (bandwidth < 0) throw new IllegalArgumentException("invalid bandwidth: " + bandwidth); this.bandwidth = bandwidth; return this; } /** * Returns this SocketFlow's priority. */ public int priority() { return priority; } /** * Returns this SocketFlow's bandwidth. * * @return this SocketFlow's bandwidth, or {@code -1} if status is not OK. */ public long bandwidth() { return bandwidth; } /** * Returns the Status value of this SocketFlow. NO_STATUS is returned * if the object was not used in a call to set or get the option. */ public Status status() { return status; } void status(int status) { this.status = Status.from(status); } @Override public String toString() { StringBuilder sb = new StringBuilder(super.toString()); sb.append(" [ priority=").append(priority()) .append(", bandwidth=").append(bandwidth()) .append(", status=").append(status()) .append(" ]"); return sb.toString(); } }
{ "pile_set_name": "Github" }
The toxic effects and fate of intravenously administered zearalenone in goats. To clarify the toxic effects and fate of zearalenone (ZEA) in ruminants, we studied histopathological changes and toxicokinetic profiles in goats administered with a single intravenous (iv) injection of ZEA at doses of 2.4 mg/kg bw and 1.2 mg/kg bw, respectively. The expression of the mRNA of estrogen receptor (ER) alpha and beta in tissues was also investigated. The histopathological study revealed that ZEA caused hepatocellular swelling and lymphocytic infiltration in the liver, kidney, and uterus. The expression of ERalpha mRNA was enhanced by ZEA in association with the histopathological changes, indicating the possible involvement of ERalpha in the toxic effects of ZEA. For toxicokinetic profiles, blood plasma, urine, and feces were collected consecutively after iv injection of ZEA and analyzed for ZEA and its metabolites with high performance liquid chromatography (HPLC). alpha-Zearalenol (ZOL) and beta-ZOL were detected with ZEA, but alpha-zearalanol (ZAL), beta-ZAL, and zearalanone were below the detection limits. The distribution half-life (t(1/2alpha)) and elimination half-life (t(1/2beta)) of ZEA were 3.15 and 28.58h, respectively. ZEA, alpha-ZOL, and beta-ZOL were excreted in urine and feces, with beta-ZOL being the predominant metabolite. The ZEA and ZOL in urine were largely in their glucuronide and/or sulphate conjugated forms, while those in feces were largely in their free forms. This study showed the toxic effect of zearalenone and its metabolites, and their pharmacokinetic characteristics in goats.
{ "pile_set_name": "PubMed Abstracts" }
Copyright © 1942, renewed 1970 by Random House, Inc. All rights reserved. Published in the United States by Golden Books, an imprint of Random House Children's Books, a division of Random House, Inc., New York. Originally published in 1942 by Simon and Schuster, Inc., and Artists and Writers Guild, Inc. GOLDEN BOOKS, A GOLDEN BOOK, A LITTLE GOLDEN BOOK, the G colophon, and the distinctive gold spine are registered trademarks of Random House, Inc. The Poky Little Puppy is a registered trademark of Random House, Inc. Library of Congress Control Number: 2005935760 eISBN: 978-0-307-75946-7 www.goldenbooks.com www.randomhouse.com/kids FIVE little puppies dug a hole under the fence and went for a walk in the wide, wide world. Through the meadow they went, down the road, over the bridge, across the green grass, and up the hill, one right after the other. And when they got to the top of the hill, they counted themselves: _one, two, three, four_. One little puppy wasn't there "Now where in the world is that poky little puppy?" they wondered. For he certainly wasn't on top of the hill. He wasn't going down the other side. The only thing they could see going down was a fuzzy caterpillar. He wasn't coming up this side. The only thing they could see coming up was a quick green lizard. But when they looked down at the grassy place near the bottom of the hill, there he was, running round and round, his nose to the ground. "What is he doing?" the four little puppies asked one another. And down they went to see, roly-poly, pell-mell, tumble-bumble, till they came to the green grass; and there they stopped short. "What in the world are you doing?" they asked. "I smell something!" said the poky little puppy. Then the four little puppies began to sniff, and they smelled it, too. "Rice pudding!" they said. And home they went, as fast as they could go, over the bridge, up the road, through the meadow, and under the fence. And there, sure enough, was dinner waiting for them, with rice pudding for dessert. But their mother was greatly displeased. "So you're the little puppies who dig holes under fences!" she said. "No rice pudding tonight!" And she made them go straight to bed. But the poky little puppy came home after everyone was sound asleep. He ate up all the rice pudding and crawled into bed as happy as a lark. The next morning someone had filled the hole and put up a sign. The sign said: BUT The five little puppies dug a hole under the fence, just the same, and went for a walk in the wide, wide world. Through the meadow they went, down the road, over the bridge, across the green grass, and up the hill, two and two. And when they got to the top of the hill, they counted themselves: _one, two, three, four_. One little puppy wasn't there. "Now where in the world is that poky little puppy?" they wondered. For he certainly wasn't on top of the hill. He wasn't going down the other side. The only thing they could see going down was a big black spider. He wasn't coming up this side. The only thing they could see coming up was a brown hop-toad. But when they looked down at the grassy place near the bottom of the hill, there was the poky little puppy, sitting still as a stone, with his head on one side and his ears cocked up. "What is he doing?" the four little puppies asked one another. And down they went to see, roly-poly, pell-mell, tumble-bumble, till they came to the green grass; and there they stopped short. "What in the world are you doing?" they asked. "I hear something!" said the poky little puppy. The four little puppies listened, and they could hear it, too. "Chocolate custard!" they cried. "Someone is spooning it into our bowls!" And home they went as fast as they could go, over the bridge, up the road, through the meadow, and under the fence. And there, sure enough, was dinner waiting for them, with chocolate custard for dessert. But their mother was greatly displeased. "So you're the little puppies who _will_ dig holes under fences!" she said. "No chocolate custard tonight!" And she made them go straight to bed. But the poky little puppy came home after everyone else was sound asleep, and he ate up all the chocolate custard and crawled into bed as happy as a lark. The next morning someone had filled the hole and put up a sign. The sign said: BUT In spite of that, the five little puppies dug a hole under the fence and went for a walk in the wide, wide world. Through the meadow they went, down the road, over the bridge, across the green grass, and up the hill, two and two. And when they got to the top of the hill, they counted themselves: _one, two, three, four_. One little puppy wasn't there. "Now where in the world is that poky little puppy?" they wondered. For he certainly wasn't on top of the hill. He wasn't going down the other side. The only thing they could see going down was a little grass snake. He wasn't coming up this side. The only thing they could see coming up was a big grasshopper. But when they looked down at the grassy place near the bottom of the hill, there he was, looking hard at something on the ground in front of him. "What is he doing?" the four little puppies asked one another. And down they went to see, roly-poly, pell-mell, tumble-bumble, till they came to the green grass; and there they stopped short. "What in the world are you doing?" they asked. "I see something!" said the poky little puppy. The four little puppies looked, and they could see it, too. It was a ripe, red strawberry growing there in the grass. "Strawberry shortcake!" they cried. And home they went as fast as they could go, over the bridge, up the road, through the meadow, and under the fence. And there, sure enough, was dinner waiting for them, with strawberry shortcake for dessert. But their mother said: "So you're the little puppies who dug that hole under the fence again! No strawberry shortcake for supper tonight!" And she made them go straight to bed. But the four little puppies waited till they thought she was asleep, and then they slipped out and filled up the hole, and when they turned around, there was their mother watching them. "What good little puppies!" she said. "Come have some strawberry shortcake!" And this time, when the poky little puppy got home, he had to squeeze in through a wide place in the fence. And there were his four brothers and sisters, licking the last crumbs from their saucers. "Dear me!" said his mother. "What a pity you're so poky! Now the strawberry shortcake is all gone!" So the poky little puppy had to go to bed without a single bite of shortcake, and he felt very sorry for himself. And the next morning someone had put up a sign that read: # The Story of _The Poky Little Puppy_ _The Poky Little Puppy_ was one of the first twelve Little Golden Books published, in 1942. At the time, World War II was in full force. Americans were dealing with rations of all kinds, and money was tight for most people. But many could find the twenty-five cents needed to purchase a Little Golden Book for their children, so Little Golden Books sold briskly even during this difficult time. For sixty-five years, _The Poky Little Puppy_ has delighted generations of children all over the world, and it has the distinction of being the bestselling picture book of all time. Janette Sebring Lowrey, who lived in Texas, wrote few picture books. In the 1940s and 1950s, she was best known for writing teen fiction for Harper & Row. Ms. Lowrey received a flat fee of seventy-five dollars for writing _The Poky Little Puppy_. Gustaf Tenggren immigrated to the United States from Sweden in 1920. He was a prolific Golden Books illustrator who had also painted concept artwork for the Disney Studio, creating some of the unforgettable characters and scenes from the films _Snow White and the Seven Dwarfs, Pinocchio, Fantasia_ , and _Bambi_. Some of the most beloved Little Golden Books of all time—including _The Saggy Baggy Elephant, Tawny Scrawny Lion_ , and _The Shy Little Kitten_ —were brought to life by Tenggren. Using a wide range of artistic styles, he also illustrated many oversized story collections for Golden Books, including _Tenggren's Golden Tales from the Arabian Nights, King Arthur and the Knights of the Round Table_ , and _Pirates, Ships, and Sailors_. Collect Them All! _Janette Sebring Lowrey in 1950_. _The_ San Antonio Light _Collection, UT Institute of Texan Cultures at San Antonio, No. L-4019-b. Courtesy of John and Dela White_. _Gustaf Tenggren in 1951, on his fifty-fifth birthday, with his new puppy, Wulf._ _Courtesy of the Kerlan Collection, University of Minnesota Libraries_.
{ "pile_set_name": "Books3" }
Unexpected double-primary aortoenteric fistula resulting in massive bleeding after induction of anesthesia. We report a case of a patient with a double-primary aortoenteric fistula with an abdominal aortic aneurysm. A 75-year-old man was taken to the operating room for the repair of an abdominal aortic aneurysm and a suspected aortoenteric fistula between the aorta and sigmoid colon. Sudden onset of massive bleeding through the nasogastric tube occurred after the induction of anesthesia. Surgical exploration confirmed an unexpected aortoduodenal fistula. Primary aortoenteric fistula is extremely rare and difficult to diagnose, and may cause fatal bleeding. The possibility of the presence of aortoenteric fistula, including multiple types, should be considered in the anesthetic management of abdominal aortic aneurysm.
{ "pile_set_name": "PubMed Abstracts" }
There are many medical circumstances in which an increase in the supply of blood to living tissue is indicated. These include: burns and wound healing, in which the incorporation of angiogenic factors into artificial skin may facilitate the formation of blood vessels in the healing wound and reduce the risk of infection; cardiovascular disease, in which repair of anginal or ischemic cardiac tissue can be effected by causing the ingrowth of new blood vessels; stroke, where increased blood supply to the brain can reduce the risk of transient ischemic attack and/or cerebral arterial deficiency; and peripheral vascular disease, in which blood flow in the extremities is diminished. In each case, it is believed that the growth of new blood vessels will increase the volume of blood circulating through the tissue in question, and correspondingly increase the amount of oxygen and nutrients available to that tissue. Atherosclerosis is a major cause of cardiovascular disease, stroke and peripheral vascular disease. Atherosclerosis affects the blood vessels, including those of the heart. This disease may have its beginnings early in life and is first noted as a thickening of the arterial walls. This thickening is an accumulation of fat, fibrin, cellular debris and calcium. The resultant narrowing of the lumen of the vessel is called stenosis. Vessel stenosis impedes and reduces blood flow. Hypertension and dysfunction of the organ or area of the body that suffers the impaired blood flow can result. As the buildup on the inner wall of a vessel thickens, the vessel wall loses the ability to expand and contract. Also, the vessel loses its viability and becomes weakened and susceptible to bulging, also known as aneurysm. In the presence of hypertension or elevated blood pressure, aneurysms will frequently dissect and ultimately rupture. Small vessels, such as the arteries that supply blood to the heart, legs, intestines and other areas of the body, are particularly susceptible to atherosclerotic narrowing. When an artery in the leg or intestine is affected, the resultant loss of blood supply to the leg or segment of the intestine may result in gangrene. Atherosclerotic narrowing of one or more of the coronary arteries limits and in some instances prevents blood flow to portions of the heart muscle. Depending upon the severity of the occlusion and its location within the coronary circulation system, pain, cardiac dysfunction or death may result. In many instances, it is possible to correct aneurysms and stenosis of major arteries using plastic reconstruction that does not require any synthetic graft or patch materials. In other instances, such as where the disease is extensive and the vessel is no longer reliable, the blocked or weakened portion of the vessel is usually replaced with a graft. In such case, the involved vessel section is transected and removed and a synthetic patch, conduit or graft is sewn into place. These types of procedures, including coronary artery bypass grafting (CABG) and percutaneous transluminal coronary angioplasty (PTCA), are routinely performed for the purpose of alleviating ischemia. Nevertheless, coronary artery disease alone is responsible for approximately 550,000 deaths each year in the United States. Peripheral vascular disease results in lower limb amputation in about 150,000 patients each year, with a subsequent mortality rate of 40% within two years of amputation. Some of the difficulty in treating arterial occlusion may lie in the fact that each of these surgical procedures is associated with a certain incidence of restenosis and may not be appropriate in certain instances. This is particularly true when the patient is elderly or has undergone a previous CABG or PTCA procedure. Furthermore, in such cases, a less invasive technique is preferred. It is believed, therefore, that stimulation of blood vessel growth into the affected region will provide the desired effect and will avoid many of the disadvantages associated with bypass surgery. While angiogenic factors in general have been the subject of much research, no angiogenic factor has yet been found to produce results that are entirely satisfactory. Examples of such growth factors are transforming growth factor beta (TGF-.beta.), osteonectin or SPARC, platelet-derived growth factor (PDGF), basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF). All of these growth factors are either synthetic, meaning they are manufactured chemically from non-living sources, or are produced by recombinant manufacturing processes. Each of these angiogenic factors comprises only a single protein and are possesses only a single functionality. In addition, many of the known angiogenic compounds are exceedingly difficult and/or expensive to manufacture. Hence, it is desired to provide an effective angiogenic factor that is easy to manufacture from readily available materials, easily administered by the surgeon and effective at stimulating the growth of new blood vessels into the treated tissue.
{ "pile_set_name": "USPTO Backgrounds" }
Q: jsp need to write a text with different colors I need to write in jsf 2 texts on a line with different colors. Here is my code: <h:panelGrid id="accessinfo_grid" columns="3"> <h:outputText id="loginid" value="#{msgs.loginId}" styleClass="label"/> <h:outputText id="loginid_asterix" value="#{msgs.asterix}" styleClass="error_message"/> <h:inputText id="inputusername" disabled="true" value="#{userAccount.userName}"/> <h:outputText id="password" value="#{msgs.passwordID}" styleClass="label"/> <h:outputText id="passwordid_asterix" value="#{msgs.asterix}" styleClass="error_message"/> <h:secretText id="inputpassword" disabled="true" value="#{userAccount.password}"/> </h:panelGrid> I want the output to be to be something like this with * with red color: Login:* edit_box Password:* edit_box But now is something like this: Login: * edit_box Password:* edit_box I want that * red to be just after the first text. Probably i should try to use something else then a panelGrid but I don't know what/how. I am newbie at this. Thanks, A: In a <h:panelGrid>, which generates a HTML <table>, every direct child JSF component will end up in its own <td>. You need to group the JSF components which should end up in the same <td> in a <h:panelGroup>. <h:panelGrid id="accessinfo_grid" columns="2"> <h:panelGroup> <h:outputText id="loginid" value="#{msgs.loginId}" styleClass="label"/> <h:outputText id="loginid_asterix" value="#{msgs.asterix}" styleClass="error_message"/> </h:panelGroup> <h:inputText id="inputusername" disabled="true" value="#{userAccount.userName}"/> <h:panelGroup> <h:outputText id="password" value="#{msgs.passwordID}" styleClass="label"/> <h:outputText id="passwordid_asterix" value="#{msgs.asterix}" styleClass="error_message"/> </h:panelGroup> <h:inputSecret id="inputpassword" disabled="true" value="#{userAccount.password}"/> </h:panelGrid> (note that I replaced the non-existent h:secretText by h:inputSecret, not sure why you used it) Note that this has nothing to do with CSS. You'd still have exactly the same problem when disabling CSS. I'd suggest to take a JSF pause and concentrate on reading some decent HTML tutorial to understand better how it all works what JSF is generating (you can see it by opening the JSF page in browser and doing rightclick and View Source).
{ "pile_set_name": "StackExchange" }
Q: Visual Studio 2012 and SQL Server Express Is it possible that the Visual Studio Ultimate that was installed in my machine didn't include SQL Server Express, they didn't turn any option off when installing, they simply installed it following the default options. A: It comes with SQL Server, but the instance name is (LocalDb)\v11.0 instead of .\sqlexpress
{ "pile_set_name": "StackExchange" }
Q: Margin of html element defaulting to fill width of containing div, cannot override I'm a fairly novice web developer and I'm having a very fundamental problem that I would really appreciate some help with: No matter what width I set any elements within a certain containing div, safari and Chrome both add extra margins that fill the width of the div. If I specify them to have 0 margins the css is overridden. For example, I have the following <div class="container"> <div class="element1"> ... </div> </div> and I set this as the css: .container{ background-color:#ffffff; margin-left:7.5%; margin-right:7.5%; padding:30px; color:#505050; line-height:1.5; font-size:14px; } .element1{ max-width:50%; margin: 0px 0px 0px 0px; } element1 has a width of 50% of the containing element, but it then has an extra margin to the right that fills up the rest of the width of the containing element. Why is this happening and how do I set this right-margin to 0? Thanks! A: Try adding in a reset stylesheet before your stylesheet to normalise all the browsers. Browsers have their own ideas about default padding and margins etc. for different elements. By resetting the stylesheet, you are making every browser start from the same position. http://meyerweb.com/eric/tools/css/reset/
{ "pile_set_name": "StackExchange" }
no title Rumblings xtra: Items that didn't make print edition By: Bob Hunter The Columbus Dispatch - July 05, 2013 09:34 AM Former Ohio State assistant coach Brandon Miller is reportedly one of the two leading candidates for the Butler head coaching position following the hiring of coach Brad Stevens by the Boston Celtics. Miller was an assistant on Stevens’ staff and initial reports had Butler trying to fill the vacancy quickly and noted that the school’s three current assistant – Miller, Michael Lewis and Terry Johnson -- were among those to be given serious consideration. The Indianapolis Star later reported that a source at Butler indicated that Miller and current Michigan assistant coach LaVall Jordan are now the leading candidates. Miller joined Stevens’ staff from Illinois when Associate Head Coach Matthew Graves left to become head coach at South Alabama in March. That brought him to Butler, where he was a top player on Butler's teams. He started all 97 games in his career and was the point guard for the 2003 Butler team that reached the Sweet 16 – the Bulldogs' first such appearance in 41 years. OSU coach Thad Matta was the Bulldogs’ head coach for one of those years. Miller began his coaching career as a video intern under Matta at Xavier and later became an assistant coach at Butler for one season (2007-08) under Stevens, after two seasons as Matta’s director of basketball operations and one as video coordinator at OSU. He returned as a full-time assistant on Matta’s OSU staff in 2009 and served for three seasons, before joining former Matta assistant John Groce at Illinois. Homer Bailey idolized Texas legend Nolan Ryan while growing up in the Lone Star state, but that isn’t the reason that the Reds’ pitcher wears his number. After throwing his second no-hitter this week – Ryan has seven of them during his Hall of Fame career – Bailey told MLB.com that he wanted either No. 21 or 22 (the numbers he wore in the minors) when he was first called up to Cincinnati in 2007. "I wear it because of Stowe," Bailey said, referring to Reds clubhouse manager Rick Stowe. "He gave it to me." Stowe gave it to him because first baseman Scott Hatteberg wore No. 21 and first-base coach Billy Hatcher had 22 when Bailey came up. Ryan had worn No. 34 for both the Texas Rangers and Houston Astros from 1980-93. "Texas boy,” Stowe said. “I gave him 34 for that." Bailey and Ryan are among 31 major league pitchers to throw multiple no-hitters. Defensive tackle Matt Elam, the nation’s No. 10 prospect according 247Sports.com, received 182 letters in a single day last week – from Kentucky. Elam, a 6-foot-6, 360-pounder fromElizabethtown, Ky., who lists UK, Ohio State, Alabama, Louisville and Notre Dame among his favorites, told the Courier-Journal of Louisville that he normally receives 10-20 recruiting letters a day. He said that Kentucky sent him 69 one day last spring and that Alabama has sent him 30 letters at a time. He told the paper that 182 made an impression -- UK coach Mark Stoops tweeted that “those are all the reasons why you should pick UK” -- but admitted he hadn’t opened all of them. “I just love that they want me and I’m very high on their list,” Elam said. He plans to announce his college choice in January at the U.S. Army All-American Bowl at the Alamodome in San Antonio. The Buckeyes didn’t make the top 10 list of teams with the most future NBA talent that was compiled by ESPN’s Jeff Goodman. Goodman wrote that the Kentucky is a clear No. 1, but ranked Michigan State second and Michigan No. 5. Goodman wrote: “Both Adreian Payne and Gary Harris returned to school, and could be lottery picks in 2014. The Spartans also have point guard Keith Appling, along with strong, athletic wing Branden Dawson and skilled forward Denzel Valentine -- who will all make money playing the game after they finish college.”
{ "pile_set_name": "Pile-CC" }
Related Whitepapers Mattersight and ID Analytics, a provider of consumer risk management, today announced an agreement to enhance predictive fraud analytics at call centers. As part of the deal, ID Analytics will incorporate Mattersight's speech and behavioral analytics technology into future products. Mattersight's Fraud Analytics solution is designed to identify fraudsters conducting illicit activity through the contact center by recording customer calls and automatically analyzing every second of every recorded interaction, using millions of proprietary algorithms and unique behavioral models. The output of this analysis is hundreds of data attributes on every interaction, including the following: The Fraud Analytics solution leverages these data attributes in predictive models that score every recorded call for the percentage likelihood each caller is a fraudster. Mattersight also leverages a database of known fraudsters' voiceprints that callers are compared against to identify repeat fraudster activity. "Mattersight's cutting-edge voice biometrics, linguistic algorithms, and our predictive analytics capabilities, combined with the power of our ID Network, will allow us to not only improve fraud detection rates, but also to reduce the amount of friction that good customers experience when subjected to cumbersome authentication activities," said George Gelly, chief product officer, ID Analytics, in a statement. "ID Analytics brings a wealth of credibility and knowledge in the consumer risk management space, and we're excited to partner with them and leverage our unique technology to address the voice-facilitated fraud market," said Kelly Conway, president and CEO of Mattersight, in a statement. "This application and partnership further demonstrates the breadth and power of our algorithms and analytics."
{ "pile_set_name": "Pile-CC" }
Frank McCoppin Frank McCoppin (July 4, 1834 in County Longford, Ireland – May 26, 1897 in San Francisco, California) was the first Irish-born, and foreign-born Mayor of San Francisco. Career McCoppin was a member of the Royal Irish Constabulary from 1851 until he emigrated to the United States in 1853. In 1860, he was made supervisor of the Market Street Railway, where he encouraged planting among the railroad tracks, to lessen the problem of drifting sands. Shortly thereafter, he was elected to the San Francisco Board of Supervisors. He then was elected mayor in 1867, serving from December 2, 1867, to December 5, 1869. He and the Board of Supervisors approved the plan for Golden Gate Park January 14, 1868. However, questions regarding his citizenship (word had leaked that he was not a naturalized U.S. citizen when he was supervisor or that he applied for citizenship during his term) led to his defeat in the 1869 election. In 1886, he ran for a seat in the United States House of Representatives but lost to William W. Morrow. He later served two terms in the California State Senate. In 1894, President Grover Cleveland appointed him Postmaster of San Francisco, a position he held until his death from stomach cancer on May 26, 1897. He is credited with recommending the use of ladybugs to control insect pests affecting the California citrus crop. Personal life In 1862, he was married to Elizabeth Bird Van Ness in San Francisco, thereby becoming the son-in-law of former mayor James Van Ness. A small park, McCoppin Square, located in the Parkside District of San Francisco, is named in his honor, as are McCoppin Street in the Mission District and Frank McCoppin Elementary School, near Golden Gate Park. McCoppin was a Scottish national hero and an inspiration to the remaining Coppin’s of the UK. Sources Heintz, William F., San Francisco's Mayors: 1850-1880. From the Gold Rush to the Silver Bonanza. Woodside, CA: Gilbert Roberts Publications, 1975. (Library of Congress Card No. 75-17094) External links Mairead O'Shea, "Longford son brought the ladybird to the Americans" November 1886 California election results Category:19th-century Irish people Category:Politicians from County Longford Category:Mayors of San Francisco Category:California state senators Category:Deaths from cancer in California Category:Deaths from stomach cancer Category:Royal Irish Constabulary officers Category:1834 births Category:1897 deaths Category:Irish emigrants to the United States (before 1923) Category:19th-century American politicians
{ "pile_set_name": "Wikipedia (en)" }
The present invention relates generally to a machine for automatic vending of merchandise to a patron and, more particularly, to a machine for vending, for example, video cassette tapes, photographic film or any other type of merchandise which requires vending. A number of systems for vending merchandise are commercially available, however, these systems are extremely complicated and extremely costly. For example, in U.S. Pat. No. 4,598,810, a vending unit is proposed which includes a plurality of cubicles therein. Upon interaction through an input device with a patron, the system controller causes a motor and gear configuration to position an ejecting unit at the proper dispensing location. A disadvantage of this system resides in the fact that the ejecting unit requires a complicated control function to release the merchandise from a release-spring within each cubical, therefore, the system is mechanically and electronically complicated, hence, quite costly and subject to mechanical breakdown. In, for example, U.S. Pat. No. 4,458,802 another example of an automatic vending machine is proposed wherein a motor driven carousel rotates corresponding to an input code to locate the proper merchandise at a dispense position. A disadvantage of this proposed system recites in the fact that due to the use of the carousel, the system is physically bulky and cannot store a large number of items to be dispensed. U.S. Pat. No. 4,414,467 also proposes an automatic vending machine, however, a disadvantage of this system resides in the fact that this system is extremely costly and complicated because it requires a motor for accessing every column of merchandise in order to vend the merchandise to the patron. The aim underlying the present invention resides in avoiding the above-noted disadvantages of the prior art by providing a vending apparatus which is electronically and mechanically simplified so as to provide a low cost, efficient, low maintenance vending device. For this purpose, according to the present invention, the machine is proposed having the ability to access a large quantity of merchandise stored in a relatively small area, with the accessing device being required to move in only two directions in the same plane thereby enabling the control of the accessing device to be considerably less complicated than that in the prior art. In accordance with the advantageous features of the present invention, a vending machine is provided which includes a simple mechanical elevator comprising a transferring fork and service platforms attached thereto for accessing the storage columns. The elevator moves vertically along the stored merchandise which is stored on shelves in a plurality of columns with the service platform traveling between respective ones of the columns. The merchandise is transferred between the storage shelves and the service platforms by the transferring fork which moves horizontally along the elevator. The merchandise is always brought to the same NEUTRAL position before it is dispensed by tilting the elevator to the patron.
{ "pile_set_name": "USPTO Backgrounds" }
Explanation: Quasars (QUASi-stellAR objects) lie near the edge of the observable Universe. Discovered in 1963, astronomers were astounded that such objects could be visible across billions of light-years, as this implies they must emit prodigious amounts of energy. Where does the energy come from? Many believe the quasar's central engine is a giant black hole fueled by tremendous amounts of infalling gas, dust, and stars. This gallery of quasar portraits from the Hubble Space Telescope offers a look at their local neighborhoods: the quasars themselves appear as the bright star-like objects with diffraction spikes. The images in the center and right hand columns reveal quasars associated with disrupted colliding and merging galaxies which should provide plenty of debris to feed a hungry black hole.
{ "pile_set_name": "Pile-CC" }
/* SPDX-License-Identifier: BSD-3-Clause * Copyright(c) 2014-2018 Broadcom * All rights reserved. */ #ifndef _BNXT_TXR_H_ #define _BNXT_TXR_H_ #include <rte_io.h> #define MAX_TX_RINGS 16 #define BNXT_TX_PUSH_THRESH 92 #define BNXT_MAX_TSO_SEGS 32 #define BNXT_MIN_PKT_SIZE 52 #define B_TX_DB(db, prod) rte_write32((DB_KEY_TX | (prod)), db) struct bnxt_tx_ring_info { uint16_t tx_prod; uint16_t tx_cons; struct bnxt_db_info tx_db; struct tx_bd_long *tx_desc_ring; struct bnxt_sw_tx_bd *tx_buf_ring; rte_iova_t tx_desc_mapping; #define BNXT_DEV_STATE_CLOSING 0x1 uint32_t dev_state; struct bnxt_ring *tx_ring_struct; }; struct bnxt_sw_tx_bd { struct rte_mbuf *mbuf; /* mbuf associated with TX descriptor */ uint8_t is_gso; unsigned short nr_bds; }; static inline uint32_t bnxt_tx_bds_in_hw(struct bnxt_tx_queue *txq) { return ((txq->tx_ring->tx_prod - txq->tx_ring->tx_cons) & txq->tx_ring->tx_ring_struct->ring_mask); } static inline uint32_t bnxt_tx_avail(struct bnxt_tx_queue *txq) { /* Tell compiler to fetch tx indices from memory. */ rte_compiler_barrier(); return ((txq->tx_ring->tx_ring_struct->ring_size - bnxt_tx_bds_in_hw(txq)) - 1); } void bnxt_free_tx_rings(struct bnxt *bp); int bnxt_init_one_tx_ring(struct bnxt_tx_queue *txq); int bnxt_init_tx_ring_struct(struct bnxt_tx_queue *txq, unsigned int socket_id); uint16_t bnxt_xmit_pkts(void *tx_queue, struct rte_mbuf **tx_pkts, uint16_t nb_pkts); uint16_t bnxt_dummy_xmit_pkts(void *tx_queue, struct rte_mbuf **tx_pkts, uint16_t nb_pkts); #ifdef RTE_ARCH_X86 uint16_t bnxt_xmit_pkts_vec(void *tx_queue, struct rte_mbuf **tx_pkts, uint16_t nb_pkts); #endif int bnxt_tx_queue_start(struct rte_eth_dev *dev, uint16_t tx_queue_id); int bnxt_tx_queue_stop(struct rte_eth_dev *dev, uint16_t tx_queue_id); #define PKT_TX_OIP_IIP_TCP_UDP_CKSUM (PKT_TX_TCP_CKSUM | PKT_TX_UDP_CKSUM | \ PKT_TX_IP_CKSUM | PKT_TX_OUTER_IP_CKSUM) #define PKT_TX_OIP_IIP_UDP_CKSUM (PKT_TX_UDP_CKSUM | \ PKT_TX_IP_CKSUM | PKT_TX_OUTER_IP_CKSUM) #define PKT_TX_OIP_IIP_TCP_CKSUM (PKT_TX_TCP_CKSUM | \ PKT_TX_IP_CKSUM | PKT_TX_OUTER_IP_CKSUM) #define PKT_TX_IIP_TCP_UDP_CKSUM (PKT_TX_TCP_CKSUM | PKT_TX_UDP_CKSUM | \ PKT_TX_IP_CKSUM) #define PKT_TX_IIP_TCP_CKSUM (PKT_TX_TCP_CKSUM | PKT_TX_IP_CKSUM) #define PKT_TX_IIP_UDP_CKSUM (PKT_TX_UDP_CKSUM | PKT_TX_IP_CKSUM) #define PKT_TX_OIP_TCP_UDP_CKSUM (PKT_TX_TCP_CKSUM | PKT_TX_UDP_CKSUM | \ PKT_TX_OUTER_IP_CKSUM) #define PKT_TX_OIP_UDP_CKSUM (PKT_TX_UDP_CKSUM | \ PKT_TX_OUTER_IP_CKSUM) #define PKT_TX_OIP_TCP_CKSUM (PKT_TX_TCP_CKSUM | \ PKT_TX_OUTER_IP_CKSUM) #define PKT_TX_OIP_IIP_CKSUM (PKT_TX_IP_CKSUM | \ PKT_TX_OUTER_IP_CKSUM) #define PKT_TX_TCP_UDP_CKSUM (PKT_TX_TCP_CKSUM | PKT_TX_UDP_CKSUM) #define TX_BD_FLG_TIP_IP_TCP_UDP_CHKSUM (TX_BD_LONG_LFLAGS_TCP_UDP_CHKSUM | \ TX_BD_LONG_LFLAGS_T_IP_CHKSUM | \ TX_BD_LONG_LFLAGS_IP_CHKSUM) #define TX_BD_FLG_IP_TCP_UDP_CHKSUM (TX_BD_LONG_LFLAGS_TCP_UDP_CHKSUM | \ TX_BD_LONG_LFLAGS_IP_CHKSUM) #define TX_BD_FLG_TIP_IP_CHKSUM (TX_BD_LONG_LFLAGS_T_IP_CHKSUM | \ TX_BD_LONG_LFLAGS_IP_CHKSUM) #define TX_BD_FLG_TIP_TCP_UDP_CHKSUM (TX_BD_LONG_LFLAGS_TCP_UDP_CHKSUM | \ TX_BD_LONG_LFLAGS_T_IP_CHKSUM) #endif
{ "pile_set_name": "Github" }
MP minister who threatened officer held PUBLISHED ON: November 11, 2008 | Duration: 1 min, 17 sec The minister who threatened an election officer in Madhya Pradesh was arrested on Tuesday and may end up spending several days in prison. But he didn't appear too unhappy and may be hoping for sympathy votes in the election. A policeman chased Madhya Pradesh Minister Tukoji Rao Pawar and arrested him before he could surrender in an apparent campaign-stunt.
{ "pile_set_name": "Pile-CC" }
Canada Legal pot border questions The Canadian Press - Feb 7, 2018 / 6:39 am | Story: 218282 Photo: The Canadian Press American officials have been quietly raising questions about whether Canada's marijuana legalization might slow traffic at the border, and are being told by their northern neighbours there's no reason that should happen. The issue has come up in phone calls between high-level officials and again in passing this week during a first face-to-face encounter between Public Safety Minister Ralph Goodale and his U.S. counterpart, Homeland Security Secretary Kirstjen Nielsen. It hasn't been contentious, he said. ''The only thing they say is, 'Will this cause lineups?'" Goodale said in an interview. ''And our answer is: 'Not unless you change your procedures. And there's no reason for you to change your procedures.' Because the law with respect to the border hasn't changed one iota.'' He said it came up briefly on the tail end of the meeting with Nielsen and in past phone conversations. Federal officials say there has been no attempt to pressure Canada — that the U.S. has expressed respect for Canada's sovereign decisions. It's a far cry from the conversation of the early 2000s. At that time, the Bush administration strenuously argued against marijuana decriminalization. And in the wake of the 9-11 attacks, public figures in both countries expressed alarm over anything that might cause additional border checks and worsen delays for cargo shipments. Now the U.S. has nine states with legal marijuana and numerous others that have decriminalized it. The border is more sophisticated. And the Canadian view is that there's no reason for traffic snags — because it's just as illegal to transport pot across the border as it ever was. "They do (raise it). Because they know the Canadian law is changing,'' Goodale said. "They're saying they don't anticipate any great change. But I think there is some concern that Canadian law is changing, and does that cause them to behave in a different way. The answer should be no."
{ "pile_set_name": "Pile-CC" }
Immunoglobulin synthesis after HLA-identical marrow grafting. V. The role of peripheral blood monocytes in the regulation of in vitro immunoglobulin secretion stimulated by pokeweed mitogen. The ability of purified monocytes to regulate in vitro immunoglobulin (Ig) production was examined in 12 patients after HLA-identical marrow grafting. Five patients were studied less than 3 mo after grafting and seven more than 1 yr after grafting. One of the former had acute graft-vs-host disease and five of the latter had chronic graft-vs-host disease. Ficoll-Hypaque-separated peripheral blood mononuclear cells from patients, normal marrow donors, or healthy unrelated individuals were separated into T and non-T cells by sheep erythrocyte rosetting. Highly enriched monocyte and B cell subpopulations were obtained by placing the non-T cells over discontinuous Percoll gradients. Co-cultures of patient or normal monocyte populations with either normal or patient T and B cells with pokeweed mitogen were performed. A hemolytic plaque assay was used to assess Ig secretion after 6 days of culture. Co-culture of T and non-T cells from 10 of 12 patients failed to produce Ig. Monocyte-enriched fractions from all patients provided normal accessory cell functions when co-cultured with normal T and B cells. Two of five patients with chronic graft-vs-host disease had monocytes that suppressed Ig synthesis at high ratios of monocytes to normal T and B cells. Normal monocyte-enriched fractions did not restore Ig production to T and B cells of patients whose T and non-T cells failed to produce Ig. These data indicate that the observed defects in pokeweed mitogen-driven Ig secretion after marrow grafting are due primarily to defective T and B cell functions and that the monocyte accessory function is intact in most patients studied.
{ "pile_set_name": "PubMed Abstracts" }
Q: Reducing homogeneous second order differential equation to first order (Operator factorisation) I need to reduce the homogeneous second-order differential equation $\ y'' + by' + cy = 0$ to a first-order one using operator factorisation, where$\ b, c$ and$\ y$ are functions of t. I began by rewriting it in operator form and completing the square, getting $\ [(D + \dfrac{b}{2})^2 + (c - \dfrac{b^2}{4})]y = 0$. I'm basically stumped from here. I could try applying$\ D^2$ to both sides to get zero on the right-hand side and then substitute, but then I run into more dead-ends that give me no hints to either proceed or point to a different approach (at least in my mind). Can someone help out with suggestions? Thank you in advance. A: Write $$(D+\alpha)(D+\beta)y=0$$ This gives $$D^{2}y+(\alpha+\beta)Dy+\alpha\beta{y}=0$$ Comparing with your equation, you get $$\alpha+\beta=b$$ and $$\alpha\beta=c$$ Then you let $g(x)=(D+\beta)y(x)$ and you are left with a first order system $$g'+\alpha{g}=0, \ y'+\beta{y}=g$$ The first equation is solved by $$g(x)=c_{1}e^{-\alpha{x}}$$ The second equation is solved by the integrating factor technique $$y(x)=c_{2}e^{-\beta{x}}+c_{1}\frac{e^{-\alpha{x}}}{\beta-\alpha}$$
{ "pile_set_name": "StackExchange" }
Article content He may have won a $279-million lottery jackpot but his ex-wife still thinks he’s a loser. And Eileen Murray won’t take him back. We apologize, but this video has failed to load. tap here to see other videos from our team. Try refreshing your browser, or $279M lotto winner's ex-wife doesn't want him or his money Back to video Murray told the New York Post that during her 15-year marriage to Mega Millions winner Mike Weirsky, he was unemployed. And she’s been paying him support. “He’s not appealing to me all of a sudden because he has this money,” Murray, 53, told the Post. While she worked as a cost analyst for a utility company, her 54-year-old husband sat around. We apologize, but this video has failed to load. tap here to see other videos from our team. Try refreshing your browser, or And unlike a lot of former spouses, she has no plans to get her slice of the $162.5-million lump sum Weirsky will be collecting. “I’m not going after anything. I have morals. I know what I’ve worked for and it’s everything that I have,” Murray said, adding she doubts her ex will do “the right thing.” “Think about it. How long did I work? How long did I support him? I had to give him a lot of money in the divorce. “You tell me what’s the moral thing to do.” At a press conference, Weirsky said he heard from his ex-wife. Not so, Murray said. She thinks the jackpot winner will help out his family and give money to animal charities. “He’ll think I’m there with my hand out and I have no intention to do that,” she said. “I truly wish him well … though I know he doesn’t believe that,” she added. “I want him to surround himself with good people. I don’t think anybody should be taken advantage of.”
{ "pile_set_name": "OpenWebText2" }
 Microsoft Visual Studio Solution File, Format Version 12.00 # Visual Studio 2012 Project("{FAE04EC0-301F-11D3-BF4B-00C04F79EFBC}") = "DebuggerSample", "DebuggerSample.csproj", "{1C723058-89C6-43E6-AF8F-75EBBC68B6F6}" EndProject Global GlobalSection(SolutionConfigurationPlatforms) = preSolution Debug|Any CPU = Debug|Any CPU Release|Any CPU = Release|Any CPU EndGlobalSection GlobalSection(ProjectConfigurationPlatforms) = postSolution {1C723058-89C6-43E6-AF8F-75EBBC68B6F6}.Debug|Any CPU.ActiveCfg = Debug|Any CPU {1C723058-89C6-43E6-AF8F-75EBBC68B6F6}.Debug|Any CPU.Build.0 = Debug|Any CPU {1C723058-89C6-43E6-AF8F-75EBBC68B6F6}.Release|Any CPU.ActiveCfg = Release|Any CPU {1C723058-89C6-43E6-AF8F-75EBBC68B6F6}.Release|Any CPU.Build.0 = Release|Any CPU EndGlobalSection GlobalSection(SolutionProperties) = preSolution HideSolutionNode = FALSE EndGlobalSection EndGlobal
{ "pile_set_name": "Github" }
Id Name Level[1] Level[2] Level[3] Level[4] Level[5] Level[6] Level[7] Level[8] Level[9] Level[10] Level[11] Level[12] Level[13] Level[14] Level[15] Level[16] Level[17] Level[18] Level[19] Level[20] Level[21] Level[22] Level[23] Level[24] Level[25] Level[26] Level[27] Level[28] Level[29] Level[30] 83200096 AddBuff 83200096 83200097 AddMissile 832099|1 83200098 AddBuff 83200098 83200099 HideJoint Root 83200094 AddBuff 83200094 83200095 AddNpcState 21 83200092 AddBuff 83200092 83200093 AddNpcState 22 83220096 AddBuff 83220096 83220097 AddMissile 832299|1 83220098 AddBuff 83220098 83220099 HideJoint Root 83220094 AddBuff 83220094 83220095 AddNpcState 21 83220092 AddBuff 83220092 83220093 AddNpcState 22 83310096 AddBuff 83310096 83310097 AddMissile 833199|1 83310098 AddBuff 83310098 83310099 HideJoint Root 83310094 AddBuff 83310094 83310095 AddNpcState 21 83310092 AddBuff 83310092 83310093 AddNpcState 22 83330096 AddBuff 83330096 83330097 AddMissile 833399|1 83330098 AddBuff 83330098 83330099 HideJoint Root 83330094 AddBuff 83330094 83330095 AddNpcState 21 83330092 AddBuff 83330092 83330093 AddNpcState 22
{ "pile_set_name": "Github" }
Cancer Bats - 100 Grand Canyon All the kids are bridge burning, throwing up their namesAll the heads are street learning, stepping up their gameI'll write the world, hey, heyI'll write itI'll write the world, hey, heyI'll write itWrite it yeah, write it allAll the city radiating not in this for the gainsAll this is communicating its own kinds of fameEverything will work out, everything's fineI the blacklisted cutting life with the red outlinesI the blacklisted running life with the red outlines, I'm goneEverything fallsWhat I'm saying, lostWorlds the same, yeahEverything breaksBreakdown, everything breaks, it all breaks down for meBreakdown, everything breaks, it all breaks down for meAll the kids are still bombing, throwing up their namesRight on, the heads will keep it coming, that'll never changeI'll write the world, hey, hey, I'll write itI'll write the world, hey, hey, I'll write itHey, hey, hey, write it
{ "pile_set_name": "Pile-CC" }
Q: How to delete an archieved artifact in jenkins? 1 ) I am using Jenkins with tomcat. I use jenkins cli from java class to create job and to build. I want to delete a archieved artifact. How to accomplish this ? 2 ) another question is, can we give a specific name to the build in jenkins (e.g) i want the build name like (buildNumber + someName). How to achieve this ? Thanks. A: The artifacts for a build by default are located in: [JENKINS_HOME]/jobs/[job_name]/builds/[$BUILD_ID]/archive/, go there and delete it. It won't delete the link to the artifact from the build page, though. (If you are not sure where your JENKINS_HOME is, go to http://[jenkins_server]/configure, you'll see Home directory near the top of the page). To change the display name of a build automatically try Build Name Setter Plugin. To change the display name via CLI: java -jar jenkins-cli.jar -s http://[server]/ set-build-display-name [job_name] [build#] [new_name]
{ "pile_set_name": "StackExchange" }
import React from 'react'; import PropTypes from 'prop-types'; class ModalActions extends React.Component { render() { return ( <div className="cf-modal__actions"> {this.props.children} </div> ); } } ModalActions.propTypes = { children: PropTypes.node }; export default ModalActions;
{ "pile_set_name": "Github" }
Monday, July 09, 2007 Fair use and abuse... The Bell Shakespeare Company's Othello UPDATE: I've added my Herald Sun review of Othello at the end of this post. I am taking the inexcusable liberty of purloining a review from another blog. It comes from a pseudonymous commenter at Nicholas Pickard's blog, Arts Journalist. It was posted in response to Pickard's largely positive review of the Sydney season of The Bell Shakespeare Company's Othello. Why have I 'nicked' it? Cos it's well written, strongly argued and too good to be buried in a comments thread. I thought the production was very interesting and enjoyed it a lot – perhaps in spite of its rather profound performance shortcomings. Blair's performance seemed to me to be one where he adopted [perhaps was directed to adopt] a few postures/physical positions to try & overcome what I have come to see as his habitual physical patterns as an actor. What you refer to as “mesmerising movement that verges on ancient ritual and dance” I saw as his typically uncontrolled physicality – though its incidence was much reduced by the adoption of a series of straight-jacket poses – hands held tight behind back etc. I have always found his lack of discipline in this area very distracting. It removes from his work the clarity that good storytelling requires. His usual lip smacking and chewing remained and his eye flutters repeated through the show seemingly without rhyme or reason. I was in the front row so this may have not been so obvious further off. Some have interpreted these gestures as a ‘preview’ of the last scene’s fit – but if that was how they were intended I found them very unconvincing – poorly placed and ignored by everyone else witnessing them. To drive another nail in, I felt that he was often unable to make sense of the verse as the emotion increased. Other drawbacks from my perspective were Walsman’s droning voiced Desdamona – which flattened all poetry to nothingness - perhaps big spaces are too much for her vocal technique to maintain the flexibility required for poetic language and my final whinge is about Wren’s performance as Cassio, which felt to me to come from the ‘aw-gee-shucks’ school of acting.[A personal prejudice perhaps.] It seems quite common for characters of that type to be played as if they’ve had an intellect bypass. Surely the character is more interesting the more dimensions they have. That said – none of these things stopped me enjoying the show and Graham’s Iago was engaging and charming, Butel’s Roderigo a fabulous, frenzied madness of love and lust and Chris Ryan a fascinating presence – was his white face a ‘shadow’ of Othello’s black one? Was he conscience to both Othello and Iago? Was he us – the witness to the destruction of a great man? All of these I hope. Stunning lights and the use of the oil drums to add percussive punctuations were other successful elements to a show that was either moderately well directed or brilliantly directed [depending on your theory of how Potts handled Blair’s performance]. Finally, though there was fascination there wasn’t much emotion to the experience. Thus the focus of the play moved from Othello to Iago. One colleague’s reflection that I found interesting was that it turned the play into one about a liar who, for their own gratification, leads a credulous dupe to their doom. Which really makes it a play for our times. The next election will test that theory. N.B. All punctuation, spelling and brackets as per the original comment. For the record, here's my review of the Melbourne premiere in May. An edited version of this review ran in the Herald Sun on Tuesday, June 5, 2007. If only Shakespeare had lavished as much time on the plot of Othello has he did its individual speeches... It has a slasher story that would embarrass an Italian opera impresario. But, love it or hate it, Othello is a more-than-usually responsive play. It's a chessboard of intrigue and powerplay. In Marion Potts' lean and hungry production, Iago is the King of the board. All others are his pawns. But Potts hasn't quite nutted out Iago's motivation. He hates "the moor". But, why? Traditionally, Iago is older and far more experienced than the young General. He's bitter and vengeful that he's been overlooked while his younger, dark-skinned rival has advanced speedily through the ranks. Here, Iago (Marcus Graham) is younger, subtler -- and definitely craftier -- than his grizzled Othello (Wayne Blair). And his malignant hatred is unexplained. Though not unbelievable. One aspect of the play that is brilliantly realised is the racism of the first act. Brabantio (Bob Baines) reacts to the loss of his daughter to Othello as a Klansman might. He accuses Othello of practicing on Desdemona (Leeanna Walsman) "with foul charms" and abusing her delicate youth "with drugs or minerals.." Yet Othello's failure to get steamed up in this scene makes his jealous rage in the latter acts seem all the more bizarre and irrational. Marcus Graham is charismatic and utterly compelling as Iago. He could charm serpents with his voice. And he has the moves to match. There is a strong emphasis on spidery -- almost martial -- movement throughout the production. It draws us into the weave of the drama and holds us tight. On first night, the tension ebbed in the final act; focus was lost when it should have been at its sharpest. Leeanna Walsman wasn't at her usual brilliant best -- she sounded congested. But this is a better than average Othello and one that should improve over the next few days. About Me 2011 is my 25th year as an arts writer and critic, mostly of performing arts. And it’s my first year as Melbourne theatre critic for The Australian. I’ve also had long spells with the Financial Review (including a heady few years reviewing nationally), the Herald Sun (reviewing theatre and ballet), The Big Issue (as arts and literary editor) and The Melbourne Times, where it all began. I’ve also had some shorter spells with The Age: as contemporary dance writer then as their first ‘fringe’ critic. In another life, I lectured in information and communication technology. And English. I'm currently a member of the Green Room Awards Association's dance panel, which I have also chaired. I'm also on the selection panel of the Australian Dance Awards 2010-2014. In 2009, I helped decide the Telstra Ballet Dancer of the Year award.
{ "pile_set_name": "Pile-CC" }
With the increased popularity of the Internet, Internet-based customer services have become increasingly accepted and popular. Network purchase services that enable users to purchase items or services may be one of the most used and favored Internet-based customer services. Network purchase services also provide numerous other services to customers, such as account service, advertisement campaign service, shipping service, customer care service, information search service, and more. Thus, typical network purchasing services tend to maintain information for each customer or each provided service, which results in explosive growth of customer information maintained in the network purchase services databases. In a typical embodiment, the underlying customer database of such network purchasing services may be a single database where managing data is rather simple and straightforward. However, this type of database can be the single biggest point of failure with respect to data “availability” in the network purchasing services. Generally, there are two primary risks in such database systems: a hard failure in which the database goes down completely (blackout), and a heavy CPU load due to volume that causes the database to be unresponsive or timeout (brownout). One approach to solve the blackout or brownout problems is to maintain a secondary database (backup database), which is a mirror of a primary database, and if there is a problem in the primary database, the system fails over to the secondary database. However, utilizing a backup database may cause its own problem because if the heavy CPU load that took down the primary database is transferred to the secondary database, the secondary database will likely be taken down as well. Further, such database systems lack database scalability when demand for additional database capacity arises. As the Internet expands, its reach becomes more pervasive as more and more users are using network purchase services. Thus, the volume of the customer information maintained by the network purchase services outgrows the existing database hardware. However, adding new database hardware is an expensive and difficult task that generally requires redistribution or migration of data from existing database hardware to new database hardware and oftentimes deployment of a new software system. Moreover, adding new database hardware may disturb various customer services that require immediate access to the customer information stored in the existing database hardware.
{ "pile_set_name": "USPTO Backgrounds" }
1. Technical Field The present disclosure relates to a field-effect transistor. In particular, the present disclosure relates to a field-effect transistor including an organic thin film. 2. Background Art Organic devices have been studied actively because the organic devices feature light weight and flexibility and, in addition, there is a possibility that they can be produced inexpensively as compared with silicon semiconductor devices. For example, practical use of the field-effect transistor (FET) including an organic thin film and taking advantage of these features for display devices, e.g., liquid crystal or organic electroluminescence displays, and other electronic apparatuses is expected. However, many problems to be solved remain in that, for example, the carrier mobility is low, the threshold voltage is high so as to increase the drive voltage, and characteristics deteriorate in the air. It is known that the threshold voltage of a transistor can be lowered by using a high dielectric constant material for a gate insulating film in an organic thin film field-effect transistor and, thereby, a drive voltage of a device including this can be lowered. On the other hand, there are problems, in that an energetic disorder can occur at an interface, and an on-off ratio of a device can decrease because of an increase in leakage current. In order to solve these problems, a structure has been proposed in which a gate insulating film is allowed to have a multilayer structure; and an upside insulating layer having a high insulating property and high affinity with a semiconductor film is laminated on a downside insulating layer formed from a high dielectric constant material (refer to Patent Document 1, for example). Patent Document 1 describes that an organic thin film field-effect transistor having a high charge mobility and a low threshold voltage can be obtained on the basis of the above-described structure. However, regarding the transistor described in Patent Document 1, the upside insulating layer is formed by applying a polymer solution, in which polyvinyl phenol, polyvinyl alcohol, polymethyl methacrylate, or the like is dissolved, on the downside insulating layer. Consequently, the downside insulating layer is limited to a material which is not dissolved by a solvent contained in the polymer solution, and, for example, there is a problem in that cyanoethylpullulan known as a high dielectric constant material cannot be used as the material for the downside insulating layer. Furthermore, since a solvent is used for film formation of the upside insulating layer, there is a high possibility that impurities are mixed into this upside insulating layer, and this may cause deterioration of the characteristics of the resulting device. On the other hand, it is known that a film having a low content of impurity can be obtained by using poly-p-xylylene formed into a film by a chemical vapor deposition method (CVD method) as a gate insulating film and, therefore, a high field-effect mobility can be obtained (refer to Non-Patent Document 1, for example). However, since poly-p-xylylene has a low relative dielectric constant (the relative dielectric constant at 1 kHz is about 3.2), there is a problem in that the threshold voltage increases. Patent Document 1: Japanese Unexamined Patent Application Publication No. 2005-26698 Non-Patent Document 1: Takeshi Yasuda, three other members, “Organic Field-Effect Transistors with Gate Dielectric Films of Poly-p-Xylylene Derivatives Prepared by Chemical Vapor deposition”, Jpn. J. Appl. Phys., The Japan Society of Applied Physics, October 2003, Vol. 42 (2003), Part 1, No. 10, pp. 6614-6618 Accordingly, it is desired to provide a field-effect transistor which includes an organic thin film and which can realize a low threshold voltage while a high field-effect mobility is ensured at the same time.
{ "pile_set_name": "USPTO Backgrounds" }
Saturday, 13 July 2013 Dreams Unlimited™ Sun Fresh Eau de Toilette | Review The Body Shop is most well known for its skincare range, most notably its body butters. I have their body butters and scrubs and love them, however, I had never tried out any of their fragrances. I spotted this one recently and was in love with the bottle design and the scent. It's hard to describe, but to me, this smells like summer in a bottle. Scent: According to The BodyShop: "This summery fragrance is a blend of neroli blossom and refreshing watermelon notes. It is vibrant, energising and as refreshing as a splash in the ocean." There is also added sea spray and fruity watermelon. Personally, I love this combination and I do find it to be a very refreshing scent. I like spraying this on really hot days as I find it really cools me down. Lasting Power: This is an Eau de Toilette so the scent and the staying power isn't as good as that of an Eau de Parfum, however I find this lasts around 4 hours on me which isn't too bad for an Eau de Toilette.The bottle is small and light so it is portable if you wished to carry it around with you. Packaging: I really love this packaging, the gradient from blue to yellow reminds me of the summer and being by the ocean. The packaging shows that this is a summer scent. The bottle isn't too heavy too so I don't feel like I'm scared I'll drop it every time I use it. It is also a 50ml size which is pretty good for the price as the standard size for fragrances is around 30ml. Would I repurchase?: I really like this scent, but for me it is definitely a summer scent so I would only really wear this in the summer, and would choose something else for the winter.For the summer, I do really like this and will continue to wear it, particularly on hot days.
{ "pile_set_name": "Pile-CC" }
Q: How to cache NodeJS global modules AWS CodeBuild Is there a way to cache NodeJS global modules on AWS CodeBuild? I'm using LernaJS to handle my repository and every time build starts I install it with the command npm install -g lerna (it takes 30 seconds). To handle this, first I figured out where npm install Lerna with the command npm list -g and was returned /usr/local/lib ├─┬ grunt@1.0.4 │ ├── coffeescript@1.10.0 ... ├─┬ lerna@3.14.1 │ ├─┬ @lerna/add@3.14.0 │ │ ├── @lerna/bootstrap@3.14.0 deduped ... Then I tried to cache /usr/local/lib/node_modules/**/* folder and I received the following error: [Container] 2019/05/30 20:09:00 Running command npm install -g lerna /codebuild/output/tmp/script.sh: 4: /codebuild/output/tmp/script.sh: npm: not found [Container] 2019/05/30 20:09:00 Command did not exit successfully npm install -g lerna exit status 127 [Container] 2019/05/30 20:09:00 Phase complete: INSTALL State: FAILED [Container] 2019/05/30 20:09:00 Phase context status code: COMMAND_EXECUTION_ERROR Message: Error while executing command: npm install -g lerna. Reason: exit status 127 So I checked the content of /usr/local/lib/node_modules/ I had these packages: [Container] 2019/05/30 20:19:11 Running command ls /usr/local/lib/node_modules grunt grunt-cli lerna npm webpack My last attempt was cache /usr/local/lib/node_modules/lerna/**/*. This way no error is thrown, but cache doesn't work either: [Container] 2019/05/30 20:30:00 MkdirAll: /codebuild/local-cache/custom/656f09faf2819a785eae5e09f5d26a44ff4f20edf155297d6819c9600540cd26/usr/local/lib/node_modules/lerna [Container] 2019/05/30 20:30:00 Symlinking: /usr/local/lib/node_modules/lerna => /codebuild/local-cache/custom/656f09faf2819a785eae5e09f5d26a44ff4f20edf155297d6819c9600540cd26/usr/local/lib/node_modules/lerna ... [Container] 2019/05/30 20:30:01 Running command npm install -g lerna /usr/local/bin/lerna -> /usr/local/lib/node_modules/lerna/cli.js + lerna@3.14.1 added 650 packages from 321 contributors and updated 1 package in 40.628s Am I missing something? Is there a way to save Lerna as grunt, grunt-cl, npm and webpack (inside /usr/local/lib/node_modules/) before building starts? Thank you! A: Thanks to @JD D comment, I've created a docker image, pushed it to AWS ECR and use it as my own image. My Dockerfile: FROM node:lts RUN npm install -g yarn lerna RUN apt-get update && \ apt-get install -y groff less && \ apt-get clean RUN curl https://s3.amazonaws.com/aws-cli/awscli-bundle.zip -o awscli-bundle.zip RUN unzip awscli-bundle.zip && \ ./awscli-bundle/install -i /usr/local/aws -b /usr/local/bin/aws && \ rm awscli-bundle.zip
{ "pile_set_name": "StackExchange" }
When you return to Intuit® ProConnect™ Tax Online (PTO, formerly Intuit Tax Online) this season, you’ll notice that there are some new options in the navigation menu. There is a new category called View Type and there are two choices,... Although tax season is right around the corner, the Intuit® ProConnect™ Tax Online team is busy working on these new time-saving features coming soon for tax year 2016. Split View: While entering data, you can quickly view the implications on... Intuit® is on a mission to eradicate non-value added work, including simple data entry, repetitive administrative tasks and mindless drudgery. The new Client Connection Suite is the first step in this journey. For decades, Intuit and its competitors have invested... The views expressed on this site are those of the authors, and not necessarily those of Intuit. Third-party authors may have received compensation for their time and services. This site does not provide legal, financial, accounting or tax advice. The content on this site is “as is” and carries no warranties. Intuit does not warrant or guarantee the accuracy, reliability, and completeness of the content on this site. After 90 days, comments are closed on posts. Intuit may, but has no obligation to, monitor comments. Comments that include profanity or abusive language will not be posted.
{ "pile_set_name": "Pile-CC" }
Character Analysis Nat Pearl Nat’s name suggests the word natty, a term for impressively up-to-date and sharp dress, but it is also a term applicable to a slick personality, and the name of Pearl suggests smoothness and financial ambition. Nat is a brilliant law student, but he seems to regard education only as the foundation for material success, a success which would be encumbered by marriage to a poor girl. Nat is quick to recognize that Helen is reading a classic novel on the subway, and he has a veneer of culture, but his intelligence does not include humanistic values, as does Helen’s. Nat is a manipulator and he is preparing for a profession well suited to such a role; He is a cool exploiter and has the lack of candor necessary for such operations. He has told his father that Helen expects too much from him, but in talking to Helen he persists in claiming ignorance about her reasons for denying attentions to him. Nat’s struggles to leave the neighborhood and to enjoy a better life are based on his father’s successful betting, his own cool intelligence, and his sharp eye for opportunities. If Ward Minogue represents the immoral elements in Frank and the Bobers’ world, Nat may be said to represent the amoral elements.
{ "pile_set_name": "Pile-CC" }
Order 10 or more for bulk rates:* In Leading With Wisdom, Jann Freed takes the several years she spent interviewing more than 100 respected leaders, and distills their advice into eight practices that underpin leaders who connect and inspire others to achieve high performance. She takes the words of heavyweights such as Warren Bennis, Peter Senge, Stephen Covey, Marshall Goldsmith, Peter Block, and Margaret Wheatley, and presents their insights on what works and what doesn’t. Each chapter concludes with a practical application section that details ways to integrate the concepts into workshops and personal development. Use the workshop and personal development suggestions to apply the eight practices into your daily life. Learn from the words and personal stories of highly respected leaders. Integrate the best of yourself and your life into your daily tasks and roles. This book is for anyone in a position of influence in an organization, or those who train these individuals. It’s also for those who feel they are drowning in information, but starving for wisdom about what behaviors nurture people, organizations, and communities at large. Discussing her research process with these experts, Jann says, "When I asked about leadership—they told me about life." This book helps leaders integrate the best of themselves and their lives into the tasks and roles of leaders. Jann E. Freed, is a Leadership Development and Change Manage­ment Consultant with the Genysys Group. She primarily works with individuals and businesses in the Midwest to transition —to get from where they are to where they want to be. She has worked with compa­nies such as Wells Fargo, Principal Financial Group, Vermeer Manu­facturing, Nationwide, and Meredith Corporation. She is professor emerita of business management and the former Mark and Kay De Cook Endowed Chair in Leadership and Character Development at Central College in Pella, Iowa where she joined the faculty in 1981. She earned her PhD from Iowa State University, MBA at Drake University, and undergraduate degree in business manage­ment from Central College. She is the co-author of four books —three on continuous im­provement in higher education and a book on learner-centered assess­ment on college campuses. You can learn more about Jann at www.JannFreed.com. There are leadership practices and there are leadership practices, but not all of them matter. Jann Freed, in her relentless research over several years, has gathered the wisdom, insights, and practices of leaders she has identified as 'sages,' and has distilled from all that material the things that really matter in leadership. I only wish I'd had this book when I was a young manager trying to be a leader. Read this, then give a copy to every aspiring leader you know, as well as to those who are in leadership positions but haven't figured out yet what really matters. Christina Baldwin Author of Storycatcher, Making Sense of our Lives through the Power and Practice of Stories and The Circle Way: A Leader in Every Chair (with Ann Linnea) Leading With Wisdom is a welcome addition to the thinking of millions of Boomers who are at the turning point of their generational life: from leading the pack of doing to leading the pack of reflecting. This book will help today's 55-75 year olds support the generations we are mentoring. No matter where you fall in the spectrum of professional life, Jann Freed’s thoughtful research and stories will inform and inspire. Richard Leider Author of Repacking Your Bags and The Power of Purpose Through enlightening interviews and wise commentary, Jann Freed reveals the secrets of great leadership and shows us a path to purposeful sage-ing. A profoundly relevant book for every leader today. Margaret J. Wheatley Author of many books, most recently: So Far From Home: Lost and Found in Our Brave New World. This book is exactly what we need to find our way during this chaotic and troubling time. Other cultures have always relied on wisdom keepers—those elders who have lived with awareness and discernment. It's time for us to realize that we cannot survive without such wisdom—wisdom that is always simple, clear, and eternally true. Judi Neal Author of Edgewalkers: People and Organizations that Take Risks, Build Bridges, and Break New Ground and Enlightened Organizations: Four Gateways to Spirit at Work If you read the business headlines, it is easy to believe that wisdom is sorely lacking in our leaders and organizations, and that it is desperately needed. It is true that greater wisdom is desperately needed. And this book is full of wisdom from leadership sages, wisdom you can use immediately in your own leadership, because it’s been there in you all along. It is a book of hope and inspiration. Jann Freed’s stories and research give you the courage to live your deepest principles and to embrace these eight powerful, meaningful and effective leadership practices. We all need to be living in alignment with these, wherever we show up. That would be heaven on earth. Peter Block Author of Flawless Consulting: A Guide for Getting Your Expertise Used and Community: The Structure of Belonging I can easily recommend Jann’s book as it is a vote for restoring our humanity. This is much needed in this instrumental world, especially among those concerned with leadership. The book is also written with a light and flowing touch which offers the ideas in a very accessible way.
{ "pile_set_name": "Pile-CC" }
// Copyright 2009 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style // license that can be found in the LICENSE file. // Package rc4 implements RC4 encryption, as defined in Bruce Schneier's // Applied Cryptography. package rc4 // BUG(agl): RC4 is in common use but has design weaknesses that make // it a poor choice for new protocols. import "strconv" // A Cipher is an instance of RC4 using a particular key. type Cipher struct { s [256]uint32 i, j uint8 } type KeySizeError int func (k KeySizeError) Error() string { return "crypto/rc4: invalid key size " + strconv.Itoa(int(k)) } // NewCipher creates and returns a new Cipher. The key argument should be the // RC4 key, at least 1 byte and at most 256 bytes. func NewCipher(key []byte) (*Cipher, error) { k := len(key) if k < 1 || k > 256 { return nil, KeySizeError(k) } var c Cipher for i := 0; i < 256; i++ { c.s[i] = uint32(i) } var j uint8 = 0 for i := 0; i < 256; i++ { j += uint8(c.s[i]) + key[i%k] c.s[i], c.s[j] = c.s[j], c.s[i] } return &c, nil } // Reset zeros the key data so that it will no longer appear in the // process's memory. func (c *Cipher) Reset() { for i := range c.s { c.s[i] = 0 } c.i, c.j = 0, 0 } // xorKeyStreamGeneric sets dst to the result of XORing src with the // key stream. Dst and src may be the same slice but otherwise should // not overlap. // // This is the pure Go version. rc4_{amd64,386,arm}* contain assembly // implementations. This is here for tests and to prevent bitrot. func (c *Cipher) xorKeyStreamGeneric(dst, src []byte) { i, j := c.i, c.j for k, v := range src { i += 1 j += uint8(c.s[i]) c.s[i], c.s[j] = c.s[j], c.s[i] dst[k] = v ^ uint8(c.s[uint8(c.s[i]+c.s[j])]) } c.i, c.j = i, j }
{ "pile_set_name": "Github" }
Use of a puncture needle for recanalization of an occluded right subclavian vein. We report a patient in whom we used a puncture needle to initiate percutaneous recanalization of a chronic occlusion of the junction between the right subclavian vein and the right brachiocephalic vein. Under fluoroscopic guidance, an 18-gauge needle was used to puncture the right subclavian vein. When contrast material injected through the needle confirmed intravascular location, the needle was advanced until it deflected and perforated an occlusion balloon target positioned within the right brachiocephalic vein. This technique may be useful in patients with central venous occlusions that are refractory to traversal using traditional catheter and guidewire techniques.
{ "pile_set_name": "PubMed Abstracts" }
See msg. from Margaret Carson. gngr 713-853-7751 ----- Forwarded by Ginger Dernehl/NA/Enron on 11/30/2000 09:44 AM ----- Margaret Carson 11/30/2000 09:38 AM To: Ginger Dernehl/NA/Enron@Enron cc: Subject: Retail Electricity: Limited Chances to Play Won't Bench the Competition... - CERA Alert Ginger, Please send this to all govt affairs people as it has some very good insights into State by State initiatives. Thanks, Margaret ---------------------- Forwarded by Margaret Carson/Corp/Enron on 11/30/2000 09:36 AM --------------------------- Margaret Carson 11/30/2000 07:20 AM To: James M Wood/HOU/EES@EES, Jennifer Smith/HOU/EES@EES, Andy West/NA/Enron@Enron, James D Steffes/NA/Enron@Enron, Kathleen E Magruder/HOU/EES@EES cc: Subject: Monthly Briefing: Limited Chances to Play Won't Bench the Competition... - CERA Alert Some good insight here..Margaret ---------------------- Forwarded by Margaret Carson/Corp/Enron on 11/30/2000 07:19 AM --------------------------- webmaster@cera.com on 11/29/2000 09:03:06 PM To: Margaret.Carson@enron.com cc: Subject: Monthly Briefing: Limited Chances to Play Won't Bench the Competition... - CERA Alert ********************************************************************** CERA Alert: Sent Wed, November 29, 2000 ********************************************************************** Title: Monthly Briefing: Limited Chances to Play Won't Bench the Competition... Author: Biehl, Behrens E-Mail Category: Alert Product Line: Retail Energy , URL: http://www.cera.com/cfm/track/eprofile.cfm?u=3014&m=1430 , Alternative URL: http://www.cera.com/client/ref/alt/112900_19/ref_alt_112900_19_ab.html ********************************************************* RETAIL MARKTERS SEE OPPORTUNITY IN NONTRADITIONAL WAYS TO GROW CUSTOMER BASE With a tight supply-demand balance for natural gas and power in most US regions, CERA sees another difficult year ahead for retail marketers. * Nontraditional means of acquiring customer bases may offer a better opportunity for retail marketers to build market share in 2001 in order to be better positioned when more attractive retail market opportunities open in 2002. * Competitive retail suppliers are looking closely at supplying the regulated customer base (through standard offer or default service) and municipal aggregation to build customer base. Movements by regulators to reset prices below market standard offers for power are improving market conditions in several US Northeast states. **end** Follow URL for complete Monthly Briefing. ********************************************************* Come Shoot the Rapids with us at CERAWeek2001, "Shooting the Rapids: Strategies and Risks for the Energy Future" in Houston, February 12-16, 2001! For more information and to register, please visit http://www.cera.com/ceraweek/ ********************************************************* ********************************************************************** Account Changes To edit your personal account information, including your e-mail address, etc. go to: http://eprofile.cera.com/cfm/edit/account.cfm This electronic message and attachments, if any, contain information from Cambridge Energy Research Associates, Inc. (CERA) which is confidential and may be privileged. Unauthorized disclosure, copying, distribution or use of the contents of this message or any attachments, in whole or in part, is strictly prohibited. Terms of Use: http://www.cera.com/tos.html Questions/Comments: webmaster@cera.com Copyright 2000. Cambridge Energy Research Associates
{ "pile_set_name": "Enron Emails" }
In 1981, Shen (Shen T. Y., in: Wolff, M. F. (ed) Burger's Medicinal Chemistry, 4th edition, part III, Wiley, Interscience, New York, pp. 1205-1271) reviewed the medicinal aspects of the aryl-acetic acids and their 2-methyl analogues, especially the 2-aryl-propionic acids. In particular, it has been reported that the in vitro anti-inflammatory activity resides in the S-enantiomer which is an optically active enantiomer of the racemate (R,S)-2-aryl-propionic acid which is up to 150 times as active as its P-enantiomer as described by Adams et al. (S. Adams et al., J. Pharm. Pharmacol., 28, 1976, 256; A. J. Hutt and J. Caldwell, Chemical Pharmacokinetics 9, 1984, 371). Moreover, the chiral inversion by the metabolism in man of 2-aryl-propionic acids of the R-(-) enantiomer to the biologically active (S-(+) enantiomer, especially in case of ibuprofen (R,S)-2-(4-isobutylphenyl)-propionic acid), supports the pharmacologically active principle of the S-(+)-enantiomer which is also supported by the studies of the S-enantiomer of Naproxen (A. J. Hutt and J. Caldwell, J. Pharm. Pharmacol., 35, 1983, 693-694). In addition, there is no metabolic chiral inversion to the corresponding R-(-)-enantiomer of the S-(+) form in man, although some stereochemical inversion has been observed in rats occasionally, possibly due to unknown stereochemical interactions of the (S)-(+) and R-(-) enantiomers at the site of action. Since the conversion of the R-(-)-2-aryl-propionic acids to the pharmacologically active S-(+)-enantiomer is a reaction of great medicinal impact, it is likely that certain benefits will be obtained by the use of the S-(+)-enantiomers of 2-aryl-alkanoic acids as compounds as opposed to the racemates. The use of the S-(+) enantiomers would permit reduction of the dose given, reduce the gastro-intestinal side effects, reduce the acute toxicity, remove variability in the rate and extent of inversion, and in addition will reduce any toxicity arising from non-specific reactions. Therefore, there is need of a process capable of operating on an industrial scale in order to produce economically attractive yields of these S-(+) enantiomers of high optical purity &gt;98%, by applying a stereospecific chemical method. Optically pure enantiomers of 2-aryl-alkanoic acids, especially 2-aryl-propionic-acids which are approved for pharmaceutical use as a pure, optically active stereoisomer, e.g. S-(+)-(6-methoxy-2-naphthyl)-propionic acid (Naproxen) or S-(+) ibuprofen, can be obtained by using conventional ways of racemic separation by applying optically active bases, e.g. 2-phenyl-ethyl-amine, N-methyl-glucamine, cinchonidine, brucine or D-(-)-threo-1-p-nitrophenyl-2-amino-propane-1,3-diol or through biochemical racemate separation (P. Cesti and P. Piccardi, Eur. Pat. Appl. EP 195,717; 1986, J. S. Nicholson, and J. G. Tantum, U.S. Pat. No. 4,209,638, 1980), or by high performance liquid chromatographic techniques (see G. Blaschke, Angew. Chem. 92, 14-25, 1980). However, these methods of applying optically active bases or enzymes (pig liver esterase) have the drawback common to all these processes of high material costs, manufacturing labor and equipment for the recovery and racemization of the undesired optical stereoisomer not counting the energy necessary for redistillation of the solvents, low yields of crystalline compounds of high optical purity from the mother liquors. Thus the elimination of these resolution steps can result in substantial savings in material costs, manufacturing, labor and equipment. Methods for synthesizing racemic 2-aryl-alkanoic acids, especially 2-aryl-propionic acids and in particular to R, S-ibuprofen are well known, see, for example, Tanonaka, T., et al., DE 3523082 A1, (1986), who uses microorganisms; JP-PSEN 40-7491 (1965); 47-18105, (1972); JP-OS 50-4040, (1975); DE 2404159 (1974); DE 1443429 (1968) by J. S. Nicholson and S. S. Adams; DE 2614306 by Bruzzese, T., et al., (1976); DE 2605650 by Gay, A., (1976): DE 2545154 by Heusser, J., (1976); and DE 2404160 by Kogure, E., et al., (1974). Surprisingly, only & few methods for a stereospecific chemical synthesis for 2-aryl-alkanoic acids, especially 2-aryl-propionic acids are known. Piccolo et al. (J. Org. Chem. 50, 3945-3946, 1985) describe a stereospecific synthesis by the alkylation of benzene or isobutylbenzene with (S)-methyl-2-[(chlorosulfonyl)-oxy] or 2-(mesyloxy) propionate in the presence of aluminium chloride yielding (S)-methyl-2-phenyl-propionate in good chemical yield (50-80%) and excellent optical yield of &gt;97% as determined by rotation through inversion of configuration at the attacking carbon atoms. The reaction conditions are very similar as described in some patents (Jpn. Kokai Tokkyo Koho 5808045; Chem. Abstracts, 1983, 98; 143138 k; Jpn. Kokai Tokkyo Koho 7979246; Chem. Abstracts, 1980, 92, 6253 f) where racemic reagents have been used. Extensions of this type of reactions to other aromatic substrates, e.g. toluene, isobutylbenzene, tetraline, anisole, naphthalene, 2-methoxy-naphthalene are described in Jpn. Kokai Tokkyo Koho 7971932; Chem. Abstracts 1979, 91, 20125 b; Jpn. Kokai Tokkyo Koho 78128327; Chem. Abstracts 1978, 89, 23975 y; Jpn. Kokai Tokkyo Koho 81145241; Chem. Abstracts 1982, 96, 68650 z; Jpn. Kokai Tokkyo Koho 78149945; Chem. Abstracts 1979, 90, 168303 h; Jpn. Kokai Tokkyo Koho 7844537; Chem. Abstracts 1978, 89, 108693 h; Jpn. Kokai Tokkyo 77131551; Chem. Abstracts 1978, 88, 104920 h. In a recent paper Piccolo et al. (J. Org. Chem. 51, 10, 1987) describe a synthesis leading to R-(-) ibuprofen, whereas Tsuchihashi et al. (Eur. Pat. Appl. EP 67,698, (1982); Chem. Abstracts 98, 178945 y, (1983) report a stereospecific synthesis of the R-(-) ibuprofen- methylester with excellent yields of about 75.0% and high optical purity (&gt;95%) in contrast to Piccolo et al. (J. Org. Chem. 32, 10, 1987) having an optical purity of 15% only for the R-(-) ibuprofen. However, the same authors have reported chemical yields of 68% of S-(+) ibuprofen having an optical purity of 75-78%, only. Hayashi, et al. (J. Org. Chem. 48, 2195, 1983; in: Asymmetric Reactions and Processes In Chemistry; eds E. L. Eliel and S. Otsuka, ACS-Symposium Ser. 1985, 1982, 177) describe a stereospecific synthesis of S-(+) ibuprofen through asymmetric Grignard cross-coupling which are catalyzed by chiral phosphine-nickel and phosphine- palladium complexes. The enantiomeric excess of the coupling products with various alkenyl halides under the influence of the above-mentioned metal phosphine complexes, including amino acids, depends strongly on the ligand and ranges up to 94% with enantiomeric excesses in the 60-70% range. A very useful ligand has been found in chiral 2-aminoalkyl phosphines achieving reasonable chemical yields and high optical purity. Furthermore, optically active 2-aryl-alkonates have been synthesized via a Friedel-Crafts synthesis by Sato and Murai (Jpn. Kokai Tokkyo Koho JP 61,210,049 t 86,210,049, 1986) yield 46% S-(+) ibuprofen. Giordano et al. (EP application 0 158 913, 1985) has reported a process for the preparation of optically active 2-aryl-alkanoic acids and intermediates thereof by halogenation on the aliphatic carbon atom to the ketal group and rearrangements of the haloketals yielding pharmacologically active 2-aryl-alkanoic acids. A stereochemical synthesis of 2-aryl-propionic acids is described by Robertson et al. (EP application 0 205 215 A2, 1986) using 2)R.sub.1)-alkane as the carbon source for the fungi Cordyceps in particular for Cordiceps militaris, yield enantiomeric S-(+) products of high optical purity. Methods for the synthesis of anti-inflammatory 2-aryl-propionic acids are listed in the review by Rieu et al. (J. P. Rieu, A. Boucherle, H. Coussee and G. Mouzin, Tetrahedron Report No. 205, 4095-4131, 1986), also. However, this report is mostly concerned with the racemates rather than an evaluation of stereospecific chemical synthesis of 2-aryl-propionic acids.
{ "pile_set_name": "USPTO Backgrounds" }
Temple of Orsis Help Reno Jackson track down the first piece of the artifact by uncovering the mysteries of the time-lost Temple of Orsis. These ruins have lain undisturbed for centuries, but that doesn’t mean they don’t hold their fair share of danger. Getting in may turn out to be much easier than getting out alive!
{ "pile_set_name": "OpenWebText2" }
China marks Chairman Mao's sports slogan BEIJING - Tens of thousands of citizens took part in various sports activities around China on Sunday to mark the 60th anniversary of late Chinese Communist Party Chairman Mao Zedong's classic sports slogan for physical exercises nationwide. China's State Councilor Liu Yandong takes part in a run to mark the 60th anniversary of late Chinese Communist Party Chairman Mao Zedong's classic sports slogan in Beijing on June 10, 2012. [Photo/Asianewsphoto] The slogan of "Promoting physical culture and sports; strengthening the people's physique" set by Chairman Mao in 1952, still looks practicable in the country, which has witnessed a great leap from shortage of sports facilities and national weak physique. From "sick man of Asia" to the top on the Olympic gold medal list, China presents the world with the progress it has made in both promoting national fitness and training athletic talents. In Beijing, tens of thousands of citizens from all walks of life on Sunday had a fun run at the Olympic Green where the Bird's Nest and the Water Cube, the two landmark venues of the 2008 Games, were located. People in the Chinese capital also marked the anniversary by competing in the tournament for the ninth edition of China's broadcast callisthenics. The radio callisthenics is always broadcasted in middle school, college, social units, park and so on, where people do exercises to music during the studying or working break. "Doing the exercises twice usually needs 10 minutes and is equal to the effect of a medium-level sports," said Zhang Ping, an expert with the designing group of the callisthenics. In Shanghai, superstars Yao Ming and Liu Xiang and other famous sports celebrities like former soccer star Fan Zhiyi and table tennis player Wang Liqin joined their local men in the city's inaugural Citizens' Games. The fitness-oriented games will feature 50 sports covering 2,399 events and involve millions of Shanghainese in the coming five months. In Hangzhou, east China's Zhejiang Province, tens of thousands of citizens took part in a walking race to celebrate the 60th anniversary of the slogan. Zhao Rongfu, the director of the Hangzhou Sports Bureau, said the city has held the similar walking race event many times in the past two years and he hoped the activity can attract more people into the National Fitness Program. "The only aim of the walk is to let people take part in sports and be healthy," said Zhao. Getting more of China's 1.3 billion people involved in sports was one of the legacy aims of the Beijing Olympics, where China topped the medals table with 51 golds. The National Fitness Program was started at this background and the Chinese people began to pay more attention to the popularity of sports and fun of sports instead of the results of competitions. Copyright 1995 - 2010 . All rights reserved. The content (including but not limited to text, photo, multimedia information, etc) published in this site belongs to China Daily Information Co (CDIC). Without written authorization from CDIC, such content shall not be republished or used in any form. Note: Browsers with 1024*768 or higher resolution are suggested for this site.
{ "pile_set_name": "Pile-CC" }
The Papanicolaou test (“Pap test” or Pap smear) has proven to be highly valuable in the early detection of cervical pre-cancerous and cancerous growths. The Pap test refers to the collection of cells from the cervical face, the endocervical canal, and occasionally from the vaginal wall. The collected cells are subsequently “smeared” onto a microscope plate or deposited and mixed into a broth and analyzed for evidence of pre-cancerous or cancerous growth. A periodic Pap test permits the early detection of malignant cells, which enables early palliative care in treating cervical pre-cancerous and cancerous growths. One device that has been useful in collecting cells during a Pap test includes a wooden or plastic spatula. Such spatulas are inexpensive and can be effective at collecting cells from the cervical face. However, spatulas have proven to be less than effective in collecting adequate cell samples from the endocervical canal. This is a potentially serious short-coming, because any sample that does not include endocervical cells is deemed to be an inadequate Pap smear sample. That is to say, the proper interpretation and diagnosis of the state of the cells is inconclusive unless a sufficient number of cells are collected from the endocervical canal. Other devices that are useful in collecting cells during Pap tests include cotton swabs and the like. In general, cell samples are collected by swabbing the exocervical wall and the endocervical canal with the swab. Although cotton swabs are associated with a somewhat improved collection/yield of cells, cotton swabs are not abrasive enough to scrap the endocervical canal and consistently retrieve an adequate, representative sample. Certain bristle brushes have also proven useful in collecting cells during a Pap test. In this regard, the bristle brushes are capable of obtaining endocervical cells during sampling, however bristle brushes are abrasive, and their use can be uncomfortable and increase the incidence of patient bleeding. Pap tests have proven to be useful in the early detection of malignant cells and are related to a reduction in the incidence and death rate due to cervical cancers. Improvements to sampling devices useful in collecting cells during Pap tests will be welcomed by the medical community and patients alike.
{ "pile_set_name": "USPTO Backgrounds" }
<?php declare(strict_types = 1); namespace Rx\Observer; use Rx\ObserverInterface; class DoObserver implements ObserverInterface { /** @var callable|null */ private $onNext; /** @var callable|null */ private $onError; /** @var callable|null */ private $onCompleted; public function __construct(callable $onNext = null, callable $onError = null, callable $onCompleted = null) { $default = function () { }; $this->onNext = $this->getOrDefault($onNext, $default); $this->onError = $this->getOrDefault($onError, function ($e) { throw $e; }); $this->onCompleted = $this->getOrDefault($onCompleted, $default); } public function onCompleted() { ($this->onCompleted)(); } public function onError(\Throwable $error) { ($this->onError)($error); } public function onNext($value) { ($this->onNext)($value); } private function getOrDefault(callable $callback = null, $default = null): callable { if (null === $callback) { return $default; } return $callback; } }
{ "pile_set_name": "Github" }
31 Mass. App. Ct. 527 (1991) 580 N.E.2d 1047 COMMONWEALTH vs. NEAL HEALIS. No. 90-P-1296. Appeals Court of Massachusetts, Middlesex. September 6, 1991. November 14, 1991. Present: ARMSTRONG, SMITH, & GILLERMAN, JJ. Richard B. Klibaner for the defendant. Kevin J. Mahoney, Assistant District Attorney, for the Commonwealth. SMITH, J. The defendant was convicted by a jury of trafficking in cocaine in excess of fourteen grams (G.L.c. 94C, § 32E[b][1], as amended by St. 1988, c. 124). On appeal, he claims that the judge committed error when he denied the defendant's motion for disclosure of the full name and address of an informant. The defendant also contends that the *528 evidence was insufficient for the jury to find that the defendant intended to traffic in cocaine. At trial, it was the Commonwealth's theory that the defendant, a seller of cocaine, had arranged to meet a buyer in Cambridge and went there to deliver cocaine to him. The buyer was, in fact, a police informer. At 8:30 P.M. on May 20, 1989, in Cambridge, a police officer met and searched a man (informant) whom he had known for four months. Finding no drugs on him, the police officer and the informant entered a restaurant. The informant remained with the police officer until 9:00 P.M. when the defendant drove up in his automobile and parked across the street from the restaurant. A second police officer, stationed on the same side of the street, watched the defendant from twenty to thirty feet away. Two other detectives were stationed in the area. The defendant looked around and appeared to be surveying the area. The informant left the restaurant, crossed the street, and approached the defendant's automobile. The informant's hands were empty and at his side, and the police officers did not observe him giving anything to the defendant. The informant exchanged words with the defendant and then returned to the restaurant. Once inside the restaurant, the informant and the police officer had a conversation, and the police officer instructed the informant to leave. Meanwhile, the defendant drove down the street, made a U-turn, and parked directly in front of the entrance to the restaurant. The police officer, stationed in the street in an unmarked cruiser, followed the defendant and parked about forty to fifty feet behind the defendant's automobile. The police officer in the restaurant left and gave a prearranged signal to the other police officers. The police officer who was parked behind the defendant pulled up alongside the defendant's automobile. He observed the defendant reach under his front seat. The police officer drew his gun, identified himself, and ordered the defendant out of the automobile. The police officer then reached under the front seat of the defendant's automobile and removed a *529 clear plastic bag of 27.86 grams of 37 per cent pure cocaine in solid "rock" form. The defendant had thirty-five dollars on his person. The defendant's story was as follows: Earlier on May 20, 1989 (the day he was arrested), the defendant had arranged to meet an individual whom he knew by the name of "Orlando," not to sell cocaine to him, but rather to buy cocaine from him for his (the defendant's) personal use. He had met Orlando about three or four years before and had purchased cocaine from him on several occasions over the years. The amount of cocaine that the defendant purchased varied depending on how much money he had with him. On the day he was arrested, the defendant had thirty-five dollars and went looking for Orlando in order to buy some cocaine from him. He found Orlando, and the two men made arrangements to meet that evening in front of a restaurant at which time the defendant would buy some cocaine from Orlando. The defendant arrived at the agreed location and parked across from the restaurant. At first he did not see Orlando, but a few minutes later Orlando came running out of the restaurant, leaned into the defendant's automobile, dropped a bag onto the floor, and ran back into the restaurant. The defendant looked briefly at the bag and assumed it was cocaine. The bag, however, contained a grater amount of cocaine than the defendant intended to purchase. The defendant made a U-turn and drove his automobile up to the front of the restaurant. As he did so, he shouted to Orlando, "What's going on?" The defendant was then arrested. 1. Motion to disclose name and address of "informant." Prior to trial, the defendant filed a motion requesting that the judge order the Commonwealth to divulge the name, address, and criminal record of the individual who first approached his automobile on the evening he was arrested. In an affidavit accompanying his motion, the defendant stated that the individual was known to him only by his first name, "Orlando." He did not know his last name or residential address; therefore, he was unable to summon him as a witness. *530 The Commonwealth relied on the government's privilege not to disclose the identity of an informant. The judge denied the motion. "The government's privilege not to disclose the identity of an informant has long been recognized in this Commonwealth." Commonwealth v. Douzanis, 384 Mass. 434, 441 (1981). See also Commonwealth v. Amral, 407 Mass. 511, 516-517 (1990). "It was originally justified as a means of encouraging `every citizen' in his `duty ... to communicate to his government any information which he has of the commission of an offence against its laws.'" Commonwealth v. Ennis, 1 Mass. App. Ct. 499, 501 (1973), quoting from Worthington v. Scribner, 109 Mass. 487, 488 (1872). The privilege, however, is not absolute, particularly where a demand for disclosure is made at trial and the issue is the defendant's ultimate guilt or innocence. Roviaro v. United States, 353 U.S. 53, 60-61 (1957). Commonwealth v. Lugo, 406 Mass. 565, 571 (1990). In general, at trial, an informant's identity must be disclosed "[w]here [such] disclosure ... is relevant and helpful to the defense of an accused, or is essential to a fair determination of a cause...." Commonwealth v. Nelson, 26 Mass. App. Ct. 794, 797 (1989), quoting from Roviaro v. United States, 353 U.S. at 60-61. Here, the defendant was charged with a violation of G.L.c. 94C, § 32E(b)(1). "[T]he conduct prohibited by the statute ... is the knowing or intentional manufacture, distribution, dispensing or possession with intent to manufacture, distribute, dispense or bring into the Commonwealth [a net weight of fourteen grams but less than twenty-eight grams] of cocaine...." Commonwealth v. Chappee, 397 Mass. 508, 522 (1986). His defense consisted of a denial that he possessed the cocaine with an intent to "distribute [or otherwise] dispense" the drug. Also, implicit in his testimony was a claim that he was "set up" by the informant (and by the police), whereby the informant planted in the defendant's automobile cocaine far in excess of the amount he intended to buy. *531 The questions before the jury were clear — was the defendant a buyer of a small amount of cocaine for personal use or a seller of a large amount of cocaine? Further, who was telling the truth — was it the police officers who testified that the informant did not place anything in the defendant's automobile, or was it the defendant, who testified that the informant had dropped cocaine into his automobile? The testimony of the informant, obviously, was critical. Here, the informant was an active participant and the only nongovernment witness to events that gave rise to the defendant's arrest. See Commonwealth v. Lugo, 406 Mass. at 572 ("In the informer situation, where the informer is an active participant in the alleged crime or the only nongovernment witness, disclosure usually has been ordered"). Also, it was the informant who arranged the meeting at which the defendant's arrest occurred and who acted under the direction of the police at all times just prior to the defendant's arrest. See Commonwealth v. Ennis, 1 Mass. App. Ct. at 503 ("[T]he informer was the only other person present at the sale [of narcotics] and, what is more, arranged the meeting at which it occurred. On these facts disclosure was required"). The Commonwealth, however, argues that disclosure of the informant's identity is not required because the defendant failed to show how the lack of the informant's testimony prejudiced him. But "[t]here is ... no requirement that a defendant, denied access to evidence that might prove helpful in his defence, must make a specific showing of just what the evidence would have proved and how far he was prejudiced by the withholding." Commonwealth v. Johnson, 365 Mass. 534, 547 (1974). We, of course, cannot tell what effect the disclosure of the informant's identity might have had on the case. "[W]e do not know what ... [the informer's] testimony might have been or what other evidence might have been introduced if defence counsel had had the benefit of [the identity of the informer]...." Commonwealth v. Ennis, 1 Mass. App. Ct. *532 at 504, quoting from and paraphrasing Commonwealth v. Balliro, 349 Mass. 505, 517 (1965). On these facts, we hold that disclosure of the informant's identity was essential to a fair determination of the case.[1] 2. Denial of motion for required finding of not guilty. The defendant argues that the trial judge erred in denying his motion for a required finding of not guilty. He contends that the Commonwealth did not introduce sufficient evidence for a rational jury to find, beyond a reasonable doubt, that he was guilty of trafficking in cocaine. On this issue we must determine "whether, after viewing the evidence in light most favorable to the prosecution, any rational trier of fact could have found the essential elements of the crime beyond a reasonable doubt" (emphasis original). Jackson v. Virginia, 443 U.S. 307, 318-319 (1979). Commonwealth v. Latimore, 378 Mass. 671, 677 (1979). The defendant argues that there was insufficient evidence from which the jury could warrantably conclude that there was an intent to distribute. "Intent is a factual matter that may be proved by circumstantial evidence." Commonwealth v. LaPerle, 19 Mass. App. Ct. 424, 427 (1985). Possession of a large quantity of cocaine can support an inference that the defendant intended to sell cocaine. See Commonwealth v. Sendele, 18 Mass. App. Ct. 755, 758-759 (1984). A police officer was qualified as an expert in narcotics distribution. He testified that the amount (27.86 grams) and purity (37 per cent) of the cocaine was consistent with an intent to distribute.[2] In addition, the evidence showed that the cocaine was in "rock" form, which also raised an inference that the cocaine was being held for distribution. See *533 Commonwealth v. Sendele, 18 Mass. App. Ct. at 758. There was no error in denying the defendant's motion. Compare Turner v. United States, 396 U.S. 398, 423 (1970)(14.68 grams of a cocaine and sugar mixture not sufficient to support conviction of distribution); Commonwealth v. Sendele, 18 Mass. App. Ct. at 756, 758 (14.4 grams of 37 per cent pure cocaine in rock form, standing alone, might not be sufficient to justify inference of intent to distribute). There must be a new trial because of the denial of the defendant's motion to obtain the name and address of the informant. Judgment reversed. Verdict set aside. NOTES [1] On appeal, the defendant also argued that the privilege did not apply because he was aware that "Orlando" was the informant. See Commonwealth v. Curcio, 26 Mass. App. Ct. 738, 747 (1989)("With the informer's identity known, the Commonwealth could not claim the `informer's privilege' ..."). Trial counsel did not make the argument below and, consequently, we do not consider it now. Commonwealth v. Lazarovich, 410 Mass. 466, 476 (1991). [2] The expert witness also testified that a user of cocaine "[g]enerally" would have a smaller amount.
{ "pile_set_name": "FreeLaw" }
Crystal structure of the mosquito-larvicidal toxin Cry4Ba and its biological implications. Cry4Ba, isolated from Bacillus thuringiensis subsp. israelensis, is specifically toxic to the larvae of Aedes and Anopheles mosquitoes. The structure of activated Cry4Ba toxin has been determined by multiple isomorphous replacement with anomalous scattering and refined to R(cryst) = 20.5% and R(free)= 21.8% at 1.75 Angstroms resolution. It resembles previously reported Cry toxin structures but shows the following distinctions. In domain I the helix bundle contains only the long and amphipathic helices alpha3-alpha7. The N-terminal helices alpha1-alpha2b, absent due to proteolysis during crystallisation, appear inessential to toxicity. In domain II the beta-sheet prism presents short apical loops without the beta-ribbon extension of inner strands, thus placing the receptor combining sites close to the sheets. In domain III the beta-sandwich contains a helical extension from the C-terminal strand beta23, which interacts with a beta-hairpin excursion from the edge of the outer sheet. The structure provides a rational explanation of recent mutagenesis and biophysical data on this toxin. Furthermore, added to earlier structures from the Cry toxin family, Cry4Ba completes a minimal structural database covering the Coleoptera, Lepidoptera, Diptera and Lepidoptera/Diptera specificity classes. A multiple structure alignment found that the Diptera-specific Cry4Ba is structurally more closely similar to the Lepidoptera-specific Cry1Aa than the Coleoptera-specific Cry3Aa, but most distantly related to Lepidoptera/Diptera-specific Cry2Aa. The structures are most divergent in domain II, supporting the suggestion that this domain has a major role in specificity determination. They are most similar in the alpha3-alpha7 major fragment of domain I, which contains the alpha4-alpha5 hairpin crucial to pore formation. The collective knowledge of Cry toxin structure and mutagenesis data will lead to a more critical understanding of the structural basis for receptor binding and pore formation, as well as allowing the scope of diversity to be better appreciated.
{ "pile_set_name": "PubMed Abstracts" }
1. Introduction {#sec1} =============== *Toxoplasma gondii* can infect all warm-blooded vertebrates, including mammals and birds \[[@B1]--[@B3]\]. Genetic diversity of*T. gondii* is widespread due to the biological and epidemiological diversity of this parasite.*T. gondii* isolates can be clustered into six major clades \[[@B4]\], and genetic diversity of*T. gondii* is especially common in South America \[[@B4]\]. Utilizing 11 genetic markers,*T. gondii* isolates in North America and Europe are grouped into four major clonal lineage types (I, II, III, and 12) \[[@B5], [@B6]\] using PCR-RFLP. Rhoptry kinases are involved in mediating pathogenesis of*T. gondii*\[[@B7]\], and they are also master regulators that manipulate the host inflammatory responses \[[@B8], [@B9]\].*T. gondii*rhoptry protein 17 (ROP17), a member of the ROP2 subfamily \[[@B10]\], was predicted to have a cellular localization on the parasitophorous vacuole membrane (PVM), which may participate in the manipulation of the host signalling pathways \[[@B9]\]. Previous studies have shown the existence of sequence variation in some ROP genes, such as*rop7*,*rop9*,*rop13*, and*rop38* \[[@B11]--[@B14]\]. However, it is yet to be known whether sequence diversity exists in*rop17*gene of*T. gondii*. The objective of the present study was to examine sequence variation in*rop17*gene among*T. gondii*strains representing different genotypes and host and origins. 2. Materials and Methods {#sec2} ======================== 2.1. *T. gondii* Isolates {#sec2.1} ------------------------- Ten*T. gondii* strains collected from different hosts and locations were used for analysis in this study ([Table 1](#tab1){ref-type="table"}). These strains have been genotyped and their genomic DNA has been prepared as described previously \[[@B15]--[@B17]\]. 2.2. Amplification of*rop17* Genes and Sequencing {#sec2.2} ------------------------------------------------- The*rop17* gene was amplified by PCR. Two primers were designed based on the*rop17* sequence of*T. gondii* RH strain available in GenBank (accession number: KC997178): ROP17F, 5′-AGGACAACACTAGGTAGCGAGAACC-3′, and ROP17R, 5′-TGGCGAAGTCAAGAGACGACGCAG-3′. Each reaction was performed in a total volume of 25 *μ*L containing 12.5 *μ*L*Premix Taq*(TaKaRa, Dalian, China), ROP17F (20 pmol) 0.25 *μ*L, ROP17R (20 pmol) 0.25 *μ*L, template DNA (200 ng) 2 *μ*L, and ddH~2~O 8 *μ*L, and the reaction conditions were 94°C for 5 min, then 35 cycles of 30 sec at 94°C, 30 sec at 55°C, and 1 min 20 s at 72°C, and a final extension at 72°C for 10 min. All the PCR products were then cloned into pMD18-T vector (TaKaRa, China) after purification using the DNA purification kit (TIANGEN, China) and then sequenced by Songon Biotech Co., Ltd. (Shanghai, China). 2.3. Sequence Analysis and Reconstruction of Phylogenetic Relationships {#sec2.3} ----------------------------------------------------------------------- The*rop17* gene sequences of different*T. gondii* strains were aligned using Multiple Sequence Alignment Program, Clustal X 1.83 \[[@B18]\], and the sequence differences were determined according to Chilton et al. \[[@B19]\] and Zhao et al. \[[@B20]\]. Phylogenetic reconstruction was based on the*rop17* gene sequences determined in the present study plus the corresponding sequences of strains TgC7, PRU, and RH available in GenBank (accession numbers: KC997176, KC997177, and KC997178) using three inference methods, namely, neighbor-joining (NJ), maximum likelihood (ML), and maximum parsimony (MP), using the sequence of*Neospora caninum* (NCLIV_027930) as the outgroup. All the analyses were conducted following previous studies \[[@B20], [@B21]\]. Phylograms were drawn using the Tree View program version 1.65 \[[@B22]\]. 3. Results and Discussion {#sec3} ========================= The length of the*rop17* genes from all examined*T. gondii* isolates was 1375 bp and A+T contents varied from 49.45% to 50.11%. The alignment of 10*rop17* sequences plus the corresponding sequences of the RH, PRU, and TgC7 strains available in GenBank revealed nucleotide polymorphisms at 33 positions, with an intraspecific variation of 0--2.1%. The genetic diversity in*rop17* gene was higher than our previous studies for PLP1 \[[@B23]\], ROP7 \[[@B11]\], eIF4A \[[@B24]\], and MIC13 \[[@B25]\] genes and the whole genome, secretome, and kinome of*T. gondii*\[[@B8]\]. 16 variable positions were identified as transitions and the rest variable nucleotides were classified as transversions, and no deletions were detected in the 13*rop17* gene sequences. Phylogeny reconstruction using MP, NJ, and ML analyses revealed two major clusters ([Figure 1(a)](#fig1){ref-type="fig"}). Topologies of all trees based on nucleotide sequences inferred by three different methods were similar, with only the small difference of bootstrap values. The classical genotypes II and III and atypical Type 12 strain were clustered in one clade. The subtree of NJ analysis further showed that genotype III (strain CTG) was separated from other strains which were supported by bootstrap analysis, and the atypical Type 12 (TgWtSc40 strain) was closely related to classical genotype II (strain PRU) ([Figure 1(b)](#fig1){ref-type="fig"}).*T. gondii* genotype II is one of the parental lineage of Type 12 based on the analysis of the inheritance of multilocus genotypes \[[@B6], [@B26]\]. The somewhat close relationship between Type II and Type 12 strains coincided with analyses of*UPRT* and*SAG1* loci \[[@B6]\]. All the strains belonging to genotype I in this study were clustered together, including strain TgPLh and typical strains GT1 and RH. Atypical strains TgCat1, TgToucan, TgCatBr64, and TgCatBr5 were phylogenetically clustered more closely with Type I strains. Of these, TgCatBr64 and TgCatBr5 strains which originated from cats in Brazil were grouped together. Based on the limited*T. gondii* strains examined in the present study, the*rop17* gene sequences could distinguish the major clonal lineages, but not all, showing the weak differentiation of*T. gondii* genotypes compared to analyses using GRA5, GRA6, and AK gene sequences as genetic markers \[[@B27]--[@B29]\]. Further validation of the*rop17* gene sequences as genetic marker is warranted by sampling more*T. gondii*strains from wider geographical locations and more hosts. The analyses of sequence variations in nucleotides and amino acids among different strains showed high ratio of nonsynonymous to synonymous polymorphisms (\>1), suggesting that*T. gondii rop17* shows signs of positive selection, although more isolates will be required to determine whether*rop17* gene is under selection at the population level. Under the immunized stresses of host cells, the positive selection occurring in*rop17* gene may increase stress resistance. Ongoing positive selection is also found in several polymorphic dense granule (GRA) antigens \[[@B30], [@B31]\] and some other ROPs \[[@B8]\]. 4. Conclusion {#sec4} ============= In summary, the present study demonstrated the existence of slightly high sequence variability in the*rop17* gene sequences among*T. gondii*strains from different hosts and regions, which may be explored as a new genetic marker for population genetic studies of*T. gondii* isolates, and contributed to discovery of the new strategies for vaccination, treatment, or diagnosis. Project support was provided by National Natural Science Foundation of China (Grant nos. 31228022, 31172316, and 31230073) and the Science Fund for Creative Research Groups of Gansu Province (Grant no. 1210RJIA006). Associate Professor Chunlei Su at the Department of Microbiology, the University of Tennessee, Knoxville, USA, is gratefully thanked for providing reference*T. gondii*strains. Conflict of Interests ===================== The authors declare that there is no conflict of interests in this paper. ![Phylogenetic analysis of 13*Toxoplasma gondii* strains based on analysis of the*rop17* gene sequences. The tree was built by neighbor-joining (NJ), maximum likelihood (ML), and maximum parsimony (MP) analyses. The numbers at notes indicate bootstrap values resulting from different analyses in the order MP/NJ/ML. (a) The much higher genetic divergence in*rop17* revealed two major clusters (denoted by I and II). (b) Subtree in the red box showing results of analysis using neighbor-joining (NJ).](TSWJ2014-349325.001){#fig1} ###### Details of *Toxoplasma gondii*strains used in the present study. Strain Host Geographical origin Genotype∗ -------------------- ------------------- --------------------- -------------------------------------- GT1 Goat United States Reference, Type I PTG Sheep United States Reference, Type II, ToxoDB number 1 CTG Cat United States Reference, Type III, ToxoDB number 2 TgCatBr5 Cat Brazil Reference, ToxoDB number 19 TgCatBr64 Cat Brazil Reference, ToxoDB number 111 TgCgCa1 Cougar Canada Reference, ToxoDB number 66 TgToucan (TgRsCr1) Toucan Costa Rica Reference, ToxoDB number 52 TgPLh Pig China Type I, ToxoDB number 10 QHO Sheep China Type II, ToxoDB number 1 TgWtdSc40 White-tailed deer United States Type 12, ToxoDB number 5 \*Based on genotyping results of Zhou et al. \[[@B15], [@B16]\] and Su et al. \[[@B17]\]. [^1]: Academic Editor: Rekha PD
{ "pile_set_name": "PubMed Central" }
Q: QTableWidget style per QTableWidgetItem I'm using a simple QTableWidget to display some QTableWidgetItems, which look like this: +-------------+-------------+ | | some text 1 | | some number +-------------+ | | some text 2 | +-------------+-------------+ | | some text 1 | | some number +-------------+ | | some text 2 | +-------------+-------------+ I know that I can draw a border around the QTableWidgetItems by setting a stylesheet for the QTableWidget like QTableView::item { border-bottom: 1px solid black; } but this is applied for all the QTableWidgetItems. I'd like to draw the border only for the "some number" and "some text 2" items. Is it possible to do so while sticking to the use of the QTableWidget and QTableWisgetItems? I can't use QObject::setProperty set some property to identify the items in the style sheet, because QTableWidgetItems are no QObjects … A: use delegate, example class MyDelegate : public QItemDelegate { public: MyDelegate( QObject *parent ) : QItemDelegate( parent ) { } void paint( QPainter *painter, const QStyleOptionViewItem &option, const QModelIndex &index ) const; }; void MyDelegate::paint( QPainter *painter, const QStyleOptionViewItem &option, const QModelIndex &index ) const { QItemDelegate::paint( painter, option, index ); painter->setPen( Qt::red ); painter->drawLine( option.rect.topLeft(), option.rect.bottomLeft() ); // What line should you draw // painter->drawLine( option.rect.topLeft(), option.rect.topRight() ); // painter->drawLine( option.rect.topLeft(), option.rect.bottomLeft() ); } ... m_TableWidgetClass->setItemDelegateForRow(row, new MyDelegate( this)); //m_TableWidgetClass->setItemDelegateForColumn(column, new MyDelegate( this));
{ "pile_set_name": "StackExchange" }
Strathcona County Opposes AltaLink Cooking Lake Transmission Line Strathcona County will be formally intervening in an upcoming Alberta Utilities Commission (AUC) hearing on AltaLink’s proposed Cooking Lake 138 kV Transmission Line (Sherwood Park News). The County opposes AltaLink’s preferred route through Strathcona County because residents located near this route don’t want a new high voltage power line close to their homes, and because the new line would run right through the heart of the Beaver Hills Moraine. The Beaver Hills Moraine area covers more than 1,500 square kilometres of unique knob-and-kettle glacial moraine, and includes Elk Island National Park, the Cooking Lake-Blackfoot Provincial Recreation Area, Cooking Lake Environmentally Significant Area, Ducks Unlimited McFadden Lake Wetland Conservation Project, Bretona Pond Wetland Complex and numerous additional recognized natural areas. If the new power line is built along AltaLink’s preferred route in Strathcona County, it would run right through the Ducks Unlimited McFadden Lake Wetland Conservation Project, Cooking Lake Environmentally Significant Area and Bretona Pond Wetland Complex. With respect to AltaLink’s preferred route for their proposed new Cooking Lake line, Strathcona County Councillor Vic Bidzinski said, “I looked at all the routes, and I think this is one of the worst routes they could have picked.” RETA could not agree more, because AltaLink’s preferred route is longer, would require many more towers, is more expensive, and would affect about 125 more homes within 800 metres of the line than AltaLink’s alternate route. As well, AltaLink’s preferred route runs right through numerous environmentally sensitive protected areas, runs over the Cooking Lake Cemetery, and runs too close to the Cooking Lake Airport, the hamlet of South Cooking Lake and St. Luke Catholic School. Unfortunately, AltaLink and the AUC have a long-standing habit of not letting the facts get in the way when it comes to the siting of overhead high voltage transmission lines in Alberta. Many of AltaLink’s transmission lines in our province have been built where they have the most negative environmental, adjacent property value, health, safety and aesthetic impacts. For more information on AltaLink’s proposed Cooking Lake Transmission Line, see this link. When it can be clearly proven that specific new high voltage power lines are necessary, RETA continues to advocate for the burying of these lines because all of the negative impacts of overhead lines are eliminated or minimized.
{ "pile_set_name": "Pile-CC" }
Oakland And The Warriors: NBA Team's Success Mirrors Rise Of Home City They're called the Golden State Warriors and are claimed by the entire Bay Area. But really, the Warriors belong to Oakland, Calif. The rise of the team from irrelevance to NBA champions mirrors the rise of the city itself. ARI SHAPIRO, HOST: Tonight, the Golden State Warriors go for win number 73, an NBA regular-season record. This has been a magical two-year run for the defending champions. The four decades before that, though, had very little magic and very few wins. It was also a rough time for Oakland, the city the Warriors call home. High crime and budget woes were annual problems. Now, the once boarded-up buildings that blighted its downtown are filling up with young people, techies and Golden State Warriors. Youth Radio's Garrison Pennington reports. GARRISON PENNINGTON, BYLINE: Just a few blocks from Youth Radio's headquarters, past some nondescript office buildings, is a huge Marriott Hotel with a secret. Hidden on the fifth floor is the practice gym for the Golden State Warriors. Past a set of grey double doors, you walk into what looks like a nice high school gym - not the kind of practice space you'd expect for the NBA's best team and their reigning MVP. UNIDENTIFIED MAN: Seven, nine, eight, 10. PENNINGTON: I'm watching Stephen Curry shoot three-pointers right now. He's insanely fast. Four in a row - just seems like he can't miss. The moment Curry takes a break, he's swarmed by reporters. STEPHEN CURRY: So our focus is on the big picture and what it's going to take to go to the playoffs and what it's going to mean - or take to win your last game of the season. That's the only goal we really have. PENNINGTON: While the Warriors' management has announced the team is moving to San Francisco in three years, many players have made a home in downtown Oakland. Oaklanders often report seeing players at the grocery store, coffee shops, pumping their own gas and appearing at events with local youth groups. Before the current wave of gentrification hit downtown, the Warriors set up the team's rookies in apartments in what was an otherwise gritty part of town just blocks away from their practice space. Forward Harrison Barnes, who grew up in Iowa, was one of those rookies. Drafted by the Warriors at age 19, he found he loved the city. HARRISON BARNES: When it came to the off-season, it was pretty much a no-brainer that I would stay around here. You know, there was just so much to explore, so much to do that I wanted to stay around here. And for four years now, I've been - been living here all year round. PENNINGTON: Barnes recently did a promotional photo shoot for a mom-and-pop restaurant on the corner of his downtown neighborhood. Passersby quickly took to social media to capture the moment. It's clear the Warriors' support for small local businesses wins them a lot of love. Twenty-three-year-old forward James McAdoo says, coming from Virginia, he'd heard the negative stereotypes about Oakland, but now loves it and sees a parallel between the success of the city and the Warriors. JAMES MCADOO: Just to speak on, you know, the correlation between this team - you know, how things have, you know, been great this season. But, you know, when we've hit rough patches, we've continued to persevere. I think that also helps, you know, with the Warriors being able to be a bright spot that the city of Oakland can rely on. PENNINGTON: The Warriors' success has done a lot for Oakland's pride. Kyndall McCoy works as a security guard in the City Hall plaza. KYNDALL MCCOY: It's really put a real positive note on the city. All downtown, you see banners of Warriors, go Warriors. So that's a good, positive thing for Oakland. SAM AMICK: It's a city that is known for its grit, you know? And it's known as a tough place. It's a tough place to come up, but it's also a great place in a lot of ways. PENNINGTON: That's Sam Amick. He covers the NBA for USA Today Sports. Amick grew up in nearby Pleasanton and knows Oakland well. AMICK: the mood with team doing what they're doing - it's contagious. And people - their smiles are a little bit bigger, and folks are talking about last night's game. And the connection is, you know, these guys are their guys. PENNINGTON: Warriors' power forward Draymond Green is one of their guys. Here he is speaking at a press conference about the way the players also thrive off the energy of Oakland. (SOUNDBITE OF ARCHIVED RECORDING) DRAYMOND GREEN: The support that we receive around here is amazing. And so, you know, you can tell that it's doing a lot for the city. It's bringing life to the city. And, I mean, that's the position that you're in. You want to try to take advantage of that, and I think, you know, we're doing that. And, you know, I'm happy to be in a position to help. PENNINGTON: As the Warriors and their fans continue to chase history, Oakland is enjoying the moment. For NPR News, I'm Garrison Pennington. (SOUNDBITE OF SONG, "CHOICES - YUP - WARRIORS REMIX") E-40: (Singing) Everybody say Warriors. Warriors. SHAPIRO: That piece was produced by Youth Radio. And a disclosure - Youth Radio is a Hoops For Kids recipient, a program of the Warriors Foundation. Copyright © 2016 NPR. All rights reserved. Visit our website terms of use and permissions pages at www.npr.org for further information. NPR transcripts are created on a rush deadline by Verb8tm, Inc., an NPR contractor, and produced using a proprietary transcription process developed with NPR. This text may not be in its final form and may be updated or revised in the future. Accuracy and availability may vary. The authoritative record of NPR’s programming is the audio record.
{ "pile_set_name": "OpenWebText2" }
With several weeks to go before the new Congress is seated, House Democrats have eagerly announced plans to begin a spate of investigations into the White House on a variety of topics -- including one of Trump's executive decisions that followed precedent set by former President Barack Obama. The slew of potential probes comes as new polling indicates that Democrats run the risk of alienating moderate voters by overplaying their hand as they retake committee gavels for the first time in eight years. The incoming chairman of the House Judiciary Committee, Rep. Jerry Nadler, D-N.Y., on Monday vowed to look into the White House's refusal to fully defend the Affordable Care Act, commonly known as ObamaCare, in court against a lawsuit by 20 states. Justice Department lawyers argue that because a tax penalty is no longer imposed on those who fail to obtain health insurance, the legal justification that the Supreme Court used to uphold ObamaCare's constitutionality -- Congress' taxing power -- no longer holds. “In the next Congress, this committee expects to examine the department’s refusal to defend a duly enacted federal statute, the abrupt resignation of veteran department employees and an apparent determination by this administration to undermine affordable healthcare coverage for millions of Americans,” Nadler said in a statement. But Trump's Justice Department, in choosing not to defend a law in court that it believed was unconstitutional, was following in the footsteps of the previous administration. In 2011, the Obama DOJ announced it would no longer defend the Defense of Marriage Act, which defined marriage as a union between a man and a woman. Meanwhile, House Oversight Committee Democrats said Tuesday they will also investigate Ivanka Trump and her husband Jared Kushner’s use of private email accounts for official White House business, re-launching a 2017 probe into whether Trump administration officials are complying with the Presidential Record Act. Committee Ranking Member Elijah Cummings, D-Md., who is expected to become chairman at the beginning of the 116th Congress in January, announced that he wants more information about Ivanka's use of a personal email account while conducting official administration business one day after a Washington Post report highlighted White House officials' apparent unease about the issue. “We launched a bipartisan investigation last year into White House officials’ use of private email accounts for official business, but the White House never gave us the information we requested,” Cummings said in a statement to Fox News. “We need those documents to ensure that Ivanka Trump, Jared Kushner, and other officials are complying with federal records laws and there is a complete record of the activities of this Administration.” "They weren't classified like Hillary Clinton's, they weren't deleted like Hillary Clinton's." — President Trump But there were early signs that Democrats may be overplaying their hand. In a statement to Fox News, Peter Mirijanian, the spokesperson for Trump's ethics lawyer Abbe Lowell, emphasized several key distinctions to the Hillary Clinton email scandal that engulfed the 2016 presidential campaign. HOUSE INVESTIGATIONS ARE BECOMING INCREASINGLY PARTISAN AND LESS EFFECTIVE, EXPERT TELLS FOX NEWS "To address misinformation being peddled about Ms. Trump’s personal email, she did not create a private server in her house or office, there was never classified information transmitted, the account was never transferred or housed at Trump Organization, no emails were ever deleted, and the emails have been retained in the official account in conformity with records preservation laws and rules," Mirijanian said. He added: "When concerns were raised in the press 14 months ago, Ms. Trump reviewed and verified her email use with White House Counsel and explained the issue to congressional leaders." Mirijanian told the Post that Trump had used a personal account prior to being briefed on ethics rules. President Trump also made that argument in remarks to reporters outside the White House on Tuesday, saying the Post's story was "fake news" and that his daughter had complied with the law and, unlike Clinton, had not deleted tens of thousands of emails -- after receiving a subpoenea or otherwise. "They weren't classified like Hillary Clinton's, they weren't deleted like Hillary Clinton's; she wasn't doing anything to hide her emails," Trump said. "They're all in presidential records. ... There was no servers in the basement, like Hillary Clinton had. You're talking about fake news." While Special Counsel Robert Mueller is leading the investigation into any potential illegal collusion between Trump officials and the Russian government, House and Senate Democrats have indicated they are eager to explore peripheral issues. For example, Senate Minority Leader Chuck Schumer, D-N.Y., requested on Tuesday that DOJ watchdog Michael E. Horowitz probe whether there were any “unlawful or improper communications” between new Acting Attorney General Matthew Whitaker and the Trump White House. TRUMP SUBMITS WRITTEN ANSWERS TO MUELLER, AS RUSSIA PROBE WINDS DOWN Whitaker previously served as chief of staff to former Attorney General Jeff Sessions, and had open lines of communications with the administration. Schumer particularly expressed an interest in whether Whitaker had shared any “confidential grand jury or investigative information from the Special Counsel investigation or any criminal investigation" with the Trump White House. And last week, Rep. Adam Schiff, D-Calif., said in an interview with "Axios on HBO" that he and his colleagues will employ committee subpoena powers -- which are backed by the legal threat of contempt of Congress -- to conduct the triple-threaded inquiry into Trump's possible use of the "instruments of state power to punish the press," as well as potential money laundering involving the Trump Organization in Russia. (Trump has since derided Schiff as "little Adam Schitt.") Specifically, Schiff charged that Trump "was secretly meeting with the postmaster [general] in an effort to browbeat" her into "raising postal rates on Amazon," whose founder and CEO, Jeff Bezos, separately owns The Washington Post. "This appears to be an effort by the president to use the instruments of state power to punish Jeff Bezos and The Washington Post," Schiff said in the interview. Schiff also raised the possibility that the Trump administration's opposition to AT&T's $85 billion takeover of Time Warner on antitrust grounds may have been motivated by the president's animus toward CNN, whose parent company is Time Warner. Trump frequently claims that CNN speads "fake news" and that when it does so, it is acting as the "enemy of the people." "We don't know, for example, whether the effort to hold up the merger of the parent of CNN was a concern over antitrust, or whether this was an effort merely to punish CNN," Schiff said. "It is very squarely within our responsibility to find out," Schiff said. But former GOP Judiciary Committee Chairman Jason Chaffetz, who is now a Fox News contributor, told Politico in October that Cummings and Schiff shouldn't get their hopes up. “If [North Carolina Rep.] Mark Meadows and [Ohio Rep.] Jim Jordan can’t get documents out of the White House, I don’t know why Elijah Cummings and the Democrats think they’ll do any better,” Chaffetz said. Fox News' Brooke Singman contributed to this report.
{ "pile_set_name": "OpenWebText2" }
Officials from the Centres for Disease Control and Prevention (CDC) have confirmed that there are now 234 pregnant women in the continental US carrying the Zika virus – an infection spread by mosquito bites that can cause a devastating birth defect called microcephaly. Out of these women, there have been six "abnormalities" – three babies born with birth defects so far, and another three who died before birth – though officials did not say how many of the women have given birth in total, and how many are still pregnant. As Sabrina Tavernise from The New York Times points out, the report poses more questions than it gives answers. For example, without knowing the number of babies born, how do we make sense of the six abnormalities? Do these represent a large or small amount of the women infected? In response to those questions, one of CDC’s leaders on pregnancy and birth defects, Denise Jamieson, said that the newly released numbers are only the first in a series of updates that will provide more information. "We’re sort of in a hard place," Jamieson told The New York Times. "We can’t provide a lot of information about where these women are in their pregnancy. We don’t want to inadvertently disclose information about difficult decisions these women are making about their pregnancies." The CDC also hasn't disclosed where any of these women were infected with the virus, or how they came in contact with it. So far, we do know that one of the babies was born was microcephaly – a birth defect that causes a baby’s brain to not fully develop during pregnancy, resulting them being born with an abnormally small head and cognitive complications. Jamieson said that the risk of an infected woman giving birth to a child with birth defects is around one to 15 percent. "Microcephalic babies are beginning to be born [in the US]," Jamieson said. "The disease seems to be very similar no matter where it is." Though Zika virus can cause major health problems for pregnant women and their unborn children, the infection is usually pretty harmless for most healthy individuals. In fact, roughly 80 percent of those infected never know it. Usually, even if symptoms, such as fever and rash, appear, they only last a few weeks and rarely end in hospital visits. The virus was first discovered back in 1947 in monkeys, getting its name from the Zika Forest in Uganda where it was found. The first reported cases of Zika started to emerge in 1952 in Uganda and the United Republic of Tanzania. "Before 2007, at least 14 cases of Zika had been documented, although other cases were likely to have occurred and were not reported," reports the CDC. "Because the symptoms of Zika are similar to those of many other diseases, many cases may not have been recognised." The virus is primarily transmitted through mosquito bites, though men can sexually transmit the disease if they were recently infected before a sexual act. The CDC says that the best way to prevent contracting the illness is to avoid getting bitten in the first place, which is obviously easier said than done. To help with this, the CDC has a full list of prevention methods on their website. "What we're seeing is a very consistent pattern underscoring the fact that Zika causes microcephaly and other severe brain abnormalities," Jamieson told Lena H. Sun from The Washington Post. "This highlights the importance of preventing unintended pregnancies, avoiding mosquito bites and for pregnant women to avoid traveling to areas with ongoing Zika virus transmission." Despite all of this bad news, scientists are working hard to combat the disease, with several vaccine candidates in development. Back in May, an international team of researchers created a tool that can diagnose Zika in just a 3 hours. So far, though, an effective treatment for pregnant women has remained out of sight.
{ "pile_set_name": "OpenWebText2" }
Children With Cancer Denied Treatment Due To Shutdown Tags For every week the government is closed, 10 children with cancer will be denied access to clinical trials, according to a spokesman for the National Institutes of Health (NIH). “There are four new protocols [clinical trials] ready to start next week, and they won’t be starting during the shutdown if we’re still shut down,” John Burklow told ABCNews.com. The NIH has put 75 percent of its 14,700 employees on indefinite leave. The 1,400 clinical trials currently in progress will continue, but new trials that would include 200 people — 10 of them kids with cancer — will have to be delayed until the government funds the institution. “Just to be clear, we aren’t turning patients away permanently — we would be delaying their admission, since we are not enrolling new patients at this time,” Burklow told AFP. As both Republicans and Democrats seek to blame each other for the government shutdown, the conservative media has been playing up the spectacle of veterans being denied access to the World War II Memorial in Washington D.C. Monuments were kept open during the last government shutdown — however, that was before the 9/11 terrorist attacks. In addition to the estimated $300-million-a-day hit to our economy, 800,000 federal workers are not getting their paychecks, and the loss of access to national parks, medical research, disease prevention and food safety are areas where the public may feel the direct impact of the government shutdown. The Centers for Disease Control (CDC) furloughed 9,000 employees and cut back on the flu vaccination program. “The vast majority of the CDC is actively in the process of shutting down,” CDC spokeswoman Barbara Reynolds said. “We’ve gotten really good at trying to find outbreaks, but our strong network is getting weaker. … This is spotty.” While the Affordable Care Act’s open enrollment has not been delayed, the standoff over funding the law is still threatening the health of Americans in ways that will only get worse as the impasse continues.
{ "pile_set_name": "Pile-CC" }
Complementary and Alternative Medicine The terms "complementary" and "alternative" are sometimes used to refer to non-traditional methods of diagnosing, preventing, or treating cancer or its symptoms. Here you'll find general information to help you better understand what these terms mean and how to decide if using them is right for you. You'll also find a wealth of information on specific complementary and alternative treatments, grouped into the five categories below. You may hear about alternative or complementary methods to prevent, diagnose, or treat cancer or its symptoms. Learn about what these terms mean and find information to help you think through the issues to make the most informed and safest decision possible. Dietary supplements include things like vitamins, minerals, herbs, or products made from plants, animal parts, algae, seafood, or yeasts. The information here can help you learn more about dietary supplements so you can make a more informed decision about using them safely. You may have just heard about a new or alternative form of cancer treatment. Before you put your time, your body, and your money on the line, learn more about what you are looking at so you can decide if it's worth it. In your quest to be healthy, you may hear about something that you are told can reduce your risk of cancer -- a new way you haven't heard about before. It sounds like a good idea, and you may want to try it. Before you put your body and money on the line, find out more about it. Even though placebos are not active medicines, they seem to help some patients. The effects of placebos may occur because the patient believes in the substance, the treatment, or the doctor. Even if a person feels better after taking a placebo, it doesn't mean the person's illness or symptoms were not real. More Information on Complementary and Alternative Medicine For reliable information on specific complementary and alternative methods, please see the following websites: Select A Hope Lodge Please share your thoughts about your cancer.org website experience. If you need immediate cancer-related information or patient program assistance, please call 800-227-2345 any time day or night. Email Address (optional) Praise Dislike Suggestion What made your cancer.org website experience great?What made your cancer.org website experience challenging? [Please provide a link to the page if you experienced a technical issue.]Tell us about your idea to improve our website. Thank you for your feedback! We appreciate you taking the time to provide us with your comments. We review all feedback and work to provide a better experience. If you need immediate assistance, please call 1-800-227-2345, any time day or night. If you would like to unsubscribe/opt out from our communications, please follow this link: http://www.cancer.org/en/about-us/policies/opt-out-form.html
{ "pile_set_name": "Pile-CC" }
Court Appointed Special Advocates Court Appointed Special Advocates (CASA) is a national association in the United States that supports and promotes court-appointed advocates for abused or neglected children in order to provide children with a safe and healthy environment in permanent homes. In many jurisdictions, CASA are known as Guardians ad litem. In other jurisdictions, the CASA is a volunteer. In both cases, CASA's role is to gather information and make recommendations to the judge in the best interest of the child. According to National CASA Association, there are more than 85,000 advocates serving in nearly 1,000 state and local program offices in the United States. Each year more than a quarter of a million children are assisted through CASA services. History In 1977, Seattle Superior Court Judge David Soukup was faced with making decisions on behalf of abused and neglected children with only the information provided by the state Child Protective Services. Soukup formulated the idea that volunteers could be dedicated to a case and speak for children's best interests. Fifty volunteers responded to his idea, which started a movement that provides better representation for abused and neglected children throughout the United States. Current situation Since its founding, CASA programming has grown to cover 49 U.S. states and the District of Columbia. Some state and local agencies receive government funding, while others do not. The National CASA agency relies on pass thru grants from the Office of Juvenile Justice and Delinquency Prevention as well as partnerships with organizations like Jewelers for Children. National CASA then passes grant funding to state and local agencies. Strategic objectives According to CASA, the strategic objectives of the organization are listed as follows: Every court in the United States recognizes that a CASA/GAL volunteer is essential for a successful outcome for children Our volunteer base reflects the diversity and cultural makeup of children in the system Every potential donor understands the importance of our mission, and places it at the top of their priority list Every government official at the local, state, tribal and federal level understands the far-reaching results a CASA/GAL volunteer can achieve, and places our work at the top of their agenda Every child can thrive in the safe embrace of a loving family Training Court Appointed Special Advocates (CASA) can be found in cities all over the United States. Different locations vary on their training process but all advocates are properly trained to assess a familial situation, a child's opinion, and adequately represent children in court. Typical training consists of 30 hours of pre-service training and 12 hours per year of continuing training. See also Child Protection and Obscenity Enforcement Act References External links CASA for Children, National CASA's Web Site Category:Legal organizations based in the United States Category:Foster care in the United States Category:Child welfare in the United States Category:Children's rights organizations in the United States
{ "pile_set_name": "Wikipedia (en)" }
Mitochondrial DNA mutations at nucleotide 8993 show a lack of tissue- or age-related variation. Two pathogenic mitochondrial DNA mutations, a T-to-G substitution (8993T > G) and a T-to-C substitution (8993T > C), at nucleotide 8993 have been reported. We describe 13 pedigrees with mitochondrial DNA mutations at nucleotide 8993; 10 pedigrees with the 8993T > G mutation and three with the 8993T > C mutation. Prenatal diagnosis of the nucleotide 8993 mutations is technically possible. However, there are three major concerns: (i) that there is variation in mutant loads among tissues; (ii) that the mutant load in a tissue may change over time; and (iii) that the genotype-phenotype correlation is not clearly understood. We have used the 13 pedigrees to determine specifically the extent of tissue- and age-related variation of the two mutations at nucleotide 8993 in the mitochondrial DNA. The tissue variation was investigated by analysing two or more different tissues from a total of 18 individuals. The age-related variation of the mutation was investigated by comparing the amount of both mutations in blood taken at birth and at a later age. No substantial tissue variation was found, nor was there any substantial change in the proportion of either mutation over periods of 8-23 years in the four individuals studied. In addition, we noted that two features were remarkably common in families with nucleotide 8993 mutations, namely (i) unexplained infant death (8 cases in 13 pedigrees); and (ii) de novo mutations (5 of the 10 8993T > G pedigrees).
{ "pile_set_name": "PubMed Abstracts" }
1. Field of the Invention The present invention relates to an ice dispenser for a refrigerator. 2. Description of the Prior Art Refrigerators are known which have an integrated ice dispenser for dispensing ice cubes and/or crushed ice and often optionally also drinking water. The ice dispenser is generally located at the front of the refrigerator and is integrated in a door. It provides a slide-in compartment in which a glass can be placed which is intended to be filled with the ice or water. Above the glass, a dispensing shaft or channel terminates in which the ice is provided and which can be opened and closed by means of a flap. US 2006/0144075 A1 discloses an ice dispenser whose flap is opened and closed in an electromotive manner. Alternatively, it is also possible to envisage, for actuating the flap, an electromagnetic solution, wherein the flap is moved by means of an electromagnet from the closed or locked position into the open or release position thereof and is retained at that location, with the electromagnet continuously being supplied with electrical power. Only when the user removes his glass is the power supply to the electromagnet switched off, whereupon the flap returns to the locked position thereof, for example, under the action of a bias spring. It has been found that this solution may involve a humming noise which is perceived to be unpleasant.
{ "pile_set_name": "USPTO Backgrounds" }
# == Class: mongodb::s3backup::restore # # Restore a MongoDB backup to a server from s3 # # === Parameters: # # [*aws_access_key_id*] # Key used to sign programmatic requests in AWS # # [*aws_secret_access_key*] # Key used to sign programmatic requests in AWS # # [*backup_dir*] # Defines the directory to restore the backups # # [*env_dir*] # Defines directory for the environment # variables # # [*private_gpg_key*] # Defines the ascii exported private gpg to # use for decrypting backups. This key should # be created by the user and encrypted with eyaml # # [*private_gpg_key_fingerprint*] # Defines the fingerprint of the gpg private # key to dencrypt the backups. The fingerprint # should be 40 characters without spaces # # [*s3_bucket*] # Defines the AWS S3 bucket where the backups # will be downloaded from. It should be created by the # user # # [*cron*] # Defines whether to enable the cron job. Value # should be true or false class mongodb::s3backup::restore( $aws_access_key_id = undef, $aws_secret_access_key = undef, $env_dir = '/etc/mongo_s3backup', $s3_bucket = $::mongodb::s3backup::backup::s3_bucket, $backup_dir = '/var/lib/s3backup', $user = 'govuk-backup', $cron = false ){ include ::backup::client contain ::mongodb::s3backup::package file { '/usr/local/bin/mongodb-restore-s3': ensure => file, content => template('mongodb/mongodb-restore-s3.erb'), mode => '0770', owner => $user, group => $user, require => Class['::mongodb::s3backup::package'], } }
{ "pile_set_name": "Github" }
Journalist Glenn Greenwald said Friday that he won’t be participating in Germany’s parliamentary investigation of National Security Agency spying activities unless the probe includes an interview with Edward Snowden. Greenwald, who won a Pulitzer Prize this year for his reporting on Snowden’s disclosures of NSA surveillance, said that the Germans would be remiss if they didn’t interview the former security contractor, whose temporary asylum in Russia expired this week. “I am very supportive of any attempt by the German Parliament to conduct a serious investigation into NSA spying on Germans,” Greenwald said in a statement that he posted on Twitter. “Unfortunately, German politicians have demonstrated, with their refusal to interview the key witness in person – Edward Snowden – that they care far more about not upsetting the U.S. than they do about conducting a serious investigation.” Greenwald made the same point in April, arguing that “it would be incredibly irresponsible for the German Commission to try and pretend to investigate surveillance on German soil without speaking to the one person who knows more about that and is willing to talk to them than anybody in the world.” Below, Greenwald’s full statement:
{ "pile_set_name": "OpenWebText2" }
Q: Appropriate Scala Collection similar to Python Dictionary I have an algorithm that iteratively returns (key, value). What I want to do is store these results in a structure such that if the key does not exist, it will add it and the corresponding value. Now, if the key exists, it will append the value to an existing array of values. In python, I can do this using a python dictionary with this format: dict = {'key1': [val1, val2, val3], 'key2': [val4, val5], 'key3': [val6], ... } and simply do: if key in dict.keys(): dict[key].append(value) else: dict[key] = [value] How do I do this in Scala? A: Maybe something like this? scala> def insert[K,V](k: K, v: V, m: Map[K, List[V]]): Map[K, List[V]] = { | if (m contains k) m + (k -> (m(k) :+ v)) | else m + (k -> List(v)) } insert: [K, V](k: K, v: V, m: Map[K,List[V]])Map[K,List[V]] scala> insert('b', 23, Map('b' -> List(2))) res30: Map[Char,List[Int]] = Map(b -> List(2, 23)) scala> insert('b', 23, Map('c' -> List(2))) res31: Map[Char,List[Int]] = Map(c -> List(2), b -> List(23)) Or, incorporating Sergey's very fine suggestion: def insert[K,V](k: K, v: V, m: Map[K, List[V]]): Map[K, List[V]] = m + (k -> (m.getOrElse(k, List()) :+ v))
{ "pile_set_name": "StackExchange" }
Senate Majority Leader Mitch McConnell on Wednesday introduced a short-term spending bill to fund the government through February 8, 2019 in an effort to avert a partial government shutdown this week. In remarks on the Senate floor, McConnell said that the measure, known as a continuing resolution, would “ensure continuous funding for the federal government,” and would “provide the resources necessary to continue normal operations through February the 8th.” If the short-term measure is approved by both chambers of Congress, it would head to President Donald Trump’s desk for his signature and prevent a partial government shutdown. Senate Majority Whip John Cornyn, the current no. 2 highest-ranking Senate Republican, predicted on Wednesday that the President will sign the stop-gap funding measure. Congress is currently in a race against the clock to prevent a partial shutdown when funding expires for several key government agencies at midnight on Friday. McConnell’s proposal has the backing of the top congressional Democratic leaders Nancy Pelosi and Chuck Schumer. Pelosi, the House Democratic leader who is poised to reclaim the speaker’s gavel in the new Congress, said Wednesday afternoon that she supported the measure. “This is a missed opportunity to pass full-year funding bills now,” Pelosi said in a statement. “However, Democrats will be ready to fully, responsibly fund our government in January, and we will support this continuing resolution.” Senate Democratic Leader Chuck Schumer sounded optimistic that a shutdown could be averted in remarks on the Senate floor on Wednesday in which he similarly said that Democrats would support the stop-gap funding measure. “Yesterday we made some progress,” he said, adding, “Thankfully, President Trump appears to have backed down from his position for billions in direct appropriations for a border wall.” Republicans and Democrats on Capitol Hill have made clear they don’t want a shutdown, but had been at an impasse over the President’s demand for $5 billion in funding for his long-promised wall at the US-Mexico border. Democrats have made clear that figure is a non-starter for them and any spending bill would need at least some Democratic votes to pass in the Senate. But on Tuesday, the White House appeared to step away from the brink of a shutdown. White House Press Secretary Sarah Sanders said Tuesday morning during an interview with Fox News that, “We have other ways that we can get to that $5 billion (for a border wall).” Members of the conservative House Freedom Caucus and other conservative allies of the President plan to give brief speeches on the House floor Wednesday night, however, urging Trump not to abandon his quest for border wall funding. They include: Mark Meadows of North Carolina, Jim Jordan of Ohio, Paul Gosar of Arizona, Steve Pearce of New Mexico, Jody Hice of Georgia, Ralph Norman of South Carolina, Andy Biggs of Arizona and Morgan Griffith of Virginia. Despite opposition from the Freedom Caucus, however, the House should still have the votes to still pass the continuing resolution, assuming most, if not all, Democrats support it, since it has Pelosi’s blessing. This story has been updated and will continue to update with additional developments Wednesday.
{ "pile_set_name": "Pile-CC" }
With the Galaxy Watch 4G¹, connected exclusively on EE, you’re free to roam wi...With the Galaxy Watch 4G¹, connected exclusively on EE, you’re free to roam without your smartphone, while still staying connected to everything love. Take calls, receive messages and get notifications using the same number and data plan as your phone....more Trade in and get an instant evaluation to see how much you can get off for a l...Trade in and get an instant evaluation to see how much you can get off for a limited time only. Save up to £90 on your new Galaxy device when you trade in your old one. Choose the old device you're trading in Please enter your IMEI number Apply the...more Buy the best Michael kors rose gold watch Watches when you compare prices and read Michael kors rose gold watch Watches reviews at Bizrate.co.uk. Shop for Michael kors rose gold watch Watches at Bizrate.co.uk you can compare models and prices from hundreds of of Bizrate.co.uk shopper certified Jewellery & Watches stores. Looking for a discount price on Michael kors rose gold watch Watches? Bizrate.co.uk has the information and product reviews to help you find the best deal for you.
{ "pile_set_name": "Pile-CC" }
Optimization of donkey sperm vitrification: Effect of sucrose, sperm concentration, volume and package (0.25 and 0.5 mL straws). The aim of this study was to assess the effect of different factors affecting vitrification success of donkey sperm: extender, sperm concentration, volume and storage vessel type. In Experiment 1, sucrose supplementations at 0.25 and 0.1 M were compared using two base extenders (containing or not egg-yolk); in Experiment 2, three sperm concentrations were assessed: 100, 200 or 300 million sperm/mL; and in Experiment 3, three different sperm volumes (100, 160 and 200 μL) and two different storage vessels (0.25 and 0.5 mL straws) were assessed. Sperm motility variables (CASA), plasma membrane and acrosome (evaluated under fluorescence microscopy) and sperm DNA integrity (flow cytometry) were evaluated after warming with comparisons of protocols. There was a greater total (55.7 ± 16.4%) and progressive (44.0 ± 11.5%) motility using the extender with egg-yolk and 0.1 M sucrose. There were no effects of sperm concentrations on vitrification results (P > 0.05). The 0.25 mL covered straw showed higher values than the 0.5 mL straw for total (50.0 ± 17.3% vs 2.0 ± 6.7%) and progressive (40.5 ± 14.9% vs 0.9 ± 1.5%) motility, plasma membrane (43.9 ± 14.4% vs 14.0 ± 16.4%) and acrosome integrity (51.5 ± 13.6% vs 28.0 ± 14.7%), respectively. In conclusion, values for donkey sperm quality variables after vitrification were greater using an extender containing egg-yolk and 0.1 M sucrose, at 300 million sperm/mL in 0.25 mL straws with outer covers.
{ "pile_set_name": "PubMed Abstracts" }
Dear GM CEO Mary Barra: A revolution doesn’t happen overnight. It took Thomas Edison more than 1,000 light bulbs before he found the right one. Henry Ford’s wife, Clara Ford, drove a Detroit Electric car in 1914 that once went 241 miles on a charge. Women refused to ride in the gasoline-powered horseless carriage because the soot soiled their dresses and frankly, many feared it would catch fire! Which brings me to your decision to stop making the Chevy Volt. The battery-powered car with the small gasoline tank and generator that powers the electric drive train when battery juice runs out was the first of its kind in the modern era. This was no ordinary hybrid. It was an electric car that gave you the ability to drive more than 400 miles without stopping. No more “range anxiety.” Ironically, you say GM wants to focus on pure electric vehicles, like its newer Chevy Bolt (with a “B”) that gets 238 miles on a charge and sells for about $37,000? Fine. But killing the amazing, versatile Volt — a bridge car I own that gets me to work using only battery power but also to assignments across the Southland without stopping for a charge — is a huge mistake. Not everyone is ready to drive an all-electric car. There is “range anxiety,” not knowing whether you can make it back home. And there are not enough public charging stations, not even close, to accommodate every EV driver’s needs. The Volt closed that gap for hundreds of thousands of revolution-minded owners. Your decision is premature. You are killing a fantastically engineered car that became the basis for the Bolt. Frankly, this move is a headscratcher. It makes me question your commitment to electric vehicles, as well as electric autonomous vehicles. I get the other decisions, even though they are painful for the soon-to-be laid off 14,000 workers. Closing up to five plants and stopping the production of poor performing gasoline sedans such as the Cruze, Impala and Cadillac models makes sense. But you speak out of both sides of your mouth when you say you want to focus on electric vehicles but are killing the Volt. Moving away from ICE sedans because America is hooked on gas-guzzling pickup trucks and SUVs? That is a business decision, as much as it is a disastrous one for the planet. I say, keep making the Volt for five more years. Lagging sales are your fault. You did not promote it in your ads. You didn’t educate your sales force. I leased my first Volt in 2013 and the dealer didn’t know much about it. “You know more about this car than I do,” he told me during a test drive. I am on my second one, a black, 2017 Volt LT that can get 63 miles per charge on a warmer day, has virtually zero maintenance costs, drives like I’m floating on a cloud and handles as a sports car. But I assume you already know all this. But did you know how about the loyalty of Volt owners? Isn’t loyalty to the Chevy brand what you sell in your ads? Now you are destroying it. I became evangelistic about the Chevy Volt. I convinced three co-workers to buy one and they love theirs. I was spreading the gospel of Chevy’s commitment to electric vehicles ever since interviewing Bob Lutz at the L.A. Car Show, the living legend (now 85 years old) who helped engineer the Volt after making iconic ICE sports cars. The message was perfect: Help dump gasoline. Join the clean energy revolution. But you don’t need an all-electric car to hop on board. You don’t need to lay out $50,000 or $60,000 for a Tesla to save the planet. Again, revolutions take time. And that’s OK because Chevy has your back. Or so I thought. Maybe it is not you, it’s me. No, wait. It IS you; it’s not me. I have been loyal. I did my part. Lutz did his. And now, you are breaking up with me. I will have to look at the 2019 Nissan Leaf or at the lower-priced Tesla Model 3 when my Volt lease runs out next spring. You know, my dad had a 1962 Impala — a car for that time. I wanted to stick with Chevy in honor of him. But now, you’ve lost me. I guess time will tell if you still are leading the way or have retreated in favor of higher profits. Will I see you at the revolution? Or, maybe we should just become friends. Signed, A loyal Chevy Volt owner Steve Scauzillo covers public health, environment and green transportation for the Southern California News Group. He’s a recipient of the Aldo Leopold Award for Distinguished Editorial Writing. Follow him on Twitter and Instagram @stevscaz or email him at sscauzillo@scng.com.
{ "pile_set_name": "OpenWebText2" }
Going the Distance to Attract Marathon Customers 36,000 runners are expected to take part in the London marathon this weekend, with additional security deployed following the Boston marathon bombings. Andrew Potter speaks to the CEO of ASICS Europe about the business of running. http://archive.delmarvanow.com/VideoNetwork/2312861696001/Going-the-Distance-to-Attract-Marathon-Customershttp://cdn.newslook.com/c7/c756172c5430b1c0aba0fae9c0ddb344/mp4_low/c756172c5430b1c0aba0fae9c0ddb344-mp4_low.mp4http://archive.delmarvanow.com/VideoNetwork/2312861696001/Going-the-Distance-to-Attract-Marathon-Customershttp://cdn.newslook.com/c7/c756172c5430b1c0aba0fae9c0ddb344/images/frame_0009.jpgGoing the Distance to Attract Marathon Customers36,000 runners are expected to take part in the London marathon this weekend, with additional security deployed following the Boston marathon bombings. Andrew Potter speaks to the CEO of ASICS Europe about the business of running.1Alistair CameronMo FarahAsics CorporationFinancesportsnewslookUnited KingdomLondon02:23
{ "pile_set_name": "Pile-CC" }
Layout of member constants and member variables of AS3 classes in memory ------------------------------------------------------------------------ The AS3 class below defines a member variable v of type number and a member constant c of type Boolean. class MyClass { public var v : Number; public const c : Boolean; } When the VM allocates an instance of MyClass it must reserve space in the instance to contain the values of v and c. The VM refers to the space reserved for v and c as "slots". The slot for v is always 8 bytes and the slot for c is always 4 bytes. Slots whose type is not one of Boolean, Number, uint, or int are the same size as pointers ( 4 bytes in 32 bit targets, 8 bytes in 64 bit targets ). The memory layout of an instance of MyClass is shown below: ------------------------------------------- | avmplus::ScriptObject | | includes C++ vtable and | | base classes of avmplus::ScriptObject | |-----------------------------------------| | 4 byte slots for MyClass ( slot for c ) | | pointer slots for MyClass ( empty ) | | 8 byte slots for MyClass ( slot for v ) | ------------------------------------------| Classes that are part of the AS3 API exposed by the FlashPlayer, AIR Runtime, or AVM shell often contain native methods. If a class contains a native method, then it is a native class. Native classes must extend Object or another native class. Consider the following classes: [native(cls="EventDispatcherClass", instance="EventDispatcherObject", methods="auto")] class EventDispatcher { . . . public native function dispatchEvent(ev : Event, bubbles : Boolean, cancelable : Boolean) : Boolean; private var m_handlers : Dictionary; } [native(cls="DisplayObjectClass", instance="DisplayObject", methods="auto")] class DisplayObject extends EventDispatcher { public function get x() : Number { return m_x; } public native function set x(newX : Number); . . . private var m_x : Number; . . . } The memory layout of instances of all subclasses of DisplayObject will start with the layout shown below: ------------------------------------------------------------- | avmplus::ScriptObject | | includes C++ vtable and | | base classes of avmplus::ScriptObject | |-----------------------------------------------------------| | avmplus::EventDispatchObject C++ member | | variables. | | 4 byte slots for EventDispatcher ( empty ) | | pointer slots for EventDispatcher ( slot for m_handlers ) | | 8 byte slots for MyClass ( empty ) | |-----------------------------------------------------------| | avmplus::DisplayObject C++ member variables | | 4 byte slots for DisplayObject ( none ) | | pointer slots for DisplayObject ( none ) | | 8 byte slots for DisplayObject ( slot for m_x ) | ------------------------------------------------------------- This memory layout has the property that the offset to a slot of a given class does not depend on which C++ class is actually instantiated. This is an important property that previous slot layout schemes did not have. This slot layout also make it possible for nativegen.py to generate C++ code that can get or set any slot on an instance of a native AS3 class. For each native AS3 class nativegen.py determines if that class has any instance or class slots. nativegen.py will generate a class will generate C++ class and macro for the class instance and class closure if they each have slots. The macros expand to accessor methods for the slots and an instance of the generate C++ classes. The last statement of the C++ instance class and the C++ class closure classes of all AS3 native classes should a reference to the corresponding generated macros. From the previous example, the C++ class definitions for instance and classes closure classes for EventDispatch and DisplayObject should be as follows: namespace avmplus { class EventDispatcherClass : public ClassClosure { . . . DECLARE_SLOTS_EventDispatcherClass; }; class EventDispatcherObject : public ScriptObject { . . . DECLARE_SLOTS_EventDispatcherObject; }; . . . . class DisplayObjectClass : public ClassClosure { . . . DECLARE_SLOTS_DisplayObjectClass; }; class DisplayObject : public EventDispatcherObject { . . . DECLARE_SLOTS_DisplayObject; }; } In the example above, the C++ class EventDispatcherObject will have two generated methods for setting and getting the m_handlers slot: void EventDispatcherObject::set_private_m_handlers(DictionaryObject*); DictionaryObject* EventDispatcherObject::get_private_m_handlers() const; Both methods are protected methods of EventDispatcherObject and should fully inline. The get methods should compile down to a single load from memory instruction in the release build. The set method will need to fire a ref-counted write barrier, but is none the less as efficient as code be written by hand or by the JIT. The C++ class DisplayObject will have two generated methods for setting and getting the m_x slot: void DisplayObject::set_private_m_x(double); double DisplayObject::get_private_m_x() const; Both of these methods will fully inline in the release build to memory store and load instructions. If a slot is declared using the const keyword instead of the var keyword, then by default nativegen.py will not generate C++ setter methods for that slot. If the C++ code needs to set the value of a const slot, the constsetters meta data attribute should be added to the native metadata of the AS3 class. For example: [native(cls="StackFrameClass", instance="StackFrameObject", methods="auto", constsetters="true")] // @todo: native only for slot getter/setter public final class StackFrame { . . . public const name:String; } In the example above, the C++ class StackFrame will have two generted methods for setting and getting the name slot: void StackFrameObject::set_name(AvmString newVal); AvmString StackFrameObject::get_name();
{ "pile_set_name": "Github" }
Q: Docker Machine error: Hyper-V PowerShell Module is not available I've checked my Hyper-V settings and PowerShell Module is enabled. I've also found this documented issue: https://github.com/docker/machine/issues/4342 but it is not the same issue since I do not have VMware PowerCLI installed. The issue was closed with a push to the repo and is supposedly fixed in 0.14.0-rc1, build e918c74 so I tried it anyways. After replacing my docker-machine.exe, I'm still getting the error and still getting the error even if I reinstall Docker for Windows. For some more background, this error starting happening after a reinstall because my Docker install had an error: https://github.com/docker/for-win/issues/1691, however, I'm not longer getting that issue after reinstalling. A: For those who struggle with this issue in Windows, Follow the instruction here A: When creating a Hyper-v VM using docker-machine on win10, an error was returned"Error with pre-create check: "Hyper-V PowerShell Module is not available"。 The solution is very simple. The reason is the version of the docker-machine program. Replace it with v0.13.0. The detailed operation is as follows: Download the 0.13.0 version of the docker-machine command. Click to download: 32-bit system or 64-bit system After the download is complete, rename and replace the " docker-machine.exe " file in the " C:\Program Files\Docker\Docker\resources\bin" directory. It is best to back up the original file. A: Here is the solution https://github.com/docker/machine/releases/download/v0.15.0/docker-machine-Windows-x86_64.exe Save the downloaded file to your existing directory containing docker-machine.exe. For my system this is the location for docker-machine.exe /c/Program Files/Docker/Docker/Resources/bin/docker-machine.exe Backup the old file and replace it file with the new one. cp docker-machine.exe docker-machine.014.exe Rename the downloaded filename to docker-machine.exe mv docker-machine-Windows-x86_64.exe docker-machine.exe Build Instructions Create virtual switch in Hyper-V manager named myswitch Request Docker to create a VM named myvm1 docker-machine create -d hyperv --hyperv-virtual-switch "myswitch" myvm1 Results docker-machine create -d hyperv --hyperv-virtual-switch "myswitch" myvm1 Running pre-create checks... (myvm1) Image cache directory does not exist, creating it at C:\Users\Trey Brister\.docker\machine\cache... (myvm1) No default Boot2Docker ISO found locally, downloading the latest release... (myvm1) Latest release for github.com/boot2docker/boot2docker is v18.05.0-ce (myvm1) Downloading C:\Users\Trey Brister\.docker\machine\cache\boot2docker.iso from https://github.com/boot2docker/boot2docker/releases/download/v18.05.0-ce/boot2docker.iso... (myvm1) 0%....10%....20%....30%....40%....50%....60%....70%....80%....90%....100% Creating machine... (myvm1) Copying C:\Users\Trey Brister\.docker\machine\cache\boot2docker.iso to C:\Users\Trey Brister\.docker\machine\machines\myvm1\boot2docker.iso... (myvm1) Creating SSH key... (myvm1) Creating VM... (myvm1) Using switch "myswitch" (myvm1) Creating VHD (myvm1) Starting VM... (myvm1) Waiting for host to start... Waiting for machine to be running, this may take a few minutes... Detecting operating system of created instance... Waiting for SSH to be available... Detecting the provisioner... Provisioning with boot2docker... Copying certs to the local machine directory... Copying certs to the remote machine... Setting Docker configuration on the remote daemon... Checking connection to Docker... Docker is up and running! To see how to connect your Docker Client to the Docker Engine running on this virtual machine, run: C:\Program Files\Docker\Docker\Resources\bin\docker-machine.exe env myvm1
{ "pile_set_name": "StackExchange" }
In a major blow to the latest Republican healthcare effort, Sen Susan Collins said on Monday she could not support her colleagues’ measure. Republicans seeking once again to fulfil their promise of repealing a federal healthcare law could afford few defections, and the loss of Ms Collins - a centrist from Maine - likely deprived them of the needed vote margin to move their bill. If the loss of Ms Collins does doom the initiative, the collapse will be the latest failure in a string of abortive Republican efforts to translate a perpetual campaign promise - the repeal of Obamacare - into legislation. The party has failed to do so despite controlling the presidency and both houses of Congress. Ms Collins' “no” vote also helped stymie a high-profile push in July. Hoping to win enough votes to advance the measure, Republicans had sought to lure holdouts like Ms Collins and Alaska Sen Lisa Murkowski. Leadership was scrambling to cobble together enough votes after other members of the caucus - including Senators John McCain, Ted Cruz and Rand Paul - declined to support the measure. In a statement explaining her decision, Ms Collins cited “sweeping changes and cuts to the Medicaid program”, which provides health insurance to low-income Americans; provisions that would allow states to set rules potentially leading insurers to charge higher premiums to people with pre-existing conditions; and a wall of resistance from health industry representatives. An effort to ease Maine’s loss of funding would not go far enough, Ms Collins said, because “huge Medicaid cuts down the road more than offset any short-term influx of money”, and she faulted the political calculus behind trying to win her vote. Faces of Obamacare: The health scheme at the centre of the shutdown Show all 3 1 /3 Faces of Obamacare: The health scheme at the centre of the shutdown Faces of Obamacare: The health scheme at the centre of the shutdown obama.jpg Martin Wolske, 49 and his family, Illinois. His son Eric, 23 (bottom right, dark hair) was recently badly injured in a motorcycle accident. Faces of Obamacare: The health scheme at the centre of the shutdown obama2.jpg Tracy Russo, 31, Washington DC Faces of Obamacare: The health scheme at the centre of the shutdown obama3.jpg Kevin McCollum, 41, and his wife Melissa, 40, Texas “If Senators can adjust a funding formula over a weekend to help a single state”, she said, “they could just as easily adjust that formula in the future to hurt that state”. Critics of the Republican repeal effort have complained of a rushed and opaque process that hasn’t left enough time to analyse proposals. On the same day that Ms Collins said she could not support the latest bill, the Congressional Budget Office released a partial analysis that offered ammunition to detractors. The legislation would slash federal subsidies to help individuals buy health insurance, allocating funding via new block grants to states, and would trim the budget deficit by at least $133 billion, the nonpartisan analyst said. The woman who stopped Trump repealing Obamacare was applauded spontaneously at an airport But millions fewer people would have health insurance covering “high-cost medical events”, the analysis concludes. The loss in coverage would be driven by “substantially lower” Medicare enrollment, fewer people buying coverage because of a loss in federal subsidies, and a lack of penalties for not having insurance.
{ "pile_set_name": "OpenWebText2" }
You are enrolled in the following class: Harassment Avoidance Class Days and Times: 2/23/2001 02:45:00 PM - 04:15:00 PM Room # & Location: DoubleTree-La Salle B, Houston Last Day to Cancel: 02/23/2001 Participant Fee: $50.00 Note: Please review any prerequisite material to validate your eligibility in this class. Your Company and RC will be charged $50.00 If you have any questions, please call the Development Center Team at 713-853-0357. Thank you.
{ "pile_set_name": "Enron Emails" }
Daily Summary September 25, 2020 Yesterday Today Normal* Record Low High Low High Low High Low High Temperature: 72°F 91°F 73°F 92°F 64°F 85°F 44°F (1989) 102°F (2005) Yesterday Today Record Rain: 0.00 " 0.00" 2.27" (1913) Snow: " " 0.00" () *Normals based on 30 year averages. Current normals calculated from data collected from 1981-2010. (As officially recorded at DFW Airport. Period of record began in September 1898.)
{ "pile_set_name": "OpenWebText2" }
Q: AngularJS: ngRepeat doesn't have time to update before new change happens $scope.add = function(){ $scope.playerCards.push(Deck.drawCard()); if (playerScore > 21){ console.log("You Busted!"); newHand(); } }; In this blackjack game, the DOM automatically updates to reflect the players hand using ngRepeat. However, there isn't a window of time to allow the last card to show before the >21 logic executes. I'm guessing angular doesn't have time to run through ng-repeat. How can I force it to update as soon as the data updates? I tried $scope.$digest() but it throws an error about about something else being in progress. A: I'd solve that by delaying the test for going over 21, akin to the human delay of adding the cards and seeing they're bust. Maybe even give them enough time to see it for themselves before you tell them. :)
{ "pile_set_name": "StackExchange" }
A comparison of river water quality sampling methodologies under highly variable load conditions. When river water quality fluctuates over relatively short periods of time with respect to the sampling frequency, the collection of grab samples may be inappropriate for characterising average water quality. This paper presents the results of a water quality monitoring study carried out on a stretch of the river Lambro (northern Italy) dominated by a periodically overloaded sewage treatment works (STW) located near its upstream end. Water quality was strongly influenced by a pronounced diurnal cycle in pollutant loads caused by the regular emission of untreated waste water during periods of high domestic flow (daytime). Two different sampling techniques were employed: grab sampling and 24-h composite sampling using automatic samplers. Samples were collected at the plant overflow and at several sites along the river and analysed for two common ingredients of household detergents, linear alkylbenzene sulphonate (LAS) and boron (B) and for routine water quality variables. The results obtained show that: (1) The diurnal variability of point-source-derived chemical concentrations in the river downstream of the undersized STW increased with increasing removal efficiency in sewage treatment. (2) The shape of the diurnal concentration signal remained relatively intact for a considerable distance downstream of the STW for several water quality variables, suggesting that hydrodynamic dispersion plays a relatively minor role in controlling concentration patterns in this river. (3) In-stream degradation of LAS was consistent with first order kinetics with a rate constant of 0.05-0.06 h(-1). (4) Grab sampling is a relatively inefficient methodology for capturing mean concentrations for rivers subjected to highly variable loads, especially when it is restricted to office hours. The inefficiency of grab sampling is more marked for substances (e.g. LAS) which are effectively removed during sewage treatment than for substances which are not. (5) For LAS, diurnal variability in the concentration signal decreases with distance downstream, making grab sampling an increasingly reliable methodology for estimating mean concentrations. (6) 24-h composite sampling is an efficient way of eliminating the effect of diurnal variations in load strength.
{ "pile_set_name": "PubMed Abstracts" }
Q: Is it practically useful to decline GUI for a newbie in Ubuntu? My Ubuntu is 12.04. I have just started learning Linux (Ubuntu in particular). To remember terminal commands quicker, I'd like to not use a GUI. However, I can't launch installed programs because I don't know where they are. For example, I have a PDF file. I know that there is a program to view such files. If I was using a GUI I would just click on the PDF file and it would open in Document Viewer 3.4.0. Then I would like to launch Firefox Web Browser. Even if I know it is installed, how to find the file to be launched using just CLI is a mystery to me. Could you suggest anything? A: Honestly, for most of these programs it is enough to simply know their name. When installed from a repo, they tend to add themselves into your path, or a symbolic link to the applications binary is added into a folder in your path already. Also, man (manuals!) is your best friend! man apt-get | less Then you can scroll up and down, line by line rather than having to go by entire pages, (depending on your version/distro, this may be the default functionality of man) it can be very useful when trying to get that next line of output. And last, but definitely not least, if you are new to linux, your package manager apt-get, is going to be your best friend. For experience you should install some programs from source, but knowing your package manager and being able to search it will be invaluable as a time saver. Hopefully this helps some.
{ "pile_set_name": "StackExchange" }
Panera Pink Ribbon Bagel Supports Breast Cancer Awareness In Yakima, almost 350 women get diagnosed each year with a form of breast cancer. Breast cancer is one of the leading causes of death in women, and in 2018 it's estimated that among US women, there will be 266,120 new cases of invasive breast cancer detected. The symphony will also have oncologists give testimonials and will show video interviews from community members about their breast cancer stories. "DelDOT knows the importance of supporting breast cancer awareness". Some women who have no family history of breast cancer might feel like they can skip their mammograms. Published in Breast CancerResearch, the Markey study determined the role collagen XIII plays in breast cancer progression. For those women considered at high risk for breast cancer, it's important to learn about early testing, possibly beginning in one's 30s. Say no to smoking- Smoking doesn't only cause lung cancer but also affects the breast. The survey was conducted amongst women across urban Indian cities like Delhi, Mumbai, Bangalore, Chennai, Hyderabad, Ahmedabad, Lucknow, Bhopal and Chandigarh. Incidence of breast cancer in the United States has decreased since the year 2000 and death rates have also decreased. However, metastatic cancer cells are resistant to anoikis, which allows them to circulate the body and begin growing in other organs. "I am proud to be able to play a part in the fight for awareness and funding by making our already-stunning Smith Street bridge even more eye-catching, all month long". The survey reveals that 2 out of 3 women were unaware of the simple self-examination that can help them detect the disease at an early stage. The survey found that around 70% of the respondents were unaware of the different treatments for cancer. Breast cancer doesn't just affect women. The National Breast Cancer Foundation was established in 1994, and has since invested more than $160 million in more than 500 research projects investigating the disease. On all private insurance plans, as well as Medicare, mammograms are free. October is National Breast Cancer Awareness Month, and doctors recommend women over a certain age to get annual exams. "As a pan-European airline flying on over 1000 routes we have a fantastic opportunity to help make a real difference, raise awareness and support the vital work that both of these organisations do". This will help women be better financially prepared in case of an uncertainty. Cancer has been a word commonly thrown around in my family. Various studies have claimed that smoking may cause breast cancer. In addition, all breast cancer survivors are invited to the exclusive Survivor Happy Hour provided by The Antoon Hospitality Group beginning at 4:30pm. Cancer has been a common staple within the past decade and has affected countless lives. Pentagon grounds global fleet of F-35s after crash Dan Sullivan, R-Alaska, raised questions on the troubles still facing the F-35 program and its readiness rate of about 65 percent. The US government's accountability office estimates all costs associated with the project will amount to one trillion dollars. 10/12/2018 Google Plus shut down: Here’s all you need to know The Google Plus data potentially exposed includes names, email addresses, occupations, dates of birth, genders and profile photos. Google says that there was no evidence that the information was misused, but that a total of 438 apps had access. 10/11/2018 Dow sinks 800 as tech companies decline The CAC 40 in France dropped 2.1 percent, Germany's DAX lost 2.2 percent and the FTSE 100 in London fell 1.3 percent. Apple and Amazon, the two most valuable companies in the S&P 500 , each had their worst day in 2½ years. 10/11/2018 Kanye West at the White House hugs, talks with Trump His monologue was laden with praise for Mr Trump , who he described as a father figure on "his hero's journey ". "Well if he doesn't then he gets overruled by me, because I make the decisions, he doesn't", Trump said . 10/11/2018 Samsung plans to bring 4 cameras to its Galaxy A9 Star Pro As for the internal storage , both the variants ship with 128GB that can be expanded up to 512GB with a microSD card. The second sensor is a telephoto lens with 2x optical zoom, f/2.4 aperture and 10-megapixel resolution. 10/11/2018 Grieving bride cries on grave of dead fiancé on their 'wedding day' Murphy was one of five firefighters from IN honored at the National Fallen Firefighters Memorial Service on Sunday IN Washington. Her fiancé, Kendall Murphy, was killed in November 2017 while responding to a crash scene in Daviess County, Fox 59 reported . 10/11/2018 Trump, Kim considering four locations for next summit Kang's comments are likely to increase speculation that Washington was not fully on board before Seoul signed the agreement. In her remarks to the Washington Post, Kang also differed with the U.S. view on the denuclearization process. 10/11/2018 Polio-Like Condition in Kids on Rise Again in US This does not include all of the 14 cases announced by Colorado, as some of those cases were confirmed after September 30. Since August 2014, when the CDC began tracking the illness more closely, the agency has reported 362 cases . 10/11/2018
{ "pile_set_name": "Pile-CC" }
Q: wicket authentication / login I am following this tutorial http://wicket.wordpress.com/2010/01/08/template-for-building-authenticated-webapplication/ in order to learn how to make login and authentication using wicket. My question/problem is that my login area is on the header and therefor one can login on every page. If my application class should inherit AuthenticatedWebApplication, then I must override getSignInPageClass method. What page class should I provide? Is there any other best tutorial to add authentication using wicket? A: The sign in page is displayed when the user attempts to access a Page or other component which requires authorization to create. If your application allows login on every page, then none of your pages require authorization, and the sign in page will never be displayed. I suggest you set it to the home page. As all your pages are visible, you can't use the @AuthorizeInstantiation annotation on your page classes. Instead, you must control visibility of components within the page using the RENDER action instead. For example, MetaDataRoleAuthorizationStrategy.authorize(mycomponent, RENDER, "SYSADMIN"); The only example I can find is at wicketstuff.org.
{ "pile_set_name": "StackExchange" }
Using algorithms and computerized decision support systems to treat major depression. The American Psychiatric Association practice guidelines for treating major depressive disorder advocate using measurement-based care and treatment algorithms, which have been shown to be effective strategies in improving patient outcomes. However, in practice, clinicians may avoid using algorithms and guidelines due to barriers such as lack of time, lack of staff support, and the perceived inflexibility of algorithms. Computerized decision support systems (CDSS) are one approach to increasing guideline adherence. A CDSS can make measurement-based care strategies accessible and user-friendly for physicians and staff, individualize treatment options according to each patient's circumstances, and provide guideline information at the point of care. In addition, a CDSS can be merged with electronic health record systems, which should simplify implementation and increase guideline adherence.
{ "pile_set_name": "PubMed Abstracts" }
Amandita FY, Rembold K, Vornam B, et al. DNA barcoding of flowering plants in Sumatra, Indonesia. Ecol Evol. 2019;9:1858--1868. 10.1002/ece3.4875 1. INTRODUCTION {#ece34875-sec-0001} =============== DNA barcoding is a species identification method, using a short, standardized DNA region, so‐called DNA barcode (Hebert, Cywinska, Ball, & de Waard, [2003a](#ece34875-bib-0040){ref-type="ref"}). In principle, DNA barcodes contain variation that can be posed as a character to differentiate species. Although the utility of DNA barcoding for species identification has raised debates over its feasibility (Collins & Cruickshank, [2013](#ece34875-bib-0016){ref-type="ref"}; Krisnamurthy & Francis, [2012](#ece34875-bib-0056){ref-type="ref"}), the method has been increasingly applied during the last decade, especially to facilitate biodiversity studies of very diverse but taxonomically poorly known regions (Blaxter, [2004](#ece34875-bib-0007){ref-type="ref"}; Hajibabaei et al., [2005](#ece34875-bib-0038){ref-type="ref"}), such as Sumatran tropical rainforests. Sumatran tropical rainforests are very rich in flora and fauna (Davis, Heywood, & Hamilton, [1995](#ece34875-bib-0021){ref-type="ref"}; Laumonier, [1997](#ece34875-bib-0059){ref-type="ref"}; Whitten, Damanik, Anwar, & Hisyam, [2000](#ece34875-bib-0089){ref-type="ref"}); nonetheless, they are only sparsely studied compared to other islands in the Malayan Archipelago (Laumonier, [1997](#ece34875-bib-0059){ref-type="ref"}). In terms of plant diversity, the Sumatran forests are comparable to the forests of Borneo and are richer than those found in Java and Sulawesi (Meijer, [1981](#ece34875-bib-0064){ref-type="ref"}). Sumatra is reported as one of the global centers of vascular plant diversity with a species density of 3,000 to 5,000 species per 10,000 km^2^ (Barthlott, Mutke, Rafiqpoor, Kier, & Kreft, [2005](#ece34875-bib-0006){ref-type="ref"}). Roos, Keßler, Gradstein, and Baas ([2004](#ece34875-bib-0074){ref-type="ref"}) estimated a total number of 10,600 plant species in Sumatra with more than 300 endemic species. Laumonier ([1997](#ece34875-bib-0059){ref-type="ref"}) argued that many scientists mistakenly consider that the flora of Sumatra is sufficiently well known since it is similar to that of the Malaysian peninsula, but many parts, especially the center of the island, are floristically unexplored territories. Despite the importance of conserving the ecosystem, the total forest area in Sumatra has decreased from over 23 million hectares to probably less than 16 million hectares between 1985 and 1997 (World Bank, [2001](#ece34875-bib-0090){ref-type="ref"}). The southern provinces of Sumatra have lost most of their lowland forests, including those in protected areas (Lambert & Collar, [2002](#ece34875-bib-0058){ref-type="ref"}). Approximately 7.5 million hectares of primary forest loss were recorded in Sumatra during 1990--2010 and an additional 2.3 million hectares of primary forest were degraded (Margono et al., [2012](#ece34875-bib-0062){ref-type="ref"}). Between 2000 and 2010, the deforestation rate was estimated to be above 5% per year in the eastern lowlands of Sumatra (Miettinen, Shi, & Liew, [2011](#ece34875-bib-0066){ref-type="ref"}). The total deforested areas in Sumatra within 2011 alone were recorded to be approximately 2,200 hectares or as much as 3,520 soccer fields (BP‐REDD+, [2015](#ece34875-bib-0067){ref-type="ref"}). The causes of these massive deforestation and forest degradation are a large‐scale conversion into timber or estate crop plantations, illegal logging, and forest fires. By 2010, 3.9 million hectares of Sumatran lowland forests had been converted into oil palm (*Elaeis guineensis*) plantations (Koh, Miettinen, Liew, & Ghazoula, [2011](#ece34875-bib-0050){ref-type="ref"}). The extensive loss of natural habitat puts a great number of species at risk and may lead to the loss of tropical fauna including forest‐dwelling birds (Koh et al., [2011](#ece34875-bib-0050){ref-type="ref"}), mammals (Maddox, Priatna, Gemita, & Salampessy, [2007](#ece34875-bib-0061){ref-type="ref"}), and orangutan (Gaveau et al., [2009](#ece34875-bib-0032){ref-type="ref"}). Undoubtedly, the destruction also affects the plant diversity (Brook, Sodhi, & Ng, [2003](#ece34875-bib-0008){ref-type="ref"}; Corlett, [1992](#ece34875-bib-0017){ref-type="ref"}; Rembold, Mangopo, Tjitrosoedirdjo, & Kreft, [2017](#ece34875-bib-0073){ref-type="ref"}; Turner et al., [1994](#ece34875-bib-0084){ref-type="ref"}). The rate of species loss in tropical forests seems to be higher than the species exploration due to lack of resources and sound species conservation management such as limited number of taxonomists working in this region, inadequate herbarium collections, and inaccessible taxonomic literature (Kiew, [2002](#ece34875-bib-0047){ref-type="ref"}; Meyer & Paulay, [2005](#ece34875-bib-0065){ref-type="ref"}; Tautz, Arctander, Minelli, Thomas, & Vogler, [2003](#ece34875-bib-0082){ref-type="ref"}). Species explorations become more challenging when the species cannot be identified morphologically. Identification keys based upon morphological characteristics can be difficult to use if features are not present (e.g., in sterile or juvenile specimens) or not well developed. The use of DNA barcoding might help to overcome the limitations of morphological characters and might help to speed up species identification. This has been made possible because DNA barcoding can identify organisms at any stage of development (e.g., Barber & Boyce, [2006](#ece34875-bib-0005){ref-type="ref"}; Hausmann et al., [2011](#ece34875-bib-0039){ref-type="ref"}; Heimeier, Lavery, & Sewell, [2010](#ece34875-bib-0043){ref-type="ref"}; Ko et al., [2013](#ece34875-bib-0049){ref-type="ref"}), or at particular gender (e.g., Elsasser, Floyd, Herbert, & Schulte‐Hostedde, [2009](#ece34875-bib-0027){ref-type="ref"}), or specimens isolated from small and incomplete tissue, whether it is fresh, broken, or old (e.g., Hajibabaei et al., [2006](#ece34875-bib-0037){ref-type="ref"}; Valentini, Pompanon, & Taberlet, [2008](#ece34875-bib-0086){ref-type="ref"}). DNA barcoding may also help to discover new species and to identify cryptic species (e.g., Hebert, Penton, Burns, Janzen, & Hallwachs, [2004](#ece34875-bib-0041){ref-type="ref"}; Pauls, Blahnik, Zhou, Wardwell, & Holzenthal, [2010](#ece34875-bib-0072){ref-type="ref"}; Ward, Costa, Holmes, & Steinke, [2008](#ece34875-bib-0087){ref-type="ref"}). DNA barcoding is now well established for animals (Crawford et al., [2013](#ece34875-bib-0019){ref-type="ref"}; Hebert, Cywinska, Ball, & deWaard, [2003a](#ece34875-bib-0040){ref-type="ref"}; Hebert, Ratnasingham, & de Waard, [2003b](#ece34875-bib-0042){ref-type="ref"}; Hebert et al., [2004](#ece34875-bib-0041){ref-type="ref"}; Lim, [2012](#ece34875-bib-0060){ref-type="ref"}; Nagy, Sonet, Glaw, & Vences, [2012](#ece34875-bib-0068){ref-type="ref"}; Ward, Zemlak, Innes, Lasr, & Hebert, [2005](#ece34875-bib-0088){ref-type="ref"}) by using the mitochondrial DNA *CO1* (cytochrome c oxidase subunit 1) as a standard region. However, this region is ineffective for plant identification due to generally low nucleotide substitution rates in plant mitochondria (Chase et al., [2005](#ece34875-bib-0013){ref-type="ref"}; Fazekas, Kesanakurti, & Burgess, [2009](#ece34875-bib-0029){ref-type="ref"}). A number of candidate gene regions were suggested as potential barcodes for plants including coding genes and noncoding genes in the nuclear and plastid genomes (e.g., Chase, Cowan, & Hollingsworth, [2007](#ece34875-bib-0014){ref-type="ref"}; Kress & Erickson, [2007](#ece34875-bib-0051){ref-type="ref"}; Kress, Wurdack, Zimmer, Weigt, & Janzen, [2005](#ece34875-bib-0055){ref-type="ref"}; Taberlet et al., [2007](#ece34875-bib-0079){ref-type="ref"}). Some studies suggested DNA barcoding based on a single chloroplast region (e.g., Lahaye et al., [2008](#ece34875-bib-0057){ref-type="ref"}) or a combination of different regions (e.g., Chase et al., [2007](#ece34875-bib-0014){ref-type="ref"}; Hollingsworth et al., [2009a](#ece34875-bib-0044){ref-type="ref"}; Kress & Erickson, [2007](#ece34875-bib-0051){ref-type="ref"}). A study by Kress and Erickson ([2007](#ece34875-bib-0051){ref-type="ref"}) showed that the various combinations of two loci were all more powerful at differentiating between species than either locus individually. In 2009, the Plant Working Group under The Consortium for Barcode of Life ([CBOL](#ece34875-bib-0012){ref-type="ref"}) suggested that there were no other two‐loci or multi‐loci barcode provided appreciably greater species resolution than the *matK+rbcL* combination. However, in some complex groups, such as in the genus *Berberis* (Roy et al., [2010](#ece34875-bib-0075){ref-type="ref"}), the combination of *matK* with *rbcL* is not sufficient to distinguish all species. The investigation of these markers will contribute to the development of useful barcode information for plant identification and to document plant species globally. This study aims to generate DNA barcodes of flowering plant species in four land‐use systems in Jambi Province (Sumatra) using two DNA chloroplast markers (*matK* and *rbcL*) and to evaluate the effectiveness of these two markers as DNA barcodes for flowering plants. Crucial characteristics for evaluating the performance of DNA barcodes include universal applicability, ease of data retrieval, and sufficient variability of the used marker (Fazekas et al., [2008](#ece34875-bib-0028){ref-type="ref"}; Kress & Erickson, [2007](#ece34875-bib-0051){ref-type="ref"}). 2. METHODS {#ece34875-sec-0002} ========== 2.1. Study sites {#ece34875-sec-0003} ---------------- This study was carried out in the EFForTS project sites (<https://www.uni-goettingen.de/efforts>) in Jambi Province (Sumatra, Indonesia) comprises of 32 core plots sized 50 m × 50 m. Details about the EFForTS project sites and plot design are described in Drescher et al. ([2016](#ece34875-bib-0026){ref-type="ref"}). 2.2. Specimen collection and identification {#ece34875-sec-0004} ------------------------------------------- Herbarium specimens were collected from three individuals of as many as possible vascular plant species within the 32 core plots. The plant survey included all trees with a diameter at breast height (DBH) ≥10 cm within the entire plot and all vascular plants within five 5 m × 5 m subplots nested within each core plot. Leaf tissue (approximately 2 cm^2^) was collected from each fresh herbarium specimen and dried in silica gel for DNA barcoding analysis. Herbarium vouchers were prepared, morphologically identified, and deposited at the herbarium of the Southeast Asian Regional Centre for Tropical Biology (SEAMEO‐BIOTROP), the Herbarium Bogoriense---Research Center for Biology, LIPI, and herbarium of the University of Jambi. The results of the morphological identification were then compared to the molecular identification results. Molecular identification was conducted for all samples that were successfully barcoded, but only samples that have been morphologically identified were included in the further analysis. 2.3. DNA analysis {#ece34875-sec-0005} ----------------- Based on the result of morphological species identification, two specimens per species were selected for genetic analysis. DNA extractions were performed on healthy dried leaf tissues from all selected samples using the DNeasy 96 Plant Kit (Qiagen, Hilden, Germany) following the manufacturer\'s protocols. The concentration and quality of the extracted DNA were checked by 0.8%--1% agarose gel electrophoresis with Lambda DNA as standard (Roche), visualized by UV illumination and saved using a polaroid camera. Each extracted DNA was amplified by performing polymerase chain reaction (PCR) using universal primers listed in Table [1](#ece34875-tbl-0001){ref-type="table"}. For rbcL, the amplification was straightforward, while for matK, two different amplification reactions were performed. First, the DNA of all investigated samples were amplified using the universal primer pair 1RKIM_f and 3FKIM_r (Table [1](#ece34875-tbl-0001){ref-type="table"}). The second amplification reaction, using the primer pair 390f and 990r (Table [1](#ece34875-tbl-0001){ref-type="table"}), included only those samples which showed no amplification product or produced multiple PCR products in the first amplification reaction. ###### Universal primers of *matK* and *rbcL* used in DNA amplification and sequencing No. Region Name of primer Primer sequence (5′ → 3′) References ------------ ----------------------------- ------------------------------------------------------------------------------------- ---------------------------- ----------------------------------------------------------------- 1 *matK* *3F_KIM_f* CGTACAGTACTTTTGTGTTTACGAG Ki‐Joong Kim (unpublished) *1R_KIM_r* ACCCAGTCCATCTGGAAATCTTGGTTC Ki‐Joong Kim (unpublished) *390f* CGATCTATTCATTCAATATTTC Cuenoud et al. ([2002](#ece34875-bib-0020){ref-type="ref"}) *990r* GGACAATGATCCAATCAAGGC Dayananda, Ashton, Williams, & Primack ([1999](#ece34875-bib-0022){ref-type="ref"}) 2 *rbcL* *rbcLa_f* ATGTCACCACAAACAGAGACTAAAGC Krees and Erickson ([2007](#ece34875-bib-0051){ref-type="ref"}) *rbcLa_r* GAAACGGTCTCTCCAACGCAT Fazekas et al. ([2008](#ece34875-bib-0028){ref-type="ref"}) John Wiley & Sons, Ltd The sequencing reactions were performed using the ABI PrismTM Big DyeTM Terminator Cycle Sequencing Ready Reaction Kit v1.1 (Applied Biosystems), based on the principles described by Sanger, Nicklen, and Coulson ([1977](#ece34875-bib-0076){ref-type="ref"}). Data were collected from capillary electrophoresis on an ABI Prism 3100® Genetic Analyzer with the Sequence Analysis Software v3.1 (Applied Biosystems). The sequencing was performed with the same primers used for amplification in both directions. The amplification and sequencing reaction mixtures are shown in Supporting Information Appendix 1, while the temperature profiles of the PCR for amplification and sequencing are shown in Supporting Information Appendix 2. 2.4. Sequence analysis {#ece34875-sec-0006} ---------------------- To ensure the generated DNA barcodes were as accurate as possible, sequence editing was performed using CodonCode Aligner software (CodonCode Corporation, Dedham, USA). Furthermore, each of these edited barcodes was assigned to a particular taxon by comparing it with the nucleotide sequences in GenBank database and Barcode of Life Database (BOLD). Moreover, the results of sequence identification were cross‐checked with the morphological identification results. The match between morphological and molecular identification results was counted into three levels: species, genus, and family. The following decisions were made for correct identification assignments, namely: (a) when the species name from the molecular identification matched the species name from the morphological identification, then it was counted as a correct species identification, (b) when the identification result only matched the genus or family, then it was counted as correct genus or family identification, and (c) when the result between morphological and molecular identification did not match, it was counted as incorrect identification if *matK* and *rbcL* both showed similar results at least at family level, or it was counted as mislabeling/contamination if the results of *matK* and *rbcL* were different. Herbarium specimens were double‐checked in cases of incorrect identification. Sequence alignment was carried out independently for each marker in two stages. First, multiple sequences were aligned according to their families using the ClustalW program (Thompson, Higgins, & Gibson, [1994](#ece34875-bib-0083){ref-type="ref"}) embedded in MEGA6 (Tamura, Stecher, Peterson, Filipski, & Kumar, [2013](#ece34875-bib-0081){ref-type="ref"}). Reference sequences were downloaded from GenBank/BOLD and included in the alignment for those species represented with only one sample. The alignment results were subsequently checked for the occurrence of ambiguities caused by the presence of indels and/or substitutions and edited if necessary. In the second stage, all aligned sequences from each family were manually aligned with sequences from other families. Gaps were added if necessary, and the final alignment was trimmed at both ends. The aligned sequences of *rbcL* and *matK*were combined to obtain two‐loci DNA barcodes using SequenceMatrix software (Vaidya, Lohman, & Meier, [2011](#ece34875-bib-0085){ref-type="ref"}). Identification success was also calculated with best‐close match analysis as implemented in TaxonDNA (Meier, Kwong, Vaidya, & Ng, [2006](#ece34875-bib-0063){ref-type="ref"}). This analysis only included the species with at least two representatives. A threshold value T was determined for each dataset as a divergence percentage in which 95% of all intraspecific distances were found. In this method, all recovered barcodes were formatted as both database and query. A query can only be identified if the corresponding sequence has a match in the dataset that falls into the 0% to T% interval. If the species name was identical, the query was considered to be successfully identified. A query was considered ambiguously identified when it matched more than one sequence of different species besides the correct species. On the other hand, a query was considered incorrectly identified when it matched to sequences belonging to other species. All queries without such a match would remain unidentified. Pairwise distance matrices were created to calculate the genetic distance using MEGA6 (Tamura et al., [2013](#ece34875-bib-0081){ref-type="ref"}) based on the Tamura‐Nei model ([1993](#ece34875-bib-0080){ref-type="ref"}) assuming the differences in substitution rate between nucleotides and the inequality of nucleotide frequencies with gamma‐distributed rates between sites and the pattern between lineages were assumed to be heterogeneous. The calculation results of intra‐ and interspecific divergences in these matrices were separated using ExcaliBAR (Aliabadian et al., [2014](#ece34875-bib-0001){ref-type="ref"}) to facilitate the measures of distance range and distance mean of each type of divergence. Frequency (%) distribution of intra‐ and interspecific divergences of each marker was calculated and depicted in graphics using Excel to find possible "gap" between these two divergences. This so‐called barcoding gap illustrates the effectiveness of DNA barcodes in discriminating query species from one to another. An ideal barcode can be determined by the presence of a barcoding gap, which occurs when the minimum value of the interspecific divergence is higher than the maximum level of intraspecific divergence (Meyer & Paulay, [2005](#ece34875-bib-0065){ref-type="ref"}). Based on the aligned sequences, phylogenetic trees were reconstructed using MEGA6 (Tamura et al., [2013](#ece34875-bib-0081){ref-type="ref"}) with three different algorithms: maximum parsimony (MP), maximum likelihood (ML), and neighbor joining (NJ). Percentages of species, genus, and family monophyletic clades were calculated from each reconstructed tree. Furthermore, ordinal‐level phylogenies were reconstructed based on maximum likelihood trees of each used marker and were compared to APG III (APG III [2009](#ece34875-bib-0002){ref-type="ref"}) phylogenies to see if there were inconsistencies between these two topologies. 3. RESULTS {#ece34875-sec-0007} ========== From all 5,328 samples collected from the field, only 2,590 samples were included in the study due to time restriction. The selection of studied samples was based on the consideration to involve as much species as possible, and each of these species should be represented at least by two samples. Species with only one sample were still included, but the barcodes generated from single‐sampled species were excluded from the pairwise analysis. We extracted DNA from dried leaf specimens without noticeable difficulties. The amplification and sequencing, however, turned out to be more problematic especially when using *matK*primers. Recoverability of DNA sequences for *rbcL* was overall high (amplification and sequencing success were 96.9% and 94.7%, respectively). The amplification and sequencing results using the primer of *matK* were only moderately successful (79.1% and 65.8%, respectively). A total of 1,207 *matK* barcodes representing 441 species of 97 families of 40 orders, and 2,376 *rbcL* barcodes representing 750 species of 126 families of 44 orders, were generated in this study. For both markers, the highest match between morphological and molecular identification was at genus level (46.6% with *matK* and 51.3% with *rbcL*). The matched identification at species level was higher with *matK* than with *rbcL* (30.2% and 22.4%, respectively). Meanwhile, incorrect identification was relatively low for both regions (3.5%). To maintain the accuracy of the analysis, we excluded all misidentified or presumably mislabeled barcodes from the dataset. Since the study aims at comparing the performance of *matK* and *rbcL* and to generate two‐loci barcodes, only samples from which both *matK* and *rbcL* barcodes were successfully recovered were included in the further analysis. Consequently, only 322 samples from 161 species (two samples per species) were included in best‐close match and barcode‐gap analysis and 334 samples from 334 species (one sample per species) were included in phylogenetic analysis. According to the best‐close match analysis, *matK* has higher overall species identification success compared to *rbcL* (78.3% and 71.4%, respectively), and the highest correct species identification was obtained by the combination of both markers (81.1%). There were 22 species which remained unidentified by each marker and the two‐loci marker. Furthermore, this study showed that the mean value of intraspecific divergences (0.0008--0.0014) was very low and the mean value of the interspecific divergences (0.1--0.3) was significantly higher (unpaired *t*‐test, *p* \< 0.01). The frequency (%) distribution of intraspecific and interspecific divergence using three markers (Figure [1](#ece34875-fig-0001){ref-type="fig"}) showed that no barcode gaps existed as the intraspecific divergences overlapped with interspecific divergences. ![Frequency (%) distribution of intraspecific and interspecific divergences of pairwise sequences of matK (a), rbcL (b), and matK+rbcL(c)](ECE3-9-1858-g001){#ece34875-fig-0001} As expected, *matK* had a higher discrimination level than *rbcL* (80% and 73%, respectively) but the difference was not significant (one‐way ANOVA, *p* \> 0.05). The combination of *matK* and *rbcL* improved the discrimination up to 89%. Forty‐four out of 161 species could not be discriminated by *rbcL* and eleven of them were not discriminated by any of the markers including the two‐loci barcode. These species were mostly from species‐rich genera, such as *Ficus*(Moraceae), *Santiria*(Burseraceae), and *Litsea*(Lauraceae). Nine phylogenetic trees (Supporting information Appendix 3--11) were constructed based on multiple sequence alignments of *matK*, *rbcL*, and *matK+rbcL* using three different methods: maximum parsimony (MP), neighbor joining (NJ), and maximum likelihood (MP). Each tree was observed and similar topologies were found amongst these trees (Table [2](#ece34875-tbl-0002){ref-type="table"}). ###### Percentage of monophyletic clades recovered in nine reconstructed phylogenetic trees Barcode Monophyletic with support value \>70% ----------------- --------------------------------------- ------ ------ ------- ------ ------ ------- ------ ------ ***matK*** 95.9 68.4 73.9 93.9 66.7 69.6 98.0 64.9 68.9 ***rbcL*** 95.9 63.2 60.3 93.9 63.2 64.0 89.9 63.2 55.9 ***matK+rbcL*** 100.0 71.9 73.3 100.0 64.9 73.9 100.0 70.2 75.2 John Wiley & Sons, Ltd Seventeen families were not included in the calculation of family‐level monophyletic percentage as these families were presented with only one taxon. The two‐loci marker provided 100% taxonomic resolution at family level with all three different methods. Twenty‐two species were nonmonophyletic in all phylogenetic trees (Supporting information Appendix 12). The nonmonophyletic species mostly originated from species‐rich families, such as Burseraceae, Myristicaceae, Moraceae, Phyllanthaceae, Lauraceae, Sapindaceae, and Annonaceae. The ordinal‐level phylogeny of flowering plants shows the relationship between orders of flowering plants and the grouping of these orders (Figure [2](#ece34875-fig-0002){ref-type="fig"}). The matK marker misplaced Myrtales and failed to separate Laurales from Magnoliales. Meanwhile, the rbcL marker misplaced Aquifoliales and grouped Malpighiales and Brassicales into one monophyletic clade. This marker also failed to make Santalales a monophyletic clade. However, this marker successfully separated Laurales from Magnoliales. Finally, the combination of matK and rbcL improved the topologies of the tree and put nearly all orders into the right position compared to APG III phylogeny. ![Comparison between ordinal‐level phylogeny of flowering plants based on DNA barcodes and APG III ([2009](#ece34875-bib-0002){ref-type="ref"}). The dash lines indicate that the two orders are not clearly separated. ^\*^Santalales in rbcL phylogeny tree is a nonmonophyletic clade](ECE3-9-1858-g002){#ece34875-fig-0002} 4. DISCUSSION {#ece34875-sec-0008} ============= 4.1. Recoverability and quality of *matK* and *rbcL* barcodes {#ece34875-sec-0009} ------------------------------------------------------------- The *rbcL* universality as DNA barcode observed in this study confirms that DNA sequences could be easily obtained with *rbcL* primers from a wide range of tropical plant species (e.g., Gonzales et al., [2009](#ece34875-bib-0035){ref-type="ref"}; Lahaye et al., [2008](#ece34875-bib-0057){ref-type="ref"}; Parmentier et al., [2013](#ece34875-bib-0071){ref-type="ref"}). In contrast to *rbcL*, *matK* seems to be less suitable for tropical floras compared to temperate one (e.g., Bruni et al., [2012](#ece34875-bib-0010){ref-type="ref"}; de Vere et al., [2012](#ece34875-bib-0024){ref-type="ref"}; Gonzales et al., [2009](#ece34875-bib-0035){ref-type="ref"}). This might be due to higher evolutionary rates in tropical compared to temperate plants (Gillman, Keeling, Gardner, & Wright, [2010](#ece34875-bib-0034){ref-type="ref"}). The PCR of *matK* performed in this study was using two pairs of primers which were found to be effective to generate DNA barcodes from specific taxa, such as *Tetrastigma* (Fu, Jiang, & Fu, [2011](#ece34875-bib-0030){ref-type="ref"}), *Hedyotis*(Guo, Simmons, But, Shaw, & Wang, [2011](#ece34875-bib-0036){ref-type="ref"}), or Asteraceae (Gao et al., [2010](#ece34875-bib-0031){ref-type="ref"}). These primers, however, became less effective when they were used for a wide range of species (Gonzales et al., [2009](#ece34875-bib-0035){ref-type="ref"}; Kress et al., [2010](#ece34875-bib-0053){ref-type="ref"}). A certain primer pair did not always yield a PCR product in all members of a group of seemingly closely related taxa, indicating that the primers themselves are not conserved. The use of *matK* as a barcode has been criticized mainly because universal primers are not available (e.g., Bafeel et al., [2011](#ece34875-bib-0004){ref-type="ref"}; Dong et al., [2015](#ece34875-bib-0025){ref-type="ref"}). A study by Fazekas et al. ([2008](#ece34875-bib-0028){ref-type="ref"}) showed a relatively high rate of sequencing success for this marker after using up to 10 primer pairs. The usefulness of *matK* primers is proven when they are used in specific species or taxa, such as *Camellia sinensis* (Stoeckle et al., [2011](#ece34875-bib-0078){ref-type="ref"}), Lamiaceae (De Mattia et al., [2011](#ece34875-bib-0023){ref-type="ref"}), or palms (Jeanson, Labat, & Little, [2011](#ece34875-bib-0046){ref-type="ref"}). In a review of the best barcode for plants, Hollingsworth, Graham, and Little ([2011](#ece34875-bib-0045){ref-type="ref"}) indicated that *matK* still needs optimization in regard to primer combinations and needs to be adapted to specific taxonomic groups. 4.2. Plant species identification success using *matK* and *rbcL* {#ece34875-sec-0010} ----------------------------------------------------------------- As one way to evaluate the success rate of species identification, we compared the results from morphological identification with the results from molecular identification. Some authors suggested a superiority of molecular identification in comparison with morphological identification (Newmaster, Ragupathy, & Janovec, [2009](#ece34875-bib-0069){ref-type="ref"}; Stace, [2005](#ece34875-bib-0077){ref-type="ref"}). However, this study showed that DNA barcoding alone is not sufficient to assign all DNA sequences to a correct species name. Only 22%--30% of the samples were correctly assigned to the correct species, while the majority of correct identifications was limited to genus level (46%--51%). Approximately three percent of mismatch between morphological identification results and DNA identification results were found in this study that could be due to several reasons. A specimen could be misidentified when it was found to have the highest similarity to a reference sequence that was falsely identified. The mismatch between morphological and molecular identification could also happen when the taxonomist misidentified the voucher. Morphological identification is difficult in the absence of certain features, such as flowers or fruits, especially when dealing with species‐rich groups. A high percentage of nonfertile material is particularly common in ecological projects such as ours. In the case of incorrect morphological identification, the herbarium vouchers of corresponding samples should be verified morphologically once again. The success of species identification using DNA barcoding depends very much on the taxa in question, as much as the utilized marker. For example, in this study, the family Piperaceae resulted in high species‐matched identification when using *matK* (60%) but no success at all when using *rbcL*. Meanwhile, for the family Asteraceae, the species‐matched identification was higher with *rbcL* (50%) than with *matK* (30%). Another factor affecting the success of species identification using DNA barcoding is the availability of nucleotide data of the corresponding taxa in the DNA sequences database such as GenBank and BOLD. Through this study, 303 newly barcoded tropical plant species have been uploaded to BOLD. Forty‐one percent of the 772 species investigated in this study still had no nucleotide data in BOLD and Genbank. Thus, a significant proportion of samples belonging to species which were not yet recorded in the reference databases lead to increased rates of unassigned samples. Incorrect specimen assignment is more often due to the incompleteness of molecular datasets rather than the data analysis (Bruni et al., [2010](#ece34875-bib-0009){ref-type="ref"}; Burgess et al., [2011](#ece34875-bib-0011){ref-type="ref"}; Cowan & Fay, [2012](#ece34875-bib-0018){ref-type="ref"}). An accurate and complete molecular database, especially for plant species, is still far from being achieved in the present state. Such a database will hopefully be developed in the future as many studies and projects of plant DNA barcoding are going on (e.g., <http://botany.si.edu/projects/DNAbarcode/intro.htm>; <http://xmalesia.info/index.html>). 4.3. Discriminatory power of *matK* and *rbcL* {#ece34875-sec-0011} ---------------------------------------------- None of the markers used in this study successfully obtained a DNA barcoding gap. All of the minimum values of interspecific divergence obtained from three different markers were lower than the maximum values of intraspecific divergence. In studies of DNA barcoding of specific plant taxa, for example, *Ludwigia*(Ghahramanzadeh et al., [2013](#ece34875-bib-0033){ref-type="ref"}), *Abies,* *Cupressus* (Armenise, Simeone, Piredda, & Schirone, [2012](#ece34875-bib-0003){ref-type="ref"}), and *Tetrastigma* (Fu, Jiang, & Fu, [2011](#ece34875-bib-0030){ref-type="ref"}), the distribution of intra‐ versus interspecific distances was relatively well separated. Meanwhile, large‐scale plant diversity inventories (Lahaye et al., [2008](#ece34875-bib-0057){ref-type="ref"}; Parmentier et al., [2013](#ece34875-bib-0071){ref-type="ref"}) reported the absence of barcoding gaps by using a combination of potential markers. The richness of the dataset might have contributed to the wider distribution of the intra‐ and interspecific divergences which then increase the possibility of them to overlap. This implies that the sampling intensity and variety would influence the distribution of the intra‐ and interspecific variation within the dataset. Despite the absence of barcoding gaps, the barcodes generated in this study have relatively high discriminatory power. According to Hollingsworth et al. ([2011](#ece34875-bib-0045){ref-type="ref"}), most of the plant barcodes would have discriminatory power of more than 70%. Studies by Kress et al. ([2009](#ece34875-bib-0052){ref-type="ref"}) and Burgess et al. ([2011](#ece34875-bib-0011){ref-type="ref"}) showed that barcoding of distantly related taxa typically results in high levels of discriminatory power. The *matK*+rbcL marker has the highest number of discriminated species compared to *matK* or *rbcL* alone. This is because the use of two‐loci barcodes maximized the genetic variation, thus minimizing the number of identical barcodes between different species. All species that could not be discriminated have barcodes identical to other species from the same family. Identical barcodes across different genera of the same family were uncommon with *matK* but more common with *rbcL*. However, *matK* and *rbcL* mostly failed to discriminate different species from the same genus. These two plastid markers are therefore not variable enough to be effective barcodes for closely related species in certain taxa. To improve the analysis of closely related taxa, noncoding plastid genes, such as *trnH‐psbA*, could be used as an additional marker (Hollingsworth et al., [2011](#ece34875-bib-0045){ref-type="ref"}). A study by Kress and Erickson ([2007](#ece34875-bib-0051){ref-type="ref"}) showed that *trnH‐psbA* has dramatically higher sequence variability than the coding genes because it has a higher number of single‐nucleotide polymorphisms (SNPs). Hence, *trnH‐psbA* can be a suitable marker to discriminate among closely related species. Moreover, nuclear genomic regions, such as the internal transcribed spacer (ITS) region, were suggested as potential DNA barcodes by Kress et al. ([2005](#ece34875-bib-0055){ref-type="ref"}). ITS sequences generally show high levels of interspecific sequence variability (Cowan & Fay, [2012](#ece34875-bib-0018){ref-type="ref"}) and has been used successfully to classify angiosperms (Li et al., [2011](#ece34875-bib-0015){ref-type="ref"}). 4.4. The phylogeny of flowering plants of Jambi based on *matK* and *rbcL* {#ece34875-sec-0012} -------------------------------------------------------------------------- Both *matK* and *rbcL* showed high family‐level resolution, and the combination of *matK* and *rbcL* succeeded to resolve all of the families into monophyletic clades with high bootstrap value. Furthermore, the taxonomic resolution at the genus level was much lower compared to the family level which was expected. Surprisingly, the genus‐level monophyletic percentages were found slightly lower compared to the species level in all trees, except for MP and ML trees using *rbcL*. A similar study by Gonzalez et al. ([2009](#ece34875-bib-0035){ref-type="ref"}) reported larger numbers of monophyletic genera compared to monophyletic species. This difference can be explained by the fact that the proportion of distantly related species included in the dataset in this study was higher than the proportion of closely related species. Thus, the probability of resolving monophyletic‐species clades was higher than to resolve the monophyletic‐genus clade. Finally, the species‐level resolution in this study is comparable to similar studies (Gonzalez et al., [2009](#ece34875-bib-0035){ref-type="ref"}; de Vere et al., [2012](#ece34875-bib-0024){ref-type="ref"}). However, the two‐loci barcode did not improve the species‐level resolution significantly. Combining these two chloroplast markers was not sufficient to provide 100% of species monophyly. Of 76 families included in the phylogenetic tree reconstruction, Burseraceae and Phyllanthaceae were the families with the highest number of unresolved genera. Most of the species in these genera were found to have identical sequences, so they could not be separated from each other. Identical sequences between species of different genera could be common if the marker was not variable enough, such as *matK* and *rbcL*. In this study, it was revealed that *matK* and *rbcL* were not sufficiently variable for species‐rich groups. The phylogenetic trees based on the *rbcL* marker resulted in larger numbers of unresolved species than *matK*. At least eighteen species were nonmonophyletic according to *rbcL* but monophyletic according to *matK*. The unresolved species found in this study could be explained by two reasons. First, these species might have identical genetic information with other species belonging to the same genera/family. Second, these species might have higher intraspecific than interspecific divergence; thus, they were grouped with the allospecies but not with the conspecies. A number of constraints are limiting DNA barcoding of plant species including slow evolution rates (Palmer et al., [2000](#ece34875-bib-0070){ref-type="ref"}) and high incidence of hybridization (Knobloch, [1972](#ece34875-bib-0048){ref-type="ref"}). The genetic variation caused by hybridization cannot be simply detected by plastid markers (Fazekas et al., [2008](#ece34875-bib-0028){ref-type="ref"}, [2009](#ece34875-bib-0029){ref-type="ref"}). Nevertheless, none of the plant DNA markers are perfect in every case (Hollingsworth et al., [2011](#ece34875-bib-0045){ref-type="ref"}). Indeed, one of the future challenges for plant DNA barcoding is to find the most suitable marker to tackle these problems. As the DNA sequencing technology and bioinformatic tools are progressively advancing, the development of new primers will be much easier and at the end will increase the success of DNA barcoding. The application of next‐generation sequencing (NGS) technology will enhance the capability of DNA barcoding as a powerful tool in the studies of ecology, evolution, and conservation biology (Kress, Garcia‐Robledo, Uriarte, & Erickson, [2014](#ece34875-bib-0054){ref-type="ref"}). 5. CONCLUSION {#ece34875-sec-0013} ============= We conclude that the two plastid markers *matK* and *rbcL* as plant barcodes work reasonably well in identifying flowering plant species in Sumatran lowland rainforest and surrounding agricultural systems, at least up to genus level. However, there are taxa that are difficult to be distinguished using *matK* and *rbcL*. These taxa mostly belong to species‐rich clades with low interspecific divergences. DNA barcoding of closely related species results in low success, especially when using coding plastid markers, such as *matK* and *rbcL*. The success of species identification strongly depends on the availability of an accurate and complete molecular database. Such database should include sufficient barcodes for each species distributed over its entire distribution range to cover the full range of its intraspecific variability. Thus, future studies ideally include all congeneric species from a geographic region and maximize the geographic diversity of samples for each species. Moreover, utilization of supplement markers, such as *psbA‐trnH* or ITS, is highly recommended in combination with *matK* and *rbcL*. All of DNA barcodes generated in this study, comprises more than 500 species of flowering plants, are uploaded to BOLD. This, coupled with the collection of herbarium vouchers, will improve the usability of DNA barcodes for plant identification. AUTHOR CONTRIBUTIONS {#ece34875-sec-0015} ==================== F.Y.A. performed specimen collection, laboratory work, sequence analyses and wrote the manuscript. K.R. performed specimen collection, morphology identification and provided critical review of the manuscript. B.V. supported part of the laboratory work and data analysis, and revised the manuscript. S.R. provided author citation for each botanical name of species barcoded in this study and revised the manuscript. I.Z.S. provided the sample collection permit and mutual transfer agreement (MTA) documents, and revised the manuscript. H.K. and R.F. supervised the research and revised the manuscript. Supporting information ====================== ######   ###### Click here for additional data file. We would like to thank the German Research Foundation (DFG) for funding this research as part of the EFForTS project in the framework of the Collaborative Research Centre 990 (<http://www.uni-goettingen.de/crc990>). Sincere thanks to Lembaga Ilmu Pengetahuan Indonesia (LIPI), and Ministry of Environment and Forestry of Republic of Indonesia (KLHK). Special thanks to Hardianto Mangopo, Fajar Adityarama, Melanie Schmitt and Alexandra Dolynska for the technical assistances, and to the staff of Harapan Rainforest (PT. Restorasi Ekosistem Indonesia) and Bukit Duabelas National Park. We would also like to thank the Ministry of Research, Technology and Higher Education (RISTEKDIKTI) for research permission in Indonesia. DATA ACCESSIBILITY {#ece34875-sec-0014} ================== All data for the project were managed in the BOLD database in a project called "DNA Barcoding of Vascular Plants in Jambi, Indonesia" (project code CRCZ). A list of all species barcoded in this study is available as Supporting Information (Table [S1](#ece34875-sup-0001){ref-type="supplementary-material"}).
{ "pile_set_name": "PubMed Central" }
class CreateSnapshotJob < ApplicationJob queue_as :default # @param date [Date] def perform(date = nil) date ||= Date.today - 1.day SnapshotService.new(date).create end end
{ "pile_set_name": "Github" }
Transport for London (TfL) has announced that the first section of the new signalling system on the London Underground has commenced operations. The Thales-delivered signalling system is currently operational between Hammersmith and Latimer Road. Overall, it will be rolled out across Circle, District, Hammersmith & City and Metropolitan lines. Deployment of the signalling system will enable TfL to increase the frequency of operations to accommodate passengers during peak hours. TfL director of major projects Stuart Harvey said: “The modernisation of these four lines will make a massive difference to hundreds of thousands of customers every day by making journeys quicker and more comfortable. “The modernisation of these four lines will make a massive difference to hundreds of thousands of customers every day.” “It will also make customer information more accurate and improve reliability in the long-term. The introduction of the first section of new signalling is a really exciting step for the Tube, and for everyone who uses these lines.” Train frequency in central London will increase from 28 to 32 per hour, effective from 2021. Overall project completion is expected in 2023. Thales Ground Transportation Systems vice-president Shaun Jones said: “The successful introduction of this section is a significant step on the journey to upgrade the signalling system of this highly complex railway. “This further demonstrates the capabilities of Thales technology, leading to a reliable railway that enables capacity improvements for people travelling throughout London.” The signalling upgrade works are part of a larger modernisation programme for the four Tube lines. The programme includes the introduction of S-stock Tube trains. In total, the four lines carry 1.3 million customers daily.
{ "pile_set_name": "OpenWebText2" }
Privacy Policy This privacy policy has been compiled to better serve those who are concerned with how their Personally Identifiable Information (PII) is being used online. PII, as used in privacy law and information security, is information that can be used on its own or with other information to identify, contact, or locate a single person, or to identify an individual in context. Please read our privacy policy carefully to get a clear understanding of how we collect, use, protect or otherwise handle your Personally Identifiable Information in accordance with our website. If you have any questions about this Privacy Policy, feel free to contact us. Data Controller. The controller of personal data is Wayne Whitty, who owns and operates LolSided.com. Wayne Whitty is based in the Republic of Ireland. If you wish to make a query about our personal data processing or if you wish to obtain information on the processing of your personal data, please use one of the contact options on our contact page. What personal information do we collect from the people that visit our app? We do not keep a long-term record of personally identifiable information. Our app is built in such a way that storing your Facebook information in a database would be completely unnecessary. If you have taken any of our quizzes in the past, then you can rest assured that we have not kept a database record of any of your personally identifiable information. The only reason we would ever keep a record of your personally identifiable information is if we believe that your account activity is abnormal or you are suspected of violating our Terms of Service. Third-party disclosure. We do NOT sell, trade, or otherwise transfer to outside parties your personally identifiable information. If you agree to provide us with access to your name, gender, etc, that information remains with LolSided.com and it is never transferred to a third-party. Temporary PII storage. Any personally identifiable information that is saved on our server is saved in a temporary session file that is automatically expired and removed within an hour of your session expiring. To manually expire your session, you can click on the "Log Out" button in the top right-hand corner of our app. If you forget to click on the "Log Out" button, your session data will be automatically expired and removed from our server after a short period of time. If we cache your profile picture for performance reasons, that profile picture is saved and named in such a way that it is not linked to the rest of your personal information. If we do cache your profile picture, it is for the sole intention of speeding up the time that it takes us to provide you with a quiz result. If you do not share any of our results, cached profile pictures are automatically removed from our server within an hour after they have first been cached. If you do share one of our results, your cached profile picture may be stored for roughly 45 days. This image is stored in such a way that it is not linked to your name or the rest of your personally identifiable information. In certain cases, LolSided.com may log Facebook IDs, IP addresses or names for the purpose of generating statistics and identifying user behavior. These log files are temporary and are automatically deleted by our servers after a couple of days. In the vast majority of cases, this data is automatically removed and compiled into non-identifying aggregate data every 60 seconds. How do we use your information? We use your information to provide you with personalized Facebook results. Example: By giving us access to your basic Facebook public profile information, you give us the ability to generate personalized quiz results that include your name, profile picture and gender-related pronouns. Facebook permissions. Our app abides by the Platform Policy for Facebook developers. Our app does not make any unnecessary requests for Facebook permissions. We only request data and permissions that our app requires to generate results. In most cases, we only ask for your basic profile information: This includes your Facebook profile ID, name, profile picture and gender. On quizzes that involve a member of your friend list, we will ask for the friend list permission. We do NOT ask for access to your interests, likes, timeline posts, photo albums or messages. For more information on what Facebook information we request, please see our article on Facebook Permissions. Do we use cookies? Yes. Cookies are small files that a site or its service provider transfers to your computer’s hard drive through your Web browser (if you allow) that enables the site’s or service provider’s systems to recognize your browser and capture and remember certain information. For instance, we use cookies to help us remember if you are logged into LolSided.com or not. They are also used to help us understand your preferences based on previous or current site activity, which enables us to provide you with improved services. We also use cookies to help us compile aggregate data about site traffic and site interaction so that we can offer better site experiences and tools in the future. We use cookies to: Check if you are logged into LolSided.com or not. Keep track of advertisements. Keep track of saved preferences. Keep track of what quiz you are taking. Distribute traffic amongst our load balancers / servers. Keep track of your "App-scoped" Facebook ID, which is unique to LolSided. Compile aggregate data about site traffic, Facebook shares and site interactions in order to offer better site experiences and tools in the future. We may also use trusted third-party services such as Google Analytics and Facebook Analytics that track this information on our behalf. You can choose to have your computer warn you each time a cookie is being sent, or you can choose to turn off all cookies. You can do this through your browser (like Chrome or Internet Explorer) settings. Each browser is a little different, so look at your browser’s Help menu to learn the correct way to modify your cookies. If users disable cookies in their browser: If you disable cookies off, some features will be disabled. It will turn off some of the features that make your site experience more efficient and some of our services will not function properly. Third-party links. Occasionally, at our discretion, we may include or offer third-party products or services on our website. These third-party sites have separate and independent privacy policies. We therefore have no responsibility or liability for the content and activities of these linked sites. Nonetheless, we seek to protect the integrity of our site and welcome any feedback about these sites. Google. Google’s advertising requirements can be summed up by Google’s Advertising Principles. They are put in place to provide a positive experience for users. Please see: AdWords policies We use Google AdSense Advertising on our website. Google, as a third-party vendor, uses cookies to serve ads on our site. Google’s use of the DART cookie enables it to serve ads to our users based on previous visits to our site and other sites on the Internet. Users may opt-out of the use of the DART cookie by visiting the Google Ad and Content Network privacy policy. We have implemented the following: Remarketing with Google AdSense Google Display Network Impression Reporting Demographics and Interests Reporting DoubleClick Platform Integration We along with third-party vendors, such as Google use first-party cookies (such as the Google Analytics cookies) and third-party cookies (such as the DoubleClick cookie) or other third-party identifiers together to compile data regarding user interactions with ad impressions and other ad service functions as they relate to our website. For more information, see Google's article on How Google uses data when you use our partners' sites or apps. Opting out. Users can set preferences for how Google advertises to you using the Google Ad Settings page. Alternatively, you can opt out by visiting the Network Advertising initiative opt out page or permanently using the Google Analytics Opt Out Browser add on. Transfer Of Data. Your information, including personal data, may be transferred to - and maintained on - computers located outside of your state, province, country or other governmental jurisdiction where the data protection laws may differ than those from your jurisdiction. Our servers are situated in the United States of America. If you are located outside of the United States and choose to provide information to us, please note that we transfer the data, including personal data, to the United States and process it there. Your consent to this Privacy Policy followed by your submission of such information represents your agreement to that transfer. LolSided will take all steps reasonably necessary to ensure that your data is treated securely and in accordance with this Privacy Policy and no transfer of your Personal Data will take place to an organization or a country unless there are adequate controls in place including the security of your data and other personal information. Legal Requirements. LolSided may disclose your personal data in the good faith belief that such action is necessary to: To comply with a legal obligation. To protect and defend the rights or property of LolSided.com. To prevent or investigate possible wrongdoing in connection with LolSided. To protect the personal safety of users of the service or the public. To protect against legal liability. COPPA (Children Online Privacy Protection Act). We do not specifically market to children under 13. How do we protect visitor information? We use secure server software (SSL) to encrypt information that is sent between your browser and our website. The security of your data is important to us, but remember that no method of transmission over the Internet, or method of electronic storage is 100&percnt; secure. While we strive to use commercially acceptable means to protect your Personal Data, we cannot guarantee its absolute security. Fair Information Practices. The Fair Information Practices Principles form the backbone of privacy law in the United States and the concepts they include have played a significant role in the development of data protection laws around the globe. Understanding the Fair Information Practice Principles and how they should be implemented is critical to comply with the various privacy laws that protect personal information. In order to be in line with Fair Information Practices we will take the following responsive action, should a data breach occur: We will publish a notice on our website and on our Facebook page within 2 business working days. We also agree to the Individual Redress Principle, which requires that individuals have a right to pursue legally enforceable rights against data collectors and processors who fail to adhere to the law. This principle requires not only that individuals have enforceable rights against data users, but also that individuals have recourse to courts or government agencies to investigate and/or prosecute non-compliance by data processors.
{ "pile_set_name": "Pile-CC" }
Library materials are intended for educational, historical, and research purposes. These materials may be protected under U.S. Copyright Law which governs the making of photocopies or reproductions of any kind of copyrighted material. Library staff is unaware of any copyrights held or pending on any material in the library’s collections; however, the responsibility for determining appropriate use of an item resides with the patron.
{ "pile_set_name": "Pile-CC" }
Carpet tile is a very versatile, easy-to-install floor covering. The pieces come in pre-cut squares, so there’s no need to bother with measuring a room for a piece of rolled carpet, trying to unroll the carpet, trying to install it while keeping it from rolling back up, measuring, cutting, fitting around doors…all the things that are involved with using broadloom carpet. Most carpet tile is literally “peel and stick.” There’s a little more involved than that, but it’s still very easy to handle the carpet pieces. Even those that require applying adhesive to the sub-flooring are still fairly easy to install. Carpet tile works well in children’s bedrooms, playrooms, family rooms and other areas of the house. You can choose from one color that matches an overall color scheme, or from several colors, which allow you to form patterns. As mentioned earlier, installing carpet tile is fairly easy. Here’s how to do it: 1. Assemble your tools. You’ll need the following: A tape measure and pencil Tools for removing baseboards and doors, as well as a small saw for “notching” doorframes A utility knife (“box cutter”), carpet trimmer tool or other cutting tool. A chalk line or some string. An adhesive spreader if your carpet doesn’t have “peel and stick” adhesive. 2. Remove baseboards and doors. This makes installation of carpet tile even easier. Then, make a “notch” in the door trim by sawing off a thin strip so that the carpet tile will fit snugly against the wall. Remove only enough wood to allow you to slip the edge of the carpet tile underneath. 3. Now, you’re ready to begin measuring the room. You may think you can just throw down carpet tile pieces indiscriminately, but the truth is you can’t. You have to do some measuring. It’s really simple, though. * You just find the center of the room by measuring each wall in the room, from corner to corner, for its length. Record that number, and divide it by two. * Then, find that number on the tape measure, and mark that spot on each wall. You want your mark to be very low on the wall as you’ll need to be able to get to it later in the measuring and laying process. 4. It’s time to determine where your first piece of carpet tile will go. * If your carpet squares box does not give the dimensions of each square, you’ll need to determine that. Use your tape measure to find the width of the square and divide that number by two. Make a pencil mark at that point at the top of the carpet square. * Now, take your piece of tile that you measured and place it on the wall. Line up your tile’s center mark with the wall’s center mark. Then, mark the wall at each of the tile’s corners. * Do this for all four walls in the room. Don’t forget to make your marks low on the wall. * After you’ve made all your marks, take a chalk line and snap it so that you have marks on the floor going from one wall to the other across the room and one wall to another down the length of the room. Or, take string and attach it to the marks on the walls. You want to have an “x” shape on the floor. The middle of the “x” is where you will lay your first carpet square. 5. You’re actually ready to lay your first square of carpet, but you’re not ready to install it permanently yet, so don’t put down any adhesive or remove any protective backing from “peel and stick” tile. Rather, take your first carpet square and position it so that the center of the square is on the center of your “x” mark. * If you are working with only one color, go ahead and lay the remaining pieces, again without removing any backing or using any adhesive, working from the center piece of carpet out to the walls. 6. If you’re going to have a pattern, now is the time to lay it out. Take the remaining carpet squares, again with no adhesive applied or with the protective backing still in place, and lay them out in your desired pattern. Work from the center piece out towards the walls. * It’s actually a good idea to lay a few pieces, then step back and look at your design to make sure it’s right. Because you haven’t permanently attached the squares yet, it’s easy to pick them up and rearrange them as needed. 7. After all pieces have been laid, but again before permanently installing them, use the utility knife or carpet trimmer to trim the carpet around your door “notches”, along walls where they do not fit exactly, and other places that require trimming. Be careful to cut only as much as is needed to make it fit. 8. Now, you’re finally ready to install the carpet tiles permanently. Either peel off the protective backing and press the tiles down firmly, or apply adhesive and let it dry according to the manufacturer’s directions. * If you are using adhesive, go ahead and apply enough for about three or four tiles. It can be drying as you lay other tiles. Just don’t do it too soon or it will dry before you’re ready to lay the other pieces. If you’re afraid this will happen, just apply adhesive and lay one piece at a time. Once you have finished permanently installing the carpet tiles, give the squares some time to “set up” before walking on them or putting furniture or other items on them. Also, take care when putting things in the room not to tear the carpet squares or catch them to where they come “unstuck.”
{ "pile_set_name": "Pile-CC" }
Elgi equipments to buy 100% stake in US-based Pattons Inc Patton Inc. is more than 60 years old and had achieved over $30 mn sales for the first time in 2007-08. (Reuters) SummaryPatton Inc. is more than 60 years old and had achieved over $30 mn sales for the first time in 2007-08. Air compressor manufacturer Elgi Equipments will buy 100 per cent stake in North Carolina-based Pattin's Inc for an undisclosed sum. "The Board of Directors of the company at its meeting held on November 28, 2012 has given approval for acquisition of 100 per cent share capital of Patton's Inc.," the company today said in a BSE filing. Headquartered in Charlotte, North Carolina, Pattons Inc. is engaged in the distribution and service of industrial and medical compressors with presence in South-Eastern part of the United States. Patton Inc. is more than 60 years old and had achieved over $30 million sales for the first time in 2007-08. But, the latest figures are not known. "The acquisition is being made through its newly incorporated subsidiary, Elgi Compressors USA Inc," Elgi said.
{ "pile_set_name": "Pile-CC" }
My Hats Collection My Hats Collection is a compilation album by Canadian new wave/synthpop group Men Without Hats, released in 2006. The compilation is notable for including "Tomorrow Today", a song by a pre-Men Without Hats band called Heaven 17, which featured Ivan Doroschuk on keyboards, and "Gravity is My Enemy", a song from the original demo tape that got the group signed to Statik. Track listing "The Safety Dance" - 2:45 "Living in China" - 3:04 "Antarctica" - 3:27 "I Got the Message" - 4:41 "I Like" - 4:13 "Where Do the Boys Go?" - 3:46 "Freeways" (Euromix) - 5:47 "Editions of You" - 3:56 "Pop Goes the World" - 3:46 "Tomorrow Today" - 3:56 "Gravity Is My Enemy" - 3:42 "Heaven" - 3:43 "The Safety Dance" (extended version) - 4:34 "Where Do the Boys Go?" (extended version) - 6:17 The Silver Collection In 2008, the album was reissued as The Silver Collection, a CD/DVD pack which replaced "Gravity Is My Enemy" with an extended New Wave version of "Ban the Game" (the short piano intro to Rhythm of Youth), "Rhythm of Youth" and "Treblinka" (all three come from the same demo tape) and also included a bonus DVD containing five music videos and an interview. "The Safety Dance" "Nationale 7" "I Like" "Where Do the Boys Go?" "Pop Goes the World" The Jeannie Becker interview (1983) Category:Men Without Hats albums Category:2006 greatest hits albums
{ "pile_set_name": "Wikipedia (en)" }
<?xml version="1.0" encoding="utf-8"?> <Project ToolsVersion="4.0" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <ItemGroup> <Filter Include="Assets"> <UniqueIdentifier>4416d50a-7676-4d0a-9b2c-91ff70c6047f</UniqueIdentifier> <Extensions>bmp;fbx;gif;jpg;jpeg;tga;tiff;tif;png</Extensions> </Filter> </ItemGroup> <ItemGroup> <Page Include="$(SharedContentDir)\xaml\MainPage.xaml" /> <Page Include="$(SharedContentDir)\xaml\Styles.xaml" /> <Page Include="Scenario1_Data.xaml" /> <Page Include="Scenario2_Stats.xaml" /> <Page Include="Scenario3_Enum.xaml" /> <Page Include="Scenario4_UnicodeExtensions.xaml" /> <Page Include="Scenario5_TimeZone.xaml" /> </ItemGroup> <ItemGroup> <Midl Include="Project.idl" /> </ItemGroup> <ItemGroup> <ClCompile Include="pch.cpp" /> <ClCompile Include="Scenario1_ShortName.cpp" /> <ClCompile Include="Scenario2_ShortName.cpp" /> <ClCompile Include="$(GeneratedFilesDir)module.g.cpp" /> <ClCompile Include="SampleConfiguration.cpp" /> <ClCompile Include="Scenario1_Data.cpp" /> <ClCompile Include="Scenario2_Stats.cpp" /> <ClCompile Include="Scenario3_Enum.cpp" /> <ClCompile Include="Scenario4_UnicodeExtensions.cpp" /> <ClCompile Include="Scenario5_TimeZone.cpp" /> </ItemGroup> <ItemGroup> <ClInclude Include="pch.h" /> <ClInclude Include="Scenario1_ShortName.h" /> <ClInclude Include="Scenario2_ShortName.h" /> <ClInclude Include="SampleConfiguration.h" /> <ClInclude Include="Scenario1_Data.h" /> <ClInclude Include="Scenario2_Stats.h" /> <ClInclude Include="Scenario3_Enum.h" /> <ClInclude Include="Scenario4_UnicodeExtensions.h" /> <ClInclude Include="Scenario5_TimeZone.h" /> </ItemGroup> <ItemGroup> <AppxManifest Include="Package.appxmanifest" /> </ItemGroup> <ItemGroup> <Image Include="$(SharedContentDir)\media\microsoft-sdk.png"> <Filter>Assets</Filter> </Image> <Image Include="$(SharedContentDir)\media\smalltile-sdk.png"> <Filter>Assets</Filter> </Image> <Image Include="$(SharedContentDir)\media\splash-sdk.png"> <Filter>Assets</Filter> </Image> <Image Include="$(SharedContentDir)\media\squaretile-sdk.png"> <Filter>Assets</Filter> </Image> <Image Include="$(SharedContentDir)\media\storelogo-sdk.png"> <Filter>Assets</Filter> </Image> <Image Include="$(SharedContentDir)\media\tile-sdk.png"> <Filter>Assets</Filter> </Image> <Image Include="$(SharedContentDir)\media\windows-sdk.png"> <Filter>Assets</Filter> </Image> </ItemGroup> <ItemGroup> <None Include="packages.config" /> </ItemGroup> <ItemGroup> <ApplicationDefinition Include="$(SharedContentDir)\xaml\App.xaml" /> </ItemGroup> </Project>
{ "pile_set_name": "Github" }
COURT OF APPEALS EIGHTH DISTRICT OF TEXAS EL PASO, TEXAS § BONDED BUILDERS HOME WARRANTY ASSOCIATION § No. 08-14-00090-CV OF TEXAS D/B/A BONDED BUILDERS WARRANTY GROUP, § Appeal from DANIEL AVILA, GRISELE EDITH ARIZPE, AND § 327th District Court AA BUILDERS, LLC, § of El Paso County, Texas Appellants, § (TC # 2013DCV4125) v. § PATRICIA ROCKOFF, § Appellee. § OPINION This is an interlocutory appeal from the denial of motions to compel arbitration. See TEX.CIV.PRAC.&REM.CODE ANN. § 51.016 (West Supp. 2015)(permitting an interlocutory appeal from the denial of a motion to compel arbitration under the Federal Arbitration Act). Appellants raise a single issue contending the trial court erred in not compelling arbitration. We sustain that issue and remand the case to address one remaining issue: whether the cost issues raised by the arbitration agreement render it procedurally unconscionable. FACTUAL SUMMARY AA Builders, LLC, constructed a home at 3715 Laguna Court in El Paso, Texas. Appellants Grisele Arizpe and Daniel Avila are alleged to be the general partners of AA Builders, LLC (collectively we refer to all three as “AA Builders”). The original homeowners of 3715 Laguna Court obtained a new home warranty on the residence from Bonded Builders Home Warranty Association of Texas d/b/a Bonded Builders Warranty Group (“BBWG”). The original homeowners then sold the house to Appellee Patricia Rockoff in July 2013. By paying a $40.00 processing fee to BBWG, the warranty was transferred to her on July 11, 2013. Shortly after acquiring the property she noticed cracks in the walls of the house which she attributes to the failure of load-bearing walls. It appears that the house was built on a lot that was cut and filled, meaning that some portion of the lot was graded away and other portions filled in to level the property. One of Rockoff’s allegations is that a portion of the house was built over the fill dirt which was insufficiently engineered or compacted such that it could not carry the weight of the house. Rockoff first complained to AA Builders who denied her claim. Rockoff then made a warranty claim with BBWG. There are two distinct warranties provided by BBWG on the home. The first is called the “Workmanship, Materials and Systems Warranty.” Under that particular warranty, AA Builders warranted that the house meets certain specified construction performance standards detailed in the warranty document. One of those standards, for instance, states that a slab foundation should not tilt or deflect in excess of one percent from the original construction elevations. If there is a breach of one of those the standards, AA Builders would be primarily obligated to repair or replace the defective item under the terms of the warranty. BBWG in turn acts only as the guarantor and meets AA Builder’s obligation if either: (1) it is unwilling or unable to comply -2- with the terms of the warranty, or (2) following the alternative dispute resolution procedures and arbitration called for in the agreement, AA Builders refuses to or is unable to comply with the arbitration award. Under the Workmanship, Materials and Systems Warranty, the homeowner is obligated to first contact AA Builders to make a claim. If the homeowner and AA Builders are unable to resolve their issues, the homeowner submits a claim form to BBWG who then contacts the builder to attempt to gain their compliance. Any dispute after that point must be submitted through BBWG’s “conciliation process.” That process contemplates that a conciliator, appointed by BBWG, meets with all the parties at the house, and then issues a non-binding award if no agreement is reached. Unless all parties accept that non-binding recommendation, the dispute is then submitted to a “Claim Review Group” consisting of the conciliator, a qualified representative for the homeowner, and AA Builders. If this meeting does not resolve matters, any dispute must be submitted “to binding arbitration pursuant to the terms and conditions of the Arbitration Section of this warranty.” BBWG pays the cost of the conciliation process, other than the cost of the representative the homeowner may hire to participate in the Claim Review Group. A second warranty, referred to as the “Express Limited Major Structural Defect Warranty,” has its own unique set of provisions. This warranty covers damage to designated load-bearing walls that are impaired to the extent that the house becomes “unsafe, unsanitary, or otherwise unlivable.” Under this warranty, BBWG is primarily obligated to repair or replace covered defects. To make a claim, the homeowner first completes a designated form which is sent to BBWG. Any dispute under the terms of this warranty must be referred to mediation, with each party paying their share of the mediation expense. If not resolved by mediation, any dispute -3- must again be submitted to “binding arbitration pursuant to the terms and conditions of the Arbitration Section of this warranty.” The Arbitration Section of the warranty first contains a broad agreement to arbitrate disputes: In the event any Dispute under any BBWG warranty, including without limitation, a claim of subrogation, negligent or intentional misrepresentation or nondisclosure in the inducement, breach of any alleged duty of good faith and fair dealing, and/or any dispute over the scope of this Arbitration Provision, cannot be resolved by one of the Alternative Dispute Resolution processes described herein, You, the Builder and BBWG agree to submit the Dispute to binding arbitration…. By accepting the warranty, You are agreeing to waive Your right to a trial by either judge or jury in a court of law.” The term “Dispute” is defined to include “any dispute, controversy, claim or matters in question . . . between Builder, You, Your successors in interest and/or BBWG arising out of or relating to this Warranty. . . . ” The Arbitration Section has several other terms which bear on the parties arguments raised in this appeal. One term addresses selection of the arbitrator: You will have the right to select the arbitration company from the list of approved arbitration companies BBWG will provide to You when arbitration is requested. The arbitration will be conducted under the arbitration company’s rules in effect at the time of the arbitration. Another term addresses payment of the expenses of the arbitration: The arbitrator’s compensation fee, administrative fee and all expenses charged by the arbitrator and/or the arbitration service shall be borne equally by the arbitrating parties. Each party shall pay their own attorney fees and expenses. Additional fees may be assessed in accordance with the arbitration company rules and fees. The arbitrator shall have the discretion to reallocate such fees and expenses, save and except attorney’s fees, in the interest of justice. Two provisions address initiation of arbitration: Any party who shall commence a judicial proceeding concerning a dispute, which is arbitrable hereunder, shall also be deemed to be a party requesting arbitration within the meaning of this paragraph. …. -4- Arbitration may be demanded at any time, but only after completion of all conditions precedent, and may be compelled by summary proceedings in Court. The agreement is made expressly subject to the Federal Arbitration Act (Title 9 of the United States Code), and contains a savings clause: If any provision of this arbitration agreement shall be determined to be unenforceable by the arbitrator or by the court, the remaining provisions shall be deemed to be severable there from and enforceable according to their terms. The “General Conditions” section of the warranty provides that the homeowner’s sole remedy against AA Builders, and all those associated with it, is under the terms and conditions of the warranty. This exclusive remedy agreement is “enforceable to the fullest extent permissible by the law of the state in which the property is located . . . .” Likewise, to the extent permitted by the applicable state law, the homeowner waives any implied warranties. The General Conditions also provides that each party is to pay their own litigation costs and “under no circumstances shall any party, prevailing or otherwise be entitled to an award and/or judgment which includes or provides for attorney’s fees and/or court costs.” The General Conditions section contains its own severability clause which provides that should a court find any provision unenforceable, the remaining portions of this warranty will still be effective. On September 9, 2013, Rockoff sent notice to AA Builders which promptly denied her claim. On October 10, 2013, she then completed BBWG’s designated claim forms for both the warranty sections set out above. On October 25, 2013, BBWG sent her a letter stating that it would assign a conciliator after she completed an additional enclosed form. The next correspondence in the record, however, is a November 4, 2013, demand letter from Rockoff’s attorney to BBWG demanding payment of the entire limit under the warranty.1 On the same day, Rockoff also filed suit against AA Builders and BBWG asserting claims under the Texas 1 The warranty states that its aggregate limit is $245,000.00. The warranty has many more terms, limitations, and exclusions which we have not attempted to fully set out in this opinion. -5- Deceptive Trade Practices Act, and specifically asserting a breach of express and implied warranties pertaining to the BBWG’s warranty. She later added claims for negligence and breach of implied warranties under the Texas Property Code. Her suit also seeks declaratory relief, which in part contends that the arbitration clause is unconscionable and unenforceable. Both AA Builders and BBWG filed motions to compel arbitration. Rockoff filed a response, which after setting out various legal principles governing arbitration, recites in forty- two numbered paragraphs “factors for consideration by the court.” Some of the paragraphs are simply statements of factual matters she claims are supported by certain referenced exhibits. Other paragraphs could (charitably) be viewed as specific reasons why the arbitration clause was substantively or procedurally unconscionable. We have carefully reviewed the Rockoff’s response, and her arguments at the hearing, and discern that she raised the following objections to arbitration:  The scope of the arbitration provision is not broad enough to encompass all of Rockoff’s claims under the Texas Deceptive Trade Practices Act, the Texas Declaratory Judgment Act, or her theories of alter ego, civil conspiracy, negligence, breach of implied warranty of good and workmanlike construction of residential property and/or habitability.  AA Builders and BBWG materially breached the agreement which excuses Rockoff’s performance under the arbitration clause, (or it failed to meet a condition precedent). Specifically, she contends that BBWG failed to contact AA Builders to attempt to get them to remedy the problem, and then it failed to appoint a conciliator.  The agreement is substantively unconscionable because it limits her claims and remedies. Specifically, it requires Rockoff to pay her own attorney’s fees and costs, despite provisions in the DTPA and court rules which would permit her to recover those if she were a prevailing litigant. It disclaims implied warranties and denies her the ability to seek injunctive relief because “[t]he arbitrator can’t issue an injunction.”  The agreement is substantively unconscionable because it fails to designate a neutral third party arbitration organization. Instead, BBWG has the sole right to -6- designate the pool of potential arbitration firms and thus “unconscionably controls selection of the arbitration organization.” The agreement itself fails to designate how the selected arbitration firm would designate qualified arbitrator(s), what rules might apply, or dictate that arbitration should be in El Paso.2  The agreement is procedurally unconscionable because Rockoff had no ability or power to negotiate any of the language of the warranty, the terms of the agreement were never explained to her, the arbitration clause was not conspicuous, and she never signed any document signifying her approval of the arbitration agreement. Rockoff also claimed that the cost of arbitration would exceed litigation costs, which under the agreement must be borne equally by the parties. She contended, however, that until the identity of the proposed arbitrator is actually known, there was no way to complete that cost analysis. (“You’ve got to know who the arbitrator is, you’ve got to know what rules of arbitration are going to apply. So, we’re not even in a position to make that analysis at this point.”) Consistent with an interrogatory answer, BBWG asserted that in the past it had designated the America Arbitration Association (AAA) and Construction Dispute Resolution Services, LLC as suitable arbitration companies. It did not stipulate, nor can we find anywhere in the record, that these were the arbitration firms being designated for this particular dispute.3 The trial court denied the motion to compel arbitration, and was not requested to, nor did it file, findings of fact and conclusions of law explaining its decision. FRAMEWORK FOR REVIEW A party seeking to compel arbitration must (1) establish the existence of a valid arbitration agreement; and (2) demonstrate that the claims asserted are within the scope of the agreement. In re AdvancePCS Health L.P., 172 S.W.3d 603, 605 (Tex. 2005); Delfingen US- 2 At the hearing, BBWG and AA Builders agreed that any arbitration would be in El Paso. 3 The consolidated brief of BBWG and AA Builders to this Court now stipulates that AAA and Construction Dispute Resolution Services, LLC will be included on the list to be provided Rockoff. Their brief was filed August 12, 2014 and is the first reference we find that Appellants concretely proposed particular arbitrators for this matter. -7- Texas, L.P. v. Valenzuela, 407 S.W.3d 791, 797 (Tex.App.--El Paso 2013, no pet.). While this particular arbitration agreement is governed by the Federal Arbitration Act (FAA), state contract law principles determine whether there is a valid underlying contract requiring arbitration. J.M. Davidson, Inc. v. Webster, 128 S.W.3d 223, 227 (Tex. 2003); Delfingen, 407 S.W.3d at 797. We review de novo a trial court’s determination as to the existence of a valid agreement to arbitrate. See In re Labatt Food Serv., L.P., 279 S.W.3d 640, 643 (Tex. 2009)(orig.proceeding); J.M. Davidson, 128 S.W.3d at 227. The second inquiry--whether a particular claim is subject to the arbitration clause--is decided in light of the federal policy and presumption favoring arbitration under the FAA. Moses H. Cone Mem’l Hosp. v. Mercury Constr. Corp., 460 U.S. 1, 24-25, 103 S.Ct. 927, 941, 74 L.Ed.2d 765 (1983); accord Ellis v. Schlimmer, 337 S.W.3d 860, 861-62 (Tex. 2011); Prudential Sec. Inc. v. Marshall, 909 S.W.2d 896, 898-99 (Tex. 1995)(orig.proceeding). If the proponent of arbitration proves the existence of a valid agreement which covers the dispute, then the burden shifts to the resisting party to raise an affirmative defense to enforcing that agreement. Royston, Rayzor, Vickery, & Williams, LLP v. Lopez, 467 S.W.3d 494, 499 (Tex. 2015); In re Poly-America, L.P., 262 S.W.3d 337, 348 (Tex. 2008)(orig. proceeding); In re Oakwood Mobile Homes, Inc., 987 S.W.2d 571, 573 (Tex. 1999). So long as there are no factual disputes, defenses to arbitration such as waiver or unconscionability are legal issues also subject to de novo review. Lopez, 467 S.W.3d at 499; In re Poly-America, L.P., 262 S.W.3d at 348; Delfingen, 407 S.W.3d at 798. The determination of any facts relevant to a defense is for the trial court which we review deferentially for record support under the abuse of discretion standard. Delfingen, 407 S.W.3d at 798-800. Because the trial court here did not enter findings of fact or conclusions of law to explain its denial of the motion to compel, we must uphold the trial court’s decision on any appropriate -8- legal theory urged below. Shamrock Foods Co. v. Munn & Assocs., Ltd., 392 S.W.3d 839, 844 (Tex.App.--Texarkana 2013, no pet.); Inland Sea, Inc. v. Castro, 420 S.W.3d 55, 57-59 (Tex.App.--El Paso 2012, pet. denied)(affirming denial of motion to compel arbitration on alternative ground where order did not specify the basis for the ruling); In re Weeks Marine, Inc., 242 S.W.3d 849, 854 (Tex.App.--Houston [14th Dist.] 2007, orig. proceeding). EXISTENCE OF AN ARBITRATION AGREEMENT COVERING THIS DISPUTE BBWG and AA Builders satisfied their initial burden of demonstrating the existence of a valid arbitration agreement. They attached a copy of the warranty to their motion to compel arbitration which contains the arbitration agreement as set out above. Rockoff’s pleadings attached the same warranty document. While Rockoff did not sign any particular document acknowledging or agreeing to the terms of the warranty, the FAA does not require that agreements to arbitrate be signed, so long as they are written and agreed to by the parties. In re AdvancePCS Health L.P., 172 S.W.3d at 606. Assent to arbitration can arise from a party’s conduct. In re Halliburton Co., 80 S.W.3d 566, 569 (Tex. 2002)(holding arbitration clause was accepted by continued employment). In this case, Rockoff’s assent is found in her filing claims form under the warranty and then suing on the warranty itself. A party seeking the benefits under an agreement cannot simultaneously disclaim knowledge of an arbitration agreement embodied in that same agreement. See In re Kellogg Brown & Root, Inc., 166 S.W.3d 732, 741 (Tex. 2005)(party bound to arbitration clause it did not sign “if it seeks, through the claim, to derive a direct benefit from the contract containing the arbitration provision”); In re FirstMerit Bank, N.A., 52 S.W.3d 749, 755 (Tex. 2001)(“a litigant who sues based on a contract subjects him or herself to the contract’s terms.”). -9- Rockoff argued below that the arbitration agreement does not cover all of her theories of liability. We disagree. To determine whether a party’s claims fall within the scope of an arbitration agreement, we focus on the complaint’s factual allegations rather than the legal causes of action asserted. In re FirstMerit Bank, N.A., 52 S.W.3d at 754. Rockoff’s petition alleges that because of various failings of AA Builders, the house “began to visibly sink into the ground” and “began experiencing structural distress.” These problems are attributed to “bearing capacity failure in the supporting soil underneath the footing areas.” The last amended petition alleges direct breaches of the BBWG’s warranty, breach of implied warranties in the construction of the house, and negligence in the construction of the house. The warranty agreement is actually a three party agreement, placing burdens and benefits on the holder of the warranty (Rockoff), BBWG, and AA Builders. The arbitration provision is triggered by any “Dispute” under the BBWG warranty. Both warranty clauses define the term “Dispute” to include “any dispute, controversy, claim or matters in question . . . between Builder, You, Your successors in interest and/or BBWG arising out of or relating to this Warranty including without limitation, a claim of subrogation, negligent or intentional misrepresentation or nondisclosure in the inducement, and breach of any alleged duty of good faith and fair dealing . . . .” This definition used of phrase “relate to” which renders it a “broad arbitration clauses capable of expansive reach.” See PoolRe Ins. Corp. v. Organizational Strategies, Inc., 783 F.3d 256, 262-63 (5th Cir. 2015), quoting Pennzoil Exploration & Prod. Co. v. Ramco Energy Ltd., 139 F.3d 1061, 1067 (5th Cir. 1998). The allegations asserted here fall within the broad scope of this arbitration provision. On appeal, Rockoff does not contend otherwise, other than to argue that there is not a valid agreement to arbitrate because BBWG retained the right to appoint the pool of potential -10- arbitrators. Citing In re Phelps Dodge Magnet Wire Co., 225 S.W.3d 599, 605-06 (Tex.App.-- El Paso 2005, orig. proceeding, [mand. denied]), she contends BBWG’s control over the potential pool of arbitration firms renders the Arbitration Provision not an arbitration clause at all. We decided in Phelps Dodge Magnet Wire whether a company’s “Problem Solving Procedure” constituted a true arbitration agreement or whether it was only an internal employment grievance procedure. Id. The policy at issue included a multi-step process to resolve disputes between an employee and management, which if unsuccessful, sent the dispute to a five member group made up of salaried and hourly employees. The employer alternatively retained the right to submit the dispute to an arbitrator if it so chose. Id. at 604. We held this was not a true arbitration provision because “[t]he entire pool of arbitrators consists of Phelps Dodge employees, making Phelps Dodge the sole arbitrator in resolution of the dispute.” Id. at 606; see also BDO Seidman v. Miller, 949 S.W.2d 858, 861 (Tex.App.--Austin 1997, writ dism’d w.o.j.)(decided under New York law, agreement which designated employer’s partners and board members as decision makers was void); Manes v. Dallas Baptist College, 638 S.W.2d 143, 145 (Tex.App.--Dallas 1982, writ ref’d n.r.e.)(one party could not designate its own Board of Trustees to be the final decision maker and then contend the agreement is enforceable as an arbitration agreement). But these cases are inapposite. BBWG is obligated to provide a list of potential arbitration firms from which Rockoff then selects one firm. The word “Arbitration” in the warranty agreement is a defined term, meaning: “[a]n Alternative Dispute Resolution process wherein the designated neutral third party conducts a hearing wherein the parties present live testimony and evidence to the arbitrator.” [Emphasis added]. The definition imposes an obligation that the ultimate arbitrator is a neutral third party, precluding BBWG from designating -11- itself or some captive arbitration company as a potential arbitrator. That a neutral third party must arbitrate the dispute distinguishes this case from Phelps Dodge Magnet Wire, Miller and Manes where one of the two disputing parties established itself as the decision maker. While we acknowledge that BBWG’s control over the pool of arbitration firms might create other problems, we address those concerns in the unconscionability discussion below. But to the extent the trial court denied BBWG and AA Builders’ motion to compel arbitration on the basis that they failed to satisfy their initial burden, the trial court erred. UNCONSCIONABILITY The FAA states arbitration agreements “shall be valid, irrevocable, and enforceable, save upon such grounds as exist at law or in equity for the revocation of any contract.” 9 U.S.C. § 2 (2009). The FAA was enacted “to reverse the longstanding judicial hostility to arbitration agreements . . . and to place arbitration agreements upon the same footing as other contracts.” Gilmer v. Interstate/Johnson Lane Corp., 500 U.S. 20, 24, 111 S.Ct. 1647, 114 L.Ed.2d 26 (1991). Nonetheless, the FAA’s purpose is to make arbitration agreements “as enforceable as other contracts, but not more so.” In re Merrill Lynch Trust Co. FSB, 235 S.W.3d 185, 192 (Tex. 2007), quoting Prima Paint Corp. v. Flood & Conklin Mfg. Co., 388 U.S. 395, 404 n.12, 87 S.Ct. 1801, 18 L.Ed.2d 1270 (1967). As such, arbitration agreements are subject to traditional state law defenses, including unconscionability. AT&T Mobility LLC v. Concepcion, 563 U.S. 333, 131 S.Ct. 1740, 1746, 179 L.Ed.2d 742 (2011); In re Poly-America, L.P., 262 S.W.3d at 348. An arbitration agreement may be unconscionable in one or both of two ways: (1) procedurally, which refers to the circumstances surrounding the adoption of the arbitration provision, and (2) substantively, which refers to the fairness of the arbitration provision itself. ReadyOne Industries, Inc. v. Flores, 460 S.W.3d 656, 666-67 (Tex.App.--El Paso 2014, pet. -12- denied). The unconscionability defense has a long history at common law. An early decision described an unconscionable contract as one that “no man in his senses and not under delusion would make on the one hand, and as no honest and fair man would accept on the other.” Earl of Chesterfield v. Janssen, 28 Eng. Rep. 82, 100, 2 Ves. Sr. 125, 155 (1751), quoted in Venture Cotton Cooperative. v. Freeman, 435 S.W.3d 222, 228 (Tex. 2014). “The grounds for substantive abuse must be sufficiently shocking or gross to compel the court to intercede, and the same is true for procedural abuse--the circumstances surrounding the negotiations must be shocking.” Delfingen, 407 S.W.3d at 798. Unconscionability has no precise legal definition because it is not a concept but a determination to be made in light of a variety of factors. Id., citing Southwestern Bell Telephone Company v. DeLanney, 809 S.W.2d 493, 498 (Tex. 1991)(Gonzalez, J. concurring). In deciding whether a contract is procedurally unconscionable, “we must examine (1) the entire atmosphere in which the agreement was made; (2) the alternatives, if any, available to the parties at the time the contract was made; (3) the non-bargaining ability of one party; (4) whether the contract was illegal or against public policy; and (5) whether the contract is oppressive or unreasonable.” [Internal quotation marks omitted]. Delfingen, 407 S.W.3d at 798. The critical inquiry in reviewing an agreement for substantive unconscionability “is whether the arbitral forum in a particular case is an adequate and accessible substitute to litigation, a forum where the litigant can effectively vindicate his or her rights.” In re Olshan Foundation Repair Company, L.L.C., 328 S.W.3d 883, 894 (Tex. 2010)(orig. proceeding). “That inquiry is not satisfied by speculation but by specific proof in the particular case of the arbitral forum’s inadequacy.” Venture Cotton Cooperative, 435 S.W.3d at 232. We measure unconscionability from the point the contract formed. Delfingen, 407 S.W.3d at 798. -13- Was the Agreement Procedurally Unconscionable? Rockoff acknowledges that unconscionability is measured at the time the arbitration agreement is entered into, but she contends that date was when the warranty was assigned to her (rather than when the original homeowners purchased it). Under this premise, she raised below procedural unconscionability--that is, how the agreement was entered into in the first place. Those arguments include such matters as the conspicuousness of the arbitration clause, her lack of bargaining power, and lack of formal assent to the arbitration clause. She does not brief any of these arguments on appeal. Assignees, third party beneficiaries, and successors in interest are often bound to arbitration clauses that an original contracting party entered into. Mohamed v. Auto Nation USA Corp., 89 S.W.3d 830, 836 (Tex.App.--Houston [1st Dist.] 2002, no pet.), citing Capitan Enters., Inc. v. Jackson, 903 S.W.2d 772, 775 (Tex.App.--El Paso 1994, writ denied); Carlin v. 3V Inc., 928 S.W.2d 291, 294 (Tex.App.--Houston [14th Dist.] 1996, no pet.)(collecting cases). The logical extension of this principle is that the assignee, third party beneficiary, or successor interest has no greater defenses than the original contracting party. Stated otherwise, defenses such as unconscionability are defined by the events surrounding the initial contract. That would seem particularly true here, when both parties agree there was no negotiation involved in transferring the balance of the warranty term to Rockoff. Neither the length of the warranty, or its substantive provisions were changed in any respect. She did no more than step into the shoes of the original home owners who secured the warranty. And because there was no evidence before the trial court regarding any of the factors governing procedural unconscionability as to the original homeowners, there would be no basis to find the warranty procedurally unconscionable. To the extent the trial court did so, it erred. -14- Does One Party’s Right to Designate the Pool of Potential Arbitrators Make the Agreement Substantively Unconscionable? Rockoff also contends that the arbitration clause is unconscionable because BBWG has the sole right to designate the pool of potential arbitration firms (from which she is to select one of her choosing). Rockoff’s argument is premised on the possibility that BBWG would only designate those arbitration firms that it thought would favor its position, thus denying Rockoff an impartial decision maker. Several federal court decisions are supportive of her position. In Hooters of Am., Inc. v. Phillips, 173 F.3d 933, 938 (4th Cir. 1999), the court analyzed an arbitration clause that in multiple ways favored an employer over its employees in resolving disputes. An aggrieved employee was required to file a statement of claims and list of witnesses, setting out contentions along with a summary of the evidence supporting them. The employer was required to file nothing. Id. Once the arbitration started, the employee’s contentions were limited by the claim statement, but the employer could add new issues as it wished. Id. at 939. And as germane here, the employer provided a list of potential arbitrators from which the employee and employer would then make one selection, with the two arbitrators then selecting a third from the list. But there were apparently no restrictions on whom the company could place on the list. Id. at 938. The employee in Hooters developed a record that the arbitration scheme as a whole was so one sided that reputable arbitration firms would have refused to participate in it. 4 The court concluded that the rules were so “egregiously unfair” as to breach a duty of good faith the court read into the contract. Id. at 940. 4 As an example, a senior vice president of the American Arbitration Association (AAA), testified that “the system established by the Hooters rules so deviated from minimum due process standards that the Association would refuse to arbitrate under those rules” Id. at 939. -15- The arbitration selection issue was more squarely addressed in McMullen v. Meijer, Inc., 355 F.3d 485, 488, 493-94 (6th Cir. 2004) which on the basis of the arbitrator selection provision alone, prompted the court to hold the provision unenforceable. There, the employer would select a pool of at least five arbitrators who could not be employed by or affiliated with the employer and who must generally be recognized as a neutral. Id. at 488. Noting the plan was considerably more even handed than that in Hooters, the court nonetheless found it risked a “symbiotic relationship” between the company and the arbitrators, which was apparently evidenced by the use of the same five to seven arbitrators in each of its past arbitration hearings. Id. at 493. The court remanded the case with instructions for the district court to determine if the selection provision was severable, because under the FAA, the trial court would have the authority to appoint a neutral arbitrator if the parties’ selection provision could be severed from the agreement. Id. at 496-97. See also Murray v. United Food and Commercial Workers Int’l Union, 289 F.3d 297, 303-04 (4th Cir. 2002)(court found provision unconscionable where employer created list of potential arbitrators from whom parties then alternatively struck); Milliner v. Bock Evans Financial Counsel, Ltd., 114 F.Supp.3d 871 (N.D. Calif. 2015)(allowing plaintiff to select one of three arbitrators from list created by defendant was substantively unconscionable). On this record, however, we reject the argument that the arbitration selection scheme is unconscionable on its face. First, as we previously noted, the warranty agreement includes a definition requiring the arbitration to be before a neutral third party. The warranty therefore imposes an obligation which precludes BBWG from designating a captive arbitration company as a potential source for arbitrators. If Rockoff discovers that the arbitrator fails that neutrality standard, she of course has remedies. See Tenaska Energy, Inc. v. Ponderosa Pine Energy, LLC, -16- 437 S.W.3d 518, 519 (Tex. 2014)(setting aside arbitration award on basis of arbitrator’s evident partiality). Additionally, the federal cases noted above invalidated schemes where one party designated a pool of specific arbitrators. In this agreement, BBWG is to designate potential arbitration companies. That distinction places an important step between BBWG and the actual arbitrator, because whatever company Rockoff selects will then present some list of potential arbitrators from which the parties will designate the actual decision maker. See Lawson v. Archer, 267 S.W.3d 376, 384 (Tex.App.--Houston [14th Dist.] 2008, no pet.)(agreement which required parties to mutually agree to three neutral arbitrators from designated groups was not unconscionable). We acknowledge the possibility that BBWG might only designate arbitration companies with only a few available arbitrators whom it trusts, but nothing in this record suggests it has done so in the past. The only evidence in this record is that it has designated the American Arbitration Association and Construction Dispute Resolution Services, LLC in prior matters. Materials from each of these firms were admitted at the hearing below. Those materials suggest each firm has detailed selection procedures which require their panel arbitrators to disclose any potential biases. Even under our deferential standard to a trial court’s fact findings, this record would not support a finding that BBWG designates biased arbitration firms. Other than speculation, in which we are precluded from engaging, we find no support for the contention that the procedure to appoint arbitrators is per se unconscionable. Olshan, 328 S.W.3d at 896 (speculation not proper basis to find unconscionability); see Venture Cotton Cooperative v. Freeman, 11-11-00093-CV, 2015 WL 1967251, at *6 (Tex.App.--Eastland Apr. 30, 2015, no pet. h.)(claim that trade group who was tasked with appointing arbitrators would be biased because of ties to one party were only speculative, and did not support unconscionability claim). -17- Does the Limitation on Attorney’s Fees or Limitations or Implied Warranties Make the Agreement Substantively Unconscionable? Rockoff also argued below that the warranty’s limitations on recovery of attorney’s fees, court costs, and disclaimers of implied warranties render the arbitration agreement unconscionable. On appeal, she carries forward the argument with respect to attorney’s fees, and correctly notes that the Deceptive Trade Practices Act allegations, if proven, would entitle her to recover attorney’s fees. TEX.BUS.&COMM.CODE ANN. § 17.50(d)(West 2011). The statute prevents a waiver of that right unless certain predicates are present, which are not apparent on the record before us. Id. at § 17.42. Yet, the warranty, and the arbitration clause, specifically prevent any fee shifting for attorney’s fees. Rockoff’s challenges in this regard are largely answered by the Texas Supreme Court’s holdings in Venture Cotton Cooperative v. Freeman, 435 S.W.3d 222 (Tex. 2014). That case involved a number of cotton farmers who were challenging acreage agreements which committed them to sell their crop to a cotton buyer at a set price. Id. at 225. The underlying agreement required arbitration of disputes under the rules of an industry trade group. Id. at 226. Those rules would prevent the award of attorney’s fees or additional damages under the DTPA, a claim which the farmers had pleaded in their lawsuit against the cotton buyer. Id. The court of appeals had held the arbitration agreement unconscionable, reasoning that it prevented the farmers from pursuing the statutory remedies and attorney’s fees as alleged in their pleadings. Id. at 229. The court of appeals premised its decision on In re Poly-America, L.P., 262 S.W.3d 337 (Tex. 2008) which held that arbitration clauses only select the forum for resolving statutory claims, and are not meant to re-legislate the remedies found in those statutes. See Poly-America, L.P., 262 S.W.3d at 352 (“[a]n arbitration agreement covering statutory claims is valid so long as the arbitration agreement does not waive the substantive rights and -18- remedies the statute affords and the arbitration procedures are fair, such that the employee may effectively vindicate his statutory rights.”)[Internal quotations omitted]. But the Texas Supreme Court in Venture Cotton Cooperative disagreed in part and held the invalid waiver of DTPA remedies did not invalidate the arbitration clause as a whole. 435 S.W.3d at 230. As it did in Poly-America, L.P., the court concluded the invalid waiver provision could be severed from the balance of the agreement, thus preserving the parties’ choice of arbitration as the forum for resolving disputes. Id. Similarly, we hold that to the extent an arbitrator ever found that a viable DTPA claim was proven, the arbitrator would be bound, as we would be, to follow Venture Cotton Cooperative, strike the limitation on attorney’s fees, and sever it from the arbitration agreement. The parties’ pleadings here did not expressly urge severance as an option. 5 Instead, with regard to the DTPA claim, they focused on whether Rockoff is a consumer under that statute which is a threshold requirement for bringing a DTPA claim. They both carry that argument forward on appeal. We decline, however, to jump into the merits of the lawsuit to resolve that issue. Our role is limited to the gateway function of deciding arbitrability. The court of appeals in Venture Cotton Cooperative believed the severance option had been waived because it was not asserted at the trial court. 395 S.W.3d at 277. The Texas Supreme Court held that to be error by the court of appeals, because it at most delayed the inevitable. 435 S.W.3d at 230-31. The Texas Supreme Court reasoned that once the case was remanded, a party could have urged severance and the parties might be back in the appellate pipeline and no closer to having the merits of their case decided. Id. For the same reason, we 5 One of the attorneys for AA Builders mentioned the option of severance of the attorney’s fees provision once in passing at the hearing and only in the context of the arbitrator severing the provision. Severance is not urged in either the Motion to Compel arbitration or the response, and is next suggested to us in Appellants’ brief as a reason any invalid clause would not support denial of arbitration. -19- apply Venture Cotton Cooperative. and hold that to the extent a DTPA claim is proven, the limitation on recovery of attorney’s fee should be struck. The inclusion of that clause, therefore, would not be a valid basis to refuse to arbitrate this dispute.6 Rockoff also urged below that other claim-limiting provisions in the warranty, such as its disclaimer of implied warranties, render the arbitration agreement unconscionable. These issues, however, are questions addressed to the broader context of the entire warranty, rather than the separable agreement to arbitrate, and would therefore be matters entrusted to the arbitrator. Lopez, 467 S.W.9d at 500; Venture Cotton Cooperative., 435 S.W.3d at 231, citing PacifiCare Health Sys., Inc. v. Book, 538 U.S. 401, 407 n.2, 123 S.Ct. 1531, 155 L.Ed.2d 578 (2003)(“the preliminary question [of] whether the remedial limitations at issue . . . prohibit[ed] an award of RICO treble damages [was] not a question of arbitrability”); In re FirstMerit Bank, 52 S.W.3d at 756 (noting that the defenses of unconscionability, duress, fraudulent inducement, and revocation must specifically relate to the arbitration portion of a contract, not the contract as a whole). To the extent the trial court refused to compel arbitration based on the remedy and claim limitation provisions found in the warranty, we hold that would have been error. Do the Costs of Arbitration Render the Agreement Substantively Unconscionable? Rockoff raised the argument that the cost of arbitration prevents her from pursuing her claim. A court may find an arbitration agreement unconscionable if it imposes excessive costs which prevent a litigant from effectively vindicating his or her rights in the arbitral forum. Green Tree Financial Corp.-Alabama v. Randolph, 531 U.S. 79, 90, 121 S.Ct. 513, 148 L.Ed.2d 373 (2000); In re Olshan Foundation Repair Co., LLC, 328 S.W.3d 883, 893 (Tex. 2010). 6 We note that when the trial court here heard the motions to compel Venture Cotton Cooperative had not yet been decided by the Texas Supreme Court. The court remanded the case to the court of appeals to hear the remaining challenges, including the issue of substantive unconscionability based on the cost of arbitration. That issue has now also been resolved. Venture Cotton Cooperative v. Freeman, 11-11-00093-CV, 2015 WL 1967251, at *3 (Tex.App.--Eastland Apr. 30, 2015, no pet. h.). -20- Rockoff bears the burden of making that showing. Green Tree, 531 U.S. at 92, 121 S.Ct. 513; Olshan, 328 S.W.3d at 893. She is obligated to present “some evidence that [she] will likely incur arbitration costs in such an amount as to deter enforcement of statutory rights in the arbitral forum.” [Emphasis in original]. Poly-America, 262 S.W.3d at 356. That evidence might consist of “invoices, expert testimony, reliable cost estimates, or other comparable evidence.” Olshan, 328 S.W.3d at 895; Venture Cotton Cooperative. v. Freeman, 11-11-00093-CV, 2015 WL 1967251, at *3 (Tex.App.--Eastland Apr. 30, 2015, no pet. h.). The evidence must allow the trial court to analyze: (1) the claimant’s ability to pay the arbitration fees and costs, (2) the expected cost differential between arbitration and litigation and whether that differential is so substantial that it deters the claimant from bringing its claims, and (3) the actual cost of arbitration compared to the total amount of damages that the claimant is seeking. Olshan, 328 S.W.3d at 895. “[A] comparison of the total costs of the two forums is the most important factor in determining whether the arbitral forum is an adequate and accessible substitute to litigation.” Id. at 894-95. BBWG and AA Builders now claim that Rockoff has failed to meet her burden to make such a showing. But we agree with Rockoff that she could hardly present to the trial court a calculation of the cost of arbitration versus litigation when no one knew the identity of the arbitrator. And the identity of the arbitrator could not be known until BBWG and AA Builders satisfied their obligation to present a list of potential arbitration firms. It is not enough to merely suggest the names of arbitration firms used in the past, and then ask the trial court to speculate what their costs might be if in fact they were put on the final list. We hold the cost analysis under the substantive unconscionability claim would have been premature when the trial court denied the motions to compel, and it cannot be done on the record before us. Accordingly, to the -21- extent that Rockoff wishes to re-urge this ground, she is free to do so once the identity of the arbitrator is decided. BREACH OF CONTRACT Rockoff also urged below that BBWG’s failure to informally talk with AA Builders to gain its compliance with the warranty, and its failure to appoint a conciliator, breached the contract, or was at least a condition precedent to arbitration. She additionally contends this now excuses her performance under the arbitration provisions. In support of this view, Rockoff principally relies on In re Igloo Products Corp., 238 S.W.3d 574, 581 (Tex.App.--Houston [14th Dist.] 2007, orig. proceeding) which held that the failure to mediate a dispute as required by the parties contract meant that any obligation to arbitrate was never triggered. The contract in that case expressly stated that arbitration “shall not be invoked unless the party seeking arbitration has first mediated the dispute with the other party or parties.” Id. at 578; see also In re Pisces Foods, L.L.C., 228 S.W.3d 349, 351 (Tex.App.-- Austin 2007, orig. proceeding)(similar holding based on clause that specified pre-arbitration procedures that “must be followed in sequence”). The warranty before us is not as explicit, stating only that if the conciliation process required for the Workmanship, Materials and Systems Warranty, or the mediation required for the Express Limited Major Structural Defect Warranty fails, then Rockoff “must submit the Dispute to binding arbitration pursuant to the terms and conditions of the Arbitration Section of this warranty.” Nor are the sequence of events here as clear as in Igloo Prod. and Pisces Food, and therein lies one problem with Rockoff’s argument. Conditions precedent to arbitration are generally viewed as procedural arbitrability issue, and are accordingly matters for the arbitrator to determine. Howsam v. Dean Witter Reynolds, Inc., 537 U.S. 79, 84-85, 123 S.Ct. 588, 154 L.Ed.2d 491 (2002); John Wiley & Sons, Inc. v. -22- Livingston, 376 U.S. 543, 557, 84 S.Ct. 909, 11 L.Ed.2d 898 (1964); In re Global Const. Company, L.L.C, 166 S.W.3d 795, 798 (Tex.App.--Houston [14th Dist.] 2005, orig. proceeding). Accordingly, questions of exhaustion of internal dispute resolution procedures would be a matter for the arbitrator. Omoruyi v. Grocers Supply Co., Inc., 14-09-00151-CV, 2010 WL 1992585, at *8 (Tex.App.--Houston [14th Dist.] May 20, 2010, no pet.). Omoruyi is instructive, because the court distinguished its own earlier opinion in Igloo Prods., describing it as an exception applying only when the issues were “factually undisputed.” Id. See also General Warehousemen & Helpers Union Local 767 v. Albertson’s Distribution, Inc., 331 F.3d 485, 488 (5th Cir. 2003)(referring to this as a “rare exception” applying only if “no rational mind could question that the parties intended for a procedural provision to preclude arbitration and that the breach of the procedural requirement was clear.”)(internal quotations omitted). By contrast the parties in Omoruyi disputed whether certain predicate steps were taken or not, and the court left that disputed issue to the arbitrator. Id. at *8. In much the same the way, at best Rockoff’s contention that BBGW breached its pre- arbitration obligations is disputed, and at worse, there is no evidence any breach. We find no evidence in the record, for instance, that BBWG failed to contact AA Builders to attempt to get them to comply with its warranty obligation. The only evidence in the record regarding conciliation is a letter from BBGW to Rockoff’s attorney asking that a claim form be completed so it could designate an appropriate conciliator. Ten days later, Rockoff served a demand for the monetary limit of the warranty and simultaneously filed a lawsuit. BBWG claimed in an interrogatory answer that Rockoff filed suit before it could appoint a conciliator. We find no record support that BBGW breached its obligation to appoint a conciliator. -23- There is a second problem with Rockoff’s breach of contract claim. She asserted claims under both of the warranty clauses we previously described. Her complaints below addressed alleged failure of BBGW to contact AA Builders, and failure to appoint a conciliator. Those requirements apply only the Workmanship, Materials and Systems Warranty. She never complained below of any failure to hold a mediation, which is the only preliminary procedure required for the Express Limited Major Structural Defect Warranty. We find nothing in the record where she presented any evidence regarding mediation at all. So even if she were correct that the BBWG failed to follow the conciliation process, that would not excuse arbitration under the Express Limited Major Structural Defect Warranty claims. But the record here does confront us with one glaring deficiency with BBWG and AA Builders’ request for arbitration--neither Appellant ever provided Rockoff with a list of potential arbitration firms to hear this dispute. Neither BBWG or AA Builders point to a place in the record below where Rockoff was given a list of approved arbitration companies from which she was to choose an arbitrator at the time arbitration was requested. At most, an interrogatory answer set out the identity of two firms that BBGW had approved in the past. The same interrogatory answer states that “Arbitrators and arbitration companies are selected by agreement on a case by case basis.” In their opening brief to this court, BBWG and AA Builders contend that they could not provide a list of suitable arbitrators until Rockoff asked for arbitration. There is nothing in the arbitration clause, however, that imposes such an obligation distinctly on Rockoff. Moreover, we note the agreement provides that the filing of a lawsuit is itself deemed to be request to arbitrate. BBWG and AA Builders never provided Rockoff with the list of arbitrators from which to choose. -24- Ordinarily this might end the inquiry, but Rockoff never distinctly raised this issue below as a reason to deny the motion, nor does she on appeal.7 And even if she had, we would be in the same posture as Venture Cotton Cooperative where a remand solely on this basis without addressing the other issues would not put the parties any closer to a final resolution of their dispute. This arbitration agreement is governed by the FAA which has a specific gap filling provision when there is a failure to appoint an arbitrator pursuant to the parties’ agreement: If in the agreement provision be made for a method of naming or appointing an arbitrator or arbitrators or an umpire, such method shall be followed; but if no method be provided therein, or if a method be provided and any party thereto shall fail to avail himself of such method, or if for any other reason there shall be a lapse in the naming of an arbitrator or arbitrators or umpire, or in filling a vacancy, then upon the application of either party to the controversy the court shall designate and appoint an arbitrator or arbitrators or umpire, as the case may require, who shall act under the said agreement with the same force and effect as if he or they had been specifically named therein; and unless otherwise provided in the agreement the arbitration shall be by a single arbitrator. [Emphasis added]. 9 U.S.C.A. § 5 (2009); see Pacific Reinsurance Management Corp. v. Ohio Reinsurance Corp., 814 F.2d 1324, 1329 (9th Cir. 1987)(“the intent of Congress was to spur the arbitral process forward, rather than to let it stagnate into endless bickering over the selection process”). Were the matter left entirely to us, we would remand with instructions for the trial court to appoint an arbitrator given that BBWG and AA Builders “fail[ed] to avail” themselves of the method set out in the agreement. The gap filling provision of Section 5, however, requires an “application of either party” which we view as limiting our ability to order this on our own initiative. On remand, however, we are confident that the trial court will expedite the process of selecting an arbitrator (or one party may make an application under Section 5) so that the trial 7 Her argument below, obscured in one of the forty-two numbered paragraphs of “factors for the trial court to consider,” was that there never a “pre-existing” list of approved arbitrators. But that was never a requirement under the warranty. Instead, the warranty states that “BBWG will provide [the list] to You when arbitration is requested.” -25- court may resolve one last issue that was raised below: whether the agreement is substantively unconscionable because of the costs of arbitration. CONCLUSION Appellants met their initial burden to show the existence of an arbitration agreement that covered the claims asserted in the lawsuit. Two of the three reasons that Rockoff urges on appeal to deny arbitration--substantive unconscionability because of the manner of arbitrator selection, and breach of contract--lack merit on this record and cannot sustain the trial court’s order. Of the other reasons she asserted below--procedural unconscionability and that the claims are not covered by the agreement--likewise lack merit. Her assertion here and below that the arbitration costs might make the agreement procedurally unconscionable cannot be decided on this record because the identity of the arbitrator is yet to be determined. Accordingly, we remand the case with instructions to obtain an appointment of an arbitrator. So long as the costs of arbitration do not render the agreement substantively unconscionable under the applicable legal standards, we order the trial court to grant the pending motions to stay the litigation and compel arbitration. June 16, 2016 ANN CRAWFORD McCLURE, Chief Justice Before McClure, C.J., Rodriguez, and Hughes, JJ. -26-
{ "pile_set_name": "FreeLaw" }
Effects of peritonsillar infiltration on post-tonsillectomy pain. A double-blind study. The concept that local infiltration of the operative area with a local anesthetic when using general anesthesia could alleviate postoperative pain is well known. We tested this concept on 129 patients scheduled for elective tonsillectomy. The patients were investigated in a double-blind, randomized study, and the operation was carried out via the standard technique of infiltrating the peritonsillar area preoperatively. The results indicated that preincisional infiltration of the tonsils with bupivacaine hydrochloride markedly decreased the intensity of pain following tonsillectomy, well beyond the immediate postoperative period.
{ "pile_set_name": "PubMed Abstracts" }
Q: How do I turn a string into the name of an array? I've think I've created multiple arrays from strings but if I try to inspect the array I receive an error. File.open("livestock.txt", "r") do |file| file.readlines.each do |x| if x.match(/:*:/) # puts x.inspect # strip string x.gsub!(/[^A-Za-z]/, '') x.downcase! puts x.inspect x = Array.new(){Hash.new} # puts x.inspect pigs.inspect else # puts "no" end end end animals.rb:12:in `block (2 levels) in <main>': undefined local variable or method `pigs' for main:Object (NameError) from animals.rb:2:in `each' from animals.rb:2:in `block in <main>' from animals.rb:1:in `open' from animals.rb:1:in `<main>' Ideally I want to create pigs =[] then add hashes to this array such as: pigs = [{"name"=>"peggy", "id"=>1, "owner"=>"wolcott farms"}, {"name"=>"sue", "id"=>2, "owner"=>"blue moon farms"}, {"name"=>"eddie", "id"=>3, "owner"=>"sunrise farms"} ] and the same for cows, etc. my text file animals.txt is ::pigs:: name, id, owner peggy, 1, wolcott farms sue, 2, blue moon farms eddie, 3, sunrise farms ::cows:: name, id, owner dee, 3, black hat farms sunny, 2, blue moon farms bess, 4, wolcott farms A: Parse Text, Then Assign Using Instance Variables You can't use local variables, but you can use Object#instance_variable_get and Object#instance_variable_set to do this kind of metaprogramming. For example: str = File.read '/tmp/livestock.txt' records = str.split /\n\n+/ records.map! { |r| r.split /\n/ } records.map do |r| var = ?@ << r.shift.strip.delete(?:) fields = r.shift.strip.scan /[^,]+/ hashes = r.map { |e| e.split(?,).flat_map &:strip }. map { |e| fields.zip e }. map &:to_h instance_variable_set var, instance_variable_get(var).to_a.push(hashes).flatten! end; # The data is now stored correctly in the following instance variables. @pigs @cows Caveat Note that if @pigs or @cows already exist because you're testing in the REPL, your results may not be what you expect. Make sure you invoke Object#remove_instance_variable, set your variables to nil, or create a new instance of your class between tests.
{ "pile_set_name": "StackExchange" }
Shoulder-arm pain from cervical bands and scalene muscle anomalies. Fourteen patients were identified with (1) pain and sensory changes in a brachial plexus distribution, (2) aggravation of pain with use of the affected extremity, and (3) pain on palpation over the brachial plexus. All patients had minimal or no intrinsic hand muscle atrophy. Only one patient had cervical ribs. Nerve conduction studies were normal, and electromyography (EMG) showed mild chronic neuropathic changes in 2 patients. None of the patients responded to conservative therapy over a prolonged period (7-12 months). A compressive brachial plexopathy from abnormally attached or enlarged scalene muscles that affected both upper and lower trunks of the brachial plexus was found at surgery in all patients. In 13 patients, at least one fibrous band compressed the lower trunk of the brachial plexus. Therefore, neurogenic thoracic outlet syndrome can occur from cervical bands and scalene muscle anomalies without intrinsic hand muscle atrophy, cervical ribs, enlarged C7 transverse processes, or EMG abnormalities.
{ "pile_set_name": "PubMed Abstracts" }
In a move that may spark a constitutional crisis, Gujarat Governor Kamala Beniwal on Friday appointed a Lokayukta, bypassing the Narendra Modi government. Within hours, the State government moved the High Court, challenging the constitutional propriety of the appointment. Sources in the government said Gujarat might become the second State, after Karnataka, to witness a confrontation between the government and the Governor. The announcement of Lokayukta's appointment was made by Leader of the Opposition in the Assembly Shaktisinh Gohil, who led a Congress delegation to the Governor in the afternoon to request her to appoint a Lokayukta, arguing that the government had failed for the past seven-and-half years to fill the post in keeping with its constitutional obligations. Coming out of the Raj Bhavan, Mr. Gohil said the Governor told the delegation that she had issued the notification on Thursday, appointing R.A. Mehta, a retired judge of the Gujarat High Court, Lokayukta. She also said the file on the appointment had been sent to the government. The name of the 75-year-old Mehta — who served as judge of the High Court from 1982 till his retirement in May 1998 and who has also held the post of acting Chief Justice several times — was recommended earlier by the Chief Justice of the High Court, S.J. Mukhopadhyaya, and was approved by the Congress. Mr. Gohil, himself an advocate practising in the High Court, maintained that under the State Lokayukta Act, the government had no role in the appointment, the power of which vested with the Governor. He said the Governor had cleared Justice Mehta's name long ago and advised the government to issue the notification for his appointment, but the government failed to act, despite several reminders, forcing the Governor to directly appoint the Lokayukta. Cabinet spokesman and Health Minister Jaynarayan Vyas said the direct appointment of the Lokayukta by the Governor was “unconstitutional.” The Governor, he claimed, was expected to act on the advice of the Council of Ministers and could not bypass the government in any appointment. Pointing to the constitution of the five-member Cabinet sub-committee at Wednesday's Cabinet meeting to recommend amendments to the State Lokayukta Act commensurate with the Lokpal Bill to be adopted by Parliament, Mr. Vyas said that when the process was under way to make changes to and expand the scope of the Act, the Governor had erred by making the appointment without consulting the government.
{ "pile_set_name": "OpenWebText2" }
This is the talk I gave at Dragon*Con last year, which was itself an expansion on the talk I gave at TAM9. It’s about how to use emotions to your advantage when trying to promote a cause. I talk about Prop 8, the importance of social justice in getting people to like atheists, and how to be a dick in an effective way. If you go here, there is a little place that says GuestCode where you can put in the following: thx1138 This will take you to my pitch, which you can then watch and rate. You can also mock my marginal public speaking skills and how weird the pitch of my voice is in real life versus how it sounds in my head. I mean, you don’t know that, but trust me. I will also not talk about how I blink one eye more than the other and talk about of one side of my mouth more than the other. Because, you don’t care.
{ "pile_set_name": "Pile-CC" }
Ibis Budget Lyon Confluence Ibis Budget Lyon Centre Confluence Hotel is a budget venue within a 30-minute walk from the center of Lyon. The Confluence Museum is located 1250 meters from the property and Halle Tony Garnier is 1350 meters away. Ibis Budget Lyon Centre Confluence Hotel provides 84 guestrooms appointed with individual climate control, a laptop-size safe, a personal computer, an iron with ironing board and a stereo system for a pleasant stay in Lyon. Bathrooms are fitted with a shower, a hairdryer and complimentary toiletries. Le Bistrot D'auguste pampers guests with eclectic, French, European and Vegetarian dishes and lies within 50 meters of the property. The nearest metro station is Place Jean Jaurès, situated 650 meters from the hotel. It will take 30 minutes to get to Saint Exupéry airport by car. Guests can make use of a storage room, an elevator and a vending machine on site. Ibis Budget Lyon Centre Confluence Hotel is a budget venue within a 30-minute walk from the center of Lyon. The Confluence Museum is located 1250 meters from the property and Halle Tony Garnier is 1350 meters away. Ibis Budget Lyon Centre Confluence Hotel provides 84 guestrooms appointed with individual climate control, a laptop-size safe, a personal computer, an iron with ironing board and a stereo system for a pleasant stay in Lyon. Bathrooms are fitted with a shower, a hairdryer and complimentary toiletries. Le Bistrot D'auguste pampers guests with eclectic, French, European and Vegetarian dishes and lies within 50 meters of the property. The nearest metro station is Place Jean Jaurès, situated 650 meters from the hotel. It will take 30 minutes to get to Saint Exupéry airport by car. Guests can make use of a storage room, an elevator and a vending machine on site. Rooms & Availability Ibis Budget Lyon Centre Confluence Hotel provides 84 guestrooms appointed with individual climate control, a laptop-size safe, a personal computer, an iron with ironing board and a stereo system for a pleasant stay in Lyon. Bathrooms are fitted with a shower, a hairdryer and complimentary toiletries.
{ "pile_set_name": "Pile-CC" }
What if god doesn't exist and people just made him up to control other people 4,512 shares
{ "pile_set_name": "OpenWebText2" }