title stringlengths 1 1.19k | keywords stringlengths 0 668 | concept stringlengths 0 909 | paragraph stringlengths 0 61.8k | PMID stringlengths 10 11 |
|---|---|---|---|---|
Data sources for process evaluation. | PMC10629640 | |||
Study setting | Fourteen health centers in eastern Ghana that provided antenatal care were included in the GRAND study. Only the 7 sites randomized for the group ANC intervention were included for collection of process evaluation data since the evaluation was of group ANC implementation. Research team members traveled to the health facility intervention sites to observe group ANC meetings (completing the Fidelity and Learning Methods Checklists), to conduct interviews with the midwife facilitators and facilitate focus groups with group ANC pregnant participants. | PMC10629640 | ||
Participants | PMC10629640 | |||
Midwife facilitators | Midwife facilitators In order to assess fidelity to the model of group ANC and to determine if all content was covered, structured observations were conducted by research team members with midwife facilitators as participants. Inclusion criteria was; being a midwife who had completed training was facilitating group ANC meetings and desire to participate as participation was voluntary. During a group ANC meeting, the research team member observed using the Fidelity Checklist and Learning Methods Checklists described below. Following the group ANC meeting, the midwives participated in an interview with the research team member who used a semi-structured interview guide. Demographic data was not collected from participants and any identifiers in the transcripts were de-identified prior to analysis. | PMC10629640 | ||
Women participating in Group ANC | For the outcome evaluation, data were collected from all women participating in group ANC with a corresponding number of participants at the control groups sites. Outcome data collection is still underway. However, for the process evaluation, focus group data was collected from a subset (1–2 groups) of participants enrolled from each of the intervention arm sites of the GRAND study. Focus groups were not conducted with participants in routine ANC at the control group sites as the goal was to gather information regarding group ANC. While demographic and health data were collected for the outcome evaluation, participants in the focus groups were not identified as individual participants in the focus group transcripts. Any identifiers such as midwife or health facility names were removed from the transcripts prior to analysis. | PMC10629640 | ||
Data collection process | PMC10629640 | |||
Structured observations | A sample of group ANC meetings were observed for each midwife facilitator to monitor fidelity to the model. Beginning with the initial groups in fall 2019, and continuing at intervals throughout the study period, members of the Ghana research team who had also participated as champion trainers traveled to the intervention site health facilities to observe the facilitation of group ANC meetings. Observations occurred during one of the later (5, 6 or 7) group ANC meetings. Observations included whether content was delivered as intended, whether women were encouraged to actively participate in group discussions and activities, whether picture cards were used as written in the Facilitators Guide, and whether feedback was provided to participants during demonstrations. During these observations the research team members completed both the Fidelity Checklist Scale and the Learning Methods Checklist ( | PMC10629640 | ||
The fidelity checklist | This scale consists of 7 items scored as “Always”, “Sometimes” or “Never”. The items identify whether or not the midwife facilitator is using the techniques taught to encourage group dynamics and discussion. For example, the midwife should sit in the group rather than stand when conducting the meeting. Additional space is available for comments at the bottom of the Fidelity Checklist ( | PMC10629640 | ||
The learning methods checklist | This is a 16-item checklist that identifies whether or not the midwife follows the format spelled out in the group ANC Facilitators Guide. The format is intentionally prescriptive to ensure all topics are adequately covered and there is group discussion around the topics. For this checklist, observers were instructed to place a check mark if the item was observed. Additional space is available for comments ( | PMC10629640 | ||
Interviews | A face-to-face semi-structured interview was completed with a midwife facilitator from each intervention site (N = 7) following the structured observation of the group ANC meeting The purpose was to explore the midwives’ perceptions of which components of the intervention were successfully implemented, to identify barriers and facilitators to implementation and to give suggestions for improvement. No personal data such as demographic information was collected from the participants, all of whom were licensed midwives working in the healthcare sector in Ghana. Informed consent for the interviews was obtained from the midwife facilitators and participation was voluntary. The interviews were conducted in English by a member of the research team using the semi-structured interview guide (included in | PMC10629640 | ||
Tracking logs | A brief form was completed by the midwife facilitator each time a group ANC meeting was held to track the date of the meeting and the number of participants from the group in attendance. This measured “dose”, or amount of the intervention each participant received for analysis of outcomes as well as feasibility by determining if participants were able to attend all or most of the group ANC meetings ( | PMC10629640 | ||
Focus groups | For each intervention site at least one focus group discussion was held with pregnant women participating in group ANC. These focus groups, conducted by a member of the research team trained in qualitative data collection methods, were held at the end of the group ANC meeting and were voluntary; women were welcome to leave the group if they did not want to participate. Using an open-ended question guide (included in | PMC10629640 | ||
Data analysis | Quantitative data (Fidelity Checklist and Learning Methods Checklist) were collected by the research team members during the observation of the group ANC then entered into an Excel spreadsheet. Data were analyzed descriptively to assess whether certain items, midwives, or intervention sites were performing less well when compared to others. Tracking logs were completed by the midwife facilitators, collected by the research assistants and also entered into an Excel spreadsheet. Data were analyzed descriptively by how many group ANC meetings each participant attended.To analyze the qualitative data from the focus groups and interviews, a qualitative comparison approach was used. Qualitative comparison is useful when more than one standpoint of a phenomenon is of interest [ | PMC10629640 | ||
Ethics statement | The study aims and design were developed in collaboration with community members of the research team. The study was approved by the Ethical Review Committee of the Ghana Health Service and the University of Michigan Institutional Review Board (HUM00161464).With IRB approval, oral consent was obtained from participants due high rates of illiteracy among Ghanaian women. The informed consent document was read aloud individually to all potential participants in their local language by Ghanaian research assistants. Using a teach-back method to confirm comprehension, the RAs then asked potential participants questions to ensure understanding of the research process and informed consent document, inviting questions until the information was clear. A health facility staff member signed that they were present while the benefits, risks, and procedures were read to the participant, that all questions were answered, and that women voluntarily agreed to take part in the research. For the midwives participating in the interviews, written consent was obtained in English. | PMC10629640 | ||
Results | PMC10629640 | |||
Checklists | The Fidelity Checklist consists of 7 items intended to assess whether the facilitator uses techniques intended to encourage group dynamics and discussion. A total of 32 Fidelity Checklist Scales were completed by the champion trainers as they observed group ANC meetings among the intervention sites. The majority of the items were ranked as “Always” (177/224 responses), “Sometimes” (36/224 responses) with 11 missing responses. None of the responses were marked “Never”. The item that scored the lowest with the most “Sometimes” vs. “Always” was item 4 “Follows the steps as written in the Facilitators Guide” ( | PMC10629640 | ||
Fidelity scale scoring. | The Learning Methods Checklist with 16 items identifies which steps may have been missed in the meeting format. In most cases, observers indicated that all steps were followed, with only two observations indicating that the midwife did not “Go through the what and why” step of explaining what actions are needed when a problem arises and why those actions are taken. However, some checklists included comments that reminders were given by the observers, such as to | PMC10629640 | ||
Tracking logs | There was a total of 70 groups tracked across the 7 intervention sites between August 2019 and April 2022 ( | PMC10629640 | ||
Tracking logs. | PMC10629640 | |||
Interviews with midwives | One-to-one interviews using a semi-structured interview guide were conducted by research team members with group ANC midwives at each of the 7 intervention sites (N = 7). Three themes were identified: 1) information sharing, 2) sense of community, and 3) time management challenges. | PMC10629640 | ||
Information sharing | Midwives identified that they enjoyed sharing information with participants in a setting that offered the opportunity for group participation | PMC10629640 | ||
Sense of community | Midwives felt that group ANC was beneficial in creating a sense of community among the women where information and support was coming from other women and not just from the midwife | PMC10629640 | ||
Time management challenges | Midwives indicated that starting on time was a challenge because not all of the women were there on time, and they needed to decide whether to finish all the material or end on time. They expressed optimism that time management would get easier with subsequent meetings: | PMC10629640 | ||
Focus groups with participants | A total of 10 focus group discussions with a total of 92 participants (5–13 women per group) were conducted after the final group ANC meetings. One focus group was conducted at 4 intervention sites and 2 focus groups were conducted at 3 of the sites. Some women in the groups had already delivered and attended with their newborns. Focus groups lasted approximately 30 minutes. Participants were overwhelmingly positive about their participation in group ANC and hoped it would continue. Qualitative, thematic analysis of focus group data revealed that participant experiences resulted in three themes identical to those in the midwifery interviews: 1) sense of community, 2) information sharing, 3) time management challenges, and an additional theme unique to the pregnant women; 4) disconnect. | PMC10629640 | ||
Sense of community | Some participants expressed initial reluctance to participate that was quickly overcome. “Participants in each group expressed their happiness that the midwives demonstrated respectful maternity care. Women came back after their babies were born to share with others. They expressed a desire to continue group ANC so other women could participate. “Participants enjoyed meeting new friends and relied on others for support. | PMC10629640 | ||
Information sharing | Participants were able to recall all topics covered. What is evident from the data is that it was important to participants that the Participants expressed enthusiasm for the group ANC model of care where participants check one another’s blood pressure and weights with the supervision of the midwife, expressing feelings of empowerment and agency. Participants in group ANC are given a booklet to take home as a helpful reminder of things they learn in the meetings. Women who had experienced traditional ANC in prior pregnancies indicated that group ANC was preferred. Participants expressed greater knowledge acquisition and feelings of support during group ANC. “ | PMC10629640 | ||
Time management challenges | Similar to the interviews with midwives, this issue was mentioned in every group. Participants shared that it was hard for them to arrive on time. | PMC10629640 | ||
Disconnect | At times participants who had already given birth saw a disconnect between the group ANC teaching and the birth experience. In other words, participants were empowered to advocate but on the maternity ward they were not always treated with respect. One participant recalled being discounted by the staff: “ | PMC10629640 | ||
Discussion | Maternal and infant mortality in LMICs remains unacceptably high and women and infants that survive pregnancy and childbirth often suffer long term sequalae. Often, the traditional approach to ANC provides little in the way of education and counseling about health-promoting behaviors. To provide the most benefit, ANC must provide quality care that is respectful and valued by both the provider and the patient.Group ANC models of care have been implemented successfully in LMIC countries with promising, but not consistent outcomes [Feasibility of implementing group ANC has been explored previously and our results are similar [ | PMC10629640 | ||
Facilitators and barriers | PMC10629640 | |||
System | Training adequate numbers of facilitators in this model of group ANC can be time consuming and costly. Using a train-the-trainer model of implementation, we were able to train champion trainers who then trained midwives at the intervention sites which increased efficiency. Training workshops occurred in small groups similar to the model of group ANC meetings so they could practice the facilitation techniques.A concern expressed by the participants as well as the midwives was that of time management. Midwives stated that often women did not come on time. Some participants were frustrated when they came on time and the meeting did not start at the allotted time while others had issues with being on time due to transportation issues. Strategies for time management were addressed in “reminder” messages sent to the midwife facilitators. | PMC10629640 | ||
Midwives | The midwives were able to administer the group ANC curricula with fidelity to the format using the techniques they learned and practiced in the training. The midwives that were interviewed all expressed a preference for group ANC over the standard, individual care model, feeling like it resulted in more education and a stronger sense of community. Each midwife was given a Facilitators Guide which they indicated helped them to cover everything in each meeting. The majority of midwives followed the steps of the ANC visit according to the Facilitators Guide, however there were some components that needed to be reinforced. This included the midwife asking open ended questions to facilitate discussion which may be contrary to the traditional educational delivery approach.In the majority of cases, the midwives conducted the meetings in accordance with the group ANC model of care. The midwives delivered the content intended for that meeting and the observers noted that the pregnant women were encouraged to participate in group discussions. At times, activities such as demonstrations were omitted due to time constraints. The midwives utilized the picture cards and the Facilitators Guide consistently.In Ghana, it is common for midwives to either work in the antenatal or intrapartum area and not in both. Because of that, some participants who gave birth before the final meeting focus group session described a disconnect between what they learned in the meetings and the care they received at the time of birth. Future implementation of group ANC should include training and information for midwives attending births as well as those in the ANC clinics. | PMC10629640 | ||
Pregnant women | The research team was able to recruit pregnant participants willing to enroll in the study and participate in group ANC despite some delay due to the COVID pandemic. Of the participants, the majority attended four or more of the 8 meetings. One approach to encouraging attendance was reminder texts and phone calls by the midwives, although reasons for non-attendance were not collected. Given that the traditional model of ANC in Ghana included 4 visits, attendance at 8 visits by more than 1/3 of the women is encouraging. Women who participated in group ANC voiced enthusiasm for the model of care and wished for it to continue. Having the opportunity to tell stories, voice opinions and ask questions in the group gave them a sense of empowerment as did self-checking blood pressures and weights. They enjoyed having materials to take home to share with friends and family. One of the most salient findings was that group ANC created a sense of community and also a connection to the midwives that they did not experience with prior antenatal care. | PMC10629640 | ||
Limitations | Implementation of the group ANC intervention and the ensuing process evaluation were impacted by the pandemic, as described above. However, the research team in Ghana and the midwife facilitators were committed to the program success. Fortunately, most of the group meetings were held outside which limited risk of COVID transmission and participants and midwives were required to wear masks during the meetings. While attempts were made by the midwives and research assistants to reach who stopped attending meetings, we do not have data on reasons for discontinuation and can only speculate that while some miscarried or moved, others may have not enjoyed or been dissatisfied with group antenatal care.Process evaluations are increasingly incorporated into health intervention research, providing value by documenting the barriers and facilitators of the intervention components [ | PMC10629640 | ||
Conclusion | Significant shifts in clinical practice do not happen easily or quickly. Valid, reproducible evidence must exist for practice guidelines to change. Implementation of group ANC in this context was not without challenges, one of which was time management, however our findings contribute to the growing evidence that group ANC in LMICs is safe, feasible and that women find it beneficial. We advocate for future research focusing on the scale-up of group ANC in LMICs to address the unacceptable high rates of maternal and newborn mortality. | PMC10629640 | ||
Supporting information | PMC10629640 | |||
Fidelity checklist. | (DOCX)Click here for additional data file. | PMC10629640 | ||
Learning methods checklist. | (DOCX)Click here for additional data file. | PMC10629640 | ||
Tracking log. | (DOCX)Click here for additional data file. | PMC10629640 | ||
Consolidated criteria for reporting qualitative research (COREQ) checklist. | (DOCX)Click here for additional data file. | PMC10629640 | ||
PLOS ONE questionnaire on inclusivity. | (DOCX)Click here for additional data file. | PMC10629640 | ||
Abstract | PMC10278510 | |||
Background | cancer, Type 2 diabetes, T2D | CANCER, TYPE 2 DIABETES | Undiagnosed Type 2 diabetes (T2D) has been associated with advanced stage cancer at diagnosis, higher mortality, and lower long‐term all‐cause survival. This was a RCT pilot study to examine the feasibility of a nurse‐led T2D intervention for adults with newly diagnosed cancer (≤3 months), and T2D, undiagnosed or untreated with medication, conducted at an outpatient oncology clinic affiliated with a large academic institution. | PMC10278510 |
Methods | diabetes | DIABETES | Participants needed to meet the eligibility criteria including a HbA1c level between 6.5% and 9.9%. Randomization was 1:1 to a 3‐month intervention that consisted of nursing‐led diabetes education and immediate initiation of metformin versus referral to primary care for usual care (control). | PMC10278510 |
Results | Three hundred and seventy nine patients were screened using EHR, 55 agreed to participate, and 3 had eligible HbA1c levels and were randomized in the study. Primary reasons for study exclusion included life expectancy ≤2 years (16.9%), current use or inability to tolerate metformin (14.8%), and abnormal labs that contraindicated metformin use (13.9%). | PMC10278510 | ||
Conclusion | cancer, Type 2 diabetes, T2D, Nelson | CANCER, TYPE 2 DIABETES, RECRUITMENT, NELSON | This study was not feasible due to recruitment inefficiencies, but acceptable to all who qualified.Undiagnosed Type 2 diabetes (T2D) has been associated with advanced stage cancer at diagnosis, higher mortality, and lower long‐term all‐cause survival. This was a pilot RCT study to examine the feasibility of a nurse‐led T2D intervention for adults with newly diagnosed cancer (=3 months), and T2D, undiagnosed or untreated with medication, conducted at an outpatient oncology clinic affiliated with a large academic institution. This study was not feasible due to the cost, time, and personnel needed to screen participants with a point‐of‐care HbA1c test.
Lisa Scarton and Tarah Nelson should be considered joint first author. | PMC10278510 |
BACKGROUND | diabetes, T2D, cancer, Cancer | DIABETES, CANCER, CANCER | Cancer and diabetes are highly prevalent in the United States.Nurses are uniquely positioned to fill critical gaps between T2D and cancer care. A nurse‐led intervention using first‐line treatment for T2D may improve the current standard of care to detect and manage undiagnosed T2D in newly diagnosed cancer patients. | PMC10278510 |
METHODS | PMC10278510 | |||
Study design and population | diabetes, cancer, T2D, RA | CANCER, PCP, DIABETES | This was a pilot, parallel‐group randomized controlled trial (RCT) feasibility study in adults with newly diagnosed cancer and undiagnosed or untreated T2D to test a nurse‐led 3‐month intervention for managing T2D. The study took place from November 2020 to November 2021, with a pause due to COVID‐19 restrictions and research assistant (RA) training from December 2020 to April 2021. The extensive RA training was conducted by the primary investigator, a nurse with expertise in T2D, and consisted of, among other topics, informed consent, T2D education, and point‐of‐care (POC) HbA1c testing based upon study protocol. Patients were first prescreened using the electronic health record (EHR) and then screened in‐clinic at an academic‐affiliated outpatient oncology clinic We planned to screen approximately 800 adults and recruit a sample of up to 40 with a goal of retaining 32 subjects (≥80%). This sample size would have sufficient power (80%) to detect a Type I error of 0.05 with an effect size of 1. No interim analysis was planned.Participants meeting the prescreening criteria (Table The nurse‐led 3‐month intervention consisted of diabetes education and standard metformin initiation. Participants received information on how to take metformin using a standardized titration protocol, potential side effects of metformin, and how to measure their blood glucose levels using a glucometer. Prescriptions for both metformin as well as a blood glucose testing kit were given to participants. The oncology visit note, HbA1c testing results, and study enrollment status were relayed to the participant's PCP. Participants were contacted by a nurse weekly by phone for the first month and then once monthly for 2 months to monitor metformin use, potential side effects, and answer any questions. Phone calls lasted approximately 15 min. Participants were also asked for a pill count to monitor medication adherence and their blood glucose logbook was reviewed.Participants in the usual care group were referred to a PCP for T2D management. The oncology visit note and HbA1c testing results were relayed to the participant's PCP. Participants were contacted weekly by phone for the first month and then once monthly for 2 months to discuss their status. The trial was registered in | PMC10278510 |
Feasibility metrics | diabetes | RECRUITMENT, DIABETES | Recruitment efficiency, retention rates, acceptability, and diabetes self‐management were assessed. At the 3‐month follow‐up, all participants completed a valid and reliable study acceptability scale that included topics such as (1) screening process; (2) time commitment; (3) education content; and (4) patient satisfaction (scores >8 indicated adequate acceptability). | PMC10278510 |
Statistical analysis | The data, stored in the REDCap database, were exported to R statistical software for analysis. R studio version (2022.02.2 + 485) was used to calculate descriptive statistics for feasibility metrics (frequency, percentage, mean) and sociodemographic characteristics of screened patients. Pretest and posttest HbA1c levels were reported. Fisher's exact tests were performed to compare characteristics between participants that agreed to in‐clinic screening versus those that declined. | PMC10278510 | ||
RESULTS | PMC10278510 | |||
Participants | leukemia or pancreatic cancer | A total of 379 patients were screened using the EHR, 94 patients met criteria and were approached in clinic with 59% (55/94) agreeing to POC HbA1c testing. Primary reasons for study exclusion during prescreening included life expectancy ≤2 years and patients diagnosed with leukemia or pancreatic cancer (16.9%), current use or inability to tolerate metformin (14.8%), and abnormal labs that contraindicated metformin use (eGFR, AST/ALT) (13.9%). No significant demographic differences were noted between patients that agreed versus patients that declined to participate (Table Baseline characteristics among patients screened in clinic.
| PMC10278510 | |
Feasibility metrics |
CONSORT diagram.
| PMC10278510 | ||
After 3 months, the HbA1c level of the intervention group participant ( | PMC10278510 | |||
DISCUSSION | cancer, comorbidity, T2D, diabetes | CANCER, DIABETES | This pilot study was closed due to failing feasibility metrics. The largest barrier was identifying eligible patients with POC HbA1c determinations. One way to improve identification of future patients would be to integrate HbA1c testing into order sets for all newly diagnosed cancer patients entering the clinic and broaden the eligibility criteria to a more pragmatic assessment of clinical acceptability for metformin use, rather than only including those with laboratory values within normal limits. This area of research is important because undiagnosed diabetes prior to cancer diagnosis may deteriorate blood glucose level and cause poor prognosis due to difficulty of co‐managing both comorbidity and low healthcare provider contact.Some patients have difficulty prioritizing primary care while undergoing cancer treatment and PCPs may also defer treatment of chronic conditions during this time.A limitation of this study was the small number of eligible patients. While many patients were agreeable to participate, the time needed to screen patients for T2D using POC HbA1c testing was inefficient. Participation may have been affected by the time and burden of a fingerstick blood sample within their first oncology visit. This study was also conducted during the COVID‐19 pandemic which may have had a negative effect on participation. Due to low enrollment, we were unable to make conclusions regarding the HbA1c levels, diabetes self‐management, or participant acceptability of the study.This study was strengthened by the large collaborative, interdisciplinary team. Another strength of this study was T2D screening within their first oncology visit and rapid access to T2D education, glucometer, and treatment with metformin for patients newly diagnosed with cancer without having to coordinate care with their primary providers. In an effort to improve the noted inefficiencies and enrollment, it is recommended that future researchers include HbA1c testing with existing order sets for all newly diagnosed cancer patients entering the clinic and consider assessing and expanding eligibility criteria as appropriate. Also, decreased access to health care is associated with undiagnosed T2D, uncontrolled T2D, and cancer diagnosed at an advanced stage so it is imperative that underserved populations at increased risk of experiencing challenges accessing health care are included in future studies. | PMC10278510 |
CONCLUSIONS | cancer, T2D, diabetes | CANCER, DIABETES | Despite a number of patients being interested in participating, only three were enrolled in this study. This study was not feasible due to the cost, time, and personnel needed to screen participants with a POC HbA1c test. This suggests a willingness and interest for patients to participate, but reliance on POC HbA1c testing is inefficient. While findings were promising, we are unable to make any meaningful conclusions regarding the HbA1c levels, diabetes self‐management, or participant acceptability of the study. However, routine HbA1c screening for all patients newly diagnosed with cancer could identify patients in whom T2D management is indicated. With refinements to this intervention, there remains potential for improving access to T2D care as well as detection and management of undiagnosed T2D for those newly diagnosed with cancer with opportunities for early and safe intervention through nursing led point‐of‐care T2D interventions. | PMC10278510 |
AUTHOR CONTRIBUTIONS | PMC10278510 | |||
FUNDING INFORMATION | Cancer | CANCER | Support was provided by the University of Florida Cancer Center pilot grant CPS‐FY20‐01 and Grant Numbers U54CA233444, U54CA233396, and U54CA233465 from the National Institutes of Health (NIH), National Cancer Institute (NCI). The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH or NCI. | PMC10278510 |
CONFLICT OF INTEREST STATEMENT | No potential conflicts of interest relevant to this article were reported. | PMC10278510 | ||
ETHICS STATEMENT | All participants completed and signed an informed consent form prior to completing the in‐clinic point‐of‐care (POC) HbA1c test. If enrolled in the study, participants then completed and signed a second consent. This pilot study was approved by the IRB of the University of Florida, IRB # IRB201902145. | PMC10278510 | ||
Supporting information |
Click here for additional data file. | PMC10278510 | ||
ACKNOWLEDGMENTS | The authors would like to thank the Biostatistics and Computational Biology Shared Resource at the University of Florida for their statistical support in this study. | PMC10278510 | ||
DATA AVAILABILITY STATEMENT | The data generated from this study are available from the corresponding author upon reasonable request. | PMC10278510 | ||
REFERENCES | PMC10278510 | |||
Subject terms | rheumatoid arthritis, RA | RHEUMATOID ARTHRITIS, PROLIFERATION, INFLAMMATION, DNA DAMAGE, DISEASE, DISEASE, PATHOGENESIS | The pathogenesis of rheumatoid arthritis (RA) is characterized by a Th17/Treg cell imbalance. A pro-inflammatory cytokine milieu that promotes the continued proliferation of Th17 cells is related to the development of autoinflammation. In RA, T cells have several hallmarks of cellular aging, and they accumulate DNA damage, predisposing to the occurrence of mutations and epigenetic alterations. Since the onset, progression, and treatment response are influenced by a variety of external stressors and environmental factors, this study aimed to evaluate the impact of 8-week yoga practice on disease severity, T cell subsets, markers of T cell ageing and inflammation, epigenetic alterations and gene expression patterns in active RA patients on standard disease-modifying anti-rheumatic drugs (DMARDs). A total of 64 participants with active RA were randomized into 2 groups, yoga group (n = 32) or non-yoga group (n = 32); that were assessed for disease severity, at baseline and after 8 week duration, for Disease Activity Score (DAS28-ESR), T cell subsets [Th17 (CD3+ CD4+ IL17+ RORγt+) cells and Treg (CD3+ CD4+ CD25+ CD127-Foxp3+) cells], markers of T cell aging [aged Th17 cells (CD3+ CD4+ IL17+ RORγt+ CD28−) and aged Treg cells (CD3+ CD4+ CD25+ CD127-Foxp3+ CD28−)], pro-inflammatory markers [IL-6, and IL-17], anti-inflammatory markers [TGF-β, and IL-10], epigenetic alterations [5-methyl cytosine, 5-hydroxymethyl cytosine, and HDAC1] and gene expression patterns [ | PMC10495372 |
Introduction | autoimmune diseases, articular damage, Rheumatoid arthritis, RA, autoimmune disease | DISEASE, AUTOIMMUNE DISEASES, RHEUMATOID ARTHRITIS, CHRONIC INFLAMMATION, AUTOIMMUNITY, PATHOGENESIS, AUTOIMMUNE DISEASE | Rheumatoid arthritis (RA) is a chronic inflammatory autoimmune disease of multifactorial origin that develops due to unfavorable coincidence of genetic, immune, and environmental factorsT helper 17 (Th17) and regulatory T cells (Treg cells) are both differentiated from the same naive CD4+ T cells, but in separate cytokine environments and with distinctive gene expression profilesAn aberrant Treg cell response with a shift towards a Th17 cell response characterizes the disease onset and course. The relationship between the imbalance of Th17/Treg cells and the production of pro- and anti-inflammatory cytokines is important for the onset and/or course of autoimmunity, chronic inflammation, and articular damage in the joints of RA patientsEpigenetic alterations like DNA methylation and histone acetylation accumulate with aging and provide a mechanistic link between immunosenescence and development of autoimmune diseases such as RA. T cell landscape is influenced by epigenetic mechanisms such as alteration in the global 5-methyl cytosine (5-mC) DNA, global 5-hydroxymethyl cytosine (5-hmC) DNA and histone deacetylase 1 (HDAC1) levels, which are susceptible to systemic factors, external stressors and environmental stimuliKeeping in mind the multifactorial etiology, diverse pathogenesis of RA, heterogeneous clinical phenotypes and the therapeutic potential of yoga, we hypothesized that yoga improves clinical outcome in RA by bringing changes in all interconnected biological components and at various levels—molecular, cellular, organ systems, and the person as a whole. With this novel context in mind, this study aimed to investigate the immune-modulatory effects of 8-weeks of yoga practice on disease severity, T cell sub-sets [Th17 (CD3+ CD4+ IL17+ RORγt+) cells and Treg (CD3+ CD4+ CD25+ CD127-Foxp3+) cells], markers of T cell aging [aged Th17 (CD3+ CD4+ IL17+ RORγt+ CD28−) cells and aged Treg (CD3+ CD4+ CD25+ CD127− Foxp3+ CD28−) cells], inflammatory markers [IL-6, IL-17, TGF-β, and IL-10], epigenetic alterations [5-mC, 5-hmC and HDAC1] and gene expression [ | PMC10495372 |
Results | PMC10495372 | |||
Overview of enrollment | A total of 105 individuals were screened for eligibility, out of which 64 were randomized into 2 groups (each group A consort flow diagram of the study. | PMC10495372 | ||
Participants’ baseline characteristics | co-morbidity | DISEASE | Baseline demographic and clinical characteristics of all randomized participants are shown in Table Baseline characteristics. Data were described as frequency (%) for sex, drug therapy, stratification by disease severity, co-morbidity and mean ± SD for others. One asterisk (*) indicates a p-value ≤ 0.05; two asterisks (**) indicate a p-value ≤ 0.01; three asterisks (***) indicates a p-value ≤ 0.001. | PMC10495372 |
Group × gender interactions | DISEASE | There was no significant difference in mean DAS28-ESR values between males and females at baseline (DAS28-ESR values 4.7Gender interactions for change in disease activity after the intervention. Mean change of DAS28-ESR score with 95% CI for males in the yoga and the control groups; p = 0.6629 for between-group differences of change in the study, adjusted for baseline value. Mean change of DAS28-ESR score with 95% CI for females in the yoga and the control groups; p = 0.0211* for the between-group difference of change on the study, adjusted for baseline value. | PMC10495372 | |
Post-intervention differences in disease activity | There was a significant reduction in DAS28-ESR scores among the participants of yoga group [0.49, 95% (0.13 to 0.85)] with a significant interaction of group and time (ηpIntent-to-treat analysis: means (SD) and results of within-group and between-group analysis of primary outcomes ( | PMC10495372 | ||
Post intervention differences in molecular markers | PMC10495372 | |||
T cell subsets | The representative graphics from flow cytometry for Th17 and Treg cells measurements are depicted in Supplementary Fig. Frequency of Th17, Treg, aged Th17, and aged Treg cells in the yoga group and non-yoga group [p value (ns = p > 0.05; *p ≤ 0.05; **p ≤ 0.01;***p ≤ 0.001)]. | PMC10495372 | ||
Markers of immune aging | A significant overall decline in the mean percentage of aged Th17 cells (CD3 | PMC10495372 | ||
Inflammatory markers | There were significant changes observed in various inflammatory markers after 8-weeks of intervention in yoga group as compared to non-yoga group. Pro-inflammatory cytokines like IL-6 [0.54, 95% CI (0.22 to 0.85); ηp | PMC10495372 | ||
Epigenetic alterations | The percentage of global 5-mC was significantly higher in the yoga group as compared to the non-yoga group [−0.72, 95% CI (−1.3 to −0.16); ηp | PMC10495372 | ||
Gene expression levels | The results for expression analysis showed significant downregulation in relative mRNA expression levels of The relative mRNA expression levels of dysregulated transcripts in the yoga group and non-yoga group [p value (ns = p > 0.05; *p ≤ 0.05; **p ≤ 0.01;***p ≤ 0.001)]. | PMC10495372 | ||
Discussion | reduced disease, RA | INFLAMMATION, DISEASE, IMMUNOLOGICAL TOLERANCE, REMISSION, JOINT INFLAMMATION | Our study is the first to highlight the positive impact of yoga on modulation of the T cell subsets, T cell aging markers, epigenetic alterations and associated transcription factors in RA. We found that 8 weeks of yoga practice significantly reduced disease activity, normalized the biomarkers associated with inflammation, and maintained Th17/Treg cell homeostasis. Further, yoga reduced the rate of immunological aging as seen by the reduction in the aged Th17 cell population (CD3+ CD4+ IL17+ RORγt+ CD28-T cells) and aged Treg cell population (CD3+ CD4+ CD25+ CD127-Foxp3+ CD28-T cells). Our findings suggest that yoga positively modified epigenetic changes such as global methylation levels, global hydroxyl methylation levels, and HDAC1 levels which may regulate gene expression patterns. The yoga group showed the downregulation of In the present study, the impact of regular practice of yoga was beneficial as there was a significant reduction in the systemic levels of pro-inflammatory markers (IL-6 and IL-17) and various transcripts associated with pro-inflammatory cytokines. IL-6 is essential for the development of RA's systemic(lung, heart skin, brain) and joint inflammation, immune system abnormalities, and joint swellingYoga is a centuries-old method of unifying the mind, body, and soul. The Patanjali’s ashtanga (eight limb) Yoga includes yama (abstinences), niyama (observances), asana (yoga postures), pranayama (breath control), pratyahara (withdrawal of the senses), dharana (concentration), dhyana (meditation) and samadhi (absorption)The immune dysregulation in RA is attributed to increased secretion of inflammatory cytokines by effector Th17 cells and a loss of Treg cells suppressor function. Yoga's anti-inflammatory properties work to restore immune homeostasis to its ideal state and promote natural immunological tolerance to treat autoimmune diseasesInflammatory changes may be influenced by epigenetic mechanisms that subsequently lead to gene expression alterations and, eventually, protein expressionLack of an active control group was one of the study's shortcomings because the non-yoga group had no equal attention control intervention and only received medication therapy in comparison to the active yoga intervention group. Therefore, including such a group would further rule out the therapeutic results that were specifically linked to the yoga intervention. In both the yoga and non-yoga groups, there were fewer men, which was explained by the fact that women had a higher prevalence of RA than men (3:1). It is challenging to maintain a regular schedule for a long-term RA management or home practice regimen because each session of yoga lasted for 120 min every day while being supervised by a certified yoga instructor. Also, the lack of long-term follow-up of the participants made it difficult to predict how quickly participants returned to their baseline levels. In order to investigate the long-term advantages of the yoga practice, we intend to conduct additional research with a large sample size and long-term follow-ups and practice of yoga for shorter duration.In conclusion, our study findings highlight that yoga possesses an immune-modulatory potential which induces molecular remission and reestablishes immunological tolerance in RA by influencing its pathobiology by optimizing inflammatory markers, maintaining immune-homeostasis, reducing the rate of immune-aging and improving RA health outcome. The 8 weeks of yoga practice significantly reduces disease activity, maintains Th17/Treg cell homeostasis and reduces inflammatory processes by optimizing the levels of various pro-inflammatory cytokines, and anti-inflammatory cytokines with changes in gene expression patterns. Yoga positively modifies the epigenome by elevating global methylation levels, reducing global hydroxyl methylation levels, and HDAC levels which may cause the normalization of dysregulated gene expression. Hence, yoga can be used as an adjuvant therapy in RA as it boosts physical functioning, enhances psychological wellbeing and reestablishes immunological tolerance. | PMC10495372 |
Methods | PMC10495372 | |||
Ethics declarations and study design | RA | DELHI | This study was a prospective, single-blinded, randomized controlled trial with active RA patients, aimed at analyzing the effects of an 8-week yoga practice in RA patients on standard drug therapy. The study was initiated after obtaining ethical clearance (IECPG-211/24.02.2016) from the Institute Ethics Committee of AIIMS, New Delhi, India, and registration under the clinical trials registry, India (CTRI/2017/05/008589, Registered on 17.05.2017). All methods were performed in accordance with the relevant guidelines and regulations. All the participants gave written informed consent before the study protocol's commencement. | PMC10495372 |
Participants and eligibility criteria | RA | DELHI | The study participants were recruited from the outpatient unit of Rheumatology department of AIIMS, New Delhi. RA patients, 18–60 years old, diagnosed as per 2010 ACR/EULAR RA classification criteria | PMC10495372 |
Sample size calculation | EVANS | The sample size calculation for the study assumed to detect a standardized effect size [difference in mean change in DAS28-ESR between the two groups/pooled standard deviation (SD)] of 0.8 with a 95% confidence level and 80% power, considering the mean and SD of a previous study by Evans et al. (2011) | PMC10495372 | |
Randomization | For this investigator blinded study, sequentially labeled sealed opaque envelopes were used to conceal random numbers as described earlier | PMC10495372 | ||
Intervention | The participants were randomized into two groups- the yoga group and non-yoga group. All the study participants were asked to undergo a clinical evaluation and provide a blood sample on day 0 (baseline) and the end of 8 | PMC10495372 | ||
Yoga program (yoga group) | As described previously | PMC10495372 | ||
Usual care control (non-yoga group) | As described previously | PMC10495372 | ||
Outcome measures | PMC10495372 | |||
Primary outcome | DISEASE | The disease activity of the patients was assessed by DAS28-ESRChange in disease severity was measured by disease activity score—erythrocyte sedimentation rate (DAS28-ESR) from baseline (day 0) to 8-weeks and recorded as primary outcome. | PMC10495372 | |
Secondary outcome | All parameters were evaluated on day 0 (baseline) and 8th week (follow-up) of the intervention and the fasting blood samples were obtained at 8 am in the morning.Alterations in cellular and molecular markers including: (a) T cell subset population: Th17 (CD3+ CD4+ IL17+ RORγt+) cells and Treg (CD3+ CD4+ CD25+ CD127− Foxp3+) cells, (b) markers of immune aging: aged Th17 (CD3+ CD4+ IL17+ RORγt+ CD28−) cells and aged Treg (CD3+ CD4+ CD25+ CD127− Foxp3+ CD28−) cells, (c) inflammatory markers: IL-6, IL-17, TGF-β, and IL-10 (d) epigenetic alterations: 5-methyl cytosine, 5-hydroxymethyl cytosine and HDAC1, and (e) gene expression levels: | PMC10495372 | ||
Measurement of molecular markers | Following techniques were employed for the measurement of molecular markers: | PMC10495372 | ||
Phenotyping of T cell subsets by flow cytometry | The isolated PBMCs (1 × 10The isolated PBMCs (1 × 10 | PMC10495372 | ||
Detection of inflammatory and epigenetic markers | Serum levels of IL-6 (Gen-Probe, Diaclone Diagnostic, France), IL-17 (Gen-Asia Biotech, China), IL-10 (Bioassay Tech Laboratory, China), and HDAC1 (Qayee Bio-Technology) were estimated by ELISA using commercially available kits. Briefly, the workflow of the HDAC1 ELISA kit utilizes the sandwich ELISA methodology where the plate was pre-coated with human HDAC1 antibody. The serum samples were then added onto the pre-coated wells. And, then biotinylated human HDAC1 antibody was added, which binded to HDAC1 in the sample. After the addition of Streptavidin-HRP developer followed by substrate and stop solution, the well absorbance for HDAC1 was measured at 450 nm. The 5-methylcytosine DNA ELISA kit (Enzo Life Sciences, Inc., USA) and 5-hydroxymethyl cytosine DNA ELISA kit (Enzo Life Sciences, Inc., USA) was used to quantify the percent 5-mC DNA and 5-hmC DNA respectively. Briefly, the workflow for the 5-mC DNA ELISA kits utilize the indirect ELISA methodology where 100 ng denatured, single-stranded DNA (ssDNA) samples per well were coated on the plate wells and a 5-mC mAb and conjugate HRP-Ab were then added to the wells. The detection of 5-mC was done after the addition of the HRP developer by measuring well absorbance at 405–450 nm. Briefly, the workflow of the 5-hmC DNA ELISA kit utilizes the sandwich ELISA methodology where a 5-hmC pAb was coated to the bottom of plate well surfaces. The ssDNA (100 ng/well) sample was then added onto the well surface which binded to 5-hmC pAb’s and was then recognized by a conjugate DNA HRP-Ab. After the addition of HRP developer, the well absorbance for 5-hmC DNA was measured at 405–450 nm. Serum TGF-β levels were estimated by a magnetic bead-based multiplex assay using Bio-Plex Pro TGF-β Assays (Bio-Rad Laboratories Inc., USA) according to the manufacturer's guidelines. Quality-control assays for biomarkers and validation were performed. | PMC10495372 | ||
Detection of gene expression patterns | As described earlierList of primer sequences.Forward: CCTGGGCTCCTCGCCTGACCReverse: TCTCTCTGCCCTCAGCCTTGCCForward: GTGGCCCGGATGTGAGAAGReverse: GGAGCCCTTGTCGGATGATGForward: CGGCTGGAGAAGATACTGGTReverse: TTAGTCCGAAATGAGGCTGTCForward: GGCACTGGCAGAAAACAACCReverse: GCAAGTCTCCTCATTGAATCCForward: GAAGGGAGACAATCGCTTTAGCReverse: TGTAGACTCCTTCCCGGTTGAGForward: TGCCAGTGCTTGCAGACReverse: TCTTAACCATGGGCGATGCForward: TGGCTTGATCAGCAAGGACTCReverse: GCCCTGAAGAAGAGCCAACAForward: CAGCTTCATGCCTTTGTAReverse: CTCAGAGTGCTCCAAATCTCForward: AACATGCTCAACATCTCCCCReverse: CCGACTCCTCCGACTCTTCForward: TGAGAGGGAAATCGTGCGTGReverse: TGCTTGCTGATCCACATCTGC | PMC10495372 | ||
Statistical analysis | All statistical analyses were carried out on an intent-to-treat basis with the baseline observation carried forward approach using IBM SPSS Statistics for Macintosh, Version 25.0. (IBM Corp. Armonk, NY, United States) and GraphPad Prism Version 6.01. (GraphPad Software, Inc., San Diego, CA). Chi-square test and Fisher’s exact test compared the baseline characteristics between the two groups. The assessment of interaction effects among baseline parameters was carried out by mixed factorial design ANOVA. For within-group analysis, paired t-test was used to study the difference between pre- to post-intervention for normally distributed data, or Wilcoxon signed-rank tests for continuous variables without normal distribution. For between-group analysis, the repeated measure ANOVA was used to study the intervention effects along with the interaction of time and group. A | PMC10495372 | ||
Supplementary Information | The online version contains supplementary material available at 10.1038/s41598-023-42231-w. | PMC10495372 | ||
Acknowledgements | We are grateful to our yoga therapist, Ms. Richa Mishra, for her patience and expertise in managing the patients and to all the patients who participated in this study. | PMC10495372 | ||
Author contributions | Conceptualization, S.G. and R.D.; methodology, S.G., R.K., and S.K.; data analysis, S.G., R.K. and S.K.; investigation, S.G., R.K., and S.K.; resources, U.K. and K.L.; writing—original draft preparation, S.G.; writing—review and editing, all authors.; visualization, R.D.; supervision, K.L., U.K., and R.D.; project administration, S.G., and R.D.; All authors have read and agreed to the published version of the manuscript. | PMC10495372 | ||
Funding | We are thankful to the Department of Science and Technology (DST), India [SR/SATYAM/55/2016] for funding provided to RD. SG is supported by the Senior Research Fellowship (SRF) [45/2/2019-ANA/BMS] awarded by the Indian Council of Medical Research (ICMR), India. The funders had no role in the decision to publish or preparation of the manuscript. | PMC10495372 | ||
Data availability | The datasets used and/or analyzed during the current study available from the corresponding author on reasonable request. | PMC10495372 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.