title stringlengths 1 1.19k | keywords stringlengths 0 668 | concept stringlengths 0 909 | paragraph stringlengths 0 61.8k | PMID stringlengths 10 11 |
|---|---|---|---|---|
Ethics Approval | NCAIDS/China | Ethics approval was obtained from the review board of the National Center for HIV/STD Control and Prevention, China CDC (NCAIDS/China CDC, Ethical Approval Number X170623469). Digitally informed consent was retrieved from all participants upon enrollment in the study. All data collected from participants were anonymous | PMC10504623 | |
Discussion | HIV testing frequency, sexual behaviors, MSM | This study found the delivery of HIV risk assessment tools and feedback by a phone-based GSN app improved the number of HIV tests over 1 year among MSM app users in Beijing, China. UAI did not significantly improve compared with controls; however, all UAI declined from baseline to 6 months. Overall, this study suggests app-based, tailored feedback from HIV risk assessment tools could be an effective, low-cost strategy for increasing HIV testing frequency among MSM in China, although longer follow-up is required to establish a definite benefit.This study shows HIV assessment along with tailored feedback significantly improved the number of HIV tests administered per person, but HIV assessment without feedback did not significantly improve testing compared with controls. This is consistent with the literature purporting that the addition of feedback to HIV assessment has additional benefits [Interestingly, the controls also improved their HIV testing rates to the expectations of the Chinese CDC and behaved in a similar fashion to the HIV assessment–only group. In this study, controls received access to a free web-based appointment-making platform to schedule an HIV test. This choice of control is more than what has been offered in other similar studies (eg, relaxation skills [This study also found that HIV risk assessment and feedback significantly reduced the incidence of UAI compared with controls, although it was observed in all 3 groups that UAI declined from baseline. This is in concordance with other studies, which found that completing a risk assessment alone motivated safe changes in sexual behaviors [This RCT included a large sample of MSM app users in Beijing, China, and investigated interventions that are low-cost, efficient, and scalable for MSM throughout China. The private and simple nature of the intervention likely makes it desirable to MSM, which may increase its success and impact compared to other face-to-face interventions [Despite the strengths of this study, some limitations should also be acknowledged. First, the number of participants lost to follow-up was high, but this was expected considering web-based interventions are known to have high dropout rates [ | PMC10504623 | |
Conclusion | AIDS, MSM, SRS, ZW | INFECTIOUS DISEASES, AIDS, VIRAL HEPATITIS | This study found GSN app–based interventions that integrate HIV risk assessment with tailored feedback significantly increased HIV testing among MSM in Beijing, China. Integrating these into popular MSM apps would likely increase screening awareness of one’s HIV risk and should be widely considered by stakeholders and government entities.This work was supported by the National Natural Science Foundation of China (72104033) and the National Science and Technology Major Project on Prevention and Treatment of Major Infectious Diseases, including AIDS and viral hepatitis, from the National Health Commission (2018ZX10721102). The authors would like to thank all study participants for their voluntary participation in the study. We thank Bulloch G for her language editing support.Authors' Contributions: QL and ZW designed the study. QL wrote the research proposal. ZW and QL received the funding for the study. QL, GM, and JX set up the study in practice. QL and SRS developed the initial draft. All authors contributed to manuscript revisions and approved the final version for publication.Conflicts of Interest: None declared.Baseline characteristics of the study participants.CONSORT-eHEALTH Checklist (V1.6.2). | PMC10504623 |
Abbreviations | DISEASE | Center for Disease Control and PreventionConsolidated Standards of Reporting Trialsgeosocial networkingincident rate ratiomen who have sex with menpre-exposure prophylaxisrandomized controlled trialunprotected anal intercourseJoint United Nations Program on HIV/AIDS | PMC10504623 | |
Data Availability | The data sets generated and analyzed during this study are not publicly available as participants’ consent only included data sharing within the project research team. | PMC10504623 | ||
Abstract | PMC10580345 | |||
Objective | cardiovascular and cerebrovascular diseases, moyamoya disease, MMD | MOYAMOYA DISEASE, PATHOGENESIS | The role of methionine (Met) cycle in the pathogenesis and progression of cardiovascular and cerebrovascular diseases has been established, but its association with moyamoya disease (MMD) has rarely been studied. This study aimed to analyze the levels of Met cycle‐related metabolites and constructed a risk model to explore its association with the risk of MMD. | PMC10580345 |
Methods | REGRESSION | In this prospective study, a total of 302 adult MMD patients and 88 age‐matched healthy individuals were consecutively recruited. The serum levels of Met cycle‐related metabolites were quantified by liquid chromatography‐mass spectrometry (LC–MS). Participants were randomly divided into training set and testing set at a ratio of 1:1. The training set was used to construct the risk score model by LASSO regression. The association between Met cycle‐related risk score and the risk of MMD was analyzed using logistic regression and assessed by ROC curves. The testing set was used for validation. | PMC10580345 | |
Results | The levels of methionine sulfoxide and homocysteine were significantly increased, while the levels of betaine and choline were significantly decreased in MMD and its subtypes compared to healthy controls ( | PMC10580345 | ||
Conclusion | This study has constructed and validated a risk model based on Met cycle‐related metabolites, which was independently associated with the risk of MMD and its subtypes. The findings provided a new perspective on the risk evaluation and prevention of MMD.We constructed a risk score model based on Met cycle‐related metabolites to analyze the association between Met cycle dysregulation and the risk of MMD and validated it with a testing set.
URL: | PMC10580345 | ||
INTRODUCTION | cerebrovascular disorder, Moyamoya disease, stenosis, MMD | CEREBROVASCULAR DISORDER, MOYAMOYA DISEASE, STENOSIS | Moyamoya disease (MMD) was a rare cerebrovascular disorder characterized by progressive stenosis or occlusion of the internal carotid arteries, leading to the formation of abnormal collateral vessels at the base of the brain.Metabolomics provided a comprehensive understanding of the metabolic state of organisms.Therefore, we analyzed the levels of Met cycle‐related metabolites in MMD and constructed a Met cycle‐related risk model, which helped to demonstrate the correlation between Met cycle and the risk of MMD. Our study suggested that interventions targeting the Met cycle might have therapeutic potential in the prevention and treatment of MMD. | PMC10580345 |
METHODS | PMC10580345 | |||
Participants and study design | RECRUITMENT | In this prospective study, we consecutively recruited patients diagnosed with MMD using digital subtraction angiography (DSA) according to the 2012 Japanese diagnostic criteria from September 2020 to December 2021 at Beijing Tiantan Hospital.Key metabolites involved in methionine cycle.Flowchart of participant recruitment. | PMC10580345 | |
Data collection | peripheral venous blood | We collected the baseline patient characteristics, including age, gender, past medical history, heart rate, systolic blood pressure (SBP), diastolic blood pressure (DBP), body mass index (BMI), RNF213 variants, and laboratory tests. Fasting peripheral venous blood samples were obtained with vacuum biochemical tubes on the second morning after admission. All samples were centrifuged, aliquoted, and stored at −80°C within 1 h after collection. In order to avoid bias in the test results, all information of participants was blinded to the laboratory technicians. RNF213 p.R4810K variants were confirmed with the following primer sequences: Forward 5′‐GCCCTCCATTTCTAGCACAC‐3′ and Reverse 5′‐AGCTGTGGCGAAAGCTTCTA‐3′. Neurological function evaluation at admission was assessed using the modified Rankin Scale (mRS) scores, which were divided into two levels (0–2 and 3–5). The severity of MMD patients was determined based on the Suzuki stage of the more severe side. | PMC10580345 | |
Construction of Met cycle‐related risk model | REGRESSION | The levels of Met cycle‐related metabolites in the training set were incorporated into LASSO regression to construct the risk model. The lambda that minimized the deviations has been selected. Based on the levels of Met cycle‐related metabolites, a risk score was calculated for each participant using the following formula ( | PMC10580345 | |
Statistical analysis | The SPSS software (version 26.0) and R project (version 3.6.3) were used for the statistical analyses in this study. Continuous variables were analyzed for normality of the distribution using the Kolmogorov–Smirnov test. Normally distributed continuous variables were compared by | PMC10580345 | ||
RESULTS | PMC10580345 | |||
Study participants and baseline information | SAH, diabetes | HYPERLIPIDEMIA, MOYAMOYA DISEASE, HYPERTENSION, DIABETES | A total of 390 individuals were eventually enrolled in this study, consisting of 88 HCs and 302 MMD patients. Baseline characteristics between the two groups were compared, revealing that MMD patients had a higher prevalence of hypertension, diabetes, hyperlipidemia, smoking, and drinking, as well as higher levels of SBP, DBP, and BMI than HCs (Baseline characteristics between HC and MMD groups.Abbreviations: ALB, albumin; ApoA, apolipoprotein A; ApoB, apolipoprotein B; BMI, body mass index; Cr, creatinine; DBP, diastolic blood pressure; DMG, dimethylglycine; eGFR, estimated glomerular filtration rate; ETA, ethanolamine; GLU, glucose; HC, healthy control; Hcy, homocysteine; HDL‐C, high‐density lipoprotein cholesterol; IQR, interquartile range; LDL‐C, low‐density lipoprotein cholesterol; LY, lymphocyte; Met, methionine; MetO, methionine sulfoxide; MMD, moyamoya disease; MONO, monocyte; NEUT, neutrophil; PLT, Platelet; SAH, S‐adenosine homocysteine; SBP, systolic blood pressure; SD, standard deviation; TC, total cholesterol; TG, triglyceride; UA, uric acid; WBC, white blood cell.
Baseline characteristics between HCs and MMD subtypes (ischemic‐type and hemorrhagic‐type) were also compared. Both subtypes showed higher rates of hypertension, hyperlipidemia, smoking, and drinking, as well as higher levels of SBP compared to HCs (Baseline characteristics between HCs and MMD subtypes.
| PMC10580345 |
Construction of Met cycle‐related risk model | REGRESSION | All participants were randomly divided into training and testing sets, with equal numbers of 44 healthy individuals and 151 MMD patients in each set. The data of Met cycle‐related metabolites in training set was used to construct the risk score system by LASSO regression (Figure Construction of Met cycle‐related risk model. A. LASSO deviance profiles; B. LASSO coefficient profiles.Coefficients in LASSO regression model of the Met cycle‐related metabolites.
Levels of risk score between different groups. ns, not significant; ***Based on the median risk score value, the MMD patients in training set were divided into low‐risk and high‐risk groups (Table Baseline characteristics of MMD patients in low and high‐risk groups.
Baseline characteristics of MMD patients according to tertiles of the risk score.
| PMC10580345 | |
Role of the risk score in | REGRESSION, EVENTS | In the training set, logistic regression analyses showed a significant positive association between the Met cycle‐related risk score and the risk of MMD in Crude model (OR = 5.904, 95%CI = 3.153–11.057, Association between Met cycle‐related risk score and risk of MMD and its subtypes in the training set.
ROC curves of Met cycle‐related risk score in different models for the risk of MMD and its subtypes in training set. (A–C) ROC curves of Met cycle‐related risk score in different models for the risk of MMD and its subtypes. A. MMD overall; B. Ischemic‐type; C. Hemorrhagic‐type. (D–F) ROC curves of low and high levels of Met cycle‐related risk score in different models for the risk of MMD and its subtypes. D. MMD overall; E. Ischemic‐type; F. Hemorrhagic‐type. (G–I) ROC curves of Met cycle‐related risk score tertiles in different models for the risk of MMD and its subtypes. G. MMD overall; H. Ischemic‐type; I. Hemorrhagic‐type.We then compared the risk of MMD between individuals with low and high‐risk scores and found that the high risk score was significantly associated with the higher risk of MMD in Crude model (OR = 23.185, 95%CI = 6.859–78.363, We further classified the risk score into three levels based on the tertiles and analyzed the correlation between risk levels and MMD. As the risk level enhanced, the proportion of MMD events significantly increased (Table We calculated the Met cycle‐related risk score of the individuals in the testing set and verified the association between the risk score and MMD. Subsequently, the participants in the testing set were then stratified into different risk levels based on the median value and tertiles of the risk score. The results confirmed that the risk score was independently associated with MMD and its subtypes (Table Association between Met cycle‐related risk score and risk of MMD and its subtypes in the testing set.
ROC curves of Met cycle‐related risk score in different models for the risk of MMD and its subtypes in testing set. (A–C) ROC curves of Met cycle‐related risk score in different models for the risk of MMD and its subtypes. A. MMD overall; B. Ischemic‐type; C. Hemorrhagic‐type. (D–F) ROC curves of low and high levels of Met cycle‐related risk score in different models for the risk of MMD and its subtypes. D. MMD overall; E. Ischemic‐type; F. Hemorrhagic‐type. (G–I) ROC curves of Met cycle‐related risk score tertiles in different models for the risk of MMD and its subtypes. G. MMD overall; H. Ischemic‐type; I. Hemorrhagic‐type. | PMC10580345 | |
DISCUSSION | hemorrhage, high disability, hemorrhagic MMD | DISEASE, HEMORRHAGE, REGRESSION, OXIDATIVE STRESS, PATHOGENESIS | In this prospective study, we first compared the difference in clinical characteristics between MMD patients and HCs. We further explored the differences in ischemic and hemorrhagic MMD groups. It showed that the levels of four Met cycle‐related metabolites were significantly different in the MMD group and its subtypes from those in the HC group. The training set was used to construct the risk model by LASSO regression and analyze the role of Met cycle‐related risk score in MMD. We found that the risk score was independently associated with an increased risk of MMD and its subtypes. After adjusting for other risk factors, it showed an improvement in risk prediction. In this study, we provided a novel perspective on the role of metabolism dysregulation in the pathogenesis of MMD and suggested potential therapeutic targets.One of the Met cycle‐related metabolites, MetO, was produced from Met by reactive oxygen species (ROS) and had the potential to serve as a biomarker of oxidative stress.Hcy, a sulfur‐containing amino acid, was a key determinant of Met cycle. Folate and vitamin B12 were involved in the remethylation of Hcy back into Met.Choline has been an essential molecule involved in several key physiological processes, including the normal function of cell membranes, regulation of neurotransmitter function, transportation of lipids, and metabolism of one‐carbon units in body.The etiology of MMD remains unclear, which has been considered as a combined effect of immune, genetic, environmental, metabolic, and other factors. MMD has long been considered an irreversible condition with high disability and fatality rate, causing a huge burden to families and society. Direct and indirect revascularization procedures have been widely used in the treatment of MMD. However, the bypass surgery aimed to increase blood supply to the affected hemispheres, improve ischemic symptoms, and reduce the risk of recurrent hemorrhage, rather than reversing the progression of the disease. Therefore, it has been necessary to investigate novel risk factors associated with this disease, particularly modifiable risk factors, and explore potential therapeutic targets. Our study provided a new point of view in the exploration of metabolism dysregulation in the pathogenesis of MMD. In this study, we identified four different Met cycle‐related metabolites in MMD patients compared with HCs, including MetO, Hcy, choline, and betaine. We constructed a Met cycle‐related risk model with these metabolites and confirmed the correlation between the risk score and the risk of MMD. The Met cycle‐related risk score showed a favorable predictive ability in the risk of MMD and was validated by the testing set. However, there were still several limitations in our study. First, the sample size was relatively small due to the nature of a single‐center study. Therefore, the correlation between Met cycle dysregulation and the risk of MMD should be validated by large‐scale prospective studies. Second, the study only included adult patients with MMD, and it remained unclear whether the results could be extended to pediatric patients. Thirdly, dietary intake information was not collected, which might potentially impact the outcomes. Due to the limitation of the study design, we were unable to establish a causal link between Met cycle dysregulation and MMD, even after adjusting for potential confounding variables. Thus, further in vitro/in vivo experiments, as well as large‐scale prospective cohort studies with follow‐up outcomes, have been necessary to elucidate the effect and mechanism of Met cycle dysregulation on the pathogenesis of MMD. | PMC10580345 |
CONCLUSION | PATHOGENESIS | In summary, our study has constructed and validated a risk model based on Met cycle‐related metabolites. We found that the Met cycle‐related risk score was independently associated with the risk of MMD and its subtypes. Our study provided a new perspective on the role of metabolism dysregulation in the pathogenesis of MMD and suggested potential therapeutic targets. | PMC10580345 | |
AUTHOR CONTRIBUTIONS | Junsheng Li illustrated all the results and drafted the manuscript. Peicong Ge and Chaofan Zeng performed all the statistical analyses. Qiheng He, Chenglong Liu, Chuming Tao, and Yuanren Zhai collected the data. Wei Liu, Qian Zhang, Rong Wang, and Yan Zhang revised the manuscript. Dong Zhang and Jizong Zhao conceived and designed this research. All authors have read and approved the final version of the manuscript. | PMC10580345 | ||
FUNDING INFORMATION | This study was supported by the National Natural Science Foundation of China (81701137), the National Key Research and Development Program of China (2021YFC2500502), Beijing Municipal Organization Department Talents Project (2015000021469G219), and Beijing Municipal Administration of Hospitals' Mission Plan (SML20150501). | PMC10580345 | ||
CONFLICT OF INTEREST STATEMENT | The authors declared that no conflicts of interest existed. | PMC10580345 | ||
CONSENT TO PARTICIPATE | Written informed consent was obtained from all participants included in this study. | PMC10580345 | ||
ACKNOWLEDGMENTS | We acknowledged all the participants involved in this study. | PMC10580345 | ||
DATA AVAILABILITY STATEMENT | All raw data supporting the findings in this study were available from the corresponding authors with reasonable requests. | PMC10580345 | ||
REFERENCES | PMC10580345 | |||
Objectives | MINST, periodontitis | PERIODONTITIS | To determine if minimally invasive non-surgical therapy (MINST) outperforms classical non-surgical periodontal therapy for stage III periodontitis with primarily suprabony (horizontal) type defects. | PMC10071470 |
Materials and methods | MINST, tooth | REGRESSION | In a split-mouth randomised controlled trial, 20 patients’ dental quadrants were randomly assigned to MINST or classical non-surgical treatment. The primary outcome variable was the number of sites with probing pocket depth ≥ 5 mm and BOP. Treatment method, tooth type, smoking status, and gender were evaluated using a multivariate multilevel logistic regression model. | PMC10071470 |
Results | MINST, PD | After 6 months, the percentage of sites with PD ≥ 5 mm and BOP that healed (MINST = 75.5%; control group = 74.1%; | PMC10071470 | |
Conclusions | periodontitis | PERIODONTITIS | MINST reduces gingival recession associated with molar teeth, although it performs similarly to traditional non-surgical therapy in treating stage III periodontitis with predominately horizontal-type defects. | PMC10071470 |
Clinical relevance | MINST, periodontitis, predominantly suprabony defects | PERIODONTITIS | MINST performs similarly to non-surgical periodontal therapy in stage III periodontitis with predominantly suprabony defects. | PMC10071470 |
Trial registration | Clinicaltrials.gov (NCT04036513) on June 29, 2019. | PMC10071470 | ||
Supplementary Information | The online version contains supplementary material available at 10.1007/s00784-023-04994-4. | PMC10071470 | ||
Keywords | Open access publishing supported by the Slovenian Research Agency and Central Technical Library in Ljubljana. | PMC10071470 | ||
Introduction | periodontitis, MINST, PD, intrabony defects, calculus | PERIODONTITIS, PLAQUE | The initial periodontal treatment aims to minimise supra/subgingival plaque, calculus deposits, and bacterial load through behavioural adjustments and risk factor management, supported by non-surgical debridement techniques. As the second stage therapeutic measure, surgical intervention or extractions are recommended for more advanced periodontitis [Nibali et al. devised a minimally invasive non-surgical periodontal treatment protocol (MINST). According to their retrospective case series evaluation, using MINST as a non-surgical periodontal treatment for intrabony defects resulted in decreased probing depth (PD), increased clinical attachment level (CAL), and radiographically determined bone fill [However, when treating advanced periodontitis, supra-alveolar (horizontal) defects are found to be three to nine times more prevalent than intrabony defects. Their ability for regeneration is limited, and therapeutic effectiveness remains a challenge [The study by Iorio-Siciliano et al. [ | PMC10071470 |
Materials and methods | A 6-month, single-centre, split-mouth, randomised controlled clinical trial was conducted. The National Medical Ethical Committee of the Republic of Slovenia granted ethical approval (No. 0120–595/2018/4). The clinical protocol was also submitted to Clinicaltrials.gov (No. NCT04036513). Before taking part, all subjects were given a description of the proposed treatment and gave their informed and written consent. The study was carried out following the Helsinki Declaration’s principles. | PMC10071470 | ||
Study population | endo-perio, periodontitis, cancer | PERIODONTITIS, CANCER, DIABETES MELLITUS, PERIODONTAL DISEASE, DISEASES | All included patients were referred by their general dentists to the Department of Oral Medicine and Periodontology, University Dental Clinic of Ljubljana, Slovenia, for periodontal assessment and treatment. Between March 2019 and November 2021, 20 male or female participants were explicitly selected as participants in this study of 207 consecutively evaluated individuals.Age 18 to 70 years, stage III periodontitis (grade B/C according to the AAP/EFP classification 2018), presence of 20 teeth for stable occlusion (excluding third molars), and equally distributed periodontal pockets on both sides of the jaw and between molar and non-molar teeth, with at least 9 non-molars in the upper arch, were the inclusion criteria. Exclusion criteria included the following: periodontal treatment in the last 12 months, the presence of prosthetic restorations, implants, endo-perio lesions, pregnancy, lactation, and systemic medical conditions that could affect the progression of periodontal disease or healing (i.e. HIV/AIDS, cancer, diabetes mellitus, diseases of bone metabolism, radiation therapy, chemotherapy, immunosuppressive therapy, antiepileptics, calcium antagonists, and nonsteroidal anti-inflammatory drugs). Less than 10 cigarettes smoked per day was not considered an exclusion criterion. | PMC10071470 |
Clinical and radiographic examination | PD, bleeding | BLEEDING, PLAQUE | At baseline and follow-ups, an experienced, masked, calibrated examiner (R. G.) performed a comprehensive periodontal examination of all patients using a manual Williams probe (POW6, Hu-Friedy, Chicago, Illinois, USA). At 6 sites of each tooth, the following periodontal parameters were measured: absence/presence of plaque on tooth surfaces using a dichotomous plaque index, absence/presence of bleeding upon gentle probing around the gingival crevice, probing pocket depth (PD), gingival recession (REC), and absence/presence of BOP provoked by gentle applying of a probe to the bottom of a sulcus/pocket. The percentage of plaque-positive sites was expressed as FMPS [ | PMC10071470 |
Clinical intervention | PD, pain | After a baseline examination, each of the 20 patients received two 90-min sessions of cause-related periodontal non-surgical treatment from the same therapist (A. C. K.) within 7 days, beginning with motivation and instruction on proper oral hygiene. Both dental arches’ left and right sides were randomly assigned to one of two treatment modalities. Randomisation was accomplished by using a computer program formula to generate the random allocation sequence number (Microsoft Office Excel, Microsoft Corporation, Redmond, W, USA). Then, a random allocation number was assigned for each side of the dentition, with an even or odd number corresponding to the test or control group. The treatment allocation cards were sealed in envelopes until the clinical procedure. To maintain blinding and allocation concealment, randomisation was carried out, and the envelopes containing specific treatment modalities were handled by a third party who was not involved in the patient’s treatment or clinical assessment. As a result, the patient and the evaluator were blinded throughout the treatment. The treatment protocol in the test quadrants adhered to the MINST concepts described by Nibali et al. [The subjects were recalled 1, 3, and 6 months after treatment. Oral hygiene instructions were reinforced at each appointment, and at 3- and 6-month follow-ups, a full-mouth periodontal examination was performed using the same protocol as at baseline and the same type of periodontal probe (POW6, Hu-Friedy, Chicago, Illinois, USA). In addition, all sites with PD ≥ 5 mm and BOP sites were re-instrumented with the same treatment modality. At the 6-month follow-up, the buccal surfaces of the teeth were stimulated using a dental syringe and compressed air for 1 s to induce pain. The discomfort was localised to each quadrant and recorded as present or absent [ | PMC10071470 | |
Statistical analysis | PD | Since further clinical attachment loss is expected at sites with PD ≥ 5 mm and persistent BOP after non-surgical periodontal treatment, surgical intervention is usually indicated [ | PMC10071470 | |
Patient-reported outcomes | pain | Conventional therapy and the MINST procedure required comparable average chair-side times (62 ± 11 and 64 ± 14 min for conventional and MINST, respectively). After treatment, none of the patients complained of pain or required pain medication. In addition, 17/40 quadrants of the test group and 19/40 quadrants of the control group demonstrated teeth with post-treatment sensitivity to provocation on compressed air 3 months after treatment ( | PMC10071470 | |
Conclusion | MINST, PD, periodontitis | REGRESSION, PERIODONTITIS, BONE LOSS | MINST and standard non-surgical periodontal debridement resulted in significant but comparable decreases in the number of sites with PD ≥ 5 mm + BOP and other clinical parameters. Furthermore, in a multilevel, multivariate logistic regression model, male gender and molar teeth were related to a higher number of residual sites with PD ≥ 5 mm + BOP. Therefore, within the scope of this study, it is reasonable to state that the MINST regimen is a clinically beneficial initial non-surgical treatment for stage III periodontitis characterised by predominantly supraalveolar bone loss, yielding results comparable to the classical treatment approach.
| PMC10071470 |
Acknowledgements | We thank Mrs. Vanja Erčulj, PhD (RHO sigma, Ljubljana) for the statistical analysis. | PMC10071470 | ||
Author contribution | A.C.K.: methodology, investigation, data curation, formal analysis, and writing—original draft; R.G.: conceptualisation, methodology, investigation, formal analysis, writing—review and editing, and funding acquisition. Both authors approved the final version of the manuscript. | PMC10071470 | ||
Funding | The study was supported by the Ministry of Science and Technology of the Republic of Slovenia, grant number P3-0293. | PMC10071470 | ||
Data Availability | The data that support the findings are avaliable on reasonable request from corresponding author. | PMC10071470 | ||
Declarations | PMC10071470 | |||
Competing interests | The authors declare no competing interests. | PMC10071470 | ||
Ethical approval | All procedures involving human participants followed the ethical standards of the 1964 Helsinki declaration and the Code of Medical Ethics of the Medical Association of Slovenia. The study protocol was reviewed by the National Medical Ethics Committee (No. 0120–595/2018/4) of the Republic of Slovenia. It was also registered at Clinicaltrials.gov (NCT04036513). | PMC10071470 | ||
Informed consent
| Informed consent was obtained from all individual participants included in the study. | PMC10071470 | ||
Conflict of interest | The authors declare no competing interests. | PMC10071470 | ||
References | PMC10071470 | |||
Background | OA, swelling, inflammation, osteoarthritis, pain | CHRONIC PAIN, INFLAMMATION, OSTEOARTHRITIS, INFLAMMATORY DISEASE | Specialized pro-resolving mediators (SPMs), including 18-HEPE, 17-HDHA, and 14-HDHA are recognized as potentially therapeutic in inflammatory diseases because SPMs regulate the inflammation process, which leads to, for example; swelling and the sensation of pain. In osteoarthritis (OA), chronic pain is described as the symptom that reduces patients´ quality of life (QoL). The GAUDI study evaluated the efficacy of SPMs supplementation in reducing pain in the symptomatic knee of OA patients. | PMC10308764 |
Methods | Pain, pain | This randomized, multicenter, double-blind, and placebo-controlled parallel-group pilot study was performed in Spain and conducted on adults 18–68 years old diagnosed with symptomatic knee OA. Patients were enrolled in the study for up to 24 weeks, which included a 12-week intervention period and a follow-up visit on week 24. The primary endpoint was pain change measured through a Visual Analog Scale (VAS). Secondary endpoints included: Pain change evaluation, stiffness, and function according to the WOMAC index; assessment of constant, intermittent, and total pain according to the OMERACT-OARSI score; evaluation of changes in health-related QoL parameters; the use or not of concomitant, rescue, and anti-inflammatory medication; and safety and tolerability assessments. | PMC10308764 | |
Results | pain | ADVERSE EVENTS, MAY | Patients were enrolled in the study from May 2018 to September 2021. VAS pain score was evaluated in the per protocol population (n = 51 patients), in which we observed a statistically significant reduction after 8 weeks (p = 0.039) and 12 weeks (p = 0.031) of treatment in patients consuming SPMs (n = 23 subjects) vs. placebo (n = 28 subjects). In line with the OMERACT-OARSI score, intermittent pain was reduced after 12 weeks with statistical significance (p = 0.019) in patients treated with SPMs (n = 23 subjects) vs. placebo (n = 28 subjects). Functional status as WOMAC score did not significantly change after SPMs or placebo consumption. Notably, patients consuming SPMs showed improvements in all five aspects of the EUROQoL-5, including a significant improvement in the usual-activities dimension. None of the patients required rescue medication, nor were any adverse events reported. | PMC10308764 |
Supplementary Information | The online version contains supplementary material available at 10.1186/s12967-023-04283-4. | PMC10308764 | ||
Keywords | PMC10308764 | |||
Background | functional disability, Osteoarthritis, OA, arthritis, pain, peripheral sensitization | INFILTRATION, OSTEOARTHRITIS, DISEASE, ARTHRITIS, INFILTRATION | Osteoarthritis (OA) is the most common form of arthritis and a significant cause of pain, functional disability, and socioeconomic cost worldwide. OA is a disease that involves inflammatory, mechanical, and metabolic factors. All these lead to pathological changes across different weight-bearing joint tissues, severely and particularly affecting cartilage tissue [Infiltration of immune cells and release of pro-inflammatory mediators activate different inflammatory pathways in joints. These lead to the release of pro-nociceptive molecules, which induce peripheral sensitization [At the cellular level, SPMs act via specific receptors that promote macrophage phagocytosis of: pathogens, apoptotic cells, and cellular debris, that precede and is necessary for tissue regeneration. SPMs also cease infiltration of pro-inflammatory immune cells, counter-regulate pro-inflammatory mediators, and increase the production of anti-inflammatory mediators [Despite OA´s prevalence and burden, its standard treatment still involves the use of non-steroidal anti-inflammatory drugs (NSAIDs), which lack sufficient efficacy and present multiple side effects. With limited pharmacological options, in many cases joint replacement is considered as the only treatment option [In this study, the effect of consuming an SPMs enriched oil has been clinically evaluated in the context of pain in patients with OA. This randomized, double-blind, placebo-controlled trial sought to assess the efficacy of SPMs 12-week consumption in reducing pain in patients with symptomatic knee OA. | PMC10308764 |
Methods | PMC10308764 | |||
Study design | The GAUDI study was a randomized, multicenter, double-blind, placebo-controlled, parallel-group pilot study conducted in 5 Spanish centers in compliance with the World Medical Association Declaration of Helsinki, all its amendments, and national regulations. The Independent Ethic Committee of Hospital Universitario La Paz (Madrid, Spain) approved this study. All patients gave their written informed consent.The study duration per patient was up to 24 weeks consisting of a screening period, a treatment period with monthly visits from the start of the study until week 12, and a last follow-up visit on week 24 conducted by telephone call (Fig. GAUDI Study design diagramFor the treatment period, participants were instructed to take two 500 mg softgels of SPMs enriched oil (SPMs group) or olive oil placebo (placebo group) after breakfast and two 500 mg softgels after dinner for a total of four softgels of SPMs or placebo per day during the first 6 weeks of the study. During the last 6 weeks, participants were instructed to take one softgel after breakfast and one after dinner for a total of two softgels of SPMs or placebo per day. Thus, the treatment period lasted in total 12 weeks per patient. | PMC10308764 | ||
Patient population | Eligible patients for the study were adults between 18 and 68 years old that were diagnosed with symptomatic knee OA (according to the American College of Rheumatology [ACR]) and primary knee OA with both confirmed scores of 2–3 on the Kellgren and Lawrence radiological scale [ | PMC10308764 | ||
Study endpoints | pain | OSTEOARTHRITIS | The primary endpoint was the change in pain measured as VAS score before supplementation and VAS score on week 12 of supplementation. Secondary endpoints included the comparison in pain change, stiffness, and joint function according to the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) between SPMs and placebo groups before supplementation to week 12. In addition, the assessment of constant, intermittent, and total pain according to the OMERACT-OARSI score was considered. Changes in health-related QoL scores measured by the EUROQoL-5 questionnaire [ | PMC10308764 |
Statistical considerations | Three patient populations were considered in analyses: (i) The per protocol (PP) population, including all randomized patients who received at least one treatment dose and had all primary endpoint measurements and no major protocol deviations; (ii) the intention-to-treat (ITT) population, including all randomized patients; (iii) and the safety population, with all randomized patients who received at least one dose of the study treatment. The PP population dataset was the only population considered for the primary analysis.For univariate analysis, the quantitative variables were described using central tendency and dispersion measures, including mean, standard deviation (SD), median and interquartile range (IQR). To define qualitative variables, total counts and percentages were used.For bivariate analysis between distinct subjects, quantitative variables were analyzed using the Student's t-test for independent samples or the Mann–Whitney U test when samples were not normally distributed. Qualitative variables were analyzed using the Chi-square test or the Fisher test. For intra-subject variables, quantitative variables were analyzed using the Student's t-test or the Wilcoxon signed-rank test, depending on whether the samples were or were not normally distributed.Missing data were discarded in the analyses, and a significance level of 0.05 was used in statistical testing. All statistical analyses were performed using the Statistical Package for the Social Sciences (SPSS) version 22.0 (SPSS Inc, Chicago, USA). | PMC10308764 | ||
Results | PMC10308764 | |||
Functional changes in OA patients treated with SPMs | Osteoarthritis, OA | OSTEOARTHRITIS | The WOMAC score mean did not significantly differ between patients in the SPMs and the placebo groups at any recorded time (at t = 0: SPMs group: 33.6 ± 19.04, placebo group: 29.6 ± 12.97, p-value = 0.377; at week 4: SPMs group: 24.9 ± 13.71, placebo group: 22.0 ± 10.62, p-value = 0.391; at week 8: SPMs group: 23.1 ± 13.96, placebo group: 23.5 ± 9.97, p-value = 0.921; at week 12: SPMs group: 19.2 ± 12.98, placebo group: 21.3 ± 11.23, p-value = 0.529) (Fig. Functional status of OA patients according to WOMAC (N = 51). Means (standard deviation) are used. Total score derived from the summation of the scores of the answers of the 24 items, which correspond to: none: 0, mild: 1, moderate: 2, severe: 3, and extreme: 4. To compare the WOMAC scores between the SPMs group (N = 23) and placebo group (N = 28), the Mann–Whitney U test (basal) and the Student's t-test (weeks 4, 8, and 12) were used. SPMs: specialized pro-resolving lipid mediators; WOMAC: Western Ontario and McMaster Universities Osteoarthritis Index | PMC10308764 |
Quality of life | OA | Overall, patients in the SPMs group showed improvements in all five dimensions of the EUROQoL-5 compared to the placebo group, including significant changes in the usual activities dimension (52.17% vs. 14.29%; p-value = 0.004) (Table Quality of life in OA patients (N = 51)Percentage change in each patient has been used to calculate the mean score change. EQ VAS: EuroQol Visual Analogue Scale; SPMs: specialized pro-resolving lipid mediators | PMC10308764 | |
Safety and tolerability | lameness | Only two AEs were reported in one patient from the SPMs group (lameness and locked knee), which were mild and not related to the study treatment. These did not require any action from the research team and were resolved. None of the patients withdrew from the study. | PMC10308764 | |
Discussion | OA, Pain, inflammation, osteoarthritis, arthritis, pain | DEGENERATION, ADVERSE EVENTS, INFLAMMATION, OSTEOARTHRITIS, ARTHRITIS, CHRONIC PAIN, DISEASES | The results of this randomized, double-blind, placebo-controlled study imply that oral supplementation with SPMs reduces pain and improves QoL in patients with symptomatic knee OA. While a placebo effect is observed in clinical variables, this is not as significant as the effect of SPMs consumption. Following a dose reduction from 2000 mg/day to 1000 mg/day from weeks 6 to 12, patients receiving oral supplementation with SPMs reported a statistically significant reduction in pain after 8 and 12 weeks of treatment compared to patients in the placebo group. Also, we observed a trend, such as the reduction in the pain VAS score up to week 12 and changes in VAS score from weeks 12 to 24, that added to the impact of continuous SPMs consumption. Altogether, these results support the recommended dual dose for OA patients.OA patients identify two types of pain: constant background pain and intermittent severe pain [Pain reduction associated with SPMs administration is in line with previous studies pertaining to inflammation resolution mechanisms. Preclinical data from different animal models of osteoarthritis, acute inflammatory pain, and chronic adjuvant-induced arthritis support the pain-relieving properties of 17-HDHA and resolvin D1 exogenous administration [To our knowledge, this is the first-in-human study evaluating possible residual effects of SPMs months after treatment. Our results do not support a long-lasting residual effect of SPMs consumption on chronic pain 12 weeks after the completion of treatment, suggesting the need for continuous supplementation to maintain clinical benefits. Preclinical studies, however, have evaluated the long-lasting effects of SPMs. A study in surgical pain in a mouse model demonstrated that intrathecal-injected resolvin D1 showed an analgesic effect for up to 30 days [Essentially, chronic pain involves central and peripheral neurological mechanisms. Preclinical studies have shown that SPMs administration dampens inflammatory pain [In this study, SPMs supplementation did not change concomitant, rescue, and anti-inflammatory medication use. Also, no adverse events related to supplementation nor any tolerability issues were reported in this study. These data support the favorable safety record of SPMs supplementation with the administered dose, which agrees with previous studies [Some limitations of this study included the modest sample size, which might have constrained the statistical significance of the results and masked the full clinical potential of SPMs consumption by OA patients. Despite the low number of participants, there is a general trend of improvement in most of the assessed clinical parameters, supporting the potential benefits to be confirmed in a larger sample number. Another limitation is the use of olive oil softgels as placebo. Olive oil has been reported to have clinical effects on OA patients, as previously reported in randomized controlled trials [One future study will involve the analysis of the biochemical parameters from plasma and serum samples of the patients on this study, including SPMs and cytokines. Other studies could be performed on assessing pain reduction in patient subpopulations. For example, studying the effect of SPMs consumption in patients with one specific degree of osteoarthritis according to the Kellgren and Lawrence classification. Patients with other diseases that also experience chronic pain may benefit from SPMs consumption, though; studies that support that need to be rigorously performed. As individual SPMs are made available in their purest forms, future studies could be performed to treat joint degeneration locally, instead of systemically. | PMC10308764 |
Conclusions | OA, pain | This randomized, double-blind, placebo-controlled study evaluates for the first time the effect of continuous oral SPMs consumption on an adult population of symptomatic knee OA patients. SPMs supplementation reduced pain and improved the quality of life of OA patients. Our results do not support a long-lasting residual effect of SPMs after treatment, suggesting the need for continuous SPMs supplementation to maintain some of the clinical benefits. The results from this study support the favorable safety record of SPMs-enriched oil consumption. | PMC10308764 | |
Acknowledgements | Alberto García Mariscal (Evidenze Group Europe SL) provided medical writing support to the authors of this paper. Dr. Jaume Padrós and Ana Regatero from the medical services of FC Barcelona helped in the design of the study. | PMC10308764 | ||
Author contributions | JV conceived and designed the study and oversaw the overall direction and planning of the study; JV and NM executed and led the completion of the project; JV and NM wrote the original draft with support and revisions from GR, IM, JMV, FA, JAR; JV and NM supervised the findings of this work; GR, IM, JMV, FA and JAR revised the manuscript. All authors read and agreed to the published version of the manuscript. | PMC10308764 | ||
Funding | Solutex GC SL funded this work. | PMC10308764 | ||
Availability of data and materials | The datasets analyzed during the current study are available from the corresponding author upon reasonable request. | PMC10308764 | ||
Declarations | PMC10308764 | |||
Ethics approval and consent to participate | The GAUDI study was conducted in compliance with the World Medical Association Declaration of Helsinki, all its amendments, and national regulations. The Independent Ethic Committee of Hospital Universitario La Paz (Madrid, Spain) approved this study. All patients gave their written informed consent. | PMC10308764 | ||
Consent for publication | Not applicable. | PMC10308764 | ||
Competing interests | The authors declare that they have no competing interests. | PMC10308764 | ||
References | PMC10308764 | |||
Background | Delpazolid, toxicity, DECODE | DRUG-RESISTANT TUBERCULOSIS | Linezolid is an effective, but toxic anti-tuberculosis drug that is currently recommended for the treatment of drug-resistant tuberculosis. Improved oxazolidinones should have a better safety profile, while preserving efficacy. Delpazolid is a novel oxazolidinone developed by LegoChem Biosciences Inc. that has been evaluated up to phase 2a clinical trials. Since oxazolidinone toxicity can occur late in treatment, LegoChem Biosciences Inc. and the PanACEA Consortium designed DECODE to be an innovative dose-ranging study with long-term follow-up for determining the exposure–response and exposure–toxicity relationship of delpazolid to support dose selection for later studies. Delpazolid is administered in combination with bedaquiline, delamanid and moxifloxacin.
| PMC10243693 |
Methods | toxicities, myelosuppression, neuropathy | PULMONARY TUBERCULOSIS, NEUROPATHY | Seventy-five participants with drug-sensitive, pulmonary tuberculosis will receive bedaquiline, delamanid and moxifloxacin, and will be randomized to delpazolid dosages of 0 mg, 400 mg, 800 mg, 1200 mg once daily, or 800 mg twice daily, for 16 weeks. The primary efficacy endpoint will be the rate of decline of bacterial load on treatment, measured by MGIT liquid culture time to detection from weekly sputum cultures. The primary safety endpoint will be the proportion of oxazolidinone class toxicities; neuropathy, myelosuppression, or tyramine pressor response.
Participants who convert to negative liquid media culture by week 8 will stop treatment after the end of their 16-week course and will be observed for relapse until week 52. Participants who do not convert to negative culture will receive continuation phase treatment with rifampicin and isoniazid to complete a six-month treatment course. | PMC10243693 |
Discussion | toxicities, DECODE | DECODE is an innovative dose-finding trial, designed to support exposure-response modelling for safe and effective dose selection. The trial design allows assessment of occurrence of late toxicities as observed with linezolid, which is necessary in clinical evaluation of novel oxazolidinones. The primary efficacy endpoint is the change in bacterial load, an endpoint conventionally used in shorter dose-finding trials. Long-term follow-up after shortened treatment is possible through a safety rule excluding slow-and non-responders from potentially poorly performing dosages. | PMC10243693 | |
Trial registration | RECRUITMENT | DECODE was registered in ClinicalTrials.gov before recruitment start on 22 October 2021 (NCT04550832). | PMC10243693 | |
Keywords | Open Access funding enabled and organized by Projekt DEAL. | PMC10243693 | ||
Introduction | PMC10243693 | |||
Background and rationale {6a} | anaemia, TB, death, cheese syndrome, neutropenia, neuropathy, toxicity, toxicities, infections, ZeNix, XDR-TB, hypertensive, peripheral and optic neuropathy | ANAEMIA, NEUTROPENIA, NEUROPATHY, ADVERSE EVENTS, THROMBOCYTOPENIA, INFECTIONS, TUBERCULOSIS (TB), DRUG-DRUG INTERACTION | Tuberculosis (TB) is the thirteenth leading cause of death worldwide and, before the advent of COVID-19, was the leading cause from a single infectious agent, ranking above human immunodeficiency virus (HIV)/AIDS [Linezolid (LZD), an oxazolidinone, approved by the US Food and Drug Administration (FDA) since 2000 for the treatment of Gram+ infections, acts to inhibit protein synthesis by binding the 23S ribosomal RNA (rRNA) portion of the bacterial 50S subunit.LZD has shown good efficacy in randomized controlled trials (RCTs) and cohort studies, mostly conducted in XDR-TB patients. In a landmark study conducted by Lee et al., LZD was added to failing treatment in participants with extensive resistance; a strategy which is otherwise not advised since the absence of active combination partner drugs predisposes towards new resistance against the drug that is added [In the NiX-TB trial, a novel regimen composed of LZD, bedaquiline (BDQ) and pretomanid (PTM) achieved cure in 90% of participants with XDR-TB or failing MDR-TB treatment [LZD has a challenging safety profile, and its use is limited by adverse events (AEs) due to its inhibition of mitochondrial protein synthesis. Given long-term toxicities related to LZD treatment are anaemia, neutropenia, thrombocytopenia, peripheral and optic neuropathy. In addition, the inhibition of monoamine oxidase A (MAO A) by LZD may result in hypertensive responses after dietary intake of tyramine (tyramine pressor response, “cheese syndrome”) [In NiX-TB, only 15% of participants completed the 6-month course of LZD without interruptions or dose reductions due to toxicity. The Global TB Alliance then set up a ZeNix trial to evaluate whether shorter dosing of LZD or dosing at a lower dose would achieve an acceptable toxicity while maintaining efficacy. This approach was partially successful, but still at the lowest dose tested for the shortest duration (600mg for 9 weeks), 6/45 (13.3%) of participants developed neuropathy (M.Olugbosi, presented at InterTB Meeting 2021); illustrating the need for safer novel oxazolidinones.The Pan-African Consortium for the Evaluation of Antituberculosis Antibiotics (PanACEA; The new oxazolidinones are combined with Delamanid (DLM), a nitroimidazole, and will be used in combination with BDQ and Moxifloxacin (MXF). Safety data suggests that these drugs may have a more favourable safety profile compared to their counterparts LZD and PTM. DLM is approved for use in Europe, Japan, and several other countries. DZD is a new, investigational oxazolidinone that is anticipated to have similar or better efficacy, compared to LZD and may cause less toxicity than LZD. Nonclinical studies demonstrated that DZD is not metabolized by major cytochrome P450 enzymes nor does it inhibit any of them. Also, DZD is neither perpetrator nor victim of drug-drug interactions based on major transporters. Prior to the study, DZD had been studied in 161 healthy participants in Phase 1 studies with the longest treatment being 21 days. 45 subjects were treated for 14 days in an early bactericidal activity (EBA) monotherapy study, but no reliable dose-response was identified for efficacy or toxicity. To assess the safety and efficacy of different doses of DZD, a trial design needs to be chosen that permits longer exposure to an oxazolidinone as most toxicities occur after an exposure of 14 days. Therefore, we developed a trial design that permits longer exposure through combination therapy with established anti-tuberculosis agents. Data from this study will inform the selection of a DZD dose for further assessment in the following studies. | PMC10243693 |
Objectives {7} | toxicity | PULMONARY TUBERCULOSIS, RECURRENCE, RECURRENT DISEASE, SECONDARY, REINFECTION | The primary objective of this study is to generate data for a pharmacokinetic–pharmacodynamic modelling approach, and to establish the exposure–response and exposure–toxicity curve for DZD.The aim is to identify the optimal dose of DZD to be used in subsequent studies that will provide the best efficacy and acceptable safety profile for the drug when given daily over 16 weeks in participants with newly diagnosed, uncomplicated, smear-positive, drug-sensitive, pulmonary tuberculosis.This will be supported by the development of a population pharmacokinetic (PK) model.Importantly, DECODE will assess the proportion of participants who suffer relapse within 12 months post randomization, out of those participants completing 16 weeks of therapy and achieving sustained sputum culture conversion, defined as two successive negative liquid media (BD BACTEC™ MGIT ) cultures at or before week 8, with no positives to follow until the week 16 visit.Secondary efficacy objectives are other culture-based response metrics, including month-2 culture status in liquid media and on solid media, and time to culture conversion in liquid and on solid media.The secondary PK objective is to describe the PK of BDQ, DLM and MXF including their main metabolites.In addition, this study has mycobacteriological identification and characterization objectives, which are (i) to assess the minimum inhibitory concentrations of BDQ, DLM, MXF, and DZD of the infecting strain (ii) to investigate the frequency of acquired mutations in the infecting strain over treatment and (iii) to compare the initial and recurrence isolates in participants with recurrent disease by whole genome sequencing to discriminate relapse from reinfection. | PMC10243693 |
Trial design {8} | TB, pulmonary TB | This will be an open-label, phase IIb, randomized, controlled, dose-finding, multi-centre study in participants with newly diagnosed, smear-positive, uncomplicated drug-sensitive pulmonary TB. Adult participants (≥ 18 years of age) will be randomized by centralized allocation at a ratio of 1:1:1:1:1 to one of five treatment arms containing BDQ, DLM and MXF, combined with different doses of DZD.After the completion of 16 weeks of experimental treatment, participants in the experimental arms, who did not achieve two successive negative liquid media cultures with the first at or before week 08, with no following positive results reported by the week 16 visit, will be referred to their local health care facility to complete their course of anti-TB treatment according to the national TB program. All other participants will be followed up until week 52 to rule out relapse or re-infection. | PMC10243693 | |
Methods: participants, interventions and outcomes | PMC10243693 | |||
Study setting {9} | TB | The study will be implemented in South Africa and Tanzania, with enrolment taking place in two dedicated TB trial centres in Johannesburg, South Africa, and in three dedicated TB trial institutes in Mbeya, Dar es Salaam and Moshi, Tanzania. A list of all participating study centres can be obtained at | PMC10243693 | |
Who will take informed consent? {26a} | pulmonary TB | Information about the trial is provided by study doctors/nurses at the trial site, who need to be delegated to perform these tasks. Participants will be invited to be screened for inclusion in the trial if they are suspected to have pulmonary TB or have an established diagnosis by smear microscopy, GeneXpert or chest X-ray done within the government or private health sector. The investigator or a person designated by the investigator will inform the participants or the participant’s legally acceptable representative in detail. After signing the informed consent form, participants are screened for inclusion and exclusion criteria, and, if eligible, enrolled in the study and randomized to one of the treatment arms. | PMC10243693 | |
Additional consent provisions for collection and use of participant data and biological specimens {26b} | TB | The study aims to collect further data and biological samples to advance the science around TB and TB treatment. Therefore, additional informed consent will be thought to collect retention samples and samples for genetic analysis for possible sub-studies. | PMC10243693 | |
Interventions | PMC10243693 | |||
Explanation for the choice of comparators {6b} | This dose-finding study is small and does not contain a classical comparator arm. 15 participants will receive DLM, BDQ, and MOX without DZD, but this is not powered to show the effect of adding DZD, unless the core regimen or DZD is much more effective or much less effective than anticipated, although this arm does provide data on a ‘0mg’ dose of DZD for the exposure modelling analysis. The intention is to provide data to set up an exposure-response model for DZD on the basis of a backbone regimen composed of the 2BDQ, a diarylquinoline compound, is the first new anti-TB drug approved after 40 years by the FDA, also specifically, as part of a combination therapy for the treatment of MDR-TB. It is approved and part of the national standard recommended treatment regimen for RR- and MDR-TB in South Africa [DLM, a nitroimidazole, represents a promising new drug for the treatment of MDR-TB. It has received regulatory approvals in several countries and has been recommended by the WHO for the treatment of MDR-TB in specific cases [MXF is a fluoroquinolone (FQ). FQ are a mainstay of MDR-TB treatment and MXF, is considered as one of the most potent drug in second-line MDR-TB therapy as recently reviewed by the WHO. Furthermore, MXF has an excellent safety profile according to data on its long-term use. | PMC10243693 | ||
Intervention description {11a} | TB | After assessing the eligibility of the participants at screening, the study will recruit into five different treatment arms. The experimental and control treatment will be administered daily for 16 weeks. Figure Study design and five different treatment arms. DZD, delpazolid; BDM, bedaquiline, delamanid, moxifloxacin; QD, once daily; BID, twice daily; SCC, sustained culture conversion to negative; WK08, treatment week 08; HR, isoniazid – rifampicin; NTP, national TB programme
| PMC10243693 | |
Criteria for discontinuing or modifying allocated interventions {11b} | TB, diaphoresis, Tremor, fever, fatigue, Hypertonia, rash, pain, eosinophilia, hyperreflexia, agitation, nausea,, tenderness, hypertension | HYPERTENSION, EOSINOPHILIA | Besides withdrawal of consent, requiring medication prohibited by protocol or sponsor decision, several stopping criteria for participants’ safety are in place:• A participant should discontinue study drug if:◦ ALT or AST >8×ULN ◦ ALT or AST >5×ULN for more than 2 weeks ◦ ALT or AST >3×ULN and (total bilirubin (TBL) >2×ULN or INR >1.5 ◦ ALT or AST >3×ULN with the appearance of fatigue, nausea, vomiting, right upper quadrant pain or tenderness, fever, rash, and/or eosinophilia (>5%) • severity grading for the QTcF interval on-treatment ECGs, adapted from [• • BP systolic >160 mmHg, or diastolic >100 mmHg: ◦ Re-assessment: Participants who develop significant hypertension with systolic blood pressure (BP) averages of three measurements of ≥ 160 mm Hg, and/or diastolic BP of ≥ 100 mm Hg, but less than 180/110 mmHg, will be re-assessed on 2 separate occasions.◦ They should be re-counselled as to the foods and drink to be avoided with study treatment, as non-compliance to this could be an important aspect to the hypertension.◦ If this evaluation supports the conclusion of a significant increase in blood pressure, the investigator will assess potential causes. If the increase is determined to be associated with study treatment, a de-challenge/re-challenge will be performed: participants will discontinue DZD. If, after ≥ 10 h (> 5 × t◦ Treatment with BDQ, DLM and MXF should continue throughout.◦ Continued hypertension after re-assessment: participants who develop persistent hypertension ≥ 160/100 mmHg after evaluation and adequate antihypertensive treatment, including those who have undergone a re-challenge with DZD, will discontinue all study treatment and complete TB treatment according to national TB program guidelines. These participants will receive follow-up to determine whether the condition normalizes after discontinuation of study treatment.BP systolic >180 mmHg, or diastolic >110 mmHg:◦ Immediate stop• ◦ Spontaneous clonus◦ Inducible clonus PLUS agitation or diaphoresis◦ Ocular clonus PLUS agitation or diaphoresis◦ Tremor PLUS hyperreflexia◦ Hypertonia PLUS temperature above 38°C PLUS ocular clonus or inducible clonus• | PMC10243693 |
Strategies to improve adherence to interventions {11c} | Study treatment intake will be observed by study staff during the study visits in the morning and will be administered at home on the other days. Facility-based directly observed treatment or community-based directly observed treatment (i.e. a friend or relative of the participant will act as a treatment supervisor) will be in place in order to maximize adherence. Furthermore, treatment adherence will be assessed by pill counting at every visit. | PMC10243693 | ||
Relevant concomitant care permitted or prohibited during the trial {11d} | CYP3A4-BDQ, epileptic seizures | EPILEPTIC SEIZURE | BDQ, DLM and MXF are metabolized by different hepatic enzymes (CYP3A4-BDQ and DLM; UDP-glucuronoyltransferase-MXF). A change in activity of these hepatic enzymes can change the drug concentrations in blood and tissue and thereby influence safety and efficacy readouts. Therefore, all drugs that would lead to a substantial change in activity of these enzymes are prohibited. Participants who are already enrolled and on study medication, and a need arises to treat with any of those drugs during the treatment phase of the trial, experimental treatment may have to be stopped.In addition, several other classes of drugs are prohibited during the trial as they might interfere with the assessment of possible AEs of the drugs given during the trial. These drugs include drugs acting on the MTB complex, drugs that might induce epileptic seizures by lowering the threshold, drugs potentially prolonging the QT-interval, drugs affecting the MAO, serotonin agonists and CYP450 inducer or inhibitor. Also, as oxazolidinones are known to have a weak reversible MAO inhibitory effect in vitro, they can block the metabolization of dietary tyramine and thus might act as pressor enhancers [Additionally, all participants able to conceive/father children will consent to be using two effective methods of contraception, one of which must be a barrier method. These will be explained to the participants in detail. Serum pregnancy tests in all females of childbearing potential will be taken at screening, week 09 and week 18 visit. | PMC10243693 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.