title stringlengths 1 1.19k | keywords stringlengths 0 668 | concept stringlengths 0 909 | paragraph stringlengths 0 61.8k | PMID stringlengths 10 11 |
|---|---|---|---|---|
Objective | pain | Academic Editor: Vahid Rakhshan This study aimed to compare the efficacy of manual therapy and pressure biofeedback-guided DCFM strength training on pain intensity and functional limitations in individuals with CGH. | PMC10442171 | |
Methods | headache disability | After applying the eligibility criteria, sixty out of eighty-nine CGH patients were recruited from King Saud University Medical Center in Riyadh and randomly allocated to intervention groups using simple random sampling. Group 1 underwent pressure biofeedback-guided DCFM strength training and conventional treatment, while Group 2 received manual therapy and conventional treatment for three consecutive weeks. The main outcome measures were scores on the visual analog scale (VAS) and the headache disability index (HDI). One assessor and two physical therapists were blinded to group allocation. | PMC10442171 | |
Results | Sixty out of eighty participants aged 29–40 years were randomized into intervention groups ( | PMC10442171 | ||
Conclusion | pain | Compared with manual therapy, pressure biofeedback-guided DCFM strength training showed a greater reduction in pain intensity (assessed using the VAS) at weeks two and three. However, both treatments were equally effective in lowering headache-related functional limitations in patients with CGH. This trial is registered with ClinicalTrial.gov PRS (Identifier ID: | PMC10442171 | |
1. Introduction | Headache, headaches, CGH, pain, ache, debilitating illness, tension-type, neck pain, cognitive pain | CERVICOGENIC HEADACHE, PATHOPHYSIOLOGY, CERVICOGENIC HEADACHES, HYPERSENSITIVITY, HEAT, CERVICOGENIC HEADACHE, COLD | Cervicogenic headache (CGH) is unilateral pain that starts in the neck and is referred from bony structures or soft tissues of the neck. It is a common and severe debilitating illness that primarily affects adult females; however, it affects both sexes aged between 20 and 60 years [The cervicogenic headache pathophysiology involves merging pain signals from multiple neck structures on top of the trigeminocervical nucleus in the brainstem [In CGH, the frontal-temporal and orbital regions of the head are affected by the unilateral referred pain of the top three cervical spinal nerves that originates from one side of the posterior head and neck [Criteria for diagnosing CGH have been set by the International Headache Society (IHS) [There is a pattern of typical symptoms that people with CGH experience; however, there may be some variation in their complaints. Symptoms typically start in the neck and progress to the head; furthermore, the symptoms are typically unilateral and do not switch sides. The pain can range in severity from a deep, dull ache to a heavy pressure that is either mild or severe [In previous studies, researchers have reported that people with neck pain and headaches showed a 43%–46% decrease in isometric cervical flexor muscle strength [The role of manual therapy is limited in the treatment of headaches. Despite not being suitable for all forms of headaches, scientific evidence supports the use of a few manual therapies, such as cervical spinal exercises, spinal joint mobilization and manipulation, trigger point therapy, physical therapy using heat and cold packs, ultrasound, electrical stimulation, massage, acupuncture, and cognitive pain approaches, which are based on a nociceptive pain theory and aim to modulate central nervous system hypersensitivity, in the treatment of tension-type and cervicogenic headaches [In CGH patients, the combination of manual treatment and muscle reeducation effectively reduced headaches and enhanced function [ | PMC10442171 |
2. Materials and Methods | PMC10442171 | |||
2.1. Study Design | pain | This study followed a double-blinded, two-arm, parallel-group, multiple-timeline, randomized comparative design to test and compare the impact of manual therapy and pressure biofeedback-guided DCFM strength training on the outcomes of pain and functional limitations in individuals with CGH. | PMC10442171 | |
2.2. Ethical Considerations | The Ethics Committee of King Saud University approved this study (file ID: RRC-2022-04, dated: February 14, 2022), ensuring the protection of human and ethical rights in research involving human subjects. The study completed trial registration with ClinicalTrial.gov PRS (Identifier ID: | PMC10442171 | ||
2.3. Sample Size | A computer program G | PMC10442171 | ||
2.4. Study Setting | neck discomfort/pain | Sixty participants diagnosed with CGH by a consultant neurological physician were referred to the University Medical Center's outpatient physiotherapy department (OPD) for neck discomfort/pain treatment. The study was completed from February to September, 2022. Handy pamphlets, posters, and large banners were used in and around the OPD building to attract patients to participate in this study. | PMC10442171 | |
2.5. Study Participants | TMJ dysfunction, headaches, vertigo, awkward head positioning, head pain, visual disturbance, stenosis | PROLAPSED DISC, STENOSIS | Sixty participants were recruited for the study based on the inclusion and exclusion criteria. The inclusion criteria were as follows: the participants exhibited unilateral head pain without side shift or bilateral head pain with a dominant side that hurts more than the other side, sustained awkward head positioning, and external pressure over the upper cervical or occipital region on the symptomatic side, recurrent CGH and chronic mechanical neck discomfort for three to twelve months, and showed positive to cervical flexion rotation test. The following conditions qualified as exclusion factors: a negative cervical flexion rotation test; subjects with a history of the following conditions: a fractured vertebral column or previous surgery on it; spinal stenosis; a prolapsed disc; TMJ dysfunction or headaches involving the autonomic nervous system; vertigo or visual disturbance; or a congenital condition of the cervical spine. | PMC10442171 |
2.6. Procedures | During seven-month screenings based on this study's inclusion and exclusion criteria, sixty participants were recruited and randomly assigned to groups 1 and 2 using simple random sampling. The participants' serial numbers were assigned equally to both groups using an online, website-based randomization program ( | PMC10442171 | ||
2.7. Outcome Measures | chronic pain, headaches, pain | CHRONIC PAIN | The participants' pain intensity was measured on a 10-cm visual analog scale (VAS) with zero (0) at one end and ten (10) at the other, signifying no pain and the worst pain possible, respectively. The participants were instructed to place a mark between 0 and 10 on the VAS scale to indicate their actual amount of pain during the week/night. The VAS has been shown to be a valid and reliable instrument with the least detectable change for measuring headaches and other chronic pain [ | PMC10442171 |
2.8. Intervention | HEAT | Both groups 1 and 2 commonly received conventional treatment (i.e., moist heat pads). Group 1 performed pressure biofeedback-guided DCFM strength training, while Group 2 received manual therapy. | PMC10442171 | |
2.8.1. Pressure Biofeedback-Guided DCFM Strength Training | Participants from Group 1 performed the DCFM strength training exercise described by Jull [ | PMC10442171 | ||
2.8.2. Manual Therapy | A slow, sustained elongation of muscles [ | PMC10442171 | ||
2.8.3. Conventional Intervention | The participants received hot water fomentation applied over the shoulder and neck region in a long sitting position for fifteen minutes per session, five days a week for four weeks [ | PMC10442171 | ||
2.9. Statistical Analysis | Statistical Package for the Social Sciences (SPSS) software was used to analyze the data (IBM SPSS v.26, IBM Corp., Armonk, NY: USA). The Shapiro‒Wilk test is used to examine the distributional homogeneity of a sample. For the study of categorical data, the chi-square test was utilized. One-way analysis of variance (ANOVA): Bonferroni's multiple comparison tests were performed to assess the main effect between group factors at the different time points, within-group factors throughout the time point, and the interaction between time and group across the time point. In addition, the post hoc analysis utilized Bonferroni's multiple comparison tests to determine which group was superior to the others. The significance level alpha was set at 95%. | PMC10442171 | ||
3. Result | pain | Sixty (females, 33; males, 27; mean age, 34.95 years) out of eighty-nine participants with chronic mechanical pain diagnosed with CGH were randomly allocated to either group ( | PMC10442171 | |
3.1. Within-Group Analysis | The within-group analysis for the variables VAS and HDI revealed a statistically significant improvement (95% CI, In group 1, the VAS scores showed a significant mean difference (∆MD) when baseline was compared with the postintervention scores at different time intervals, such as VAS0-VAS1 (∆Furthermore, in group 1, the variable HDI showed a significant mean difference (∆MD) when baseline was compared with the postintervention scores at different time intervals, such as HDI0-HDI1 (∆ | PMC10442171 | ||
3.2. Between-Group Analysis | Nevertheless, between-group (1 vs. 2) analysis of VAS and HDI outcomes revealed nonsignificant (95% CI, Furthermore, Cohen's | PMC10442171 | ||
4. Discussion | TrPs, headaches, head posture, pain, tension-type, headache, cognitive pain | CERVICOGENIC HEADACHE, CERVICOGENIC HEADACHES, HYPERSENSITIVITY, CCF | This study compared the efficacy of pressure biofeedback-guided DCFM strength training to cervical isometric exercises on pain and functional limitation in patients with cervicogenic headaches. The results of the study indicate that DCFM strength training using pressure biofeedback was more effective at reducing pain intensity and functional limitations, thereby increasing the endurance capacity of the DCFM over a 3-week period for the treatment of CGH. A referred pain reported in any head portion generated by a primary nociceptive source in the musculoskeletal tissues innervated by cervical nerves is defined as CGH by The World Cervicogenic Headache Society (WCHS) [This study provides preliminary evidence that such a trial is feasible. Manual therapy targeted to active TrPs in the sternocleidomastoid muscle may reduce headache and neck pain intensity and boost the motor function of the deep cervical flexors, PPT, and active CROM in persons with CGH and active TrPs in this muscle [Numerous researchers have investigated the anatomic basis of CGH, including the distribution of referred pain, to pinpoint the segmental location of symptomatic joints. Using fluoroscopically guided intraarticular injections, these authors demonstrated that C0-1, C1-2, and C2-3 are the segments most likely to refer pain to a location that would be experienced as a headache [The current scientific evidence supports the use of manual therapy in treating tension-type and cervicogenic headaches; however, the results are inconsistent. These disparate outcomes may be attributable to not all manual therapies being suited for all types of headaches, or not all headache patients will benefit from manual therapy. Based on a nociceptive pain rationale, this research provides examples of manual therapies for tension-type and cervicogenic headaches that modulate central nervous system hypersensitivity, including trigger point therapy, joint mobilization, joint manipulation, exercise, and cognitive pain methods [These results imply that DCFM strengthening exercises employing a pressure biofeedback unit are more beneficial than traditional exercise alone in lowering headache frequency in persons with CGH. The roller massage technique may be recommended to augment the initial ROM and strength of the CCF in individuals with a forward head posture [ | PMC10442171 |
4.1. Limitations | pain | Despite its benefits, this study also had limitations. This study compared a manual therapy (single intervention approach) with a conventional intervention to alleviate the symptoms of patients with CGH. However, comparing a multimodal approach with a conventional intervention to manage the symptoms would have been an effective way to determine a perfect management line instead of using a single approach in patients with CGH. In addition, outcome variables, such as DCFM strength and cervical ROM, were not assessed. Therefore, future studies need to include a multimodel approach to intervention to identify the most practical and reasonable intervention for managing the symptoms, including pain, DCFM strength, ROM, and functional limitations in patients with CGH. | PMC10442171 | |
5. Conclusion | pain | Compared with manual therapy, pressure biofeedback-guided DCFM strength training showed a greater reduction in pain intensity (VAS) at weeks two and three. However, both treatments were equally effective in lowering headache-related functional limitations in patients with CGH. While managing patients with CGH, the physical therapist should select one of the two intervention regimens based on the desired goals. | PMC10442171 | |
Acknowledgments | The authors are grateful to the Researchers Supporting Project number RSP2023R382, King Saud University, Riyadh, Saudi Arabia, for funding this research. | PMC10442171 | ||
Data Availability | The dataset for the results of this study will be available from the corresponding author upon reasonable request. | PMC10442171 | ||
Consent | Informed consent was obtained from all subjects involved in the study. | PMC10442171 | ||
Conflicts of Interest | The authors declare that there are no conflicts of interest. | PMC10442171 | ||
Authors' Contributions | headache disability | Shahnaz Hasan and Abeer R. Ibrahim conceptualized the study; Shahnaz Hasan, Abeer R. Ibrahim, Naiyer Shahzad, and Nasrin Bharti curated the data; AMIR IQBAL and Naiyer Shahzad formally analyzed the study; Ahmad H. Alghadir acquired the funding; Shahnaz Hasan, AMIR IQBAL, Ahmad H. Alghadir, Abeer R. Ibrahim, and Nasrin Bharti proposed the methodology; Ahmad H. Alghadir administered the project; Ahmad H. Alghadir, Naiyer Shahzad, and Nasrin Bharti gathered the resources; Ahmad H. Alghadir supervised the study; Shahnaz Hasan, Abeer R. Ibrahim, Naiyer Shahzad, AMIR IQBAL, and Nasrin Bharti wrote the original draft; and Shahnaz Hasan, AMIR IQBAL, Ahmad H. Alghadir, Abeer R. Ibrahim, and Naiyer Shahzad reviewed and edited the manuscript. All authors read and approved the final version of the manuscript.A CONSORT (2010) flow diagram shows the study procedures, such as participant enrollment, randomization, group allocation, intervention received, follow-up, and analysis.The participants' demographic characteristics mean and standard deviation scores within each group (1 vs. 2).Comparison of the VAS mean scores between groups (1 vs. 2) at multiple time points.Comparison of the HDI mean scores between groups (1 vs. 2) at multiple time points.Shapiro‒Wilk test of normality for the participant distribution in both groups (Demographic characteristics of the participants from both groups (1: group 1; 2: group 2; SD: standard deviation; CI: confidence interval; BMI: body mass index; Descriptive statistics of participants' outcome scores (VAS and HDI) in both groups (1: group 1; 2: group 2; SD: standard deviation; CI: confidence interval; VAS: visual analog scale; VAS0: VAS score at baseline; VAS1, 2, and 3: VAS scores at week 1Pairwise comparison of mean differences (treatment effect) within groups (1 and 2). Repeated measures ANOVA test: Bonferroni's multiple comparison tests, with 95% confidence interval of means.VAS: visual analog scale; HDI: headache disability index; SD: standard deviation; Between-group comparison of the variables at different timelines. One-way ANOVA test: Bonferroni's multiple comparison tests, 95% confidence interval of means.∆MD: mean differences (group 1-group 2); VAS: visual analog scale; HDI: headache disability index; SD: standard deviation; | PMC10442171 | |
Background: | Human social behavior | Human social behavior is modulated by oxytocin (OT). Intranasal administration of OT (IN-OT) is a noninvasive route shown to elicit changes in the autonomic nervous system (ANS) activity; however, IN-OT’s effect on the temporal profile of ANS activity at rest is yet to be described. | PMC10291383 | |
Aims: | We aimed to describe the temporal profile of IN-OT at six 10-min time windows from 15- to 100-min post-administration in 20 male participants at rest while continuously recording their pupillary in an eyes-open condition and cardiac activity in eyes-open and eyes-closed conditions. | PMC10291383 | ||
Methods: | We used a double-blind, placebo-controlled, within-subjects design study where we extracted two proxies of parasympathetic nervous system (PNS) activity: high-frequency heart rate variability (HF-HRV) and pupillary unrest index (PUI); and a proxy of sympathetic nervous system activity: sample entropy of the pupillary unrest. | PMC10291383 | ||
Results: | In the eyes-open condition, we found an effect of IN-OT on the proxies of PNS activity: decreased PUI in the three-time windows post-administration spanning 65–100 min, and as an exploratory finding, an increased HF-HRV in the 80–85 min time window. | PMC10291383 | ||
Conclusions: | alertness | We suggest there is a role of OT in PNS regulation that may be consistent with OT’s currently theorized role in the facilitation of alertness and approach behavior. | PMC10291383 | |
Introduction | CONSTRICTION, DILATION | Oxytocin (OT) has increasingly gathered the interest of cognitive neuroscientists since it was shown to be implicated in social cognition and behavior in humans (The effects of OT on social cognition have been linked to both central and peripherally measured nervous system activity and integrated into hypotheses such as the social salience hypothesis (OT is produced in the paraventricular, supraoptic, and accessory magnocellular nuclei of the hypothalamus (Yet, the characterization of IN-OT’s impact on the ANS function is still unclear, both during cognitive tasks and at rest. So far, IN-OT’s effects on each branch of the ANS have been inconsistent. During tasks, it has been found to (1) increase PNS activity (specifically, indexed by increased HF-HRV) in a facial emotion recognition task, albeit with no effect on the sympathetic nervous system (SNS) measured by electrodermal activity (Pupillary oscillations also reflect ANS activity; however, it has not yet been used to help characterize the effects of IN-OT at rest. The pupil’s constriction is controlled by the sphincter muscle, innervated by the PNS, and its dilation is controlled by the dilator muscle, innervated by the SNS (In sum, the temporal profile of IN-OT’s effect on the ANS at rest remains to be examined, and its impact at a commonly reported time window of assessments of around 40 min is not known. In the present study, we aimed to assess the effect of 24 IU IN-OT on ANS activity at rest, across a large neuroscience experimental session duration, in healthy males, with a double-blind, randomized placebo-controlled cross-over design, recording their pupillary and cardiac activity at one baseline time window pre-administration and at six time windows post-administration (from 15 to 100 min). We examined the effect of IN-OT on proxies of PNS and SNS activity, in each time window, using electrocardiography (ECG) and pupillometry signals: two positive proxies of PNS activity (HF-HRV and PUI) ( | PMC10291383 | |
Materials and methods | PMC10291383 | |||
Participants | We recruited 20 young ( | PMC10291383 | ||
Experimental procedure | The experimental session took place in a quiet room of the CAML’s Clinical Research Centre (Centro para Investigação Clínica) at the Hospital de Santa Maria, Lisbon, Portugal. We used a double-blind (throughout data collection up to statistical analysis, inclusive), randomized placebo-controlled, cross-over design, whereby each participant took part in two sessions: one for IN-OT and another for placebo administration, in a counterbalanced order, and at the same time each day (by 2 pm). The IN-OT administration of 24 IU was via three puffs of 0.1 ml each, in each nostril, from a 40 IU mlParticipants spent seven time windows of 5-min eyes-closed and 5-min eyes-open (−10–0 min before administration and 15–27 min, 30–42 min, 45–57 min, 1 h to 1 h 12 min, 1 h 15 min to 1 h 27 min, 1 h 30 min to 1 h 42 min after administration) (see The resting-state task. Neurophysiological data were recorded in eyes-closed (HRV) and eyes-open (HRV and pupil size) conditions in seven time windows, one prior to drug administration (baseline) and six post administration. Each time window was preceded by a 30-s countdown. Then followed 5 min of eyes-closed, a beep as an instruction to open eyes, a 15-s countdown, and finally five more minutes of recording. Afterwards, the participants filled in on-screen Likert-type scales for alertness, excitement and sociability. Between time windows, participants were allowed to rest until the start of the following recording period. OT: oxytocin; PL: placebo; HRV: heart rate variability. | PMC10291383 | ||
Data acquisition and preprocessing | PMC10291383 | |||
Pupillary activity | blinks, partial occlusion of the eyelids | Participants sat comfortably with their chin supported over a chinrest to minimize head movement, at approximately 56 cm away from a Lenovo 23.8-inch screen with 1920 × 1080 resolution and 60 Hz refresh rate. At a 1000 Hz sampling rate, monocular gaze tracking and pupil size of the left eye of every participant were recorded with an SR Research EyeLink 1000 Plus which has an average accuracy of 0.15 visual angle. From the raw pupil size signal, samples 75 ms before and after blinks, as identified by the eye tracker, were converted to missing data to remove artifacts caused by partial occlusion of the eyelids (In order to assess the possible confounding impact of the pupil foreshortening error ( | PMC10291383 | |
Heart rate variability | The HRV was measured using a BIOPAC MP150 amplifier with the ECG recording module ECG100C-MRI in R wave at 1000 Hz sampling rate, gain as 1000, LP as 35 Hz and HP as 1 Hz (Biopac Systems Inc., Goleta, CA, USA) and AcqKnowledge 4.3 software. Three Ag/AgCl electrodes with 11-mm diameter (EL503 EKG , Biopac Systems Inc., Goleta, CA, USA) were placed in a Lead II disposition. The beat-to-beat RR intervals were analyzed using the Kubios Premium software (version 3.2) ( | PMC10291383 | ||
Statistical analysis | Statistical analysis was performed in R software 3.6 ( | PMC10291383 | ||
Results | PMC10291383 | |||
Heart rate variability | PMC10291383 | |||
Eyes-closed | The main effect of drug on HF-HRV in eyes-closed, Profile of HF-HRV after IN-OT in a resting-state paradigm with eyes-closed (left) and eyes-open (right) conditions. Significant pairwise comparisons (IN-OT vs placebo) at specific time windows are marked with an asterisk (*). Eyes-closed time windows: 1 = 15–20 min; 2 = 30–35 min; 3 = 45–50 min; 4 = 60–65 min; 5 = 75–80 min; and 6 = 90–95 min. Eyes-open time windows: 1 = 20–25 min; 2 = 35–40 min; 3 = 50–55 min; 4 = 65–70 min; 5 = 80–85 min; and 6 = 95–100 min. Error bars: Standard error. HF-HRV: high-frequency heart rate variability; IN-OT: intranasal oxytocin; HRV: heart rate variability.Summary of the results of the effect of drug on the neurophysiological measures.All main effects of drug are shown; with statistically significant main effects (i.e., Bonferroni-corrected for the number of neurophysiological measures used) marked with an asterisk (*). Only follow-up pairwise comparisons surviving an uncorrected | PMC10291383 | ||
Eyes-open | The main effect of drug on HF-HRV in eyes-open, | PMC10291383 | ||
Pupillary unrest (PUI and SampEn) | The main effect of drug on PUI was significant, Profile of two pupil size measures after IN-OT: PUI and SampEn; in a resting-state paradigm. Significant pairwise comparisons (IN-OT vs placebo) at specific time windows are marked with an asterisk (*). Time windows: 1 = 20–25 min; 2 = 35–40 min; 3 = 50–55 min; 4 = 65–70 min; 5 = 80–85 min; and 6 = 95–100 min. Error bars: Standard error. PUI: pupillary unrest index; SampEn: sample entropy; IN-OT: intranasal oxytocin. | PMC10291383 | ||
Behavioral and Mood scales | The main effect of drug on excitability, | PMC10291383 | ||
Discussion | In this study, we aimed, for the first time, to our knowledge, to describe the temporal profile of 24 IU of IN-OT on ANS activity at rest. We included eyes-closed and eyes-open conditions and multiple time windows across a typically large neuroscience experiment duration (including a baseline assessment prior to drug administration), where we examined two positive proxies of PNS activity (HF-HRV and PUI) ( | PMC10291383 | ||
The temporal profile of IN-OT effects | As abovementioned, the IN-OT effects we found both on pupillary unrest (at 65–100 min), and the exploratory finding on HF-HRV (at 80–85 min), were detected later than 40 min. Forty minutes is the starting time point which most previous studies have investigated ( | PMC10291383 | ||
IN-OT decreased PUI at rest: (Unexpectedly) suggestive of PNS | sleepiness, alertness, drowsiness | Our finding of IN-OT having an effect on pupil size at rest, that is, a medium-sized (On the other hand, and more substantially supported by previous evidence, PUI also increases with sleepiness and drowsiness and decreases with alertness (While PUI’s direct association with each branch of the ANS has not yet been researched, HF-HRV is one of the most robust proxies of the PNS, backed by practical and theoretical evidence ( | PMC10291383 | |
Limitations | DRUG EFFECT | Herein we computed the Euclidean distance from each sample’s location to the center of the screen (i.e., fixation cross) and subjected this measure to the same statistical analysis of our dependent variables—to assess a, by chance, possible confounding effect of the pupil foreshortening error on our drug effect analyses ( | PMC10291383 | |
Conclusions | alertness | We report herein on the temporal profile of IN-OT in the human ANS at rest using HRV and, for the first time, pupillary unrest measures. Having found OT to decrease PUI (suggesting PNS deactivation) and tentatively (as an exploratory finding) that it may increase HF-HRV (suggesting PNS activation), we speculated that both might be consistent with the facilitation of alertness and preparedness for an approach behavior. Given the early days of IN-OT and ANS association research, the interpretation of these results remains speculative. Nevertheless, we hope our findings may assist in future study design, in the investigation of the comparability between IN-OT findings across data modalities, and in the assessment of usefulness of ANS markers for IN-OT response monitoring and human social cognition understanding. | PMC10291383 | |
Supplemental Material | PMC10291383 | |||
References | PMC10291383 | |||
Purpose | Carboxymethylcellulose is an artificial tear ingredient known to decrease gut microbiome diversity when ingested. This study examines the effect of carboxymethylcellulose on ocular surface microbiome diversity and composition. | PMC10424155 | ||
Methods | DISEASE, DISEASE | Healthy adult participants without significant ophthalmic disease or concurrent carboxymethylcellulose artificial tear use were allocated randomly to take carboxymethylcellulose or control polyethylene glycol artificial tears for seven days. Conjunctival swabs were collected before and after artificial tear treatment. This trial is registered at clinicaltrials.gov (NCT05292755). Primary outcomes included abundance of bacterial taxa and microbiome diversity as measured by the Chao-1 richness estimate, Shannon's phylogenetic diversity index, and UniFrac analysis. Secondary outcomes included Ocular Surface Disease Index scores and artificial tear compliance. | PMC10424155 | |
Results | Of the 80 enrolled participants, 66 completed the trial. Neither intervention affected Chao-1 richness (analysis of variance [ANOVA], | PMC10424155 | ||
Conclusions | Carboxymethylcellulose artificial tears increased | PMC10424155 | ||
Translational Relevance | The 16S microbiome analysis has revealed small changes in the ocular surface microbiome associated with artificial tear use. | PMC10424155 | ||
Introduction | disorder of the ocular surface, Dry eye syndrome | PATHOPHYSIOLOGY, DRY EYE SYNDROME | Dry eye syndrome (DES) is a disorder of the ocular surface, frequently characterized by lipid or aqueous deficiency of the tear film.One potential factor mediating the inflammatory pathophysiology of DES is the ocular surface microbiome (OSM), composed of all microbial flora colonizing the ocular surface.Artificial tears (ATs) are a mainstay of DES therapy.Given the widespread use of CMC-ATs and its potential implications for the OSM, we conducted a double-masked randomized controlled trial examining the effects of CMC-ATs on the OSM and DES symptoms, compared to a control PEG-AT without CMC. Outcomes included metagenomic analysis of the OSM by 16S bacterial ribosomal RNA (rRNA) sequencing, | PMC10424155 |
Methods | PMC10424155 | |||
Patients and Study Design | This is a double-masked randomized controlled trial (Study design and participant flow chart. After 96 prospective participants were assessed for eligibility, 80 participants were enrolled. Patients were assigned by simple randomization to receive either CMC or PEG ATs, masked to the participant and the researcher. Conjunctival swabs and surveys were administered on days 1 and 7. Participant dropout was five for the CMC group and nine for the PEG group. | PMC10424155 | ||
Intervention and Outcomes | DRY EYE | Enrolled participants were randomized to receive either ATs containing 0.5% CMC (Refresh Plus; Allergan Inc., Dublin, Ireland) or control ATs containing 0.4% PEG (Systane PF; Alcon Labs, Fort Worth, TX, USA). For the purposes of masking, one researcher with no participant contact (Li, Y.) created 80 identical boxes, each labeled with a unique alphanumeric code. Boxes contained 30 similar, unlabeled, and transparent vials of either CMC (n = 40) or PEG (n = 40) ATs. Each alphanumeric code and its contents were recorded on a spreadsheet (Excel 2016; Microsoft, Redmond, WA, USA) and randomly paired with a numerical code (1–80) using a computer algorithm. Required sample size was calculated by power estimates in IBM SPSS 28 (IBM Corp., Armonk, NY, USA) with anticipated 20% participant dropout. The spreadsheet with listed interventions was not accessible to other researchers until completion of the protocol. Enrolled participants received boxes 1 to 80 in order of enrollment and used the alphanumeric box codes for identification. Participants were asked to instill one drop of the given AT in both eyes three times daily for seven days, spaced evenly throughout the day, and to return for follow-up on the seventh day. PEG-ATs were chosen as the control because of their similar physical properties and vial appearance, because saline solution has a noticeably lower viscosity than CMC-ATs.Primary outcomes included alpha diversity, beta diversity, and relative abundance of bacterial genera derived from pooled conjunctival swabs at days 1 and 7 for each participant. Secondary outcomes included the OSDI survey and compliance scores, collected from a computerized survey. Compliance scores were self-reported by participants as the estimated number of AT drops used in each eye daily, with ideal scores at one drops per eye daily although participants may have used more or fewer drops. The OSDI is a validated survey for assessing subjective dry eye symptomatology and quality of life, ranging from a score of 0 indicating no symptoms up to 48 indicating severe symptoms. | PMC10424155 | |
Ocular Surface Microbiome Sample Collection and Processing | STERILE, LYSIS | Before each conjunctival swab, one drop of proparacaine was instilled in both eyes. A sterile solid-core nylon swab (DNA/RNA Shield Swab collection kit; Zymo, Orange, CA, USA) was rotated in the inferior fornix of the left eye, then the right eye, and placed into a bead-beating tube containing 750 µL DNeasy lysis buffer (DNeasy PowerSoil Pro DNA extraction kit; Qiagen, Hilden, Germany) and stored at 4°C until further processing. Several blank swabs with the same proparacaine, swabs, and tubes were performed in room air without a participant present as controls.Genomic DNA was extracted using the DNeasy PowerSoil Pro DNA extraction kit according to the manufacturer's instructions. For each sample, the V1-V3 hypervariable region of the 16S rRNA gene was amplified using primers 27F (5ʹ AGAGTTTGATCCTGGCTCAG 3ʹ) and 534R (5ʹ ATTACCGCGGCTGCTGG 3ʹ) with barcodes to allow multiplex deep sequencing as described previously. | PMC10424155 | |
Data Processing and Statistical Analysis | Raw MiSeq reads (covering the V1–V3 hypervariable region of the 16S rRNA gene using primers 27F and 534R) were demultiplexed using cutadapt4. | PMC10424155 | ||
Results | OCULAR SURFACE DISEASE, COMPLICATIONS | Among the 80 participants enrolled, 35 participants in the CMC group completed the follow-up period, and 31 participants in the PEG group completed the follow-up period. No intervention-associated complications were observed, and both interventions were well tolerated. Participant characteristics are displayed in the Participant CharacteristicsParticipant characteristics were not significantly different between treatment groups at a 95% confidence threshold using statistical tests indicated (At baseline, the mean (standard deviation [SD]) OSDI scores were 7.69 (9.35) for the CMC group and 5.71 (7.70) for the PEG group. After intervention, the mean (SD) OSDI scores were 4.77 (7.93) for the CMC group and 3.35 (4.56) for the PEG group. This constituted a mean ΔOSDI (SD) of −2.91 (4.43) for the CMC group and −2.35 (5.42) for the PEG group. Both interventions were associated with a significant reduction in OSDI scores by pairwise Wilcoxon signed rank test (Box plots of ocular surface disease index scores. Outliers are shown as circles, and extreme outliers are shown as asterisks. (a) Ocular surface disease index scores are significantly lower after either CMC or PEG interventions. (b) There was no significant difference in reduction of ocular surface disease index scores between groups.Sequencing generated a maximum of 590 ASVs. The total number of reads from all participant samples and controls was 8,894,613 and was reduced to 4,554,231 after filtering and denoising. After contaminant filtering, 490 ASVs remained for analysis and were classified into 12 phyla (Next-Generation Sequencing Results. Taxonomic classification summary for all unfiltered samples at the (a) phylum and (b) class level. Sample letters indicate participant and numbers indicate before or after intervention. Asterisks indicate no classification available at this taxonomic level. (c) Principal coordinate analysis of unweighted UniFrac distances showing negative control samples have a distinct grouping within unfiltered sample microbiomes. (d) Principal coordinate analysis of weighted UniFrac distances showing negative control samples have a distinct grouping within unfiltered sample microbiomes.Box plots of alpha diversity. Alpha diversity measures are displayed for samples collected from both intervention groups at days 1 and 7. Outliers are shown as circles, and extreme outliers are shown as asterisks. (a) Species richness is not significantly different between groups at any time point. (b) Species diversity is not significantly different between groups at any time point.Differences in the microbial community structure were compared using UniFrac. Mann-Whitney repeated-measure comparisons of unweighted UniFrac distances (Beta diversity analysis. (a) Box plot of pairwise unweighted Unifrac distances between day 1 and day 7 time points, showing no significant differences between the two intervention groups. (b) Box plot of pairwise weighted UniFrac distances between day 1 and day 7 time points, showing no significant differences between the two intervention groups. (c) Principal coordinate analysis of unweighted UniFrac distances showing no significant grouping by intervention or time point. (d) Principal coordinate analysis of weighted UniFrac distances showing no significant grouping by intervention or time point. (e) Principal coordinate analysis of unweighted UniFrac distances shows grouping by participant sex. (f) Principal coordinate analysis of weighted UniFrac distances shows no significant grouping by participant sex.Bacterial relative abundance. (a) Bar graph of the top 10 most abundant bacterial genera from all ocular surface microbiome samples, with mean relative abundances listed. (b) LEfSe taxonomic analysis of taxa before and after CMC AT treatment at the genus level. (c) LEfSe taxonomic analysis of species before and after PEG AT treatment at the genus level. | PMC10424155 | |
Discussion | To our knowledge, this is the first randomized double-masked clinical trial assessing the effect of CMC-ATs on the OSM. Existing studies comparing AT formulations found minimal differences in subjective and objective outcomes among over-the-counter ATs but have yet to examine implications for the OSM. | PMC10424155 | ||
Participants, Compliance, and Dry Eye Symptoms | Participants who completed the study were healthy adults without significant comorbidities, and there were no significant differences in the demographics of both study arms (On enrollment, both study arms had comparable DES symptomatology, with OSDI scores less than 22 in 60 participants (90.1%). Therefore only the remaining six participants were considered to have moderate or severe DES. Both study arms experienced a small and statistically similar reduction in OSDI ( | PMC10424155 | ||
OSM Diversity | SEPARATION | When examining OSM diversity, several measures have been reported in the literature.Similar Chao-1 estimates and Shannon diversities between the CMC and PEG study arms and time points (Overall, it appears that the high microbial diversity associated with DES may be resilient to topical elution or short-term interventions. Based on these two trials, it is possible that long-term AT use or saline elution exceeding one month may change alpha diversity, but there is no evidence that it may convert a DES-associated OSM into a healthy control-associated OSM by reducing alpha diversity. Some interventions such as topical prostaglandin therapy may increase alpha diversity,There were no significant differences in UniFrac distances between study arms (Among the variables examined in our study, gender explained the separation in microbiome beta diversity among samples ( | PMC10424155 | |
OSM Composition | Before the advent of metagenomic analysis using bacterial ribosomal RNA high-throughput sequencing, the ocular surface was thought to have low bacterial abundance and diversity dominated by onfallen skin flora.In our participants, we found high relative abundances of To identify differentially abundant taxa between groups, we used LEfSe (CMC-ATs were associated with enrichment of periocular skin-associated phyla Both CMC-AT and PEG-AT treatments were associated with enrichment of Overall, CMC-ATs were associated with enrichment of | PMC10424155 | ||
Study Limitations | Interpretation of this study should consider that AT compliance was participant-reported and not actively monitored (i.e., checking empty vials) as other studies have done.Although the objective of this study was to identify effects of CMC on the OSM, neither pure CMC solution nor a perfect control were available. Instead, commercially available ATs were chosen, with different inactive ingredients such as ionic salt buffers, organic (Aminomethylpropanol) salt buffers, hyaluronate, and sorbitol. Although these differences may confound results, their concentration is relatively low. Participants were also compared by time point with no differences in OSM diversity, suggesting that the impacts of these ingredients are not significant confounding factors.Interpretation of these microbiome results should consider that this was a bilateral pooled, anesthetized, and deep conjunctival swab with nylon flocking. The bacterial microbiome at the lid margin may be different from the inferior fornix, and samples may also be affected by anesthesia and swab type. | PMC10424155 | ||
Conclusion | In this double-masked randomized controlled trial, CMC AT treatment increased | PMC10424155 | ||
Acknowledgments | Supported in part by NIAID R21 AI150250, VA CSR&D Merit Review I01CX001391, and the Gatorade Trust through funds distributed by the University of Florida, Department of Medicine. The funding organization had no role in the design or conduct of this research.Disclosure: | PMC10424155 | ||
References | PMC10424155 | |||
Introduction | deficiencies of the hematopoietic system, herpes virus specific T cells, hematologic malignancies, immunodeficiency of the host | DISEASE, HEMATOLOGIC MALIGNANCIES | Edited by: Christian Muenz, University of Zurich, SwitzerlandReviewed by: Enrico Maffini, University of Bologna, Italy; Maria Teresa Lupo Stanghellini, Scientific Institute for Research, Hospitalization and Healthcare (IRCCS), ItalyAllogeneic stem cell transplantation is used to cure hematologic malignancies or deficiencies of the hematopoietic system. It is associated with severe immunodeficiency of the host early after transplant and therefore early reactivation of latent herpesviruses such as CMV and EBV within the first 100 days are frequent. Small studies and case series indicated that application of herpes virus specific T cells can control and prevent disease in this patient population. | PMC10642256 |
Methods | TRANSFUSION REACTION | We report the results of a randomized controlled multi centre phase I/IIa study (MULTIVIR-01) using a newly developed T cell product with specificity for CMV and EBV derived from the allogeneic stem cell grafts used for transplantation. The study aimed at prevention and preemptive treatment of both viruses in patients after allogeneic stem cell transplantation targeting first infusion on day +30. Primary endpoints were acute transfusion reaction and acute-graft versus-host-disease after infusion of activated T cells. | PMC10642256 | |
Results | ADVERSE EVENTS, VIRUS, GRAFT VERSUS HOST DISEASE | Thirty-three patients were screened and 9 patients were treated with a total of 25 doses of the T cell product. We show that central manufacturing can be achieved successfully under study conditions and the product can be applied without major side effects. Overall survival, transplant related mortality, cumulative incidence of graft versus host disease and number of severe adverse events were not different between treatment and control groups. Expansion of CMV/EBV specific T cells was observed in a fraction of patients, but overall there was no difference in virus reactivation. | PMC10642256 | |
Discussion | ACUTE GRAFT VERSUS HOST DISEASE | Our study results indicate peptide stimulated epitope specific T cells derived from stem cell grafts can be administered safely for prevention and preemptive treatment of reactivation without evidence for induction of acute graft versus host disease. | PMC10642256 | |
Clinical trial registration | PMC10642256 | |||
Introduction | deficiencies of the hematopoietic system, toxicity, GvHD, Epstein-Barr virus, EBV infections, infection, malignant diseases, latent-, herpesvirus reactivations | CYTOMEGALOVIRUS, GRAFT-VERSUS-HOST DISEASE, COMPLICATION, MALIGNANT DISEASE, INFECTION, EBV INFECTION | Allogeneic stem cell transplantation (aSCT) in the adult patient aims at curing malignant diseases or other deficiencies of the hematopoietic system. Aside from graft-versus-host disease (GvHD), reactivation of latent herpesviruses represents a major complication significantly contributing to morbidity and impairment of quality of life. Due to the immunosuppressive nature of the transplant procedure and due to medical immunosuppression, herpesvirus reactivations are frequent and often require toxic antiviral treatments. Especially cytomegalovirus (CMV) and Epstein-Barr virus (EBV) impose a considerable risk for treatment success and are therefore monitored in the peripheral blood by PCR post transplant. Available antiviral drugs are effective for CMV, but come at high toxicity for bone marrow, kidney and other organs (The immune response that controls new CMV and EBV infections is dominated by a strong expansion of CD8+ T cells which are reactive to both latent- and lytic-cycle viral antigens and persist after the infection has been cleared (Cellular therapy of both CMV and EBV reactivation after aSCT has been used with convincing results in several studies over the past decades (A key factor in preventing reactivation of CMV and EBV after aSCT are sustained anti-viral T cell responses. However, the Here we present results from a randomized phase I/IIa study utilizing a manufacturing protocol for CMV- and EBV-specific T cell for prevention and pre-emptive treatment of reactivation of both viruses in patient after aSCT ( | PMC10642256 |
Patients and methods | PMC10642256 | |||
Study design/protocol | comorbidity, MM, toxicity, SIB, AML, MPS, ALL, Non-Hodgkin-lymphoma, COPD, NHL | MULTIPLE MYELOMA, ACUTE MYELOID LEUKEMIA, MYELODYSPLASTIC SYNDROME, AML, ACUTE LYMPHOBLASTIC LEUKEMIA, COPD, CHRONIC OBSTRUCTIVE PULMONARY DISEASE, MYELOPROLIFERATIVE SYNDROME, NHL, ONCOLOGY, TRANSFUSION REACTION | This controlled, randomized, open label, multicenter phase I/IIa trial exploring the safety and efficacy of allogeneic donor-derived peptide-stimulated T cells with specificity for CMV and EBV in a preventative/pre-emptive setting in patients after aSCT was approved by the federal authority Paul Ehrlich Institute (No. 2016/01) and by the Institutional Review Board of the University Hospital Erlangen (306_13 Az). It was conducted in accordance with the ethical principles of the Declaration of Helsinki (ClinicalTrials.gov Identifier: NCT02227641). All patients and donors provided written informed consent.The major goal of this study was to assess feasibility of manufacturing and safety of the T cell product. The primary endpoint was acute transfusion reaction and acute GvHD as a potential late toxicity of the product due to the transfer of activated T cells acute GvHD. The design of the study is shown in detail in Enrollment and randomization were performed within 28 days prior to stem cell transplantation. Details of the patient population enrolled in this study are shown in Summary of patient characteristics.There was no statistically significant difference with regard to major factors influencing outcome between the groups. Only patients with 10/10 HLA match were included into the study. ALL, acute lymphoblastic leukemia; AML, acute myeloid leukemia; MDS, myelodysplastic syndrome; NHL, Non-Hodgkin-lymphoma; MM, multiple myeloma; MPS, myeloproliferative syndrome; SIB, sibling donor; MUD, matched unrelated donor; BSA, body surface area; BMI, body mass index; ECOG, Eastern Cooperative Oncology Group performance score; HSCT-CI, hematopoietic stem cell transplantation comorbidity index; COPD, chronic obstructive pulmonary disease. For test of significance Fisher-exact and Chi-Square test was used.The SAE-Management was independently performed by the Centre for Clinical Studies of the University of Erlangen using VigilanceOne™ database for safety data acquisition and reporting. | PMC10642256 |
Patient cohort | Major inclusion and exclusion criteria are shown in Prevalence of required HLA class I loci among patients screened. Peptides chosen for stimulation required the presence of distinct HLA class I loci. | PMC10642256 | ||
Manufacturing of T cell product | The manufacturing process (approval number by Government of Oberfranken (DE_BY_05_MIA_2014_0045/55.2-2678.3-6-1) for the T cell product has been described previously (Peptides used for HLA multimer analysis of virus-specific CD8+ T cells.To assess the presence of CMV/EBV specific CD8+ T cells before and after the T cell product application flow cytometric analysis using peptide loaded HLA multimers was used. The HLA multimers used were selected according to the presence of the HLA genotype of the patient. | PMC10642256 | ||
Flow cytometric analysis | APC | All antibodies were purchased from BD Biosciences (Heidelberg, Germany) unless otherwise specified. For phenotypic analysis, cells were stained with anti-CD8 FITC (clone SK1), anti-CD25 PE (clone 2A3), anti-CD14 PerCP (clone MφP9), anti-CD56 APC (clone B159), anti-CD19 PE-Cy7 (clone SJ25C1), anti-CD4 APC-Cy7 (clone RPA-T4), anti-CD3 V450 (clone UCHT1), and anti-CD45 V500 (clone HI30). Gating included the exclusion of debris in a SSC vs. FSC plot. Leukocytes were gated in a CD45 vs SSC dot plot as CD45+ cells. The CD45high/SSClow population was termed lymphocytes and could be distinguished from monocytes and granulocytes. Within CD45high cells, subsets were characterized by expression of CD3 (T-cells), CD19 (B-cells), and CD56 (negative for CD3) NK-cells. Monocytes were gated as CD14+ SSC low cells.For analysis of CMV- and EBV-specific T-cells, 1x10 | PMC10642256 | |
Statistical analysis | Statistical analysis was performed using IBM SPSS software Version 28. Survival curves were generated using Kaplan-Meyer estimates. Comparison of means was performed using a non parametric Mann-Whitney-U test. To test the frequency distribution of categorical variables a Chi Square test was used. For analysis of contingency tables Fisher exact test was used. | PMC10642256 | ||
Results | PMC10642256 | |||
Patients and recruitment | Over the study period from 2013 to 2019, 33 patients were screened and 29 patients were enrolled in to the study and randomized (see Inclusion into the study required the presence of at least one of the following HLA alleles: HLA-A*01:01, A*02:01, B*07:02, B*08:01, B*35:01, or C*07:02. | PMC10642256 | ||
Manufacturing of the T cell product | A total of 17 products were manufactured during the study period. Overview of T cell products manufactured.In total 17 products were generated throughout the study. Products transfused are highlighted in dark grey. Light grey indicates products not transfused. The table shows the absolute dosing and dosing/kg bodyweight of the active ingredient (CD3+, possible range 20,000-50,000/kg body weight) and contaminating cells (CD45+, CD19+).Manufacturing of the T cell product. | PMC10642256 | ||
Application of the T cell product | As this study aimed at prevention and pre-emptive treatment of reactivation of CMV and EBV the dose schedule was planned to start as early as day 30 post aSCT. A total of 3 equal doses was planned for each patient with consecutive doses on days 30, 60, and 90 while patients were still receiving cyclosporine A. The targeted cell dose was 50,000 CD3+ T cells/kg body weight. On average, the cell number per dose administered to patients was 29,882 ± 5,883 CD3+ T cells/kg BW (Application of the T cell product. | PMC10642256 | ||
Adverse events | ADVERSE EVENTS, EVENTS | We observed in total 618 adverse events (AE) in both groups with an average of 24.7 ± 17.2 per patient. As shown in Events during study.Number of AE, SAE, medical treatments, and hospitalizations in both groups. There was no statistical difference between both groups regarding all adverse observations (non-parametric Mann-Whitney-U test). | PMC10642256 | |
Outcomes | The study recruited patients from 2013 until the end of 2018. The database was closed on 31Outcomes. Database was closed on Dec 31 | PMC10642256 | ||
Study endpoints | toxicity | EVENTS, TRANSFUSION REACTION | The primary endpoint of this first-in-human study was toxicity assessed by the incidence of acute transfusion reaction related to the T cell product and/or late toxicity manifested by the development of acute GvHD due to the infusion of activated T cells. As shown previously, the T-cell products can substantially expand in the host and persist long term (Secondary endpoints of the study included the incidence of CMV and EBV reactivation, the use of antiviral drugs such as ganciclovir, valganciclovir, foscavir or cidofovir, and the use of rituximab for the treatment of EBV. T-cell reconstitution was assessed in both groups throughout the observation period and was started before the first transfusion of the T cell product. CMV and EBV DNA in peripheral blood plasma or PBMCs was determined by PCR in the laboratory used by the transplant center. Reactivation was defined as a single positive result in a PCR-based test. As shown in Reactivation of CMV and EBV. Secondary endpoints.Secondary endpoints included number of patients with CMV and/or EBV reactivation, number of patients treated with Ganciclovir, Valganciclovir, Foscavir, Cidofovir and Rituximab. Cumulative drug dosing was assessed throughout the study for all antiviral drugs including Rituximab. For comparison of events among the groups, Chi-Square test was used. For comparisons of means non-parametric Mann-Whitney-U test was used.None of the patients received Foscarnet or Cidovovir as a treatment. There was no statistically significant difference in the use of Ganciclovir (3 out of 23 cases). The most frequent drug used for the treatment of CMV was Valganciclovir. There was no difference regarding the number of patients treated, the duration of treatment and cumulative dose applied in each patient ( | PMC10642256 |
T cell reconstitution | SECONDARY | As a secondary endpoint, T cell reconstitution was compared between the two groups at equivalent time points, starting before the first infusion of the T cell product. An example of flow cytometric analysis of peripheral blood is shown in T cell reconstitution during study treatment. Patients (n=9) randomized into treatment group (red line) were analyzed at the time of the visit before the T cell transfer (24-48h, visits 2, 8, and 12). Patients in the control arm (n=13, black line) were analyzed at study visits aligned as possible with the treatment group at day 30 ± 3 (visit 2), 60 ± 3 (visit 8), 90 ± 3 (visit 8), and at the end of study at approximately day 204 ± 7 (visit 17). The graph shows average numbers of CD4+
Reconstitution of CMV/EBV specific T cell immunity in treated individuals. Left Panel: Reconstitution of CMV- and EBV-specific T cells during the study observation period. Red lines indicate the sum of all CMV specific in the peripheral blood (cells/ul), yellow lines the sum of all EBV-specific CD8+ T cells detected by using peptide-loaded HLA class I multimers according to the HLA class I loci present in the patient on the top right of each graph. Black arrows indicate the transfusion of the IMP. Red and yellow horizontal bars indicate the presence of CMV and EBV respectively as assessed by PCR in the peripheral blood. Right Panel shows the overall reconstitution (number of cells/ul peripheral blood) of CD4+ (light blue line) and CD8+ (dark blue line) T cells in each individual patient. | PMC10642256 | |
Discussion | toxicity | RECRUITMENT, VIRUS, DISEASE, RECRUITMENT, SECONDARY, TRANSFUSION REACTION, TRANSFUSION REACTIONS | In this paper we present the results of a randomized controlled phase I/IIa study (MULTIVIR-01) aiming at prevention or pre-emptive treatment of CMV/EBV viral reactivation in patients after aSCT. Patients received 3 consecutive doses of 21,000-41,000 CD3+ T cells per kg bodyweight and dose, separated by 2 intervals of at least 30 days. The primary endpoint of the study was to demonstrate safety of the T-cell product as assessed by the occurrence of an acute transfusion reaction and/or as late toxicity the development of acute GvHD. Both endpoints were met, as we did not observe any transfusion reactions in 25 T cell infusions, and the cumulative incidence of acute GvHD was not significantly different between the two groups. Thus, the product can be considered safe for application in humans.Several studies have aimed at prevention of reactivation predominantly for CMV employing various techniques of manufacturing including selection of specific T cells based on IFNγ production (To overcome the problem of early reactivation, several studies have employed partially HLA-matched third party CMV-, EBV-, or even multi-virus-specific T cells. In currently ongoing placebo controlled randomized phase III studies this concept is being explored in more than 60 centers worldwide (Clinicaltrials Identifier: NCT05305040) (The phase II part of this study suffered from low patient numbers in both groups, and we were not able to demonstrate any influence of the T cell product on any of the secondary endpoints monitored. Recruitment into the study was seriously compromised with the marketing authorization of letermovir as a prevention for CMV reactivation in late 2017. No preventative anti-viral treatment other than aciclovir was available when the study started recruiting in 2013. Although funding of letermovir was initially problematic and not secured in Germany, many care takers were reluctant to enroll patients into a phase I study when an approved drug for CMV prevention was available. Hence recruitment slowed down significantly over time and the study stopped recruiting in 2019.Patient 4, 5, 28 and 29 reactivated EBV as early as day 17, 20, 35 and 39 in the treatment group. These patients received the T-cell product on day 47, 51, 55, and 41, respectively, in a pre-emptive treatment fashion. In all four patients, EBV reactivation resolved within less than 10 days. Patients 4 and 28 were treated for EBV reactivation with 2 doses of rituximab. Our data neither confirm nor exclude a potential role of infused EBV-specific T cells in reversal of EBV reactivation in these patients. Only 2 of 4 patients within this group required treatment with rituximab as the copy numbers observed did not trigger treatment in 2 patients. Similarly, 2 patients of the control group were treated with rituximab; the difference between treatment and control groups was not statistically significant with regard to the use of rituximab. Patients 28 also reactivated CMV before receiving the first infusion of the T-cell product. Patients 4, 11 and 23 reactivated CMV after initiation of T-cell transfer. In contrast, 9 out of 14 patients in the control arm reactivated CMV beginning on day 30. Given this situation and the low number of patients in both groups, the study could not demonstrate prevention of reactivation of either virus. However, we noted a reduction of the cumulative incidence of CMV reactivation in the treatment group, which was significant when the observation period was limited to 100 days.The function of virus-specific T-cell transfer in prophylaxis and prevention of CMV reactivation or disease in stem cell recipients has been difficult to assess. Several studies have been published over the last two decades (The study was able to demonstrate expansion of T cells with specificity for CMV and EBV after the infusions in a number of cases. Patients 4, 5, 11, 23 and 28 displayed an increase in T cell numbers after infusion, especially when viral antigens were expected to be present due to reactivation. This is in our view an important finding, as it demonstrates activity of the T cells infused. It is noteworthy that the most substantial increase in T cells was seen in those patients where more than one of the required HLA class I loci was present. Especially presence of HLA B*07:02, B*08:01, and C*07:02 gave rise to a substantial expansion as shown for patient 4, 5, 11, and 28. In the presence of only HLA A*02:01 (patient 25) or in combination with HLA B*35:01 (patient 19) we were not able to demonstrate significant expansion, which is in contrast with our recent findings (In summary, we have been able to demonstrate that centralized manufacturing in an academic institution and application of virus specific T cells is feasible in a multi-center setup in spite of high logistical efforts. We have shown that the T-cell product can be safely applied and did not find any toxicity. The study fell short at demonstrating efficacy of the T-cell product mainly due low patient numbers but has provided the foundation for subsequent efficacy studies. | PMC10642256 |
Data availability statement | The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation. | PMC10642256 | ||
Ethics statement | The studies involving humans were approved by Institutional Review Board of the University Hospital Erlangen (306_13 Az). The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study. | PMC10642256 | ||
Author contributions | AG: Designed study, wrote study protocol, developed cell product and manufacturing protocol, wrote IB, recruited patients, analyzed data, generated figures, wrote manuscript. RG: Developed manufacturing protocol, wrote IB, performed quality analysis of the cell product, performed manufacturing, analyzed data, generated figures. MA: Designed study, wrote IB, developed manufacturing protocol, wrote manuscript. AMo: Designed study, designed peptide pools, analyzed data, wrote manuscript. AK: Recruited patient as principal investigator at University Hospital of Erlangen, helped analyzing data, helped writing manuscript. CS: Recruited patients as principal investigator at University Hospital of Augsburg. KH: Recruited patients as principal investigator at University Hospital of Augsburg. EW: Recruited patients as principal investigator at University Hospital Mainz. BH: Recruited patients at University Hospital Mainz. DT: Recruited patients at University Hospital Mainz. WR: Recruited patient as principal investigator at University Hospital of Erlangen. BS: Recruited patient as co-principal investigator at University Hospital of Erlangen. JT: Recruited patient as principal investigator at University Hospital of Munich. SMo: Manufactured T cell products, performed quality analysis of products. HB: Manufactured T cell products, helped in quality analysis. SS: Manufactured T cell products, helped in quality analysis. JBa: Manufactured T cell products, helped in quality analysis. AW: Coordinated logistics and communication with donor centers. Organized transportation of products and raw material. FS: Coordinated logistics and communication with donor centers. Organized transportation of products and raw material. Helped consenting patients at University Hospital Erlangen. Applied products. JBr: Recruited and consented patients at Charite University Hospital Berlin. BU: Designed secuTrial ECRF and VigilanceOne™ database. Prepared and analyzed data. SMa: Designed study, helped writing study protocol and IB, communicated with authorities, performed data analysis and submission. SH: Designed study, helped writing study protocol and IB, communicated with authorities, performed data analysis and submission. Performed pharmacovilgilance. JS: Supervised manufacturing and quality analysis, performed product release. RZi: Helped writing IB, supervised manufacturing and quality analysis, performed product release. VW: Supervised manufacturing and quality analysis, performed product release. LH: Recruited patients at Charite University Hospital Berlin, analyzed data, helped writing manuscript. FL-C: Analyzed data, analyzed T cell products, performed patient follow up analysis at Charite University Hospital Berlin. MR: performed statistical analysis, helped analyzing data. MS: Served as member of the Data Safety Monitoring Board. FA: Served as member of the Data Safety Monitoring Board. RZe: Served as member of the Data Safety Monitoring Board. AMa: Designed study, wrote study protocol, recruited patients, analyzed data, wrote manuscript. All authors contributed to the article and approved the submitted version. | PMC10642256 | ||
Acknowledgments | We would like to thank all patients participating in this study. Especially we would like to thank members of the study teams at all participating centers for their excellent work. Many thanks go to the excellent study monitors provided by the Center for Clinical Studies CCS and the support from the IT department of the University Hospital of Erlangen. | PMC10642256 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.