text
stringlengths 1
3.78M
| meta
dict |
|---|---|
Jewish Dating in Pacific, WA
The Evergreen State of Washington. Match.com is an online dating service for Washington singles. Match.com has been the leading online dating site for over 10 years. To laugh often and love much... to appreciate beauty, to find love in Pacific... this is the Match.com way.
|
{
"pile_set_name": "Pile-CC"
}
|
Last weekend, President Trump slammed US Representative Elijah Cummings’s Baltimore district as a “disgusting, rat and rodent infested mess.” Today, a new study from RentHop shows that, as faithful Washingtonian readers know, the District is actually the rattier city. Here’s how the two municipalities compare:
Total number of rat complaints
Loser: DC
The study counted the number of rat complaints filed in 2017 and 2018 in five cities: DC, Baltimore, Chicago, Boston and New York. In 2018, DC had a whopping total of 5,715 complaints to Baltimore’s 4,476. Though both are certainly ratty, they’ve got nothing on Chicago–official rat capital of the US–which touts a staggering 40,057 complaints.
Rat complaints per square mile
Loser: DC
Controlling for the range of territory in each of the rat kingdoms, the study divided the total number of rat complaints by total square mileage to calculate each city’s relative rat density (ew). While Baltimore has a disturbing 48.5 rat complaints per square mile, Washingtonians are twice as likely to encounter a rogue rodent, coming in with 83.6 rats per square mile.
Overall rat growth
Loser: DC
DC doesn’t have the sheer number or concentration of rats compared to Chicago or New York City. But while rat complaints are decreasing in those two cities, DC’s number of rodent sightings have increased. Complaints rose 50 percent from 2016 to 2017 and another 7.6 percent from 2017 to 2018. Considering that the pace of rat copulation makes bunnies look like Doris Day, this could grow to become an even bigger public health issue in the coming years. In comparison, Baltimore’s rodent complaints have steadily dropped over the past four years, with a 47 percent drop from 2015 to 2018.
Rats as a symbol of inequality
Loser: Baltimore
In a city with such a gross income inequality, there’s a Schadenfreude in knowing even the most loaded of K Street lobbyists isn’t safe from rat invasion. By plotting rat concentration levels compared to average area rent, the study found there was no correlation between rent prices and number of rats in DC. This can be easily confirmed by taking a late-night stroll around Dupont Circle. While Dupont is definitely still a rat hotspot, the study found the highest concentration of rats took refuge in the Columbia Heights and Mount Pleasant neighborhoods. In comparison, Baltimore had a distinct negative correlation between average rent and number of rodent complaints, meaning poorer neighborhoods were more likely to experience rat infestations.
Trump’s nabe v. Cummings’s nabe
Loser: Baltimore
Though his city as a whole is faring far better than Trump’s, Cummings’s Druid Heights neighborhood recorded just 13 rodent complaints in 2018, as opposed to 132 complaints in downtown DC. But Druid Hill’s small size means it had an average of 271.8 complaints per square mile in comparison to the White House’s neighborhood, which had 71.4 complaints per square mile.
Don’t Miss Another Big Story—Get Our Weekend Newsletter Our most popular stories of the week, sent every Saturday. Or, see all of our newsletters. By signing up, you agree to our terms
Join the conversation!
|
{
"pile_set_name": "OpenWebText2"
}
|
Rupert Murdoch, the 81-year-old chief executive of News Corp., has been told by a select committee of the British parliament that he is “unfit” to head his global media conglomerate.
It is a particularly British accusation and one that is especially punishing, both because it is so indelible and is so seldom used.
“Unfit” is not a charge that is often leveled, so its impact is especially great. In 1971 a publishing rival of Murdoch’s, Robert Maxwell, was indicted as being “unfit” to run a public company. His were sins of greed and venality.
Murdoch’s sins, you might say, are sins of encouraging a culture of corruption in two of his London-based tabloid newspapers: the defunct News of the World and The Sun. It should be said that Murdoch did not invent the culture of Britain’s tabloid press, but he encouraged it to lengths of excess that had not been dreamed of earlier.
Fleet Street — the collective name for British newspapers which derives from the street where they were once all located — has always been a place of excess. But things really turned white hot in the late 1950s and 1960s.
Television and radio were competing for entertainment value, but news was still the province of newspapers. The game was to shock the readers without depressing them. The publisher Lord Beaverbrook said during World War II of his Daily Express: “I want the readers to feel the sun is shining when they read the Express.”
When I arrived in Fleet Street, well after the war, the sun was still shining in the popular papers. And what better way to keep the sun shining than by exposing the foibles of the aristocracy, the Royal Family and, of course, film stars?
We, the denizens of Fleet Street, were modestly paid but were given essentially unlimited expense accounts to disport ourselves around the clubs and restaurants of London in search of the rich and famous at unguarded play. The culture was one of discover, speculate, elaborate and publish.
Reporters were pushed very hard to dig up the titillating, embellish it and present it as news. We descended on crime scenes, the sexually engaged and the overtly greedy.
Yet there were limits, unwritten but understood, especially pertaining to private grief and even the Royal Family. Infidelity from a vicar was reportable. Similarly rumored goings on by major politicians and national figures, less so.
But change was on its way in the shape of Rupert Murdoch, and in the growing force of television in British life. Murdoch trashed the barriers, such as they were. He started publishing pictures of bare-breasted girls in The Sun, and turned his tabloids from being newspapers that published gossip along with the news to gossip-only papers. They became vicious as well as tawdry.
Murdoch also turned his papers from leaning politically left-wing to being savagely right-wing. It worked.
The Sun and the News of the World started making enough money to finance Murdoch’s other ventures, including buying and building Fox News.
Murdoch established an even more irresponsible culture. There were no rules now: Hence the phone-tapping, police bribing and other sins that have brought Murdoch to his sorry state of being “unfit.” There was a new thuggery and vulgarity that had not existed.
Yet if Murdoch is unfit, so are his accusers. It is British politicians — including Margaret Thatcher, Tony Blair and David Cameron and their followers — who indulged Murdoch, courted him and encouraged the arrogance of Fleet Street.
British newspaper publishers have always considered it their right to have access to the prime minister and no holder of that office has sought to disillusion them. – For the Hearst-New York Times Syndicate
White House Chronicle on Social
There is disquiet in the soul of America. It has been expressed night after night on the streets of more than 100 towns and cities. That number of urban sites, with all those tens of thousands of people, are a cry from the hurting heart of America — yes, over the death of George Floyd, […]
A plow breaks up the soil, turns it over. If seed is put down, that sprouts along with any other seed that happens to be there, weeds and other wild plants. The new normal will be a plowed field where all sorts of innovations will spring forth. It will be a time of innovation, creativity […]
Snapshots. That’s what we have of the United States as we emerge tentative and fraught from lockdown. We don’t have the whole picture, just snapshots of this and that. Some of the snapshots are encouraging: The air is clearer, crime is down and a collective spirit is apparent in many places. Others are more disturbing: […]
A study envisioning how societies might address the complexities of the COVID-19 pandemic, undertaken by more than 70 leaders in innovation from around the world, is out. It is the largest, nongovernmental study on the virus, and it paints a picture of a world recalibrated by it — with a heavy dependence on data in […]
|
{
"pile_set_name": "Pile-CC"
}
|
Eutane nivea
Eutane nivea is a moth of the subfamily Arctiinae. It was described by George Hampson in 1905. It is known from Borneo. The habitat consists of lowland forests, including coastal and swamp forests.
Adults are satiny white, the forewings with a black discal dot.
References
Category:Lithosiini
Category:Moths described in 1905
|
{
"pile_set_name": "Wikipedia (en)"
}
|
The development of immunological relationship between mother and fetus under physiological and pathological conditions.
On the basis of results of our research and review of literature, the complex of immuno logical influences, operating during the development of the human fetus, were evaluated. It is obvious that during the early stages of pregnancy the conceptus is protected by non-specific mechanisms, i.e. hormonally (HCG, progesterone) and by certain properties of the trophoblast (barrier function, immunologically inert surface). Specific immunological tolerance is formed by gradual penetration of trophoblast particles and later by penetration of fetal blood cells into maternal circulation. Thus a specific suppression of maternal T lymphocytes against fetal antigens develops, other immunological functions being intact. - Following a strong antigenic stimulus (e.g. Rh-D), isoimmunization of the mother and serious risk for the fetus occur. Immunological causes of abortion could not be unequivocally proved in recurrent abortions. The explanation of the origin of EPH-gestosis on the basis of toxic action of immunocomplexes is highly probable, however the laboratory and experimental proof is still lacking.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
2505 Hidden MeaBallwin MO 63021
322 Fox Hollow Ballwin MO 63021
269 Treasure CoBallwin MO 63021
Property History Of 608 Wood Fern Drive
Date
Event & Source
Price
May 26, 2017
Listed (Active) MLS: 17041796
$659,000
The information is being provided by Mid America Regional Information Systems MLS. Information deemed reliable but not guaranteed. Information is provided for consumers' personal, non-commercial use, and may not be used for any purpose other than the identification of potential properties for purchase. Copyright 2017 Mid America Regional Information Systems MLS. All Rights Reserved.
IDX information is provided exclusively for consumers' personal, non-commercial use that it may not be used for any purpose other than to identify prospective properties consumers may be interested in purchasing, and that data is deemed reliable but is not guaranteed accurate by the MLS. The MLS may, at its discretion, require use of other disclaimers as necessary to protect Participants and/or the MLS from liability.
|
{
"pile_set_name": "Pile-CC"
}
|
Santorini is probably the most famous and
most popular Greek island, because of its
beautiful scenery, primarily, dramatically
perched on the edge of a volcano overlooking
a beautiful bay.
It's also famous for its mules.
So what are these mules doing in a resort
island like this?
Santorini seems like a pretty modern and expensive
place.
So why are there mules walking around, right
through the middle of town?
Well, it's no great surprise, or secret.
You savvy viewers probably already know, the
mules are here to bring tourists from the
water up to the village.
Mules have a long history of working for the
people of Santorini, well before there was
ever any tourists here.
They've always been an important part of the
human occupation of the island because that's
how goods and people got around, probably
for thousands of years.
Most visitors to Santorini arrive by ship
and they face the challenge of getting up
the hill to the village up above.
You've got three choices: take the cable car,
ride a mule, or walk.
If you choose to walk up the 600 steps, that's
going to take over an hour and it might be
a little smelly, and it's exhausting.
So let's take the mule.
There are some ethical issues to consider
about riding the mules.
Many animal rights and welfare organizations
discourage the riding of these mules, and
if you agree with that, then by all means,
take the cable car.
But on the other hand, mules have been bred
to do this kind of work for a long time, starting
perhaps about 5000 years ago in Turkey, and
spreading from there throughout the world.
That's why they were bred.
And the mule drivers take good care of their
animals, it's their livelihood after all,
and even through the long winter when these
animals are not doing much work, they are
well taken care of, so they get a winter vacation.
The biggest issue for the animals is the amount
of weight they have to carry.
If they were just walking up the hill with
nobody on their back, the climb would be easy
for these strong animals, so the government
has put a weight limit – nobody more than
220 pounds is allowed to ride on the mule.
If a heavy person tries to ride, they can
be fined as much is $32,000.
Mules are fascinating animals with some peculiarities
that belong to the mule alone.
So let's consider the nature of this hard-working
animal as he climbs the hill in Santorini.
A mule is a offspring of a male donkey and
a female horse, making it a hybrid and sterile
so two mules cannot mate and give birth to
another mule.
You can see how this donkey on the left is
smaller and looks different than the mule.
The mule is valued because it has the positive
characteristics of each species while minimizing
their negative aspects.
It's an example of hybrid vigor.
Charles Darwin said the mule is superior to
horse or donkey because it quote "possesses
more reason, memory, obstinacy, social affection,
powers of muscular endurance and length of
life than either of its parents."
The mule inherits from its donkey the traits
of intelligence, surefootedness, toughness,
endurance, gentle disposition, independence
and natural cautiousness.
From the horse, it inherits speed, basic shape
and agility.
The mule has the size and ground covering
ability of a horse, yet is stronger than a
horse of similar size and tends to require
less food.
Mules are reputed to be more patient, hearty
and long-lived than horses, and more intelligent
than either of their parents species.
The mule is a powerful work animal, able to
endure hardship and perform excellent service
under adverse conditions.
You've heard the phrase "stubborn as a mule."
Yes, they do not like to be hurried, worried,
or cuffed about.
To try and force him to do things against
his will is practically impossible, and only
makes matters worse.
The mule must be understood and gently, but
firmly, persuaded to do things.
They show a lot of patience under the pressure
of heavy weights, and their skin is harder
and less sensitive than that of horses, making
them more capable of resisting sun and rain.
Their hooves are harder than horses, and they
show a natural resistance to disease and insects.
At night when the mules are done with their
long working day in Santorini, they come walking
right through the middle of town on their
way back to the stables.
It's a big surprise for many tourists, who
are walking along shopping, and all of a sudden
here comes a mule train.
It's an unusual event in this unique place
that make Santorini all that much more interesting.
It's another good reason, if you're on a cruise
ship, to stay in town as long as you possibly
can.
The twilight in Thera is a wonderful time
to be walking around shopping anyway, and
then you'll have this added bonus of watching
the mules parade by.
Mules and donkeys have worked here for many
centuries, hauling goods and people from the
shoreline way up to the settlements up on
top of the hill.
The roads were always too rough for any kind
of a cart or wagon, and later on for trucks,
and so the mules and donkeys have always beared
the burden of hauling the stuff up and down
the hill.
They are responsible for the creation of these
towns because without them, no towns could've
ever been built up here.
Mules have long played a historical role of
working for people, as far back as 3000 BC
in Egypt.
Christopher Columbus introduced mules to the
New World.
George Washington is known as the father of
the American mule, with nearly 60 of them
at his home in Mount Vernon.
Pack trains of mules were instrumental in
opening up the American west, as the surefooted
animals could carry up to 250 pounds, surviving
on rough forage, and could operate in the
arid, high levels of the Rockies, serving
as the main cargo carriers to the American
west during the heyday of expansion into the
frontier.
There are mules in other parts of Greece,
such as the island of Hydra and the town of
Lindos on Rhodes, but here in Santorini, they
provide a very special kind of ass transit.
We have two other movies about Santorini,
including an in-depth look at the town of
Thera, and the cats of Santorini.
Take a look at a brief sample of those two
movies.
For cat lovers, the Greek island of Santorini
is a paradise.
It seems like there are cats everywhere here,
roaming around freely and they are so cute
and friendly.
Greece is famous for its cats, which you will
find throughout the country, but especially
out in the Greek islands and here in Santorini
the cats are especially abundant.
The best word to describe Santorini is magical,
or how about a romantic?
These whitewashed cubic shape houses are typical
of the traditional architecture of the Greek
Cyclades Islands, but here it's different
because they're built on the inside rim of
a volcano.
We upload a new movie every week so please
subscribe to our channel and click that little
alarm bell so you'll be notified.
And if you enjoyed the movie, how about a
thumbs up, and we always welcome comments
down below, or if you have questions about
the destination, make note and we will answer
them.
Thanks for watching.
|
{
"pile_set_name": "YoutubeSubtitles"
}
|
1. Field of the Invention
The present invention generally relates to a method of making headliners used in a motor vehicle and, more particularly, to methods of making headliners that use adhesives to adhere the headliner layers together.
2. Background Art
As for all automotive components, improved methods of manufacturing that produce higher quality parts at lower costs are always desirable. The aesthetic demands of vehicle interiors makes improvements for such components particularly important. Such components include headliners, trim, upholstery, and the like. Headliners are particularly important because vehicle interiors have significant areas covered by this component.
In the typical headliner forming operation, a PU pre-polymer is roller coated onto a PU foam mat. Water is then sprayed on both surfaces of the PU foam mat. A sandwich structure of a non-woven polyester, glass fiber mat, the adhesive-coated PU foam, a second glass fiber mat, and a non-woven polyester with polyethylene film is positioned in a pressing tool. The sandwich structure is heated to about 130° C. with a pressing time of about 30 seconds to form the finished headliner. In order to remove the headliner from the pressing tool, it is necessary to spray a release agent onto the tool before pressing. The use of release agents results in residues on both sides of the headliner after pressing. In a related refinement of this process, a textile is laminated onto the side that faces the car interior and small parts such as cables or retainers are glued to the side facing the car roof. The existing release agents impair bonding in both these instances The adhesives used in the current processes also cause various problems. For example, foaming of the adhesive during reaction occurs causing it to partially bleed through and sticks to the tools which are typically aluminum or steel. Finally, the polyethylene film on the polyester non-woven material melts in areas of high pressure thereby sticking to the tooling as well.
Accordingly, there exists a need in the prior art for an improved process of forming headliners to be used in motor vehicle interiors.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Puck Treasures looks to find those hidden hockey treasures from the past and present, and gives them their proper remembrance. Seen an interesting piece of hockey apparel? Send us an email at puckdaddyblog@yahoo.com.
The world would be a much better place with a little NHL ’93 (and/or NHL ’94) in everyone’s lives.
We've documented many things related to EA Sports' NHL series over the years, from Cliff Ronning standing on an actual NHL '93 player star to Bobby Orr's famous goal immortalized as NHL '94 wallpaper to chatting with the immortal Ron Barr; but nothing beats this piece of goalie equipment.
Via Upper Corner Hockey, the crew at Royal Essex Custom Airbrushing have brought us one of the best goalie masks out there featuring an NHL ’93 theme.
View photos Royal Essex Custom Airbrushing More
View photos Royal Essex Custom Airbrushing More
View photos Royal Essex Custom Airbrushing More
View photos Royal Essex Custom Airbrushing More
|
{
"pile_set_name": "OpenWebText2"
}
|
Background
==========
Surface layers (S-layers) are cell envelope structures ubiquitously found in Gram-positive and Gram-negative bacterial species as well as in *Archaea*. They are composed of numerous identical (glyco)protein subunits, 40--200 kDa in molecular weight, which completely cover the cell surface forming a two-dimensional, regular array having either oblique (p1, p2), square (p4) or hexagonal (p3, p6) symmetry. The subunits are held together and attached to the underlying cell surface by noncovalent interactions, and they have an intrinsic ability to spontaneously form regular layers either in solution or on a solid support under suitable conditions \[[@B1]\]. Functions of S-layers are poorly known thus far. They include the determination and maintenance of cell shape, action as a protective coat, molecular sieve or ion trap or as a mediator of adhesion or surface recognition. The contribution of S-layers to virulence has been reported \[[@B1],[@B2]\].
In general, S-layer proteins have two structural regions in which two essential functions reside: a region involved in the attachment of the S-layer subunit to the cell envelope and a region involved in S-layer assembly. These regions have been characterized in several Gram-positive and some Gram-negative bacteria. In many Gram-positive bacilli and in *Thermus thermophilus*so called SLH (S-layer homology) motifs \[[@B3]\], 55--60 amino acids long and often located in the N-terminal part of the protein, are responsible for the attachment of the subunit proteins to the cell wall through a pyruvylated polysaccharide receptor in the cell wall \[[@B4]\]. In S-layers of Gram-positive bacteria not having SLH-motifs the attachment to the cell wall has been proposed to be mediated by an interaction between basic amino acids in the cell wall binding region and negatively charged secondary cell wall polymers. The cell wall receptors of such S-layers in *Geobacillus*species characterized so far contain mannuronic acid and can be classified as acidic oligosaccharides other than teichoic or teichuronic acids, while teichoic and lipoteichoic acids have been shown to be the cell wall receptors of the S-layer proteins of *Lactobacillus acidophilus*and *Lactobacillus crispatus*. However, some cell wall polysaccharides of Gram-positive bacteria proposed to be involved in S-layer binding have a net neutral charge \[[@B1],[@B5]-[@B7]\].
Among Gram-positive bacteria, the self-assembly regions of S-layer proteins have so far been studied in the S-layers of lactobacilli (see below), and in the S-layers of *Bacillus anthracis*, *Lysinibacillus sphaericus*and *Geobacillus stearothermophilus*. These studies rely on electron microscopy of recombinant S-layer protein fragments, and the self-assembly region has been shown to be of either central or C-terminal location \[[@B8]-[@B11]\].
In addition to *L. brevis*, S-layers have also been found in *Lactobacillus helveticus*as well as in several *Lactobacillus acidophilus*group bacteria \[[@B12]\] including *L. acidophilus*, *L. crispatus*and *L. gallinarum*. The overall sequence similarity between characterized *Lactobacillus*S-layer protein genes is low and similarity is usually found only between related species. The presence of multiple S-layer protein genes in a single strain is common in lactobacilli. For example, *L. brevis*ATCC 14869 has three S-layer protein genes, two of which are expressed under different environmental conditions and one is silent under laboratory conditions \[[@B13]\]. Other typical features of *Lactobacillus*S-layer proteins include their relatively small size and a high predicted overall pI \[[@B7]\]. Self-assembly and cell wall binding regions have been characterized in the S-layer protein S~A~of *Lactobacillus acidophilus*ATCC 4356 \[[@B14]\] and CbsA of *L. crispatus*JCM 5810 \[[@B15]\]. The sequences of S~A~and CbsA are homologous especially in the C-terminal region, which mediates the attachment to the cell wall, and the more variable N-terminal part is responsible for the self-assembly of the S-layer subunits.
The S-layer protein of *Lactobacillus brevis*ATCC 8287, SlpA \[[@B16]\], is a 435 amino acid, 46 kDa protein, which assembles on the bacterial cell forming an oblique lattice \[[@B17]\] and for which a fibronectin-binding function has been described \[[@B18]\]. *L. brevis*is phylogenetically distant from *L. acidophilus*group \[[@B19]\], and this is reflected in the unique amino acid sequence of SlpA compared to *L. acidophilus*group S-layer proteins \[[@B7]\]. Foreign epitopes up to 11 amino acids long have been expressed in SlpA in order to develop tools for mucosal immunization \[[@B17]\]. *L. brevis*ATCC 8287 would be a suitable strain to be used as a live oral vaccine, as it has a GRAS (Generally Recognized As Safe) status and it has been shown to possess probiotic properties \[[@B20]\]. For vaccine development, as well as for nanobiotechnological applications, for which regularly arranged S-layers are especially well-suited \[[@B21],[@B22]\], knowledge about the structure-function relationships of SlpA, presented in this study, is essential.
In this work, we have characterized the two-domain structure of the S-layer protein SlpA of *L. brevis*ATCC 8287 with its C-terminal self-assembly and N-terminal cell wall binding domains. Conserved carbohydrate binding motifs were detected in the N-terminal, positively charged regions of six *L. brevis*S-layer proteins; however, the cell wall receptor of SlpA was found to be different from the receptors of previously characterized *Lactobacillus*S-layer proteins.
Methods
=======
Bacterial strains, plasmids and culture conditions
--------------------------------------------------
The strains and plasmids used in this study are listed in Table [1](#T1){ref-type="table"}. *Lactobacillus brevis*ATCC 8287 and *Lactobacillus acidophilus*ATCC 4356 were grown in MRS (Difco, Detroit, MI, USA) at 37°C. *E. coli*strains were grown in Luria-Bertani medium or M9ZB-medium \[[@B23]\] at 37°C under aeration. When appropriate, kanamycin, 30 μg/ml, was used for *E. coli*.
######
Strains and plasmids used in this study
---------------------------------------------------------------------------------------------------------------------------------------------
Strain or plasmid Relevant properties^a^ Reference or source
-------------------------------------- -------------------------------------------------------------------------------- ---------------------
Strains
*Lactobacillus brevis*ATCC 8287 ATCC
*Lactobacillus acidophilus*ATCC 4356 ATCC
*Escherichia coli*DH5αF\'\ F\' *endA1 hsd17*(r~k~^-^m~k~^+^) *supE44 thi-1 recA1 gyrA*(NaI^r^) *relA1Δ*\ 58\
*(lacIZYA-argF) U169 deoR*\[ϕ80 d *lacΔ(lacZ)*M15\]
*Escherichia coli*BL21(DE3) F^-^*ompT hsdS*~*B*~(r~B~^-^m~B~^-^) *gal dcm*(DE3) Novagen
Plasmids
pET-28a(+) Km^r^, *E. coli*expression vector Novagen
pET-28b(+) Km^r^, *E. coli*expression vector Novagen
pKTH5198 Km^r^, pET-28b(+)(*Nco*I/*Xho*I::SlpA~1--435~-linker~thrombin~-Tag~*his*6~) This study
pKTH5199 Km^r^, pET-28a(+)(*Nhe*I::Tag~*his*6~-linker~thrombin~-SlpA~1--435~) This study
pKTH5200 Km^r^, pET-28b(+)(*Nco*I/*Xho*I::SlpA ~146--435~-linker~thrombin~-Tag~*his*6~) This study
pKTH5201 Km^r^, pET-28b(+)(*Nco*I/*Xho*I::SlpA~291--435~-linker~thrombin~-Tag~*his*6~) This study
pKTH5203 Km^r^, pET-28a(+)(*Nhe*I::Tag~*his*6~-linker~thrombin~-SlpA~1--145~) This study
pKTH5204 Km^r^, pET-28a(+)(*Nhe*I::Tag~*his*6~-linker~thrombin~-SlpA~1--290~) This study
pKTH5258 Km^r^, pET-28a(+)(*Nhe*I::Tag~*his*6~-linker~thrombin~-SlpA~190--423~) This study
pKTH5259 Km^r^, pET-28a(+)(*NheI*::Tag~*his*6~-linker~thrombin~-SlpA~210--423~) This study
pKTH5260 Km^r^, pET-28a(+)(*NheI*::Tag~*his*6~-linker~thrombin~-SlpA~1--189~) This study
pKTH5261 Km^r^, pET-28a(+)(*Nhe*I::Tag~*his*6~-linker~thrombin~-SlpA~190--435~) This study
pKTH5262 Km^r^, pET-28a(+)(*Nhe*I::Tag~*his*6~-linker~thrombin~-SlpA~210--435~) This study
pKTH5264 Km^r^, pET-28a(+)(*Nhe*I::Tag~*his*6~-linker~thrombin~-SlpA~167--435~) This study
pKTH5325 Km~r~, pET-28a(+)(*Nhe*I::Tag~*his*6~-linker~thrombin~-SlpA~179--435~) This study
pKTH5333 Km~r~, pET-28a(+)(*Nhe*I::Tag~*his*6~-linker~thrombin~-SlpA~149--435~) This study
---------------------------------------------------------------------------------------------------------------------------------------------
^a^Km^r^, resistance to kanamycin
DNA manipulations and transformation
------------------------------------
Routine molecular biology techniques were used essentially as described previously \[[@B24]\]. Plasmid DNA of *E. coli*clones was isolated by using the Wizard Minipreps kit (Promega, Madison, WI, USA). Chromosomal DNA of *L. brevis*was isolated essentially as described before \[[@B16]\]. PCR products were purified with the QIAquick PCR purification kit (Qiagen). DNA restriction and modification enzymes were used as recommended by the manufacturers (New England Biolabs Inc., Beverly, MA, USA; Promega). PCR was carried out with DyNAzyme II DNA polymerase as recommended by the manufacturer (Finnzymes, Helsinki, Finland). *E. coli*cells were transformed by standard methods \[[@B24]\].
Oligonucleotides and DNA sequencing
-----------------------------------
Oligonucleotides (Oligomer, Helsinki, Finland) used in this work are listed in Table [2](#T2){ref-type="table"}. Nucleotide sequencing was performed by the dideoxy chain termination method of Sanger *et al*. \[[@B25]\] by using an ABI Prism 310 Genetic analyzer (Applied biosystems, Foster City, CA, USA) in combination with the DNA sequencing kit for BigDye Terminator cycle sequencing (Applied Biosystems).
######
Oligonucleotides used in this study.
Oligonucleotide Nucleotide sequence (5\'→3\')^a^
----------------- -------------------------------------------------------------------
1594 GTCAT[CCATGG]{.ul}GCAAGTCATACGCTACTGCAGG
1595 TCGCA[CTCGAG]{.ul}GCTGCCGCGCGGCACCAGGCCGCTGCTGTTGAACCAAGTAGTACCGT
1596 TCGTA[TCTAGA]{.ul}AAGTCATACGCTACTGCAGG
1597 TCGCA[TCTAGA]{.ul}TTATTAGTTGAACCAAGTAGTAC
1602 GTCAT[CCATGG]{.ul}GCCTTTATGGTGTTGCTAAGGAC
1603 GTCAT[CCATGG]{.ul}GCTCCCAAGCAGCTACTTCTAAG
1604 TCGCA[CTCGAG]{.ul}GCTGCCGCGC
1628 GTCAT[GCTAGC]{.ul}AAGTCATACGCTACTGCAGG
1629 ATTCC[GCTAGC]{.ul}TTATTAAACAGTAGCGTAAACTGTGTT
1630 TGATA[GCTAGC]{.ul}TTATTAGCTAACTTTACTTGCCTTGTAT
1635 ATTCC[GCTAGC]{.ul}GGCTTCAGTACTACTGCTACT
1636 TCGCA[GCTAGC]{.ul}TTATTAGTTGAACCAAGTAGTAC
1637 ATTCC[GCTAGC]{.ul}GTTACAGCAACCAACGATAAC
1638 TGATA[GCTAGC]{.ul}TTATTACTTACCAGCGTAAATCC
1639 TGATA[GCTAGC]{.ul}TTATTACTTACCCATAACAAGGGT
1644 ACTAC[GCTAGC]{.ul}GGTTCATTATACTATCACGTAAC
1776 GCGG[GCTAGC]{.ul}AGTGGTATTAGTGGTTGGATTT
1777 GCGG[GCTAGC]{.ul}GTTGCTAAGGACACCAAGTTT
^a^recognition sites of restriction enzymes are underlined
Protein analysis
----------------
Protein concentrations were determined by Bio-Rad Protein Assay (Bio-Rad, Hercules, CA, USA) using bovine serum albumin as a standard. Protein samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) as described by Laemmli \[[@B26]\] and stained with Coomassie brilliant blue.
Construction of plasmid vectors
-------------------------------
For the expression of the mature SlpA protein, SlpA~1--435~, the gene was amplified by PCR from the chromosomal DNA of *L. brevis*ATCC 8287 using primer pairs 1594/1595 or 1596/1597 (Table [2](#T2){ref-type="table"}). The PCR fragment obtained with primer pair 1594/1595 was digested with *Nco*I and *Xho*I and ligated with *Nco*I-*Xho*I digested pET-28b(+), resulting in plasmid pKTH5198 encoding rSlpA with a C-terminal His-tag (Table [1](#T1){ref-type="table"}). The PCR product amplified with primers 1596 and 1597 was digested with *Xba*I and cloned into the *Nhe*I site of plasmid pET-28a(+). The resulting plasmid, encoding rSlpA with an N-terminal His-tag, was named pKTH5199.
Three C-terminal truncations, seven N-terminal truncations and two N-and C-terminal truncations of SlpA were constructed, each with a His-tag sequence at either N- or C-terminus. For a summary of the plasmid constructs, see Table [1](#T1){ref-type="table"}. For cloning the C-terminal truncations, primer pairs 1628/1630 (for SlpA~1--145~), 1628/1629 (for SlpA~1--290~) and 1628/1638 (for SlpA~1--189~) (Table [2](#T2){ref-type="table"}) were used to amplify the *slpA*sequences with plasmid pKTH5199 as a template. PCR fragments obtained were digested with *Nhe*I and cloned into *Nhe*I-digested pET-28a(+). The resulting plasmids were named pKTH5203, pKTH5204 and pKTH5260, respectively (Table [1](#T1){ref-type="table"}).
Cloning of the N-terminal truncations of SlpA with the His-tag sequence at the 3\'-terminus was carried out with primer pairs 1602/1604 (for SlpA~146--435~) and 1603/1604 (for SlpA~291--435~) (Table [2](#T2){ref-type="table"}) and pKTH5198 as a template. The resulting PCR fragments were cloned as *Nco*I-*Xho*I fragments into pET-28b(+), giving plasmids pKTH5200 and pKTH5201, respectively (Table [1](#T1){ref-type="table"}). For cloning the N-terminal truncations with the His-tag sequence at the 5\'-terminus, primer pairs 1777/1636 (for SlpA~149--435~), 1644/1636 (for SlpA~167--435~), 1776/1636 (for SlpA~179--435~), 1635/1636 (for SlpA~190--435~), or 1637/1636 (for SlpA~210--435~) were used to amplify the *slpA*sequences with plasmid pKTH5199 as a template. The PCR fragments obtained were digested with *Nhe*I and cloned into *Nhe*I-digested pET-28a(+) resulting in plasmids pKTH5333, pKTH5264, pKTH5325, pKTH5261 and pKTH5262, respectively (Table [1](#T1){ref-type="table"}).
Sequences encoding N-and C-terminally truncated SlpA were PCR amplified with primers 1635/1639 (for SlpA~190--423~) and 1637/1639 (for SlpA~210--423~), using plasmid pKTH5199 as a template. The resulting PCR fragments were cloned as *Nhe*I-fragments into pET-28a(+), giving plasmids pKTH5258 and pKTH5259, respectively (Table [1](#T1){ref-type="table"}). All constructs were sequenced to verify the correct open reading frames.
Heterologous expression of the sequences encoding mature SlpA and its truncated forms
-------------------------------------------------------------------------------------
Gene expression was carried out as described in the pET System Manual (Novagen, Madison, WI, USA) by using *Escherichia coli*strain BL21(DE3). Briefly, expression of recombinant SlpA proteins was induced by adding isopropylthiogalactoside (IPTG) at a concentration of 0.5 to 1.0 mM to the medium of exponentially growing *E. coli*strains harboring one of the expression plasmids listed in Table [1](#T1){ref-type="table"}. After IPTG was added, the incubation was continued for one to five hours, depending on the protein to be purified. Recombinant SlpA proteins were purified in the presence of 4 M guanidine hydrochloride (GHCl) or 6 M urea with a His Trap HP column according to the instructions given by Amersham Biosciences (Uppsala, Sweden). After purification the fractions containing the recombinant SlpA protein were dialyzed overnight at +4°C against distilled water. Purity of the recombinant proteins, present as a precipitate and/or as soluble proteins after dialysis, was checked by SDS-PAGE.
Isolation of SlpA protein from *L. brevis*ATCC 8287
---------------------------------------------------
The S-layer protein was extracted from *L. brevis*cells grown to an OD~600\ nm~of 1.0 in MRS broth. Cells from 1 l of culture were harvested and washed twice with distilled water. The pellet was resuspended in 15 ml of 2 M GHCl and incubated for 30 min at +4°C followed by centrifugation (15,000 × g for 20 min). The supernatant was concentrated with Centricon Plus-20 centrifugal filter (Millipore, Bedford, MA, USA) before dialysis against distilled water supplemented with 5 mM CaCl~2~overnight at +4°C, followed by dialysis against distilled water overnight at 4°C. Before dialysis the SlpA protein concentration was adjusted to 1 mg/ml. After dialysis a centrifugation step (20,000 × g for 20 min) was performed. The pellet containing the S-layer self-assembly products was resuspended in 25 mM Tris-HCl buffer (pH 8.0).
Proteolytic degradation of SlpA with trypsin and peptide mapping
----------------------------------------------------------------
Isolated SlpA at a concentration of 1 mg/ml was dialyzed against distilled water supplemented with 5 mM CaCl~2~overnight followed by a second overnight dialysis against distilled water. The dialysis was followed by a centrifugation step (16,000 × g for 30 min). The S-layer monomers, present in the supernatant, were digested with trypsin under the following conditions: 300 ng SlpA protein and 3 μg trypsin (Sigma-Aldrich, St. Louis, MO, USA) in 300 μl of 25 mM Tris-HCl (pH 8.0) for 10 to 30 min at 37°C. The reaction was stopped by heating the samples for 10 min at 100°C and the samples were subjected to SDS-PAGE. N-terminal sequencing was performed by a gas-pulsed liquid sequencer as described previously \[[@B27]\] and peptide mapping by a Biflex matrix-assisted laser desorption ionization-time of flight mass spectrometer (Bruker-Franzen Analytic, Bremen, Germany) as described by \[[@B28]\].
Investigation of the self-assembly properties of purified truncated S-layer proteins
------------------------------------------------------------------------------------
To assess the ability of the recombinant S-layer proteins to self-assemble, affinity purified proteins were dissolved in 5 M GHCl at a concentration of 1 mg/ml and the solutions were dialyzed against phosphate-buffered saline (PBS) in Slide-A-Lyzer Mini Dialysis Units (Pierce, Rockford, IL, USA) for two hours at 4°C. Dialysis was followed by a centrifugation step (16,000 × g for 30 min) and the formation of a precipitate was checked by SDS-PAGE. For transmission electron microscopy, 1 mg of the purified, lyophilized proteins were dissolved in 1 ml 5 M GHCl in 50 mM Tris-HCl buffer (pH 7.2) and the solution was dialyzed against 10 mM CaCl~2~in distilled water for 18 h. Samples were transferred onto carbon-coated electron microscope grids rendered hydrophilic by glow discharge, negative stained with 2,5% uranyl acetate as described previously \[[@B29]\], and electron micrographs were taken with Philips CM 12 transmission electron microscope (Philips Eindhoven, the Netherlands) operated at 80 kV in a low-dose mode. Freeze-etched preparations of *L. brevis*ATCC 8287 cells were prepared as previously described \[[@B30]\], and lattice constants of the S-layer formed by SlpA were determined as described by \[[@B31]\].
Isolation of native cell wall fragments (CWF) from *L. brevis*ATCC 8287
-----------------------------------------------------------------------
*L. brevis*ATCC 8287 cells were cultivated overnight in 1 l of MRS broth, collected and washed three times with distilled water. Cells were suspended in 30 ml of 2 M GHCl, incubated shaking for 30 minutes at +4°C, collected and washed once with 50 mM Tris-HCl (pH 7.4). Cells were disrupted by French Pressure Cell Press (SLM Instruments Inc, IL, USA) in 50 mM Tris-HCl (pH 7.4), and the lysate was centrifuged at 3000 g for 5 minutes at +4°C. Cell wall fragments were collected, washed five times with 50 mM Tris-HCl (pH 7.4) and treated with DNAase I (25 μg/ml, Sigma-Aldrich, St. Louis, MO, USA) and RNAase I (25 μg/ml, Roche Diagnostics GmbH, Mannheim, Germany) in 50 mM Tris-HCl (pH 7.4), 10 mM MgCl~2~for 30 minutes at 37°C. Cell wall fragments were collected, treated with 1% SDS for 30 minutes at 100°C, washed extensively with distilled water at room temperature and lyophilized.
Treatment of native cell wall fragments with TCA
------------------------------------------------
0.5 mg or 0.25 mg of isolated CWF in water were incubated in the presence of 5% (V/V) TCA either at +4°C or at +37°C for 24 h in a rotary shaker. The cell walls were collected, washed three times with distilled water at +4°C and suspended in distilled water. The treatment at +4°C was performed twice. Organic phosphorous was measured from native and treated CWF and from the supernatant obtained in the extraction by the method described by \[[@B32]\].
Binding of the truncated S-layer proteins to bacterial cells and isolated cell wall fragments
---------------------------------------------------------------------------------------------
Binding assays of recombinant S-layer proteins to LiCl-extracted *L. brevis*ATCC 8287 and *L. acidophilus*ATCC 4356 cells were performed essentially as described previously \[[@B14]\]. The amount of recombinant S-layer protein used in one binding reaction was 50 μg and the buffer was 50 mM Tris-HCl (pH 7.5) with 150 mM NaCl. The presence of cell-bound S-layer protein in the samples was verified by SDS-PAGE. In binding assays with isolated cell wall fragments, monomeric truncated S-layer proteins, present in the supernatant after centrifugation (20 minutes at 16 000 g at +4°C), were used. 20 μg CWF and 10 μg full length recombinant SlpA or an equimolar amount of truncated S-layer proteins were combined in 50 μl of 50 mM Tris-HCl (pH 7.5), 150 mM NaCl. After incubation (1 hour at room temperature) cell wall fragments were collected, washed once with 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, and analyzed by SDS-PAGE.
Analysis of primary amino acid sequences
----------------------------------------
The isoelectric point (pI) values of the *L. brevis*S-layer proteins as well as those of the constructed rSlpA proteins were obtained by ProtParam \[[@B33]\], and the analyses of the hydrophobicity patterns of S-layer proteins of *L. brevis*were performed by the Kyte-Doolittle method \[[@B34]\] with ProtScale \[[@B35]\] on the ExPASy server. Repeat structures from S-layer proteins were localized by REPRO \[[@B36],[@B37]\]. The comparison matrix used in the protein repeat analysis was blosum62 (gap open penalty, 12; gap extension penalty, 1). Sequence alignment analyses of *L. brevis*S-layer proteins were performed by ClustalW \[[@B38]\] using gonnet as a comparison matrix (gap open penalty, 10; gap extension penalty, 0.2). Pairwise comparison analyses were performed by SIM \[[@B39],[@B40]\] using blosum62 as a comparison matrix (gap open penalty, 12; gap extension penalty, 4). From the complete genome sequence of ATCC 367, deposited under GenBank accession number [CP000416](CP000416), the hypothetical S-layer proteins of *L. brevis*ATCC 367 were identified by BLAST \[[@B39]\] using complete SlpA, SlpB, SlpC and SlpD sequences. The identified hypothetical S-layer proteins of ATCC 367 have been deposited in Swiss-Prot under accession numbers Q03P39 and Q03NT3.
Results
=======
Primary amino acid sequence analysis of the S-layer proteins of *L. brevis*
---------------------------------------------------------------------------
The only thus far characterized S-layer proteins in *L. brevis*are the SlpA protein of *L. brevis*ATCC 8287 \[[@B16]\] and the SlpB, SlpC and SlpD proteins of *L. brevis*ATCC 14869 \[[@B13]\]. By performing a homology search for the recently sequenced genome of *L. brevis*ATCC 367 \[[@B41]\] with the BLAST program, two new putative S-layer proteins, Q03P39 and Q03NT3, were identified in the genome.
The amino acid sequences encoding the mature S-layer proteins of *L. brevis*ATCC 8287 (SlpA) and ATCC 14869 (SlpB, C and D) and the putative mature S-layer proteins of ATCC 367 (Q03NT3 and Q03P39) were subjected to a number of analyses. A multiple alignment of SlpA, SlpB, SlpC, SlpD, Q03NT3 and Q03P39 amino acid sequences revealed significant conservation in the N-terminal regions (see Fig. [1a](#F1){ref-type="fig"} and additional file [1](#S1){ref-type="supplementary-material"}: Multiple amino acid sequence alignment of the *L. brevis*S-layer proteins). Analysis of the distribution of the isoelectric point values in *L. brevis*S-layer proteins revealed a distinction between the N-terminal region with a high predicted pI and a C-terminal region with a low predicted pI in each of the proteins (Fig. [1c](#F1){ref-type="fig"}). In SlpA and SlpB the region of a high predicted pI comprises approximately two fifths of the protein, while in SlpD and its homolog, Q03P39, as well as in SlpC and its homolog, Q03NT3, the region of an overall high pI extends further towards the C-terminus and the most distinct boundary between the differently charged regions is located around residue 260 in SlpC and Q03NT3 and around residue 290 in SlpD and Q03P39. Hydrophobicity analysis performed for the S-layer protein sequences of *L. brevis*showed a similar distribution of hydrophilic and hydrophobic amino acid residues along the mature proteins with evenly alternating hydrophobic and hydrophilic residues, as exemplified by the hydrophobicity plot of SlpA in Fig. [1b](#F1){ref-type="fig"}.
![**1(a) -- Alignment of *L. brevis*S-layer protein sequences**. The mature forms of S-layer proteins were aligned by ClustalW and the alignments were divided into stretches of 10 amino acids, from which the percentage of identical amino acids and amino acids with conserved substitutions were calculated. The following colours are used to indicate the percentages of identical and similar amino acids in each calculated stretch: white, 0--20%, light gray, 21--40%, medium gray, 41--60%, dark gray, 61--80%. 1(b) &\#8211 Hydrophobicity of mature SlpA. The hydrophobicity was calculated according to Kyte and Doolittle \[[@B34]\] with a window of seven amino acids. 1(c) &\#8211 Predicted pI values of the N- and C-terminal regions of *L. brevis* S-layer proteins. The lengths of the N- and C-terminal regions as well as the full lengths of the mature forms of the proteins are indicated in brackets.](1471-2180-8-165-1){#F1}
To predict the domain organization of SlpA, the analyses performed were compared with similar analyses of the S-layer proteins of *L. acidophilus*group organisms \[[@B14]\]. In each of the *L. acidophilus*S-layer proteins, one region is found which is conserved, located at the C-terminus and contains positively charged and hydrophilic sequences. In S~A~of *L. acidophilus*ATCC 4356 and CbsA of *L. crispatus*JCM 5810 these domains mediate the binding to the cell wall, while the variable N-terminal regions are responsible for the assembly of the S-layer \[[@B14],[@B15]\]. In CbsA the variable N-terminal domain is also responsible for collagen binding \[[@B42]\]. The only function characterized for SlpA so far, binding to fibronectin and human epithelial cells \[[@B18]\], resides in the conserved N-terminal region. However, the pattern of sequence conservation and the distribution of charge in the six *L. brevis*S-layer proteins strongly suggested a domain organization similar to that found in *L. acidophilus*-group S-layer proteins with the functional domains in a reverse order.
Cloning and expression of gene sequences encoding the mature or truncated forms of the S-layer protein SlpA and purification of the recombinant proteins
--------------------------------------------------------------------------------------------------------------------------------------------------------
PCR products encoding the mature SlpA and the various N- or C-terminal SlpA truncations were cloned in *E. coli*DH5αF\' and expressed in *E. coli*BL21(DE3). The proteins produced are summarized in Fig [2](#F2){ref-type="fig"}. After induction of expression by the addition of IPTG, samples of cultures from *E. coli*BL21(DE3) were harvested and analyzed by SDS-PAGE. On SDS-gels, each of the recombinant SlpA proteins became visible as an additional protein band, corresponding approximately to the calculated molecular mass of the rSlpA proteins (data not shown). The proteins were purified in a large scale, and total protein yields varied from 5 to 25 mg per a batch cultivation of 200 ml.
{#F2}
Proteolytic degradation of SlpA protein with trypsin and peptide mapping
------------------------------------------------------------------------
To gain insight to the domain structure of SlpA, wild type SlpA was digested with trypsin. This revealed two protease resistant fragments with apparent molecular masses of 25 kDa and 23 kDa (Fig. [3](#F3){ref-type="fig"}). The N-terminal sequences of these peptides were determined to be GFSTTAG (larger peptide) and SVTATND (smaller peptide). These correspond to amino acids starting from 190 and 209 of mature SlpA, respectively. Peptide mass mapping of the protease resistant fragments obtained after trypsin digestion revealed that the peptide encompassing the last 12 amino acids of full length SlpA is lacking from these fragments (data not shown). The protease resistance of the regions 190 to 423 and 209 to 423 in mature SlpA strongly suggested the existence of a compact domain structure most likely representing a region exposed on the outer surface of the S-layer.
{#F3}
Investigation of the self-assembly properties of the truncated S-layer protein forms
------------------------------------------------------------------------------------
As a preliminary test for the putative self-assembly properties of the truncated S-layer proteins, the formation of a precipitate after dialysis from GHCl was inspected. As shown in Fig. [2](#F2){ref-type="fig"}, C-terminally truncated proteins rSlpA~1--145~, rSlpA~1--189~and rSlpA~1--290~had lost the ability to form precipitates. N-terminally truncated forms rSlpA~179--435~and rSlpA~167--435~precipitated efficiently after dialysis, while rSlpA~146--435~, rSlpA~149--435~as well as rSlpA~190--435~and rSlpA~190--423~showed a reduced precipitation. The last twelve residues in the C-terminus of SlpA had no effect on the precipitation, as rSlpA~190--423~showed a precipitation similar to rSlpA~190--435~. The removal of 209 residues or more from the N-terminus of SlpA abolished the ability of the truncated proteins to form precipitates.
Precipitate-forming N-terminally truncated SlpA proteins were chosen for transmission electron microscopical analysis of lattice formation. In these studies, rSlpA formed an oblique lattice that was identical with that formed by SlpA isolated from wild type *L. brevis*ATCC 8287 cells (compare Figures [4a](#F4){ref-type="fig"} and [4c](#F4){ref-type="fig"}), as well as with the lattice seen on *L. brevis*ATCC 8287 cells in the freeze-etched preparation (Fig. [4d](#F4){ref-type="fig"}), proving the native conformation of recombinant SlpA. In accordance, lattice constants for the self-assembly products of rSlpA (a = 10.38, b = 6.36 and 72.7°) and for the self-assembly products of SlpA isolated from *L. brevis*ATCC 8287 cells (a = 9.39, b = 6.10 and 79.8°) were practically identical. The recombinant protein SlpA~179--435~(Fig. [4b](#F4){ref-type="fig"}) was found to form a regular, oblique lattice indistinguishable from that formed by full length rSlpA, but the removal of eleven residues more from the N-terminus resulting in rSlpA~190--435~prevented lattice formation (Fig. [2](#F2){ref-type="fig"}). Surprisingly, the two larger N-terminally truncated proteins, rSlpA~167--435~and rSlpA~149--435~, were unable to form regular lattice structures. Thus, residues 179--435 in mature SlpA define the region responsible for the crystallization of SlpA monomers.
{#F4}
Isolation of native cell wall fragments and binding of the truncated S-layer proteins to cell wall fragments
------------------------------------------------------------------------------------------------------------
Cell wall fragments were purified from a stationary phase culture of *L. brevis*cells by differential centrifugation of GHCl-treated, mechanically disrupted cells followed by treatments with nucleases and boiling SDS as described in Materials and methods. This method efficiently removes membrane fragments and noncovalently bound cell wall components like lipoteichoic acids (LTAs), but leaves covalently bound secondary cell wall polymers, like wall teichoic acids and other carbohydrates, essentially intact. The purity of the cell wall preparation was checked by light and transmission electron microscopy (Fig. [5](#F5){ref-type="fig"}). From 1.6 g of wet cells approximately 28 mg of cell wall fragments (dry weight) were recovered.
{#F5}
To test the hypothesis that the N-terminal, positively charged region of SlpA is responsible for anchoring the S-layer to the cell wall, truncated recombinant SlpA-proteins encompassing the N- and C-terminal regions of SlpA were tested for binding to isolated *L. brevis*cell wall fragments. As shown in Fig. [6a](#F6){ref-type="fig"}, full length rSlpA, rSlpA~1--145~and rSlpA~1--189~localized in the pellet fraction after incubation with the cell wall fragments, while rSlpA~190--435~and rSlpA~167--435~were unable to bind to CWF and were found in the supernatant. Truncated S-layer proteins incubated alone mainly localized to the supernatant, although small amounts were found in the pellets due to the inherent tendency of S-layer proteins to aggregate. These results are in good accordance with our results from similar experiments with whole, LiCl-treated *L. brevis*ATCC 8287 and *L. acidophilus*ATCC 4356 cells. In these experiments, full length rSlpA, rSlpA~1--145~and rSlpA~1--189~as well as rSlpA~1--290~bound to *L. brevis*cells, while rSlpA~190--435~, rSlpA~167--435~and rSlpA~210--435~were unable to bind. Full-length rSlpA and its cell wall binding fragment rSlpA~1--145~also bound to LiCl-treated *L. acidophilus*ATCC 4356 cells (data not shown).
{#F6}
To get preliminary information about the cell wall component interacting with the N-terminal region of SlpA, binding tests with full length rSlpA and CWF treated with TCA at +4°C or at +37°C were performed. rSlpA bound to CWF treated with TCA at +4°C as efficiently as to native CWF, while the treatment of CWF with TCA at +37°C substantially reduced the binding of rSlpA (Fig. [6b](#F6){ref-type="fig"}). Repeated TCA-extraction at +4°C and a change in the rSlpA: CWF-ratio from 1:2 to 1:1 did not change the result (data not shown). TCA extracts carbohydrate polymers, and the treatment at +4°C has been reported to selectively remove teichoic acids, while the treatment at +37°C removes teichuronic acids and polysaccharides \[[@B43]\]. The efficiency of the extraction was confirmed by the measurement of organic phosphorous from native and TCA-treated CWF as well as from the supernatant obtained in the extraction, which indicated the loss of approximately 75% of the organic phosphorous from the CWF by the treatment at +4°C (data not shown). These results suggest that the binding component in the *L. brevis*ATCC 8287 cell wall is other than teichoic acid, and that cell wall components extractable by TCA at +37°C, presumably polysaccharides, participate in the binding.
The amino acid sequence analysis of SlpA and other *Lactobacillus brevis*S-layer proteins revealed sequences in the N-terminal regions with apparent similarity to the repetitive carbohydrate binding motifs of clostridial toxins and streptococcal glucosyltransferases \[[@B44],[@B45]\]. These regions were found within amino acids 60--90 and 165--192 in each of the mature proteins (Fig. [7](#F7){ref-type="fig"}). In the N-terminal parts of SlpC and Q03NT3 as well as SlpD and Q03P39 additional regions with less obvious similarity were detected as well. Similar motifs have also been detected in the C-terminal cell wall binding regions of *L. acidophilus*ATCC 4356 S~A~protein and *L. crispatus*JCM 5810 CbsA protein as well as in the S-layer protein of *L. helveticus*CNRZ 892 and in several other bacterial cell surface-associated proteins, in which they were located in two tandemly repeated sequences of 65--72 amino acids \[[@B14]\]. A protein repeat analysis of the *L. brevis*S-layer proteins did not indicate the presence of the carbohydrate binding sequences in obvious repeat sequences, and despite the similar carbohydrate binding motifs in SlpA and in *L. acidophilus*group S-layer proteins, the cell wall receptor of SlpA apparently is dissimilar.
![**Similarity of the N-terminal regions of *L. brevis*S-layer proteins with carbohydrate binding motifs**. The motifs were determined by Wren \[[@B45]\] and von Eichel-Streiber *et al*\[[@B44]\]. In the consensus sequences upper case letters indicate highly conserved residues \[[@B44]\] or residues with an identity of 50% or higher \[[@B45]\]. X, variable residue. A broken underline indicates potential carbohydrate-binding motifs at different locations: YFRAYG of SlpA corresponds to YFDxNG of the consensus sequence of Ref \[[@B44]\]; KAYRGW of SlpB corresponds to KAVTGW of the consensus sequences of References \[[@B44]\] and \[[@B45]\]; LSNKSYY of SlpD and Q03P39 corresponds to IDGkwYY of the consensus sequence of Ref \[[@B44]\].](1471-2180-8-165-7){#F7}
Discussion
==========
In this study, we have identified the cell wall binding and self-assembly domains in the S-layer protein SlpA of *L. brevis*ATCC 8287, a strain phylogenetically distant from *L. acidophilus*group organisms, the S-layer proteins of which have previously been functionally characterized. Two new putative S-layer proteins, Q03P39 and Q03NT3, were identified in the recently sequenced genome of *L. brevis*ATCC 367 \[[@B41]\] and compared with SlpA and other *L. brevis*S-layer proteins characterized thus far. Q03P39 is almost identical (99% identity) with SlpD of *L. brevis*ATCC 14869 and relatively dissimilar (\<40% identity) from the SlpA, SlpB and SlpC sequences. Q03NT3 is highly similar with SlpC of *L. brevis*ATCC 14869 (87% identity) whereas not that similar with the other characterized *L. brevis*S-layer proteins (\<44% identity). Similarity of the mature forms of the new putative S-layer proteins or the mature forms of SlpA, SlpB, SlpC or SlpD proteins with *L. acidophilus*group S-layer proteins is negligible.
Analysis of the six *L. brevis*S-layer protein sequences deposited in databanks indicated the subdivision of each sequence into two regions: a conserved N-terminal region characterized by a high predicted pI and potential carbohydrate binding motifs, and a more variable C-terminal region with an acidic predicted pI, with the N-terminal region corresponding for 40--75% of the sequence lengths. The observed high predicted overall pI values of *Lactobacillus*S-layer proteins \[[@B7]\] thus seem to be due to the concentration of basic amino acids to a defined region, as is also the case in the S-layer proteins of *L. acidophilus*group, which have cationic, cell wall binding C-terminal regions.
The presence of a conserved N-terminal region with a high predicted pI in *L. brevis*S-layer proteins strongly suggested an N-terminal cell wall binding domain. This was confirmed for SlpA of *L. brevis*ATCC 8287 by interaction studies performed with truncated rSlpA proteins and LiCl-treated *L. brevis*cells or isolated *L. brevis*cell wall fragments. In these studies, truncated proteins encompassing the whole positively charged region of SlpA bound to the cell wall; however, the first 145 residues in mature SlpA contained sufficient information for cell wall binding. An assay suitable for measuring the binding strength would be needed to detect the putative difference between the cell wall binding affinities of SlpA~1--145~and SlpA~1--189~. In S-layer proteins of lactobacilli, no SLH motifs have been detected. Instead, interactions between a positively charged S-layer protein region and negatively charged secondary cell wall polymers have been shown to mediate the cell wall binding in the case of S~A~of *L. acidophilus*ATCC 4356 \[[@B46]\] and CbsA of *L. crispatus*JCM 5810 \[[@B41]\]. S~A~and CbsA were shown to bind teichoic acids, and CbsA bound also to lipoteichoic acids purified from *Staphylococcus aureus*and *Streptococcus faecalis*, but not to the teichuronic acid/polysaccharide fraction of the cell wall of *L. crispatus*JCM 5810. In contrast, the results of this study suggest the involvement of another cell wall structure than teichoic acid or lipoteichoic acid in the interaction between SlpA and the cell wall, as the purification process of the CWF used efficiently removed LTAs, and the extraction of CWF with TCA at +4°C to remove teichoic acids had no effect on the binding of SlpA.
The chemical nature of the cell wall component interacting with the S-layer protein has been determined in *Geobacillus stearothermophilus*strains \[[@B47]-[@B49]\], in *Lysinibacillus sphaericus*\[[@B50]\] and in *Aneurinibacillus thermoaerophilus*\[[@B6]\]. In *G. stearothermophilus*and *L. sphaericus*S-layers, which possess SLH-domains, the component is a pyruvylated GlcNac and GalNac-containing polysaccharide not groupable as a teichoic or lipoteichoic acid. In other *G. stearothermophilus*strains the component is a negatively charged mannuronic acid-containing cell wall polymer, and in *A. thermoaerophilus*the cell wall receptor is a neutral biantennary oligosaccharide.
The secondary cell wall polymers of lactobacilli are poorly characterized. The detailed structure of a wall polysaccharide of *L. casei*has been determined \[[@B51]\], but no precise structures for polysaccharides of *L. brevis*strains are available at present. In early studies, the cell walls of *L. buchneri*\[[@B52]\] and *L. brevis*ATCC 8287 \[[@B53]\] were shown to contain neutral polysaccharides, which were suggested to be involved in the anchoring of the S-layer protein to the cell wall through hydrogen bonding \[[@B54],[@B55]\]. These results are in agreement with the data presented in this study, which suggest a non-teichoic acid polysaccharide, either neutral or anionic, involved in the cell wall binding of SlpA, but the detailed structure of this polysaccharide remains to be elucidated.
Interestingly, despite the fact that polysaccharides rather than (lipo)teichoic acids of *L. brevis*ATCC 8287 are involved in the cell wall binding of SlpA, the C-terminal cell wall binding region of the S-layer protein CbsA of *L. crispatus*JCM 5810 bound to GHCl-treated *L. brevis*ATCC 8287 cells \[[@B15]\]. Using the same experimental design we showed that rSlpA and its cell wall binding fragment rSlpA~1--145~bind to LiCl-treated *L. acidophilus*ATCC 4356 cells. The interaction between the S-layer protein and the secondary cell wall component is supposed to be lectin-like and highly specific \[[@B56]\], and in artificial experimental procedures the lack of a specific interaction between two complementary surfaces may be masked by unspecific charge interactions with lower affinity. To obtain information about specific interactions, competition experiments with fragments of S~A~, CbsA and SlpA and the corresponding bacterial strains, or direct determinations of the K~D~values of the interactions, e. g. by surface plasmon resonance studies, are needed.
Amino acid sequence analysis of the *L. brevis*S-layer proteins revealed motifs with similarity to repeated C-terminal carbohydrate binding sequences detected in clostridial toxins, streptococcal glucosyltransferases and the S-layer proteins of *L. acidophilus*group organisms \[[@B14],[@B44],[@B45]\]. These motifs are supposed to play a general role in protein-carbohydrate interactions by acting as initial attachment sites and thus enabling the specific interactions to occur \[[@B44]\] and may thus be partly responsible for the observed positive cross-binding results between SlpA and *L. acidophilus*ATCC 4356 cells, and between the cell wall binding domain of CbsA and *L. brevis*ATCC 8287 cells (see above). The sequences of the potential *L. brevis*carbohydrate-binding motifs deviated to some extent from the consensus sequences determined for clostridial toxins and streptococcal transferases \[[@B44],[@B45]\]. The divergence of the sequences in distantly related organisms and different macromolecular structures is apparently allowed as long as the basic function of the motif, bringing the interacting partners to initial contact, is preserved.
The self-assembly domain of SlpA was shown to comprise residues 179--435 in mature SlpA, as truncated proteins encompassing this region were able to form a periodic structure indistinguishable from that formed by full length SlpA, as detected by electron microscopy. The length of the truncated protein was critical, since rSlpA~167--435~and rSlpA~149--435~as well as N-terminal truncations shorter than rSlpA~179--435~were unable to form regular lattices. Apparently, the region, or part of the region, encompassing amino acids 149--178 disturbs the lattice formation of the truncated proteins either by steric hindrance and/or by preventing the acquisition of a native conformation. Trypsin degradation experiments revealed two protease resistant peptides encompassing residues 190--423 and 209--423 in mature SlpA supporting the hypothesis about a morphologically separate, compact C-terminal unit, which most probably corresponds to the round, periodically arranged structures seen in electron microscope pictures of self-assembly products of SlpA (Fig. [4](#F4){ref-type="fig"}). Similar trypsin degradation experiments with whole *L. brevis*cells resulted in identical fragments but at a very low efficiency (data not shown), indicating poor accessibility of the enzyme to the N-terminal domain through the pores in the S-layer, and further supporting the presumption about a protease sensitive, more flexible N-terminal domain shielded from the environment beneath the C-terminal self-assembly domain. A protease-resistant, surface-located self-assembly domain has also been observed in the N-terminal part of the S-layer protein S~A~of *L. acidophilus*ATCC 4356 \[[@B14]\]. The results of the present study are supported by the report of Hynönen *et al*\[[@B18]\], in which an antiserum specific for the recombinant peptide SlpA~66--215~, originating from the cell wall binding region, was not able to recognize polymerized SlpA on *Lactobacillus brevis*ATCC 8287 cells. In the same report, whole S-layered *L. brevis*ATCC 8287 cells as well as the N-terminal part of SlpA, residues 66--146 of mature SlpA in minimum, were shown to bind to immobilized fibronectin. Fibronectin is highly glycosylated, and the binding of fibronectin to a region of SlpA shielded beneath the C-terminal domain may be explained by an interaction between the protruding oligosaccharide moieties of fibronectin and the identified N-terminal carbohydrate binding sequences of SlpA. In this respect the identification of human blood group A-trisaccharide as the receptor for the S-layer protein of a human *L. brevis*isolate \[[@B57]\] is of interest, especially considering that the nine N-terminal amino acids of the S-layer protein of this strain were identical with the N-terminus of SlpA.
Conclusion
==========
In this work SlpA of *L. brevis*ATCC 8287 was shown to be a two-modular protein in which the domains responsible for the self-assembly (C-terminal) and cell wall binding (N-terminal) are located in a reverse order compared to those in all other *Lactobacillus*S-layer proteins characterized thus far, reflecting the unrelatedness of SlpA with previously characterized *Lactobacillus*S-layer proteins. The study confirms the role of conserved, repeated, general carbohydrate binding sequences in the cell wall binding domains of *Lactobacillus*S-layer proteins, but in contrast to the *Lactobacillus acidophilus*-group organisms, the specific cell wall component interacting with the S-layer protein in *L. brevis*ATCC 8287 was shown to be other than (lipo)teichoic acid. As SlpA is a potential tool for mucosal immunization, the data presented in this study forms a basis for further studies concerning vaccine development. The mapping of surface exposed residues in the self-assembly domain of SlpA is currently in progress.
Authors\' contributions
=======================
SÅJ and UH performed the experiments (excluding electron microscopy, N-terminal sequencing and peptide mass mapping), analyzed the results, carried out the sequence analyses and prepared the manuscript. NI carried out electron microscopy, DP determined the lattice constants and performed the statistical analysis, UBS coordinated the EM studies, AP participated in the design and coordination of the study and helped to draft the manuscript. All authors read and approved the final manuscript.
Supplementary Material
======================
###### Additional file 1
**Multiple amino acid sequence alignment of the *L. brevis*S-layer proteins**. ClustalW -- alignment of the predicted mature forms of SlpA, SlpB, SlpC, SlpD, Q03NT3 and Q03P39 proteins. Asterisks, colons and dots indicate identical, strongly similar and weakly similar amino acids, respectively. A primary consensus sequence is shown below the alignment.
######
Click here for file
Acknowledgements
================
We thank Ilkka Palva for valuable discussions and critical reading of the manuscript, Esa Pohjolainen, Outi Immonen and Sinikka Ahonen for skillful technical assistance and Nisse Kalkkinen for amino acid sequencing and mass mapping.
This work was supported by the FP6 EC-STREP project NAS-SAP 13523. The work was performed in the Centre of Excellence on Microbial Food Safety Research, Academy of Finland.
|
{
"pile_set_name": "PubMed Central"
}
|
Q:
GWT showing low disk space
I am new to GWT. Iam using eclipse Indigo along with GWT. The moment I open eclipse and start running a simple program I have created , my system shows low disk space. I can understand it is something related to cache. But dont know how to proceed. The system becomes very slow and not allowing me to work. Again If I close my eclipse and browser , things become normal. Before starting my eclipse I have 2 GB in C. But after some time it become 100 mb and forcing me to clean or close.
What I need to do?
A:
This is a known issue of the Google Plugin for Eclipse.
Workaround:
avoid relaunching the DevMode too much (you can launch it once and then reload the app at will)
clean your temporary directory regularly
|
{
"pile_set_name": "StackExchange"
}
|
TEXAS COURT OF APPEALS, THIRD DISTRICT, AT AUSTIN
NO. 03-04-00117-CV
In re Joseph Martinez
ORIGINAL PROCEEDING FROM HAYS COUNTY
M E M O R A N D U M O P I N I O N
We are advised that following the Court's order granting temporary relief in this
mandamus proceeding, the district court stayed Joseph Martinez's trial in Hays County cause number
CR-03-787 pending final disposition of his appeal to this Court in Ex parte Joseph Martinez, number
03-04-00118-CR. Because we are confident that no further order is required to preserve the Court's
jurisdiction, the petition for writ of mandamus is dismissed.
__________________________________________
W. Kenneth Law, Justice
Before Chief Justice Law, Justices Kidd and Puryear
Filed: March 26, 2004
|
{
"pile_set_name": "FreeLaw"
}
|
EXCLUSIVE: Denée Benton (Hamilton), Louisa Jacobson (Gone Hollywood), Taissa Farmiga (The Twilight Zone), Blake Ritson (Krypton) and Simon Jones (The Hitchhiker’s Guide to the Galaxy) are set to co-star in Julian Fellowes’ The Gilded Age drama series at HBO. The project, which moved from NBC to HBO earlier this year, is a co-production between HBO and Universal TV. The fictional epic of the millionaire titans of New York City in the 1880s hails from the Downton Abbey team of Fellowes, producer Gareth Neame and director Michael Engler. They join previously announced cast Christine Baranski, Cynthia Nixon, Amanda Peet and Morgan Spector.
Created, written and executive produced by Fellowes, The Gilded Age centers on a period of immense economic change in America, of huge fortunes made and lost, and the rise of disparity between old money and new. Against this backdrop of change, the story begins in 1882 – introducing young Marian Brook, the orphaned daughter of a Southern general, who moves into the home of her rigidly conventional aunts in New York City. Accompanied by the mysterious Peggy Scott, an African-American woman masquerading as her maid, Marian gets caught up in the dazzling lives of her stupendously rich neighbors, led by a ruthless railroad tycoon and his ambitious wife struggling for acceptance by the Astor and Vanderbilt set. Will Marian follow the established rules of society, or forge her own path in this exciting new world that is on the brink of transformation into the modern age?
Related Story 'The Gilded Age': Christine Baranski, Cynthia Nixon, Amanda Peet & Morgan Spector To Star In HBO Period Drama
Benton will play Peggy, who was a young child when slavery was abolished and her parents were freed in West Virginia. Raised in NY, she is among the first generation of African Americans who never really knew slavery first hand. She has a past which she is not anxious to share with anyone, but like Marian, she is in need of a friend and a new start when they meet in Charleston. They travel to New York together and decide that Peggy will pose as Marian’s maid until she can decide what to do next with her life. Her dream is to become a writer, but she has difficulty in expressing this because she thinks she will be perceived as foolish for having such a desire.
Jacobson is Marian Brook. Our principal heroine. Lovely and strong. Born to an old southern family, but her father has left her without a penny. In one way, Marian knows that her probable fate will be to marry as well as she can and survive, but she wants more than this. She is of her own time, and so curtailed by the rules then obtaining, but there is a modern streak in her, too. She wants to do something with her life. She wants to be fulfilled. She moves from Charleston to New York City after her father dies to live with her estranged aunts.
Farmiga portrays Gladys Russell. A classic, innocent and lovely child of the rich who doesn’t want a governess or for her mother to treat her as a child anymore, she wants to be out in society meeting suitable young men. She doesn’t really know how her father made his money, and she doesn’t much care, but she is used to it and wouldn’t know what to do without it. She has an independent streak, but her petulance is no match for her mama. Her mother uses her as a tool for her own ambition and forces her toward socially advantageous situations.
Ritson plays Oscar Van Rhijn, Agnes van Rhijn’s charismatic son. He’s decided it’s time to settle down and has become obsessed with money while on the lookout for a serious heiress who will allow him to live, as he would put it, properly. Smart, attractive, poised, charming and mischievous, he enjoys witty banter. He is one of the few who will stand up to his mother and will not listen to his mother’s advice which will cause her a good deal of frustration.
Jones portrays Bannister. As an English immigrant, the van Rhijn’s butler likes to give the impression that he is immensely grand but in fact he was the son of a poor cobbler from the English midlands, whose grandmother paid for him to sail on an emigration ship when he was fourteen years old. He came up the hard way, learning how to speak, how to dress, how to behave, changing jobs each time he felt he was ready for the next step. He joined the van Rhijn household a year before the death of Mr van Rhijn and so, for the old lady, he is a link with her own past. He will take a risk, exposing his rival in the Russell household, Church, by digging up his unsavory past and humiliating him in front of the staff he commands.
Fellowes, Neame, Engler and David Crockett executive produce and Engler also directs.
2019 HBO Max Pilots & Series Orders
Benton currently stars as Eliza in Broadway’s Tony-winning musical Hamilton. On television, she starred as Ruby in season 2 of Lifetime’s hit series UnReal and filmed the pilot 25 for CBS. Upcoming, Benton will appear alongside Dakota Johnson, Casey Affleck, and Jason Segel in indie feature The Friend. which recently premiered at the Toronto International Film Festival.
Jacobson shot the FX pilot, Gone Hollywood, opposite John Magaro and Judd Hirsch, written and directed by Ted Griffin and produced by Scott Rudin. On stage, Jacobson recently starred as Juliet in The Old Globe’s production of Romeo and Juliet, directed by Barry Edelstein.
Farmiga’s recent television credits include FX’s American Horror Story and The Twilight Zone for CBS All Access. She can also seen in features The Nun and Clint Eastwood’s The Mule. She will also appear in Quibi’s upcoming anthology series, 50 States.
Ritson was most recently seen playing DC Comic’s super villain, Brainiac, in Syfy’s Krypton. Other previous credits include Indian Summers for UK’s Channel 4 and Starz’s Davinci’s Demons, along with starring roles in the miniseries Upstairs Downstairs and World Without End with Cynthia Nixon.
Jones is best known for his portrayal of Arthur Dent in the radio, television and stage adaptations of The Hitchhiker’s Guide To The Galaxy. He also appeared as Bridey in miniseries Brideshead Revisited, and as Sir Walter Raleigh in Blackadder. He was seen most recently in the feature film version of Downton Abbey.
Benton is repped by Perennial Entertainment, WME, and Schreck Rose Dapello Adams Berlin & Dunham LLP. Jacobson is repped by CAA and Brookside Artist Management. Farmiga is repped by ICM Partners, Anonymous Content and Peikoff Mahan. Ritson is repped by ICM Partners, Authentic Talent and Literary Management, Curtis Brown in the UK and Peikoff Mahan. Jones is repped by Innovative Artists and Roger Carey Associates.
|
{
"pile_set_name": "OpenWebText2"
}
|
Association between Cognitive Status before Surgery and Outcomes in Elderly Patients with Hip Fracture in a Dedicated Orthogeriatric Care Pathway.
Dementia is associated with a worse prognosis of hip fracture, but the impact of a dedicated geriatric care pathway on the prognosis of these patients has not been evaluated. According to the cognitive status before surgery, our main objective was to compare mortality rate at 6 months; secondary outcomes were to compare in-hospital complications, the risk of new institutionalization, and the ability to walk at 6 months. Between 2009 and 2015, all patients (>70 years) admitted after hip fracture surgery into a dedicated unit of peri-operative geriatric care were included: patients with dementia (DP), without dementia (NDP), and with cognitive status not determined (CSND). Data are expressed as hazard ratio (HR) for multivariate cox analysis or odds ratio (OR) for multivariate logistic regression analysis and their 95% confidence interval (CI). We included 650 patients (86±6 years): 168 DP, 400 NDP, and 82 CSND. After adjustment for age, sex, comorbidities, polypharmacy, pre-fracture autonomy, time-to-surgery, and delirium, there were no significant differences for 6-month mortality (DP versus NDP: HR = 0.7[0.4-1.2], DP versus CSND: HR = 0.6[0.3-1.4], CSND versus NDP: HR = 0.8[0.4-1.7]); but DP and CSND were more likely to be newly institutionalized after 6 months compared to NDP (OR DP = 2.6[1.4-4.9], p = 0.003, OR CSND = 2.9[1.4-6.1], p = 0.004). 92% of population was walking after 6 months (63% with assistance): no difference was found between the three groups. In a dedicated geriatric care pathway, DP and CSND undergoing hip surgery have the same 6-month mortality and walking ability as NDP.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The streetlights in San Diego are doing more than illuminating sidewalks.
Around 3,200 cameras and sensors have been installed atop street lights or lamps posts that collect temperature, air pressure and humidity levels. The purpose is to gather information that will be of use to the city and developers for future infrastructure and sustainability projects. Another 250 video-equipped lamps are currently being installed.
TRAFFIC CAMERA IN ITALIAN VILLAGE CATCHES 58,000 SPEEDERS IN TWO WEEKS
“The information will give us great insight into how people move through the urban environment,” said Erik Caldwell, the city’s director of economic development. “This information is critical to planning and making good decisions.”
The city plans to install 4,200 smart sensor nodes on street lights by 2020, Caldwell told the San Diego Union-Tribune. The cameras are equipped with video and audio capabilities and will be used to gather real-time video or video data. The footage will be retained for up to five days and will only be available to police if a crime has been committed in the vicinity. A large concentration of the camera and sensor technology is located downtown.
Caldwell said the video data could help city engineers and software developers solve issues at certain intersections, KNSD-TV reported. The cameras and sensors are not used as a surveillance system, he said.
CLICK HERE TO GET THE FOX NEWS APP
San Diego resident Emma Hall Bilsback told the news station she fears the city’s good intentions could have bad consequences if it gets into the wrong hands.
“And it's the internet so anyone can just hack into it,” Hall Bilsback said. “At the stage we're in that technology is advancing so quickly, but the laws are not advancing anywhere as quickly.”
|
{
"pile_set_name": "OpenWebText2"
}
|
“I think just getting older in the league, you have to continue to be smarter,” said Aaron Rodgers. Credit: Mark Hoffman
Green Bay — Suddenly, the unproven kid from Chico, Calif., who took over for Brett Favre is 30 years old.
The quarterback once booed by his own fans during an intrasquad scrimmage at Lambeau Field, the one who took over for a legend in an unprecedented fashion has officially entered the back nine of his career. Since that manic summer of 2008, Aaron Rodgers has won a Super Bowl, a league MVP award, received a historic $110 million contract extension and, last season, fractured his collarbone.
As the Green Bay Packers quarterback explains to the Journal Sentinel's Tyler Dunne in a sit-down interview, this has all made him wiser.
On three different occasions, Rodgers cites his age. Entering his 10th NFL season — and seventh as the starter — Rodgers looks back at the injury that turned the Packers' 2013 season upside down and why he must play smarter in light of it. He details his relationship with Mike McCarthy, saying they're both "alpha dogs" and can both get "salty" at times. And Rodgers also explains the responsibility that comes with being the longest-tenured player on the team.
Q. Let's start with Nov. 4, 2013. You fracture your collarbone. Did you realize the magnitude of everything the moment it happened?
A. I knew I was hurt. I like to be able to get off the field under my own power, in a timely fashion with any injury. When I came over to the sidelines—a lot of times when you take a hit and come off—it kind of goes away or lightens up a little bit. This one lingered. Doc came over and saw me, and when he pushed on it, I knew something was wrong. I came in the back, got an X-ray, looked at the X-ray and it looked fine. But the problem was we had X-rayed the wrong shoulder. When they got the right X-ray, they could tell there was a fracture there and I knew it was going to be some time. I've always wanted it to be on the shorter side of any recovery. But this proved to be—despite some of the early leaks, which we weren't sure where they were coming from, the early leaks said three to six and two to four (weeks). It was a significant injury, one that was tough to deal with physically, as far as sleeping and being able to work out, but also mentally being separated from the team and having to watch from the sideline and especially as we tumbled there for a while until we righted it and I was able to come back. It was definitely a tough injury."
Q. When you walk back onto the field — you're giving fans the thumbs up and the stadium erupts — are you thinking back to Family Night '08, practices '08 when some of these fans are booing you?
A. I did. That's a great point. That was one of the top moments of my career. I actually got teary-eyed coming back onto the field when I got the ovation. I'd put it right up there with running off the field after we beat the winless Lions and finished 6-10 in '08 and I got a very nice ovation. And then, up there with the "Welcome Back to Lambeau" when we won the Super Bowl. Those are three of my top moments at Lambeau. One of them was really special with the Super Bowl. And the other two, one I'm walking back on the field and the other we're out of the playoffs, the season's over and we just beat a hapless Lions team. That was a special moment, one I'll never forget. In that moment of sadness, knowing that I was done, I got just an incredible perspective on the connection that we as players and me personally have with our fans.
Q. For you personally, why did this ovation mean so much to you after everything you've been through?
A. The '08 summer was a difficult one, as Brett was trying to get back into the mix and some of the comments that I heard or saw, you know, were hurtful. I never held that against the fans because there was such a small percentage and the fans are so loyal they just want to see a winning product on the field. As difficult as that season was to get through, to have a moment like that at the end of the '08 season and then to also have a moment on the field this past season, that kind of outpouring of love is what makes this game so special. And more than that, it's what makes this organization and this city, this franchise so special. There's a direct connection between the fans and the players. And they love their football, they love their Packers. I'm proud to be one of them.
Q. Those seven games where you weren't the Green Bay Packers' starting quarterback, what was your personal darkest moment?
A. I don't know if there were any real dark moments. I learned when I was on the IR in '06 when I broke my foot that it is tough to be separated from the team. And I had a reminder in 2010 when I had my second concussion and had to go home for a couple days. It's tough to be separate from the team, but there's a lot to be said about the kind of teammate you're going to be in those situations. I tried to be as helpful as I could to Seneca and then Scott and then Matt in realizing that when you're done playing it's about more than what you did on the field. It's going to be the kind of teammate you were and the kind of friend you were. I wanted to do as much as I could to help those guys out. And also, there's something inside you that wants to feel connected to a team when you're out. For me, that connection was made through being in the meeting rooms, being on the sideline with the headset, talking to the starter on the sidelines and trying to help them out as much as I could.
Q. Did sitting out that long further feed your competitiveness?
A. It didn't feed my competitiveness. It sucked. It made me have a greater appreciation for what we do and the opportunity we have, much like I felt when I had to go home for two days during the New England week in 2010. I love this game. I'm blessed to be able to play it. I'd love to play it as long as I possibly can. And hopefully, I can stay relatively injury-free the rest of the way.
Q. In light of a fractured collarbone, do you feel the need to change, to tweak your playing style at all?
A. I think just getting older in the league, you have to continue to be smarter. After I took that second concussion, I think I've been smarter with my running in not taking a whole lot of chances. Alex (Van Pelt) has done a great job this year of getting the quarterbacks in the right frame of mind as far as our thought process and our reads, just honing in on those. I think I'm always going to want to use my legs — it adds an extra dimension to my game that's always been helpful. It's about knowing when to do that and being smarter every year. The more games I play, the more experience I have and it will hopefully translate to making better decisions.
Q. If it was up to Ted (Thompson) and Mike (McCarthy), would they want you to stay in the pocket?
A. Ted, probably. Mike just wants me to play I think. But Ted probably wants me to stay in there a little more.
Q. But isn't that what makes you different from other quarterbacks, different from the best passers in the league? You can use your feet to keep plays alive.
A. I think so. But it's about knowing when to do that and knowing when to get to the checkdown and throw it away. We've done some good scheme tweaks. But I'm 30 now. So I'm a lot smarter than what I was in my 20s.
Q. How satisfying was the Week 17 win at Chicago to clinch the division your first game back?
A. That was right up there with the top games in my career. It wasn't the cleanest game of my career. I made a couple uncharacteristic mistakes. But especially the last drive was one of the more special moments that we've shared together — Mike and I, in our time — and one we'll always look back on fondly.
Q. And one week later, it's over. Have you thought about that last offensive possession against San Francisco this off-season?
A. Not really. We had it down there. We had a chance to take the lead. We tied it and wish we could have gotten it into the end zone. But it's a game of inches.
Q. What separates the Green Bay Packers from the San Francisco 49ers?
A. Not much.
Q. How would you describe your relationship with Mike McCarthy, your head coach?
A. I think it's a real good relationship. I think there's a lot of communication between us. I think there's a lot of trust. We played a lot of games together, shared a lot of wins together, had a lot of ups and downs together. But it's been mostly ups. And we know each other well. We know each other's body language. We can read each other on the field. I think we're in a real good place.
Q. So when you say "body language," what would be an example of that?
A. It's probably more on his side, but he can tell sometimes what kind of mood I'm in and what kind of play I'm looking for. And I can tell on the flip side by the inflection of his voice what he's thinking about on certain plays or if I look over at him and he's giving me the "McCarthy eye" or the snarl, I know what he's thinking. But I think there's a lot more laughter in store for our relationship in the coming years and I look forward to that.
Q. We all saw the sideline deal between you two at Cincinnati in Week 3. How often do you two butt heads?
A. Not that often. That wasn't really butting heads. That was a couple competitors having a conversation. That happens from time to time when competitors collide. But every now and then, you have to stir it up a little bit and it all comes back together.
Q. So why is that important for both of you to be competitive, to be yourselves and stir it up?
A. Because we're competitors. We're both alpha dogs. We're both leaders. We just have to remember there's two alpha dogs leading the sled, not one.
Q. Is this a difficult power struggle?
A. No, I don't think so. It's just how we both view the relationship and now that he's 50 and I'm 30, I think we're both a little wiser.
Q. What do you and Mike do off the field? Do you guys hang out?
A. Yeah, we've always had a good relationship. We spend a lot of time together at the facility and have a lot of conversations in group settings and also one-on-one settings during the game week and get together every now and then off the field. I spent some time together with him on Christmas this year.
Q. So can you get "salty," as your coach said after that Bengals game?
A. I think he was referring to being on edge and sometimes I get on edge from time to time. But, yeah, we're both salty.
Q. This week you said this team has a "different feel" and a "hunger." Where have you seen that and why is it different this year?
A.There are some different players and different coaches (and) that breeds new energy. I think you've seen some young guys come in that look good in practice. Whenever that happens, it just kind of picks up the intensity of everybody else. You always need to add some new guys to the mix. It helps adding (Julius) Peppers. We've got some guys back as well. (Bryan) Bulaga back. DuJuan Harris back. Casey Hayward. Bringing those guys back kind of raises everybody else's play. You start thinking about — and guys do this naturally — you start thinking about who's going to make the 53. And you look around at the kind of talent we're adding, you add a guy like Sam Gash, who's a vocal presence at practice. And Alex in his new role I think has really amped up the focus, the intensity and really the energy at practice. It's fun to feel that.
Q. What responsibilities come with being the fourth-oldest player on the team, the longest-tenured Packer and you are an elder statesman around here all of a sudden?
A. Yeah, nobody's been here as long as I have, which is interesting. You find yourself having more inside jokes with people who work here — the training staff, the equipment staff — because I've been around them for so long, which is fun. But I think it makes you have to really spend more time on relationships with the younger guys, whether it's at a lunch table or a breakfast table or it's setting up a get-together or going to a get-together with teammates. It's important to make the most of those relationships because team chemistry is probably an underrated part of a team's success. And when guys are hanging out together and spending time together, truly caring about each other, there's a closer-knit feeling and a trust in the guy who's lined up next to you and you're in the huddle with them.
Q. So what is your leadership style then? How would you characterize that?
A. It's by example, first. That's most important. Words can fall on deaf ears when there are no actions associated with it. But it is also a lot of words based on my experiences and there's an offense that's on paper and there's an offense that gets adjusted from time to time, so the guys need to know the adjustments. One thing I've always appreciated with various coaches, I'll highlight Edgar Bennett. He always takes notes of stuff I've said in meetings and relays that to the receivers because the relationship between myself and the skill guys is very important as we do a lot of non-verbal communication and a lot of eye-contact communication. So the guys need to learn that and be ready for it. Physical errors are going to happen. They're going to happen by me. But the mental errors and the lapses in preparation don't really have a place on this team. That's what Mike always stresses and I've always stressed, is being perfect in your execution. Physical errors happen. So be it. But you have to make sure you're doing the right thing every time.
Q. How do you go about motivating specific teammates? What are some things that you do to motivate players?
A. I think you can inspire guys. But you have to be self-motivated in this league. So I try to inspire them, encourage them and figure out how to push the right buttons on each guy because everybody responds differently to different types of leadership styles. I learned that back at my coaching class with Coach (Russ) Critchfield at Butte College. But you have to be self-motivated to last in this league. And that's what I tell the young guys — you have to be a self-starter, you have to put the time in in the off-season and during the season. Make sure you're studying the right way, studying the right things and getting yourself ready to play by Sunday because ultimately the guys who are the self-motivated guys — two guys who are a great example are John Kuhn and Jarrett Bush. They've been in this league for a long time. Talented guys but not the most talented guys. They're guys who care about it and are always putting the time in the weight room, and the preparation shows. They are guys who are consistently our best special teams players and our smartest guys on offense and defense.
Q. Last year when we were sitting here you said there are "silly" and "comical" things out there that you still see, slights that you can use as motivation for yourself. Is that something you still seek?
A.I've never really seeked it, but I have friends who feel it's important to tell me that kind of stuff. I think the older you get, the less that really means to you. And I do Twitter, but I don't do it during the season. So during the season, I have really zero social media access. So I don't really pay a lot of attention to that. I know that my lifestyle and the career I've had leads to greater scrutiny and at times greater praise. But that stuff is pretty fickle and I don't give a whole lot of credence to the experts on Twitter or any other social media site — or really on TV for that matter. I know it comes with the territory. I embrace it. It's part of my life now and my career. But I don't need that to motivate. I'm very self-motivated.
Q. But for a while this has been a source of motivation for you that does keep that chip on the shoulder. Is this an area where you've grown?
A. Like I said, I'm 30 now. I'm a lot more mature. That's tongue in cheek. But I think the older you get, things that used to motivate you aren't as important anymore. You refocus on things that are really important. I'm going to focus on the challenge to be great every day. That's a strong motivator. I've played with a chip on shoulder. And I feel that I've proved a lot of my critics, my initial critics, wrong. Now, it's about proving it to myself and my teammates that I can still be the best every day and I look forward to leading this team for a number of years.
Q. A lot of quarterbacks get to the eighth, ninth year of their careers and start to fade — even Hall of Famers could start to fade at this point. How do you sustain a level of excellence?
A. To me, it's a lot about how you take care of your body in the off-season. And in-season, finding the right routine to get your body right every week. And mentally, it's about the preparation that gives you the best chance to be successful. You learn that over the years. You refine it. You feel good about the week and how you go about getting ready to play on Sunday. And then you have to trust your instincts and your reactions when you get on the field and have that execution that comes from doing it a long time. I look forward to that challenge. I love the fact that my teammates count on me every week to play at a high level. I expect greatness when I step on the practice field and on the game field.
Q. You're a "110 Million-Dollar Man," an MVP in a town of 105,000 people. Can you go out and live the way you want to live or do you need to stay private, secluded?
A. No, I love going out. I love the interactions with the fans. It's a first-name basis at a lot of places. There's a lot of places that I may tend to go to over others because of the feel I have there or the food. Like Chives for instance, which I have zero stake in for the record. I just love to eat there and love the people there. But, no, I'm going to live my life. Especially in Green Bay, there's a special connection you feel when you step on the field, that I felt that night when I broke my collarbone and I feel every time I take the field. I embrace being a Packer, living here, working here and the interactions with the fans.
|
{
"pile_set_name": "OpenWebText2"
}
|
Pathway length and evolutionary constraint in amino acid biosynthesis.
The evolutionary properties of a metabolic network may be determined by the topology of the network. One attribute of pathways that make up the network is the number of enzymatic steps between initial substrates and final products. To determine the effect of pathway length on evolutionary lability of pathway structure, we examined amino acid biosynthetic pathways across 48 sequenced organisms. We demonstrate that longer pathways exhibit lower rates of change in pathway structure than shorter pathways. This finding suggests that increasing complexity may increase constraint on evolutionary change.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Bandwagon Survey
For fans of NHL teams that didn't make the playoffs. Who are you rooting for?
* Erforderlich
|
{
"pile_set_name": "OpenWebText2"
}
|
Mycoplasmal pneumonia in pigs in Croatia: first evaluation of a vaccine in fattening pigs.
The immunoprophylaxis of mycoplasmal pneumonia of swine (MPS) caused by Mycoplasma hypopneumoniae was investigated for the first time in fattening pigs in Croatia. The incidence of MPS was monitored in pigs weighing on average 27.5 kg (12 weeks old) after immunization with a M. hyopneumoniae vaccine. Of 350 pigs in each group, in the nonvaccinated group 55 animals (15.7%) were affected by pneumonia and 11 (3.1%) died of consequences of pneumonia, whereas in the vaccinated group 20 pigs (5.7%) were affected by pneumonia without any death due to the infection. In the nonvaccinated group 44% more pigs were individually treated with antibiotic, and these animals received in-feed therapy for more than 1/4 of the fattening period. Vaccinated pigs gained weight faster, at the rate of 0.745 kg/day (or 82 g/day more) than control animals. The mean score of lung lesions due to M. hyopneumoniae was 10.51 in the control pigs and only 0.54 in the vaccinated animals. The total tissue alterations on lungs due to M. hyopneumoniae, Pasteurella multocida and/or Actinobacillus pleuropneumoniae expressed as the mean-score were 13.21 in the control group and 2.98 in the vaccinated group. According to the results of evaluation of the M. hyopneumoniae vaccine in the field, the vaccine appeared to provide an adequate immunity in fattening pigs but was less effective when administered to younger pigs at 1-3 weeks of age.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Current topics in neuropathology. Cushing's disease.
The application of modern investigative techniques, particularly electron microscopy and immunohistochemistry, to the pituitary gland in Cushing's disease have confirmed that in the majority of cases (up to 90% in some series) the disease is due to a corticotroph microadenoma. It has also been shown that the tumours may produce not only ACTH, but also other peptides derived from the same precursor molecule, pro-opiomelanocortin and, in a small minority of cases, other pituitary hormones (e.g. prolactin). Since these peptides are known to have physiological actions they may account for some of the varied symptoms and signs of Cushing's disease. Because of the high incidence of single tumours the treatment of choice in many centres has become selective adenomectomy by the transsphenoidal route. However, a minority of cases appear to be the result of primary hypothalamic or central abnormalities and this may account for the identification of a normal pituitary gland or of corticotroph hyperplasia (with or without tumour formation). It is not possible at the present to identify these groups of patients on the basis of biochemical testing. It is hoped that detailed prospective studies correlating hormone secretion, responses to biochemical testing and detailed investigation of pathological tissue will provide further insight into the pathogenesis of particular variants of the disease.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
How to set an image in imageview swift 3?
So I have an image view titled cashOrCredit and have am trying to set it's image programatically but somehow not able to.
First I set the image like this
cell.cashOrCredit.image = UIImage(named: "cash1.png")
and I get an error saying a separator of "," is needed.
Then I tried it this way
var cashImage: UIImage?
cashImage = "cash1.png"
cell.cashOrCredit.image = cashImage
But I get a THREAD 1 EXC BAD INSTRUCTION error.
I can't seem to understand what is going wrong ?
Here is the error
A:
Try this:
cell.cashOrCredit.image = UIImage(named: "cash1")
and check "cash1.png" image is available in Assets.xcassets or not.
If you get solution, then give upvote to my answer.
A:
Updated for Swift 3:
use below simple code, to set the image to UIImageView;
class YourViewControllerName: UIViewController {
var mYourImageViewOutlet: UIImageView?
func addImageToUIImageView{
var yourImage: UIImage = UIImage(named: "Birthday_logo")!
mYourImageViewOutlet.image = yourImage
} // call this function where you want to set image.
}
Note: "Birthday_logo" type of image must be present in your Assets.xcassets of your project.
I attached the screenshot if you want any help please refer it.
****// used anywhere you want to add an image to UIImageView. [Here I used one function & in that function, I write a code to set image to UIImageView]****
Enjoy..!
|
{
"pile_set_name": "StackExchange"
}
|
Q:
How can I use google.visualization typings with Angular CLI?
I'm trying to use Google Charts in an Angular CLI (7.2.3) project but am running into an issue getting the typings to work.
First, I installed the typings with this command (both with and without the -dev flag):
npm install --save-dev @types/google.visualization
After doing this, intellisense starts working immediately in Visual Studio Code and I don't get any highlighted errors when I create a simple test like this:
const chartBoxStyle: google.visualization.ChartBoxStyle = {};
However, when I try to build by running ng build, I get this error:
error TS2503: Cannot find namespace 'google'.
I have tried adding this to my file with no luck:
declare const google: any;
My tsconfig.json file has the following for typeRoots and I see the google.visualization folder in there:
"typeRoots": ["node_modules/@types"]
Any help would be greatly appreciated as I'm out of ideas on how to progress past this.
A:
Summary
The problem is the "types" property in the ./src/tsconfig.app.json file.
Even though the root ./tsconfig.json file sets "typeRoots" to ["node_modules/@types"], the ./src/tsconfig.app.json file disables inclusion of those types by setting its own types property to an empty array.
Solution
Open ./src/tsconfig.app.json and make one of two changes:
Delete the "types": []" property; that will tell the compiler to include all typeRoots packages.
Alternatively, add the types that you want to use into the "types": []" array.
The latter option would look like this:
"types": [
"google.visualization"
]
Details
ng build reads its configuration from the ./angular.json file.
That ./angular.json file sets "tsConfig" to "src/tsconfig.app.json".
That ./src/tsconfig.app.json file sets its "types" property to an empty array.
{
"extends": "../tsconfig.json",
"compilerOptions": {
"outDir": "../out-tsc/app",
"types": [] <------------------------------- empty array
},
"exclude": [
"test.ts",
"**/*.spec.ts"
]
}
That's the problem, because as the TypeScript documentation says: "If types is specified, only packages listed will be included."
|
{
"pile_set_name": "StackExchange"
}
|
For a stylish yet sporty look, these Flex Appeal-Serengeti women's trainers by Skechers are perfect. With a stylish animal print upper designed on a breathable mesh fabric upper, your feet can breathe during sportswear or even for leisure wear. Walk, jog or run on luxury comfort memory foam insole to support your feet whilst the padded collar provides additional ankle support. The shock absorbing FlexSole midsole is radically lightweight, as is the nearly seamless upper. Ensure your feet can move naturally with the flexible rubber outsole with great traction which shapes to the movement of your feet.
Upper: Textile MeshLining: TextileSole: Rubber
Choose a ranking for this item. 1 star is the worst and 5 stars is the best.
Please tell us what you think and share your opinions with others. Be sure to focus your comments on the product.
NOTE: HTML tags are not allowed.NOTE: Reviews require prior approval before they will be displayed
|
{
"pile_set_name": "Pile-CC"
}
|
.row-split {
.col-content {
margin-top: 20px;
}
@media (min-width: @media-xs) {
display: flex;
flex-direction: row;
.col-side {
width: 360px;
}
.col-content {
flex-grow: 1;
margin-top: 0;
}
}
}
.palette-preview {
.rs-panel {
position: relative;
height: 578px;
}
}
.panel-color-wrap {
.panel-color {
th,
td {
text-align: left;
padding: 11px;
font-family: 'DejaVu Sans Mono';
}
}
}
.palette-logo-tool {
margin-top: 20px;
}
.palette-image-preview {
position: relative;
margin-top: 20px;
padding: 10px;
border-radius: 6px;
}
.palette-image-position-dot {
position: absolute;
background: #fff;
width: 8px;
height: 8px;
border-radius: 4px;
border: 1px solid #000;
}
.circle-picker-wrapper {
display: inline-block;
vertical-align: top;
}
.sketch-picker-wrapper {
margin-left: 20px;
display: inline-block;
position: relative;
.sketch-color-review {
padding: 5px;
background: rgb(255, 255, 255);
border-radius: 1px;
box-shadow: rgba(0, 0, 0, 0.1) 0px 0px 0px 1px;
display: inline-block;
cursor: pointer;
}
.sketch-color-value {
width: 68px;
height: 100px;
border-radius: 2px;
}
.sketch-picker-overlay {
position: absolute;
z-index: 2;
}
.sketch-picker-backdrop {
position: fixed;
top: 0px;
right: 0px;
bottom: 0px;
left: 0px;
}
}
|
{
"pile_set_name": "Github"
}
|
A survey of anesthesiologist and anesthetist attitudes toward single-use vials in an academic medical center.
To evaluate whether proper implementation of safety measures was uniform at 5 hospitals, and to elucidate motivating factors that lead to nonadherence. Electronic anonymous survey instrument. Academic medical center. Of the 319 surveys sent to anesthesia providers across 5 hospitals, 89 responses were obtained. Questions addressed compliance with Centers of Disease Control (CDC) safety standards and the rationale for anesthesia providers' decisions to comply or not comply with these standards. 59.6% of respondents reported that they had reused vials between cases, while 40.4% had never done so. Of the 89 respondents, 63 (44%) felt that cost was the primary factor that prevented them from using entirely new medications on each case. Thirty-two (23%) reported convenience/efficiency as the reason; 11 (8%) responded that time prevented them from using entirely new medications on each case; 14 (10%) reported that the environment was a driving factor; and 3 individuals (2%) responded apathy. Eighteen (13%) responded "other" and, when asked to amplify a response, most of these individuals reported that they do use entirely new medications on each case. Safe anesthetic practices were not uniform among respondents, and one of the main reasons given for noncompliance with safe standards was cost.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Old Town Square
REVITALIZING A TREASURED COMMUNITY EVENT SPACE
OLD TOWN SQUARE
FORT COLLINS, CO
INFRASTRUCTURE UPGRADES AT THE CORE OF URBAN REVITALIZATION
After 30 years of use, Old Town Square was due for an upgrade. The beloved square was suffering from aging infrastructure that could not keep up with current demand. With the need for utility improvements came the opportunity to refresh the space. The most critical aspect of the renovation effort was to maintain the intimate feeling of the square. Through extensive stakeholder feedback, studioINSITE created a detailed program document, schematic design and construction documentation.
PRESERVING COMMUNITY TREASURES, UPGRADING FOR TODAY'S USES
The iconic fountain was updated and a new water feature was added. A large performance stage was designed to host Fort Collins' many outdoor concerts. The redesigned Old Town Square is a more unified space that can host large gatherings. studioINSITE's design efforts successfully revitalized the heart of the community while maintaining the essence of the place that people cherish.
|
{
"pile_set_name": "Pile-CC"
}
|
Linkbar
Welcome!
Habit & Home is an online publication which was formed with the hope of bringing strangers together by recognizing similarities in one another through verbal and visual storytelling, celebrating various practices of habit, and broad perspectives on home.
Elsewhere
Social
Follow
Other Categories
Search
Archive
Habit & Home contains original written and visual content from both Cassandra Dias, and other fellow creatives. All words and photographs not belonging to Cassandra Dias have been approved for use, and properly credited.
Thursday, November 26, 2015
It always amazes me what I am capable of making with my own two hands.
Just spent the afternoon in the studio cranking out new pottery pieces, and these beauties were fresh out of the kiln and ready to bring home. It always amazes me what I am capable of making with my own two hands.
|
{
"pile_set_name": "Pile-CC"
}
|
Sector 9 started in La Jolla, CA in 1993 with a bunch of friends, a halfpipe, pool table, ping pong table, and a shaping room all across the street from some nice smooth hills that lead down to the reefs. Sector 9 makes longboards of all shapes and sizes. Complete longboard series are available from Sector 9. Check out their Platinum series, Bamboo series, Cosmic Series, sidewinder Series, Mini series, OG series, and Deep End Series.
|
{
"pile_set_name": "Pile-CC"
}
|
The 'Distress Barometer': validation of method of combining the Distress Thermometer with a rated complaint scale.
Screening instruments may enhance the clinician's ability to detect elevated levels of distress in cancer patients, but these are often neither suitable nor effective for the routine of daily care for cancer patients. The newly developed Distress Barometer (DB) was intended to provide medical doctors with a convenient tool to interpret 'at single glance' the nature and the intensity of distress in ambulatory cancer patients. The DB, i.e. a combination of the Distress Thermometer (DT) and a new tool, the Colored Complaint Scale was developed to improve the specificity of distress screening without decreasing the sensitivity of the Distress Thermometer. Distress was screened in a sample of 538 out-patients, using the Hospital Anxiety and Depression Scale (HADS) and the new Distress Barometer (DB). The results confirm the validity of the Dutch version of the DT against the HADS as standard measure. In addition, it was found that the overall accuracy of the new DB was higher, with a sensitivity of 0.79 and a specificity of 0.81. These results indicate that the Distress Barometer, which is convenient for both patients and doctors, can be used as an acceptable, brief and sufficiently accurate method for detecting distress in cancer patients.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
How to iterate over a char pointer array returned by a function in cpp
I create a function that creates a 28 array from random chars from a-z.
When I try to iterate over the pointer array from main I get the wrong values.
What do I'm missing?
I know array are passed by reference to function, does are returned by reference too?
#include <iostream>
#include <ctime>
#define MAX 28
// Generate random char array with a-z values
char* generateRandomString(int length) {
char random[length];
for (int i = 0; i < length; i++) {
// Minimun a ascii = 97
// Maximun z ascii = 122
srand(int(time(NULL))); // Timestamp seed generator
int randomInt = 97 + (rand() % 25);
char randomChar = randomInt;
random[i] = randomChar;
}
return random;
}
int main() {
char* random = generateRandomString(MAX);
for (int i = 0; i < MAX; i++) {
std::cout << random[i] << std::endl; // (*random)[i] Does not work neither
}
return 0;
}
A:
You are returning a pointer to a local variable that goes out of scope before the caller can use it. Just use std::string instead.
And don't call srand() multiple times, call it only once.1
1: Even better, don't use srand() at all, use a C++ random number generator from the <random> library instead.
#include <iostream>
#include <string>
#include <ctime>
#define MAX 28
// Generate random char array with a-z values
std::string generateRandomString(int length) {
std::string random;
random.resize(length);
for (int i = 0; i < length; i++) {
// Minimun a ascii = 97
// Maximun z ascii = 122
int randomInt = 97 + (rand() % 25);
char randomChar = randomInt;
random[i] = randomChar;
}
return random;
}
int main() {
srand(int(time(NULL))); // Timestamp seed generator
std::string random = generateRandomString(MAX);
for (int i = 0; i < MAX; i++) {
std::cout << random[i] << std::endl; // (*random)[i] Does not work neither
}
return 0;
}
|
{
"pile_set_name": "StackExchange"
}
|
Synthetic polycation: polynucleotide interactions determined using liquid chromatography with short monolithic columns.
LC on short monolithic columns (Convective Interaction Medium Disks) was applied to investigate several specially synthesized water soluble polycations of different charge type (primary, tertiary, quaternary amine), as well as a copolymer of neutral saccharide and cationic monomers, regarding their ability to form reversible complexes with DNA. For this purpose, two separation modes were used, namely, pseudo-affinity and cation-exchange chromatography. Synthetic polynucleotides, namely, polyriboadenylic acid (poly(rA)) and polyribocytidylic acid (poly(rC)), were used as approximate structural analogues of DNA. In first case, the hypothetical specific binding between dissolved polymers and polynucleotide (poly(rA) or poly(rC)), covalently attached to epoxy-bearing monolithic sorbent, has been studied and compared to the results obtained using cation exchange chromatography. Quantitative parameters of interactions between macromolecules were established using frontal elution method.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Opinions of the United
2007 Decisions States Court of Appeals
for the Third Circuit
6-13-2007
Joseph v. Atty Gen USA
Precedential or Non-Precedential: Non-Precedential
Docket No. 06-1496
Follow this and additional works at: http://digitalcommons.law.villanova.edu/thirdcircuit_2007
Recommended Citation
"Joseph v. Atty Gen USA" (2007). 2007 Decisions. Paper 950.
http://digitalcommons.law.villanova.edu/thirdcircuit_2007/950
This decision is brought to you for free and open access by the Opinions of the United States Court of Appeals for the Third Circuit at Villanova
University School of Law Digital Repository. It has been accepted for inclusion in 2007 Decisions by an authorized administrator of Villanova
University School of Law Digital Repository. For more information, please contact Benjamin.Carlson@law.villanova.edu.
NOT PRECEDENTIAL
UNITED STATES COURT OF APPEALS
FOR THE THIRD CIRCUIT
NO. 06-1496
________________
GEORGE RUSSELL JOSEPH,
Petitioner
v.
UNITED STATES ATTORNEY GENERAL
____________________________________
On Petition for Review of an Order
of the Board of Immigration Appeals
Agency No. A43 578 078
on January 18, 2006
_______________________________________
Submitted Under Third Circuit LAR 34.1(a)
SEPTEMBER 22, 2006
Before: BARRY, CHAGARES AND COWEN, CIRCUIT JUDGES
(Filed June 13, 2007)
_______________________
OPINION
_______________________
PER CURIAM
George Russell Joseph is a native and citizen of Trinidad and Tobago.1 Joseph
seeks review of an order of the Board of Immigration Appeals (BIA), upholding an
Immigration Judge’s decision that found him removable and ineligible for cancellation of
removal. Because Joseph is ineligible for cancellation of removal, we will deny the
petition for review.
Joseph entered the United States in December 1992 as a conditional resident. He
became a permanent resident in December 1994. He was placed in removal proceedings
by a notice to appear, dated June 15, 2005, which charged him with being removable for
having committed a controlled substance violation and an aggravated felony. The
Immigration Judge (IJ) found him removable for the controlled substance violation, but
found that the Government had not met its burden of showing that any of his convictions
was also an aggravated felony. The IJ found Joseph ineligible for cancellation of removal
under INA § 240A(a) [8 U.S.C. § 1229b(a)], the only relief for which he applied.
The Board of Immigration Appeals (BIA) affirmed, specifically noting that the IJ
did not err in denying cancellation of removal, because Joseph had not accrued 5 years of
continuous presence from the time he was admitted as a permanent resident in December
1
It is not clear if this is Petitioner’s correct name. Petitioner filed his petition for
review under the name of “George Russell Joseph.” His brief is signed “Russell J.
George” and alternatively refers to himself as “Mr. Russell.” As our caption reflects the
name he used in his petition for review, we will refer to petitioner as “Joseph.”
2
1994 to the time he was convicted of a controlled substance violation in January 1998.2
Joseph timely filed a petition for review and a motion for stay of removal.
Pursuant to section 242(a)(2)(C) of the Immigration and Nationality Act (INA) [8
U.S.C. § 1252(a)(2)(C)], we lack jurisdiction to review “any final order of removal
against an alien who is removable” because of a controlled substance violation.
However, the REAL ID Act of 2005 restored direct review of constitutional claims and
questions of law presented in petitions for review of final removal orders. See INA
§ 242(a)(2)(D) [8 U.S.C. § 1252(a)(2)(D)]; see Papageorgiou v. Gonzales, 413 F.3d 356,
358 (3d Cir. 2005). We therefore may consider whether the BIA correctly applied the law
in denying Joseph cancellation of removal.
Pursuant to 8 U.S.C. § 1229b, the Attorney General may, in his discretion, cancel
the removal of an alien who has been: (1) lawfully admitted for permanent residence for
not less than five years, (2) if the alien has also continuously resided in the U.S. in any
status for seven years, and (3) if the alien has not committed an aggravated felony.
However, the calculation of the period of continuous residence required for relief stops
when an alien commits a controlled substance violation. See 8 U.S.C. § 1229b(d)(1) [INA
§ 240A(d)(1)]. As the Government candidly explains in its brief, this “stop-time”
provision applies only to the second requirement listed above; i.e., that the alien has
2
The BIA noted that Joseph’s argument that he had not committed an aggravated
felony was irrelevant, as he was not found removable on that ground, and that it could not
entertain his arguments concerning his continued detention outside the context of bond
hearings.
3
continuously resided in the U.S. for seven years after having been admitted in any status.
See Matter of Perez, 22 I&N Dec. 689, 692 n.2 (BIA 1999) (en banc). The stop-time
provision does not apply to the first requirement. Id.
The BIA erroneously found that Joseph had not met the first requirement of five
years of permanent residence, since Joseph had been a permanent resident for over nine
years at the time of the IJ’s decision. However, Joseph is ineligible for cancellation of
removal under the second step (lack of continuous residence for seven years), because
Joseph, who was admitted to the United States in December of 1992, committed a
controlled substance violation, triggering the statute’s “stop-time” provision, in August of
1997. He thus did not accrue seven years of “continuous residence” under the statute.3
For the foregoing reasons, we will deny the petition for review.
3
In his brief, Joseph argues that he did not commit an aggravated felony. His
argument is irrelevant, as he was not found removable for having committed an
aggravated felony. We agree with the Government that other issues in his brief regarding
adjustment of status and parole for arriving aliens have no relevance to this petition for
review.
We note that Joseph also challenges his continued detention. Challenges to
post-removal order detention should be raised in a habeas petition filed in the appropriate
District Court. See Zadvydas v. Davis, 533 U.S. 678, 687-88 (2001); 8 U.S.C. § 1252(a)
(only eliminating district court's habeas jurisdiction over orders of removal).
4
|
{
"pile_set_name": "FreeLaw"
}
|
Many devices used in the care and treatment of swimming pools provide for a high velocity jet of water to stir dirt, leaves and other foreign matter from the pool bottom and walls and into suspension for removal by the pool circulation system, or to create a low pressure zone for suction of same from the bottom and walls. Since pumps are employed in the regular circulation of water from the pool through heating and/or filtering media and back to the pool again, it is highly desirable to use the available circulation pump for the pool treating equipment, as well as for other water circulation systems. In such event, it is necessary to have suitable valving means to direct the pump discharge selectively through either the normal circulation system or the auxilary pool treating systems. It is also necessary, because of the generally high flow capacity requirements for such auxilary systems, that the valve device provide high flow capacity in both the circulation and pool-treating modes. It is further highly desirable that the three-way valve be adapted so that any one of the three hubs may be connected to the suction or discharge line connected to a pump, with the other two being connected to circulation and cleaning system delivery, thus offering flexibility in plumping arrangements.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Danny Barrett
Danny Barrett (born December 18, 1961) is an American football coach and former player who is currently the running backs coach for the Houston Texans. He served as the UCF Knights interim head coach in 2015, and is a former Canadian Football League (CFL) quarterback and former quarterbacks coach at the University at Buffalo. He has been the head coach of the CFL's Saskatchewan Roughriders and the running backs coach of the Miami Dolphins.
Playing career
Before playing professional football with the Calgary Stampeders, Barrett was a star at the University of Cincinnati. In 1982, he co-captained the Bearcats and earned an Honorable Mention Associated Press All-American nomination. During his professional playing career, Barrett played in 163 regular season CFL games with Calgary, Toronto, B.C. and Ottawa. His career totals include; 23,419 yards passing, 1,656 completions in 3,078 attempts and 133 touchdowns passed. At one point, he held the record for most passing yards (601) in a CFL game.
In 1985, Barrett saw playing time as a slotback with the Calgary Stampeders hauling in 32 passes for 455 yards and two touchdowns. Barrett also quarterbacked the 1987 Argonauts and the 1991 Stampeders to Grey Cup appearances. In the 1991 Grey Cup, Barrett set a CFL record for completions with 34. In 1992, Barrett was selected as the Tom Pate recipient while a member of the BC Lions for his outstanding contributions to the league, his team and his community. This award was voted on by the CFLPA. In 1993, still as a member of the BC Lions, Barrett briefly held the CFL record for passing in a single game, with 601 yards, which was surpassed the following year by Matt Dunigan (713 yards).
Coaching career
Barrett joined the coaching fraternity in 1997 with the Calgary Stampeders. As a first year assistant coach, Barrett was in charge of the Stampeder quarterbacks, which included Jeff Garcia, Dave Dickenson and Henry Burris. In 1998, his first season with the BC Lions, Barrett began the season on the sidelines as the quarterback coach and assistant offensive coordinator but was forced out of retirement and dressed as the Lions’ backup quarterback for 15 games. During the 1999 campaign, Barrett coached the Lions’ receiver corps.
In 1999, Roy Shivers, the former Director of Player Personnel for the Calgary Stampeders, assumed the duties of general manager of the Roughriders. Shivers hired Barrett as the head coach despite the latter's limited coaching experience. The Roughriders made football history by being the first professional team with a black general manager and head coach. The team improved during Barrett's first four seasons, largely because Shivers—an astute appraiser of football talent with many connections to U.S. college teams—recruited and signed better players. In 2003 the team ended with an 11-7 record, and lost a close Western final playoff game to the Edmonton Eskimos. The team seemed on the verge of being championship calibre.
By 2006, after three consecutive .500 seasons—capped by a humiliating 2006 Western final loss to the BC Lions by a score of 45-18—an increasing number of fans began to question the leadership provided by Shivers and Barrett, and Shivers eventually was dismissed by the team's Board of Directors. On August 23, 2006 the Roughriders hired Eric Tillman as general manager. There was rampant speculation that Barrett would be dismissed, but Tillman was publicly circumspect. In the weeks leading to his ultimate departure, Barrett was unusually—and perhaps unwisely—expressive to the media about his views on the firing of Shivers. Reports indicate that Tillman had offered Barrett a one-year contract to continue as head coach, but either Barrett rejected the offer or Tillman withdrew it.
Barrett coached the Riders in more regular season games than any other coach in Roughrider history; however, Barrett posted a winning record only once in his previous seven years of coaching the Roughriders. His overall record as head coach of the Roughriders was 57 wins, 68 losses, and one tie.
On February 7, 2007, Barrett turned down an offensive coordinator position offered by the Winnipeg Blue Bombers, and opted to become the quarterbacks and assistant head coach at the University at Buffalo.
On December 13, 2009, Barrett was named interim head coach of the Buffalo Bulls after spending two seasons (2007 and 2008) as the Bulls quarterbacks coach/assistant head coach. The move followed the departure of Turner Gill, who left Buffalo to take the head coaching position at the University of Kansas.
On February 10, 2010, the Daytona Beach News-Journal reported Barrett was named offensive coordinator—in charge of the "Speedway Offense"—at Bethune-Cookman University.
On February 21, 2011, UCFAthletics.com reported Barrett was named running backs coach at UCF.
On January 14, 2015, UCFKnights.com reported that Barrett was moved from running backs coach to quarterbacks coach at UCF.
On October 25, 2015, UCFKnights.com reported that Barrett was announced as interim head coach for the remainder of the 2015 season, after George O'Leary announced his retirement from football.
On January 23, 2016, Barrett was hired by the Miami Dolphins to be their running backs coach.
On January 19, 2018, Barrett was hired by the Houston Texans to be their running backs coach.
Head coaching record
CFL
College
References
Category:1961 births
Category:Living people
Category:American football quarterbacks
Category:BC Lions players
Category:Buffalo Bulls football coaches
Category:Calgary Stampeders players
Category:Canadian football quarterbacks
Category:Canadian football slotbacks
Category:Cincinnati Bearcats football players
Category:Houston Texans coaches
Category:Miami Dolphins coaches
Category:Ottawa Rough Riders players
Category:Saskatchewan Roughriders coaches
Category:Toronto Argonauts players
Category:UCF Knights football coaches
Category:Sportspeople from Boynton Beach, Florida
Category:African-American coaches of American football
Category:African-American coaches of Canadian football
Category:African-American players of American football
Category:African-American players of Canadian football
Category:BC Lions coaches
Category:Calgary Stampeders coaches
|
{
"pile_set_name": "Wikipedia (en)"
}
|
From the Middle East to Russia to Asia, President Obama’s foreign policy has left the U.S. in a weaker position than when he took office, analysts say.
As Mr. Obama prepares to depart the White House, U.S. relations with traditional allies such as Israel and Saudi Arabia have frayed badly, Moscow is exerting its power increasingly in Syria and in Eastern Europe, and even the U.S. relationship with Western Europe has been called into question. On his watch, U.S. influence has diminished in all of those regions.
“I can’t really think of any concrete success that President Obama’s had in terms of foreign policy,” said Nile Gardiner, a foreign affairs analyst at the conservative Heritage Foundation. “You can point to an overall weakening of American power on the world stage and an eroding of key alliances.”
When he came into office, Mr. Obama was faced with wars in Iraq and Afghanistan, with a total of about 180,000 troops deployed. He also was dealing with a global financial crisis and recession that caused the U.S. unemployment rate to rise to 10 percent during the first year of his presidency.
“The president came into office eight years ago with the view of being principally a domestic president, with the financial crisis looming, and to be transformative,” said Heather Conley, director of the Europe program at the Center for Strategic and International Studies. “The administration felt that his victory and the fact that he was not President [George W.] Bush would be sufficient in transforming the trans-Atlantic relationship and relations with Europe.”
White House press secretary Josh Earnest said among Mr. Obama’s biggest achievements in foreign affairs were bringing home all but about 15,000 troops from Iraq and Afghanistan, ordering the Special Forces raid that killed Osama bin Laden in 2011 and re-establishing diplomatic and cultural ties with Cuba in 2014.
“That is an indication of the important progress that President Obama has made,” he said.
But the withdrawal of U.S. forces from Iraq in late 2011, critics argue, created a power vacuum that led to the rise of the Islamic State, the Salafist terrorist group that has launched horrific attacks against the West and has dominated the administration’s counterterrorism operations since 2014.
Meanwhile, Libya descended into extremist anarchy after the U.S. helped oust Moammar Gadhafi in 2011, with the Islamic State gaining a foothold there.
“President Obama’s approach was extraordinarily naive in the Middle East,” said Mr. Gardiner, a former aide to British Prime Minister Margaret Thatcher. “He also failed to combine his optimism with any hard power. That really enabled a number of very dangerous actors to emerge and to threaten directly the United States and its allies. It isn’t very clear that the Obama White House has any real strategy for eradicating ISIS. It’s a containment strategy; it’s not one of victory.”
In a final address to military brass and troops last week, Mr. Obama insisted that his strategy against the terrorist network is succeeding.
“We are breaking the back of ISIL and taking away its safe havens, and we’ve accomplished this at a cost of $10 billion over two years — the same amount that we spent in one month at the height of the Iraq War,” he said, using another term for the Islamic State.
Mr. Obama rested much of his strategy for the broader Middle East on reaching the deal with Iran in 2015 to limit its nuclear program in return for the lifting of international sanctions.
“When President Obama took office, the No. 1 threat that was identified by the United States and our allies around the world was the risk that Iran would develop a nuclear weapon,” Mr. Earnest said. “That would be extraordinarily destabilizing to not just the Middle East, but to the world. It would be extraordinarily concerning to our closest ally, Israel. And it would pose a threat to our allies in Europe that are within range of some of Iran’s missile capabilities.”
He said the administration’s “principled, hard-nosed diplomacy” has ensured that Iran is “now farther away from being able to get a nuclear weapon than they have been in some time.”
“All of that was accomplished without deploying a single soldier or firing a single shot,” Mr. Earnest said. “And that certainly is a testament to the president’s success in addressing some of the most significant threats facing the United States.”
Reset with Russia
The president’s critics at home and in Israel contend the deal gave too much to Tehran and won’t prevent it from developing nuclear weapons. Mr. Gardiner called it one of Mr. Obama’s biggest strategic failures.
“The Iran nuclear deal will go down in history as a massive failure and a very dangerous, poorly thought-out move,” he said. “This deal is very short-sighted and will certainly allow Iran to [get a nuclear weapon] within this generation.”
Mr. Obama’s relations with Israel, never strong, reached a low point last month when the administration failed to veto a vote by the U.N. Security Council condemning Israeli settlements in the West Bank.
Russia has confounded Mr. Obama almost since the start of his presidency. The infamous Russian “reset” of his first term is little more than a mocked memory, as the U.S. has been unable to reverse Russian military gains in eastern Ukraine or to thwart Russia’s decisive support for Syrian President Bashar Assad in that country’s 6-year-old civil war.
“The reset was a real foreign policy disaster and a complete misreading of [President] Vladimir Putin, and an underestimation of the scale of the threat posed by Russia,” Mr. Gardiner said. “Moscow ran rings around the Obama White House.”
Ms. Conley said Mr. Obama did receive cooperation from Moscow initially in several key policy areas, working with Russia and other world powers to negotiate the Iranian nuclear deal, cooperating on counternarcotics and military supply lines in Afghanistan, and negotiating the New START agreement to reduce nuclear weapons. But the relationship began to sour by 2011, as Mr. Putin confronted large public demonstrations and then-Secretary of State Hillary Clinton accused Moscow of rigging parliamentary elections.
Mrs. Clinton’s actions so infuriated Mr. Putin that, U.S. intelligence agencies say, the Russian leader ordered a cybercampaign to undermine her presidential candidacy last year.
The problems with Mr. Putin culminated last month when Mr. Obama expelled 35 Russian operatives from the U.S. over the campaign of extensive cyberattacks in an effort to influence the November presidential election. While President-elect Donald Trump has questioned the administration’s conclusions, he and congressional Republicans have blamed Mr. Obama for failing to take seriously enough the overall threat of cyberattacks.
Even after highly embarrassing hacks of sensitive government personnel records in recent years, Mr. Obama said Sunday that he wasn’t paying enough attention to the threat from Russia.
“I don’t think I underestimated [Mr. Putin], but I think that I underestimated the degree to which, in this new information age, it is possible for misinformation for cyberhacking and so forth to have an impact on our open societies, our open systems, to insinuate themselves into our democratic practices in ways that I think are accelerating,” Mr. Obama told ABC’s “This Week.”
Mr. Trump and other Republicans have accused the administration of trying to undermine his victory with claims of Russian meddling. The president rejected that accusation, saying he ordered a review of the cyberattacks to better guard against Mr. Putin’s hacking in the future.
European debt and migration
The president’s deteriorating relationship with Mr. Putin has followed a predictable pattern in relations between Moscow and Washington, Ms. Conley said.
“Almost every U.S. president comes into office thinking that they personally can overcome profound challenges of the U.S.-Soviet, U.S.-Russian relationship,” she said. “They get about two years into it, and then they run into the same roadblocks. We have very different values and very different interests.”
In Asia, Mr. Obama tried to “rebalance” U.S. foreign policy chiefly through a 12-nation free trade agreement called the Trans-Pacific Partnership, hoping to use it as a counterweight to China’s influence. But Congress has not ratified the pact, and Mr. Trump has panned it as a bad deal for American workers.
Mr. Earnest said the blame rests with Congress, where virtually all Democrats joined some Republicans to kill the agreement.
“The president is disappointed that Congress didn’t act to ratify the Trans-Pacific Partnership,” he said. “That certainly had the potential to strengthen our security and economic relationships throughout the Asia-Pacific. That was a missed opportunity, but I don’t think that’s one that you can pin on the president of the United States, because he did the hard work of negotiating the kind of an agreement that would have advanced our interests. It didn’t move forward because of Congress’ failure to act.”
In Europe, Mr. Obama seems to have miscalculated the impact of the debt and migration crises on allies from Britain to Italy. He personally lobbied British voters last spring to remain in the European Union, a bid that failed spectacularly.
“It was a bold and risky move, because I think the average American would not appreciate a British prime minister spending three days saying what they should do,” Ms. Conley said.
With the approach of the 70th anniversary of the Marshall Plan that rebuilt Europe after World War II, she said, “Now we are understanding how fragile the European project is.”
“All of that has come into question. Europe itself has come into question,” she said.
These international developments present “huge challenges for the new administration,” Mr. Gardiner said.
“It has to clear up a lot of the mess that has been left by the Obama presidency, especially in the Middle East,” he said. “It also has to deal with a greatly strengthened Russia that is increasingly assertive and menacing.”
Sign up for Daily Newsletters Manage Newsletters
Copyright © 2020 The Washington Times, LLC. Click here for reprint permission.
|
{
"pile_set_name": "OpenWebText2"
}
|
"Damn it." "You've guts." "Save the hostage." "Damn you cop." "I was far better than you." "Why don't you let my territory go?" "Nice weather." "Now, you know my choice is correct?" "One week's holiday isn't enough, I guess." "We may stay few more days." "Our boss won't let us go." "Someone comes to pick you up, look." "I am Lisa Li." "Miss Li, our boss asked us to pick you up." "Who is your boss?" "Mr. Ben Hung." "Fantastic, thank you." "Your cousin is somebody, he can pick you up in the restricted area." "Let's go." "So big." "So pretty is the house." "Nice place." "Your cousin should be rich." "My boss is waiting for you." "Let's go." "This way please." "Alright." "We could never buy this house, right?" "Unless being bribed." "Damn corruption." "Cousin." "Long time no see, how are you..." "Let me introduce, she is Anna." "He is Master Hung." "I am warming up, why don't you come and play with me?" "Alright." "Great, go and see your friend." "You're rich, I remember you told me your wish when were small." "Your wish comes true, right?" "My time and effort haven't been wasted." "I've had hard time too." "Behind my success, there was blood and sweat." "Good." "Good work..." "Why don't you stay few more days?" "Great." "This way please." "Go in and have a chat." "Boss, I have something to talk to you." "Let's go in." "Boss." "The goods..." "Have you fixed it?" "It isn't smooth." "What?" "How come?" "Did you follow my instruction?" "Yes, but..." "It's ruined by Eddie." "What?" "You dumb-bell." "You are all useless." "You can't fix such tiny matter." "How can you lose a truck of arms?" "Why couldn't you guys kill that cop Eddie?" "Don't you know how to shoot and fire?" "Listen, kill Eddie, if not, don't come back to see me." "Got me?" "Yes." "Dear father, have you eaten breakfast yet?" "I miss you, I love you." "Your baby Angel." "Who are you looking for?" "Delivery, please sign." "I didn't buy anything." "Just sign it, I am responsible for delivery only." "Why don't you live few more days?" "You're welcome." "We have important matters to do." "Well, visit us if you have time." "Your cousin is leaving, they come to say goodbye to you." "She is Miss Yeung." "Do you want to shoot?" "No, make it next time." "Dad." "I feel so happy to see you." "Forget about him, he dragged your mom to death." "He isn't a good dad." "This is a nice place for vacation." "Great." "We may have a peaceful holiday." "Not exactly." "Why?" "I've told Commissioner that we are having holiday here." "What did you say?" "You are too much!" "Sorry, I am late." "Are you feeling lonely?" "Kidding, don't let others wait next time." "Cut the crap, any information?" "Ben Hung is growing." "Do you have any clue?" "He wants to be the number one in the arms smuggling market." "You've to watch him." "He doesn't trust his own sister." "The outsider can't be trusted by him too." "At the time being, I have nothing to tell." "If we don't have enough evidence..." "We can't put him to jail." "I've heard that a HK buyer is coming to purchase arms." "Good news." "But if he is not a big buyer..." "Ben won't serve him." "Are you kidding?" "That's too much." "The ball is ours, give it back." "A Chinese girl." "We come here everyday." "Hurry up, give our ball back to us." "Hurry up..." "So what?" "Return the ball." "Alright, come if you have guts." "Give it back to me." "Come if you have guts." "Go, bring the ball back." "We needn't be afraid of these two girls." "Good Kung fu." "Come and take it." "They are something, what'll we do?" "I have the ball." "Why not let them go?" "Have you seen Angel?" "Your mother-in-law doesn't forgive you?" "Same temper." "She is still mad at me." "I went to school that day..." "She didn't let me see Angel." "Strong prejudice." "I haven't seen Angel for a long time." "She is so cute..." "I wish to see her too." "My boss is looking for me, I am leaving." "Contact me if you've got any news." "Take care." "Alright." "Lie down." "Where are those people who fought just then?" "All gone." "Do you remember that man?" "They are smart." "Forget it, I don't notice men." "Why?" "I tell you." "My dad dumped my mom when I was six." "From that time on, I hate men." "You can't put it in that way." "You are not young, you should consider your future." "Don't miss your time." "Let's talk about our visit." "What do you think?" "No flying, it's too dangerous." "You chicken." "It's really dangerous." "But why are you so bold in fighting?" "That's different." "Answer the door." "No." "I can't go." "Alright, I am going." "What's the matter?" "A phone from Hong Kong." "Thank you." "What's this?" "Look." "You reported to boss during the holiday, we've no freedom at all." "I want a promotion." "You are selfish." "You want a promotion?" "!" "Damn it." "How dare you hit me?" "Answer the call." "Are you Lisa?" "Yes sir." "Have you received the phone?" "Yes." "You and Anna have been following the case of Chan's brothers..." "They will come to Manila tomorrow." "You've to watch them." "But we are on leave." "Leave?" "Your leave has been canceled." "Work now, got me?" "Yes, sir." "Cut the crap, this is an order." "It's hanged." "What did he say?" "Chan's brothers will pay a visit here." "I want to eat steak." "No problem, follow me." "That way." "Please sit." "I am going to take sample." "Up to you." "This is the most powerful gun." "Machine or halfly automatic." "Not bad." "No bullets?" "For safety's sake." "So it is not loaded." "I see." "How can we test it?" "Tomorrow morning." "I will give you arrangement." "A special place for testing." "Bitch." "Don't move." "Don't move." "Cuff." "We are cops." "Right." "Are you cops?" "What are we then?" "Follow me to the police station." "They are cops?" "!" "Cuff them." "Hurry up." "Cuff them." "It's alright." "And you, hurry up." "Why don't you believe we are HK cops?" "Explain to our seniors." "This cop is too cocky." "Right, I am." "He wants to fool us." "Let's fool him if we have chance." "Mind your words, I won't give you face." "I love talking, so what?" "What can you do to us?" "All women in this world are troublesome." "This man is sick." "He doesn't seem to be disgusting." "How are you ladies?" "Major." "Thank god, a fair judge has come." "Are you..." "I am Major Sin Wah." "How are you, I am Lisa Li." "We are from HK to carry duties." "Are you related to the drugs smuggling case?" "Yes." "You are Inspector Li and you must be Inspector Yeung." "Yes." "How do you know my name?" "Are you informed?" "Your boss Tiger is my best friend." "He called me and asked me to assist you." "He faxed your information to me." "Eddie, uncuff them." "Major, they are fierce." "Eddie." "You know you've caught a wrong guy." "You think you are smart." "Listen, here is not HK, don't mess up." "So what with Royal HK police, I am not scared." "Look, he's tough." "Being bullied." "Alright, cut the crap, I've promised your boss..." "To assist you by all means, Eddie, have you listened?" "They will bother our work." "No, this is my order." "Are there any smart cops here?" "He is the smartest." "Let's go, cut the crap." "Slighter." "When is the next shipment?" "Around next week." "How's the business of Chan's Brothers?" "Dik Hung has been following, they are going to see sample." "He will be back soon." "Have a reception dinner for them tonight, got me?" "Yes." "Brother." "These goods are not bad, pack and ship it tonight." "Boss." "Are they satisfied with our goods?" "They are very satisfied." "What else?" "I've something to report to you." "What's the matter?" "Your cousin is a cop, she is watching us." "What?" "Suddenly..." "They fought with Chan's Brothers." "Later, Eddie came and killed Chan's Brothers." "Eddie?" "My cousin is a cop?" "I can't tell it." "Brother said here is dangerous to you." "I hope you would leave now." "This is his idea, do you understand?" "I don't understand what you mean." "By the way, we haven't had enough fun." "We don't have intention to leave here." "Alright, take care." "She seems to be angry." "She can't threaten us." "Catch it." "Catch it now." "Take back your gun." "Here is too dangerous." "What'll we do?" "You should move to a safe place." "What are you talking about?" "To live with you?" "Go, how dare you be kidding?" "This your home." "What do you think?" "Not bad." "The same house in Hong Kong would be very expensive." "Who lived here?" "My friend, an architect, who is working in Australia now." "I love this place, safe and pretty, thank you." "I will show you around." "Go" "Why don't you go out for fun?" "Who offended our little princess?" "Your cousin." "Are they going back to Hong Kong?" "They didn't, and..." "They are not willing to ho back." "So, kill them." "If there wasn't Eddie, they would have been killed." "That bastard again." "We may eat now." "Dinner's time." "Come try this." "Cut the crap, it's started." "Not bad, you are something." "This dinner is to serve you for helping us." "To repay your help." "Right." "No, I helped two." "Anyway..." "We have to thank you." "My wife was a good cook too." "Are you married?" "How can she tolerate you?" "My wife..." "She died?" "How?" "She was killed." "Sorry." "Come on, don't forget our food, try this." "You mean it?" "If you are afraid, don't come then." "Come on, I won't be afraid of you." "Come on." "Let's practice." "No problem." "1 2 3 4 5 6 7 8 9 10." "I am going to listen." "Oh, my egg." "Are you Inspector Li?" "Speaking." "The latest news, Henry Wong has arrived Manila." "Shit." "What's the matter?" "Shut up." "Watch Henry Wong." "Yes, Commissioner." "Keep contact." "Yes, boss." "Do you want to put an egg into it?" "Your egg..." "I am driven crazy." "Mr. Lee, see." "The construction site is the best place for golf." "I want to have cable car as transportation." "Boss, Mr. Wong has arrived." "It will be done after 3 months." "Boss, Mr. Wong is here." "Welcome." "My good partner, you should have a nice life recently." "Welcome for holiday." "Come this way." "Alright." "This is my new investment, I want to make it a vacation center." "I want to build a golf site here." "Transported by cable car, my godown for arms is below." "This is a covered place." "You are great, from arms smuggling to real estate." "If I don't invest, the government will check my income." "If a vacational center is built, then the source of income is solved." "Are you coming for vacation?" "I need goods of about $50 million, so I come myself." "You need so many goods for a war?" "If there is a war, you've to inform me first." "Middle East client, he wants to establish a new government." "How about the goods?" "No problem." "That's good." "Don't worry." "Let's check the goods now." "No hurry, I will show you around first." "You haven't seen such a good field." "Have you got any news?" "The biggest arms smuggler Henry Wong's arrived Manila, he's the best friend of Lee." "His arrival will cause trouble among the Big Five." "Watch your boss." "He will take action." "My boss knows Henry can bring him good fortune." "He won't let him go, he is thinking of something." "To liaise with Henry Wong." "Within couple of days, something may happen." "My boss is looking for me." "I won't accompany you." "Take care." "My informer told me Henry Wong has arrived." "Have you sent anyone to watch him?" "If so, then our police department will be too busy." "He is right, here is different from Hong Kong." "Now, we are in Manila." "Sorry, detective." "I think he is coming for me." "I have to use my baby." "What is it?" "Great stuff." "Hold it." "Do you really want to use it?" "Watch out." "So great." "So powerful." "Don't mess up without my order, alright." "Do you want to fool me?" "Everyone has lost three." "He is real lucky." "He wins again, how weird." "So weird." "Again, again..." "He wins every time, how can we play again?" "Let's stop playing." "Never mind, come on." "Let's play again." "So great, who will play with you still?" "Don't go..." "Are you leaving?" "He wins every game." "Are you leaving?" "Don't you think I am the swindler?" "May I join the gambling?" "Do you welcome me?" "Why not?" "Come and take a seat, come on." "What game do you like?" "No problem, up to you." "Let's play black jack then." "Anything will do." "$50.000, deal now." "She is showing love to me." "Please pick the cards up." "Sure." "Why not play inside the room?" "Wonderful, no problem." "I know you've got a big fish." "I don't understand." "I want to co-operate with you." "Do you want to share the business with me?" "Do you mean it?" "We always work separately." "Henry Wong and I have co-operated for years." "You'd better behave yourself, don't mess up." "Yes, let's do accordingly." "Bye bye." "Let's go." "I've got a message." "Lee has been killed by Ben Hung." "The other big heads are all against Hung." "In fact, Ben won't be afraid of others..." "He is like a tiger, he is afraid of nothing." "There will be many troubles, the police can't forget it." "There is a civil war among them, indirectly, they are helping us." "About these two..." "I think you'd better leave here." "Why?" "This is dangerous, I don't want you to be hurt." "You are despising us." "The murdering case of yesterday is related to arms smuggling." "You know how powerful are the arms?" "Really?" "It's related to an arms smuggling gang of HK leaded by Henry Wong." "Henry Wong?" "Have you seen him?" "Yes, we fought." "I came here from Hong Kong..." "Because of him." "What's the matter?" "I want to invite you to a party." "A party?" "Why don't you listen to me?" "I asked you not to phone him." "I just informed him to join my birthday party." "He isn't a good dad, how many times have I told you?" "No, why do you treat him like this?" "Hey, my car." "Stop, I am police." "You asshole." "Help yourself." "Angel, why do you stand here alone?" "I am waiting for my dad, I've informed him." "That jerk won't come, today is your birthday." "You've to cheer up, come and play with the kids." "Happy birthday to you..." "Happy birthday to you, do you have a wish?" "I have a wish." "Close your eyes, say it and this wish will come true." "I wish to see my dad at once." "Your wish has just come true, see who I am?" "Dad." "My baby Angel." "I've missed you so much." "So touching." "Move in." "Why do you move them to the hut." "The goods will be shipped..." "It won't be easily discovered if it is moved to the hut first." "Hurry up..." "Don't move, police." "Cops?" "Don't shoot, we will surrender." "What's wrong?" "Eddie, it's Eddie again." "What are you waiting?" "Why don't you move on?" "Move." "Forget it, we don't have speedboat, clean up now." "Go." "Drop the weapon, hands up, don't move." "Move, hurry up..." "Boss." "Is the loading smooth?" "We've prepared to move Henry's goods to the hut." "And shipped it to the runner." "But Eddie ruined our plan." "That bastard cop." "You mean Eddie the cop?" "Not only Eddie, and your cousin too, they are two of a kind." "Listen, let's separate." "You go to fix that bastard, I am going to fix our opponents." "Don't leave anyone alive." "Boss, Henry Wong wants to co-operate with Dai Tin." "I've predicted it, go with Lando to fix him." "Yes, boss." "How is my godown?" "Lee developed a vacational camp, and you've such a great godown." "Is arms smuggling a real fortune making business?" "Fortune making?" "I've heard that Lee was killed." "You have an opponent less." "Don't you think it's done by me?" "I don't mean it, let's talk about business." "How much do you want?" "About $50 million US." "I'll take this order." "How is your stuff?" "Watch the sample first, Lee, come here." "Yes, boss." "Bring Mr. Wong to see the sample, serve him well." "This way please." "See you later." "See you." "Why don't you go now?" "I am going to kill you." "Ask Eddie to come here at once." "Or I will kill her." "Don't you want your grand-daughter to be shot to death?" "I beg you, don't shoot, don't hurt my Angel." "I will do according to your words." "Did I act well?" "Fantastic." "My mother-in-law is looking for me, there must be some problem." "Sorry, I am leaving." "Why don't you hurry?" "I hope Eddie could please his mother-in-law." "Wish him good luck." "To, is Eddie here?" "His mother-in-law called him." "She hates him so much, what is she calling him for?" "There must be trick." "Do you know his address?" "Of course." "Take us there." "Go now." "That's good." "Go." "Next time will be your daughter." "Wait." "Eddie." "Eddie." "You go that way." "Go." "Listen, kill that two girls first, and then the old and the kid." "Don't move." "You are surrounded, surrender now." "Hurry up." "Be quick and clean." "Put in." "Brother." "From your cheerful face, you seem to be happy." "I've caught him." "You mean Eddie?" "Right." "Now, he is under my control." "Kill him then." "I want him to die slowly." "Be careful of killing yourself." "Don't worry, I want him to suffer before his death." "I want him to die slowly." "Alright, but be careful." "Water..." "Do you want water?" "It's wise to be thirsty than to be beaten." "A girl, come and take a look." "Really?" "She is quite attractive." "Go and take a look." "Ladyboy?" "!" "Aren't you dead?" "It stinks." "Are you alright?" "Your makeup is really ugly." "Who called you?" "He didn't mention, he just asked me to pick Eddie up right here." "No one is around." "What do you think?" "It may be a trap, be careful." "Alright." "Where are you going to get him?" "To, he is right here." "Eddie." "Send him to the hospital." "Go and help." "Brother, who saved that jerk?" "Boss, may I interrupt you?" "What's the matter?" "Do you know who is the ladyboy?" "I don't know, I've heard that Kwok's brothers and Frank..." "They are prepared to go against us." "And they've received the order from Henry Wong." "They will deliver their goods tomorrow." "Well, I want to uproot them." "Brother, you want to do it yourself?" "I want to gather our pals to kill them all." "Sister, let's do it together." "Dad, don't go to work, you've just recovered." "You should go to arrest the thieves after you are fully recovered." "Or I won't love you." "Alright, I will listen to you, are you satisfied, my baby?" "Don't worry, we'll keep an eye on him and won't let him go elsewhere." "Right." "Thank you." "Alright." "Hurry up." "Go tell the buyers from HK and Taiwan." "If you get the money in Manila, you can get whatever you want." "Thank you for helping us." "Don't forget to tell them one thing." "This place is our territory." "How about Ben Hung?" "We didn't care about him, do you understand?" "I am shipping the goods you want, do you want to take a look?" "This is our own ship, you may trust us." "I have a gambling date, I want to leave now, thank you." "See you." "Thank you." "Don't worry." "See you." "What is Ben Hung?" "Don't talk about him." "Great co-operation." "Be quick, hang it up." "Hurry up..." "Anymore?" "Boss, another five, don't worry." "Protect boss, hurry up." "Stay back." "Kill him." "Don't let her go." "Are you crazy?" "Why do you treat us like this?" "What do you want?" "How can you break in my territory?" "Don't you think your liaison can harm me?" "I am not easily to be destroyed." "Henry Wong is my client, you take him away from my hand?" "Don't you think I am not powerful enough?" "Lee and Dai Tin are the good examples." "Trust me, we brothers respect you so much." "Right, it's the idea of Frank." "How can you do that?" "You are not righteous." "You put all the blame on me, did I force you to do so?" "I don't want to hear bullshit, go argue in hell." "Sir, wish you good luck." "Listen to my explanation, I beg you." "What do you mean?" "You'd be the man of the world." "Your last judgment is so wise." "When can you deliver the goods to me?" "It depends on you." "I will pay once I receive the goods." "How can I trust you?" "You are right." "I will stay to be hostage, if I don't pay, kill me then." "I may consider it." "When can I pay a visit to your godown?" "Any time." "Right now." "Hurry up..." "Ben, you are great." "I think I won't mistake my partner this time." "I should co-operate with you." "Don't worry, I'll arrange it properly, there won't be any problem." "But I have to add 20%." "What?" "Do you have any choice?" "I have some good stuff, come here." "When will the goods from Iraq arrive?" "About next week, some were used in fighting with Americans." "And the missiles will arrive next week." "Good job." "Can't you listen?" "You can get the arms from Iraq." "You are something." "I tell you, I will increase the price to 150%." "No problem." "What's the matter?" "Di Hung called secretly." "Where did you go?" "To washroom." "You lied, you called." "I know we have to serve Mr. Wong." "So I canceled the date with my girlfriend." "He is the betrayer." "I will show you to see the sample, this way please." "Alright." "Dik Hung saved Eddie last time." "This was found in his car." "Are you sure?" "'Cause I fought with him." "You betrayer, you are going to die." "I..." "How dare you betray me?" "I want you to die terribly." "I didn't..." "I want you to die slowly." "Stay back." "Follow me." "Let's go together." "Go." "You're surrounded, surrender now." "Boss, I've bullets, take it." "Ben Hung, if you surrender, I will let you go." "Stop dreaming, don't you think I will believe in you?" "If you have guts, come to arrest me." "If you have guts, come here." "I am here..." "Don't dream of arresting my boss." "You've guns, but we have something more powerful." "Boss, let them try your little stuff." "If only you come out to surrender, we'll beg for mercy for you." "Bullshit." "Damn it, alright, I will risk my life to fight with you." "To die with you." "Asshole." "Jimmy, let's run for our lives." "Let's go separately." "Boss, you go first." "I am going to kill you." "You've no way out." "You'd better surrender." "Come to arrest me." "How many people do you want to kill?" "I am a decent merchant, it's you who pushed me." "I can't help, only the judge could determine if you are guilty or not." "Why do you want to arrest me?" "We are doing decent trade, how can you arrest us?" "What proof do you have?" "If you have guts, come out and kill him." "Brother, I am your own sister, how can you drag me like this?" "To do something for your brother is repaying me." "See how can you be cocky again." "Don't you think you are Superman?" "You'd be dead meat." "Drop the gun, can't you listen to me?" "Do you want me to blow your head off?" "Drop the gun and you won't be killed." "You heard me?" "Now I will count to three." "One, two..." "Asshole." "Kill me, if you have guts, kill me." "Can you hold it?" "I am still alive." "The ambulance is coming." "I am fine." "You've to cheer up." "I've to live." "Because I want to play with your daughter." "She will be happy to see you." "Especially you are in woman's dress." "Why don't you kill me?" "Because you are chicken." "I am ugly to dress like a woman, they think that I am ladyboy." "Watch out." "You asshole." "Dik Hung..." "Dik Hung!" "Thank you for your help." "Take him back to Hong Kong." "Great co-operation, let's go." "I will come back to see you." "Go." "I am waiting for you." "Thank you for your help." "This is my duty." "Angel, see you." "Thank you very much." "Don't mention it." "See you." "Bon voyage." "Alright." "Angel..." "Listen to your dad." "You have to come to see me." "You cook well." "I've heard that Ocean Park is a nice place." "Your dad will take you there." "He is so busy, he won't have time to take me there." "Work hard, your dad will apply for a leave and take you there." "I promise." "Deal." "Deal." "See you, thank you." "Go now." "Go." "Auntie." "Don't go, auntie." "Please don't go, please don't leave me, I know you won't come back." "Angel, be good, I will be back." "Auntie, don't go." "Angel, be good." "What a tragedy." "Shut your mouth." "Angel, good girl, don't cry, I will come back to see you." "I will visit and play with you." "You won't come back, you are cheating me." "Don't cry, be good." "Angel, go with your dad." "No." "I've lost mom, I can't lose you." "Anna, please apply a leave for me, I will go back few days later." "No problem, I will help you." "Two of a kind." "Cut the crap, go now." "Fantastic, we may go back." "I will cook you a great dinner tonight, go." "Take care." "I know it."
|
{
"pile_set_name": "OpenSubtitles"
}
|
Plantago lanceolata
Plantago lanceolata is a species of flowering plant in the plantain family Plantaginaceae. It is known by the common names ribwort plantain, narrowleaf plantain, English plantain , ribleaf , lamb's tongue, and buckhorn. . It is a common weed on cultivated or disturbed land.
Description
The plant is a rosette-forming perennial herb, with leafless, silky, hairy flower stems (). The basal leaves are lanceolate spreading or erect, scarcely toothed with 3-5 strong parallel veins narrowed to a short petiole. The flower stalk is deeply furrowed, ending in an ovoid inflorescence of many small flowers each with a pointed bract. Each flower can produce up to two hundred seeds. Flowers are (calyx green, corolla brownish), 4 bent back lobes with brown midribs and long white stamens. It is native to temperate Eurasia, widespread throughout the British Isles, but scarce on the most acidic soils (pH < 4.5). It is present and widespread in the Americas and Australia as an introduced species.
Distribution
Plantago lanceolata is native to Eurasia, but has been introduced to North America and many other parts of the world with suitable habitats.
History
Considered to be an indicator of agriculture in pollen diagrams, P. lanceolata has been found in western Norway from the Early Neolithic onwards, which is considered an indicator of grazing in that area at the time. This would make sense, as P. lanceolata thrives in open fields where livestock are frequently disturbing the ground.
Uses
Plantago lanceolata is used frequently in herbal teas and other herbal remedies.
A tea from the leaves is used as a cough medicine. In the traditional Austrian medicine Plantago lanceolata leaves have been used internally (as syrup or tea) or externally (fresh leaves) for treatment of disorders of the respiratory tract, skin, insect bites, and infections.
Songbirds eat the seeds, and the leaves are eaten by rabbits.
Chemistry
Plantago lanceolata contains phenylethanoids such as acteoside (verbascoside), cistanoside F, lavandulifolioside, plantamajoside and isoacteoside. It also contains the iridoid glycosides aucubin and catalpol. These iridoid glycosides make the plant inedible to some herbivores, but others are unperturbed by them--for example, the buckeye butterfly Junonia coenia, whose larvae eat the leaves of P. lanceolata and ingest the iridoid glycosides to make themselves unpalatable to predators.
Habitat
Plantago lanceolata can live anywhere from very dry meadows to places similar to a rain forest, but it does best in open, disturbed areas. It is therefore common near roadsides where other plants cannot flourish; it grows tall if it can do so, but in frequently-mowed areas it adopts a flat growth habit instead. Historically, the plant has thrived in areas where ungulates graze and turn up the earth with their hooves.
Reproduction
The mode of reproduction can vary among populations of P. lanceolata. Reproduction occurs sexually, with the pollen being wind dispersed for the most part, though the plant is occasionally pollinated by bees. P. lanceolata cannot self (reproduce asexually) in the way that many other species of Plantago can; instead, it is an obligate outcrosser.
Enemies
Insect predation
Plantago lanceolata is host to many different species of the order Lepidoptera. Species such as Junonia coenia, Spilosoma congrua, and Melitaea cinxia lay their eggs on P. lanceolata plants so they can serve as a food source for the larvae when they hatch. The iridoid glycosides in the plant leaves accumulate in the caterpillars and make them unpalatable to predators.
Infection by powdery mildew
Podosphaera plantaginis is a powdery mildew fungus that infects P. lanceolata. All of the P. lanceolata populations are infected by several strains of this powdery mildew fungus. Once the populations are infected, the symptoms are minimal at first. Then, after a few weeks or months lesions start to appear covering the entire surface of the leaves and the stem, making it very noticeable. Another species that infects P. lanceolata is Golovinomyces sordidus. Both of these mildews are obligate biotrophs, meaning that they can only infect living tissue. They cover the surface of the leaves and extend hyphae into the cell matrix in order to extract nutrients.
Resistance to powdery mildew
After the populations are infected, they react in different ways. Some populations of P. lanceolata are more susceptible to different strains of powdery mildew. Also, some populations have multiple resistance phenotypes where on the other hand, others may only have one resistance phenotype.
Overall, the populations that have the highest variety of resistance phenotypes will have the highest survival rates particularly when rates of infection are high.
In popular culture
In the UK and Ireland the plant is used by children to play various simple games. In Edinburgh, Scotland this game is called ‘The 1 o’clock gun’ after the gun that fires everyday from Edinburgh Castle. Writer Sean Michael Wilson notes that: "When I was a kid in Edinburgh we used it for a cute wee game called ‘The 1 o’clock gun’ - we twisted the stalk around into a kind of noose, quickly pulled it (with the left hand pulling back sharply and the right hand moving forward) and then the head of the stalk would go shooting off. Piitttt!! We used to see how far we could get it to go - great fun." In the West Country of England the same game is called 'cannonballs'. Another game played with the plant in Scotland and Ireland and possibly also in England is called 'Bishops'. This game is a bit like conkers; a child tries to knock off the head of their friend's stalk using their own stalk, via a fast downward thrust.
References
External links
Jepson Manual Treatment
Photo gallery
Buckhorn
Ribwort
Category:Medicinal plants
lanceolata
Category:Plants described in 1753
Category:Taxa named by Carl Linnaeus
|
{
"pile_set_name": "Wikipedia (en)"
}
|
MYSTIC (surveillance program)
MYSTIC is a former secret program used since 2009 by the US National Security Agency (NSA) to collect the metadata as well as the content of phone calls from several countries. The program was first revealed in March 2014, based upon documents leaked by Edward Snowden.
MYSTIC operates under the legal authority of Executive Order 12333.
History
The MYSTIC program started in 2009, but reached its full capability to record the content of phone calls in an entire country for 30 days, in 2011. Documents from 2013 say the surveillance program could be extended to other countries.
On March 18, 2014, the existence of the program was first revealed by The Washington Post, based upon documents leaked by Edward Snowden. It was reported that the NSA had the capability to record all the phone calls from an unidentified foreign country.
On May 19, 2014, the website The Intercept published the name of one country of which the phone calls were recorded, and also identified three other countries of which only the telephony metadata were collected (see below).
Scope
Under a sub-program of MYSTIC codenamed SOMALGET, the NSA is actively recording and archiving the content of "virtually every" phone call for thirty days. After thirty days, the recorded calls are overwritten by newer phone calls, although concern was raised that the NSA may start storing collected phone calls indefinitely.
Although NSA analysts can only listen to less than 1% of the phone calls collected under MYSTIC, millions of voice clips are forwarded for processing and storage every month.
A representative of the American Civil Liberties Union (ACLU) criticized the program, stating that the NSA now has the ability to record anything it wants to. It was also noted that MYSTIC is the first revealed NSA surveillance operation capable of monitoring and recording an entire nation's telecommunication system.
Targets
As of 2013, the NSA collected the metadata of phone calls from five entire countries, according to a report by The Intercept from May 19, 2014: Mexico, the Philippines, Kenya, the Bahamas and an initially unidentified country.
For the latter two countries, the NSA not only collected the metadata, but also the content of phone calls. This took place under the SOMALGET sub-program.
The NSA documents purport that unlawful mass surveillance of the Bahamas resulted in the apprehension of narcotics traffickers. The US government has also not yet shared information with the Bahamas, despite indicating that it would.
Afghanistan
In March 2014, former NSA Deputy Director John C. Inglis had already said that the other country was Iraq, but on May 19, an analysis published on the website Cryptome identified the country as Afghanistan. Several days later, on May 23, WikiLeaks also reported that Afghanistan was the country of which the NSA collected nearly all phone calls.
On September 9, 2015, US Director of National Intelligence James Clapper said that the disclosure of what reporters believed to be the MYSTIC and/or SOMALGET program, led the Afghan government to immediately close down an important intelligence program, that "was the single most important source of force protection and warning for our people in Afghanistan", according to Clapper.
See also
Global surveillance disclosures (2013–present)
List of government mass surveillance projects
References
Category:Mass surveillance
Category:National Security Agency operations
Category:Intelligence agency programmes revealed by Edward Snowden
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Unable to extract the content from this file. Please try reading the original.
|
{
"pile_set_name": "FreeLaw"
}
|
Q:
Using STL containers in GNU Assembler
Is it possible to "link" the STL to an assembly program, e.g. similar to linking the glibc to use functions like strlen, etc.? Specifically, I want to write an assembly function which takes as an argument a std::vector and will be part of a lib. If this is possible, is there any documentation on this?
A:
Any use of C++ templates will require the compiler to generate instantiations of those templates. So you don't really "link" something like the STL into a program; the compiler generates object code based upon your use of templates in the library.
However, if you can write some C++ code that forces the templates to be instantiated for whatever types and other arguments you need to use, then write some C-linkage functions to wrap the uses of those template instantiations, then you should be able to call those from your assembly code.
|
{
"pile_set_name": "StackExchange"
}
|
Array ( [actionDate] => 2012-04-27 [displayText] => Passed/agreed to in House: On motion to suspend the rules and pass the bill, as amended Agreed to by voice vote.(text: CR H2223-2225) [externalActionCode] => 8000 [description] => Passed House [chamberOfAction] => House )
There are 3 summaries for H.R.3834. Passed House amended (04/27/2012) Reported to House with amendment(s) (03/22/2012) Introduced in House (01/27/2012) Bill summaries are authored by CRS
Shown Here:
Passed House amended (04/27/2012)
(This measure has not been amended since it was reported to the House on March 22, 2012. The summary of that version is repeated here.)
Advancing America's Networking and Information Technology Research and Development Act of 2012 - Amends the High-Performance Computing Act of 1991 to rename the National High-Performance Computing Program as the Networking and Information Technology Research and Development Program.
(Sec. 2) Directs the federal agencies participating in the Program to: (1) periodically assess the contents and funding levels of program component areas and restructure the Program when warranted; and (2) ensure that the Program includes large-scale, long-term, interdisciplinary research and development (R&D) activities, including such activities in networking and information technology in areas having the potential for significant contributions to national economic competitiveness and for other societal benefits.
Requires the participating federal agencies to develop, and update every three years, a five-year strategic plan to guide activities provided for under the Program.
Requires the plan to specify near-term and long-term objectives and how the Program will accomplish other specified objectives, including by: (1) fostering the transfer of R&D results into new technologies and applications for the benefit of society, including through cooperation and collaborations with networking and information technology research, development, and technology transition initiatives supported by the states; and (2) encouraging and supporting mechanisms for interdisciplinary R&D in networking and information technology, including through collaborations across agencies and program component areas, with industry, federal laboratories, and international organizations.
Requires the strategic plan to be accompanied by milestones and road maps for establishing the national research infrastructure required to support the Program. Instructs the entities involved in developing the plan to consider recommendations of the: (1) advisory committee on networking and information technology (the advisory committee) (under current law, titled as the advisory committee on high-performance computing); and (2) stakeholders whose input was solicited by the National Coordination Office, as required under section 6 of this Act.
Requires the Director of the National Coordination Office to transmit the strategic plan to Congress and the advisory committee.
Requires the Director of the Office of Science and Technology Policy (OSTP) to encourage and monitor the efforts of participating agencies to allocate the resources and management attention necessary to ensure that the strategic plan is executed effectively and that Program objectives are met.
Amends the High-Performance Computing Act of 1991 to require the co-chairs of the advisory committee to meet the qualifications for membership on the committee and permits them to be members of the President's Council of Advisors on Science and Technology.
Requires the OSTP Director to develop a research, development, and deployment roadmap covering all states and regions for the provision of high-end computing and networking systems (under current law, high-performance computing and networking systems), as specified in such Act.
Amends the High-Performance Computing Act of 1991 to require annual reports on the implementation of the Program to: (1) describe the levels of federal funding for the previous fiscal year, (2) describe the levels of federal funding for the previous fiscal year for agencies and departments participating in the Program, and (3) include reporting on the research areas supported under section 3 of this Act.
Requires the OSTP Director to include in such reports: (1) a description of how the objectives for program component areas, and for activities that involve multiple program component areas relate to the Program's objectives identified in the strategic plan; (2) a description of the funding required by the National Coordination Office to perform its functions for the next and current fiscal years; and (3) the amount of funding provided for such Office for the current fiscal year.
(Sec. 3) Directs the Program to encourage the federal agencies to support large-scale, long-term, interdisciplinary R&D activities in networking and information technology directed toward areas having the potential for significant contributions to national economic competitiveness and for other societal benefits. Requires such activities to be designed to advance the development of research discoveries. Instructs the advisory committee to make recommendations for candidate R&D areas for support.
Requires that such R&D activities shall: (1) include projects based on applications for support that are selected through a competitive, merit-based process; (2) involve collaborations among researchers in institutions of higher education and industry, permitting the involvement of nonprofit research institutions and federal laboratories, as appropriate; (3) leverage federal investments through collaboration with related state initiatives, when possible; and (4) include a plan for fostering the transfer of research discoveries and the results of technology demonstration activities to industry for commercial development.
Requires the federal agencies to give special consideration to projects that include cost sharing from non-federal sources.
Instructs, when two or more of the federal agencies or other appropriate agencies are working on large-scale R&D activities in the same area, such agencies to strive to collaborate through joint solicitation and selection of applications for support and subsequent funding of projects.
Allows R&D activities under this section to be supported through interdisciplinary research centers organized to investigate basic research questions and carry out technology demonstration activities. Permits research to be carried out through existing centers, including the multidisciplinary Centers for Communications Research authorized under the America COMPETES Act.
(Sec. 4) Requires the Program, in addition to its current requirements, to provide for: (1) increased understanding of the scientific principles of cyber-physical systems and improve the methods available for the design, development, and operation of such systems; and (2) R&D on human-computer interactions, visualization, and big data. Defines "cyber-physical systems" as physical or engineered systems whose networking and information technology functions and physical elements are deeply integrated and are actively connected to the physical world through sensors, actuators, or other means to perform monitoring and control functions.
Requires the Director of the National Coordination Office to convene a task force to explore mechanisms for carrying out collaborative R&D activities for cyber-physical systems, including the related technologies required to enable such systems, through a consortium or other appropriate entity with participants from institutions of higher education, federal laboratories, and industry.
Requires the task force to: (1) propose a process for the development of a R&D agenda for such entity, including guidelines ensuring an appropriate scope of work focused on nationally significant challenges which require collaboration and ensuring development of related scientific and technological milestones; and (2) propose guidelines for assigning intellectual property rights and for the transfer of research results to the private sector; and (3) recommend how such entity could be funded from federal, state, and non-governmental sources. Requires such Director to transmit to Congress a report that describes the task force's findings and recommendations.
(Sec. 5) Requires the Director of the National Coordination Office, through the National Science and Technology Council, to convene an interagency working group to examine: (1) the R&D needed to enhance the effectiveness of cloud computing environments, increase the trustworthiness of cloud applications and infrastructure, and enhance the foundations of cloud architectures, programming models, and interoperability; (2) the potential use of cloud computing for federally-funded science and engineering research; and (3) report to Congress on the findings and recommendations of the working group.
(Sec. 6) Repeals provisions for the National Research and Education Network.
Requires continuation of a National Coordination Office. Directs the National Coordination Office to: (1) serve as the primary point of contact on federal networking and information technology activities; (2) solicit input and recommendations from stakeholders during the development of each strategic plan through the convening of at least one workshop; (3) conduct public outreach, including dissemination of the findings and recommendations of the advisory committee, as appropriate; and (4) promote access to and early application of the technologies, innovations, and expertise derived from Program activities to agency missions and systems across the federal government and to U.S. industry.
Requires the operation of the National Coordination Office to be supported by funds from agencies participating in the Program.
(Sec. 7) Directs the National Science Foundation (NSF), as part of the Program, to use its existing programs, in collaboration with other agencies, as appropriate, for improving the teaching and learning of networking and information technology at all education levels and to increase participation in networking and information technology fields.
(Sec. 8) Makes technical and conforming amendments, including with respect to the activities of the NSF, National Aeronautics and Space Administration (NASA), Department of Energy (DOE), Department of Commerce, Environmental Protection Agency (EPA), and Department of Education under the Program.
Requires the advisory committee to report to Congress, no less frequently than once every three fiscal years (under current law, no less frequently than once every 2 fiscal years) on the committee's findings and recommendations from its periodic evaluations of the funding, management, coordination, implementation, and activities of the Program.
Requires NIST to develop and propose standards and guidelines needed for assuring the cost-effective security and privacy of information in federal computer systems (under current law, privacy of sensitive information in those systems).
|
{
"pile_set_name": "OpenWebText2"
}
|
Why Would Someone End A Good Relationship While Grieving?
Recommended Posts
Hi everyone, this is my first post, although I've been reading some topics here in recent weeks. I've been struggling to understand and cope with how my boyfriend has been grieving. We had a very close, wonderful relationship and it was going absolutely great until his mother died unexpectedly. I was the person he was emotionally closest to, so at first he turned to me immediately and wanted my comfort and company. He is very much alone in the world right now because his father died a few years ago and he has no remaining close relatives.
He had to leave to take care of arrangements because his mother lived in another state. I wanted to go with him but all flights were fully booked that week, and he said he would be fine. I just tried to be as supportive as possible over the phone, and we talked at least once every day. But after about a week, he seemed to collapse emotionally and withdrew, and when he came home, he said we needed to take a break because he couldn't be in a relationship anymore. He said he needed to deal with everything alone and didn't want to talk to anyone about what he was going through. He said maybe it would be different if we had been together for years, but I just didn't know him well enough to understand his grief. He said he loved me and cared about me deeply but didn't know if he should ever be in a relationship with anyone ever again. At the same time, he recognized on some level that this was a rash decision and said to give it some time.
It's now been about 2 months, and we've only really had two more conversations since then. I've been trying to give him space, so I contact him rarely and I try not to bring up relationship matters (so as not to make him feel any pressure), but somehow he always ends up talking about them. He seems conflicted and confused about what he wants and says we'll talk more or he'll see me soon, but he never contacts me. I haven't heard anything from him at all in a month now. It is so hard to be treated like we never existed.
I've read a lot of threads on here where people have experienced similar shut-outs from their significant others. It has been so hard to deal with this - I'm still crying almost every day, 2 months later. I want so much to be supportive and he seems to really need it, but he won't let me back into my place in his life. I worry that if I give him too much space, I will simply just drop out of his life completely because it'll be harder for us to ever talk again. Every day I come across things that remind me so much of his absence from my life, and I don't know how he couldn't feel the same way because we were so close and spent so much time together. He always told me that I made him happy because I understood him and made everything else in life worthwhile. He only has a small circle of friends, and they say that he doesn't ever talk about his mother or me at all, even if they try to ask him about it, but he just seems to be returning to his old routines now and looking forward.
Is there anything I can do?? I feel like I am going crazy because none of this makes any sense and I don't know if I am waiting and hoping in vain. We used to always talk so much and spent nearly every day and night together. All our routines are gone now and it has been such a sudden change in my life. I don't know why he doesn't miss our life together, when he used to miss me so much whenever I wasn't with him. What makes it harder to understand and accept is that I know it probably really has nothing to do with me but just with his own emotional issues. Is two months still early in the grieving process even if outwardly he is trying to seem like everything's back to normal? How can I know whether he'll ever come around? Is there anything more I can do or should be doing differently?
Share this post
Link to post
Share on other sites
I don't have much time right now but I know how you feel and I know how much it hurts. I'll post a longer reply later on today when I have more time on my hands. For now, just try and stay busy, spend extra time with friends and family and do things that will help keep your mind off things. If you have a job make sure you go work, works probably been the best place for me over the past 6 weeks since my ex broke up with me after her Dad passed away.
Believe me you will be okay! I'm not 100% yet and it will take time but you'll pull through. Like I said, I'll post a longer, more helpful post later on.
Share this post
Link to post
Share on other sites
Interests:I lead a grief support group and I enjoy volunteering in my church (Treasurer & on Praise Team, choir) and the senior site, where I do the bingo prizes. I love stamping, hiking, nature, singing. I am a retired Office Mgr./Bkpr.
I'm sorry you're going through this. You probably read about my fiance dumping me by Fed Ex when his mom was dying (he was her caregiver the last two months of her life). I was shut out completely, not allowed to talk to him, bring him a meal, nothing. After she died he talked to me (grieving issues) on the phone but it was sporadic...he might talk for hours and then not contact me for weeks. I was crying daily, nightly, not sleeping, it was really doing a number on me, until I finally accepted we are broken up permanently and for whatever reason, he doesn't want me anymore. Now we talk on the phone about every other day, but it's more like friends...he still doesn't let me too close and I've only gotten to see him twice since all this happened...he broke up with me ten months ago. This is the man I'd thought I was going to spend the rest of my life with so it was a real shock. I don't understand the reaction, but there are enough of them that this has happened to that it tells me it's actually fairly common. I did a lot of reading on loveshack.org under the breakup and reconciliations section and it helped me a lot in how to deal with it.
Here is a link to Don Ho's thread that has some guidelines that really helped me:
I can't seem to get the link to work but he's told us we can re-post what he says, so here goes:
Reconciliation List
I'm not a fan of second chances because they typically end up with the Dumpee getting dumped again and I think the Dumpees most often are holding on to false hope of getting back together. However, I have this list I was working on (based largely on another LS Members thread) for those of you that want to know how to act and what to do IF a Dumper contacts you and really wants you back. Before you read this, you should probably take a look at No Foolin's thread:
This should give you PLENTY to read and think about. Ironically, my list turns out to be 12 steps:
1. ACT HAPPY
Don’t show any signs of being sad or depressed in front of them. This doesn’t mean going up to them and saying “my life’s fabulous now I’m sooo glad we’re finished”. It just means you should put on an appearance that everything is fine and dandy. This is an especially important rule if your ex found you to be clingy. No one wants to feel like they’re responsible for someone else' happiness, so show them that they’re not. You don’t need them to be happy.
2. DO NOT BRING UP THE RELATIONSHIP!
As above under ‘stop questioning them’. If they happen to bring up any relationship type talk, it’s ok to engage if you think you can both do it in a calm collected manner. If not or if it drags on without going anywhere, it’s best to just to divert and go back to normal, friendly chit chat or make your excuses and exit the conversation (in a polite way). If they’re constantly on the phone to you crying over what’s gone on but show no sign whatsoever in wanting to reconcile, they’re just stringing you along and you can’t let them.
3. DON'T ARGUE
Arguing closes off lines of communication which is not what you want to do when you’re trying to open them up or keep them open. The more you fight, the more you criticize, the more they defend themselves, the more they back off the less they think of you and the more they think they’ve made the right decision to leave you. Stop arguing, keep your emotions in check!
4. DON’T REACT TO THEIR HOSTILITY
It’s not unknown for dumpers to react in a cold or hostile way to the dumpee after a break up even when the dumpee hasn’t done anything to deserve it, especially when they have a new person!! The natural thing to do is react angrily to this and demand to know why you’re being treated unfairly. I don’t know why the dumper feels this need to be cruel but I do know that when you react to it, you just make matters worse. Quite often you don’t get an answer for their behavior and the more you push the more hostile and distant they get. If they tell you that you can’t pick up the rest of your stuff from their place because they’re too busy, just tell them “that’s fine, we can sort that out another time”. You’re easy going, you’re cool, you’re calm and that should hopefully force your ex to stop fighting and start acting rationally.
5. FAKE INDIFFERENCE
Fake indifference about the breakup. It’s not what you wanted but it was their decision so that’s ok with you. Obviously it’s not ok, but acting like you care too much is unlikely to work. Especially if they’ve told you there’s no chance they’ll change their mind and want you back. They’ve broken up with you and they’re totally unfazed by the whole thing. You on the other hand are heartbroken, confused, hurt and angry. You cry, you get upset and you give off the impression that you’re desperate and you need them. You push and you push and you push and they back further and further away. When you act indifferent to the break up you stop becoming needy and instead come across as a mature rational person who although didn’t want the break up is willing to accept it and refuses to dwell.
6. STOP TELLING THEM YOU LOVE THEM
When they’ve dumped you and you’re saying “I love you” you’re trying to claw them back into a relationship they don’t want to be in. You’re saying to them I need you, I want you, please give me what I’m looking for. As far as they’re concerned it’s all done and dusted and you’re just grasping at straws. You can’t force someone to feel what they don’t feel. They don’t love you anymore, that’s fine. You’re backing off. There’s no pressure and you’re not gonna tell them you love them because although you’d like to have them you don’t need them.
7. STOP QUESTIONING THEM
Don’t ask them what they’re thinking, what they’re feeling, what they thinking about the break up, if they’ve noticed how much you’ve changed. This can be very intimidating to people and it puts them on the defensive. Also if you keep asking them and they keep having to explain what they feel they’ve already explained, they’re gonna start getting annoyed with you and want less and less to do with you. Take off the pressure and watch them feel more at ease.
8. STOP CRITICIZING & COMPLAINING
Don’t blame them for the break up, don’t complain about what they did wrong in the relationship. It’s fine to talk to let off steam to others about this (just don’t do it too often otherwise your friends will dump you) but if you want to reconcile with your ex, don’t criticize. Judging them and chipping away at them is not gonna keep the lines of communication open. If you wanna discuss the ins and outs of what you both did wrong in the relationship, chances are you’ll have that talk if you get back together. Now is not the time.
9. DON'T TRY TO CONVINCE THEM TO FEEL DIFFERENTLY
People don’t like to be told what to think and feel. It’s a form of control and who likes to be controlled? Nobody. They already know how they feel, they’ve made their decision and the more you try to persuade them otherwise, the more they’ll dig in their heels. Don’t try to convince them that you’re so wonderful, the perfect BF or GF and why they should love you and feel a certain way. You’re just pushing and it will push them away. Also, when you try to persuade them to feel differently you’re insulting them because they think you’re questioning their judgement and decision. That’s not going to help your cause.
10. DON'T GIVE THE IMPRESSION YOU'RE WAITING AROUND
If you keep letting them know that you’re there if they ever change their mind, you’re nothing but a pushover and a sap. Every time you give off that impression you’re saying I can’t get anyone else, I have low self esteem, I’ll be your plan B, I’m willing to accept whatever breadcrumb you throw in my direction. Not very attractive to a potential mate. This attitude doesn’t give of confidence or sex appeal. You’re absolutely no challenge to them anymore. They don’t even have to try. Boring! Best to tell them or give them the impression that you’re out having fun, seeing people of the opposite sex and moving on.
11. TRY NEW THINGS
If you’ve been stuck in a bit of a rut in your life, now’s the time to get out of it. One of the reasons your ex may have left you is boredom. Everyone has things they’ve been putting off doing or have always wanted to do but have never had the time. Now’s the time to take action. Now your partner has gone you probably have that extra bit of spare time to try some new things and show your ex that you’re not as boring and predictable as they thought you were. It could be anything at all. Maybe you’ve always wanted to learn to drive, or learn a language or visit some far flung city or take cooking lessons. It doesn’t matter what it is as long as it’s something you want to do. Your new found confidence that you’ve gained from your new skill/new experience will be alluring and you’ll find yourself having more to talk about which will make you more interesting too.
12. TANTALIZE, REASSURE & WORRY THEM
Tantalize them, reassure them and worry them. Tantalize means your new found confidence, your looks, your conversational skills or whatever it was that your ex was attracted to in the beginning. Tantalizing them means alluring them back to you but in an indirect sort of way. You don’t want them to know that all this effort is for them! Reassuring means making sure they realize you’re not gonna be needy, you’re not gonna be possessive, you wont be jealous and you’re not desperate to win them back. Worry means worrying them that they might lose you. Don’t tell them they might lose you, just go out and date and don’t let them know that nobody else compares to them. If you do that they’ll know you’re effectively just waiting in the wings. Reverse the roles and hopefully when they know someone else is cozy-ing up to you they’ll start to wonder what they’ve thrown away.
Yes two months is still really fresh, I am not surprised you are still crying and feeling like you are. It takes time and that's the hardest thing to rush.
If we can help you, please let us know, keep posting here.
Kay
1
Share this post
Link to post
Share on other sites
Thanks for the advice. It's been a difficult adjustment but I'm trying to find happiness on my own again. I think the situation is complicated for us because of the grief component, which is why I found the posts on this site to provide the most insight, rather than a site about general relationship advice. I know that my relationship in itself was great before this death happened - even the night before his mother died, he expressed how happy and in love he was with me, and we were making plans to travel outside of the country together. We had so much we were looking forward to. I can understand needing to put those things aside now, of course, but I can't understand why grieving means that he has to treat me like I don't even exist and it's like he made a decision overnight to throw away everything we had built together. I get very angry sometimes because I feel like he's treating me horribly and I know I deserve better, even though I feel a lot of sympathy for his terrible situation.
I wish I could hear from people who have been on the other side of this, to understand why someone would do this in grief and push away their nearest and dearest source of support. At first, my friends who knew both of us thought he had just gone crazy with grief and would surely come around soon because they knew how great we had been together. They can't make any sense out of his behavior. I can understand needing some time alone to grieve but he is letting friends and family gather around him and I am the only one who has to stay away. Memorial services are scheduled for later this month but he has asked me not to come (although originally, the first week after his mom died, he had asked me to be there with him). Why would someone's feelings change like that, when I haven't done anything wrong? It feels so wrong for me not to be there at a time like this. I was closer to him than anyone and most of his friends didn't know anything about his mother at all.
Share this post
Link to post
Share on other sites
Maybe he feels guilty for spending time with you instead of his mother, I know thats how I feel about my ex boyfriend, all those times and last moments I couldve had with my dad and instead I was with him. Doesnt make sense of course because thats what happens people have boyfriends/girlfriends and dont spend as much time with their parents but its just because you asked how you think someone on the other side might feel and I know thats how I feel. But its different because my ex was never there for me or supportive but thats just a possible reason?
1
Share this post
Link to post
Share on other sites
I do think there are a lot of guilt issues involved. Although he did talk to his mother over the phone pretty regularly, I felt like he often wasn't very supportive of her emotionally and I once kind of chided him (in a way that was mild and constructive) for that last year. They definitely had a love-hate relationship where he was always resisting her influence because certain aspects of her personality annoyed him. He was always complaining about her to me. I'm sure he feels a lot of remorse for that now. But it isn't fair of him to take it out on me as I've always tried to be supportive.
What I find hardest to understand is the sudden breaking off of contact so abruptly, when everything had been going great between us. When she died, we had come back a couple of weeks before from a very romantic trip and we were very happy, more in love than ever. I could tolerate needing to cool off relationship stuff now, as it isn't the time to think about that, but don't know why he can't even treat me as a friend anymore (though at first he begged me to stay in his life), when I had been such an important person in his life before. I feel like he's punishing me for something even though I've been nothing but good and supportive to him. I haven't done anything to deserve being treated like this.
I have a hard time deciding between whether it's better to maintain radio silence for a while longer or to try to check in on him again. Friends are of two different minds about this, and I constantly finding myself wishing I could contact him but then holding myself back.
Share this post
Link to post
Share on other sites
Don't take it personally, it's just what they need right now. It takes a lot for us to understand, I still don't understand but I respect my ex's wishes and I'm now trying to move on after 6 weeks of trying to talk to her. There's nothing we can do to help them unless we bring back that person they want in their lives. Maybe one day they will realise what they have given up, Fern's friends used to tell her that they all thought she had the perfect relationship with me, something Fern thought as well but losing her Dad changed her and changed things for us, there's no one else in the world they want apart from that one person they can't have.
My advice would be to protect yourself, retreat and focus on you! If they come back great, if not, remember it's not your fault, it's not their fault but it's just something that happened and you can't chance how they feel. You'll be fine in time, I promise.
Share this post
Link to post
Share on other sites
It's hard not to take it personally. On one hand you can say it's not his fault, but of course he can make choices about how he treats people he cares about and he hasn't pushed away anyone else except for me. He is responsible for how he behaves, especially if he seems to be functioning okay with friends, family, and work. Maybe those things require less emotional involvement, but at least he could drop me a line now and then, right? It's hard to understand why I have to be excluded completely when I did nothing wrong and have only been sweet and supportive to him (as he said himself).
I think the memorial service is this weekend but I don't even know for sure since he hasn't contacted me in over a month. It's horrible considering how close we were before all of this happened. Not sure I should say anything at this point, or if any contact I try to make before he's ready would be viewed as an intrusion.
Share this post
Link to post
Share on other sites
I know how hard this is not to take personally, sometimes I think about it and get angry but Fern's done exactly the same to me as what your boyfriend is doing to you. Fern told me I've done nothing wrong and she doesn't know herself why she's chose just to push me away so I'm guessing your boyfriend will be the same. For now, having a relationship is just too much for them, they're probably scared to lose someone who's so close to them again and so they push us away to protect them. It seems like me and Fern had a very similar relationship to yours and so I can see where you're coming from, and for dropping you a line every now and then, they probably just don't know what to say unfortunately.
Don't contact them, maybe a little text or e-mail now and then but not too much and maybe things will be okay again in the future, but for now, just try and focus on you, do things you like and stay busy as it will hit you hardest when you're alone.
Share this post
Link to post
Share on other sites
Thanks, I had considered posting there originally but thought this was a better section for my topic because it's not just about the loss of a love relationship but specifically about grieving behavior and why it would lead to ending a relationship which should not have ended for any other reason.
I want to try to understand why someone would behave this way while grieving. I was hoping to get a broader perspective and insight into grief as it applies to my situation, from people who have grieved in this way - people who have pushed away a significant other as part of their grieving process. It's hard for me to rationalize it but maybe if someone can explain what it is like to go through that and why they would do it, I can begin to understand it a little better.
Share this post
Link to post
Share on other sites
I know how hard this is not to take personally, sometimes I think about it and get angry but Fern's done exactly the same to me as what your boyfriend is doing to you. Fern told me I've done nothing wrong and she doesn't know herself why she's chose just to push me away so I'm guessing your boyfriend will be the same. For now, having a relationship is just too much for them, they're probably scared to lose someone who's so close to them again and so they push us away to protect them. It seems like me and Fern had a very similar relationship to yours and so I can see where you're coming from, and for dropping you a line every now and then, they probably just don't know what to say unfortunately.
Don't contact them, maybe a little text or e-mail now and then but not too much and maybe things will be okay again in the future, but for now, just try and focus on you, do things you like and stay busy as it will hit you hardest when you're alone.
Tom you're so right about how similar our situations are. My boyfriend did say a couple of times before that he had thought about emailing or calling me but couldn't finish the email or didn't know what to say. I guess it is just too much effort and they want to take time out for themselves for a while? He says being around me is too confusing and causes emotional stress but I don't understand why my presence wouldn't be comforting at a time like this, why there is this inner conflict which never existed before. He has a high-pressure job and in the past, he would always vent to me and say how much better I made him feel after he talked to me about things. Now he is going through a more difficult time than ever but he doesn't want to turn to me as usual. I hope he is seeing a therapist as it seems like he really needs it, but of course now I can't know what he has been doing lately or whether he's starting to feel better at all yet.
It feels wrong to not send any words of support while he's going through the memorial service stuff this weekend, but I guess I have already reached out enough times to express my condolences and let him know that I care. At this point, I may just have to let it be.
Share this post
Link to post
Share on other sites
Whatever you do, don't ever feel like you didn't do anything, you gave everything but sometimes your best won't be good enough for anyone, the one person they truely want is no longer here and so to them, nothing means what it used to. Fern told me she had changed and so she broke up with me out of care for me, that she didn't want it to be one sided, maybe it's the same for you? You're right, right now it's all about them, no one else, it's time for them to find themselves again, to find a way of life without that special person. Fern loved me, she might still love me but nothing can replace that love of a parent, it's hard to understand, I still don't understand but I respect Fern's wishes and leave her be, she doesn't want me in her life, yeah she says she's confused but I'd rather stay away for her, and to protect myself and to give myself a chance to heal too and move on.
I would send a little text this weekend, just saying that you're thinking of him or something. Nothing too much and nothing to put any sort of pressure onto the situation, if he doesn't reply, then at least you tried.
Share this post
Link to post
Share on other sites
Miri, Tom, I feel your pain, sorrow and frustrations as I read through each and every post. I find myself in a similar situation, and can relate to questioning "why?". I found KayC's contribution and advice extremely helpful, and my heart just swells with warmth when she talks about the love she had with first husband.
My boyfriend (him 43, me 35) of over two years ended our relationship the same day as he came home from cleaning out his deceased father's house out of state. It absolutely slaughtered my heart, my dreams and so much more. It's been over a month and a half since that day and yet the pain is still drags me down. I want to be there for him, hold his hand and share the path thru the good and bad times......but he's let me go and I feel like I have no place in his life or heart anymore. The past two years with him were the best two of my life, so much love, laughter, fun, caring, intellectual and physical stimulation. No drama, infidelity, lies or such things, just pure and honest respect, love and fun. He reasoning for the breakup was that he stated the three following things: I'm too nice, he doesn't feel the same way about me and that I deserve better. He may have said more, but I was in to much shock to grasp what was happening. He never stated the break up had anything to do with his father's passing, but it's hard to not imagine that grieving process was involved in some manner. I guess what complicates the matter is that his relationship with his father was not good. The father had been a disappointment in his life multiple times. They spoke, but not often and ex-b was appalled by the way his fathered lived, handled his health and finances. To add to the complexity of the situation the father had passed in his home, alone and wasn't found until a week later (I haven't mentioned the hoarding yet either.) So the responsibilities that fall on ex-b are huge, I can only imagine a myriad of feelings come with it such as anger and guilt as well. He has wonderful friends, boss, an amazing mother and sister, so I am comforted that he is not alone in this difficult time.
Not until I found this forum, did I learn that shutting a partner out like this is not as rare as I thought it was. I felt like I was being punished and really coludn't figure out what I had done to deserve this pain. So I guess we're both grieving, one the loss of a father who never was what a father should have been and the other the loss of the one partner that she took forever to finally find.
Share this post
Link to post
Share on other sites
Caroline, I feel your pain. It seems like it is a common reaction to a parent's death, as several people here seem to be in the same boat. I wish I could understand it and know whether we can have hope. It is such a difficult place to be in. You might be able to get more responses about your situation if you started a new thread of your own about it.
I have decided to move this to the other forum about Loss of Love Relationships, as someone suggested earlier, in hopes that it will get more responses there. [Edit: It looks like a moderator just moved this over to the new section now. Sorry for any confusion.]
However, I would still really like to hear from people who have been through grief and pushed loved ones away, if you stumble across this topic and have any words of advice. Sometimes it is just so hard to know what to do, because I don't know how to address his grief. Is space the answer? Or is it okay to try to send him little notes or check in on him even though he never contacts me? How can I know whether he's still grieving or if he's really just done with our relationship?
Share this post
Link to post
Share on other sites
Today it's been about two weeks after the memorial service. I still haven't heard from him, but a mutual friend confirmed for me that it took place. He had many of his friends there, even though it was in another state and most of them had never met his mother and didn't know much about her. They are old friends from school, but as guys, they don't really talk a lot about intimate emotional stuff. They say he is acting like "business as usual" but I did hear though that he's gone back to smoking (he had just quit before she died) and drinking more heavily than normal.
I feel bad that he no longer wanted me to be at the service, even though I was closer to him than anyone and he had actually wanted his mother to meet me. I wanted to be there more than anyone else. I wish I could say something to express my feelings. Right after she died, which was three months ago, I did have flowers sent and he appreciated that, but I could only put a few lines on the card. I don't know what to do now.
It helped a lot to talk to a friend at work who lost her mother six years ago. She said three months is nothing when one is devastated by grief, so maybe he just needs more time. But for me, my life has been completely disrupted as well, and I am left hanging. We never got to have a proper talk about anything, there is no real resolution yet, and he kept saying we would talk soon or he would see me soon, but I haven't heard anything from him in almost two months now. I want to be patient, but without signs to give me hope, it is so hard. I don't know whether he just needs more time and whether to keep giving him space.
My friend also said to know that it really isn't about me or the relationship, it's just something that is so overwhelming that he cannot deal with my needs right now. On one level I try to understand this intellectually. But then a day like this comes, when I am not busy or have a schedule packed with activities as usual, and I just feel his absence so much and can't understand why he doesn't miss me and won't just drop a line. I want to pick up the phone and check in on him but I don't know if that is the right thing to do.
The whole thing has seemed really terrible and abnormal to me. One day we were so happy together, so affectionate with each other and in love, looking forward to so much...then suddenly a few days later, it just ends and there is no contact. And because of nothing that I did, nothing that should have been wrong with us... To have someone you were that close to just ripped out of your life like that is horrible, it is almost as if he died too. How can it just be this way? Everything was going so well and now everything feels wrong with the world.
Share this post
Link to post
Share on other sites
Interests:I lead a grief support group and I enjoy volunteering in my church (Treasurer & on Praise Team, choir) and the senior site, where I do the bingo prizes. I love stamping, hiking, nature, singing. I am a retired Office Mgr./Bkpr.
I'm afraid most of us here can't shed much light on it as we are the dumpees not the dumpers. But as Tom said, they feel a relationship is too much right now and it's taking all that is within them to deal with the death of their parent. It's been 11 months since my fiance broke up with me and he never did resume our relationship after the death of his mom, we are more like "phone pals" but that's it. In the beginning we had two or three months without any contact at all and then he made contact, but it's never been the same since. Neither of us date. For him I think he doesn't want to hurt anyone else and for me, I don't trust anymore.
The other thing that I have learned is that they can't handle the slightest bit of pressure. If you offer encouragement and support, maybe send a card with a very short message on it...praying for you, something like that, nothing that could be taken the wrong way.
I'm sorry there are so many going through this. The one thing I do know is that it isn't personal, even though it sure feels like it, and it happens often enough to know this is fairly common. It does make it hard to trust again because calamities do strike without warning in life and how can we know it won't happen again?
Share this post
Link to post
Share on other sites
Time, time, more time and lots of space,....there obviously is no recipe how to successfully deal with the situations we are in. But what gives me hope and keeps me going is that I know the famlies affected and significant others are in my thoughts and prayers every single day. For myself, I'm trying to be that strong confident person I once was, even though I miss and love Chris dearly, I just can't let his method of dealing with his grief leave me behind as damaged goods.....that's just not right.
Share this post
Link to post
Share on other sites
Thank you for your messages of support. I am sure I will hear from him eventually, because I believe he is a good guy and not the kind to just run off and disappear forever. We also have mutual friends who will make him feel accountable. Nevertheless, it does seem like it's taking a really long time - three months since the death, and almost two months now since I last saw him or heard anything from him. I feel like I was just abandoned, and I don't understand why he can't talk to me at all, when he is interacting with everybody who is important to him, including an old ex-gf from ten years ago (she is with someone else now, but they are still friends). I know it is different with me because of the type of relationship we had, and because he owes me expectations of an emotional commitment that he is unable to give to anyone right now. But it still sucks to be completely shut out when he is still talking to everyone else. I want to believe that he still cares. It doesn't make any sense and seems really wrong for him to simply want to drop all contact with me when I haven't done anything wrong, and have always been good to him.
I just want to have faith in him, that he will eventually feel better and come around. We had so much good that was going for us...it would be stupid of him to turn his back on that chance at love and happiness. Our friends think he is being an idiot, because they quite frankly do not believe he will ever be able to meet another person like me again in his life. I was really good for him and made his life better. He says he prefers his solitude right now, but I don't think that will last forever, as he was not happy being alone before he met me.
Weekends are the hardest, especially because I think of all the things we should be doing, would be doing together, if his mother hadn't died. Especially on a long holiday weekend like this, when everyone else seems to be going about with their normal happy lives.
I probably made a mistake by trying to call him this weekend, he didn't pick up and I just got voicemail and didn't leave a message, but he will see that I called. I don't know if he'll try to call back, but at least he'll know that I'm thinking of him.
Share this post
Link to post
Share on other sites
Interests:I lead a grief support group and I enjoy volunteering in my church (Treasurer & on Praise Team, choir) and the senior site, where I do the bingo prizes. I love stamping, hiking, nature, singing. I am a retired Office Mgr./Bkpr.
I know exactly how you feel, it's almost as if they follow a script it's so similar, all of our experiences. Jim made contact with an XGF that he hadn't talked with in years either, and still keeps up with her. It's like the reach out to everyone who is familiar...except for us. I do not for the life of me understand why/how their response is like this...I know it's nothing personal but it sure feels personal, I know they don't feel they have it in them to invest in a relationship right now and I get that, but they invest in everything else, their friends, etc. I just don't get it. That's why I wonder if there was something they weren't happy with and hadn't told us, I dont know, but just two weeks before he broke up with me he told me he saw us spending our whole lives together...from that to this? He's completely moved on in his life without me...oh sure, he calls now but it's more like he views me as an old friend, not someone he'd intended to share his life with.
Share this post
Link to post
Share on other sites
It is a gutt wrenching feeling that we are all experiencing. And it is true, that it feels almost as if this has been scripted -with how similarly we are all facing this situation. And, as it seems, there is a scripted answer. --Be patient, and carry hope inside of your heart.
Share this post
Link to post
Share on other sites
Interests:I lead a grief support group and I enjoy volunteering in my church (Treasurer & on Praise Team, choir) and the senior site, where I do the bingo prizes. I love stamping, hiking, nature, singing. I am a retired Office Mgr./Bkpr.
Share this post
Link to post
Share on other sites
So I never did get a call back to my spur-of-the-moment attempt to call him last weekend, but I wasn't too surprised. The question is I don't know whether that means anything. I've read that when someone is grieving it can just be hard for them to get back to you because of what they're going through. It doesn't necessarily mean that they don't want to hear from you or want you to stop trying, but just that they don't have the emotional energy to deal with it at that moment.
But I'm starting to have some moments where I don't know if he just really doesn't want to hear from me anymore. It's been over two months now since I last talked to him. I didn't contact him at all for over a month (all of June and a little before and after). I broke my silence by sending him a postcard a week ago and then trying to call him last weekend (but didn't leave a message). I find it really hard to understand why he won't talk to me at all, as I haven't done anything wrong to him and we did not leave on upset terms. He never asked me not to contact him, or even to give him space, in those words - just said he couldn't be in a relationship with anyone right now, but he asked me to stay in his life and be a friend for now because I was important to him. We were fine, he just said he needed to figure things out and that we'd talk more and he'd see me soon - but that never happened because I gave him some space, and now there's nothing. I don't understand how things came to this.
He doesn't seem to have fallen into a deep depression - in fact someone just told me he was kind of upbeat when they last saw him - but he could just be acting that way on the surface with them.
His birthday is this weekend and I bought a card to send him. But a friend told me that since I haven't heard anything from him in so long that he seriously needs space (even though he never actually requested this) and that any attempt to contact him might be interpreted as not respecting his wishes.
I am so confused - I've always heard advice to give space, but also show that you're still there for him, and to be gentle, patient, supportive, etc. Now I don't know whether it's worse to ignore his birthday or to acknowledge it. What harm could be done, as long as I keep it light and friendly? I posted a bit about this in Tom's thread and he suggested sending a text message instead, but my friend said a card was better because it doesn't imply that a response is expected (unlike a text message, where it would be polite to reply).
I am so frustrated right now. I just wish I could talk to him so I could know how he feels, because without that communication, I have no idea how I should act.
Share this post
Link to post
Share on other sites
It blows my mind how similar your situation is to mine. I went through the same exact thing. In my case, his birthday was in March and I was angry about him not having spoken to me in a while. The way I thought of it -I knew it would catch his attention if I chose not to wish him a happy birthday, rather than being looked at like everyone else who wished him that day. As a way to attract his attention, rather than pursuing it –I ignored the date. It wasn’t until a month and a half later when we finally saw each other for a mutual friend’s get together that he brought it up saying, “hmm… you didn’t even wish me a happy birthday! Did you? ” And my response to that had simply been, “I tried to contact you before that, and you never honored my trials with a response, so what’s the point?” And he sort of respected that. It is important for a man to see that you respect yourself, before he respects you. Value yourself enough to just back off for a little while, and allow him to realize what a wonderful person you are for himself, instead of it being forced. “Attract, instead of pursue” –that was the best advice I ever got.
Share this post
Link to post
Share on other sites
The other thing I remember now is that he seemed to withdraw in stages. For about a week right after his mother died, things were fine between us. Although I wasn't with him as he took care of arrangements (but I offered several times to travel there), we spoke by phone extensively a couple of times a day, and he would tell me everything about what he had been through that day and what he was feeling. He would say how much he missed me, and how he wanted to put this horrible event behind him and come home and spend time with me. He also asked me to help him with things he'd have to deal with later and asked me to be at the memorial service.
By the end of the week, he seemed quieter but I thought it was just from being tired and grieving as the harsh truth of his mother's death sank in. Then one evening he said he wanted to spend a little time alone when he got back - but he also said that he wanted to spend time with me too, just needed a little time to himself to think, which I could understand. It seemed like everything would be fine. But a few more days after that, when he came home, he abruptly said he needed to take a break from our relationship. At first it was phrased in such a way that showed he intended it to be "just for now". He said he just couldn't be in a relationship with anyone while he was grieving. He also suddenly reversed everything he'd said a few days earlier and asked me not to come to the memorial service anymore.
I tried to give him space, but as time passed, he seemed to withdraw further. Without any further discussion, the break turned into a more serious break-up, then he started saying that he didn't think he could be in a relationship ever again. And now, even though he said we would leave things on hold and not decide anything yet, there is just no contact from him at all.
Is it normal for grief to have this effect and progression? I wonder if I have done the right things, or if my giving him so much space (and not reaching out to him more) has made it easier for him to grow more distant. Other than that, I don't see how his change could be due to anything I've said or done, as I haven't changed. I really just don't know what to do anymore, I tried dropping all contact for over a month but nothing came of it. We do have to talk eventually, as we never had closure and everything is still unresolved. I also have all my things still at his apartment (some are valuable and can't be replaced), but he said a long time ago that I didn't have to move my things out yet (as if he thought this break wouldn't last too long) and I'm still clinging to the hope that someday I'll be able to go back again and we can try to return to the life we had together before. I thought it would happen sooner, but it seems like things have been getting worse between us rather than better.
|
{
"pile_set_name": "Pile-CC"
}
|
Hi! Can anyone share with an experience of smoking marijuana like this purple urkle http://www.ilovegrowingmarijuana.com/purple-urkle/through a vaporizer.
Is it the same as using a bong or not? What are the advantage and disadvantages of using a vaporizer where smoking marijuana?
(whether to buy or not to buy? if yes, then what the best compact vaporizer?) thanks
|
{
"pile_set_name": "Pile-CC"
}
|
Free Resume Templates
Sort by:
The best free resume templates we've found from the amazing sources. Including multiple different free resume templates for different jobs. Including freely downloadable resumes, curriculum vitae / cv, cover letter and many more examples in Photoshop PSD, Illustrator AI, Microsoft Word DOC/DOCX and Indesign INDD formats.
|
{
"pile_set_name": "Pile-CC"
}
|
AT THE “Singapore Summit”, a gathering of Asia’s great and good held back in September, a speaker asked the audience of several hundred for a show of hands by those who thought Mitt Romney would win the American presidency. If a solitary palm reached for the sky, Banyan missed it. The almost unanimous expectation of Barack Obama’s re-election in part reflected the opinion polls at the time. But there was perhaps also an element of wishful thinking. If it had a vote in this election, much of Asia, though dissatisfied with many American policies of the past four years, would, like The Economist, have plumped for the devil they knew. Ravi Velloor, foreign editor of the Straits Times in Singapore, summed up what is probably a common view in South-East Asia and the broader region in a front-page article finding “reason to cheer“ Mr Obama’s win. He expressed relief that “the world’s most powerful nation did not land in the hands of a novice at a time when Asia needs a seasoned hand at America’s wheel.” That view was probably shared in China. Traditionally, if perversely, Chinese leaders have found Republican administrations easier to deal with, even if, like Democrats, Republicans tend to make fire-breathing threats towards China during election campaigns. And much in Mr Obama’s first term has alarmed China. He has called China an “adversary” as well as a potential partner, and many Chinese see his “pivot” of America’s military strategy towards Asia as a long-term plot to contain China’s rise. However, Mr Romney’s commitment to designate China a “currency manipulator” on day one of his presidency may have proved hollow. But it would have meant, at the very least, that China would become an issue from day one. And Mr Romney would certainly not have wanted to appear softer in military strategy than Mr Obama. In the Chinese social media, the American election was the big issue on November 7th. The coincidence of its falling on the eve of the opening of the Chinese Communist Party’s 18th congress gave posters on Twitter-like services an obvious topic of conversation. One post, translated by the China Media Project at the University of Hong Kong, asked plaintively: “So when will we, in our Great Mother Country, be able to elect our own leaders?”
But another website, ChinaSMACK, translated a post that reflected a very common cynicism about the process: “Win or not has nothing to do with China; they will all be against China, containing our development.”
In Asia’s second-largest economy, Japan, there was probably also some relief at Mr Obama’s victory. At a time of great tension with China over the disputed Senkaku (Diaoyu) islands, “the security environment in East Asia is severe,” according to Osamu Fujimura, Japan’s chief cabinet secretary, so the alliance with America is even more important. Japan will welcome continuity.
India was one of the few countries in Asia where Mr Obama was rather unpopular in the early days of his administration. Loose talk of a “G2” with China made India feel undervalued; a brief attempt to push it to negotiate with Pakistan over the future of Kashmir was resented. However, in Indian eyes, Mr Obama has come a long way—especially in reaching a better understanding of the shortcomings of India’s rivals, China and Pakistan. A well-placed commentator thinks India will be happy with the prospect of “business as usual”.
Correspondingly, the one place where Mr Obama’s victory seems broadly unpopular is in Pakistan. Pakistanis are angry at his stepping up of unmanned “drone” raids on Pakistani territory. They have been further antagonised by bloody mishaps involving American troops and CIA contractors. And the episode which appeared such a triumph at home—the raid that killed Osama bin Laden at his comfy Pakistani hide-out—was seen as an outrageous breach of Pakistani sovereignty. So in a poll on the election conducted last month by the BBC in 21 countries, there was only one where Mr Romney was the more popular candidate: Pakistan. Of course, 20 out of 21 is a good score. But Pakistan, the source of Mr Obama’s “biggest single national-security concern”, is a bad loss.
(Picture credit: AFP)
|
{
"pile_set_name": "OpenWebText2"
}
|
Valerie Solanas, som försökte mörda Andy Warhol, är en favorit bland svenska radikalfeminister. En gång använde Ireen von Wachenfeldt, dåvarande ordförande i Riksorganisationen för kvinnojourer och tjejjourer i Sverige (ROKS), Solanas uttryck ”Män är djur” i tv-reportaget Könskriget (SVT:s ”Dokument inifrån”, våren 2005).
Hon bad senare om ursäkt för det med orden: ”Jag skulle ha sagt att män är värre än djur. En del våldsamma män kan till och med njuta av kvinnors lidande. Det gör inte djuren”.
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
How to let ogr/gdal CreateLayer() create a `geom` field instead of `wkb_geometry`?
When creating a new table (PostGIS) using OGR/GDAL (2.1+), is there a way to select a specific name for the geometry field (such as geom), rather than using the default name?
I created a new table via python3 ogr/grdal liek this:
ds = gdal.OpenEx(connection_string, gdal.OF_VECTOR | gdal.OF_UPDATE)
lyr = ds.CreateLayer( "mylayer", XXX, ogr.wkbLineString)
The problem is that I can't find a parameter to specify the name of the geometry field, only its type. In the table created, the geometry field seems to be called wkb_geometry by default:
wkb_geometry geometry(LineString,26945)
Is there a parameter or option to let CreateLayer() use a different name such as geom?
Related question: Use Postgis to convert wkb_geometry data type to geom datatype
A:
As you can see from http://gdal.org/python/osgeo.ogr.DataSource-class.html#CreateLayer, CreateLayer support also "options" which are "None" by default.
The papszOptions argument can be used to control driver specific
creation options. These options are normally documented in the format
specific documentation.
Usage example for PostgeSQL and Python can be found from the GDAL autotest script https://trac.osgeo.org/gdal/browser/trunk/autotest/ogr/ogr_pg.py
See for example row 5191:
lyr = gdaltest.pg_ds.CreateLayer('ogr_pg_82', geom_type = ogr.wkbNone, options = ['GEOMETRY_NAME=another_name'])
|
{
"pile_set_name": "StackExchange"
}
|
BATON ROUGE, La. -- Les Miles will not be the next coach at Michigan. So says Les Miles.
Les Miles sent a message after LSU's practice Monday: A return to Ann Arbor is not going to happen. Chris Graythen/Getty Images
After LSU's Monday evening bowl practice, the Tigers' coach addressed persistent rumors that he will return to his alma mater, where he played under Bo Schembechler and spent a decade as an assistant coach.
Miles refused to be quoted on the record in the post-practice chat with reporters, but he sent a clear message: A return to Ann Arbor is not going to happen. He and his agent, George Bass, have not heard from Michigan, Miles said, and he would not change jobs even if Michigan made contact.
Miles also has told LSU athletic officials that he has not been contacted by Michigan and that he has no intention of leaving the Tigers, LSU spokesman Michael Bonnette said.
Miles is nearing the end of his 10th season at LSU, where he has won two SEC titles and one Bowl Championship Series crown. Miles-to-Michigan rumors have emerged in the past -- most notably late in the 2007 season, when he famously addressed reports on the subject prior to the SEC championship game -- but he has remained at LSU each time the Wolverines have had a coaching vacancy.
Since Michigan fired Brady Hoke on Dec. 2, Miles has shot down questions about a return to the Wolverines, but never as emphatically as he did Monday. After unofficially addressing the Michigan job opening, Miles went on to discuss several subjects related to his current job, including injuries, underclassmen who might become early entries in the 2015 NFL draft and the Tigers' upcoming bowl matchup with Notre Dame.
Information from The Associated Press was used in this report.
|
{
"pile_set_name": "OpenWebText2"
}
|
# minimatch
A minimal matching utility.
[](http://travis-ci.org/isaacs/minimatch)
This is the matching library used internally by npm.
Eventually, it will replace the C binding in node-glob.
It works by converting glob expressions into JavaScript `RegExp`
objects.
## Usage
```javascript
var minimatch = require("minimatch")
minimatch("bar.foo", "*.foo") // true!
minimatch("bar.foo", "*.bar") // false!
minimatch("bar.foo", "*.+(bar|foo)", { debug: true }) // true, and noisy!
```
## Features
Supports these glob features:
* Brace Expansion
* Extended glob matching
* "Globstar" `**` matching
See:
* `man sh`
* `man bash`
* `man 3 fnmatch`
* `man 5 gitignore`
## Minimatch Class
Create a minimatch object by instanting the `minimatch.Minimatch` class.
```javascript
var Minimatch = require("minimatch").Minimatch
var mm = new Minimatch(pattern, options)
```
### Properties
* `pattern` The original pattern the minimatch object represents.
* `options` The options supplied to the constructor.
* `set` A 2-dimensional array of regexp or string expressions.
Each row in the
array corresponds to a brace-expanded pattern. Each item in the row
corresponds to a single path-part. For example, the pattern
`{a,b/c}/d` would expand to a set of patterns like:
[ [ a, d ]
, [ b, c, d ] ]
If a portion of the pattern doesn't have any "magic" in it
(that is, it's something like `"foo"` rather than `fo*o?`), then it
will be left as a string rather than converted to a regular
expression.
* `regexp` Created by the `makeRe` method. A single regular expression
expressing the entire pattern. This is useful in cases where you wish
to use the pattern somewhat like `fnmatch(3)` with `FNM_PATH` enabled.
* `negate` True if the pattern is negated.
* `comment` True if the pattern is a comment.
* `empty` True if the pattern is `""`.
### Methods
* `makeRe` Generate the `regexp` member if necessary, and return it.
Will return `false` if the pattern is invalid.
* `match(fname)` Return true if the filename matches the pattern, or
false otherwise.
* `matchOne(fileArray, patternArray, partial)` Take a `/`-split
filename, and match it against a single row in the `regExpSet`. This
method is mainly for internal use, but is exposed so that it can be
used by a glob-walker that needs to avoid excessive filesystem calls.
All other methods are internal, and will be called as necessary.
## Functions
The top-level exported function has a `cache` property, which is an LRU
cache set to store 100 items. So, calling these methods repeatedly
with the same pattern and options will use the same Minimatch object,
saving the cost of parsing it multiple times.
### minimatch(path, pattern, options)
Main export. Tests a path against the pattern using the options.
```javascript
var isJS = minimatch(file, "*.js", { matchBase: true })
```
### minimatch.filter(pattern, options)
Returns a function that tests its
supplied argument, suitable for use with `Array.filter`. Example:
```javascript
var javascripts = fileList.filter(minimatch.filter("*.js", {matchBase: true}))
```
### minimatch.match(list, pattern, options)
Match against the list of
files, in the style of fnmatch or glob. If nothing is matched, and
options.nonull is set, then return a list containing the pattern itself.
```javascript
var javascripts = minimatch.match(fileList, "*.js", {matchBase: true}))
```
### minimatch.makeRe(pattern, options)
Make a regular expression object from the pattern.
## Options
All options are `false` by default.
### debug
Dump a ton of stuff to stderr.
### nobrace
Do not expand `{a,b}` and `{1..3}` brace sets.
### noglobstar
Disable `**` matching against multiple folder names.
### dot
Allow patterns to match filenames starting with a period, even if
the pattern does not explicitly have a period in that spot.
Note that by default, `a/**/b` will **not** match `a/.d/b`, unless `dot`
is set.
### noext
Disable "extglob" style patterns like `+(a|b)`.
### nocase
Perform a case-insensitive match.
### nonull
When a match is not found by `minimatch.match`, return a list containing
the pattern itself. When set, an empty list is returned if there are
no matches.
### matchBase
If set, then patterns without slashes will be matched
against the basename of the path if it contains slashes. For example,
`a?b` would match the path `/xyz/123/acb`, but not `/xyz/acb/123`.
### nocomment
Suppress the behavior of treating `#` at the start of a pattern as a
comment.
### nonegate
Suppress the behavior of treating a leading `!` character as negation.
### flipNegate
Returns from negate expressions the same as if they were not negated.
(Ie, true on a hit, false on a miss.)
## Comparisons to other fnmatch/glob implementations
While strict compliance with the existing standards is a worthwhile
goal, some discrepancies exist between minimatch and other
implementations, and are intentional.
If the pattern starts with a `!` character, then it is negated. Set the
`nonegate` flag to suppress this behavior, and treat leading `!`
characters normally. This is perhaps relevant if you wish to start the
pattern with a negative extglob pattern like `!(a|B)`. Multiple `!`
characters at the start of a pattern will negate the pattern multiple
times.
If a pattern starts with `#`, then it is treated as a comment, and
will not match anything. Use `\#` to match a literal `#` at the
start of a line, or set the `nocomment` flag to suppress this behavior.
The double-star character `**` is supported by default, unless the
`noglobstar` flag is set. This is supported in the manner of bsdglob
and bash 4.1, where `**` only has special significance if it is the only
thing in a path part. That is, `a/**/b` will match `a/x/y/b`, but
`a/**b` will not.
If an escaped pattern has no matches, and the `nonull` flag is set,
then minimatch.match returns the pattern as-provided, rather than
interpreting the character escapes. For example,
`minimatch.match([], "\\*a\\?")` will return `"\\*a\\?"` rather than
`"*a?"`. This is akin to setting the `nullglob` option in bash, except
that it does not resolve escaped pattern characters.
If brace expansion is not disabled, then it is performed before any
other interpretation of the glob pattern. Thus, a pattern like
`+(a|{b),c)}`, which would not be valid in bash or zsh, is expanded
**first** into the set of `+(a|b)` and `+(a|c)`, and those patterns are
checked for validity. Since those two are valid, matching proceeds.
|
{
"pile_set_name": "Github"
}
|
/*
Copyright 2016 The Kubernetes Authors.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
*/
package homedir
import (
"os"
"path/filepath"
"runtime"
)
// HomeDir returns the home directory for the current user.
// On Windows:
// 1. the first of %HOME%, %HOMEDRIVE%%HOMEPATH%, %USERPROFILE% containing a `.kube\config` file is returned.
// 2. if none of those locations contain a `.kube\config` file, the first of %HOME%, %USERPROFILE%, %HOMEDRIVE%%HOMEPATH% that exists and is writeable is returned.
// 3. if none of those locations are writeable, the first of %HOME%, %USERPROFILE%, %HOMEDRIVE%%HOMEPATH% that exists is returned.
// 4. if none of those locations exists, the first of %HOME%, %USERPROFILE%, %HOMEDRIVE%%HOMEPATH% that is set is returned.
func HomeDir() string {
if runtime.GOOS == "windows" {
home := os.Getenv("HOME")
homeDriveHomePath := ""
if homeDrive, homePath := os.Getenv("HOMEDRIVE"), os.Getenv("HOMEPATH"); len(homeDrive) > 0 && len(homePath) > 0 {
homeDriveHomePath = homeDrive + homePath
}
userProfile := os.Getenv("USERPROFILE")
// Return first of %HOME%, %HOMEDRIVE%/%HOMEPATH%, %USERPROFILE% that contains a `.kube\config` file.
// %HOMEDRIVE%/%HOMEPATH% is preferred over %USERPROFILE% for backwards-compatibility.
for _, p := range []string{home, homeDriveHomePath, userProfile} {
if len(p) == 0 {
continue
}
if _, err := os.Stat(filepath.Join(p, ".kube", "config")); err != nil {
continue
}
return p
}
firstSetPath := ""
firstExistingPath := ""
// Prefer %USERPROFILE% over %HOMEDRIVE%/%HOMEPATH% for compatibility with other auth-writing tools
for _, p := range []string{home, userProfile, homeDriveHomePath} {
if len(p) == 0 {
continue
}
if len(firstSetPath) == 0 {
// remember the first path that is set
firstSetPath = p
}
info, err := os.Stat(p)
if err != nil {
continue
}
if len(firstExistingPath) == 0 {
// remember the first path that exists
firstExistingPath = p
}
if info.IsDir() && info.Mode().Perm()&(1<<(uint(7))) != 0 {
// return first path that is writeable
return p
}
}
// If none are writeable, return first location that exists
if len(firstExistingPath) > 0 {
return firstExistingPath
}
// If none exist, return first location that is set
if len(firstSetPath) > 0 {
return firstSetPath
}
// We've got nothing
return ""
}
return os.Getenv("HOME")
}
|
{
"pile_set_name": "Github"
}
|
Günther Rittau
Günther Rittau (born 7 August 1893 in Königshütte (Silesia); died 6 August 1971 in Munich) was a German cinematographer and film director.
After study of science in Berlin, Rittau started his career in 1919 at the documentary-film department of Decla, later at Universum Film AG. He learned the job of camera operator "on the side". From 1924, he was active as a feature cameraman. His experiences with the documentary film production and the production of trick photographs let to the development of his style. Metropolis (1927, as camera operator) and a propaganda movie U-Boote westwärts! (en:U-boats westwards!) (1941, as director) are considered to be among his best artistic achievements. His film The Eternal Tone (1943) about two brothers (a violinist and a violin maker) was considered "artistically valuable" by the Reichsfilmkammer.
After World War II, he returned to filmmaking only in 1954. He was active into the 1960s. In 1967, he was awarded Filmband in Gold. Günther Rittau is buried at the Waldfriedhof cemetery in Munich.
Filmography
Cinematographer
{|width="100%" align="center|
|width="50% valign="top"|
The Railway King (1921) (2 parts)
The Stone Rider (1923)
Die Nibelungen (1924) (2 parts)
The Found Bride (1925)
The Tower of Silence (1925)
Metropolis (1927)
The Trial of Donald Westhof (1927)
Heimkehr (1928)
Prince or Clown (1928)
What's Wrong with Nanette? (1929)
Melody of the Heart (1929)
Asphalt (1929)
The Blue Angel (1930)
Burglars (1930)
Darling of the Gods (1930)
Der Kampf mit dem Drachen (1930)
Bombs on Monte Carlo (1931)
Captain Craddock (1931)
Her Grace Commands (1931)
Caught in the Act (1931)
Princess, At Your Orders! (1931)
Storms of Passion (1932)
A Blonde Dream (1932)
Happy Ever After (1932)
Quick (1932)
The Victor (1932)
F.P.1 Doesn't Respond (1932)
Die verlorene Melodie (1933)
|width="50% valign="top"|
Wie werde ich energisch? (1933)
Abel mit der Mundharmonika (1933)
Kind, ich freu' mich auf Dein Kommen (1933)
Count Woronzeff (1934)
The Double (1934)
Liebeslied (1935)
The Green Domino (1935)
The Gypsy Baron (1935)
Winter in the Woods (1936)
Ride to Freedom (1937)
Starke Herzen (1937)
Faded Melody (1938)
Nordlicht (1938)
S.O.S. Sahara (1938)
The Curtain Falls (1939)
The Hunter's Cross (1954)
The Fisherman from Heiligensee (1955)
Children, Mother, and the General (1955)
Das Forsthaus in Tirol (1955)
Die fröhliche Wallfahrt (1956)
Das Erbe vom Pruggerhof (1956)
If We All Were Angels (1956)
Between Munich and St. Pauli (1957)
Frauen sind für die Liebe da (1957)
|-
|}
Director
(1939)
U-Boote westwärts (1941)
Der Strom (1942)
The Eternal Tone (also screenplay) (1943)Meine vier Jungens (1944) Der Scheiterhaufen (1945)
The Years Pass (1945)
An Everyday Story (1948)
Vor uns liegt das Leben'' (also screenplay) (1948)
External links
Günther Rittau at filmportal.de
Category:1893 births
Category:1971 deaths
Category:German cinematographers
Category:German film directors
Category:German-language film directors
Category:People from Chorzów
Category:People from the Province of Silesia
|
{
"pile_set_name": "Wikipedia (en)"
}
|
This invention pertains to a pedestal for supporting a top for a starting platform for one end of a swimming pool. Pedestals embodying this invention are adjustable so as not to require, in many instances, custom fitting, via custom cutting or welding operations, to accommodate pool dimensions, water level, and other factors from one swimming pool to another.
In a swimming meet, each swimmer starts at a starting platform, which may be also called a starting block, at one end of a swimming pool. Typically, a starting platform comprises a base, stand, or pedestal, to which a top is mounted so that its upper surface is horizontal or so that its upper surface is sloped slightly (e.g. not more than 10xc2x0 from horizontal) from the back edge of the top toward its front edge. Several models of such starting platforms are available commercially from Kiefer Pool Equipment Co. of Zion, Ill., as illustrated and described briefly on page 2 of its 2002 Product Guide, in which such starting platforms are called starting blocks.
Typically, installation of a starting block must conform to governmental and non-governmental rules, standards, and regulations. As an example, a 1991 rule of the National Federation of State High School Associations provides that, if a swimming pool has less than four feet of water at its starting end, a starting platform may be no higher than eighteen inches from the water level at the starting end. Commonly, therefore, the base, stand, or pedestal of a starting platform, as known heretofore, must be custom fitted, via custom cutting and welding operations, so as to accommodate pool dimensions, water level, and other factors from one swimming pool to another.
This invention provides, for supporting a top for a starting platform for one end of a swimming pool, an adjustable pedestal, which has an upper member and a lower member. The upper and lower members are fastened releasably to each other, as by means comprising a bolt or bolts, so as to define a generally upright column having any of a plurality of adjusted lengths. The upper member is adapted to support a top for the starting platform. The lower member is adapted for anchoring to a base. Preferably, the upper and lower members are tubular and have a telescoping relationship when not fastened to each other, the upper member extending downwardly into the lower member.
The starting platform may have a step, which is fastened releasably to the generally upright column, via a bracket, to which the step is mounted, at any of a plurality of adjustable positions. Means comprising a bolt or bolts are used for fastening the bracket, to which the step is mounted, releasably to the generally upright column. The means used for fastening the upper and lower members releasably to each other may be also used for fastening the bracket, to which the step is mounted, releasably to the generally upright column.
The pedestal may have an upper step, an upper bracket, to which the upper step is mounted, a lower step, and a lower bracket, to which the lower step is mounted. Means comprising bolts are used for fastening the upper and lower members of the generally upright column releasably to each other, for fastening the upper bracket, to which the upper step is mounted, releasably to the generally upright column, and for fastening the lower bracket, to which the lower step is mounted, to the generally upright column. The means for fastening the upper and lower members of the generally upright column to each other may be also used for fastening the upper bracket, to which the upper step is mounted, releasably to the generally upright column.
In this document, all directional terms referring to a pedestal, particularly but not exclusively xe2x80x9cupperxe2x80x9d, xe2x80x9clowerxe2x80x9d, and xe2x80x9cgenerally uprightxe2x80x9d, are intended to refer to the pedestal, as installed in its usual orientation, not to limit the pedestal, as made and sold, to any particular orientation. Moreover, the term xe2x80x9cgenerally upright columnxe2x80x9d is intended to cover a sloping column, as well as a vertical column.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
When managing an access control or security system, there’s a lot of information to process. IDenticard’s new PremiSys Security Management Dashboard simplifies your access control system by giving you access to key functions of your system on a single customizable screen. With the PremiSys Security Management Dashboard, monitoring your facilities will be easier than ever.
What is the PremiSys Security Management Dashboard?
The PremiSys Security Management Dashboard is an add-on software management tool for the PremiSys access control system and patented Rack Armor Server Protection designed to streamline the monitoring of your access control system.The PremiSys Security Management Dashboard provides information that isn’t available elsewhere in your system, like open door thresholds and graphed trend data, in a convenient central location. The PremiSys Security Management Dashboard can be viewed in a standard web browser window or on a tablet.
This helpful software management tool is designed to give users a “quick view” into their access control system, providing key information at a glance. A convenient search function makes finding the information you need simple, while system administrators can customize what information individual users are able to see on the Dashboard.
The PremiSys Security Management Dashboard provides convenience and a feature set that other access control providers can’t match. Add the Dashboard to your PremiSys access control system or Rack Armor solution today to make monitoring your sites simpler than ever before!
Enhance your system with the PremiSys Dashboard today!
PremiSys: The Dashboard provides fast, easy access to a wealth of important data and information about the security of your site.
PremiSys Security Management Dashboard: A convenient management tool for your access control system
The PremiSys Security Management Dashboard simplifies the management of your access control system while still boasting a comprehensive set of features. With Dashboard, you’ll benefit from a full-featured, easy-to-use security management tool that will give you maximum control over all aspects of your site. Dashboard features include:
Doors open now: Helpful graphics display the number of open doors or server cabinets on your system at a given time. Thresholds can be set based on your system needs, allowing you to monitor risk levels and use custom settings to determine “normal” activity.
Doors open for a certain time: For facilities concerned about doors being left open, the PremiSys Security Management Dashboard allows users to set a predetermined length of time and be alerted when a door has been open for too long. A clear red indicator shows the number of doors that have been left open, allowing for maximum security.
Hardware health: The PremiSys Security Management Dashboard will alert users to various hardware issues and provide detailed information on where the affected doors or locks, power issues, communication issues and more.
Total alarms: Quickly view a graph showing the total number of door alarms during a given time period, allowing administrators to view alarm trends and adjust their security protocols accordingly.
Point activity: This helpful page shows the most and least active monitor points on your system, allowing administrators to make more informed decisions about where to place hardware. For example, if a door isn’t being accessed frequently, its reader can be moved to monitor a different door, saving a facility money by not requiring the purchase of a new reader.
Card activity: A graph provides detailed information on the number of card transactions during a preset time period, allowing administrators to better monitor trends in the number of card transactions.
Unused active cards: Eliminate the risk of lost or unused cards with this helpful PremiSys Security Management Dashboard feature. Unused cards can be filtered by a preset time, including days, months or even a year. The Dashboard will display the number of cards that haven’t been used during that time period. Unused cards can be instantly deactivated through the dashboard.
|
{
"pile_set_name": "Pile-CC"
}
|
Percutaneous testicular sperm aspiration and intracytoplasmic sperm injection in obstructive and non-obstructive azoospermia: an easy alternative to TESE and MESA.
To evaluate the recovery rate of sperm from the testis using percutaneous testicular aspiration with a 22-gauge hypodermic needle followed by evaluation of the fertilization rate and pregnancy rate after intracytoplasmic sperm injection. This is a prospective observational study performed in a private in vitro fertilization setting in Kuwait. Fifteen patients with obstructive and non-obstructive azoospermia were included in the study. Thirteen of them had previous microepididymal sperm aspiration, percutaneous epididymal sperm aspiration or testicular sperm extraction. The sperm were retrieved using percutaneous testicular aspiration under local analgesia. This was followed by intracytoplasmic sperm injection. A total of 146 eggs were collected and 112 were injected. Normal fertilization occurred in 91 oocytes (87.5%) and the total number of embryos cleaved was 83 (91%). Embryo transfer was performed in 13 with pregnancy rate of 33.3 per treatment cycle and 38.5 per embryo transfer. Failure to retrieve sperm was encountered in 2 cases both in the hypospermatogenesis group. Percutaneous testicular sperm aspiration using hypodermic needles under local analgesic is an easy and cheap method with high patient acceptability, minimal complications and no need of special training. In this small group, it seems to have an acceptable success rate in terms of sperm retrieval and pregnancy in the obstructive type as well as hypospermatogenesis, but to lesser extent.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Doug Ford’s budget makes life harder for Northern families
Post Views: 193
During question period Monday, NDP Northern Development critic, Michael Mantha, continued to advocate for the North in the face of Doug Ford’s first budget, which attacks northern Ontario, hitting families with deep cuts to services, infrastructure, and economic development.
“Ministries that are dedicated to the development of the Northern economy, like the Ministries of Natural Resources and Forestry and Northern Development and Mines, have been cut by hundreds of millions of dollars,” said Mantha.
“There wasn’t even lip service to the billion dollars in funding needed to build roads to the Ring of Fire, or a commitment to meaningful consultations with impacted First Nations.
“And the government announced its intention to interfere with the successful Northern Ontario Heritage Fund.
“Instead of investing in the North, why is Doug Ford choosing to cut funding for Northern Ontario economic development?”
Mantha said to make matters worse the Ford government made deep cuts to infrastructure spending which will mean less funding to improve Northern roads, bridges, schools and hospitals, or provide northern transit, like the Northlander.
“The government once again refused to commit to reinstating the Northlander passenger rail service,” said Mantha.
“And as we all know the cuts to education will hit rural and northern schools the hardest.”
Mantha said the North was ignored under Kathleen Wynne and years of Liberal governments — but it looks like Doug Ford is making it much, much worse.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Determining the difference between odd and even numbers
I have code that converts each character of a String to an int and returns the difference between odd and even numbers. Can this code be simplified?
int compareSumOfDigits(String N) {
int e=0,o=0;
for (int i =0;i<N.length();i++){
int t = Character.getNumericValue(N.charAt(i));
if(t%2==0)
e+=t;
else
o+=t;
}
return o-e ;
}
A:
Combining some of the existing answers, you can do
s.chars() // get the char stream
.map(Character::getNumericValue) // convert to ints
.map(n -> n%2==0 ? -n : n) // negate the even ones
.sum() // sum it all up
This will give you the sum of the odds and the negative evens, which is the same as the sum of the odds minus the sum of the evens.
edit
In response to @kai, for absolute max readability, I'd probably do (pseudocode)
List<int> ints = s.chars().map(Character::getNumericValue)
Map<Boolean, List<int>> intsEven = ints.partitioningBy(n -> n%2==0)
return intsEven.get(false).sum() - intsEven.get(true).sum()
or with isEven from the other answers and not defined here
List<int> ints = s.chars().map(Character::getNumericValue)
List<int> evens = ints.filter(isEven)
List<int> odds = ints.filter(not(isEven))
return odds.sum() - evens.sum()
A:
Instead of counting two sums (of odd and even digits) and returning their difference,
you could use a single sum value,
subtracting a digit's value if it's even and adding if it's odd.
An added benefit of this approach is that you are more protected from integer overflows:
if odd and even digits are interleaved,
the two-sum approach will be much less likely to overflow.
Building on @m0nhawk's version, with further improving the variable names and a few other tidbits:
boolean isEven(int number) {
return (number % 2) == 0;
}
int compareSumOfDigits(String numericString) {
int sum = 0;
for (Character ch : numericString.toCharArray()) {
int digit = Character.getNumericValue(ch);
if (isEven(digit)) {
sum -= digit;
} else {
sum += digit;
}
}
return sum;
}
Or as @tobias_k proposed,
the if-else can be flattened for a more compact form,
but this is less readable so it goes away from "simple",
and I don't recommend it, but here you go anyway:
int compareSumOfDigits(String numericString) {
int sum = 0;
for (Character ch : numericString.toCharArray()) {
int digit = Character.getNumericValue(ch);
sum += digit * (isEven(digit) ? -1 : 1);
}
return sum;
}
Nothing to do with simplicity,
but when playing with an implementation,
it helps to have some JUnit tests handy to verify that the code still works.
A few examples to get you started:
@Test
public void test_compareSumOfDigits_11111111() {
assertEquals(8, compareSumOfDigits("11111111"));
}
@Test
public void test_compareSumOfDigits_22222222() {
assertEquals(-16, compareSumOfDigits("22222222"));
}
@Test
public void test_compareSumOfDigits_12345678() {
assertEquals(-4, compareSumOfDigits("12345678"));
}
A:
It depend on you definition of a "more simple code". From my point of view it can be extend with the next stuff:
Formatting, obviously.
Using foreach loop, instead of indexing (notice, that you use index once in the for, only to get a character), this will greatly simplify the code.
Introduce function isEven for check. Java compiler is smart enough to reduce to zero all overhead on calling this function, but from reader view it's clearer now.
Put more expressible variable names, instead of one letter. I can hardly recall any situation where it impossible to seek for a better, explanatory name.
So, my simplier code looks like this.
Boolean isEven(int number) {
return (number % 2) == 0;
}
int compareSumOfDigits(String numbers) {
int sumEvens = 0, sumOdds = 0;
for (Character ch : numbers.toCharArray()) {
int number = Character.getNumericValue(ch);
if (isEven(number)) {
sumEvens += number;
} else {
sumOdds += number;
}
}
return sumOdds - sumEvens;
}
|
{
"pile_set_name": "StackExchange"
}
|
To our family Web page. We are a family
of 5. Our oldest son is 16 and has a great love of computers and Web design. He
created the Web page for our construction company. Click on the Artisan Builders
button below to see it.
Our middle son is 14 years old. His
interests right now are skateboarding and indoor rock climbing.
Our daughter is 6 years old. Her
favorite things to do are swim, ride her bike and be outside.
|
{
"pile_set_name": "Pile-CC"
}
|
Amyloid b-peptide (Ab), the major molecular component of the cerebral amyloid plaques, appears to play a central role in the neuropathology of Alzheimer's disease (AD). Compounds that prevent the formation of Ab aggregates or that selectively destroy these aggregates are attractive candidates for the development of therapeutic reagents for prevention and treatment of Alzheimer's disease. Also, compounds that interfere with the interactions of amyloid precursor protein (APP) with other factors that are involved in directing it into pathological pathway as well as those that are capable to prevent or destroy intraneuronal accumulations of Ab, are of great interest for developing therapeutic molecules for Alzheimer's disease. In this project we are proposing the possible immunological intervention for prevention and treatment of AD applying phage display technology for the construction of the first anti-Ab single chain fragment variable (scFv) antibody library and the selection of individual phage clones expressing Ab-specific scFv antibody, capable of preventing the aggregation of Ab or dissolving the preexisting aggregates, scFv phage display library enriched in anti-Ab antibodies will be constructed using the first strand cDNA synthesized from mRNA of spleen and lymph node cells isolated from mice immunized with Ab. The constructed library as well as a human scFv library will be used in bioselection procedure to isolate Ab-specific scFvs expressed on phage. The amino acid sequences of antibody complementarity-determinig regions (CDR) will be prepared and used as "mini-antibodies". Evaluation of in vitro Ab aggregation and neurotoxicity in the presence of the selected compounds: scFv antibodies expressed on phage or in soluble form and "mini-antibodies" will be performed. The most promising molecules selected in this project will be proposed for further evaluation in animal models to all researchers interested in these studies. If successful, these molecules could be of interest for passive immunization in humans, may be after modification with substances that would increase their blood-brain barrier permeability. [unreadable] [unreadable]
|
{
"pile_set_name": "NIH ExPorter"
}
|
Q:
What airplane does this vintage instrument panel come from?
Can anyone please tell me what this is from?
It looks like it's military. I have a few panels that came with this and gauges (not if it's a b-16)
A:
The shape makes it clear that this is from a single seater or tandem aircraft. This makes a glider very likely, which is supported by the "Vario" engraving over the column of small holes on the bottom right.
A little googling then brings me to this page and the assumption that this panel is from a Schempp-Hirth Standard Cirrus, Serial No. 176. The plane was badly damaged at Minisink, NY on October 23, 1976 in a botched landing and consequently written off. At that time it was registered as N11JY.
Schempp-Hirth Standard Cirrus (picture source)
Standard Cirrus instrument panel (picture source)
A:
It has the legend "Vario", short for variometer stenciled on it and it looks very much like the panel from a Cirrus sailplane.
Source. Standard Cirrus
|
{
"pile_set_name": "StackExchange"
}
|
INTRODUCTION
============
*Acinetobacter baumannii* is considered as an important cause of healthcare associated infections, particularly in the intensive care units (ICU), and many reports have indicated that antibiotic misuse leads to appearance of resistance strains \[[@R1], [@R2]\]. So, a lot of efforts have been contributed to find out a solution in order to treat theses nosocomial pathogen, one of which is combined therapy \[[@R3], [@R4]\]. The combinations of two antibiotics have shown different effects on each other and in many cases the effect is synergistic or strengthening but in some cases, antagonism is observed \[[@R5], [@R6]\]. combination therapy is usually used in life-threatening infections, to cover a wide spectrum broad against all potential pathogens, to induce synergistic effects of the combination against a specific pathogen to prevent resistance emergence, or to combat a polymicrobial infection not easily treated with a single medication. In combination therapy the balance in its potential disadvantages, including, the possible increase in side effects, superinfection, antagonistic activity and increase in cost should be considered. Combination therapy might also be used to prevent the side effects of a specific drug \[[@R7]\].
Rifampin is an antibiotic which is frequently used with other antibiotics, and the results have shown synergy with colistin; however, the result of this combination is dependent on various conditions such as the rifampin's MICs or the methods used. For example, the enhancement effects have not been observed in the strains with MIC higher than 256µg/ml \[[@R8], [@R9]\]. We focused on the studies that examined the combination effects of rifampin and colistin against *Acinetobacter in vitro*. The aim of this study was to obtain the information about the activity of rifampin and colistin and their effects on *A. baumannii* isolates through a review of existing literature and data analysis.
MATERIALS AND METHOD
====================
Data Source and Criteria for Selecting Articles
-----------------------------------------------
In the period from December 2014 to January 2015 the detailed databases (PubMed, Scopus, EMBASE and ISI Web of Sciences) search was performed. The inclusion criteria for meta-analysis were the studies that had examined the interactions of the two antibiotics (rifampin and colistin) and all *in vitro* combination therapies (Checkerboard, Time-kill). The posters printed (ECCMID) from 2007 to 2014 were also checked (the ISI Web of Science web site) (flow chart. **[Chart 1](#FC1){ref-type="fig"}**. The key words used were \" *A. baumannii* + colistin, *A. baumannii* + rifampicin, \" *A. baumannii* + colistimethate \" and *A. baumannii* + colistin and rifampicin \". In order to avoid bias, the search was performed by 2 independent researchers.
Interaction Analysis and Data
-----------------------------
The following information-researcher's name, year, country, number of strains, strain's resistance and sensitivity to rifampin and colistin, MIC and type of interaction including additive, partially synergism, synergism and antagonism and applied methods were extracted.
The interaction between two antibiotics was evaluated by two methods (Checkerboard, Time-kill) and the initial results of the *in vitro* effects on the bacteria were based on inhibition or killing. In the time-kill method the synergism was defined as the reduction by the amount of log 2 of CFU/ml of the bacteria in the presence of antibiotics' combination compared to the single state and as antagonism, if it showed an increase. For the checkerboard method the index FICI was applied and the amount of it was obtained by the sum of the two drugs MIC divided by each drugs individual MIC.
FICI
=
(
MIC
of
drug
A
in
combination
MIC
of
drug
A
alone
)
\+
(
MIC
of
drug
B
in
combination
MIC
of
drug
B
alone
)
The results were interpreted according to the following crieteria: FICI≤0.5, synergistic; 0.5 \< FICI \< 1, partially synergistic; FICI = 1, additive; 1\> FICI≤4, indifferent; and FICI \> 4, antagonistic.
Data Analysis
-------------
The heterogeneity between studies was assessed by Chi-squared test with significance level of 0.05. and *I* ^2^ test. Heterogeneity was considered as *I* ^2^ 50%. The random effects model was applied to combine the studies\' results. The data analysis was performed by STATA software version 11.1.
RESULT
======
A total of 104 articles were found in the initial search. The titles and abstracts were reviewed and after the exclusion of unrelated articles, 17 studies entered the meta-analysis. The included articles were 1 poster from ECCMID, 1 short communication, 1 letter to editor, 1 brief report and 13 original articles (Table **[1](#T1){ref-type="table"}**) \[10 - 22\]. The sensitivity of 448 strains was analyzed and 2% and 72% resistance to colistin and rifampin when administrated individually were observed, respectively. We also analyzed the abundance of the strains\` MIC comparing these two antibiotics.
The range of MIC for rifampin and colistin was 0.25 μg/ml to 64 μg/ml and 0.25 μg/ml to 16 μg/ml, respectively. The majority of strains (42%) demonstrated MIC= 4 and 30% had MIC= 2 for rifampin and colistin, respectively. The interaction between these two antibiotics was analyzed by the Time-kill method (11 studies) and the Checkerboard method (6 studies). The results demonstrated synergy in 63%, while, partial synergy, additive effect and no effect were present in 7, 3 and 14% of the cases, respectively. No combinations were antagonistic. Results and its details were shown in Figs. (**[1](#F1){ref-type="fig"}**-**[6](#F6){ref-type="fig"}**).
DISCUSSION
==========
Recent increase of the healthcare associated infections caused by MDR strains of *A. baumannii* is becoming a serious problem. The combination antibiotic therapy is proven to reduce the resistance and increase the efficiency of antibiotics. Two antibiotics that are commonly used in combination therapy are colistin and rifampin. There is no reliable information about the amount of resistance to these two antibiotics, especially to rifampin, and resistance pattern varies from hospital to hospital. Therefore, we analyzed the amounts of synergism and resistance to colistin and rifampin and their relationship with the MIC. After analyzing 448 strains, it was identified that 72% of the strains were resistant towards rifampin. Interestingly, in 4 studies the amount of resistance to rifampin was 100%. In one of the studies no synergy was observed, while in another study in 50% of the strains, the two antibiotics had no effect on each other. This shows that the relationship between MIC and the interactions of the two antibiotics are very important \[[@R5]\]. On the contrary, another study showed that 49% of the strains were sensitive to rifampin and in 100% of the cases synergism was observed. It seems that higher MIC and the consequent increase of the resistance to the antibiotic, caused the decrease of the antibiotic\`s efficiency and amount of synergism. It is notable that in one of the studies, 6% of the XDR strains were antagonistic towards antibiotics and no synergism was observed in this study. In this study, in 88% of the strains the combination of the two antibiotics was ineffective (13). These results suggested that the increase in resistance to rifampin reduces synergism. The synergic mechanism of the two antibiotics is based on colistin's effect to the outer membrane of gram-negative bacteria which causes increasing penetration of rifampin into the bacterial cell. One of the mechanisms of resistance to rifampin is *rpo* gene mutation, which causes high-level of resistance, with the concentration of bacterial MIC reaching 256 μg/ml. In Zarrilli and colleagues study the synergy of two antibiotics on the strains of *Acinetobacter* was examined and in one of the strains, where the synergism was not found, the study had identified mutations in the *rpo* gene with MIC higher than 512 μg/ml \[[@R9]-[@R18]\]. The resistance to colistin, observed in 3 studies, was found in 2% of the strains. In one of the studies that took place in Taiwan, from the total of 134 MDR strains of *A. baumannii*, 6 strains (10.2%) were resistant to colistin. The same strains were destroyed in the synergistic test \[[@R19]\]. In a study conducted in China, from the 25 strains of XDR *A. baumannii* 3 strains were resistant to colistin. The synergism test results showed 56%, 36% and 0.8% relative to synergism, additive effect and indifference to the two antibiotics, respectively \[[@R20]-[@R22]\]. These cases demonstrated the importance of combination therapy against MDR strains, and that the use of combination of two antibiotics can also control the strains resistant to colistin. The mechanism of synergy between two antibiotics in strains resistant to colistin is unknown and it needs further studies. The limitations of the current study were the inclusion of some studies that only mentioned synergism and not referring to interactions such as indifferent or antagonism. Also, some of the studies did not mention the strains' MIC fully and accurately, however, we tried to do calculation and analysis with less bias possible. In addition, in some cases the breakpoint for rifampin in *A. baumannii* was not defined, and in some articles the break point of *Staphylococcus aureus* for rifampin was used. In this study, the different effects of two antibiotics and their relationship with MIC were conducted in a systematic review method. As a result, in 63% of the strains synergy was observed. This study investigated the interaction of two antibiotics and recommend the use of combination therapy in the treatment of infection caused by *A. baumannii,* especially by MDR strains. The situation in these two phases is not the same, due to different pharmacodynamic and pharmacokinetic effects of different drugs in the host and drug concentration at the site of infection. However, for further simulation of the 2-phase in the time-kill method we used 6 mg/l for colistin and 5mg/l for rifampin, which are suitable concentrations for the human body. Greater use of this method seems to be due to the similarity in the concentration. In addition, the results of a study indicated that the resistance to rifampin occurs after 48 to 72 hours \[[@R11]\]. By increasing the time of the Time-Kill test we can compare the interaction of the two antibiotics better. *In vitro* studies were not able to evaluate the toxicity of the drug, this issue being more important for colistin. The other problem of *in vitro* studies is the lack of generalization and its use in treatment. In detailed *in vitro* studies by examining the MIC of antibiotics in 2 phases (single and in combination), the resistance was evaluated, but in the body phase, we were not able to check the resistance. Thus, more research should be done to fix these problems. The combination therapy has several advantages and one of them is that by using a combination of 2 antibiotics the concentration of each antibiotic can be reduced. This issue, as mentioned above, is more important for colistin. On the other hand, in this study, most of the strains showed MIC=4 for rifampin (42%) and MIC=2 for colistin (30%). In the observed studies, MIC of each antibiotic was calculated individually and then for the combination of two antibiotics the sub inhibitory concentration or a concentration lower than MIC was applied. We suggest an experimental basis to combine two antibiotics with a concentration of 2ug/ml for rifampin and 1 ug/ml for colistin, based on our study results. However, depending on the resistance of the strains (XDR or MDR) these concentrations could be different. It is recommended to use an accurate test such as E-test or micro dilution to measure the MIC of each of the 2 antibiotics first, because the synergy depends on rifampin. Examination of the strains' MIC can help predict the effect of the two antibiotics on each other.
CONCLUSION
==========
In this study, based on a systematic review and analysis of the existing studies we have shown that rifampin and colistin had a significant synergy in the in-vitro phase.
Declared None.
FUNDING
=======
Clinical Microbiology Research Center, Department of Microbiology, School of Medicine, Ilam University of Medical Sciences, Ilam, Iran.
CONFLICT OF INTEREST
====================
The authors confirm that this article content has no conflict of interest.
ETHICAL APPROVAL
================
Not required.
{#FC1}
{#F1}
{#F2}
{#F3}
{#F4}
{#F5}
{#F6}
######
Characteristics of the Studies Included in Meta-analysis.
--------------------------------------------------------------------------------------------------------------------------------------------
**Reference** **Country** **Published year** **No. of isolates** **Susceptibility**\ **Synergy method(s)**
**test**
--------------------------------- ----------------- -------------------- --------------------- --------------------- -----------------------
**Timurk \[**[@R10]**\]** **Turkey** **2005** **60** **Agar dilution** **Checkerboard**
**Tripodi \[**[@R6]**\]** **Italy** **2007** **9** **Micro dilution** **Time-kill**
**Ibanez \[**[@R11]**\]** **Spain** **2010** **4** **Agar dilution** **Time-kill**
**Lee \[**[@R12]**\]** **USA** **2013** **2** **Micro dilution** **Time-kill**
**Shields \[**[@R13]**\]** **USA** **2010** **17** **E-test** **Checkerboard**
**Rodriguez \[**[@R14]**\]** **Argentina** **2010** **14** **Agar dilution** **Time-kill**
**Giamarel \[**[@R8]**\]** **Greece** **2001** **39** **Micro dilution** **Time-kill**
**Song \[**[@R15]**\]** **South Korea** **2007** **8** **Micro dilution** **Time-kill**
**Montero \[**[@R5]**\]** **Spain** **2004** **2** **Micro dilution** **Time-kill**
**Hogg \[**[@R16]**\]** **England** **1998** **13** **Micro dilution** **Checkerboard**
**Liang \[**[@R17]**\]** **China** **2011** **4** **Micro dilution** **Time-kill**
**Dizbay \[**[@R18]**\]** **Turkey** **2009** **25** **E-test** **Checkerboard**
**Chang \[**[@R19]**\]** **Taiwan** **2010** **134** **Micro dilution** **Checkerboard**
**Dong \[**[@R20]**\]** **China.** **2014** **25** **Micro dilution** **Checkerboard**
**Jian \[**[@R21]**\]** **Australia** **2007** **17** **Micro dilution** **Checkerboard**
**Giannouli \[**[@R9]**\]** **Italy** **2011** **57** **Micro dilution** **Time-kill**
**Antonopoulou \[**[@R22]**\]** **Greece** **2007** **18** **Micro dilution** **Time-kill**
--------------------------------------------------------------------------------------------------------------------------------------------
|
{
"pile_set_name": "PubMed Central"
}
|
Q:
Extend TTPhotoViewController with custom TTPhotoView
I have successfully integrated the three20 framework in my project,
and I have extended the TTPhotoViewController to add some further
functionality.
Now I need to add some subviews to the TTPhotoView loaded by the
TTPhotoViewController. In particular I would like to add that subviews
after every TTPhotoView as been loaded. These subviews represents
sensible area over the image so they should scale proportionally with
the image.
The user can tap a subview to get extra info about the image.
I don't know how to implement this behavior. Should I extend the
TTPhotoView and make sure that the TTPhotoViewController use this
extended version instead of its TTPhotoView?
Could someone point me to the right direction?
Thank you
A:
Solved subclassing the TTPhotoView (TapDetectingPhotoView) and then adding all my subviews to that subclass.
The main problem was represented by the photo switching, because the TTPhotoViewController (in particular its inner TTScrollView) reuse the TTPhotoView during switching operation.
So for example if you add your subview to your TTPhotoView subclass and try to switch to the next photo, your subview will probably be here, because the TTPhotoView is reused.
To solve this problem I decided to add and remove all my subviews every time a photo switch occur (see TTPhotoViewController::didMoveToPhoto).
In this way I'm sure that every photoview has its subviews.
Here my implementation (only remarkable methods)
Hope these help!
PhotoViewController.h:
#import "TapDetectingPhotoView.h"
@interface PhotoGalleryController : TTPhotoViewController <TTScrollViewDelegate, TapDetectingPhotoViewDelegate> {
NSArray *images;
}
@property (nonatomic, retain) NSArray *images;
@end
PhotoViewController.m:
#import "PhotoGalleryController.h"
@implementation PhotoGalleryController
@synthesize images;
- (void)viewDidLoad { // fill self.images = ... }
- (TTPhotoView*)createPhotoView {
TapDetectingPhotoView *photoView = [[TapDetectingPhotoView alloc] init];
photoView.tappableAreaDelegate = self;
return [photoView autorelease];
}
#pragma mark -
#pragma mark TTPhotoViewController
- (void)didMoveToPhoto:(id<TTPhoto>)photo fromPhoto:(id<TTPhoto>)fromPhoto {
[super didMoveToPhoto:photo fromPhoto:fromPhoto];
TapDetectingPhotoView *previousPhotoView = (TapDetectingPhotoView *)[_scrollView pageAtIndex:fromPhoto.index];
TapDetectingPhotoView *currentPhotoView = (TapDetectingPhotoView *)[_scrollView pageAtIndex:photo.index];
// destroy the sensible areas from the previous photoview, because the photo could be reused by the TTPhotoViewController!
if (previousPhotoView)
previousPhotoView.sensibleAreas = nil;
// if sensible areas has not been already created, create new
if (currentPhotoView && currentPhotoView.sensibleAreas == nil) {
currentPhotoView.sensibleAreas = [[self.images objectAtIndex:photo.index] valueForKey:@"aMap"];
[self showSensibleAreas:YES animated:YES];
}
}
#pragma mark -
#pragma mark TappablePhotoViewDelegate
// show a detail view when a sensible area is tapped
- (void)tapDidOccurOnSensibleAreaWithId:(NSUInteger)ids {
NSLog(@"SENSIBLE AREA TAPPED ids:%d", ids);
// ..push new view controller...
}
TapDetectingPhotoView.h:
#import "SensibleAreaView.h"
@protocol TapDetectingPhotoViewDelegate;
@interface TapDetectingPhotoView : TTPhotoView <SensibleAreaViewDelegate> {
NSArray *sensibleAreas;
id <TapDetectingPhotoViewDelegate> tappableAreaDelegate;
}
@property (nonatomic, retain) NSArray *sensibleAreas;
@property (nonatomic, assign) id <TapDetectingPhotoViewDelegate> tappableAreaDelegate;
@end
@protocol TapDetectingPhotoViewDelegate <NSObject>
@required
- (void)tapDidOccurOnSensibleAreaWithId:(NSUInteger)ids;
@end
TapDetectingPhotoView.m:
#import "TapDetectingPhotoView.h"
@interface TapDetectingPhotoView (Private)
- (void)createSensibleAreas;
@end
@implementation TapDetectingPhotoView
@synthesize sensibleAreas, tappableAreaDelegate;
- (id)init {
return [self initWithSensibleAreas:nil];
}
- (id)initWithFrame:(CGRect)frame {
return [self initWithSensibleAreas:nil];
}
// designated initializer
- (id)initWithSensibleAreas:(NSArray *)areasList {
if (self = [super initWithFrame:CGRectZero]) {
self.sensibleAreas = areasList;
[self createSensibleAreas];
}
return self;
}
- (void)setSensibleAreas:(NSArray *)newSensibleAreas {
if (newSensibleAreas != self.sensibleAreas) {
// destroy previous sensible area and ensure that only sensible area's subviews are removed
for (UIView *subview in self.subviews)
if ([subview isMemberOfClass:[SensibleAreaView class]])
[subview removeFromSuperview];
[newSensibleAreas retain];
[sensibleAreas release];
sensibleAreas = newSensibleAreas;
[self createSensibleAreas];
}
}
- (void)createSensibleAreas {
SensibleAreaView *area;
NSNumber *areaID;
for (NSDictionary *sensibleArea in self.sensibleAreas) {
CGFloat x1 = [[sensibleArea objectForKey:@"nX1"] floatValue];
CGFloat y1 = [[sensibleArea objectForKey:@"nY1"] floatValue];
area = [[SensibleAreaView alloc] initWithFrame:
CGRectMake(
x1, y1,
[[sensibleArea objectForKey:@"nX2"] floatValue]-x1, [[sensibleArea objectForKey:@"nY2"] floatValue]-y1
)
];
areaID = [sensibleArea objectForKey:@"sId"];
area.ids = [areaID unsignedIntegerValue]; // sensible area internal ID
area.tag = [areaID integerValue];
area.delegate = self;
[self addSubview:area];
[area release];
}
}
// to make sure that if the zoom factor of the TTScrollView is > than 1.0 the subviews continue to respond to the tap events
- (UIView *)hitTest:(CGPoint)point withEvent:(UIEvent *)event {
UIView *result = nil;
for (UIView *child in self.subviews) {
CGPoint convertedPoint = [self convertPoint:point toView:child];
if ([child pointInside:convertedPoint withEvent:event]) {
result = child;
}
}
return result;
}
#pragma mark -
#pragma mark TapDetectingPhotoViewDelegate methods
- (void)tapDidOccur:(SensibleAreaView *)aView {
NSLog(@"tapDidOccur ids:%d tag:%d", aView.ids, aView.tag);
[tappableAreaDelegate tapDidOccurOnSensibleAreaWithId:aView.ids];
}
SensibleAreaView.h:
@protocol SensibleAreaViewDelegate;
@interface SensibleAreaView : UIView {
id <SensibleAreaViewDelegate> delegate;
NSUInteger ids;
UIButton *disclosureButton;
}
@property (nonatomic, assign) id <SensibleAreaViewDelegate> delegate;
@property (nonatomic, assign) NSUInteger ids;
@property (nonatomic, retain) UIButton *disclosureButton;
@end
@protocol SensibleAreaViewDelegate <NSObject>
@required
- (void)tapDidOccur:(SensibleAreaView *)aView;
@end
SensibleAreaView.m:
#import "SensibleAreaView.h"
@implementation SensibleAreaView
@synthesize delegate, ids, disclosureButton;
- (id)initWithFrame:(CGRect)frame {
if (self = [super initWithFrame:frame]) {
self.userInteractionEnabled = YES;
UIColor *color = [[UIColor alloc] initWithWhite:0.4 alpha:1.0];
self.backgroundColor = color;
[color release];
UIButton *button = [UIButton buttonWithType:UIButtonTypeDetailDisclosure];
[button addTarget:self action:@selector(buttonTouched) forControlEvents:UIControlEventTouchUpInside];
CGRect buttonFrame = button.frame;
// set the button position over the right edge of the sensible area
buttonFrame.origin.x = frame.size.width - buttonFrame.size.width + 5.0f;
buttonFrame.origin.y = frame.size.height/2 - 10.0f;
button.frame = buttonFrame;
button.autoresizingMask = UIViewAutoresizingFlexibleTopMargin |UIViewAutoresizingFlexibleBottomMargin | UIViewAutoresizingFlexibleLeftMargin |UIViewAutoresizingFlexibleRightMargin | UIViewAutoresizingFlexibleWidth |UIViewAutoresizingFlexibleHeight;
self.disclosureButton = button;
[self addSubview:button];
// notification used to make sure that the button is properly scaled together with the photoview. I do not want the button looks bigger if the photoview is zoomed, I want to preserve its default dimensions
[[NSNotificationCenter defaultCenter] addObserver:self selector:@selector(zoomFactorChanged:) name:@"zoomFactorChanged" object:nil];
}
return self;
}
- (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event {
[super touchesBegan:touches withEvent:event];
if ([[touches anyObject] tapCount] == 1)
[delegate tapDidOccur:self];
}
- (void)buttonTouched {
[delegate tapDidOccur:self];
}
- (void)zoomFactorChanged:(NSNotification *)message {
NSDictionary *userInfo = [message userInfo];
CGFloat factor = [[userInfo valueForKey:@"zoomFactor"] floatValue];
BOOL withAnimation = [[userInfo valueForKey:@"useAnimation"] boolValue];
if (withAnimation) {
[UIView beginAnimations:nil context:nil];
[UIView setAnimationDuration:0.18];
}
disclosureButton.transform = CGAffineTransformMake(1/factor, 0.0, 0.0, 1/factor, 0.0, 0.0);
if (withAnimation)
[UIView commitAnimations];
}
- (void)dealloc {
[[NSNotificationCenter defaultCenter] removeObserver:self name:@"zoomFactorChanged" object:nil];
[disclosureButton release];
[super dealloc];
}
|
{
"pile_set_name": "StackExchange"
}
|
Emmy Award for Best Television Documentary
Emmy Award for Best Television Documentary may refer to the following Emmy Awards:
News & Documentary Emmy Award
Primetime Emmy Award for Outstanding Documentary or Nonfiction Series
Primetime Emmy Award for Outstanding Documentary or Nonfiction Special
International Emmy Award for Best Documentary
Category:Emmy Awards
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
Pasting text into a webview
in the default android browser, when you long-press on a textbox inside of a webpage you get a context menu showing several options, such as the ability to paste text into the textbox. How do I replicate this functionality with my own webview?
I looked in the android source code, specifically the code that handles context menu creation and found this:
@Override
public void onCreateContextMenu(ContextMenu menu, View v, ContextMenuInfo menuInfo) {
...
WebView.HitTestResult result = webview.getHitTestResult();
int type = result.getType();
if (type == WebView.HitTestResult.EDIT_TEXT_TYPE) {
// let TextView handles context menu
return;
}
...
}
What the code means is that when the user long-presses on a "EDIT_TEXT_TYPE" ie. a textbox, the webview does nothing. Some magical "TextView" handles the context menu. Now I'm lost, how do I get this context menu to appear in my webview?
A:
Have you tried using registerForContextMenu(). I know it works on ListView for sure but it also works on other views.
It should go something like this:
registerForContextMenu(yourWebView);
@Override
public void onCreateContextMenu(ContextMenu menu, View v, ContextMenuInfo menuInfo) {
//Code for "Paste";
}
Hope this helps!
|
{
"pile_set_name": "StackExchange"
}
|
nelmio_cors:
defaults:
origin_regex: true
allow_origin: ['%env(CORS_ALLOW_ORIGIN)%']
allow_methods: ['GET', 'OPTIONS', 'POST', 'PUT', 'PATCH', 'DELETE']
allow_headers: ['Content-Type', 'Authorization', 'Preload', 'Fields']
expose_headers: ['Link']
max_age: 3600
paths:
'^/': null
|
{
"pile_set_name": "Github"
}
|
John Stubbs
At the Democratic National convention in Philadelphia and again in the final debate in Las Vegas, Hillary Clinton made a direct appeal for Republican votes. Last week, FBI Director Jim Comey reminded Republicans why they have reservations.
Americans of all political stripes know a lot about Clinton. Much of what they know is unpleasant, and there are lots of mind-boggling, unnecessary, unforced errors. She fails to embrace the transparency her public life demands, and her efforts to maintain a private life are often the core of the problem.
On substance, where Clinton is supposed to shine, Washington has failed to produce solutions to many pressing domestic and global challenges, and Clinton has played a role in some of those failures.
Yet Donald Trump is not the answer. You may believe Clinton to be a ‘2,’ but Trump is a ‘-11.’ And there is a difference.
The journey for Republicans to vote for Clinton is not an easy one. For me, the seven stages of grief went something like this:
1. Trump is a funny guy. Like a clown, he amuses me.
2. Wow, look at that: Clown = ratings. Could Republicans be popular again? It’s sure nice to have a celebrity act other than Clint Eastwood and an empty chair.
3. Let’s be real, we were never popular, and we shouldn’t try to be. Jeb, take control.
4. Yep, Trump’s surrounded by white supremacists. That dog whistle really works.
5. Wait, that’s it? We’re nominating the guy who seeks approval from Vladimir Putin? We’re really going to turn the Republican convention into the Temple of Doom?
6. Seriously, I have to look my kids in the eyes. I will do anything to stop this. This man can’t have the U.S. military as his new favorite toy.
7. Fine. FINE. I did say anything. Binary option. I’ll vote for Clinton, but let’s keep the Congress.
Trump at the top would be a disaster: Claudia J. Kennedy
For my fellow Americans who vote Republican, when you get to number 6, it’s time to talk about number 7. There is only one thing standing between Trump and the role of commander in chief, and that’s Hillary Clinton.
This is a serious job, and Trump is not a serious man. It’s telling the number of serious Republicans who cannot support Trump. These are not political operatives. These are the people we entrust with our global security. And they have kept us and the rest of the world relatively safe.
We were not relatively safe in World War II, a war both of my grandfathers served in, when more than 50 million people died. Since then, we’ve built institutions, partnerships, alliances and networks to integrate nations into a broad, layered global security framework. When countries are working together towards common goals, when they trade with each other, when they depend on each other, they are less likely to go to war. This is what Trump wants to light on fire.
Clinton will not solve all of our problems, but she will not risk Armageddon either. She will be a better president than Trump.
Evangelicals aren't who you think: Jim Wallis
POLICING THE USA: A look at race, justice, media
With Republican majorities in the House and Senate, she could be even better than just better than Trump. It’s no secret that Washington has been plagued by partisanship. President Reagan was able to accomplish a great deal with Tip O’Neill, the Democratic Speaker of the House for much of his presidency. The economy under President Bill Clinton did much better with a Republican Congress than a Democratic one.
Today, millions of Republicans are planning to vote for Clinton. Millions more may join them before Election Day. If she were willing to move to the middle on some issues and engage her new constituency of Republican voters, Clinton could potentially find common ground with leaders such as Speaker Paul Ryan, Sen. Rob Portman and other capable and reasonable Republicans.
Responsible Republican voters should split their ballots: vote for Clinton to defeat Trump, and for Republicans to lead the Congress and provide a stable, balanced government. In the process, we will restore credibility to the GOP by voting against Trump, and we may even be surprised by what Republicans and President Clinton can accomplish together.
John Stubbs, a founder of R4C16.org, Republicans for Clinton in 2016, was senior adviser for the U.S. Trade Representative in the White House of George W. Bush.
You can read diverse opinions from our Board of Contributors and other writers on the Opinion front page, on Twitter @USATOpinion and in our daily Opinion newsletter. To submit a letter, comment or column, check our submission guidelines.
|
{
"pile_set_name": "OpenWebText2"
}
|
1. Introduction {#sec1}
===============
The cholesteatoma of the middle ear is a chronic otitis described as dangerous because of the evolutionary risks and the potentially serious complications.
The posttraumatic cholesteatoma is recognized like a rare late complication of various types of the temporal bone damage.
We report in this study a case of posttraumatic cholesteatoma revealed by a facial paralysis occurring several years after a crash of the external auditory canal.
2. Case Report {#sec2}
==============
A patient, 51 years old, has consulted for a progressive right facial paralysis evolving for two years. In his antecedents there is a war wound caused by a splinter at the right temporomandibular area dating back over 23 years.
The examination, carried out on a patient in good general state, finds at the inspection signs of a right complete peripheral facial paralysis, with presence in the ipsilateral preauricular area of an old traumatic scar.
The otoscopy objectifies a cicatricial total stenosis of the right external auditory meatus.
The instrumental acoumetry is in favour of a right transmission deafness confirmed by the liminary tonal audiometry. The stapedial reflex is absent on the affected side.
The remainder of ENT and somatic examination is strictly normal.
A CT-scan of the temporal bone objectifies a crash of the right external auditory canal, quasitotal lysis of the mastoïd, tissue filling the middle ear cavities with total destruction of the ossicular chain, and erosion of 2nd and 3rd portions of right facial nerve canal (Figures [1](#fig1){ref-type="fig"} and [2](#fig2){ref-type="fig"}).
The surgery confirmed the CT-scan data and the patient benefited from an open technique of tympanoplasty (canal wall down) aimed at eradication of the cholesteatoma and decompression of the facial nerve with repermeabilisation of the external auditory meatus.
The postoperative courses were simple but no improvement of facial nerve function was noted.
3. Discussion {#sec3}
=============
The cholesteatoma is the result of development in the middle ear of a keratinized malpighian epithelium endowed with a potential of desquamation, migration, and erosion \[[@B1], [@B2]\].
There are two main types of cholesteatomas: the primitive or congenital cholesteatoma developing behind an intact tympanic membrane, and the acquired cholesteatoma whose origin can be an invasion by progressive colonization of the mucosae after crossing the free edge of a tympanic perforation, an evolution of a retraction pocket, or an iatrogenic or posttraumatic epidermal inclusion by skin incarceration during a fracture involving the external auditory canal \[[@B1]\].
The posttraumatic cholesteatoma is a rare and often very delayed complication of temporal bone trauma and can remain undetected for years allowing it to develop intensively \[[@B3]\].
The time interval between the temporal bone damage and the diagnosis of the posttraumatic cholesteatoma is very variable and may range from 1 to 25 years. In the majority of the cases reported in the literature, the interval was more than 10 years \[[@B4], [@B5]\]. In our case, the latent interval is 23 years.
In most cases, the evocative clinical signs of a cholesteatoma are fetid otorrhea, otalgy, and hearing loss \[[@B1]\]. In our case, the otorrhea is absent because there is a complete meatal stenosis.
In the evolved forms, the diagnosis can be revealed by labyrinthian, neuromeningeal, or facial complications, sources of cholesteatoma severity \[[@B1]\].
The facial paralysis is a rare complication of cholesteatoma with a frequency estimated at 1-2% \[[@B1], [@B6]\]. Generally, his installation is rapid during an infection but sometimes, it is progressive during an erosion of the facial canal, as in the case of our patient \[[@B7]\].
The CT-scan currently occupies an essential place in the diagnosis of middle ear cholesteatoma \[[@B8], [@B9]\] because it can provide semiological arguments in favour of the positive diagnosis with tissue filling the middle ear cavities and signs of osteolysis, specify the extensions, and seek possible complications like a lysis of the tegmen tympani and/or antri, a labyrinthine fistula, or an erosion of the facial nerve canal, what is essential for presurgical planning. The MRI occupies the second place. However, it may provide additional information on the delineation and extension of cholesteatoma and on potential complications \[[@B10]\].
The therapeutic management is surgical consisting primarily of a canal wall up (closed) or a canal wall down (open) tympanoplasty \[[@B11], [@B12]\] with treatment of the complications if it is necessary.
4. Conclusion {#sec4}
=============
The posttraumatic cholesteatoma is a rare complication of the temporal bone trauma. Its diagnosis is often done in the majority of cases after several years of evolution, sometimes even at the stage of complications that can compromise the functional and even vital prognosis, hence the need for regular monitoring, by otoscopy and/or CT-scan of the temporal bone, of any patient with a temporal bone trauma in order to make an early diagnosis and lead to a therapy as soon as possible.
{#fig1}
{#fig2}
[^1]: Academic Editors: M. B. Naguib and Y. Orita
|
{
"pile_set_name": "PubMed Central"
}
|
Products
Brochures
When you need to communicate key messages to your audience, there’s nothing more effective than a full-color, custom brochure. Business brochures allow you to share detailed information about your products and services in a uniquely presentable way. Bring us your project, and we’ll work tirelessly to craft the perfect brochure for your organization.
Ready to get started?
Get a Quote!
Related Products
One of your most important selling tools may be a professionally printed catalog. We'll help you showcase your products in the best way possible with a high-quality catalog you'll be proud to distribute.
“It’s what’s inside that counts” may be true—but it can’t hurt to have a little outside appeal as well. Send your mail in style with professionally designed envelopes, from classic black and white to colorful designs.
|
{
"pile_set_name": "Pile-CC"
}
|
""Guys with Kids" is taped in front of a live studio audience." " Mom's home!" " Mom's home!" "Ow, hey!" "Welcome to my life." "These guys today." " Hi, sweetheart." " Take 'em." "Look, and I'm not talking to this one for the rest of the night." " Oh." " Mom, did you know there's a" "Boys, boys." "Back up, back up." "Come on, give your mom some space." " Oh, thank you, Gary." " Oh, you're welcome, baby." "So how was your day?" "What'd you do?" "Tell me about it." "Come on, come on, come on." "What did you have for lunch?" "Uh, turkey sandwich?" "Oh, a turkey sandwich?" "All right." "On what type of bread?" "Come on, don't leave me hanging, woman!" "Gary, I just got home." "I'm tired." "Baby, I'm tired too." "And I've been trapped in here all day." "I need to know what's going on out in the real world." "Give me details." " You want details?" " Yes." "I spent five hours in a windowless conference room debating whether to put the title of a PowerPoint presentation in all caps or initial caps." "Oh, so what did you decide?" "Oh, baby, please, can I just get a minute?" "No, baby, I need adult conversation." "The only thing I talked to today was this thing." "You're special." "The positive reinforcement is great, but the conversation doesn't go anywhere." "I like you." "Say it less and mean it more, Teddy bear." "♪ Life is how you live it" "♪ ooh ooh ooh" "♪ wake up where you wanna be" "♪ hey hey" " ♪ you and me - ♪ Ooh ooh ooh" " ♪ we're happy - ♪ Ooh ooh ooh" "♪ we need our friends like the sun ♪" "♪ why would you walk when you can run?" "♪" "♪ everybody sing it loud" "♪ why would you walk when you can run?" "♪" "So what's the big news, Chris?" "Cagney's is starting a trivia night." "Apparently all those cards we stuffed in the suggestion box paid off." "The system works." "Let's do it." "Finally, some real competition." "I think we should pull Violet out of school so she can quiz us during the day." "There's the overly competitive guy who got into a butterfly drawing competition with my niece." "She thinks she's so good." " Hi." " What are you guys doing?" "Oh, nobody move." "If we hold perfectly still, she might not spray us." "Oh, my God." "Your dog can talk." "Hmm." "Sheila, we are forming a bar trivia team." "Do you wanna join?" "Does kamusta mean "yes" in tagalog?" "No, it means "hello." That was a trick question." "You need me." "Sheila, I know that Emily just asked you to join our team, but I am asking you to take the temperature of the room, read between the lines, and pick up on the general vibe that I am sending out right now." "Got it..." "I'm in." "And I've already figured out our team name." ""Let's Get Quizzical," huh?" "It's a pun on the song by Oli" "Olivia Newton-John, 1981, MCA Records." "Bang." "Winner." "I beat you." "Nick, you're on the same team." "Yeah, I know, but I won." "Hold the elevator!" " Whoa." "Oh." "Oh." " Hey." " You two." " Hey." "Yes, we'll ride the elevator with you." "Jeez, Marny, you're so needy." "It's nothing personal, guys." "This one-minute elevator ride is the only alone time in my day." "I love my kids." "I love my husband." "But sometimes I see someone in a coma on a medical show, and I say, "I could use some of that."" "Mm-hmm." "I totally get it." "I totally get it." "The stay-at-home spouses, they do not understand." "We go straight from working at work to working at home." "It's like, hey, I need some alone time." "But if I ask Gary for alone time, it's gonna hurt his feelings." "Yeah, right, but that's why you don't ask for alone time." "You have to sneak it." "Dirty little secret about divorce, guys:" "Filled with wonderful alone time." "Like, lots of alone time, you know?" "Sometimes too much alone time." "Now I'm sad." "Nick, I don't think I could ever deceive Gary that way." "Sure you can." "Do it." "Maybe I'm just over-tired and blowing things out of proportion." "Hey, baby, the suspense is killing me." "Did you go with all caps or initial caps, huh?" "How long have you been waiting here?" "We watched you get off the subway from the window." "We always watch you." "Welcome to Cagney's inaugural Trivia Night." "All right, first question." "Who is the current prime minister of Canada?" "Stephen Harper!" "Correct." "I'm outside counsel for a pharmaceutical company based in Toronto." "I watch hockey." "Oh!" "Sir Arthur Conan Doyle?" "Incorrect." "That's a point lost for team "Let's Get Quizzical."" "Good guess, Chris." "Good job!" "I know." "No, the thing is, you don't know." "You made a baby with that." "Colors of the German flag?" "Oh, uh, uh, I'm not positive, but I think it's" " Black, red, and gold!" " Correct." "Final question of the night." "Name the 1990s pop duo who lip-synched their way to the top of the charts." "Ding!" "Vanilla Ice!" " No!" " How is that a duo?" "Milli Vanilli." " Correct!" " Oh!" "Ugh, that's what I was thinking." "And the winning team:" ""No Quizness Like Show Quizness."" "This was so fun." " We did so well." " I know." "Oh, hey, let's go buy the winning team a drink." " Oh, good idea." " Right?" "Yeah." "Their enthusiasm is sickening." "I never should have married a camp counselor." "Gary, are you sure you can't join our team?" "I can't do it, man." "Marny's boss has been making her stay late recently." "She's working hard." " Yeah, I'm really proud of her." " Mom!" "Yes, son, that's who we're talking about, your mom." "Now stay out of adult conversations." "No, Mom's right there." "What is she doing here?" "She told me she was working." "She is working." "Working on those calves." "I'm just trying to lighten the mood." "I can't believe Marny lied to me about working late, then went to the gym." "Doesn't sound like Marny." "I wonder where she'd get an idea like that." "Women's magazines, obviously." "Hey, baby." "How was, uh, work?" " Oh, brutal." " Oh?" "Oh, I can see that they're working you hard." "So hard that you have sweat on your brow." "Oh." "Well, you know, they were really cranking the heat at work." "Hmm, I bet." "And I wanted to get home, baby." "But, you know, it's 6:00 here, and they're just waking up in Tokyo." " Mm-hmm." " Then Kashegawa calls and start asking for materials and, you know-- it actually was through a translator, Terry" "He knows." "And then I stopped by the gym to get a run in." "Okay, so we're gonna go." "Yeah, okay." "So..." "Let me get this straight." "Instead of coming home..." "You went to the gym." "Yes." "Yes, I did." " Huh." " But I did it because..." "You know, because, uh..." "Because I want to look good for my husband." "Huh." "So why didn't you, uh, tell... your husband?" " Because..." " Hmm." "I knew that..." "You'd want to go with me." "And I know how much you hate the gym." "And I don't want to put that kind of pressure on you." "Because you... are a beautiful man." "What are you talking about?" "I love the gym." "In fact, why don't we get a sitter?" "And we can go together." " Together?" " Mm-hmm." "But--but you would do your thing, and I would do my thing." "Exactly." "Well, great." "Why wouldn't that work?" "♪ Rising up" "♪ back on my feet" "♪ jogging here next to Marny ♪" "Did you tell Chris and Emily they're off the trivia team?" "No, but I did learn that Chris thinks true love is one of the seven wonders of the world." "We're never going to win with them on the team, so sack up and cut 'em loose." "I guess I could tell them that I'm working late, and we can't do trivia this week." "I don't care how the sausage is made." "Just get it done." "And you said this would be awkward." "See?" "We can hold hands." "Gary, I'm feeling a little dehydrated." "Can you get me some of that cucumber water?" " Oh, sure thing, baby." " Thank you." "♪ Getting cucumber water" "♪ it's the thrill of the fight, hey ♪" "♪ there's a climbing wall over here ♪" "Nick." " Hey, Marny." " You got me into this." "Now how do I get out?" "Gary's with me at the gym, talking through all my alone time." "He got on the back of my treadmill and acted like he was trying to catch me." "Okay, you can go one of two ways with this." "You can divorce Gary." "Nah." "It would take too long to train somebody new." "Or-- ah!" "Fake an injury." "Don't you think that's going a little far?" "No." "Do it." "Hey, Marny." "Marny." "Marny." "Marny." "Marny!" " Marny!" "Marny!" " Yes?" "We should come here three times a week." " Three?" " Mm-hmm." "Oh." "Oh!" "Oh!" "Oh!" "Baby, what's going on?" "Baby, you all right?" " My hamstring!" "Oh!" " Oh!" "Ow, ow, I think I pulled it." " Oh, my God." "What--what can I do to help?" "Uh, I'm just gonna go to the women's locker room and ice it down." " Oh, okay." " Quietly." " Mm-hmm." " For, like, half an hour." "Oh, yeah." "Yeah, baby, that's a good idea." "Come here." "I got you." "I got you." "Come on." "Oh!" "Gary, you're not allowed in there." "The hell I'm not!" "Get out of my way!" "My wife is hurt!" "Oh, wow." "This is way nicer than the guys' locker room." "Hey, come look at ours." "All right baby, time to change your ice pack." "Oh, no, Gary, it's okay." "I think two hours of icing is good." "And I really don't need the walker." "You know what?" "You're right." "I'm gonna get you one of those motorized old person scooters." "Honey, I feel really guilty taking all of your time like this." "Baby, nothing is more important than your health." "All I need to do is go to physical therapy twice a week at night." "By myself." " Okay." " I'll be fine." "Don't worry about it." "All right?" "I got it under control." "You won't even have to leave the house." "Ah." "Hey, come on in, Doc." "Who is this?" "This is Dr. Wallace Yee." "I hired him to acupuncture you." "This is all your fault." "Oh, we are gonna crush trivia now that we no longer have those albatrosses around our neck." "What poem is that from?" "Rime Of The Ancient Mariner." "Oh, we are so ready." "Knowledge." "Hey, Quizzicals." "You guys ready to lose again?" "Ah." "We're not gonna lose this time." "In fact, let's make it more interesting." "How about the losing team can never show their face in this bar again?" "Bup bup bup bup, bup bup bup, bup bup bup bup bup-- hey." "Um, maybe not that interesting." "I come here all the time." "If you think we're gonna lose to these guys, why am I working with you?" "Okay." "Yes." "You're right." "Yes." "Okay, losing team can't show their face in here anymore." "Deal." "Prepare to go down like the Lusitania." "That's a" " British ocean liner, yeah." "The sinking of which precipitated U.S. involvement in World War I." "Duh." " Hi." " Oh, hey." "Glad you guys are here." "Thanks for coming to look after Marny while I use the bathroom." "Oh." "I'm not really hurt." "This whole sneaking alone time thing has just gotten out of control." "That's what you get for listening to Nick." ""Oh, don't worry, Chris." "Bears are more afraid of us than we are of them."" "They are not." "I'm worried Gary might be on to me." "He's being so nice." "I think he's trying to guilt me into confessing." " Hmm." " All right." "Okay, Marny." "I'm running your bath, and it's almost time for your ibuprofen and chocolate milk." "Uh--oh." "Hi, Sheila." "Oh." " Yeah." " Hey, Nick." "Okay." "I'll see you when you get home." "Love you too." "Nick's stuck at work." "Said he's gonna be another 35 minutes." "Huh." "That was Sheila, just calling to say she was gonna be late to pick up Ernie-- 35 minutes late." "Was there music playing in the background?" "Yeah." "Did it sound like they were at a bar?" "Oh, come on!" "They're playing trivia without us!" "The team was my idea, and they got rid of us?" "We're like that guy who was originally in the Beatles but got kicked out." " You know who I'm talking about." " Yeah, uh" " Uh" " Uh, what was his name?" "Uh, um, something with the word "fish" in it." " Yeah, um" " Pete Best." "God, we're bad at trivia." "You know what, though?" "That's no excuse." "Nick still lied to both of us." "Hey, never lie to your spouse." "You always get caught." "Isn't that right, Marny?" "So you figured it out." "That is why you've been doting on me." "What are you talking about?" "Figured what out?" "And what happened to your limp?" "Oh." "It's still here." "Now you're limping with the other leg!" "Ma--Marny, what's going on?" "Uh, w" "I, uh" "Now I'm all mixed up." "You've been faking this whole time?" "Why?" "Please don't take this personally." "I just wanted a little time to myself." "What?" "I put handicap bars in the shower!" "Okay, I think we're gonna-- we're gonna take off." "Yep." "We gotta yell at our people too." "Gary, I'm really sorry." "I know that I was wrong." "It's just that I thought if I asked you for some alone time, you would say no." "You're right." "I would've said no." "I work hard here, and I need you." "But mostly because the best part of my day is when you come through that door." "Gary, it was never that I didn't want to be with you, sweetheart." "I love being with you." "I just wanted a little alone time to clear my head." "Baby, I want some alone time too." "And we'll both get it." "When those two jokers are in college." "September 3, 2029." "I already have it circled on the calendar." "I'm really sorry." "Mm." "Oh, I don't know why I let Nick get in my head like that." "Nick?" "Yeah." "He's the one that told me to lie." "Huh." "He did, huh?" "Yes, he did." " Hmm." " It's all his fault!" " Mm-hmm." " Go get him." "What did I tell you?" "There is no way the other team can catch us." "One more correct answer and we win." "This is the third largest mountain range in Europe." "The Carpathians!" " Incorrect." " Nick, I got this." "For the victory, it is" " Spice Girls." " No!" "Hey!" "Incorrect." "Next question." "What element" " Spice Girls!" " No!" " Incorrect." "Next question" " I'm sorry--hey!" "Can we just have a second here, please?" "Guys, I'm s" "I see you guys are all here, and I understand that you're all mad at me." "Okay, fine, but you have to know, if we don't get this next question right, we will lose, and I will not be able to come here ever again." "Okay?" "Okay, which rebellion was defeated at the Battle of Sedgemoor in 1685?" "I don't know this one." "I don't know this either." "Neither does anyone else." " I think we're still good." " Okay." " I know the answer." " Oh!" " History major." " Oh!" " Quick, what is it?" " Okay!" " Quick, please, tell us!" " Yeah." "Hey." "Hey." "Hey, Gary!" "Hey, where are you going, man?" "Oh, to these nice people and give them the answer." "Hey, Gary, what-- Oh, my God." "If I lose, I can never come back here." "You should've never encouraged my wife to lie to me." "Gary, Gary, this is very serious." "All right?" "Chris, Emily, please?" "I'm sorry, honey." "I warned you not to be so competitive." "Yeah, and you kicked me out of my own group like Pete fish." "Gary, I am begging you right now." "Okay?" "I love this place." "Please." "I don't know why I do the things I do, okay?" "I'm a flawed person." "I'm working on it." "But I admit it, okay?" "Today I lied to my best friend." "I lied to my wife." "Guys, I'm so, so sorry." "I think there's probably something wrong with me." "And it's worth looking into." "I will search for it on WebMD when I get home." "But right now..." "Gary, please, can you find it in your heart to forgive me?" "I'll forgive you." "After I get even with you." "The Monmouth Rebellion." "We have a winner." "Second place," ""Let's Get Quizzical," you get a Cagney's shot glass." "And he's banned for life." "And you are banned from this bar for life." "Okay." "Okay." "All right, then." "I guess--I guess I'm leaving." "All right." "But you guys are gonna miss me." "You're gonna say, "hey,"" ""hey, what happened to that guy Nick Thayer, huh?" ""Where's that guy that used to-- that used to order one beer at the bar and then hang out with his kid for three hours?"" "Oh, right, honey, that is quite a legacy." "Let's go." "Well, I don't mind being banned." "I'm tired of having to throw away all my clothes after I leave this place anyway." "Hey." "Oh, hey, baby." "Boys, your mom's home!" "Mom, Mom!" "Clark didn't change his underpants today!" "I wanted to tell her that." "Baby, how was your day?" " Yeah!" " Oh, long." "Oh?" "What'd you have for lunch?" "Turkey sandwich." "With a side of potato chips." "And a pickle spear." "Oh, see?" "Baby, that's all I want." "Oh, I took some pictures of it to show you." "Wow, marble rye." "You gone crazy." "You see...?" "Mama went crazy."
|
{
"pile_set_name": "OpenSubtitles"
}
|
All the samples are written in Java and [https://en.wikipedia.org/wiki/Kotlin_(programming_language) Kotlin].
+
+
= Common Mistakes =
+
I suggest you to take a read to these two pages for a quick overview over the most common problems, it is a very useful reading, legacy sections are carefully signaled.
+
+
[https://www.opengl.org/wiki/Common_Mistakes OpenGL]
+
[https://www.opengl.org/wiki/GLSL_:_common_mistakes GLSL]
+
+
Another common mistake that may happen if you port code from C/C++ to Java is this one:
+
+
<code>
+
Caused by: com.jogamp.opengl.GLException: unpack pixel_buffer_object must be bound to call this method
+
at jogamp.opengl.gl4.GL4bcImpl.checkBufferObject(GL4bcImpl.java:40621)
+
at jogamp.opengl.gl4.GL4bcImpl.checkUnpackPBOBound(GL4bcImpl.java:40707)
+
at jogamp.opengl.gl4.GL4bcImpl.glTexImage2D(GL4bcImpl.java:5535)
+
at tests.gl320.Gl_320_fbo_blit.initTexture(Gl_320_fbo_blit.java:199)
+
</code>
+
+
This happens because in C/C++, when you just want to allocate the space for a texture using, for example, ''glTexImage2D'', you should not pass 0 as the last argument, but ''null''.
+
+
+
N.B: The use of color picking is '''NOT''' recommended on any hardware whose palette is partially emulated.
+
+
= Java OpenGL Samples Pack =
+
+
The [https://github.com/elect86/jogl-samples Java OpenGL Samples Pack] (called unsurprisingly jogl-samples) is a port of the [http://www.g-truc.net/project-0026.html OpenGL Samples Pack], a collection of OpenGL samples based on the OpenGL "core profile" specifications.
+
+
The project aims to promote the new OpenGL features making easier version transitions for OpenGL programmers with a complementary documentation for the OpenGL specification. Despite the fact that the OpenGL Samples Pack provides as simple (and dumb) as possible samples, it's not a tutorial for beginner but a project for programmers already familiar with OpenGL. The OpenGL Samples Pack is also a good OpenGL drivers feature test.
+
+
These samples illustrate mostly of the OpenGL features from ES 2.0 up to the last GL extenstions, same of them usually also called AZDO (Almost Zero Driver Overhead).
Shader-based modern OpenGL 3D graphics programming textbook entirely in JOGL. Also works as a JOGL primer. "Computer Graphics Programming in OpenGL with Java" by V. Scott Gordon and John L. Clevenger, published by [http://www.merclearning.com/titles/Computer_Graphics_Programming.html Mercury], available at [https://www.amazon.com/Computer-Graphics-Programming-OpenGL-Java/dp/1683920279/ Amazon].
Common Mistakes
Another common mistake that may happen if you port code from C/C++ to Java is this one:
Caused by: com.jogamp.opengl.GLException: unpack pixel_buffer_object must be bound to call this method
at jogamp.opengl.gl4.GL4bcImpl.checkBufferObject(GL4bcImpl.java:40621)
at jogamp.opengl.gl4.GL4bcImpl.checkUnpackPBOBound(GL4bcImpl.java:40707)
at jogamp.opengl.gl4.GL4bcImpl.glTexImage2D(GL4bcImpl.java:5535)
at tests.gl320.Gl_320_fbo_blit.initTexture(Gl_320_fbo_blit.java:199)
This happens because in C/C++, when you just want to allocate the space for a texture using, for example, glTexImage2D, you should not pass 0 as the last argument, but null.
N.B: The use of color picking is NOT recommended on any hardware whose palette is partially emulated.
Java OpenGL Samples Pack
The project aims to promote the new OpenGL features making easier version transitions for OpenGL programmers with a complementary documentation for the OpenGL specification. Despite the fact that the OpenGL Samples Pack provides as simple (and dumb) as possible samples, it's not a tutorial for beginner but a project for programmers already familiar with OpenGL. The OpenGL Samples Pack is also a good OpenGL drivers feature test.
These samples illustrate mostly of the OpenGL features from ES 2.0 up to the last GL extenstions, same of them usually also called AZDO (Almost Zero Driver Overhead).
Shader-based modern OpenGL 3D graphics programming textbook entirely in JOGL. Also works as a JOGL primer. "Computer Graphics Programming in OpenGL with Java" by V. Scott Gordon and John L. Clevenger, published by Mercury, available at Amazon.
|
{
"pile_set_name": "Pile-CC"
}
|
North Korean Leader Kim Jong Un observes a target-striking contest by the Korean People's Army (KPA) in this undated photo, released by North Korea's Korean Central News Agency (KCNA), April 13, 2017.
WASHINGTON — North Korea on Friday fired two short-range ballistic missiles into the sea, multiple intelligence sources told NBC News.
The missiles did not appear to pose any immediate threat to the U.S. or its allies in the region, NBC reported.
North Korea's latest provocation comes hours since Pyongyang last fired of a pair of similar missiles.
On Wednesday, North Korea fired two ballistic missiles from the Hodo Peninsula in South Hamgyong province on the country's east coast. The projectiles appeared to be a different type to previous launches, National Defense Minister Jeong Kyeong-doo said, according to South Korean news agency Yonhap.
The Pentagon did not immediately respond to CNBC's request for comment.
President Donald Trump, who has pointed to the absence of nuclear tests as evidence that his diplomatic strategy with North Korean leader Kim Jong Un has worked, said outside the White House on Thursday that he wasn't worried about the new tests because they are standard, short-range missiles. Trump said he was still open to negotiations with Kim despite the missile launches.
"These are short-range missiles -- we never discussed that," Trump told reporters on the White House South Lawn. "We discussed nuclear. A lot of other countries test that kind of missile."
This week's tests come on the heels of an earlier test in July that marked the first provocation since Kim and Trump agreed to revive denuclearization talks in June.
North Korea, the only nation to have tested nuclear weapons this century, spent most of Trump's first year in office perfecting its nuclear arsenal. The newest member of the world's exclusive nuclear weapons club has stopped testing of its nukes for now as the U.S. and international community offer the possibility of relief from crippling economic sanctions.
While North Korea has paused nuclear tests that prompted Trump's threat to bring "fire and fury" upon that country, it had already made significant progress before the historic dialogue with the U.S. started.
Under the third-generation North Korean leader, the reclusive state has conducted its most powerful nuclear test, launched its first-ever intercontinental ballistic missile and threatened to send missiles into the waters near the U.S. territory of Guam.
Since 2011, Kim has fired more than 90 missiles and had four nuclear weapons tests, which is more than what his father, Kim Jong Il, and grandfather, Kim Il Sung, launched over a period of 27 years.
|
{
"pile_set_name": "OpenWebText2"
}
|
Dysregulation of cellular signaling in gastric cancer.
The pathogenesis of gastric cancer is complex and related to multiple factors. Dysregulation of intracellular signaling pathways represents a common pathogenic mechanism and may be amenable to drug targeting. Multiple well-established oncogenic pathways, such as those mediated by cell cycle regulators, nuclear factor-kappaB, cyclooxygenase-2 and epidermal growth factor receptor are implicated in gastric carcinogenesis. Emerging evidence also underscores the importance of signaling pathways involved in the developmental process, including transforming growth factor-beta/bone morphogenetic protein signaling, Wnt/beta-catenin signaling, Hedgehog signaling and Notch signaling. Understanding their biological significance will provide a rational basis for drug development. Their relative importance and cross-talk in gastric carcinogenesis, however, are still not completely understood and warrant further investigation.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Alcohol Cutdown Coachhttp://alcoholcutdowncoach.com
Available on the App Store now!Tue, 29 Sep 2015 23:29:33 +0000en-UShourly1https://wordpress.org/?v=4.9.4Alcohol Cutdown Coach Interview on 3RRR’s “Byte Into It”http://alcoholcutdowncoach.com/alcohol-cutdown-coach-interview-on-3rrrs-byte-into-it/
http://alcoholcutdowncoach.com/alcohol-cutdown-coach-interview-on-3rrrs-byte-into-it/#respondTue, 29 Sep 2015 07:36:29 +0000http://alcoholcutdowncoach.com/?p=72Continue reading →]]>We had a lot of fun being interviewed on Melbourne radio station 3RRR’s technology program, Byte Into It. Many thanks to Triple R for having us on to talk about the Alcohol Cutdown Coach app, how it came about and how it can be utilized by people who want to cut down on their alcohol use.
For anybody interested in listening to the interview in full, here it is. We will look to upload a full transcript of the interview in due course as well.
One complaint that is rarely heard these days is that people have too much time. Although this may be true for a small minority, many of us feel the pressures of everyday life eating away at more and more of our day. Whether you’re working, staying at home with the kids or otherwise, you may find like many others that once the working day is done you just have time to get the kids fed and bathed and in bed, ditto yourself, and barely have any time at all left over. And the little amount of time you do have is spent recovering from an exhausting day. You might also find that as soon as you get home you habitually try to unwind by pouring yourself a beer or a wine. This may help you to relax, but have you found that once you do that it’s so much harder to do everything else? And once you’re on the couch having a drink, how difficult is it to get back up again?
What if you spent a few nights each week breaking out of the habit and spending some time playing with the kids, gardening outside, going for a run – whatever you choose! And while you’re at it why not turn off the tv as well – you’ll be amazed at how much extra time you can find. Not only this, but the spare time you do have will be made more productive because you’re not feeling so sleepy from alcohol – so it’s a double win. And as you increase your exercise and natural relaxation, the process becomes even more effective.
Don’t forget too, without alcohol your sleep can be more refreshing; perhaps you’ll need less of it and be able to get up that little bit earlier, which reclaims even more time.
But don’t take our word for it – download the Alcohol Cutdown Coach app, set a number of days per week that you want to test the theory out and go for it today!
]]>http://alcoholcutdowncoach.com/reasons-you-should-download-the-alcohol-cutdown-coach-app-reason-3/feed/0Reasons you should download the Alcohol Cutdown Coach app. Reason # 2http://alcoholcutdowncoach.com/reasons-you-should-download-the-alcohol-cutdown-coach-app-reason-2/
http://alcoholcutdowncoach.com/reasons-you-should-download-the-alcohol-cutdown-coach-app-reason-2/#respondWed, 22 Apr 2015 05:11:04 +0000http://alcoholcutdowncoach.com/?p=61Continue reading →]]>Reason # 2: You are spending more money than you would like on alcohol.
Unless you’re growing a beer tree at your house, chances are if you drink alcohol, then that alcohol is costing you money. And because alcohol consumption can become such a habit for some, that money can really add up over time. So now you can see what people mean when they talk about peeing their money up against the wall!! Why not do a little experiement and write down how much you think you drink on average, on the days that you consume alcohol. Then have a think about what that is costing you each time and write that figure down. Now, bear in mind that every time you have an extra AFD (i.e. when you deliberately, and in conjunction with the Alcohol Cutdown Coach app, refrain from drinking any alcohol on a day that you otherwise might have opted to drink), that amount on average is roughly what you could be saving each time!!
When you download the Alcohol Cutdown Coach app, don’t forget to use the customise feature – that will let you input all the information we’ve just mentioned above and the app will help you to keep track of the money you’re saving. And of course if you have a particular goal in mind (i.e. saving enough money to pay for a holiday, or enough to finance a particular gift to yourself), that will give you all the more motivation to stick to your goals. And then you really will have something tangible to show for all your hard work!
]]>http://alcoholcutdowncoach.com/reasons-you-should-download-the-alcohol-cutdown-coach-app-reason-2/feed/0Reasons you should download the Alcohol Cutdown Coach app. Reason #1http://alcoholcutdowncoach.com/reasons-you-should-download-the-alcohol-cutdown-coach-app/
http://alcoholcutdowncoach.com/reasons-you-should-download-the-alcohol-cutdown-coach-app/#respondTue, 21 Apr 2015 02:59:31 +0000http://alcoholcutdowncoach.com/?p=58Continue reading →]]>Hi there, beginning today we are going to make a series of posts about why it might be a great idea for you to cut down on your alcohol consumption and increase your Alcohol Free Days.
Of course most of these also double as reasons why you should download the Alcohol Cutdown Coach app and start using it today…. There are a multitude of reasons why this app could help you to change your life, so be sure to stay tuned to these posts!!!
Reason #1 : You are frequently hung over.
Many of us know how it feels like to wake up with a terrible hangover. This awful feeling is often accompanied by confusion about the events of the night before, as well as guilt and remorse. And of course it’s just so difficult to get much else done when you feel weak and debilitated. Did you stay out late on a Friday night and spend all day Saturday feeling sick? That’s HALF YOUR WEEKEND GONE – what a waste!!
Have you ever woken up in this state and said to yourself: “Never again”?! Perhaps you actually followed through on this for a time as well. But for how long did you stick to your promise? If you really want to reduce the amount of time that you are spending hung over (and simultaneously reap all of the other benefits associated with drinking less), it’s important to have a plan, and to stick to it. And of course sticking to it means monitoring your progress as you go. Starting today, why not pick a number of AFDs that you want to achieve and use our app to help you achieve this – spending less time hung over could be one of the many resulting benefits!
A new app released this month for iPhone and iPad assists users to track and increase the regularity of their Alcohol Free Days (AFDs) and to improve their health.
April, 2015 – available now in the App Store, Alcohol Cutdown Coach is designed for people looking to improve their lifestyle, bank balance and calorie intake by introducing or maintaining alcohol free days into their usual routine. It’s a way to set alcohol free day goals for yourself and track them (with the help of reminders) in a fun and motivating way.
Users select a date range and nominate the number of AFDs that they wish to achieve. They then track their AFDs with daily reminders appearing on their device. Over time the app provides a graphical summary of how the user is performing. Users can also input their own drinking habits, allowing the app to provide further statistics such as calories and money saved.
“Both my husband and myself were looking for a fun challenge to help us become more energised, lose weight and save money”, says co-developer Vanessa. “We’d tried abstaining over certain months, such as ‘Feb Fast’ and ‘Dry July’, which was great, but these didn’t really modify our lifestyle choices long term. Likewise, setting a hard and fast rule such as “no drinking from Monday to Friday” is so rigid it gets difficult to maintain. We wanted a tool to help us to look at our long term habits, then set and track goals to improve them. Plus we wanted the flexibility to pick and choose which days to abstain and when we could have an occasional drink…. This app is the result.”
Alcohol Cutdown Coach is currently available in most countries worldwide for iPhone and iPad. It costs $0.99 in the US and is priced accordingly in other regions. Age restrictions apply. For further information, search for Alcohol Cutdown Coach in the App Store, or visit alcoholcutdowncoach.com.
Developed by Dell ‘Aquila Road Pty Ltd in Melbourne Australia.
###
]]>http://alcoholcutdowncoach.com/press-release/feed/0Alcohol Cutdown Coach app published for iPhone and iPadhttp://alcoholcutdowncoach.com/alcohol-cutdown-coach-ios-app-published/
http://alcoholcutdowncoach.com/alcohol-cutdown-coach-ios-app-published/#respondTue, 17 Mar 2015 01:59:42 +0000http://alcoholcutdowncoach.com/?p=25Great news, the Alcohol Cutdown Coach app is now available for download for iPhone and iPad!!
If you’re looking for a fun and simple way to cut down your drinking, this app could be a great way to start.
]]>http://alcoholcutdowncoach.com/alcohol-cutdown-coach-ios-app-published/feed/0Welcomehttp://alcoholcutdowncoach.com/wordpress-resources-at-siteground/
http://alcoholcutdowncoach.com/wordpress-resources-at-siteground/#commentsTue, 30 Dec 2014 02:40:40 +0000Continue reading →]]>Welcome, and thank you for visiting the Alcohol Cutdown Coach Website. Here you will find information relating to the Alcohol Cutdown Coach app. In future we will also be providing some facts, stories and testimonials that we thought might be relevant and interesting to those of you who have downloaded the app or are considering doing so, as well as anybody who is interested in issues related to alcohol consumption and cutting down.
]]>http://alcoholcutdowncoach.com/wordpress-resources-at-siteground/feed/4
|
{
"pile_set_name": "Pile-CC"
}
|
Coincident
In geometry, two points are called coincident when they are actually the same point as each other. The same word has also been used more generally for other forms of incidence or special position between geometric objects.
References
Category:Euclidean geometry
|
{
"pile_set_name": "Wikipedia (en)"
}
|
[Stabilization double osteotomy of the knee].
Stabilization osteotomy of the knee is a single or double 1-stage osteotomy done to correct ligamentous deficiency of the knee. The concept of stabilization osteotomy depends on the residual ligamentous and capsular tissues which envelope the circumference of the joint. The technique relies on open wedge osteotomy to restore alignment of the joint. Satisfactory results in 6 patients who underwent stabilization osteotomy as a salvage procedure during the past 5 years encouraged us to publish the principles of this concept.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Open Space and Regional Parks Commission
The Parks Commission acts in an advisory capacity to the Board of County Commissioners. Examples of items that come before the Board include District and Park Master Plans; schedule of priorities for acquisition and development of park property; purchase, lease or exchange of lands for recreation or park purposes; and rates and charges for services and facility use.
Membership
The Commission is comprised of nine at-large members appointed by the County Commission for a four-year term. Members can serve two consecutive four-year terms.
Authority
Nevada Revised Statute 244.308
Meeting Schedule
The Commission meets monthly in Commission Chambers, usually on the first Tuesday, at 2:30 p.m., with a minimum of nine meetings annually. Members receive no compensation.
|
{
"pile_set_name": "Pile-CC"
}
|
IN THE COURT OF APPEALS OF TENNESSEE
WESTERN SECTION AT KNOXVILLE
________________________________________________ FILED
TAMMY RUSHING GREENE,
April 9, 1996
Plaintiff-Appellant,
Monroe Circuit #6455 Cecil Crowson, Jr.
Vs. C.A. No. 03A01-9503-CV-00091 C ourt Clerk
Appellate
BRYAN LYNN GREENE,
Defendant-Appellee.
___________________________________________________________________________
FROM THE MONROE COUNTY CIRCUIT COURT
THE HONORABLE JAMES C. WITT, JUDGE
John W. Cleveland, Cleveland & Cleveland
of Sweetwart, for Appellant
William A. Buckley, Jr., of Athens
For Appellee
REVERSED AND REMANDED
Opinion filed:
W. FRANK CRAWFORD,
PRESIDING JUDGE,W.S.
CONCUR:
ALAN E. HIGHERS, JUDGE
DAVID R. FARMER, JUDGE
This is a child custody case. Bryan L. Greene (Father) and Tammy Rushing Greene, now
Harris (Mother), were divorced by decree entered June 2, 1988. The decree incorporated a prior
Marital Dissolution Agreement, which granted custody of the parties' minor child, Sara Ann
Greene, to Mother, with liberal visitation rights to Father. On September 15, 1994, Father filed
a petition seeking custody, alleging a material change in circumstances. After an evidentiary
hearing on March 10, 1995, the trial court granted Father's Petition for Change of Custody. 1
Mother has appealed, and the only issue is whether the trial court erred in ordering a change of
custody.
Sara Ann Greene was born in August of 1986. Since the time of the parties' separation
in April of 1987, Sara has resided with Mother or with Mother's parents. Prior to the present
proceeding, Father exercised his visitation rights approximately 50% of the time and generally
paid child support payments in a timely fashion. There was testimony at trial that Sara has a
good relationship with both parents.
Sara's current teacher at Sweetwater Elementary School, Cleo Davis, testified that Sara
is a good, well-behaved student who shows continued, steady growth in her school work. She
testified that Sara is like "any other third-grader." However, there was evidence that Sara had
been absent from school frequently, missing 32 of 180 days in the second grade. Mother
testified that Sara's absences were generally caused by colds, and she also missed ten days of
school because of chicken pox.
Dr. Tom Hanaway, a clinical psychologist who performs forensic evaluations for courts
in custody matters, met with Sara twice. He also met with Sara's mother, father, maternal
grandmother, and talked to two of Sara's school teachers. He testified that Sara is very bonded
to her mother, and that she expressed a strong desire to continue living with Mother. Dr.
Hanaway found Sara to be a bright, well-adjusted child who did not exhibit signs of
psychological problems.
Father is a 29 year old resident of Kingsport, Tennessee. He works part-time for Wells
Fargo and part-time on his family's farm. Father admitted on cross-examination that he has had
numerous jobs since the parties' divorce. Although Father receives no compensation for working
on the farm, he lives in his parents' home, has his meals there, and receives some financial
support from the elder Greenes. Father testified that if he is awarded custody, he will continue
1
This Court granted Mother’s Motion for Stay Pending Appeal, pursuant to T.R.A.P. 7.
2
to live with his parents in this four bedroom home. Mrs. Greene will take care of Sara when
Father is at work.
As evidence of changed circumstances affecting Sara's welfare, Father asserts that Mother
has changed her residence approximately five times since the parties' 1988 divorce. Father
testified that Mother has had several boyfriends. There was evidence that at least one boyfriend,
Tony Harris, whom Mother later married, lived with Mother and Sara outside of wedlock. Both
Mother's second and third marriages failed.2 Father admitted that Sara had adequate housing and
food. Although Father has never met or talked with Sara’s teachers, he stated that her education
was neglected during the first and second grades.
Trina Johnson, Mother's first cousin, testified on behalf of Father. She testified that
Mother lived with David Thompson, whom Mother did not marry, in 1988, and that Father was
aware of this living situation. (Mother denied living with Thompson.) Trina also stated that,
during the period Mother was involved with Thompson, Trina saw Mother and Thompson at a
convenience store, without Sara. Trina, concerned about Sara's welfare, immediately went to
Mother's apartment. Trina testified that she heard crying inside the apartment, but that no one
came to the door when she knocked. Trina waited at the apartment, hidden, until Mother and
Thompson returned, approximately thirty minutes later. Trina also testified that on one occasion
in 1992, when she went to Mother's house, at Mother's request, to pick up Sara, she noted that
the apartment was a mess and there was no food in the house. Trina also testified that when
Mother moved out of a house owned by Mother and Trina's great-grandmother, Dovie Rushing,
Mother left the house in complete disarray. This testimony was contradicted by Jane Moser,
Sara's maternal grandmother.
Dovie Rushing, Mother's grandmother, also testified on Father's behalf. Mrs. Rushing,
who lives in Sweetwater, has a close relationship with Sara and has kept her frequently since
Sara was a small child. She testified that although Sara always had adequate food, clothing, and
2
Mother's third marriage, to Neil Turner, took place on February 1, 1994. The ceremony
was performed by Fay Tennyson, a former County Commissioner. Mother testified that she
believed she was married, but later discovered that the marriage certificate had not been returned
to the county clerk's office, shedding doubt on the validity of the marriage. Regardless, Mother
ended her relationship with Turner prior to her discovery that the marriage might not be valid.
3
housing, Mother was a “poor housekeeper” and had not given Sara “the best of care.”
Mr. Robert Greene, Sara's paternal grandfather, testified on behalf on his son. He
testified that Sara would be welcome in his home in Kingsport. He also stated that he did not
harbor any bad feelings against Mother.
Mother testified that a change of custody would not be in Sara's best interest. However,
she testified that she has always encouraged, and continues to encourage, her daughter's
relationship with Father. After the parties' divorce, Mother lived in public housing for two years.
Mother and Sara then moved to a house owned by one of Mother's aunts in Athens, where they
lived for one year. Mother testified that she and Sara moved to Athens because Mother was
unhappy with Sara's school in Sweetwater, which was experimenting with a "non-traditional"
classroom. Mother and Sara next moved to Knoxville in order for Mother to attend the
University of Tennessee. Mother and Sara lived there for one semester, but returned to Mother's
parent's home in Sweetwater because Mother had to undergo major surgery. After Mother
recuperated, Mother and Sara moved to a house in Sweetwater owned by Mother's grandmother.
After leaving that house, Mother and Sara lived in an apartment in Sweetwater, near Mother's
parents' home. When Mother married Turner in spring of 1994, they moved briefly to Tellico
(however, Sara continued to attend school in Sweetwater). At the time of trial, Mother and Sara
were living with Mother's parents in Sweetwater.
Questions regarding custody first arose in May of 1994, when Mother checked herself
into a psychiatric hospital in Chattanooga. Mother, who suffers from chronic depression, felt
that it would be in the best interest of Sara and Katie, a daughter from Mother's marriage to Tony
Harris, to spend time with their respective fathers while she recovered. Mother contacted Sara's
father and Kate's father to suggest a joint custody arrangement. Kate's father, Harris, agreed to
joint custody; Sara's father demanded sole custody, which Mother refused to grant. In September
of 1994, Mother checked herself into a psychiatric hospital in Knoxville. Currently, Mother
meets with a counselor every two weeks. She testified without contradiction that her medication
for depression has stabilized and she is doing well. She feels that she is capable, with the
assistance of her extended family when needed, of providing for all of Sara's needs.
Jane Moser testified on behalf of her daughter. Mrs. Moser keeps Sara frequently. Mrs.
4
Moser stated that Mother is a very good housekeeper. Mrs. Moser corroborated Mother's
testimony that Mother never lived with Thompson. Mrs. Moser stated that she had never noticed
that Mother's problems with depression affected either of Mother's children, and it is her
observation Mrs. Moser stated that Mother is a loving parent who has always provided
adequately for Sara.
At the close of all the testimony, the trial court stated from the bench:
It looks to me like that there's two groups of family
members, some up in Kingsport and some down here around
Sweetwater, generally speaking. And there are-- both families
love this little girl . . . . And for the most part both families have
been respectful people.
But I don't believe that the actions of the mama have been
particularly conducive to the raising of the child. Now, there was
some proof . . . about her living with a man or two. I think that
I heard proof that she lived with Turner several months before
they were married . . . If she wasn't living with him, it was
awfully close to it.
****
And I'm going to rule, and it is my ruling, that the
defendant, that would be the petitioner I guess, Greene, will have
custody of the child.
Now, you all, I think--and it's also my ruling that this lady
will have liberal visitation rights. But I don't think she ought to
be around that child at times when she's experiencing these deep
depressions. You know, that's not conducive to raising of the
child, is to be in the depression part of the time. And it's not
conducive to raising the child to live with somebody or --before
you marry them.
****
What I am trying to look at is 10 years from now or 20
years form now, which one, looking back, would have most likely
give [sic] this girl a college education, a profession, the
opportunity to meet and marry first-class people that would be
good for her and good for her future family and so forth.
Our review of the findings of fact of the lower court is de novo upon the record,
accompanied by a presumption of the correctness of the trial court's findings. Unless we find
that the evidence preponderates against these findings, we must affirm, absent error of law.
T.R.A.P. 13(d); Nichols v. Nichols, 792 S.W.2d 713, 716 (Tenn. 1990).
The doctrine of res judicata bars a second suit between the same parties on the same
cause of action with respect to all issues which were or which could have been litigated in the
5
former suit. Wall v. Wall, 907 S.W.2d 829, 832 (Tenn. App. 1995). Thus, a custody order
cannot be changed absent a showing of new facts, or "changed circumstances," which require
an alteration of the original custody award. Woodard v. Woodard, 783 S.W.2d 188, 189 (Tenn.
App. 1989).
Child custody cases present primarily factual, not legal questions. Rogero v. Pitt, 759
S.W.2d 109, 112 (Tenn. 1988). Although there are no hard and fast rules as to what constitutes
"changed circumstances," Arnold v. Arnold, 774 S.W.2d 613, 618 (Tenn. App. 1989), it is well
settled that the best interest of the child is the paramount consideration in a child custody case.
Contreras v. Ward, 831 S.W.2d 288, 289 (Tenn. App. 1991). The party seeking a change in
custody has the burden of proving by the preponderance of the evidence that a change in custody
is in the child's best interest. Musselman v. Acuff, 826 S.W.2d 920, 922 (Tenn. Ct. App. 1991).
In considering whether or not changed circumstances exist, we find the statement of the Wall
court instructive:
When two people join in conceiving a child, they select that
child's natural parents. When they decide to separate and divorce,
they give up the privilege of jointly rearing the child, and the
divorce court must decide which parent will have primary
responsibility for rearing the child. This decision of the Court is
not changeable except for "change of circumstances" which is
defined as that which requires a change to prevent substantial
harm to the child. Custody is not changed for the welfare or
pleasure of either parent or to punish either parent, but to preserve
the welfare of the child. Custody is not changed because one
parent is able to furnish a more commodious or pleasant
environment than the other, but where continuation of the
adjudicated custody will substantially harm the child.
Id. 907 S.W.2d at 834.
In the instant case, we cannot agree with the lower court's determination that there has
been a change in circumstances which warrants changing Sara Greene's custody. While there
was evidence that Mother has moved frequently and has been involved in several unsuccessful
relationships, neither a parent's remarriage nor a parent's sexual indiscretion are, per se, grounds
for a change in custody. See, e.g. Mimms v. Mimms, 780 S.W.2d 739, 745 (Tenn. App. 1989);
Arnold, 774 S.W.2d at 618; Curry v. Curry, 416 S.W.2d 372, 377 (Tenn. App. 1967). There
was no evidence that Sara has been harmed either by Mother's moves or by Mother's romantic
involvements. Additionally, there is no evidence that Mother's experiences with depression
6
have had a negative effect on Sara's welfare. Mother testified at trial, without contradiction, that
her depression is under control through medication and counseling. Both Sara's teacher and Dr.
Hanaway testified that Sara was a well-adjusted child who exhibited no behavioral problems.
Neither Father nor any of the witnesses who testified on his behalf stated that Sara lacked food,
shelter, or clothing. Although both Mother and Father have good relationships with Sara,
neither relationship is flawless.3 However, Sara has been in her mother's custody for her entire
life. Sara expressed a desire to both the lower court and to Dr. Hanaway to remain in her
mother's custody. While the preference of an eight year old child is not binding upon this Court,
it is a factor which we may consider. T.C.A. § 36-6-102(b) (Michie 1991). Absent a threat to
Sara's welfare, we find her close relationship with Mother and Mother's extended family in
Sweetwater to be significant. In Contreras, this Court emphasized the importance of stability
in a child's life:
The stability provided by the continuation of a successful
relationship with a parent who has been in day to day contact with
a child generally far outweighs any alleged advantage which
might accrue to the child as a result of custodial change. In short,
when all goes well with children, stability, not change, is in their
best interests.
Id., 831 S.W.2d at 290.
Our review of the record reveals no change in circumstances which threatens to cause
substantial harm to Sara's welfare. Accordingly, the judgment of the trial court is reversed, and
the case is remanded for such further proceedings as are necessary. Costs on appeal are taxed
to the appellee.
_________________________________
W. FRANK CRAWFORD,
PRESIDING JUDGE, W.S.
CONCUR:
_________________________________
ALAN E. HIGHERS, JUDGE
3
This Court does not look lightly upon the fact that Father violated the trial court's
original custody order by refusing to return Sara to her mother's custody at the end of a scheduled
visit which began September 16, 1994. Although Mother's actions have not always reflected
good judgment, this action on the part of Father shows a clear lack of responsibility.
7
_________________________________
DAVID R. FARMER, JUDGE
8
|
{
"pile_set_name": "FreeLaw"
}
|
In today's episode of Pick your Poison we'll take a brief look at popular options for dealing with Internet Explorer's rendering issues, glitches, and bugs. Basically, it's all about feeding specific versions of IE version specific property/value pairs which happen to yield the desired result(s).
I say "happen", because those pairs are always complete nonsense and they will usually break the layout in horrible ways if a sane browser were to interpret them. Well, we aren't talking about sane browsers today, but we need to make sure that we won't get in their way with these questionable and awkward workarounds.
If you're already familiar with these concepts, you can jump right to "The Small Twist" at the bottom of this article.
I always wondered why browsers don't support any lossy 32bit image format. With opaque images you can always pick a suitable image format, which will be reasonably small while looking reasonably good. There are always some trade-offs, but that's alright.
If it's photo-based (or just a plain photo), JPG is a great choice. If there are less than 257 colors a PNG8 will work great. If it's also very tiny (like a 1x13 gradient) a GIF might be even a tad smaller than a PNG8. If there are only a few thousand colors and little noise (i.e. there are large areas filled with a solid color), a PNG24 should work great.
Now, if you throw alpha channels into the mix, things become a bit annoying. PNG8 and GIF support so called "bitmask transparency", which marks one specific color as fully translucent. PNG8 actually supports one transparency value per palette entry. This means it's effectively like an RGBA palette with up to 256 values. This option is somewhat less well-known and the support by most tools is also somewhat lacking.
You can quantize and dither PNG32 images with pngquant and pngnq. PNGOUT will also create this kind of PNG, but only if there are less than 257 colors to begin with.
So, this area is covered pretty well by current browsers. However, once you need a "few" more colors, you'll run out of options. There is only PNG32 and – as we all know – PNG is a poor choice for photo-based images. Well, of course it will look perfect (it's lossless after all), but it will be prohibitively huge.
Lossy RGBA images are something that always has been missing on the web (If you ignore Mozilla's brief support of JNG, that is). Nowadays, browsers typically support JPG, PNG, GIF, ICO, and BMP. There is obviously some feature overlap, but there isn't any good choice for true color images which also happen to use alpha.
Generally your choices boil down to JPG and PNG. If you ignore animated GIFs (which are pretty useless for Canvas usage), PNG can easily replace GIF, ICO, and of course BMP.
Today, I'll demonstrate how you can create RGBA images which use JPG for the RGB channels. Since this can decrease the file size up to 75%, it's a very easy and intriguing way to speed up the loading time of your game or application. (If you are currently using heavy PNG32 images, that is.)
Update: This whole thing has been superseded with a more uniform and rigid concept. You can check an early draft outline over at the OOCSS Google Group.
There is no coupling whatsoever between your CSS and your markup. But don't get me wrong – this is a very good thing. However, this also means you can't use your markup to verify your CSS and of course it also means that you can't use your CSS to check your markup.
If you create a relatively complex website with more than 2000 lines of CSS this gets pretty annoying. With practice this just gets more annoying, since the impact on your productivity becomes more apparent with each project. During a site's lifetime you'll often notice how theoretically solid structures start to crumble. One mistake in the markup, another one in the CSS, and sooner or later everything will be in a somewhat inconsistent state.
If you come from a programming background this feels just plain wrong. It's almost like your selectors happen to coincidentally select some things here and there. There is no clear way to define a structure and to check if your markup and CSS adhere to your rules. There is currently only one way to check it: the dreaded, time-consuming, and error-prone manual one.
Also, if things are inconsistent – and chances are this happens right off the bat – it's very difficult to reason about it. You might look at two pieces of markup and their corresponding CSS and both might wrong in different places. Sure, you can just refer to your documentation… eh, yea, who am I kidding? No one knows how stuff like that is supposed to be documented. And if they do, it probably still won't happen.
Generally speaking: off-screen rendering allows you to cache expensive drawing operations in some sort of image, texture, or buffer. With the new Canvas API the vector drawing operations for example can be a bit taxing. Same goes for gradients or patterns (Firefox 3.x). Or well, anything that requires many drawing steps or per-pixel calculations.
If you have used any other 2D drawing API in the past, you'll probably picture this a bit more complicated than it actually needs to be. As it turns out, it's surprisingly easy with Canvas since the drawImage function can also take another Canvas as parameter. So, there is no need to construct an actual image – you already got one, kinda.
Komodo Edit – the open source spin-off of Komodo IDE – is hands down my personal open source application of the year. It had a massive impact on my productivity and it made web development so much less of a pain.
I used so many different text editors in my life, but none of them comes anywhere near the sheer awesomeness of Komodo. There is proper Unicode support, smart indent (which actually behaves smart), remote file editing (FTP, FTPS, SFTP, and SCP), Code Intelligence (~IntelliSense™), and lots of polish on top. It supports many languages and runs on the three most popular platforms (i.e. Windows, Mac OS, and Linux). It's also extremely stable, which is very important for this kind of tools.
The ActiveState guys are also very helpful and surprisingly responsive. For example there were some issues with active mode FTP, but after a bit of nagging and poking around in the code (mostly nagging though) the problem was solved. Just like that. I also asked for some shortcut which basically does the same as a double click; selecting the word below the caret. A few minutes later the JavaScript macro was there (thanks Todd!) and it even made it's way upstream; the next version of Komodo will include it as a regular command.
I really like standards and absolute strictness when it comes to things which are interpreted by zillions of different programs. After all, a scenario like this just asks for trouble. Validators do help there and as I wrote a few months ago they can really help you avoid many issues, potential issues, and also future issues.
However, I do like automation a bit more and herein lies the problem: 100% standards compliance isn't always an attainable goal. And if you simply can't get a perfect score, you cannot use those validators for your automated tests. A test which always fails isn't really helpful.
There are many things, which never will be valid and you can't do anything about it. Proprietary or legacy content management systems and components thereof are a good example. Another source of pain are those bloody rich text editors. Some of them produce amazingly awkward markup with zillions of font tags all over the place for good measure.
In a nutshell: A static initializer is executed whenever you do anything with that class. It's executed before whatever you wanted to do (e.g. calling the constructor or accessing a field). It's also only executed once.
Many moons ago I released some code which utilized a static initializer. That code worked fine back then, but recent versions of the Flex SDK compiler don't really like it. Well, to tell the truth I also didn't like it, because the construct I used was sorta ugly and, well, pretty wrong.
Update: Good news, everyone! A proper proposal for this kind of thing is already on its way. :)
CSS sprites are a nuisance
While CSS sprites offer nice performance benefits (less connections/overhead), they are troublesome in every respect. Putting lots of tiny images with different dimensions into one bigger image is fiddly and very hard – np-hard in fact. But that's the smallest issue. It doesn't need to be perfect after all. Deflate will happily squish all that extraneous white-space to virtually nothing.
One of the real problems is CSS. It just isn't flexible enough to let you do everything you might want to do with your sprite sheet. For example repeating parts of the image isn't possible. And if you want to display a sub region of an image in the upper right of some element, it only works if that sub region is in the lower left of the sprite sheet. So, the best thing you can do is to use elements in the size of the sub region and use background-position to slide the image around, but that usually means extra markup for something that should be very simple.
But it doesn't stop there. The real nightmare is maintenance. A year or two and several iterations later it becomes very hard to figure out which parts of the sheet are used. Where can you add one? Which one can be removed? How many places do you have to fix if you move this column a bit up? It all becomes a mess of fuzzy uncertainty.
CSS sprites are a huge time sink. They waste my time, they waste your time, and they also waste the time of millions of other front-end developers. It's about time to do something about it.
About a week ago a friend of mine released his very first indie game – for the iPhone of all platforms. Sounds like a bit of a pain and probably it actually was. The game is basically a bigger and better version of one of his old games. The old one was written in C++ for Win32 (the source is also available over there). Later on he also ported it over to the GBA.
The new version looks and sounds pretty cool. If you're interested check out the video over at the official site. By the way, all models were done with everyone's favorite box modeler Wings3D. And the final audio cutting was done in Audacity. Both tools are mind-boggling awesome for these tasks. Check them out if you haven't yet.
Well, about a week has passed and he only sold a dozen copies so far. In the meantime it was pirated a few thousand times. Ouch. So, if you got $2.99 to burn (and an iPhone to boot) you can make one poor student very happy.
|
{
"pile_set_name": "Pile-CC"
}
|
import { run } from '@ember/runloop';
import { module, test } from 'qunit';
import { setupRenderingTest } from 'ember-qunit';
import { render } from '@ember/test-helpers';
import setupStyles from '../helpers/render-with-styles';
module('Integration | Changing local classes', function(hooks) {
setupRenderingTest(hooks);
test('changing a dynamic class value works', async function(assert) {
const hbs = setupStyles({
foo: '--foo',
bar: '--bar',
baz: '--baz'
});
this.set('extraClass', 'bar');
await render(hbs`<div data-test-element class="global" local-class="foo {{extraClass}}"></div>`);
assert.dom('[data-test-element]').hasAttribute('class', 'global --foo --bar');
run(() => this.set('extraClass', 'baz'));
assert.dom('[data-test-element]').hasAttribute('class', 'global --foo --baz');
run(() => this.set('extraClass', 'qux'));
assert.dom('[data-test-element]').hasAttribute('class', 'global --foo');
});
});
|
{
"pile_set_name": "Github"
}
|
Introduction {#s0001}
============
The cellular injury caused by oxidative stress and excess of free radicals such as reactive oxygen species has been associated with ageing and great number of clinical disorders including age-associated disorders such as neurodegenerative diseases. For example, Parkinson\'s disease, which is the second most common neurodegenerative disorder after Alzheimer\'s disease (AD), has been linked to increased levels of oxidative stress.\[[@cit0001]\] Also oxidative stress has been postulated to have an important role in the pathogenesis of schizophrenia, bipolar disorder and major depression.\[[@cit0003]\] It is also discussed, that the radical production and lipid peroxidation are involved in the pathogenesis of other diseases, including atherosclerosis, cardiac and cerebral ischemia, carcinogenesis, diabetes, alcohol induced liver disease, ulcerative colitis and rheumatic disorders.\[[@cit0005]\]
Antioxidant-based drugs and formulations for the prevention and treatment of complex diseases like atherosclerosis, stroke, diabetes, AD, cancer and some psychiatric disorders have appeared during the last decades.\[[@cit0008]\] This has attracted a great deal of research interest in the field of antioxidants.
Piperazine nucleus is one of the most important heterocycles exhibiting remarkable pharmacological activities. Piperazine is consisting of a six-membered ring containing two opposing nitrogen atoms. Slight change in substitution pattern in piperazine nucleus causes distinguishable difference in their pharmacological activities, such as antipsychotic, anticonvulsant, antiarrhythmic, antimicrobial, antimalarial, citotoxic and antioxidant effects.\[[@cit0010]\]
Thus, in this study some new aryl/aralkyl substituted piperazine derivatives, containing methylxanthine moiety were synthesized and their antioxidant activity was established.
Materials and methods {#s0002}
=====================
Materials {#s0002-0001}
---------
Synthetic grade chemicals procured from Acros organics, Belgium, were used for the synthesis of the target compounds, as received. Non-commercially available intermediates required for the synthesis of novel derivatives of arylpiperazine were prepared according to the literature procedures without modifications: 1-(3-iodopropyl)-3,7-dimethylxanthine.\[[@cit0013]\] The completion of reactions and the purity of the final products was monitored and confirmed through thin layer chromatography (TLC) using Kieselgel 60 F~254~ plates (Merck) and solvent system: ethanol:chloroform:acetone (4:3:3 ). The spots were detected at UV~254~ nm.
The reagents: 2,2′-Diphenyl-1-picrylhydrazyl (DPPH), 2,2′-azinobis-(3-ethylbenzo thiazine-6-sulfonic acid) (ABTS), sulfanilamide, 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox), 2,4,6-tripyridyl-s-triazine (TPTZ), ferric chloride × 6H~2~O, sodium acetate and potassium persulphate were purchased from Sigma-Aldrich. All the other chemicals including the solvents were of analytical grade.
Apparatus {#s0002-0002}
---------
Melting points were determined on an electrothermal apparatus (Büchi 535, Switzerland) in an open capillary tube and are not corrected. The IR spectra 400--4000 cm^−1^ were recorded on an FT-IR Nicolet iS10 spectrophotometer (Thermo Scientific, USA). The ^1^H NMR spectra were measured on a Bruker Avance DRX 250 (250 MHz) spectrometer (Germany). ^1^H NMR spectra were measured for approximately 0.03 mol/L while using CDCl~3~ and D~2~O as solvents and chemical shifts, and were expressed as δ values in ppm against TMS as an internal standard. All names were generated by using structure-to-name and name-to-structure algorithms included with ChemBioDraw Ultra 11.0 (CambridgeSoft). Antioxidant assays were carried out using a Shimadzu UV-1203 spectrophotometer (Japan).
Synthetic procedures for obtaining of the target compounds 3a--f {#s0002-0003}
----------------------------------------------------------------
### General procedure {#s0002-0003-0001}
A mixture of 1-(3-iodopropyl)-3,7-dimethyl-1H-purine-2,6(3H,7H)-dione (1, 1 mmol), the appropriate 1-substituted piperazine (2a--f, 1 mmol) and triethylamine (1 mmol) in acetone (10 mL) was refluxed till exhaustion of the starting products. The progress of the reaction was monitored by TLC. Then the acetone was evaporated to dryness. The reaction mixture was cooled overnight if it was necessary. The precipitated crude product was filtered off and purified by recrystallization from *i*-propanol.
### 1-(3-(4-benzylpiperazin-1-yl)propyl)-3,7-dimethyl-1H-purine-2,6(3H,7H)-dione (3a) {#s0002-0003-0002}
Reaction time 10 hours. Yield: 77%, melting point (m.p.) 191--193 °C, Rf = 0.45, IR: 3070 (CH aromatic), 2911--2833 (CH~3~ and CH~2~), 1702 (CO xanthine), 1654 (CO xanthine), 1602 (C = N xanthine), 1552 (C = C xanthine), 762 (mono-substituted aromatic ring), ^1^H--NMR (CDCl~3~, δ, ppm): 7.54 (s, 1H, C^8^--[H]{.ul}); 7.36--7.37 (m, 4H, aromatic ring); 7.27 (bs, 1H, aromatic ring); 4.09 (t, 2H, N^1^(xanthine)--[CH~2~]{.ul}); 3.98 (s, 3H, N^7^--[CH~3~]{.ul}); 3.84 (bs, 2H, N^1^(piperazine)--[CH~2~]{.ul}); 3.56 (s, 3H, N^3^--[CH~3~]{.ul}); 3.03 (bs, 8H, piperazine); 2.17 (s, 2H, N^1^(xanthine)--CH~2~--[CH~2~)]{.ul}, 1.26, 1.22 (d, 2H, CH~2~--N^1^(piperazine), J = 8.43 Hz).
### 1-(3-(4-(4-fluorophenyl)piperazin-1-yl)propyl)-3,7-dimethyl-1H-purine-2,6 (3H,7H)-dione (3b) {#s0002-0003-0003}
Reaction time 10 hours. Yield: 67%, m.p. 156--158 °C, Rf = 0.64, IR: 3054 (CH aromatic), 2966--2817 (CH~3~ and CH~2~), 1709 (CO xanthine), 1651 (CO xanthine), 1604 (C = N xanthine), 1577 (C = C xanthine), 1143 (C--F), 820 (1,4-disubstituted aromatic ring), ^1^H--NMR (CDCl~3~, δ, ppm): 7.51 (s, 1H, C^8^--[H]{.ul}); 6.96 (t, 2H, aromatic ring); 6.85--6.88 (m, 2H, aromatic ring); 4.10 (t, 2H, N^1^(xanthine)--[CH~2~]{.ul}); 3.99 (s, 3H, N^7^--[CH~3~]{.ul}); 3.58 (s, 3H, N^3^--[CH~3~]{.ul}); 3.11 (s, 4H, piperazine); 2.63 (s, 4H, piperazine); 2.54 (bs, 2H, [CH~2~]{.ul}--N^1^ piperazine[)]{.ul}, 1.41 ( t, 2H, N^1^(xanthine)--CH~2~--[CH~2~)]{.ul}.
### 1-(3-(4-(4-hydroxyphenyl)piperazin-1-yl)propyl)-3,7-dimethyl-1H-purine-2,6 (3H,7H)-dione (3c) {#s0002-0003-0004}
Reaction time 10 hours. Yield: 93%, m.p. 263--264 °C with decomposition, Rf = 0.43, IR: 3202 (Aryl-OH), 3075 (CH aromatic), 2926--2815 (CH~3~ and CH~2~), 1701 (CO xanthine), 1657 (CO xanthine), 1609 with shoulder 1595 (C˭N xanthine), 1550 (C˭C xanthine), 1359 (δOH), 1186 (C--OH), 828 (1,4-disubstituted aromatic ring), ^1^H--NMR (D~2~O, δ, ppm): 8.39 (s, 1H, OH-aromatic ring) 7.85 (s, 1H, C^8^--[H]{.ul}); 6.97--6.85 (m, 2H, aromatic ring); 6.85--6.88 (m, 2H, aromatic ring); 4.04 (t, 2H, N^1^(xanthine)--[CH~2~]{.ul}); 3.89 (s, 3H, N^7^--[CH~3~]{.ul}); 3.48 (s, 3H, N^3^--[CH~3~]{.ul}); 3.34, 3.28 (d, 8H, piperazine, J = 13.08); 3.13 (s, 2H, N^1^(xanthine)--CH~2~--[CH~2~)]{.ul}, 2.06 (bs, 2H, [CH~2~]{.ul}--N^1^(piperazine[)]{.ul}.
### 1-(3-(4-(2-methoxyphenyl)piperazin-1-yl)propyl)-3,7-dimethyl-1H-purine 2,6 (3H,7H)-dione (3d) {#s0002-0003-0005}
Reaction time 5 hours. Yield: 75%, m.p. 177--179 °C, Rf = 0.56, IR: 3125 (CH aromatic), 2931--2817 (CH~3~ and CH~2~), 2817 (O--CH~3~), 1694 (CO xanthine), 1652 (CO xanthine), 1602 (C˭ N xanthine), 1548 (C˭C xanthine), 1454 (δCH~3~ O--CH~3~), 1154 (C--O--C), 745 (1,2-disubstituted aromatic ring), ^1^H--NMR (CDCl~3~, δ, ppm): 7.50 (s, 1H, C^8^--[H]{.ul}); 7.00--6.97 (m, 1H, aromatic ring); 6.93--6.90 (m, 2H, aromatic ring); 6.86--6.84 (m, 1H, aromatic ring); 4.10 (t, 2H, N^1^(xanthine)--[CH~2~]{.ul}); 3.99 (s, 3H, N^7^--[CH~3~]{.ul}); 3.85 (s, 3H, OCH~3~--aromatic ring); 3.58 (s, 3H, N^3^--[CH~3~]{.ul}); 3.06 (bs, 4H, piperazine); 2.66 (bs, 4H, piperazine); 2.53 (t, 2H, [CH~2~]{.ul}--N^1^(piperazine[)]{.ul}, 1.90 (t, 2H, N^1^(xanthine)--CH~2~--[CH~2~)]{.ul}.
### 1-(3-(4-(4-methoxyphenyl)piperazin-1-yl)propyl)-3,7-dimethyl-1H-purine-2,6(3H,7H)-dione (3e) {#s0002-0003-0006}
Reaction time 13 hours. Yield: 64%, m.p. 154--156 °C, Rf = 0.58, IR: 3120 (CH aromatic), 2946--2813 (CH~3~ and CH~2~), 2813 (O--CH~3~), 1698 (CO xanthine), 1651 (CO xanthine), 1604 (C˭N xanthine), 1548 (C˭C xanthine), 1456 (δCH~3~ O--CH~3~), 1125 (C--O--C), 844 (1,4-disubstituted aromatic ring), ^1^H--NMR (CDCl~3~, δ, ppm): 7.50 (s, 1H, C^8^--[H]{.ul}); 6.90--6.88 (m, 2H, aromatic ring); 6.84--6.82 (m, 2H, aromatic ring); 4.09 (t, 2H, N^1^(xanthine)--[CH~2~]{.ul}); 3.99 (s, 3H, N^7^--[CH~3~]{.ul}); 3.76 (s, 3H, OCH~3~-aromatic ring); 3.58 (s, 3H, N^3^--[CH~3~]{.ul}); 3.06 (bt, 4H, piperazine); 2.62 (bt, 4H, piperazine); 2.52 (t, 2H, [CH~2~]{.ul}--N^1^(piperazine[)]{.ul}, 1.90 ( t, 2H, N^1^(xanthine)--CH~2~--[CH~2~)]{.ul}.
### 1-(3-(4-(bis(4-fluorophenyl)methyl)piperazin-1-yl)propyl)-3,7-dimethyl-1H-purine-2,6 (3H,7H)-dione (3f) {#s0002-0003-0007}
Reaction time 5 hours. Yield: 60%, m.p. 144--146 °C, Rf = 0.74, IR: 3070 (CH aromatic), 2962--2825 (CH~3~ and CH~2~), 1703 (CO xanthine), 1655 (CO xanthine), 1602 (C˭N xanthine), 1551 (C˭C xanthine), 1223 (C--F), 826 (p- di-substituted aromatic ring), ^1^H--NMR (CDCl~3~, δ, ppm): 7.53 (s, 1H, C^8^--[H]{.ul}); 7.35--7.27 (m, 4H, aromatic ring); 7.02--6.93 (m, 4H, aromatic ring); 4.36 (s, 1H, N^1^(piperazine)--C[H]{.ul}); 4.08 (t, 2H, N^1^(xanthine)--[CH~2~]{.ul}); 3.96 (s, 3H, N^7^--[CH~3~]{.ul}); 3.56 (s, 3H, N^3^--[CH~3~]{.ul}); 3.14 (t, 4H, piperazine); 2.94 (bs, 4H, piperazine); 2.33 (t, 2H, [CH~2~]{.ul}--N^1^(piperazine[)]{.ul}, 1.48 (t, 2H, N^1^(xanthine)--CH~2~--[CH~2~)]{.ul}.
Antioxidant assays {#s0002-0004}
------------------
### DPPH radical scavenging activity {#s0002-0004-0001}
Free radical scavenging activity was measured by using the DPPH method.\[[@cit0014]\] Different concentrations (6.25--1000 μmol/L) (400 μL) of compounds in methanol were added to the 400 μL methanol solution of DPPH (0.5 mmol/L). After 30 min incubation at room temperature, their absorptions were read at 517 nm against a control sample containing the methanol solution of DPPH. Percentage of the DPPH radicals scavenged by the studied concentration was calculated according to equation: where Abs~control~ is the absorbance of DPPH radical in methanol, Abs~sample~ is the absorbance of DPPH radical solution mixed with sample.
IC~50~ value (concentration of sample where the absorbance of DPPH decreases 50% with respect to the absorbance of blank) of the sample was determined. Butylated hydroxytoluene (BHT) was used as positive control. All determinations were performed in triplicate (*n* = 3).
### ABTS-radical scavenging assay {#s0002-0004-0002}
For ABTS assay, the procedure followed the method of Arnao et al. \[[@cit0015]\] with some modifications.\[[@cit0014]\] The stock solutions included 7 mmol/L ABTS solution and 2.4 mmol/L potassium persulphate solution. The working solution was then prepared by mixing the two stock solutions in equal quantities and allowing them to react for 14 hours at room temperature in dark. The solution was then diluted by mixing 2 mL ABTS solution with 50 mL methanol to obtain an absorbance of 0.305 ± 0.01 units at 734 nm using a spectrophotometer. A fresh ABTS solution was prepared for each assay. Different concentrations (400 μL) of compounds were allowed to react with 400 μL of the ABTS solution and the absorbance was taken at 734 nm after 5 min. The capability to scavenge the ABTS radical was compared with that of BHT and was calculated using the following equation: where Abs~control~ is the absorbance of ABTS radical in methanol; Abs~sample~ is the absorbance of an ABTS radical solution mixed with sample.
IC~50~ value (concentration of sample where the absorbance of ABTS decreases 50% with respect to the absorbance of blank) of the sample was determined. BHT was used as positive control. All determinations were performed in triplicate (*n* = 3).
### Ferric reducing/antioxidant power (FRAP) {#s0002-0004-0003}
The FRAP assay was done according to the method described by Benzie and Strain \[[@cit0016]\] with some modifications.\[[@cit0014]\] The stock solutions included 300 mmol/L acetate buffer (3.1 g C~2~H~3~NaO~2~ × 3H~2~O and 16 mL C~2~H~4~O~2~), pH 3.6, 10 mmol/L TPTZ solution in 40 mmol/L HCl and 20 mmol/L FeCl~3~ × 6H~2~O solution. The fresh working solution was prepared by mixing 25 mL acetate buffer, 2.5 mL TPTZ solution and 2.5 mL FeCl~3~ × 6H~2~O solution and then warmed at 37 °C before using. 0.15 mL of compound in methanol was allowed to react with 2.8 mL of the FRAP solution for 30 min in the dark condition. Readings of the coloured product (ferrous tripyridyltriazine complex) were then taken at 593 nm. Results are expressed in μg Trolox equivalent (μM TE/mmol/L\]). BHT was used as reference. All determinations were performed in triplicate (*n* = 3).
### Determination of antioxidant activity in linoleic acid system by the ferric thiocyanate (FTC) method {#s0002-0004-0004}
The antioxidant activity of studied compounds against lipid peroxidation was measured through ammonium thiocyanate assay, as described by Takao et al., \[[@cit0017]\] with some modifications.\[[@cit0020]\] The reaction solution, containing 0.2 mL of compound (1 mmol/L in methanol), 0.2 mL of linoleic acid emulsion (25 mg/mL in 99 % ethanol) and 0.4 mL of 50 mmol/L phosphate buffer (pH 7.4), was incubated in the dark at 40 °C. A 0.1 mL aliquot of the reaction solution was then added to 3 mL of 70 % (v/v) ethanol and 0.05 mL of 30% (w/v) ammonium thiocyanate. Precisely 3 min after the addition of 0.05 mL of 20 mmol/L ferrous chloride in 3.5% (v/v) hydrochloric acid to the reaction mixture, the absorbance of the resulting red colour was measured at 500 nm. Aliquots were assayed every 24 hour until the day after the absorbance of the control solution (without compound) reached maximum value. BHT (1 mmol/L) was used as a positive control. All determinations were performed in triplicate (*n* = 3).
Results and discussion {#s0003}
======================
Chemistry {#s0003-0001}
---------
The target compounds have been synthesized according to the above-presented synthetic procedure. The general synthetic scheme is presented in [Scheme 1](#c0001){ref-type="fig"}. The readily available compound 1-(3-iodoropropyl)-3,7-dimethylxanthine (1) was aminated with 1-aryl/aralkylpiperazines (2a--f) in the presence of triethylamine to give the target compounds 3a--f in high yields. In this reaction scheme, it is possible to use 1-(3-chloropropyl)-3,7-dimethylxanthine as the starting compound instead of 1. When it was used as a starting material to obtain 3a--f, their yield was found to be remarkably lower and the reaction time about two times longer. This was probably due to low reactivity of this compound in comparison with 1. We also found that if there is no protection from the atmospheric moisture whilst obtaining the target compounds from both of 1 and 1-(3-chloropropyl)-3,7-dimethylxanthine, the hydrolysis took place and the yield of the new compounds decreased. The hydrolysis product is 1-(3-hydroxypropyl)-3,7-dimethylxanthine (13) and was detected by TLC. Scheme 1.General synthesis of the target compounds 3a--f.
All the synthesized compounds were freely soluble in chloroform, dichloromethane, dimethylformamide (DMF) and dimethyl sulfoxide (DMSO), but insoluble in non-polar solvents like *n*-hexane, except 3c which is soluble only in boiling water. The structures of the synthesized compounds were confirmed by IR and ^1^H NMR. The results were consistent with the assigned structures.
The FT-IR spectra of the studied compounds 3a--f in the region of the 4000--400 cm^−1^ exhibit several characteristic bands. Vibrations at 3054--3125 cm^−1^ belong to stretching vibrations of aromatic C--H bonds. The stretching vibration of phenolic group in the spectrum of 3c appears at 3202 cm^−1^. The two strong bands at about 1680--1702 cm^−1^ are ascribable to the stretching vibration of two carbonyl groups in the xanthine ring. The band at about 1550 cm^−1^ belongs to the stretching vibration of C˭C bonds in xanthine ring.
More detailed information about the structure of compounds 3a--f was provided by the ^1^H NMR spectra. The ^1^H NMR spectra of the compounds 3a--f showed the signals of the respective protons of the synthesized compounds, which were verified on the basis of their chemicals shifts, multiplicities and coupling constants. Thus, the strong singlets at 3.48\\3.58 and 3.89\\3.99 ppm in the spectrum of the studied compounds correspond to *N*-methyl protons at positions 3 and 7. The signal of the proton at position 8 appears at 7.50\\7.54 ppm as strong singlet. The signals of methylene protons from the benzyl side chain at position 1 form strong singlet at 4.80 ppm. The signals of the aromatic protons from substituted benzyl side chain in the spectra of 3b--e correspond to complicated multiplets between 6.82 and 6.97 ppm, while the same protons in unsubstituted benzyl moiety (3a) appear as multiplet 7.27 and 7.37 ppm. The aromatic protons in benzhydryl group in 3f form multiplet at 7.27 and 7.35 ppm. The methylene proton from the benzhydryl residue forms a singlet with weak to medium intensity at 4.36 ppm. The integral curves correspond to the exact number of the protons. The values of the chemical shifts of the protons registered by ^1^H NMR spectra were compared with simulated values.\[[@cit0018]\] Due to an impossibility to render an account of influence of the solvent, we observed only small deviations of the computed values from the experimental values. Regardless, the simulated ^1^H NMR spectra are in good correlation with experimental ones.
Antioxidant assays {#s0003-0002}
------------------
In this paper, we apply four common methods \[[@cit0014]\] for the determination of free radicals scavenging activity, total antioxidant capacity and antioxidant activity against lipid peroxidation to both lipophilic and hydrophilic antioxidants in an attempt to establish the most appropriate one for evaluation of possible antioxidant effects, demonstrated from the newly synthesized arylpiperazine derivatives. The described methods were chosen for their user-friendly mechanisms for antioxidant activity determination since they require a simple machine like a spectrophotometer, which is commonly available in most laboratories.
The free radicals scavenging activity was measured by using DPPH and ABTS methods with slight modifications.\[[@cit0020]\] The inhibitory effect of different concentrations of compounds (6.25--1000 μmol/L^2^) on DPPH ([Figure 1](#f0001){ref-type="fig"}) and ABTS ([Figure 2](#f0002){ref-type="fig"}) was determined by recording the absorbance of the reaction mixture at 517 and 734 nm, respectively. The IC~50~ values (concentration of sample where the absorbance of DPPH and ABTS decreases 50% with respect to the absorbance of blank) of the samples were determined. Figure 1.DPPH radical scavenging activity of studied compounds 3a, 3c, 3f and BHT. Figure 2.ABTS-radical scavenging activity of studied compounds (a) 3a, 3c, 3f and BHT and (b) 3b, 3e, 3d and BHT.
The applied FRAP assay was done according to the method described previously.\[[@cit0014]\] The obtained results are expressed in μmol/L Trolox equivalent for mmol/L compound (μmol/L TE/\[μmol/L TE/mmol/L\]) for 1000 μmol/L^2^ solutions of piperazines.
The corresponding radical scavenging activities against DPPH, ABTS and FRAP of the compounds were compared with those of BHT, used as positive control. All determinations are performed in triplicate (*n* = 3), and the results are expressed as IC~50~ μmol L^−2^ of inhibition in DPPH and ABTS determinations and as mmol/L TE mM^−1^ in FRAP determination. The obtained values are presented in [Table 1](#t0001){ref-type="table"}. Table 1.DPPH, ABTS-radical scavenging and FRAP-activities of studied compounds.Sample IDDPPH IC~50~ (μmol/L^2^)ABTS IC~50~ (μmol/L^2^)FRAP (μmol/L TE/mmol/L)3a371.9755.87--3b--345.2527.22 ± 1.353c189.42243.45173.99 ± 1.503d--1028.99--3e--242.4883.10 ± 1.843f420.5741.04--BHT113.1726.2923.26 ± 0.45
Among the analysed structures, DPPH radical scavenging activity was shown by compounds 3a (IC~50~ 371.97 μmol/L), 3c (IC~50~ 189.42 μmol/L) and 3f (IC~50~ 420.57 μmol/L), with the highest antioxidant activity demonstrated by compound 3c. However, the obtained IC~50~ values of all piperazines were lower than that of BHT (IC~50~ 113.17 μmol/L).
All studied compounds demonstrated ABTS-radical scavenging decreasing in order: 3c (IC~50~ 3.45 μmol/L) \> BHT (IC~50~ 26.29 μmol/L) \> 3f (IC~50~ 41.04 μmol/L) \> 3a (IC~50~ 55.87 μmol/L) \> 3e (IC~50~ 242.48 μmol/L) \> 3b (IC~50~ 345.25 μmol/L) \> 3d (IC~50~ 1028.99 μmol/L).
In the performed FRAP assay, the reduction of ferric tripyridyl triazine (Fe III TPTZ) complex to ferrous form (which has an intense blue colour) at low pH was monitored by measuring the change in the absorption at 593 nm, which is considered to be directly related to the combined or 'total' reducing power of the electron donating antioxidants present in the reaction mixture. Among the synthesized compounds only 3b, 3c and 3e (with p-substitution in phenyl ring) manifest some activity in the FRAP method, while compound 3c demonstrated the highest activity (173.99 ± 1.50 μmol/L TE/mmol/L), followed by 3e (83.10 ± 1.84 μmol/L TE/mmol/L) and 3b (27.22 ± 1.35 μmol/L TE/mmol/L). However, piperazines 3b, 3c and 3e exhibited stronger activity compared to BHT (23.26 ± 0.45 μmol/L TE/mmol/L). These effects are probably due to the possibility of the analytes to break up the free radical chain by donating a hydrogen atom.
As seen from the presented results for the three discussed methods used for evaluation of the free radicals scavenging activity and FRAP of the newly synthesized structures, the highest antioxidant activity was demonstrated by compound 3c. We believe that this result is due to the presence of hydroxyl group in the structure of this product.
Furthermore, the difference in the chemical structure of the newly obtained compounds will reflect to their relative ability to quench aqueous peroxyl radicals and to reduce the ABTS+, the DPPH free radical and the ferric ion in *in vitro* systems.
Moreover, ABTS, DPPH and FRAP assays gave comparable results for the antioxidant activity measured for all compounds, whereas the ABTS technique was simple, rapidly performed and was applicable for the determination of the oxidative properties for all the analysed structures. An additional advantage of the ABTS to DPPH is that the reaction is more rapid, whereas the DPPH reaction takes much longer. Therefore, it would be an appropriate technique for antioxidant evaluation of structural derivatives with piperazine residue.
In this study, the antioxidant activity of the studied compounds (1000 μmol/L^2^) against lipid peroxidation was also measured through ammonium thiocyanate assay, as described previously.\[[@cit0017]\] The inhibition of lipid peroxidation of the analysed structures (1 mmol/L) was determined in the linoleic acid system using the FTC method ([Figure 3](#f0003){ref-type="fig"}). The obtained results revealed that compound 3c demonstrated the highest significant diminution, whereas it hindered the oxidation of linoleic acid for five days with an effect comparable with the BHT effect, used as a control. However, all other analytes did not show significant inhibition of lipid peroxidation compared to the control. Figure 3.Antioxidant activity of structures 3a--f in the linoleic acid system 1 μmol/L^2^.
Conclusion {#s0004}
==========
A series of six piperazine like derivatives of 3,7-dimethylxanthine (theobromine) was synthesized. The structures of the new compounds were confirmed by IR and ^1^H NMR. The results were consistent with the assigned structures. All compounds were *in vitro* screened for their activity as antioxidants. It was established that the difference in the chemical structure of the compounds reflects to their relative ability to quench aqueous peroxyl radicals and to reduce the ABTS+, DPPH free radical and ferric ion in *in vitro* systems. For the three discussed methods, the highest antioxidant activity was demonstrated by compound 3c. The antioxidant activity of the studied compounds against lipid peroxidation was also measured. No significant inhibition of lipid peroxidation compared to the control has been observed for the set of compounds, except for compound 3c**,** which demonstrated the highest significant diminution of linoleic acid with an effect comparable with the BHT effect, used as a control. From the performed evaluations, we may conclude that the presence of a hydroxyl group in the structure is essential for the antioxidant properties and should be taken into consideration in further design of structures with potential antioxidant properties.
|
{
"pile_set_name": "PubMed Central"
}
|
Trichovirus
Trichovirus is a genus of viruses in the order Tymovirales, in the family Betaflexiviridae. Plants, specifically angiosperms such as pome fruits, citrus, and pear, serve as natural hosts for this plant pathogen. There are currently seven species in this genus including the type species Apple chlorotic leaf spot virus.
Taxonomy
Group: ssRNA(+)
Structure
Viruses in Trichovirus are non-enveloped, with flexuous and filamentous geometries. The diameter is around 10-12 nm, with a length of 640-760 nm. Genomes are linear, around 7.5-8.0kb in length. The genome codes for 3 proteins.
Life cycle
Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows the positive stranded RNA virus replication model. Positive stranded RNA virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral movement.
Plants, pome fruits, citrus, and pear serve as the natural host. Transmission routes are grafting. It is transmitted by mites of the family Eriophyidae, requiring a helper virus for transmission.
References
External links
Viralzone: Trichovirus
ICTV
Category:Betaflexiviridae
Category:Trichoviruses
Category:Viral plant pathogens and diseases
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Occupy Homes
Occupy Homes or Occupy Our Homes is part of the Occupy movement which attempts to prevent the foreclosure of people's homes. Protesters delay foreclosures by camping out on the foreclosed property. They also stage protests at the banks responsible for the ongoing foreclosure crisis, sometimes blocking their entrances. It has been compared to the direct action taken by people to prevent home foreclosures during the Great Depression in the United States.
History
The late-2000s financial crisis resulted in the collapse of some large financial institutions, the bailout of banks by national governments, and downturns in stock markets around the world. In many areas, the housing market also suffered, resulting in numerous evictions and foreclosures; in the U.S., 3.6 million homes have been foreclosed since August 2007.
In 2008, a federal law termed the Troubled Asset Relief Program (TARP) was passed to spend 700 billion dollars to bail out banks. The law also specifically called for the government to encourage banks to modify loans to prevent foreclosures. However, very little money has actually been used to bail out home owners and the banks have done little to change their lending practices to help people to avoid losing their homes.
The Occupy Homes movement has its roots in the early 1970s, when declining working-class incomes and a lack of bank financing for low-rent properties left thousands of New York City buildings abandoned and hundreds of former tenants squatted vacant buildings on Manhattan's Upper West Side, East Harlem, Chelsea, Chinatown, the Lower East Side, and the Williamsburg section of Brooklyn. A similar group based in Miami, Florida, Take Back the Land, has been working to block evictions, and rehousing homeless people in foreclosed houses since 2007. Early successful actions included the delay of an eviction of a woman in Ohio when protesters camped out in her yard,
convincing Fannie Mae to hold off on an eviction by holding a vigil outside a home in California, delaying a foreclosure in Minnesota so that an occupant could first move out of a home, and convincing a New York landlord to provide adequate heating to tenants by occupying a boiler room.
National Day of Action
On December 6, 2011, Occupy Our Homes, an offshoot of Occupy Wall Street, said it was embarking on a "National Day of Action" to protest the mistreatment of homeowners by big banks, who they say made billions of dollars off of the housing bubble by offering predatory loans and indulging in practices that took advantage of consumers. In more than two dozen cities across the nation the movement took on the housing crisis by re-occupying foreclosed homes, disrupting bank auctions and blocking evictions.
Saying, "The banks got bailed out, but our families are getting kicked out", Occupy Wall Street joined in solidarity with a Brooklyn community to occupy homes that were foreclosed and are now owned by banks. A peaceful group of more than 500 staged what it termed "a National Day of Action" to fight fraudulent lending practices and "illegal evictions by banks" — the institutions Occupiers blame for the nation's economic predicament. Occupy Wall Street said there would be similar occupations in other communities and that they also will try to disrupt auctions at which foreclosed properties are sold. There were also similar occupations in Atlanta, San Francisco and Portland, Oregon.
In Minneapolis, a nonprofit group, Minnesota's Neighborhoods Organizing for Change, has joined with Occupy Minneapolis protesters to live on the properties of two foreclosed homeowners. On December 6, about 50 people began occupying the home of an unemployed man who faces eviction after several heart attacks and shoulder surgery that prevented him from working at his former job as an independent contractor. A spokesperson for Neighborhoods Organizing for Change said, "Foreclosure in his case made no sense. His mortgage balance was $275,000 but the auction of his home only fetched $80,000, less than one-third of the amount he owed. Everybody, including the bank, would have been better off reducing his balance to an affordable level."
In Atlanta, Occupy Our Homes activists went to the courthouses in three of the area's largest counties to disrupt the foreclosure auctions happening there. The group is demanding an immediate moratorium on all foreclosures. In Chicago, activists took over homes left vacant due to foreclosures. They moved a homeless mother and child, an evicted homeowner and a college student into one of the houses which had been abandoned by its owner in April and was severely vandalized.
Calling the December 6 demonstrations and actions just a "warm-up" for actions of the next few months, Max Rameau, a housing activist with Take Back the Land, one of the organizations that has aligned itself with the Occupy Our Homes movement, said, "This is an important practice round for our 2012 spring offensive".
Continuing actions
On December 6, 2011, members of Occupy Atlanta began an occupation of the home of Brigitte Walker, a former Army Staff Sergeant who was medically discharged in 2007. Unable to keep up with payments on her reduced salary, her home was scheduled to be auctioned off on January 3. At a press conference on December 20, it was announced by members of Occupy Atlanta and State Senator Vincent Fort, who Walker had contacted for aid, that they had successfully renegotiated her loan to a monthly payment she could afford that would allow her to stay in her home. By late December hundreds of other foreclosure victims were being defended by local branches of the Occupy movement.
Reaction
Conservative commentator Andrew Breitbart said the movement's new focus is "fomenting civil unrest, fomenting class warfare" and that this action shows that Occupy Wall Street is not "an authentic grass-roots movement but a political maneuver backed by organized labor and remnants of the ACORN community-organizing group aimed at boosting President Obama's re-election campaign".
Speaking on CNN, law professors Sonia Katyal and Eduardo Peñalver compared the occupation of foreclosed homes to earlier social protests that brought about positive legal change. In their opinion, the Occupy Homes movement demonstrates an obvious connection between the Occupy Wall Street protestor's disobedience (the occupation of parks and streets) and their complaints of economic inequality, political corruption and the excessive power of banks. They point out that the financial institutions that brought about the current recession, often using illegal procedures such as robo-signing, now own the very homes that were lost due to their illegal practices and they believe that Occupy Homes forms a tighter link between its acts of occupation and its political objections.
New York writer, filmmaker, and Occupier Astra Taylor wrote:
Not only does the occupation of abandoned foreclosed homes connect the dots between Wall Street and Main Street, it can also lead to swift and tangible victories, something movements desperately need for momentum to be maintained. The banks, it seems, are softer targets than one might expect because so many cases are rife with legal irregularities and outright criminality. With one in five homes facing foreclosure and filings showing no sign of slowing down in the next few years, the number of people touched by the mortgage crisis—whether because they have lost their homes or because their homes are now underwater—truly boggles the mind.
See also
Occupy movement
2010 United States foreclosure crisis
Foreclosure rescue
Mortgage discrimination
Penny auction (foreclosure)
Subprime mortgage crisis
Take Back the Land
References
Further reading
Occupy Homes: New Coalition Links Homeowners, Activists in Direct Action to Halt Foreclosures, Democracy Now!, November 11, 2011. Retrieved December 4, 2011.
External links
4 closure Fraud
Free Foreclosure Guide
Category:Occupy movement in the United States
Category:Squatters' movements
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Product Review: Shark Portable Steam Pocket Cleaner
Infomercial-mania
I adore the art (and science) of infomercials. I remember sitting up late at night when I was younger, watching the food dehydrator infomercial and being mesmerized by Rom Popeil’s ability to sell something seemingly useless and make it look so fascinating and easy to use (and clean up). I loved the ‘easy payments’ scheme too…that’s how they get ya. Anyway, fast forward a few years and here I am, getting asked from all corners of the globe to examine how a steam cleaner works because many of you have seen them advertised on these infomercials. According to these commercials, steam cleaning is probably as exciting and innovative as the vacuum cleaner was when it came out. Can this technology live up to its hype?
At some point I know I’ll do one on a steam mop as well, but we’ll get started with the steam cleaning revolution in-depth examination using the portable steam cleaner. Tool on the exam table is the Shark Portable Steam Pocket Cleaner (also referred to as the Shark Steam Pocket Handheld Steam Cleaner, or some variation of those words).
Alright, you’re interested.
So, exactly do what do they do, why do we need them, can they replace all of my other cleaning tools and products and do they really work as well as the commercial says they do? We will put it through the paces and let you know these answers as well as some best practices for it if you do choose to use one.
First, what is a steam cleaner?
A steam cleaner is a machine that runs on water and electricity; the water is poured in, boiled and heated up, at which point vapour is let out through a nozzle and into a hose or attachment. The hose or attachment then allows the user to apply the steam to a variety of cleaning applications by using various nozzles, brush attachments and microfiber pads attached to hollow forms. Steam flows through so that you can use the attachment or pad to scrub, wipe or clean the bacteria or debris that the steam has loosened.
People love steam cleaning because it uses only water (i.e. no more chemicals), has the ability to disinfect a surface, it uses powerful and reusable microfiber pads and it can reduce the time and elbow grease you invest in getting challenging areas clean. These ultimately can save you time and money and keep your family healthier (what infomercial product can’t?).
The machine creates steam with plain water, steam that is hot enough to break down dirt and kill bacteria (extreme heat will kill bacteria on contact) and dries almost instantly. The steamer comes with a main body, and a small hose with attachments either with bristles or microfiber pads that are used to actually clean the surfaces. And that’s all you need to get the job done!
Steam cleaners like this are designed to heat up the water to a certain temperature and that high temperature is what gives you the ability to disinfect a surface quite quickly, like within 10-15 seconds, as opposed to the 5-10 minute wet ‘dwell’ time required for a disinfecting product to use. The steam also helps power through horrible messes that require a lot of scrubbing and product (which can potentially damage a surface). That’s pretty cool, I’ve got to say! Now keep in mind, higher-end steamers will heat up faster and clean and disinfect surfaces quicker because of their superior technology. However, for your home, a consumer product like this one is just fine.
Unboxing the Shark Steam Pocket Steam Cleaner
First, it’s purple (my favourite colour), so it scores some points there. When I ‘unbox’ something, I like it filmed so that my first impressions can be captured immediately allowing me to give an opinion without much humming and hawing. I took out the product and it had a variety of well-built tools and attachments, good quality microfiber cloths (I know microfiber like a sommelier knows wine) and a lightweight, well-designed body which is what Shark is known for.
So here’s what came in the box:
Shark Steam Pocket Handheld Steam Cleaner
Cylinder Cleaning Wand
Wedge Cleaning Attachment
2 Micro-Fiber Cylinder Pockets (white)
1 Cylinder Dusting Pocket (purple)
2 Micro-Fiber Wedge Pockets (white)
Direct Steam Nozzle
Garment Steamer Kit
2 Bristle Brushes
Scrubber Wedge Pocket (bluish/metallic)
Squeegee Wedge Pocket (yellow)
Tote Bag
Filling flask
Owner’s manual
Build Quality
I like this product. Shark makes good quality items. They feel strong and durable; however they are not heavy, clunky or burdensome.
I didn’t look at anything and doubted its functionality; in other words nothing looked flimsy. All of the parts had sturdy attachment pieces too, which may sound strange but sometimes attachment pieces snap off and that can render a product useless. The microfiber pockets were all really good quality (as mentioned above) and I liked the variety of the pads. The elastic closures reminded me of a Lulu Lemon garment – I like that system. I really liked the idea of including a storage bag with the kit, because all of those little parts would lead to a storage issue otherwise. I know you could have used your own bag and whatnot, but I liked the extra attention to detail. The downside of that is that there are a lot of small parts, and I know that at times I get flustered with a lot of parts and that has lead to me leaving something in the closet, untouched. I hope this isn’t the case.
The Instructions
They are fairly straightforward and simple, but read them for goodness sake! I am not going to cover every warning and cautionary word in this blog post, you must do this yourself! Learn how to put everything together, learn how to keep yourself and your finishes safe, learn how to change up the nozzles, hose and attachments and you’ll be all set. In the end, you’ll save time because you will actually know what to do from the get go.
Getting Started
Assemble the steamer to your preferred configuration before plugging it in. We opted for the wedge tool and an all-purpose pocket (the white one), which was attached by the hose. I then unscrewed the water reservoir and filled the filling flask (aside: while shooting the video, my husband and I couldn’t stop saying that like a bunch of drunk cowboys! Fillin’ flask! ) with water twice and then plugged in the steamer. Although the box claims that it heats up in 25 seconds, we found it took longer. Let it sit for a couple of minutes when you first plug it in to get things going and then start your cleaning.
It should be stated that you need to wipe the surface clean of debris before steaming it. In other words, the steam cleaner will not pick up crumbs and debris, you need to. So give any surfaces a quick preliminary wipe to remove debris before using the steamer. It is designed more to remove sticky, tough stains, not pick up debris.
This steam cleaner is well designed because it keeps the water cool in the reservoir until it is turned into steam. That’s a good feature, or else we’d be hearing about people being burned with their steam cleaners.
Are you wondering just how hot these get? I was too, and when I spoke with Shark about this, I was told ‘the temperature of the steam directly at the nozzle gets to 121 C’. That’s pretty hot, hot enough to melt grime and kill bacteria.
The Parts
What can all of these wands and wedges actually do? Here’s my framework for what these tools can actually do for you around the house:
The microfiber wedge and cylinder pockets
Are used for general cleaning, meaning you can tackle anything from cleaning all general surfaces in the house including countertops, sinks, stainless steel appliances, bathroom fixtures and tubs. The two different shapes (4-sided wedge and slender cylinder) allow you to maneuver through parts of your home with ease.
The cylinder dusting pocket
Can be used to clean window coverings, ceiling fans, dust hard to reach areas, awkwardly shaped items that need dusting (like a wine cellar with a lot of bottles that you don’t want to remove), and general dusting.
Direct steam nozzle
This monster just powers through grime, it’s amusing to watch actually. Use it to blast away grime in your oven, tough, sticky stains and areas that you feel nothing else can actually help (think: you’ve used 16 SOS pads on the area already to no avail). The direct steam nozzle (depending on how daring you are) can also be used in the bathroom to blast your toilet clean. The nozzle can fit under the rim and can get into grimy corners. Make sure you sanitize the nozzle when you are done.
Bristle brushes
If you watch my videos, you will often hear me refer to ‘the cleaning toothbrush’ which is an absolute requirement for proper and deep cleaning. Essentially, a toothbrush can get in to those tight spaces we just can’t reach with anything else (sound like a toothbrush commercial?) and cleaning our spaces is no different. These bristle brushes are what to use for cleaning grout (it’s amazing on grout), grimy surfaces, around faucets, and into other sneaky spots where you need steam and scrub to get the job done. Be sure to clean them well when you finish using them.
Garment steamer kit
Goes without saying; you can use this to steam your clothing to wrinkle-free status. I have an actual Rowenta steamer at home and this one did effectively the same job. The little bonnet can be used to steam and clean surfaces such as upholstery and drapes.
Scrubber wedge pocket
Is amazing on grimy surfaces like inside the oven, cook tops and the scummiest shower tiles. Wash well when completed! Put your biggest challenge up against this pocket.
Squeegee wedge pocket
Works wonders on glass. It features a heavily-matted flat-weave microfiber material that is very absorbent and can power through dirty windows and will clean mirrors using less effort and leaving less streaks (if any) than you would get with traditional glass cleaner.
For the techies, here are some product specifications
Warranty Terms – Parts: 1 year limited
Warranty Terms – Labor: 1 year limited
Product Height: 10-1/4″
Product Width: 9-7/8″
Product Weight: 2.6 lbs.
Product Depth: 5-1/8″
Motor: 1500W
Cord Length: 20′
Best Practices
Since I’ve used the product and know how to get it to purr, I figured I’d share some of my best practices with you.
1) Always have a microfiber cloth at the ready to wipe up any blasted-away grime, residue or excess liquid. Since you want to have a streak-free finish, you will need to quickly dry areas once you’ve cleaned them as the pocket gets used. Reason being, the pocket cannot be rinsed, wrung out or dried and since it is receiving a constant stream of steam so it is bound to get wet. This means that you will notice film and liquid can get left behind. Plus, you don’t want to re-distribute that crusty grime from your sink all over your counters.
2) Change your pockets when they are heavy and soiled. They will reach the tipping point where they’ll no longer be effective and will produce more film than clean surfaces. On the Shark website, you can purchase replacement (or additional) pockets for about $30. It’s good to have spares, you’ll get your cleaning done fully and effectively as opposed to waiting until the pockets have been laundered and start at it again.
4) Clean your pockets after each use using gentle detergent that is free of fabric softeners or bleach. Hang them to dry!
5) Don’t put your hand directly in front of the nozzle, you’ll have no time to clean if you are sitting in the emergency room with a burn. I kept quickly testing it this way and admittedly, almost burned my hand.
6) Move in one continuous motion instead of starting and stopping this will allow the steam to work effectively without over-dampening the wedge. If you have to go over an area afterward (I usually run my hand over the surface to see if it is fully clean), then you would simply ‘touch up’ that area as opposed to wasting your time starting, stopping and checking.
7) Feel it out because it will seem very awkward when you start using it. You need to administer the steam with one hand by depressing a button on the unit (which I did with my left hand) and operate the wand or tool with your right hand (unless you are not using the hose). You’ll need to get strategic about where you clean so that you prep your area first (or figure out a way to get a 3rd hand). As an example, I cleared off my kitchen counter before cleaning it or else I wouldn’t be able to move items with my left hand as I cleaned with my right hand.
Test Lab
Kitchen results
Stainless steel sink: pretty good, took a few passes but got up all the grime. I’d probably use the cylinder tool next time since it would be easier to maneuver than the wedge. My sink looked shiiiiny!
Cruddy countertop: The wedge was perfect for this. It wiped away juice, ketchup, salsa and chocolate sauce that had been sitting there for a few hours prior to filming. I wiped away the chunky debris with a paper towel first and then steamed the surface clean. It was pretty sweet.
Cupboard doors: I used the wedge but would probably use the cylinder next time so that I would be able to access the areas behind the hardware (which tend to get grimy). Worked well and the greasy spots came right off. Loved it.
Stove exterior: The glass cooktop came out nice and clean. I think I would still have to work at those tough burned-on spots in some of the other methods I’ve discussed before (How to clean a stovetop VIDEO BLOG INSERT HERE) but to get it clean and shiny, this worked well. It was also good for sanitizing the stove dials which can harbour bacteria.
Overhead exhaust: It got rid of any dust or stickiness built-up from cooking. It also made the stainless steel shine. I like that!
Interior stove door: Wow, this was most impressive. It blasted away those burnt-on grease spatters with ease. It was like watching something on the Discovery Channel, very cool and very effective! I used the direct steam nozzle for this task.
Stainless steel fridge: I used the wedge and just worked my way from top to bottom using an ‘S’ pattern. It worked beautifully and took next to no effort to have a shiny fridge.
Lime scale build-up in sink: I used the direct steam nozzle for this and didn’t have much luck. I was hesitant to use the bristle attachment because I didn’t want to scratch anything.
Bathroom results
Toilet bowl (not aired in video footage): It did work at blasting away build-up, however I didn’t like that the steamer had to be used on an angle which steamed in my face. There’s something quite unappealing about toilet bowl vapours. I will stick to the ol’ brush method (check out our toilet cleaning video here).
Toilet seat hinges (not aired in video footage): This worked, it blew away any build-up around the toilet seat hinges and didn’t require much effort. All I had to do was wipe up the remnants. I used a paper towel instead of microfiber cloth so that I could toss it when I was done. Good for sanitizing the commode, that’s for sure.
Toilet flusher hinges (not aired in video footage): I blasted steam with it using the direct steam nozzle and wiped clean with a paper towel. Clean and sanitized. Nice!
Faucet: It blasted away little bits of hair and debris (my husband sports a wicked half-shaven look, so this comes compliments of his face) and made for an easy wipe up.
Drain surround: I tried both the direct steam nozzle and the bristle attachment to clean the gunk In the drain surround (the part where the metal meets the porcelain – there’s always something growing in there). I didn’t have much luck with this area, to my disappointment.
Bathroom sink: You can’t see much of this in the video, but we did attempt it. However, I used the direct steam nozzle and bristle. Since neither worked, I can tell you that it would require the scrubber wedge pocket to remove build-up for certain. I didn’t try these out in the bathroom, but I know for certain that the scrubber wedge would clean the toothpaste spatters out of the sink and leave it clean and sanitized.
Tile grout (not aired in video footage): I didn’t put this in the video but I have tried it in the past and can tell you with certainty that it works. I may do a separate video on more uses for the steamer including this, since it’s a great visual. It is pretty powerful and can blast stains and mildew right out of grout. Have a cloth handy to wipe up the blasted-out gunk!
Dusting results
Fireplace vent: the small purple ‘fingers’ got right into that vent and made dusting pretty straightforward. However, dusting that area isn’t otherwise challenging so it’s neither here nor there for me.
Upholstered pillow: I like the idea that it ‘refreshes’ the upholstery, especially considering that our cats plant themselves on every conceivable horizontal surface in our home, and I sometimes fall asleep on that pillow. Having that pillow steamed makes for sweeter (and less paranoid) dreams, that’s for sure.
Sofa (not aired in video footage): Same idea as pillows. The results were not visually obvious, but after waiving the wand atop my sofa, I feel better (cleaner) about sitting on my couch. The sofa isn’t even a year old so didn’t notice much difference in odour-removal (I’d like to think it doesn’t really smell). However, professionals use steam to ‘clean’ upholstery so the same principle must apply in this situation too, although it was sight unseen (or smell un-smelt) for me.
Frames, decorative objects (Some aired in video footage): It did a good job on the frames, however if they were very dusty and the wand was very damp, then some of the dust could stick to the frames. Just beware of this. Again, this is something that could or could not be done with a steamer and I think it may be easier to do this with a microfiber cloth. It’s not like the frames or décor objects need to be disinfected.
Garment results
Silk skirt: Super sweet. It got rid of the wrinkles in a quick and effective manner. I like!
Cotton dress shirt (not aired in video footage): Took longer, wrinkles didn’t come out. However my Rowenta steamer(specifically designed for this purpose) can’t really do better, so I think if one has a cotton shirt, one must wield ye olde iron to remove the wrinkles.
Closing Arguments
Microfiber is the most powerful cleaning material we know of. Steam breaks up even the toughest dirt, grease and grime and kills 99.9% of bacteria in the process. With these two combined and leveraging the good design and quality of Shark, how can you not love this cleaning tool?
Pros: Re-usable microfiber pockets, well-designed and quality tools, powerful steam, simple to use (once you read the instructions) and for the most part, holds true to its claims. I also like that it is chemical-free and uses cheap, easily accessible water to do its dirty work. It did make my cleaning (of certain areas) easier and I appreciated that. It kicked butt on the tougher jobs that usually require heavy-duty product, lots of elbow grease or specialized tools.
Cons: I will state it is not perfect. My main issues with it are that there are some design flaws (namely the challenge in cleaning with one hand as opposed to two when the hose is in use) and it didn’t work on every surface. It also didn’t heat up in 25 seconds when I first turned it on. It did not power through every single challenge I put it to in my home and finally, I think that some of the touted cleaning uses are superfluous. Finally, there’s a bit of a learning curve with it for certain and a definite adjustment of your cleaning routines. Some people may find this frustrating. Others may be too lax to take the time to use all tools and therefore find it ineffective. But, if you can get past these two metal obstacles, you will learn to love this tool.
The Verdict
So you want it, right? Well, don’t get it because you think it is going to make your everyday housekeeping easier. It’s not. Keep doing what you’re doing. Get it because you dislike cleaning up the heavy-duty messes and leave them because you don’t want to expend your precious time and energy on it. Get it because you don’t want to use chemicals to get rid of oven soot or soap scum. Get it because the idea of sanitizing with just steam delights and excites you. This tool will make heavy-duty cleaning and sanitizing much easier and you can expect to cut your cleaning time in half on those tasks.
What do you think about the Shark Steam Pocket Handheld Steam Cleaner? Are you going to get one?
Melissa Maker is an entrepreneur, cleaning expert, founder of Toronto’s most popular boutique cleaning service, and star of the Clean My Space channel on YouTube (but she still hates to clean!). Every week, Melissa delivers new videos dishing expert advice on cleaning products, tools, DIY substitutes, and practical, timesaving solutions to everyday problems. Melissa has appeared on the Today Show, and has been featured in InStyle, Real Simple, and Better Homes and Gardens.
This was quite informative and useful however, it would have been better if you had not hinted that you hurt the cat at the beginning. There is nothing redeeming about pretending to injure an animal. I hope you were pretending.
I like Shark products. I I have the floor steamer. But I really need an upholstery cleaner. A light one, not too heavy, easy to maneuver. One that cleans, not just refreshes. Enjoyed your video, and I need one of these too!!!! Can you clean showers and the shower doors that are plastic or whatever they are made of, really could use help on the mold and soap build up there.
I have this steamer and it makes a loud whirring noise when steaming. Did you have that problem as well, or is it suppose to make that noise? The company let me exchange it, but the second one made the same noise, even though there is nothing in the instructions that indicate it will make a noise.
Shark pretty much sums up how they treat their customers. They sell a product with a huge design flaw – THE TIP OF THE STEAM NOZZLE BREAKS OFF FROM STRESS CRACKS FROM CHANGING OUT THE MANY ATTACHMENTS INCLUDED WITH THE MACHINE AND THE HEAT FROM THE STEAM. THIS IS WHAT IT WAS SUPPOSEDLY DESIGNED FOR! Shark offered every other attachment replacement on-line BUT NOT REPLACEMENT NOZZLE TIP. Instead, they wanted to sell me another flawed machine for $39.99 plus shipping & handling. I paid $120.00 for this piece of garbage and now they want another $54.00. Was going to buy a Shark Steam Mop for my office. NOT NOW!
Even in France, we bought this Shark Steam Cleaner 15 or 16 months ago and used it 3/4 times (less than 3 hours in total), to clean some moisture in the bathroom, another time for the windows, nothing special, just to use it, like when you get a new toy. It worked but its a job to manage all the stuff just to to clean 4 windows ! Then it was put in a cupboard.
Today, thinking “steam cleaning” we remember and want to use it, fill the water, plug it… the water is heated but the pump is dead !
The brand new stuff is going to trash. By chance we got it very cheap. No regret ! That’s a gadget, don’t buy it, at least rent a professional one.
Thank you,you were very helpful.I need something lightweight & fast cleaning.I have a bad lower back & trouble bending with a lot of strain on my back & knees.Doing house cleaning,I have to frequently sit and rest my back.I also,need to find a product that would easily clean walls during “spring cleaning”.
Betsy
You must have special Shark products that nobody else can get! I would never purchase another Shark product again. I purchased this steam cleaner and a hand held vacuum, both Shark products and both broke within 6 months of purchase. The steam feature no longer works on my steam mop. The little beater attachment that came with the hand vac broke within 6 weeks. I vacuum 6 steps with it, and the battery starts to die. What’s worse, the hair and dirt get stuck in the curve that the dirt has to negotiate before it gets to the collection compartment. When I tried to contact Shark, I found that they make it pretty much impossible to get customer support or for customers to leave feedback about their product. Considering how crappy they are, I guess I don’t blame them! If you want a good steam mop, buy a Bissell. Shark stinks:(
There were two reasons I bought this thing: 1. The commercial makes it look like it dissolves any grease in milliseconds. 2. The commercial makes it look like it de-wrinkles clothes in seconds.
PAY ATTENTION:
1.) The steam is intermittent; 10 seconds on, then 30 seconds to warm back up… ¼ time actual steam…
2.) In order to get grease to budge, you have to hold the nozzle against a sq. cm. of it for three cycles (2.5 minutes). With soap and brillo, you can take up grease in seconds!
3.) I just emptied two containers-full and spent over ½-hour on ONE shirt which was mildly wrinkled. The wrinkle condition of the shirt did not improve ONE BIT. The machine did not relax ONE SINGLE WRINKLE in 30 WHOLE MINUTES of operation.
For those who are wondering, I purchased the Shark Steam Mop (the one that all it is is a mop, NOT a handheld) from Sam’s Club. It was $20 more than Walmart, but included twice the amount of cleaning pads (2 white triangle, 2 white rectangle, 2 purple wood triangles, 2 purple wood rectangles). We use Mr Clean with Febreeze in it (following diluting directions) and it makes the house smell fresh just like the Swifter pads. I did a test & mopped before hand with my Swifter (took 6 pads for kitchen, dinning room, short hallway, and bathroom for a weeks worth of grime) then the Shark mop. I still had both sides of the pad almost black when I was done. This mop does heat up right away. You pump the handle (pushing like you are mopping with a swifter) and the steam comes out in less than a minute. Great that there were 2 pads in the box so i could mop again the next day. It also had 2 heads; rectangle for most floors & triangle for bathrooms (for behind the toilet). Good buy at Walmart & great one at Sam’s. $20 for 4 extra pads. And yes, it does laminate great (what I had) and wood without damage (from a neighbor).
Entertaining video.
And useful, I will not be buying one based on what you showed with regard to steaming around the drain area. The direct Steam mode looks to be poor.
We have under mounted sinks in our kitchen and were hoping to clean the joining points of counter and sink.I don,t think this will do the job, and for that I thank-you. I would not build the counter and sink this way again
Any chance you have reviewed other shark products? I purchased the lift away pro steam pocket . Which is a floor mop with the removable hand held steam unit all in one for 150 dollars at cdn tire and can’t decide whether to open it up and try it or return it . You did a great job reviewing with the above video
Hi! Thank you for the Video- i bought a refurbished Shark portable at a great price and am very happy with it. I initially thought something was wrong when it did not “go to it” as quickly as the box says but thanks to you i know i just had to wait a little! I like sanitizing everything so it is awesome for my household. Thanks again
I own a shark steam steam cleaner that is also a steam mop. I looks a lot like a canister vac with attachments. Got it at Lowes 2 or 3 years ago for $100 and it is well worth the price just for the mop alone. I love it, gets my floors barefoot clean and crawling grandchild clean.
Thanks Linda – I do really like it. There’s am Amazon link in this blog post which takes you to a shopping cart. It can also be purchased at home hardware stores and bed and bath stores. I just saw the Amazon price and it’s lower than what it’s retailing for where I live by $20!
|
{
"pile_set_name": "Pile-CC"
}
|
Alistipes onderdonkii
Alistipes onderdonkii is a Gram-negative, rod-shaped and anaerobic bacterium from the genus of Alistipes which has been isolated from a human abdominal abscess in the United States.
References
Category:Bacteria described in 2006
Category:Bacteroidetes
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
Should I mention teaching experience in my cover letter?
I am applying for tenure-track positions in R1 (say, top 50) universities in Computer Science in the US.
When writing the cover letter, should I mention teaching experience and competence?
Or should I leave it for the teaching statement?
A:
I've been on the faculty recruiting committee of my American R1 top-whatever computer science department for more than 15 years, including three years as committee chair. (But my experience is only in one department, so take this with a grain of salt.)
To first approximation, nobody will read your cover letter.
It's quite common to get faculty applications that have no cover letter at all, or that include a plain-text email "cover letter" that reads "I'm applying for an assistant professor position; I've uploaded the requested documents and the contact info for my references. Kthxbye!" I have never seen this affect discussions about who to interview or who to hire. Nobody ever notices. Nobody ever cares.
All the information we care about is already in your other application materials, your recommendation letters, and your papers. In particular, recruiting committees already expect to see a detailed description of your teaching experience in your CV and in your teaching statement. That's where everyone puts it, so that's where we look. And we'll look there regardless of whether you mention it in your cover letter. So why would we look at your cover letter?
In my experience, cover letters are only useful if they contain information that potentially changes the hiring process — like "I am applying for a tenured position at the rank of full professor." or "Please keep my application confidential." or "My spouse is also applying to your chemistry department."
Cover letters do play a more important role in some departments, because they want convincing evidence that you are seriously interested in a job there. After all, if you're just shotgunning your application to every ivy-colored building in the country, then interviewing you is probably a waste of their time and money. But this is much less likely to be a concern in a top-50 R1 department. It's never been a concern at mine.
A:
At an R1 university you will still need to teach. Mentioning teaching in the cover letter is certainly appropriate, but a few words will do. It needn't even be as much as a full sentence since you get to expand in a teaching statement here. But a sentence that simply says you have wide experience in both research and teaching is probably enough for the cover letter.
For a different sort of university teaching would be the most important thing to mention, but for almost any academic job, don't try to seem too focused on any one thing. The job has multiple facets. Your application will be evaluated by people with different viewpoints in most cases.
|
{
"pile_set_name": "StackExchange"
}
|
1934 Claxton Shield
The 1934 Claxton Shield was the first annual Claxton Shield, an Australian national baseball tournament. It was held at the Adelaide Oval and Hindmarsh Oval in Adelaide from 5 to 12 August, and was won by the hosts South Australia. The other participating teams were New South Wales and Victoria.
The tournament was the first of what would be an ongoing series of regular national tournaments. Prior to 1934, there had been interstate tournaments, where one state would host only one of the others for a series of games, and there had been two national tournaments, the first in 1910 with New South Wales, Tasmania and Victoria, the second in 1912 which also included South Australia, both of which were won by New South Wales. Though the specifics of the tournament's format would change over the years, with the exception of the suspension due to World War II, the tournament would continue through to 1988 as the highest level of baseball in the country.
Format
Each team met each other team twice over the course of the week. In each game, two competition points were on offer to the teams. The points were awarded as follows:
Win – two points
Tie – one point
Loss – no points
At the end of the tournament, the team with the most points was declared the winner, and awarded the Claxton Shield. As there was a tie between New South Wales and Victoria for second place at the end of the tournament, their net for and against was used to split them, hence New South Wales finishing second.
Results
References
Bibliography
Claxton Shield
Claxton Shield
Category:August 1934 sports events
Category:1930s in Adelaide
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Tuesday, November 15, 2016
Werewolf in the Wild: My ProcJam game for 2016
It was super fun, and I did several things for the first time, including...
Using Raycasts to do some simple AI steering, so that the birds follow the contours of the land, and fly over obstacles. I want to expand on this so they fly around things, and feel more organic.
Procedural terrain generation, allowing the player to generate a new terrain at any time by pressing "T" at any time while playing! This adjusts the height field of the terrain, sometimes making spiky tall terrains, sometimes making smooth low terrains, etc.
I went crazy on Image Effects to get a unique look that reminds me of David Lynch's Lost Highway or some surreal dreamscape. This look inspired the werewolf theme, and it all took shape very organically.
I built all the props myself in Maya, which was great, as I now feel I can comfortably use that pipeline in future projects. The look of the game allowed me to model things simply, and still have them characterful.
Added some sweet werewolf sounds to really bring the unique player character to life!
Added some kooky arthouse experimental ambient sounds to set the mood.
I want to continue with this game, doing things like...
Giving the wolf arms, so they can slash and claw at things.
Adding some more AIs into the game, such as foxes, deer, and townsfolk.
A goal of some sort, whether it is just to survive being hunted by townsfolk, needing to feed, needing to find your cave before daybreak, or some more narrative driven goal.
Townsfolk could track you down using sight and sound, and you can hide in wait, leaping from the shadows, or just go on a massacre and see how long you can survive.
Model more varied items for the environment.
Have different items that appear at different heights in the world, and things that can be placed on slopes, such as small rocks, or shrubs growing on an angle.
Implement more variety into the terrain system.
Perhaps a mechanic revolving around the moon.
Possible a day/night cycle, which affects whether you're a werewolf or a human, and adding a whole mechanic around that.
Perhaps a climbing, bounding, leaping system that lets you climb up towers, mantle up through small trees into larger trees, etc.
An asymmetrical multiplayer mode could be very cool, with hunters on one team, and the lone wolf on the other team.
Howl at the moon!
I feel a bit inspired by Dusk, and thought it'd be fun to add some ghoulish fast paced crazy 90's FPS style gameplay, like slashing things to death, leaping about etc.
But I also feel inclined to maintain the arthouse surreal feel in some way, having a bit of a Tangiersvibe. Like Tangiers, I'm very interested in stealth mechanics, loving the original Thief games.
I have had a few narrative ideas, around the werewolf being ferocious and driven by a sort of madness, but also still aware of their human form, with their thoughts in their head, regrets, pain, feelings that cause anguish and tension between the killing and violence they need to perform to survive, and their pain at being misunderstood and not being in control of their own behaviour or how others perceive them.
I feel that such a story could help facilitate action gameplay, while maintaining some other interesting themes and ideas.
Stay tuned, and hopefully I'll have some updates to it soon, in between finishing off my other games! :D
|
{
"pile_set_name": "Pile-CC"
}
|
Check out our new site Makeup Addiction
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
why do jews have such big noses? it's hereditary
|
{
"pile_set_name": "OpenWebText2"
}
|
An alternative parameterization of the general linear mixture model for longitudinal data with non-ignorable drop-outs.
This paper considers the mixture model methodology for handling non-ignorable drop-outs in longitudinal studies with continuous outcomes. Recently, Hogan and Laird have developed a mixture model for non-ignorable drop-outs which is a standard linear mixed effects model except that the parameters which characterize change over time depend also upon time of drop-out. That is, the mean response is linear in time, other covariates and drop-out time, and their interactions. One of the key attractions of the mixture modelling approach to drop-outs is that it is relatively easy to explore the sensitivity of results to model specification. However, the main drawback of mixture models is that the parameters that are ordinarily of interest are not immediately available, but require marginalization of the distribution of outcome over drop-out times. Furthermore, although a linear model is assumed for the conditional mean of the outcome vector given time of drop out, after marginalization, the unconditional mean of the outcome vector is not, in general, linear in the regression parameters. As a result, it is not possible to parsimoniously describe the effects of covariates on the marginal distribution of the outcome in terms of regression coefficients. The need to explicitly average over the distribution of the drop-out times and the absence of regression coefficients that describe the effects of covariates on the outcome are two unappealing features of the mixture modelling approach. In this paper we describe a particular parameterization of the general linear mixture model that circumvents both of these problems.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
A mammoth and humans on the banks of the Marne
A nearly complete mammoth skeleton has just been uncovered at Changis-sur-Marne in the Seine-et-Marne department. This type of discovery, in its original context, is exceptional in France since only three specimens have been found in 150 years: the first such discovery, known as “the mammoth of Choulans”, was discovered in Sainte-Foy-lès-Lyon in 1859.
A nearly complete mammoth skeleton has just been uncovered at Changis-sur-Marne in the Seine-et-Marne department. This type of discovery, in its original context, is exceptional in France since only three specimens have been found in 150 years: the first such discovery, known as “the mammoth of Choulans”, was discovered in Sainte-Foy-lès-Lyon in 1859.
This mammoth is probably a Mammuthus primigenius, a wooly mammoth with long tusks that were used to expose edible vegetation under the snow. These animals could attain 2.8 to 3.4 meters high at their withers and were covered with fur and a thick layer of fat. They usually lived in grassy steppe environments.
Credit : Inrap
This species lived in Eurasia and North America. The mammoth of Changis-sur-Marne lived between 200,000 and 50,000 years ago, at the same time as Neandertals. Mammoths were well adapted to cold climates and thus disappeared from western Europe 10,000 years ago when the climate became warmer. The most recent specimen died off the coast of the Bering Strait, 3700 years ago.
Mammoths and humans
The current excavation will enable archaeologists to clarify the age of the probscidian and perhaps the circumstances of its death: did it drown, or was it trapped in mud? Was it hunted or scavenged by predators? A usewear analysis of the flint flake will be performed to determine its function and a zooarchaeological study will detect possible cut marks on the bones.
Credit : Inrap
The discovery at Changis-sur-Marne is exceptional since humans and mammoths have been found together at only two Middle Paleolithic sites in western Europe: Lehringen and Gröbern in Germany. There is also the site of Ranville, in the Calvados region, where an ancient elephant (Elephas antiquus) was scavenged approximately 220,000 years ago. Finally, the excavation at Tourville-la-Rivière, in the Seine-Maritime department, recently uncovered aurochs, horses, bears, lions and panthers that were transported by the Seine, 200,000 years ago. Neandertals, who were fine connoisseurs of their territory, recovered several resources (meat, tendons, hide, etc.) from this natural jackpot.
Credit : Inrap
In the near future, archaeologists and paleontologists should be able to determine whether the mammoth of Changis was killed by Neandertals, or whether they scavenged the animal after its natural death. This discovery will contribute to the debate among scientists concerning the predatory skills of Neandertals. The ultimate challenge is to determine the precise date of the event, using radiometric and chrono-stratigraphic methods.
The excavation of Changis-sur-Marne
The animal was discovered in a quarry in Changis-sur-Marne during the preventive excavation of a Gallo-Roman site, which is itself remarkable. The first bones appeared in the front cut of the quarry. Due to the interest of this discovery, the Regional Direction of Cultral Affairs (Drac) of Île-de-France organized a preventive operation, realized conjointly by the Drac and the Institut National de Recherches Archéologiques Préventives (Inrap), with the collaboration of the Muséum National d’Histoire Naturelle in Paris, the physical geography laboratory of the CNRS in Meudon and the CEMEX, who is exploiting the quarry. This is the first excavation of its kind in France. It will be completed in early November.
FACEBOOK
TWITTER
HeritageDaily is an independent online science publication by HeritageGateway that is dedicated to the dissemination of knowledge on past sciences such as archaeology, palaeontology and palaeoanthropology.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Resources describing Somerset English
Can anyone suggest any good resources describing the grammar of traditional Somerset English (not accented standard English)? The Wikipedia article for the West Country dialects provides a good introduction, but I am looking for sources that go into greater depth regarding the grammatical differences between Somerset and standard English.
A:
The first two books on this Amazon UK page are popular guides to the Somerset dialect. The third is an academic account of English dialects by Peter Trudgill, a prominent linguist who has written on regional dialects and on socioliguistics. The index has an entry for Somerset, and there may be some pointers to more specific works in the Further Reading section.
|
{
"pile_set_name": "StackExchange"
}
|
Christoforos Kourtis
Christoforos Kourtis (; born November 5, 1996) is a Cypriot footballer who currently plays for Anagennisi Deryneia as a midfielder.
References
External links
Category:1996 births
Category:Living people
Category:Cypriot footballers
Category:AEK Larnaca FC players
Category:ASIL Lysi players
Category:Anagennisi Deryneia FC players
Category:Cypriot First Division players
Category:Cypriot Second Division players
Category:Association football midfielders
Category:Greek Cypriot people
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Mycophenolate mofetil and daclizumab targeting T lymphocytes in bleomycin-induced experimental scleroderma.
T lymphocytes induce the transformation of fibroblasts into myofibroblasts, the main mediators of fibrogenesis. The inosine 5'-monophosphate dehydrogenase inhibitor mycophenolate mofetil (MMF) and the anti-CD25 monoclonal antibody daclizumab (DCZ) have been reported to suppress the proliferation of T lymphocytes. To evaluate the preventive effects of MMF and DCZ in early stages of bleomycin (BLM)-induced scleroderma. This study involved five groups of Balb/c mice (n = 10 per group). Mice in four of the groups were injected subcutaneously (SC) with BLM [100 μg/day in 100 μL phosphate-buffered saline (PBS)] for 4 weeks; the remaining (control) group received only 100 μL PBS. Three of the BLM-treated groups also received either intraperitoneal MMF 50 or 150 mg/kg/day, or SC DCZ 100 μg/week. At the end of the fourth week, all mice were killed, and blood and tissue samples were obtained for further analysis. In the BLM-treated group, increases were seen in inflammatory-cell infiltration, α-smooth muscle actin-positive (α-SMA+) fibroblastic cell count, tissue hydroxyproline content, and dermal thickness. Dermal fibrosis was histopathologically prominent. In BLM-treated mice also given MMF or DCZ, inflammatory-cell infiltration, tissue hydroxyproline content and dermal thickness were decreased. In the MMF groups, decreases were also noted in α-SMA+ fibroblastic cell count. In this BLM-induced dermal fibrosis model, MMF and DCZ treatments prevented the development of dermal fibrosis. Further studies are needed to evaluate whether targeting T lymphocytes is effective in resolving pre-existing fibrosis in human scleroderma.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
How to read .runsettings test parameter in xUnit fixture
I'm writing xUnit unit test cases for a dotnet core application which uses DocumentDB (CosmosDB) as storage. The unit test are written to execute against the local cosmos db emulator. On the Azure DevOps build environment, I've setup the Azure Cosmos DB CI/CD task which internally creates a container to install the emulator. However, I'm not able to figure out that how the endpoint of emulator can be passed to xUnit fixture?
Is there any way through which xUnit fixture can read the .runsettings test parameters or parameters can be passed via other source?
Update
Currently, I implemented the scenario using Environment Variable but still not happy to define the connection string as a environment variable using powershell in build task and read it in through code during unit test execution. I was thinking if there could be another way of achieving it..
Below snapshot shows how the build tasks are configured currently as workaround to achieve the desired:
And code to read the value as
var serviceEndpoint = Environment.GetEnvironmentVariable("CosmosDbEmulatorEndpointEnvironmentVariable");
Since, UnitTest task provides the option to pass .runsettings/.testsettings with option to override the test run parameters so was thinking it something can be achieved using those options.
A:
This is not supported in xUnit.
See SO answers here and here, and this github issue indicating that it is not something that will be supported in xUnit.
A:
Currently, I implemented the scenario using Environment Variable but still not happy to define the connection string as a environment variable using powershell in build task and read it in through code during unit test execution. I was thinking if there could be another way of achieving it..
Below snapshot shows how the build tasks are configured currently as workaround to achieve the desired:
And code to read the value as
var serviceEndpoint = Environment.GetEnvironmentVariable("CosmosDbEmulatorEndpointEnvironmentVariable");
Since, UnitTest task provides the option to pass .runsettings/.testsettings with option to override the test run parameters so was thinking it something can be achieved using those options.
|
{
"pile_set_name": "StackExchange"
}
|
A1 Racer Beats Boeing 777 In Runway Showdown
A Boeing 777 jet and an A1 Grand Prix racer clashed at the Auckland International Airport in New Zealand to see which was the faster machine. The Boeing got a headstart down the runway for the first race, and defeated the A1 handily. When the starting points were equal, however, the A1 emerged as the victor, reaching a top speed of 285 km/h (versus 270 km/h for the Boeing). And is it just me, or does watching this news piece give you a strange urge to watch Flight of the Conchords? [TV New Zealand via Jalopnik]
Trending Stories Right Now
Video. Pretty much anything can be improved by adding Jeff Goldblum, but Taika Waititi's Thor. Ragnarok really used the actor to his fullest potential. Marvel has been releasing a few of their bonus clips from the upcoming Blu-ray release, and with them we get to see Goldblum at his... Goldblum-iest.
Star Wars and toys have gone hand in hand ever since the franchise kicked off four decades ago. But usually, it's the movies dictating what we see on store shelves - not the other way around. But in one particularly odd case, it ended up being that way for The Last Jedi.
|
{
"pile_set_name": "Pile-CC"
}
|
Company Description
Americo Manufacturing Company, headquartered in Acworth, Georgia, is a world leading manufacturer of environmentally friendly cleaning products such as synthetic and natural fiber floor pads, hand pads, utility pads and floor matting. 100% of the polyester fib...more
|
{
"pile_set_name": "Pile-CC"
}
|
In episode 158 of the podcast astrologers Kelly Surtees, Austin Coppock, and Chris Brennan discuss the astrological forecast for June of 2018, which features a prominent Mars retrograde period beginning in Aquarius.
This episode was recorded a couple of weeks ago, just before we all left for the United Astrology Conference in Chicago. The conference was a blast, and we are hoping to record a post-conference recap discussion sometime soon.
We also recorded a live episode of the podcast in front of an audience at the conference, and that will be released as one of the early episodes of June pretty soon as well.
This forecast episode of the podcast is available in both audio and video formats, and you can find links to both below.
Major Alignments for June
Here are the major astrological alignments for June:
June 5, Sun conjunct Mercury, 15 Gemini (Sun-Mercury is almost perfectly square Neptune! And the Moon is conj Neptune on the same day as the cazimi. )
June 8, Mars deep in shadow, conj South Node, Rx station 7 Aquarius
June 12, Mercury into Cancer
June 13, Venus into Leo
June 13, Gemini New Moon 22 degrees
June 18, Neptune station, 16 Pisces
June 21, Sun into Cancer (solstice)
June 26, Mars station, 9 Aquarius
June 27, Sun opposite Saturn 5 Cancer/Cap
June 28, Capricorn Full Moon 6 Cap (conjunct Saturn)
Auspicious Electional Chart for June
The auspicious election this month is set for:
June 11 2018 at 7:30 AM with Cancer rising
There are three more electional charts that we found for June, which will be presented in our private subscriber-only podcast on auspicious elections that was released last week.
If you would like to get access to that discussion, then all you have to do is become a patron of The Astrology Podcast on the $5 or $10 tier through our page on on Patreon, and then you will get access to the 40-minute Auspicious Elections Podcast immediately.
Watch the Video Version of this Episode
Here is the video version of this month’s forecast episode:
Listen to the Audio Version of This Episode
You can either play this episode of the podcast directly from the website or download it as an MP3 to your computer by using the buttons below:
Share this: Facebook
Twitter
Reddit
Email
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
When is the adjoint to a monoidal functor monoidal?
Let $\mathcal C,\mathcal D$ be monoidal categories. Recall that a functor $F : \mathcal C \to \mathcal D$ is lax monoidal if it is equipped with maps $1_{\mathcal D} \to F(1_{\mathcal C})$ and $F(X) \otimes_{\mathcal D} F(Y) \to F(X \otimes_{\mathcal C} Y)$, the latter natural in $X,Y\in \mathcal C$, compatible with associators and unitors. It is oplax monoidal if it is instead equipped with maps in the other direction, and strong monoidal if it is equipped with isomorphisms. For each choice of lax/oplax/strong, there is a bicategory of monoidal categories, lax/oplax/strong monoidal functors, and monoidal natural transformations.
Suppose that $F : \mathcal C \to \mathcal D$ is one of lax/oplax/strong monoidal, and also admits a left adjoint $F^L$ in the bicategory of all functors. Under what circumstances is $F^L$ naturally lax/oplax/strong monoidal? Under what circumstances does this adjunction come from an adjunction in the bicategory of monoidal categories and lax/oplax/strong monoidal functors?
A:
If $L$ and $R$ are a left and right adjoint, then doctrinal adjunction asserts that $L$ is oplax monoidal iff $R$ is lax monoidal. (I'm being a bit imprecise here, treating monoidality as if it were a property instead of a structure, but hopefully the meaning is clear.)
|
{
"pile_set_name": "StackExchange"
}
|
Taiwan Times Village
The Taiwan Times Village () is a museum in Caotun Township, Nantou County, Taiwan.
Exhibitions
The museums exhibits the past life of Taiwan, which includes the life of Hakka, Hoklo, Taiwanese aborigines and veterans from Mainland China in different community blocks.
Transportation
The museum is accessible from Highway 3.
See also
List of museums in Taiwan
References
Category:Museums in Nantou County
|
{
"pile_set_name": "Wikipedia (en)"
}
|
3.6 - The Lazarus Experiment
Rating
Votes
10
1%
1
9
2%
2
8
3%
3
7
27%
28
6
18%
18
5
32%
33
4
16%
16
3
0%
0
2
1%
1
1
0%
0
Average Rating
5.8
Votes
102
Synopsis
From IMDB:
A 76 year old scientist, Doctor Lazarus of LazLabs, has created a device to restore youthfulness. However, the process doesn't go as planned. The Doctor and Martha must stop Lazarus before its too late.
There is some over the top criticism of this episode in my opinion. I do agree with some of the reasons it gets criticised but some people overstate the issues I think while others, like me, acknowledge some positives whilst being realistic about its shortcomings.
The first 20 minutes of this episode are great. It basically is a body horror like 'The Fly' where a mad scientist carries out an experiment on himself which goes wrong and causes them to turn into a monster. It harks back to greats like The Brain of Morbius where they took aspects of Frankenstein and made a superb horror based Doctor Who story. The build up through the first half of the episode is excellent in many ways. That horror feel permeating the episode which could be traced back as far as Dr. Jekyll and Mr. Hyde as well as 50s science-goes-wrong movies and 80s body horror films, is perfect for a Doctor Who episode. It feels hugely promising up up to and including the initial change by Dr. Lazarus into a monster. The transformation scene is great and evokes yet another horror classic An American Werewolf in London for a moment before cleverly leaving the finished appearance of the creature to the imagination. The husks of bodies from the creature's victims is effectively repulsive too. All is set up for a classic episode despite a couple of less interesting scenes along the way. With a great second half and a well designed monster this would have been awesome. The acting is also great as guest stars Mark Gatiss and Thelma Barlow put in fabulous performances as well as regulars David Tennant and Freema Agyeman. Gugu Mbatha-Raw is solid as Martha's sister too though the character is weak and a pale shadow of the wonderful Martha.
The problems begin when we see the monster properly. It is not so much the CGI which is at fault, it is the design of the creature. It is reasonably scary looking but is unconvincing and over the top. The idea that it is a genetic throwback from Lazarus's DNA is a nice idea but a huge scorpion like beast just seems the wrong thing entirely. It wastes the opportunity for a terrifying and believable body horror.
In addition the plot goes nowhere once the monster arrives. It goes straight into a big monster on the loose action sequence that then seemingly ends only to repeat in an overly similar sequence in Southwark Cathedral which has a rather silly resolution. The acting maintains its quality when Gatiss and Tennant get their moments towards the end but the episode overall has by then dropped away from the promise shown earlier on. It would have been much better with some good make up and a scary but basically humanoid monster. Gatiss could have carried it off well and it could have been fabulous and frightening as well as thoughtful. Instead it went overboard on the monster and its marauding about. What a pity. I still give credit for the great first half, the ideas and the acting but a possible 10/10 drops down to a 7/10 for me.
While The Lazarus Experiment has a nice central premise, and a superb guest turn from Mark Gatiss, it's a story that, sadly, leaves the viewer underwhelmed with it's simple plot, strange structural choices and some flat out baffling design decision.
The idea of a scientist rejuvenating himself is a sound one, and follows the RTD principle of taking an aspect of modern-day life (this time plastic surgery) to bizarre levels. However, the story has no real momentum, despite the lightning fast pace. As such, the whole thing ends up feeling hollow: nothing more than surface details to both plot and character. It doesn't help that the final 15 minutes appear to have been tacked on at last minute, leading to a conclusion that falls flat because we've already been through one seemingly definitive conclusion. Then, there's all the forced (and I mean forced) set-up for the finale, which just doesn't work, because it lacks total subtlety. Every scene draws attention to it, instead of integrating it into the narrative successfully. This was also the episode where it became apparent that Martha's family just don't work at all. They're so one-note and bland, and Russell spent no real time building them up that it just feels like a waste. Whereas Rose and Donna's family's at least try to ground themselves in reality (even if with Jackie, Pete and Mickey it felt like Russell was hitting you over the head with it), but Martha's family are built out of stock clichés from Eastenders.
Overall, while The Lazarus Experiment shows some promise, it just fails to deliver on that promise to any extent. Lazy storytelling and characterisation couple with some terrible CGI (seriously, that Lazarus creature?) and the usual Tennant era irritants to make a poor story that could have been so much better.
I think the problem with this is it goes onto long. After 30 minutes the ambulance goes off and you think it's all over, you could wrap up there, another five minutes to resolve everything like the Doctor telling Martha she can go with him on his next adventure but basically the run around in the church just repeats the chase in the building for no real good reason. I think that's the main flaw, but also the monster is crap CGI, Martha's sister fancying the younger Lazarus (despite the older one being a creep) and Martha's mother's overreaction to the Doctor (how dare you talk to any man!) are details that just don't help. Just not a strong story and too long by about 10-15 minutes.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
How to prevent ServiceStackVS to add ApiResponse attribute on generated DTOs?
How to prevent ServiceStackVS to add ApiResponse attribute on generated DTOs?
A:
You can choose which attributes are exported by either adding or removing them from the NativeTypesFeature plugin, e.g The Swagger API attributes can be removed in AppHost.Configure() with:
var feature = this.GetPlugin<NativeTypesFeature>();
feature.MetadataTypesConfig.ExportAttributes.RemoveWhere(
x => x is ApiAttribute ||
x is ApiMemberAttribute ||
x is ApiResponseAttribute);
|
{
"pile_set_name": "StackExchange"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.