text
stringlengths 1
3.78M
| meta
dict |
|---|---|
The present invention relates generally to washers used in the assembly of mechanical structures, and particularly to two-piece washers that can be inserted in a mechanical structure after assembly.
During and after the process of putting together a mechanical structure it is often discovered that a washer has either been inadvertently left out of the assembly or that a washer should be assembled in order to more precisely adjust the final assembly. This need may arise because of excess play along the shaft or to improve relative rotational movement between component parts. Usually, and under the best of circumstances, the only solution is to disassemble at least part of the structure to allow the washer to be slipped onto the shaft in the proper order of assembly, and then reassemble the remainder of the component parts. Under other circumstances, perhaps where the structure has been welded together, the only solution is to destroy some parts and start the assembly process from the beginning. These are time-consuming processes that cost money and efficiency in a commercial setting, and frustration for the mechanic in all situations.
Solutions to this problem have been proposed, but none have met reasonable commercial acceptance. For instance, U-shaped spacers have been utilized in this application, but these must have some means of being securely locked into place or they can work themselves free of, or out of, the area in which they are meant to remain. Such hardware is relatively expensive to manufacture and less reliable in use than is required in a commercial assembly operation.
Another solution is proposed in U.S. Pat. No. 1,777,614. Generally, the washers described are designed to eliminate axial shifting relative to the shaft while, as will be discussed further below, the washer of the instant invention requires such shifting to move into and out of the interlocking position. In FIG. 5 a two-piece washer, including male and female parts is depicted. The male member has outer ends formed into ratchet teeth and the female member has ends terminating in spring jaws and ratchet teeth that engage with those on the male member. The two pieces are not identical and must be flexed or sprung apart in order to engage each other. Non-identical parts result in a more costly manufacturing requirement, call for greater logistics and packaging, and more difficulty in assembly because of the need to handle two parts. Additionally, the need to flex one or both pieces in order to interlock them is not always possible because of other close-fitting parts or components.
Yet another proposed solution is disclosed in U.S. Pat. No. 1,558,364. There is shown a two-piece structure using identical parts, each with a male end and a female end. However, the female end is bent open for assembly and must be physically bent into a locking position around the male end. The need to bend components makes this possible solution more impractical because, as pointed out above, often there is inadequate space available to insert pliers or other tools to accomplish this end.
It would be desirable and beneficial to provide a washer that would overcome the above-noted disadvantages of known washers.
It is an object of the instant invention to provide an improved washer that can be easily inserted onto an assembled shaft without the need to disassemble other component parts already fitted to the shaft.
It is another object of the instant invention to provide an improved washer that is more cost-effective, durable, cheap to produce, easier to use, and reliable than those known in the prior art.
It is yet another object of the instant invention to provide an improved washer that can be inserted at substantially any location along the length of a shaft with other component parts thereon without the need to disassemble the structure.
It is a still further object of the instant invention to provide an improved two-piece washer that includes a tab, or tabs, extending outwardly there from adjacent the interlocking elements to aide in the placement or removal of the washer, thus eliminating the need for special tools and the likelihood that parts will be dropped or mishandled during use.
These and other objects are obtained by providing a two-piece washer that can be inserted in a fully or partially assembled shaft structure without the necessity of removing component parts. The two identical substantially inflexible pieces each have, on the circumferential ends thereof, a tab and recess that interlock with the corresponding tab and recess on the respective ends of the mating piece. To insert the washer, the mating surfaces of the component parts at the insertion location on the shaft must be separated a distance at least twice the thickness of the washer so that the two pieces of the washer can be placed around the shaft and moved axially along the shaft and relative to each other into the interlocking position.
The foregoing and other objects, features and advantages of the invention will appear more fully hereinafter from a consideration of the detailed description which follows, in conjunction with the accompanying drawings wherein one primary embodiment of the invention is illustrated by way of example. It is to be expressly understood, however, that the drawings are for illustrative purposes and are not to be construed as defining the limits of the invention.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Babatunde Olatunji
Interview by Jason Gross (October 2000)
Thirty-two years ago, African music made a huge dent
into the Western market. Nigerian drummer Babatunde Olatunji's ensemble
heard on Drums of Passion not only was released on a major label
but became a top 10 record in America. Though it was many decades this
occurred before the 'world music' explosion, it shouldn't have been that
much of a surprise that this comparatively minimal music would make such
an impact in the States. Even at that time, folklorists and historians
had recognized the enormous debt that homegrown styles like blues and jazz
owed to African music and its rhythms.
Olatunji was much more than a gifted, groundbreaking
artist. By the time that his music was making the charts, he was also making
the lecture circuit, going around colleges to talk about African culture.
He also decided to create his own arts center to promote the work of other
musicians and teach young people about music. His work schedule was punishing
but Olatunji was tireless: from 1968 to 1982, he taught at Roxbury (Massachusetts)
two days a week then teaching two days a week a class at Kent State and
then traveling back to New York for the weekends to teach at his own school.
His quest has spanned to today and found him many
musicians as supporters (and collaborators) of his work, including John
Coltrane, Carlos Santana, Taj Mahal and the Grateful Dead. His latest album,
Love
Drum Talk (on Chesky,
1997) earned him a Grammy nomination and a new generation of admirers.
I met Olatunji in April 1999 to talk about the span of his career.
Special thanks to Olatunji enthusiast Maureen 'Moe'
Tucker for her encouragement.
2003 update: Sad news as Baba passed away in California on April 6th at the age of 76 from diabetes. He will be missed and he will be remembered.
PSF: Before you came to America, when you were growing
up in Nigeria, how did your interests and studies with music begin?
I grew up in a village where music was a way of life.
Everyday you wake up and you may be celebrating the birth of a child, the
coming of age of a young man or woman, someone taking a giant step in life
(getting married) or someone passing into the spirit world. All of this
is celebrated with music and chants and dance. I would say that music covers
all the vicissitudes of life. So you grow up as a child seeing all of this
and being part of it. There's no way of escaping it. It's just like any
young man here in America will wake up at any time during the summer and
can grab a baseball bat or pick up a basketball and play around with it.
It's one thing to know something about it but becoming Michael Jordan is
another thing.
I grew up with that and my interests grew up with
that. In retrospect, I remember very well that I was always on the side
where the musicians were instead of where the audience was at all festivals.
Every weekend there was a festival in the villages. You are just there
and you are a part of it. But for me, I would always stand where the musicians,
the drummers were. I remember that very well.
PSF: Who were some of these musicians who influenced
you early on?
Master drummers, griots whose daily life involved
preserving the culture. These are really professional musicians whom you
would see at all the occasions that I mentioned.
PSF: What was it about their work that made you want
to do it yourself?
I noticed that people paid them respect and gave
them a tremendous amount of attention for what they did. They acknowledged
their presence and really had a place for them in society. Those who wake
up every day to play music, those who go to the marketplaces to perform
where the women sell their wares, those are the professional musicians.
Those are the historians. Those are the people who through their songs,
you can really write the history of a city, about the movers and the shakers
in the city or people who are legendary, people who are great, people who
did good work and those who did bad also. Through the songs that they write,
you can learn about people who make contributions to society. I was so
fascinated by them.
There was one particular griot called Denge. He was
like one who would sing about kings and chiefs, remind them of their upbringing,
remind them of the great contributions that their ancestors gave and make
sure that they follow tradition. He was very, very cool.
PSF: This was probably before radio or television
entered the picture so they were probably an equivalent form of entertainment
also, right?
No radio, no TV. (There were) social events that
followed each other in succession in our daily lives. There's always a
child being born in the village. There's always someone getting married
in the next town and you hear about it and people go to it. These are events
that are announced by word of mouth.
PSF: What led you to come to the United States in
the 1950's?
Luckily, by divine right, both of us (his brother
also) won the Rotary Educational Scholarship in 1950. That's how we came
to the United States, to go to Morehouse College in Atlanta, Georgia. We
were overwhelmed when we came here. (laughs) Really, it wasn't what we
thought it was or all of things that we read about it. We were very naïve
about the social situation, the race relation situation. We went to school
in the South. At our arrival at Morehouse Campus, which is a black college,
we saw some people who looked like people we knew at home. They would tell
us "No, we're not from Africa." I'd tell them "you look just like my cousin"
and they'd say "no way!"
We went through all that whole period of trying to
educate our brothers and sisters about their African heritage. That's how
the whole thing started with me as a lecturer.
I was studying political science to become a diplomat.
I changed though. When I came to New York, I went to the New York University
Graduate School of Public Administration and International Relations. But
that was a period when social change was going on in the process and I
was a part of that. I was the one who was called to present African programs
for Black awareness for NAACP and other groups. There was a good response
to this. I performed at these events throughout the sixties.
PSF: What led to you getting the chance to record
an album?
The way the whole situation started was that I had
been in a situation where before I left Morehouse college, I had established
myself in a way of letting it be known that this is a cultural basis for
our unity. I did this by presenting African music and dance while at Morehouse.
I wanted to create the true image of African- not Tarzan or the Hollywood
image. So upon graduation, I planned to continue the same thing. When I
came to New York, I started going about lecturing in schools.
In 1956, I contributed to the first UNICEF recording
for children. I had a sponsor who was teaching history in Boston and we
recorded it when he returned. The UN Choir was singing at a party for New
Year's Eve, which I went to. I was asked to do a chant and the choir director
said 'Ooh, that voice!'
I was introduced to a man at Radio City (Music Hall),
Raymond White, the arranger for their Symphony Orchestra. I went there
and met him and (we) collaborated- we did a 12-minute piece called "African
Drum Fantasy" in 1958. That was my biggest break. Before that, I had been
at schools lecturing and performing African music and dance, talking about
he rich cultural heritage of Africa as related to blues, jazz, gospel singing.
I was there (Radio City) for seven weeks, four shows a day with the Symphony
Orchestra. It was reviewed by all the daily newspapers there of the day.
It was then that Al Han, artists representative of
Columbia Records, came to me and said 'We'll put you in the studio.' That
was the recording of Drums of Passion. It was number 13 on the Billboard
charts. It was the first African recording that really demonstrated the
impact of percussion in music.
PSF: Do you feel that there are medicinal powers
in your music?
Possibly. We are now experiencing and trying to discover
how it works. We use our instruments to bring people together. We know
that it will always do that. The instruments that we use in Africa are
sources of communication. The other aspect of it is that we use it for
healing. That's an important aspect of drumming in African music, the polyrhythmic
nature. We know that rhythm is the soul of life. Every cell in your body
and mine is in constant frequency, in rhythm. Everything that we do is
in rhythm. So that music, it attracts, it energizes every cell in our body.
We're trying to find the answers of how music can be used to heal. We will
come to it somehow, but words are not adequate to describe how you feel,
if you are tired or if you feel competitive. But once you start, the adrenaline
flows, you become more energetic, you feel something flowing through your
whole body. You can't say what it is but it is something powerful. You
feel in excess of it.
That's what happens. That aspect of it is what I
know that has come to maintain the validity of that. But we know it heals.
It heals. So for me personally, it has helped me, healed me through many,
many conditions. I know that if it effect me, it effects others. Definitely.
PSF: You were talking about how African music informed
other styles. When you were playing with jazz musicians such as John Coltrane,
what kind of common thread did you find between your work and theirs?
In talking about jazz, you call it a phenomenon that
has been born from so many sources. Africa's contribution to jazz is rhythm.
The jazz musician (like Coltrane) with their hands, do improvisation. With
that going on, there is a steady beat, a heartbeat. The same thing in singing-
call and response as you have in gospel. "Oh happy day, happy day." You
have African rhythms, revisions of African traditions.
In the way of life of people in the area of arts,
it's the same thing when you think about it. People who are very, very
eloquent in the sense when you go through times like Ozzy Davis, people
who are natural at things. People who can recite verses. People who have
memory retention. The style of presentation. You have blues singers who
through their songs, tell stories about their lifestyle or the lifestyle
of the people they deal with and what is happening in their immediate environment,
how they feel about life in general. What is their emotional feelings about
subject matters like love, like pain, like wealth, like death and God?
Through their songs, through their renditions, they let this all out. And
how they feel about the one that gives them the most pleasure. That's an
African tradition that has survived the test of time. It's something that
will carry on.
As you move from North America to South America,
the retention of African tradition even becomes more powerful than it is
in North America. The continents were not really separated as they were
with North America. So if go to Surinam, you can see a whole village of
nothing but Guyanians who are carving the same way that they are doing
in Surinam. If you go to Trinidad, you can listen to people who are chanting
the same songs to the God of thunder as they do in Nigeria. If you go to
the oriental province in Cuba, where Mongo Santamaria came from, they have
the same way of live and the same way of talking is practically the same
thing as a Guinea tribe. The same thing in Guyana, the South Sea Islands.
It's all over. That's how the contribution of African culture, development
of world culture, has been very tremendous.
PSF: Talk about how you present your albums as part
of a cycle.
The first one was actually a signature to let people
know what African percussion is all about. We put it together to make music.
It really speaks for itself. What I am hoping to be do… You know, for twenty-eight
years, I didn't collect any royalties. I was so excited that when I signed
the contract, I didn't read it! (laughs) I didn't cross the T's and dot
the I's!
It's like seeing a vision of what's going to happen.
That's why I changed course, foreseeing the whole idea of diplomacy that
I was studying for. At that appearance at Radio City in 1958, I had been
here eight years and in 1957, Ghana became independent. I was getting 500
dollars a week so I was able to save money. I was invited to a very important
meeting in Ghana- the All African Peoples Conference held by President
Kwame Nkrumah in 1958. So I was able to go Ghana- that's when I was elected
President of the Student's Union (at Morehouse). I was very political in
those days. I had a degree in diplomacy so I had to organize African students
from all over.
I went to that meeting and read a paper at the conference.
I was a non-voting member because I was a student. In essence, I said that
there should be a cultural center in every major city in America so as
to disseminate information about the rich cultural heritage of Africa to
correct the ugly image of Africa in the mind of Americans. The President
applauded the speech and the next day, he called me and my wife to his
castle. He said 'that was a great thing- why don't you just pursue that
(drumming)? We will be able to help you.' So the first drum set I had for
Drums
Of Passion actually came from Ghana. I didn't have money to buy drums
in those days. I was just leeching around, using a few conga drums that
I rented. I didn't get that set until years after I graduated from college
in New York in 1954. This was four years later!
Drums Of Passion was the first album. I didn't
know that I would get a contract but we would rehearse every day, Monday
through Sunday. Those who say they were gonna charge us, they say 'when
you're finished charging, you come over here.' This group was mainly African-Americans,
some from the islands. We came together and we were a very unique group-
they were interested and eager. That was the beginning of it. From there,
it became a necessary way of life with me to pursue and looking for support
from abroad and from here. That led to the establishment of the Olatunji
Center of African Culture.
It was all the period when the late Alvin Alley would
watch us rehearse. That was before he started his company. We would present
modern jazz groups and they perform with us. We started the Olatunji Center
in Harlem then (1967). That was our first home- the center had been operating
but without a specific home, using different spaces. Before that, we formed
at the World's Fair, 1964, 1965. We were the first African group in this
country to perform at the World's Fair. The audience at the African pavilion
was the most popular one at the Fair. The money I made there, I used to
open the Center. I couldn't buy a building though so I had to pay $15,000
a year for to rent a loft space. Coltrane was one person who was sending
$250 every month to help. Then later on, he did not perform for two years
and the last performance he gave was where? At my center. He was very concerned
about the way that promoters were cheating the musicians. They go and borrow
money from their cousins. They would play at Carnegie Hall and make $50,000
for the show and then they pay them (musicians) scale wages. It was unequal
distribution of wealth.
So he (Coltrane) said, 'I want to deal with this
and do some research and see where I am, learn what I can learn about Western
music and jazz.' He was following me at that time. He came to me and said
'you and me and several other people like ourselves should come together.
We know how to promote shows. How about three groups? You want to have
a center in every center in America? We can do that? Your group, my group
and Yusef's (Lateef) group can start with Lincoln Center and we'll raise
enough money.' I was appointed Secretary-treasurer. I went and booked the
first concert for January 1968. Trane passed in 1967 though.
The center was also there for the purpose of bringing
back what I read about Harlem. Things were so different. You had black
and white (people) everywhere. So I was wondering why it wasn't happening
again? So I instituted a Sunday afternoon program called 'Roots of Africa'-
the program had a picture of Africa with Coltrane in the middle. So we
performed, Yusef performed, Pete Seeger performed, Bill Lee (Spike Lee's
father) performed with eight bass players. That hasn't been done again.
It was done right there at the center. It was really going well. I had
somebody different every Sunday afternoon, all for two dollars! That's
it! (laughs) I had been surviving without any foundation support. I would
write for grants, do proposals and hear back from the Ford Foundation 'we
do not fund your kind of program.' The first money I got was from the Rockefeller
brothers: 25,000.
Then from the National Endowment of the Arts, we
got a grant for our teacher training program. So most of the most of people
you see teaching African dance were trained there. We went to all over
the schools in the tri-state area, all the way to Long Island.
That's where I met Mickey Hart (Grateful Dead). He
was at one of the schools where they had the African program. I always
asked the students to come and beat on the drums. He came and did it and
I said "He's good!" That was 25 years ago. It wasn't until November 1985
in San Francisco that I met him again at one of the Bill Graham theatres.
Mickey was coming from a (basketball) game and he brought Larry Bird to
meet me after the show. He was helping with the sound and the whole place
was dancing with drums. He said "You don't remember me but I want to tell
you something... It's because of you that I'm doing what I'm doing today.
What are you doing tomorrow?" I didn't have any plans. So he says "OK,
you're going to open for the Grateful Dead." That was December 1985. It
was at that time that Columbia refused to renew my contract. That was George
Butler- he might have recognized that I'm a legend but he didn't go for
my kind of music. I said "You told me that my first record wouldn't sell
and you know it did!"
PSF: Could you talk about the other bands and performances
you were doing at clubs during the 1960's?
I started experimenting back then, when I started.
I had my jazz combo and we used to have 12-13 weeks at Birdland (New York).
We used to open for all the big bands. We would also close out the shows
at 4AM. In 1960, 1961, you had the bands like Count Basie, Duke Ellington,
Quincy Jones. I got to meet a lot of the Europeans too because when they
came to New York, they'd arrive late. And where would they go then? Birdland.
It was a fascinating period.
Then for a ten-year period, nothing was happening
for me. The Center closed because we kept missing the rent. I didn't get
any support from the city. They could have given me a building for one
dollar because we were non-profit. None of the middle-class blacks gave
any support for my effort. They did not send their kids to my school. I
picked up kids that used to sell drugs in Harlem just to (earn money to)
come upstairs and drum. I didn't get ANY support. It was humiliating. It
was so devastating that here was an opportunity to help these people to
have an image of themselves. They were talking about kids not doing the
right thing. But they didn't do the right thing by them. I used to walk
between 126th Street to 138th Street and I saw that those kids didn't go
school. They walked around, had nowhere to go. So I took them upstairs
and had them play drums. I was charging two dollars and I wasn't just teaching
them about drums. I was teaching them history, culture and I offered them
12 languages. The history about themselves. If they ever knew who their
ancestors where, they would want to do the right thing.
But they (the parents and adults) didn't do anything
about the situation. I think the same thing is still going on now. The
answer is not spending millions of dollars to go on television and tell
people "JUST SAY NO." That's not the answer. You got to do what Malcolm
(X) said. He put it in the street language- "Stop it downtown and it won't
come uptown." You know who the people are who are bringing these things
in- those are the people you need to stop. You need to fortify the borders
so that no one can bring any drugs in.
PSF: Did you find any support among the colleges?
Integration came on college campuses where I used
to go all over the world. I was being sponsored by the entire university.
Now, the black student unions would want to sponsor me but they don't have
no money. It's black backlash that I experienced. I used to go to Kent
State to perform three times a year. Now, I can only go once because the
student union can't afford it. The black student union gets very little
money and they want to do so much. They can only pay me a fraction of what
I was getting before to tie the drums to our car and drive all the way
out there. We used to do that- drive all around the country in those days.
It was devastating. It was so heart-breaking to see what was going on in
those days. But now, everyone is playing drums.
PSF: In your groups, how do the drums communicate
with each other and interweave with the singers?
The African theatre is a total theatre. You cannot
write a dramatic play without song and without movement. The trial is lost
if you have a presentation that does not address ALL aspects of the music.
The dancers must be able to dance with the beat of the drum. The drummers
who play for the dancers must have knowledge of the dance. That's the only
way that they're going to be able to play adequately and professionally.
That's how they will be able to communicate with them.
Not until recent times have I been noticing in Western
theatre, in Broadway shows, the people who audition must be able to sing,
dance and act. That was never a problem with an African performance. Automatically,
he or she is trained right from the start to be able to combine all of
those parts together. This is no sense in the whole presentation that the
drummer does not know the dance. He must know the dance- the required changes
necessary in the choreography of the dance. Not only in tempo, in intensity,
maybe to a completely new interpretation.
In the other words, the dancer and the drummer have
become one. The drummer as well as the dancer has the ability to sing along
as they perform. It is part of the whole presentation. That is normally
taught from the beginning of any particular presentation or production.
PSF: Do you also have a sense that the drums are
interacting with each other?
The drummers between themselves are interacting and
communicating. Irrespective of the number of drummers involved in a presentation,
each drummer is given a part to play for the whole. He must know where
the change is from one part to the next. That's (been) happening for thousands
of years.
A lot of people go about teaching African dance but
they don't teach the music. They just play for the dance. Every traditional
dance that's been passed on from time immortal is all music, unless it
is a new work. So (then) you got to write the music for it. New choreography,
new music, new costumes. But the interaction among the drummers is very
clear that you don't jump into playing rhythmic patterns unless there is
a reason or the group can help bring you back as a reminder to say 'this
is what you're supposed to be playing.' All the musicians know the parts,
including the part of the lead drummer.
PSF: I had heard that you performed at a celebration
here for Nelson Mandela. Could you talk about that?
There were 120 clergyman at Riverside Church of all
denominations in the community. They had a special service for Mandela
when he first came here (1990). It was my group that led him into the church,
with the drums and the chants. I led him to his seat and then performed.
From there, the group also performed at the reception given to him at Yankee
Stadium. I also followed him out to San Francisco, which was also organized
by Bill Graham. I am looking forward to going back to San Francisco to
discuss a project, the Voices of Africa.
PSF: How has it felt to be an expatriate here in
the States, playing the music from your homeland and occasionally going
back there to perform?
Well, I'm a citizen of the world now. I am very concerned
about what has been happening in Africa. What I've been doing here... I
wanted to repeat (my) performance in Africa. I want to be going around
now, reminding people that in our quest to become totally free as we pursue
our goals, we need to remember and put into place all of the traditional
wisdom that will help us survive in the new millennium. We need to re-institute
some of our traditional values that seem to be evaporating in our society
now. That is to restore our traditional ways of life in the areas of culture,
music, arts that has helped us define what we call the African personality.
In my estimation, we are in an educational pursuit.
In the Western world, we have neglected those traditional values. So it's
what I call 'misplacement of values.' Unless we go back to restoring them
into our lives, we're going to have trouble- a lot of misgivings among
our own people in the very near future. A lot of young people are clamoring
now to find out 'what is it that we can call our own? What is it about
our heritage?' They want to know. These times now make them very, very
aware of that.
PSF: Do you see your work as carrying on tradition
and bringing a message to people?
That's exactly what I'm so grateful about. I may
not have any money to show about it but what I have started here, from
five years ago, is like planting a new seed that is beginning to germinate.
It will come out very well. I'm quite sure that the leadership will become
very, very concerned about the need for looking into the past. The past
and the present are inevitably put together. What we had in the past is
what we have today- it will make a wonderful combination for tomorrow.
Then we cannot let time go by without taking care of that particular aspect
of our development now, especially if we try to patch up the rest of the
world.
If we're really going to catch up, as they say, he
who is behind must run faster than he who is in front. That's if you want
to catch up. And we need to catch up with the rest of the world. Africa
needs a very strong leadership, compassionate leadership. We need someone
who will really want to serve the people. You have to be tolerant and be
able to listen and do the right thing by the people.
You look at this country and how they spend all the
money buying arms. Who are we trying to fight? They spend 12 million dollars
to save 1 million people in Rwanda. Why didn't they raise that money years
ago to prevent what happened there? The military annulled the election
and go away with it and we were doing business with a tyrant.
PSF: How do you think your work has evolved?
The music has not changed, but it has evolved. I
had been able to incorporate my musical experiences in different CD's and
albums. I have always had a message. At the same time, (I) make sure that
the foundation of what I'm presenting is still tradition. My recent album,
the subject matter is love. I let traditional percussion music be very,
very strong there. It was overpowered by other instruments. I wanted people
to experience how it could be done without the use of synthesizers and
hard rock instrumentation. There's always a message about each CD that
I put out. So, I have been very careful about that. I think every student
of African music, even Africans themselves, needs to make sure that we
don't lose that touch. We should really maintain the roots, the strong
background that we have. That our performances really be a signature of
where the roots of the music come from.
There is no doubt in my mind (that) we all go through
a process of incorporation. No matter who you are or where you are, you
will be effect by an environment. But nevertheless, you cannot afford to
lose yourself. Being how you are. I will always make sure that you have
a taste of that particular instrument, the drum.
PSF: And the voice too.
Yes, of course.
PSF: You have a very impressive range.
Well, I am proud of that. I had attended a session
with a voice teacher from Boston who had trained many singers and politicians.
So I sang for him " Do-re-mi-fa-so-la-ti-do!" He said "what a voice- what
conservatory did you study at?" I said "Conservatory? I studied in the
bush! The village was my conservatory."
|
{
"pile_set_name": "Pile-CC"
}
|
Anthene chirinda
Anthene chirinda, the Chirinda hairtail, is a butterfly in the family Lycaenidae. It is found in Tanzania, Malawi and Zimbabwe.
References
Category:Butterflies described in 1910
Category:Anthene
|
{
"pile_set_name": "Wikipedia (en)"
}
|
The Vegas Golden Knights are riding a historic run to the Stanley Cup Final. How impressive is the expansion team's season? Watch above to see how the Golden Knights are setting records in their inaugural campaign...
|
{
"pile_set_name": "Pile-CC"
}
|
Cryptic polyadenylation within coding sequences (CDS) or incompletely removed introns produce aberrant transcripts that lack in-frame stop codons[@b1]. Translation of such mRNAs may result in proteins prone to malfunction and deleterious effects on cells[@b2][@b3][@b4]. To mitigate these errors, cells have developed quality-control processes to monitor translating mRNAs and detect aberrant mRNAs, such as those with premature polyA tails within their CDS. Defects in components of the surveillance machineries have been implicated in several types of diseases including neurodegeneration and cancer[@b5][@b6].
The ribosome-associated quality control (RQC) is a mechanism that senses the state of mRNA translation and detects ribosome stalling at the site of defective mRNAs, which results in targeting of both the translating mRNA and nascent peptide for degradation[@b7]. RQC can be divided into several steps, surveillance of the translating mRNA and detection of stalled ribosome, ribosomal subunit dissociation, and degradation of the defective mRNA and nascent peptide. Although the processes of ribosomal subunit dissociation and nascent peptide degradation are well studied[@b8][@b9][@b10][@b11][@b12], the mechanism of surveillance of the translating mRNA and detection of stalled ribosome, in particular the molecular sensors of aberrant mRNAs and their mechanism of action, remain largely unknown. Earlier studies suggested that presence of the polyA sequences within the CDS causes ribosome stalling through interactions between the positively charged peptide (poly-lysine) and the negatively charged exit channel of the ribosome[@b8][@b13][@b14]. However, others showed that at least in mammalian cells RQC at poly-lysine sites is codon-sequence dependent as runs of poly-lysine residues coded by AAA codons induced ribosome stalling much more efficiently than equivalent runs of poly-lysine encoded by AAG codons[@b15]. These results indicate that sensing A-rich mRNA sequence in mammalian cells dominates over general polybasic amino-acid-triggered translational regulation. Nevertheless, the mechanisms by which premature polyA sequences are detected in aberrant mRNAs and the following molecular events leading to ribosome stalling are not known.
In yeast, the E3 ubiquitin ligase Hel2 has been implicated in facilitating the earlier steps of RQC at polybasic sequences[@b8]. Notably, Hel2-dependent K63 polyubiquitination is necessary for the initial processes involved in stalled translation surveillance[@b16]. However, the precise functions of Hel2 in detection of stalled ribosomes or its ubiquitination substrates have not been identified. The Zinc Finger Protein 598 (ZNF598) is the human ortholog of Hel2 and contains a RING domain characteristic of E3 ubiquitin ligases and several C2H2-type zinc finger motifs, commonly found in nucleic acid-binding proteins[@b17][@b18]. We previously described ZNF598 protein in a complex with the translation repressor proteins EIF4E2/4EHP and GIGYF2 (ref. [@b19]). Two recent reports showed that ZNF598 is also required for stalling at polyA sequences and linked its E3 ubiquitin ligase activity to translation arrest through ubiquitinating the 40S subunit ribosomal proteins RPS10 and RPS20 (refs [@b20], [@b21]).
Here, we reveal that ZNF598 directly binds to the translating mRNA and tRNAs on ribosomes and triggers ribosome stalling and RQC at premature polyA sequences. We further identified RPS3A as an additional substrate of ZNF598 E3 ubiquitin ligase activity, and UBE2D3 as the ZNF598-interacting E2 ubiquitin ligase. Our findings establish a link between the RNA-binding properties and ubiquitin ligase activity of a uniquely conserved protein in monitoring mRNA translation.
Results
=======
ZNF598 associates with translating ribosomes
--------------------------------------------
Human ZNF598 encodes a ubiquitously expressed 904 amino acid (aa) protein containing one *N*-terminal RING domain characteristic of E3 ubiquitin ligases and four *N*-terminal and one *C*-terminal C2H2-type zinc finger motifs ([Fig. 1a](#f1){ref-type="fig"} & [Supplementary Fig. 1](#S1){ref-type="supplementary-material"}). To evaluate its potential role in translational control, we performed polysome profiling using ZNF598 overexpression (ZNF598-OE) or ZNF598 knockout HEK293 cells (ZNF598-KO; [Supplementary Fig. 2](#S1){ref-type="supplementary-material"}). ZNF598-OE induced a shift from heavy polysomes to monosomes and ZNF598-KO induced a shift to heavier polysomes, indicating translational repression ([Fig. 1b,c](#f1){ref-type="fig"}). This effect was independent of EIF4E2 ([Supplementary Fig. 3](#S1){ref-type="supplementary-material"}) and was neither due to general translational repression mediated by phosphorylation of eukaryotic initiation factor 2α EIF2S1/eIF2α ([Fig. 1d](#f1){ref-type="fig"}) under stress condition. Western blot analysis of the polysome fractions showed that a proportion of ZNF598 protein was associated with heavy polysomes in ZNF598-OE cells ([Fig. 1e](#f1){ref-type="fig"}). Size exclusion chromatography also revealed that ZNF598 protein co-fractionated with ribosomes in a ≥2 MDa complex ([Supplementary Fig. 4](#S1){ref-type="supplementary-material"}), suggesting that ZNF598 either interacted transiently with assembled ribosomes or associated with a subset of actively translating ribosomes. Immunofluorescence analysis of ZNF598 upon exposure to arsenite-induced stress did not reveal any change in its cytosolic distribution, unlike many known cytosolic RNA-binding proteins or 18S ribosomal RNA which accumulate in stress granules[@b22][@b23] ([Supplementary Fig. 5](#S1){ref-type="supplementary-material"}). Together, these observations support a role of ZNF598 in translation.
ZNF598 binds to RNAs associated with translating ribosomes
----------------------------------------------------------
To investigate ZNF598 function and identify its target RNAs, we performed 4-thiouridine (4SU) photoactivatable ribonucleoside-enhanced cross-linking and immunoprecipitation (PAR-CLIP)[@b24] in ZNF598-OE HEK293 cells ([Supplementary Figs. 2a and 6a](#S1){ref-type="supplementary-material"}). We observed that ZNF598 cross-linked to tRNAs, mRNAs and rRNAs ([Fig. 2a](#f2){ref-type="fig"}, [Supplementary Fig. 6b--g](#S1){ref-type="supplementary-material"} & [Supplementary Data 1](#S1){ref-type="supplementary-material"}). The average ratio of cross-linked reads annotated as tRNAs, mRNAs and rRNAs was ∼4:2:1. Cross-linked reads derived from mRNAs showed evenly distributed enrichment for CDS over untranslated regions (UTRs) ([Fig. 2a,b](#f2){ref-type="fig"}). The cross-linked mRNA read abundance resembled the overall mRNA abundance in HEK293 cells as determined by polyA mRNA-Seq ([Supplementary Fig. 7](#S1){ref-type="supplementary-material"}). The reads mapped to nuclear encoded cytoplasmic tRNAs originated predominantly from their 5′ halves, which were cross-linked to ZNF598 via their D-loops ([Fig. 2c,d](#f2){ref-type="fig"}). Although ZNF598 protein cross-linked to every cytoplasmic tRNA, cross-linked reads unique to tRNA^Lys^(UUU) were ∼10-fold enriched relative to their total cellular abundance, whereas cross-linked reads to tRNA^Lys^(CUU) only displayed an average twofold enrichment ([Fig. 2e](#f2){ref-type="fig"} & [Supplementary Data 2](#S1){ref-type="supplementary-material"}). Cross-linked reads to rRNA ([Fig. 2f](#f2){ref-type="fig"}) originated predominantly from 5S (pos. 96--121) and 18S rRNAs (pos. 686--707 and 745--778) and to a lesser extent from 5.8S and 28S ([Supplementary Figs. 8 and 9](#S1){ref-type="supplementary-material"}). Taken together, the cross-linked RNA targets and positional cross-linking spectra indicate that a fraction of ZNF598 protein was bound to translating ribosomes. In light of the enrichment of cross-linking to (AAA)-decoding tRNA^Lys^(UUU), we hypothesized that ZNF598 may have a role in detecting premature polyA tails or protein-folding problems of poly-lysine rich proteins that would induce ribosome stalling and RQC pathway[@b7][@b13]. The transcript abundance of ZNF598 is ∼10-fold below the average of transcripts encoding ribosomal proteins but similar in abundance to other proteins implicated in RQC ([Supplementary Data 3](#S1){ref-type="supplementary-material"}). Considering that direct molecular contacts are required for photo-cross-linking of ZNF598 to the CDS of mRNAs, tRNAs and rRNAs, we conclude that ZNF598 protein is associated with translating ribosomes and intimately monitors the CDS of translated mRNAs and/or identity of tRNAs occupying the ribosome and triggering RQC upon encounter with premature polyA tails.
ZNF598 initiates RQC at premature polyA sequences
-------------------------------------------------
In yeast, Hel2 facilitates ribosome stalling at both poly-lysine and poly-arginine polybasic amino-acid coding sites[@b8][@b16][@b25][@b26]. Polybasic peptides are lysine- (AAA or AAG codons) and/or arginine-rich (CGU, CGC, CGA, CGG, AGG or AGA codons). To determine whether the amino acid or the mRNA sequence is responsible for ribosome stalling, we generated stable HEK293 reporter cell lines for parental (CTR) and ZNF598-KO expressing GFP and mCherry fusion proteins separated by a 12 aa spacer composed of various lysine, arginine or control threonine-serine codon repeats ([Fig. 3a](#f3){ref-type="fig"}). We observed fourfold decreased expression of the fusion protein separated by a (AAA)~12~ poly-lysine-coding sequence as compared with either control poly-threonine-serine-coding (ACT AGC)~6~, poly-lysine-coding (AAG)~12~, poly-arginine (AGA)~12~, or poly-arginine-coding combinations of CGC, CGA and CGG. Importantly, expression of the (AAA)~12~ reporter reverted to the level of the (ACT AGC)~6~ control in ZNF598-KO cells ([Fig. 3b](#f3){ref-type="fig"} & [Supplementary Fig. 10b](#S1){ref-type="supplementary-material"} left panels), demonstrating ZNF598-dependent repression of the (AAA)~12~ reporter. The expression of the reporter fusion proteins was also studied in ZNF598-OE and its empty vector control (EV) using transient reporter plasmid transfection, revealing further decreased (AAA)~12~ reporter expression as compared with the (ACT AGC)~6~ control ([Fig. 3b](#f3){ref-type="fig"} & [Supplementary Fig. 10b](#S1){ref-type="supplementary-material"} right panels). The increased repression of the (AAA)~12~ reporter in ZNF598-OE cells also suggests that ZNF598 protein is sub-stoichiometric to ribosomes at standard conditions. Translational repression of the (AAA)~12~ reporter was not associated with an imbalance of the GFP to mCherry signal ratio ([Fig. 3b](#f3){ref-type="fig"}) or accumulation of truncated fusion protein ([Supplementary Fig. 10b](#S1){ref-type="supplementary-material"}), which is consistent with activation of the RQC pathway and destruction of the nascent reporter GFP segment[@b8]. These results demonstrate that whereas both poly-lysine and poly-arginine sequences induce ribosome stalling and RQC in yeast[@b8][@b16][@b26], only poly-lysine, encoded by the AAA codon induces RQC in mammalian cells in a ZNF598-dependent manner. Therefore, sensing A-rich mRNA sequence in mammalian cells dominates over general polybasic amino-acid-triggered translational regulation, as reported previously[@b15].
Interestingly, although there are 7,433 (AAA)~2~ and 175 (AAA)~3~ consecutive codons in human CDS, multiple consecutive (AAA) codons are scarce and do not exceed more than four ([Supplementary Fig. 11](#S1){ref-type="supplementary-material"} and [Supplementary Data 4](#S1){ref-type="supplementary-material"}). This implies that ZNF598 protein may be directly involved in detecting aberrant CDS containing ≥12 nt polyA during translation, and/or senses the simultaneous occupation of the ribosomal A, P and E sites with tRNA^Lys^(UUU), and/or a translating ribosome conformational transition as a consequence of the above. The multiple C2H2-type zinc fingers positioned along the protein may be implicated in such function.
The *N*-terminal RING domain is critical for ZNF598 function
------------------------------------------------------------
To identify the protein domains of ZNF598 critical for triggering premature polyA-dependent ribosome stalling and RQC, we complemented the ZNF598-KO cells with full-length or a series of truncated mutants of ZNF598 ([Fig. 3c](#f3){ref-type="fig"}). Although the *C*-terminal C2H2 domain (aa 864--904) was dispensable for RQC of the reporter without compromising RNA cross-linking, the *N*-terminal RING domain (lacking in the 81--904 truncation) was required for RQC ([Fig. 3d](#f3){ref-type="fig"}), albeit RNA cross-linking and thus translating ribosome binding was unaffected by deletion of the RING domain ([Fig. 3e](#f3){ref-type="fig"} & [Supplementary Fig. 12](#S1){ref-type="supplementary-material"}). These functional observations were corroborated by polysome profiling, which show the requirement of the RING domain and unstructured central domain, but not the *C*-terminal C2H2 motif for translational repression of the endogenous mRNAs ([Supplementary Fig. 13](#S1){ref-type="supplementary-material"}).
Ubiquitination of ribosomal proteins is required for RQC
--------------------------------------------------------
RING finger proteins coordinate the transfer of ubiquitin to substrate proteins by the recruitment of E2 ubiquitin ligases[@b27]. Although Hel2-dependent ubiquitination has been implicated in the initial surveillance process of stalled ribosomes in yeast[@b16], the target substrates of Hel2 or its corresponding E2 ubiquitin ligase were not known. The *N*-terminal domains of Hel2, including the RING domain, are the most conserved in ZNF598 ([Supplementary Fig. 1](#S1){ref-type="supplementary-material"}), suggesting a similar E3 ligase activity for ZNF598. To identify proteins targeted by ZNF598-dependent ubiquitination, we used ubiquitin remnant immuno-affinity profiling[@b28] in control, ZNF598-OE and ZNF598-KO HEK293 cells. Three small ribosomal subunit proteins RPS3A (eS1), RPS10 (eS10) and RPS20 (uS10), and the heat-shock protein HSPH1 were enriched more than fourfold in ZNF598-OE cells and decreased more than fourfold in ZNF598-KO cells as compared with CTR cells ([Fig. 4a](#f4){ref-type="fig"} and [Supplementary Data 5](#S1){ref-type="supplementary-material"}). In addition to priming the target proteins to proteasome degradation, ubiquitination also has a regulatory function in diverse molecular pathways such as DNA repair[@b29], anti-viral immunity[@b30] and signal transduction[@b31]. Evolutionarily conserved, regulatory ubiquitination of the small ribosomal subunit proteins induced by inhibitors of translation elongation has previously been reported in mammalian cells[@b32]. Western blot analysis revealed that overexpression or depletion of ZNF598 failed to affect the expression of RPS3A, RPS10 and RPS20 proteins ([Supplementary Fig. 14](#S1){ref-type="supplementary-material"}), indicating that the ZNF598-regulated ubiquitination of small ribosomal subunit proteins is likely a signalling event rather than inducing protein degradation by the proteasome.
Further biochemical experiments were performed to investigate the functional consequence of ZNF598-mediated ubiquitination of RPS3A, RPS10 and RPS20. We generated stable cell lines expressing the *C*-terminus Myc-DDK-tagged wild-type or mutant RPS3A, RPS20 or RPS10 in which lysines that are subject to ubiquitination were substituted by arginine. For RPS10 and RPS20, where multiple lysines were ubiquitinated (RPS10; K138, K139 and RPS20; K4, K8), we also created double mutants. Western blot analysis confirmed that the mutant proteins were at least as abundantly expressed as the wild-type proteins ([Supplementary Fig. 15a--c](#S1){ref-type="supplementary-material"}). However, only RPS10 K138R, and the double mutant K138R/K139R, partially impaired RQC for the (AAA)~12~ reporter, whereas mutations in RPS20 and RPS3A failed to effect (AAA)~12~ reporter expression ([Supplementary Fig. 15d](#S1){ref-type="supplementary-material"}). This indicates that downstream ribosomal protein ubiquitination of RPS10 contributes to RQC.
Recent reports also identified ZNF598-dependent ubiquitination of ribosomal proteins RPS10 and RPS20 as ZNF598-stimulated ubiquitin conjugates; although these studies differ with respect to the relative importance of the two proteins as well as their ubiquitination sites[@b20][@b21]. Both studies showed the requirement for ubiquitination of RPS10 in polyA-induced ribosome stalling. Nevertheless, while Juszkiewicz and Hegde[@b21] observed only a partial effect in RPS20 K4R/K8R double mutant, Sundaramoorthy, *et al*.[@b20] observed that both RPS20 and RPS10 mutants displayed enhanced readthrough of the polyA sequence. We detected RPS3A as an additional target of ZNF598-regulated ubiquitination, which is surprising considering its distance from RPS10 and RPS20 in the ribosome[@b33][@b34]. However, as mutations in RPS3A did not impact the polyA-induced ribosome stalling, it is likely that ubiquitination of this protein occurs or has a role in downstream events such as during ribosomal subunit dissociation.
RING family E3 ubiquitin ligases catalyse the transfer of ubiquitin from an E2 enzyme to target proteins[@b35]. To identify the E2 ligase for ZNF598 we performed immunoprecipitation (IP) in ZNF598-OE HEK293 cells followed by mass spectrometry (IP/MS) analysis of the immunoprecipitate. We identified the 97% identical UBE2D2 and UBE2D3 E2 ligases among the most significant hits ([Fig. 4b](#f4){ref-type="fig"}, [Supplementary Figs. 16 and 17a](#S1){ref-type="supplementary-material"} & [Supplementary Data 6](#S1){ref-type="supplementary-material"}). Their interactions with ZNF598 were verified by IP and western blot analysis, which revealed that UBE2D3 (the most abundant homologue in HEK293 cells; [Supplementary Fig. 17b](#S1){ref-type="supplementary-material"}), but not UBE2D2, specifically interacted with ZNF598 ([Supplementary Fig. 17c,d](#S1){ref-type="supplementary-material"}). UBE2D3 also co-fractionated with ZNF598 and ribosomal proteins in ≥2 MDa complexes ([Supplementary Fig. 18](#S1){ref-type="supplementary-material"}), but failed to co-fractionate in heavy complexes with the ΔRING mutant (aa 81--904) of ZNF598 ([Supplementary Fig. 12](#S1){ref-type="supplementary-material"}). In addition, knockdown of UBE2D3, but not UBE2D2, partially abrogated RQC on the (AAA)~12~ reporter ([Fig. 4c,d](#f4){ref-type="fig"}) or translational repression of endogenous mRNAs in ZNF598-OE cells ([Supplementary Fig. 19](#S1){ref-type="supplementary-material"}). These results underscore the requirement of the E3 ligase activity of ZNF598 and highlight the regulatory ubiquitination of the ribosomal proteins RPS3A, RPS10 and RPS20 in ribosome stalling and RQC.
Although ZNF598 was originally identified as a component of the ZNF598/GIGYF2/EIF4E2 complex, we showed that ZNF598-dependent translational repression was independent of the cap-binding EIF4E2 protein. Considering that EIF4E2 represses mRNA translation[@b19], we propose that this complex may have a role in downstream degradation of premature polyadenylated mRNAs via displacement of the canonical cap-binding protein EIF4E by the repressive EIF4E2 homolog. The sub-stoichiometric abundance of ZNF598 as well as other proteins implicated in RQC sensing deleterious amino-acid repeats, premature stop codons or truncated non-polyadenylated mRNAs, suggest that subpopulations of error-sensing ribosomes distributed randomly among translating polysomes divide the labour of detecting faulty mRNAs. The study of molecular and functional ribosome heterogeneity[@b36] will provide further direction in elucidating mechanisms of RQC. Although the human genome encodes 864 proteins with RING domain and 2,474 proteins containing at least one C2H2 domain, only three additional proteins, TRIM23, ZNF645 and CBLL1, carry a combination of RING and C2H2 domains (<http://www.ebi.ac.uk/interpro/protein/>), but none is as strongly evolutionarily conserved as ZNF598 ([Supplementary Fig. 20](#S1){ref-type="supplementary-material"}). In as much these proteins contribute to other possibly less conserved ubiquitination-dependent RNA pathways outside of translation, it poses an intriguing question. In summary, we showed that ribosome stalling and RQC in mammalian cells at premature polyA-containing mRNAs involved recognition of the tRNA^Lys^(UUU) and/or the mRNA (AAA) codon repeats by the unique RNA-binding and E3 ligase protein ZNF598 (see model; [Fig. 4e](#f4){ref-type="fig"}).
Methods
=======
Cell lines and culture conditions
---------------------------------
Flp-In T-REx 293 cells (Thermo Fisher Scientific, R78007) were grown in high glucose Dulbecco\'s Modified Eagle\'s Medium (DMEM) (Thermo Fisher Scientific, 11965118) supplemented with 10% v/v fetal bovine serum (FBS), 100 U ml^−1^ penicillin, 100 μg ml^−1^ streptomycin, 2 mM [L]{.smallcaps}-glutamine, 100 μg ml^−1^ zeocin and 15 μg ml^−1^ blasticidin. Presence of mycoplasma contamination in cells was tested by mRNA-Seq. Cell lines inducibly expressing 3xFlag-ZNF598 or Flag/HA-tagged truncated ZNF598 variants were generated as described previously[@b37] and selected and maintained in media supplemented with 100 μg ml^−1^ hygromycin. Expression of tagged proteins was induced for 24 h by the addition of doxycycline at 1 μg ml^−1^ final concentration. In the text, figures and tables, parental Flp-In T-REx 293 cells are labelled as CTR and the CRISPR-Cas9-mediated knockout as ZNF598-KO. 3xFlag-ZNF598 cells are labelled as ZNF598-OE. Because they were grown in different media than the CTR and ZNF598-KO cells, ZNF598-OE cells were always compared with control cells expressing 3xFlag EV, labelled as EV. For experiments with truncated variants, cells expressing full-length or truncated variants of ZNF598 were established using ZNF598-KO cells.
Antibodies and RNA interferences
--------------------------------
The following antibodies were used: mouse anti-β-tubulin (Sigma, T4026; 1:5,000 dilution), mouse anti-α-tubulin (Santa Cruz, sc-23948; 1:1,000 dilution), mouse anti-β-actin (Sigma, A5441; 1:1,000 dilution), mouse anti-Flag M2 (Sigma, F3165; 1:2,000 dilution), mouse anti-RPS6 (Cell Signaling, C-8; 1:2,000 dilution), rabbit anti-RPS3A (Abcam, ab171742; 1: 2,000 dilution), rabbit anti-RPS10 (Abcam, ab151550; 1: 2,000 dilution), rabbit anti-RPS20 (Abcam, ab133776; 1: 2,000 dilution), rabbit anti-Rack1 (Cell Signaling, 4716; 1:2,000 dilution), rabbit anti-EEF2 (Cell Signaling, 2332; 1:1,000 dilution), rabbit anti-4EHP (GeneTex, GTX103977; 1:500 dilution), mouse anti-HA (Fisher; 50-103-0108; 1:2,000 dilution), rabbit anti-UBE2D2 (Abcam, ab155088; 1:2,000 dilution), mouse anti-UBE2D3 (Abcam, ab58251; 1:2,000 dilution), mouse anti-GFP (Clontech, 632375; 1:1,000 dilution), rabbit anti-ZNF598 (Abcam, ab135921; 1:500 dilution), rabbit anti-ZNF598 (a gift from Jianxin Xie at Cell Signaling Technology; 1:1,000 dilution), rabbit anti-ZNF598 (GeneTex, GTX119245; 1:500 dilution). For ZNF598 the Cell Signaling antibody was used in most experiments, unless stated otherwise. Uncropped images of all of the immune-blots in this manuscript are shown in [Supplementary Figs 21 and 22](#S1){ref-type="supplementary-material"}.
The following siRNA and shRNAs were used: ON-TARGETplus Non-targeting Control Pool (Dharmacon, D-001810-10-05), UBE2D2 siRNA SMARTpool (Dharmacon, L-010383-00-0005), UBE2D3 siRNA SMARTpool (Dharmacon, L-008478-00-0005), Non-Targeting shRNA Controls (Sigma, SHC002) and EIF4E2 shRNA (Sigma, TRCN0000152006).
Lentivirus production
---------------------
A total of 8 × 10^6^ 293FT (Thermo Fisher Scientific, R70007) cells were cultured in a 10-cm dish for 24 h in high-glucose DMEM supplemented with 10% v/v FBS. Medium was replaced by OptiMEM (Thermo Fisher Scientific, 51985091) 30 min before transfection. Lentivirus particles were produced by transfecting the 293FT cells using Lipofectamine 2000 (Thermo Fisher Scientific, 11668019) and 10 μg shRNA plasmid, 6.5 μg psPAX2 (Addgene, plasmid 12260) and 3.5 μg pMD2.G (Addgene, plasmid 12259) packaging plasmids. 5 h post transfection, the medium was replaced with fresh high-glucose DMEM supplemented with 10% v/v FBS. Supernatant was collected at 48 h post transfection, replaced with fresh medium and harvested again after 24 h. Viral particles were cleared by filtration (45 μm; Fisher Scientific, 09-720-005) and virus titre was measured by colony formation assay using 293FT cells. The multiplicity of infection was adjusted to ∼5. Virus solution was stored at −80 °C without cryopreservative in 1 ml aliquots or used to infect the cells directly in the presence of 6 μg ml^−1^ polybrene (Sigma, H9268).
Generation of ZNF598 knockout cell lines
----------------------------------------
CRISPR-Cas9-mediated genome editing was performed as described previously[@b38]. We designed three small guide RNAs (sgRNAs) cognate to the coding region of ZNF598 gene: 5′-CTACTGCGCCGTGTGCCGCG, 5′-GAAAGGTGTACGCATTGTAC, and 5′-TACGCATTGTACAGGTGAGC. The following primers were used for the PCR-genotyping: sense primer1, 5′-GGAGGCGGAGGCGGCGGCAGC; anti-sense primer1, 5′-CCCCGCCCTGGGTGGCCCCACC; sense primer2, 5′- GGGGGTCCCATCCCAGTCCTGC; anti-sense primer2, 5′- CCTGGCCCCAGCATTGGTGCACC. PCR products were cloned using the Zero Blunt PCR Cloning Kit (Thermo Fisher Scientific, K270040) and 11 clones were sequenced per cell line to verify successful genome editing.
Plasmid construction
--------------------
For overexpression, ZNF598 cDNA was cloned into pcDNA5/FRT/TO/3xFlag/N-term plasmid (a gift from Dr Jernej Ule) by digestion with *Kpn*I and *Not*I and subsequent use of T4 DNA ligase. pENTR4 (Thermo Fisher Scientific, A10465) plasmids for expression of ZNF598 full-length or truncated variants were generated by PCR amplification of the respective sequences adding attB1 and attB2 recombination sites to the primers followed by recombination using the Gateway BP recombinase (Thermo Fisher Scientific, 11789020). pENTR4 plasmids were recombined into the pFRT/TO/Flag/HA-DEST destination vector (Thermo Fisher Scientific) using the GATEWAY LR recombinase (Thermo Fisher Scientific, 11791020). Reporters expressing GFP, mCherry, or GFP-mCherry fusion proteins separated by 12 amino-acid spacers were cloned into pcDNA5/FRT (Thermo Fisher Scientific, V6010-20) by digestion with BamHI and NotI and subsequent use of T4 DNA ligase. For expression of ribosomal proteins, wild-type cDNAs were cloned into pLenti-C-Myc-DDK-IRES-Puro (Origene) plasmid by digestion with AscI and MluI. Further mutagenesis was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
Fluorescence-activated cell-sorting analysis (FACS)
---------------------------------------------------
CTR and ZNF598-KO cells with stable, and EV and ZNF598-OE cells with transient, expression of GFP, mCherry and GFP-mCherry fusion proteins separated by 12 amino-acid spacers were sorted and analysed by flow cytometry (LSR II, BD Biosciences).
Polysome profiling
------------------
A total of 20 × 10^6^ cells in a 15-cm plate were pretreated with cycloheximide (100 μg ml^−1^; BioShop Canada, CYC003) for 5 min, collected by centrifugation at 4 °C for 5 min and lysed in 500 μl hypotonic buffer containing 5 mM Tris-HCl, pH 7.5, 2.5 mM MgCl~2~, 1.5 mM KCl, complete EDTA-free protease inhibitor cocktail (Roche, 04693159001), 100 μg ml^−1^ cycloheximide, 2 mM DTT, 200 U ml^−1^ RNasin (Promega, N2111), 0.5% v/w Triton X-100, and 0.5% v/w sodium deoxycholate using 1.5 ml microtubes. The lysates were cleared by centrifugation at 20,000 × g for 5 min at 4 °C. Total RNA concentration in the supernatant was measured by NanoDrop 2000 (Thermo Fisher Scientific) at 254 nm supernatant, and the equivalent of 300 μg of RNA was diluted to a final 500 μl volume and separated on 12 ml of 10--50% sucrose gradient by ultracentrifugation at 230,500 × g for 2 h in an SW40 rotor (Beckman Coulter) at 4 °C. Fractions of 700 μl were collected using an ISCO gradient fractionation system and the OD254 was continuously recorded with a Foxy JR Fractionator (Teledyne ISCO) during the collection process.
Size exclusion chromatography
-----------------------------
HEK293 cells overexpressing 3xFlag-ZNF598 (20 × 10^6^) were collected by centrifugation and resuspended in 600 μl of lysis buffer containing 25 mM HEPES-KOH, pH 7.4, 150 mM KCl, 75 mM KOAc, 2 mM MgCl~2~, 0.5% NP40, supplemented with complete EDTA-free protease inhibitor cocktail and 1 mM NaF, 1 mM Na~3~VO~4~ and 1 mM β-glycerophosphate phosphatase inhibitor. The lysate was clarified by centrifugation at 15,000 × g for 10 min at 4 °C. 5 mg of the protein extract was brought to a total volume of 500 μl of lysis buffer (final concentration 10 μg μl^−1^) and directly loaded onto a 24 ml Superose 6 column (HR 10/300, GE Healthcare Life Sciences) pre-equilibrated with lysis buffer and run in the same buffer at a flow rate of 0.5 ml min^-1^. Molecular mass calibration was carried out by using the Gel Filtration HMW Calibration Kit (Healthcare Life Sciences, 28-4038-42).
Fluorescence microscopy
-----------------------
Immunofluorescence and RNA-FISH experiments were performed following the protocol described previously[@b23]. For stress granule assays, HEK293 cells expressing 3xFlag-ZNF598 were grown on chamber slides. Arsenite was added to the cells at a final concentration of 400 μM and incubation was continued for 30 min at 37 °C. Chamber slides were hybridized overnight at 40 °C in hybridisation buffer containing 20 nM LNA-modified oligoT probe labelled with ATTO647N for detection of polyA and a cocktail of four different anti-28S rRNA LNA-modified oligodeoxynucleotides labelled with ATTO550 at 10 nM each for detection of 28S rRNA[@b23]. The slides were subsequently incubated for 1 h with anti-Flag antibody (Sigma, F3165) followed by incubation with a DAPI and Alexa Fluor 488-labelled goat anti-mouse IgG H+L (Thermo Fisher Scientific, A11001) for 1 h at RT. Images were recorded on the Olympus VS110 and processed using Visiopharm Integrated Systems Inc. software.
PAR-CLIP
--------
PAR-CLIP was performed using a single RNase A digestion step and using anti-Flag-M2 magnetic beads (Sigma, M8823) for IP as described previously[@b39]. PAR-CLIP cDNA libraries were sequenced on an Illumina HiSeq 2500 instrument, and data were analysed using the PAR-CLIP suite[@b39]. Reads mapping to mRNAs with d1 T-to-C sequence transitions and ≥20 nt were extracted and mapped to human genome using STAR-2.5.2a. For the metagene analysis, gencode gtf file (gencode.v19.chr_patch_hapl_scaff.annotation.gtf) was used to calculate the logarithm of average read coverage for 3′ UTR, CDS and 5′ UTR for the 2,000 mRNAs with highest coverage. Relative UTR and CDS sizes were calculated based in their average size in all mRNAs expressed in HEK293. Average coverage was calculated for each UTR and CDS independently according to the actual length of the region and number of bins (10 for 5′ UTR, 60 for CDS and 20 for 3′ UTR) and additionally represented in the upper panel as percent of total gene coverage. Reads mapping to tRNAs with d1 T-to-C sequence transitions and ≥20 nt were extracted and compared with tRNA sequencing (Gogakos, T & Tuschl, T, Characterizing expression and processing of precursor and mature human tRNAs by hydro-tRNAseq and PAR-CLIP, manuscript in preparation) data set obtained by hydro-tRNAseq[@b40] for differential expression. The analysis was conducted with the R/Bioconductor package edgeR[@b41] v. 3.14.0. The read counts were normalized using the weighted trimmed mean of M values[@b42] and normalized for library size. The differences were tested using the Fisher\'s exact test and the read count variation was estimated using tagwise or common dispersion. Differences were considered significant below a false discovery rate of 5%. Reads mapping to rRNAs with d0, d1 T-to-C and d1 other and ≥15 nt were mapped independently using bowtie2 (ref. [@b43]) to rRNA sequences, and bedtools[@b44] were used to obtain the coverage across each rRNA.
polyA mRNA-sequencing
---------------------
Oligo(dT)-selected RNA was converted into cDNA for polyA mRNA-sequencing using the Illumina TruSeq RNA Sample Preparation Kit v2 according to the instructions of the manufacturer and sequenced on an Illumina HiSeq 2500 platform using 100 nt single-end sequencing.
Co-IP and mass spectrometry (IP/MS)
-----------------------------------
Cell lines expressing 3xFlag and 3xFlag-ZNF598 from one 15-cm plate (∼20 × 10^6^) were lysed in NP40 lysis buffer composed of 50 mM HEPES-KOH, pH 7.5, 150 mM KCl, 2 mM MgCl~2~, 2% v/v NP40, 0.5 mM DTT, 1 × complete EDTA-free protease inhibitor cocktail and 1 × PhosStop (Roche, 04906837001) and the Flag-tagged protein was immunoprecipitated from the lysate with anti-FLAG-M2 magnetic beads. Magnetic beads were washed three times with washing buffer composed of 50 mM HEPES-KOH, pH 7.5, 300 mM KCl, 2 mM MgCl~2~, 0.5% v/v NP40 and three times with high-salt washing buffer composed of 50 mM HEPES-KOH, pH 7.5, 500 mM KCl, 2 mM MgCl~2~, 0.5% v/v NP40. The immunoprecipitates were eluted with Flag peptide and separated on NuPAGE Novex 4--12% Bis-Tris protein gels (Thermo Fisher Scientific, NP0322BOX), which were run shortly with the dye front 12 mm from the loading pocket. The experiment was performed for three biological replicates per condition. The protein bands were excised, carefully washed and followed by reduction (DTT final concentration of 5 mM for 30 min at 55 °C) and alkylation (iodoacetamide final concentration of 2 μg ml^−1^ for 15 min at room temperature). Proteins were digested overnight with Endopeptidase Lys-C (Wako) and trypsin (Sequencing Grade, Promega). Peptides were extracted, desalted[@b45] and analysed by nano LC-MS/MS (Dionex Ultimate 3000 coupled to a Q-Exactive Plus, Thermo Fisher Scientific). Data were processed using MaxQuant v. 1.5.3.28 (ref. [@b46]). Proteins quantitated in two out of three biological replicates for at least one condition and with Welch's *t*-test false discovery rate \<5% were analysed using the statistical software Perseus[@b47].
Co-IP assays
------------
Parental Flp-In T-REx 293 cells (6 × 10^6^ cells grown in a 10-cm plate) were transiently transfected with pcDNA5.A-3xFlag-ZNF598 and control EV (3xFlag) using Lipofectamine 2000 according to the manufacturer's instructions. After 24 h, cells were washed twice with cold PBS and collected in 1 ml of cold lysis buffer composed of 40 mM HEPES-KOH, pH 7.5, 0.3% CHAPS, 120 mM NaCl, 1 mM EDTA supplemented with complete EDTA-free protease inhibitor cocktail, and RNase A (10 μg/ml), and incubated for 30 min on ice. Lysates were cleared by centrifugation at 20,000 × g for 15 min at 4 °C. The protein concentration of lysates was quantified using the Bradford assay and 1 mg of lysate protein was used for IP. Before IP, the lysates were cleared again by incubating with 50 μl of 50% protein G agarose fast flow beads (EMD Millipore, 16--266) for 2 h at 4 °C with gentle agitation. The pre-cleared lysates were centrifuged at 3,000 × g for 1 min at 4 °C and the supernatant was incubated with 1 μl of anti-Flag M2 antibody in 1 ml total volume on an end-over-end rotator for 3 h at 4 °C. Subsequently, 50 μl of 50% protein G agarose beads were added to the lysate/antibody and the mixture was incubated at 4 °C overnight on an end-over-end rotator. Beads were washed three times with 500 μl of lysis buffer and the immunoprecipitated complex was eluted from the beads by boiling in 30 μl of 2 × SDS loading buffer composed of 100 mM Tris-HCl, pH 6.8, 4% w/v SDS, 0.2% bromophenol blue, 20% v/v glycerol and 200 mM DTT for 10 min at 65 °C.
Ubiquitin remnant immunoaffinity profiling
------------------------------------------
Proteome-wide ubiquitination sites were identified by using the PTMScan Ubiquitin Remnant Motif (K-ε-GG) Kit (Cell Signaling Technologies, 5562). Ubiquitinated peptides were enriched and identified by immunoprecipitation using a bead-conjugated monoclonal antibody generated against the sequence CXXXXXXK-ε-GGXXXXXX, where X is any amino-acid except cysteine and tryptophan, and K-ε-GG is a di-glycine moiety bound to the ε amino group of a lysine residue. Enrichment of ubiquitinated peptides in conjunction with liquid chromatography (LC) tandem mass spectrometry (MS/MS; EasyLC 1200 coupled to a Fusion Lumos operated in HCD high/high mode, Thermo Fisher Scientific) was performed according to the manufacturer's instructions. In brief, for each experiment ∼1--2 × 10^8^ cells were grown to 90% confluency. Cells were harvested, washed with 1 × PBS, and lysed in 10 ml of freshly prepared urea lysis buffer (20 mM HEPES-KOH, pH 8.0, 9 M urea, 1 mM Na~3~VO~4~, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM iodoacetamide). Using a microtip, the cell lysate was sonicated by three 15 s bursts at 15 W. The lysate was cleared by centrifugation for 15 min at 20,000 × g at room temperature. The cleared supernatant contained about 20 mg of total protein and was subjected to reduction (DTT final concentration of 5 mM for 30 min at 55 °C) and alkylation (iodoacetamide final concentration of 2 μg ml^−1^ for 15 min at room temperature) followed by overnight trypsinization (TPCK Treated, Worthington Biochemical Corporation). Peptides were desalted and purified using a Sep-Pak C18 column (WAT051910, Waters Corporation). Peptides were eluted with 20 ml Solvent B (0.1% TFA, 40% acetonitrile), frozen in liquid nitrogen, and lyophilized for 2 days to assure complete TFA removal. For immunoaffinity purification, the lyophilized peptides were dissolved in 1.4 ml IAP buffer containing 50 mM MOPS-NaOH, pH 7.2, 10 mM Na~2~HPO~4~, 50 mM NaCl. The peptide solution was added to a microtube of the anti-K-ε-GG motif antibody beads and immunoprecipitated on a rotator for 2 h at 4 °C. After IP, the bead slurry was centrifuged at 2,000 × g for 30 s and the supernatant was removed. The beads were washed three times with 1 ml of IAP buffer followed by two washes with 1 ml 1 × PBS. Peptides were eluted in 100 μl of 0.15% TFA, concentrated and desalted by stage tip chromatography, and subjected to nano LC-MS/MS analysis in technical replicate. LC-MS/MS data were queried against a Uniprots Human database (March 2016) using MaxQuant v. 1.5.3.28.
Sequence alignment and domain analysis
--------------------------------------
Amino-acid sequences were obtained from the NCBI database. ZNF598 proteins: human, NP_835461.2; mouse, NP_898972.1; *Xenopus*, NP_001119543.1; *Drosophila*, NP_611932.2; *Arabidopsis*, NP_566094.2: *S. cerevisiae*, NP_010552.3. UBE2D family proteins: human UBE2D1 protein, NP_003329.1; human UBE2D2, NP_003330.1; human UBE2D3, NP_871621.1; human UBE2D4, NP_057067.1. Trim23 proteins: human, NP_001647.1; mouse, NP_109656.1; *Xenopus*, XP_002934252.2. CBLL1 proteins: human, NP_079090.2; human ZNF645, NP_689790.1; mouse, NP_001240776.1; *Xenopus*, NP_001123714.1; *Drosophila*, NP_001260593.1. Protein sequence alignments were carried out using PRALINE[@b48][@b49] (<http://www.ibi.vu.nl/programs/pralinewww/>). Conservation analyses were carried out using Clustal Omega (<http://www.clustal.org/omega/>) in combination with Trex Newick Viewer (<http://www.trex.uqam.ca/index.php?action=newick&project=trex>) to obtain the radial tree. Domains analyses were performed via Interpro (≤<http://www.ebi.ac.uk/interpro/>). Disorder profile of proteins was mapped via DISOPRED3 (ref. [@b50]).
Data availability
-----------------
The NCBI SRA accession numbers for the sequencing data reported in this paper are SRR5137268 and SRR5137269 for ZNF598 PAR-CLIP experiments and SRR5137268 for HEK293 polyA mRNA-Seq. [Supplementary Data](#S1){ref-type="supplementary-material"} are also available on <https://rnaworld.rockefeller.edu/ZNF598>. The additional data that support the findings of this study are available from the corresponding author upon request.
Additional information
======================
**How to cite this article:** Garzia, A. *et al*. The E3 ubiquitin ligase and RNA-binding protein ZNF598 orchestrates ribosome quality control of premature polyadenylated mRNAs. *Nat. Commun.* **8**, 16056 doi: 10.1038/ncomms16056 (2017).
**Publisher's note:** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Material {#S1}
======================
###### Supplementary Information
###### Supplementary Data 1
###### Supplementary Data 2
###### Supplementary Data 3
###### Supplementary Data 4
###### Supplementary Data 5
###### Supplementary Data 6
The authors thank Edna Matta-Camacho, Pudchalaluck Panichnantakul, Connie Zhao (The Rockefeller University Genomics Resource Center) and Svetlana Mazel (The Rockefeller University Flow Cytometry Resource Center) for technical assistance, Witold Filipowicz (Friedrich Miescher Institute) for critical reading of the manuscript and Wen Li and Joachim Frank (Columbia University) for valuable discussions. This work was supported by CIHR MOP-7214 (N.S.) and NIH R01GM104962 (T.T.). A.G. held a postdoctoral fellowship from the Basque Government. S.M.J. is a recipient of CIHR postdoctoral Fellowship. C.M. was supported by the German Academic Exchange Service (DAAD). M.A. is a recipient of McGill Graduate Excellence Fellowship. C.C. is supported by FRQS and FRM postdoctoral fellowships. The Sohn Conferences Foundation and the Leona M. and Harry B. Helmsley Charitable Trust are acknowledged for mass spectrometer instrumentations.
T.T. is cofounder and advisor to Alnylam Pharmaceuticals. The remaining authors declare no competing financial interests.
**Author contributions** A.G. and S.M.J. designed, performed experiments, analysed data and wrote the manuscript; C.M. performed the microscopy and ubiquitin remnant immunoaffinity profiling; C.C. performed size exclusion chromatography; T.G. contributed to tRNA and codon bias analysis; P.M. developed the bioinformatics tools for metagene analysis; M.A. performed some co-immunoprecipitation assays; M.S. provided unpublished reagents; H.M. performed mass spectrometry analysis; T.T. and N.S. provided general oversight, analysed data, and edited the manuscript.
{#f1}
{#f2}
![The RING domain of ZNF598 is essential for ribosome stalling at polyA residing within coding sequences.\
(**a**) Schematic diagram of the reporter constructs sandwiching a polybasic oligopeptide track between the fluorescent GFP and mCherry (mCh) fusion protein. (ACT AGC)~6~ \[(ThrSer)~6~\] encoded a neutrally charged amino-acid tract that served as a control. (**b**) Detection of GFP and mCherry fluorescent signals by FACS analyses in samples from (**a**) shown as relative cell numbers. Each experiment was performed in triplicates. (**c**) Domain structures of ZNF598 full-length and truncation mutants, with numbers referring to the position of amino acids. (**d**) Detection of GFP and mCherry fluorescent signals by FACS analyses in samples expressing full-length or truncated versions of ZNF598 and transiently transfected with GFP-mCherry reporter with (ACT AGC)~6~ and (AAA)~12~ linkers. Each experiment was performed in triplicate. (**e**) Upper panel: autoradiograph of cross-linked, ^32^P-labelled, RNA- Flag/HA-ZNF598 immunoprecipitate. Flag/HA-tagged full-length ZNF598 or truncated versions were separated by SDS-PAGE after 4SU PAR-CLIP. Lower panel: Anti-HA Western blot analyses of the cross-linked RNA-protein immunoprecipitates; HC, antibody heavy chain.](ncomms16056-f3){#f3}
{ref-type="supplementary-material"} for a complete list of all detected peptides. (**b**) Volcano plots of the quantitative proteomic analysis of the ZNF598 interactome. The *t*-test difference based on label free quantitation for each detected protein is plotted against the negative logarithmic *P* value of a Welch's *t*-test. The intensity based absolute quantitation (iBAQ)[@b51] values correspond to the sum of all the peptide intensities divided by the number of observable peptides of a protein and are represented by point size. Proteins with a permutation-based FDR-value of \<5% and *t*-test difference \>0 are labelled in red and represent putative ZNF598 interactors (see also [Supplementary Fig. 15](#S1){ref-type="supplementary-material"} and [Supplementary Data 6](#S1){ref-type="supplementary-material"}). (**c**) Analysis of siRNA-mediated knockdown of UBE2D2, UBE2D3 or both UBE2D2 and UBE2D3 in HEK293 cells by western blot. C indicates mock transfection. (**d**) Detection of GFP and mCherry fluorescent signals by FACS analyses in samples from (**c**), for reporter constructs containing (ACT AGC)~6~ and (AAA)~12~ linkers. Each experiment was performed in triplicate. (**e**) Model for ZNF598-dependent ribosome stalling and RQC at cryptic polyadenylated protein-coding mRNAs.](ncomms16056-f4){#f4}
[^1]: These authors contributed equally to this work.
|
{
"pile_set_name": "PubMed Central"
}
|
19 Signs You’re Intelligent — Even If It Doesn’t Feel Like It
Stupid people tend to overestimate their competence, while smart people tend to sell themselves short. As Shakespeare put it in “As You Like It”: “The fool doth think he is wise, but the wise man knows himself to be a fool.”
That conventional wisdom is backed up by a Cornell University study conducted by David Dunning and Justin Kruger. The phenomenon is now known as the Dunning-Kruger effect.
So, if you’re not too sure about your own intellect, it actually might be a indication that you’re pretty intelligent — thoughtful enough to realize your limitations, at least.
Here are some subtle signs that you are considerably smarter than you think.
1. You took music lessons
Research suggests that music helps kids’ minds develop in a few ways:
• A 2011 study found that scores on a test of verbal intelligence among 4- to 6-year-olds rose after only a month of music lessons.
• A 2004 study led by Glenn Schellenberg found that 6-year-olds who took nine months of keyboard or voice lessons had an IQ boost compared with kids who took drama lessons or no classes at all.
Meanwhile, a 2013 study, also led by Schellenberg, suggested that high-achieving kids were the ones most likely to take music lessons. In other words, in the real world, musical training may only enhance cognitive differences that already exist.
2. You’re the oldest
Oldest siblings are usually smarter, but it’s not because of genetics, one study found.
Norwegian epidemiologists used military records to examine the birth order, health status, and IQ scores of nearly 250,000 18- and 19-year-old men born between 1967 and 1976. Results showed that the average firstborn had an IQ of 103, compared to 100 for second children and 99 for third children.
The New York Times reports: “The new findings, from a landmark study published [in June 2007], showed that eldest children had a slight but significant edge in IQ — an average of three points over the closest sibling. And it found that the difference was not because of biological factors but the psychological interplay of parents and children.”
For this and other reasons, firstborns tend to be more successful (but not that much more successful) than their siblings.
3. You’re thin
For a 2006 study, scientists gave roughly 2,200 adults intelligence tests over a five-year period and results suggested that the bigger the waistline, the lower the cognitive ability.
Another study published that same year found that 11-year-olds who scored lower on verbal and nonverbal tests were more likely to be obese in their 40s. The study authors say that smarter kids might have pursued better educational opportunities, landed higher-status and higher-paying jobs, and therefore ended up in a better position to take care of their health than their less intelligent peers.
Meanwhile, a more recent study found that, among preschoolers, a lower IQ was linked to a higher BMI. Those researchers also say environmental factors are at play, since the relationship between BMI and smarts was mediated by socioeconomic status.
4. You have a cat
A 2014 study of 600 college students found that individuals who identified as “dog people” were more outgoing than those who identified as “cat people,” according to a test that measures personality and intelligence.
But guess what? Those same cat people scored higher on the part of the test that measures cognitive ability.
5. You were breastfed
2007 research suggests that babies who are breastfed might grow up to be smarter kids.
In two studies, the researchers looked at more than 3,000 children in Britain and New Zealand. Those children who had been breastfed scored nearly seven points higher on an IQ test — but only if they had a particular version of the FADS2 gene. (That version of the gene was present in roughly equal numbers among kids who were and weren’t breastfed.)
Figuring out the exact mechanism of this relationship between FADS2, breastfeeding, and IQ will require further study, the scientists noted in their paper on the finding.
6. You’ve used recreational drugs
A 2012 study of more than 6,000 Brits born in 1958 found a link between high IQ in childhood and the use of illegal drugs in adulthood.
“In our large population-based cohort study, IQ at 11 years was associated with a greater likelihood of using selected illegal drugs 31 years later,” wrote researchers James W. White, Catharine R. Gale, and David Batty.
They conclude that “in contrast to most studies on the association between childhood IQ and later health,” their findings suggest “a high childhood IQ may prompt the adoption of behaviors that are potentially harmful to health (i.e., excess alcohol consumption and drug use) in adulthood.”
7. You’re lefthanded
Left-handedness used to be associated with criminality, and researchers are still unclear as to whether and why there are slightly more lefties among criminal populations.
More recent research associates left-handedness with “divergent thinking,” a form of creativity that allows you to come up with novel ideas from a prompt — at least among men.
In her review of a 1995 paper, New Yorker reporter Maria Konnikova writes:
The more marked the left-handed preference in a group of males, the better they were at tests of divergent thought.
Left-handers were more adept, for instance, at combining two common objects in novel ways to form a third — for example, using a pole and a tin can to make a birdhouse. They also excelled at grouping lists of words into as many alternate categories as possible.
8. You’re tall
A 2008 Princeton study of thousands of people found that taller individuals scored higher on IQ tests as kids and earned more money as adults.
The researchers write: “As early as age 3 — before schooling has had a chance to play a role — and throughout childhood, taller children perform significantly better on cognitive tests.”
9. You drink alcohol regularly
Evolutionary psychologist Satoshi Kanazawa and colleagues found that, among Brits as well as Americans, adults who had scored higher on IQ tests when they were kids or teens drank more alcohol, more often in adulthood than those who had scored lower.
10. You learned to read early
In 2012, researchers looked at nearly 2,000 pairs of identical twins in the UK and found that the sibling who had learned to read earlier tended to score higher on tests of cognitive ability.
The study authors suggest that reading from an early age increases both verbal and nonverbal (e.g. reasoning) ability, as opposed to the other way around.
11. You worry a lot
A growing body of research suggests that anxious individuals may be smarter than others in certain ways, according to Slate’s coverage of several different studies on anxiety.
In one study, for example, researchers asked 126 undergrads to fill out questionnaires in which they indicated how often they experienced worry. They also indicated how often they engaged in rumination, or thinking continuously about the aspects of situations that upset them, as psychologist Dr. Edward Selby reported in Psychology Today.
Results showed that people who tended to worry and ruminate a lot scored higher on measures of verbal intelligence, while people who didn’t do much worrying or ruminating scored higher on tests of nonverbal intelligence.
12. You’re funny
In one study, 400 psychology students took intelligence tests that measured abstract reasoning abilities and verbal intelligence.
Then they were asked to come up with captions for several New Yorker cartoons, and those captions were reviewed by independent raters.
As predicted, smarter students were rated as funnier.
13. You’re curious
In University of London business psychology professor Tomas Chamorro-Premuzi’s post for Harvard Business Review, he discussed how the curiosity quotient and having a hungry mind makes one more inquisitive.
Regarding the importance of CQ, he wrote that, “It has not been as deeply studied as EQ and IQ, but there’s some evidence to suggest it is just as important when it comes to managing complexity in two major ways. First, individuals with higher CQ are generally more tolerant of ambiguity. This nuanced, sophisticated, subtle thinking style defines the very essence of complexity. Second, CQ leads to higher levels of intellectual investment and knowledge acquisition over time, especially in formal domains of education, such as science and art (note: this is of course different from IQ’s measurement of raw intellectual horsepower).”
A Goldsmiths University of London study found that intellectual investment, or “how people invest their time and effort in their intellect,” plays a major part in cognitive growth.
14. You’re messy
A study published in “Psychological Science” by the University of Minnesota Carlson School of Management’s Dr. Kathleen Vohs revealed that working in an untidy room actually fuels creativity.
In the study, 48 participants were asked to come up with unusual uses for a pingpong ball. The 24 individuals working in neat rooms came up with substantially less creative responses than the individuals working in cluttered rooms.
So if you are a pack rat, tell everyone you’re just fueling your sense of creativity and innovation the next time someone tells you to clean up your act.
15. You didn’t have sex until after high school
High schoolers with higher IQs are more likely to be virgins than those with average or lower IQs, according to a study from the University of North Carolina Chapel Hill. The core sample looked at 12,000 teens from the 7th to the 12th grade.
Not only were the teens with the higher IQs more likely to be virgins, they were also less likely to kiss or hold hands with a romantic partner. A number of explanations have been put forward by the science blog Gene Expression to explain this gap, including suggestions that smart people possess lower sex drives, are risk adverse, or simply less able to find sexual partners.
16. You’re a night owl
One study published in the “The Official Journal of the International Society for the Study of Individual Differences” found that, when all other variables are factored out, night owls tend to beat out early birds in terms of intellect. It concluded that ethnographic evidence indicates that “nocturnal activities” were rarer in the ancestral environment. That means that more intelligent individuals are more likely to stay up late because smarter people are more likely to “espouse evolutionarily novel values.”
17. You don’t always have to try hard
This isn’t to say that laziness is a sign of being smart. But it is fair to say that smart people simply don’t always have to try as hard as “strivers” who fight to build up their skills — at least in certain fields.In an opinions piece for The New York Times, psychologists David Z. Hambrick and Elizabeth J. Meinz cited a Vanderbilt University study of highly intelligent young people.
The study tracked 2,000 people who scored in the top 1% of the SAT by the age of 13. Hambrick and Meinz wrote that, “The remarkable finding of their study is that, compared with the participants who were “only” in the 99.1 percentile for intellectual ability at age 12, those who were in the 99.9 percentile — the profoundly gifted — were between three and five times more likely to go on to earn a doctorate, secure a patent, publish an article in a scientific journal or publish a literary work. A high level of intellectual ability gives you an enormous real-world advantage.”
They concluded that while striving to be smarter is commendable, there are certain innate abilities that can’t always be learned.
18. You don’t constantly need to be around people
We tend to be happier when we spend more time with friends.
That is, except for the hyper-intelligent people among us. As Business Insider previously reported, a Singapore Management University and London School of Economics study found that smart people differ from the rest of us when it comes to happiness levels and socialization.
So if you adore your friends but require a solid chunk of “me time” too, that could be a sign that you’re super smart.
19. You live in a ‘walkable’ city
As it turns out, geography could be a pretty good indicator of how smart you are. As Chris Weller wrote for Tech Insider, Smart Growth America’s study found that cities built for pedestrians tend to attract more college grads than cities built for cars. Washington DC scored highest in education and second in walkability, while New York City was voted “the most walkable metro area” in the US.
Drake Baer and Chelsea Harvey contributed to a previous version of this article.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Как поснимать checkbox
Имеется Чек Бокс вот такого вида, как на него нажать, при помощи, Python + Selenium?
<input data-v-3719c1ac="" type="checkbox" testid="ns-chbox">
A:
Альтернативный, более лаконичный, и, кстати, быстрый способ нахождения этого элемента - это "by css selector":
checkbox = browser.find_by_css_selector("input[testid=ns-chbox]")
checkbox.click()
|
{
"pile_set_name": "StackExchange"
}
|
Q:
принадлежность переменной к списку в Python
есть функция:
def checkSomething(var,varList):
if var in varList:
doSomeStuff()
else:
print("error")
передаваемые значения таковы, что ветка else не должна выполняться(например, var=354, varList=[123,321,354]). Вывод переданных значений перед проверкой условия это подтверждает, однако каким-то непостижимым образом выполняется ветка else.
при этом если попробовать то же самое запустить в командной строке(без всяких фреймворков и библиотек) то все работает как надо(т.е. else не выполняется)
вопрос в том, как такое вообще возможно и как этого избежать?
A:
в общем я сам дурак, проблема была в том, что var на самом деле был не int (как я считал), а unicode
|
{
"pile_set_name": "StackExchange"
}
|
SM U-23 (Germany)
SM U-23 was one of the 329 U-boats serving in the Imperial German Navy in World War I.
U-23 was engaged in the naval warfare and took part in the First Battle of the Atlantic.
U-23 served on three war patrols, sinking a total of seven ships for . She was baited by the Q ship Princess Louise and torpedoed by at , off Fair Isle, in Shetland, Scotland. Twenty four men died and 10 survived.
Summary of raiding history
References
Notes
Citations
Bibliography
Category:World War I submarines of Germany
Category:Maritime incidents in 1915
Category:U-boats sunk in 1915
Category:1912 ships
Category:Ships built in Kiel
Category:U-boats sunk by British submarines
Category:Type U 23 submarines
Category:U-boats commissioned in 1913
Category:World War I shipwrecks in the Atlantic Ocean
Category:Shipwrecks of Scotland
Category:1915 in Scotland
Category:Fair Isle
Category:History of Shetland
|
{
"pile_set_name": "Wikipedia (en)"
}
|
The use of chemiluminescence and the ELISA spot assay to identify and enumerate rare immunoglobulin switch variants.
The use of chemiluminescence and the ELISA spot assay for identifying rare immunoglobulin switch variants is described. The technique utilizes nitrocellulose membranes and allows rapid screening of a large number of cells. The number of spots can be recorded either manually or automatically by using a commercially available colony counting program. This modification of the ELISA spot assay makes it less labor intensive and time consuming and can be adapted for the search for rare cells secreting small amounts of Ig or other macromolecules.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The present invention relates to improvements of a workpiece feeding device in a sewing machine, which, in particular, is installed with an endless feeding member such as a feed wheel, a feed belt or a feed chain steadily contacting a workpiece.
In U.S. Pat. No. 4,271,776 there is disclosed a sewing machine having a feeding device with such an endless feeding member intermittently driven by employing a one-way coupling in combination with a reversing gear device. As the one-way coupling is applied for converting an oscillating movement into an intermittent rotating movement of one direction, the reversing gear device serves for reversing the intermittent movement to make possible reversal of the feed movement for the workpiece to be sewn.
The reversing gear device of this known feeding device incorporates a clutch and gears for reversing the movement at which both elements are exposed to wear. Furthermore, the known feeding device is composed of an extensive number of elements of high quality so that this feeding device cannot be produced at low cost.
In U.S. Pat. No. 3,141,428 there are employed one-way couplings in a plurality of arrangements in which the individual couplings are separately and in different phases driven so as to generate a quasi rotating movement. To achieve such a movement a uni-directional arrangement of the couplings is necessary, i.e. the one-way couplings are arranged so as to transmit a torque in a common direction. By arranging one-way couplings in this manner, the reversing of the output movement may be achieved only with the application of a reversing gear device, as disclosed in the first-mentioned U.S. patent.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
High concentrations of cannabinoids activate apoptosis in human U373MG glioma cells.
Cannabinoids bind to two G-protein-coupled receptors, CB1 and CB2, expressed by neurons and cells of the immune system, respectively. Glioma cells (astrocyte-derived brain tumor cells) express cannabinoid receptors, and numerous in vitro and in vivo studies performed in rodents have concluded that apoptosis could be induced by cannabinoids in these cells. Whether this also applies to human cells is controversial; we, therefore, assessed the effect of cannabinoids on human glioma cell viability with the human astrocytoma cell line U373MG. We report here that U373MG human glioma cells are sensitive only to high concentrations of cannabinoids (>5 microg/ml for Delta(9)-THC). Similar concentrations of the compounds promoted a rapid activation of extracellular-regulated kinase and c-Jun NH2-terminal kinase, suggesting that cannabinoid receptors are functional in U373MG cells. Nevertheless, these kinases are not involved in cannabinoid-induced cell death in U373MG cells, insofar as blocking their activation with specific inhibitors does not reduce cell death. CB1 is expressed in U373MG cells and is involved in cannabinoid-induced cell death, in that blocking its activation with a specific antagonist (AM251) almost totally prevented cell death following incubation of the cells with Delta(9)-THC. In addition, as already reported, some cannabinoids may have modest proproliferative properties in U373MG cells. Human U373MG glioma cells are sensitive only to very high, pharmacologically irrelevant concentrations of cannabinoids, so it seems unlikely that cannabinoids would constitute promising molecules for treating malignant astrocytoma; they do not induce glioma cell death at doses that could be applied safely to humans.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
Extrema of Real-Valued Functions
Let $ f(x,y) = 1 + xy + x - 2y $ and let $ D $ be the trangular region in $ \Bbb R^2 $ with vertices $ (1, -2) $ , $ (5, -2), $ and $ (2, 1) $. Find the absolute maximum and minimum values of $ f $ on $ D $. Give all the points where these extreme values occur.
A:
Welcome to the site. Normally you should include your own thoughts on the problem, and tell us where you are stuck. I will give you some general pointers for your problem.
We have $f_x(x,y) = y+1$ and $f_y(x,y) = x-2$. These two derivatives are simultaneously $0$ at $(x,y) = (2,-1)$. Check if this point is inside of your triangle.
You also need to check the values of your function on the boundary of the triangle. For instance, the edge connecting $(1,-2)$ to $(5,-2)$ is part of the line $y=-2$ in the $(x,y)$-plane. Plug this into your function and see what it looks like: $f(x,-2) = 1-2x+x+4 = 5-x$. Then check where this function has its maximum on this particular side of the triangle. Do this for all three sides.
|
{
"pile_set_name": "StackExchange"
}
|
Presenilin I interaction with cytoskeleton and association with actin filaments.
Presenilin I (PSI) has been shown to interact with microfilament-associated proteins of the filamin family. Here, we investigated a possible association of PSI with the cytoskeleton. Immunoblotting of detergent-insoluble fractions of rat brain homogenate revealed enrichment of neuron-specific 36 and 14 kDa proteolytic fragments of PSI, whereas 30 and 20 kDa fragments were found in the detergent-soluble fraction. Specific severing of microfilaments with gelsolin in the detergent-insoluble pellet and subsequent centrifugation led to the detection of both actin and PSI fragments in the supernatant. In addition, in vitro translated PSI cosedimented with actin filaments. Our findings provide biochemical evidence for the association of PSI fragments with actin filaments.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Rapid and selective sampling of IgG from skin in less than 1 min using a high surface area wearable immunoassay patch.
Microprojection array (MPA) patches are an attractive approach to selectively capture circulating proteins from the skin with minimal invasiveness for diagnostics at the point-of-care or in the home. A key challenge to develop this technology is to extract sufficient quantities of specific proteins from within the skin to enable high diagnostic sensitivity within a convenient amount of time. To achieve this, we investigated the effect of MPA geometry (i.e. projection density, length and array size) on protein capture. We hypothesised that the penetrated surface area of MPAs is a major determinant of protein capture however it was not known if simultaneously increasing projection density, length and array size is possible without adversely affecting penetration and/or tolerability. We show that increasing the projection density (5000-30,000 proj. cm-2) and array size (4-36 mm2) significantly increases biomarker capture whilst maintaining of a similar level tolerability, which supports previous literature for projection length (40-190 μm). Ultimately, we designed a high surface area MPA (30,000 proj. cm-2, 36 mm2, 140 μm) with a 4.5-fold increase in penetrated surface area compared to our standard MPA design (20,408 proj. cm-2, 16 mm2, 100 μm). The high surface area MPA captured antigen-specific IgG from mice in 30 s with 100% diagnostic sensitivity compared with 10-30 min for previous MPA immunoassay patches, which is over an order of magnitude reduction in wear time. This demonstrates for the first time that MPAs may be used for ultra-rapid (<1 min) protein capture from skin in a time competitive with standard clinical procedures like the needle and lancet, which has broad implications for minimally invasive and point-of-care diagnostics.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
After years of playing with the same guys, we are finally gonna start a keeper league next year. There are many ideas as to how exactly we will determine keepers. I was wondering what your experiences are with keeper leagues and what your preference is. Also any ideas as to certain rules about who you can and cannot keep. I have heard things like any 5 players and 2 players that have less than 3 full years in the league to keeping 4 hitter and 4 pitchers. Any and all ideas are welcome. My league is very undecided so far, so maybe if I have some input I can help sway some of the guys as to how the keeper issue can be handled. There is talk also of making it an auction league, and we're not sure how the keeper system would work with that. Using this years team as an example, I snatched up Aaron Hill off free agencies, so would I keep him for next year for only a dollar? And if so, how long is his value only a dollar? How do you guys handle things like that?
I'm the Cleave, so thats what you call me. That, or um, Cleaver, or his Cleaveness, or um, El Cleaverino, if your not into the whole brevity thing.
cleaver596 wrote:After years of playing with the same guys, we are finally gonna start a keeper league next year. There are many ideas as to how exactly we will determine keepers. I was wondering what your experiences are with keeper leagues and what your preference is. Also any ideas as to certain rules about who you can and cannot keep. I have heard things like any 5 players and 2 players that have less than 3 full years in the league to keeping 4 hitter and 4 pitchers. Any and all ideas are welcome. My league is very undecided so far, so maybe if I have some input I can help sway some of the guys as to how the keeper issue can be handled. There is talk also of making it an auction league, and we're not sure how the keeper system would work with that. Using this years team as an example, I snatched up Aaron Hill off free agencies, so would I keep him for next year for only a dollar? And if so, how long is his value only a dollar? How do you guys handle things like that?
El Cleaverino,
If you're going to make it a keeper league, you should begin with a clean slate. I.e., no guys from this past year. Draft entire new teams.
Go with the auction. It's much easier for keepers. Then you just put in an inflation clause. I use a $5 inflation clause in my longest running league. So if you draft Votto for $20 this year, then you can keep him for $25 in 2011, then $30 in 2012 and so on. This way people all have keepers and eventually all players end up back in the pool of players to get redrafted.
Only keep 5 players.
Use a $260 cap and a $100 FAAB. So you draft with the $260, then you have $100 in season to bid on players once a week.
Make it deep enough with corner and middle infielders or two utility players.
If you want me to look at your team, post the team. Don't post a link to another site where the team is.Have you given me all the info I need to judge your team? The number of teams in the league is a good start for the big overall questions.Is your league H2H? Roto?I don't know who's on your waivers. Don't just ask me who you should pick up. Give me names to choose from.If you only have one team, post your team in your signature with the league parameters.I don't know every single matchup for next week, so if you want me to choose a player for the following week and you think the matchups are important, tell me who they're facing.
yeah for sure we will redraft. I was just using Hill as an example. As far as CI and MI, this has been an idea that has never taken with this group of guys. We use only 3 OF and 2 UTIL. Last year I tried to push for expanded rosters, 5 OF and the MI and CI spots, but only a few guys were interested. They feel the talent level will decrease significantly to the point of having to use bums as starters. I told them to draft better and keep a better eye on the free agents out there, but this fell on deaf ears. The thing is, only half of the guys in the league are REAL fantasy ballers, with the rest playing for fun more than to win. We have one guy that has finished in the bottom third in both baseball and football for 4 years running. We can't kick him out because he actually plays the entire year and is an active manager, he just sucks. But its guys like him that arent interested in adding more starting positions because they lack the knowledge to fill that many spots.
One other question, how many bench spots do you prefer. I think this past year we used 5, which some argued was too few, other loved it because that meant there was actually usable players in free agency.
I'm the Cleave, so thats what you call me. That, or um, Cleaver, or his Cleaveness, or um, El Cleaverino, if your not into the whole brevity thing.
If you want me to look at your team, post the team. Don't post a link to another site where the team is.Have you given me all the info I need to judge your team? The number of teams in the league is a good start for the big overall questions.Is your league H2H? Roto?I don't know who's on your waivers. Don't just ask me who you should pick up. Give me names to choose from.If you only have one team, post your team in your signature with the league parameters.I don't know every single matchup for next week, so if you want me to choose a player for the following week and you think the matchups are important, tell me who they're facing.
A variation on Grey's $5 annual inflation rule for keeper salaries: in my auction keeper league, a player is assigned a three-year "contract" when he is drafted or picked up off waivers, and he can be kept for up to those three years. E.g., I drafted Jose Lopez for $10 at last year's auction, so Lopez was assigned a 2009 contract and I can keep him for 2010 and 2011 at $10 (unlikely, but I could if I wanted to). I also picked up Dice-K for $1 in the Free Agent Auction Bidding process when he was hurt last year, so Dice-K also has a 2009 contract and can be kept for 2010 and 2011 for $1 (more likely).
We also have a twist that allows an owner to purchase an option to keep a player for a fourth year; to purchase that option, the owner must decide to do so before the third year, and the player's salary then goes up by $5 for both the third and the fourth years. So for example, I bought Tim Lincecum at the 2008 draft for $20 (that has turned out nicely for me). Before this year's draft, I have to decide whether I want to purchase an option to keep Lincecum for 2011 (which would be my fourth year of keeping him); if I do so, Lincecum's salary will increase to $25 for both 2010 and 2011.
It's a little complicated (every year at least one owner gets confused by it), but overall I really like the system. I like the hard cap of 4 years on keeping a player--that means that a player like Hanley Ramirez, who I picked up on the waiver wire in Spring 2006 for $2, is back on the auction market this year, whereas under a $5 annual inflation system Hanley likely would be kept this year at $22. But there are reasons in favor and against either system; just thought I'd throw out an alternative to you.
I like the idea of only keeping players for a maximum of 4 years. Maybe we will try some combination of contracts with inflated prices each year. Thinking about starting a keeper league has me all giddy. I know football has just ended, and I should take a break, but I just jumped right back into baseball.
Also, who offers the best options in the way of keepers? I like ESPN because of free live scoring.
I'm the Cleave, so thats what you call me. That, or um, Cleaver, or his Cleaveness, or um, El Cleaverino, if your not into the whole brevity thing.
Another possibility if you decide not to go with an auction league is to inflate them by draft round. For instance, say I picked Tulo in the 2nd round and decided to keep him. I would give up my first round pick the following year. If I picked up, say, Justin Heyward in the 13th round, I would give up my 12th round the following year. This places a fair amount of emphasis on finding and keeping new talent and sleepers. And obviously, you cannot keep a 1st round pick.
|
{
"pile_set_name": "Pile-CC"
}
|
Nutritional Information
Cautions
Contains Peanuts. May Contain other Nuts.
Vegetarian
Customer reviews - Whole Earth Original Crunchy Peanut Butter 340g
Reviews
Peanut Butter - Sat 28th Nov 2015
This has a delicious earthy crunch that is made for celery sticks. However after hearing about the ecological damage done by growing palm fruit I am disappointed to see palm oil used in this product. I will look for another alternative in future.
Reviewer's Name: Miss Ty
Addictive! - Wed 29th Apr 2015
Very very moreish! And very crunchy too. It passed our spreadability test with ease and good to know it's a healthy option.
Reviewer's Name: Karen
- Mon 24th Mar 2014
Peanut buttery goodness, can't really go wrong.
Reviewer's Name: C O'connell
very filling - Tue 28th Jan 2014
I feel the crunchy texture adds a little something extra over the smooth version as it gives me something extra to munch on and enjoy more, but I suppose it depends on what it's used on or with.
Reviewer's Name: JM
- Wed 13th Nov 2013
My husband is a big fan of peanut butter, he likes this one a lot, good sized jar and value for money.
Reviewer's Name: lorna wallace
- Tue 15th Oct 2013
Try spreading on rice cakes or ryvitas, then spreading strawberry jam on top and topping with sliced bananas, delicious.
Reviewer's Name: L E Champion
Our favourite. - Tue 16th Jul 2013
This is delicious peanut butter. Whole Earth have it spot on. Not too grainy, it has a lovely nutty crunch, not too salty, spreads well, I can't fault it. I wonder if they could sell it in litre tubs as we go through so much of it. My son is a lover of the smooth peanut butter, and it is just as yummy. I wont consider buying other brands now, as none compare to this.
Reviewer's Name: Amye Armstrong
- Sun 7th Jul 2013
I've repurchased this item many times before, this peanut butter is great added to a peanut butter blondie mixture, mix with some agave syrup and put inside a split banana (skin still on) then placed under a grill or simply spread on ryvitas or rice cakes and topped with jam and sliced bananas. Delicious.
Reviewer's Name: L E Champion
The bestest peanut butter in the world - Wed 10th Oct 2012
The subject line says it all!
Reviewer's Name: Miss H C Schofield
- Wed 20th Oct 2010
Best peanut butter in the world!
Reviewer's Name: A L Williams
- Sun 4th Mar 2007
You really have to try this item - the flavour is incredible and you will find yourself eating the whole lot before you know it - just dip your finger in and lick it off - scrumptious
|
{
"pile_set_name": "Pile-CC"
}
|
Approach to the Assessment and Management of Adult Patients With Atopic Dermatitis: A Consensus Document. Section IV: Treatment Options for the Management of Atopic Dermatitis.
The objectives of therapy for atopic dermatitis (AD) are to reduce skin inflammation and pruritus, restore skin barrier function, and improve quality of life (QoL). Treatments can be classified as moisturizing and basic care, topical therapy, phototherapy, and systemic therapy. In this review, we summarize the treatments for AD and recommendations for their use.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
In general, a flat panel display device such as a PDP or a LCD is equipped with an antireflection film for minimizing the reflection of light incident from the outside.
As a method for minimizing the reflection of light, there exist a method (anti-glare: AG coating) in which a filler such as an inorganic fine particle is dispersed in a resin and coated on a substrate film to impart irregularities; a method (anti-reflection: AR coating) of using the interference of light by forming a plurality of layers having different refractive indexes on a substrate film; or a method for mixing them, etc.
Among them, in the case of the AG coating, the absolute amount of the reflected light is equivalent to that of a general hard coating, but a low reflection effect can be obtained by reducing the amount of light entering the eye using light scattering through irregularities. However, since the AG coating has poor surface sharpness due to the surface irregularities, many studies on AR coating have been conducted recently.
As for a film using the AR coating, a multi-layer structure in which a hard coating layer (high refractive index layer), a low reflective coating layer, and the like are laminated on a substrate film has been commercialized. However, in the case of a clear coating having no irregularities on the surface, there are disadvantages in that the anti-glare effect is not sufficient and a defect inside the display is easily visible.
Accordingly, many studies have been actively conducted to minimize the reflection of light incident from the outside while maintaining the sharpness of the image. However, as the resolution of the display increases, the degree of improvement of the physical properties is insufficient. Recently, there are cases in which a COT (color filter on TFT) structure is used as a liquid crystal panel of a liquid crystal display device.
When a liquid crystal panel having such a COT structure is used, the reflectivity of the inside of the panel is increased due to the metals included in the electrodes and the like, and thus the optical characteristics of the display such as external black visibility and contrast ratio are reduced. Accordingly, there is a need to develop a surface coating film having an excellent antireflection function while increasing the yield of the display panel.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
An unpublished opinion of the North Carolina Court of Appeals does not constitute
controlling legal authority. Citation is disfavored, but may be permitted in
accordance with the provisions of Rule 30(e)(3) of the North Carolina Rules of
A p p e l l a t e P r o c e d u r e .
NO. COA13-1433
NORTH CAROLINA COURT OF APPEALS
Filed: 1 July 2014
STATE OF NORTH CAROLINA
Iredell County
v. Nos. 08 CRS 59811-15, 59892-
96; 09 CRS 7498-99, 7500; 12
CRS 51941-43
MARSHALL LEE ELLER
Appeal by Defendant from Judgments entered 22 March 2013 by
Judge Joe Crosswhite in Iredell County Superior Court. Heard in
the Court of Appeals 21 May 2014.
Attorney General Roy Cooper, by Assistant Attorney General
Alexandra Gruber, for the State.
Glover & Petersen, P.A., by James R. Glover and Ann B.
Petersen, for Defendant.
STEPHENS, Judge.
Factual Background and Procedural History
On 12 October 2009, Defendant Marshall Lee Eller was
indicted on sixteen counts of indecent liberties with a child
-2-
and one count of first-degree sex offense.1
Prior to the trial, the State moved for joinder of all
charges. The trial court granted the motion and found that the
charges constituted a single scheme or plan, noting that the
same attorney represented Defendant on all charges, the facts
surrounding each charge were similar in scheme or plan, joinder
would not impair Defendant’s ability to present a defense, and
the charges were “not so separate in time and place or so
distinct in circumstance as to render their consolidation unjust
or prejudicial to . . . Defendant.” The case came on for trial
on 18 March 2013, and verdicts were rendered on 22 March 2013.
The State’s evidence tended to show the following:
Over the span of twenty-two years, Defendant engaged in
indecent liberties with three children: Defendant’s
stepdaughter, “Mary”; Mary’s childhood friend, “Brenda”; and
Defendant’s stepgranddaughter, “Alison.”2 The incidents involving
Mary took place between 1985 and 1992, beginning when she was
nine years old. The incidents involving Brenda took place
1
Neither the indictment nor the verdict for the charge of first-
degree sex offense appears in the record. However, both the
record and transcript indicate that Defendant was charged with
and found not guilty of this offense.
2
Pseudonyms are used to protect the juveniles’ identities.
-3-
between August of 1987 and April of 1988, beginning when she was
eleven years old. The incidents involving Alison took place
between 2004 and 2008, beginning when she was eleven years old.
A. Mary (1985 to 1992)
Mary testified to two specific incidents between her and
Defendant as well as a series of reoccurring incidents that took
place from when she was nine years old until she was eighteen.
In addition, Mary testified to two other types of reoccurring
incidents, the first of which took place beginning when she was
ten years old until she was thirteen and the second of which
went on as she grew older. The first specific incident between
Defendant and Mary occurred when Mary was about nine years old.
Defendant took Mary, who lived with Defendant until she was
eighteen, into his bedroom, wrestled with her, lifted her shirt,
and kissed her on the stomach and chest. The second specific
incident occurred when Mary was approximately twelve years old.
Defendant instructed Mary to lie on the floor in his bedroom,
where he rubbed her back and bottom through her nightgown,
reached his hand underneath her underwear, and placed his finger
in her vagina.
The series of reoccurring incidents took place from the
time Mary was ten until she was eighteen. Defendant would
-4-
regularly instruct her to sit on his lap, raise her shirt,
fondle her, and put his mouth on her breasts for roughly fifteen
minutes at a time. About once a week, Defendant would also place
Mary’s hand “on the outside of his pants at his crotch area”
where she could feel his erect penis. About three times a week,
Defendant would come to Mary’s room at night and, as she lay on
her stomach, lift her nightgown, rub her back, pull down her
underwear slightly, and rub her bottom. During these bedtime
visits, Defendant would also attempt to roll Mary over or put
his hands underneath her in an attempt to touch her breasts.
These visits occurred “pretty often” and would last “[thirty]
minutes to an hour at times.”
The first other reoccurring incident took place when Mary
was between the ages of ten and thirteen. While staying at a
house he owned and rented to his sister, Defendant took Mary for
motorcycle rides and, in a secluded area, “would turn around and
. . . feel [Mary’s] breasts.” Second, as Mary got older,
Defendant “[attempted] to come into the bathroom whenever [Mary]
was in the shower.” Defendant would open the shower curtain,
peek at Mary, and touch her breasts.
Mary testified that “most of the time,” the incidents
occurred in the mobile home that Defendant shared with Mary’s
-5-
mother. Other times, the incidents occurred when Defendant and
Mary were in a car or in the house Defendant owned and rented to
his sister.
B. Brenda (1987 to 1988)
Brenda came to know Defendant through his stepdaughter,
Mary. The first incident between Defendant and Brenda occurred
when Defendant entered Mary’s room to tuck in both Mary and
Brenda during a sleepover. As Defendant tucked in the two girls,
he “went up [Brenda’s] shirt and [rubbed her] breasts.” He then
put “his hand . . . under [her] panties . . . [and rubbed] the
outside of [her] vagina.”
A second incident occurred in spring 1988 when Defendant
invited Brenda on a motorcycle ride with him. Defendant stopped
his motorcycle in the woods and “took his hand and put it on
[Brenda’s] . . . vagina outside of [her] clothes and started
rubbing [her].”
C. Alison (2004 to 2008)
In 1995, Defendant sold his rental property and purchased a
house. In 2004, Defendant installed a pool at that residence.
-6-
Alison and her family3 spent almost every weekend at Defendant’s
house between 2004 and 2008. Defendant also visited Alison at
her home.
According to Alison, the first incident with Defendant
occurred in August of 2004 when Alison was about eleven years
old. In his garage, Defendant “put his hands up [Alison’s] skirt
on the outside of [her] panties, and [Defendant] rubbed [her]
butt.”
A second incident occurred when Alison was about twelve.
Defendant gave her a piggyback ride in the pool at his
residence. During the piggyback ride, Defendant rubbed and
squeezed Alison’s buttocks and thighs. He then “told [her] that
he was sorry that he made [her] feel uncomfortable and that if
he ever made [her] feel uncomfortable again that [she] should
tell [Defendant], and he wouldn’t do it anymore.”
A third incident occurred in 2008 when Alison was about
fifteen. Defendant and Alison were alone in Defendant’s basement
when he “put his hand on [her] thigh and was rubbing it and then
moved [his hand] down towards [her] vagina” and touched Alison’s
vagina through her clothing.
Although Alison did not cite specific dates, she testified
3
Alison’s father, Michael, is Mary’s brother.
-7-
to two additional incidents involving Defendant. First, she
testified that Defendant visited her and her brother at her
home. After sending Alison’s brother to take a shower, Defendant
approached Alison and rubbed and squeezed her breasts through
her shirt as she sat at her computer. Second, after Defendant’s
wife went to bed, Defendant attempted to kiss Alison on the
mouth.
Alison also testified to reoccurring incidents of
misconduct. “There were several times that [Alison] would be in
the basement, and [Defendant] would come down and just rub [her]
on the butt from behind, and he would take [her] hands and put
them on his penis.” Additionally, “[a] few times in the car,
[Defendant] would . . . rub [Alison’s] leg while he was
driving.” Besides these few times in the car, the touching
occurred “[n]owhere else besides [Alison’s and Defendant’s]
houses.”
At the close of the State’s evidence, Defendant moved to
dismiss the charges against him. The trial court denied the
motion. Thereafter, Defendant testified, denied all the
allegations, and again moved to dismiss the charges. Again, the
trial court denied the motion.
The jury returned guilty verdicts on sixteen counts of
-8-
indecent liberties with a child. The jury found Defendant not
guilty on one count of first-degree sex offense. Defendant gave
notice of appeal in open court.
Discussion
On appeal, Defendant contends the trial court erred by (1)
joining the charges arising from the incidents occurring between
1985 and 1992 with those arising from the incidents occurring
between 2004 and 2008 and (2) denying Defendant’s motion to
dismiss one of the three charges of indecent liberties with
Brenda. We hold that the trial court committed harmless error in
joining all the charges for trial. We vacate one of the three
convictions of indecent liberties with Brenda and remand for
resentencing.
I. Joinder of Charges
A. Transactional Relationship
As noted above, the trial court joined the 1985–1992
charges with the 2004–2008 charges on the grounds that “the
transactions are connected together and . . . constitute a
single scheme or plan.”
On appeal, Defendant argues that joinder of all the charges
was improper. According to Defendant, the fact that all the
charges may have been committed “under the same general modus
-9-
operandi is not enough to supply the required transactional
connection [and, therefore, is] not enough to make [the charges]
a series of connected acts which constitute a single plan or
scheme.” Defendant further argues that “sexually abus[ing]
adolescent girls that were in . . . [D]efendant’s home or to
whom [Defendant] had access” does not constitute a common scheme
or plan. In addition, Defendant points out that the twelve years
separating the 2004–2008 charges from the 1985–1992 charges is a
far greater gap in time than in previous cases where this Court
has found joinder of charges to be proper.
When determining whether offenses should be joined for
trial, N.C. Gen. Stat. § 15A-926(a) “requires a two-step
analysis: (1) a determination of whether the offenses have a
transactional connection, and (2) if there is such a connection,
consideration then must be given as to whether the accused can
receive a fair hearing on more than one charge at the same
trial.” State v. Perry, 142 N.C. App. 177, 180-81, 541 S.E.2d
746, 748–49 (2001) (citation and internal quotation marks
omitted). “The [legal] determination of whether a group of
offenses are [sic] transactionally related so that they may be
joined for trial is a question of law fully reviewable on
appeal.” State v. Guarascio, 205 N.C. App. 548, 553, 696 S.E.2d
-10-
704, 709 (2010) (citation and internal quotation marks omitted).
However, the decision regarding whether to join offenses
pursuant to that relationship is within the sound discretion of
the trial court. State v. Miller, 61 N.C. App. 1, 5, 300 S.E.2d
431, 435 (1983) (citations omitted). Therefore, the
determination of whether the offenses have a transactional
connection is reviewed de novo, and the determination of whether
the defendant can receive a fear hearing if the offenses are
joined is reviewed for abuse of discretion. See Perry, 142 N.C.
App. at 180-81, 541 S.E.2d at 748–49.
Joinder of charges in a criminal case is proper when the
charges are “based on the same act or transaction or on a series
of acts or transactions connected together or constituting parts
of a single scheme or plan.” N.C. Gen. Stat. § 15A-926(a)
(2013). Joinder is improper when “the offenses are so separate
in time and place and so distinct in circumstances as to render
consolidation unjust and prejudicial [to the defendant].” State
v. Chandler, 324 N.C. 172, 188, 376 S.E.2d 728, 738 (1989)
(citation and internal quotation marks omitted). “[O]ffenses
that are committed on separate dates cannot be joined for trial,
even when they are of like character, unless the circumstances
of each offense are so distinctly similar that they serve almost
-11-
as a fingerprint.” State v. Williams, 74 N.C. App. 695, 697, 329
S.E.2d 705, 707 (1985).
This Court has allowed joinder of charges involving the
sexual abuse of minors when that abuse was separated by five
months. State v. Street, 45 N.C. App. 1, 5-6, 262 S.E.2d 365,
368 (1980) (“[W]e think that even though the time period [of
five months] between some of the acts was substantial, the acts
were nonetheless so similar in circumstance and place as not to
render the [joinder] of the offenses prejudicial to the
defendant.”). We have declined, however, to join charges
involving the sexual abuse of minors when that abuse was
separated by as many as seven years. See generally State v.
Bowen, 139 N.C. App. 18, 29, 533 S.E.2d 248, 255 (2000) (holding
that the seven years between offenses and the non-uniform nature
of the individual acts meant that the defendant did not have a
single scheme or plan); State v. Owens, 135 N.C. App. 456, 459–
60, 520 S.E.2d 590, 593 (1999) (“[I]n light of (1) the extended
interval of as much as [seven] years between some of these
offenses and (2) the lack of a consistent pattern in [the]
defendant’s molesting behavior, we hold that . . . all of the
charged acts did not constitute part of a single scheme[.]”).
In Owens, this Court determined that certain sex-based
-12-
offenses separated by at least one year and at most seven years
were not transactionally related. Id. According to the Court,
the following actions were not sufficiently uniform: “[s]ome
molestations took place when [the defendant] was alone in the
house with a single child. On other occasions, he would isolate
a child in his bedroom while others were in the house. [The
d]efendant twice took indecent liberties while all three girls
were present.” Id. Due to the separation of time and the lack of
uniformity in the defendant’s conduct, this Court concluded that
joinder was improper. See id.
In Bowen, this Court was unwilling to permit joinder of
charges of alleged sexual crimes against children when the
charges occurred over twelve years, were separated by a maximum
of seven years, involved three different victims, and the
individual acts were of differing natures. Bowen, 139 N.C. App.
at 30, 533 S.E.2d at 255. There, the first victim testified that
in May of 1996, the defendant forced her onto a bed, pinned her
down, and inserted his fingers into her vagina. Id. at 21, 533
S.E.2d at 250. She also testified that the defendant “had
inappropriately touched her on a regular basis.” Id. at 21, 533
S.E.2d at 250–51. The second victim testified that “in the
summer of 1996, [the] defendant forcibly touched her private
-13-
parts[.]” Id. The third victim, nineteen years old at the time
of trial, testified that the defendant had abused her since she
was a young child, including forcing her to perform oral sex on
the defendant multiple times. Id. at 21, 533 S.E.2d at 251.
By contrast, in Street, this Court found joinder of alleged
sexual crimes involving three victims to be proper when the
incidents were separated by five months. 45 N.C. App. at 6, 262
S.E.2d at 368. There, each alleged incident “occurred at the
same place and under the same circumstances.” Id. at 5-6, 262
S.E.2d at 368. In that case, the victims were siblings; all the
incidents occurred for a long period of time; every time the
defendant was given access, he abused his stepchildren; and, in
each incident, the defendant used his authority as a parent to
coerce his victims. Id. at 6, 262 S.E.2d at 368.
Here, the offenses concerning Alison took place, at a
minimum, twelve years after the offenses concerning Mary and
Brenda. In addition, the incidents involving Alison were not
sufficiently similar to the incidents involving Mary and Brenda.
Alison testified that she was abused in Defendant’s home, in her
home, and in Defendant’s car. Defendant gained access to Alison
through family gatherings and his relationship with Alison’s
brother. In contrast, Mary testified that the abuse occurred on
-14-
a motorcycle, in her bedroom in Defendant’s house, in
Defendant’s bedroom, and in Defendant’s bathroom when Mary would
shower. Notably, Defendant would often visit Mary in her bedroom
at night. Defendant had access to Mary because she lived in his
home whereas Alison never lived with Defendant. Brenda’s abuse
occurred in Mary’s bedroom and on a motorcycle. Because
Defendant’s access to Mary was of a different character than his
access to Alison, the crimes against Mary and Alison are no more
uniform than the conduct in Owens. See 135 N.C. App. at 459-60,
520 S.E.2d at 593. As in Owens, the incidents in this case took
place in a number of different ways and places. Defendant would
isolate Alison by instructing her brother to take a shower,
leaving Defendant alone with his victim; he would molest his
victims when he was alone in the victim’s house; he would molest
his victims when the victim was alone in Defendant’s house; and,
once, he took indecent liberties with two victims while both
were present. Moreover, the abuse occurred on a motorcycle, in
several bedrooms, in a pool, and in a basement.
“North Carolina appellate courts have been willing to find
a transactional connection in cases involving sexual abuse of
children.” Bowen, 139 N.C. App. at 29, 533 S.E.2d at 255
(citation and internal quotation marks omitted). However, we are
-15-
not aware of any cases allowing joinder of offenses separated by
a period of time longer than two years. See, e.g., State v.
Estes, 99 N.C. App 312, 317, 393 S.E.2d 158, 161 (1990). Here,
the incidents involving Alison took place twelve years after the
incidents involving Mary and Brenda. The State cites Street, 45
N.C. App. at 1, 262 S.E.2d at 365, to support its position that
the time between the 1985–1992 charges and the 2004–2008 charges
is not too long to make joinder improper. That case, however,
held only that incidents occurring “at the same place and under
the same circumstances,” five months apart, may be joined.
Street, 45 N.C. App. at 5–6, 262 S.E.2d at 368. Street is not
controlling where the charges are separated by twelve years, as
here. Therefore, because the incidents are separated by twelve
years and the conduct is no more uniform than the conduct in
Owens, we hold that the trial court erred in determining that
the abuse concerning Alison from 2004 to 2008 was so
transactionally linked to the abuse concerning Brenda and Mary
from 1985 to 1992 that joinder of all the charges was proper.
B. Unfair Prejudice
Even though the charges were improperly joined, Defendant
does not articulate any meaningful prejudice resulting from that
joinder, nor do we perceive any. On appeal, Defendant merely
-16-
asserts that “joinder would prejudice . . . [his] ability to
receive a fair trial.” At trial, Defendant argued that joinder
was improper because “any arguments made by the [d]efense would
be clouded by these other allegations . . . hanging over
[Defendant’s] head.” We note, however, that “evidence of other
molestations would have been admissible pursuant to . . . Rule
404(b) [of the North Carolina Rules of Evidence] to show intent,
plan, or design” even if the charges had not been joined. See
Bowen, 139 N.C. App. at 29, 533 S.E.2d at 255 (“[S]hould the
trial court allow joinder, and on appeal that joinder be deemed
error, this Court should review any resulting prejudice with
reference to Rule 404(b).”) (citation and internal quotation
marks omitted).
Under Rule 404(b), intent, plan, or design may be
established using a “lower threshold of proof than that needed
to establish the ‘series of acts or transactions connected
together or constituting parts of a single scheme or plan,’
which must be shown for joinder of offenses for trial under
section 15A-926(a).” Id. “The very terms used in section 15A-
926(a) requiring a ‘single scheme or plan,’ are more exacting
than the term ‘plan’ used in Rule 404(b).” Owens, 135 N.C. App.
at 460, 520 S.E.2d at 593. Therefore, even if joinder is
-17-
improper, additional victims may still testify about similar
incidents under Rule 404(b). As a result, the jury would still
be aware of the existence of allegations from multiple victims
and give that fact weight in their deliberations. See N.C. Gen.
Stat. § 8C-1, Rule 404(b) (2013).
In a criminal case, evidence of other crimes, wrongs, or
acts is admissible under Rule 404(b) as long as it is relevant
for some purpose other than to show that the defendant has a
propensity for the type of conduct for which he is being tried
and as long as it is not too remote. See, e.g., State v.
Frazier, 344 N.C. 611, 616, 476 S.E.2d 297, 300 (1996) (holding
that prior acts of sexual abuse alleged to have occurred over a
time period of seven to twenty-seven years before trial were
admissible to show a common plan or scheme); State v.
DeLeonardo, 315 N.C. 762, 771, 340 S.E.2d 350, 357 (1986)
(holding that testimony of the defendant’s three-year-old
daughter regarding his sexual conduct toward her was admissible
to establish a common plan or scheme in the defendant’s trial
for molesting his two sons); State v. Goforth, 59 N.C. App. 504,
506, 297 S.E.2d 128, 129 (1982) (affirming the trial court’s
admission of two sisters’ testimony regarding the defendant’s
sexual abuse to show a pattern of conduct in the defendant’s
-18-
trial for sexual abuse of his stepdaughter), reversed on other
grounds, 307 N.C. 699, 307 S.E.2d 162 (1983).
While the admissibility of evidence is not dispositive of
the absence of prejudice, admissibility “may be considered in
determining whether the consolidation [of charges for purposes
of joinder] was unjust and prejudicial to the defendant.” State
v. Corbett, 309 N.C. 382, 389, 307 S.E.2d 139, 144 (1983). When
examining the prejudicial impact of joining offenses, this Court
“must look to whether [the] defendant was hindered or deprived
of his ability to defend one or more of the charges.” Id. at
389, 307 S.E.2d at 144. Although the trial court erred in
joining the charges in this case, neither the record nor
Defendant’s arguments support the conclusion that Defendant was
prejudicially hindered or deprived of his ability to defend one
or more of the charges. Accordingly, Defendant’s first argument
is overruled.
II. Motion to Dismiss
“This Court reviews the trial court’s denial of a motion to
dismiss de novo.” State v. Smith, 186 N.C. App. 57, 62, 650
S.E.2d 29, 33 (2007) (citation omitted).
Upon [the] defendant’s motion for dismissal,
the question for the Court is whether there
is substantial evidence (1) of each
essential element of the offense charged, or
-19-
of a lesser offense included therein, and
(2) of [the] defendant’s being the
perpetrator of such offense. If so, the
motion is properly denied.
State v. Fritsch, 351 N.C. 373, 378, 526 S.E.2d 451, 455
(citation and internal quotation marks omitted), cert. denied,
531 U.S. 890, 148 L. Ed. 2d 150 (2000). “Substantial evidence is
such relevant evidence as a reasonable mind might accept as
adequate to support a conclusion.” State v. Smith, 300 N.C. 71,
78-79, 265 S.E.2d 164, 169 (1980). “In making its determination,
the trial court must consider all evidence admitted, whether
competent or incompetent, in the light most favorable to the
State, giving the State the benefit of every reasonable
inference and resolving any contradictions in its favor.” State
v. Rose, 339 N.C. 172, 192–93, 451 S.E.2d 211, 223 (1994)
(citation omitted), cert. denied, 515 U.S. 1135, 132 L. Ed. 2d
818 (1995).
On appeal, Defendant argues that the trial court erred in
denying his motion to dismiss one of the charges of indecent
liberties concerning Brenda because “[t]ouching two parts of a
child’s body in the course of a single incident is one crime,
not two.” The State offers no objection and concedes that it “is
unable to distinguish the cases cited by [D]efendant from the
case at bar.” We find Defendant’s argument persuasive.
-20-
When examining acts prosecuted under the statute governing
the taking of indecent liberties with children under N.C. Gen
Stat. § 14-202.1(a)(1),
our Supreme Court has stated that the evil
the legislature sought to prevent in this
context was the defendant’s performance of
any immoral, improper, or indecent act in
the presence of a child for the purpose of
arousing or gratifying sexual desire. [The
d]efendant’s purpose for committing such act
is the gravamen of this offense; the
particular act performed is immaterial.
State v. Jones, 172 N.C. App 308, 315, 616 S.E.2d 15, 20 (2005)
(citation and internal quotation marks omitted). “[A]lthough
[N.C. Gen. Stat § 14-202.1] sets out alternative acts that might
establish an element of the offense, a single act can support
only one conviction.” Id.
As Defendant notes in his brief, this case is
indistinguishable from State v. Laney, 178 N.C. App. 337, 631
S.E.2d 522 (2006). There we found that “[the] defendant’s acts
of touching the victim’s breasts and putting his hands inside
the waistband of her pants were part of one transaction that
occurred the night [in question]. The sole act involved was
touching — not two distinct sexual acts.” Id. at 341, 631 S.E.2d
at 524. Here, Defendant was indicted for and convicted of three
acts of indecent liberties against Brenda. However, Brenda’s
-21-
testimony proved only two occasions on which Defendant touched
her inappropriately. The first occasion occurred when Brenda
spent the night with Mary in her bed. The second occasion
occurred when Defendant took Brenda on a motorcycle ride. The
three indictments concerning indecent liberties against Brenda
lay out no specifics other than a date range, and all three
indictments are identical. Accordingly, we conclude that the
trial court erred in denying the motion to dismiss one of the
three indecent liberties charges concerning Brenda, and we
vacate the corresponding conviction.
Defendant’s three convictions for indecent liberties
against Brenda were consolidated into one judgment. When one
such conviction is vacated, “the better procedure is to remand
for resentencing . . . .” State v. Wortham, 318 N.C. 669, 674,
351 S.E.2d 294, 297 (1987). Accordingly, we remand judgment
number 12 CRS 51941 to the trial court for resentencing
consistent with this opinion.
NO PREJUDICIAL ERROR in part; VACATED AND REMANDED in part.
Judges STROUD and MCCULLOUGH concur.
Report per Rule 30(e).
|
{
"pile_set_name": "FreeLaw"
}
|
---
abstract: 'We show that any arbitrary time-dependent density operator of an open system can always be described in terms of an operator-sum representation (Kraus representation) regardless of its initial condition and the path of its evolution in the state space, and we provide a general expression of Kraus operators for arbitrary time-dependent density operator of an $N$-dimensional system. Moreover, applications of our result are illustrated through several examples.'
address: |
$^1$Department of Physics, National University of Singapore, 10 Kent Ridge Crescent, Singapore 119260, Singapore\
$^2$Department of Physics, Shandong Normal University, Jinan 250014, People’s Republic of China\
$^3$ National Institute of Education, Nanyang Technological University, 1 Nanyang Walk, Singapore 639798, Singapore
author:
- 'D. M. Tong$^{1,2}$, L. C. Kwek$^{1,3}$, C. H. Oh$^1$, Jing-Ling Chen$^1$, and L. Ma$^1$'
title: 'Operator-sum representation of time-dependent density operators and its applications'
---
Arbitrary states of any quantum system, be it open or closed, can always be described by density matrices $\rho(t)$. If the system is closed, its time evolution is unitary, and there exists a unitary operator $U(t)$, such that $\rho(t)=U(t)\rho(0)U(t)^\dagger$, where $\rho(0)$ is the initial state. However, if the system is open, the evolution is not necessarily unitary and the above relation between $\rho(t)$ and $\rho(0)$ is in general not valid. To describe the evolution of an open system, one usually employs the Kraus representation[@Kraus]. If there exist operators $M_\mu(t)$, called Kraus operators, that satisfy $$\begin{aligned}
\rho(t)=\sum\limits_\mu M_\mu(t)\rho(0)M_\mu(t)^\dagger,
\label{rhot}\end{aligned}$$and $$\begin{aligned}
\sum\limits_\mu M_\mu(t)^\dagger M_\mu(t)=I, \label{mm}\end{aligned}$$ then the evolution of $\rho(t)$ is said to have operator-sum representation or the Kraus representation.
It has been known that a completely positive map always possesses the operator-sum representation while a general positive map may not do[@Kraus; @Preskill; @Pechukas; @Pomero; @Bouda; @Philip; @Gen; @Peixoto; @Mika; @Sonja]. The papers[@Peter; @Salgado; @Hayashi] furthermore pursued the existence of the Kraus representation by investigating the role of initial correlations between the open system and its environment, and showed that a map based on the reduced dynamics, in general, cannot be described as the Kraus representation in the presence of the initial correlations because an additional inhomogeneous part appears. On the other hand, we know that for a qubit system, although a non-completely positive map $\$:\rho(0)\rightarrow\rho(t)$ does not possess the Kraus representation with the Kraus operators independent of $\rho(0)$, the state $\rho(t)=\$(\rho(0))$ can still be expressed in the form of Eq. (\[rhot\]) with the operators $M_\mu(t)$ selected for $\rho(0)$[@Philip; @Gen; @Tong1]. Arbitrary density matrices $\rho(t)$ of a qubit system can always be described in terms of the operator-sum representation. This start us to wonder whether the same property is valid for $N$-dimensional systems. That is, for any arbitrary time-dependent state $\rho(t)$ and initial state $\rho(0)$ of an $N$-dimensional system, is it true that the operators $M_\mu(t) $ can always be found so that (\[rhot\]) and (\[mm\]) are fulfilled? This is a interesting issue as it extends the notion of the Kraus representation associated with a map to that associated with an evolution of the state and we find that it is useful to some physical problem.
In this paper, we prove that the time-dependent density operator of an arbitrary $N$-dimensional quantum system can always be described in terms of the Kraus representation and provide a general expression of Kraus operators for the $N$-dimensional system. Some applications of our result are also discussed.
Firstly, we prove that any arbitrary two density matrices $\rho_A$ and $\rho_B$ of an $N$-dimensional open system can always be connected by Kraus operators.
Suppose $$\begin{aligned}
\rho_A=\sum\limits_{i=1}^N p^A_i |A_i\rangle\langle A_i|=U_A\rho^d_AU_A^\dagger,\label{rhoab1}\\
\rho_B=\sum\limits_{i=1}^N p^B_i |B_i\rangle\langle
B_i|=U_B\rho^d_BU_B^\dagger, \label{rhoab2}\end{aligned}$$ where $p^A_i$ ($p^B_i$) and $|A_i\rangle$ ($|B_i\rangle$) are the eigenvalues and the orthonormal eigenvectors of the density matrix $\rho_A$ ($\rho_B$) respectively, $\rho^d_A$ ($\rho^d_B$) is the diagonal matrix with the entries $p^A_i$ ($p^B_i$), and $U_A$ ($U_B$) is the unitary transformation matrix, the $i$-th column of which is just the vector $|A_i\rangle $ ($|B_i\rangle$). We want to prove that there exist the operators $M_\mu$, satisfying $$\begin{aligned}
&&\rho_B=\sum\limits_\mu M_\mu\rho_AM_\mu^\dagger,\label{rhoa}\\
&&\sum\limits_\mu M_\mu^\dagger M_\mu=I. \label{mm2}\end{aligned}$$
To find the required Kraus operators, one may write $M_\mu$ as $N\times N$ matrices with unknown elements and then directly solve (\[rhoa\]) and (\[mm2\]) to determine the matrices. However, this method is not feasible for high dimensional systems due to the computational complexity. To overcome the problem, we first seek diagonal matrices, which are generally easier to manipulate. To this end, we look for operators $M'_i$ such that $$\begin{aligned}
&&\rho^d_B=\sum\limits_\mu M'_\mu \rho^d_A {M'_\mu}^\dagger,\label{rhod}\\
&&\sum\limits_\mu {M'_\mu}^\dagger M'_\mu=I. \label{mm3}\end{aligned}$$ To solve the above equations, we obtain the matrix operators $M'_\mu $ ($\mu=0,1,2,...N-1$) with the entries $$\begin{aligned}
(M'_\mu)_{ij}= \sqrt{p^B_i}\delta_{i,j-\mu}+\sqrt{p^B_i}\delta_{i,j-\mu+N}~~,
\label{m}\end{aligned}$$ where $i,j=1,2,...N$[@Tong2].
With the matrices $M'_\mu $, we can construct the Kraus operators $M_\mu $ satisfying (\[rhoa\]) and (\[mm2\]). To see this, we use the relations, $$\begin{aligned}
\rho^d_A=U_A^\dagger\rho_AU_A,\label{rhoab3}\\
\rho^d_B=U_B^\dagger\rho_BU_B. \label{rhoab4}\end{aligned}$$ Substituting (\[rhoab3\]) and (\[rhoab4\]) into (\[rhod\]), we have $$\begin{aligned}
U_B^\dagger\rho_BU_B=\sum\limits_\mu M'_\mu U_A^\dagger\rho_A
U_A{M'_\mu}^\dagger,\end{aligned}$$ that is, $$\begin{aligned}
\rho_B=\sum\limits_\mu U_B M'_\mu U_A^\dagger\rho_A (U_BM'_\mu
U_A^\dagger)^\dagger.\end{aligned}$$ Let $$\begin{aligned}
M_\mu=U_BM'_\mu U_A^\dagger, \label{mmu}\end{aligned}$$ it is obvious that $M_\mu $ defined by (\[mmu\]) satisfy (\[rhoa\]) and (\[mm2\]). They are the Kraus operators connecting $\rho_A$ with $\rho_B$. Since $U_A$, $U_B$ and $M'_\mu $ can be deduced directly from $\rho_A$ and $\rho_B$, the explicit expression of $M_\mu$ is obtained for arbitrary density matrices.
Secondly, having proved that any arbitrary two density matrices $\rho_A$ and $\rho_B$ of an $N$-dimensional open system can always be connected by Kraus operators, we now revert to our discussion concerning the time evolution of open systems. We show that the time-dependent state of an arbitrary open system can always be described in terms of the Kraus representation.
We replace $\rho_A$ and $\rho_B$ in the above demonstration by $\rho(0)$ and $\rho(t)$ respectively. Note that for any evolution of an $N$-dimensional open system, the state $\rho(t)$ and the initial state $\rho(0)$ can always be expressed as $$\begin{aligned}
\rho(t)=\sum\limits_{i=1}^N p_i(t) |\psi_i(t)\rangle\langle
\psi_i(t)|
,\label{rhot1}\\
\rho(0)=\sum\limits_{i=1}^N p_i(0) |\psi_i(0)\rangle\langle
\psi_i(0)|.
\label{rhot2}\end{aligned}$$ By comparing (\[rhot1\]) (\[rhot2\]) with (\[rhoab1\]) (\[rhoab2\]) and using (\[mmu\]), one can immediately write down the Kraus operators $M_\mu (t)$ as $$\begin{aligned}
M_\mu(t)=U(t)M'_\mu(t) U(0)^\dagger, \label{mmt}\end{aligned}$$ where $U(t)$ ($U(0)$) is the unitary transformation matrix that diagonalizes $\rho(t)$ ($\rho(0)$) given explicitly by $$\begin{aligned}
&U(t)&=\left(\begin{array}{ccccc}\psi_1(t)~&\psi_2(t)~&...&...&~\psi_N(t)
\end{array}\right)\label{ut},\\
&U(0)&=\left(\begin{array}{ccccc}\psi_1(0)~&\psi_2(0)~&...&...&~\psi_N(0)
\end{array}\right),
\label{u0}\end{aligned}$$ and $M'_\mu(t) $ ($\mu=0,1,...N-1$) are given by $$\begin{aligned}
&M'_0(t)&=\left(\begin{array}{ccccc}
\sqrt{p_1(t)}&0&0&...&0\\
0&\sqrt{p_2(t)}&0&...&0\\
0&0&\sqrt{p_3(t)}&...&0\\
&...&...&...&\\
0&0&0&0&\sqrt{p_N(t)}
\end{array}\right),
\nonumber\end{aligned}$$ $$\begin{aligned}
&M'_1(t)&=\left(\begin{array}{ccccc}
0&\sqrt{p_1(t)}&0&...&0\\
0&0&\sqrt{p_2(t)}&...&0\\
&...&...&...&\\
0&0&0&...&\sqrt{p_{N-1}(t)}\\
\sqrt{p_N(t)}&0&0&0&0
\end{array}\right),\nonumber\end{aligned}$$ $$\begin{aligned}
...~~~~~~~...~~~~~~~...~~~~~~~\nonumber\end{aligned}$$
$$\begin{aligned}
&M'_{N-1}(t)&=\left(\begin{array}{ccccc}
0&0&...&0&\sqrt{p_1(t)}\\
\sqrt{p_2(t)}&0&0&...&0\\
0&\sqrt{p_3(t)}&0&...&0\\
&...&...&...&\\
0&0&0&\sqrt{p_N(t)}&0
\end{array}\right).
\label{m0m1}\end{aligned}$$
The operators $M_\mu (t)$ defined by (\[mmt\])-(\[m0m1\]) satisfy (\[rhot\]) and (\[mm\]), giving the Kraus representation of $\rho(t)$. Generally speaking, one cannot assert that any arbitrary time-dependent density operator possesses the Kraus representation simply from the result that any two states can be connected by Kraus operators. However, here we can make the assertion because $p_i(t)$ are always positive and (\[m0m1\]) is always valid independent of time $t$.
So far, we have shown that the time-dependent state of an open system can always be described in terms of the Kraus representation. A general expression of Kraus operators for any arbitrary $N$-dimensional system is given. When the evolution of the open system is given by $\rho(t)$ and $\rho(0)$, the Kraus operators can be written immediately as $M_\mu(t)=U(t)M'_\mu(t)
U(0)^\dagger$, where $U(t)$, $U(0)$ and $M'_\mu(t)$ are explicitly given by (\[ut\]), (\[u0\]) and (\[m0m1\]). Since the Kraus operators are not unique, the expression (\[mmt\]) is only one set of them. The other equivalent expressions of the Kraus operators can be obtained by $\tilde{M}_\mu(t)=\sum\limits_\nu M_\nu(t) V_{\mu\nu}$, where $V_{\mu\nu}$ are the elements of an arbitrary unitary matrix $V$.
Thirdly, in the following paragraphs, we will illustrate some applications of our result.
The result can help to clarify some ambiguous concepts. For example, the [*[Kraus representation theorem]{}*]{}, recalling the well-known [*[representation theorem]{}*]{}, which states that a map has the Kraus representation if and only if it is linear, completely positive (CP) and trace preserving[@Kraus], one may thought that the expression $\rho'=\$(\rho)$ has no Kraus representation if the map $\$$ is not CP. However, our result shows that any two states $\rho$ and $\rho'$ can always be connected by the Kraus operators irrespective of the form of the map acting on $\rho$. This shows that although non-CP map does not possess the Kraus representation, the expression $\rho'=\$(\rho)$ can still be cast into the Kraus representation. For instance, the transposition operator $T: \rho \rightarrow
\rho^T$ is positive but not completely positive. According to the [*[Kraus representation theorem]{}*]{}, there does not exist the Kraus representation of the map $T$. However, the expression $
\rho^T=T(\rho)$ can still be described by Kraus operators. Let $\rho_A=\rho$ and $\rho_B=\rho^T$, the Kraus operators can be obtained directly using (\[mmu\]). The important key for clarifying the ambiguity is to note that there is a difference between the Kraus representation of a map and the Kraus representation for a state under the action of a map. The Kraus operators describing the Kraus representation of a map are independent of the state $\rho$ while the Kraus operators describing the Kraus representation of a state $\rho$ under the action of a map may be dependent on the state. A non-CP map has no Kraus representation, but $\rho'=\$(\rho)$, be $\$$ a CP map or not, always has the Kraus representation.
An important corollary of our result is that there always exists a CP map between any two quantum states and the map can be represented through $N$ Kraus operators. This corollary is obvious, because any two states can be connected by $N$ Kraus operators $M_\mu $ and the CP map can then be defined by the $N$ Kraus operators. The corollary shows that even for such two states $\rho$ and $\rho'$, where $\rho'$ is obtained from $\rho$ by a non-CP map $\$:\rho\rightarrow\rho'$, one can still find an alternative map ${\tilde{\$}}$ that is completely positive, satisfying ${\tilde{\$}}:\rho\rightarrow\rho'$.
The conclusion that an arbitrary time-dependent state $\rho(t)$ can always be described by the Kraus representation could have other deep applications in the study of open systems, especially in the field of quantum information. For example, it is useful for the study on geometric phase. As we know, geometric phases of both pure state and mixed state under unitary evolutions have been clarified[@Berry; @Aharonov; @Samuel; @Mukunda; @Pati; @Sjoqvistm; @Tong]. A new issue is on the geometric phases for open systems under nonunitary evolutions. Some papers[@Peixoto; @Ericsson; @Carollo] just use the Kraus operators $M_\mu$ to define and calculate the geometric phases of open systems. As described in ref. [@Ericsson], the relative phases are defined by $\alpha_\mu=\arg tr[M_\mu(\tau)\rho(0)]$, and the geometric phases can be calculated by making polar decomposition of $M_{\mu}(t)$, such that $M_{\mu}(t)=h_{\mu}(t)u_{\mu}(t)$, where $h_\mu(t)$ are Hermitian and positive, and $u_\mu(t)$ are unitary. The relative phases $\alpha_\mu$ will then lead to the geometric phase when $u_{\mu}(t)$ satisfy the $N$ parallel transport conditions $\langle \psi_i(0)|u_{\mu}(t)^+\dot
{u}_{\mu}(t)|\psi_i(0)\rangle =0,~~(i=1,2,...,N)$. With the scheme showed in the present paper, any time-dependent density matrix can be easily written as the Kraus representation. So one can transplant the notion of geometric phases defined by using Kraus operators to arbitrary evolutions of quantum systems by writing $\rho(t)$ as the Kraus representation.
Another example of its applications concerns the inverse problem of the evolutions of open systems. Suppose that the density matrix of a system is given as a time-dependent function $\rho(t)$, one wants inversely to deduce the evolutional operators or Hamiltonians that evolve the initial state $\rho(0)$ to the state $\rho(t)$. This is an important issue because physicists sometimes need to prepare experimentally a quantum system that is expected to evolve along a given path in the projected Hilbert space. The approach for solving the problem is to constitute a closed system by combining the open system with an ancilla. The open system will undergo nonunitary evolution while the combined system evolves unitarily as $\varrho(t)=U_{sa}(t)\varrho(0)U_{sa}(t)^+$, where $U_{sa}(t)$ are unitary operators acting on the combined system and $\varrho(0)=\rho(0)\otimes|0_a\rangle\langle 0_a|$ is the initial state. The issue becomes to finding the unitary operators $U_{sa}(t)$ so that $tr_e\varrho(t)=\rho(t)$. It is quite a difficult problem in general. However, the present paper can provide an effective approach to obtain the unitary operators. As concluded above, evolutions of an open system always have the Kraus representation and the Kraus operators can be directly deduced by the given $\rho(t)$. With the Kraus operators $M_\mu(t)$, one can easily obtain the unitary operator $U_{sa}(t)$. In fact, in order to satisfy $tr_e\varrho(t)=\rho(t)$, the elements of $U_{sa}(t)$ in the bases $|\Psi_i(0)\rangle \otimes|j_a\rangle$ are only required to be $[U_{sa}(t)]_{ij,k0}=[M_{j}(t)]_{ik}$ while $[U_{sa}(t)]_{ij,kl}~(l\neq 0)$ are arbitrary but keeping $U_{sa}(t)$ to be unitary and $U_{sa}(t)|_{t=0}=I$, where $|j_a\rangle~ (j=0,1,...K-1)$ are the bases of the ancilla. Obviously, there are infinitely many such unitary operators $U_{sa}(t)$, so do the Hamiltonians $H=i\dot U(t)U(t)^+$. One can choose the suitable ones which can be easily performed in the laboratory.
It is also interesting to note that the Kraus operators provided in the present paper have some intriguing properties. Since these Kraus operators are dependent on the eigenvectors of “input state" $\rho_A$ but independent of its eigenvalues, all the input states with distinct eigenvalues but the same eigenvectors will yield the same “output" state $\rho_B$. That is, the map defined by the Kraus operators can transform all the input states whose Bloch vectors lie on the same diameter of the Bloch sphere to the same output state. Specially, one may let $\rho_A=\frac{1}{N}I$, and then has $\rho_B=\frac{1}{N}\sum M_\mu
M_\mu^\dagger$. We suppose that these properties of the Kraus operators may be useful in the study of open systems.
The work was supported by NUS Research Project Grant: Quantum Entanglement with WBS R-144-000-089-112. J.L.C. acknowledges financial support from Singapore Millennium.
[99]{} K. Kraus, [*[States, Effects and Operations]{}*]{} (Spring-Verlag, Berlin, 1983) J. Preskill, Lecture notes:[*[Information for Physics 219/Computer Science 219, Quantum Computation,]{}*]{} www.theory.caltech.edu/people/preskill/ph229. P. Pechukas, Phys. Rev. Lett. [**73**]{}, 1060(1994). L.D. Romero and J. P. Paz, Phys. Rev. A [**55**]{}, 4070 (1997). J. Bouda and V. Buzek, Phys. Rev. A [**65**]{}, 034304 (2003). Philip Pechukas, Phys. Rev. Lett. [**73**]{}, 1060(1994). G. Kimura, Bussei-Kenkyu, 79-1(2002); Phys. Rev. A [**66**]{}, 062113 (2002). J. G. Peixoto de Faria, A. F. R. de Toledo Piza and M. C. Nemes, Europhys. lett. [**62**]{}, 782(2003). Mika Hirvensalo, [*[Quantum Computing]{}*]{}, p137 (Spring-Verlag, Berlin, 2001) Sonja Daffer, Krzysztof Wódkiewicz, James D. Cresser, and John K. Mclver, e-print:quant-ph/0309081 v1(2003). P. Stelmachovic and V. Buzek, Phys. Rev. A [**64**]{}, 062106 (2001); [**67**]{}, 029902(E)(2003). D. Salgado, and J. L. Sánchez-Gómez, e-print:quant-ph/0211164(2002). H. Hayashi, G. Kimura and Y. Ota, Phys. Rev. A [**67**]{}, 062109 (2003). D. M. Tong, Jing-Ling Chen, L. C. Kwek, and C. H. Oh, e-print:quant-ph/0311091 v2(2003). Noticing that $\sum_{\mu=0}^{N-1}(\delta_{i,k-\mu}+\delta_{i,k-\mu+N})(\delta_{j,k-\mu}+\delta_{j,k-\mu+N})= \delta_{ij}$ $(i,j,k=1,2,...,N)$, one can verify that Eq. (9) satisfies Eqs. (7) and (8) by showing $(\sum\limits_\mu M'_\mu \rho^d_A {M'_\mu}^\dagger)_{ij}=p^B_i\delta_{ij}$ and $(\sum\limits_\mu {M'_\mu}^\dagger M'_\mu)_{ij}=\delta_{ij}$. Besides, Eq. (9) can be written as $M_\mu=\sqrt{\rho^d_B}S^\mu$, where $S$ is a shift unitarity defined by $S_{ij}=\delta_{i+1,j}+\delta_{N,j+N-1}$. With this form of $M_\mu$, the verification can also be carried out by direct matrix operations. M.V. Berry, Proc. R. Soc. London Ser. A [**392**]{}, 45 (1984). Y. Aharonov and J. Anandan, Phys. Rev. Lett. [**58**]{}, 1593 (1987). J. Samuel and R. Bhandari, Phys. Rev. Lett. [**60**]{}, 2339 (1988). N. Mukunda and R. Simon, Ann. Phys. (N.Y.) [**228**]{}, 205 (1993). A.K. Pati, Phys. Rev. A [**52**]{}, 2576 (1995). E. Sjöqvist, A.K. Pati, A. Ekert, J.S. Anandan, M. Ericsson, D.K.L. Oi, and V. Vedral, Phys. Rev. Lett. [**85**]{}, 2845 (2000). D. M. Tong, E. Sjöqvist, L. C. Kwek, C. H. Oh, and M. Ericsson, Phys. Rev. A [**68**]{}, 022106 (2003). M. Ericsson, E. Sj" oqvist,J. Brannlund, D. K. L. Oi, and A. K. Pati, Phys. Rev. A [**67**]{}, 020101(R) (2003). A. Carollo, I. Fuentes-Guridi, M. F. Santos, and V. Vedral Phys. Rev. Lett. [**90**]{}, 160402 (2003).
|
{
"pile_set_name": "ArXiv"
}
|
Article content continued
“But the benefits of removing them as a safety measure certainly offset that inconvenience.”
According to the city, 55 slides in playgrounds it operates have been removed. The Calgary Catholic School District has had 25 affected, with another 20 in playgrounds operated by the Calgary Board of Education.
Blair said slides in Edmonton and Lethbridge have also been removed. A recall notice from Health Canada said 161 of the affected slides were sold in Canada.
Due to Alberta’s high ratio, Blair said the city has asked the distributor of the equipment to supply at least half of the 25 slides produced monthly by Playworld to this province, but are still waiting on an answer.
“It’s going to take some time to get things covered,” he said.
“They’re anticipating this process won’t end until the end of the year.”
According to the U.S. Consumer Product Safety Commission, the affected slides were produced and distributed to parks, schools and municipalities between November 2000 to October 2016. The slides, which are being replaced free of charge, ranged in price from US$1,500 to $4,000.
The recall order said in some cases the weld between the slide wall and bedway can crack and separate, potentially allowing a child’s fingers or hands to become stuck, creating an amputation hazard.
Health Canada reported as of January there had been no reports of any injuries on the slides in Canada.
Blair said while some families may be disappointed by the absence of the slides at some parks, the city maintains some 1,100 playgrounds, so there are other options for kids seeking out sliding adventures.
In 2015, a south-facing slide at St. Patrick’s Island park was fenced off after a report through the city’s 311 call centre that a child was burned while sliding.
slogan@postmedia.com
On Twitter: @ShawnLogan403
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
Remove/Hide Text at Footer of Contact Form
I'm using Wordpress and FormGet. When I paste the HTML code of the contact from of FormGet into a page on my site (http://jrbweddings.com/contact/) it adds a "Report Abuse' text at the bottom of the form. Is there a way to remove this or make the text white? It has an 'a' tag and if I try to use css code it changes the whole site.
Here is the code for the form:
<iframe style="width: 100%; border: none;" src="//www.formget.com/app/forms/view/FELr-104915/i?w=328" width="300" height="1257" frameborder="0" scrolling="no">Your Contact </iframe>
A:
I'm assuming the HTML and CSS for the page inside the <iframe> are out of your control.
If so (and alternative inline contact plugins are out of the question), I can only suggest you use the <iframe> parameters to "cut off" the lower part of the frame's content with a smaller height:
<iframe style="width: 100%; border: none;" src="//www.formget.com/app/forms/view/FELr-104915/i?w=328" width="300" height="990" frameborder="0" scrolling="no">Your Contact </iframe>
|
{
"pile_set_name": "StackExchange"
}
|
Day Tripper Kayak Paddle
Recreational: entry level Asymmetric blades of polypropylene shaped for smooth, efficient strokes. A lightweight anodized aluminum shaft is ovalized for easy gripping. This is the paddle of choice for beginners - or for use as a backup. A push-button takedown allows blades to be feathered at 60-degrees or inline, for right- and left-hand control.
Available in select stores
We currently do not offer online purchasing. Selection varies by store. Please call store for availability. Or find an MCSPORTS NEAR YOU.
|
{
"pile_set_name": "Pile-CC"
}
|
MUNICH — The stumbling effort by Germany’s auto giants to embrace electric cars has entrepreneurs taking matters into their own hands.
German car manufacturers are gradually joining the race to swap combustion engines for batteries, jolted into action by Tesla’s success and the European Union’s recent decision to tighten carbon dioxide emission rules for cars.
Yet they are still lagging behind: Germany looks set to miss its goal of having 1 million electric cars on the road by 2020, as well as undershooting its overall emissions targets for next year.
The German government, which is reportedly considering extending its €4,000 subsidy for buyers of electric cars, is urging manufacturers to step up their efforts. At the German car industry association’s annual New Year’s reception last month, Transport Minister Andreas Scheuer called on the hosts to develop more affordable electric car models.
Germany needs an “electric Beetle effect,” Scheuer added, referring to the Volkswagen car that became a symbol of the German postwar economic boom.
“No one believed us academics ... So we built a prototype, but people still didn’t believe it. I couldn’t accept that, and that’s how I came to found a startup” — Günther Schuh, founder of startup e.Go
As traditional carmakers scramble to catch up, a handful of startups are racing ahead to kick off the Verkehrswende, Germany’s much-anticipated shift to sustainable transport.
In Aachen, near the border with France, university professor Günther Schuh founded the startup e.Go in 2015. This March, the company will begin production on an affordable electric car, the compact four-seater e.Go Life.
Schuh credits the German car industry’s sluggishness with turning him into an entrepreneur.
In 2010, he and his students at Aachen University developed a concept for a small electric delivery truck to explore whether producing an affordable electric vehicle was possible. Established carmakers did not take the idea seriously, he said.
“No one believed us academics,” Schuh said. “So we built a prototype, but people still didn’t believe it. I couldn’t accept that, and that’s how I came to found a startup.”
The truck, dubbed StreetScooter, was a hit: it was eventually bought by Germany’s postal service Deutsche Post, which plans to ramp up production.
In Munich, meanwhile, a team of young entrepreneurs has developed a solar-powered electric car. Their startup, Sono Motors, began as a garage experiment in 2012 but has since become a company employing some 100 people.
A prototype of their car, the Sion, is parked outside the company offices. Its surface is covered with solar panels; other features include an air purifying system made from moss. They also plan to integrate car-sharing software into every Sion.
The Sion’s electric battery provides up to 250 kilometers in range, according to Sono Motors. The integrated solar cells can give an added boost of up to 30 kilometers depending on weather conditions.
While 30 kilometers might not sound like much, it covers the average commuting distance in Germany, said co-founder Laurin Hahn. On a sunny day, the car could recharge itself while the driver is at work.
The founders say that more than 9,000 people have paid a downpayment on a Sion, which is scheduled to go into production later this year.
“We need startups to make transport sustainable,” said co-founder Jona Christians. “We can push ahead much faster in areas like e-mobility because we don’t come with the baggage that large manufacturers have.”
Cost concerns
Yet being a small player in the car industry also has its challenges. Last year, Sono Motors announced that the Sion’s price would have to rise from €20,000 to €25,500 as the battery cost had increased.
Schuh, the professor turned entrepreneur, noted that startups often pay more for auto parts than established firms, as they buy in smaller quantities.
“Making an electric car isn’t an art. Making one that’s affordable is,” he said. “And that’s difficult for startups because they’re at a disadvantage when buying parts.”
Schuh’s e.Go Life will start at €15,900 including the battery, a comparatively cheap price for an electric car, but it features a shorter range of 120 kilometers to 180 kilometers.
Financing remains a major issue for German car startups: Schuh said that he was only able to get e.Go off the ground thanks to the profit from selling StreetScooter to Deutsche Post.
“I don’t think startups can compete against traditional car manufacturers. It’s incredibly difficult and requires billions of investment" — Markus Lienkamp, professor of automotive technology at the Technical University of Munich
“We have a huge obstacle in Germany and that’s access to capital. You’ll get the first €100,000 and the next €3-€5 million of venture capital, but €20 million or more is difficult,” he said. “That stops big ideas in their tracks.”
The risk-averse behavior of German investors worries Christian Hochfeld, director of Berlin-based sustainable transport think tank Agora Verkehrswende. He believes the lack of investment in startups is hampering innovation in the transport sector.
“New companies are mainly emerging in California or China, where large amounts of venture capital — or state capital, in China’s case — are spent on mobility solutions,” he said. “We need that to change if Germany wants to keep up.”
Yet given the vast amounts of investment required, some are skeptical that startups can play a major role in the electric car sector once large manufacturers catch up.
After their slow start, Germany's iconic carmakers are now throwing vast quantities of cash at electric vehicles.
Volkswagen says it will invest €44 billion to develop electric cars and more for batteries; it aims to be making 3 million electric vehicles a year across all its brands by 2025. BMW recently announced it would invest €200 million to expand a Munich electric car factory, while also spending €4 billion on batteries. Daimler is spending €1 billion globally on battery production.
That doesn't leave much space for newcomers.
Markus Lienkamp, professor of automotive technology at the Technical University of Munich, currently oversees a startup at his faculty: an electric car intended for developing countries.
Dubbed the aCar, the small flatbed truck is designed for rural terrain with little infrastructure. A prototype, dusty from test drives in Ghana, stands in the faculty garage; production is due to start next year.
Lienkamp believes the project can succeed, as the startup plugs a gap in the market — therefore avoiding competition with large firms — and keeps costs as low as possible by using off-the-shelf parts.
In the mass market, however, he sees few opportunities for car startups.
Producing a car, from design to crash testing, is an expensive business. As small firms pay more for parts and equipment, most startups would struggle to sell their cars at a competitive price, Lienkamp said.
“I don’t think startups can compete against traditional car manufacturers. It’s incredibly difficult and requires billions of investment,” he said. Tesla, he added, was a rare exception.
Lienkamp speaks from experience. Beside the aCar prototype, the faculty garage also houses an electric car called the Visio.M, a sleek two-seater.
When the university presented the car prototype in 2014, it made headlines. The Visio.M was not only lighter but also far cheaper than other models available at the time, projected to sell for about €16,000.
The engineering team was ready to go into serial development, but Lienkamp calculated that such a move would require €1 billion — more than any manufacturer or investor was prepared to give.
Five years on, the Visio.M is still unlikely to enter the market. Nevertheless, Lienkamp believes the project fulfilled its purpose: provoking Germany’s car giants into action.
“After that, car manufacturers had no more excuses. If even a university manages to build an affordable electric car, they cannot say it’s too difficult,” Lienkamp said.
“That’s the role of universities and start-ups,” he added. “To annoy the car industry long enough until they change their ways.”
This article is from POLITICO Pro: POLITICO’s premium policy service. To discover why thousands of professionals rely on Pro every day, email pro@politico.eu for a complimentary trial.
|
{
"pile_set_name": "OpenWebText2"
}
|
Differential regulation of immediate-early gene expression in the prefrontal cortex of rats with a high vs low behavioral response to methamphetamine.
Methamphetamine (METH) administration mimics many of the symptoms of mania and can produce psychosis after chronic use. Both rodents and man display interindividual variation in response to METH. The molecular mechanisms underlying these differences might be relevant to both stimulant addiction and endogenous psychosis. We treated 50 Sprague-Dawley rats acutely with METH (4.0 mg/kg) and 10 control rats with saline, and measured their behavior for 3 h after drug administration. Animals were divided into high responders (HR) (top 20%) and low responders (LR) (lowest 20%) based on their stereotypy response. They were killed 24 h after injection. Total RNA was extracted from the prefrontal cortex (PFC) and the expression of approximately 30 000 transcripts were analyzed using Affymetrix 230 2.0 GeneChips. Real-time reverse transcription-polymerase chain reaction was used to validate the expression of a select group of genes. Forty-three genes exhibited significant differences in expression in HR vs LR 24 h after METH treatment including a group of immediate-early genes (IEGs) (eg, c-fos, junB, NGFI-B, serum-regulated glucocorticoid kinase). These IEG expression differences were accompanied by the significant downregulation of many of these genes compared to saline in the HR but not LR, suggesting a differential responsiveness of signal transduction pathways in these two groups of rats. In addition, the expression of other transcription factors in the PFC was significantly different in HR compared to LR. These gene expression changes may contribute to individual differences in responsiveness to stimulants and the development of mania and psychosis.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
obtener JSON creado por API con JQUERY
Estoy tratandod e consumir un API a traves de Jquery, al momento he logrado conectarme sin problema e incluso obtengo la respuesta del API el cual tiene el siguiente formato:
{
"status": "OK",
"status_codes": [
200
],
"status_messages": [
{
"request": "Request processed."
}
],
"data": {
"package": {
"contentValue": 120.01,
"weight": 1.01,
"length": 30.01,
"height": 15.01
},
"insurance": {
"contentValue": 120.01,
"amountInsurance": 2.09
},
"originZipCode": "44100",
"destinationZipCode": "44510",
"rates": [
{
"idRates": 999999,
"idProduct": 11,
"product": "Dos días",
"vehicle": "bike",
"idCarrier": 6,
"carrier": "ESTAFETA",
"total": 203.15,
"deliveryType": "Ocurre",
"deliveryDays": 1
}
],
"idCarriersNoWsResult": "44510"
}
}
Esta información la puedo ver en la consola mediante console.log, pero no he podido plasmarla en un div, el código que uso es:
$.ajax({
headers: {'Authorization':'Mi Clave de Usuario o API KEY', 'Content-Type':'application/json'},
url: 'https://api.envioclickpro.com/api/v1/quotation',
type: 'POST',
dataType: 'json',
data: packInfo,
success: function(respuesta){
console.log(respuesta);
}
})
Como puedo almacenar ese JSON en un array ya sea de php o JS para poder acceder a su información?
A:
Nat, parece que debes aprender como imprimir cosas en el dom y mas allá de ello empezar a trabajar con tecnología y APIs mas modernas, aunque en teoría está bien, en la practica es mejor actualizarse, por eso te dejo fetch que es mas moderno y es estandar para manejar peticiones, puede que hasta mas intuitivo, por otro lado estaría bien que trabajaras con JS Vanilla aunque en principio aún ne he visto donde has utilizado Jquey.
A continuación te dejo un ejemplo de como imprimir Json en el dom:
var preformato = document.querySelector("#main");
fetch("https://api.myjson.com/bins/hinqa")
.then(res => res.json())
.then(res => main.innerHTML = JSON.stringify(res,null,2))
<pre id="main"></pre>
Como ves obteniendo un Json de cualquier fuente podemos imprimirlo en nuestro documento dentro de una etiqueta pre y formateandolo con JSON.stringify(json,null,2) el dos del tercer parámetro indica la cantidad del tabulado.
Si quieres hacerlo con Jquery seria tan sencillo como:
$("#main").html(JSON.stringify(res,null,2))
Espero que te sea de ayuda, un saludo.
|
{
"pile_set_name": "StackExchange"
}
|
Jim Jess
Jim Jess (born ) is a retired Australian rules football player who played in the VFL between 1976 and 1988 for the Richmond Football Club.
Jess was commonly referred to as 'The Ghost'.
References
Hogan P: The Tigers Of Old, Richmond FC, Melbourne 1996
External links
Category:Living people
Category:Richmond Football Club players
Category:Burnie Football Club players
Category:Victorian State of Origin players
Category:All-Australians (1953–1988)
Category:1955 births
Category:Australian rules footballers from Victoria (Australia)
|
{
"pile_set_name": "Wikipedia (en)"
}
|
MOST POPULAR ARTICLES
Sheriff’s deputies rally around great-grandma after theft
Raise nearly $400 in three hours to replace money stolen from purse
NORTH FORSYTH — A 71-year-old northwest Forsyth woman had extra reason to celebrate this Easter after Forsyth County Sheriff’s deputies surprised her by raising $380 to replace church camp money stolen from her vehicle.
“I just broke down. That’s all I can tell you is I just broke down and cried. I couldn’t believe it,” Grace Samples said. “My granddaughter and my great-granddaughter was there and one of them was hollering, ‘Thank you, God.’ And she said, ‘Nanny, are those happy tears or sad tears?’
“It was just so overwhelming, I couldn’t believe it. I just didn’t think of anybody ever doing anything like that.”
Sheriff’s Deputy Rodney Pirkle, who handled the case Saturday and organized the fundraising effort, said Samples’ plight struck a chord.
“She’d done something I haven’t seen in seven years. She was crying,” he said. “When I got there, she was so upset about the loss of this money and there was no way that I could not put something together and try to collect as much as we could.”
After taking her statement, Pirkle sent a text message to other members of his shift and the county’s dispatch center, asking for donations.
“The entire shift came together,” he said. “Everybody donated and we were able to return $380 to her so she could have the money she needs.”
The incident began Saturday morning after Samples discovered her purse, which was in her car, had been cleaned out overnight.
“They got every penny, every penny out of my pocket book,” she said. “They even dug down at the bottom and got the change I had dropped down at the bottom.
“My husband, he usually goes and feeds the dogs and goes to the mailbox ... and he goes out every night and gets [the purse] and locks the door.”
But her husband forgot Friday night and she didn’t think to remind him.
Samples said she usually doesn’t carry that much money in her purse, but the family had recently returned from church camp.
“We didn’t spend much at church camp and some of it was going to go to the vacation Bible school,” she said. “Some of that I had saved up and it was for gas money.”
Pirkle said it was a routine entering auto report, but he felt for Samples, who is living on a fixed income.
“This is not something that is commonly done at all,” he said. “I can’t tell you over seven years how many entering auto reports I’ve taken and investigations I’ve done. They’re numerous.
“But definitely, this is the first time something like this was done ... it was Easter and honestly she reminded me of my grandmother.”
Pirkle was hoping for a quick turnaround. In about three hours, he and the other night shift workers had exceeded their goal of $350.
And after a morning of tears, Samples said the crying just started all over again when Pirkle presented the money to her Saturday afternoon.
“I’ve never heard tell of anyone doing anything like that before. It just shocked me,” she said.
|
{
"pile_set_name": "Pile-CC"
}
|
About Welcome to Above The Bit Gaming! A channel dedicated to gaming.
Make sure to subscribe to our Tumblr! We subscribe back!
|
{
"pile_set_name": "OpenWebText2"
}
|
(a) Technical Field
Embodiments relate to a switch control circuit for zero voltage switching and a buck converter including the same.
(b) Description of the Related Art
A buck converter includes a power switch that receives an input voltage and performs switching and an inductor and a capacitor that are connected to the power switch. A diode may be connected between the inductor and the ground to decrease a flowing inductor current while the power switch is turned off. The buck converter may include a metal-oxide semiconductor field-effect transistor (MOSFET) instead of a diode. The switching of MOSFET may be controlled in synchronization with the switching of the power switch.
The buck converter may operate according to a threshold operation mode in which an inductor current reaches zero. In this case, in order to perform zero voltage switching (ZVS), the buck converter further includes a separate ZVS circuit.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Citizen, where art thou?
Mon, 07 Aug 2017
It’s time to get the public directly engaged with saving threatened species
Citizen science has been steadily increasing in recent years, both in terms of number of projects and people involved. Environmental research has been
the focus of many citizen-science projects, and now the TSR Hub has launched a project to help improve outcomes for threatened species. What’s the
connection between citizen science and threatened species? Dr Rochelle Steven from the University of Queensland sets out the arguments.
Australia’s threatened species are facing numerous threats across the continent. The vast area this beautiful land occupies makes for a unique and
diverse fauna and flora, but its sheer vastness also creates a major challenge for our efforts to track and manage the decline of those species facing
imminent extinction. That vastness makes monitoring difficult and getting around very expensive. So how do we maximise efficiency while also learning
more about the species whose very existence is under threat?
Many have touted ‘citizen science’ as a strategy to alleviate the cost burden on conservation managers and researchers. At the same time, citizen science
is touted as increasing the engagement between the public and nature.
So, what is citizen science and what is its potential? There are a few definitions around but, generally speaking, citizen science involves getting
volunteers (citizens) to participate in the collection of data that can be used to answer scientific questions. At a minimum, citizen science involving
the environment and conservation gets people thinking about nature. But it can achieve much more as well; with citizens collecting valuable biological
data that will contribute to better conservation outcomes.
The lesser swamp-orchid (Phaius australis) was once found along the east coast from north Queensland to north-east New South Wales. Citizens can assist in the recovery of the lesser swamp-orchid by working with local NRM groups to monitor the remaining populations of the species and protect them from weed invasion and illegal collection by orchid enthusiasts. Plants can also be purchased from licensed and reputable nurseries which may assist in supplementing local populations.
Mixing threatened-species conservation and citizen science presents a few challenges. First, many threatened species do not occur in urban areas, where
the greatest pool of potential participants reside. How do we overcome this mismatch? Finding ways to connect urban citizen scientists to projects
in regional areas that need additional human resources is a start. This could assist regional projects and provide rich experiences to people from
cities.
One citizen-science platform that is already established and regularly contributing to the published scientific literature is Redmap. It’s a citizen-science
reporting tool for recording the sightings of uncommon marine species. With 55 species of fish currently listed on the Environment Protection and Biodiversity Conservation Act (1999) and numerous grey nomads and regionally based citizens enjoying fishing as their recreational pastime, this link presents an exciting opportunity
for threatened-species monitoring.
The second challenge is that threatened species may be ‘sensitive’ or ‘vulnerable’ to the potential disturbance of direct monitoring activities.
A strategy to deal with this is to recruit citizen scientists to monitor species remotely. That is, to review images and footage from camera
monitors to identify occurrences of threatened species (all done without setting foot in their habitat).
KEY MESSAGES
Citizen science has enormous potential to help gather information on threatened species and the threats they face.
The TSR Hub is building a framework of best practice for citizen science that maximises the impact of citizen science for threatened species recovery.
One network combining several of these types of projects into a central portal is called Wildlife Spotter. Wildlife Spotter is administered by the Australian Broadcasting Corporation (ABC) and provides citizens with the chance to contribute to science by identifying threatened species remotely. Species that have been worked with so far include malleefowl, bandicoots, bettongs and feral cats. Feral cats, of course, are not threatened species but they are a key threat to many native mammals.
Aside from preventing disturbance to threatened species, the additional benefit of remote monitoring is the reduced logistical cost for the participant (ie, no travel) and health and safety risks are also largely removed. It also enables urban citizen scientists to contribute to the conservation of regional and remote threatened species.
With increasing interest in the use of remote technology like cameras, drones and acoustic recorders, this approach is likely to really take off in the years to come.
Researchers in the Threatened Species Recovery Hub are currently reviewing the link between citizen science and threatened species in Australia. We are working on building a framework for best practice that maximises the positive impact that citizen science might have for our nationally-listed threatened species.
To develop this best-practice framework, we will be talking with practitioners and project officers associated with citizen science and threatened species in Australia. We will be asking them how they measure their successes, what impact their citizen-science projects are having and what challenges they have faced in the past and continue to deal with. Essentially, we are hoping to create a recipe for success for how citizen science is best done for threatened species.
By sharing experiences and developing a generic framework that can be applied to multiple situations, we hope to give practitioners peace of mind about their day-to-day operations. Often they are doing their work with little guidance on what is a good benchmark to work towards. Or it might be that we can provide guidance on how they can implement strategies for dealing with obstructions to them achieving their goals.
Our citizen-science project has only recently started. We are eager to hear from anyone with knowledge of citizen-science programs actively involved in threatened-species monitoring and recovery. If you can help us or would like more information about our project, please get in touch.
For further information:
Rochelle Steven r.steven@uq.edu.au
Top Image: ‘Citizens’ collecting data out in the field may be an effective way of obtaining information in a vast country.
The Citizen and the cassowary
The southern cassowary (Casuarius casuarius johnsonii) is an enigmatic species found in the Wet Tropics Word Heritage Area (http://www.wettropics.gov.au/cassowaries) of North Queensland. It is hard to look at a cassowary and not think ‘dinosaur’, because they truly look like something that walked out of a Jurassic Park movie set.
Image: Rochelle Steven
This ‘keystone’ species plays a critical role in maintaining ecosystem processes in the rainforests as they are the key disperser of large-fruited rainforest plants throughout the region. Unfortunately, the species is facing multiple threats in the form of habitat loss, car strikes and attacks from dogs. They are currently classified as Endangered under the national EPBC Act.
The more we can learn about these extraordinary birds the better placed we will be to protect them, and this is where citizen science can play a role. Visitors and residents alike can assist local conservation work by reporting sightings of all cassowaries throughout the Mission Beach (http://www.missionbeachcassowaries.com/cassowary-id-and-tracking.html) and Daintree (http://www.daintreecassowary.org.au/) areas, two of the main hotspots for the species. Recording every sighting is important to understand how the birds move through the landscape through time, and can inform where corridor plantings and additional signage are needed to ensure the species safety and survival.
|
{
"pile_set_name": "Pile-CC"
}
|
Showtime (Angel & Khriz album)
Showtime is the second album by Angel & Khriz released on March 11, 2008. It was a success with fans and critics, receiving 4.5 stars from AllMusic and reaching No. 18 on the Billboard Top Latin Albums chart.
Showtime was nominated for a Lo Nuestro Award for Urban Album of the Year.
Track listing
Intro
Que Nos Vean
La Vecina
Showtime (featuring Zion)
Muévela
Juguete
Tu Aroma
Na De Na (featuring Gocho & John Eric)
He Tratado
Quiere Más
Me Pegué - (featuring Montana & Mora)
No Me Conoces
Pa'l Barrio
Va y Ven
Carita de Ángel (Version Bachata) (Remix)
Charts
References
External links
New Album: Angel & Khriz - Showtime
Category:2008 albums
Category:Angel & Khriz albums
Category:Machete Music albums
Category:Albums produced by Noriega
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Meet the Robinsons (video game)
Meet the Robinsons refers to three different video games based on a film by the same name.
Console version
Storyline
The game begins with Wilbur Robinson doing some time-traveling of his own, risking both his safety and the time stream in the process. Despite his father's warning not to mess with the time machine while he's away on a business trip, Wilbur doesn't seem fazed. Soon, the second time machine is stolen by the Bowler Hat Guy and Wilbur ends up following him into the past. It is here where Wilbur accidentally knocks down Stanley and Lizzie, disrupting the time stream in the process. With their projects ruined and their dreams crushed, an alternate future develops.
Carl immediately calls Wilbur back to the future, realizing that their world is now under the dangerous control of Emperor Stanley and Queen Lizzie. It is up to Wilbur to fix the time stream before he can go back to pursue the Bowler Hat Guy, events which lead straight-up to Wilbur's entrance in the movie.
Gameplay
The game follows Wilbur through 40 missions and 6 different locales, a few of which are revisited in the movie. Secret Blueprints allow the player to "build" different Cheats and Extras, using Cornelius Robinson's Transmogrifier. This machine creates items using Base Components which Wilbur collects during his adventure. A Breakout like game called Chargeball is both featured in the game itself and as an extra gameplay option. Different Chargeball "maps" can be found throughout game and it is up to Wilbur to become the Chargeball champion.
Original actors such as Wesley Singerman, Harland Williams, Adam West, Nicole Sullivan, and Stephen Anderson reprise their roles for the Robinson family, while Daniel Hansen (Lewis) doesn't appear in the game at all.
The locations in this game include: Ancient Egypt, the Robinsons' house, the Robinsons' basement, Joyce Williams Elementary School, the alternate future, Magma Industries, and Old Town.
Game Boy Advance version
Storyline
After Lewis returns to the past and prepares for his new life, Wilbur arrives back home only to find that his house has been invaded by several hundred Mini-Doris hats. He learns that Mini-Doris, which Frannie's Frogs originally captured, has made its way to Robinson Industries to begin cloning herself. Wilbur travels back into the past in the hopes that Lewis will be able to help him again, an offer which Lewis is at first reluctant to take.
Gameplay
Exclusively developed for the Game Boy Advance, the Climax Entertainment game features a completely different storyline and uses a mix of side-scrolling, top-view, and flying levels (for the Time Machine) throughout. Both Wilbur and Lewis are able to create and activate several different inventions by finding invention pieces throughout the levels. In addition, InventCo Egg-Timers and Gift Boxes are hidden throughout; collecting enough of these will unlock special "Goodies" on the main menu. In addition, a "Battery" meter serves as both a life gauge and a power gauge for the many different inventions.
The events of the game take place immediately after the movie, rather than before like in the Buena Vista Games version. Inexplicably, this is also the only Meet the Robinsons game which features Lewis as a main playable character. Due to the limitations of the Game Boy Advance, no voice-acting is featured.
Nintendo DS version
The Nintendo DS version is a third-person shooter with a simplified version of the console storyline, borrowing familiar game elements, such as the Dissembler and Charge Glove as well as adding exclusive ones. It follows the console version in four different worlds; Egypt, Lizzy, Stanley, and finally the Bowler Hat Guy's robotic hat- Doris, that ensures a final battle for the future. The Nintendo DS version also includes chargeball as well, just as the console version.
Reception
Results of the game were average to mixed.
Cast
Danny Cooksey as Emperor Stanley
Bill Farmer as Ice Cream Vendor
Parker Goris as Genetic Kid #4
Don Hall as Uncle Gaston
Robbie E. Harrison as Wilbur's Friends
Tracey Miller-Zarneke as Lizzy
Wesley Singerman as Wilbur Robinson
Alex Brooklyn Stein as Girl
Nicole Sullivan as Franny Robinson
Andre Ware as Chargeball Champion
Adam West as Uncle Art
Harland Williams as Carl
See also
List of Wii games
List of Nintendo DS games
References
Category:2007 video games
Category:Avalanche Software games
Category:Cancelled PlayStation Portable games
Category:Cancelled Xbox games
Category:Video games based on films
Category:Game Boy Advance games
Category:GameCube games
Category:Nintendo DS games
Category:PlayStation 2 games
Category:PlayStation Network games
Category:Video games developed in the United States
Category:Wii games
Category:Windows games
Category:Xbox 360 games
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Blackbriar
Blackbriar may refer to:
Black-Briar, from The Elder Scrolls V: Skyrim
Blackbriar (novel), a young adult novel by William Sleator
Blackbriar Thorn, a DC Comics character
Project Blackbriar, a spy program in the Bourne film series
Blackbriar (band), gothic rock/alternative metal band from Assen, Netherlands
|
{
"pile_set_name": "Wikipedia (en)"
}
|
“Royal River” Promotion for a riverside apartment building in Shanghai
A live action promotion we produced, typical for China. As with any promotional film the client wants the product to be bigger and better than reality. We were happy to comply and most of the footage represents reality, until the end scene where the couple are looking out over the river. This is an effect and in reality the river can’t even be seen from the apartment. We weren’t too bothered by this since the first time a potential buyer looks out the window they will realize it’s quite a different story.
|
{
"pile_set_name": "Pile-CC"
}
|
{
"_from": "react",
"_id": "react@0.14.9",
"_inBundle": false,
"_integrity": "sha1-uqhDTsZ4C96ZfNw4C3nNM7ljk98=",
"_location": "/react",
"_phantomChildren": {},
"_requested": {
"type": "tag",
"registry": true,
"raw": "react",
"name": "react",
"escapedName": "react",
"rawSpec": "",
"saveSpec": null,
"fetchSpec": "latest"
},
"_requiredBy": [
"#USER",
"/"
],
"_resolved": "https://registry.npmjs.org/react/-/react-0.14.9.tgz",
"_shasum": "baa8434ec6780bde997cdc380b79cd33b96393df",
"_spec": "react",
"_where": "/home/thomas/Code/dynamic-cdn-webpack-plugin/test/fixtures/multiple",
"browserify": {
"transform": [
"loose-envify"
]
},
"bugs": {
"url": "https://github.com/facebook/react/issues"
},
"bundleDependencies": false,
"dependencies": {
"create-react-class": "^15.6.0",
"fbjs": "^0.8.9",
"loose-envify": "^1.1.0",
"object-assign": "^4.1.0",
"prop-types": "^15.5.10"
},
"deprecated": false,
"description": "React is a JavaScript library for building user interfaces.",
"engines": {
"node": ">=0.10.0"
},
"files": [
"LICENSE",
"PATENTS",
"addons.js",
"react.js",
"addons/",
"dist/",
"lib/"
],
"homepage": "https://facebook.github.io/react/",
"keywords": [
"react"
],
"license": "BSD-3-Clause",
"main": "react.js",
"name": "react",
"repository": {
"type": "git",
"url": "git+https://github.com/facebook/react.git"
},
"version": "0.14.9"
}
|
{
"pile_set_name": "Github"
}
|
Q:
Best practice for recursive class
Problem:
I want to build a class for a custom dice. But it should also provide the following:
Every side can contain an other dice
The number of sides should be dynamically expandable, but must at least contain one
Logically the dice need to have a currentSide
Every side has a property, which provides the content of this side (on a D6, it would be "4")
So far so good, I went and made two classes dice and side and gave them the properties I think they needed.
public class Side
{
//public bool HasDice { get { return Dice != null; } } - Removed not needed
public Dice Dice { get; set; }
public string Value { get; set; }
}
public class Dice
{
public ObservableCollection<Side> Sides { get; set; }
public string Name { get; set; }
public Side CurrentSide { get; set; }
}
Is this right, I never made any recursive classes so I'm not sure ?
Also how am I able to detect if the same dice and side are "endlessly" referring to them self.
Like:
D1.CurrentSide = Side1; Side1.Dice = D1;
Should I check this when building objects ?
Edit:
If D1 rolls S2 then D2 shouldn't be rolled. Also D2.Dice = Null.
If D1 rolls S1 then D2 should be rolled.
If D2 rolls S1 then D3 should be rolled.
If D2 rolls S2 then D4 should be rolled.
D3 and D4 shouldn't trigger any roll.
A:
What you are making is called a state machine. Your program (the "machine") is always in some state, but can change the state as a consequence of performing some action. Depending on the logic it can be quite acceptable that the machine can be in the same state more than once. So, I wouldn't bother too much about loops in the machine's logic. If a user wants the loop then let him have it, as long as the machine can reach some final state and program reaches the end of execution.
|
{
"pile_set_name": "StackExchange"
}
|
Q:
Where does the "arguments" variable come from in "this.callParent(arguments)"?
While learning ExtJS 4, I found out that while defining a new class, in the initComponent method the constructor of the parent class can be called using this.callParent(arguments).
I would like to know where this arguments variable (I know it can be args or a or arg too) is defined, and where its value is assigned.
For example, if I define my class as follows:
Ext.define('shekhar.MyWindow', {
extend : 'Ext.Window',
title : 'This is title',
initComponent : function() {
this.items = [
// whatever controls to be displayed in window
];
// I have not defined argument variable anywhere
// but still ExtJS will render this window properly without any error
this.callParent(arguments);
}
});
Does anyone know where this arguments variable is defined, and how values are assigned to it?
A:
The arguments variable is a special variable in Javascript, available within any function. It's not a true array, but it contains the argument values passed to the function which can be accessed like array elements (so, arguments[0] is the first argument, arguments[1] is the second, and so on).
Check out this page on the Mozilla Developer Network for more information and examples.
|
{
"pile_set_name": "StackExchange"
}
|
Monday, April 16, 2012
Ars Animalis | Goya's Dog
"There is not a single contemporary painter in the world that does not pray in front of The Dog." -- Manuela Mena, curator, Museo del Prado
[Animals were there at the beginning of art. But how did we get from Chauvet to "Dogs Playing Poker" and beyond? That's one of the questions 13.7 will be asking with this month's series, "Ars Animalis"—art of the animals.]
When he was 72 years old, the Spanish painter Francisco Goya moved into a house outside Madrid. Though the two-story building was named "Quinta del Sordo" ("Deaf Man's House") by the previous owner, it was an apt name for the new tenant: Goya was almost completely deaf at the time. These were dark years for the celebrated artist, who developed a bleak outlook and feared going insane.
On the walls of Quinta del Sordo, between 1819 and 1823, Goya painted 14 strange, dark, haunting works that depicted such themes as violence and witchcraft, the most famous being Saturn Devouring His Son. They were never intended to be seen by the outside world. In his 1983 book Goya: The Origins of the Modern Temper in Art, Fred Licht notes that these so-called Pinturas Negras ("Black Paintings") "are as close to being hermetically private as any that have ever been produced in the history of Western art."
Among them is this enigmatic painting, known simply as The Dog, in which a small canine peeks out from behind an unidentified mass, gazing upward at some unknown thing. It is also known as A Dog, Head of a Dog, The Buried Dog, The Half-Drowned Dog, The Half-Submerged Dog or Goya's Dog. It is not known if Goya titled any of his Black Paintings, which are on permanent display at the Museo del Prado in Madrid.
In his 2004 book Francisco Goya: A Life, American novelist Evan Connell writes, "There's a lonesome dog—nobody ever saw a lonelier dog—who could be lost in a sandstorm, possibly sinking into quicksand, bewildered by a senseless universe. Nothing but the pooch's head. What does it think?"
The Spanish artist Antonio Saura called The Dog "the world's most beautiful picture." Rafael Canogar, also a Spanish artist, called it the first Symbolist painting of the Western world.
In his 2004 book Goya, Australian art critic Robert Hughes writes, "We do not know what it means, but its pathos moves us on a level below narrative." Manuela Mena, curator at the Prado, said, "There is not a single contemporary painter in the world that does not pray in front of The Dog."
ACTION ALERTS
Promote greyhound adoption just by clicking your mouse. In honor of April's Adopt-A-Greyhound Month, the GREY2K USA Education Fund is eager to launch a focused effort to educate Floridians about dog racing and to promote the adoption of ex-racers. Their idea is to erect colorful billboards across the state that point readers to a web site with adoption information and local rescue group links. The magazine Good is offering a starter grant of $2,500 to non-profit groups with the best, most productive idea. The project with the most votes will win the prize. Please vote for this important greyhound adoption campaign and help ex-racing dogs get adopted into loving homes. (Good Maker)
|
{
"pile_set_name": "Pile-CC"
}
|
INTRODUCTION {#sec1-1}
============
Surgical site infections (SSIs) are either superficial or deep and may involve the organs, or spaces accessed during an operation. The reported incidence of SSIs in coronary artery bypass grafting (CABG) surgery ranges between 0.3% and 8%.\[[@ref1]\]
There is a strong suggestion that an impairment of vascular supply of the sternum may be one of the most important factors influencing the incidence of deep sternal wound infection (DSWI). Several studies have studied the risk factors for SSIs including DSWI in cardiac surgery. These risk factors included obesity, diabetes mellitus, chronic obstructive pulmonary disease (COPD), connective tissue disease, steroid use, smoking, peripheral vascular disease and renal insufficiency. In addition, intraoperative factors (e.g., use of bilateral internal mammary arteries \[BIMA\] grafting, prolonged cardiopulmonary bypass \[CPB\] duration) and postoperative variables (e.g., prolonged mechanical ventilation, reoperation for bleeding, postoperative transfusions and gastrointestinal, nephrological and respiratory complications) have been shown to be associated with DSWI.\[[@ref2][@ref3][@ref4]\]
The risk for sternal wound infection (SWI) is increased if cardiac surgery involves internal thoracic arteries grafting and a valve procedure, or use of a ventricular assist device.\[[@ref5][@ref6]\] Leg wound infections at donor sites account for \>70% of cases with severe infection following cardiac surgery.\[[@ref7]\]
Cardiac SSIs increase the length of hospital stay (LOS) and increase treatment costs in proportion to the severity of the infection. These costs increase by 3.8%, 14.7% and 29.4% in mild, moderate and severe infections respectively.\[[@ref7]\]
Treatment is often confounded by the emergence of antibiotic-resistant pathogens and in addition, substantial proportions of these infected patients are elderly and have co-existing medical problems. In the past, such elderly patients with significant comorbidities would not have been considered for surgery.\[[@ref8]\] As the population ages, it is reasonable to assume that older and sicker patients will be admitted for surgery, and this will inevitably increase the risk and incidence of SSIs.\[[@ref9]\]
Within our institution, the infection rate of postoperative wounds has been under surveillance by the infection control team since 2005. According to our preliminary data of rates of SSIs among isolated CABG patients, this was found to be significantly disproportionate to other regional institutions. As a result, we decided to audit, study and identify likely perioperative risk factors among our patients who have undergone isolated CABG between 2012 and 2013.\[[@ref10]\]
The most important step in the management of wound infection is prevention, and this is best done by identifying risk factors. The present study was carried out in our centre to identify the incidence of wound infections following isolated CABG and identify the risk factors that may be associated with SSIs in our center.
None of these perioperative risk factors have been studied previously in our population undergoing isolated CABG. Our pool of patients originates from a general Middle Eastern population, known to have a high prevalence of diabetes and obesity, a sedentary lifestyle with a lack of exercise, which represents a change of lifestyle following the discovery of oil in the region.\[[@ref10][@ref11][@ref12][@ref13][@ref14]\]
MATERIALS AND METHODS {#sec1-2}
=====================
Definitions of Infection {#sec2-1}
------------------------
Sternal SSI was defined according to the SSI criteria of the US Centers for Disease Control and Prevention. Sternal infections occurring within 30 days after surgery can include the following types: (1) Superficial incisional (infection above the sternum with no bony involvement); (2) deep incisional (infection involving the sternum); and (3) organ/space (site-specific infection such as mediastinitis).\[[@ref8][@ref15]\]
Leg SSI was defined as redness, swelling, increased pain, excessive bleeding or discharge at the incision site among the patients who had undergone CABG. All SSI cases were diagnosed by attending physicians and confirmed by the nosocomial infection control committee. Patients who did not have any SSI formed the control group.
Study Design {#sec2-2}
------------
From January 2012 to December 2013, 357 isolated CABG procedures were performed at our cardiac center. Totally, 40 postoperative patients diagnosed with an SSI (including sternal SSI, leg SSI and double SSI \[both sternum and leg\]), in accordance with the CDC criteria for SSI surveillance, were selected randomly. These 40 patients formed our study group (SSI) (*n* = 40, group I). This group was matched according to age, sex, nature of procedure and timing within the above study period with a control group (non-SSI) of 40 postoperative patients who did not suffer from an SSI (non-SSI group: *n* = 40, group II).
The eighty selected CABG patients\' data were collected and analyzed retrospectively. Eight potential risk variables were compared between groups I and II.
Potential Risk Factors {#sec2-3}
----------------------
Eight possible perioperative risk factors were analyzed and included the following: A prolonged LOS (LOS by days) which was arbitrarily taken as beyond a 30 days stay, a previous diagnosis of diabetes mellitus, impaired estimated glomerular filtration rate (eGFR \< 60 ml/min) taken as a sign of renal insufficiency, urgency of surgery (i.e. surgery done within 24 h of diagnosis of surgical coronary artery disease), the use of BIMA for grafting, impaired ejection fraction (EF) including moderate and severe (EF% \<45%), prolonged CPB duration taken as \>2 h and an elevated body mass index (BMI) that is, \>25.
Data Analysis {#sec2-4}
-------------
The risk factors for infection were assessed by univariate analysis. Discrete variables were assessed using Chi-squared analysis or Fisher\'s exact test. Variables were assessed using two tailed Student\'s *t*-test. All variables suggested by the univariate analysis were entered into a stepwise binary logistic regression analysis model. The chosen level of significance was 5%. All analysis was performed using the Statistical Package for the Social Sciences (SPSS) 19.0. IBM Corporation.
RESULTS {#sec1-3}
=======
All of the 80 patients who enrolled during the study period underwent isolated CABG only.
Among the eight potential risk factors studied, the factors that had significant differences between the SSI study group and non-SSI control group were an impaired eGFR (*P* = 0.011, odds ratio \[OR\]: 3.8) and an impaired EF% (*P* = 0.015, OR: 5.1) \[Tables [1](#T1){ref-type="table"} and [2](#T2){ref-type="table"}\].
######
Association of exposure with SSI
######
Potential preoperative risk factor for cardiac surgical infection for underwent CABG, 2012-2013\*
Patient\'s LOS (days), urgency of surgery, BIMA grafting, prolonged CPB duration and an increased BMI had no significant influence on the incidence of wound infection \[[Table 1](#T1){ref-type="table"}\].
Of the 40 patients in the SSI group, 22 were male, and 18 were female that was equivalent to the non-SSI group. The mean age for the SSI group was 59 versus 61 for the non-SSI group. There was no significant statistical difference in the age and sex of both groups.
Only 2 patients in the SSI group stayed in the hospital beyond 30 days. None of the non-SSI group had a prolonged LOS. The difference was statistically insignificant.
Thirty-five patients (87%) in the SSI group were previously diagnosed with diabetes mellitus (type 1 or type 2) while 30 patients (75%) in the non-SSI group were diabetic. Hence, diabetes was not found to be a preoperative predictor of SSIs (*P* - 0.156).
Urgent isolated CABG was performed on 6 patients (15%) in the SSI group compared to only 4 patients in the non-SSI group. There was no statistically significant difference with a *P* = 0.499 and an OR: 1.5.
Seventeen patients (42%) in the SSI group had a prolonged CPB time of more than 2 h duration while 13 (32%) of patients in the non-SSI group had a prolonged CPB time. Again, prolonged CPB duration was not found to be an intraoperative predictor of SSI (*P* - 0.356).
Bilateral internal mammary harvesting was performed on 6 patients in the SSI group while 11 patients in the non-SSI group had bilateral mammary harvesting performed. Bilateral mammary harvesting was not found to be a risk factor for SSI with a *P* - 0.1/OR: 2.1.
DISCUSSION {#sec1-4}
==========
Surgical site infections are a manifestation of an imbalance between microbial growth and host\'s defenses. The Surgical stress response imposes an impairment of these defenses.\[[@ref16]\]
Loop *et al*., described several risk factors for sternal wound complications in cardiac surgery. Bilateral internal mammary harvesting, diabetes, obesity, blood transfusion and operative time were considered significant risk factors for sternal wound complications.\[[@ref17]\] Other authors had described other risk factors for SSIs in cardiac surgery, with conflicting findings.
Preoperative hospital admission duration, antibiotic prophylaxis use, surgical urgency, reoperation, surgical time, CPB duration, amount of blood transfused, postoperative blood loss, chest re-exploration, rewiring of a sterile sternal dehiscence, duration of mechanical ventilation and days of treatment in the intensive care unit were described as other perioperative factors contributing to the development of SSIs.\[[@ref18]\]
Our cardiac center had performed 377 isolated CABG procedures over the designated study period of which, 67 patients developed an SSI. This was an incidence rate of 17%. This elevated incidence of infection prompted us to perform this study in an attempt to analyze perioperative surgical and patient risk factors that might contribute to this rate.
Following a literature review, we decided to study eight variables \[[Table 2](#T2){ref-type="table"}\] in our cohort of patients who originate from a population, known to have a high prevalence of prediabetes, diabetes mellitus, obesity and pursues a modern, sedentary lifestyle.\[[@ref10]\] The Bahraini population has become increasingly modernized, over the last 40 years, resulting in a transformation from an active lifestyle to one that lacks physical activity, sunlight exposure and has acquired unhealthy dietary patterns. These social factors have led to a higher prevalence of chronic obesity, insulin resistance, prediabetes, and type 2 diabetes.\[[@ref11][@ref12][@ref13][@ref14][@ref19]\]
We found that an impaired renal function and/or impaired left ventricular ejection fraction (LVEF) are statistically significant patient characteristics for acquiring SSIs. Interestingly, other risk factors like diabetes, bilateral mammary harvesting and an elevated BMI were found to be statistically insignificant risk factors.
Sakamoto *et al*. had previously concluded that patients in a poor perioperative condition, that is, in a poorly perfused state and requiring hemodynamic supportive devices, were more likely to develop DSWI.\[[@ref20]\] We believe, having an impaired LVEF could be considered a marker for poor tissue perfusion in the perioperative period. Since our study did not identify those patients who had had the aid of hemodynamic support devices, we think these patients would be included in our cohort that had a severely impaired EF. A moderate or severely impaired EF can lead to a state of generalized poor perfusion, which would hinder wound healing. Hence, we correlate our findings with those of Sakamoto *et al*.
Renal failure was found by some authors, to be a significant risk factor for mediastinitis and hemorrhage after cardiac surgery and isolated CABG.\[[@ref6][@ref20][@ref21]\] We studied patients with an impaired preoperative estimated GFR, that is, chronic kidney disease (CKD) stage 2 or more; an eGFR \< 60 ml/min. We found this to be a statistically significant risk factor. CKD impairs immunity and the healing process through hyperuremia, presence of anemia of chronic disease, previous multiple blood product transfusions and a long-term indwelling dialysis catheter. Such catheters can harbor microorganisms that become a source of infection.
Several authors have identified obesity/overweight (BMI \> 25) as a major risk factor.\[[@ref6][@ref22][@ref23]\] Surprisingly, our study found that obesity and being overweight were not statistically significant risk factors. This could be because of the high prevalence of obesity in both our study and control groups (87% and 72% respectively) which is a reflection of its high prevalence in the general population.\[[@ref10][@ref11][@ref12][@ref13]\] In Bahrain, a study by Hubail and Culligan showed that the prevalence of a BMI ≥25.0 kg/m^2^ was 56.4% in males and 79.7% in females among the general Bahrain population.\[[@ref19]\] Obesity is a known modifiable risk factor for coronary artery disease. The high prevalence of obesity and the fact that our study is a study of coronary artery disease might have led to a selection bias. Both of these factors might have affected our study finding regarding obesity.
We conducted an extensive literature review with respect to diabetes and the incidence of SSIs.\[[@ref24]\] We found that the diabetes is one of the major risk factors for post CABG SSIs. The increased infection rate in diabetes has been attributed to the impairment of neutrophil chemotaxis, phagocytosis, adherence plus the glycosylation of collagen matrix proteins - all of which lead to weakened antibacterial defenses and delayed wound healing.\[[@ref14]\] We studied the preoperative diagnosis of diabetes regardless of type and control, anticipating a correlation between being diabetic and acquisition of an SSI. However, our results showed no correlation between a preoperative diagnosis of diabetes and CABG SSI. This again was surprising, and we assume this would be because of the high prevalence of diabetes in both our study and control groups (87.5% and 75%, respectively). Studies of diabetes in Bahrain indicate prevalence rates of 25.8% in males and 36.4% in females. These are considered to be among the highest in the world.\[[@ref19]\] In addition, we practice tight intraoperative and postoperative glucose control which may have contributed to this lack of correlation. Hence, we suggest that further regional studies should focus rather on the preoperative control of diabetes, for example correlating the preoperative level of HBA1C with CABG SSIs.
The role of surgical urgency as a risk factor for developing SSI in cardiac surgery is controversial. Sakamoto *et al*. studied surgical urgency and found it to be a significant factor for DSWIs,\[[@ref20]\] while Ku *et al*.,\[[@ref25]\] could not identify such a correlation. We looked at surgical urgency as a risk factor, defining it for isolated CABG as the performance of CABG within 24 h of diagnosis of coronary artery disease that required surgical intervention and/or unscheduled CABG performed out of normal working hours in our center. About 15% of our study group were done as an emergency versus 10% in the control group. Our univariate analysis could not show a correlation between urgency of surgery and SSI. This may be due to that our preoperative preparation for these urgent cases is very similar to that of elective CABG, that is, bathing, chest hair shaving, and iodine preparation. In addition, preoperative hemodynamic stabilization with assist devices (e.g., Intra-Aortic Balloon Pump (IABP)) and medical management allows time for adequate preoperative preparation. Another possible explanation is our use of an identical antibiotic prophylaxis regimen for all cardiac surgical cases, elective or urgent.
Kouchoukos *et al*.\[[@ref26]\] and Grossi *et al*.\[[@ref27]\] reported that the use of bilateral mammary grafting in isolated CABG did significantly increase the incidence of SWIs; attributed to the diminished blood supply to the sternum resulting in impaired healing. Saso *et al*.\[[@ref28]\] found a reduction in SWIs in isolated CABGs with skeletonized bilateral internal mammary harvest rather than pedicled harvests. The practice in our center is pedicled dissection of internal mammary harvests. We found no significant relationship between bilateral mammary harvesting and SSIs. We did not specifically address deep versus superficial SWIs but rather SSIs in general. Another limitation is the univariant correlation analysis performed by our study that did not investigate the concordance of diabetes and bilateral mammary harvesting on SSI incidence.
Cardiopulmonary bypass causes immunosuppression. The lungs\' role of macrophageal scavenging is bypassed, in addition to the release of immunosuppressive immunomodulators.\[[@ref29]\] We studied the relationship between CPB duration and SSIs, we arbitrarily considered 2 h to represent a prolonged duration of exposure to CPB. Sakamoto *et al*. and Minohara *et al*. studied CPB duration and SWIs and found no relation.\[[@ref20][@ref30]\] Our study concurs with their findings. About 42% of our study group had a prolonged CPB, with 32% in the control group. This was found to be insignificant. Our explanation; that CPB-induced immunomodulation might be event-related rather than time-dependent. CPB triggers the complement cascade and activates cytokines like C3a and TGF-β~1.~
Some studies have shown a relationship between prolonged perioperative hospital stay and SSIs.\[[@ref31][@ref32][@ref33]\] We looked at prolonged perioperative hospital stay (\>30 days) and found only 2 patients from our study group had a prolonged hospital stay. However, controversy remains regarding the role of a prolonged perioperative hospital stay.
CONCLUSION {#sec1-5}
==========
In our Middle Eastern population, we found that a poor preoperative clinical condition manifested as a moderately or severely impaired left ventricular and/or renal impairment were significant preoperative risk factors for acquiring SSIs in patients undergoing isolated CABG.
Interestingly, obesity, diabetes, bilateral mammary harvesting, prolonged CPB time, urgency of surgery and length of perioperative hospital stay were found to be statistically insignificant risk factors in this small study.
We recognize limitations in our study that include the small sample size and the univariant analysis of individual known risk factors. We did not investigate the possibility of the concordance of these factors. Our study also omitted the investigation of other known risk factors, e.g., blood transfusions, smoking and other comorbidities like COPD and hypertension.
We suggest that future regional studies should carry out multivariant analysis on these and other risk factors in a larger cohort. We postulate that several factors do play a role in the acquisition of post CABG SSIs and possibly have an additive/cumulative effect on the incidence of SSIs.
The authors gratefully acknowledge the work of the Shk. Moahmmad Al Khalifa Cardiac Center statistician Ms. Na Lian for her support in the data analysis of our study.
**Source of Support:** Nil
**Conflict of Interest:** None declared.
|
{
"pile_set_name": "PubMed Central"
}
|
Q:
MySQL: Which join is better between left outer join and inner join
Which join is better peforming if all of them provides the same result?
For example, I have a two tables employees(emp_id,name, address, designation, age, sex) and work_log(emp_id,date,hours_wored). To get some specific results both inner join and left join gives the same result. But, I have still some doubts which is not limited to this question only.
which join is more efficient which should prefer in case of same result values ?
What are other factors which must be considered at the time of applying join?
Is there any relationship between inner join and cross join?
A:
There is not a "better" or a "worse" join type. They have different meaning and they must be used depending on it.
In your case, you probably do not have employees with no work_log (no rows in that table), so LEFT JOIN and JOIN will be equivalent in results. However, if you had such a thing (a new employee with no registered work_log), a JOIN wold omit that employee, while a left join (whose first table is employees) would show all of them, and nulls on the fields from work_log if there are not matches.
Again, performance is a secondary thing to query correctness. Some people say that you shouldn't use LEFT JOINs. It is true that a LEFT JOIN forces the optimizer to execute the query in one particular order, preventing some optimizations (table reordering) in some cases. Here is one example. But you should not choose one over the other if correctness/meaning is sacrified, as an INNER JOIN is not inherently worse. The rest of the usual optimizations apply as usual.
In summary, do not use LEFT JOIN if you really mean INNER JOIN.
In MySQL CROSS JOIN, INNER JOIN and JOIN are the same. In the standard, and semantically, a CROSS JOIN is an INNER JOIN without an ON clause, so you get every combination of rows between tables.
You have examples of all semantic types of join on Wikipedia. In practice, in MySQL, we tend to only write JOIN and LEFT JOIN.
|
{
"pile_set_name": "StackExchange"
}
|
Dulwich College
Dulwich College is a 2–19 independent, day and boarding school for boys in Dulwich, London, England. It was founded in 1619 by Edward Alleyn, an Elizabethan actor, with the original purpose of educating 12 poor scholars as the foundation of 'God's Gift'.
Admission by examination is mainly into years 3, 7, 9, and 12 (i.e. ages 7, 11, 13, and 16 years old) to the Junior, Lower, Middle and Upper Schools into which the college is divided. It is a member of both the Headmasters' and Headmistresses' Conference and the Eton Group.
History
1619: Foundation: The College of God's Gift at Dulwich
Founder's Day at Dulwich College is celebrated at the end of the Summer Term to commemorate the signing of the letters patent by James I on 21 June 1619 authorising Edward Alleyn to establish a college in Dulwich to be called 'the College of God's Gift, in Dulwich in Surrey'. The term "Dulwich College" was used colloquially from that date, such as in 1675 when John Evelyn described his visit to Dulwich College in his Diary. However, for at least 263 years this colloquialism was incorrect as the school was part of the overall charitable Foundation. Edward Alleyn, as well as being a famous Elizabethan actor, for whom Christopher Marlowe wrote his title roles, performed at the Rose Theatre, was also a man of great property and wealth, derived mainly from places of entertainment including theatres and bear-gardens. There is no documentary evidence for the legend that he owned brothels. He was 'Chief Maister, Ruler and Overseer of [the King's] games of Beares, Bulls, Mastiff Dogs and Mastiff Bitches'. Rumours that Alleyn turned his attention towards charitable pursuits out of fear for his moral well-being have been traced to the journalist George Sala and questioned though never firmly answered in the negative.
Since 1605, Alleyn had owned the manorial estate of Dulwich, and it may have been around this time that he first had the idea of establishing a college or hospital for poor people and the education of poor boys.
The building on Dulwich Green of a chapel, a schoolhouse and twelve almshouses, began in 1613 and was completed in the autumn of 1616. On 1 September 1616 the chapel was consecrated by the Archbishop of Canterbury who became the official Visitor. However, Edward Alleyn faced objections from Francis Bacon, the Lord Chancellor, in getting the patent of incorporation that was necessary to secure the Foundation's status as a college. It was Alleyn's persistence that led to the foundation being endowed by James I's signing of the letters patent.
The charity originally consisted of a Master, Warden, four fellows, six poor brothers, six poor sisters and twelve poor scholars (orphans admitted from the age of six years), who became the joint legal owners of Alleyn's endowment of the manor and lands of Dulwich, collectively known as the Members of the College. The poor brothers and sisters and scholars were to be drawn from the four parishes that were most closely tied to Alleyn (being St Botolph's Bishopsgate where he was born, St Giles, Middlesex where he had built his Fortune Theatre, St Saviour's Southwark where he had the Paris Bear Garden and had managed the Rose Theatre, and St Giles Camberwell where the college was founded). The business of the charity was conducted in the name of these thirty members by the Master, Warden and four Fellows (Chaplain, Schoolmaster, Usher and Organist).
Alleyn drew upon the experience of other similar establishments in order to formulate the statutes and ordinances of the college, including drawing on the statutes of the already ancient Winchester College and visiting the more contemporary establishments of Sutton's Hospital (now Charterhouse School) and Croydon's Hospital (now the almshouses of the Whitgift Foundation). Among the many statutes and ordinances signed by Alleyn that pertained to the charitable scheme were provisions that the scholars were entitled to stay until they were eighteen. And to be taught in good and sound learning’…’that they might be prepared for university or for good and sweet trades and occupations. Another stipulation was that the Master and Warden should always be unmarried and of Alleyn's blood, and surname, and if the former was impossible then at least of Alleyn's surname. Alleyn also made provision that the people of Dulwich should be able to have their men children instructed at the school for a fee as well as children from outside Dulwich for a separate fee.
The next two centuries were beset by both external difficulties such as diminishing financial fortunes and failing buildings as well as internal strife between the various Members of the College. The Official Visitor, the Archbishop of Canterbury, whose function was to ensure that the statutes were obeyed, was called in many times. The lack of a disinterested body of governors and of any official connection to the Universities of Oxford or Cambridge contributed significantly to the school failing to fulfill Alleyn's vision in its first two centuries. Some notable Masters did preside over the college during this time, including James Allen (the first Master to drop the 'y' from his surname), who in 1741 made over to the college six houses in Kensington, the rents of which were to be used in the establishment of two small schools in Dulwich, one for boys from the village, the other for girls to read and sew, out of which James Allen's Girls' School (JAGS) arose. Dr John Allen (1771–1843) of Holland House was a most learned and influential man, but neglected the education of the Poor Scholars.
1808: Dulwich College Building Act
Having already obtained an Act in 1805 allowing them to enclose and develop of common land within the manor, the college was granted the power by the 1808 Dulwich College Building Act to extend the period over which leases ran, from twenty-one years as laid down by Alleyn, to eighty-four years, thus attracting richer tenants and bringing in large sums of money. The increased wealth of the college eventually resulted in the Charity Commission establishment of an enquiry into the advisability of widening the application of the funds to those extra beneficiaries Alleyn had specified in later amended clauses to the foundation's original statutes. Although the Master of the Rolls, Lord Langdale rejected the appeal in 1841 on the grounds that Alleyn had no right to alter the original statutes, he did express dissatisfaction with the college's educational provision.
Immediately after this criticism, the Dulwich College Grammar School was established in 1842 for the education of poor boys from Dulwich and Camberwell. To this school were transferred the boys of the James Allen Foundation, leaving James Allen's school for girls only. The Old Grammar School, as it became known, was erected in 1841 opposite the Old College, designed by Sir Charles Barry, the architect of the Palace of Westminster. It still exists today. The foundation scholars of the college continued to receive an education far short of Alleyn's vision, despite further attempts at reform by the Visitor. In 1854, the college was investigated by a new Commission set up by the 1853 Charitable Trusts Act which led to the 1857 Dulwich College Act.
1857: Alleyn's College of God's Gift
The 'College of God's Gift' became Alleyn's College of God's Gift when, on 25 August 1857, the Dulwich College Act dissolved the existing corporation and the charity was reconstituted with the new name. It was split into two parts with a joint Board of Governors: the educational (for the college) and the eleemosynary (for the charity). The Master, Warden, four fellows and 12 servants were pensioned off, although Alleyn's wishes were, and continue to be, respected, as sixteen pensioners (being the equivalent of 12 poor brothers and sisters plus four fellows) still live in flats in the Old College, looked after by a Warden. As for the Master, he was still to be appointed as the head of the new school. In its new form, the Master of the College was Reverend Alfred Carver (Master from April 1857 to April 1883).
Carver successfully fought with the Chairman of the Governors, the Rev William Rogers, to create a public school with high academic standards. He was the first Master not to share the name of the school's founder "Alleyn" (or latterly "Allen"). The educational college was split into an "Upper" and "Lower" school. The "Upper school" was for boys between 8 and 18, to be taught a wide and detailed syllabus, and continued to be colloquially referred to as "Dulwich College". The "Lower school" for boys between 8 and 16, had lower fees and a syllabus and was aimed at children of the industrial and poorer classes. The Lower School was the incorporation of the boys from the grammar school established in the previous decade and was referred to as "Alleyn's College of God's Gift", although this was the name of the complete charitable foundation.
1870: The New College
Dulwich College was included in Howard Staunton's 1865 book, The Great Schools of England, who wrote of the unusually comprehensive [scheme of instruction] and by the mid-1860s such was the enhanced reputation of the school that the pressure for places led to the introduction of a competitive examination. In 1869 the upper school took possession of the current site, referred to as the "New College", but it was not until Founder's Day (21 June) 1870 that the new college was officially opened by the Prince and Princess of Wales. The new college buildings, sited in the 24 hectares (60 acres) of Dulwich Common, were designed by Charles Barry, Jr. (the eldest son of Sir Charles Barry). The lower school alone continued to occupy the Old College in Dulwich Village from 1870 until it was moved to its new (and current) premises in East Dulwich in 1887.
The present school colours and school magazine (The Alleynian) were established in the 1860s and 1870s, as were school societies such as Debating and Natural Science. By the time Canon Carver retired from the position of Master in 1882, Dulwich College was said to have expanded more rapidly in the previous 25 years than any other establishment and to be holding its own at universities, to have won a large number of places of honour in the Indian and Home Civil Service and at the Royal Military College of Woolwich and to be well represented among the public schools medals of the Royal Geographic Society and the prizes of the Art Schools of the Royal Academy.
1882: Separation from Alleyn's School; the college's 'Golden Age'
Despite its excellent reputation, the college was the focus of pressure by the Charity Commissioners and other parties (including the Board of Governors and the outlying parishes named in Edward Alleyn's will) to reorganise it and divert much of its endowment to other schemes. The Master, Canon Carver, resisted these pressures for many years, finally winning an appeal in 1876 at the highest possible level (the Privy Council) where Lord Selborne ruled in his favour. In 1882, the Charity Commissioners finally issued a scheme that Canon Carver found acceptable. This passed into law by Act of Parliament and resulted in the Upper and Lower schools being officially split into separate institutions. The Upper School became Dulwich College (officially for the first time) and the Lower became Alleyn's School. Both schools remained within the Alleyn's College of God's Gift charitable foundation (along with James Allen's Girls' School, St Olave's and St Saviour's Grammar School, and the three Central Foundation schools in Finsbury and Bishopsgate).
Two Boards of Governors came into being. Both Dulwich College and Alleyn's School were to be managed by the college Governors who also administered the Chapel and Picture Gallery. The Estates and Almshouses were placed in the hands of the Estates Governors. The foundation and the college are still governed under the same arrangement. The Archbishop of Canterbury's position as Visitor was also changed to that of Honorary Visitor of Alleyn's College of God's Gift, his powers being vested in the Charity Commissioners. Dulwich College's income is derived from the contributions by the Estates Governors, among whom the College Governors are well represented (having eight of the twenty five places) Canon Carver retired at this point, being the first headmaster to be both appointed and retired by Act of Parliament.
Canon Carver was said to have given the college a body, but Arthur Herman Gilkes (Master from 1885–1914) to have given it a soul, with his noble ideals of scholarship and public service. He founded the College Mission in a poverty-stricken part of Camberwell.
London County Council scholars were admitted to Dulwich College from 1903. The college was saved from bankruptcy by the 'Dulwich College Experiment' or 'Gilkes Experiment', the work of A H Gilkes's son Christopher Gilkes (Master from 1941–1953), the forerunner of the state 'Assisted Places Scheme', by which the majority of boys selected to attend the college had their fees paid by local councils. This resulted in an academic 'Renaissance' of the college which came to a climax from the late 1950s when the college was at the forefront of the schools winning awards on entry to Oxford and Cambridge.
School arms
When Edward Alleyn founded the school he was awarded a coat of arms and crest. This was used by the school until, in 1935, it was decreed by the College of Arms that it was the exclusive property of Edward Alleyn and his family. The new arms granted by the College of Arms were very similar to the old ones retaining most of the features. Deism and learning are represented by the flames in the crest. From the ring of flames an arm with a hand holding a heart protrudes. This probably symbolises charity and has a twofold meaning. First, it represents Alleyn's charitable intentions, and second it recalls Alleyn's famous speech, written by Ben Jonson, when he presented King James I with the flaming heart of London during The Magnificent Entertainment, involving a procession through the streets and through triumphal arches by which the City of London welcomed King James I from Scotland in 1604. The lower portion of the shield incorporates the original shield being an argent (silver) background on which are placed a chevron (bent bar) dividing three cinquefoils gules (red five pointed stars).
Houses
Boarding Houses
Boarders now belong to one of three boarding houses, although the number of boarding houses has fluctuated over time. Those up to the age of sixteen (Year 11) live in "The Orchard", whilst boys of the Upper School (Year 12 and Year 13) live in either "Ivyholme" or "Blew House".
After the college was reconstituted in 1857 most of the boys were day-boys but provision was made for boarders, and the Governors licensed three boarding houses to be kept by respectable ladies in the village (hence they were then known as dames' houses). A fourth was added soon afterwards. The number of functioning boarding houses has fluctuated between one and five since that point and in total there have been six different houses:
Blew House Now one of the two senior houses, it was moved to its current position on College Road in the 1930s on the site of what had previously been the Master's garden (who had been residing in the south block of the New College). The original Blew House is called Old Blew House and still stands in Dulwich. Blew House was the only house to remain in commission throughout the Second World War for Alleynians and became a senior house at this point.
Ivyholme The second of the two current senior houses, it too was moved to its current position on College Road in the 1930s. It was bombed during the Second World War but was re-opened soon after as a senior house. During the Second World War whilst housing students of the School of Oriental and African Studies (who were going through a crash course in languages sponsored by the War Office) it was also run by the Master of the College.
The Orchard This is the only junior house still functioning as a boarding house. It was bombed during the Second World War but was re-opened as one of two junior houses very close to the war ending. During the Second World War, like Ivyholme, it housed students of the School of Oriental and African Studies who were going through a crash course in languages sponsored by the War Office.
Elm Lawn This was the house in which P.G.Wodehouse once boarded prior to it becoming a junior house. After the Second World War it re-opened as a junior house, along with The Orchard. In 1949 the boys of Elm Lawn were moved into Bell House (see below) and it became the home of the Master of the College, and still is today.
Bell House This eighteenth century building close to Dulwich Picture Gallery became the family home of the Master of the College in 1927 who until then had lived with his family in the south block of the New College. The Master moved out of this premises during the Second World War into Ivyholme. When Ivyholme reopened as a boarding house it was decided that the Master should not return to Bell House because it was too large for the purposes of a family residence. The Master moved to The Chestnuts and then in 1949 to Elm Lawn. Meanwhile, Bell House was adapted as a boarding house and became the second junior house, replacing Elm Lawn. In 1993 it was returned to private ownership, as the college recognised the lack of need for a second junior boarding house.
Carver House As the number of boys requiring boarding increased towards the end of the Second World War a fifth house was created by converting the cricket pavilion. It was named after Canon Carver, first Master of the reconstituted College, but it did not last long in this form.
Boarding house clubs and colours
The colour system (for more detail see School uniform and colours below) also extended to the Boarding Houses due to their particular impact on college life. At one time, Bell, Ivyholme and Blew, had their own sports teams and their own distinct colours. Those awarded colours could wear ties and caps and for outstanding contribution the house blazer was awarded. Boarders with no colours could wear black ties to distinguish them from day boys.
Today, senior boys can still become members of the Zodiac and Caerulean Clubs for Ivyholme and Blew respectively. The house captain, who is automatically a member of the club, controls membership of clubs, and such membership confers the right to wear a special tie. When, across the school, the uniform was standardised in 1970, the tradition of the house blazers disappeared save for the House Captain who, if he has earned full school colours, may wear the house blazer.
Gordon Bowl
This trophy was presented to the college prior to the Second World War. It was a trophy competed for by boarders only presented by an Old Alleynian, A.G.Gordon. It was originally competed for by the four boarding houses (when there was no junior/senior distinction), but after the Second World War only by the senior houses Blew House and Ivyholme until 2017, the year which Orchard were readded to the competition. It is still played for today.
Day Houses
All boys are members of one of eight day houses or Athletic Houses as they were originally known. The Houses were the brainchild of W.D. ('Scottie') Gibbon, an assistant master and rugby coach. The idea was decided upon in 1919 and in the school magazine, The Alleynian, of March 1920 the process was described. The division would be into six houses to be named after distinguished Englishmen of the Elizabethan period (see table below). The name of Shakespeare was omitted as being considered pre-eminent. Upon their original creation Boarders and Day Boys were divided thus: Grenville included Blew House, Marlowe included The Orchard, Spenser included Elm Lawn, Sidney included Ivyholme and two entirely Day-boy houses were created: Drake and Raleigh. In 1982 two more Houses (Jonson and Howard) were added due to an increased College roll.
The athletic houses were created to improve the standard of games at the college, which had deteriorated during the First World War. Before the creation of these houses, the most keenly anticipated matches were the Boarders vs Day-Boys or the Prefects vs The Rest of the School. The Athletic Houses produced, and still produce, Big Sides and Little Sides for competition. Big Sides are Houses teams that include players who also represent the school and Little are House sides that do not include school sporting representatives.
A boy's house is decided randomly or through family connection where possible. The houses continue to compete in sporting and cultural competitions (such as music, drama, chess and debating). The Cock House Shield or Cup are presented to the leading House at the end of the school year taking into account all competitions.
School uniform and colours
The dress code for pupils of Dulwich College depends on the boarding or day houses a boy might belong to, the sports teams represented, or whether a boy has attained school colours or become a prefect. Alleyn had prescribed the clothing of poor scholars to be "a white calico surplice, a long coat such as that worn by Christ's Hospital boys, of good cloth of sad (dark and sober) colour, a bodice lined with canvas, skirts with cotton lining, canvas shirts, white cotton drawers, knitted stockings, shoes and belt, a girdle and a black cap." This is how boys were dressed for over two centuries, until the new foundation in 1857.
In 1863, the Master, Alfred Carver, decreed the uniform should be "Short tunic buttoned to the chin, trousers of an Oxford mixture, an ordinary rifle cap with a broad band and narrow peak, and a dark coloured Inverness cape for winter." Under Carver, boys still wore waistcoats of varied hues and "the latest creations in neckties". This was suppressed in 1883 by the new Master, Welldon, whose first rule on arrival was that the boys should wear uniform, a forerunner of the subfusc jackets of today.
The colours of the college, blue and black, according to tradition are based on Marlborough College although Haileybury is more likely the model. It is known that in 1864 caps were introduced, with cross ribbons of purple soon altered to blue. The college arms were added in 1875. From this time, the colour scheme arose for rewarding achievement, limited at first to sport with blazers for the 1st and 2nd team of the major sports, rugby and cricket (as well as ties, caps and squares). The minor sports also had colours, although these did not extend to a full blazer. Rather, athletics, fives, shooting, boxing, tennis, swimming, gymnastics, fencing and waterpolo had blazer badges (plus caps and ties). Additionally, the boarding houses, which historically had a disproportionate effect on the sporting life of the college, had their own boarding house colours. (For more details see Boarding Houses)
By 1909 there were seventeen different caps plus a variety of blazers. The striped jackets for prominent sportsmen also conferred certain privileges, such as having the right to proceed first through the doors of centre block.
Further emphasising status were special caps for major sports colours. Rugby had a pie-shaped porker with tassels. Likewise, prefects wearing caps quartered in blue and black, could unbutton their jackets and keep their hands in their trousers. The most exclusive items took precedence even over the striped blazers of members of the 1st teams for major sports. The very best rugby players were on rare occasions awarded the rugby honours cap, and perhaps the most fabled item of all, still displayed in the college's Wodehouse library, was the white blazer. This was only awarded on the recommendation of the Field Sports Committee (see Sport section) with the essential requirement being that a boy be a member of both the Cricket 1st XI and the Rugby 1st XV and display prominence in a minor sport (e.g. boxing, fives, squash, fencing, shooting).
This uniform changed little till the 1960s (save for the arms change in 1935, and the addition of the house colours on sports shirts following the athletics houses foundation in 1920). By the 60s, boys (other than prefects and those with sporting honours) had to wear a black jacket and either grey flannels or pinstripe trousers in the Autumn and Winter terms. Shortly after the start of the Summer term, an announcement would be made that henceforth, for the rest of the term, blazers (navy blue with a white embroidered DC in gothic script) and grey flannels would be worn, along with the option of boaters. The traditional cap which was balanced on the back of the head was to be worn when in uniform off school premises and (no doubt because of its precarious perch) boys would "cap" those to whom they would otherwise have raised their caps. "Capping" involved touching the College arms on the cap with the left hand. The 1960s saw the demise of caps and boaters and a reduction in the variety of blazers, as well as the end of shirts with separate collars.
Co-Curricular
Sport
When Arthur Herman Gilkes became Master, he adhered to Carver's belief that the physical organisation of the school should be based on the principle that as far as possible management should be in the hands of the boys. Therefore, he continued the tradition of the general running of games being entrusted to a Field Sports Board (sometimes referred to as the Field Sports Committee), composed of the "school captain, captains of cricket, football (rugby), gymnastics, the baths (swimming), fencing, fives, athletics sports, boxing and shooting". Gilkes had it that the only masters with authorised status with regards to games were the captain of the Rifle Corps, and treasurer of the Sports Board. By 1894 there no more masters on the Field Sports Committee. The Board at the time controlled the appointment of captains and had some say in the style of blazers that could be worn as uniform. It was the Field Sports Committee, for example, that governed the award of the college's most prestigious colours, the white blazer. The system today is very different with assistant masters now being in charge of games, and acting more as coaches.
Colours for sporting achievement were the first such colours to be established at the college (see School uniform and colours below). Originally colours consisted of blazers for the 1st and 2nd team of the major sports, rugby and cricket (as well as ties, caps and squares) and colours for minor sports, (not extending to a full blazer but blazer badges plus caps and ties). Caps were also available, such as for rugby, the pie shaped porker and more exclusive items such as the rare rugby honours cap, and the white blazer, only awarded on the recommendation of the Field Sports Committee with the essential requirement being that a boy be a member of both the Cricket 1st XI and the Rugby 1st XV and display prominence in a minor sport. Testament to the judgment of the committee are the careers of certain alumni who received this blazer such as Trevor Bailey the England cricket all-rounder, who was so awarded because he was also a distinguished squash player.
The college still divides sport into Major and Minor. The major sports have always included rugby and cricket in the Michaelmas and summer terms respectively and for many decades just these two were deemed as major. In the twentieth century, field hockey became a major sport in the Lent term, having been introduced in 1953. Soccer, a minor sport since it was allowed in 1970, became of equal status to hockey in 2000. A raft of minor sports have also been recognised at the college for well over a century in many cases. Minor sports have included athletics from 1864; Fives from 1894 (effectively ended by the courts being destroyed by enemy bombs in the Second World War); shooting from 1878 (less applicable due to safety regulations and the loss of the .22 range); boxing from 1879 (abandoned in the 1960s but with martial arts now filling the void), tennis from 1880 (although banned during A H Gilkes' time); swimming from 1883 with the college being one of the first schools to erect a swimming pool; gymnastics from 1891; fencing (like boxing, saw a demise in the 1960s but still has a representative team); squash and water polo. The school also has teams for golf; rowing (a recent introduction in 1991 – the school now owns a boathouse on the River Thames); badminton; basketball; croquet; cycling; skiing; table tennis and rugby fives. The facilities, which include a sports centre complex, courts for most racquet sports, an athletic track, tennis courts, a swimming pool and acres of playing fields, cater to almost all sporting requirements.
Rugby
The major sport of the Michaelmas term, Dulwich College rugby has long enjoyed a powerful reputation. The school began its rugby tradition with a 1–0 victory over City of London School in 1859, 12 years before the founding of the Rugby Football Union. Since that time the school has had upwards of 30 Old Alleynians play at full international level, with more playing at schoolboy international level, national reserve and professional club rugby as well as representatives for invitational sides such as the Barbarians.
Three British and Irish Lions have emerged from the college. 1909 featured an unbeaten first XV which contained five future internationals dubbed the 'Famous Five'. Between 2012 and 2014, Dulwich College won the Natwest Schools Cup (previously known as the Daily Mail Cup) three times in a row. Then in 2017 secured an historic double, becoming the first ever team to win both the schools cup (in the years mentioned) and the Champions Trophy, the highest Tier of School Cup Rugby.
CCF
Dulwich College has a well-established Combined Cadet Force contingent that has been running since when the organisation was founded in 1859. The boys can choose between three sections: Royal Navy, Army and Royal Air Force, with most boys joining in year 9. The DCCCF regularly conducts battlecraft trips, flying days at RAF Benson and expeditions to the arctic or desert. The DCCCF are Gold medal winners in the Cambrian Patrol and have won both the Guthrie cup, London district shooting competition and the Air Squadron Trophy Competition.
Scouts
Dulwich College has a scout troop which has two patrols within it. It runs from year 6 to year 13 with both scouts and explorers. The troop is called the 25th Camberwell and has been running for over 80 years.
Dulwich College Union
Dulwich College has a large union for clubs and societies containing over 50 societies. There is a wide range of clubs ranging from Rocketry to History and the college used to have a Chicken society in which boys tended to the college's chickens. The clubs, and Union, are run by boys in Year 12 and 13 and contribute to their Duke of Edinburg awards. Most of these clubs and societies have their own personalised ties.
Debating
Within the Dulwich College Union debating plays a large role. The Dulwich College society runs during the school terms but competes both nationally and internationally. The society runs from year 7 to 13 and has around 50 members. It has recently enjoyed great success, winning the Oxford Union Debating Competition in 2014, 2015 and 2016, the Cambridge Union Schools Debating Competition in 2014 and 2015, and the ESU (English Speaking Union) Schools Mace Debating Competition, also in 2014 and 2015. It has also represented Team England and competed internationally against other national teams. It has also competed in Texas, Singapore and Stuttgart. Dulwich College is, therefore, ranked as one of the top debating schools in the UK (second only to St Paul's) and one of the best in the world.
School magazine
The Dulwich College school magazine is called the Alleynian, named after the school's founder Edward Alleyn. This magazine was first published in 1873, although the school's first magazine under the name the Dulwich College Magazine for School News and General Reading had been published in 1864 but only lasted for fourteen issues after its editor left for Cambridge University. The Alleynian was edited at one point by P.G.Wodehouse in his last year at the school.
Old Alleynians
Old boys of Dulwich College are called "Old Alleynians", after the founder of the school. This is often abbreviated to "O.A." as post-nominal letters in brackets in school publications or publications specifically concerning the school. The term should not be confused with "Alleyn's Old Boys" used for alumni of Alleyn's School. Current pupils of the school are known as Alleynians. Prior to around 1880, the terms Alleynian and Old Alleynian were not used and the pupils and ex-pupils were known as Dulwichians.
Notable Old Alleynians include Sir Ernest Shackleton, Sir P G Wodehouse, Raymond Chandler, Sir Edward George, Bob Monkhouse, Michael Ondaatje, David Thomson, Chiwetel Ejiofor, Nigel Farage, the cricketer Trevor Bailey, C. S. Forester and the architect C. F. A. Voysey.
Headmastership of Dulwich College
The Head Master of Dulwich College is styled The Master of Dulwich College, as laid out in the 1882 scheme of the Charity Commissioners. This continued a tradition of the Head of the college being called the Master since its foundation in 1619. The Foundation originally had a governing body consisting of a Master, Warden, four Fellows, and six Assistants made up of the two churchwardens of each of the three parishes of St Botolph's, Bishopsgate, of St Saviour's, Southwark, and of St Giles', Cripplegate. The Master was most senior, followed by the Warden and on vacancy of the Mastership, the Warden succeeded. By the 1857 Dulwich College Act the Master, Warden and Fellows were pensioned and the governance of the foundation switched to a body of nineteen Governors. However, the position of Master continued as the title of the Headmaster of the new Upper School, with an Undermaster as deputy. The 1882 Act (as a result of the Charity Commissioners scheme) abolished the office of Undermaster.
Masters of the College of God's Gift in Dulwich
Thomas Alleyn (appointed 1619 (assumed office on death of Founder Edward Alleyn); died 1631)
Matthias Alleyn (succeeded 1631; died 1642)
Thomas Alleyn (succeeded 1642; died 1668-9)
Raph Alleyn (succeeded 1668–9; died 1677–8)
John Alleyn (succeeded 1677–8; died 1686)
Richard Alleyn (succeeded 1686; died 1690)
John Alleyn (succeeded 1690; died 1712)
Thomas Alleyn (succeeded 1712; died 1721)
James Allen (formerly Alleyn) (succeeded 1721; died 1746)
Joseph Allen (succeeded 1746; resigned 1775)
Thomas Allen (succeeded 1775; died 1805)
William Allen (succeeded 1805; died 1811)
Lancelot Baugh Allen (succeeded 1811; resigned 1820)
John Allen (succeeded 1820; died 1843)
George John Allen (succeeded 1843; pensioned 1857)
Masters of Alleyn's College of God's Gift at Dulwich and (from 18 August 1882) Dulwich College
Rev. Alfred James Carver (appointed 1858; retired 1883)
Rev. James Edward Cowell Welldon (appointed 1883; retired 1885)
Arthur Herman Gilkes (appointed 1885; retired 1914)
George Smith (appointed 1914; retired 1928)
Walter Reynolds Booth (appointed 1928; retired 1941)
Christopher H. Gilkes (appointed 1941; died 1953)
C. Thomas (Deputy Master, took over the Mastership in 1953 for the year it took to find a permanent replacement)
Ronald Groves (appointed 1954; retired 1966)
Charles W. Lloyd (appointed 1966; retired 1975)
David A. Emms (appointed 1975; retired 1986)
Anthony C. F. Verity (appointed 1986; resigned 1995)
Christopher Field (The Deputy Master who became Acting Master during 1996.)
Graham G. Able (appointed 1997; retired 2009)
Joseph A. F. Spence (appointed 2009)
Collections
At the college
The school has a very extensive archive, especially of material relating to drama and the arts, much of which is from Edward Alleyn's (the founder) own library. Apart from diaries kept by Alleyn and his partner Philip Henslowe are many other documents relating to the college and foundation. There are also 12 volumes of unpublished music by John Reading; two of the three volumes of the First Folio Shakespeare; a Mercator Atlas; first editions of poetry by John Donne, Edmund Spenser and Dryden; A Book of Hours from the fifteenth century and even a copy of the first book to be printed in London in 1480.
Other interesting artefacts held by the college include the "James Caird", the whaler in which Ernest Shackleton made his intrepid voyage for survival to South Georgia from Elephant Island in 1916, as well as other items such as sledges from the earlier Nimrod expedition.
Above the fireplace in the Masters' Library are two panels depicting pietas (Duty) and liberalitas (Generosity) bought by Edward Alleyn in 1618 from Elizabeth I's state barge. They are reputed to have originally come from Francis Drake's Golden Hinde.
Dulwich Picture Gallery
Alleyn's College was also bequeathed a large collection of paintings by Francis Bourgeois in 1811, which had originally been intended to form the nucleus of the collection of the last king of Poland, Stanisław August Poniatowski. Following the partitions of Poland the paintings were left to the college, which set up the Dulwich Picture Gallery under a trusteeship in a building designed by Sir John Soane, which became Britain's first public art gallery. Since 1995 the Gallery has been an independent registered charity.
In culture and cultural influence
Painting of the college
In 1870, the buildings of the New College were painted by the impressionist artist, Camille Pissarro. Pissarro was at the time living in Upper Norwood having fled from France at the time of the Franco-Prussian War and was entranced by the London landscapes.
Other cultural influence
The school lent its name to a locomotive in the Southern Railway V Class. This class was known as the Schools Class because all 40 locomotives were named after prominent English public schools. The nameplate from 907, Dulwich, is now displayed by the Model Railway Society within Dulwich College.
See also
Alleyn's College of God's Gift
Dulwich International College
Dulwich College Beijing
Dulwich College Seoul
Dulwich College Shanghai
Dulwich College Singapore
Dulwich College Suzhou
Dulwich International High School Suzhou
Dulwich International High School Zhuhai
Edward Alleyn
Graham Able
List of Old Alleynians
List of Victoria Crosses by School
References
External links
OA Victoria Cross and George Cross Holders
Category:Dulwich
Category:Charles Barry Jr. buildings
Category:Independent schools in the London Borough of Southwark
Category:Independent boys' schools in London
Category:Member schools of the Headmasters' and Headmistresses' Conference
Category:Charities based in London
Category:Educational institutions established in the 1610s
Category:1619 establishments in England
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Obsessive-compulsive symptoms in panic disorder.
Previous reports have noted an increased prevalence of obsessive-compulsive symptoms in patients with panic disorder. The authors found a prevalence of obsessive-compulsive symptoms in 19 (27%) of 70 patients with panic disorder. Compared to a subgroup of 25 patients with classic features of panic disorder and no obsessive-compulsive symptoms, the subgroup with obsessive-compulsive symptoms had an earlier onset of illness, were more likely to have personal and family histories of major depression and substance abuse, and showed a poorer outcome after treatment.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Blue Anarchy >> The Construction Of The Sea Louse
The Sea Louse Begins
I was back in the Bay Area again, squatting an Emeryville warehouse with all the free space that I'd ever dreamed of, having gone from three boats to none. After owning a share of a 55' tripple-masted schooner, then a couple of 30' sloops, and now nothing, I was in serious danger of somehow accumulating another boat. I decided that I'd learn from my mistakes, and that what I really wanted was something very small. Maybe 12 or 13 feet.
The thing about squatting is, you end up with a certain amount of freedom that you're afraid to use. After your fifth eviction, you start to think twice about spending a lot of time on a place, or even painting the walls. The world is full of multi-year squats that still look as bad as they did on the first day, because any day could have been the last. So when I finally found that I had all the space I'd always dreamed of, it was difficult to make myself do anything with it. But the tragedy of it seemed too overwhelming, so I started building a boat -- hoping that I'd finish before we were discovered and kicked out in the middle of the night.
The Plan
Since I didn't have a lot of time (or money), and since I'd never built a boat before, I decided to employ the fastest but least respected form of wooden boat building: stitch and glue. I walked to the bookstore and got a book called "Stitch And Glue Boat Building" that had plans for something called "The Jimmy Skiff." Since I didn't have a lot of tools (or the lifestyle that could really accomodate a lot of tools long-term), I decided that I'd build the whole thing using only hand tools. I got a small Japanese pull-stroke hand saw, a block plane, a rubber mallet, a bit-and-brace screw driver/drill, and some clamps. Nothing large, and no electricity. While I made a lot of mistakes during this process, resolving to use only hand tools was the best decision of the project.
The next day I got four sheets of plywood from the hardware store, and began.
Scarf Joints
My skiff was to be 13ft long, but I was building it out of plywood, and plywood only comes in lengths of 8ft. So the first thing I had to do was turn two peices of 4'x8' plywood into one long peice of 4'x16' plywood. One way to do this is to lay both pieces of plywood on the floor, then line the 4' ends up, and screw in a small piece of 1x4 such that it holds the two pieces of plywood together. This is called a "butt joint."
The problem with butt joints is that they look bad and aren't very sturdy. This is especially true when you're bending the wood, since it won't bend at a constant rate near the joint. One alternative is called a "scarf joint." Essentially, you make two matching diagonal cuts in two peices of wood, such that they fit together and are a constant thickness. While you might be able to do this with a hand saw on a small 2x4, it's more difficult with plywood.
The trick is to lay your plywood on top of each-other, then plane across them until you have a constant slope that's the length of your scarf. When I'd gotten pretty close with the block plane, I put a peice of sand-paper on a scrap piece of 1x4 and sanded it the rest of the way down. This took a while, but at the end of the day I'd discovered a new love in my life, and it was a finely sharpened block plane.
Lofting
After I finished planing out the scarf joint, I flipped one of the pieces of plywood over and lined it up with the planed edge of the other one. From the side, the tapers should match pretty much exactly, so that the thickness of the plywood doesn't change in the area where they're joined. Being my first scarf joint, it wasn't exactly perfect. I mixed some two-part epoxy, slathered it down with glue, and then put some cinder blocks on top of it while I waited for it to dry.
The next day, I sanded down the excess glue, and started lofting. This is the interesting process of transfering the dimensions from a set of plans (whether your own or someone else's) to the scale of your lumber. Since boats are symmetrical, all the measurements are provided from a center line, and one side is just the mirror-image of the other. The plywood I just scarfed was to become the bottom of the boat. The first thing I did was mark the length-wise center of the plywood with a chalk line. The plans I had specified the distance from the center-line to the edge of the bottom in 16inch increments. So every 16 inches, I marked another chalk-line width-wise, then measured the specified distance from the center, and drove in a finishing nail at that point. I was left with a set of finishing nails that approximated the curve of the bottom of the boat.
To get the exact curve, I took a long/thin piece of trim, and bent it across all of the nails. Using clamps to hold it in place, I was able to draw a line along the inside edge of the trim. This was the curve of the boat.
After drawing out the curve on both sides, I removed the finishing nails and made quick work of the cut with my pull-stroke japanese hand saw. While the pull-stroke saw cuts pretty quickly, I found it difficult to get a perfectly straight line. So throughout the process, whenever I needed to cut something, I'd cut it about 1/8in wider then necessary, then plane it down to the exact width.
Stitching
Once I had the bottom cut out, I repeated the process for the side panels: I took my other two sheets of plywood, planed them for a scarf joint, glued them together, then lofted out the side panels. Once I'd cut them, it was time to start stitching the pieces together.
It's called stitch-and-glue construction because the wood pieces are temporarily stitched together with string or bits of wire, then epoxied in place. After the epoxy cures, the stitching is removed and everything's ready.
I had dumpstered a large bag of small plastic zip-ties, so I decided to use those for stitching (which worked quite well). I drilled corresponding 1/8in holes in the very stern and the very head of the floor panel and side panels. I zipped one of the panels on, then bent it out in the middle and marked the place where it matched up with the floor at that point. Then I drilled corresponding holes there, zipped them together, and had my basic shape. To get things exactly right, I went back along the edge, drilled holes and zipped through them every 6 inches. I put on the other panel, finished zipping everything together, and was left with something that had actually started to resemble a boat.
The Stench Of Fiberglass
Fiberglass is not the most pleasant material to work with, and it requires a lot of patience. Once everything was stitched together, I made fiberglass fillets over the interior zip-ties. This consist of mixing fiberglass epoxy with a thickener until you have the consistency of paste, then spreading it evenly across the seam. Before it hardened, I put a layer of fiberglass tape on top of that. Once I'd done that for each seam and they'd all dried, I cut the zip-ties off from the outside, sanded them down as well as I could, and plugged the exterior holes with more epoxy paste. The result was a water-tight hull.
I then cut some more plywood into the shape of a skeg, and fiberlgassed that on to the bottom, as straight as I could get it.
Trim, Daggerboard, and Rudder
Around about this time, I was evicted from the Emeryville squat. It was being demolished, so that they could expand the mall. Nearly defeated, I put my partially-completed boat onto the roof of a friend's truck, and drove at 25mph over the Bay Bridge towards San Francisco, where I moved into another house with an empty driveway.
There, I fashioned up a daggerboard trunk, put strong popular rub-rails on, made a small deck, cut out a folding rudder and tiller, and started painting. It was kind of nice to work on the sidewalk, actually. Neighbors would walk by all day and stop to talk about the boat, ask about its progress, or just shout "lookin good, moxie!"
The Mast
For the mast, I decided I'd just use a long piece of 2x2. Everyone who saw it looked at it and said "that's too thin." And they were right.
The Tyvek Sail
The only thing that remained was a sail. I decided to follow Bill Wallace's excellent instructions for making a Tyvek sail, and started looking for Tyvek. It's incredibly expensive to buy, so I just rode my bike around until I found a house that was under construction and had visible Tyvek. I walked in, told the fellow doing the work that I was a boat builder in need of a sail, and he handed me a roll of Tyvek right there. It was a 12' wide roll, so I was able to make my whole sail out of one panel.
I didn't have access to a lofting setup, but one of the roommates in my new house had just moved out, so in the day where the room was completely empty but the new roommate hadn't moved in yet, I layed out and cut the sail. It definitely took me a while to remember the appropriate trigonometry.
Following Bill Wallace's instructions, I then re-inforced and grommetted the corners. I decided on a lace-up style lashing, and put grommets all along the luff for it.
Setting Sail
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
How do I call a method inside ApplicationHelper from my Model?
# application_helper.rb
def do_some_stuff
...
end
# my_model.rb
def my_model_method
# I want to call the method "do_some_stuff" here, how exactly?
end
Obviously, I can't just call do_some_stuff, since it would tell me that the model does not have this method.
A:
You can accomplish this by adding the following line to your model file:
include ActionView::Helpers
Now, you may want to reconsider placing your helper method somewhere else (e.g. the model, or a mixin module), but use the above line to do what you've asked for.
|
{
"pile_set_name": "StackExchange"
}
|
The Role of the Trustee or Trustees
When you create a trust, put serious thought into who you name as trustee. A qualified trustee will be good with numbers, and with people too.
When you create a trust, you'll need to decide who will be trustee when or if you cannot do the job yourself. Trustees have a great deal of authority over the money and property in a trust, so you should choose someone in whom you have great confidence. In the event the trustee proves unable to handle the responsibilities, you or the trust beneficiaries have will be able to remove the trustee and seek to recover any damages he or she caused.
Appointing Joint and Alternative Trustees
Appointing just one person as trustee can be risky. If the named trustee becomes unable to manage the trust because of a medical issue, lack of time, or any other reason, a new trustee will have to be appointed by a court.
One option is to name more than one trustee to serve at the same time. Appointing "cotrustees" or "joint trustees" can increase the likelihood that someone you've chosen will be available to do the job. However, you'll need to decide whether the trustees must act together or whether any trustee can act alone -- and both of these scenarios have complications. In fact, naming more than one trustee can sometimes create more problems than it solves.
A better option is to name successor or alternate trustees to serve if the original trusteed becomes unavailable.
Trustees Should Be Comfortable With Numbers
State laws require a trustee to administer a trust in the best interests of the beneficiaries.
Trustees have a large number of responsibilities, many of which require some general accounting skills. Depending on the amount and type of assets you put into the trust, your trustee may need to correspond with financial institutions, keep track of all income and losses from investments, prepare periodic financial reports for beneficiaries, file tax returns, and distribute money to beneficiaries.
Trustees Must Manage the Trust for the Benefit of Beneficiaries
State laws require a trustee to administer a trust in the best interests of the beneficiaries. Trustees who fail to exercise beneficiary loyalty in every decision they make can be subject to adverse legal consequences. For example, a trustee who stands to gain more from a trust transaction than the beneficiaries do is in breach of the duty of loyalty - and can be financially liable.
Beneficiaries Can Have a Trustee Removed
Trust beneficiaries can always ask a state court judge to remove a trustee if they feel that the trust isn't being handled properly. A trustee can be removed for many reasons, such as lacking the skill to handle trust transactions, failing to file tax returns or pay taxes that cost the trust money in penalties, or serving the interests of others who aren't trust beneficiaries.
A Trusts and Estate Lawyer Can Help
The law surrounding the responsibilities of trustees can be complicated, and the facts of each case are unique. This article provides a brief, general introduction to the topic. For more detailed information and a discussion about your individual circumstances, contact a trusts and estates lawyer.
|
{
"pile_set_name": "Pile-CC"
}
|
Interrelationship between ovine follicular fluid inhibin and serum albumin.
Ovine follicular fluid inhibin (oFF-I) as isolated in this laboratory, proved to be a monomeric protein (M(r).65 kDa). It was found to share very many of the physico-chemical characteristics of ovine serum albumin (oSA)-such as molecular size, iso-electric point, N-terminal aminoacid, finger-print patterns following enzymatic or cyanogen bromide cleavage, as well as binding of estradiol-17 beta and tryptophan. Furthermore, an antiserum containing polyclonal antibodies to oSA showed perfect cross-reaction with oFF-I. Nevertheless, oFF-I is distinct and different from oSA, as would be evident from the data reported here. Of the two proteins, oFF-I alone is capable of suppressing pituitary FSH output in a dose-dependent manner. Secondly, an antiserum containing polyclonal antibodies against Fraction-S2, a partially purified, biologically active fragment (M(r): 30-40 kDa)-derived from oFF-I, cross-reacted with the 65 kDa inhibin, but did not recognize oSA. Finally, the CD-spectra of the two proteins, when examined as a function of pH, show characteristic differences.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Welcome to: FYEAHAMBROSE Welcome to:
Welcome to FYeahAmbrose, your ultimate source for the 2 time Intercontinental Champion and former WWE Champion and US Champion, Dean Ambrose. Here you will find edits,gifs, and much more!
Official Links social media Official Links
Upcoming Events Raw,Smackdown,House Shows,and Etc. Upcoming Events
Bossier City,LA Lafayette,LA Lake Charles,LA SD:Baton Rouge,LA Birmingham,AL Jackson,MS
Spotlight Photo of the Week Spotlight
Affiliates blogs you should follow Affiliates
About the site info about the blog About the site
|
{
"pile_set_name": "OpenWebText2"
}
|
Marcus Fronius
Marcus Fronius (1659 – 14 April 1713) was a Lutheran theologian, pedagogue, and author whose published works covered topics such as theology, metaphysics, and humoural physiology.
Fronius, a Transylvanian Saxon, was born in Neustadt, Siebenbürgen, and studied under the tutelage of Johann Deutschmann and Abraham Calovius, obtaining an M.Th. from the University of Wittenberg in 1682.
He was also a poet and musician of some note, having composed pieces to accompany the Lutheran Mass; and was said to have had "extraordinary skill in drawing and in the Latin language." He died in Kronstadt, Siebenbürgen.
[see also Fronius]
Works by Marcus Fronius
Dissertatio Metaphysica, de distinctione, Praeside Christ. Donati Kal. Nov. Vitebergae, 1681.
Dissertatio de distinctione Totius et Partium, Respond. Joh. Hoch. Parathia Transsilvano. Kal. Nov. Vitebergae, 1682.
Dissertatio de τριαδγνϖσια primorum N. T. Fidelium, ante publicum Christi Praeconium, Praes. Joh. Deutschmann. Vitebergae, 1682.
Ugyanez Deutschmannnak Theosophia et Triadosophia, Witebergae, 1685.
Eccur prae se ferat aliud, aliud animo destinet, Deus Optim. Max., Praeside M. Marco Fronio, Andreas Nekesch, Cibiniens. Transsilv. propugnabit, anno 1686. d. 3. Február Witebergae.
Cum coelum levius sit, fitque gravissima terra... Witebergae, 1700.
Tusculanae Heltesdendes Coronae. 1704. (Dissertationes de SS. Theologia, quibus Articulorum Fidei omnium connexio methodo scriptuaria e septem omnino S. Sc. Locis deducta, commonstratur, ventilatae, Praeside Marco Fronio).
Von der zum Himmel führenden Heimlichen und verborgenen Weisheit wie sie uns Gott durch seine Propheten und Apostel hat wissen lassen. Psal. 51. 8. I. Cor. 2. 7. Kronstadt, 1704.
Patriam Quaerens Exul Psyche. Kronstadt, 1705.
Der Artikel Von der Busse, in etlichen Sermonen fürgestellet, aus denen Worten des Propheten Joëls 2. 12. 13. 14... Kronstadt, 1707.
Ordinationspredigt, als Herr Simon Draud, Gymn. Cor. L. 1. zum Pfarrer in Roth-Bach ordiniret und installiret wurde. Im Jahre Christi, 1709. 12. Hornung. Kronstadt.
Enchiridon, Der kleine Catechismus D. M. L. Kronstadt, 1709.
Die heimliche und verborgene Weisheit Gottes, welche Gott verordnet hat für der Welt, zu unser Herrlichkeit. (I. Theil.) In sieben Sprüchen heiliger Schrifft entworffen. Seinen Kindern aber gezeiget, von M. F. P. C. Kronstadt, 1709.
Sprüche, woraus die Glaubens Artikel, in schrifftmässiger Ordnung, nach Einleitung derer sieben Grund-Sprüche, welche unterm Namen der Heimlichen und Verborgenen Weisheit Gottes, herausgegeben, sind abgehalten worden. Kronstadt, 1710.
Die von unserm Herrn Jesu allen denen zu Ihm Kommenden und Beladenen versprochene Ruhe der Seelen, in einer Fest-Andacht betrachtet, zu Cronstadt 1711. Jahrs August Monat. Kronstadt.
Ordinations. Predigt, als 1711. Jahres, den Pfingst-Montag zum heiligen Ammt, die Heerde Christi in Clausenburg zu weiden, die Hände auffgelegt werden. (Tit.) Hn. Georgen Marci, der H. Schrifit befliessenen, etc. geschehen in Cron-Stadt. Kronstadt, 1711.
Ists auch recht? Bei dem betrübten Falle eines Eigenmordes abgehändelt Am Sonntage Trinit. über das ordentliche Evangelium, von M. F. C. D. Kronstadt, 1712.
M. Marcus Fronius Visitationsbüchlein. Ein Beitrag zur Kirchen- und Sittengeschichte des Burzenlandes. Kronstadt, 1868.
References
Category:Transylvanian-Saxon people
Category:German Lutheran theologians
Category:1659 births
Category:1713 deaths
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Ornarantia
Ornarantia is a genus of moths in the family Choreutidae.
Species
Ornarantia biferana (Walker, 1863)
Ornarantia bigerana (Walker, 1863)
Ornarantia canofusana (Walker, 1863)
Ornarantia chorica (Meyrick, 1926)
Ornarantia cinctipes (Felder & Rogenhofer, 1875)
Ornarantia contrariana (Walker, 1863)
Ornarantia contubernalis (Zeller, 1877)
Ornarantia dyari Busck, 1900
Ornarantia gradella Walsingham, 1914
Ornarantia immarginata Walsingham, 1914
Ornarantia laciniosella Busck, 1914
Ornarantia meratella Busck, 1914
Ornarantia ophiodesma (Meyrick, 1915)
Ornarantia rimulalis (Zeller, 1875)
Ornarantia scenophora (Meyrick, 1922)
Ornarantia tristis (Felder & Rogenhofer, 1875)
Ornarantia velatana (Walker, 1863)
Ornarantia xutholopa Walsingham, 1914
External links
choreutidae.lifedesks.org
Category:Choreutidae
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Mission Statement
Kathy Moore brings a unique skill set to the design table. With a background that includes textile and apparel design at companies such as Ralph Lauren, a long career in merchandising both retail and commercial spaces, and as a co-owner of a successful fashion accessories business, she has recently focused her talents on interiors. “Designing an inspired living space is like getting dressed – blending elements, textures, and styles to arrive at a look that is uniquely yours.” Kathy focuses on ensuring the functionality of the spaces she designs while shaping the overall experience into one that is pleasing to all the senses. Since 2012, Kathy has designed multiple projects on the Main Line and in Martha’s Vineyard.
|
{
"pile_set_name": "Pile-CC"
}
|
Manage Black Friday without a black eye
Black Friday, the most anticipated shopping day of the year, is fast approaching, and now is the time to get mentally prepared. This year, many stores like Target are opening their doors during the early evening of Nov. 22, Thanksgiving Day. As a result, Thanksgiving dinner and family visits may get cut short this year. However, as a solution, take your family with you as you hunt for the best deals of the holiday season. Before you head out, take these five tips into consideration to make the most of your Black Thursday/Friday experience.
Get some sleep
Sleep should be your greatest priority before heading out for Black Friday shopping. The success of your trip is greatly based on when you get to your shopping destinations, which can be determined by whether or not you get an adequate amount of sleep. In more cases than not, waking up and heading out early (or logging onto Amazon) will allow you to gain access to the best deals and selections as well. So, plan your Thanksgiving dinner accordingly, so you can plot out late-night shopping destinations as well.
Dress in layers
You should obviously dress warm to offset the cold weather you’ll face waiting outdoors in long lines. However, bulky clothing isn’t the answer. Black Friday shopping can be more physically exerting than shoppers anticipate. Bulky clothing, like chunky sweaters or large coats, will keep you warm when necessary, but can become cumbersome and uncomfortable when you begin to shop. Try wearing a lightweight tank top, and put a t-shirt or sweater over it. Essentially, adding light layers is key. This will build a wall against the cold that will be easy to peel away as necessary. Also, leaving bulky clothing at home will make trying on clothes much easier.
Wear comfortable shoes
Black Friday shopping has the potential to be an all-night ordeal, with a lot of standing up and walking around. However, choosing your shoes wisely can turn the ordeal into a more pleasant experience. Lightweight shoes are best, as heavier shoes will require more work to walk in. Consider wearing lightweight shoes made of flexible material that allow your feet to breathe. Shoes with adequate heel support, like walking or exercise shoes, are good choices. They will perform well while supporting both your heels and arches. When looking for style and comfort, try flats or boots with half-inch or 1 inch heels, which will aid in preventing that burning feeling in your calves from fast-paced walking.
Make a list
Know what you will be shopping for by making a list of items you plan to buy. Consider the most important items you want to purchase when making your list. A list of priorities will also keep you from giving in to tempting sales and low prices. Don’t crowd your mind with every item you would like to buy this holiday season; allow yourself to spend money on what is important, instead of spending money for someone’s gift on a spontaneous purchase. Get in and get out.
Plan your trip
As mentioned before, planning your shopping trip before you head out will help alleviate stress and confusion, as well as overspending. Do research on your favorite stores to find the best sales. You can also use your list of important purchases to help plan your trip. Both methods of planning will allow you to determine if shopping online is a possible alternative to going to some stores. Based on what you plan to buy, and from where, look for the best deals to decide what you can buy online, and what you will go hunting for. Furthermore, planning will allow you to determine whether you should bring cash or your debit or credit card. Bringing more money than necessary can promote frivolous spending. Thus, knowing how you will spend can save you money.
|
{
"pile_set_name": "Pile-CC"
}
|
Robin Gibson
Robin Gibson may refer to:
Robin Gibson (architect) (1930–2014), Australian architect
Robin Gibson (footballer) (born 1979), English footballer
Robin Warwick Gibson (1944–2010), British gallery curator and art historian
|
{
"pile_set_name": "Wikipedia (en)"
}
|
All though I got a lot done in the shop yesterday, it was not my day. They say bad luck comes in threes, but I wonder if that rule applies to bad judgment too.
After gluing each of the drawer fronts to the drawer boxes, I needed to clamp them together so the joint would dry properly. So I placed a couple of paper towels down on a flat surface, then stood the each drawer up on its drawer front and clamped it to the flat surface. I did all that after I meticulously sanded through all the dry grits and wet grits using paraffin oil. When an hour or so went by, I unclamped the drawers, and lo and behold, the paper towel texture was molded onto the drawer front! I had to go back to the 220 grit sandpaper and work my way through the sanding process again. My shoulder was not very happy about that!
When it came time to put the top on, I noticed that the top was not longer sitting perfectly flat when I set it down on the table saw top. I have no idea how this could have happened. So on the back left corner, I was forced to insert a small shim. There is not excuse for a piece of fine furniture to be shimmed, but I really did not know what else to do. The band saw box “Yud” will at least hide the shim.
Finally, the “Hinny Youngman Bone Head Award of the Year” award was presented to me yesterday. I don’t know where you live, but it is cold out there! Whilst applying the shellac to the top, I moved the Chai-boy in the area of the shop with the propane heater. Let me clarify, I moved the Chai-boy too close to the heater and the high heat did something to the surface of the wood that made rough. Only a small area was affected, but I will need to go back and sand out that area! I think my shoulder will most likely send me a nasty gram about that too.
Chai-boy with drawer fronts attached
At least the assembly of the “Ches” is pretty much done except for the drawer pulls. Now I need to start on the “Yud” bandsaw box part of the project. I’ve got a lot to think through on that part of the project. At least today is an odd numbered day, so perhaps my luck will change and I will get my list of objectives SUCCESSFULLY completed. One can only hope.
|
{
"pile_set_name": "Pile-CC"
}
|
On Thu, Jan 08, 1998 at 02:38:52PM -0600, hawk@eyry.econ.iastate.edu wrote:
>
> I currently have my floppy set up so that users can mount ms floppies with the
> line
>
> /dev/fd0 /floppy msdos user,rw 0 0
>
> in /etc/fstab
>
> I tried changing "msdos" to "auto", but no dice. Is there a change so that it
> can automount both msdos and ext2 disks?
What about having several mount points?
/dev/fd0 /floppy/fat msdos user,rw 0 0
/dev/fd0 /floppy/ext2 ext2 user,rw 0 0
[etc...]
--
TO UNSUBSCRIBE FROM THIS MAILING LIST: e-mail the word "unsubscribe" to
debian-user-request@lists.debian.org .
Trouble? e-mail to templin@bucknell.edu .
|
{
"pile_set_name": "Pile-CC"
}
|
Chris Long, retired NFL player and crucially important part of the Eagles’ first-ever Super Bowl, appeared on the Dan Patrick Show on Wednesday just days after announcing his retirement.
It’s clear that Long, who has often been an advocate for progressive policies in the league, as well as in the world around him, isn’t going to spend his retirement time being quiet.
Long and Patrick talked about recreational marijuana use, and the usage of marijuana league-wide. Long said he used his “fair share” of marijuana on a regular basis, and also offered up his point of view as someone who spent years across a number of locker rooms.
The whole segment is worth a watch:
Long’s public stance comes a day after the NFL’s chief medical officer, Allen Sills, told Boston.com that the league’s pain management committee has been asked to bring the league suggestions, saying the NFL will “look at marijuana” for pain relief.
Long, who won the league's prestigious Walter Payton NFL Man of the Year Award in 2018 for his humanitarian efforts, thinks it’s a no-brainer.
“I think, from a standpoint of what’s safer for the people and the player, and certainly people in the spotlight, it is far less harmful than alcohol,” Long said Wednesday. “It is far less harmful than tobacco. And at various points in the league’s history, they have engaged in partnerships with those respective industries.
“I think — I’m not a dry snitch, I’m not going to put a percentage on how much the league smokes, but I certainly enjoyed my fair share on a regular basis throughout my career. I was never afraid to say that, but I’m able to say it more explicitly now. Listen, if not for that, I’m not as capable of coping with the stressors of day-to-day NFL life. A lot of guys get a lot of pain management out of it.”
Marijuana has seen numerous studies in the past five years examine its efficacy in pain-relief. A 2016 research paper, for example, found that marijuana use for cancer pain led to a 64% reduction in opioid use, and led to participants using fewer medications, along with improving general quality of life.
Follow Adam & PhillyVoice on Twitter: @adamwhermann | @thePhillyVoice
Like us on Facebook: PhillyVoice
Add Adam's RSS feed to your feed reader
Have a news tip? Let us know.
|
{
"pile_set_name": "OpenWebText2"
}
|
Short-time growth of a Kardar-Parisi-Zhang interface with flat initial conditions.
The short-time behavior of the (1+1)-dimensional Kardar-Parisi-Zhang (KPZ) growth equation with a flat initial condition is obtained from the exact expressions for the moments of the partition function of a directed polymer with one end point free and the other fixed. From these expressions, the short-time expansions of the lowest cumulants of the KPZ height field are exactly derived. The results for these two classes of cumulants are checked in high-precision lattice numerical simulations. The short-time limit considered here is relevant for the study of the interface growth in the large-diffusivity or weak-noise limit and describes the universal crossover between the Edwards-Wilkinson and the KPZ universality classes for an initially flat interface.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Until then, Scotland had been, in the English imagination especially, a wild and lawless place that had to be subdued by force.
Scott made it safe, even romantic.
"Scott was very clear when he wrote his first novel, Waverley, that what he was doing was introducing Scottish readers to their own history, and English readers to Scotland's history," says Stuart Kelly, author of the critically acclaimed Scott-land: The man who invented a nation.
"But there is something fictitious about it all, not fake but fictitious."
Media captionWatch Allan Little's BBC Newsnight film in full
We are sitting in Scott's impressive drawing room at Abbotsford and Kelly gestures to what appears to be the finely carved, oak-wood ceiling above us.
"This wonderful roof is modelled on Rosslyn Chapel," he says, "but it isn't even wood. It's papier mache and sawdust.
"This whole place is a kind of theatrical set.
"But there's something good about that, the idea that our identity is not something fixed, that it's something changeable, that Scott could actively go out there and think 'I will change the way people think about Scotland'."
Dancing around swords
Victorian Britain loved this manufactured Scotland and bought it wholesale.
Queen Victoria mimicked it in the design of her Scottish retreat at Balmoral. This Scotland sat comfortably in the prospering British Union.
Image copyrightAFPImage caption
Do you think of kilts when you think of Scotland?
But a generation emerged in the 1970s that wondered why it was still, so late in the 20th Century, watching men in kilts dancing around swords while demure ladies in white frocks and tartan sashes looked on.
Why, it wondered, was Scotland still presenting itself in this way when none of us knew anyone who actually did this kind of thing?
"Kilts, haggis, the White Heather Club… on television as a young person, certainly growing up in Scotland, I didn't feel like it related very much to me," Scots actress and comedian Elaine C Smith told me.
"I didn't look out there and see anyone that reflected me at all."
But that Scotland - that sense of what the country was - had been carried around the world by the British Empire.
The canny Scot and the dour Scot, and their cousin the chippie Scot, landed on every shore.
They dressed in tartan and toasted Robert Burns every January and sang sweet, sentimental songs about exile and distance and longing for a Scotland which didn't really exist; a Scotland which was an imagined romantic construct.
Rebellious past
That Scotland was tame, it was safe, it knew its place in the greater scheme of things.
It had a rebellious past that could be saluted and celebrated as long as that rebelliousness stayed safely in the past.
And that Scotland survived well into our own age. Think of Private Fraser in Dad's Army.
"One Saturday night, at the age of 15 or something, on to the television came a version of John McGrath's play The Cheviot, the Stag, and the Black Black Oil," says Smith.
"And it changed my life really. I had never seen my own culture and my own country reflected back to me in the way that it did.
"There was a sort of reclaiming of who we were."
Image copyrightAFP
The Cheviot, the Stag, and the Black Black Oil drew a direct line between the Highland Clearances of the 18th Century and the sudden, catastrophic decline of heavy industry in the 20th.
This was a powerful new voice in Scottish culture. It was an angry play.
It was produced by a theatre company called 7:84, so named because 7% of the population of the country owned 84% of the wealth.
Scottish national identity began to wrap itself in the cause of social justice - in the idea of resistance to unaccountable wealth and power imposing its will from outside.
Voice of cities
"The reason Scottish identity so closely allied with left-of-centre politics, a sense of social justice and inclusion is because of the mauling Scotland perceived itself to get during the Thatcherite years," says the novelist James Robertson.
"Thatcherism was obviously disliked by lots of people in lots of other parts of the British Isles, but it seems to me that in Scotland, because we had a sense of national identity, we had something to coalesce around, to respond to.
Image copyrightAFP
"Culture, it seems to me, is a way of asking questions about who we are, or who do we think we are.
"And those questions can be much more easily answered through culture than through politicians standing up and sort of wagging fingers at people and saying this is who you are."
This Scotland was also irreverent, self-mocking, and hilariously funny.
Billy Connolly, who'd been a Glasgow shipyard welder, spoke for a Scotland that now began to eclipse the old stereotype.
This wasn't just funny. It was genuinely liberating.
This was the Scotland that emerged to replace the heirs of Harry Lauder and Balmorality and the green hills of Tyrol.
This Scotland was urban with a collective folk memory of displacement from a rural past.
This Scotland felt increasingly dispossessed as the industries that had serviced the British Empire collapsed and spoke in the voice of the cities, especially of Glasgow.
This Scotland was dismayed by what was happening.
It was angrier, less tame, less docile, more political.
It didn't much care about the Bonnie Bonnie Banks of Loch Lomond and it didn't know the difference between the low road and the high road.
This Scotland was much less British.
Revival of identity
Scottish children had always been punished for using Scots idioms and locutions in school.
Standard English was thumped into you. But by the 1980s, publishers wanted literature to reflect the demotic speech of ordinary folk.
"They realised there was a market for work in which we talked about ourselves in our own terms," says Liz Lochhead, one of Scotland's most celebrated poets and playwrights.
"And then with the first failed referendum [on devolution in 1979] there really was, afterwards, a sort of sense of depression, which then expressed itself in a sense of let's get on with it, and... a revival of Scottish identity."
In the visual arts too you sense this gradual decoupling.
Ross Sinclair is one of a group of young artists who emerged from the Glasgow School of Art in the 1980s.
Image caption
Abbotsford was designed by Scott himself
He says for his generation of artists, Scotland's access to the wider world no longer lies through London alone.
"London still has its thrall, it's still fantastic.... but there are all these other kinds of relationships, in Europe and Berlin and Scandinavia and the States, China and Africa - just thinking of projects that are kind of going at the moment.
"These are relationships that aren't based on some kind of historical premise that has this sort of built-in power relationship.
"These are new, fresh relationships, horizontal, organic, there is a feeling that anything can happen."
Scotland's independence debate is shaped by this change in the way the country represents itself.
It is a sentiment that chimes with Walter Scott, for whom Scotland was, of necessity, outward looking, internationalist in character.
Pushing at boundaries
"Waverley's the great novel of border crossing," says Stuart Kelly.
"Scottish novels from the 18th Century to the early 20th Century often feature characters who will cross borders, who will experience more than one country.
"Now by contrast... the great English novels of the 19th Century are very settled affairs.
"The truly great novels, the kind of Bleak House novels, or Jude the Obscure, or Middlemarch, these are not novels about travel."
Walter Scott conjured a Scottish identity that could fit in a wider British context.
Scotland's artists have been pushing at the boundaries of that for 40 years.
|
{
"pile_set_name": "Pile-CC"
}
|
850 F.2d 694
271 U.S.App.D.C. 1
FEDERAL TRADE COMMISSION, Appellantv.OWENS-ILLINOIS, INC., et al.
No. 88-5048.
Civ. A. No. 88-00022.
United States Court of Appeals,District of Columbia Circuit.
April 8, 1988.
Prior report: 681 F.Supp. 27.
Before ROBINSON, D.H. GINSBURG and SENTELLE, Circuit Judges.
ORDER
PER CURIAM.
1
Upon consideration of Appellant's Suggestion of Mootness and Motion to Vacate Order of the District Court and to Remand With Instructions to Dismiss Complaint, and the Response thereto, it is
2
ORDERED by the court that the motion be granted. The present appeal, from an order of the district court denying appellant's motion for a preliminary injunction, has become moot as a result of the consummation of the merger sought to be enjoined. Accordingly, because the case has become moot, the judgment of the District court is vacated, and the case is remanded with instructions to dismiss the complaint. See United States v. Munsingwear, Inc, 340 U.S. 36, 39, 71 S.Ct. 104, 106, 95 L.Ed. 36 (1950).
3
The Clerk is directed to withhold the issuance of the mandate herein until seven days after disposition of any timely petition for rehearing. See D.C. Cir. Rule 15.
|
{
"pile_set_name": "FreeLaw"
}
|
Q:
How to Map Database Lookup Tables Automatically on Insert (Oracle)
I have existing tables that are pretty much denormalized. There are no lookup tables for things list status, type, country, etc... This original design was done just to simplify the application's access to the database, so there was no performance reason for this denormalization.
This has resulted in tables with tons of duplicate data, and I would like to normalize properly by introducing lookup tables for various status/type/country columns.
Is there some was I can do this in the database (oracle) that would remain transparent to clients? Applications would continue to do inserts but the database would map things to the proper lookup tables behind the scenes.
I've been experimenting with a combination of views and triggers that will do the mapping, but it feels like there should be a more automatic way of doing this.
A:
In the general case, you can make your changes transparent to the users if you can create updatable views.
Normalize a base table to 3NF, BCNF, or 5NF.
Rename the original base table.
Build an updatable view that has the same name, columns, and rows as
the original, denormalized base table.
Make sure the permissions on the new view correlate with the
permissions on the original base table.
Test.
Repeat until done.
Any client software that tries to SELECT, INSERT, UPDATE, or DELETE the original base table will hit the updatable view instead. (That's because tables and views share a namespace, and that's not an accident.) The dbms and your supporting code will make sure the Right Thing happens.
Depending on your platform and decomposition, building an updatable view might be easy, and it might be impossible. On Oracle, I think the worst case is that you'd have to write INSTEAD OF triggers to support all the query operations. That's not too bad.
But based on a few months knocking around on SO, I have to say I'm not 100% confident you really need to do this, or that you really want to do this. Post your tables' DDL and representative sample data as SQL INSERT statements, and we can offer better, more concrete suggestions.
|
{
"pile_set_name": "StackExchange"
}
|
Hammer Nutrition Perpetuem | 16 Servings
Hammer Nutrition Perpetuem - Welcome to the world’s finest fuel specifically formulated for multi-hour to multi-day events. No matter how long or extreme your exercise regimen or Ironman races may be, Hammer Nutrition Perpetuem is always up to the task. Thoroughly tested and proven in the world’s toughest endurance events, Hammer Nutrition Perpetuem’s unique formula – containing complex carbohydrates, soy protein, healthy fats, and key auxiliary nutrients such as sodium phosphate – is unsurpassed for maintaining optimal athletic performance for as long as you want. Perpetuem provides consistent, reliable energy, maximizes stored fat utilization, and buffers lactic acid to prevent muscle fatigue. On the road or trail, Hammer Nutrition Perpetuem is the breakfast, lunch, and dinner of champions. Take it long with Hammer Nutrition Perpetuem!
Extra Benefits:
Carnosine, one of the ingredients in Hammer Nutrition Perpetuem (it’s also in HEED, Sustained Energy, and Recoverite), is both a performance aid (a superb acid buffer) and a premium general health nutrient (multiple free-radical scavenging and anti-glycation antioxidant).
Gluten-free
Consistent, stable energy
Easy to digest
Minimize lean muscle tissue cannibalization
Never before has a fuel so complete and effective been available to endurance athletes prior to now.
The container of fuel you possess is a result of several years of research and thousands of miles of testing in a variety of endurance disciplines; it is the first fuel introduced by Hammer Nutrition in over a decade. PERPETUEM represents the ultimate, never-before-available link to satisfying the body's fueling requirements no matter how long or difficult your exercise session or race is.
Carbohydrates - As with all Hammer Nutrition fuels, we never add simple sugars to the carbohydrate profile. Hammer Nutrition Perpetuem contains a specific maltodextrin, which provides nearly 87% of its caloric composition in long chain carbohydrates.
Protein - A new calcium-enhanced soy protein isolate known as "XT" makes up nearly 10% of the caloric profile of Hammer Nutrition Perpetuem, the same percentage as is cannibalized during long slow endurance workouts. This particular soy protein contains a very high amount of intact, cardiovascular-enhancing isoflavones.
Fat - A de-oiled "super lecithin" (extracted from the soybean) is ideal for consistently and reliably fueling the body and maximizing energy production from stored fatty acids.
Sweetener - We use Energy Smart, the same healthy sweetener in Hammer Gel, in Hammer Nutrition Perpetuem. This gives Hammer Nutrition Perpetuem a mellow-orange "Dreamsicle" flavor.
Application:
Use as a primary source of calories during exercise/competition lasting more than two hours.
Mixing / Usage Instructions:
IMPORTANT NOTE: Due to potential spoilage issues, Hammer Nutrition Perpetuem cannot be premixed and left for several hours in warm weather.
You can mix and consume Hammer Nutrition Perpetuem three different ways depending on individual preference and logistical concerns. Please experiment with the following options to determine which works best for you.
The One-Hour Bottle - Mix the suggested amount of Hammer Nutrition Perpetuem for your bodyweight (see chart below) in a 21-24 ounce (approx 520-710 ml) water bottle. Consume one bottle hourly. This method is ideal when training or racing with a support crew and vehicle. If you’re without a support crew but still want to use this option for mixing, keep in mind that it’s obviously less convenient as you’ll have to stop more frequently to mix your fuel drink. Also, because you are trying to fulfill both hydration and caloric requirements from one source, you have limited ability to adjust one without affecting the other; you may need to consume additional water to satisfy hydration requirements.
The Multi-Hour Bottle - This is by far the most convenient method of fueling because it allows you to be self-sufficient for many hours, requiring only additional plain water along the way. The only limitation is how many scoops you can fit into a bottle. Determine your proper hourly intake of scoops by experimenting with the numbers from the dosage chart. Let’s say you’ve determined through testing that 2 scoops of Hammer Nutrition Perpetuem per hour is your ideal caloric intake. For a 4-hour workout, you’ll need 8 scoops in a bottle, then filled with water and shaken well. You may need to add a few scoops at a time to get it all to mix well. You then “nurse” this bottle, taking small sips every 15-20 minutes. At this concentration, the water in the mixed bottle does not contribute much at all to your hourly fluid intake needs. To meet your fluid requirements, you carry a second and possibly even a third bottle of plain water, or use a hydration system, or know where you can refill along your route. Drink according to the temperature/humidity and your exertion level so that you consume in the range of 16-28 ounces (approx 475-830 ml) of plain water per hour.* This way, as long as you can obtain water along the way, you’re set for hours of hard training.
Gel or Paste - If you want to carry the highest volume of calories in the least amount of space, making a thick mix is your best option. Hammer Nutrition Perpetuem can be made into a super-concentrated, near paste-like consistency and dispensed from a Hammer Gel flask. Using a blender or bowl and spoon, mix scoops of powder with a small amount of water, gradually adding water as necessary to create the consistency desired. If you're using the orange-vanilla flavor of Hammer Nutrition Perpetuem, remember that the heavier and more concentrated you mix it, the sweeter and stronger the flavor will become. You can also add Hammer Nutrition Hammer Gel or Hammer Nutrition HEED for flavor, if desired. Depending on how many scoops per hour you require, and how concentrated the mix is, each flask of Hammer Nutrition Perpetuem can supply you with 2-4 hours of fuel. As with the multi-hour bottle, you must carry additional bottles of plain water or use a hydration system to meet your fluid requirements.
Suggested Doses by Body Weight*
Up to 120 lbs (approx 54.5 kg) - up to 1 scoop/hour
120-155 lbs (approx 54.5-70 kg) - up to 1.5 scoops/hour
155-190 lbs (approx 70-86 kg) - up to 2 scoops/hour
190+ lbs (86+ kg) - up to 2.5 scoops/hour
*These are estimated doses. Each athlete should determine in training, under a variety of conditions, their personal optimum.
Important information:
By design, neither Hammer Nutrition Perpetuem nor Hammer Nutrition Sustained Energy contain any artificial preservatives. Preservatives provide absolutely no benefits for athletic performance or general health—we consider them health hazards, in fact—which is why we do not include them in either of these products, or any of the Hammer Nutrition fuels.
As a result of this, however, once mixed in solution the protein component in both Hammer Nutrition Perpetuem and Hammer Nutrition Sustained Energy is affected in the following ways:
At some point in time it will eventually sour and no longer be acceptable for consumption.
It tends to separate after awhile and may settle on the bottom of a bottle or hydration pack bladder.
We believe that not having artificial preservatives in the products is far more important that these two inconveniences; however, they are things that you need to remember when using Hammer Nutrition Perpetuem or Hammer Nutrition Sustained Energy.
Comparing Hammer Nutrition Sustained Energy and Perpetuem
Hammer Nutrition Sustained Energy is neutrally (a.k.a. “plain”) flavored. Perpetuem is available in two options: an orange-vanilla "Dreamsicle" flavor and in an unflavored/plain version.
Bottom line: With Sustained Energy and Perpetuem, you have two great long distance fuel choices. When exercise goes beyond about two hours, you can use either product as your primary or sole fuel, in any combination with each other or any other Hammer Nutrition fuel.
Shipping Weight: 3.5 lbs.
reviews
Hammer Nutrition Perpetuem | 16 Servings
$29.99
5 Stars based on 1 Review(s)
Guillermo
Mexicali, BC, Mexico
5 Stars
I would recommend this item to a friend.
I would buy this product again and again
January 25, 2011
is a good product, just say food problems have to prepare
differently than suggested by the product, but gives very good
results over longer distances, I use it for an Ironman and only on
the bike
|
{
"pile_set_name": "Pile-CC"
}
|
Alasdair MacIntyre once quipped that “facts, like telescopes and wigs for gentlemen, were a seventeenth-century invention.” Something similar can be said about sexual orientation: Heterosexuals, like typewriters and urinals (also, obviously, for gentlemen), were an invention of the 1860s. Contrary to our cultural preconceptions and the lies of what has come to be called “orientation essentialism,” “straight” and “gay” are not ageless absolutes. Sexual orientation is a conceptual scheme with a history, and a dark one at that. It is a history that began far more recently than most people know, and it is one that will likely end much sooner than most people think.
Over the course of several centuries, the West had progressively abandoned Christianity’s marital architecture for human sexuality. Then, about one hundred and fifty years ago, it began to replace that longstanding teleological tradition with a brand new creation: the absolutist but absurd taxonomy of sexual orientations. Heterosexuality was made to serve as this fanciful framework’s regulating ideal, preserving the social prohibitions against sodomy and other sexual debaucheries without requiring recourse to the procreative nature of human sexuality.
On this novel account, same-sex sex acts were wrong not because they spurn the rational-animal purpose of sex—namely the family—but rather because the desire for these actions allegedly arises from a distasteful psychological disorder. As queer theorist Hanne Blank recounts, “This new concept [of heterosexuality], gussied up in a mangled mix of impressive-sounding dead languages, gave old orthodoxies a new and vibrant lease on life by suggesting, in authoritative tones, that science had effectively pronounced them natural, inevitable, and innate.”
Sexual orientation has not provided the dependable underpinning for virtue that its inventors hoped it would, especially lately. Nevertheless, many conservative-minded Christians today feel that we should continue to enshrine the gay–straight divide and the heterosexual ideal in our popular catechesis, since that still seems to them the best way to make our moral maxims appear reasonable and attractive.
These Christian compatriots of mine are wrong to cling so tightly to sexual orientation, confusing our unprecedented and unsuccessful apologia for chastity with its eternal foundation. We do not need “heteronormativity” to defend against debauchery. On the contrary, it is just getting in our way.
Michel Foucault, an unexpected ally, details the pedigree of sexual orientation in his History of Sexuality. Whereas “sodomy” had long identified a class of actions, suddenly for the first time, in the second half of the nineteenth century, the term “homosexual” appeared alongside it. This European neologism was used in a way that would have struck previous generations as a plain category mistake, designating not actions, but people—and so also with its counterpart and foil “heterosexual.”
Psychiatrists and legislators of the mid- to late-1800s, Foucault recounts, rejected the classical convention in which the “perpetrator” of sodomitical acts was “nothing more than the juridical subject of them.” With secular society rendering classical religious beliefs publicly illegitimate, pseudoscience stepped in and replaced religion as the moral foundation for venereal norms. To achieve secular sexual social stability, the medical experts crafted what Foucault describes as “a natural order of disorder.”
“The nineteenth-century homosexual became a personage,” “a type of life,” “a morphology,” Foucault writes. This perverted psychiatric identity, elevated to the status of a mutant “life form” in order to safeguard polite society against its disgusting depravities, swallowed up the entire character of the afflicted: “Nothing that went into [the homosexual’s] total composition was unaffected by his sexuality. It was everywhere present in him: at the root of all his actions because it was their insidious and indefinitely active principle.”
The imprudent aristocrats encouraging these medical innovations changed the measure of public morality, substituting religiously colored human nature with the secularly safer option of individual passion. In doing so, they were forced also to trade the robust natural law tradition for the recently constructed standard of “psychiatric normality,” with “heterosexuality” serving as the new normal for human sexuality. Such a vague standard of normality, unsurprisingly, offered far flimsier support for sexual ethics than did the classical natural law tradition.
But emphasizing this new standard did succeed in cementing these categories of hetero- and homosexuality in the popular imagination. “Homosexuality appeared as one of the forms of sexuality,” Foucault writes, “when it was transposed from the practice of sodomy onto a kind of interior androgyny, a hermaphrodism of the soul. The sodomite had been a temporary aberration; the homosexual was now a species.” Sexual orientation, then, is nothing more than a fragile social construct, and one constructed terribly recently.
While our popular culture has not caught up— yet—the queer theorists increasingly calling the shots at the elite level already agree with Foucault on this point. Such thinkers echo Gore Vidal’s LGBT-heretical line: “Actually, there is no such thing as a homosexual person, any more than there is such a thing as a heterosexual person.” True, the firm natural division between the two identities has proven useful to the “gay rights” activists on the ground, and not least of all for the civil-rights-era ethos such power dynamics conjure up. But most queer theorists—and, for that matter, most academics throughout the humanities and the social/behavioral disciplines today—will readily concede that such distinctions are fledgling constructs and not much more. Many in this camp aim to expose the counterfeit credentials of sexual orientation and, taking a page from Nietzsche, to genealogically explain it away once and for all.
Jonathan Ned Katz, a historian of sexuality on the radical left who has previously taught at both Yale and New York University, nicely captures the contemporary queer-theory consensus in The Invention of Heterosexuality , where he explains, “I speak of heterosexuality’s historical invention to contest head-on our usual assumption of an eternal heterosexuality, to suggest the unstable, relative, and historical status of an idea and a sexuality we usually assume were carved long ago in stone.” As he goes on to argue, “Contrary to today’s bio-belief, the heterosexual/homosexual binary is not in nature, but is socially constructed, therefore deconstructable.”
My own prediction is that we will see this binary thoroughly deconstructed within our lifetimes. But in my view, we proponents of Christian chastity should see the impending doom of the gay–straight divide not as a tragedy, but as an opportunity. More than that, I want to suggest that we should do our best to encourage the dissolution of orientation within our own subcultural spheres wherever possible.
Of course, given our immersion in a culture for which these categories seem as connatural as the English language, uprooting them from our vocabulary and worldview will not be anything like a simple task. So why bother? As long as we do not succumb to sinful acts, why does it matter if people—even we Christians—continue to identify as homosexuals or heterosexuals?
First of all, within orientation essentialism, the distinction between heterosexuality and homosexuality is a construct that is dishonest about its identity as a construct. These classifications masquerade as natural categories, applicable to all people in all times and places according to the typical objects of their sexual desires (albeit with perhaps a few more options on offer for the more politically correct categorizers). Claiming to be not simply an accidental nineteenth-century invention but a timeless truth about human sexual nature, this framework puts on airs, deceiving those who adopt its labels into believing that such distinctions are worth far more than they really are.
A second reason to doubt whether this schema is one that we Christians should readily use is that its introduction into our sexual discourse has not noticeably increased the virtues—intellectual or moral—of those who employ its concepts. On the contrary, it has bred both intellectual obscurity and moral disarray.
As to the former, orientation essentialism has made ethical philosophy in this realm all but impossible: It has displaced the old marital-procreative principles of chastity without offering any alternative that is not entirely arbitrary. The older teleological view measured morality against man’s rational-animal nature; in the sexual realm, this meant evaluating sex acts by reference to the common good of marriage, which integrated spousal union and the bearing and rearing of children. The newer heteronormative system, on the other hand, cannot account for the wickedness of same-sex sodomy by reference to anything but a conditioned and unprincipled gag reflex, and one which, left unjustified, has weakened considerably over time.
As to the latter result, moral disarray, the orientation takeover has counterproductively shifted our everyday attention from objective purposes to subjective passions. Young people, for instance, now regularly find themselves agonizing over their sexual identity, navel-gazing in an attempt to discern their place in this allegedly natural Venn diagram of orientations. Such obsessions generate far more heat than light, and focus already sexually excited adolescents on discerning extraneous dimensions of their own sexual makeup. This self-searching becomes even more needlessly distressing for those who discern in themselves a “homosexual orientation,” as they adopt an identity distinguished essentially by a set of sexual desires that cannot morally be fulfilled.
There is a third reason this categorization should be disposed of, this one theological: It is at odds with the freedom for which Christ set us free. My future prior in religious life, Fr. Hugh Barbour of the Norbertine Fathers, has expanded on this idea in an essay in Chronicles Magazine , entitled “Do Homosexuals Exist? Or, Where Do We Go from Here?” As Fr. Prior argues, “Traditional moral theology evaluated acts, and did not generalize so unsatisfyingly about the tendencies that lead to these acts. That was left to the casuistry of occasions of sin, and to spiritual direction. If the sin is theft, then is the standard of evaluation kleptomania? If drunkenness, alcoholism? If sloth, clinical depression?” Even orthodox Christians, he writes,
have given in to the custom of treating sexual inclinations as identities. Pastorally, we are meant to preach the freedom whereby Christ has made us free. In treating the sin of sodomy as a prima facie proof of an identity, are we not, in the guise of compassion and sensitivity, helping bind the sinner to his sinful inclination, and so laying on him a burden that is too great to bear without perhaps moving a finger to lift it?
Self-describing as a “homosexual” tends to multiply occasions of sin for those who adopt the label—provoking, in Prior’s words, an unnecessary “dramatization of the temptation.” Whereas the infusion of the theological virtues sets the Christian free, identifying as homosexual only further enslaves the sinner. It intensifies lust, a sad distortion of love, by amplifying the apparent significance of concupiscent desires. It fosters a despairing self-pity, harming hope, which is meant to motivate moral virtues. And it encourages a strong sense of entitlement, which often undermines the obedience of faith by demanding the overthrow of doctrines that seem to repress “who I really am.”
There are a handful of laudable counterexamples to this discouraging pattern, self-identified “gay Christians” who are both virtuous and faithful to the teachings of the Church. But given the inherent tension between the classical Christian narrative and the modern sexual-orientation account, it should come as no surprise that the praiseworthy outliers who try to combine these two inconsonant traditions are the exception rather than the rule.
Baptizing the homosexual identity is fraught with preventable perils. And yet, when it comes to the gravest evil effected by the sexual-orientation binary, homosexuality is not the culprit. Heterosexuality is—not, of course, as though we can have one without the other. The most pernicious aspect of the orientation-identity system is that it tends to exempt heterosexuals from moral evaluation. If homosexuality binds us to sin, heterosexuality blinds us to sin.
There is no question that some morally self-aware “heterosexuals” exist. Nevertheless, as a general rule, identifying as a heterosexual person today amounts to declaring oneself a member of the “normal group,” against which all deviant sexual desires and attractions and temptations are to be measured. Such hetero-identification thus ushers in a pathetically uncritical and—hopefully it goes without saying—unmerited self-assurance, not to mention an inaccurate measure for evaluating temptation.
Of course, we do have a model norm for the evaluation of sexual deviancy. But that model is not heterosexuality. It is Christ Jesus himself, the God-man who both perfected human nature and perfectly exemplified its perfection, “one who in every respect has been tempted as we are, yet without sin.” For the self-declared heterosexual to displace our Lord in this position is the height of folly.
It is true that homosexuality may be distinguished by an inappropriate despair, accepting sinful inclinations as identity-constituting and thereby implicitly rejecting the freedom bought for us by the blood of Christ. But heterosexuality, in its pretensions to act as the norm for assessing our sexual customs, is marked by something even worse: pride, which St. Thomas Aquinas classifies as the queen of all vices.
There are practical reasons to be wary of heterosexuality as well. Because our post-Freudian world associates all physical attraction and interpersonal affection with genital erotic desire, intimate same-sex friendship and a chaste appreciation for the beauty of one’s own sex have become all but impossible to achieve. (Freud, by the way, was one of the most influential architects of the vicious orientation-essentialist myth.)
For “heterosexuals” in particular, getting close to a friend of the same sex ends up seeming perverse, and being moved by his or her beauty feels queer. To avoid being mistaken for gay, these days many self-proclaimed straight people—men especially—settle for superficial associations with their comrades and reserve the sort of costly intimacy that once characterized such chaste same-sex relationships for their romantic partners alone. Their ostensibly normal sexual orientation cheats them out of an essential aspect of human flourishing: deep friendship.
The earliest usages of the term “heterosexuality” give further reason to doubt whether we should celebrate the idea too enthusiastically. It is true that even in the late nineteenth century, sometimes the label was employed merely to denote “normal-sex.” This is, of course, how we still tend to use “heterosexual” today, which I am arguing is tragically confused.
But another prominent meaning of the term around the time of its invention, including its first recorded usage in English in 1892, continues to inform our warped conception of human sexuality, even though this secondary definition has since fallen out of fashion. In its alternative definition, the word designated not “normal-sex,” but rather a different brand of deviant sex, like its homosexual counterpart in its disregard for procreation but made distinct by the typical object of its lustful inclinations.
The unfortunate history of “heterosexual” we have chosen to forget is that this word came into the English language as a label for a perverted sexual disorder that delighted in sterile sex acts. Usually such desires were for those of the opposite sex, but even that line was blurry, because as it turned out, once the generative purpose of sex had been severed, it often mattered very little who the heterosexual’s mutual masturbatory partner was.
Our Christian forebears would be shocked at our complacency with sexual orientation. The only reason that this whole program fails to alarm us as it would them is that we have been systematically indoctrinated into it from childhood, especially the young adults among us. But to take an analogue that we do not have such familiarity with, let’s consider how we would react if a different sort of category worked its way into our cultural vocabulary.
Slate recently ran an article entitled “Is Polyamory a Choice?” which argued that, in addition to inclinations toward men or women, there may also be innate and immutable fidelity- and infidelity-constituted sexual orientations. Dan Savage must be so proud.
Imagine if those people who anticipated being most romantically satisfied by committed sexual exclusivity began identifying as “faithfuls,” while those who were usually most excited by the prospect of unbounded sexual promiscuity started identifying as “unfaithfuls.” Would we not find that troubling, especially when Christian men and women began adopting the latter label for themselves, and even offering the fact that they are “unfaithfuls” as a reason not to marry, since they would not be sufficiently fulfilled by the sexual life to which they would be committing themselves via the marital vows?
“Unfaithfulness” is obviously playing the role of homosexuality in this analogy. But whether we are considering the number of one’s sexual partners or their gender, how can it not shock us when our Christian brethren adopt an identity for themselves that is essentially distinguished from its foil by nothing but a particular brand of temptation to sin? That is the opposite of Christian freedom. Of course, all of us are fallen and tempted and in need of divine assistance. But while we continue to struggle against these sinful temptations, what has been given to us in Christ Jesus is liberation from the shackles of sin that claims us as its own.
We do not belong to our transgressions any longer. So why create identities for ourselves using sin as the standard? I do not care how attractive promiscuity happens to be to you. You are emphatically not “an unfaithful.” Sure, we could socially construct categories that would make speaking that way appear obvious and connatural. But for the Christian to do so, or for him to participate willingly in such a framework once it has been constructed around him, would be severely mistaken.
I am not my sin. I am not my temptation to sin. By the blood of Jesus Christ, I have been liberated from this bondage. I will have all sorts of identities, to be sure, especially in our crazily over-psychoanalytic age. But at the very least, none of these identities should be essentially defined by my attraction to that which separates me from God.
The other side of this Slate-inspired hypothetical brings to light the characteristic evils of heterosexuality. Our justified disapproval of Christians despairingly identifying as “unfaithfuls” notwithstanding, would there not be something even more absurd and vicious in their vaingloriously self-identifying as “faithfuls”? Put it this way: Does the fact that my erotic desires tend to take a single person for their object rather than a vast collective necessarily signify some inherent moral quality on my part? For that matter, does it even signal that my desires are virtuous, or—I think more probably—does it simply indicate that I happen not to be strongly tempted to one of many potential lustful abuses? Like so-called “faithful” folks, “heterosexual” individuals are not paragons of chastity just because they avoid the unchaste pitfall du jour.
However, despite the illogic of it all, “straight people” still tend to receive more societal advantages from their appellation, and thus the dismantling of the orientation schema threatens them far more than it does their “gay” and “lesbian” counterparts. As Jenell Williams Paris of Messiah College writes in her book The End of Sexual Identity, “Grounding sexual ethics in our humanity more than in contemporary sexual identity categories . . . comes at a cost to heterosexuals,” because “it puts them in the game as players instead of umpires.” For that very reason, though, it is self-proclaimed heterosexuals who may prove most effective in leading our chaste charge against sexual orientation, sacrificing their unchristian security blanket of “straightness” for the sake of caritas in veritate.
Yet whether we Christians choose to join the campaign or not, over time, sexual orientation will inevitably fall out of fashion—our choice is simply whether we want to fall out with it. One obvious reason for its unavoidable demise is that feeling is considerably more fickle than those early psychosexual movers and shakers believed. The empirical evidence shows their hard-and-fast categories turn out to be radically insufficient.
A second factor in the inevitable downfall of sexual orientation is that these hetero/homo categories cannot logically ground the sexual norms they were made to support anyway. The original orientation essentialists could not even offer a principled reason to prefer heterosexuality over homosexuality, the linchpin of their position. Left with nothing but inherited sensibilities and arbitrary fiat, their heteronormative measure failed where its procreative predecessor had succeeded for centuries, in offering sound reasons for rules.
Philosophical failure has damned the orientation enterprise throughout its existence. Because the inadequate heteronormative standard left opposite-sex instances of lust entirely untouched, sins previously considered mortal—such as masturbation, pornography, fornication, contraception, and male-female sodomy—were progressively tolerated. Yet with all those injunctions lifted, understandably, it began seeming inconsistent and thus prejudiced to keep insisting on same-sex sodomitical proscriptions. The orientation-essentialist structure, which was meant to be a surefire defense against homosexual debauchery, thereby became the strongest weapon in its arsenal.
Which brings us to the final, perhaps most surprising, reason that sexual orientation will fall: It has nearly exhausted its political utility, which always had an expiration date. The nineteenth-century moral conservatives’ plan for orientation backfired, of course, when what were supposed to be normatively unequal psychiatric conditions evolved into morally indistinguishable psychological identities.
Yet neither does liberalism have much left to glean from it, since, between Romer and Lawrence and Windsor and ENDA, very few “gay rights” issues remain to be settled. Orientation might have a few years’ worth of political capital still, but many progressives already boast that they could discard the absurd natural-categories myth and be just fine, having now initiated an irresistible liberalizing trend that will continue apace with or without it. Sooner or later, the queer theorists’ ivory-tower pronouncements will become cultural orthodoxy as well.
Although I expect many conservative Christian thinkers will find Foucault a strange bedfellow, I want to suggest that our endorsement of the radical left on this subject should be an enthusiastic one, although it must also be carefully circumscribed. In essence, we should happily join our voices to those of the poststructuralist queer theorists in their vigorous critiques of the naive orientation essentialists, who mistakenly think “straight” and “gay” are natural, neutral, and timeless classifications.
Their disillusioned historicism makes these sexual genealogists uniquely positioned to see through the deceptions of sexual orientation, and while we Christians do not need them in some essential sense, nevertheless, in an accidental way, they may prove a great asset to us at present. Ironically, these radical leftists may be the only ones who can heal the blindness we have foolishly inflicted upon ourselves of late by uncritically adopting the language of hetero- and homosexuality.
However, while we can and should recommend the queer theorists’ diagnosis of the absurdity plaguing our popular sexual categories today, nevertheless we cannot sign on to their plan of treatment. Jonathan Ned Katz, Hanne Blank, and contemporary queer theorists generally, aim to genealogically explain away the rigid orientation schema precisely because they believe this will give them the freedom and the power to make, unmake, and remake their sexuality as they see fit.
They want to tear down these failed social constructs not so that something better can be constructed in their place—or, perhaps, rediscovered amid the rubble—but because they hope to achieve an even greater degree of sexual libertinism than we have today, even if it comes at the cost of endorsing a wretched sort of sexual nihilism. To riff on Dostoevsky, these radicals would like to believe that if orientation does not exist, then all things are permissible.
The Christian cannot follow them down this miserific road, of course. But neither, I believe, can the Christian remain content in today’s deceptive, doomed orientation taxonomy. Mark my words: The queer theorists will have their way in dismantling the thing before long. Even our popular culture is beginning to show signs of stress here. The ever-increasing laundry list of orientations demonstrates the insufficiency of those neat and discrete categories. And the now familiar concept of the “hasbian” suggests that these identities are far less static than we were initially led to believe. (Think, for example, of our new ex-homosexual first lady of New York City.)
The question is, once this sexual-orientation structure collapses, what will come to replace it: the queer theorists’ nihilistic anything-goes ethic, or the classical Christian view from which all of this is a departure, the view that takes the marital-procreative as its end and organizing principle, evaluating passions against nature rather than vice versa?
The role of the champion of Christian chastity today, I argue, is to dissociate the Church from the false absolutism of identity based upon erotic tendency, and to rediscover our own anthropological foundation for traditional moral maxims. If we do not wish to be swept away with modernity’s orientation essentialists, then we need to remind the world that our sexual ethics was never really at home in the modern framework anyway, and thus that our forsaking the framework need not lead to postmodern nihilistic libertinism. There is firmer ground to stand on in the classical Christian tradition. Indeed, it seems to me the only place left to stand.
The Bible never called homosexuality an abomination. Nor could it have, for as we have seen, Leviticus predates any conception of sexual orientation by a couple of millennia at least. What the Scriptures condemn is sodomy, regardless of who commits it or why. And yet, as I have argued throughout, in our own day homosexuality deserves the abominable label, and heterosexuality does too.
As regards sexual morality, we have reached a point at which it is no longer sufficient for us to criticize modernity’s poor answers. Like our Lord in the gospel narratives, we must also correct its terribly impoverished questions. Rather than struggling to articulate how to live as a “homosexual Christian”—or, for that matter, the even more problematic question of how to live as a “heterosexual Christian”—we should be teaching our Christian brethren, especially those in their most formative adolescent years, that these categories are not worth employing.
They are recent inventions that are utterly foreign to our faith, inadequate for justifying sexual norms, and antithetical to true philosophical anthropology. The time has come for us to eradicate sexual orientation from our worldview as systemically as we can manage—with all due prudence as to complicated particular cases, of course.
If Pope Francis is right that contextualizing our moral discourse is a necessary prerequisite to being found convincing—or even intelligible—by our interlocutors, then abandoning heteronormativity and resurrecting our own tradition of familial-teleological chastity is the only way to adequately explain Christian sexual ethics.
Michael W. Hannon is preparing to enter religious life with the Norbertines of St. Michael’s Abbey in Orange County, California.
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
java.lang.NullPointerException in jsp
Hi all I am a fresher in java and jsp and honestly I dont have knowledge of json. but I have some requirement that I have to pull the data from database and display on jsp page. but the criteria is that I have to use Bootstrap Data Table why I am using this because it provide lot of flexibility like Pagination Filtering Sorting Multi-column sorting Individual column filter.
I am getting a java.lang.NullPointerException in my jsp
can any body tell me why am I getting this error.
This is my jsp page
dataTable.jsp
<%@page import="org.codehaus.jettison.json.JSONObject"%>
<%@ page language="java" contentType="text/html; charset=ISO-8859-1"
pageEncoding="ISO-8859-1"%>
<%@ page import ="java.util.*" %>
<%-- <%@ page import="com.varun.DataBase"%> --%>
<%@ page import="java.sql.*" %>
<%-- <%@ page import="org.json.*"%> --%>
<%@ page import ="net.sf.json.JSONArray" %>
<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd">
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1">
<title>DataTable</title>
</head>
<body>
<h1>Lets display the data from database using dataTabel</h1>
<%
String[] cols = { "id","engine", "browser", "platform", "version", "grade" };
String table = "ajax";
JSONObject result = new JSONObject();
JSONArray arr = new JSONArray();
int amount = 10;
int start = 0;
int echo = 0;
int col = 0;
int id=0;
String engine = "";
String browser = "";
String platform = "";
String version = "";
String grade = "";
String dir = "asc";
String sStart = request.getParameter("iDisplayStart");
String sAmount = request.getParameter("iDisplayLength");
String sEcho = request.getParameter("sEcho");
String sCol = request.getParameter("iSortCol_0");
String sdir = request.getParameter("sSortDir_0");
engine = request.getParameter("sSearch_0");
browser = request.getParameter("sSearch_1");
platform = request.getParameter("sSearch_2");
version = request.getParameter("sSearch_3");
grade = request.getParameter("sSearch_4");
List<String> sArray = new ArrayList<String>();
if (!engine.equals("")) {
String sEngine = " engine like '%" + engine + "%'";
sArray.add(sEngine);
//or combine the above two steps as:
//sArray.add(" engine like '%" + engine + "%'");
//the same as followings
}
if (!browser.equals("")) {
String sBrowser = " browser like '%" + browser + "%'";
sArray.add(sBrowser);
}
if (!platform.equals("")) {
String sPlatform = " platform like '%" + platform + "%'";
sArray.add(sPlatform);
}
if (!version.equals("")) {
String sVersion = " version like '%" + version + "%'";
sArray.add(sVersion);
}
if (!grade.equals("")) {
String sGrade = " grade like '%" + grade + "%'";
sArray.add(sGrade);
}
String individualSearch = "";
if(sArray.size()==1){
individualSearch = sArray.get(0);
}else if(sArray.size()>1){
for(int i=0;i<sArray.size()-1;i++){
individualSearch += sArray.get(i)+ " and ";
}
individualSearch += sArray.get(sArray.size()-1);
}
if (sStart != null) {
start = Integer.parseInt(sStart);
if (start < 0)
start = 0;
}
if (sAmount != null) {
amount = Integer.parseInt(sAmount);
if (amount < 10 || amount > 100)
amount = 10;
}
if (sEcho != null) {
echo = Integer.parseInt(sEcho);
}
if (sCol != null) {
col = Integer.parseInt(sCol);
if (col < 0 || col > 5)
col = 0;
}
if (sdir != null) {
if (!sdir.equals("asc"))
dir = "desc";
}
String colName = cols[col];
int total = 0;
Connection conn = DriverManager.getConnection("jdbc:oracle:thin:@localhost:1521:orcl","system","admin");
try {
String sql = "SELECT count(*) FROM "+table;
PreparedStatement ps = conn.prepareStatement(sql);
ResultSet rs = ps.executeQuery();
if(rs.next()){
total = rs.getInt("count(*)");
}
}catch(Exception e){
}
int totalAfterFilter = total;
//result.put("sEcho",echo);
try {
String searchSQL = "";
String sql = "SELECT * FROM "+table;
String searchTerm = request.getParameter("sSearch");
String globeSearch = " where (engine like '%"+searchTerm+"%'"
+ " or browser like '%"+searchTerm+"%'"
+ " or platform like '%"+searchTerm+"%'"
+ " or version like '%"+searchTerm+"%'"
+ " or grade like '%"+searchTerm+"%')";
if(searchTerm!=""&&individualSearch!=""){
searchSQL = globeSearch + " and " + individualSearch;
}
else if(individualSearch!=""){
searchSQL = " where " + individualSearch;
}else if(searchTerm!=""){
searchSQL=globeSearch;
}
sql += searchSQL;
sql += " order by " + colName + " " + dir;
sql += " limit " + start + ", " + amount;
PreparedStatement ps = conn.prepareStatement(sql);
ResultSet rs = ps.executeQuery();
while (rs.next()) {
// JSONArray ja = new JSONArray();
net.sf.json.JSONArray ja = new net.sf.json.JSONArray();
ja.add(rs.getInt("id"));
ja.add(rs.getString("engine"));
ja.add(rs.getString("browser"));
ja.add(rs.getString("platform"));
ja.add(rs.getString("version"));
ja.add(rs.getString("grade"));
arr.add(ja);
}
String sql2 = "SELECT count(*) FROM "+table;
if (searchTerm != "") {
sql2 += searchSQL;
PreparedStatement ps2 = conn.prepareStatement(sql2);
ResultSet rs2 = ps2.executeQuery();
if (rs2.next()) {
totalAfterFilter = rs2.getInt("count(*)");
}
}
result.put("iTotalRecords", total);
result.put("iTotalDisplayRecords", totalAfterFilter);
result.put("aaData", arr);
response.setContentType("application/json");
response.setHeader("Cache-Control", "no-store");
out.print(result);
conn.close();
} catch (Exception e) {
}
%>
</body>
</html>
Stack Trace
11:26:50,224 ERROR [[jsp]] Servlet.service() for servlet jsp threw exception
java.lang.NullPointerException
at org.apache.jsp.dataTable_jsp._jspService(dataTable_jsp.java:114)
at org.apache.jasper.runtime.HttpJspBase.service(HttpJspBase.java:70)
at javax.servlet.http.HttpServlet.service(HttpServlet.java:717)
at org.apache.jasper.servlet.JspServletWrapper.service(JspServletWrapper.java:369)
at org.apache.jasper.servlet.JspServlet.serviceJspFile(JspServlet.java:322)
at org.apache.jasper.servlet.JspServlet.service(JspServlet.java:249)
at javax.servlet.http.HttpServlet.service(HttpServlet.java:717)
at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:290)
at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:206)
at org.jboss.web.tomcat.filters.ReplyHeaderFilter.doFilter(ReplyHeaderFilter.java:96)
at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:235)
at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:206)
at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:235)
at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:191)
at org.jboss.web.tomcat.security.SecurityAssociationValve.invoke(SecurityAssociationValve.java:190)
at org.jboss.web.tomcat.security.JaccContextValve.invoke(JaccContextValve.java:92)
at org.jboss.web.tomcat.security.SecurityContextEstablishmentValve.process(SecurityContextEstablishmentValve.java:126)
at org.jboss.web.tomcat.security.SecurityContextEstablishmentValve.invoke(SecurityContextEstablishmentValve.java:70)
at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:127)
at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:102)
at org.jboss.web.tomcat.service.jca.CachedConnectionValve.invoke(CachedConnectionValve.java:158)
at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:109)
at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:330)
at org.apache.coyote.http11.Http11Processor.process(Http11Processor.java:829)
at org.apache.coyote.http11.Http11Protocol$Http11ConnectionHandler.process(Http11Protocol.java:598)
at org.apache.tomcat.util.net.JIoEndpoint$Worker.run(JIoEndpoint.java:447)
at java.lang.Thread.run(Unknown Source)
A:
If the answer of Ajil Mohan prevent the error to appear, it means that you have no value in your ParametersMap.
engine = request.getParameter("sSearch_0");
browser = request.getParameter("sSearch_1");
platform = request.getParameter("sSearch_2");
version = request.getParameter("sSearch_3");
grade = request.getParameter("sSearch_4");
These lines just get the data in the Parameter map of your request. If the given is not in the map it returns null (https://docs.oracle.com/javaee/6/api/javax/servlet/ServletRequest.html#getParameter%28java.lang.String%29).
This map is created when you send the POST request on the previous page with the data contained in your form. Your input field has to be set with the name you give to the getParameter method.
If you don't have previous page with a form then you may want to send data from server to JSP. If you use Servlet then you should use the request AttributeMap.
public class BasicTotoServlet extends HttpServlet {
/**
* Manage GET HTTP Request
*/
protected void doGet(HttpServletRequest request, HttpServletResponse response) {
String data = getData();
request.setAttibute("sSearch_0", data)
}
}
Then in your JSP :
engine = request.getAttribute("sSearch_0");
I hope I was clear enough.
Ask for precision if needed
EDIT :
Here is what I understand.
You arrive on your JSP and you get several Parameter from the previous page's form. This form may not give to you all the information, that is why you get a NPE on this
engine = request.getParameter("sSearch_0");
engine.equals("")
To solve this as told you Ajil Mohan, just turn the equals the other way round, so that if engine is NULL you have no problem
"".equals(engine);
As "" is never null you'll never get NPE.
Now you don't have any data in you table. Why? If I'm correct you create a SQL Query by concatenating several data. searchSQL = globeSearch + " and " + individualSearch;
individualSearch is the result of concatenating your Parameters but what if they're null?
if (!"".equals(browser)) {
String sBrowser = " browser like '%" + browser + "%'";
sArray.add(sBrowser);
}
In this code, if browser is null (as we saw earlier it can be), you will add the String " browser like '%null%'" to you query with the and key word. I'm not sure there will be any browser with "null" in its name.
You better put this test :
if (!"".equals(browser) && browser != null) {
String sBrowser = " browser like '%" + browser + "%'";
sArray.add(sBrowser);
}
|
{
"pile_set_name": "StackExchange"
}
|
The surge of predatory open-access in neurosciences and neurology.
Predatory open access is a controversial publishing business model that exploits the open-access system by charging publication fees in the absence of transparent editorial services. The credibility of academic publishing is now seriously threatened by predatory journals, whose articles are accorded real citations and thus contaminate the genuine scientific records of legitimate journals. This is of particular concern for public health since clinical practice relies on the findings generated by scholarly articles. Aim of this study was to compile a list of predatory journals targeting the neurosciences and neurology disciplines and to analyze the magnitude and geographical distribution of the phenomenon in these fields. Eighty-seven predatory journals operate in neurosciences and 101 in neurology, for a total of 2404 and 3134 articles issued, respectively. Publication fees range 521-637 USD, much less than those charged by genuine open-access journals. The country of origin of 26.0-37.0% of the publishers was impossible to determine due to poor websites or provision of vague or non-credible locations. Of the rest 35.3-42.0% reported their headquarters in the USA, 19.0-39.2% in India, 3.0-9.8% in other countries. Although calling themselves "open-access", none of the journals retrieved was listed in the Directory of Open Access Journals. However, 14.9-24.7% of them were found to be indexed in PubMed and PubMed Central, which raises concerns on the criteria for inclusion of journals and publishers imposed by these popular databases. Scholars in the neurosciences are advised to use all the available tools to recognize predatory practices and avoid the downsides of predatory journals.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Hundreds of boxing enthusiasts gathered at Bacolod City Government Center to witness the victory of Genesis “Azukal’ Servania against his challenger Konosuke Tomiyami of Japan, Saturday night in Macau, a press release from city hall said.
Servania, the pride of Barangay Punta Taytay, defended his World Boxing Council international silver superbantamwieght title against Tomiyami with a split technical decision after the referee stopped the fight at the ninth round.
The boxing champ from Bacolod City is the son of Antonio and Saluna Servania of Barangay Punta Taytay. He remains undefeated with 22 wins with 8 knockouts.
Jast secures semifinals seat
in Fil-Sino Class B cagefest
Jast Enterprises earned the last ticket to the semifinals by dominating Basecom, 91-83, in the FIl-Sino All Asian Countertrade Inter-Color Basketball Tournament at the Bacolod Tay Tung High School Po Hang Gym.
JSY Countertrade also caught the last bus to semifinals in Class A semis by defeating AACI Transport, 92-85.
Jast started out the tournament with five straight losses but finished the tournament on a three-game winning streak.
Still, Basecom ended its elimination campaign atop the standings and tied with Royal Star at 5-3. Basecom has beaten Royal twice in the elimination to get the top spot and will have a twice-to-beat advantage against Jast enterprises today, at 7 p.m.
|
{
"pile_set_name": "Pile-CC"
}
|
One hundred years ago, on May 7, 1915, the Cunard luxury liner Lusitania was sunk by a German torpedo off the Irish coast.
It was the fastest, most luxurious passenger ship ever to have sailed the seas and, like the Titanic, was believed to be invulnerable.
This illustration shows the May 7, 1915, sinking of the Lusitania after it was torpedoed by a German submarine off the coast of Ireland.
At the time, the ship was believed fast enough to outrun any submarine.
Illustration by Popperfoto/Getty
But of the 1,959 passengers on board, 1,195 perished, among them 128 American citizens.
Like 9/11, the callous murder of civilians caused outrage on both sides of the Atlantic and led to calls for the United States to enter the war.
But to the dismay of the First Lord of the Admiralty, a certain Winston Churchill, it would take another two years and millions more deaths on the Western Front before President Woodrow Wilson ordered American boots on European ground.
In his new book Dead Wake: The Last Crossing of the Lusitania, best-selling author Erik Larson takes readers inside what he calls “a disaster of monumental proportions.” (see video interview)
From his home in New York, he explains how, as with the Titanic, a concatenation of events caused a catastrophic tragedy; how Britain’s top-secret anti-submarine intelligence unit, Room 40, may have organized a cover-up after the event; and what it felt like to come face-to-face with the morgue photographs of the dead.
An obvious question: Why is your book called Dead Wake?
Dead wake is an old maritime term for the disturbance that remains on the water long after a boat has passed.
There’s the live wake, I suppose you could call it, which comes off the engine.
But in the case of a liner, the wake can persist for many thousands of yards, if not miles, behind the ship. And that was called, at one time, the dead wake.
It’s an allusion to a number of things, but primarily to the track left by the torpedo that sank the Lusitania.
Put the Lusitania into the historical context of the war between Britain and Germany for control of the seas.
The war had broken out in August 1914.
We all know about the horrific land battles. What’s happening at sea is that Germany recognized England was an island nation, and that one way to bring England to her knees was to destroy as much seaborne commerce as possible.
The submarine proved to be a very effective weapon in that respect and one that Germany decided to use in a major break with naval warfare against merchant and civilian vessels.
The Lusitania was thought to be immune from such an attack because nobody could possibly imagine it.
It was hard enough to imagine the German Navy going after merchant vessels.
But the Germans had started sinking merchant vessels, often without warning.
Then, along comes the Lusitania in May 1915 in waters that Germany had determined to be a war zone.
They said: “If you enter these waters, you do so at your own risk.”
The rest, as they say, is history.
The wreck lies 93m down on its starboard side and measures 240m in length.
(Image
produced by INFOMAR/Geological Survey of Ireland/Marine Institute)
The German High Command actually warned of an attack.Some passengers canceled out of security concerns.But wasn’t the Lusitania cloaked in the same myth of invincibility as the Titanic? Should the ship ever have set sail?
It’s very important, doing the kind of history that I do, to always keep the reader in the era’s point of view—POV, as screenwriters call it.
Today, you think: “Oh, my gosh, what were they thinking?
Why did this ship even set sail from New York when there was a war zone declared and German submarines were everywhere, attacking without warning?”But people at the time didn’t see it that way.They saw this ship as so fast it could outrun any submarine.They saw it
as being so immense, so well built, so safe, and so well equipped with
lifeboats in the wake of the Titanic disaster that even if it
were hit by a torpedo, no one imagined this thing actually sinking.But
no one could imagine a submarine going after the Lusitania in the first place.That seemed such an absurd and immoral concept.So in the end only a couple of people actually canceled.
I’m not much of a believer in heroes, frankly.
And I have a feeling that Churchill, if he were with us on this conference call today, would have argued very much in the opposite direction, though he had his own motives.
Turner was a staunch Cunard captain of the old school who had come to Cunard after serving in the hard school of sailing vessels.
He believed in doing things the classic way, like making his crew tie absurdly complex knots that they would most likely never use.
But he was utterly unprepared for the new age of submarine warfare, as were all captains.
Nobody understood the submarine.
People didn’t understand torpedoes.
So, here was this captain of the old school forced suddenly to confront this horrendous situation of submarines hunting his ship.
The villain of the story is a German U-boat captain, Walter Schwieger.He was kind and jolly with his crew, but a cold-blooded psychopath toward the enemy; he even attacked a Red Cross ship.
Walter Schwieger was, by all counts, loved by his men.
A friend of his in the submarine service said of him: “He wouldn’t hurt a fly.”
Unless it were a British fly?
[Laughs] He loved animals.
He rescued a dachshund that was adrift after he had attacked the ship in which the dog was traveling, and brought it aboard.
So here was this young, humane, handsome guy, who was dispatched by the German Navy to do what submarines were supposed to do.
He is clearly in my view the villain.
Nobody made him press the button and launch the torpedo that sank that ship.
The British Admiralty later tried to lay the blame on Captain Turner.
But in the end it all comes down to Schwieger. He killed almost 1,200 people at the push of a button.
The British mounted an amazing anti-submarine espionage operation reminiscent of Bletchley Park, which featured in the recent movie The Imitation Game.Tell us about Room 40 and one of my favorite characters, “Blinker” Hall.
Room 40 was this super-secret organization founded by the Admiralty to take advantage of the miraculous recovery of three German codebooks.
Using those codebooks, they successfully intercepted and read German naval communications.
One of the best moments of my research came at the National Archives of the United Kingdom.
One of the boxes I’d ordered from the archive came up.
I put it on my desk in the reading room, opened it up, and there was this very large codebook which was said to have been in the arms of a German sailor washed ashore after his destroyer was sunk by the Russians.
It contained all the German code words for some 30,000 code crypts.
Seeing it there in the archives, touching this thing, was incredible!
Blinker Hall is often thought to have been the head of Room 40.
He was, in fact, the head of British Naval Intelligence.
But Blinker Hall was the guy who understood how this information could be used to best advantage.
He was nicknamed “Blinker” because of this odd, neurological quirk where his eyes blinked ceaselessly.
He had the features of a woodpecker and a keen imagination.
He was a very, very cunning guy.
The tragedy, in which 128 Americans died,
took over the front page of the New York Times the next day.
Photograph by MPI/Getty
The encounter of ship and submarine is like the Titanic and the iceberg: the fatal conjunction of improbable events.
It is incorrect to say that Schwieger was stalking the Lusitania.
That’s not what happened at all. It is this confluence of chance forces that converged in the Irish Sea.
The ship departed two hours late because it had to take on passengers from a ship that had been commandeered by the British Admiralty.
Those two hours put the ship right on the path of contact with the submarine.
Schwieger had actually decided to go home and end his patrol because of fog and bad weather.
But he came up for a look and found that the weather had suddenly cleared.
In the distance, he saw this large collection of masts and antennae.
At first he thought it might be a number of ships.
But as he watched, he saw that it was just one ship.
It was too far away to catch.
But he decided to follow and see what would happen.
And sure enough, the Lusitania made a starboard turn that put it directly in the path of the U-20, and Schwieger was able to set up his shot and attack.
That study contends that time was the crucial element in what kind of “disaster decorum” prevailed. In the case of the Titanic, it was women and children first on the available boats.
In the case of the Lusitania, the study argues that the very short time it took for the ship to sink caused mores to break down and it became every man for himself.
But you can’t really compare how the passengers behaved on the Titanic and the Lusitania.
The passengers on the Lusitania actually behaved with great courtesy and calm.
The problem was that, after the torpedo struck, the ship immediately took on this very severe list. Half the lifeboats were unusable.
The other half were slung out 60 feet above the sea and 8 to 10 feet out from the hull, so it was definitely not for the faint of heart to try and board them.
In fact, relatively few people went into the lifeboats at all.
Most people jumped or remained on the ship—for reasons that are very hard to fathom—and were ultimately swept away in the final cataclysm.
Winston Churchill was scathing about Woodrow Wilson’s delay in entering the war. “What he did in April 1917 could have been done in May 1915,” he wrote. And if done then … in how many millions of homes would an empty chair be occupied now?”
You can argue for both sides of this.
Churchill saw it from a British point of view.
And there is a lot to his argument.
In fact, what he wrote in his book enhanced my appreciation of him.
He was a unique, if at times erratic, genius.
But I think Wilson was doing the right thing for his country.
It wasn’t his job to keep the young men of Britain safe.
He didn’t feel America was ready for war.
It is a misconception that America was champing at the bit to get into the war after the Lusitania was sunk.
Teddy Roosevelt and his party were.
But the vast majority of Americans did not want to get into the war.
In fact, many charming petitions were filed with the President endorsing his calm reaction to the Lusitania [sinking], expressing confidence that he would do the judicious thing and not be affected by the passions of the moment. [Laughs] Can you imagine that today?
We have recently had notorious instances of captains abandoning their ships: the Italian liner Costa Concordia and the South Korean ferry Sewol.How did Captain Turner shape up?
In that respect, Captain Turner shapes up very well.
He stayed on the bridge to the last moment.
He did put on a life jacket, but I’m not going to fault him for that.
He stayed on the bridge until the ship was washed away below him.
I believe he was the last member of the crew off, but I can’t say for sure because by the time he was washed from the bridge a portion of the ship that was still above water was packed with passengers. Was he the last man off?
No. But he would have been if the ship had sunk differently.
One of the shabbiest aspects of the story is how the Admiralty tried to pin the blame on Captain Turner.What was their argument?
It’s not exactly clear why the Admiralty went after Turner.
But what is very clear from the record is that the Admiralty went after him immediately, within 24 hours.
Turner was going to be made the scapegoat, which is odd, because the publicity value of laying the blame on Germany would have been enormous.
I believe it’s because the Admiralty was trying to protect Room 40.
Hence, the whole idea of letting it stand in the historical record for decades that the Lusitania was sunk by two torpedoes, when Room 40 knew beyond a doubt that it was only one torpedo.
Cover-up is a very contemporary term.
But one of Churchill’s top priorities when he was in the Admiralty was to keep Room 40 secret.
Even to the point, as one of its members said, of not passing along actionable information that could have saved lives.
A prominent naval historian, who is now dead, wrote a book about Room 40.
In it, he said that he believed it wasn’t a plot by the Admiralty but, as the British say, an incredible “cock-up.”
In later life he was interviewed—there is a transcript in the Imperial War Museum in London—and had changed his mind.
He said: “I’ve thought and thought about this and there’s no other way to think about it except to imagine some sort of conspiracy.”
I’m not saying that there was or there wasn’t [a cover-up].
I’ll leave that to the conspiracy theorists.
My goal was to capture the magnitude and drama of this episode and show it for what it was: a disaster of monumental proportions, filled with tragedy and horror. Your research took you all over Europe. What were some of the high points?
The single most interesting and moving moment was at the University of Liverpool, in England, which is the keeper of the Cunard archives.
I managed to get permission to look at the morgue photos of the people killed in the disaster.
It was not easy to get access, and I was not allowed to bring in a camera.
But, sitting there, looking at these photographs, really brought home to me that this was not some little node on a high school time line.
These were men, women, and children who were suddenly struck down in the midst of the most beautiful day, on the most beautiful ship.
In the photos, they look as if they had just stepped off the ship and fallen asleep in the morgue.
They were still fully dressed and, in some cases, impeccably dressed.
Some even still had a light sprinkling of sand from when they were pulled from the beach.
It was just very, very moving.
|
{
"pile_set_name": "Pile-CC"
}
|
The 3080IPG-NAT platform is a complete hardware based solution to remove the need for service providers to enforce address range restrictions and VLAN schemes for their customers in multi-tenant environments.
Controlled by the industry leading VistaLINK® PRO, the 3080IPG-NAT-2-10GE is a high density NAT (Network Address Translator) used specifically for video applications. It allows to bridge two IP networks by appropriately translating IP addresses of one network to another. When datagrams from one network enter into the inbound port of the NAT, its addresses in these datagrams get translated, and then delivered to a second network connected to the outbound port of the NAT.
The 3080IPG-NAT provides the following three modes of operation:
The One-to-one NAT which allows a static mapping between one unicast/multicast IP address from one network to another unicast/multicast IP address from another network.
The VLAN based NAT which allows a VLAN tagged datagram from one network to seamlessly enter into another network by encapsulating it as regular multicast.
The Port based NAT which allows to apply a multicast IP address to all incoming datagrams on a physical port, and makes the datagram appear as if it were a video stream when it enters into another network.
|
{
"pile_set_name": "Pile-CC"
}
|
name: "BigPanda"
url: "https://bigpanda.io/"
|
{
"pile_set_name": "Github"
}
|
The benefit of adding a physiotherapy or occupational therapy intervention programme to a standardized group-based interdisciplinary rehabilitation programme for patients with chronic widespread pain: a randomized active-controlled non-blinded trial.
To evaluate the benefit of adding occupational therapy or physiotherapy interventions to a standard rehabilitation programme targeted for chronic widespread pain. Randomized active-controlled non-blinded trial. Women with chronic widespread pain recruited in a tertiary outpatient clinic. Participants were randomized to a two-week, group-based standard rehabilitation programme followed by 16 weeks of group-based occupational therapy (Group BOT, n = 43) or 16 weeks of group-based physiotherapy (Group BPT, n = 42). Group A only received the two-week rehabilitation programme acting as comparator (n = 96). Primary outcomes were the Assessment of Motor and Process Skills and Short Form-36 (SF36) Mental Component Summary score. Mean changes in motor and process ability measures were clinically and statistically insignificant and without differences across the three groups assessed 88 weeks from baseline. Motor ability measures: -0.006 (95% confidence interval (CI): -0.244 to 0.233) in Group BOT; -0.045 (95% CI: -0.291 to 0.202) in Group BPT; and -0.017 (95% CI: -0.248 to 0.213) in Group A, P = 0.903. Process ability measures: 0.087 (95% CI: -0.056 to 0.231) in Group BOT; 0.075 (95% CI: -0.075 to 0.226) in Group BPT; and 0.072 (95% CI: -0.067 to 0.211) in Group A, P = 0.924. Mean changes in patient-reported outcomes were likewise small; clinically and statistically insignificant; and independent of group allocation, except for the SF36 mental component summary score in the BPT group: 8.58 (95% CI: 1.75 to 15.41). Participants were on average stable in observation-based measures of functional ability and patient-reported outcomes, except in overall mental well-being, favouring the enhanced intervention. Efficacy of additional interventions on functional ability remains uncertain.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Roland SH09
Roland SH09
was a smaller version of the SH2, only one VCO and small size. nice on stage. one VCO, ENV, subosc and PWM, one LFO, but still enough for basses and stuff, it's not really a monophonic juno 6 but sort of.. looks like the sh2 but one VCO lost
User Comments
I purchased a SH-09 at a used gear shop for $350. The only cool thing about it is that it's analog. The sound capability is very limited. It's sound is very distinct, but that is it's main downfall. It can't produce any wild ARP-2600 type sounds. Although, I have heard this synth on some recent recordings including Meat Beat Mainfesto.
I have a roland sh-09. I got it for 50 bux and it is in very nice shape. I run the sh-09 through a digitech rp-3 and it really gives the ol' synth a breth of new life but you still can't beet that old anolog sound the sh-09 give. and I will more then likely take mine to the grave with me
this is one of the most easy to use synths I have ever seen. and it puts out a really nice sound. The sh-09 is in my mind about as good if not better then a minimoog I'll catch a lot of flack for saying that but oh well. Roland really hit the nail in the head with this synth and I really wish every one coul have the chance to play one cause there wonderfull. I have my SH-09 playing in to a digitech RP-3 ( for a little FX) and I use a Marshel amp all in all I would say that once it warms up (it's analog) it's a really nice synth. and watch out for the plastic panle that the bender is on, it has a nasty habbit of braking (and or cracking). but I just love the little unit it's compact and easy to use and it gives the classic analog fuzz )
the sh09 is a pretty popular machine in analogue circles, not least because there are so many of them floating about, a sign that they were popular when thet came out originally.For a one oscillator synth the 09 is pretty cool especially as there are no specialist Ics inside for the vco and filter.(specialist chips such as the CEMand SSM chips all had a particular sound which meant that most synths sounded similar)The Vcf is especially cool,a very phat 24db self oscillating beast which can filter external audio.It is made up of four operational Transconductance amplifiers and a whole bunch of discreet components,which make it sound typically Roland but yet not quite as you expect. Sonically the 09 comes into its own when used with a sequencer,I use mine with a home made linear device which can scale up to 12vThat is to say thay it can switch between 0.5v or so right up to 12v ,covering the whole of the synths audio range .When this is used it gives some very wierd atmospheric and very wild analogue sounding sounds, that have to be heard to be believed!For this reason alone the 09 with all its short comings is well worth investigating. Mine cost me £40 five years ago and Ive been tempted to sell it once but I decided that It and I shouldnt really ever part!
I have an SH-2, which is similar to the SH-09 but with an extra oscillator, some extra keys, etc. But I think it´s important for any electronic musician to know that Vince Clarke had an SH-09 on the top of his rack, in the Cowboy tour, only for basses. That means something...
i am a bit confused, cause i know the sounds of my sh 09 are awesome BUT it gets totally out of tune : ( with this detune problem i cannot go out and play live with it ... Does someone over here had the same problem and what should or can i do about it ? ?
If you imagine a really pissed off robot of epic dimensions - one which has gone haywire and is crushing puny humans and stamping buildings underfoot. Now if you imagine that robot shouting at top volume, then that's the sound of the Roland SH09.
This is an ideal introduction to analogue synthesis. Within a fairly short period of time, it becomes very easy to dial in new patches and quickly get the sound you want. The synth is only monophonic and is of a relatively small size, but don't let that decieve you. The sound quality is awesome - I run this through my Marshall amp and have had it mic'd up and blasting out a big PA before: the tone and volume on this tiny beast was insane.
I love this synth to bits. It is capable of a lot more than most people would assume, and if you run it through an effects processor, you can get close to any sound you want. As someone already rightly commented, the only limitations are those of the musician.
I'm deeply and utterly in love with my sh-09, but years of touring and gigging have left it looking a bit battered and bruised. worse, though, it is currently around three semitones out of tune. anyone know any tips for keeping it in tune? also, anyone link there's to an organ strings 09? know how this is done? good sounds? any tips for getting the sounds of the sh09 with improved reliability massively appreciated.......
|
{
"pile_set_name": "Pile-CC"
}
|
Newly synthesized glycoconjugates from two cell lines derived from rat osteogenic sarcoma: effects of Matrigenin activity from bone.
An activity isolated from bovine bone was previously shown to stimulate proteoglycan synthesis by several connective tissue cell lines from normal tissues (Matrigenin activity). The effect of this activity on glycoconjugate synthesis by two osteoblastic cell lines, ROS 17/2 and UMR-106, derived from rat osteogenic sarcoma, was examined after labelling of the cells with [3H]glucosamine and [35S]sulfate. The glycoconjugates from the cell layers and the media were separated by DEAE-Sephacel chromatography and the anionic glycoconjugates of the media were further analyzed by chromatography on Sepharose CL-2B and enzymatic digestion of the papain-released glycosaminoglycans. The ROS 17/2 cells secreted at least two distinct species of proteoglycan (one heparan sulfate rich and the other chondroitin sulfate rich), whereas the UMR-106 secreted primarily an anionic glycoprotein. The addition of Matrigenin activity to the ROS 17/2 cells resulted in stimulation of incorporation of radioactivity into the proteoglycan and hyaluronic acid, but in UMR-106 cultures it resulted in decreased incorporation into the anionic glycoprotein. The decrease in incorporation into the anionic glycoprotein from the medium was shown, by alkaline beta-elimination, to have occurred mainly in the oligosaccharide fraction, relative to control cultures.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
SlackBuilds Repository
PHAT is a collection of GTK+ widgets geared toward pro-audio apps.The goal is to eliminate duplication of effort and provide somestandardization (well, at least for GTK+ apps). It's open sourcesoftware, licensed under the GNU GPL, version 2.0 or later.
|
{
"pile_set_name": "Pile-CC"
}
|
Emerging understanding of the advantage of small molecules such as hydroxypyridinones in the treatment of iron overload.
Deferiprone, a hydroxypyridin-4-one, is effective at facilitating iron removal from iron overloaded patients, when administered orally. Some problems associated with deferiprone are discussed. Hydroxypyridinone analogues with improved distribution, metabolism and affinity for iron are described. In particular the "high pFe(3+)" hydroxypyridin-4-ones possess considerable clinical potential.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
How to output variables such as the current page's entry_id in the script tag
One one of our sites, we have ChannelFiles add-on installed and in the control panel (when editing an entry) it outputs a useful set of variables (see attached). But this is only part of add-on and if it's not installed, those variables aren't outputted. Is there anyway I can output these variables without ChannelFiles?
Background: There are certain fields that I only want to ever appear when editing a specific entry so I include a bit of jquery in the field instruction to hide/show field by checking against the variables outputted by ChannelFiles add-on in the script tag.
http://imagebin.org/258416
Thanks
UPDATE (to clarify): I need this when editing the entry in the control panel of EE (see Background section on why) and not in the front end. As far as I know, I don't have access to the templates for the control panel (or do I?).
A:
You can output entry ids from within the channel:entries tag pair like this:
{exp:channel:entries channel="my_channel"}
entry_id: {entry_id}<br>
{/exp:channel:entries
The Channel Entries documenation at EllisLab provide all the variable options available to you.
Update
You can add this script to any of the field's Field Instructions section.
<script>
$(document).ready(function() {
entryId = (document.URL).split('entry_id=')[1].replace(/\D/g,'');
$('.heading h2').append(' #' + entryId); // adds to heading at top of form
alert("entry id = " + entryId);
});
</script>
Second Update
The previous script wasn't removing numerical characters from the url that occurred after the entry_id. The problem is that EE encodes the & as &. So here's this:
<script>
$(document).ready(function() {
firstPart = (document.URL).split('entry_id=')[0];
entryId = (document.URL).split('entry_id=')[1].split(firstPart[firstPart.length -1])[0];
$('.heading h2').append(' #' + entryId);
});
</script>
|
{
"pile_set_name": "StackExchange"
}
|
Q:
Double Summation $\sum_{i=1}^{n+1}\sum_{j=0}^{n-1}(i+j)=(2n+1)\sum_{r=1}^n r=3\sum_{r=1}^n r^2$
It can be easily shown by step-by-step and rather messy summation over $j$ and then over $i$ that $$\sum_{i=1}^{n+1}\sum_{j=0}^{n-1}(i+j)=\tfrac12 (2n+1)n(n+1)$$
Note that RHS is equivalent to
$$\displaystyle (2n+1)\sum_{r=1}^n r$$
(1) Is there a clever transform that will simplify the original summation into the summation above without first working out the closed form?
It is interesting to note that RHS is also equivalent to
$$3\sum_{r=1}^n r^2$$
(2) Is there also another clever transform to convert the original summation into this summation without first working out the closed form?
A:
(1)
$$\sum_{i=1}^{n+1}\sum_{j=0}^{n-1}(i+j)=\sum_{j=0}^{n-1}\sum_{i=1}^{n+1}i + \sum_{i=1}^{n+1}\sum_{j=0}^{n-1}j=n\left((n+1)+\sum_{i=1}^n i\right)+(n+1)\left(-n+\sum_{j=1}^n j\right) \\ =(n+(n+1))\sum_{r=1}^n r=(2n+1)\sum_{r=1}^n r$$
(2)
$$\sum_{i=1}^{n+1}\sum_{j=0}^{n-1}(i+j)=
\sum_{\begin{array} c 1 \le i \le n+1,\\ 0 \le j \le n-1, \\ 1 \le i+j \le n \end{array}} \!(i+j) + \!\!\sum_{\begin{array} c 1 \le i \le n+1,\\ 0 \le j \le n-1, \\ n+1 \le i+j \le 2n \end{array}} \!((i-1)+(j+1)) \\
=\sum_{k=1}^n\sum_{\begin{array} c 1 \le i \le n+1,\\ 0 \le j \le n-1, \\ i+j=k \end{array}} \!k + \!\sum_{\begin{array} c k=0 \\ (i-1=k) \end{array}}^n\!\!\sum_{\begin{array} c 0 \le j \le n-1, \\ n-k \le j \le 2n-1-k \end{array}} \!\!\!\!k + \!\sum_{\begin{array} c k=1 \\ (j+1=k) \end{array}}^n\!\sum_{\begin{array} c 1 \le i \le n+1, \\ n+2-k \le i \le 2n+1-k \end{array}} \!\!\!\!\!k \\
=\sum_{k=1}^n \,k \!\sum_{\begin{array} c 1 \le i \le k \\ (j=k-i) \end{array}} \!\!1 + \!\sum_{k=1}^n \,k \sum_{j=n-k}^{n-1} \!1 + \!\sum_{k=1}^n \,k\sum_{i=n+2-k}^{n+1} \!1 \\
= \sum_{k=1}^n k \cdot k + \sum_{k=1}^n k \cdot k + \sum_{k=1}^n k \cdot k = 3 \sum_{r=1}^n r^2$$
|
{
"pile_set_name": "StackExchange"
}
|
This invention relates to an essentially hydroxyl-free fused silica glass which is resistant to laser damage and a method of making such glass using molecular hydrogen. Specifically, the invention relates to the use of molecular hydrogen to prevent the 190-300 nm optical absorption of fused silica associated with prolonged exposure to radiation within that wavelength.
Although the exact origin, nature and mechanism of formation of the centers that give rise to absorptions in fused silica are not completely understood, these defects can be identified and tracked by optical absorption and/or electron spin resonance techniques. Two categories of defects can be described: the E' center, centered at about 210 nm and an oxygen related defect, having an absorption at about 260 nm with a corresponding fluorescence at 650 nm.
The E' defect structure consists of a paramagnetic electron trapped in a dangling silicon orbital projecting into interstitial space. As the E' center has an unpaired electron it is detectable by electron spin resonance spectroscopy. The induced E' center has a 5.8 eV (210 nm) absorption band and a 2.7 eV (458 nm) fluorescence band. The absorption at 210 nm is particularly deleterious in ArF (193 nm) laser applications as it tails into the irradiating wavelength region of the laser. For applications such as lenses for 193 nm microlithography it is important to minimize or eliminate any optical absorption in this region of the UV spectrum.
The second observed absorption at 260 nm is a consequence of irradiating silica that contains dissolved molecular oxygen. It has been found that the more oxidizing the flame used to make the glasses the more 260 nm absorption is produced with laser irradiation. Along with the 260 nm absorption is formed 1.9 eV (650 nm) red fluorescence. The 260 absorption is undesirable for KrF (248 nm) laser applications as it is very close to the lasing wavelength; its minimization or elimination is important for the successful use of silica in KrF applications.
One model for the formation of the 260 absorption involves the reaction of dissolved molecular oxygen with fight to give oxygen atoms. The reactive oxygen atoms further react with molecular oxygen to give ozone (260 nm absorption). The ozone has a radiative transition with a red (650 nm) emission. Alternatively, it should be noted that molecular oxygen has also been theorized to react photolytically with silica. Regardless of the mechanism of formation, it is important to note that the 260 nm absorption is related to the molecular oxygen content of the glass.
In the past, many methods have been suggested for improving the optical damage resistance of fused silica glass. It has been generally known that high purity fused silica prepared by such methods as CVD- soot remelting process, plasma CVD process, electrical fusing of quartz crystal powder, and other similar methods, are susceptible to laser damage to various degrees. This variable propensity to laser damage has been attributed to low OH content, sometimes measuring as low as 10 ppm or less as measured from the value of the beta-OH. Therefore, most commonly, it has been suggested to increase the OH content of such glass to a high level. For example, Escher, G. C., KrF Laser Induced Color Centers In Commercial Fused Silicas, SPIE Vol. 998, Excimer Beam Applications, pp. 30-37 (1988), confirms that defect generation rate is dependent upon the fused silica OH content, and that "wet" silicas are the material of choice for KrF applications. Specifically, they note that high OH content silicas are more damage resistant than low OH silicas, due to their room temperature hydrogen annealing properties.
U.S. Pat. No. 5,086,352 and its related U.S. Pat. No. 5,325,230 also claim that the ability to resist optical deterioration from exposure to a short wavelength ultraviolet laser beam depends on the OH group content in the presence of hydrogen gas. Specifically, these references show that for high purity silica glass having low OH content, KrF excimer laser durability is poor. Thus, they suggest to have an OH content of at least 50 ppm.
Similarly, Yamagata, S., Improvement of Excimer Laser Durability of Silica Glass, Transactions of the Materials Research Society of Japan, Vol. 8, pp. 82-96, 1992, discloses the effect of dissolved hydrogen on fluorescence emission behavior and the degradation of transmission under irradiation of KrF excimer laser ray for high purity silica glass containing OH groups to 750 ppm by weight such as those synthesized from high purity silicon tetrachloride by the oxygen flame hydrolysis method.
Others have also suggested methods of increasing the optical durability of fused silica. For example, Faile, S. P., and Roy, D. M., Mechanism of Color Center Destruction in Hydrogen Impregnated Radiation Resistant Glasses, Materials Research Bull., Vol. 5, pp. 385-390, 1970, have disclosed that hydrogen-impregnated glasses tend to resist gamma ray-induced radiation.
Japanese Patent Abstract 40-10228 discloses a process by which quartz glass article made by melting is heated at about 400.degree. to 1000.degree. C. in an atmosphere containing hydrogen to prevent colorization due to the influence of ionizing radiation (solarization). Similarly, Japanese Patent Abstract 39-23850 discloses that the transmittance of UV light by silica glass can be improved by heat treating the glass in a hydrogen atmosphere at 950.degree. to 1400.degree. C. followed by heat treatment in an oxygen atmosphere at the same temperature range.
Shelby, J. E., Radiation Effects in Hydrogen-impregnated Vitreous Silica, J. Applied Physics, Vol. 50, No. 5, pp. 3702-06 (1979), suggests that irradiation of hydrogen-impregnated vitreous silica suppresses the formation of optical defects, but that hydrogen impregnation also results in the formation of large quantities of bound hydroxyl and hydride, and also results in the expansion or decrease in density of the glass.
There has been no suggestion in the past for a practical method of increasing the optical damage resistance of fused silica glass having low to no OH content, in particular, resistance to optical damage associated with prolonged exposure to UV radiation e.g., 193 or 248 nm excimer laser. Accordingly, it is the object of the present invention to disclose a method of increasing the resistance of high purity fused silica glass to optical damage.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
SMS jokes & text messages in english, hindi & urdu
Those who appear in your life
Those who appear in your life – whether to help or to harm – are all given by God. Meet all of them with a peaceful heart but with a warrior’s spirit. You will fail many times, but in failing, you will learn, and in learning you will find your way.. Remember, there are no mistakes in life – only lessons.
|
{
"pile_set_name": "Pile-CC"
}
|
Tumor necrosis factor-alpha induces expression of monocyte chemoattractant JE via fos and jun genes in clonal osteoblastic MC3T3-E1 cells.
The mechanism by which circulating monocytes are attracted to sites of bone remodeling is unknown. We now report that tumor necrosis factor-alpha (TNF-alpha), a potent osteotrophic cytokine, was stimulatory for expression of the monocyte chemoattractant JE gene in osteoblastic MC3T3-E1 cells. TNF-alpha stimulated this JE gene expression transcriptionally. The presence of JE gene product in conditioned medium of the cytokine-treated cells was evidenced by an immunoprecipitation assay with antiserum specific for JE/MCP-1. The stimulated JE gene expression was markedly inhibited by H-7, a potent inhibitor of protein kinase C. Phorbol 12-myristate 13-acetate induced the JE gene expression, and the cytokine-induced JE gene expression was down-regulated by the phorbol ester pretreatment. TNF-alpha induced expression of both early protooncogenes, c-fos and c-jun, in the cells. Antisense oligonucleotides to these oncogenes significantly inhibited the cytokine-induced monocyte chemotactic activity. Furthermore, curcumin, a specific inhibitor of c-jun/AP-1, markedly inhibited JE gene expression and monocyte chemotactic activity induced by the cytokine. These results suggest that TNF-alpha may contribute to the regulation of remodeling and inflammation of bone tissues through the JE gene product.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Mom was right: Why nice guys usually get the girls
Nov 05, 2009
The Aquarius remigis water strider on the right, identified by the blue-red-white dot sequence, is a highly aggressive male who is trying to break up a mating. The low-aggression water strider with the white-yellow-blue dots is mating with the female beneath him. The female, who has green dots near her head, is almost completely covered by the male on top of her. Credit: Omar Tonsi Eldakar
(PhysOrg.com) -- Female water striders often reject their most persistent and aggressive suitors and prefer the males who aren't so grabby, according to new research. Water striders are insects commonly seen skittering across the surface of streams.
Groups of low-key male water striders mated with more females than did groups of highly sexually aggressive males, according to a study led by Omar Tonsi Eldakar of the University of Arizona's Arizona Research Laboratories.
The research contradicts previous laboratory studies that found the most sexually aggressive males are the most successful at reproducing, said Eldakar, who conducted the experiments while an instructor at Binghamton University in N.Y. He is now a postdoctoral research associate in UA's Center for Insect Science.
"Nice guys don't always finish last," he said. "In this study we've shown that it's possible for non-aggressive males to have the advantage."
His co-author John W. Pepper said, "If the early laboratory studies were a realistic representation of nature, nature should be overrun by hyperaggressive males -- and it's not. So something was wrong with that idea, and now we know what."
In the previous studies, the females were not able to leave areas populated by sexually aggressive males.
By simulating a more natural situation, the current study showed that female water striders moved away from areas where they were being harassed by males. The females preferred to hang out in locations where the males did not pursue females relentlessly.
The new research explains why hyperaggressive males are a minority in the water strider world, said Pepper, a UA assistant professor of ecology and evolutionary biology. The groups of water striders that were composed of females and less aggressive males had more overall mating success.
The finding supports the idea that natural selection simultaneously acts on individuals and on groups of individuals, he said.
"Omar's work says that what happens between groups is important," Pepper said. "Individually, less aggressive males may get a smaller piece of the pie. But a group of less aggressive males has a bigger pie, because the males don't drive away females or harass them so much they don't reproduce."
Eldakar, Pepper and their co-authors Michael J. Dlugos and David Sloan Wilson of Binghamton University in N.Y. will publish their paper, "Population Structure Mediates Sexual Conflict in Water Striders," in the Nov. 6 issue of the journal Science. The Edmund Niles Huyck Preserve in Rensselaerville, N.Y., the National institutes of Health and the National Science Foundation funded the study.
Eldakar and his colleagues studied Aquarius remigis, a species of stream-dwelling water striders common throughout North America.
The team collected the insects from the wild during the breeding season. To tell the individuals apart, the researchers marked each one with a unique combination of colored dots by using toothpicks dipped in model airplane paint.
The scientists observed the water striders and categorized each male in terms of his degree of sexual aggressiveness toward females. The team then placed various combinations of six male and six female water striders into six individual chambers within a tank of water 12 feet by 4 feet. The researchers then recorded the insects' behaviors.
Each water strider was observed for at least an hour, Eldakar said.
When hyperaggressive males were present in the same chamber as less aggressive males, the hyperaggressive males monopolized the females.
However, when the researchers opened gates between the chambers so they were all connected and the insects could range more freely, things changed. Females left areas where they were harassed and congregated in regions of the tank that had only non-aggressive males. As a group, those males had significantly more successful matings than did the hyperaggressive males.
In a natural setting, water striders are free to move between different areas of a stream.
"You can't see the advantage (of being non-aggressive) until you see the females move toward the areas where the non-aggressive males congregate," Eldakar said. "In natural settings, the aggressive males are not going to have access (to females), because the females are going to gather where the males are non-aggressive."
Pepper is interested in how cooperation functions in nature. He defines cooperation as behavior that helps the group.
"The non-cooperator tries to get a bigger piece of the pie, but the cooperator helps the pie be bigger," Pepper said.
"The naive view of Darwinian evolution is that it always favors the most savage, brutal and selfish behaviors. It doesn't -- and this is one example of that. In nature, groups of cooperative individuals are more successful than groups of selfish individuals."
Related Stories
In a study published in PLoS ONE June 10, Chang Seok Han and Piotr Jablonski at Seoul National University, Korea, report that by evolving a morphological shield to protect their genitalia from males' forceful copulatory attemp ...
Why are males larger than females in some animal species (such as most mammals), females larger than males in others (such as most insects), and why are the sexes alike in yet other species (such as several ...
Researchers at Uppsala University can now show that what is good for one sex is not always good for the other sex. In fact, evolutionary conflicts between the two sexes cause characteristics and behaviors that are downright ...
In some promiscuous species, sexual conflict runs in reverse, reveals a new study published online on November 29th in Current Biology, a publication of Cell Press. Among African topi antelopes, females are the ones who ag ...
Female fish prefer brightly coloured males because they are easier to see and are in better shape concludes Dutch researcher Martine Maan following her study of fish speciation in the East African Lakes. Environmental variation ...
When Jonas the lemur died in January, just five months short of his thirtieth birthday, he was the oldest of his kind. A primate called a fat-tailed dwarf lemur, Jonas belonged to a long-lived clan. Dwarf ...
According to research published today in the Journal of Feline Medicine and Surgery by veterinary clinicians at the University of Lisbon and a clinic in the nearby town of Barreiro in Portugal, music is likew ...
The world around us is full of amazing creatures. My favorite is an animal the size of a pinhead, that can fly and land on the ceiling, that stages an elaborate (if not beautiful) courtship ritual, that can ...
|
{
"pile_set_name": "Pile-CC"
}
|
Introduction {#Sec1}
============
In contrast to mammals, lampreys show spontaneous and successful functional recovery after a complete spinal cord injury (SCI) and this is in part due to their impressive ability for axonal regeneration^[@CR1]--[@CR8]^. But, even in lampreys, not all descending neurons of the brain are able to regenerate their axons through the site of injury after a complete spinal cord transection^[@CR4],[@CR9]--[@CR12]^. The lamprey brainstem contains approximately 30 large individually identifiable descending reticulospinal neurons that vary greatly in their ability for axonal regeneration after SCI, even when their axons run in similar paths in a spinal cord that is permissive for axonal regrowth^[@CR4],[@CR12],[@CR13]^. Some identifiable descending neurons of lampreys are considered "good regenerators" (i.e. they regenerate their axon more than 55% of the times; the I3, I4, I5, B2, B5 and B6 neurons) and others are considered "bad regenerators" (i.e. they regenerate their axon less than 50% of the times; the M1, M2, M3, I1, I2, B1, B3, B4 and Mth neurons)^[@CR4],[@CR6],[@CR12]^. This indicates that interactions with the extrinsic spinal cord environment and intrinsic differences between descending neurons affect their regenerative abilities after SCI. Recent work has also shown that identifiable descending neurons of lampreys that are known to be "bad regenerators" slowly die after a complete SCI and are also "poor survivors"^[@CR12],[@CR14],[@CR15]^. The death of these neurons after SCI appears to be apoptotic as indicated by the appearance of TUNEL labelling and activated caspases in their soma^[@CR14]--[@CR18]^. This offers a convenient vertebrate model to study the inhibition or promotion of neuronal survival and axonal regeneration in the same in vivo preparation and at the level of single neurons.
In mammals, SCI leads to a massive release of aminoacidergic neurotransmitters (glycine and GABA:^[@CR19],[@CR20]^; glutamate:^[@CR21]--[@CR23]^). Excessive glutamate release after SCI is responsible for excitotoxicity and neuronal death^[@CR21],[@CR22]^. High extracellular glutamate levels result in excessive activation of glutamate receptors, triggering massive Ca^2+^ influx into cells, which leads to neuronal death^[@CR24]^. Extracellular glycine could also contribute to glutamate excitotoxicity^[@CR20]^, since it is a co-agonist of the *N*-methyl-D-aspartate glutamate receptor^[@CR25]^. The phenomenon of excitotoxicity has been mainly studied in intrinsic spinal cord cells; however, retrograde damage to neurons is also likely due to the fact that Ca^2+^ ions gain access to the axoplasm of damaged axons^[@CR26]^. In contrast to glutamate, it has been reported that GABA could have neuroprotective effects after different types of central nervous system (CNS) damage^[@CR27]--[@CR31]^. The activation of pre-synaptic GABAB receptors causes inactivation of voltage-dependent Ca^2+^ channels (see^[@CR32]^), which could prevent the influx of Ca^2+^ ions due to glutamate release. In addition, it has been shown that GABA can modulate and promote neurite outgrowth in vitro or during development (for reviews see^[@CR33],[@CR34]^). However, a role for GABA and GABAB receptors in neuroprotection and especially in axonal regeneration after SCI has not been reported yet.
In lampreys, glutamate induces an inhibition of neurite outgrowth in reticulospinal neurons in vitro due to Ca^2+^ influx^[@CR35]^. Electrophysiological studies have also suggested that low intracellular Ca^2+^ levels due to downregulation of Ca^2+^ channels could facilitate axonal regeneration in axotomized descending neurons of lampreys^[@CR36]^. More recently, we have reported that, as in mammals, there is a massive release of glutamate, GABA and glycine from most spinal cord neurons close to the lesion site following a complete SCI^[@CR37]--[@CR39]^. Between 1 and 3 days after the injury, we observed the extracellular accumulation of GABA in the form of "*halos*" around some axotomized axons of descending neurons close to the site of injury. Statistical analyses revealed a significant correlation between GABA accumulation and a higher survival ability of the corresponding identifiable descending neurons^[@CR37]^. An electrophysiological study in the spinal cord of lampreys has also found a correlation between higher GABAergic inhibition and a better recovery of function in spinal lesioned animals^[@CR40]^. These data prompted us to hypothesize that, in lampreys, increased GABA signalling after SCI could be favouring the recovery process by promoting survival and axonal regeneration of descending neurons. Here, we address this question for the first time in vivo in any vertebrate and provide gain and loss of function evidence showing that endogenous GABA, acting through GABAB receptors, promotes survival and axonal regeneration of identifiable descending neurons after SCI in lampreys.
Materials and methods {#Sec2}
=====================
Animals {#Sec3}
-------
All experiments involving animals were approved by the Bioethics Committee at the University of Santiago de Compostela and the *Consellería do Medio Rural e do Mar* of the *Xunta de Galicia* (License reference JLPV/IId; Galicia, Spain) or the Institutional Animal Care and Use Committee at the Marine Biological Laboratory (Woods Hole, MA) and were performed in accordance to European Union and Spanish guidelines on animal care and experimentation or the National Institutes of Health, respectively. During experimental procedures, special effort was taken to minimize animal suffering and to reduce the use of animals. Animals were deeply anaesthetized with 0.1% MS-222 (Sigma, St. Louis, MO) in lamprey Ringer solution before all experimental procedures and euthanized by decapitation at the end of the experiments.
Mature and developmentally stable larval sea lampreys, *Petromyzon marinus* L. (*n* = 115; between 95 and 120 mm in body length, 5 to 7 years of age), were used in the study. Larval lampreys were collected from the river Ulla (Galicia, Spain), with permission from the *Xunta de Galicia*, or provided by Lamprey Services, Inc. (Ludington, MI, USA) and maintained in aerated fresh water aquaria at 15--23 °C with a bed of river sediment until their use in experimental procedures. Lampreys were randomly distributed between the different experimental groups.
SCI surgical procedures {#Sec4}
-----------------------
Animals were assigned to the following experimental groups: control unlesioned animals or animals with a complete spinal cord transection that were analyzed 1 week post-lesion (wpl), 2 wpl, 4 wpl, 10 wpl or 12 wpl. Within the 2, 10 and 12 wpl groups, the injured animals were assigned to either control or treatment groups. Table [1](#Tab1){ref-type="table"} summarizes the number of animals assigned to each experimental group and condition. Each experiment was carried out in at least two different batches of animals. Complete spinal cord transections were performed as previously described^[@CR41]^. Briefly, the rostral spinal cord was exposed from the dorsal midline at the level of the 5th gill by making a longitudinal incision with a scalpel (\#11). A complete spinal cord transection was performed with Castroviejo scissors and the spinal cord cut ends were visualized under the stereomicroscope. After spinal transections, the animals were returned to fresh water tanks and each transected animal was examined 24 h after surgery to confirm that there was no movement caudal to the lesion site. Then, the animals were allowed to recover in individual fresh water tanks at 19.5 °C and in the dark.Table 1Table showing the number of animals included in each experimental group and also the total number of identifiable descending neurons that were included in the analysesAnimalsTotal number of neurons included in the analysesM1M2M3I1I2I3I4I5B1B2B3B4B5B6MthChanges in gabab1 expressionControl71111128--5859--109--791 wpl710101412--12969--139--11144 wpl61012129--6665--65--57GABA treatment (2 wpl)Control6\*1111101291112712111212111212Treated568896995101010107910Baclofen treatment (caspase activation, 2 wpl)Control7\*1312111491314814131414121414Treated71213131471413614131414131313GABOB treatment (12 wpl)Control15303029292430302930303030303030Treated14262524282428272825242628232824Baclofen treatment (axonal regeneration, 12 wpl)Control7121213141214141114121414141213Treated11212121221922222122222222222222Gabab1 morpholino (ISH, 2 wpl)Control36----6----------------------Treated47----8----------------------Gabab1 morpholino (axonal regeneration, 10 wpl)Control9181818181818181818181818181818Treated13262626252626262626262626262626Total115Please note that in the in situ hybridization experiments, only the neurons that were unequivocally identified in at least two brain sections were included in the quantifications. In the FLICA experiments, six animals were used as controls for both the GABA and baclofen treatments and an extra animal was used as a control only for the baclofen treatment (asterisks)
In situ hybridization {#Sec5}
---------------------
For gabab1 in situ hybridization, the head of the animals was fixed by immersion in 4% paraformaldehyde (PFA) in 0.05 M Tris-buffered saline (TBS; pH 7.4) for 12 h. Then, the brains were dissected out, washed and embedded in Neg 50^TM^ (Microm International GmbH, Walldorf, Germany), frozen in liquid nitrogen-cooled isopentane, sectioned on a cryostat in the transverse plane (14 μm thick) and mounted on Superfrost Plus glass slides (Menzel, Braunschweig, Germany). In situ hybridization with a specific riboprobe for the gabab1 subunit of the sea lamprey gabab receptor (GenBank accession number KX655780; see Suppl. Figure [1](#MOESM1){ref-type="media"}) was conducted as previously described^[@CR42]^. Briefly, brain sections were incubated with the sea lamprey gabab1 DIG-labelled probe at 70 °C and treated with RNAse A (Invitrogen, Massachusetts, USA) in the post-hybridization washes. Then, the sections were incubated with a sheep anti-DIG antibody conjugated to alkaline phosphatase (1:2000; Roche, Mannhein, Germany) overnight. Staining was conducted in BM Purple (Roche) at 37 °C. In situ hybridization experiments were performed in parallel with animals from the different experimental groups (control, 1 wpl, 2 wpl and 4 wpl) and the colorimetric reaction was stopped simultaneously for all sections from the different groups of animals.
Drug treatments {#Sec6}
---------------
The following drugs were used to treat the animals following the complete spinal cord transection: GABA (Sigma; Cat\#: A2129; MW: 103.12 g/mol), GABOB (a GABA analogue; Sigma; Cat\#: A56655; MW: 119.12 g/mol) and baclofen (a GABAB receptor agonist). Baclofen was acquired from two different companies: for the experiments of caspase activation, we used baclofen from Molekula (Newcastle, UK; Cat\#: 31184509; MW: 213.66 g/mol), and for the experiments of axonal regeneration, we used baclofen from Carbosynth (Berkshire, UK; Cat\#: FB18127; MW: 213.66 g/mol). The drugs were applied in the water where the animals were left after the SCI surgical procedures (GABA at a concentration of 500 µM, GABOB at a concentration of 50 µM and baclofen at a concentration of 125 µM). The concentrations of baclofen and GABA were selected based on previous in vitro electrophysiological studies in lampreys^[@CR43]^. Since GABA does not easily cross the blood--brain barrier, it was applied at a high concentration and only in the first days after the injury when the spinal cord is still disrupted. We assumed that GABOB and baclofen also cross the blood--brain barrier as in mammals, since the blood--brain barrier of lampreys is similar to that of higher vertebrates^[@CR44],[@CR45]^. While we do not know the final concentration of the drugs in the CNS, we were confident that this application route allows access to the CNS as there were changes in the swimming behaviour of unlesioned animals in pilot experiments using baclofen and GABOB at these concentrations (not shown). Since these drugs are water soluble, control lesioned and non-treated animals were left in fresh water only. The animals that were analyzed for caspase activation 2 wpl were treated with GABA or baclofen during 4 days from the day of injury and replacing the drug and water every day during those 4 days. The animals that were analyzed for axonal regeneration 12 wpl were treated with GABOB or baclofen during the 12 weeks replacing the drug and the water four times each week. The animals were always kept in the dark during the drug treatments to prevent light degradation of these drugs.
Morpholino treatment {#Sec7}
--------------------
Application of morpholinos was performed as previously described in ref.^[@CR13]^. Briefly, the spinal cord was transected at the level of the 5th gill (see surgical procedures), and morpholinos (20 µg in lamprey internal solution: 180 mM KCl, 10 mM HEPES, pH 7.4; designed by GeneTools, LLC; Philomath, OR) were added at the time and site of SCI soaked in a small piece of Gelfoam (Pfizer; New York, NY). These included an active splicing-blocking gabab1 morpholino (5′-ACGTCTGCAACGGAGAGTCATGAGA-3′) generated against the boundary between the second intron and the second exon of the partial sea lamprey gabab1 sequence (Suppl. Figure [1](#MOESM1){ref-type="media"}), and a 5-base pair mismatch gabab1 negative control morpholino (5′-ACcTCTcCAACcGAGAcTCATcAGA-3′). During recovery, the morpholinos are retrogradely transported to the cell soma of descending neurons where they can knockdown the expression of the target mRNA^[@CR13],[@CR46]--[@CR48]^. Animals were allowed to recover for 10 wpl to analyze the effect of gabab1 knockdown (KD) in axonal regeneration of identifiable descending neurons. In situ hybridization was used to control the efficacy of the gabab1 morpholino KD in animals processed at 2 wpl.
Detection of activated caspases in whole-mounted brain preparations {#Sec8}
-------------------------------------------------------------------
The Image-iT LIVE Green Poly Caspases Detection Kit (Cat. No. I35104, Invitrogen, USA) was used to detect activated caspases in identifiable descending neurons (the M1, M2, M3, I1, I2, I3, I4, I5, B1, B2, B3, B4, B5, B6 and Mth neurons; see Suppl. Figure [2A](#MOESM2){ref-type="media"}) of larval sea lampreys 2 weeks after the complete spinal cord transection and the GABA or baclofen treatments. This kit contains 1 vial (component A of the kit) of the lyophilized FLICA reagent (FAM--VAD--FMK). The reagent associates a fluoromethyl ketone (FMK) moiety, which can react covalently with a cysteine, with a caspase-specific aminoacid sequence (valine--alanine--aspartic acid (VAD)). A carboxyfluorescein group (FAM) is attached as a fluorescent reporter. The FLICA reagent interacts with the enzyme active centre of an activated caspase via the recognition sequence, and then attaches covalently through the FMK moiety. Experiments for the detection of activated caspases in whole-mounted brain preparations were done as previously described^[@CR16]--[@CR18]^. Briefly, brains from control and treated 2 wpl animals were dissected out and immediately incubated in 150 µL of phosphate buffered saline (PBS) containing 1 μL of the 150× FLICA labelling solution at 37 °C for 1 h. Then, the brains were washed with PBS. Brains were fixed in 4% PFA in PBS for 2 h and 30 min at 4 °C. Next, the brains were washed with PBS, mounted on Superfrost Plus glass slides, and mounted with Mowiol.
Retrograde labelling of descending neurons with regenerated axons {#Sec9}
-----------------------------------------------------------------
At 10 (morpholino treatments) or 12 (GABOB and baclofen treatments) wpl, a second complete spinal cord transection was performed 5 mm below the site of the original transection and the retrograde tracer Neurobiotin (NB, 322.8 Da molecular weight; Vector; Burlingame, CA) was applied to the spinal cord lesion with the aid of a Minutien pin (\#000). The animals were allowed to recover at 19.5 °C with appropriate ventilation conditions for 7 days to allow the transport of the tracer from the application point to the neuronal soma of identifiable descending neurons (the M1, M2, M3, I1, I2, I3, I4, I5, B1, B2, B3, B4, B5, B6 and Mth were analyzed; see Suppl. Figure [2A](#MOESM2){ref-type="media"}). Since the original SCI also was a complete spinal cord transection, only neurons whose axons regenerated at least 5 mm below the site of injury were labelled by the tracer. Brains of these larvae were dissected out, and the posterior and cerebrotectal commissures of the brain were cut along the dorsal midline, and the alar plates were deflected laterally and pinned flat to a small strip of Sylgard (Dow Corning Co., USA) and fixed with 4% PFA in TBS for 4 h at room temperature. After washes in TBS, the brains were incubated at room temperature with Avidin D-FITC conjugated (Vector; Cat\#: A-2001; 1:500) diluted in TBS containing 0.3% Triton X-100 for 2 days to reveal the presence of Neurobiotin. Brains were rinsed in TBS and distilled water and mounted with Mowiol.
Imaging and quantifications {#Sec10}
---------------------------
An Olympus photomicroscope (AX-70; Provis) with a 20× Apochromatic 0.75 lens and equipped with a colour digital camera (Olympus DP70, Tokyo, Japan) was used to acquire images of brain sections from the in situ hybridization experiments. Images were always acquired with the same microscope and software settings. For the quantification of the level of gabab1 positive signal in identifiable descending neurons, first we established the intensity rank of positive colorimetric in situ signal. For this, we analyzed 10 random images from different descending neurons of control and lesioned animals. The "histogram" function in Image J shows the number of pixels in each image in a range of intensity from 0 to 255. With these images, we compared the intensity values in regions with clear in situ signal and the intensity values in regions without in situ signal. Based on this, we established a value of 179 as the lower limit to consider the colorimetric in situ signal as positive. Then the number of pixels of positive in situ signal was quantified for each section of each identified descending neuron. In brain sections, the identification of some of the specific descending cells becomes more difficult than in whole-mounts. Thus, only the cells that were unequivocally identified in at least two different sections were included in the quantifications (the M1, M2, M3, I1, I3, I4, I5, B1, B3, B4, B6 and Mth neurons; see Suppl. Figure [2A](#MOESM2){ref-type="media"}). Then, we calculated the average number of positive pixels per section for each individual neuron (see Table [1](#Tab1){ref-type="table"}) and these data were used for statistical analyses. The experimenter was blinded during quantifications.
The quantification of the intensity of FLICA labelling was done as previously described^[@CR18]^. Briefly, photomicrographs were acquired with a spectral confocal microscope (model TCS-SP2; Leica, Wetzlar, Germany). Images were always acquired under the same microscope conditions for control or treated animals. Quantification of mean fluorescent intensity (mean grey value) of each identifiable neuron was done using the Fiji software. In whole-mounted brain preparations, the specific descending neurons are easily identifiable based on their morphology and rostro-caudal and dorso-ventral anatomical location. The experimenter was blinded during quantifications. The data from each individual identifiable neuron (see Table [1](#Tab1){ref-type="table"}) were used for statistical analyses.
The percentage of neurons with regenerated axons (labelled by the Neurobiotin tracer) with respect to the total number of analyzed neurons (see Table [1](#Tab1){ref-type="table"}) was calculated for each type of identifiable descending neuron using an Olympus microscope or a Zeiss AxioImager Z2 microscope. The percentage of neurons with regenerated axons with respect to the total number of analyzed neurons in each animal was also calculated and these data were used for statistical analyses. The experimenter was blinded during quantifications. For the figures, images were taken with the Olympus microscope or the spectral confocal microscope (model TCS-SP2; Leica).
After quantifications, contrast and brightness were minimally adjusted with Adobe Photoshop CS4 or CS6 (Adobe Systems, San José, CA, USA). Figure plates and lettering were generated using Adobe Photoshop CS4 or CS6 (Adobe Systems).
Statistical analyses {#Sec11}
--------------------
Statistical analysis was carried out using Prism 6 (GraphPad software, La Jolla, CA). Data were presented as mean ± S.E.M. Normality of the data was determined only when *n* numbers were higher than 10 by using the D'Agostino-Pearson omnibus test, and the homoscedasticity was determined by the Brown-Forsythe test. The in situ hybridization data that were normally distributed and homoscedastic were analyzed by a one-way ANOVA. Post-hoc Dunnett's multiple comparison tests were used to compare pairs of data. In situ hybridization data that were not normally distributed (or when the *n* numbers were lower than 10) were analyzed by a Kruskal--Wallis test and post-hoc Dunn's multiple comparisons test. The results of control vs. treatment groups were analyzed by a Student's *t*-test (for normally distributed data) or a Mann--Whitney *U* test (for non-normally distributed data). The in situ hybridization data after morpholino application were analyzed by a Mann--Whitney *U* test. The significance level was set at 0.05. In the figures, significance values were represented by different number of asterisks: 1 asterisk (*p* value between 0.01 and 0.05), 2 asterisks (*p* value between 0.001 and 0.01), 3 asterisks (*p* value between 0.0001 and 0.001) and 4 asterisks (*p* value \<0.0001).
Results {#Sec12}
=======
Increased expression of the gabab1 subunit in identifiable descending neurons after SCI {#Sec13}
---------------------------------------------------------------------------------------
GABAB receptors are obligate heterodimers formed by gabab1 and gabab2 subunits^[@CR49]^. In previous work, we reported the expression of the gabab1 and gabab2 receptor subunits in identifiable descending neurons of adult sea lampreys under normal conditions^[@CR42]^. Here, we used gabab1 in situ hybridization first to confirm that this receptor is also expressed in identifiable descending neurons of mature larval sea lampreys (Suppl. Figure [2B](#MOESM2){ref-type="media"}; Fig. [1a, c, e](#Fig1){ref-type="fig"}) and then to quantify changes in its expression after SCI (Fig. [1a--g](#Fig1){ref-type="fig"}; Suppl. Figure [3](#MOESM3){ref-type="media"}). The M1, M2, M3, I1, I3, I4, I5, B1, B3, B4, B6 and Mth neurons were included in the analyses (see Material and Methods). This revealed a significant increase in the expression of the gabab1 subunit in the M2 (ANOVA, *p* = 0.0049), M3 (ANOVA, *p* = 0.002), I1 (Kruskal--Wallis, *p* = 0.0009), I3 (Kruskal--Wallis, *p* = 0.0097), B1 (Kruskal--Wallis, *p* = 0.015) and B3 (Kruskal--Wallis, *p* = 0.0178) neurons (Fig. [1g](#Fig1){ref-type="fig"}; Table [2](#Tab2){ref-type="table"}) in 1 wpl animals as compared to control unlesioned animals. Subsequent power calculations (using 80% power) indicated that the sample sizes were appropriately powered. Although a similar trend was observed for the M1, I4, I5, B4, B6 and Mth neurons in 1 wpl animals as compared to control unlesioned animals, statistical analyses did not reveal significant changes in the expression of the gabab1 subunit in these neurons (Suppl. Figure [3](#MOESM3){ref-type="media"}; Table [2](#Tab2){ref-type="table"}). At 4 wpl, the expression of the gabab1 subunit was not significantly different to control unlesioned animals in all identifiable descending neurons and returned to control levels (Fig. [1g](#Fig1){ref-type="fig"}; Suppl. Figure [3](#MOESM3){ref-type="media"}; Table [2](#Tab2){ref-type="table"}). This shows that the complete SCI induced an acute increase in the expression of the gabab1 subunit in descending neurons, which, together with the accumulation of GABA around the axons of identifiable neurons^[@CR37]^, supports the possible role of endogenous GABA as a neuroprotective and pro-regenerative molecule after SCI in lampreys.Fig. 1Changes in the expression of the gabab1 subunit in identifiable descending neurons after a complete SCI.**a**, **c** and **e** Photomicrographs of transverse sections of the brain showing the expression of the gabab1 transcript in descending neurons of control animals. **b**, **d** and **f** Photomicrographs of transverse sections of the brain showing the expression of the gabab1 transcript in descending neurons of lesioned animals at 1 wpl. **g** Graphs showing significant changes (asterisks) in the number of gabab1 positive pixels per section of the soma of identifiable descending neurons. The mean ± S.E.M. values are provided in Table [2](#Tab2){ref-type="table"}. Scale bars: 20 µmTable 2Mean ± S.E.M. values of the number of gabab1 positive in situ pixels/section in identifiable descending neurons of control and injured animalsGabab1 positive pixels/sectionControl1 wpl4 wplM1258,170 ± 86,006320,350 ± 78,104148,657 ± 43,920M2237,552 ± 61,602618,158 ± 176,397131,367 ± 19,089M3144,448 ± 56,162423,439 ± 93,05985,245 ± 16,702I1140,858 ± 94,768627,179 ± 137,246176,392 ± 74,810I339,783 ± 17,599204,914 ± 49,09961,945 ± 34,492I468,678 ± 11,645147,613 ± 44,90345,723 ± 7,610I537,027 ± 21,46362,221 ± 13,38054,634 ± 23,587B1198,893 ± 57,286429,418 ± 43,503202,694 ± 75,156B3184,112 ± 51,392488,947 ± 86,189161,864 ± 70,596B4183,470 ± 49,454317,944 ± 79,980274,012 ± 88,414B6222,515 ± 105,034456,303 ± 87,734273,466 ± 101,442Mth201,230 ± 84,794395,530 ± 90,345139,834 ± 31,750Refers to Fig. [1](#Fig1){ref-type="fig"} and Suppl. Figure [2](#MOESM2){ref-type="media"}
GABA and baclofen treatments inhibit caspase activation in descending neurons after SCI {#Sec14}
---------------------------------------------------------------------------------------
To test our hypothesis, we first analyzed the effect of GABA and baclofen (GABAB agonist) treatments in caspase activation in identifiable descending neurons after a complete SCI using FLICA labelling (Fig. [2a--i](#Fig2){ref-type="fig"}). As previously shown, in control lesioned animals, there is a statistically significant correlation between the intensity of FLICA labelling and the long-term survival and regenerative abilities of identifiable neurons (not shown;^[@CR18],[@CR50]^). At 2 wpl, animals treated with GABA or baclofen during 4 days showed a significant inhibition of caspase activation (fluorescence intensity of FLICA labelling) in identifiable descending neurons as compared to control animals (GABA: Student's *t*-test, *p* \< 0.0001; baclofen: Student's *t*-test, *p* \< 0.0001; Fig. [2j, k](#Fig2){ref-type="fig"}). This suggests that GABA can inhibit apoptosis in descending neurons after SCI by activating GABAB receptors.Fig. 2GABOB and baclofen treatments inhibit caspase activation in identifiable descending neurons.**a**, **d** and **g** Photomicrographs of whole-mounted brains showing identifiable descending neurons with intense FLICA labelling in control animals. **b**, **e** and **h** Photomicrographs of whole-mounted brains showing identifiable descending neurons with a reduction in FLICA labelling in GABA-treated animals. **c**, **f** and **i** Photomicrographs of whole-mounted brains showing identifiable descending neurons with a reduction in FLICA labelling in baclofen-treated animals. **j** Graph showing significant changes (asterisks) in the level of caspase activation (intensity of fluorescent FLICA labelling) after the GABA treatment. **k** Graph showing significant changes (asterisks) in the level of caspase activation (intensity of fluorescent FLICA labelling) after the baclofen treatment. Rostral is up in all photomicrographs. Scale bars: 100 µm
GABOB and baclofen long-term treatments promote axonal regeneration in descending neurons after SCI {#Sec15}
---------------------------------------------------------------------------------------------------
Then, we studied the long-term effect of increasing GABAergic signalling in axonal regeneration after a complete SCI. Retrograde neuronal tract-tracing with Neurobiotin showed that a treatment with either GABOB (Fig. [3](#Fig3){ref-type="fig"}) or baclofen (Fig. [4](#Fig4){ref-type="fig"}) during 12 weeks post-lesion significantly promoted axonal regeneration of identifiable descending neurons after a complete SCI as compared to control animals (GABOB: Student's *t*-test, *p* = 0.0129 (Fig. [3h](#Fig3){ref-type="fig"}); baclofen: Mann--Whitney *U* test, *p* = 0.0004 (Fig. [4h](#Fig4){ref-type="fig"})). The baclofen used in these experiments (from Carbosynth) was also tested to confirm that it had the same effect in the activation of caspases as the baclofen acquired from Molekula. This baclofen also inhibited caspase activation significantly in identifiable descending neurons as compared to control animals in a different set of experiments (Mann--Whitney *U* test, *p* \< 0.0001; not shown). This shows that an increase in GABAergic signalling through GABAB receptors promotes axonal regeneration after a complete SCI.Fig. 3A long-term GABOB treatment promotes axonal regeneration of identifiable descending neurons.**a**, **c** and **e** Photomicrographs of whole-mounted brains showing different reticulospinal populations with regenerated identifiable neurons in control animals, as identified by retrograde labelling. **b**, **d** and **f** Photomicrographs of whole-mounted brains showing different reticulospinal populations with an increased number of labelled (regenerated) identifiable neurons in treated animals. **g** Graph showing the percentage of regenerated neurons (with respect to the total number of analyzed neurons) for each identifiable cell in control and GABOB-treated animals. **h** Graph showing significant changes (asterisks) in the percentage of regenerated neurons per animal after the GABOB treatment (control: 37.27 ± 3.33%; GABOB: 49.79 ± 4.16%). Arrows indicate descending neurons that regenerated in GABOB-treated animals but not in controls animals. Rostral is up in all photomicrographs. Scale bars: 50 µmFig. 4A long-term baclofen treatment promotes axonal regeneration of identifiable descending neurons.**a**, **c** and **e** Photomicrographs of whole-mounted brains showing different reticulospinal populations with regenerated identifiable neurons in control animals. **b**, **d** and **f** Photomicrographs of whole-mounted brains showing different reticulospinal populations with an increased number of labelled (regenerated) identifiable neurons in treated animals. **g** Graph showing the percentage of regenerated neurons (with respect to the total number of analyzed neurons) for each identifiable cell in control and baclofen-treated animals. **h** Graph showing significant changes (asterisks) in the percentage of regenerated neurons per animal after the baclofen treatment (control: 46.17 ± 7.15%; baclofen: 77.91 ± 3.56%). Arrows indicate descending neurons that regenerated in baclofen-treated animals but not in controls animals. Rostral is up in all photomicrographs. Scale bars: 100 µm
Endogenous GABA signalling through GABAB receptors promotes axonal regeneration after SCI {#Sec16}
-----------------------------------------------------------------------------------------
To test whether endogenous GABA also promotes regeneration by activating GABAB receptors, we decided to use morpholinos to knockdown the expression of the gabab1 subunit in descending neurons after a complete SCI (Fig. [5](#Fig5){ref-type="fig"}). First, we used in situ hybridization to confirm that the active gabab1 morpholino is able to knockdown the expression of the gabab1 mRNA in identifiable neurons of 2 wpl animals (Fig. [5a--e](#Fig5){ref-type="fig"}). As an example, we analyzed the M1 (Fig. [5a, b](#Fig5){ref-type="fig"}) and the I1 neurons (Fig. [5c, d](#Fig5){ref-type="fig"}). The active gabab1 morpholino was able to significantly knockdown the expression of the gabab1 mRNA in identifiable descending neurons as compared to the gabab1 mismatch control morpholino (M1: Mann--Whitney *U* test, *p* = 0.0111; I1: Mann--Whitney *U* test, *p* = 0.0057; Fig. [5e](#Fig5){ref-type="fig"}). Then, neuronal tract-tracing showed that the treatment with the active gabab1 morpholino significantly inhibited axonal regeneration of identifiable descending neurons 10 weeks after a complete SCI as compared to the animals treated with the gabab1 mismatch control morpholino (Mann--Whitney *U* test, *p* = 0.0133; Fig. [5f--m](#Fig5){ref-type="fig"}). This confirms that, in lampreys, endogenous GABA promotes axonal regeneration of descending neurons after a complete SCI by activating GABAB receptors.Fig. 5Gabab1 morpholino treatments inhibit axonal regeneration of identifiable descending neurons.**a**, **c** Photomicrographs of transverse sections of M1 (**a**) and I1 (**c**) neurons showing the expression of the gabab1 transcript in control animals. **b**, **d** Photomicrographs of transverse sections of M1 (**b**) and I1 (**d**) neurons showing the decreased expression of gabab1 transcript in gabab1 morpholino-treated animals. **e** Graphs showing significant changes (asterisks) in the number of gabab1 positive pixels per section in the soma of M1 and I1 neurons after the gabab1 morpholino treatment. **f**, **h** and **j** Photomicrographs of whole-mounted brains showing different reticulospinal populations with regenerated identifiable neurons in animals treated with the control morpholino. **g**, **i**, **k**: Photomicrographs of whole-mounted brains showing different reticulospinal populations with fewer regenerated identifiable neurons in animals treated with the active gabab1 morpholino. **l** Graph showing the percentage of regenerated neurons (respect to the total number of analyzed neurons) for each identifiable cell in control and active gabab1 morpholino-treated animals. **m** Graph showing significant changes (asterisk) in the percentage of regenerated neurons per animal after the morpholino treatment (control mismatch morpholino: 43.89 ± 3.26%; gabab1 active morpholino: 33 ± 5%). Arrows indicate descending neurons that regenerated in gabab1 morpholino-treated animals but not in controls animals treated with the mismatch control morpholino. Rostral is up in photomicrographs (**f**) to (**k**). Scale bars: black, 20 µm; white, 50 µm
Discussion {#Sec17}
==========
Here, we have provided gain and loss of function data, using pharmacological and genetic treatments, showing that endogenous GABA signalling through GABAB receptors promotes neuronal survival and axonal regeneration of identifiable descending neurons of lampreys after a complete SCI.
The analysis of the changes of expression of the gabab1 subunit in response to a complete SCI revealed a significant increase in the expression of this subunit in some identifiable descending neurons (with other neurons showing a similar trend). As stated in the introduction, massive glutamate release and the subsequent activation of glutamate receptors lead to an increase in Ca^2+^ influx into cells, which causes excitotoxicity and neuronal death after SCI^[@CR21],[@CR22],[@CR24],[@CR51]^; see^[@CR52]^. GABAB receptors can cause the inactivation of voltage-dependent Ca^2+^ channels (see^[@CR32]^). Therefore, this increase in the expression of GABAB receptors could compensate for the influx of Ca^2+^ into axotomized descending neurons caused by massive glutamate release. The acute increase in the expression of the gabab1 subunit in descending neurons and the massive release of GABA after SCI^[@CR37]^ appears as one of the mechanisms favouring neuronal survival and axonal regeneration after SCI in lampreys. As far as we are aware, no study has analyzed the expression of gabab subunits after SCI in mammals. Only a few mammalian studies have looked at changes in the expression of this receptor following other types of nervous system injuries (sciatic nerve ligation:^[@CR53]^; traumatic brain injury:^[@CR54]^; ulnar nerve transection:^[@CR55]^; cerebral ischaemia:^[@CR56]^). In contrast to the present results in lampreys, these studies showed that the expression of GABAB receptors decreases after the injury in different regions of the brain^[@CR54]--[@CR56]^. This could be a key difference between regenerating and non-regenerating animals, since axons of the later do not show good regenerative abilities after CNS injuries. Interestingly, and in agreement with the results in lampreys, Huang and colleagues^[@CR56]^ reported that an elevation in the protein expression of GABAB receptors in the cerebral cortex promotes neuroprotection after ischaemic damage.
There is some controversy on the topic of whether descending neurons of the brain of mammals die after SCI. Some studies have shown the death of brain neurons after SCI^[@CR57]--[@CR63]^. On the other hand, two recent reports did not find evidence of the death of corticospinal neurons after SCI^[@CR64],[@CR65]^, and suggested that these neurons only suffer atrophy but do not die^[@CR65]^. In any case, the death or atrophy of descending neurons of mammals appears to involve apoptotic mechanisms as shown by the appearance of TUNEL labelling and activated caspase-3 immunoreactivity in these neurons after the injury at spinal levels^[@CR60]--[@CR62]^. Recent work in lampreys has also shown that identifiable descending neurons known to be "bad regenerators" are actually "poor survivors" after a complete SCI^[@CR8],[@CR12],[@CR14],[@CR50]^. These neurons enter in a process of slow and delayed death after SCI^[@CR8],[@CR12]--[@CR18]^ that is initiated by caspase activation in the injured axon at spinal levels^[@CR17],[@CR18]^. The death of these neurons also occurs through apoptotic mechanisms as shown by the appearance of activated caspases^[@CR15]--[@CR18]^, TUNEL labelling^[@CR14],[@CR15]^ and Fluoro-Jade® C labelling^[@CR12],[@CR18]^. Recent results have shown that there is a significant correlation between the intensity of caspase activation 2 wpl and the long-term regenerative^[@CR18]^ and survival^[@CR50]^ abilities of identifiable descending neurons of lampreys after SCI. Present results indicate that the activation of GABAB receptors by GABA/baclofen can inhibit caspase activation after SCI in identifiable descending neurons, which is a key step to preventing the development of apoptosis and promoting neuronal survival. Previous work in other models of CNS injury also showed that a baclofen treatment can inhibit caspase activation (model of kainic-acid-induced seizure in rats:^[@CR29]^; models of ischaemic brain injury in rats:^[@CR27],[@CR31]^; model of chemical hypoxia in retinal ganglion cells in rats:^[@CR66]^). Our study shows that the activation of GABAB receptors can also prevent apoptosis after a traumatic SCI.
Of major importance is the fact that our results also support the role of GABA as a molecule that promotes true axonal regeneration of descending neurons through the site of a complete SCI. Behavioural analyses were not performed to establish a relationship between increased regeneration and improved functional recovery after the treatments. First, because in our case, control animals usually reach the highest level of recovery when using the Ayers test (see ref.^[@CR39]^) and also because the treated animals were in the drugs until the day of analysis. Experiments using a gabab1 morpholino demonstrated that endogenous GABA acts as a pro-regenerative factor after SCI by activating GABAB receptors. The morpholino experiments suggest that GABA might promote regeneration by activating GABAB receptors expressed in the axotomized descending neurons. But, we cannot rule out the possibility that GABA could also promote the regeneration of descending neurons indirectly by inhibiting other cells expressing GABAB receptors, like intrinsic spinal cord neurons^[@CR39],[@CR42]^ that could have also taken the morpholino in our experiments. Our data agree with previous in vitro or developmental studies regarding the role of GABA and GABAB receptors in neurite outgrowth^[@CR67]^. López-Bendito and coworkers^[@CR67]^ showed that the GABAB antagonist CGP52432 decreases the length of the leading process in migrating inhibitory neurons in brain slice cultures of mice. Also, both GABA and baclofen stimulate retinal ganglion neurite outgrowth in *Xenopus* cultures, and the GABAB antagonist CGP54262 shortened the developing optic projection in vivo^[@CR68]^. But, as far as we are aware, our results are the first in vivo demonstration showing that GABA promotes axonal regrowth after a CNS injury by activating GABAB receptors. Present and previous^[@CR37]^ results indicate that the GABAergic system of lampreys responds successfully to a SCI to limit retrograde degeneration and promote the regeneration of descending pathways.
Conclusion {#Sec18}
==========
We have revealed a major role of GABA and GABAB receptors in promoting the survival and regeneration of individually identifiable descending neurons of lampreys following a complete SCI. Now, it would be of interest to decipher the underlying mechanisms behind the neuroprotective and pro-regenerative effect of GABA. Based on previous results in lampreys showing a negative effect of Ca^2+^ in neurite outgrowth^[@CR35],[@CR36]^, a decrease in Ca^2+^ levels due to the activation of GABAB receptors could be one of the key events in the inhibition of apoptosis and activation of axonal regeneration by GABA. In future studies, it might be also interesting to analyze changes in gene expression elicited by GABA signalling and the activation of GABAB receptors to reveal new pathways involved in axonal regeneration and neuronal survival in lampreys.
The present results provide further support for the idea suggesting that the lesioned spinal cord is a "new spinal cord"^[@CR69]^ and the importance of understanding the changes that occur after SCI in different neurotransmitter systems in the brain and in the spinal cord above and below the site of injury. This study adds to previous work revealing anatomical^[@CR37]--[@CR39],[@CR70],[@CR71]^ and physiological^[@CR40],[@CR72],[@CR73]^ changes in different neurotransmitter systems above and below the lesion in recovered lampreys and highlights the importance of understanding these changes before applying neuropharmacological interventions in SCI patients. Specially, when drugs affecting neurotransmission might not only modulate locomotor circuits, but also affect the process of neuronal regeneration and recovery (e.g. serotonin inhibitors/toxins: see refs.^[@CR72],[@CR74]^; GABOB/baclofen: present results).
Our results provide a strong basis to translate this knowledge to mammalian models of SCI for the development of new therapies for patients with SCI. A recent large observational cohort study has found that the early administration of gabapentinoids (which are administered as anticonvulsants for SCI patients) improves motor recovery following SCI^[@CR75]^. Interestingly, baclofen is also already in use in the clinic, even for the treatment of SCI patients with spasticity^[@CR76]^ or neuropathic pain^[@CR77]^, which could facilitate the clinical translation of similar results in pre-clinical models of SCI.
Electronic supplementary material
=================================
{#Sec20}
Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary figure legends
These authors contributed equally: Antón Barreiro-Iglesias, María Celina Rodicio
Edited by: A. Verkhratsky
**Electronic supplementary material**
**Supplementary Information** accompanies this paper at (10.1038/s41419-018-0704-9).
**Publisher\'s note:** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Grant sponsors: Spanish Ministry of Economy and Competitiveness and the European Regional Development Fund 2007--2013 (Grant number: BFU2014-56300-P) and Xunta de Galicia (Grant number: GPC2014/030). D.R.-S. was supported by a fellowship from EMBO (Ref.: 7010) to carry out a short-term stay at the laboratory of JRM. A.B.-I. was supported by a grant from the Xunta de Galicia (Grant number: 2016-PG008) and a grant from the crowdfunding platform *Precipita* (FECYT; Spanish Ministry of Economy and Competitiveness; grant number 2017-CP081). The authors would like to acknowledge the following individual donors of the crowdfunding campaign in *Precipita*: Blanca Fernández, Emilio Río, Guillermo Vivar, Pablo Pérez, Jorge Férnandez, Ignacio Valiño, Pago de los Centenarios, Eva Candal, María del Pilar Balsa, Jorge Faraldo, Isabel Rodríguez-Moldes, José Manuel López, Juan José Pita, María E. Cameán, Jesús Torres, José Pumares, Verónica Rodríguez, Sara López, Tania Villares Balsa, Rocío Lizcano, José García, Ana M. Cereijo, María Pardo, Nerea Santamaría, Carolina Hernández, Jesús López and María Maneiro. The authors thank the staff of *Ximonde* Biological Station for providing lampreys used in this study, and the Microscopy Service (University of Santiago de Compostela) and Dr. Mercedes Rivas Cascallar for confocal microscope facilities and help. We also thank the Director of the Central Microscopy Facility at the Marine Biological Laboratory, Louie Kerr, for technical assistance and the Marine Biological Laboratory in Woods Hole (MA) for providing support for these experiments. This article is dedicated to the memory of José Manuel Pérez Cancela (20/11/1975--05/03/2018) from the *Ximonde* Biological Station.
Conflict of interest {#FPar1}
====================
The authors declare that they have no conflict of interest.
|
{
"pile_set_name": "PubMed Central"
}
|
Augmented reality company Magic Leap has settled a sex discrimination lawsuit brought by former employee Tannen Campbell. A notice of settlement was filed yesterday, although further terms haven’t been revealed, and a legal representative for Campbell tells The Verge that they will remain confidential. The case should be officially dismissed by June 2nd.
Campbell’s lawsuit, filed in February, alleged that Magic Leap’s executives turned a blind eye toward sexism at the company. Among other things, it claimed that Magic Leap employees made comments about women being bad with computers, dismissed female team members’ input, and created a “macho bullying” culture at the office. Campbell also alleged that she was fired for pointing out problems with the company’s treatment of women.
Magic Leap has spent several years working on augmented reality glasses that are supposed to rival anything currently on the market, including Microsoft HoloLens. However, the company has been dogged by allegations that it’s facing major technical difficulties and is far behind on its original plans. It’s currently rumored to be releasing an augmented reality headset later this year, at a cost of at least $1,000.
Update 3PM ET: Added comment from Campbell’s attorney.
|
{
"pile_set_name": "OpenWebText2"
}
|
Adding a face to an AI
Update 02/12/2014: I made a slightly better version using graphics that implement a little bit of the actual mouth movements (see here for code):
So for a face, I thought I would try making some sort of realtime voice animating system. I made a very very simple one in python. Here is an example of what it looks like and sounds like:
The source code is very simple. Get the whole code at my github page (the following excludes the saySomething function which is part of mouth_function. Basically the following code opens a process to say something and at the same time tries to animate it with an open/closing mouth. The timing between the mouth open and mouth closed comes from an average timing I got from recording the Google TTS and recording how much time it takes to say a word and the amount of time between words.
The other trick is to count the number of syllables in a word. Python has a fast way of doing this using nltk (coded below).
That’s it! Future implementations will try to make the timing a little better. Unfortunately it would probably work better with a worse TTS because the Google TTS has some special phrasing for common phrases that changes the time in between words. Also, I am going to work with a linguist to figure out the right kind of mouth openings.
|
{
"pile_set_name": "Pile-CC"
}
|
Microbial population profiles of the microflora associated with pre- and postharvest tomatoes contaminated with Salmonella typhimurium or Salmonella montevideo.
To determine the microflora profiles of pre- and postharvest tomatoes contaminated with Salmonella montevideo or S. typhimurium DT104. Salmonella montevideo or S. typhimurium was inoculated onto the flowers of tomato plants with the microflora of the subsequent fruit examined using a combination of Source Carbon Utilization and 16S rDNA-PCR profiling. From 16S rDNA profiles it was evident that tomatoes derived from Salmonella inoculated plants harboured a different microbial population compared to nontreated controls. The same result was observed for tomatoes inoculated at postharvest and subsequently stored for 14 days at 15 degrees C. From sequencing analysis it was found that tomatoes derived from Salmonella inoculated plants but testing negative for the enteric pathogen, frequently harboured Enterobacter and Bacillus spp. In contrast, both bacterial types were not found associated with tomatoes testing positive for Salmonella. Salmonella introduced onto tomatoes at pre- or postharvest alters the composition of the microbial community. The presence of Enterobacter and Bacillus spp negatively affects the persistence of Salmonella on preharvest tomatoes. Salmonella appears to modify rather than become integrated into the microbial communities associated with tomatoes. Yet, the presence of antagonistic bacteria appears to reduce the persistence of the enteric pathogen.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
Comparator - overloading the operator <
I am trying to use the std::set to contain a struct of three member variables.
struct blah{
int a,b,c;
bool operator < ( const blah& blo ) const{
return ( a < blo.a || (a == blo.a && (b != blo.b || c != blo.c ) ) );
}
};
But I keep getting an error that my operator < is invalid. What is wrong with my approach?
struct blah {
int a,b,c;
blah(int aa,int bb,int cc){ a=aa; b=bb; c=cc; }
bool operator < ( const blah& blo ) const{
return ( a < blo.a
|| (a == blo.a && b < blo.b )
|| (a == blo.a && b == blo.b && c < blo.c )
);
}
};
int main() {
std::set<blah> st;
st.insert(blah(1,2,3));
st.insert(blah(1,1,1));
st.insert(blah(1,3,2));
return 0;
}
After altering the code following @paxdiablo code, this worked well. Thanks y'all!
A:
That code compiles fine for me in the following complete program:
#include <iostream>
struct blah {
int a,b,c;
bool operator < ( const blah& blo ) const{
return ( a < blo.a || (a == blo.a && (b != blo.b || c != blo.c ) ) );
}
};
int main (void) {
blah x, y;
x.a=2; x.b=2; x.c=2;
y.a=2; y.b=2; y.c=2;
if (x < y) std::cout << "x<y\n";
if (y < x) std::cout << "x>y\n";
if (!(y < x) && !(x < y)) std::cout << "x=y\n";
return 0;
}
Changing the fields of x and y outputs different messages.
But I see one major problem with the function. It can tell you that both x < y and y < x, in the situation where the two a fields are identical but the b fields differ between the two. If you set both a fields to 1 and set the b fields to 2 and 1, you see:
x<y
y<x
That's not going to end well :-)
The fact that what you're getting is a debug assertion (something specifically built to catch runtime errors in mostly debug code) leads me to believe that the runtime libraries may explicitly be checking for incorrect operator< overloads by detecting that latter case (ie, both x < y and y < x are true).
You should really fix that because it will cause all sorts of problems with collections where (for example) you need to keep things sorted.
By way of example, let's say you wanted to use a, b and c as keys in that priority. A function to do that would contain something like:
// Check primary key.
if (a < blo.a) return true;
if (a > blo.a) return false;
// Primary key equal here, use secondary key.
if (b < blo.b) return true;
if (b > blo.b) return false;
// Primary and secondary keys equal here, use tertiary key.
return (c < blo.c);
|
{
"pile_set_name": "StackExchange"
}
|
Efficacy of various doses and schedules of second-generation tyrosine kinase inhibitors.
Imatinib is one of the most potent cancer therapeutic agents identified to date. Before the introduction of this tyrosine kinase inhibitor (TKI), 5-year survival in chronic myeloid leukemia (CML) was approximately 40%-60%, but since the introduction of imatinib, overall survival has increased to approximately 90% for patients with chronic-phase disease. However, nearly one fifth of patients are intolerant or resistant to imatinib, resulting in patients with persistent or progressive disease. Recent research has identified a number of additional compounds that more efficiently inhibit the Abl tyrosine kinase and additional kinases that potentially play a role in imatinib resistance. The advent of dasatinib and nilotinib has provided additional options for patients with progressive disease. A number of phase II clinical trials have recently demonstrated that these second-generation TKIs are well tolerated and effective in patients with Philadelphia chromosome-positive (Ph+) leukemias. Recent clinical trial developments raise questions regarding the proper dosage and schedule of these newer agents as well as the timing of their use in the treatment of patients with CML. Additionally, the development of nonoverlapping resistance patterns with sequential drug exposure argues for the possibility of a drug selection scheme that might limit the development of resistant disease. As the era of personalized medicine has begun to take shape in the 21st century, the addition of newer TKIs might facilitate this trend in the treatment of Ph+ leukemias.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Jimmy Lyggett Sr
Jimmy Lyggett (1897, Philadelphia, Pennsylvania – c. 1955, somewhere in US) was an American boxer and boxing trainer.
Boxer
He started boxing at the age of 17. At the age of 20, he won the United States Championship for professional Black boxers. One year later, he boxed with Eddie Palmer and won the match by KO in 19 rounds, taking the title of the champion of the "Colored Championship of the World'.
Lyggett fought with several great boxers during his career.
He boxed against Jack Blackburn on November 25, 1918 in Philadelphia (ND, 6 rounds) and in 1919 with George Robinson, who later two times fought for 'Colored' World middleweight title.
After winning the World Colored Heavyweight Championship, he moved Europe in order to prove himself as the best boxer in the world. He fought several top European boxers , including state champions and vice champions of Germany: Rudolf Arndt, Hans Breitenstraeter, Walter Buckszun, Kurt Prenzel, Adolf Seybold, Rudi Wagener, and Adolf Wiegert, as well as Dane Chic Nelson, and Italian Giuseppe Spalla. He boxed against Max Schmeling twice: the first time on December 26, 1924 in Cologne, losing by TKO in 4th round (disqualification ), and second time, in a rematch in Berlin, on April 3, 1925. The two men drew in 8 rounds. After these fights, he was Schmeling's sparring partner for a period of time.
Boxing trainer
While he lived in Vienna, Austria, he met a woman of Croat descent, Roza, whom he married. The couple moved to Zagreb, Croatia in the 1930s. There, he opened his boxing school in Ilica street.
At the age of 33, he ended his career as boxer.
He trained many young boxers in several boxing clubs in Zagreb, starting with boxing club Croatia, and later with clubs Herkules, Makabi and Radnik.
After a while, he became a friend with a neighboring tavern owner. He gave him his warehouse in Preradovićeva as a training hall.
When the Independent State of Croatia was formed, its Minister of Sports, Miško Zebić talked Lyggett into training the Croatian national boxing team. He prepared the Croatian team for the cancelled 1940 Olympics.
Lyggett was an anti-Communist. Before the end of the war, his brother invited him to return to the US. Finally he accepted the invitation and convinced his wife to move to the US. In 1945, they set off for the US via Italy. They waited for months the ship that would take them to United States. His wife got ill and died in Milan. Broken, Lyggett returned to America alone.
His death place and death date are unclear. Some sources say that he died in US in 1955.
Sources and references
Jutarnji list Marin Penavić: Jimmy Lyggett, crnac na čelu boksačke reprezentacije NDH, Feb 2, 2010, accessed Sep 2, 2010 (pictures of Lyggett)
External links
Boxing Tko je Jimmy Lyggett? – An American Boxer in Zagreb, November 2, 2006
Google Books Peter Benson: Battling Siki: A Tale of Ring Fixes, Race, and Murder in the 1920s
Category:1897 births
Category:1955 deaths
Category:American boxing trainers
Category:Heavyweight boxers
Category:African-American boxers
Category:Sportspeople from Philadelphia
Category:American male boxers
Category:Boxers from Pennsylvania
|
{
"pile_set_name": "Wikipedia (en)"
}
|
# Copyright 2014 Google Inc. All rights reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
#
# RAPPOR simulation library. Contains code for encoding simulated data and
# creating the map used to encode and decode reports.
library(glmnet)
library(parallel) # mclapply
SetOfStrings <- function(num_strings = 100) {
# Generates a set of strings for simulation purposes.
strs <- paste0("V_", as.character(1:num_strings))
strs
}
GetSampleProbs <- function(params) {
# Generate different underlying distributions for simulations purposes.
# Args:
# - params: a list describing the shape of the true distribution:
# c(num_strings, prop_nonzero_strings, decay_type,
# rate_exponetial).
nstrs <- params[[1]]
nonzero <- params[[2]]
decay <- params[[3]]
expo <- params[[4]]
background <- params[[5]]
probs <- rep(0, nstrs)
ind <- floor(nstrs * nonzero)
if (decay == "Linear") {
probs[1:ind] <- (ind:1) / sum(1:ind)
} else if (decay == "Constant") {
probs[1:ind] <- 1 / ind
} else if (decay == "Exponential") {
temp <- seq(0, nonzero, length.out = ind)
temp <- exp(-temp * expo)
temp <- temp + background
temp <- temp / sum(temp)
probs[1:ind] <- temp
} else {
stop('params[[4]] must be in c("Linear", "Exponenential", "Constant")')
}
probs
}
EncodeAll <- function(x, cohorts, map, params, num_cores = 1) {
# Encodes the ground truth into RAPPOR reports.
#
# Args:
# x: Observed strings for each report, Nx1 vector
# cohort: Cohort assignment for each report, Nx1 vector
# map: list of matrices encoding locations of hashes for each
# string, for each cohort
# params: System parameters
#
# Returns:
# RAPPOR reports for each piece of data.
p <- params$p
q <- params$q
f <- params$f
k <- params$k
qstar <- (1 - f / 2) * q + (f / 2) * p
pstar <- (1 - f / 2) * p + (f / 2) * q
candidates <- colnames(map[[1]])
if (!all(x %in% candidates)) {
stop("Some strings are not in the map. set(X) - set(candidates): ",
paste(setdiff(unique(x), candidates), collapse=" "), "\n")
}
bfs <- mapply(function(x, y) y[, x], x, map[cohorts], SIMPLIFY = FALSE,
USE.NAMES = FALSE)
reports <- mclapply(bfs, function(x) {
noise <- sample(0:1, k, replace = TRUE, prob = c(1 - pstar, pstar))
ind <- which(x)
noise[ind] <- sample(0:1, length(ind), replace = TRUE,
prob = c(1 - qstar, qstar))
noise
}, mc.cores = num_cores)
reports
}
CreateMap <- function(strs, params, generate_pos = TRUE, basic = FALSE) {
# Creates a list of 0/1 matrices corresponding to mapping between the strs and
# Bloom filters for each instance of the RAPPOR.
# Ex. for 3 strings, 2 instances, 1 hash function and Bloom filter of size 4,
# the result could look this:
# [[1]]
# 1 0 0 0
# 0 1 0 0
# 0 0 0 1
# [[2]]
# 0 1 0 0
# 0 0 0 1
# 0 0 1 0
#
# Args:
# strs: a vector of strings
# params: a list of parameters in the following format:
# (k, h, m, p, q, f).
# generate_pos: Tells whether to generate an object storing the
# positions of the nonzeros in the matrix
# basic: Tells whether to use basic RAPPOR (only works if h=1).
M <- length(strs)
map_by_cohort <- list()
k <- params$k
h <- params$h
m <- params$m
for (i in 1:m) {
if (basic && (h == 1) && (k == M)) {
ones <- 1:M
} else {
ones <- sample(1:k, M * h, replace = TRUE)
}
cols <- rep(1:M, each = h)
map_by_cohort[[i]] <- sparseMatrix(ones, cols, dims = c(k, M))
colnames(map_by_cohort[[i]]) <- strs
}
all_cohorts_map <- do.call("rBind", map_by_cohort)
if (generate_pos) {
map_pos <- t(apply(all_cohorts_map, 2, function(x) {
ind <- which(x == 1)
n <- length(ind)
if (n < h * m) {
ind <- c(ind, rep(NA, h * m - n))
}
ind
}))
} else {
map_pos <- NULL
}
list(map_by_cohort = map_by_cohort, all_cohorts_map = all_cohorts_map,
map_pos = map_pos)
}
GetSample <- function(N, strs, probs) {
# Sample for the strs population with distribution probs.
sample(strs, N, replace = TRUE, prob = probs)
}
GetTrueBits <- function(samp, map, params) {
# Convert sample generated by GetSample() to Bloom filters where mapping
# is defined in map.
# Output:
# - reports: a matrix of size [num_instances x size] where each row
# represents the number of times each bit in the Bloom filter
# was set for a particular instance.
# Note: reports[, 1] contains the same size for each instance.
N <- length(samp)
k <- params$k
m <- params$m
strs <- colnames(map[[1]])
reports <- matrix(0, m, k + 1)
inst <- sample(1:m, N, replace = TRUE)
for (i in 1:m) {
tab <- table(samp[inst == i])
tab2 <- rep(0, length(strs))
tab2[match(names(tab), strs)] <- tab
counts <- apply(map[[i]], 1, function(x) x * tab2)
# cat(length(tab2), dim(map[[i]]), dim(counts), "\n")
reports[i, ] <- c(sum(tab2), apply(counts, 2, sum))
}
reports
}
GetNoisyBits <- function(truth, params) {
# Applies RAPPOR to the Bloom filters.
# Args:
# - truth: a matrix generated by GetTrueBits().
k <- params$k
p <- params$p
q <- params$q
f <- params$f
rappors <- apply(truth, 1, function(x) {
# The following samples considering 4 cases:
# 1. Signal and we lie on the bit.
# 2. Signal and we tell the truth.
# 3. Noise and we lie.
# 4. Noise and we tell the truth.
# Lies when signal sampled from the binomial distribution.
lied_signal <- rbinom(k, x[-1], f)
# Remaining must be the non-lying bits when signal. Sampled with q.
truth_signal <- x[-1] - lied_signal
# Lies when there is no signal which happens x[1] - x[-1] times.
lied_nosignal <- rbinom(k, x[1] - x[-1], f)
# Trtuh when there's no signal. These are sampled with p.
truth_nosignal <- x[1] - x[-1] - lied_nosignal
# Total lies and sampling lies with 50/50 for either p or q.
lied <- lied_signal + lied_nosignal
lied_p <- rbinom(k, lied, .5)
lied_q <- lied - lied_p
# Generating the report where sampling of either p or q occurs.
rbinom(k, lied_q + truth_signal, q) + rbinom(k, lied_p + truth_nosignal, p)
})
cbind(truth[, 1], t(rappors))
}
GenerateSamples <- function(N = 10^5, params, pop_params, alpha = .05,
prop_missing = 0,
correction = "Bonferroni") {
# Simulate N reports with pop_params describing the population and
# params describing the RAPPOR configuration.
num_strings = pop_params[[1]]
strs <- SetOfStrings(num_strings)
probs <- GetSampleProbs(pop_params)
samp <- GetSample(N, strs, probs)
map <- CreateMap(strs, params)
truth <- GetTrueBits(samp, map$map_by_cohort, params)
rappors <- GetNoisyBits(truth, params)
strs_apprx <- strs
map_apprx <- map$all_cohorts_map
# Remove % of strings to simulate missing variables.
if (prop_missing > 0) {
ind <- which(probs > 0)
removed <- sample(ind, ceiling(prop_missing * length(ind)))
map_apprx <- map$all_cohorts_map[, -removed]
strs_apprx <- strs[-removed]
}
# Randomize the columns.
ind <- sample(1:length(strs_apprx), length(strs_apprx))
map_apprx <- map_apprx[, ind]
strs_apprx <- strs_apprx[ind]
fit <- Decode(rappors, map_apprx, params, alpha = alpha,
correction = correction)
# Add truth column.
fit$fit$Truth <- table(samp)[fit$fit$string]
fit$fit$Truth[is.na(fit$fit$Truth)] <- 0
fit$map <- map$map_by_cohort
fit$truth <- truth
fit$strs <- strs
fit$probs <- probs
fit
}
|
{
"pile_set_name": "Github"
}
|
Modeling the time-intensity profile of solar flare generated particle fluxes in the inner heliosphere.
It is possible to model the time-intensity profile of solar particles expected in space after the occurrence of a significant solar flare on the sun. After the particles are accelerated in the flare process, if conditions are favorable, they may be released into the solar corona and then into space. The heliolongitudinal gradients observed in the inner heliosphere are extremely variable, reflecting the major magnetic structures in the solar corona which extend into space. These magnetic structures control the particle gradients in the inner heliosphere. The most extensive solar particle measurements are those observed by earth-orbiting spacecraft, and forecast and prediction procedures are best for the position of the earth. There is no consensus of how to extend the earth-based models to other locations in space. Local interplanetary conditions and structures exert considerable influence on the time-intensity profiles observed. The interplanetary shock may either reduce or enhance the particle intensity observed at a specific point in space and the observed effects are very dependent on energy.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
"I hit myself in the head to distract myself from the pain when I have a cluster headache. The pain is indescribable hell, and in desperate moments, I have hit my head against a brick wall and hit myself in the head with a cell phone,” says Hilde Vollan (34), a PhD candidate in bioinformatics at the University of Oslo.
Four years and four months ago, her life turned upside down when she started getting cluster headaches. Her life has been transformed – once, she was an active student with many friends, but she now lives a life in the dark at home with her parents. She has two to five cluster headaches every day, and also suffers
from migraine and tension headaches. If she dares to go out for a walk, she always brings someone who can support her, and a bag of pills – including an oxygen bottle, a mask to breathe with and migraine medicines she takes by injection. Her attacks can come in the middle of the street or inside a store.
“For years, I have tried to hide when the pain takes over, because people are scared and shocked to see me suffer such pain. But I've stopped hiding now. It's not my fault that I get such bad headaches,” says Vollan.
Now, Vollan will participate in a pilot study at the Norwegian University of Science and Technology (NTNU) where she will help in the testing of a new treatment.
MEN MORE SUSCEPTIBLE THAN WOMEN
“We also call this a suicide headache, because many sufferers become suicidal,” says NTNU senior consultant and researcher Erling Tronvik.
“This is the most extreme form of a headache, and the intensity of the pain is worse than what migraine patients experience. I've had patients tell me that they bang their head against the wall because of the pain. Others say that they put their thumb in a pair of pincers while they pull with all their might, all in a desperate attempt to deflect the intense pain,” says Tronvik, who is also affiliated with the Norwegian National Headache Centre at St. Olavs Hospital in Trondheim.
Unlike migraines, which mostly afflict women, cluster headaches mainly occur in men. About 5000 Norwegians suffer from cluster headaches. Some have daily seizures for a few months each year, while others have attacks several times a day, every day of the year.
CRIPPLED BY PAIN
“People who get these headaches daily are crippled by the pain. It’s an extremely challenging disease for both doctors and patients,” Tronvik says.
Until now, it has been difficult to help these patients. Scientists do not know why some people get cluster headaches. A number of patients have found relief from injections of migraine medicine and the use of oxygen, but this treatment does not help most sufferers. The illness leaves patients with a tremendous sense of helplessness.
But now Tronvik, in collaboration with physician Daniel Bratbak at St. Olavs Hospital and Professor Ståle Nordgård at NTNU, has come up with an entirely new treatment. The gear they have developed looks a pistol with a very thin barrel, just the thickness of a knitting needle. The barrel is inserted up through
the nose of the patient, and by passing through a natural hole in the nasal wall, the mouth of the barrel comes to a bundle of nerves behind the sinuses.
The surgeon pulls the trigger of the pistol, which shoots a dose of Botox to the area around the
nerve bundle. The whole process takes about a half-an-hour.
IN SEARCH OF PATIENTS
“Botox is a neurotoxin that stops the flow of impulses along the nerves. In theory, the connection
between the two nerves in the bundle is reduced or eliminated. The effect lasts from three to eight months. Then the patient has to get another injection. We designed the equipment ourselves, and
Botox has never been used for this anywhere else,” says Tronvik.
The researchers strongly believe in their treatment method, in part because a new study unrelated
to their work has shown an effect by using an electric current to paralyse the nerve
bundle.
“But that approach requires a lengthy operation,” Tronvik says. Now he’s in search of ten patients for a pilot study.
If the method proves to be effective, the researchers will extend the experiment to include 30 to 40 cluster headache patients and approximately 80 migraine patients. The treatment uses an MRI of the patient’s
head to make certain that the surgeon knows exactly where the nerve bundle is. A navigation tool, composed of three small spheres on the pistol, and a plate with three spheres mounted on the patient's head, enables the surgeon to find the nerve bundle using the MRI image.
TESTED ON TWO PATIENTS
“A computer sends light signals to all the spheres to form precise points. We don’t miss, but anyone who wants to participate in the study must accept the risk that it could happen, because this has never been done before. If the Botox hits an area near the nerve bundle, it could cause temporary double vision, or weaken the ability of the patient to chew. But with the use of the MRI and our navigation tools we can hit
the nerve bundle without any problem. We hope that this treatment method can help give patients a life without such great pain,” says Tronvik.
|
{
"pile_set_name": "OpenWebText2"
}
|
Tooth Color as a Predictor of Oral Health-Related Quality of Life in Young Adults.
Smiling plays an important role in social interaction. The purpose of this research was to explore the extent to which objective parameters of color of one's own teeth affected the social and emotional dimensions of young adults' lives. The sample included 134 subjects-students of the University of Rijeka, Croatia (65% female) aged 19 to 28 years (median 21). All subjects had six intact maxillary anterior teeth without restorations or severe malocclusions and healthy gingiva with no signs of inflammation. Tooth color was assessed intraorally using a spectrophotometer. Lightness, chroma, and translucency of the right maxillary central incisors (the reference teeth) were calculated and used for analysis. Subjects reported dimensions of their oral health-related quality of life (OHRQoL) using the Oral Health Impact Profile (OHIP), Orofacial Esthetic Scale (OES), and the Psychosocial Impact of Dental Aesthetics Questionnaire (PIDAQ). Linear relationships between elements of tooth color and OHRQoL were explored using Pearson correlations. Multiple linear regression, while controlling for the influence of age and gender, was also calculated. ANOVA with a Tukey post hoc test was employed to test whether nonlinear relationships existed between OHRQoL and categories of color elements. Dental self-confidence, esthetic concerns, orofacial appearance, social impact and psychological impact were not related to lightness, chroma, or translucency of the subjects' teeth. Neither linear nor nonlinear relationships were detected between those aspects. Satisfaction with smile esthetics was only related to translucency where subjects with moderate translucency were least likely to be satisfied (p = 0.033). Women tended to report greater psychosocial impacts than men (p < 0.05), regardless of their tooth color. According to the results of this study objective, measurable, quantitative parameters of tooth color did not accurately predict psychosocial dimensions of OHRQoL in dentate young adults.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The present invention relates to detection of subsoil contaminants including chlorinated hydrocarbons. More specifically, but without limitation thereto, the present invention relates to a fiber optic probe for detecting Raman emissions that may be used with a cone penetrometer.
Raman spectroscopy is an emission technique that uses scattering of incident optical energy to produce spectral peaks that are frequency shifted from the incident optical energy. These so-called Raman emissions are believed to arise from changes in molecule polarization. Virtually all organic molecules display a characteristic Raman emission. The inherently high resolution of Raman spectra often permits the analysis of several chemicals present together in a mixture. This technique is particularly applicable to detecting chlorinated hydrocarbons that frequently contaminate subsoil around aquafers. Cone penetrometers have been used with a variety of probe designs to detect these contaminants.
The advent of inexpensive, portable Raman spectrometers has gained renewed interest in the area of Raman spectrometry. These spectrometers offer a minimum of components compared to conventional instrumentation and provide high light throughputs.
Despite the advantages of Raman spectroscopy and the technological advances, there are additional issues that must be resolved to realize a practical fiber optic Raman sensor (FORS), such as low sensitivity and interference from Raman emissions in the optical fibers.
A need therefore exists for a fiber optic Raman sensor that suppresses interference from the optical fibers, is operable with optical fiber lengths in excess of 30 meters, has high sensitivity, and is rugged enough to be deployed in a cone penetrometer.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Germany’s new government has vowed to become a “grand coalition for the little people”, as Angela Merkel’s conservatives and her two coalition partners embark on a precarious project of reforming Europe while nodding to the language and concerns of the far-right.
Merkel, who is due to be sworn in for her fourth term as chancellor on Wednesday, almost six months after national elections last September, said on Monday that her new government would focus on “the integration of refugees, but also on the state’s ability to act when people have not been granted right of residence”.
“We have all enjoyed the benefits of the Schengen area, allowing us to move freely,” Merkel said at a joint press conference with her new vice-chancellor and finance minister, the Social Democrat (SPD) Olaf Scholz, and her interior minister, Horst Seehofer of the Bavarian-based Christian Social Union (CSU).
“But when we introduced free movement, we did not sufficiently think about securing our outer borders. That has to happen now, as well as a development policy that tackles the causes of migration,” she added.
Facebook Twitter Pinterest Andrea Nahles of the SPD toasts the grand coalition with Angela Merkel. Photograph: Michele Tantussi/Getty Images
On Sunday, Seehofer laid down his government’s law-and-order credentials by pushing for more video surveillance in public areas and faster deportations of rejected asylum seekers.
Wednesday’s swearing-in of the new government will put an official end to the longest period of coalition-building in Germany’s postwar history.
An aborted attempt to forge an unorthodox “Jamaica” coalition between Merkel’s CDU, the pro-business FDP and the Green party last November resulted in a revival of the “grand coalition” between centre-right and centre-left that has governed the country for the last four years, eventually approved by a vote of the SPD’s membership at the start of this month.
On Monday, Merkel nonetheless insisted that plans to present joint European initiatives with the French president, Emmanuel Macron, in March remained on schedule, in spite of her ponderous path to power.
“I never said anything about a delay,” said Merkel, announcing that she would visit Paris shortly after her inauguration. “We certainly won’t have settled every last question, but we’ll be able to say more than in December. It surely would be too much to expect us to spell out every facet of the eurozone for the next 20 years.”
Merkel said the Franco-German tandem had been galvanised into action by the US president Donald Trump’s plans to introduce 25% tariffs on steel imports.
Referring to the threat of a pending trade war, Scholz said: “In an ever more complex world, it is absolutely necessary that Europeans stick together and develop solutions and methods to take control of shaping their future.”
Facebook Twitter Pinterest The party leaders pose with copies of their coalition agreement. Photograph: Sean Gallup/Getty Images
Scholz, the SPD caretaker leader and a former mayor of Hamburg, signalled that his party would foster more combative relations with its coalition partner, remarking that “the fourth grand coalition in German history did not start out as a love match”. Merkel said she was looking forward to a “good debating culture” within her cabinet.
Both parties go into government on the back of historically poor election results last September, and the SPD’s polling figures have nosedived after its leadership made a U-turn on an announcement to seek renewal in opposition.
Yet Scholz can embark on his new ministerial portfolio with his party on a high after successive polls over the weekend appeared to reward the SPD for going into government. A survey on Sunday by the polling institute Insa saw the far-right Alternative für Deutschland drop into fourth place behind Merkel’s Christian Democratic Union, the SPD and the Green party.
The new government will start with the same constellation of political parties but a reshuffled lineup of personnel. The CDU has ceded control of the finance ministry to the SPD and of the interior ministry to the CSU. Merkel and the defence minister, Ursula von der Leyen, will be the only politicians to retain the roles they held over the last four years.
|
{
"pile_set_name": "OpenWebText2"
}
|
How Justice League Should Have Ended
How Justice League Should Have Ended
Possibly our most anticipated episode next to the massive character juggernaut that undoubtedly will be Infinity War. Before Justice League was in theaters we had geared ourselves up to experience the final chapter in the Controversial Dark Snyder DC Trilogy, full of themes about responsibility, temptations of power, gods vs humans type stuff. It was going to be this awesome bow on the end of the Justice League hype train and we were gonna have our work cut out for us for sure. Then the film came out and it was just… meh. Like play it safe, change everything we’ve established Meh. So the question was… Well what do we do with this?! After a LOT of discussion. We decided to break the fourth wall in a sense and give our artistic expression of what the Justice League has become while also keeping true to keeping things HISHE. Enter the Mighty Martha. Since Justice League is the finale (pretending to be just the beginning) of this trilogy. We decided it was time for our easter egg threat that is Martha to finally enter the scene. DC’s greatest foe. A character that represents everything the DCU now has to put up with. A character who came from another universe and who is set on making sure the Justice League doesn’t have a place to stay. So where is the one place you can find the League with their guard down? The Super Cafe. It was not easy to make and took way longer than was intended. But I really enjoyed getting to open up our cafe in a direction we’ve never gone before. I hope you enjoy the episode!
The film was announced in October 2014, with Snyder on board to direct and Terrio attached to write the script. Initially titled Justice League Part One, with a second part to follow in 2019, the second film was indefinitely delayed to accommodate a standalone Batman film with Affleck. Principal photography commenced in April 2016 and ended in October 2016. Snyder then hired Joss Whedon to write scenes that would be filmed during reshoots; however, Snyder left the project in May 2017 following the death of his daughter. Whedon was hired to oversee the remainder of post-production, including directing additional scenes written by himself. Snyder received sole director credit for the film, while Whedon received a screenwriting credit.
With an estimated production budget of $300 million, Justice League is one of the most expensive films ever made. It premiered in Beijing on October 26, 2017, and was released in the United States in 2D, 3D, and IMAX on November 17, 2017. The film underperformed at the box office, grossing just $657 million worldwide against its massive budget, making it the lowest of the DCEU[3] . It received mixed reviews from critics; the action sequences, visual effects, and performances (particularly Gadot and Miller) were praised, while the plot, writing, pacing, villain, and overuse of CGI were criticized. The film’s tone was met with a polarized reception, with some appreciating the lighter tone compared to previous DC films, while others found it inconsistent
|
{
"pile_set_name": "Pile-CC"
}
|
Comparison of muscle-sparing thoracotomy and thoracoscopic ligation for the treatment of patent ductus arteriosus.
We reviewed our experience with the treatment of patent ductus arteriosus (PDA), and compared two therapeutic techniques; muscle-sparing thoracotomy (MST) and thoracoscopic PDA ligation (TPDAL). We reviewed the clinical records and operative reports of 19 nonnewborn patients who were treated at our institution for PDA. Eleven patients underwent TPDAL and eight patients MST. The TPDAL patients underwent thoracoscopic clipping (ligation) of the PDA, whereas the MST group had a complete division of the ductus. A two-tailed Student's t test was used to calculate the 95% confidence intervals for length of operation, number of doses of intravenous narcotics and hospital stay. Costs were also compared. All patients underwent diagnostic echocardiography in the evaluation of an asymptomatic murmur. Both groups were similar in age (average, 4 years) and gender. All procedures were performed electively. Two thoracoscopic attempts were aborted, one for bleeding and the other for inadequate clip size. The length of the procedure averaged 1.3 hours +/- 0.330 SD for TPDAL versus 1.4 hours +/- 0.335 SD for MST. Five of the nine successful TPDAL patients were admitted to the Pediatric Intensive Care Unit (PICU) with an average length of stay of 20 hours, and two of eight MST patients stayed in the PICU for average of 18 hours. All patients were extubated after the procedure. Chest tubes were placed in two TPDAL patients and three MST patients. However, two patients who underwent TPDAL required tube thoracostomy for persistent postoperative pneumothorax. Average number of intravenous narcotics administered for the TPDAL was 1.2 doses per patient and for MST, 1.75 doses per patient. Mean hospital stay for TPDAL was 1.33 +/- 0.71 SD days and for MST 1.8 +/- 0.83 SD days. Ninety-five percent (95%) confidence intervals for the difference in means demonstrated no difference between the two groups for length of operation, hospital stay, or number of doses of intravenous narcotics administered. The authors were unable to identify any benefit to thoracoscopic patent ductus arteriosus ligation versus muscle-sparing thoracotomy in terms of hospital stay, length of operation, or morbidity. Additionally, with MST there is a complete division of the PDA theoretically decreasing the risk of recurrence in comparison with clip ligation.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Nel mio ultimo articolo su questo giornale avevo notato che i programmi elettorali dei vari partiti sono spesso vaghi e pieni di incoerenze. Ciononostante, è possibile individuare differenze di visione economica in tali programmi. Vediamo quali sono queste differenze focalizzandoci, in particolare, sugli obiettivi di finanza pubblica.
In un articolo pubblicato su questo giornale il 19 dicembre, avevo invitato i partiti a chiarire tali obiettivi (deficit, avanzo primario, debito pubblico) anno per anno per il prossimo quinquennio. Quattro partiti hanno risposto: in ordine temporale, Più Europa, Forza Italia, Lega e Liberi e Uguali. Il Pd non ha risposto ma ha comunque pubblicato un piano di rientro dal debito che contiene informazioni utili per valutare come questo partito gestirebbe i conti pubblici nei prossimi anni.
Il Movimento 5 Stelle ha inizialmente indicato che avrebbe risposto ma alla fine non è arrivato nulla, se non la conferma dell’obiettivo di ridurre il rapporto tra debito pubblico e Pil di 40 punti percentuali in dieci anni. Fratelli d’Italia non ha risposto.
I quadri di finanza pubblica pubblicati hanno elementi in comune. Tutti prevedono una riduzione del debito pubblico rispetto al Pil. In tutti i quadri questa riduzione è facilitata, ottimisticamente, da un aumento dell’inflazione (più inflazione vuol dire più Pil): sono anni che attendiamo una ripresa dell’inflazione. Tutti i quadri sottostimano la dinamica del debito: i partiti si sono dimenticati che, nei prossimi anni, il debito dovrebbe crescere più rapidamente di quanto giustificato dal deficit pubblico (e da eventuali flussi di privatizzazioni) per una serie di motivi (per esempio il deficit non include le spese per i contratti derivati). Non è un dettaglio da poco: nei prossimi tre anni questa discrepanza equivale a 55 miliardi (tre per cento del Pil).
Ma ci sono anche importanti differenze, soprattutto per quanto riguarda l’orientamento, più o meno espansivo, della finanza pubblica. A un estremo c’è la Lega che sottoscrive in pieno la tesi per cui occorre prendere a prestito più soldi per ridurre il debito (rispetto al Pil). L’avanzo primario (la differenza tra entrate e spese al netto degli interessi sul debito, il principale indicatore dell’orientamento più o meno espansivo della politica fiscale), stimato all’1,7 per cento del Pil nel 2017, verrebbe quasi azzerato nel giro di due anni e resterebbe basso negli anni seguenti. Le regole europee verrebbero violate in modo palese (con un deficit al di sopra del 3 per cento). Questo, secondo la Lega, farebbe ripartire l’economia e il rapporto tra debito e Pil scenderebbe. Anche prendendo per buona questa previsione, il debito scenderebbe meno che nei quadri presentati dagli altri partiti (11 punti percentuali di Pil). All’estremo opposto, c’è Più Europa che propone di aumentare l’avanzo primario al 5,2 per cento del Pil entro il 2022, in pieno rispetto delle regole europee e con un calo del debito di ben 23 punti percentuali. Gli altri stanno tra questi due estremi. Più vicino al rispetto delle regole europee, è il quadro di Forza Italia, con un avanzo primario che arriva al 4 per cento, nel contesto però di un tasso di crescita del Pil molto più elevato di quello di più Europa (un bel 2 per cento contro un prudente 1 per cento): insomma, si arriva a risultati non troppo distanti da quelli di Più Europa, ma sperando che la maggiore crescita faccia aumentare le entrate pubbliche. Non troppo distante sta Liberi e Uguali con un avanzo primario del 3,6 per cento nel 2022. Qui però l’aiutino del Pil è ancora più forte: si raggiunge una crescita di quasi il 2 e mezzo per cento al 2022. Quel che propone il Pd è invece lo status quo: l’avanzo primario resterebbe fermo al 2 per cento per i prossimi cinque anni (anzi per i prossimi dieci), come è rimasto fermo su questi livelli nei passati cinque anni. Il debito scenderebbe di 13 punti percentuali nel quinquennio essenzialmente perché l’inflazione farebbe accelerare il Pil. E il Movimento5 Stelle? Come ho detto, non hanno inviato un quadro completo di obiettivi, ma hanno espresso in varie sedi l’intenzione di aumentare il deficit e quindi di ridurre l’avanzo primario rispetto ai livelli correnti. Questo sarebbe compatibile con una riduzione del debito di 40 punti percentuali di Pil in 10 anni, il loro obiettivo, solo se il Pil crescesse di almeno 5 punti percentuali all’anno in termini reali, ritmi quasi cinesi.
Queste differenze non sono irrilevanti anche perché hanno diverse implicazioni per il dialogo con l’Europa. Un conto è presentarsi agli elettori con obiettivi in linea con le regole europee, come fa Più Europa (lo farebbe anche Forza Italia salvo che le generose promesse elettorali di questo partito, senza adeguate coperture, non sembrano coerenti con gli obiettivi di avanzo primario). Un altro conto è presentarsi con obiettivi che sfidano palesemente le regole europee, come la Lega, o che comunque non sono in regola con queste, come fanno tutti gli altri. Si dirà che l’elettore medio non si legge le tabelle con l’avanzo primario. Ma i sopra citati numeri sono del tutto in linea con la retorica seguita negli ultimi anni dai vari partiti nei dibattiti sull’austerità e sul rispetto delle regole europee. Essi riflettono diverse visioni del modo in cui funziona l’economia e delle priorità e dei rischi che la nostra economia fronteggia. Sta all’elettore scegliere quale visione preferire.
|
{
"pile_set_name": "OpenWebText2"
}
|
By Kim Jae-heun
Celebrities from around the world were in attendance as fashion mogul Karl Lagerfeld presented his first Chanel Cruise collection at the Dongdaemun Design Plaza (DDP), Monday.
Lagerfeld, head designer of Chanel, said that he loves traditional Korean clothes, “hanbok,” material and patterns.
“The concept is a modern, international version of a typical Korean mood, how we see it for the modern 21st century but with inspiration from the past,” Lagerfeld said.
The top designer’s Seoul show, brought a host of K-pop stars, such as CL and G-Dragon, as well as international celebrities, including Tilda Swinton, Kristen Stewart, Gisele Bundchen and Barbara Palvin.
The event was the second Cruise collection the French fashion house held in Asia after hosting one in Singapore in 2013.
The Cruise collection, or resort collection, began as an event to offer ready-to-wear clothing for wealthy consumers traveling on cruises during the winter season. Luxury fashion labels now open the event annually, including Chanel’s in May. They have become a barometer to see brands’ future trends for spring and summer lines.
The Chanel 2015/16 Cruise collection in Seoul was a show full of energy. Karl Lagerfeld, Chanel’s head designer and creative director, melted bright colors like fuchsia pink, coral vivid orange and violet into the brand’s signature woven tweeds and textured cotton. He used light and diaphanous fabrics such as linen, organza, tulle, lace and shantung – a type of raw silk that the brand’s founder Mademoiselle Chanel often favored. Lagerfeld completed the pieces with ethereal and geometric patchworks and multi-colored stripes combined with delicate floral embroidery.
The top designer took inspiration from the Korean traditional dress “Hanbok” combining Asian sophistication and a contemporary spirit. Jackets had large sleeves and rounded shoulders while the original costume’s flat or folded collars were hidden. Lagerfeld cut the trousers wide and short, with skirts straight or pencil-shape just below the knee.
“I was impressed by his design of saekdong-jeogori (the Korean traditional jacket with sleeves of multicolored stripes) and the idea to graft origami as garments,” said Jung Ryeo-won, a Korean actress.
Some 1,000 VIPs including press and celebrities from around the world participated at the event.
British actress and fashion muse Tilda Swinton made her second visit to Korea, which she called her second home.
“Korea is full of friends for me,” said Swinton before the event began. “I am very curious about whites and colors. I am looking forward to seeing the show.”
Soo Joo, a Korean fashion model for Chanel, expressed her delight to perform the show in her home country.
“I have been working with Channel for two years and I am more than happy to show the modern and traditional side of Seoul,” Soo Joo said. Lagerfeld picked her as the Chanel muse representing Asia at the fashion show.
World renowned model Gisele Bunchen visiting Korea for the first time and Namie Amuro attended the show. American actress Kristen Stewart from “The Twilight Saga” film series was presented as a face of Chanel, while 21-year old Hungarian model Barbara Palvin was also in attendance.
Chanel model Jade de Lavareille of IMG models, said the Cruise collection as one of the best events she had ever taken part in.
“I started modeling two years ago and it is my second time with Chanel since a show at Brasseries Gabrielle in Paris, last March,” Lavereille said. “Coming to Korea on the other side of the world is such a different culture from what I am used to. People are nice and the places look so beautiful.
“I was really excited to model at the show because the clothes were so beautiful. I loved the colors and texture. It looked amazing in set and overall matched perfectly,” Lavereille said.
|
{
"pile_set_name": "OpenWebText2"
}
|
75+ Free Retina Display iPhone Wallpapers
Last Updated onApril 14, 2020
With a 960×640 pixel resolution, the “Retina Display” is begging to showcase beautiful wallpapers. The iPhone 4 Retina display uses technology called IPS (in-plane switching) — the same technology used in the Apple LED Cinema Display and iPad — to achieve a wider viewing angle than on typical LCDs. In this article we have compiled a large showcase of stunning Iphone 4 Wallpapers. Spice thing up a little, enjoy!
Check out our previous articles!
We hope you enjoyed this showcase! We would love to hear your opinion/feedback, so please don’t hesitate to comment below. For more inspirational articles don’t forget to subscribe to the RSS-feed and follow Inspirationfeed on Twitter, Google+ and Facebook! If you enjoyed the following article we humbly ask you to comment, and help us spread the word!
|
{
"pile_set_name": "Pile-CC"
}
|
[Experimental study of miRNA200a regulating Wnt/β-catenin signaling pathway in silica-induced mouse lung epithelial cells].
Objective: To observe the effect of overexpression of miRNA200a (miR-200a) recombinant lentivirus on the expression of Wnt/β-catenin signaling pathway in mouse lung epithelial cell line MLE-12 induced by silica (SiO(2)) . Methods: The mice were divided into SiO(2) control group (SiO(2)) , virus control group (SiO(2)+Lv-NC) group and overexpressing miR-200a virus group (SiO(2)+Lv-miR-200a). The expression of β-catenin, MMP2, MMP9, TCF-4 and Cyclin D1 mRNA and protein were detected by realtime-PCR and western blot after incubating cells for 18 h stimulating at the final concentration of 200 μg/ml of SiO(2). Results: The expression of miR-200a in MLE-12 cells of SiO(2)+Lv-miR-200 a group was significantly higher than that in SiO(2) group and SiO(2)+Lv-NC group. The mRNA and protein expression of β-catenin, MMP2, MMP9, TCF-4 and Cyclin D1 in MLE-12 cells of SiO(2)+Lv-miR-200a group were significantly lower than those in SiO(2) group and SiO(2)+Lv-NC group (P<0.05) . Conclusion: Overexpression of miR-200a can inhibit the expression of related genes of Wnt/β-catenin signaling pathway in silica-induced mouse lung epithelial cells.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
"Want something fun/quirky and younger vibe: Check out State Park (fun food options, killer cocktails), The Cambridge Brewing Company (best craft beer pub around), or Meadhall (great food, 100 taps of beer) If you're just looking for something fun, quick, cheap: Check out Emma's Pizza, The Friendly Toast, All Star Pizza Bar/Sandwich Bar (more Inman Square, but not far and great food, Inman is a must know neighborhood for MIT kids as well" See More
|
{
"pile_set_name": "Pile-CC"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.