contestId
int64
0
1.01k
index
stringclasses
40 values
name
stringlengths
2
54
type
stringclasses
2 values
rating
int64
0
3.4k
tags
listlengths
0
7
title
stringclasses
393 values
time-limit
stringclasses
7 values
memory-limit
stringclasses
6 values
problem-description
stringlengths
0
2.97k
input-specification
stringlengths
4
1.87k
output-specification
stringlengths
4
1.12k
demo-input
listlengths
0
7
demo-output
listlengths
0
7
note
stringlengths
0
5.24k
points
float64
0
3.5k
test_cases
listlengths
0
402
creationTimeSeconds
int64
1.37B
1.7B
relativeTimeSeconds
int64
8
2.15B
programmingLanguage
stringclasses
3 values
verdict
stringclasses
1 value
testset
stringclasses
9 values
passedTestCount
int64
1
402
timeConsumedMillis
int64
15
8.06k
memoryConsumedBytes
int64
0
514M
code
stringlengths
11
61.4k
prompt
stringlengths
297
7.35k
response
stringlengths
25
61.4k
score
float64
2.82
3.99
78
A
Haiku
PROGRAMMING
800
[ "implementation", "strings" ]
A. Haiku
2
256
Haiku is a genre of Japanese traditional poetry. A haiku poem consists of 17 syllables split into three phrases, containing 5, 7 and 5 syllables correspondingly (the first phrase should contain exactly 5 syllables, the second phrase should contain exactly 7 syllables, and the third phrase should contain exactly 5 syllables). A haiku masterpiece contains a description of a moment in those three phrases. Every word is important in a small poem, which is why haiku are rich with symbols. Each word has a special meaning, a special role. The main principle of haiku is to say much using a few words. To simplify the matter, in the given problem we will consider that the number of syllable in the phrase is equal to the number of vowel letters there. Only the following letters are regarded as vowel letters: "a", "e", "i", "o" and "u". Three phases from a certain poem are given. Determine whether it is haiku or not.
The input data consists of three lines. The length of each line is between 1 and 100, inclusive. The *i*-th line contains the *i*-th phrase of the poem. Each phrase consists of one or more words, which are separated by one or more spaces. A word is a non-empty sequence of lowercase Latin letters. Leading and/or trailing spaces in phrases are allowed. Every phrase has at least one non-space character. See the example for clarification.
Print "YES" (without the quotes) if the poem is a haiku. Otherwise, print "NO" (also without the quotes).
[ "on codeforces \nbeta round is running\n a rustling of keys \n", "how many gallons\nof edo s rain did you drink\n cuckoo\n" ]
[ "YES", "NO" ]
none
500
[ { "input": "on codeforces \nbeta round is running\n a rustling of keys ", "output": "YES" }, { "input": "how many gallons\nof edo s rain did you drink\n cuckoo", "output": "NO" }, { "input": " hatsu shigure\n saru mo komino wo\nhoshige nari", "output": "YES" }, { "input": "o vetus stagnum\n rana de ripa salit\n ac sonant aquae", "output": "NO" }, { "input": " furuike ya\nkawazu tobikomu\nmizu no oto ", "output": "YES" }, { "input": " noch da leich\na stamperl zum aufwaerma\n da pfarrer kimmt a ", "output": "NO" }, { "input": " sommerfuglene \n hvorfor bruge mange ord\n et kan gore det", "output": "YES" }, { "input": " ab der mittagszeit\n ist es etwas schattiger\n ein wolkenhimmel", "output": "NO" }, { "input": "tornando a vederli\ni fiori di ciliegio la sera\nson divenuti frutti", "output": "NO" }, { "input": "kutaburete\nyado karu koro ya\nfuji no hana", "output": "YES" }, { "input": " beginnings of poetry\n the rice planting songs \n of the interior", "output": "NO" }, { "input": " door zomerregens\n zijn de kraanvogelpoten\n korter geworden", "output": "NO" }, { "input": " derevo na srub\na ptitsi bezzabotno\n gnezdishko tam vyut", "output": "YES" }, { "input": "writing in the dark\nunaware that my pen\nhas run out of ink", "output": "NO" }, { "input": "kusaaiu\nuieueua\nuo efaa", "output": "YES" }, { "input": "v\nh\np", "output": "NO" }, { "input": "i\ni\nu", "output": "NO" }, { "input": "awmio eoj\nabdoolceegood\nwaadeuoy", "output": "YES" }, { "input": "xzpnhhnqsjpxdboqojixmofawhdjcfbscq\nfoparnxnbzbveycoltwdrfbwwsuobyoz hfbrszy\nimtqryscsahrxpic agfjh wvpmczjjdrnwj mcggxcdo", "output": "YES" }, { "input": "wxjcvccp cppwsjpzbd dhizbcnnllckybrnfyamhgkvkjtxxfzzzuyczmhedhztugpbgpvgh\nmdewztdoycbpxtp bsiw hknggnggykdkrlihvsaykzfiiw\ndewdztnngpsnn lfwfbvnwwmxoojknygqb hfe ibsrxsxr", "output": "YES" }, { "input": "nbmtgyyfuxdvrhuhuhpcfywzrbclp znvxw synxmzymyxcntmhrjriqgdjh xkjckydbzjbvtjurnf\nhhnhxdknvamywhsrkprofnyzlcgtdyzzjdsfxyddvilnzjziz qmwfdvzckgcbrrxplxnxf mpxwxyrpesnewjrx ajxlfj\nvcczq hddzd cvefmhxwxxyqcwkr fdsndckmesqeq zyjbwbnbyhybd cta nsxzidl jpcvtzkldwd", "output": "YES" }, { "input": "rvwdsgdsrutgjwscxz pkd qtpmfbqsmctuevxdj kjzknzghdvxzlaljcntg jxhvzn yciktbsbyscfypx x xhkxnfpdp\nwdfhvqgxbcts mnrwbr iqttsvigwdgvlxwhsmnyxnttedonxcfrtmdjjmacvqtkbmsnwwvvrlxwvtggeowtgsqld qj\nvsxcdhbzktrxbywpdvstr meykarwtkbm pkkbhvwvelclfmpngzxdmblhcvf qmabmweldplmczgbqgzbqnhvcdpnpjtch ", "output": "YES" }, { "input": "brydyfsmtzzkpdsqvvztmprhqzbzqvgsblnz naait tdtiprjsttwusdykndwcccxfmzmrmfmzjywkpgbfnjpypgcbcfpsyfj k\nucwdfkfyxxxht lxvnovqnnsqutjsyagrplb jhvtwdptrwcqrovncdvqljjlrpxcfbxqgsfylbgmcjpvpl ccbcybmigpmjrxpu\nfgwtpcjeywgnxgbttgx htntpbk tkkpwbgxwtbxvcpkqbzetjdkcwad tftnjdxxjdvbpfibvxuglvx llyhgjvggtw jtjyphs", "output": "YES" }, { "input": "nyc aqgqzjjlj mswgmjfcxlqdscheskchlzljlsbhyn iobxymwzykrsnljj\nnnebeaoiraga\nqpjximoqzswhyyszhzzrhfwhf iyxysdtcpmikkwpugwlxlhqfkn", "output": "NO" }, { "input": "lzrkztgfe mlcnq ay ydmdzxh cdgcghxnkdgmgfzgahdjjmqkpdbskreswpnblnrc fmkwziiqrbskp\np oukeaz gvvy kghtrjlczyl qeqhgfgfej\nwfolhkmktvsjnrpzfxcxzqmfidtlzmuhxac wsncjgmkckrywvxmnjdpjpfydhk qlmdwphcvyngansqhl", "output": "NO" }, { "input": "yxcboqmpwoevrdhvpxfzqmammak\njmhphkxppkqkszhqqtkvflarsxzla pbxlnnnafqbsnmznfj qmhoktgzix qpmrgzxqvmjxhskkksrtryehfnmrt dtzcvnvwp\nscwymuecjxhw rdgsffqywwhjpjbfcvcrnisfqllnbplpadfklayjguyvtrzhwblftclfmsr", "output": "NO" }, { "input": "qfdwsr jsbrpfmn znplcx nhlselflytndzmgxqpgwhpi ghvbbxrkjdirfghcybhkkqdzmyacvrrcgsneyjlgzfvdmxyjmph\nylxlyrzs drbktzsniwcbahjkgohcghoaczsmtzhuwdryjwdijmxkmbmxv yyfrokdnsx\nyw xtwyzqlfxwxghugoyscqlx pljtz aldfskvxlsxqgbihzndhxkswkxqpwnfcxzfyvncstfpqf", "output": "NO" }, { "input": "g rguhqhcrzmuqthtmwzhfyhpmqzzosa\nmhjimzvchkhejh irvzejhtjgaujkqfxhpdqjnxr dvqallgssktqvsxi\npcwbliftjcvuzrsqiswohi", "output": "NO" }, { "input": " ngxtlq iehiise vgffqcpnmsoqzyseuqqtggokymol zn\nvjdjljazeujwoubkcvtsbepooxqzrueaauokhepiquuopfild\ngoabauauaeotoieufueeknudiilupouaiaexcoapapu", "output": "NO" }, { "input": "ycnvnnqk mhrmhctpkfbc qbyvtjznmndqjzgbcxmvrpkfcll zwspfptmbxgrdv dsgkk nfytsqjrnfbhh pzdldzymvkdxxwh\nvnhjfwgdnyjptsmblyxmpzylsbjlmtkkwjcbqwjctqvrlqqkdsrktxlnslspvnn mdgsmzblhbnvpczmqkcffwhwljqkzmk hxcm\nrghnjvzcpprrgmtgytpkzyc mrdnnhpkwypwqbtzjyfwvrdwyjltbzxtbstzs xdjzdmx yjsqtzlrnvyssvglsdjrmsrfrcdpqt", "output": "NO" }, { "input": "ioeeaioeiuoeaeieuuieooaouiuouiioaueeaiaiuoaoiioeeaauooiuuieeuaeeoauieeaiuoieiaieuoauaaoioooieueueuai\nuooaoeeaoiuuoeioaoouaououoeioiaeueoioaiouaeaoioiuuaueeuaiuoiueoiuaoeeieeouaeeaeeieioeoiiieuuueuuieuo\naeeouieeieoueaioeoioooiouaeeeiaaioueauaueiouuuaieuuioiaeiueauueaoieauauoeueuaiueuuaueeoueauaeaoieeoo", "output": "NO" }, { "input": "mkgycgmrqtmlwj vddlbsgdptyfrcj nmrddjchydvbsyhgzytfzvwbhqmmhkpsyrcnknpsqrr wcnf wfvgskrnsmnrcqgcnc q\npn cclcyjjdp rqkpgyrvyyd hhynrochfa pthyffqvskazfshvzcmvhmsrxvquzkdvivlbfypwbgltfbjmhzljvgzmxjlrjdjq\nauuouieuaaauoooeoiuoaueuueauiuuuiaeuwuoiaeoeaieauieouoaeiiieiioiuuuiuauioiiuoeauueieaueiaioeuaoaaau", "output": "NO" }, { "input": "ab\na\na", "output": "NO" }, { "input": "on codeforcs\nbeta round is runnineg\na rustling of keys", "output": "NO" }, { "input": "coooooooooooooooood\nd\nd", "output": "NO" }, { "input": "on codeforces \nbeta round is runninog\n a rustling of keys", "output": "NO" }, { "input": "aaaaaaaaaaaaaaa\na\na", "output": "NO" }, { "input": "aaaaaccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc\naaaaaaaccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc\naaaaaccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc", "output": "YES" }, { "input": "cccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc\ncccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc\ncccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc", "output": "NO" }, { "input": "aaaaaa\naaaaaa\naaaaa", "output": "NO" } ]
1,658,335,566
2,147,483,647
Python 3
OK
TESTS
40
92
0
s1=input() s2=input() s3=input() s1=s1.strip() s2=s2.strip() s3=s3.strip() syllables = set("AEIOUaeiou") ##print(s1) ##print(s2) ##print(s3) c1=0 c2=0 c3=0 for i in s1: if(i in syllables): c1+=1 for i in s2: if(i in syllables): c2+=1 for i in s3: if(i in syllables): c3+=1 if(c1==5 and c2==7 and c3==5): print("YES") else: print("NO")
Title: Haiku Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Haiku is a genre of Japanese traditional poetry. A haiku poem consists of 17 syllables split into three phrases, containing 5, 7 and 5 syllables correspondingly (the first phrase should contain exactly 5 syllables, the second phrase should contain exactly 7 syllables, and the third phrase should contain exactly 5 syllables). A haiku masterpiece contains a description of a moment in those three phrases. Every word is important in a small poem, which is why haiku are rich with symbols. Each word has a special meaning, a special role. The main principle of haiku is to say much using a few words. To simplify the matter, in the given problem we will consider that the number of syllable in the phrase is equal to the number of vowel letters there. Only the following letters are regarded as vowel letters: "a", "e", "i", "o" and "u". Three phases from a certain poem are given. Determine whether it is haiku or not. Input Specification: The input data consists of three lines. The length of each line is between 1 and 100, inclusive. The *i*-th line contains the *i*-th phrase of the poem. Each phrase consists of one or more words, which are separated by one or more spaces. A word is a non-empty sequence of lowercase Latin letters. Leading and/or trailing spaces in phrases are allowed. Every phrase has at least one non-space character. See the example for clarification. Output Specification: Print "YES" (without the quotes) if the poem is a haiku. Otherwise, print "NO" (also without the quotes). Demo Input: ['on codeforces \nbeta round is running\n a rustling of keys \n', 'how many gallons\nof edo s rain did you drink\n cuckoo\n'] Demo Output: ['YES', 'NO'] Note: none
```python s1=input() s2=input() s3=input() s1=s1.strip() s2=s2.strip() s3=s3.strip() syllables = set("AEIOUaeiou") ##print(s1) ##print(s2) ##print(s3) c1=0 c2=0 c3=0 for i in s1: if(i in syllables): c1+=1 for i in s2: if(i in syllables): c2+=1 for i in s3: if(i in syllables): c3+=1 if(c1==5 and c2==7 and c3==5): print("YES") else: print("NO") ```
3.977
59
A
Word
PROGRAMMING
800
[ "implementation", "strings" ]
A. Word
2
256
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
[ "HoUse\n", "ViP\n", "maTRIx\n" ]
[ "house\n", "VIP\n", "matrix\n" ]
none
500
[ { "input": "HoUse", "output": "house" }, { "input": "ViP", "output": "VIP" }, { "input": "maTRIx", "output": "matrix" }, { "input": "BNHWpnpawg", "output": "bnhwpnpawg" }, { "input": "VTYGP", "output": "VTYGP" }, { "input": "CHNenu", "output": "chnenu" }, { "input": "ERPZGrodyu", "output": "erpzgrodyu" }, { "input": "KSXBXWpebh", "output": "KSXBXWPEBH" }, { "input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv", "output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv" }, { "input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd", "output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd" }, { "input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv", "output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv" }, { "input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg", "output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg" }, { "input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak", "output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK" }, { "input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw", "output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW" }, { "input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB", "output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB" }, { "input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge", "output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge" }, { "input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw", "output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw" }, { "input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks", "output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks" }, { "input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz", "output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ" }, { "input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg", "output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG" }, { "input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO", "output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO" }, { "input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd", "output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD" }, { "input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas", "output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas" }, { "input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm", "output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM" }, { "input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn", "output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn" }, { "input": "t", "output": "t" }, { "input": "N", "output": "N" }, { "input": "kv", "output": "kv" }, { "input": "Ur", "output": "ur" }, { "input": "CN", "output": "CN" } ]
1,615,612,037
2,147,483,647
Python 3
OK
TESTS
30
124
0
string = input() low=0 high=0 for i in string: if (i.islower()): low+=1 else : high+=1 if low >= high: print(string.lower()) else : print(string.upper())
Title: Word Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word. Input Specification: The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100. Output Specification: Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one. Demo Input: ['HoUse\n', 'ViP\n', 'maTRIx\n'] Demo Output: ['house\n', 'VIP\n', 'matrix\n'] Note: none
```python string = input() low=0 high=0 for i in string: if (i.islower()): low+=1 else : high+=1 if low >= high: print(string.lower()) else : print(string.upper()) ```
3.969
43
A
Football
PROGRAMMING
1,000
[ "strings" ]
A. Football
2
256
One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie.
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams.
Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner.
[ "1\nABC\n", "5\nA\nABA\nABA\nA\nA\n" ]
[ "ABC\n", "A\n" ]
none
500
[ { "input": "1\nABC", "output": "ABC" }, { "input": "5\nA\nABA\nABA\nA\nA", "output": "A" }, { "input": "2\nXTSJEP\nXTSJEP", "output": "XTSJEP" }, { "input": "3\nXZYDJAEDZ\nXZYDJAEDZ\nXZYDJAEDZ", "output": "XZYDJAEDZ" }, { "input": "3\nQCCYXL\nQCCYXL\nAXGLFQDD", "output": "QCCYXL" }, { "input": "3\nAZID\nEERWBC\nEERWBC", "output": "EERWBC" }, { "input": "3\nHNCGYL\nHNCGYL\nHNCGYL", "output": "HNCGYL" }, { "input": "4\nZZWZTG\nZZWZTG\nZZWZTG\nZZWZTG", "output": "ZZWZTG" }, { "input": "4\nA\nA\nKUDLJMXCSE\nA", "output": "A" }, { "input": "5\nPHBTW\nPHBTW\nPHBTW\nPHBTW\nPHBTW", "output": "PHBTW" }, { "input": "5\nPKUZYTFYWN\nPKUZYTFYWN\nSTC\nPKUZYTFYWN\nPKUZYTFYWN", "output": "PKUZYTFYWN" }, { "input": "5\nHH\nHH\nNTQWPA\nNTQWPA\nHH", "output": "HH" }, { "input": "10\nW\nW\nW\nW\nW\nD\nW\nD\nD\nW", "output": "W" }, { "input": "19\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nTGACNIH\nTGACNIH\nXBCP", "output": "XBCP" }, { "input": "33\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS", "output": "PYPAS" }, { "input": "51\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC", "output": "NC" }, { "input": "89\nH\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nVOCI\nVOCI\nH\nH\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nH\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI", "output": "VOCI" }, { "input": "100\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nM\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA", "output": "HA" }, { "input": "100\nG\nG\nS\nS\nG\nG\nS\nS\nG\nS\nS\nS\nG\nS\nG\nG\nS\nG\nS\nS\nG\nS\nS\nS\nS\nS\nG\nS\nG\nS\nS\nG\nG\nG\nS\nS\nS\nS\nG\nS\nS\nG\nG\nG\nG\nG\nS\nG\nG\nS\nS\nS\nS\nS\nG\nG\nS\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nS\nS\nG\nS\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nG\nG\nS\nG\nG\nG\nS", "output": "G" }, { "input": "100\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nOBH\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL", "output": "WL" } ]
1,589,313,408
2,147,483,647
Python 3
OK
TESTS
34
218
6,963,200
n = int(input()) lst=[] for i in range(n): a = input() lst.append(a) used=[] if n==1: print(lst[0]) else: unique = [used.append(x) for x in lst if x not in used] if len(used) == 2: team1 = lst.count(used[0]) team2 = lst.count(used[1]) if team1 > team2: print(used[0]) else: print(used[1]) else: team1 = lst.count(used[0]) team2 = 0 if team1 > team2: print(used[0])
Title: Football Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie. Input Specification: The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams. Output Specification: Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner. Demo Input: ['1\nABC\n', '5\nA\nABA\nABA\nA\nA\n'] Demo Output: ['ABC\n', 'A\n'] Note: none
```python n = int(input()) lst=[] for i in range(n): a = input() lst.append(a) used=[] if n==1: print(lst[0]) else: unique = [used.append(x) for x in lst if x not in used] if len(used) == 2: team1 = lst.count(used[0]) team2 = lst.count(used[1]) if team1 > team2: print(used[0]) else: print(used[1]) else: team1 = lst.count(used[0]) team2 = 0 if team1 > team2: print(used[0]) ```
3.93253
743
B
Chloe and the sequence
PROGRAMMING
1,200
[ "binary search", "bitmasks", "constructive algorithms", "implementation" ]
null
null
Chloe, the same as Vladik, is a competitive programmer. She didn't have any problems to get to the olympiad like Vladik, but she was confused by the task proposed on the olympiad. Let's consider the following algorithm of generating a sequence of integers. Initially we have a sequence consisting of a single element equal to 1. Then we perform (*n*<=-<=1) steps. On each step we take the sequence we've got on the previous step, append it to the end of itself and insert in the middle the minimum positive integer we haven't used before. For example, we get the sequence [1,<=2,<=1] after the first step, the sequence [1,<=2,<=1,<=3,<=1,<=2,<=1] after the second step. The task is to find the value of the element with index *k* (the elements are numbered from 1) in the obtained sequence, i. e. after (*n*<=-<=1) steps. Please help Chloe to solve the problem!
The only line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=50, 1<=≤<=*k*<=≤<=2*n*<=-<=1).
Print single integer — the integer at the *k*-th position in the obtained sequence.
[ "3 2\n", "4 8\n" ]
[ "2", "4" ]
In the first sample the obtained sequence is [1, 2, 1, 3, 1, 2, 1]. The number on the second position is 2. In the second sample the obtained sequence is [1, 2, 1, 3, 1, 2, 1, 4, 1, 2, 1, 3, 1, 2, 1]. The number on the eighth position is 4.
1,000
[ { "input": "3 2", "output": "2" }, { "input": "4 8", "output": "4" }, { "input": "5 27", "output": "1" }, { "input": "7 44", "output": "3" }, { "input": "15 18432", "output": "12" }, { "input": "20 259676", "output": "3" }, { "input": "30 671088640", "output": "28" }, { "input": "38 137438953472", "output": "38" }, { "input": "1 1", "output": "1" }, { "input": "3 3", "output": "1" }, { "input": "4 12", "output": "3" }, { "input": "8 224", "output": "6" }, { "input": "13 1368", "output": "4" }, { "input": "16 49152", "output": "15" }, { "input": "19 1024", "output": "11" }, { "input": "24 15204352", "output": "20" }, { "input": "27 6586544", "output": "5" }, { "input": "31 536870912", "output": "30" }, { "input": "38 94489280512", "output": "34" }, { "input": "42 215268308020", "output": "3" }, { "input": "42 3452074721280", "output": "21" }, { "input": "46 34394312982528", "output": "15" }, { "input": "48 133865540681728", "output": "39" }, { "input": "49 76541041985542", "output": "2" }, { "input": "49 104822971826176", "output": "34" }, { "input": "49 351843720888320", "output": "47" }, { "input": "50 743042492421629", "output": "1" }, { "input": "50 666266740436818", "output": "2" }, { "input": "50 704239287953456", "output": "5" }, { "input": "50 116938486513664", "output": "17" }, { "input": "50 806423059496960", "output": "37" }, { "input": "50 985162418487296", "output": "48" }, { "input": "50 844424930131968", "output": "49" }, { "input": "50 562949953421312", "output": "50" }, { "input": "50 1", "output": "1" }, { "input": "50 1125899906842623", "output": "1" }, { "input": "50 1125899906842620", "output": "3" }, { "input": "39 549755813887", "output": "1" }, { "input": "50 100000000000", "output": "12" } ]
1,536,588,424
2,147,483,647
Python 3
OK
TESTS
39
124
0
def mexk(n,k): #n,k=map(int,input().split()) ans=n low=1 high=pow(2,n)-1 while low<=high: mid=(low+high)//2 if mid==k: return ans ans-=1 if k<mid: high=mid-1 else: low=mid+1 n,k=map(int,input().split()) print(mexk(n,k))
Title: Chloe and the sequence Time Limit: None seconds Memory Limit: None megabytes Problem Description: Chloe, the same as Vladik, is a competitive programmer. She didn't have any problems to get to the olympiad like Vladik, but she was confused by the task proposed on the olympiad. Let's consider the following algorithm of generating a sequence of integers. Initially we have a sequence consisting of a single element equal to 1. Then we perform (*n*<=-<=1) steps. On each step we take the sequence we've got on the previous step, append it to the end of itself and insert in the middle the minimum positive integer we haven't used before. For example, we get the sequence [1,<=2,<=1] after the first step, the sequence [1,<=2,<=1,<=3,<=1,<=2,<=1] after the second step. The task is to find the value of the element with index *k* (the elements are numbered from 1) in the obtained sequence, i. e. after (*n*<=-<=1) steps. Please help Chloe to solve the problem! Input Specification: The only line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=50, 1<=≤<=*k*<=≤<=2*n*<=-<=1). Output Specification: Print single integer — the integer at the *k*-th position in the obtained sequence. Demo Input: ['3 2\n', '4 8\n'] Demo Output: ['2', '4'] Note: In the first sample the obtained sequence is [1, 2, 1, 3, 1, 2, 1]. The number on the second position is 2. In the second sample the obtained sequence is [1, 2, 1, 3, 1, 2, 1, 4, 1, 2, 1, 3, 1, 2, 1]. The number on the eighth position is 4.
```python def mexk(n,k): #n,k=map(int,input().split()) ans=n low=1 high=pow(2,n)-1 while low<=high: mid=(low+high)//2 if mid==k: return ans ans-=1 if k<mid: high=mid-1 else: low=mid+1 n,k=map(int,input().split()) print(mexk(n,k)) ```
3
888
A
Local Extrema
PROGRAMMING
800
[ "brute force", "implementation" ]
null
null
You are given an array *a*. Some element of this array *a**i* is a local minimum iff it is strictly less than both of its neighbours (that is, *a**i*<=&lt;<=*a**i*<=-<=1 and *a**i*<=&lt;<=*a**i*<=+<=1). Also the element can be called local maximum iff it is strictly greater than its neighbours (that is, *a**i*<=&gt;<=*a**i*<=-<=1 and *a**i*<=&gt;<=*a**i*<=+<=1). Since *a*1 and *a**n* have only one neighbour each, they are neither local minima nor local maxima. An element is called a local extremum iff it is either local maximum or local minimum. Your task is to calculate the number of local extrema in the given array.
The first line contains one integer *n* (1<=≤<=*n*<=≤<=1000) — the number of elements in array *a*. The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=1000) — the elements of array *a*.
Print the number of local extrema in the given array.
[ "3\n1 2 3\n", "4\n1 5 2 5\n" ]
[ "0\n", "2\n" ]
none
0
[ { "input": "3\n1 2 3", "output": "0" }, { "input": "4\n1 5 2 5", "output": "2" }, { "input": "1\n1", "output": "0" }, { "input": "1\n548", "output": "0" }, { "input": "2\n1 1", "output": "0" }, { "input": "3\n3 2 3", "output": "1" }, { "input": "2\n1 1000", "output": "0" }, { "input": "3\n1 2 1", "output": "1" } ]
1,676,460,962
2,147,483,647
PyPy 3-64
OK
TESTS
14
46
0
n = int(input()) *a, = map(int, input().split()) cnt = 0 for i in range(1, n - 1): if a[i - 1] > a[i] < a[i + 1] or a[i - 1] < a[i] > a[i + 1]: cnt += 1 print(cnt)
Title: Local Extrema Time Limit: None seconds Memory Limit: None megabytes Problem Description: You are given an array *a*. Some element of this array *a**i* is a local minimum iff it is strictly less than both of its neighbours (that is, *a**i*<=&lt;<=*a**i*<=-<=1 and *a**i*<=&lt;<=*a**i*<=+<=1). Also the element can be called local maximum iff it is strictly greater than its neighbours (that is, *a**i*<=&gt;<=*a**i*<=-<=1 and *a**i*<=&gt;<=*a**i*<=+<=1). Since *a*1 and *a**n* have only one neighbour each, they are neither local minima nor local maxima. An element is called a local extremum iff it is either local maximum or local minimum. Your task is to calculate the number of local extrema in the given array. Input Specification: The first line contains one integer *n* (1<=≤<=*n*<=≤<=1000) — the number of elements in array *a*. The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=1000) — the elements of array *a*. Output Specification: Print the number of local extrema in the given array. Demo Input: ['3\n1 2 3\n', '4\n1 5 2 5\n'] Demo Output: ['0\n', '2\n'] Note: none
```python n = int(input()) *a, = map(int, input().split()) cnt = 0 for i in range(1, n - 1): if a[i - 1] > a[i] < a[i + 1] or a[i - 1] < a[i] > a[i + 1]: cnt += 1 print(cnt) ```
3
461
A
Appleman and Toastman
PROGRAMMING
1,200
[ "greedy", "sortings" ]
null
null
Appleman and Toastman play a game. Initially Appleman gives one group of *n* numbers to the Toastman, then they start to complete the following tasks: - Each time Toastman gets a group of numbers, he sums up all the numbers and adds this sum to the score. Then he gives the group to the Appleman. - Each time Appleman gets a group consisting of a single number, he throws this group out. Each time Appleman gets a group consisting of more than one number, he splits the group into two non-empty groups (he can do it in any way) and gives each of them to Toastman. After guys complete all the tasks they look at the score value. What is the maximum possible value of score they can get?
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=3·105). The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=106) — the initial group that is given to Toastman.
Print a single integer — the largest possible score.
[ "3\n3 1 5\n", "1\n10\n" ]
[ "26\n", "10\n" ]
Consider the following situation in the first example. Initially Toastman gets group [3, 1, 5] and adds 9 to the score, then he give the group to Appleman. Appleman splits group [3, 1, 5] into two groups: [3, 5] and [1]. Both of them should be given to Toastman. When Toastman receives group [1], he adds 1 to score and gives the group to Appleman (he will throw it out). When Toastman receives group [3, 5], he adds 8 to the score and gives the group to Appleman. Appleman splits [3, 5] in the only possible way: [5] and [3]. Then he gives both groups to Toastman. When Toastman receives [5], he adds 5 to the score and gives the group to Appleman (he will throws it out). When Toastman receives [3], he adds 3 to the score and gives the group to Appleman (he will throws it out). Finally Toastman have added 9 + 1 + 8 + 5 + 3 = 26 to the score. This is the optimal sequence of actions.
500
[ { "input": "3\n3 1 5", "output": "26" }, { "input": "1\n10", "output": "10" }, { "input": "10\n8 10 2 5 6 2 4 7 2 1", "output": "376" }, { "input": "10\n171308 397870 724672 431255 228496 892002 542924 718337 888642 161821", "output": "40204082" }, { "input": "10\n1 2 2 2 4 5 6 7 8 10", "output": "376" }, { "input": "10\n161821 171308 228496 397870 431255 542924 718337 724672 888642 892002", "output": "40204082" }, { "input": "1\n397870", "output": "397870" }, { "input": "1\n1000000", "output": "1000000" }, { "input": "10\n10 8 7 6 5 4 2 2 2 1", "output": "376" }, { "input": "10\n892002 888642 724672 718337 542924 431255 397870 228496 171308 161821", "output": "40204082" }, { "input": "10\n5 2 6 10 10 10 10 2 2 5", "output": "485" }, { "input": "10\n431255 724672 228496 397870 397870 397870 397870 724672 888642 431255", "output": "36742665" }, { "input": "10\n2 2 2 5 5 6 10 10 10 10", "output": "485" }, { "input": "10\n228496 397870 397870 397870 397870 431255 431255 724672 724672 888642", "output": "36742665" }, { "input": "10\n10 10 10 10 6 5 5 2 2 2", "output": "485" }, { "input": "10\n888642 724672 724672 431255 431255 397870 397870 397870 397870 228496", "output": "36742665" }, { "input": "10\n10 10 10 10 10 10 10 10 10 10", "output": "640" }, { "input": "10\n1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000", "output": "64000000" }, { "input": "1\n397870", "output": "397870" }, { "input": "2\n1 2", "output": "6" }, { "input": "2\n2 3", "output": "10" }, { "input": "2\n1 1", "output": "4" } ]
1,595,993,583
2,147,483,647
Python 3
OK
TESTS
36
467
27,648,000
# -*- coding: utf-8 -*- """ Created on Wed Jul 29 08:53:49 2020 @author: Harshal """ n=int(input()) arr=list(map(int,input().split())) arr.sort(reverse=True) sums=sum(arr) ans=0 while len(arr)>1: ans+=sums x=arr.pop() ans+=x sums-=x print(ans+arr[0])
Title: Appleman and Toastman Time Limit: None seconds Memory Limit: None megabytes Problem Description: Appleman and Toastman play a game. Initially Appleman gives one group of *n* numbers to the Toastman, then they start to complete the following tasks: - Each time Toastman gets a group of numbers, he sums up all the numbers and adds this sum to the score. Then he gives the group to the Appleman. - Each time Appleman gets a group consisting of a single number, he throws this group out. Each time Appleman gets a group consisting of more than one number, he splits the group into two non-empty groups (he can do it in any way) and gives each of them to Toastman. After guys complete all the tasks they look at the score value. What is the maximum possible value of score they can get? Input Specification: The first line contains a single integer *n* (1<=≤<=*n*<=≤<=3·105). The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=106) — the initial group that is given to Toastman. Output Specification: Print a single integer — the largest possible score. Demo Input: ['3\n3 1 5\n', '1\n10\n'] Demo Output: ['26\n', '10\n'] Note: Consider the following situation in the first example. Initially Toastman gets group [3, 1, 5] and adds 9 to the score, then he give the group to Appleman. Appleman splits group [3, 1, 5] into two groups: [3, 5] and [1]. Both of them should be given to Toastman. When Toastman receives group [1], he adds 1 to score and gives the group to Appleman (he will throw it out). When Toastman receives group [3, 5], he adds 8 to the score and gives the group to Appleman. Appleman splits [3, 5] in the only possible way: [5] and [3]. Then he gives both groups to Toastman. When Toastman receives [5], he adds 5 to the score and gives the group to Appleman (he will throws it out). When Toastman receives [3], he adds 3 to the score and gives the group to Appleman (he will throws it out). Finally Toastman have added 9 + 1 + 8 + 5 + 3 = 26 to the score. This is the optimal sequence of actions.
```python # -*- coding: utf-8 -*- """ Created on Wed Jul 29 08:53:49 2020 @author: Harshal """ n=int(input()) arr=list(map(int,input().split())) arr.sort(reverse=True) sums=sum(arr) ans=0 while len(arr)>1: ans+=sums x=arr.pop() ans+=x sums-=x print(ans+arr[0]) ```
3
841
B
Godsend
PROGRAMMING
1,100
[ "games", "math" ]
null
null
Leha somehow found an array consisting of *n* integers. Looking at it, he came up with a task. Two players play the game on the array. Players move one by one. The first player can choose for his move a subsegment of non-zero length with an odd sum of numbers and remove it from the array, after that the remaining parts are glued together into one array and the game continues. The second player can choose a subsegment of non-zero length with an even sum and remove it. Loses the one who can not make a move. Who will win if both play optimally?
First line of input data contains single integer *n* (1<=≤<=*n*<=≤<=106) — length of the array. Next line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=109).
Output answer in single line. "First", if first player wins, and "Second" otherwise (without quotes).
[ "4\n1 3 2 3\n", "2\n2 2\n" ]
[ "First\n", "Second\n" ]
In first sample first player remove whole array in one move and win. In second sample first player can't make a move and lose.
1,000
[ { "input": "4\n1 3 2 3", "output": "First" }, { "input": "2\n2 2", "output": "Second" }, { "input": "4\n2 4 6 8", "output": "Second" }, { "input": "5\n1 1 1 1 1", "output": "First" }, { "input": "4\n720074544 345031254 849487632 80870826", "output": "Second" }, { "input": "1\n0", "output": "Second" }, { "input": "1\n999999999", "output": "First" }, { "input": "2\n1 999999999", "output": "First" }, { "input": "4\n3 3 4 4", "output": "First" }, { "input": "2\n1 2", "output": "First" }, { "input": "8\n2 2 2 1 1 2 2 2", "output": "First" }, { "input": "5\n3 3 2 2 2", "output": "First" }, { "input": "4\n0 1 1 0", "output": "First" }, { "input": "3\n1 2 2", "output": "First" }, { "input": "6\n2 2 1 1 4 2", "output": "First" }, { "input": "8\n2 2 2 3 3 2 2 2", "output": "First" }, { "input": "4\n2 3 3 4", "output": "First" }, { "input": "10\n2 2 2 2 3 1 2 2 2 2", "output": "First" }, { "input": "6\n2 2 1 1 2 2", "output": "First" }, { "input": "3\n1 1 2", "output": "First" }, { "input": "6\n2 4 3 3 4 6", "output": "First" }, { "input": "6\n4 4 3 3 4 4", "output": "First" }, { "input": "4\n1 1 2 2", "output": "First" }, { "input": "4\n1 3 5 7", "output": "First" }, { "input": "4\n2 1 1 2", "output": "First" }, { "input": "4\n1 3 3 2", "output": "First" }, { "input": "5\n3 2 2 2 2", "output": "First" }, { "input": "3\n2 1 1", "output": "First" }, { "input": "4\n1000000000 1000000000 1000000000 99999999", "output": "First" }, { "input": "4\n2 2 1 1", "output": "First" }, { "input": "5\n2 3 2 3 2", "output": "First" }, { "input": "1\n1", "output": "First" }, { "input": "4\n1000000000 1000000000 1000000000 1", "output": "First" }, { "input": "5\n2 2 2 1 1", "output": "First" }, { "input": "6\n2 1 1 1 1 2", "output": "First" }, { "input": "6\n1 2 2 2 2 1", "output": "First" }, { "input": "11\n2 2 2 2 2 1 2 2 2 2 2", "output": "First" }, { "input": "5\n1 3 2 2 2", "output": "First" }, { "input": "3\n2 3 2", "output": "First" }, { "input": "2\n1 1", "output": "First" }, { "input": "5\n4 4 4 3 3", "output": "First" }, { "input": "5\n3 3 4 4 4", "output": "First" }, { "input": "1\n2", "output": "Second" } ]
1,608,561,846
2,147,483,647
Python 3
OK
TESTS
88
920
57,241,600
n = int(input()) a = input() uneven = False s = 0 for i in a.split(): v = int(i) if v % 2: uneven = True s += v if s % 2 or uneven: print('First') else: print('Second')
Title: Godsend Time Limit: None seconds Memory Limit: None megabytes Problem Description: Leha somehow found an array consisting of *n* integers. Looking at it, he came up with a task. Two players play the game on the array. Players move one by one. The first player can choose for his move a subsegment of non-zero length with an odd sum of numbers and remove it from the array, after that the remaining parts are glued together into one array and the game continues. The second player can choose a subsegment of non-zero length with an even sum and remove it. Loses the one who can not make a move. Who will win if both play optimally? Input Specification: First line of input data contains single integer *n* (1<=≤<=*n*<=≤<=106) — length of the array. Next line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=109). Output Specification: Output answer in single line. "First", if first player wins, and "Second" otherwise (without quotes). Demo Input: ['4\n1 3 2 3\n', '2\n2 2\n'] Demo Output: ['First\n', 'Second\n'] Note: In first sample first player remove whole array in one move and win. In second sample first player can't make a move and lose.
```python n = int(input()) a = input() uneven = False s = 0 for i in a.split(): v = int(i) if v % 2: uneven = True s += v if s % 2 or uneven: print('First') else: print('Second') ```
3
228
A
Is your horseshoe on the other hoof?
PROGRAMMING
800
[ "implementation" ]
null
null
Valera the Horse is going to the party with friends. He has been following the fashion trends for a while, and he knows that it is very popular to wear all horseshoes of different color. Valera has got four horseshoes left from the last year, but maybe some of them have the same color. In this case he needs to go to the store and buy some few more horseshoes, not to lose face in front of his stylish comrades. Fortunately, the store sells horseshoes of all colors under the sun and Valera has enough money to buy any four of them. However, in order to save the money, he would like to spend as little money as possible, so you need to help Valera and determine what is the minimum number of horseshoes he needs to buy to wear four horseshoes of different colors to a party.
The first line contains four space-separated integers *s*1,<=*s*2,<=*s*3,<=*s*4 (1<=≤<=*s*1,<=*s*2,<=*s*3,<=*s*4<=≤<=109) — the colors of horseshoes Valera has. Consider all possible colors indexed with integers.
Print a single integer — the minimum number of horseshoes Valera needs to buy.
[ "1 7 3 3\n", "7 7 7 7\n" ]
[ "1\n", "3\n" ]
none
500
[ { "input": "1 7 3 3", "output": "1" }, { "input": "7 7 7 7", "output": "3" }, { "input": "81170865 673572653 756938629 995577259", "output": "0" }, { "input": "3491663 217797045 522540872 715355328", "output": "0" }, { "input": "251590420 586975278 916631563 586975278", "output": "1" }, { "input": "259504825 377489979 588153796 377489979", "output": "1" }, { "input": "652588203 931100304 931100304 652588203", "output": "2" }, { "input": "391958720 651507265 391958720 651507265", "output": "2" }, { "input": "90793237 90793237 90793237 90793237", "output": "3" }, { "input": "551651653 551651653 551651653 551651653", "output": "3" }, { "input": "156630260 609654355 668943582 973622757", "output": "0" }, { "input": "17061017 110313588 434481173 796661222", "output": "0" }, { "input": "24975422 256716298 337790533 690960249", "output": "0" }, { "input": "255635360 732742923 798648949 883146723", "output": "0" }, { "input": "133315691 265159773 734556507 265159773", "output": "1" }, { "input": "28442865 741657755 978106882 978106882", "output": "1" }, { "input": "131245479 174845575 497483467 131245479", "output": "1" }, { "input": "139159884 616215581 958341883 616215581", "output": "1" }, { "input": "147784432 947653080 947653080 947653080", "output": "2" }, { "input": "94055790 756126496 756126496 94055790", "output": "2" }, { "input": "240458500 511952208 240458500 511952208", "output": "2" }, { "input": "681828506 972810624 972810624 681828506", "output": "2" }, { "input": "454961014 454961014 454961014 454961014", "output": "3" }, { "input": "915819430 915819430 915819430 915819430", "output": "3" }, { "input": "671645142 671645142 671645142 671645142", "output": "3" }, { "input": "132503558 132503558 132503558 132503558", "output": "3" }, { "input": "5 5 999999 6", "output": "1" }, { "input": "1 1 2 5", "output": "1" }, { "input": "2 1 2 3", "output": "1" }, { "input": "1 1 3 5", "output": "1" }, { "input": "1 1 3 3", "output": "2" }, { "input": "2 2 2 1", "output": "2" }, { "input": "3 1 1 1", "output": "2" }, { "input": "1 2 2 2", "output": "2" } ]
1,684,330,469
2,147,483,647
PyPy 3-64
OK
TESTS
34
124
0
x=list(map(int,input().split(" "))) count=0 l=[] for i in x: if i not in l: l.append(i) else: count+=1 print(count)
Title: Is your horseshoe on the other hoof? Time Limit: None seconds Memory Limit: None megabytes Problem Description: Valera the Horse is going to the party with friends. He has been following the fashion trends for a while, and he knows that it is very popular to wear all horseshoes of different color. Valera has got four horseshoes left from the last year, but maybe some of them have the same color. In this case he needs to go to the store and buy some few more horseshoes, not to lose face in front of his stylish comrades. Fortunately, the store sells horseshoes of all colors under the sun and Valera has enough money to buy any four of them. However, in order to save the money, he would like to spend as little money as possible, so you need to help Valera and determine what is the minimum number of horseshoes he needs to buy to wear four horseshoes of different colors to a party. Input Specification: The first line contains four space-separated integers *s*1,<=*s*2,<=*s*3,<=*s*4 (1<=≤<=*s*1,<=*s*2,<=*s*3,<=*s*4<=≤<=109) — the colors of horseshoes Valera has. Consider all possible colors indexed with integers. Output Specification: Print a single integer — the minimum number of horseshoes Valera needs to buy. Demo Input: ['1 7 3 3\n', '7 7 7 7\n'] Demo Output: ['1\n', '3\n'] Note: none
```python x=list(map(int,input().split(" "))) count=0 l=[] for i in x: if i not in l: l.append(i) else: count+=1 print(count) ```
3
463
B
Caisa and Pylons
PROGRAMMING
1,100
[ "brute force", "implementation", "math" ]
null
null
Caisa solved the problem with the sugar and now he is on the way back to home. Caisa is playing a mobile game during his path. There are (*n*<=+<=1) pylons numbered from 0 to *n* in this game. The pylon with number 0 has zero height, the pylon with number *i* (*i*<=&gt;<=0) has height *h**i*. The goal of the game is to reach *n*-th pylon, and the only move the player can do is to jump from the current pylon (let's denote its number as *k*) to the next one (its number will be *k*<=+<=1). When the player have made such a move, its energy increases by *h**k*<=-<=*h**k*<=+<=1 (if this value is negative the player loses energy). The player must have non-negative amount of energy at any moment of the time. Initially Caisa stand at 0 pylon and has 0 energy. The game provides a special opportunity: one can pay a single dollar and increase the height of anyone pylon by one. Caisa may use that opportunity several times, but he doesn't want to spend too much money. What is the minimal amount of money he must paid to reach the goal of the game?
The first line contains integer *n* (1<=≤<=*n*<=≤<=105). The next line contains *n* integers *h*1, *h*2,<=..., *h**n* (1<=<=≤<=<=*h**i*<=<=≤<=<=105) representing the heights of the pylons.
Print a single number representing the minimum number of dollars paid by Caisa.
[ "5\n3 4 3 2 4\n", "3\n4 4 4\n" ]
[ "4\n", "4\n" ]
In the first sample he can pay 4 dollars and increase the height of pylon with number 0 by 4 units. Then he can safely pass to the last pylon.
1,000
[ { "input": "5\n3 4 3 2 4", "output": "4" }, { "input": "3\n4 4 4", "output": "4" }, { "input": "99\n1401 2019 1748 3785 3236 3177 3443 3772 2138 1049 353 908 310 2388 1322 88 2160 2783 435 2248 1471 706 2468 2319 3156 3506 2794 1999 1983 2519 2597 3735 537 344 3519 3772 3872 2961 3895 2010 10 247 3269 671 2986 942 758 1146 77 1545 3745 1547 2250 2565 217 1406 2070 3010 3404 404 1528 2352 138 2065 3047 3656 2188 2919 2616 2083 1280 2977 2681 548 4000 1667 1489 1109 3164 1565 2653 3260 3463 903 1824 3679 2308 245 2689 2063 648 568 766 785 2984 3812 440 1172 2730", "output": "4000" }, { "input": "68\n477 1931 3738 3921 2306 1823 3328 2057 661 3993 2967 3520 171 1739 1525 1817 209 3475 1902 2666 518 3283 3412 3040 3383 2331 1147 1460 1452 1800 1327 2280 82 1416 2200 2388 3238 1879 796 250 1872 114 121 2042 1853 1645 211 2061 1472 2464 726 1989 1746 489 1380 1128 2819 2527 2939 622 678 265 2902 1111 2032 1453 3850 1621", "output": "3993" }, { "input": "30\n30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1", "output": "30" }, { "input": "3\n3 2 1", "output": "3" }, { "input": "1\n69", "output": "69" } ]
1,621,781,673
2,147,483,647
Python 3
OK
TESTS
49
140
7,577,600
n=int(input()) a=[0]+list(map(int,input().split())) s=0 x=0 for i in range(n): s+=a[i]-a[i+1] if s<0: x+=abs(s) s=0 print(x) ''' max(a) '''
Title: Caisa and Pylons Time Limit: None seconds Memory Limit: None megabytes Problem Description: Caisa solved the problem with the sugar and now he is on the way back to home. Caisa is playing a mobile game during his path. There are (*n*<=+<=1) pylons numbered from 0 to *n* in this game. The pylon with number 0 has zero height, the pylon with number *i* (*i*<=&gt;<=0) has height *h**i*. The goal of the game is to reach *n*-th pylon, and the only move the player can do is to jump from the current pylon (let's denote its number as *k*) to the next one (its number will be *k*<=+<=1). When the player have made such a move, its energy increases by *h**k*<=-<=*h**k*<=+<=1 (if this value is negative the player loses energy). The player must have non-negative amount of energy at any moment of the time. Initially Caisa stand at 0 pylon and has 0 energy. The game provides a special opportunity: one can pay a single dollar and increase the height of anyone pylon by one. Caisa may use that opportunity several times, but he doesn't want to spend too much money. What is the minimal amount of money he must paid to reach the goal of the game? Input Specification: The first line contains integer *n* (1<=≤<=*n*<=≤<=105). The next line contains *n* integers *h*1, *h*2,<=..., *h**n* (1<=<=≤<=<=*h**i*<=<=≤<=<=105) representing the heights of the pylons. Output Specification: Print a single number representing the minimum number of dollars paid by Caisa. Demo Input: ['5\n3 4 3 2 4\n', '3\n4 4 4\n'] Demo Output: ['4\n', '4\n'] Note: In the first sample he can pay 4 dollars and increase the height of pylon with number 0 by 4 units. Then he can safely pass to the last pylon.
```python n=int(input()) a=[0]+list(map(int,input().split())) s=0 x=0 for i in range(n): s+=a[i]-a[i+1] if s<0: x+=abs(s) s=0 print(x) ''' max(a) ''' ```
3
984
A
Game
PROGRAMMING
800
[ "sortings" ]
null
null
Two players play a game. Initially there are $n$ integers $a_1, a_2, \ldots, a_n$ written on the board. Each turn a player selects one number and erases it from the board. This continues until there is only one number left on the board, i. e. $n - 1$ turns are made. The first player makes the first move, then players alternate turns. The first player wants to minimize the last number that would be left on the board, while the second player wants to maximize it. You want to know what number will be left on the board after $n - 1$ turns if both players make optimal moves.
The first line contains one integer $n$ ($1 \le n \le 1000$) — the number of numbers on the board. The second line contains $n$ integers $a_1, a_2, \ldots, a_n$ ($1 \le a_i \le 10^6$).
Print one number that will be left on the board.
[ "3\n2 1 3\n", "3\n2 2 2\n" ]
[ "2", "2" ]
In the first sample, the first player erases $3$ and the second erases $1$. $2$ is left on the board. In the second sample, $2$ is left on the board regardless of the actions of the players.
500
[ { "input": "3\n2 1 3", "output": "2" }, { "input": "3\n2 2 2", "output": "2" }, { "input": "9\n44 53 51 80 5 27 74 79 94", "output": "53" }, { "input": "10\n38 82 23 37 96 4 81 60 67 86", "output": "60" }, { "input": "10\n58 26 77 15 53 81 68 48 22 65", "output": "53" }, { "input": "1\n124", "output": "124" }, { "input": "2\n2 1", "output": "1" }, { "input": "3\n1 1 1000", "output": "1" }, { "input": "2\n322 322", "output": "322" }, { "input": "3\n9 92 12", "output": "12" }, { "input": "3\n1 2 2", "output": "2" } ]
1,634,657,852
2,147,483,647
Python 3
OK
TESTS
35
62
0
a = int(input()) b = list(map(int, input().split())) for i in range(a -1): if i % 2 == 0: b.remove(max(b)) else: b.remove(min(b)) print(b[0])
Title: Game Time Limit: None seconds Memory Limit: None megabytes Problem Description: Two players play a game. Initially there are $n$ integers $a_1, a_2, \ldots, a_n$ written on the board. Each turn a player selects one number and erases it from the board. This continues until there is only one number left on the board, i. e. $n - 1$ turns are made. The first player makes the first move, then players alternate turns. The first player wants to minimize the last number that would be left on the board, while the second player wants to maximize it. You want to know what number will be left on the board after $n - 1$ turns if both players make optimal moves. Input Specification: The first line contains one integer $n$ ($1 \le n \le 1000$) — the number of numbers on the board. The second line contains $n$ integers $a_1, a_2, \ldots, a_n$ ($1 \le a_i \le 10^6$). Output Specification: Print one number that will be left on the board. Demo Input: ['3\n2 1 3\n', '3\n2 2 2\n'] Demo Output: ['2', '2'] Note: In the first sample, the first player erases $3$ and the second erases $1$. $2$ is left on the board. In the second sample, $2$ is left on the board regardless of the actions of the players.
```python a = int(input()) b = list(map(int, input().split())) for i in range(a -1): if i % 2 == 0: b.remove(max(b)) else: b.remove(min(b)) print(b[0]) ```
3
224
A
Parallelepiped
PROGRAMMING
1,100
[ "brute force", "geometry", "math" ]
null
null
You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped.
The first and the single line contains three space-separated integers — the areas of the parallelepiped's faces. The area's values are positive (<=&gt;<=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement.
Print a single number — the sum of all edges of the parallelepiped.
[ "1 1 1\n", "4 6 6\n" ]
[ "12\n", "28\n" ]
In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second one — 2 × 2 × 3.
500
[ { "input": "1 1 1", "output": "12" }, { "input": "4 6 6", "output": "28" }, { "input": "20 10 50", "output": "68" }, { "input": "9 4 36", "output": "56" }, { "input": "324 9 36", "output": "184" }, { "input": "1333 93 129", "output": "308" }, { "input": "1022 584 112", "output": "380" }, { "input": "66 174 319", "output": "184" }, { "input": "912 276 1748", "output": "444" }, { "input": "65 156 60", "output": "120" }, { "input": "1 10000 10000", "output": "40008" }, { "input": "1485 55 27", "output": "332" }, { "input": "152 108 4104", "output": "528" }, { "input": "1656 6900 1350", "output": "740" }, { "input": "12 14 42", "output": "60" }, { "input": "615 18 1230", "output": "856" }, { "input": "680 60 408", "output": "336" }, { "input": "644 966 6", "output": "1308" }, { "input": "1 432 432", "output": "1736" }, { "input": "2239 2239 1", "output": "8964" }, { "input": "4106 8212 2", "output": "16436" }, { "input": "10000 10000 10000", "output": "1200" }, { "input": "3623 3623 1", "output": "14500" }, { "input": "9801 9801 9801", "output": "1188" }, { "input": "10000 1 10000", "output": "40008" }, { "input": "9 9 9", "output": "36" }, { "input": "9801 9702 9702", "output": "1184" } ]
1,649,270,550
2,147,483,647
Python 3
OK
TESTS
27
92
0
import math arr = list(map(int, input().split())) s1 = math.sqrt(arr[0] * arr[1] / arr[2]) s2 = math.sqrt(arr[2] * arr[0] / arr[1]) s3 = math.sqrt(arr[2] * arr[1] / arr[0]) print(int(4*(s1+s2+s3)))
Title: Parallelepiped Time Limit: None seconds Memory Limit: None megabytes Problem Description: You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped. Input Specification: The first and the single line contains three space-separated integers — the areas of the parallelepiped's faces. The area's values are positive (<=&gt;<=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement. Output Specification: Print a single number — the sum of all edges of the parallelepiped. Demo Input: ['1 1 1\n', '4 6 6\n'] Demo Output: ['12\n', '28\n'] Note: In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second one — 2 × 2 × 3.
```python import math arr = list(map(int, input().split())) s1 = math.sqrt(arr[0] * arr[1] / arr[2]) s2 = math.sqrt(arr[2] * arr[0] / arr[1]) s3 = math.sqrt(arr[2] * arr[1] / arr[0]) print(int(4*(s1+s2+s3))) ```
3
279
B
Books
PROGRAMMING
1,400
[ "binary search", "brute force", "implementation", "two pointers" ]
null
null
When Valera has got some free time, he goes to the library to read some books. Today he's got *t* free minutes to read. That's why Valera took *n* books in the library and for each book he estimated the time he is going to need to read it. Let's number the books by integers from 1 to *n*. Valera needs *a**i* minutes to read the *i*-th book. Valera decided to choose an arbitrary book with number *i* and read the books one by one, starting from this book. In other words, he will first read book number *i*, then book number *i*<=+<=1, then book number *i*<=+<=2 and so on. He continues the process until he either runs out of the free time or finishes reading the *n*-th book. Valera reads each book up to the end, that is, he doesn't start reading the book if he doesn't have enough free time to finish reading it. Print the maximum number of books Valera can read.
The first line contains two integers *n* and *t* (1<=≤<=*n*<=≤<=105; 1<=≤<=*t*<=≤<=109) — the number of books and the number of free minutes Valera's got. The second line contains a sequence of *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=104), where number *a**i* shows the number of minutes that the boy needs to read the *i*-th book.
Print a single integer — the maximum number of books Valera can read.
[ "4 5\n3 1 2 1\n", "3 3\n2 2 3\n" ]
[ "3\n", "1\n" ]
none
1,000
[ { "input": "4 5\n3 1 2 1", "output": "3" }, { "input": "3 3\n2 2 3", "output": "1" }, { "input": "1 3\n5", "output": "0" }, { "input": "1 10\n4", "output": "1" }, { "input": "2 10\n6 4", "output": "2" }, { "input": "6 10\n2 3 4 2 1 1", "output": "4" }, { "input": "7 13\n6 8 14 9 4 11 10", "output": "2" }, { "input": "10 15\n10 9 1 1 5 10 5 3 7 2", "output": "3" }, { "input": "20 30\n8 1 2 6 9 4 1 9 9 10 4 7 8 9 5 7 1 8 7 4", "output": "6" }, { "input": "30 60\n16 13 22 38 13 35 17 17 20 38 12 19 9 22 20 3 35 34 34 21 35 40 22 3 27 19 12 4 8 19", "output": "4" }, { "input": "100 100\n75 92 18 6 81 67 7 92 100 65 82 32 50 67 85 31 80 91 84 63 39 52 92 81 1 98 24 12 43 48 17 86 51 72 48 95 45 50 12 66 19 79 49 89 34 1 97 75 20 33 96 27 42 23 73 71 93 1 85 19 66 14 17 61 20 39 36 33 42 61 56 64 23 91 80 99 40 74 13 18 98 85 74 39 62 84 46 74 50 23 38 11 79 14 9 25 66 100 25 52", "output": "3" }, { "input": "10 1\n4418 7528 8170 1736 1317 3205 8183 4995 8039 4708", "output": "0" }, { "input": "50 2\n124 214 63 73 996 760 38 571 451 300 970 1 706 937 837 494 619 88 851 411 957 990 842 613 821 649 627 34 693 678 734 116 816 985 705 940 499 493 922 967 854 439 112 644 961 438 189 572 655 550", "output": "1" } ]
1,684,783,776
2,147,483,647
PyPy 3-64
OK
TESTS
38
218
13,824,000
n,t=map(int,input().split()) times=list(map(int,input().split())) from itertools import accumulate from bisect import bisect_right times=list(accumulate(times,initial=0)) res=0 for i in range(n): res=max(res,bisect_right(times,t+times[i])-(i+1)) print(res)
Title: Books Time Limit: None seconds Memory Limit: None megabytes Problem Description: When Valera has got some free time, he goes to the library to read some books. Today he's got *t* free minutes to read. That's why Valera took *n* books in the library and for each book he estimated the time he is going to need to read it. Let's number the books by integers from 1 to *n*. Valera needs *a**i* minutes to read the *i*-th book. Valera decided to choose an arbitrary book with number *i* and read the books one by one, starting from this book. In other words, he will first read book number *i*, then book number *i*<=+<=1, then book number *i*<=+<=2 and so on. He continues the process until he either runs out of the free time or finishes reading the *n*-th book. Valera reads each book up to the end, that is, he doesn't start reading the book if he doesn't have enough free time to finish reading it. Print the maximum number of books Valera can read. Input Specification: The first line contains two integers *n* and *t* (1<=≤<=*n*<=≤<=105; 1<=≤<=*t*<=≤<=109) — the number of books and the number of free minutes Valera's got. The second line contains a sequence of *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=104), where number *a**i* shows the number of minutes that the boy needs to read the *i*-th book. Output Specification: Print a single integer — the maximum number of books Valera can read. Demo Input: ['4 5\n3 1 2 1\n', '3 3\n2 2 3\n'] Demo Output: ['3\n', '1\n'] Note: none
```python n,t=map(int,input().split()) times=list(map(int,input().split())) from itertools import accumulate from bisect import bisect_right times=list(accumulate(times,initial=0)) res=0 for i in range(n): res=max(res,bisect_right(times,t+times[i])-(i+1)) print(res) ```
3
0
none
none
none
0
[ "none" ]
null
null
One department of some software company has $n$ servers of different specifications. Servers are indexed with consecutive integers from $1$ to $n$. Suppose that the specifications of the $j$-th server may be expressed with a single integer number $c_j$ of artificial resource units. In order for production to work, it is needed to deploy two services $S_1$ and $S_2$ to process incoming requests using the servers of the department. Processing of incoming requests of service $S_i$ takes $x_i$ resource units. The described situation happens in an advanced company, that is why each service may be deployed using not only one server, but several servers simultaneously. If service $S_i$ is deployed using $k_i$ servers, then the load is divided equally between these servers and each server requires only $x_i / k_i$ (that may be a fractional number) resource units. Each server may be left unused at all, or be used for deploying exactly one of the services (but not for two of them simultaneously). The service should not use more resources than the server provides. Determine if it is possible to deploy both services using the given servers, and if yes, determine which servers should be used for deploying each of the services.
The first line contains three integers $n$, $x_1$, $x_2$ ($2 \leq n \leq 300\,000$, $1 \leq x_1, x_2 \leq 10^9$) — the number of servers that the department may use, and resource units requirements for each of the services. The second line contains $n$ space-separated integers $c_1, c_2, \ldots, c_n$ ($1 \leq c_i \leq 10^9$) — the number of resource units provided by each of the servers.
If it is impossible to deploy both services using the given servers, print the only word "No" (without the quotes). Otherwise print the word "Yes" (without the quotes). In the second line print two integers $k_1$ and $k_2$ ($1 \leq k_1, k_2 \leq n$) — the number of servers used for each of the services. In the third line print $k_1$ integers, the indices of the servers that will be used for the first service. In the fourth line print $k_2$ integers, the indices of the servers that will be used for the second service. No index may appear twice among the indices you print in the last two lines. If there are several possible answers, it is allowed to print any of them.
[ "6 8 16\n3 5 2 9 8 7\n", "4 20 32\n21 11 11 12\n", "4 11 32\n5 5 16 16\n", "5 12 20\n7 8 4 11 9\n" ]
[ "Yes\n3 2\n1 2 6\n5 4", "Yes\n1 3\n1\n2 3 4\n", "No\n", "No\n" ]
In the first sample test each of the servers 1, 2 and 6 will will provide $8 / 3 = 2.(6)$ resource units and each of the servers 5, 4 will provide $16 / 2 = 8$ resource units. In the second sample test the first server will provide $20$ resource units and each of the remaining servers will provide $32 / 3 = 10.(6)$ resource units.
0
[ { "input": "6 8 16\n3 5 2 9 8 7", "output": "Yes\n4 2\n3 1 2 6\n5 4" }, { "input": "4 20 32\n21 11 11 12", "output": "Yes\n1 3\n1\n2 3 4" }, { "input": "4 11 32\n5 5 16 16", "output": "No" }, { "input": "5 12 20\n7 8 4 11 9", "output": "No" }, { "input": "2 1 1\n1 1", "output": "Yes\n1 1\n1\n2" }, { "input": "2 1 1\n1 1000000", "output": "Yes\n1 1\n1\n2" }, { "input": "2 1 1\n1000000000 1000000000", "output": "Yes\n1 1\n1\n2" }, { "input": "2 1 2\n1 1", "output": "No" }, { "input": "15 250 200\n71 2 77 69 100 53 54 40 73 32 82 58 24 82 41", "output": "Yes\n11 3\n13 10 8 15 6 7 12 4 1 9 3\n11 14 5" }, { "input": "4 12 11\n4 4 6 11", "output": "Yes\n3 1\n1 2 3\n4" } ]
1,525,497,451
2,147,483,647
Python 3
OK
TESTS
40
1,668
39,014,400
import sys n,x1,x2=map(int,input().split()) a=list(map(int,input().split())) for i in range(n): a[i]=[a[i],i+1] a.sort() #print(a) for i in range(1,n+1): if(a[n-i][0]*(i)>=x1): break pt=i #print(pt) ans=-1 for i in range(pt+1,n+1): if(a[n-i][0]*(i-pt)>=x2): ans=i break if(ans!=-1): print('Yes') print(pt,ans-pt) b=[] c=[] for i in range(n-1,n-1-pt,-1): b.append(a[i][1]) for i in range(n-1-pt,n-1-ans,-1): c.append(a[i][1]) print(*b) print(*c) sys.exit() for i in range(1,n+1): if(a[n-i][0]*(i)>=x2): break pt=i ans=-1 for i in range(pt+1,n+1): if(a[n-i][0]*(i-pt)>=x1): ans=i break #print(pt) if(ans!=-1): print('Yes') print(ans-pt,pt) b=[] for i in range(n-1-pt,n-1-ans,-1): b.append(a[i][1]) c=[] for i in range(n-1,n-1-pt,-1): c.append(a[i][1]) print(*b) print(*c) sys.exit() print('No')
Title: none Time Limit: None seconds Memory Limit: None megabytes Problem Description: One department of some software company has $n$ servers of different specifications. Servers are indexed with consecutive integers from $1$ to $n$. Suppose that the specifications of the $j$-th server may be expressed with a single integer number $c_j$ of artificial resource units. In order for production to work, it is needed to deploy two services $S_1$ and $S_2$ to process incoming requests using the servers of the department. Processing of incoming requests of service $S_i$ takes $x_i$ resource units. The described situation happens in an advanced company, that is why each service may be deployed using not only one server, but several servers simultaneously. If service $S_i$ is deployed using $k_i$ servers, then the load is divided equally between these servers and each server requires only $x_i / k_i$ (that may be a fractional number) resource units. Each server may be left unused at all, or be used for deploying exactly one of the services (but not for two of them simultaneously). The service should not use more resources than the server provides. Determine if it is possible to deploy both services using the given servers, and if yes, determine which servers should be used for deploying each of the services. Input Specification: The first line contains three integers $n$, $x_1$, $x_2$ ($2 \leq n \leq 300\,000$, $1 \leq x_1, x_2 \leq 10^9$) — the number of servers that the department may use, and resource units requirements for each of the services. The second line contains $n$ space-separated integers $c_1, c_2, \ldots, c_n$ ($1 \leq c_i \leq 10^9$) — the number of resource units provided by each of the servers. Output Specification: If it is impossible to deploy both services using the given servers, print the only word "No" (without the quotes). Otherwise print the word "Yes" (without the quotes). In the second line print two integers $k_1$ and $k_2$ ($1 \leq k_1, k_2 \leq n$) — the number of servers used for each of the services. In the third line print $k_1$ integers, the indices of the servers that will be used for the first service. In the fourth line print $k_2$ integers, the indices of the servers that will be used for the second service. No index may appear twice among the indices you print in the last two lines. If there are several possible answers, it is allowed to print any of them. Demo Input: ['6 8 16\n3 5 2 9 8 7\n', '4 20 32\n21 11 11 12\n', '4 11 32\n5 5 16 16\n', '5 12 20\n7 8 4 11 9\n'] Demo Output: ['Yes\n3 2\n1 2 6\n5 4', 'Yes\n1 3\n1\n2 3 4\n', 'No\n', 'No\n'] Note: In the first sample test each of the servers 1, 2 and 6 will will provide $8 / 3 = 2.(6)$ resource units and each of the servers 5, 4 will provide $16 / 2 = 8$ resource units. In the second sample test the first server will provide $20$ resource units and each of the remaining servers will provide $32 / 3 = 10.(6)$ resource units.
```python import sys n,x1,x2=map(int,input().split()) a=list(map(int,input().split())) for i in range(n): a[i]=[a[i],i+1] a.sort() #print(a) for i in range(1,n+1): if(a[n-i][0]*(i)>=x1): break pt=i #print(pt) ans=-1 for i in range(pt+1,n+1): if(a[n-i][0]*(i-pt)>=x2): ans=i break if(ans!=-1): print('Yes') print(pt,ans-pt) b=[] c=[] for i in range(n-1,n-1-pt,-1): b.append(a[i][1]) for i in range(n-1-pt,n-1-ans,-1): c.append(a[i][1]) print(*b) print(*c) sys.exit() for i in range(1,n+1): if(a[n-i][0]*(i)>=x2): break pt=i ans=-1 for i in range(pt+1,n+1): if(a[n-i][0]*(i-pt)>=x1): ans=i break #print(pt) if(ans!=-1): print('Yes') print(ans-pt,pt) b=[] for i in range(n-1-pt,n-1-ans,-1): b.append(a[i][1]) c=[] for i in range(n-1,n-1-pt,-1): c.append(a[i][1]) print(*b) print(*c) sys.exit() print('No') ```
3
248
A
Cupboards
PROGRAMMING
800
[ "implementation" ]
null
null
One foggy Stockholm morning, Karlsson decided to snack on some jam in his friend Lillebror Svantenson's house. Fortunately for Karlsson, there wasn't anybody in his friend's house. Karlsson was not going to be hungry any longer, so he decided to get some food in the house. Karlsson's gaze immediately fell on *n* wooden cupboards, standing in the kitchen. He immediately realized that these cupboards have hidden jam stocks. Karlsson began to fly greedily around the kitchen, opening and closing the cupboards' doors, grab and empty all the jars of jam that he could find. And now all jars of jam are empty, Karlsson has had enough and does not want to leave traces of his stay, so as not to let down his friend. Each of the cupboards has two doors: the left one and the right one. Karlsson remembers that when he rushed to the kitchen, all the cupboards' left doors were in the same position (open or closed), similarly, all the cupboards' right doors were in the same position (open or closed). Karlsson wants the doors to meet this condition as well by the time the family returns. Karlsson does not remember the position of all the left doors, also, he cannot remember the position of all the right doors. Therefore, it does not matter to him in what position will be all left or right doors. It is important to leave all the left doors in the same position, and all the right doors in the same position. For example, all the left doors may be closed, and all the right ones may be open. Karlsson needs one second to open or close a door of a cupboard. He understands that he has very little time before the family returns, so he wants to know the minimum number of seconds *t*, in which he is able to bring all the cupboard doors in the required position. Your task is to write a program that will determine the required number of seconds *t*.
The first input line contains a single integer *n* — the number of cupboards in the kitchen (2<=≤<=*n*<=≤<=104). Then follow *n* lines, each containing two integers *l**i* and *r**i* (0<=≤<=*l**i*,<=*r**i*<=≤<=1). Number *l**i* equals one, if the left door of the *i*-th cupboard is opened, otherwise number *l**i* equals zero. Similarly, number *r**i* equals one, if the right door of the *i*-th cupboard is opened, otherwise number *r**i* equals zero. The numbers in the lines are separated by single spaces.
In the only output line print a single integer *t* — the minimum number of seconds Karlsson needs to change the doors of all cupboards to the position he needs.
[ "5\n0 1\n1 0\n0 1\n1 1\n0 1\n" ]
[ "3\n" ]
none
500
[ { "input": "5\n0 1\n1 0\n0 1\n1 1\n0 1", "output": "3" }, { "input": "2\n0 0\n0 0", "output": "0" }, { "input": "3\n0 1\n1 1\n1 1", "output": "1" }, { "input": "8\n0 1\n1 0\n0 1\n1 1\n0 1\n1 0\n0 1\n1 0", "output": "7" }, { "input": "8\n1 0\n1 0\n1 0\n0 1\n0 1\n1 1\n1 1\n0 1", "output": "6" }, { "input": "15\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0", "output": "0" }, { "input": "5\n1 0\n1 0\n1 0\n0 1\n0 1", "output": "4" } ]
1,610,720,224
2,147,483,647
Python 3
OK
TESTS
57
156
512,000
n = int(input()) one = [] two = [] for i in range(n): x, y = map(int, input().split(" ")) one.append(x) two.append(y) if one.count(0) > one.count(1): c_1 = one.count(1) else: c_1 = one.count(0) if two.count(0) > two.count(1): c_2 = two.count(1) else: c_2 = two.count(0) print(c_1 + c_2)
Title: Cupboards Time Limit: None seconds Memory Limit: None megabytes Problem Description: One foggy Stockholm morning, Karlsson decided to snack on some jam in his friend Lillebror Svantenson's house. Fortunately for Karlsson, there wasn't anybody in his friend's house. Karlsson was not going to be hungry any longer, so he decided to get some food in the house. Karlsson's gaze immediately fell on *n* wooden cupboards, standing in the kitchen. He immediately realized that these cupboards have hidden jam stocks. Karlsson began to fly greedily around the kitchen, opening and closing the cupboards' doors, grab and empty all the jars of jam that he could find. And now all jars of jam are empty, Karlsson has had enough and does not want to leave traces of his stay, so as not to let down his friend. Each of the cupboards has two doors: the left one and the right one. Karlsson remembers that when he rushed to the kitchen, all the cupboards' left doors were in the same position (open or closed), similarly, all the cupboards' right doors were in the same position (open or closed). Karlsson wants the doors to meet this condition as well by the time the family returns. Karlsson does not remember the position of all the left doors, also, he cannot remember the position of all the right doors. Therefore, it does not matter to him in what position will be all left or right doors. It is important to leave all the left doors in the same position, and all the right doors in the same position. For example, all the left doors may be closed, and all the right ones may be open. Karlsson needs one second to open or close a door of a cupboard. He understands that he has very little time before the family returns, so he wants to know the minimum number of seconds *t*, in which he is able to bring all the cupboard doors in the required position. Your task is to write a program that will determine the required number of seconds *t*. Input Specification: The first input line contains a single integer *n* — the number of cupboards in the kitchen (2<=≤<=*n*<=≤<=104). Then follow *n* lines, each containing two integers *l**i* and *r**i* (0<=≤<=*l**i*,<=*r**i*<=≤<=1). Number *l**i* equals one, if the left door of the *i*-th cupboard is opened, otherwise number *l**i* equals zero. Similarly, number *r**i* equals one, if the right door of the *i*-th cupboard is opened, otherwise number *r**i* equals zero. The numbers in the lines are separated by single spaces. Output Specification: In the only output line print a single integer *t* — the minimum number of seconds Karlsson needs to change the doors of all cupboards to the position he needs. Demo Input: ['5\n0 1\n1 0\n0 1\n1 1\n0 1\n'] Demo Output: ['3\n'] Note: none
```python n = int(input()) one = [] two = [] for i in range(n): x, y = map(int, input().split(" ")) one.append(x) two.append(y) if one.count(0) > one.count(1): c_1 = one.count(1) else: c_1 = one.count(0) if two.count(0) > two.count(1): c_2 = two.count(1) else: c_2 = two.count(0) print(c_1 + c_2) ```
3
894
A
QAQ
PROGRAMMING
800
[ "brute force", "dp" ]
null
null
"QAQ" is a word to denote an expression of crying. Imagine "Q" as eyes with tears and "A" as a mouth. Now Diamond has given Bort a string consisting of only uppercase English letters of length *n*. There is a great number of "QAQ" in the string (Diamond is so cute!). Bort wants to know how many subsequences "QAQ" are in the string Diamond has given. Note that the letters "QAQ" don't have to be consecutive, but the order of letters should be exact.
The only line contains a string of length *n* (1<=≤<=*n*<=≤<=100). It's guaranteed that the string only contains uppercase English letters.
Print a single integer — the number of subsequences "QAQ" in the string.
[ "QAQAQYSYIOIWIN\n", "QAQQQZZYNOIWIN\n" ]
[ "4\n", "3\n" ]
In the first example there are 4 subsequences "QAQ": "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN".
500
[ { "input": "QAQAQYSYIOIWIN", "output": "4" }, { "input": "QAQQQZZYNOIWIN", "output": "3" }, { "input": "QA", "output": "0" }, { "input": "IAQVAQZLQBQVQFTQQQADAQJA", "output": "24" }, { "input": "QQAAQASGAYAAAAKAKAQIQEAQAIAAIAQQQQQ", "output": "378" }, { "input": "AMVFNFJIAVNQJWIVONQOAOOQSNQSONOASONAONQINAONAOIQONANOIQOANOQINAONOQINAONOXJCOIAQOAOQAQAQAQAQWWWAQQAQ", "output": "1077" }, { "input": "AAQQAXBQQBQQXBNQRJAQKQNAQNQVDQASAGGANQQQQTJFFQQQTQQA", "output": "568" }, { "input": "KAZXAVLPJQBQVQQQQQAPAQQGQTQVZQAAAOYA", "output": "70" }, { "input": "W", "output": "0" }, { "input": "DBA", "output": "0" }, { "input": "RQAWNACASAAKAGAAAAQ", "output": "10" }, { "input": "QJAWZAAOAAGIAAAAAOQATASQAEAAAAQFQQHPA", "output": "111" }, { "input": "QQKWQAQAAAAAAAAGAAVAQUEQQUMQMAQQQNQLAMAAAUAEAAEMAAA", "output": "411" }, { "input": "QQUMQAYAUAAGWAAAQSDAVAAQAAAASKQJJQQQQMAWAYYAAAAAAEAJAXWQQ", "output": "625" }, { "input": "QORZOYAQ", "output": "1" }, { "input": "QCQAQAGAWAQQQAQAVQAQQQQAQAQQQAQAAATQAAVAAAQQQQAAAUUQAQQNQQWQQWAQAAQQKQYAQAAQQQAAQRAQQQWBQQQQAPBAQGQA", "output": "13174" }, { "input": "QQAQQAKQFAQLQAAWAMQAZQAJQAAQQOACQQAAAYANAQAQQAQAAQQAOBQQJQAQAQAQQQAAAAABQQQAVNZAQQQQAMQQAFAAEAQAQHQT", "output": "10420" }, { "input": "AQEGQHQQKQAQQPQKAQQQAAAAQQQAQEQAAQAAQAQFSLAAQQAQOQQAVQAAAPQQAWAQAQAFQAXAQQQQTRLOQAQQJQNQXQQQQSQVDQQQ", "output": "12488" }, { "input": "QNQKQQQLASQBAVQQQQAAQQOQRJQQAQQQEQZUOANAADAAQQJAQAQARAAAQQQEQBHTQAAQAAAAQQMKQQQIAOJJQQAQAAADADQUQQQA", "output": "9114" }, { "input": "QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ", "output": "35937" }, { "input": "AMQQAAQAAQAAAAAAQQQBOAAANAAKQJCYQAE", "output": "254" }, { "input": "AYQBAEQGAQEOAKGIXLQJAIAKQAAAQPUAJAKAATFWQQAOQQQUFQYAQQMQHOKAAJXGFCARAQSATHAUQQAATQJJQDQRAANQQAE", "output": "2174" }, { "input": "AAQXAAQAYQAAAAGAQHVQYAGIVACADFAAQAAAAQZAAQMAKZAADQAQDAAQDAAAMQQOXYAQQQAKQBAAQQKAXQBJZDDLAAHQQ", "output": "2962" }, { "input": "AYQQYAVAMNIAUAAKBBQVACWKTQSAQZAAQAAASZJAWBCAALAARHACQAKQQAQAARPAQAAQAQAAZQUSHQAMFVFZQQQQSAQQXAA", "output": "2482" }, { "input": "LQMAQQARQAQBJQQQAGAAZQQXALQQAARQAQQQQAAQQAQQQAQQCAQQAQQAYQQQRAAZATQALYQQAAHHAAQHAAAAAAAAQQMAAQNAKQ", "output": "7768" }, { "input": "MAQQWAQOYQMAAAQAQPQZAOAAQAUAQNAAQAAAITQSAQAKAQKAQQWSQAAQQAGUCDQMQWKQUXKWQQAAQQAAQQZQDQQQAABXQUUXQOA", "output": "5422" }, { "input": "QTAAQDAQXAQQJQQQGAAAQQQQSBQZKAQQAQQQQEAQNUQBZCQLYQZQEQQAAQHQVAORKQVAQYQNASZQAARZAAGAAAAOQDCQ", "output": "3024" }, { "input": "QQWAQQGQQUZQQQLZAAQYQXQVAQFQUAQZUQZZQUKBHSHTQYLQAOQXAQQGAQQTQOAQARQADAJRAAQPQAQQUQAUAMAUVQAAAQQAWQ", "output": "4527" }, { "input": "QQAAQQAQVAQZQQQQAOEAQZPQIBQZACQQAFQQLAAQDATZQANHKYQQAQTAAFQRQAIQAJPWQAQTEIRXAEQQAYWAAAUKQQAQAQQQSQQH", "output": "6416" }, { "input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQAQAAAA", "output": "14270" }, { "input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQ", "output": "13136" }, { "input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQAQAA", "output": "14270" }, { "input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQQAA", "output": "14231" }, { "input": "QQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQAQAA", "output": "15296" }, { "input": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ", "output": "0" }, { "input": "QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA", "output": "0" }, { "input": "QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ", "output": "0" }, { "input": "QAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQA", "output": "20825" }, { "input": "AQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQ", "output": "20825" }, { "input": "Q", "output": "0" }, { "input": "A", "output": "0" }, { "input": "FFF", "output": "0" }, { "input": "AAAAAA", "output": "0" } ]
1,644,985,055
2,147,483,647
Python 3
OK
TESTS
43
46
0
s = input() res = 0 n = len(s) for i in range(1, n - 1): if s[i] == 'A': l = i - 1 r = i + 1 a = 0 b = 0 while l >= 0: if s[l] == 'Q': a += 1 l -= 1 while r < n: if s[r] == 'Q': b += 1 r += 1 res += a*b print(res)
Title: QAQ Time Limit: None seconds Memory Limit: None megabytes Problem Description: "QAQ" is a word to denote an expression of crying. Imagine "Q" as eyes with tears and "A" as a mouth. Now Diamond has given Bort a string consisting of only uppercase English letters of length *n*. There is a great number of "QAQ" in the string (Diamond is so cute!). Bort wants to know how many subsequences "QAQ" are in the string Diamond has given. Note that the letters "QAQ" don't have to be consecutive, but the order of letters should be exact. Input Specification: The only line contains a string of length *n* (1<=≤<=*n*<=≤<=100). It's guaranteed that the string only contains uppercase English letters. Output Specification: Print a single integer — the number of subsequences "QAQ" in the string. Demo Input: ['QAQAQYSYIOIWIN\n', 'QAQQQZZYNOIWIN\n'] Demo Output: ['4\n', '3\n'] Note: In the first example there are 4 subsequences "QAQ": "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN".
```python s = input() res = 0 n = len(s) for i in range(1, n - 1): if s[i] == 'A': l = i - 1 r = i + 1 a = 0 b = 0 while l >= 0: if s[l] == 'Q': a += 1 l -= 1 while r < n: if s[r] == 'Q': b += 1 r += 1 res += a*b print(res) ```
3
3
A
Shortest path of the king
PROGRAMMING
1,000
[ "greedy", "shortest paths" ]
A. Shortest path of the king
1
64
The king is left alone on the chessboard. In spite of this loneliness, he doesn't lose heart, because he has business of national importance. For example, he has to pay an official visit to square *t*. As the king is not in habit of wasting his time, he wants to get from his current position *s* to square *t* in the least number of moves. Help him to do this. In one move the king can get to the square that has a common side or a common vertex with the square the king is currently in (generally there are 8 different squares he can move to).
The first line contains the chessboard coordinates of square *s*, the second line — of square *t*. Chessboard coordinates consist of two characters, the first one is a lowercase Latin letter (from a to h), the second one is a digit from 1 to 8.
In the first line print *n* — minimum number of the king's moves. Then in *n* lines print the moves themselves. Each move is described with one of the 8: L, R, U, D, LU, LD, RU or RD. L, R, U, D stand respectively for moves left, right, up and down (according to the picture), and 2-letter combinations stand for diagonal moves. If the answer is not unique, print any of them.
[ "a8\nh1\n" ]
[ "7\nRD\nRD\nRD\nRD\nRD\nRD\nRD\n" ]
none
0
[ { "input": "a8\nh1", "output": "7\nRD\nRD\nRD\nRD\nRD\nRD\nRD" }, { "input": "b2\nb4", "output": "2\nU\nU" }, { "input": "a5\na5", "output": "0" }, { "input": "h1\nb2", "output": "6\nLU\nL\nL\nL\nL\nL" }, { "input": "c5\nh2", "output": "5\nRD\nRD\nRD\nR\nR" }, { "input": "e1\nf2", "output": "1\nRU" }, { "input": "g4\nd2", "output": "3\nLD\nLD\nL" }, { "input": "a8\nb2", "output": "6\nRD\nD\nD\nD\nD\nD" }, { "input": "d4\nh2", "output": "4\nRD\nRD\nR\nR" }, { "input": "c5\na2", "output": "3\nLD\nLD\nD" }, { "input": "h5\nf8", "output": "3\nLU\nLU\nU" }, { "input": "e6\nb6", "output": "3\nL\nL\nL" }, { "input": "a6\ng4", "output": "6\nRD\nRD\nR\nR\nR\nR" }, { "input": "f7\nc2", "output": "5\nLD\nLD\nLD\nD\nD" }, { "input": "b7\nh8", "output": "6\nRU\nR\nR\nR\nR\nR" }, { "input": "g7\nd6", "output": "3\nLD\nL\nL" }, { "input": "c8\na3", "output": "5\nLD\nLD\nD\nD\nD" }, { "input": "h8\nf1", "output": "7\nLD\nLD\nD\nD\nD\nD\nD" }, { "input": "d1\nb7", "output": "6\nLU\nLU\nU\nU\nU\nU" }, { "input": "a7\ne5", "output": "4\nRD\nRD\nR\nR" }, { "input": "d6\nb1", "output": "5\nLD\nLD\nD\nD\nD" }, { "input": "f5\ng5", "output": "1\nR" }, { "input": "h4\nd1", "output": "4\nLD\nLD\nLD\nL" }, { "input": "b3\na5", "output": "2\nLU\nU" }, { "input": "d2\nf1", "output": "2\nRD\nR" }, { "input": "f1\nc5", "output": "4\nLU\nLU\nLU\nU" }, { "input": "a8\nh1", "output": "7\nRD\nRD\nRD\nRD\nRD\nRD\nRD" }, { "input": "c7\ne5", "output": "2\nRD\nRD" }, { "input": "e7\nb1", "output": "6\nLD\nLD\nLD\nD\nD\nD" }, { "input": "g8\na8", "output": "6\nL\nL\nL\nL\nL\nL" }, { "input": "g6\nf2", "output": "4\nLD\nD\nD\nD" }, { "input": "g4\nc4", "output": "4\nL\nL\nL\nL" }, { "input": "g2\na6", "output": "6\nLU\nLU\nLU\nLU\nL\nL" }, { "input": "f8\nf8", "output": "0" }, { "input": "f5\nd2", "output": "3\nLD\nLD\nD" } ]
1,689,068,239
2,147,483,647
PyPy 3
OK
TESTS
35
186
0
a = input() b = input() c = 'abcdefgh' x1, y1 = c.index(a[0]), int(a[1]) x2, y2 = c.index(b[0]), int(b[1]) print(max(abs(x1 - x2), abs(y1 - y2))) x1 += 1 x2 += 1 x = x1 y = y1 while (x != x2 or y != y2): if x < x2 and y > y2: print('RD') x += 1 y -= 1 if x > x2 and y > y2: print('LD') x -= 1 y -= 1 if x < x2 and y < y2: print('RU') x += 1 y += 1 if x > x2 and y < y2: print('LU') x -= 1 y += 1 if x == x2: if y > y2: print('D') y -= 1 elif y2 > y: print('U') y += 1 if y == y2: if x > x2: print('L') x -= 1 elif x2 > x: print('R') x += 1 # Tue Jul 11 2023 12:37:18 GMT+0300 (Moscow Standard Time)
Title: Shortest path of the king Time Limit: 1 seconds Memory Limit: 64 megabytes Problem Description: The king is left alone on the chessboard. In spite of this loneliness, he doesn't lose heart, because he has business of national importance. For example, he has to pay an official visit to square *t*. As the king is not in habit of wasting his time, he wants to get from his current position *s* to square *t* in the least number of moves. Help him to do this. In one move the king can get to the square that has a common side or a common vertex with the square the king is currently in (generally there are 8 different squares he can move to). Input Specification: The first line contains the chessboard coordinates of square *s*, the second line — of square *t*. Chessboard coordinates consist of two characters, the first one is a lowercase Latin letter (from a to h), the second one is a digit from 1 to 8. Output Specification: In the first line print *n* — minimum number of the king's moves. Then in *n* lines print the moves themselves. Each move is described with one of the 8: L, R, U, D, LU, LD, RU or RD. L, R, U, D stand respectively for moves left, right, up and down (according to the picture), and 2-letter combinations stand for diagonal moves. If the answer is not unique, print any of them. Demo Input: ['a8\nh1\n'] Demo Output: ['7\nRD\nRD\nRD\nRD\nRD\nRD\nRD\n'] Note: none
```python a = input() b = input() c = 'abcdefgh' x1, y1 = c.index(a[0]), int(a[1]) x2, y2 = c.index(b[0]), int(b[1]) print(max(abs(x1 - x2), abs(y1 - y2))) x1 += 1 x2 += 1 x = x1 y = y1 while (x != x2 or y != y2): if x < x2 and y > y2: print('RD') x += 1 y -= 1 if x > x2 and y > y2: print('LD') x -= 1 y -= 1 if x < x2 and y < y2: print('RU') x += 1 y += 1 if x > x2 and y < y2: print('LU') x -= 1 y += 1 if x == x2: if y > y2: print('D') y -= 1 elif y2 > y: print('U') y += 1 if y == y2: if x > x2: print('L') x -= 1 elif x2 > x: print('R') x += 1 # Tue Jul 11 2023 12:37:18 GMT+0300 (Moscow Standard Time) ```
3.907
137
B
Permutation
PROGRAMMING
1,000
[ "greedy" ]
null
null
"Hey, it's homework time" — thought Polycarpus and of course he started with his favourite subject, IT. Polycarpus managed to solve all tasks but for the last one in 20 minutes. However, as he failed to solve the last task after some considerable time, the boy asked you to help him. The sequence of *n* integers is called a permutation if it contains all integers from 1 to *n* exactly once. You are given an arbitrary sequence *a*1,<=*a*2,<=...,<=*a**n* containing *n* integers. Each integer is not less than 1 and not greater than 5000. Determine what minimum number of elements Polycarpus needs to change to get a permutation (he should not delete or add numbers). In a single change he can modify any single sequence element (i. e. replace it with another integer).
The first line of the input data contains an integer *n* (1<=≤<=*n*<=≤<=5000) which represents how many numbers are in the sequence. The second line contains a sequence of integers *a**i* (1<=≤<=*a**i*<=≤<=5000,<=1<=≤<=*i*<=≤<=*n*).
Print the only number — the minimum number of changes needed to get the permutation.
[ "3\n3 1 2\n", "2\n2 2\n", "5\n5 3 3 3 1\n" ]
[ "0\n", "1\n", "2\n" ]
The first sample contains the permutation, which is why no replacements are required. In the second sample it is enough to replace the first element with the number 1 and that will make the sequence the needed permutation. In the third sample we can replace the second element with number 4 and the fourth element with number 2.
1,000
[ { "input": "3\n3 1 2", "output": "0" }, { "input": "2\n2 2", "output": "1" }, { "input": "5\n5 3 3 3 1", "output": "2" }, { "input": "5\n6 6 6 6 6", "output": "5" }, { "input": "10\n1 1 2 2 8 8 7 7 9 9", "output": "5" }, { "input": "8\n9 8 7 6 5 4 3 2", "output": "1" }, { "input": "15\n1 2 3 4 5 5 4 3 2 1 1 2 3 4 5", "output": "10" }, { "input": "1\n1", "output": "0" }, { "input": "1\n5000", "output": "1" }, { "input": "4\n5000 5000 5000 5000", "output": "4" }, { "input": "5\n3366 3461 4 5 4370", "output": "3" }, { "input": "10\n8 2 10 3 4 6 1 7 9 5", "output": "0" }, { "input": "10\n551 3192 3213 2846 3068 1224 3447 1 10 9", "output": "7" }, { "input": "15\n4 1459 12 4281 3241 2748 10 3590 14 845 3518 1721 2 2880 1974", "output": "10" }, { "input": "15\n15 1 8 2 13 11 12 7 3 14 6 10 9 4 5", "output": "0" }, { "input": "15\n2436 2354 4259 1210 2037 2665 700 3578 2880 973 1317 1024 24 3621 4142", "output": "15" }, { "input": "30\n28 1 3449 9 3242 4735 26 3472 15 21 2698 7 4073 3190 10 3 29 1301 4526 22 345 3876 19 12 4562 2535 2 630 18 27", "output": "14" }, { "input": "100\n50 39 95 30 66 78 2169 4326 81 31 74 34 80 40 19 48 97 63 82 6 88 16 21 57 92 77 10 1213 17 93 32 91 38 4375 29 75 44 22 4 45 14 2395 3254 59 3379 2 85 96 8 83 27 94 1512 2960 100 9 73 79 7 25 55 69 90 99 51 87 98 62 18 35 43 4376 4668 28 72 56 4070 61 65 36 54 4106 11 24 15 86 70 71 4087 23 13 76 20 4694 26 4962 4726 37 14 64", "output": "18" }, { "input": "100\n340 14 3275 2283 2673 1107 817 2243 1226 32 2382 3638 4652 418 68 4962 387 764 4647 159 1846 225 2760 4904 3150 403 3 2439 91 4428 92 4705 75 348 1566 1465 69 6 49 4 62 4643 564 1090 3447 1871 2255 139 24 99 2669 969 86 61 4550 158 4537 3993 1589 872 2907 1888 401 80 1825 1483 63 1 2264 4068 4113 2548 41 885 4806 36 67 167 4447 34 1248 2593 82 202 81 1783 1284 4973 16 43 95 7 865 2091 3008 1793 20 947 4912 3604", "output": "70" }, { "input": "1\n2", "output": "1" }, { "input": "2\n5000 5000", "output": "2" }, { "input": "2\n1 2", "output": "0" }, { "input": "2\n1 1", "output": "1" }, { "input": "2\n2 3", "output": "1" }, { "input": "2\n3 4", "output": "2" }, { "input": "10\n1 2 3 4 5 6 7 1000 10 10", "output": "2" } ]
1,608,803,378
2,147,483,647
Python 3
OK
TESTS
48
280
819,200
from collections import Counter n = int(input()) arr = list(map(int, input().split())) c = Counter(arr) count = 0 for i in range(1, n+1): if i not in c: count += 1 print(count)
Title: Permutation Time Limit: None seconds Memory Limit: None megabytes Problem Description: "Hey, it's homework time" — thought Polycarpus and of course he started with his favourite subject, IT. Polycarpus managed to solve all tasks but for the last one in 20 minutes. However, as he failed to solve the last task after some considerable time, the boy asked you to help him. The sequence of *n* integers is called a permutation if it contains all integers from 1 to *n* exactly once. You are given an arbitrary sequence *a*1,<=*a*2,<=...,<=*a**n* containing *n* integers. Each integer is not less than 1 and not greater than 5000. Determine what minimum number of elements Polycarpus needs to change to get a permutation (he should not delete or add numbers). In a single change he can modify any single sequence element (i. e. replace it with another integer). Input Specification: The first line of the input data contains an integer *n* (1<=≤<=*n*<=≤<=5000) which represents how many numbers are in the sequence. The second line contains a sequence of integers *a**i* (1<=≤<=*a**i*<=≤<=5000,<=1<=≤<=*i*<=≤<=*n*). Output Specification: Print the only number — the minimum number of changes needed to get the permutation. Demo Input: ['3\n3 1 2\n', '2\n2 2\n', '5\n5 3 3 3 1\n'] Demo Output: ['0\n', '1\n', '2\n'] Note: The first sample contains the permutation, which is why no replacements are required. In the second sample it is enough to replace the first element with the number 1 and that will make the sequence the needed permutation. In the third sample we can replace the second element with number 4 and the fourth element with number 2.
```python from collections import Counter n = int(input()) arr = list(map(int, input().split())) c = Counter(arr) count = 0 for i in range(1, n+1): if i not in c: count += 1 print(count) ```
3
262
A
Roma and Lucky Numbers
PROGRAMMING
800
[ "implementation" ]
null
null
Roma (a popular Russian name that means 'Roman') loves the Little Lvov Elephant's lucky numbers. Let us remind you that lucky numbers are positive integers whose decimal representation only contains lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not. Roma's got *n* positive integers. He wonders, how many of those integers have not more than *k* lucky digits? Help him, write the program that solves the problem.
The first line contains two integers *n*, *k* (1<=≤<=*n*,<=*k*<=≤<=100). The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=109) — the numbers that Roma has. The numbers in the lines are separated by single spaces.
In a single line print a single integer — the answer to the problem.
[ "3 4\n1 2 4\n", "3 2\n447 44 77\n" ]
[ "3\n", "2\n" ]
In the first sample all numbers contain at most four lucky digits, so the answer is 3. In the second sample number 447 doesn't fit in, as it contains more than two lucky digits. All other numbers are fine, so the answer is 2.
500
[ { "input": "3 4\n1 2 4", "output": "3" }, { "input": "3 2\n447 44 77", "output": "2" }, { "input": "2 2\n507978501 180480073", "output": "2" }, { "input": "9 6\n655243746 167613748 1470546 57644035 176077477 56984809 44677 215706823 369042089", "output": "9" }, { "input": "6 100\n170427799 37215529 675016434 168544291 683447134 950090227", "output": "6" }, { "input": "4 2\n194041605 706221269 69909135 257655784", "output": "3" }, { "input": "4 2\n9581849 67346651 530497 272158241", "output": "4" }, { "input": "3 47\n378261451 163985731 230342101", "output": "3" }, { "input": "2 3\n247776868 480572137", "output": "1" }, { "input": "7 77\n366496749 549646417 278840199 119255907 33557677 379268590 150378796", "output": "7" }, { "input": "40 31\n32230963 709031779 144328646 513494529 36547831 416998222 84161665 318773941 170724397 553666286 368402971 48581613 31452501 368026285 47903381 939151438 204145360 189920160 288159400 133145006 314295423 450219949 160203213 358403181 478734385 29331901 31051111 110710191 567314089 139695685 111511396 87708701 317333277 103301481 110400517 634446253 481551313 39202255 105948 738066085", "output": "40" }, { "input": "1 8\n55521105", "output": "1" }, { "input": "49 3\n34644511 150953622 136135827 144208961 359490601 86708232 719413689 188605873 64330753 488776302 104482891 63360106 437791390 46521319 70778345 339141601 136198441 292941209 299339510 582531183 555958105 437904637 74219097 439816011 236010407 122674666 438442529 186501223 63932449 407678041 596993853 92223251 849265278 480265849 30983497 330283357 186901672 20271344 794252593 123774176 27851201 52717531 479907210 196833889 149331196 82147847 255966471 278600081 899317843", "output": "44" }, { "input": "26 2\n330381357 185218042 850474297 483015466 296129476 1205865 538807493 103205601 160403321 694220263 416255901 7245756 507755361 88187633 91426751 1917161 58276681 59540376 576539745 595950717 390256887 105690055 607818885 28976353 488947089 50643601", "output": "22" }, { "input": "38 1\n194481717 126247087 815196361 106258801 381703249 283859137 15290101 40086151 213688513 577996947 513899717 371428417 107799271 11136651 5615081 323386401 381128815 34217126 17709913 520702093 201694245 570931849 169037023 417019726 282437316 7417126 271667553 11375851 185087449 410130883 383045677 5764771 905017051 328584026 215330671 299553233 15838255 234532105", "output": "20" }, { "input": "44 9\n683216389 250581469 130029957 467020047 188395565 206237982 63257361 68314981 732878407 563579660 199133851 53045209 665723851 16273169 10806790 556633156 350593410 474645249 478790761 708234243 71841230 18090541 19836685 146373571 17947452 534010506 46933264 377035021 311636557 75193963 54321761 12759959 71120181 548816939 23608621 31876417 107672995 72575155 369667956 20574379 210596751 532163173 75726739 853719629", "output": "44" }, { "input": "8 6\n204157376 10514197 65483881 347219841 263304577 296402721 11739011 229776191", "output": "8" }, { "input": "38 29\n333702889 680931737 61137217 203030505 68728281 11414209 642645708 590904616 3042901 607198177 189041074 700764043 813035201 198341461 126403544 401436841 420826465 45046581 20249976 46978855 46397957 706610773 24701041 57954481 51603266 593109701 385569073 178982291 582152863 287317968 1474090 34825141 432421977 130257781 151516903 540852403 548392 117246529", "output": "38" }, { "input": "19 3\n562569697 549131571 50676718 84501863 74567295 702372009 365895280 451459937 40378543 167666701 158635641 53639293 442332661 825055617 100109161 326616021 862332843 533271196 4791547", "output": "18" }, { "input": "1 1\n44", "output": "0" }, { "input": "1 1\n4", "output": "1" }, { "input": "10 3\n444 447 774 777 7777 4447 4 7 7 4", "output": "8" } ]
1,679,648,713
2,147,483,647
PyPy 3-64
OK
TESTS
34
124
0
n,k = map(int, input().split(' ')) nums = list(map(str, input().split(' '))) lucky = ['4','7'] res = 0 count = 0 for i in nums: for j in i : if j in lucky : count += 1 if count <= k : res += 1 count = 0 print(res)
Title: Roma and Lucky Numbers Time Limit: None seconds Memory Limit: None megabytes Problem Description: Roma (a popular Russian name that means 'Roman') loves the Little Lvov Elephant's lucky numbers. Let us remind you that lucky numbers are positive integers whose decimal representation only contains lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not. Roma's got *n* positive integers. He wonders, how many of those integers have not more than *k* lucky digits? Help him, write the program that solves the problem. Input Specification: The first line contains two integers *n*, *k* (1<=≤<=*n*,<=*k*<=≤<=100). The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=109) — the numbers that Roma has. The numbers in the lines are separated by single spaces. Output Specification: In a single line print a single integer — the answer to the problem. Demo Input: ['3 4\n1 2 4\n', '3 2\n447 44 77\n'] Demo Output: ['3\n', '2\n'] Note: In the first sample all numbers contain at most four lucky digits, so the answer is 3. In the second sample number 447 doesn't fit in, as it contains more than two lucky digits. All other numbers are fine, so the answer is 2.
```python n,k = map(int, input().split(' ')) nums = list(map(str, input().split(' '))) lucky = ['4','7'] res = 0 count = 0 for i in nums: for j in i : if j in lucky : count += 1 if count <= k : res += 1 count = 0 print(res) ```
3
142
A
Help Farmer
PROGRAMMING
1,600
[ "brute force", "math" ]
null
null
Once upon a time in the Kingdom of Far Far Away lived Sam the Farmer. Sam had a cow named Dawn and he was deeply attached to her. Sam would spend the whole summer stocking hay to feed Dawn in winter. Sam scythed hay and put it into haystack. As Sam was a bright farmer, he tried to make the process of storing hay simpler and more convenient to use. He collected the hay into cubical hay blocks of the same size. Then he stored the blocks in his barn. After a summer spent in hard toil Sam stored *A*·*B*·*C* hay blocks and stored them in a barn as a rectangular parallelepiped *A* layers high. Each layer had *B* rows and each row had *C* blocks. At the end of the autumn Sam came into the barn to admire one more time the hay he'd been stacking during this hard summer. Unfortunately, Sam was horrified to see that the hay blocks had been carelessly scattered around the barn. The place was a complete mess. As it turned out, thieves had sneaked into the barn. They completely dissembled and took away a layer of blocks from the parallelepiped's front, back, top and sides. As a result, the barn only had a parallelepiped containing (*A*<=-<=1)<=×<=(*B*<=-<=2)<=×<=(*C*<=-<=2) hay blocks. To hide the evidence of the crime, the thieves had dissembled the parallelepiped into single 1<=×<=1<=×<=1 blocks and scattered them around the barn. After the theft Sam counted *n* hay blocks in the barn but he forgot numbers *A*, *B* и *C*. Given number *n*, find the minimally possible and maximally possible number of stolen hay blocks.
The only line contains integer *n* from the problem's statement (1<=≤<=*n*<=≤<=109).
Print space-separated minimum and maximum number of hay blocks that could have been stolen by the thieves. Note that the answer to the problem can be large enough, so you must use the 64-bit integer type for calculations. Please, do not use the %lld specificator to read or write 64-bit integers in С++. It is preferred to use cin, cout streams or the %I64d specificator.
[ "4\n", "7\n", "12\n" ]
[ "28 41\n", "47 65\n", "48 105\n" ]
Let's consider the first sample test. If initially Sam has a parallelepiped consisting of 32 = 2 × 4 × 4 hay blocks in his barn, then after the theft the barn has 4 = (2 - 1) × (4 - 2) × (4 - 2) hay blocks left. Thus, the thieves could have stolen 32 - 4 = 28 hay blocks. If Sam initially had a parallelepiped consisting of 45 = 5 × 3 × 3 hay blocks in his barn, then after the theft the barn has 4 = (5 - 1) × (3 - 2) × (3 - 2) hay blocks left. Thus, the thieves could have stolen 45 - 4 = 41 hay blocks. No other variants of the blocks' initial arrangement (that leave Sam with exactly 4 blocks after the theft) can permit the thieves to steal less than 28 or more than 41 blocks.
500
[ { "input": "4", "output": "28 41" }, { "input": "7", "output": "47 65" }, { "input": "12", "output": "48 105" }, { "input": "1", "output": "17 17" }, { "input": "6", "output": "34 57" }, { "input": "8", "output": "40 73" }, { "input": "9", "output": "41 81" }, { "input": "14", "output": "58 121" }, { "input": "15", "output": "55 129" }, { "input": "16", "output": "56 137" }, { "input": "18", "output": "57 153" }, { "input": "20", "output": "64 169" }, { "input": "299999771", "output": "1499998867 2399998177" }, { "input": "54", "output": "106 441" }, { "input": "96", "output": "144 777" }, { "input": "348", "output": "396 2793" }, { "input": "748", "output": "487 5993" }, { "input": "908", "output": "1840 7273" }, { "input": "1026", "output": "591 8217" }, { "input": "1985", "output": "3601 15889" }, { "input": "4472", "output": "1603 35785" }, { "input": "20845", "output": "8873 166769" }, { "input": "50480", "output": "17884 403849" }, { "input": "62497", "output": "312497 499985" }, { "input": "646055", "output": "140995 5168449" }, { "input": "790620", "output": "316416 6324969" }, { "input": "989903", "output": "1082167 7919233" }, { "input": "7033800", "output": "210976 56270409" }, { "input": "7661860", "output": "546725 61294889" }, { "input": "7834243", "output": "8302235 62673953" }, { "input": "45134118", "output": "19223945 361072953" }, { "input": "89054701", "output": "445273517 712437617" }, { "input": "99264891", "output": "15587889 794119137" }, { "input": "127039320", "output": "1209066 1016314569" }, { "input": "206898748", "output": "1683461 1655189993" }, { "input": "231136953", "output": "539319577 1849095633" }, { "input": "257259713", "output": "2122207 2058077713" }, { "input": "286736327", "output": "290355727 2293890625" }, { "input": "311933803", "output": "1559669027 2495470433" }, { "input": "332393619", "output": "10714371 2659148961" }, { "input": "422114561", "output": "78417139 3376916497" }, { "input": "453012754", "output": "2844347 3624102041" }, { "input": "470860680", "output": "129486993 3766885449" }, { "input": "509607936", "output": "3045276 4076863497" }, { "input": "534879507", "output": "253364145 4279036065" }, { "input": "535074941", "output": "647722381 4280599537" }, { "input": "536870912", "output": "3151876 4294967305" }, { "input": "573308928", "output": "3301020 4586471433" }, { "input": "603979776", "output": "3414276 4831838217" }, { "input": "605404800", "output": "3414952 4843238409" }, { "input": "615716902", "output": "10508698 4925735225" }, { "input": "628464178", "output": "3574502 5027713433" }, { "input": "631243141", "output": "634644469 5049945137" }, { "input": "644972544", "output": "3573148 5159780361" }, { "input": "659274082", "output": "1977822262 5274192665" }, { "input": "679477248", "output": "3693060 5435817993" }, { "input": "735134400", "output": "3886608 5881075209" }, { "input": "764411904", "output": "3988228 6115295241" }, { "input": "778377600", "output": "4036708 6227020809" }, { "input": "791683200", "output": "4082888 6333465609" }, { "input": "805306368", "output": "4201476 6442450953" }, { "input": "821620800", "output": "4185636 6572966409" }, { "input": "856079286", "output": "196667409 6848634297" }, { "input": "857656800", "output": "4307008 6861254409" }, { "input": "859963392", "output": "4320292 6879707145" }, { "input": "864864000", "output": "4331048 6918912009" }, { "input": "882161280", "output": "4388720 7057290249" }, { "input": "884822400", "output": "4396766 7078579209" }, { "input": "905969664", "output": "4529412 7247757321" }, { "input": "908107200", "output": "4474050 7264857609" }, { "input": "918918000", "output": "4511288 7351344009" }, { "input": "931170240", "output": "4548514 7449361929" }, { "input": "935625600", "output": "4563150 7485004809" }, { "input": "936354996", "output": "40069269 7490839977" }, { "input": "951350400", "output": "4614600 7610803209" }, { "input": "958557600", "output": "4637398 7668460809" }, { "input": "972972000", "output": "4685478 7783776009" }, { "input": "980179200", "output": "4707050 7841433609" }, { "input": "985944960", "output": "4725040 7887559689" }, { "input": "994593600", "output": "4752650 7956748809" }, { "input": "999893227", "output": "1000183267 7999145825" }, { "input": "999893387", "output": "1000724227 7999147105" }, { "input": "999905161", "output": "1000161721 7999241297" }, { "input": "999942949", "output": "1000368197 7999543601" }, { "input": "999996583", "output": "1022096687 7999972673" }, { "input": "999999797", "output": "4999998997 7999998385" }, { "input": "999999883", "output": "4999999427 7999999073" }, { "input": "999999893", "output": "4999999477 7999999153" }, { "input": "999999929", "output": "4999999657 7999999441" }, { "input": "999999937", "output": "4999999697 7999999505" }, { "input": "999999991", "output": "1059701759 7999999937" }, { "input": "999999992", "output": "129518035 7999999945" }, { "input": "999999993", "output": "490196227 7999999953" }, { "input": "999999994", "output": "928571477 7999999961" }, { "input": "999999995", "output": "4924975 7999999969" }, { "input": "999999996", "output": "1000000044 7999999977" }, { "input": "999999997", "output": "15309947 7999999985" }, { "input": "999999998", "output": "504345691 7999999993" }, { "input": "999999999", "output": "52392027 8000000001" }, { "input": "1000000000", "output": "4770064 8000000009" } ]
1,691,165,660
2,147,483,647
PyPy 3-64
OK
TESTS
100
124
3,072,000
n = int(input()) kd = 0 d = [0] * 100010 for x in range(1, n + 1): if x * x > n: break elif n % x == 0: kd += 1 d[kd] = x if x * x < n: kd += 1 d[kd] = n // x minimum = float('inf') maximum = -1 for a in range(1, kd + 1): for b in range(1, kd + 1): if n // d[a] % d[b] != 0: continue c = n // d[a] // d[b] cur = (d[a] + 1) * (d[b] + 2) * (c + 2) - n minimum = min(minimum, cur) maximum = max(maximum, cur) print(minimum, maximum)# 1691165660.7016428
Title: Help Farmer Time Limit: None seconds Memory Limit: None megabytes Problem Description: Once upon a time in the Kingdom of Far Far Away lived Sam the Farmer. Sam had a cow named Dawn and he was deeply attached to her. Sam would spend the whole summer stocking hay to feed Dawn in winter. Sam scythed hay and put it into haystack. As Sam was a bright farmer, he tried to make the process of storing hay simpler and more convenient to use. He collected the hay into cubical hay blocks of the same size. Then he stored the blocks in his barn. After a summer spent in hard toil Sam stored *A*·*B*·*C* hay blocks and stored them in a barn as a rectangular parallelepiped *A* layers high. Each layer had *B* rows and each row had *C* blocks. At the end of the autumn Sam came into the barn to admire one more time the hay he'd been stacking during this hard summer. Unfortunately, Sam was horrified to see that the hay blocks had been carelessly scattered around the barn. The place was a complete mess. As it turned out, thieves had sneaked into the barn. They completely dissembled and took away a layer of blocks from the parallelepiped's front, back, top and sides. As a result, the barn only had a parallelepiped containing (*A*<=-<=1)<=×<=(*B*<=-<=2)<=×<=(*C*<=-<=2) hay blocks. To hide the evidence of the crime, the thieves had dissembled the parallelepiped into single 1<=×<=1<=×<=1 blocks and scattered them around the barn. After the theft Sam counted *n* hay blocks in the barn but he forgot numbers *A*, *B* и *C*. Given number *n*, find the minimally possible and maximally possible number of stolen hay blocks. Input Specification: The only line contains integer *n* from the problem's statement (1<=≤<=*n*<=≤<=109). Output Specification: Print space-separated minimum and maximum number of hay blocks that could have been stolen by the thieves. Note that the answer to the problem can be large enough, so you must use the 64-bit integer type for calculations. Please, do not use the %lld specificator to read or write 64-bit integers in С++. It is preferred to use cin, cout streams or the %I64d specificator. Demo Input: ['4\n', '7\n', '12\n'] Demo Output: ['28 41\n', '47 65\n', '48 105\n'] Note: Let's consider the first sample test. If initially Sam has a parallelepiped consisting of 32 = 2 × 4 × 4 hay blocks in his barn, then after the theft the barn has 4 = (2 - 1) × (4 - 2) × (4 - 2) hay blocks left. Thus, the thieves could have stolen 32 - 4 = 28 hay blocks. If Sam initially had a parallelepiped consisting of 45 = 5 × 3 × 3 hay blocks in his barn, then after the theft the barn has 4 = (5 - 1) × (3 - 2) × (3 - 2) hay blocks left. Thus, the thieves could have stolen 45 - 4 = 41 hay blocks. No other variants of the blocks' initial arrangement (that leave Sam with exactly 4 blocks after the theft) can permit the thieves to steal less than 28 or more than 41 blocks.
```python n = int(input()) kd = 0 d = [0] * 100010 for x in range(1, n + 1): if x * x > n: break elif n % x == 0: kd += 1 d[kd] = x if x * x < n: kd += 1 d[kd] = n // x minimum = float('inf') maximum = -1 for a in range(1, kd + 1): for b in range(1, kd + 1): if n // d[a] % d[b] != 0: continue c = n // d[a] // d[b] cur = (d[a] + 1) * (d[b] + 2) * (c + 2) - n minimum = min(minimum, cur) maximum = max(maximum, cur) print(minimum, maximum)# 1691165660.7016428 ```
3
507
B
Amr and Pins
PROGRAMMING
1,400
[ "geometry", "math" ]
null
null
Amr loves Geometry. One day he came up with a very interesting problem. Amr has a circle of radius *r* and center in point (*x*,<=*y*). He wants the circle center to be in new position (*x*',<=*y*'). In one step Amr can put a pin to the border of the circle in a certain point, then rotate the circle around that pin by any angle and finally remove the pin. Help Amr to achieve his goal in minimum number of steps.
Input consists of 5 space-separated integers *r*, *x*, *y*, *x*' *y*' (1<=≤<=*r*<=≤<=105, <=-<=105<=≤<=*x*,<=*y*,<=*x*',<=*y*'<=≤<=105), circle radius, coordinates of original center of the circle and coordinates of destination center of the circle respectively.
Output a single integer — minimum number of steps required to move the center of the circle to the destination point.
[ "2 0 0 0 4\n", "1 1 1 4 4\n", "4 5 6 5 6\n" ]
[ "1\n", "3\n", "0\n" ]
In the first sample test the optimal way is to put a pin at point (0, 2) and rotate the circle by 180 degrees counter-clockwise (or clockwise, no matter). <img class="tex-graphics" src="https://espresso.codeforces.com/4e40fd4cc24a2050a0488aa131e6244369328039.png" style="max-width: 100.0%;max-height: 100.0%;"/>
1,000
[ { "input": "2 0 0 0 4", "output": "1" }, { "input": "1 1 1 4 4", "output": "3" }, { "input": "4 5 6 5 6", "output": "0" }, { "input": "10 20 0 40 0", "output": "1" }, { "input": "9 20 0 40 0", "output": "2" }, { "input": "5 -1 -6 -5 1", "output": "1" }, { "input": "99125 26876 -21414 14176 17443", "output": "1" }, { "input": "8066 7339 19155 -90534 -60666", "output": "8" }, { "input": "100000 -100000 -100000 100000 100000", "output": "2" }, { "input": "10 20 0 41 0", "output": "2" }, { "input": "25 -64 -6 -56 64", "output": "2" }, { "input": "125 455 450 439 721", "output": "2" }, { "input": "5 6 3 7 2", "output": "1" }, { "input": "24 130 14786 3147 2140", "output": "271" }, { "input": "125 -363 176 93 330", "output": "2" }, { "input": "1 14 30 30 14", "output": "12" }, { "input": "25 96 13 7 2", "output": "2" }, { "input": "4 100000 -100000 100000 -100000", "output": "0" }, { "input": "1 3 4 2 5", "output": "1" }, { "input": "1 -3 3 2 6", "output": "3" }, { "input": "2 7 20 13 -5", "output": "7" }, { "input": "1 1 1 1 4", "output": "2" }, { "input": "249 -54242 -30537 -45023 -89682", "output": "121" }, { "input": "4 100000 -100000 100000 -99999", "output": "1" }, { "input": "97741 23818 78751 97583 26933", "output": "1" }, { "input": "56767 -29030 51625 79823 -56297", "output": "2" }, { "input": "98260 13729 74998 23701 9253", "output": "1" }, { "input": "67377 -80131 -90254 -57320 14102", "output": "1" }, { "input": "1 100000 100000 100000 -100000", "output": "100000" }, { "input": "19312 19470 82059 58064 62231", "output": "2" }, { "input": "67398 -68747 -79056 -34193 29400", "output": "1" }, { "input": "91099 37184 -71137 75650 -3655", "output": "1" }, { "input": "46456 -2621 -23623 -98302 -99305", "output": "2" }, { "input": "100 100000 -100000 100000 -99999", "output": "1" }, { "input": "1 100000 -100000 100000 -100000", "output": "0" }, { "input": "8 0 0 0 32", "output": "2" }, { "input": "100000 100000 1 -100000 0", "output": "2" } ]
1,607,504,287
2,147,483,647
Python 3
OK
TESTS
37
93
0
import math r, x, y, x1, y1 = map(int, input().split()) print(int(-(math.sqrt((x1-x)**2 + (y1-y)**2) // (-2*r))))
Title: Amr and Pins Time Limit: None seconds Memory Limit: None megabytes Problem Description: Amr loves Geometry. One day he came up with a very interesting problem. Amr has a circle of radius *r* and center in point (*x*,<=*y*). He wants the circle center to be in new position (*x*',<=*y*'). In one step Amr can put a pin to the border of the circle in a certain point, then rotate the circle around that pin by any angle and finally remove the pin. Help Amr to achieve his goal in minimum number of steps. Input Specification: Input consists of 5 space-separated integers *r*, *x*, *y*, *x*' *y*' (1<=≤<=*r*<=≤<=105, <=-<=105<=≤<=*x*,<=*y*,<=*x*',<=*y*'<=≤<=105), circle radius, coordinates of original center of the circle and coordinates of destination center of the circle respectively. Output Specification: Output a single integer — minimum number of steps required to move the center of the circle to the destination point. Demo Input: ['2 0 0 0 4\n', '1 1 1 4 4\n', '4 5 6 5 6\n'] Demo Output: ['1\n', '3\n', '0\n'] Note: In the first sample test the optimal way is to put a pin at point (0, 2) and rotate the circle by 180 degrees counter-clockwise (or clockwise, no matter). <img class="tex-graphics" src="https://espresso.codeforces.com/4e40fd4cc24a2050a0488aa131e6244369328039.png" style="max-width: 100.0%;max-height: 100.0%;"/>
```python import math r, x, y, x1, y1 = map(int, input().split()) print(int(-(math.sqrt((x1-x)**2 + (y1-y)**2) // (-2*r)))) ```
3
987
A
Infinity Gauntlet
PROGRAMMING
800
[ "implementation" ]
null
null
You took a peek on Thanos wearing Infinity Gauntlet. In the Gauntlet there is a place for six Infinity Gems: - the Power Gem of purple color, - the Time Gem of green color, - the Space Gem of blue color, - the Soul Gem of orange color, - the Reality Gem of red color, - the Mind Gem of yellow color. Using colors of Gems you saw in the Gauntlet determine the names of absent Gems.
In the first line of input there is one integer $n$ ($0 \le n \le 6$) — the number of Gems in Infinity Gauntlet. In next $n$ lines there are colors of Gems you saw. Words used for colors are: purple, green, blue, orange, red, yellow. It is guaranteed that all the colors are distinct. All colors are given in lowercase English letters.
In the first line output one integer $m$ ($0 \le m \le 6$) — the number of absent Gems. Then in $m$ lines print the names of absent Gems, each on its own line. Words used for names are: Power, Time, Space, Soul, Reality, Mind. Names can be printed in any order. Keep the first letter uppercase, others lowercase.
[ "4\nred\npurple\nyellow\norange\n", "0\n" ]
[ "2\nSpace\nTime\n", "6\nTime\nMind\nSoul\nPower\nReality\nSpace\n" ]
In the first sample Thanos already has Reality, Power, Mind and Soul Gems, so he needs two more: Time and Space. In the second sample Thanos doesn't have any Gems, so he needs all six.
500
[ { "input": "4\nred\npurple\nyellow\norange", "output": "2\nSpace\nTime" }, { "input": "0", "output": "6\nMind\nSpace\nPower\nTime\nReality\nSoul" }, { "input": "6\npurple\nblue\nyellow\nred\ngreen\norange", "output": "0" }, { "input": "1\npurple", "output": "5\nTime\nReality\nSoul\nSpace\nMind" }, { "input": "3\nblue\norange\npurple", "output": "3\nTime\nReality\nMind" }, { "input": "2\nyellow\nred", "output": "4\nPower\nSoul\nSpace\nTime" }, { "input": "1\ngreen", "output": "5\nReality\nSpace\nPower\nSoul\nMind" }, { "input": "2\npurple\ngreen", "output": "4\nReality\nMind\nSpace\nSoul" }, { "input": "1\nblue", "output": "5\nPower\nReality\nSoul\nTime\nMind" }, { "input": "2\npurple\nblue", "output": "4\nMind\nSoul\nTime\nReality" }, { "input": "2\ngreen\nblue", "output": "4\nReality\nMind\nPower\nSoul" }, { "input": "3\npurple\ngreen\nblue", "output": "3\nMind\nReality\nSoul" }, { "input": "1\norange", "output": "5\nReality\nTime\nPower\nSpace\nMind" }, { "input": "2\npurple\norange", "output": "4\nReality\nMind\nTime\nSpace" }, { "input": "2\norange\ngreen", "output": "4\nSpace\nMind\nReality\nPower" }, { "input": "3\norange\npurple\ngreen", "output": "3\nReality\nSpace\nMind" }, { "input": "2\norange\nblue", "output": "4\nTime\nMind\nReality\nPower" }, { "input": "3\nblue\ngreen\norange", "output": "3\nPower\nMind\nReality" }, { "input": "4\nblue\norange\ngreen\npurple", "output": "2\nMind\nReality" }, { "input": "1\nred", "output": "5\nTime\nSoul\nMind\nPower\nSpace" }, { "input": "2\nred\npurple", "output": "4\nMind\nSpace\nTime\nSoul" }, { "input": "2\nred\ngreen", "output": "4\nMind\nSpace\nPower\nSoul" }, { "input": "3\nred\npurple\ngreen", "output": "3\nSoul\nSpace\nMind" }, { "input": "2\nblue\nred", "output": "4\nMind\nTime\nPower\nSoul" }, { "input": "3\nred\nblue\npurple", "output": "3\nTime\nMind\nSoul" }, { "input": "3\nred\nblue\ngreen", "output": "3\nSoul\nPower\nMind" }, { "input": "4\npurple\nblue\ngreen\nred", "output": "2\nMind\nSoul" }, { "input": "2\norange\nred", "output": "4\nPower\nMind\nTime\nSpace" }, { "input": "3\nred\norange\npurple", "output": "3\nMind\nSpace\nTime" }, { "input": "3\nred\norange\ngreen", "output": "3\nMind\nSpace\nPower" }, { "input": "4\nred\norange\ngreen\npurple", "output": "2\nSpace\nMind" }, { "input": "3\nblue\norange\nred", "output": "3\nPower\nMind\nTime" }, { "input": "4\norange\nblue\npurple\nred", "output": "2\nTime\nMind" }, { "input": "4\ngreen\norange\nred\nblue", "output": "2\nMind\nPower" }, { "input": "5\npurple\norange\nblue\nred\ngreen", "output": "1\nMind" }, { "input": "1\nyellow", "output": "5\nPower\nSoul\nReality\nSpace\nTime" }, { "input": "2\npurple\nyellow", "output": "4\nTime\nReality\nSpace\nSoul" }, { "input": "2\ngreen\nyellow", "output": "4\nSpace\nReality\nPower\nSoul" }, { "input": "3\npurple\nyellow\ngreen", "output": "3\nSoul\nReality\nSpace" }, { "input": "2\nblue\nyellow", "output": "4\nTime\nReality\nPower\nSoul" }, { "input": "3\nyellow\nblue\npurple", "output": "3\nSoul\nReality\nTime" }, { "input": "3\ngreen\nyellow\nblue", "output": "3\nSoul\nReality\nPower" }, { "input": "4\nyellow\nblue\ngreen\npurple", "output": "2\nReality\nSoul" }, { "input": "2\nyellow\norange", "output": "4\nTime\nSpace\nReality\nPower" }, { "input": "3\nyellow\npurple\norange", "output": "3\nSpace\nReality\nTime" }, { "input": "3\norange\nyellow\ngreen", "output": "3\nSpace\nReality\nPower" }, { "input": "4\ngreen\nyellow\norange\npurple", "output": "2\nSpace\nReality" }, { "input": "3\nyellow\nblue\norange", "output": "3\nTime\nReality\nPower" }, { "input": "4\norange\npurple\nblue\nyellow", "output": "2\nReality\nTime" }, { "input": "4\nblue\norange\nyellow\ngreen", "output": "2\nReality\nPower" }, { "input": "5\ngreen\nyellow\norange\nblue\npurple", "output": "1\nReality" }, { "input": "3\nyellow\npurple\nred", "output": "3\nTime\nSoul\nSpace" }, { "input": "3\nred\ngreen\nyellow", "output": "3\nPower\nSoul\nSpace" }, { "input": "4\nred\npurple\ngreen\nyellow", "output": "2\nSpace\nSoul" }, { "input": "3\nred\nyellow\nblue", "output": "3\nPower\nSoul\nTime" }, { "input": "4\nblue\nyellow\nred\npurple", "output": "2\nTime\nSoul" }, { "input": "4\nblue\nyellow\nred\ngreen", "output": "2\nSoul\nPower" }, { "input": "5\nred\nyellow\ngreen\nblue\npurple", "output": "1\nSoul" }, { "input": "3\nred\nyellow\norange", "output": "3\nPower\nSpace\nTime" }, { "input": "4\norange\ngreen\nyellow\nred", "output": "2\nPower\nSpace" }, { "input": "5\norange\nred\ngreen\nyellow\npurple", "output": "1\nSpace" }, { "input": "4\nyellow\nred\norange\nblue", "output": "2\nTime\nPower" }, { "input": "5\npurple\nblue\norange\nyellow\nred", "output": "1\nTime" }, { "input": "5\norange\nblue\nyellow\nred\ngreen", "output": "1\nPower" } ]
1,653,737,112
2,147,483,647
Python 3
OK
TESTS
64
46
0
q='Power' q1='purple' w='Time' w1='green' e='Space' e1='blue' r='Soul' r1='orange' t='Reality' t1='red' y='Mind' y1='yellow' k=6 n=int(input()) for i in range(n): a=input() if q1==a: q1=' ' k=k-1 if w1==a: w1=' ' k=k-1 if e1==a: e1=' ' k=k-1 if r1==a: r1=' ' k=k-1 if t1==a: t1=' ' k=k-1 if y1==a: y1=' ' k=k-1 print(k) if (q1!=' '): print(q) if (w1!=' '): print(w) if (e1!=' '): print(e) if (r1!=' '): print(r) if (t1!=' '): print(t) if (y1!=' '): print(y)
Title: Infinity Gauntlet Time Limit: None seconds Memory Limit: None megabytes Problem Description: You took a peek on Thanos wearing Infinity Gauntlet. In the Gauntlet there is a place for six Infinity Gems: - the Power Gem of purple color, - the Time Gem of green color, - the Space Gem of blue color, - the Soul Gem of orange color, - the Reality Gem of red color, - the Mind Gem of yellow color. Using colors of Gems you saw in the Gauntlet determine the names of absent Gems. Input Specification: In the first line of input there is one integer $n$ ($0 \le n \le 6$) — the number of Gems in Infinity Gauntlet. In next $n$ lines there are colors of Gems you saw. Words used for colors are: purple, green, blue, orange, red, yellow. It is guaranteed that all the colors are distinct. All colors are given in lowercase English letters. Output Specification: In the first line output one integer $m$ ($0 \le m \le 6$) — the number of absent Gems. Then in $m$ lines print the names of absent Gems, each on its own line. Words used for names are: Power, Time, Space, Soul, Reality, Mind. Names can be printed in any order. Keep the first letter uppercase, others lowercase. Demo Input: ['4\nred\npurple\nyellow\norange\n', '0\n'] Demo Output: ['2\nSpace\nTime\n', '6\nTime\nMind\nSoul\nPower\nReality\nSpace\n'] Note: In the first sample Thanos already has Reality, Power, Mind and Soul Gems, so he needs two more: Time and Space. In the second sample Thanos doesn't have any Gems, so he needs all six.
```python q='Power' q1='purple' w='Time' w1='green' e='Space' e1='blue' r='Soul' r1='orange' t='Reality' t1='red' y='Mind' y1='yellow' k=6 n=int(input()) for i in range(n): a=input() if q1==a: q1=' ' k=k-1 if w1==a: w1=' ' k=k-1 if e1==a: e1=' ' k=k-1 if r1==a: r1=' ' k=k-1 if t1==a: t1=' ' k=k-1 if y1==a: y1=' ' k=k-1 print(k) if (q1!=' '): print(q) if (w1!=' '): print(w) if (e1!=' '): print(e) if (r1!=' '): print(r) if (t1!=' '): print(t) if (y1!=' '): print(y) ```
3
43
A
Football
PROGRAMMING
1,000
[ "strings" ]
A. Football
2
256
One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie.
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams.
Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner.
[ "1\nABC\n", "5\nA\nABA\nABA\nA\nA\n" ]
[ "ABC\n", "A\n" ]
none
500
[ { "input": "1\nABC", "output": "ABC" }, { "input": "5\nA\nABA\nABA\nA\nA", "output": "A" }, { "input": "2\nXTSJEP\nXTSJEP", "output": "XTSJEP" }, { "input": "3\nXZYDJAEDZ\nXZYDJAEDZ\nXZYDJAEDZ", "output": "XZYDJAEDZ" }, { "input": "3\nQCCYXL\nQCCYXL\nAXGLFQDD", "output": "QCCYXL" }, { "input": "3\nAZID\nEERWBC\nEERWBC", "output": "EERWBC" }, { "input": "3\nHNCGYL\nHNCGYL\nHNCGYL", "output": "HNCGYL" }, { "input": "4\nZZWZTG\nZZWZTG\nZZWZTG\nZZWZTG", "output": "ZZWZTG" }, { "input": "4\nA\nA\nKUDLJMXCSE\nA", "output": "A" }, { "input": "5\nPHBTW\nPHBTW\nPHBTW\nPHBTW\nPHBTW", "output": "PHBTW" }, { "input": "5\nPKUZYTFYWN\nPKUZYTFYWN\nSTC\nPKUZYTFYWN\nPKUZYTFYWN", "output": "PKUZYTFYWN" }, { "input": "5\nHH\nHH\nNTQWPA\nNTQWPA\nHH", "output": "HH" }, { "input": "10\nW\nW\nW\nW\nW\nD\nW\nD\nD\nW", "output": "W" }, { "input": "19\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nTGACNIH\nTGACNIH\nXBCP", "output": "XBCP" }, { "input": "33\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS", "output": "PYPAS" }, { "input": "51\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC", "output": "NC" }, { "input": "89\nH\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nVOCI\nVOCI\nH\nH\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nH\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI", "output": "VOCI" }, { "input": "100\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nM\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA", "output": "HA" }, { "input": "100\nG\nG\nS\nS\nG\nG\nS\nS\nG\nS\nS\nS\nG\nS\nG\nG\nS\nG\nS\nS\nG\nS\nS\nS\nS\nS\nG\nS\nG\nS\nS\nG\nG\nG\nS\nS\nS\nS\nG\nS\nS\nG\nG\nG\nG\nG\nS\nG\nG\nS\nS\nS\nS\nS\nG\nG\nS\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nS\nS\nG\nS\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nG\nG\nS\nG\nG\nG\nS", "output": "G" }, { "input": "100\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nOBH\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL", "output": "WL" } ]
1,600,793,031
2,147,483,647
Python 3
OK
TESTS
34
280
409,600
from collections import * print(sorted(Counter([*open(0)][1:]).items(), key=lambda x: x[1])[::-1][0][0])
Title: Football Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie. Input Specification: The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams. Output Specification: Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner. Demo Input: ['1\nABC\n', '5\nA\nABA\nABA\nA\nA\n'] Demo Output: ['ABC\n', 'A\n'] Note: none
```python from collections import * print(sorted(Counter([*open(0)][1:]).items(), key=lambda x: x[1])[::-1][0][0]) ```
3.929237
22
A
Second Order Statistics
PROGRAMMING
800
[ "brute force" ]
A. Second Order Statistics
2
256
Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statistics of the given sequence. In other words it is the smallest element strictly greater than the minimum. Help Bob solve this problem.
The first input line contains integer *n* (1<=≤<=*n*<=≤<=100) — amount of numbers in the sequence. The second line contains *n* space-separated integer numbers — elements of the sequence. These numbers don't exceed 100 in absolute value.
If the given sequence has the second order statistics, output this order statistics, otherwise output NO.
[ "4\n1 2 2 -4\n", "5\n1 2 3 1 1\n" ]
[ "1\n", "2\n" ]
none
0
[ { "input": "4\n1 2 2 -4", "output": "1" }, { "input": "5\n1 2 3 1 1", "output": "2" }, { "input": "1\n28", "output": "NO" }, { "input": "2\n-28 12", "output": "12" }, { "input": "3\n-83 40 -80", "output": "-80" }, { "input": "8\n93 77 -92 26 21 -48 53 91", "output": "-48" }, { "input": "20\n-72 -9 -86 80 7 -10 40 -27 -94 92 96 56 28 -19 79 36 -3 -73 -63 -49", "output": "-86" }, { "input": "49\n-74 -100 -80 23 -8 -83 -41 -20 48 17 46 -73 -55 67 85 4 40 -60 -69 -75 56 -74 -42 93 74 -95 64 -46 97 -47 55 0 -78 -34 -31 40 -63 -49 -76 48 21 -1 -49 -29 -98 -11 76 26 94", "output": "-98" }, { "input": "88\n63 48 1 -53 -89 -49 64 -70 -49 71 -17 -16 76 81 -26 -50 67 -59 -56 97 2 100 14 18 -91 -80 42 92 -25 -88 59 8 -56 38 48 -71 -78 24 -14 48 -1 69 73 -76 54 16 -92 44 47 33 -34 -17 -81 21 -59 -61 53 26 10 -76 67 35 -29 70 65 -13 -29 81 80 32 74 -6 34 46 57 1 -45 -55 69 79 -58 11 -2 22 -18 -16 -89 -46", "output": "-91" }, { "input": "100\n34 32 88 20 76 53 -71 -39 -98 -10 57 37 63 -3 -54 -64 -78 -82 73 20 -30 -4 22 75 51 -64 -91 29 -52 -48 83 19 18 -47 46 57 -44 95 89 89 -30 84 -83 67 58 -99 -90 -53 92 -60 -5 -56 -61 27 68 -48 52 -95 64 -48 -30 -67 66 89 14 -33 -31 -91 39 7 -94 -54 92 -96 -99 -83 -16 91 -28 -66 81 44 14 -85 -21 18 40 16 -13 -82 -33 47 -10 -40 -19 10 25 60 -34 -89", "output": "-98" }, { "input": "2\n-1 -1", "output": "NO" }, { "input": "3\n-2 -2 -2", "output": "NO" }, { "input": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", "output": "NO" }, { "input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 -100 100 100 100 100 100 100 100 100 100 100 100 -100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 -100 100 100 100 100 100 100 100 100 100 100 -100 100 100 100 100 -100 100 100 100 100 100 100 100 100 100 100 100", "output": "100" }, { "input": "10\n40 71 -85 -85 40 -85 -85 64 -85 47", "output": "40" }, { "input": "23\n-90 -90 -41 -64 -64 -90 -15 10 -43 -90 -64 -64 89 -64 36 47 38 -90 -64 -90 -90 68 -90", "output": "-64" }, { "input": "39\n-97 -93 -42 -93 -97 -93 56 -97 -97 -97 76 -33 -60 91 7 82 17 47 -97 -97 -93 73 -97 12 -97 -97 -97 -97 56 -92 -83 -93 -93 49 -93 -97 -97 -17 -93", "output": "-93" }, { "input": "51\n-21 6 -35 -98 -86 -98 -86 -43 -65 32 -98 -40 96 -98 -98 -98 -98 -86 -86 -98 56 -86 -98 -98 -30 -98 -86 -31 -98 -86 -86 -86 -86 -30 96 -86 -86 -86 -60 25 88 -86 -86 58 31 -47 57 -86 37 44 -83", "output": "-86" }, { "input": "66\n-14 -95 65 -95 -95 -97 -90 -71 -97 -97 70 -95 -95 -97 -95 -27 35 -87 -95 -5 -97 -97 87 34 -49 -95 -97 -95 -97 -95 -30 -95 -97 47 -95 -17 -97 -95 -97 -69 51 -97 -97 -95 -75 87 59 21 63 56 76 -91 98 -97 6 -97 -95 -95 -97 -73 11 -97 -35 -95 -95 -43", "output": "-95" }, { "input": "77\n-67 -93 -93 -92 97 29 93 -93 -93 -5 -93 -7 60 -92 -93 44 -84 68 -92 -93 69 -92 -37 56 43 -93 35 -92 -93 19 -79 18 -92 -93 -93 -37 -93 -47 -93 -92 -92 74 67 19 40 -92 -92 -92 -92 -93 -93 -41 -93 -92 -93 -93 -92 -93 51 -80 6 -42 -92 -92 -66 -12 -92 -92 -3 93 -92 -49 -93 40 62 -92 -92", "output": "-92" }, { "input": "89\n-98 40 16 -87 -98 63 -100 55 -96 -98 -21 -100 -93 26 -98 -98 -100 -89 -98 -5 -65 -28 -100 -6 -66 67 -100 -98 -98 10 -98 -98 -70 7 -98 2 -100 -100 -98 25 -100 -100 -98 23 -68 -100 -98 3 98 -100 -98 -98 -98 -98 -24 -100 -100 -9 -98 35 -100 99 -5 -98 -100 -100 37 -100 -84 57 -98 40 -47 -100 -1 -92 -76 -98 -98 -100 -100 -100 -63 30 21 -100 -100 -100 -12", "output": "-98" }, { "input": "99\n10 -84 -100 -100 73 -64 -100 -94 33 -100 -100 -100 -100 71 64 24 7 -100 -32 -100 -100 77 -100 62 -12 55 45 -100 -100 -80 -100 -100 -100 -100 -100 -100 -100 -100 -100 -39 -48 -100 -34 47 -100 -100 -100 -100 -100 -77 -100 -100 -100 -100 -100 -100 -52 40 -55 -100 -44 -100 72 33 70 -100 -100 -78 -100 -3 100 -77 22 -100 95 -30 -100 10 -69 -100 -100 -100 -100 52 -39 -100 -100 -100 7 -100 -98 -66 95 -17 -100 52 -100 68 -100", "output": "-98" }, { "input": "100\n-99 -98 -64 89 53 57 -99 29 -78 18 -3 -54 76 -98 -99 -98 37 -98 19 -47 89 73 -98 -91 -99 -99 -98 -48 -99 22 -99 -98 -99 -99 -98 -60 84 67 -99 -98 20 -98 88 -98 46 -98 -99 -98 -99 -71 -99 -98 -98 -39 83 95 -98 63 -98 -99 32 -98 -99 -64 57 -30 -53 -83 -4 -99 58 20 -98 -10 -99 -44 -99 -99 -99 -99 75 34 -98 -52 -98 -30 -98 -99 -98 -98 51 -99 -99 -99 -98 -99 -99 -82 -90 92", "output": "-98" }, { "input": "3\n1 2 3", "output": "2" }, { "input": "3\n1 3 2", "output": "2" }, { "input": "3\n2 1 3", "output": "2" }, { "input": "3\n2 3 1", "output": "2" }, { "input": "3\n3 1 2", "output": "2" }, { "input": "3\n3 2 1", "output": "2" }, { "input": "9\n99 99 99 99 100 100 100 100 100", "output": "100" }, { "input": "5\n-100 -100 -100 -100 -100", "output": "NO" } ]
1,587,764,897
2,147,483,647
Python 3
OK
TESTS
31
218
0
n=int(input()) l=list(map(int,input().split())) s=list(set(l)) s.sort() if len(s)>=2: print(s[1]) else: print("NO")
Title: Second Order Statistics Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statistics of the given sequence. In other words it is the smallest element strictly greater than the minimum. Help Bob solve this problem. Input Specification: The first input line contains integer *n* (1<=≤<=*n*<=≤<=100) — amount of numbers in the sequence. The second line contains *n* space-separated integer numbers — elements of the sequence. These numbers don't exceed 100 in absolute value. Output Specification: If the given sequence has the second order statistics, output this order statistics, otherwise output NO. Demo Input: ['4\n1 2 2 -4\n', '5\n1 2 3 1 1\n'] Demo Output: ['1\n', '2\n'] Note: none
```python n=int(input()) l=list(map(int,input().split())) s=list(set(l)) s.sort() if len(s)>=2: print(s[1]) else: print("NO") ```
3.9455
908
A
New Year and Counting Cards
PROGRAMMING
800
[ "brute force", "implementation" ]
null
null
Your friend has *n* cards. You know that each card has a lowercase English letter on one side and a digit on the other. Currently, your friend has laid out the cards on a table so only one side of each card is visible. You would like to know if the following statement is true for cards that your friend owns: "If a card has a vowel on one side, then it has an even digit on the other side." More specifically, a vowel is one of 'a', 'e', 'i', 'o' or 'u', and even digit is one of '0', '2', '4', '6' or '8'. For example, if a card has 'a' on one side, and '6' on the other side, then this statement is true for it. Also, the statement is true, for example, for a card with 'b' and '4', and for a card with 'b' and '3' (since the letter is not a vowel). The statement is false, for example, for card with 'e' and '5'. You are interested if the statement is true for all cards. In particular, if no card has a vowel, the statement is true. To determine this, you can flip over some cards to reveal the other side. You would like to know what is the minimum number of cards you need to flip in the worst case in order to verify that the statement is true.
The first and only line of input will contain a string *s* (1<=≤<=|*s*|<=≤<=50), denoting the sides of the cards that you can see on the table currently. Each character of *s* is either a lowercase English letter or a digit.
Print a single integer, the minimum number of cards you must turn over to verify your claim.
[ "ee\n", "z\n", "0ay1\n" ]
[ "2\n", "0\n", "2\n" ]
In the first sample, we must turn over both cards. Note that even though both cards have the same letter, they could possibly have different numbers on the other side. In the second sample, we don't need to turn over any cards. The statement is vacuously true, since you know your friend has no cards with a vowel on them. In the third sample, we need to flip the second and fourth cards.
500
[ { "input": "ee", "output": "2" }, { "input": "z", "output": "0" }, { "input": "0ay1", "output": "2" }, { "input": "0abcdefghijklmnopqrstuvwxyz1234567896", "output": "10" }, { "input": "0a0a9e9e2i2i9o9o6u6u9z9z4x4x9b9b", "output": "18" }, { "input": "01234567890123456789012345678901234567890123456789", "output": "25" }, { "input": "qwertyuioplkjhgfdsazxcvbnmqwertyuioplkjhgfdsazxcvb", "output": "10" }, { "input": "cjw2dwmr10pku4yxohe0wglktd", "output": "4" }, { "input": "6z2tx805jie8cfybwtfqvmlveec3iak5z5u3lu62vbxyqht6", "output": "13" }, { "input": "kaq7jyialrfp4ilkni90eq8v3amcbygon7py0hb8z26fbl8ss1", "output": "13" }, { "input": "hpwn50zgbmct80k9rizjqg40nycgs0acwikjqt11nr6m61krfs", "output": "8" }, { "input": "l3rw91a4m25l8iytxyeuixsegzcbm4h41ornf3pixkrmwznrzc", "output": "14" }, { "input": "2222", "output": "0" }, { "input": "13579", "output": "5" }, { "input": "1", "output": "1" }, { "input": "0", "output": "0" }, { "input": "a", "output": "1" }, { "input": "y", "output": "0" }, { "input": "w", "output": "0" }, { "input": "oo", "output": "2" }, { "input": "oy", "output": "1" }, { "input": "yo", "output": "1" }, { "input": "yy", "output": "0" }, { "input": "a0", "output": "1" }, { "input": "a9", "output": "2" }, { "input": "y0", "output": "0" }, { "input": "y7", "output": "1" }, { "input": "0a", "output": "1" }, { "input": "3a", "output": "2" }, { "input": "06", "output": "0" }, { "input": "07", "output": "1" }, { "input": "70", "output": "1" }, { "input": "77", "output": "2" }, { "input": "13570", "output": "4" }, { "input": "0000000000011111", "output": "5" }, { "input": "1357", "output": "4" }, { "input": "uuuuuuuuuuuuuuuuuu", "output": "18" }, { "input": "gabieurat", "output": "5" } ]
1,638,274,519
2,147,483,647
Python 3
OK
TESTS
38
46
0
s = input() vowels = ['a', 'e', 'i', 'o', 'u'] cards_to_turn = 0 for w in s: if (w in vowels): cards_to_turn += 1 elif (w.isnumeric() and int(w) % 2 != 0): cards_to_turn += 1 print(cards_to_turn)
Title: New Year and Counting Cards Time Limit: None seconds Memory Limit: None megabytes Problem Description: Your friend has *n* cards. You know that each card has a lowercase English letter on one side and a digit on the other. Currently, your friend has laid out the cards on a table so only one side of each card is visible. You would like to know if the following statement is true for cards that your friend owns: "If a card has a vowel on one side, then it has an even digit on the other side." More specifically, a vowel is one of 'a', 'e', 'i', 'o' or 'u', and even digit is one of '0', '2', '4', '6' or '8'. For example, if a card has 'a' on one side, and '6' on the other side, then this statement is true for it. Also, the statement is true, for example, for a card with 'b' and '4', and for a card with 'b' and '3' (since the letter is not a vowel). The statement is false, for example, for card with 'e' and '5'. You are interested if the statement is true for all cards. In particular, if no card has a vowel, the statement is true. To determine this, you can flip over some cards to reveal the other side. You would like to know what is the minimum number of cards you need to flip in the worst case in order to verify that the statement is true. Input Specification: The first and only line of input will contain a string *s* (1<=≤<=|*s*|<=≤<=50), denoting the sides of the cards that you can see on the table currently. Each character of *s* is either a lowercase English letter or a digit. Output Specification: Print a single integer, the minimum number of cards you must turn over to verify your claim. Demo Input: ['ee\n', 'z\n', '0ay1\n'] Demo Output: ['2\n', '0\n', '2\n'] Note: In the first sample, we must turn over both cards. Note that even though both cards have the same letter, they could possibly have different numbers on the other side. In the second sample, we don't need to turn over any cards. The statement is vacuously true, since you know your friend has no cards with a vowel on them. In the third sample, we need to flip the second and fourth cards.
```python s = input() vowels = ['a', 'e', 'i', 'o', 'u'] cards_to_turn = 0 for w in s: if (w in vowels): cards_to_turn += 1 elif (w.isnumeric() and int(w) % 2 != 0): cards_to_turn += 1 print(cards_to_turn) ```
3
122
A
Lucky Division
PROGRAMMING
1,000
[ "brute force", "number theory" ]
null
null
Petya loves lucky numbers. Everybody knows that lucky numbers are positive integers whose decimal representation contains only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not. Petya calls a number almost lucky if it could be evenly divided by some lucky number. Help him find out if the given number *n* is almost lucky.
The single line contains an integer *n* (1<=≤<=*n*<=≤<=1000) — the number that needs to be checked.
In the only line print "YES" (without the quotes), if number *n* is almost lucky. Otherwise, print "NO" (without the quotes).
[ "47\n", "16\n", "78\n" ]
[ "YES\n", "YES\n", "NO\n" ]
Note that all lucky numbers are almost lucky as any number is evenly divisible by itself. In the first sample 47 is a lucky number. In the second sample 16 is divisible by 4.
500
[ { "input": "47", "output": "YES" }, { "input": "16", "output": "YES" }, { "input": "78", "output": "NO" }, { "input": "48", "output": "YES" }, { "input": "100", "output": "YES" }, { "input": "107", "output": "NO" }, { "input": "77", "output": "YES" }, { "input": "477", "output": "YES" }, { "input": "480", "output": "YES" }, { "input": "1", "output": "NO" }, { "input": "3", "output": "NO" }, { "input": "4", "output": "YES" }, { "input": "49", "output": "YES" }, { "input": "56", "output": "YES" }, { "input": "124", "output": "YES" }, { "input": "1000", "output": "YES" }, { "input": "999", "output": "NO" }, { "input": "298", "output": "NO" }, { "input": "274", "output": "NO" }, { "input": "998", "output": "NO" }, { "input": "42", "output": "YES" }, { "input": "788", "output": "YES" }, { "input": "70", "output": "YES" }, { "input": "444", "output": "YES" }, { "input": "777", "output": "YES" }, { "input": "799", "output": "YES" }, { "input": "25", "output": "NO" }, { "input": "882", "output": "YES" }, { "input": "88", "output": "YES" }, { "input": "11", "output": "NO" }, { "input": "2", "output": "NO" }, { "input": "7", "output": "YES" }, { "input": "8", "output": "YES" }, { "input": "94", "output": "YES" }, { "input": "477", "output": "YES" }, { "input": "141", "output": "YES" } ]
1,693,201,434
2,147,483,647
Python 3
OK
TESTS
36
92
0
def is_lucky(number): # Function to check if a number is lucky (contains only 4 and 7) while number > 0: digit = number % 10 if digit != 4 and digit != 7: return False number //= 10 return True def is_almost_lucky(n): # Function to check if a number is almost lucky for i in range(1, n + 1): if n % i == 0 and (is_lucky(i) or is_lucky(n // i)): return True return False # Read the input n = int(input()) # Check if n is almost lucky and print the result if is_almost_lucky(n): print("YES") else: print("NO")
Title: Lucky Division Time Limit: None seconds Memory Limit: None megabytes Problem Description: Petya loves lucky numbers. Everybody knows that lucky numbers are positive integers whose decimal representation contains only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not. Petya calls a number almost lucky if it could be evenly divided by some lucky number. Help him find out if the given number *n* is almost lucky. Input Specification: The single line contains an integer *n* (1<=≤<=*n*<=≤<=1000) — the number that needs to be checked. Output Specification: In the only line print "YES" (without the quotes), if number *n* is almost lucky. Otherwise, print "NO" (without the quotes). Demo Input: ['47\n', '16\n', '78\n'] Demo Output: ['YES\n', 'YES\n', 'NO\n'] Note: Note that all lucky numbers are almost lucky as any number is evenly divisible by itself. In the first sample 47 is a lucky number. In the second sample 16 is divisible by 4.
```python def is_lucky(number): # Function to check if a number is lucky (contains only 4 and 7) while number > 0: digit = number % 10 if digit != 4 and digit != 7: return False number //= 10 return True def is_almost_lucky(n): # Function to check if a number is almost lucky for i in range(1, n + 1): if n % i == 0 and (is_lucky(i) or is_lucky(n // i)): return True return False # Read the input n = int(input()) # Check if n is almost lucky and print the result if is_almost_lucky(n): print("YES") else: print("NO") ```
3
822
A
I'm bored with life
PROGRAMMING
800
[ "implementation", "math", "number theory" ]
null
null
Holidays have finished. Thanks to the help of the hacker Leha, Noora managed to enter the university of her dreams which is located in a town Pavlopolis. It's well known that universities provide students with dormitory for the period of university studies. Consequently Noora had to leave Vičkopolis and move to Pavlopolis. Thus Leha was left completely alone in a quiet town Vičkopolis. He almost even fell into a depression from boredom! Leha came up with a task for himself to relax a little. He chooses two integers *A* and *B* and then calculates the greatest common divisor of integers "*A* factorial" and "*B* factorial". Formally the hacker wants to find out GCD(*A*!,<=*B*!). It's well known that the factorial of an integer *x* is a product of all positive integers less than or equal to *x*. Thus *x*!<==<=1·2·3·...·(*x*<=-<=1)·*x*. For example 4!<==<=1·2·3·4<==<=24. Recall that GCD(*x*,<=*y*) is the largest positive integer *q* that divides (without a remainder) both *x* and *y*. Leha has learned how to solve this task very effective. You are able to cope with it not worse, aren't you?
The first and single line contains two integers *A* and *B* (1<=≤<=*A*,<=*B*<=≤<=109,<=*min*(*A*,<=*B*)<=≤<=12).
Print a single integer denoting the greatest common divisor of integers *A*! and *B*!.
[ "4 3\n" ]
[ "6\n" ]
Consider the sample. 4! = 1·2·3·4 = 24. 3! = 1·2·3 = 6. The greatest common divisor of integers 24 and 6 is exactly 6.
500
[ { "input": "4 3", "output": "6" }, { "input": "10 399603090", "output": "3628800" }, { "input": "6 973151934", "output": "720" }, { "input": "2 841668075", "output": "2" }, { "input": "7 415216919", "output": "5040" }, { "input": "3 283733059", "output": "6" }, { "input": "11 562314608", "output": "39916800" }, { "input": "3 990639260", "output": "6" }, { "input": "11 859155400", "output": "39916800" }, { "input": "1 1", "output": "1" }, { "input": "5 3", "output": "6" }, { "input": "1 4", "output": "1" }, { "input": "5 4", "output": "24" }, { "input": "1 12", "output": "1" }, { "input": "9 7", "output": "5040" }, { "input": "2 3", "output": "2" }, { "input": "6 11", "output": "720" }, { "input": "6 7", "output": "720" }, { "input": "11 11", "output": "39916800" }, { "input": "4 999832660", "output": "24" }, { "input": "7 999228288", "output": "5040" }, { "input": "11 999257105", "output": "39916800" }, { "input": "11 999286606", "output": "39916800" }, { "input": "3 999279109", "output": "6" }, { "input": "999632727 11", "output": "39916800" }, { "input": "999625230 7", "output": "5040" }, { "input": "999617047 3", "output": "6" }, { "input": "999646548 7", "output": "5040" }, { "input": "999639051 3", "output": "6" }, { "input": "12 12", "output": "479001600" }, { "input": "12 1", "output": "1" }, { "input": "1213 5", "output": "120" }, { "input": "8 9", "output": "40320" }, { "input": "12 9", "output": "362880" }, { "input": "12 1000000000", "output": "479001600" }, { "input": "1000000000 1", "output": "1" }, { "input": "12 13", "output": "479001600" }, { "input": "2 29845", "output": "2" }, { "input": "10 21", "output": "3628800" }, { "input": "12 20", "output": "479001600" }, { "input": "15 12", "output": "479001600" }, { "input": "1 1", "output": "1" }, { "input": "1000000000 12", "output": "479001600" }, { "input": "11 30", "output": "39916800" }, { "input": "17 12", "output": "479001600" }, { "input": "4 19", "output": "24" }, { "input": "12 15", "output": "479001600" }, { "input": "20 6", "output": "720" }, { "input": "10 20", "output": "3628800" }, { "input": "10 10", "output": "3628800" }, { "input": "22 12", "output": "479001600" }, { "input": "20 12", "output": "479001600" }, { "input": "12 23", "output": "479001600" }, { "input": "12 22", "output": "479001600" }, { "input": "18 3", "output": "6" }, { "input": "14 10", "output": "3628800" }, { "input": "14 12", "output": "479001600" }, { "input": "8 3", "output": "6" }, { "input": "5 5", "output": "120" } ]
1,632,210,310
2,147,483,647
PyPy 3
OK
TESTS
59
93
20,172,800
import math u,i=map(int,input().split()) e=min(u,i) print(math.factorial(e))
Title: I'm bored with life Time Limit: None seconds Memory Limit: None megabytes Problem Description: Holidays have finished. Thanks to the help of the hacker Leha, Noora managed to enter the university of her dreams which is located in a town Pavlopolis. It's well known that universities provide students with dormitory for the period of university studies. Consequently Noora had to leave Vičkopolis and move to Pavlopolis. Thus Leha was left completely alone in a quiet town Vičkopolis. He almost even fell into a depression from boredom! Leha came up with a task for himself to relax a little. He chooses two integers *A* and *B* and then calculates the greatest common divisor of integers "*A* factorial" and "*B* factorial". Formally the hacker wants to find out GCD(*A*!,<=*B*!). It's well known that the factorial of an integer *x* is a product of all positive integers less than or equal to *x*. Thus *x*!<==<=1·2·3·...·(*x*<=-<=1)·*x*. For example 4!<==<=1·2·3·4<==<=24. Recall that GCD(*x*,<=*y*) is the largest positive integer *q* that divides (without a remainder) both *x* and *y*. Leha has learned how to solve this task very effective. You are able to cope with it not worse, aren't you? Input Specification: The first and single line contains two integers *A* and *B* (1<=≤<=*A*,<=*B*<=≤<=109,<=*min*(*A*,<=*B*)<=≤<=12). Output Specification: Print a single integer denoting the greatest common divisor of integers *A*! and *B*!. Demo Input: ['4 3\n'] Demo Output: ['6\n'] Note: Consider the sample. 4! = 1·2·3·4 = 24. 3! = 1·2·3 = 6. The greatest common divisor of integers 24 and 6 is exactly 6.
```python import math u,i=map(int,input().split()) e=min(u,i) print(math.factorial(e)) ```
3
445
A
DZY Loves Chessboard
PROGRAMMING
1,200
[ "dfs and similar", "implementation" ]
null
null
DZY loves chessboard, and he enjoys playing with it. He has a chessboard of *n* rows and *m* columns. Some cells of the chessboard are bad, others are good. For every good cell, DZY wants to put a chessman on it. Each chessman is either white or black. After putting all chessmen, DZY wants that no two chessmen with the same color are on two adjacent cells. Two cells are adjacent if and only if they share a common edge. You task is to find any suitable placement of chessmen on the given chessboard.
The first line contains two space-separated integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100). Each of the next *n* lines contains a string of *m* characters: the *j*-th character of the *i*-th string is either "." or "-". A "." means that the corresponding cell (in the *i*-th row and the *j*-th column) is good, while a "-" means it is bad.
Output must contain *n* lines, each line must contain a string of *m* characters. The *j*-th character of the *i*-th string should be either "W", "B" or "-". Character "W" means the chessman on the cell is white, "B" means it is black, "-" means the cell is a bad cell. If multiple answers exist, print any of them. It is guaranteed that at least one answer exists.
[ "1 1\n.\n", "2 2\n..\n..\n", "3 3\n.-.\n---\n--." ]
[ "B\n", "BW\nWB\n", "B-B\n---\n--B" ]
In the first sample, DZY puts a single black chessman. Of course putting a white one is also OK. In the second sample, all 4 cells are good. No two same chessmen share an edge in the sample output. In the third sample, no good cells are adjacent. So you can just put 3 chessmen, no matter what their colors are.
500
[ { "input": "1 1\n.", "output": "B" }, { "input": "2 2\n..\n..", "output": "BW\nWB" }, { "input": "3 3\n.-.\n---\n--.", "output": "B-B\n---\n--B" }, { "input": "3 1\n-\n.\n.", "output": "-\nW\nB" }, { "input": "11 11\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------", "output": "-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------" }, { "input": "1 1\n-", "output": "-" }, { "input": "4 2\n..\n..\n..\n..", "output": "BW\nWB\nBW\nWB" }, { "input": "5 1\n.\n.\n.\n.\n.", "output": "B\nW\nB\nW\nB" } ]
1,628,205,805
2,147,483,647
Python 3
OK
TESTS
37
77
6,963,200
a,b = map(int, input().split()) mat = [] for i in range(0,a): x = input() mat.append([]) for j in range(0,b): if x[j] != '-': if (i % 2 == 0 and j % 2 == 0) or (i % 2 == 1 and j % 2 == 1): mat[i].append('B') else: mat[i].append('W') else: mat[i].append('-') for i in range(0,a): print(''.join(mat[i]))
Title: DZY Loves Chessboard Time Limit: None seconds Memory Limit: None megabytes Problem Description: DZY loves chessboard, and he enjoys playing with it. He has a chessboard of *n* rows and *m* columns. Some cells of the chessboard are bad, others are good. For every good cell, DZY wants to put a chessman on it. Each chessman is either white or black. After putting all chessmen, DZY wants that no two chessmen with the same color are on two adjacent cells. Two cells are adjacent if and only if they share a common edge. You task is to find any suitable placement of chessmen on the given chessboard. Input Specification: The first line contains two space-separated integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100). Each of the next *n* lines contains a string of *m* characters: the *j*-th character of the *i*-th string is either "." or "-". A "." means that the corresponding cell (in the *i*-th row and the *j*-th column) is good, while a "-" means it is bad. Output Specification: Output must contain *n* lines, each line must contain a string of *m* characters. The *j*-th character of the *i*-th string should be either "W", "B" or "-". Character "W" means the chessman on the cell is white, "B" means it is black, "-" means the cell is a bad cell. If multiple answers exist, print any of them. It is guaranteed that at least one answer exists. Demo Input: ['1 1\n.\n', '2 2\n..\n..\n', '3 3\n.-.\n---\n--.'] Demo Output: ['B\n', 'BW\nWB\n', 'B-B\n---\n--B'] Note: In the first sample, DZY puts a single black chessman. Of course putting a white one is also OK. In the second sample, all 4 cells are good. No two same chessmen share an edge in the sample output. In the third sample, no good cells are adjacent. So you can just put 3 chessmen, no matter what their colors are.
```python a,b = map(int, input().split()) mat = [] for i in range(0,a): x = input() mat.append([]) for j in range(0,b): if x[j] != '-': if (i % 2 == 0 and j % 2 == 0) or (i % 2 == 1 and j % 2 == 1): mat[i].append('B') else: mat[i].append('W') else: mat[i].append('-') for i in range(0,a): print(''.join(mat[i])) ```
3
171
D
Broken checker
PROGRAMMING
1,300
[ "*special", "brute force" ]
null
null
"This problem is rubbish! There is not statement, and there are only 5 test cases. The problemsetter took liberties with this problem!" — people complained in the comments to one round on Codeforces. And even more... No, wait, the checker for the problem was alright, that's a mercy.
The only line of the input contains an integer between 1 and 5, inclusive. All tests for this problem are different. The contents of the test case doesn't need to be equal to its index.
The only line of the output contains an integer between 1 and 3, inclusive.
[]
[]
This problem has no samples, since there so few test cases.
0
[ { "input": "3", "output": "1" }, { "input": "1", "output": "2" }, { "input": "4", "output": "2" }, { "input": "2", "output": "3" }, { "input": "5", "output": "1" } ]
1,561,462,990
2,147,483,647
Python 3
OK
TESTS
5
216
0
print((int(input())%5)%3+1)
Title: Broken checker Time Limit: None seconds Memory Limit: None megabytes Problem Description: "This problem is rubbish! There is not statement, and there are only 5 test cases. The problemsetter took liberties with this problem!" — people complained in the comments to one round on Codeforces. And even more... No, wait, the checker for the problem was alright, that's a mercy. Input Specification: The only line of the input contains an integer between 1 and 5, inclusive. All tests for this problem are different. The contents of the test case doesn't need to be equal to its index. Output Specification: The only line of the output contains an integer between 1 and 3, inclusive. Note: This problem has no samples, since there so few test cases.
```python print((int(input())%5)%3+1) ```
3
592
B
The Monster and the Squirrel
PROGRAMMING
1,100
[ "math" ]
null
null
Ari the monster always wakes up very early with the first ray of the sun and the first thing she does is feeding her squirrel. Ari draws a regular convex polygon on the floor and numbers it's vertices 1,<=2,<=...,<=*n* in clockwise order. Then starting from the vertex 1 she draws a ray in the direction of each other vertex. The ray stops when it reaches a vertex or intersects with another ray drawn before. Ari repeats this process for vertex 2,<=3,<=...,<=*n* (in this particular order). And then she puts a walnut in each region inside the polygon. Ada the squirrel wants to collect all the walnuts, but she is not allowed to step on the lines drawn by Ari. That means Ada have to perform a small jump if she wants to go from one region to another. Ada can jump from one region P to another region Q if and only if P and Q share a side or a corner. Assuming that Ada starts from outside of the picture, what is the minimum number of jumps she has to perform in order to collect all the walnuts?
The first and only line of the input contains a single integer *n* (3<=≤<=*n*<=≤<=54321) - the number of vertices of the regular polygon drawn by Ari.
Print the minimum number of jumps Ada should make to collect all the walnuts. Note, that she doesn't need to leave the polygon after.
[ "5\n", "3\n" ]
[ "9\n", "1\n" ]
One of the possible solutions for the first sample is shown on the picture above.
1,000
[ { "input": "5", "output": "9" }, { "input": "3", "output": "1" }, { "input": "54321", "output": "2950553761" }, { "input": "4", "output": "4" }, { "input": "6", "output": "16" }, { "input": "7", "output": "25" }, { "input": "8", "output": "36" }, { "input": "9", "output": "49" }, { "input": "10", "output": "64" }, { "input": "54320", "output": "2950445124" }, { "input": "54319", "output": "2950336489" }, { "input": "54318", "output": "2950227856" }, { "input": "54317", "output": "2950119225" }, { "input": "54316", "output": "2950010596" }, { "input": "54315", "output": "2949901969" }, { "input": "54314", "output": "2949793344" }, { "input": "8153", "output": "66438801" }, { "input": "51689", "output": "2671545969" }, { "input": "16659", "output": "277455649" }, { "input": "47389", "output": "2245527769" }, { "input": "314", "output": "97344" }, { "input": "23481", "output": "551263441" }, { "input": "20380", "output": "415262884" }, { "input": "1994", "output": "3968064" } ]
1,470,346,984
2,147,483,647
Python 3
OK
TESTS
24
62
4,608,000
n = int(input()) - 2 print(n * n)
Title: The Monster and the Squirrel Time Limit: None seconds Memory Limit: None megabytes Problem Description: Ari the monster always wakes up very early with the first ray of the sun and the first thing she does is feeding her squirrel. Ari draws a regular convex polygon on the floor and numbers it's vertices 1,<=2,<=...,<=*n* in clockwise order. Then starting from the vertex 1 she draws a ray in the direction of each other vertex. The ray stops when it reaches a vertex or intersects with another ray drawn before. Ari repeats this process for vertex 2,<=3,<=...,<=*n* (in this particular order). And then she puts a walnut in each region inside the polygon. Ada the squirrel wants to collect all the walnuts, but she is not allowed to step on the lines drawn by Ari. That means Ada have to perform a small jump if she wants to go from one region to another. Ada can jump from one region P to another region Q if and only if P and Q share a side or a corner. Assuming that Ada starts from outside of the picture, what is the minimum number of jumps she has to perform in order to collect all the walnuts? Input Specification: The first and only line of the input contains a single integer *n* (3<=≤<=*n*<=≤<=54321) - the number of vertices of the regular polygon drawn by Ari. Output Specification: Print the minimum number of jumps Ada should make to collect all the walnuts. Note, that she doesn't need to leave the polygon after. Demo Input: ['5\n', '3\n'] Demo Output: ['9\n', '1\n'] Note: One of the possible solutions for the first sample is shown on the picture above.
```python n = int(input()) - 2 print(n * n) ```
3
41
A
Translation
PROGRAMMING
800
[ "implementation", "strings" ]
A. Translation
2
256
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
[ "code\nedoc\n", "abb\naba\n", "code\ncode\n" ]
[ "YES\n", "NO\n", "NO\n" ]
none
500
[ { "input": "code\nedoc", "output": "YES" }, { "input": "abb\naba", "output": "NO" }, { "input": "code\ncode", "output": "NO" }, { "input": "abacaba\nabacaba", "output": "YES" }, { "input": "q\nq", "output": "YES" }, { "input": "asrgdfngfnmfgnhweratgjkk\nasrgdfngfnmfgnhweratgjkk", "output": "NO" }, { "input": "z\na", "output": "NO" }, { "input": "asd\ndsa", "output": "YES" }, { "input": "abcdef\nfecdba", "output": "NO" }, { "input": "ywjjbirapvskozubvxoemscfwl\ngnduubaogtfaiowjizlvjcu", "output": "NO" }, { "input": "mfrmqxtzvgaeuleubcmcxcfqyruwzenguhgrmkuhdgnhgtgkdszwqyd\nmfxufheiperjnhyczclkmzyhcxntdfskzkzdwzzujdinf", "output": "NO" }, { "input": "bnbnemvybqizywlnghlykniaxxxlkhftppbdeqpesrtgkcpoeqowjwhrylpsziiwcldodcoonpimudvrxejjo\ntiynnekmlalogyvrgptbinkoqdwzuiyjlrldxhzjmmp", "output": "NO" }, { "input": "pwlpubwyhzqvcitemnhvvwkmwcaawjvdiwtoxyhbhbxerlypelevasmelpfqwjk\nstruuzebbcenziscuoecywugxncdwzyfozhljjyizpqcgkyonyetarcpwkqhuugsqjuixsxptmbnlfupdcfigacdhhrzb", "output": "NO" }, { "input": "gdvqjoyxnkypfvdxssgrihnwxkeojmnpdeobpecytkbdwujqfjtxsqspxvxpqioyfagzjxupqqzpgnpnpxcuipweunqch\nkkqkiwwasbhezqcfeceyngcyuogrkhqecwsyerdniqiocjehrpkljiljophqhyaiefjpavoom", "output": "NO" }, { "input": "umeszdawsvgkjhlqwzents\nhxqhdungbylhnikwviuh", "output": "NO" }, { "input": "juotpscvyfmgntshcealgbsrwwksgrwnrrbyaqqsxdlzhkbugdyx\nibqvffmfktyipgiopznsqtrtxiijntdbgyy", "output": "NO" }, { "input": "zbwueheveouatecaglziqmudxemhrsozmaujrwlqmppzoumxhamwugedikvkblvmxwuofmpafdprbcftew\nulczwrqhctbtbxrhhodwbcxwimncnexosksujlisgclllxokrsbnozthajnnlilyffmsyko", "output": "NO" }, { "input": "nkgwuugukzcv\nqktnpxedwxpxkrxdvgmfgoxkdfpbzvwsduyiybynbkouonhvmzakeiruhfmvrktghadbfkmwxduoqv", "output": "NO" }, { "input": "incenvizhqpcenhjhehvjvgbsnfixbatrrjstxjzhlmdmxijztphxbrldlqwdfimweepkggzcxsrwelodpnryntepioqpvk\ndhjbjjftlvnxibkklxquwmzhjfvnmwpapdrslioxisbyhhfymyiaqhlgecpxamqnocizwxniubrmpyubvpenoukhcobkdojlybxd", "output": "NO" }, { "input": "w\nw", "output": "YES" }, { "input": "vz\nzv", "output": "YES" }, { "input": "ry\nyr", "output": "YES" }, { "input": "xou\nuox", "output": "YES" }, { "input": "axg\ngax", "output": "NO" }, { "input": "zdsl\nlsdz", "output": "YES" }, { "input": "kudl\nldku", "output": "NO" }, { "input": "zzlzwnqlcl\nlclqnwzlzz", "output": "YES" }, { "input": "vzzgicnzqooejpjzads\nsdazjpjeooqzncigzzv", "output": "YES" }, { "input": "raqhmvmzuwaykjpyxsykr\nxkysrypjkyawuzmvmhqar", "output": "NO" }, { "input": "ngedczubzdcqbxksnxuavdjaqtmdwncjnoaicvmodcqvhfezew\nwezefhvqcdomvciaonjcnwdmtqajdvauxnskxbqcdzbuzcdegn", "output": "YES" }, { "input": "muooqttvrrljcxbroizkymuidvfmhhsjtumksdkcbwwpfqdyvxtrlymofendqvznzlmim\nmimlznzvqdnefomylrtxvydqfpwwbckdskmutjshhmfvdiumykziorbxcjlrrvttqooum", "output": "YES" }, { "input": "vxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaivg\ngviayyikkitmuomcpiakhbxszgbnhvwyzkftwoagzixaearxpjacrnvpvbuzenvovehkmmxvblqyxvctroddksdsgebcmlluqpxv", "output": "YES" }, { "input": "mnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfdc\ncdfmkdgrdptkpewbsqvszipgxvgvuiuzbkkwuowbafkikgvnqdkxnayzdjygvezmtsgywnupocdntipiyiorblqkrzjpzatxahnm", "output": "NO" }, { "input": "dgxmzbqofstzcdgthbaewbwocowvhqpinehpjatnnbrijcolvsatbblsrxabzrpszoiecpwhfjmwuhqrapvtcgvikuxtzbftydkw\nwkdytfbztxukivgctvparqhuwmjfhwpceiozsprzbaxrslbbqasvlocjirbnntajphenipthvwocowbweabhtgdcztsfoqbzmxgd", "output": "NO" }, { "input": "gxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwgeh\nhegwxvocotmzstqfbmpjvijgkcyodlxyjawrpkczpmdspsuhoiruavnnnuwvtwohglkdxjetshkboalvzqbgjgthoteceixioxg", "output": "YES" }, { "input": "sihxuwvmaambplxvjfoskinghzicyfqebjtkysotattkahssumfcgrkheotdxwjckpvapbkaepqrxseyfrwtyaycmrzsrsngkh\nhkgnsrszrmcyaytwrfyesxrqpeakbpavpkcjwxdtoehkrgcfmusshakttatosyktjbeqfycizhgniksofjvxlpbmaamvwuxhis", "output": "YES" }, { "input": "ycnahksbughnonldzrhkysujmylcgcfuludjvjiahtkyzqvkopzqcnwhltbzfugzojqkjjlggmvnultascmygelkiktmfieok\nkoeifmtkiklegkmcsatlunvmggkjjlqjozgufzbtlhwncqzpokvqzykthaijvjdulufcgclymjusyyhrzdlnonhgubskhancy", "output": "NO" }, { "input": "wbqasaehtkfojruzyhrlgwmtyiovmzyfifslvlemhqheyaelzwnthrenjsbmntwaoryzwfbxmscmypvxlfmzpnkkjlvwvmtz\nztmvwvljkknpzmflxvpymcsmxbfwzyroawtnmbsjnerhtnwzleayehqhmelvlsfifyzmvoiytmwglrhyzurjofktheasaqbw", "output": "YES" }, { "input": "imippqurprbhfugngtgifelytadegwrgaefnfhbjjnmzikvjaccotqzemufqieqldgnbmviisgkynzeldlhqxuqphjfmyij\njiymfjhpquxqhldleznykgsiivmbngdlqeiqfumezqtoccajvkizmnjjbhfnfeagrwgedatylefigtgngufhbrpruqppimi", "output": "YES" }, { "input": "bikydffiuisckpvzqlteqfhegsagimodb\nbdomigasgehfqetlqzvpkcsiuiffdykib", "output": "YES" } ]
1,669,118,051
2,147,483,647
Python 3
OK
TESTS
40
92
0
k=input() p=input() rev=k[::-1] if rev==p: print('YES') else: print('NO')
Title: Translation Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly. Input Specification: The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols. Output Specification: If the word *t* is a word *s*, written reversely, print YES, otherwise print NO. Demo Input: ['code\nedoc\n', 'abb\naba\n', 'code\ncode\n'] Demo Output: ['YES\n', 'NO\n', 'NO\n'] Note: none
```python k=input() p=input() rev=k[::-1] if rev==p: print('YES') else: print('NO') ```
3.977
837
A
Text Volume
PROGRAMMING
800
[ "implementation" ]
null
null
You are given a text of single-space separated words, consisting of small and capital Latin letters. Volume of the word is number of capital letters in the word. Volume of the text is maximum volume of all words in the text. Calculate the volume of the given text.
The first line contains one integer number *n* (1<=≤<=*n*<=≤<=200) — length of the text. The second line contains text of single-space separated words *s*1,<=*s*2,<=...,<=*s**i*, consisting only of small and capital Latin letters.
Print one integer number — volume of text.
[ "7\nNonZERO\n", "24\nthis is zero answer text\n", "24\nHarbour Space University\n" ]
[ "5\n", "0\n", "1\n" ]
In the first example there is only one word, there are 5 capital letters in it. In the second example all of the words contain 0 capital letters.
0
[ { "input": "7\nNonZERO", "output": "5" }, { "input": "24\nthis is zero answer text", "output": "0" }, { "input": "24\nHarbour Space University", "output": "1" }, { "input": "2\nWM", "output": "2" }, { "input": "200\nLBmJKQLCKUgtTxMoDsEerwvLOXsxASSydOqWyULsRcjMYDWdDCgaDvBfATIWPVSXlbcCLHPYahhxMEYUiaxoCebghJqvmRnaNHYTKLeOiaLDnATPZAOgSNfBzaxLymTGjfzvTegbXsAthTxyDTcmBUkqyGlVGZhoazQzVSoKbTFcCRvYsgSCwjGMxBfWEwMHuagTBxkz", "output": "105" }, { "input": "199\no A r v H e J q k J k v w Q F p O R y R Z o a K R L Z E H t X y X N y y p b x B m r R S q i A x V S u i c L y M n N X c C W Z m S j e w C w T r I S X T D F l w o k f t X u n W w p Z r A k I Y E h s g", "output": "1" }, { "input": "200\nhCyIdivIiISmmYIsCLbpKcTyHaOgTUQEwnQACXnrLdHAVFLtvliTEMlzBVzTesQbhXmcqvwPDeojglBMIjOXANfyQxCSjOJyO SIqOTnRzVzseGIDDYNtrwIusScWSuEhPyEmgQIVEzXofRptjeMzzhtUQxJgcUWILUhEaaRmYRBVsjoqgmyPIKwSajdlNPccOOtWrez", "output": "50" }, { "input": "1\ne", "output": "0" }, { "input": "1\nA", "output": "1" }, { "input": "200\nABCDEFGHIJ ABCDEFGHIJ ABCDEFGHIJ ABCDEFGHIJ ABCDEFGHIJ ABCDEFGHIJ ABCDEFGHIJ ABCDEFGHIJ ABCDEFGHIJ ABCDEFGHIJ KLMNOPRSTU KLMNOPRSTU KLMNOPRSTU VWXYZABCDE KLMNOPRSTU KLMNOPRSTU KLMNOPRSTU KLMNOPRSTU KZ", "output": "10" }, { "input": "200\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA", "output": "200" }, { "input": "200\nffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff", "output": "0" }, { "input": "24\nHarbour Space UniversitY", "output": "2" }, { "input": "5\naA AA", "output": "2" }, { "input": "10\nas AS ASDA", "output": "4" }, { "input": "10\nas AS ASDZ", "output": "4" }, { "input": "3\na A", "output": "1" }, { "input": "24\nHarbour space UniversitY", "output": "2" }, { "input": "10\nas AS ASAa", "output": "3" }, { "input": "15\naAb ABCDFGRHTJS", "output": "11" }, { "input": "53\nsdfAZEZR AZE dfdf dsdRFGSDF ZZDZSD dfsd ERBGF dsfsdfR", "output": "6" }, { "input": "10\nABC ABc AB", "output": "3" }, { "input": "10\nA c de CDE", "output": "3" }, { "input": "4\nA AB", "output": "2" }, { "input": "18\nHARbour Space UNIV", "output": "4" }, { "input": "13\na b c d e f A", "output": "1" }, { "input": "6\nA B CA", "output": "2" }, { "input": "4\naa A", "output": "1" }, { "input": "3\nA a", "output": "1" } ]
1,628,935,154
2,147,483,647
Python 3
OK
TESTS
29
62
6,758,400
n = int(input()) s = input().split() mx = 0 for w in s: c = 0 for x in w: if x.isupper(): c += 1 if c > mx: mx = c print(mx)
Title: Text Volume Time Limit: None seconds Memory Limit: None megabytes Problem Description: You are given a text of single-space separated words, consisting of small and capital Latin letters. Volume of the word is number of capital letters in the word. Volume of the text is maximum volume of all words in the text. Calculate the volume of the given text. Input Specification: The first line contains one integer number *n* (1<=≤<=*n*<=≤<=200) — length of the text. The second line contains text of single-space separated words *s*1,<=*s*2,<=...,<=*s**i*, consisting only of small and capital Latin letters. Output Specification: Print one integer number — volume of text. Demo Input: ['7\nNonZERO\n', '24\nthis is zero answer text\n', '24\nHarbour Space University\n'] Demo Output: ['5\n', '0\n', '1\n'] Note: In the first example there is only one word, there are 5 capital letters in it. In the second example all of the words contain 0 capital letters.
```python n = int(input()) s = input().split() mx = 0 for w in s: c = 0 for x in w: if x.isupper(): c += 1 if c > mx: mx = c print(mx) ```
3
760
A
Petr and a calendar
PROGRAMMING
800
[ "implementation", "math" ]
null
null
Petr wants to make a calendar for current month. For this purpose he draws a table in which columns correspond to weeks (a week is seven consequent days from Monday to Sunday), rows correspond to weekdays, and cells contain dates. For example, a calendar for January 2017 should look like on the picture: Petr wants to know how many columns his table should have given the month and the weekday of the first date of that month? Assume that the year is non-leap.
The only line contain two integers *m* and *d* (1<=≤<=*m*<=≤<=12, 1<=≤<=*d*<=≤<=7) — the number of month (January is the first month, December is the twelfth) and the weekday of the first date of this month (1 is Monday, 7 is Sunday).
Print single integer: the number of columns the table should have.
[ "1 7\n", "1 1\n", "11 6\n" ]
[ "6\n", "5\n", "5\n" ]
The first example corresponds to the January 2017 shown on the picture in the statements. In the second example 1-st January is Monday, so the whole month fits into 5 columns. In the third example 1-st November is Saturday and 5 columns is enough.
500
[ { "input": "1 7", "output": "6" }, { "input": "1 1", "output": "5" }, { "input": "11 6", "output": "5" }, { "input": "2 7", "output": "5" }, { "input": "2 1", "output": "4" }, { "input": "8 6", "output": "6" }, { "input": "1 1", "output": "5" }, { "input": "1 2", "output": "5" }, { "input": "1 3", "output": "5" }, { "input": "1 4", "output": "5" }, { "input": "1 5", "output": "5" }, { "input": "1 6", "output": "6" }, { "input": "1 7", "output": "6" }, { "input": "2 1", "output": "4" }, { "input": "2 2", "output": "5" }, { "input": "2 3", "output": "5" }, { "input": "2 4", "output": "5" }, { "input": "2 5", "output": "5" }, { "input": "2 6", "output": "5" }, { "input": "2 7", "output": "5" }, { "input": "3 1", "output": "5" }, { "input": "3 2", "output": "5" }, { "input": "3 3", "output": "5" }, { "input": "3 4", "output": "5" }, { "input": "3 5", "output": "5" }, { "input": "3 6", "output": "6" }, { "input": "3 7", "output": "6" }, { "input": "4 1", "output": "5" }, { "input": "4 2", "output": "5" }, { "input": "4 3", "output": "5" }, { "input": "4 4", "output": "5" }, { "input": "4 5", "output": "5" }, { "input": "4 6", "output": "5" }, { "input": "4 7", "output": "6" }, { "input": "5 1", "output": "5" }, { "input": "5 2", "output": "5" }, { "input": "5 3", "output": "5" }, { "input": "5 4", "output": "5" }, { "input": "5 5", "output": "5" }, { "input": "5 6", "output": "6" }, { "input": "5 7", "output": "6" }, { "input": "6 1", "output": "5" }, { "input": "6 2", "output": "5" }, { "input": "6 3", "output": "5" }, { "input": "6 4", "output": "5" }, { "input": "6 5", "output": "5" }, { "input": "6 6", "output": "5" }, { "input": "6 7", "output": "6" }, { "input": "7 1", "output": "5" }, { "input": "7 2", "output": "5" }, { "input": "7 3", "output": "5" }, { "input": "7 4", "output": "5" }, { "input": "7 5", "output": "5" }, { "input": "7 6", "output": "6" }, { "input": "7 7", "output": "6" }, { "input": "8 1", "output": "5" }, { "input": "8 2", "output": "5" }, { "input": "8 3", "output": "5" }, { "input": "8 4", "output": "5" }, { "input": "8 5", "output": "5" }, { "input": "8 6", "output": "6" }, { "input": "8 7", "output": "6" }, { "input": "9 1", "output": "5" }, { "input": "9 2", "output": "5" }, { "input": "9 3", "output": "5" }, { "input": "9 4", "output": "5" }, { "input": "9 5", "output": "5" }, { "input": "9 6", "output": "5" }, { "input": "9 7", "output": "6" }, { "input": "10 1", "output": "5" }, { "input": "10 2", "output": "5" }, { "input": "10 3", "output": "5" }, { "input": "10 4", "output": "5" }, { "input": "10 5", "output": "5" }, { "input": "10 6", "output": "6" }, { "input": "10 7", "output": "6" }, { "input": "11 1", "output": "5" }, { "input": "11 2", "output": "5" }, { "input": "11 3", "output": "5" }, { "input": "11 4", "output": "5" }, { "input": "11 5", "output": "5" }, { "input": "11 6", "output": "5" }, { "input": "11 7", "output": "6" }, { "input": "12 1", "output": "5" }, { "input": "12 2", "output": "5" }, { "input": "12 3", "output": "5" }, { "input": "12 4", "output": "5" }, { "input": "12 5", "output": "5" }, { "input": "12 6", "output": "6" }, { "input": "12 7", "output": "6" }, { "input": "1 4", "output": "5" }, { "input": "1 5", "output": "5" }, { "input": "9 7", "output": "6" }, { "input": "2 6", "output": "5" }, { "input": "1 6", "output": "6" }, { "input": "2 2", "output": "5" }, { "input": "4 7", "output": "6" }, { "input": "12 6", "output": "6" }, { "input": "12 3", "output": "5" }, { "input": "3 6", "output": "6" }, { "input": "9 6", "output": "5" }, { "input": "7 6", "output": "6" }, { "input": "11 7", "output": "6" }, { "input": "6 6", "output": "5" } ]
1,485,109,429
529
Python 3
OK
TESTS
104
77
4,608,000
m, d = list(map(int, input().split())) days = [31, 28, 31, 30, 31, 30, 31, 31, 30, 31, 30, 31] import math day = days[m-1] print(math.ceil((day + d-1)/7))
Title: Petr and a calendar Time Limit: None seconds Memory Limit: None megabytes Problem Description: Petr wants to make a calendar for current month. For this purpose he draws a table in which columns correspond to weeks (a week is seven consequent days from Monday to Sunday), rows correspond to weekdays, and cells contain dates. For example, a calendar for January 2017 should look like on the picture: Petr wants to know how many columns his table should have given the month and the weekday of the first date of that month? Assume that the year is non-leap. Input Specification: The only line contain two integers *m* and *d* (1<=≤<=*m*<=≤<=12, 1<=≤<=*d*<=≤<=7) — the number of month (January is the first month, December is the twelfth) and the weekday of the first date of this month (1 is Monday, 7 is Sunday). Output Specification: Print single integer: the number of columns the table should have. Demo Input: ['1 7\n', '1 1\n', '11 6\n'] Demo Output: ['6\n', '5\n', '5\n'] Note: The first example corresponds to the January 2017 shown on the picture in the statements. In the second example 1-st January is Monday, so the whole month fits into 5 columns. In the third example 1-st November is Saturday and 5 columns is enough.
```python m, d = list(map(int, input().split())) days = [31, 28, 31, 30, 31, 30, 31, 31, 30, 31, 30, 31] import math day = days[m-1] print(math.ceil((day + d-1)/7)) ```
3
231
A
Team
PROGRAMMING
800
[ "brute force", "greedy" ]
null
null
One day three best friends Petya, Vasya and Tonya decided to form a team and take part in programming contests. Participants are usually offered several problems during programming contests. Long before the start the friends decided that they will implement a problem if at least two of them are sure about the solution. Otherwise, the friends won't write the problem's solution. This contest offers *n* problems to the participants. For each problem we know, which friend is sure about the solution. Help the friends find the number of problems for which they will write a solution.
The first input line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of problems in the contest. Then *n* lines contain three integers each, each integer is either 0 or 1. If the first number in the line equals 1, then Petya is sure about the problem's solution, otherwise he isn't sure. The second number shows Vasya's view on the solution, the third number shows Tonya's view. The numbers on the lines are separated by spaces.
Print a single integer — the number of problems the friends will implement on the contest.
[ "3\n1 1 0\n1 1 1\n1 0 0\n", "2\n1 0 0\n0 1 1\n" ]
[ "2\n", "1\n" ]
In the first sample Petya and Vasya are sure that they know how to solve the first problem and all three of them know how to solve the second problem. That means that they will write solutions for these problems. Only Petya is sure about the solution for the third problem, but that isn't enough, so the friends won't take it. In the second sample the friends will only implement the second problem, as Vasya and Tonya are sure about the solution.
500
[ { "input": "3\n1 1 0\n1 1 1\n1 0 0", "output": "2" }, { "input": "2\n1 0 0\n0 1 1", "output": "1" }, { "input": "1\n1 0 0", "output": "0" }, { "input": "2\n1 0 0\n1 1 1", "output": "1" }, { "input": "5\n1 0 0\n0 1 0\n1 1 1\n0 0 1\n0 0 0", "output": "1" }, { "input": "10\n0 1 0\n0 1 0\n1 1 0\n1 0 0\n0 0 1\n0 1 1\n1 1 1\n1 1 0\n0 0 0\n0 0 0", "output": "4" }, { "input": "15\n0 1 0\n1 0 0\n1 1 0\n1 1 1\n0 1 0\n0 0 1\n1 0 1\n1 0 1\n1 0 1\n0 0 0\n1 1 1\n1 1 0\n0 1 1\n1 1 0\n1 1 1", "output": "10" }, { "input": "50\n0 0 0\n0 1 1\n1 1 1\n0 1 0\n1 0 1\n1 1 1\n0 0 1\n1 0 0\n1 1 0\n1 0 1\n0 1 0\n0 0 1\n1 1 0\n0 1 0\n1 1 0\n0 0 0\n1 1 1\n1 0 1\n0 0 1\n1 1 0\n1 1 1\n0 1 1\n1 1 0\n0 0 0\n0 0 0\n1 1 1\n0 0 0\n1 1 1\n0 1 1\n0 0 1\n0 0 0\n0 0 0\n1 1 0\n1 1 0\n1 0 1\n1 0 0\n1 0 1\n1 0 1\n0 1 1\n1 1 0\n1 1 0\n0 1 0\n1 0 1\n0 0 0\n0 0 0\n0 0 0\n0 0 1\n1 1 1\n0 1 1\n1 0 1", "output": "29" }, { "input": "1\n1 1 1", "output": "1" }, { "input": "8\n0 0 0\n0 0 1\n0 0 0\n0 1 1\n1 0 0\n1 0 1\n1 1 0\n1 1 1", "output": "4" }, { "input": "16\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1", "output": "16" } ]
1,696,094,974
2,147,483,647
Python 3
OK
TESTS
21
92
0
n=int(input()) ans=0 for i in range(n): x=input() nb_1=int(x[0]) nb_2=int(x[2]) nb_3=int(x[4]) sm=nb_3+nb_2+nb_1 if sm >=2: ans=ans+1 print(ans)
Title: Team Time Limit: None seconds Memory Limit: None megabytes Problem Description: One day three best friends Petya, Vasya and Tonya decided to form a team and take part in programming contests. Participants are usually offered several problems during programming contests. Long before the start the friends decided that they will implement a problem if at least two of them are sure about the solution. Otherwise, the friends won't write the problem's solution. This contest offers *n* problems to the participants. For each problem we know, which friend is sure about the solution. Help the friends find the number of problems for which they will write a solution. Input Specification: The first input line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of problems in the contest. Then *n* lines contain three integers each, each integer is either 0 or 1. If the first number in the line equals 1, then Petya is sure about the problem's solution, otherwise he isn't sure. The second number shows Vasya's view on the solution, the third number shows Tonya's view. The numbers on the lines are separated by spaces. Output Specification: Print a single integer — the number of problems the friends will implement on the contest. Demo Input: ['3\n1 1 0\n1 1 1\n1 0 0\n', '2\n1 0 0\n0 1 1\n'] Demo Output: ['2\n', '1\n'] Note: In the first sample Petya and Vasya are sure that they know how to solve the first problem and all three of them know how to solve the second problem. That means that they will write solutions for these problems. Only Petya is sure about the solution for the third problem, but that isn't enough, so the friends won't take it. In the second sample the friends will only implement the second problem, as Vasya and Tonya are sure about the solution.
```python n=int(input()) ans=0 for i in range(n): x=input() nb_1=int(x[0]) nb_2=int(x[2]) nb_3=int(x[4]) sm=nb_3+nb_2+nb_1 if sm >=2: ans=ans+1 print(ans) ```
3
275
A
Lights Out
PROGRAMMING
900
[ "implementation" ]
null
null
Lenny is playing a game on a 3<=×<=3 grid of lights. In the beginning of the game all lights are switched on. Pressing any of the lights will toggle it and all side-adjacent lights. The goal of the game is to switch all the lights off. We consider the toggling as follows: if the light was switched on then it will be switched off, if it was switched off then it will be switched on. Lenny has spent some time playing with the grid and by now he has pressed each light a certain number of times. Given the number of times each light is pressed, you have to print the current state of each light.
The input consists of three rows. Each row contains three integers each between 0 to 100 inclusive. The *j*-th number in the *i*-th row is the number of times the *j*-th light of the *i*-th row of the grid is pressed.
Print three lines, each containing three characters. The *j*-th character of the *i*-th line is "1" if and only if the corresponding light is switched on, otherwise it's "0".
[ "1 0 0\n0 0 0\n0 0 1\n", "1 0 1\n8 8 8\n2 0 3\n" ]
[ "001\n010\n100\n", "010\n011\n100\n" ]
none
500
[ { "input": "1 0 0\n0 0 0\n0 0 1", "output": "001\n010\n100" }, { "input": "1 0 1\n8 8 8\n2 0 3", "output": "010\n011\n100" }, { "input": "13 85 77\n25 50 45\n65 79 9", "output": "000\n010\n000" }, { "input": "96 95 5\n8 84 74\n67 31 61", "output": "011\n011\n101" }, { "input": "24 54 37\n60 63 6\n1 84 26", "output": "110\n101\n011" }, { "input": "23 10 40\n15 6 40\n92 80 77", "output": "101\n100\n000" }, { "input": "62 74 80\n95 74 93\n2 47 95", "output": "010\n001\n110" }, { "input": "80 83 48\n26 0 66\n47 76 37", "output": "000\n000\n010" }, { "input": "32 15 65\n7 54 36\n5 51 3", "output": "111\n101\n001" }, { "input": "22 97 12\n71 8 24\n100 21 64", "output": "100\n001\n100" }, { "input": "46 37 13\n87 0 50\n90 8 55", "output": "111\n011\n000" }, { "input": "57 43 58\n20 82 83\n66 16 52", "output": "111\n010\n110" }, { "input": "45 56 93\n47 51 59\n18 51 63", "output": "101\n011\n100" }, { "input": "47 66 67\n14 1 37\n27 81 69", "output": "001\n001\n110" }, { "input": "26 69 69\n85 18 23\n14 22 74", "output": "110\n001\n010" }, { "input": "10 70 65\n94 27 25\n74 66 30", "output": "111\n010\n100" }, { "input": "97 1 74\n15 99 1\n88 68 86", "output": "001\n011\n000" }, { "input": "36 48 42\n45 41 66\n26 64 1", "output": "001\n111\n010" }, { "input": "52 81 97\n29 77 71\n66 11 2", "output": "100\n100\n111" }, { "input": "18 66 33\n19 49 49\n48 46 26", "output": "011\n100\n000" }, { "input": "68 79 52\n51 39 100\n29 14 26", "output": "110\n000\n111" }, { "input": "91 69 77\n91 26 64\n91 88 57", "output": "001\n011\n110" }, { "input": "16 69 64\n48 21 80\n81 51 51", "output": "010\n101\n111" }, { "input": "96 14 2\n100 18 12\n65 34 89", "output": "111\n010\n010" }, { "input": "93 95 90\n8 59 42\n53 13 19", "output": "100\n001\n111" }, { "input": "71 84 18\n100 19 67\n9 76 15", "output": "010\n010\n001" }, { "input": "38 93 85\n21 88 64\n4 96 25", "output": "111\n011\n000" }, { "input": "75 20 20\n60 5 78\n77 4 69", "output": "011\n001\n000" }, { "input": "65 70 96\n19 6 83\n33 37 82", "output": "100\n000\n011" }, { "input": "11 13 60\n17 13 46\n42 21 39", "output": "000\n011\n101" }, { "input": "0 0 0\n0 0 0\n0 0 0", "output": "111\n111\n111" }, { "input": "0 0 0\n0 1 0\n0 0 0", "output": "101\n000\n101" }, { "input": "0 0 0\n0 0 0\n0 0 1", "output": "111\n110\n100" } ]
1,667,708,227
2,147,483,647
PyPy 3-64
OK
TESTS
33
62
0
l1=[int(i) for i in input().split()] l2=[int(i) for i in input().split()] l3=[int(i) for i in input().split()] s1=[1,1,1] s2=[1,1,1] s3=[1,1,1] for j in range(3): if l1[j]%2!=0: if j==0: s1[0]=1-s1[0] s1[1]=1-s1[1] s2[0]=1-s2[0] elif j==1: s1[0]=1-s1[0] s1[1]=1-s1[1] s1[-1]=1-s1[-1] s2[1]=1-s2[1] else : s1[-1]=1-s1[-1] s1[1]=1-s1[1] s2[-1]=1-s2[-1] for k in range(3): if l2[k]%2!=0: if k==0: s1[0]=1-s1[0] s2[0]=1-s2[0] s3[0]=1-s3[0] s2[1]=1-s2[1] elif k==1: s2[0]=1-s2[0] s2[1]=1-s2[1] s2[-1]=1-s2[-1] s1[1]=1-s1[1] s3[1]=1-s3[1] else : s1[-1]=1-s1[-1] s2[-1]=1-s2[-1] s3[-1]=1-s3[-1] s2[1]=1-s2[1] for l in range(3): if l3[l]%2!=0: if l==0: s3[0]=1-s3[0] s3[1]=1-s3[1] s2[0]=1-s2[0] elif l==1: s3[0]=1-s3[0] s3[1]=1-s3[1] s3[-1]=1-s3[-1] s2[1]=1-s2[1] else : s3[-1]=1-s3[-1] s3[1]=1-s3[1] s2[-1]=1-s2[-1] print(*s1,sep="") print(*s2,sep="") print(*s3,sep="")
Title: Lights Out Time Limit: None seconds Memory Limit: None megabytes Problem Description: Lenny is playing a game on a 3<=×<=3 grid of lights. In the beginning of the game all lights are switched on. Pressing any of the lights will toggle it and all side-adjacent lights. The goal of the game is to switch all the lights off. We consider the toggling as follows: if the light was switched on then it will be switched off, if it was switched off then it will be switched on. Lenny has spent some time playing with the grid and by now he has pressed each light a certain number of times. Given the number of times each light is pressed, you have to print the current state of each light. Input Specification: The input consists of three rows. Each row contains three integers each between 0 to 100 inclusive. The *j*-th number in the *i*-th row is the number of times the *j*-th light of the *i*-th row of the grid is pressed. Output Specification: Print three lines, each containing three characters. The *j*-th character of the *i*-th line is "1" if and only if the corresponding light is switched on, otherwise it's "0". Demo Input: ['1 0 0\n0 0 0\n0 0 1\n', '1 0 1\n8 8 8\n2 0 3\n'] Demo Output: ['001\n010\n100\n', '010\n011\n100\n'] Note: none
```python l1=[int(i) for i in input().split()] l2=[int(i) for i in input().split()] l3=[int(i) for i in input().split()] s1=[1,1,1] s2=[1,1,1] s3=[1,1,1] for j in range(3): if l1[j]%2!=0: if j==0: s1[0]=1-s1[0] s1[1]=1-s1[1] s2[0]=1-s2[0] elif j==1: s1[0]=1-s1[0] s1[1]=1-s1[1] s1[-1]=1-s1[-1] s2[1]=1-s2[1] else : s1[-1]=1-s1[-1] s1[1]=1-s1[1] s2[-1]=1-s2[-1] for k in range(3): if l2[k]%2!=0: if k==0: s1[0]=1-s1[0] s2[0]=1-s2[0] s3[0]=1-s3[0] s2[1]=1-s2[1] elif k==1: s2[0]=1-s2[0] s2[1]=1-s2[1] s2[-1]=1-s2[-1] s1[1]=1-s1[1] s3[1]=1-s3[1] else : s1[-1]=1-s1[-1] s2[-1]=1-s2[-1] s3[-1]=1-s3[-1] s2[1]=1-s2[1] for l in range(3): if l3[l]%2!=0: if l==0: s3[0]=1-s3[0] s3[1]=1-s3[1] s2[0]=1-s2[0] elif l==1: s3[0]=1-s3[0] s3[1]=1-s3[1] s3[-1]=1-s3[-1] s2[1]=1-s2[1] else : s3[-1]=1-s3[-1] s3[1]=1-s3[1] s2[-1]=1-s2[-1] print(*s1,sep="") print(*s2,sep="") print(*s3,sep="") ```
3
383
A
Milking cows
PROGRAMMING
1,600
[ "data structures", "greedy" ]
null
null
Iahub helps his grandfather at the farm. Today he must milk the cows. There are *n* cows sitting in a row, numbered from 1 to *n* from left to right. Each cow is either facing to the left or facing to the right. When Iahub milks a cow, all the cows that see the current cow get scared and lose one unit of the quantity of milk that they can give. A cow facing left sees all the cows with lower indices than her index, and a cow facing right sees all the cows with higher indices than her index. A cow that got scared once can get scared again (and lose one more unit of milk). A cow that has been milked once cannot get scared and lose any more milk. You can assume that a cow never loses all the milk she can give (a cow gives an infinitely amount of milk). Iahub can decide the order in which he milks the cows. But he must milk each cow exactly once. Iahub wants to lose as little milk as possible. Print the minimum amount of milk that is lost.
The first line contains an integer *n* (1<=≤<=*n*<=≤<=200000). The second line contains *n* integers *a*1, *a*2, ..., *a**n*, where *a**i* is 0 if the cow number *i* is facing left, and 1 if it is facing right.
Print a single integer, the minimum amount of lost milk. Please, do not write the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier.
[ "4\n0 0 1 0\n", "5\n1 0 1 0 1\n" ]
[ "1", "3" ]
In the first sample Iahub milks the cows in the following order: cow 3, cow 4, cow 2, cow 1. When he milks cow 3, cow 4 loses 1 unit of milk. After that, no more milk is lost.
500
[ { "input": "4\n0 0 1 0", "output": "1" }, { "input": "5\n1 0 1 0 1", "output": "3" }, { "input": "50\n1 1 0 1 1 1 1 1 1 0 0 1 1 0 1 1 0 0 1 0 1 1 0 1 1 1 1 0 1 0 1 0 1 1 1 0 0 0 0 0 0 0 1 1 0 1 0 0 1 0", "output": "416" }, { "input": "100\n1 1 0 0 1 1 1 1 0 1 1 1 1 1 1 1 0 0 0 0 0 0 1 1 0 1 0 0 0 0 1 1 1 1 0 0 1 0 0 1 1 0 1 1 1 1 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 0 1 0 0 1 0 0 1 0 1 0 0 0 0 1 0 1 1 0 1 1 1 1 0 0 1 1 0 0 0 0 1 1 1 0 0 1 0 0", "output": "1446" }, { "input": "1\n1", "output": "0" }, { "input": "1\n0", "output": "0" }, { "input": "2\n0 1", "output": "0" }, { "input": "2\n1 0", "output": "1" }, { "input": "2\n0 0", "output": "0" }, { "input": "2\n1 1", "output": "0" }, { "input": "4\n1 1 1 1", "output": "0" } ]
1,390,233,360
1,560
Python 3
OK
TESTS
42
265
6,860,800
import sys n=int(input()) L=list(map(int,sys.stdin.readline().split())) z=L.count(0) if(z==n or z==0): print(0) Zeros=[0]*n Zeros[n-1]+=1-L[n-1] for i in range(n-2,-1,-1): Zeros[i]=Zeros[i+1] if(L[i]==0): Zeros[i]+=1 else: Zeros=[0]*n Zeros[n-1]+=1-L[n-1] for i in range(n-2,-1,-1): Zeros[i]=Zeros[i+1] if(L[i]==0): Zeros[i]+=1 Ans=0 o=0 z=0 p=L[0] if(L[0]==1): o+=1 for i in range(1,n): if(L[i]==p): if(p==1): o+=1 else: if(L[i]==0): Ans+=Zeros[i]*o p=0 else: o=1 p=1 print(Ans)
Title: Milking cows Time Limit: None seconds Memory Limit: None megabytes Problem Description: Iahub helps his grandfather at the farm. Today he must milk the cows. There are *n* cows sitting in a row, numbered from 1 to *n* from left to right. Each cow is either facing to the left or facing to the right. When Iahub milks a cow, all the cows that see the current cow get scared and lose one unit of the quantity of milk that they can give. A cow facing left sees all the cows with lower indices than her index, and a cow facing right sees all the cows with higher indices than her index. A cow that got scared once can get scared again (and lose one more unit of milk). A cow that has been milked once cannot get scared and lose any more milk. You can assume that a cow never loses all the milk she can give (a cow gives an infinitely amount of milk). Iahub can decide the order in which he milks the cows. But he must milk each cow exactly once. Iahub wants to lose as little milk as possible. Print the minimum amount of milk that is lost. Input Specification: The first line contains an integer *n* (1<=≤<=*n*<=≤<=200000). The second line contains *n* integers *a*1, *a*2, ..., *a**n*, where *a**i* is 0 if the cow number *i* is facing left, and 1 if it is facing right. Output Specification: Print a single integer, the minimum amount of lost milk. Please, do not write the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier. Demo Input: ['4\n0 0 1 0\n', '5\n1 0 1 0 1\n'] Demo Output: ['1', '3'] Note: In the first sample Iahub milks the cows in the following order: cow 3, cow 4, cow 2, cow 1. When he milks cow 3, cow 4 loses 1 unit of milk. After that, no more milk is lost.
```python import sys n=int(input()) L=list(map(int,sys.stdin.readline().split())) z=L.count(0) if(z==n or z==0): print(0) Zeros=[0]*n Zeros[n-1]+=1-L[n-1] for i in range(n-2,-1,-1): Zeros[i]=Zeros[i+1] if(L[i]==0): Zeros[i]+=1 else: Zeros=[0]*n Zeros[n-1]+=1-L[n-1] for i in range(n-2,-1,-1): Zeros[i]=Zeros[i+1] if(L[i]==0): Zeros[i]+=1 Ans=0 o=0 z=0 p=L[0] if(L[0]==1): o+=1 for i in range(1,n): if(L[i]==p): if(p==1): o+=1 else: if(L[i]==0): Ans+=Zeros[i]*o p=0 else: o=1 p=1 print(Ans) ```
3
560
A
Currency System in Geraldion
PROGRAMMING
1,000
[ "implementation", "sortings" ]
null
null
A magic island Geraldion, where Gerald lives, has its own currency system. It uses banknotes of several values. But the problem is, the system is not perfect and sometimes it happens that Geraldionians cannot express a certain sum of money with any set of banknotes. Of course, they can use any number of banknotes of each value. Such sum is called unfortunate. Gerald wondered: what is the minimum unfortunate sum?
The first line contains number *n* (1<=≤<=*n*<=≤<=1000) — the number of values of the banknotes that used in Geraldion. The second line contains *n* distinct space-separated numbers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=106) — the values of the banknotes.
Print a single line — the minimum unfortunate sum. If there are no unfortunate sums, print <=-<=1.
[ "5\n1 2 3 4 5\n" ]
[ "-1\n" ]
none
500
[ { "input": "5\n1 2 3 4 5", "output": "-1" }, { "input": "1\n2", "output": "1" }, { "input": "10\n371054 506438 397130 1 766759 208409 769264 549213 641270 771837", "output": "-1" }, { "input": "10\n635370 154890 909382 220996 276501 716105 538714 140162 171960 271264", "output": "1" }, { "input": "50\n110876 835020 859879 999908 712969 788264 287153 921820 330355 499311 209594 484829 296329 940051 174081 931503 1 780512 390075 97866 124255 950067 697612 244256 782385 789882 37608 82153 399889 598867 416717 377988 535636 511221 792568 683271 131077 290194 496712 330720 587436 563481 645817 942562 654093 980561 382937 48293 582608 116156", "output": "-1" }, { "input": "50\n474421 421097 217233 156339 27075 733996 281778 863492 184707 956857 288561 70997 393786 337382 663642 131184 637 273801 799870 295017 392338 842567 161819 297705 102013 930684 375703 838048 154915 138503 629056 256591 893619 19263 787927 684541 320265 841090 421423 490879 394582 493952 619247 633202 612928 50907 276653 407819 489945 153173", "output": "1" }, { "input": "1\n1", "output": "-1" }, { "input": "1\n1000000", "output": "1" }, { "input": "2\n3 2", "output": "1" }, { "input": "2\n2 3", "output": "1" } ]
1,477,936,700
2,147,483,647
Python 3
OK
TESTS
16
77
0
n = input() banknotes = [int(x) for x in input().split()] print('-1') if 1 in banknotes else print('1')
Title: Currency System in Geraldion Time Limit: None seconds Memory Limit: None megabytes Problem Description: A magic island Geraldion, where Gerald lives, has its own currency system. It uses banknotes of several values. But the problem is, the system is not perfect and sometimes it happens that Geraldionians cannot express a certain sum of money with any set of banknotes. Of course, they can use any number of banknotes of each value. Such sum is called unfortunate. Gerald wondered: what is the minimum unfortunate sum? Input Specification: The first line contains number *n* (1<=≤<=*n*<=≤<=1000) — the number of values of the banknotes that used in Geraldion. The second line contains *n* distinct space-separated numbers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=106) — the values of the banknotes. Output Specification: Print a single line — the minimum unfortunate sum. If there are no unfortunate sums, print <=-<=1. Demo Input: ['5\n1 2 3 4 5\n'] Demo Output: ['-1\n'] Note: none
```python n = input() banknotes = [int(x) for x in input().split()] print('-1') if 1 in banknotes else print('1') ```
3
514
C
Watto and Mechanism
PROGRAMMING
2,000
[ "binary search", "data structures", "hashing", "string suffix structures", "strings" ]
null
null
Watto, the owner of a spare parts store, has recently got an order for the mechanism that can process strings in a certain way. Initially the memory of the mechanism is filled with *n* strings. Then the mechanism should be able to process queries of the following type: "Given string *s*, determine if the memory of the mechanism contains string *t* that consists of the same number of characters as *s* and differs from *s* in exactly one position". Watto has already compiled the mechanism, all that's left is to write a program for it and check it on the data consisting of *n* initial lines and *m* queries. He decided to entrust this job to you.
The first line contains two non-negative numbers *n* and *m* (0<=≤<=*n*<=≤<=3·105, 0<=≤<=*m*<=≤<=3·105) — the number of the initial strings and the number of queries, respectively. Next follow *n* non-empty strings that are uploaded to the memory of the mechanism. Next follow *m* non-empty strings that are the queries to the mechanism. The total length of lines in the input doesn't exceed 6·105. Each line consists only of letters 'a', 'b', 'c'.
For each query print on a single line "YES" (without the quotes), if the memory of the mechanism contains the required string, otherwise print "NO" (without the quotes).
[ "2 3\naaaaa\nacacaca\naabaa\nccacacc\ncaaac\n" ]
[ "YES\nNO\nNO\n" ]
none
2,000
[ { "input": "2 3\naaaaa\nacacaca\naabaa\nccacacc\ncaaac", "output": "YES\nNO\nNO" }, { "input": "1 5\nacbacbacb\ncbacbacb\nacbacbac\naacbacbacb\nacbacbacbb\nacbaabacb", "output": "NO\nNO\nNO\nNO\nYES" }, { "input": "5 4\nab\ncacab\ncbabc\nacc\ncacab\nabc\naa\nacbca\ncb", "output": "YES\nYES\nNO\nYES" }, { "input": "9 9\ncaccbcacabccba\naacbcbcaabacbcbcba\nbabccaaacccacbb\ncaaabcaacbababbabbb\nabbaccacabacaaaa\nbccbccababcaacb\ncaacbcaacbababbabbb\nbcacababbbcaaca\nccbbcbababbccaab\nbbcbccababcaacb\naacccbabbacbabacaca\nbbcbcccbabcaacb\nacbacacbcacc\ncaaabcaaabacabbabbb\nabbbabaaaba\naacccbcaabacbcbcba\nabbaccacabbcaaaa\naaccbbcabbacbcbcba", "output": "YES\nNO\nNO\nNO\nNO\nNO\nYES\nYES\nNO" }, { "input": "1 1\nbbbbbbbaaaabbbbbaabbbba\naaabbbabbbbbbbaabbabbbb", "output": "NO" } ]
1,676,015,492
2,147,483,647
PyPy 3-64
OK
TESTS
41
343
46,694,400
# Use two hashes to avoid collisions import sys input = sys.stdin.readline MAXN = 6 * 10 ** 5 MOD = 10 ** 9 + 7 base = [5, 7] # hash stuff pw = [[1] * MAXN for i in range(2)] for j in range(2): for i in range(1, MAXN): pw[j][i] = pw[j][i - 1] * base[j] % MOD def hash_s(s: str): hsh = [0, 0] for j in range(2): for i, c in enumerate(s): hsh[j] = (hsh[j] + (ord(c)-ord('a')+1) * pw[j][i]) % MOD return hsh def conv_hash(hsh): return hsh[0] + hsh[1] * MOD # Main solution procedure n, m = map(int, input().split()) possible_string_hashes = set() for _ in range(n): s = input().strip() base_hash = hash_s(s) for i in range(len(s)): sc = ord(s[i]) - ord('a') for c in range(3): if sc != c: new_hsh = base_hash.copy() for j in range(2): new_hsh[j] = (new_hsh[j] + (c-sc) * pw[j][i]) % MOD possible_string_hashes.add(conv_hash(new_hsh)) for query in range(m): s = input().strip() if conv_hash(hash_s(s)) in possible_string_hashes: print("YES") else: print("NO")
Title: Watto and Mechanism Time Limit: None seconds Memory Limit: None megabytes Problem Description: Watto, the owner of a spare parts store, has recently got an order for the mechanism that can process strings in a certain way. Initially the memory of the mechanism is filled with *n* strings. Then the mechanism should be able to process queries of the following type: "Given string *s*, determine if the memory of the mechanism contains string *t* that consists of the same number of characters as *s* and differs from *s* in exactly one position". Watto has already compiled the mechanism, all that's left is to write a program for it and check it on the data consisting of *n* initial lines and *m* queries. He decided to entrust this job to you. Input Specification: The first line contains two non-negative numbers *n* and *m* (0<=≤<=*n*<=≤<=3·105, 0<=≤<=*m*<=≤<=3·105) — the number of the initial strings and the number of queries, respectively. Next follow *n* non-empty strings that are uploaded to the memory of the mechanism. Next follow *m* non-empty strings that are the queries to the mechanism. The total length of lines in the input doesn't exceed 6·105. Each line consists only of letters 'a', 'b', 'c'. Output Specification: For each query print on a single line "YES" (without the quotes), if the memory of the mechanism contains the required string, otherwise print "NO" (without the quotes). Demo Input: ['2 3\naaaaa\nacacaca\naabaa\nccacacc\ncaaac\n'] Demo Output: ['YES\nNO\nNO\n'] Note: none
```python # Use two hashes to avoid collisions import sys input = sys.stdin.readline MAXN = 6 * 10 ** 5 MOD = 10 ** 9 + 7 base = [5, 7] # hash stuff pw = [[1] * MAXN for i in range(2)] for j in range(2): for i in range(1, MAXN): pw[j][i] = pw[j][i - 1] * base[j] % MOD def hash_s(s: str): hsh = [0, 0] for j in range(2): for i, c in enumerate(s): hsh[j] = (hsh[j] + (ord(c)-ord('a')+1) * pw[j][i]) % MOD return hsh def conv_hash(hsh): return hsh[0] + hsh[1] * MOD # Main solution procedure n, m = map(int, input().split()) possible_string_hashes = set() for _ in range(n): s = input().strip() base_hash = hash_s(s) for i in range(len(s)): sc = ord(s[i]) - ord('a') for c in range(3): if sc != c: new_hsh = base_hash.copy() for j in range(2): new_hsh[j] = (new_hsh[j] + (c-sc) * pw[j][i]) % MOD possible_string_hashes.add(conv_hash(new_hsh)) for query in range(m): s = input().strip() if conv_hash(hash_s(s)) in possible_string_hashes: print("YES") else: print("NO") ```
3
71
A
Way Too Long Words
PROGRAMMING
800
[ "strings" ]
A. Way Too Long Words
1
256
Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome. Let's consider a word too long, if its length is strictly more than 10 characters. All too long words should be replaced with a special abbreviation. This abbreviation is made like this: we write down the first and the last letter of a word and between them we write the number of letters between the first and the last letters. That number is in decimal system and doesn't contain any leading zeroes. Thus, "localization" will be spelt as "l10n", and "internationalization» will be spelt as "i18n". You are suggested to automatize the process of changing the words with abbreviations. At that all too long words should be replaced by the abbreviation and the words that are not too long should not undergo any changes.
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100). Each of the following *n* lines contains one word. All the words consist of lowercase Latin letters and possess the lengths of from 1 to 100 characters.
Print *n* lines. The *i*-th line should contain the result of replacing of the *i*-th word from the input data.
[ "4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis\n" ]
[ "word\nl10n\ni18n\np43s\n" ]
none
500
[ { "input": "4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis", "output": "word\nl10n\ni18n\np43s" }, { "input": "5\nabcdefgh\nabcdefghi\nabcdefghij\nabcdefghijk\nabcdefghijklm", "output": "abcdefgh\nabcdefghi\nabcdefghij\na9k\na11m" }, { "input": "3\nnjfngnrurunrgunrunvurn\njfvnjfdnvjdbfvsbdubruvbubvkdb\nksdnvidnviudbvibd", "output": "n20n\nj27b\nk15d" }, { "input": "1\ntcyctkktcctrcyvbyiuhihhhgyvyvyvyvjvytchjckt", "output": "t41t" }, { "input": "24\nyou\nare\nregistered\nfor\npractice\nyou\ncan\nsolve\nproblems\nunofficially\nresults\ncan\nbe\nfound\nin\nthe\ncontest\nstatus\nand\nin\nthe\nbottom\nof\nstandings", "output": "you\nare\nregistered\nfor\npractice\nyou\ncan\nsolve\nproblems\nu10y\nresults\ncan\nbe\nfound\nin\nthe\ncontest\nstatus\nand\nin\nthe\nbottom\nof\nstandings" }, { "input": "1\na", "output": "a" }, { "input": "26\na\nb\nc\nd\ne\nf\ng\nh\ni\nj\nk\nl\nm\nn\no\np\nq\nr\ns\nt\nu\nv\nw\nx\ny\nz", "output": "a\nb\nc\nd\ne\nf\ng\nh\ni\nj\nk\nl\nm\nn\no\np\nq\nr\ns\nt\nu\nv\nw\nx\ny\nz" }, { "input": "1\nabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghij", "output": "a98j" }, { "input": "10\ngyartjdxxlcl\nfzsck\nuidwu\nxbymclornemdmtj\nilppyoapitawgje\ncibzc\ndrgbeu\nhezplmsdekhhbo\nfeuzlrimbqbytdu\nkgdco", "output": "g10l\nfzsck\nuidwu\nx13j\ni13e\ncibzc\ndrgbeu\nh12o\nf13u\nkgdco" }, { "input": "20\nlkpmx\nkovxmxorlgwaomlswjxlpnbvltfv\nhykasjxqyjrmybejnmeumzha\ntuevlumpqbbhbww\nqgqsphvrmupxxc\ntrissbaf\nqfgrlinkzvzqdryckaizutd\nzzqtoaxkvwoscyx\noswytrlnhpjvvnwookx\nlpuzqgec\ngyzqfwxggtvpjhzmzmdw\nrlxjgmvdftvrmvbdwudra\nvsntnjpepnvdaxiporggmglhagv\nxlvcqkqgcrbgtgglj\nlyxwxbiszyhlsrgzeedzprbmcpduvq\nyrmqqvrkqskqukzqrwukpsifgtdc\nxpuohcsjhhuhvr\nvvlfrlxpvqejngwrbfbpmqeirxlw\nsvmasocxdvadmaxtrpakysmeaympy\nyuflqboqfdt", "output": "lkpmx\nk26v\nh22a\nt13w\nq12c\ntrissbaf\nq21d\nz13x\no17x\nlpuzqgec\ng18w\nr19a\nv25v\nx15j\nl28q\ny26c\nx12r\nv26w\ns27y\ny9t" }, { "input": "100\nm\nz\ns\nv\nd\nr\nv\ny\ny\ne\np\nt\nc\na\nn\nm\np\ng\ni\nj\nc\na\nb\nq\ne\nn\nv\no\nk\nx\nf\ni\nl\na\nq\nr\nu\nb\ns\nl\nc\nl\ne\nv\nj\nm\nx\nb\na\nq\nb\na\nf\nj\nv\nm\nq\nc\nt\nt\nn\nx\no\ny\nr\nu\nh\nm\nj\np\nj\nq\nz\ns\nj\no\ng\nc\nm\nn\no\nm\nr\no\ns\nt\nh\nr\np\nk\nb\nz\ng\no\nc\nc\nz\nz\ng\nr", "output": "m\nz\ns\nv\nd\nr\nv\ny\ny\ne\np\nt\nc\na\nn\nm\np\ng\ni\nj\nc\na\nb\nq\ne\nn\nv\no\nk\nx\nf\ni\nl\na\nq\nr\nu\nb\ns\nl\nc\nl\ne\nv\nj\nm\nx\nb\na\nq\nb\na\nf\nj\nv\nm\nq\nc\nt\nt\nn\nx\no\ny\nr\nu\nh\nm\nj\np\nj\nq\nz\ns\nj\no\ng\nc\nm\nn\no\nm\nr\no\ns\nt\nh\nr\np\nk\nb\nz\ng\no\nc\nc\nz\nz\ng\nr" } ]
1,696,499,871
2,147,483,647
Python 3
OK
TESTS
20
46
0
for _ in range(int(input())): inp=input() if len(inp)<=10: print(inp) else: s="" s+=inp[0] s+=str(len(inp)-2) s+=inp[-1] print(s)
Title: Way Too Long Words Time Limit: 1 seconds Memory Limit: 256 megabytes Problem Description: Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome. Let's consider a word too long, if its length is strictly more than 10 characters. All too long words should be replaced with a special abbreviation. This abbreviation is made like this: we write down the first and the last letter of a word and between them we write the number of letters between the first and the last letters. That number is in decimal system and doesn't contain any leading zeroes. Thus, "localization" will be spelt as "l10n", and "internationalization» will be spelt as "i18n". You are suggested to automatize the process of changing the words with abbreviations. At that all too long words should be replaced by the abbreviation and the words that are not too long should not undergo any changes. Input Specification: The first line contains an integer *n* (1<=≤<=*n*<=≤<=100). Each of the following *n* lines contains one word. All the words consist of lowercase Latin letters and possess the lengths of from 1 to 100 characters. Output Specification: Print *n* lines. The *i*-th line should contain the result of replacing of the *i*-th word from the input data. Demo Input: ['4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis\n'] Demo Output: ['word\nl10n\ni18n\np43s\n'] Note: none
```python for _ in range(int(input())): inp=input() if len(inp)<=10: print(inp) else: s="" s+=inp[0] s+=str(len(inp)-2) s+=inp[-1] print(s) ```
3.977
472
A
Design Tutorial: Learn from Math
PROGRAMMING
800
[ "math", "number theory" ]
null
null
One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that. For example, there is a statement called the "Goldbach's conjecture". It says: "each even number no less than four can be expressed as the sum of two primes". Let's modify it. How about a statement like that: "each integer no less than 12 can be expressed as the sum of two composite numbers." Not like the Goldbach's conjecture, I can prove this theorem. You are given an integer *n* no less than 12, express it as a sum of two composite numbers.
The only line contains an integer *n* (12<=≤<=*n*<=≤<=106).
Output two composite integers *x* and *y* (1<=&lt;<=*x*,<=*y*<=&lt;<=*n*) such that *x*<=+<=*y*<==<=*n*. If there are multiple solutions, you can output any of them.
[ "12\n", "15\n", "23\n", "1000000\n" ]
[ "4 8\n", "6 9\n", "8 15\n", "500000 500000\n" ]
In the first example, 12 = 4 + 8 and both 4, 8 are composite numbers. You can output "6 6" or "8 4" as well. In the second example, 15 = 6 + 9. Note that you can't output "1 14" because 1 is not a composite number.
500
[ { "input": "12", "output": "4 8" }, { "input": "15", "output": "6 9" }, { "input": "23", "output": "8 15" }, { "input": "1000000", "output": "500000 500000" }, { "input": "63874", "output": "4 63870" }, { "input": "14568", "output": "4 14564" }, { "input": "192", "output": "4 188" }, { "input": "86", "output": "4 82" }, { "input": "46220", "output": "4 46216" }, { "input": "57114", "output": "4 57110" }, { "input": "869", "output": "4 865" }, { "input": "738457", "output": "4 738453" }, { "input": "58113", "output": "6 58107" }, { "input": "4864", "output": "4 4860" }, { "input": "15", "output": "6 9" }, { "input": "74752", "output": "4 74748" }, { "input": "6073", "output": "4 6069" }, { "input": "1289", "output": "4 1285" }, { "input": "20", "output": "4 16" }, { "input": "58134", "output": "4 58130" }, { "input": "57756", "output": "4 57752" }, { "input": "765", "output": "6 759" }, { "input": "59", "output": "4 55" }, { "input": "991666", "output": "4 991662" }, { "input": "70761", "output": "4 70757" }, { "input": "13", "output": "4 9" }, { "input": "999999", "output": "4 999995" }, { "input": "17", "output": "8 9" }, { "input": "21", "output": "6 15" }, { "input": "19", "output": "4 15" }, { "input": "100007", "output": "6 100001" }, { "input": "999987", "output": "6 999981" }, { "input": "22", "output": "4 18" } ]
1,684,276,322
2,147,483,647
PyPy 3-64
OK
TESTS
33
77
0
def prime(n): if n == 1 or n == 2 : return True else: p = int(n**(1/2))+1 for i in range(2,p): if n%i == 0: return False return True n = int(input()) i = 3 while prime(i) or prime(n-i) : i +=1 print(i,n-i)
Title: Design Tutorial: Learn from Math Time Limit: None seconds Memory Limit: None megabytes Problem Description: One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that. For example, there is a statement called the "Goldbach's conjecture". It says: "each even number no less than four can be expressed as the sum of two primes". Let's modify it. How about a statement like that: "each integer no less than 12 can be expressed as the sum of two composite numbers." Not like the Goldbach's conjecture, I can prove this theorem. You are given an integer *n* no less than 12, express it as a sum of two composite numbers. Input Specification: The only line contains an integer *n* (12<=≤<=*n*<=≤<=106). Output Specification: Output two composite integers *x* and *y* (1<=&lt;<=*x*,<=*y*<=&lt;<=*n*) such that *x*<=+<=*y*<==<=*n*. If there are multiple solutions, you can output any of them. Demo Input: ['12\n', '15\n', '23\n', '1000000\n'] Demo Output: ['4 8\n', '6 9\n', '8 15\n', '500000 500000\n'] Note: In the first example, 12 = 4 + 8 and both 4, 8 are composite numbers. You can output "6 6" or "8 4" as well. In the second example, 15 = 6 + 9. Note that you can't output "1 14" because 1 is not a composite number.
```python def prime(n): if n == 1 or n == 2 : return True else: p = int(n**(1/2))+1 for i in range(2,p): if n%i == 0: return False return True n = int(input()) i = 3 while prime(i) or prime(n-i) : i +=1 print(i,n-i) ```
3
439
A
Devu, the Singer and Churu, the Joker
PROGRAMMING
900
[ "greedy", "implementation" ]
null
null
Devu is a renowned classical singer. He is invited to many big functions/festivals. Recently he was invited to "All World Classical Singing Festival". Other than Devu, comedian Churu was also invited. Devu has provided organizers a list of the songs and required time for singing them. He will sing *n* songs, *i**th* song will take *t**i* minutes exactly. The Comedian, Churu will crack jokes. All his jokes are of 5 minutes exactly. People have mainly come to listen Devu. But you know that he needs rest of 10 minutes after each song. On the other hand, Churu being a very active person, doesn't need any rest. You as one of the organizers should make an optimal sсhedule for the event. For some reasons you must follow the conditions: - The duration of the event must be no more than *d* minutes; - Devu must complete all his songs; - With satisfying the two previous conditions the number of jokes cracked by Churu should be as many as possible. If it is not possible to find a way to conduct all the songs of the Devu, output -1. Otherwise find out maximum number of jokes that Churu can crack in the grand event.
The first line contains two space separated integers *n*, *d* (1<=≤<=*n*<=≤<=100; 1<=≤<=*d*<=≤<=10000). The second line contains *n* space-separated integers: *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t**i*<=≤<=100).
If there is no way to conduct all the songs of Devu, output -1. Otherwise output the maximum number of jokes that Churu can crack in the grand event.
[ "3 30\n2 2 1\n", "3 20\n2 1 1\n" ]
[ "5\n", "-1\n" ]
Consider the first example. The duration of the event is 30 minutes. There could be maximum 5 jokes in the following way: - First Churu cracks a joke in 5 minutes. - Then Devu performs the first song for 2 minutes. - Then Churu cracks 2 jokes in 10 minutes. - Now Devu performs second song for 2 minutes. - Then Churu cracks 2 jokes in 10 minutes. - Now finally Devu will perform his last song in 1 minutes. Total time spent is 5 + 2 + 10 + 2 + 10 + 1 = 30 minutes. Consider the second example. There is no way of organizing Devu's all songs. Hence the answer is -1.
500
[ { "input": "3 30\n2 2 1", "output": "5" }, { "input": "3 20\n2 1 1", "output": "-1" }, { "input": "50 10000\n5 4 10 9 9 6 7 7 7 3 3 7 7 4 7 4 10 10 1 7 10 3 1 4 5 7 2 10 10 10 2 3 4 7 6 1 8 4 7 3 8 8 4 10 1 1 9 2 6 1", "output": "1943" }, { "input": "50 10000\n4 7 15 9 11 12 20 9 14 14 10 13 6 13 14 17 6 8 20 12 10 15 13 17 5 12 13 11 7 5 5 2 3 15 13 7 14 14 19 2 13 14 5 15 3 19 15 16 4 1", "output": "1891" }, { "input": "100 9000\n5 2 3 1 1 3 4 9 9 6 7 10 10 10 2 10 6 8 8 6 7 9 9 5 6 2 1 10 10 9 4 5 9 2 4 3 8 5 6 1 1 5 3 6 2 6 6 6 5 8 3 6 7 3 1 10 9 1 8 3 10 9 5 6 3 4 1 1 10 10 2 3 4 8 10 10 5 1 5 3 6 8 10 6 10 2 1 8 10 1 7 6 9 10 5 2 3 5 3 2", "output": "1688" }, { "input": "100 8007\n5 19 14 18 9 6 15 8 1 14 11 20 3 17 7 12 2 6 3 17 7 20 1 14 20 17 2 10 13 7 18 18 9 10 16 8 1 11 11 9 13 18 9 20 12 12 7 15 12 17 11 5 11 15 9 2 15 1 18 3 18 16 15 4 10 5 18 13 13 12 3 8 17 2 12 2 13 3 1 13 2 4 9 10 18 10 14 4 4 17 12 19 2 9 6 5 5 20 18 12", "output": "1391" }, { "input": "39 2412\n1 1 1 1 1 1 26 1 1 1 99 1 1 1 1 1 1 1 1 1 1 88 7 1 1 1 1 76 1 1 1 93 40 1 13 1 68 1 32", "output": "368" }, { "input": "39 2617\n47 1 1 1 63 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 70 1 99 63 1 1 1 1 1 1 1 1 64 1 1", "output": "435" }, { "input": "39 3681\n83 77 1 94 85 47 1 98 29 16 1 1 1 71 96 85 31 97 96 93 40 50 98 1 60 51 1 96 100 72 1 1 1 89 1 93 1 92 100", "output": "326" }, { "input": "45 894\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 28 28 1 1 1 1 1 1 1 1 1 1 1 1 1 1 99 3 1 1", "output": "139" }, { "input": "45 4534\n1 99 65 99 4 46 54 80 51 30 96 1 28 30 44 70 78 1 1 100 1 62 1 1 1 85 1 1 1 61 1 46 75 1 61 77 97 26 67 1 1 63 81 85 86", "output": "514" }, { "input": "72 3538\n52 1 8 1 1 1 7 1 1 1 1 48 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 40 1 1 38 1 1 1 1 1 1 1 1 1 1 1 35 1 93 79 1 1 1 1 1 1 1 1 1 51 1 1 1 1 1 1 1 1 1 1 1 1 96 1", "output": "586" }, { "input": "81 2200\n1 59 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 93 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 50 1 1 1 1 1 1 1 1 1 1 1", "output": "384" }, { "input": "81 2577\n85 91 1 1 2 1 1 100 1 80 1 1 17 86 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 37 1 66 24 1 1 96 49 1 66 1 44 1 1 1 1 98 1 1 1 1 35 1 37 3 35 1 1 87 64 1 24 1 58 1 1 42 83 5 1 1 1 1 1 95 1 94 1 50 1 1", "output": "174" }, { "input": "81 4131\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 16 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "807" }, { "input": "81 6315\n1 1 67 100 1 99 36 1 92 5 1 96 42 12 1 57 91 1 1 66 41 30 74 95 1 37 1 39 91 69 1 52 77 47 65 1 1 93 96 74 90 35 85 76 71 92 92 1 1 67 92 74 1 1 86 76 35 1 56 16 27 57 37 95 1 40 20 100 51 1 80 60 45 79 95 1 46 1 25 100 96", "output": "490" }, { "input": "96 1688\n1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 45 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 25 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 71 1 1 1 30 1 1 1", "output": "284" }, { "input": "96 8889\n1 1 18 1 1 1 1 1 1 1 1 1 99 1 1 1 1 88 1 45 1 1 1 1 1 1 1 1 1 1 1 1 1 1 96 1 1 1 1 21 1 1 1 1 1 1 1 73 1 1 1 1 1 10 1 1 1 1 1 1 1 46 43 1 1 1 1 1 98 1 1 1 1 1 1 6 1 1 1 1 1 74 1 25 1 55 1 1 1 13 1 1 54 1 1 1", "output": "1589" }, { "input": "10 100\n1 1 1 1 1 1 1 1 1 1", "output": "18" }, { "input": "100 10000\n54 46 72 94 79 83 91 54 73 3 24 55 54 31 28 20 19 6 25 19 47 23 1 70 15 87 51 39 54 77 55 5 60 3 15 99 56 88 22 78 79 21 38 27 28 86 7 88 12 59 55 70 25 1 70 49 1 45 69 72 50 17 4 56 8 100 90 34 35 20 61 76 88 79 4 74 65 68 75 26 40 72 59 94 10 67 96 85 29 90 47 24 44 1 66 93 55 36 1 99", "output": "1017" }, { "input": "100 6000\n41 31 23 17 24 78 26 96 93 48 46 2 49 33 35 9 73 100 34 48 83 36 33 69 43 24 3 74 8 81 27 33 94 38 77 9 76 90 62 90 21 67 22 22 12 2 17 27 61 18 72 85 59 65 71 38 90 75 74 66 60 47 58 50 90 95 75 10 5 100 97 29 83 88 65 26 93 90 22 98 36 55 70 38 50 92 88 72 99 96 25 14 74 16 25 92 67 94 77 96", "output": "-1" }, { "input": "1 1\n1", "output": "0" }, { "input": "1 6\n1", "output": "1" }, { "input": "1 5\n1", "output": "0" }, { "input": "1 3\n4", "output": "-1" }, { "input": "3 24\n2 1 2", "output": "-1" } ]
1,611,390,166
2,147,483,647
Python 3
OK
TESTS
26
77
0
n,d = map(int,input().split()) a=list(map(int,input().split())) if d < (sum(a) + (len(a)-1)*10): print(-1) else: x=(d-sum(a))//5 print(x)
Title: Devu, the Singer and Churu, the Joker Time Limit: None seconds Memory Limit: None megabytes Problem Description: Devu is a renowned classical singer. He is invited to many big functions/festivals. Recently he was invited to "All World Classical Singing Festival". Other than Devu, comedian Churu was also invited. Devu has provided organizers a list of the songs and required time for singing them. He will sing *n* songs, *i**th* song will take *t**i* minutes exactly. The Comedian, Churu will crack jokes. All his jokes are of 5 minutes exactly. People have mainly come to listen Devu. But you know that he needs rest of 10 minutes after each song. On the other hand, Churu being a very active person, doesn't need any rest. You as one of the organizers should make an optimal sсhedule for the event. For some reasons you must follow the conditions: - The duration of the event must be no more than *d* minutes; - Devu must complete all his songs; - With satisfying the two previous conditions the number of jokes cracked by Churu should be as many as possible. If it is not possible to find a way to conduct all the songs of the Devu, output -1. Otherwise find out maximum number of jokes that Churu can crack in the grand event. Input Specification: The first line contains two space separated integers *n*, *d* (1<=≤<=*n*<=≤<=100; 1<=≤<=*d*<=≤<=10000). The second line contains *n* space-separated integers: *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t**i*<=≤<=100). Output Specification: If there is no way to conduct all the songs of Devu, output -1. Otherwise output the maximum number of jokes that Churu can crack in the grand event. Demo Input: ['3 30\n2 2 1\n', '3 20\n2 1 1\n'] Demo Output: ['5\n', '-1\n'] Note: Consider the first example. The duration of the event is 30 minutes. There could be maximum 5 jokes in the following way: - First Churu cracks a joke in 5 minutes. - Then Devu performs the first song for 2 minutes. - Then Churu cracks 2 jokes in 10 minutes. - Now Devu performs second song for 2 minutes. - Then Churu cracks 2 jokes in 10 minutes. - Now finally Devu will perform his last song in 1 minutes. Total time spent is 5 + 2 + 10 + 2 + 10 + 1 = 30 minutes. Consider the second example. There is no way of organizing Devu's all songs. Hence the answer is -1.
```python n,d = map(int,input().split()) a=list(map(int,input().split())) if d < (sum(a) + (len(a)-1)*10): print(-1) else: x=(d-sum(a))//5 print(x) ```
3
270
A
Fancy Fence
PROGRAMMING
1,100
[ "geometry", "implementation", "math" ]
null
null
Emuskald needs a fence around his farm, but he is too lazy to build it himself. So he purchased a fence-building robot. He wants the fence to be a regular polygon. The robot builds the fence along a single path, but it can only make fence corners at a single angle *a*. Will the robot be able to build the fence Emuskald wants? In other words, is there a regular polygon which angles are equal to *a*?
The first line of input contains an integer *t* (0<=&lt;<=*t*<=&lt;<=180) — the number of tests. Each of the following *t* lines contains a single integer *a* (0<=&lt;<=*a*<=&lt;<=180) — the angle the robot can make corners at measured in degrees.
For each test, output on a single line "YES" (without quotes), if the robot can build a fence Emuskald wants, and "NO" (without quotes), if it is impossible.
[ "3\n30\n60\n90\n" ]
[ "NO\nYES\nYES\n" ]
In the first test case, it is impossible to build the fence, since there is no regular polygon with angle <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/df5f4b07dd5316fde165b43657b2696e2919e791.png" style="max-width: 100.0%;max-height: 100.0%;"/>. In the second test case, the fence is a regular triangle, and in the last test case — a square.
500
[ { "input": "3\n30\n60\n90", "output": "NO\nYES\nYES" }, { "input": "6\n1\n2\n3\n170\n179\n25", "output": "NO\nNO\nNO\nYES\nYES\nNO" } ]
1,642,775,411
2,147,483,647
Python 3
OK
TESTS
3
92
0
for _ in range(int(input())): a = int(input()) print("YES") if 360%(180-a)==0 else print("NO")
Title: Fancy Fence Time Limit: None seconds Memory Limit: None megabytes Problem Description: Emuskald needs a fence around his farm, but he is too lazy to build it himself. So he purchased a fence-building robot. He wants the fence to be a regular polygon. The robot builds the fence along a single path, but it can only make fence corners at a single angle *a*. Will the robot be able to build the fence Emuskald wants? In other words, is there a regular polygon which angles are equal to *a*? Input Specification: The first line of input contains an integer *t* (0<=&lt;<=*t*<=&lt;<=180) — the number of tests. Each of the following *t* lines contains a single integer *a* (0<=&lt;<=*a*<=&lt;<=180) — the angle the robot can make corners at measured in degrees. Output Specification: For each test, output on a single line "YES" (without quotes), if the robot can build a fence Emuskald wants, and "NO" (without quotes), if it is impossible. Demo Input: ['3\n30\n60\n90\n'] Demo Output: ['NO\nYES\nYES\n'] Note: In the first test case, it is impossible to build the fence, since there is no regular polygon with angle <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/df5f4b07dd5316fde165b43657b2696e2919e791.png" style="max-width: 100.0%;max-height: 100.0%;"/>. In the second test case, the fence is a regular triangle, and in the last test case — a square.
```python for _ in range(int(input())): a = int(input()) print("YES") if 360%(180-a)==0 else print("NO") ```
3
535
B
Tavas and SaDDas
PROGRAMMING
1,100
[ "bitmasks", "brute force", "combinatorics", "implementation" ]
null
null
Once again Tavas started eating coffee mix without water! Keione told him that it smells awful, but he didn't stop doing that. That's why Keione told his smart friend, SaDDas to punish him! SaDDas took Tavas' headphones and told him: "If you solve the following problem, I'll return it to you." The problem is: You are given a lucky number *n*. Lucky numbers are the positive integers whose decimal representations contain only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not. If we sort all lucky numbers in increasing order, what's the 1-based index of *n*? Tavas is not as smart as SaDDas, so he asked you to do him a favor and solve this problem so he can have his headphones back.
The first and only line of input contains a lucky number *n* (1<=≤<=*n*<=≤<=109).
Print the index of *n* among all lucky numbers.
[ "4\n", "7\n", "77\n" ]
[ "1\n", "2\n", "6\n" ]
none
1,000
[ { "input": "4", "output": "1" }, { "input": "7", "output": "2" }, { "input": "77", "output": "6" }, { "input": "4", "output": "1" }, { "input": "474744", "output": "83" }, { "input": "777774", "output": "125" }, { "input": "447", "output": "8" }, { "input": "774", "output": "13" }, { "input": "4", "output": "1" }, { "input": "4447747", "output": "140" }, { "input": "7747474", "output": "233" }, { "input": "4444", "output": "15" }, { "input": "4447", "output": "16" }, { "input": "7", "output": "2" }, { "input": "4", "output": "1" }, { "input": "4447744", "output": "139" }, { "input": "77474", "output": "57" }, { "input": "7747", "output": "28" }, { "input": "444", "output": "7" }, { "input": "7", "output": "2" }, { "input": "7774477", "output": "242" }, { "input": "4477774", "output": "157" }, { "input": "7444", "output": "23" }, { "input": "7474747", "output": "212" }, { "input": "77", "output": "6" }, { "input": "774477", "output": "114" }, { "input": "7", "output": "2" }, { "input": "47", "output": "4" }, { "input": "747777", "output": "110" }, { "input": "444444444", "output": "511" }, { "input": "777777777", "output": "1022" }, { "input": "477477447", "output": "728" }, { "input": "777744747", "output": "996" } ]
1,585,882,049
2,147,483,647
Python 3
OK
TESTS
33
109
0
s = input().replace('7', '1').replace('4', '0') n = 0 for i in range(1, len(s)): n += 2**i print(n + int(s, 2) + 1)
Title: Tavas and SaDDas Time Limit: None seconds Memory Limit: None megabytes Problem Description: Once again Tavas started eating coffee mix without water! Keione told him that it smells awful, but he didn't stop doing that. That's why Keione told his smart friend, SaDDas to punish him! SaDDas took Tavas' headphones and told him: "If you solve the following problem, I'll return it to you." The problem is: You are given a lucky number *n*. Lucky numbers are the positive integers whose decimal representations contain only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not. If we sort all lucky numbers in increasing order, what's the 1-based index of *n*? Tavas is not as smart as SaDDas, so he asked you to do him a favor and solve this problem so he can have his headphones back. Input Specification: The first and only line of input contains a lucky number *n* (1<=≤<=*n*<=≤<=109). Output Specification: Print the index of *n* among all lucky numbers. Demo Input: ['4\n', '7\n', '77\n'] Demo Output: ['1\n', '2\n', '6\n'] Note: none
```python s = input().replace('7', '1').replace('4', '0') n = 0 for i in range(1, len(s)): n += 2**i print(n + int(s, 2) + 1) ```
3
472
A
Design Tutorial: Learn from Math
PROGRAMMING
800
[ "math", "number theory" ]
null
null
One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that. For example, there is a statement called the "Goldbach's conjecture". It says: "each even number no less than four can be expressed as the sum of two primes". Let's modify it. How about a statement like that: "each integer no less than 12 can be expressed as the sum of two composite numbers." Not like the Goldbach's conjecture, I can prove this theorem. You are given an integer *n* no less than 12, express it as a sum of two composite numbers.
The only line contains an integer *n* (12<=≤<=*n*<=≤<=106).
Output two composite integers *x* and *y* (1<=&lt;<=*x*,<=*y*<=&lt;<=*n*) such that *x*<=+<=*y*<==<=*n*. If there are multiple solutions, you can output any of them.
[ "12\n", "15\n", "23\n", "1000000\n" ]
[ "4 8\n", "6 9\n", "8 15\n", "500000 500000\n" ]
In the first example, 12 = 4 + 8 and both 4, 8 are composite numbers. You can output "6 6" or "8 4" as well. In the second example, 15 = 6 + 9. Note that you can't output "1 14" because 1 is not a composite number.
500
[ { "input": "12", "output": "4 8" }, { "input": "15", "output": "6 9" }, { "input": "23", "output": "8 15" }, { "input": "1000000", "output": "500000 500000" }, { "input": "63874", "output": "4 63870" }, { "input": "14568", "output": "4 14564" }, { "input": "192", "output": "4 188" }, { "input": "86", "output": "4 82" }, { "input": "46220", "output": "4 46216" }, { "input": "57114", "output": "4 57110" }, { "input": "869", "output": "4 865" }, { "input": "738457", "output": "4 738453" }, { "input": "58113", "output": "6 58107" }, { "input": "4864", "output": "4 4860" }, { "input": "15", "output": "6 9" }, { "input": "74752", "output": "4 74748" }, { "input": "6073", "output": "4 6069" }, { "input": "1289", "output": "4 1285" }, { "input": "20", "output": "4 16" }, { "input": "58134", "output": "4 58130" }, { "input": "57756", "output": "4 57752" }, { "input": "765", "output": "6 759" }, { "input": "59", "output": "4 55" }, { "input": "991666", "output": "4 991662" }, { "input": "70761", "output": "4 70757" }, { "input": "13", "output": "4 9" }, { "input": "999999", "output": "4 999995" }, { "input": "17", "output": "8 9" }, { "input": "21", "output": "6 15" }, { "input": "19", "output": "4 15" }, { "input": "100007", "output": "6 100001" }, { "input": "999987", "output": "6 999981" }, { "input": "22", "output": "4 18" } ]
1,680,014,440
2,147,483,647
Python 3
OK
TESTS
33
46
0
#문제가 제대로 이해는 안됐지만.. 합성수로 나타내라는 조건하에 #8을 기준으로 잡는 풀이방법 x=int(input()) a=8+x%2 b=x-a print(a,b)
Title: Design Tutorial: Learn from Math Time Limit: None seconds Memory Limit: None megabytes Problem Description: One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that. For example, there is a statement called the "Goldbach's conjecture". It says: "each even number no less than four can be expressed as the sum of two primes". Let's modify it. How about a statement like that: "each integer no less than 12 can be expressed as the sum of two composite numbers." Not like the Goldbach's conjecture, I can prove this theorem. You are given an integer *n* no less than 12, express it as a sum of two composite numbers. Input Specification: The only line contains an integer *n* (12<=≤<=*n*<=≤<=106). Output Specification: Output two composite integers *x* and *y* (1<=&lt;<=*x*,<=*y*<=&lt;<=*n*) such that *x*<=+<=*y*<==<=*n*. If there are multiple solutions, you can output any of them. Demo Input: ['12\n', '15\n', '23\n', '1000000\n'] Demo Output: ['4 8\n', '6 9\n', '8 15\n', '500000 500000\n'] Note: In the first example, 12 = 4 + 8 and both 4, 8 are composite numbers. You can output "6 6" or "8 4" as well. In the second example, 15 = 6 + 9. Note that you can't output "1 14" because 1 is not a composite number.
```python #문제가 제대로 이해는 안됐지만.. 합성수로 나타내라는 조건하에 #8을 기준으로 잡는 풀이방법 x=int(input()) a=8+x%2 b=x-a print(a,b) ```
3
667
A
Pouring Rain
PROGRAMMING
1,100
[ "geometry", "math" ]
null
null
A lot of people in Berland hates rain, but you do not. Rain pacifies, puts your thoughts in order. By these years you have developed a good tradition — when it rains, you go on the street and stay silent for a moment, contemplate all around you, enjoy freshness, think about big deeds you have to do. Today everything had changed quietly. You went on the street with a cup contained water, your favorite drink. In a moment when you were drinking a water you noticed that the process became quite long: the cup still contained water because of rain. You decided to make a formal model of what was happening and to find if it was possible to drink all water in that situation. Thus, your cup is a cylinder with diameter equals *d* centimeters. Initial level of water in cup equals *h* centimeters from the bottom. You drink a water with a speed equals *v* milliliters per second. But rain goes with such speed that if you do not drink a water from the cup, the level of water increases on *e* centimeters per second. The process of drinking water from the cup and the addition of rain to the cup goes evenly and continuously. Find the time needed to make the cup empty or find that it will never happen. It is guaranteed that if it is possible to drink all water, it will happen not later than after 104 seconds. Note one milliliter equals to one cubic centimeter.
The only line of the input contains four integer numbers *d*,<=*h*,<=*v*,<=*e* (1<=≤<=*d*,<=*h*,<=*v*,<=*e*<=≤<=104), where: - *d* — the diameter of your cylindrical cup, - *h* — the initial level of water in the cup, - *v* — the speed of drinking process from the cup in milliliters per second, - *e* — the growth of water because of rain if you do not drink from the cup.
If it is impossible to make the cup empty, print "NO" (without quotes). Otherwise print "YES" (without quotes) in the first line. In the second line print a real number — time in seconds needed the cup will be empty. The answer will be considered correct if its relative or absolute error doesn't exceed 10<=-<=4. It is guaranteed that if the answer exists, it doesn't exceed 104.
[ "1 2 3 100\n", "1 1 1 1\n" ]
[ "NO\n", "YES\n3.659792366325\n" ]
In the first example the water fills the cup faster than you can drink from it. In the second example area of the cup's bottom equals to <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/419dc74dcd7bc392019c9fe748fe1fdb08ab521a.png" style="max-width: 100.0%;max-height: 100.0%;"/>, thus we can conclude that you decrease the level of water by <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/e8edb237e1f805fe83c2f47e48d3a9d03f2ee304.png" style="max-width: 100.0%;max-height: 100.0%;"/> centimeters per second. At the same time water level increases by 1 centimeter per second due to rain. Thus, cup will be empty in <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/9dae615d7e2c5c7c03cb478848fb06aba1a8942e.png" style="max-width: 100.0%;max-height: 100.0%;"/> seconds.
500
[ { "input": "1 2 3 100", "output": "NO" }, { "input": "1 1 1 1", "output": "YES\n3.659792366325" }, { "input": "48 7946 7992 72", "output": "NO" }, { "input": "72 6791 8546 46", "output": "NO" }, { "input": "100 5635 9099 23", "output": "NO" }, { "input": "20 287 3845 5", "output": "YES\n39.646277165210" }, { "input": "48 6428 9807 83", "output": "NO" }, { "input": "72 5272 4552 64", "output": "NO" }, { "input": "100 4117 5106 34", "output": "NO" }, { "input": "20 2961 9852 15", "output": "YES\n180.991437129723" }, { "input": "48 1805 3109 93", "output": "NO" }, { "input": "72 8534 7042 65", "output": "NO" }, { "input": "1 47 80 68", "output": "YES\n1.388102806810" }, { "input": "4 495 8813 1", "output": "YES\n0.706823517575" }, { "input": "5 2797 5925 9", "output": "YES\n9.553973511669" }, { "input": "1 8324 4362 23", "output": "YES\n1.505007106354" }, { "input": "6 1976 8455 3", "output": "YES\n6.674898722265" }, { "input": "7 2644 8080 5", "output": "YES\n12.900417790197" }, { "input": "3 4183 5491 98", "output": "YES\n6.162185601824" }, { "input": "2 8591 320 101", "output": "YES\n9999.259991757254" }, { "input": "10000 10000 10000 10000", "output": "NO" }, { "input": "2 5000 12 3", "output": "YES\n6099.653943875812" }, { "input": "10 1000 100 1", "output": "YES\n3659.792366325487" } ]
1,671,287,217
2,147,483,647
PyPy 3-64
OK
TESTS
23
46
0
import math d, h, v, e = map(int, input().split()) drink_s = (4 * v) / (math.pi * (d**2)) if drink_s > e: print("YES") result = (h / (drink_s - e)) print(round(result, 12)) else: print("NO")
Title: Pouring Rain Time Limit: None seconds Memory Limit: None megabytes Problem Description: A lot of people in Berland hates rain, but you do not. Rain pacifies, puts your thoughts in order. By these years you have developed a good tradition — when it rains, you go on the street and stay silent for a moment, contemplate all around you, enjoy freshness, think about big deeds you have to do. Today everything had changed quietly. You went on the street with a cup contained water, your favorite drink. In a moment when you were drinking a water you noticed that the process became quite long: the cup still contained water because of rain. You decided to make a formal model of what was happening and to find if it was possible to drink all water in that situation. Thus, your cup is a cylinder with diameter equals *d* centimeters. Initial level of water in cup equals *h* centimeters from the bottom. You drink a water with a speed equals *v* milliliters per second. But rain goes with such speed that if you do not drink a water from the cup, the level of water increases on *e* centimeters per second. The process of drinking water from the cup and the addition of rain to the cup goes evenly and continuously. Find the time needed to make the cup empty or find that it will never happen. It is guaranteed that if it is possible to drink all water, it will happen not later than after 104 seconds. Note one milliliter equals to one cubic centimeter. Input Specification: The only line of the input contains four integer numbers *d*,<=*h*,<=*v*,<=*e* (1<=≤<=*d*,<=*h*,<=*v*,<=*e*<=≤<=104), where: - *d* — the diameter of your cylindrical cup, - *h* — the initial level of water in the cup, - *v* — the speed of drinking process from the cup in milliliters per second, - *e* — the growth of water because of rain if you do not drink from the cup. Output Specification: If it is impossible to make the cup empty, print "NO" (without quotes). Otherwise print "YES" (without quotes) in the first line. In the second line print a real number — time in seconds needed the cup will be empty. The answer will be considered correct if its relative or absolute error doesn't exceed 10<=-<=4. It is guaranteed that if the answer exists, it doesn't exceed 104. Demo Input: ['1 2 3 100\n', '1 1 1 1\n'] Demo Output: ['NO\n', 'YES\n3.659792366325\n'] Note: In the first example the water fills the cup faster than you can drink from it. In the second example area of the cup's bottom equals to <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/419dc74dcd7bc392019c9fe748fe1fdb08ab521a.png" style="max-width: 100.0%;max-height: 100.0%;"/>, thus we can conclude that you decrease the level of water by <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/e8edb237e1f805fe83c2f47e48d3a9d03f2ee304.png" style="max-width: 100.0%;max-height: 100.0%;"/> centimeters per second. At the same time water level increases by 1 centimeter per second due to rain. Thus, cup will be empty in <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/9dae615d7e2c5c7c03cb478848fb06aba1a8942e.png" style="max-width: 100.0%;max-height: 100.0%;"/> seconds.
```python import math d, h, v, e = map(int, input().split()) drink_s = (4 * v) / (math.pi * (d**2)) if drink_s > e: print("YES") result = (h / (drink_s - e)) print(round(result, 12)) else: print("NO") ```
3
59
A
Word
PROGRAMMING
800
[ "implementation", "strings" ]
A. Word
2
256
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
[ "HoUse\n", "ViP\n", "maTRIx\n" ]
[ "house\n", "VIP\n", "matrix\n" ]
none
500
[ { "input": "HoUse", "output": "house" }, { "input": "ViP", "output": "VIP" }, { "input": "maTRIx", "output": "matrix" }, { "input": "BNHWpnpawg", "output": "bnhwpnpawg" }, { "input": "VTYGP", "output": "VTYGP" }, { "input": "CHNenu", "output": "chnenu" }, { "input": "ERPZGrodyu", "output": "erpzgrodyu" }, { "input": "KSXBXWpebh", "output": "KSXBXWPEBH" }, { "input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv", "output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv" }, { "input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd", "output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd" }, { "input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv", "output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv" }, { "input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg", "output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg" }, { "input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak", "output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK" }, { "input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw", "output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW" }, { "input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB", "output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB" }, { "input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge", "output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge" }, { "input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw", "output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw" }, { "input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks", "output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks" }, { "input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz", "output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ" }, { "input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg", "output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG" }, { "input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO", "output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO" }, { "input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd", "output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD" }, { "input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas", "output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas" }, { "input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm", "output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM" }, { "input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn", "output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn" }, { "input": "t", "output": "t" }, { "input": "N", "output": "N" }, { "input": "kv", "output": "kv" }, { "input": "Ur", "output": "ur" }, { "input": "CN", "output": "CN" } ]
1,669,116,016
2,147,483,647
Python 3
OK
TESTS
30
92
0
k=input() cl=0 cu=0 for i in k: if i.islower(): cl=cl+1 if i.isupper(): cu=cu+1 if cl>cu: print(k.lower()) if cl<cu: print(k.upper()) if cl==cu: print(k.lower())
Title: Word Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word. Input Specification: The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100. Output Specification: Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one. Demo Input: ['HoUse\n', 'ViP\n', 'maTRIx\n'] Demo Output: ['house\n', 'VIP\n', 'matrix\n'] Note: none
```python k=input() cl=0 cu=0 for i in k: if i.islower(): cl=cl+1 if i.isupper(): cu=cu+1 if cl>cu: print(k.lower()) if cl<cu: print(k.upper()) if cl==cu: print(k.lower()) ```
3.977
731
A
Night at the Museum
PROGRAMMING
800
[ "implementation", "strings" ]
null
null
Grigoriy, like the hero of one famous comedy film, found a job as a night security guard at the museum. At first night he received embosser and was to take stock of the whole exposition. Embosser is a special devise that allows to "print" the text of a plastic tape. Text is printed sequentially, character by character. The device consists of a wheel with a lowercase English letters written in a circle, static pointer to the current letter and a button that print the chosen letter. At one move it's allowed to rotate the alphabetic wheel one step clockwise or counterclockwise. Initially, static pointer points to letter 'a'. Other letters are located as shown on the picture: After Grigoriy add new item to the base he has to print its name on the plastic tape and attach it to the corresponding exhibit. It's not required to return the wheel to its initial position with pointer on the letter 'a'. Our hero is afraid that some exhibits may become alive and start to attack him, so he wants to print the names as fast as possible. Help him, for the given string find the minimum number of rotations of the wheel required to print it.
The only line of input contains the name of some exhibit — the non-empty string consisting of no more than 100 characters. It's guaranteed that the string consists of only lowercase English letters.
Print one integer — the minimum number of rotations of the wheel, required to print the name given in the input.
[ "zeus\n", "map\n", "ares\n" ]
[ "18\n", "35\n", "34\n" ]
To print the string from the first sample it would be optimal to perform the following sequence of rotations: 1. from 'a' to 'z' (1 rotation counterclockwise), 1. from 'z' to 'e' (5 clockwise rotations), 1. from 'e' to 'u' (10 rotations counterclockwise), 1. from 'u' to 's' (2 counterclockwise rotations).
500
[ { "input": "zeus", "output": "18" }, { "input": "map", "output": "35" }, { "input": "ares", "output": "34" }, { "input": "l", "output": "11" }, { "input": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuv", "output": "99" }, { "input": "gngvi", "output": "44" }, { "input": "aaaaa", "output": "0" }, { "input": "a", "output": "0" }, { "input": "z", "output": "1" }, { "input": "vyadeehhikklnoqrs", "output": "28" }, { "input": "jjiihhhhgggfedcccbazyxx", "output": "21" }, { "input": "fyyptqqxuciqvwdewyppjdzur", "output": "117" }, { "input": "fqcnzmzmbobmancqcoalzmanaobpdse", "output": "368" }, { "input": "zzzzzaaaaaaazzzzzzaaaaaaazzzzzzaaaazzzza", "output": "8" }, { "input": "aucnwhfixuruefkypvrvnvznwtjgwlghoqtisbkhuwxmgzuljvqhmnwzisnsgjhivnjmbknptxatdkelhzkhsuxzrmlcpeoyukiy", "output": "644" }, { "input": "sssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss", "output": "8" }, { "input": "nypjygrdtpzpigzyrisqeqfriwgwlengnezppgttgtndbrryjdl", "output": "421" }, { "input": "pnllnnmmmmoqqqqqrrtssssuuvtsrpopqoonllmonnnpppopnonoopooqpnopppqppqstuuuwwwwvxzxzzaa", "output": "84" }, { "input": "btaoahqgxnfsdmzsjxgvdwjukcvereqeskrdufqfqgzqfsftdqcthtkcnaipftcnco", "output": "666" }, { "input": "eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeerrrrrrrrrrrrrrrrwwwwwwwwww", "output": "22" }, { "input": "uyknzcrwjyzmscqucclvacmorepdgmnyhmakmmnygqwglrxkxhkpansbmruwxdeoprxzmpsvwackopujxbbkpwyeggsvjykpxh", "output": "643" }, { "input": "gzwpooohffcxwtpjgfzwtooiccxsrrokezutoojdzwsrmmhecaxwrojcbyrqlfdwwrliiib", "output": "245" }, { "input": "dbvnkktasjdwqsrzfwwtmjgbcxggdxsoeilecihduypktkkbwfbruxzzhlttrssicgdwqruddwrlbtxgmhdbatzvdxbbro", "output": "468" }, { "input": "mdtvowlktxzzbuaeiuebfeorgbdczauxsovbucactkvyvemsknsjfhifqgycqredzchipmkvzbxdjkcbyukomjlzvxzoswumned", "output": "523" }, { "input": "kkkkkkkaaaaxxaaaaaaaxxxxxxxxaaaaaaxaaaaaaaaaakkkkkkkkkaaaaaaannnnnxxxxkkkkkkkkaannnnnnna", "output": "130" }, { "input": "dffiknqqrsvwzcdgjkmpqtuwxadfhkkkmpqrtwxyadfggjmpppsuuwyyzcdgghhknnpsvvvwwwyabccffiloqruwwyyzabeeehh", "output": "163" }, { "input": "qpppmmkjihgecbyvvsppnnnkjiffeebaaywutrrqpmkjhgddbzzzywtssssqnmmljheddbbaxvusrqonmlifedbbzyywwtqnkheb", "output": "155" }, { "input": "wvvwwwvvwxxxyyyxxwwvwwvuttttttuvvwxxwxxyxxwwwwwvvuttssrssstsssssrqpqqppqrssrsrrssrssssrrsrqqrrqpppqp", "output": "57" }, { "input": "dqcpcobpcobnznamznamzlykxkxlxlylzmaobnaobpbnanbpcoaobnboaoboanzlymzmykylymylzlylymanboanaocqdqesfrfs", "output": "1236" }, { "input": "nnnnnnnnnnnnnnnnnnnnaaaaaaaaaaaaaaaaaaaakkkkkkkkkkkkkkkkkkkkkkaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxx", "output": "49" }, { "input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "output": "0" }, { "input": "cgilqsuwzaffilptwwbgmnttyyejkorxzflqvzbddhmnrvxchijpuwaeiimosxyycejlpquuwbfkpvbgijkqvxybdjjjptxcfkqt", "output": "331" }, { "input": "ufsepwgtzgtgjssxaitgpailuvgqweoppszjwhoxdhhhpwwdorwfrdjwcdekxiktwziqwbkvbknrtvajpyeqbjvhiikxxaejjpte", "output": "692" }, { "input": "uhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuh", "output": "1293" }, { "input": "vvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvgggggggggggggggggggggggggggggggggggggggggggggggggg", "output": "16" }, { "input": "lyidmjyzbszgiwkxhhpnnthfwcvvstueionspfrvqgkvngmwyhezlosrpdnbvtcjjxxsykixwnepbumaacdzadlqhnjlcejovple", "output": "616" }, { "input": "etzqqbaveffalkdguunfmyyrzkccnxmlluxeasqmopxzfvlkbhipqdwjgrttoemruohgwukfisdhznqyvhswbbypoxgtxyappcrl", "output": "605" }, { "input": "lizussgedcbdjhrbeskhgatyozvwwekanlggcstijrniivupmcoofbaxfqrxddyzzptwxcftlhajsmmkkriarrqtkoauhcqefyud", "output": "549" }, { "input": "dvjuvgfdogpknmbowlsfjzcimnygbtjiucyeeroqwhmzwpjqxlbjkqawrdtmvxbiqufllfuqibxvmtdrwaqkjblxqjpwzmhwqore", "output": "688" }, { "input": "eeycuijtbgynmiczjfslwobmnkpgodfgvujvduyfeqchuaoktqrrairkkmmsjahltfcxwtpzzyddxrqfxabfoocmpuviinrjitsc", "output": "604" }, { "input": "cgglnakewwvzoytaghksebrhjdbcdegssuzilrcppayxtgxopybbwshvyqnzhdsifkuwghourmeottrgjwdqpihbklvfzxpomqsa", "output": "572" }, { "input": "aexullmxncckzryymfnuugdklaffevabqqztelpvojecljnhqldazdcaamubpenwxikysxxjjctvbndprsolzehywmgnvkgqvrfp", "output": "609" }, { "input": "psnoieutsvvcwfhtnnphhxkwigzsbzyjmdiyl", "output": "223" }, { "input": "aa", "output": "0" } ]
1,683,672,028
2,147,483,647
Python 3
OK
TESTS
44
46
0
""" contest= https://codeforces.com/contest/731/problem/A date= Thursday, May 11, 2023 Verdict = """ w='a'+input() x=0 for i in range(len(w)-1): tem_1= abs((ord(w[i])%ord('a') ) -(ord(w[i+1])%ord('a') )) tem_2= abs(tem_1-26) x+= min (tem_1 , tem_2 ) print(x)
Title: Night at the Museum Time Limit: None seconds Memory Limit: None megabytes Problem Description: Grigoriy, like the hero of one famous comedy film, found a job as a night security guard at the museum. At first night he received embosser and was to take stock of the whole exposition. Embosser is a special devise that allows to "print" the text of a plastic tape. Text is printed sequentially, character by character. The device consists of a wheel with a lowercase English letters written in a circle, static pointer to the current letter and a button that print the chosen letter. At one move it's allowed to rotate the alphabetic wheel one step clockwise or counterclockwise. Initially, static pointer points to letter 'a'. Other letters are located as shown on the picture: After Grigoriy add new item to the base he has to print its name on the plastic tape and attach it to the corresponding exhibit. It's not required to return the wheel to its initial position with pointer on the letter 'a'. Our hero is afraid that some exhibits may become alive and start to attack him, so he wants to print the names as fast as possible. Help him, for the given string find the minimum number of rotations of the wheel required to print it. Input Specification: The only line of input contains the name of some exhibit — the non-empty string consisting of no more than 100 characters. It's guaranteed that the string consists of only lowercase English letters. Output Specification: Print one integer — the minimum number of rotations of the wheel, required to print the name given in the input. Demo Input: ['zeus\n', 'map\n', 'ares\n'] Demo Output: ['18\n', '35\n', '34\n'] Note: To print the string from the first sample it would be optimal to perform the following sequence of rotations: 1. from 'a' to 'z' (1 rotation counterclockwise), 1. from 'z' to 'e' (5 clockwise rotations), 1. from 'e' to 'u' (10 rotations counterclockwise), 1. from 'u' to 's' (2 counterclockwise rotations).
```python """ contest= https://codeforces.com/contest/731/problem/A date= Thursday, May 11, 2023 Verdict = """ w='a'+input() x=0 for i in range(len(w)-1): tem_1= abs((ord(w[i])%ord('a') ) -(ord(w[i+1])%ord('a') )) tem_2= abs(tem_1-26) x+= min (tem_1 , tem_2 ) print(x) ```
3
922
A
Cloning Toys
PROGRAMMING
1,300
[ "implementation" ]
null
null
Imp likes his plush toy a lot. Recently, he found a machine that can clone plush toys. Imp knows that if he applies the machine to an original toy, he additionally gets one more original toy and one copy, and if he applies the machine to a copied toy, he gets two additional copies. Initially, Imp has only one original toy. He wants to know if it is possible to use machine to get exactly *x* copied toys and *y* original toys? He can't throw toys away, and he can't apply the machine to a copy if he doesn't currently have any copies.
The only line contains two integers *x* and *y* (0<=≤<=*x*,<=*y*<=≤<=109) — the number of copies and the number of original toys Imp wants to get (including the initial one).
Print "Yes", if the desired configuration is possible, and "No" otherwise. You can print each letter in arbitrary case (upper or lower).
[ "6 3\n", "4 2\n", "1000 1001\n" ]
[ "Yes\n", "No\n", "Yes\n" ]
In the first example, Imp has to apply the machine twice to original toys and then twice to copies.
500
[ { "input": "6 3", "output": "Yes" }, { "input": "4 2", "output": "No" }, { "input": "1000 1001", "output": "Yes" }, { "input": "1000000000 999999999", "output": "Yes" }, { "input": "81452244 81452247", "output": "No" }, { "input": "188032448 86524683", "output": "Yes" }, { "input": "365289629 223844571", "output": "No" }, { "input": "247579518 361164458", "output": "No" }, { "input": "424836699 793451637", "output": "No" }, { "input": "602093880 930771525", "output": "No" }, { "input": "779351061 773124120", "output": "Yes" }, { "input": "661640950 836815080", "output": "No" }, { "input": "543930839 974134967", "output": "No" }, { "input": "16155311 406422145", "output": "No" }, { "input": "81601559 445618240", "output": "No" }, { "input": "963891449 582938127", "output": "No" }, { "input": "141148629 351661795", "output": "No" }, { "input": "318405810 783948974", "output": "No" }, { "input": "495662991 921268861", "output": "No" }, { "input": "1 0", "output": "No" }, { "input": "0 1", "output": "Yes" }, { "input": "0 0", "output": "No" }, { "input": "453462237 167520068", "output": "Yes" }, { "input": "630719418 9872663", "output": "Yes" }, { "input": "807976599 442159843", "output": "No" }, { "input": "690266488 579479730", "output": "No" }, { "input": "771581370 589752968", "output": "No" }, { "input": "948838551 727072855", "output": "No" }, { "input": "831128440 790763814", "output": "No" }, { "input": "303352912 928083702", "output": "No" }, { "input": "185642801 65403588", "output": "Yes" }, { "input": "67932690 202723476", "output": "No" }, { "input": "540157163 340043363", "output": "No" }, { "input": "422447052 772330542", "output": "No" }, { "input": "599704233 541054210", "output": "Yes" }, { "input": "481994122 678374097", "output": "No" }, { "input": "48564714 743566477", "output": "No" }, { "input": "225821895 880886365", "output": "No" }, { "input": "403079076 313173543", "output": "Yes" }, { "input": "1000000000 1000000000", "output": "No" }, { "input": "1 1", "output": "No" }, { "input": "1 2", "output": "Yes" }, { "input": "2 1", "output": "No" }, { "input": "2 2", "output": "No" }, { "input": "2 0", "output": "No" }, { "input": "0 2", "output": "No" }, { "input": "1000000000 1", "output": "No" }, { "input": "777777 0", "output": "No" }, { "input": "10 1", "output": "No" }, { "input": "7 0", "output": "No" }, { "input": "3 0", "output": "No" }, { "input": "3 2", "output": "Yes" } ]
1,589,968,385
2,147,483,647
PyPy 3
OK
TESTS
52
140
0
n, m = map(int, input().split()) if m < 1: print('No') elif m == 1: if n == 0: print('YES') else: print('No') else: n -= m-1 #print(n) if n >= 0 and n%2 == 0: print('Yes') else: print('No')
Title: Cloning Toys Time Limit: None seconds Memory Limit: None megabytes Problem Description: Imp likes his plush toy a lot. Recently, he found a machine that can clone plush toys. Imp knows that if he applies the machine to an original toy, he additionally gets one more original toy and one copy, and if he applies the machine to a copied toy, he gets two additional copies. Initially, Imp has only one original toy. He wants to know if it is possible to use machine to get exactly *x* copied toys and *y* original toys? He can't throw toys away, and he can't apply the machine to a copy if he doesn't currently have any copies. Input Specification: The only line contains two integers *x* and *y* (0<=≤<=*x*,<=*y*<=≤<=109) — the number of copies and the number of original toys Imp wants to get (including the initial one). Output Specification: Print "Yes", if the desired configuration is possible, and "No" otherwise. You can print each letter in arbitrary case (upper or lower). Demo Input: ['6 3\n', '4 2\n', '1000 1001\n'] Demo Output: ['Yes\n', 'No\n', 'Yes\n'] Note: In the first example, Imp has to apply the machine twice to original toys and then twice to copies.
```python n, m = map(int, input().split()) if m < 1: print('No') elif m == 1: if n == 0: print('YES') else: print('No') else: n -= m-1 #print(n) if n >= 0 and n%2 == 0: print('Yes') else: print('No') ```
3
25
A
IQ test
PROGRAMMING
1,300
[ "brute force" ]
A. IQ test
2
256
Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness.
The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness.
Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order.
[ "5\n2 4 7 8 10\n", "4\n1 2 1 1\n" ]
[ "3\n", "2\n" ]
none
0
[ { "input": "5\n2 4 7 8 10", "output": "3" }, { "input": "4\n1 2 1 1", "output": "2" }, { "input": "3\n1 2 2", "output": "1" }, { "input": "3\n100 99 100", "output": "2" }, { "input": "3\n5 3 2", "output": "3" }, { "input": "4\n43 28 1 91", "output": "2" }, { "input": "4\n75 13 94 77", "output": "3" }, { "input": "4\n97 8 27 3", "output": "2" }, { "input": "10\n95 51 12 91 85 3 1 31 25 7", "output": "3" }, { "input": "20\n88 96 66 51 14 88 2 92 18 72 18 88 20 30 4 82 90 100 24 46", "output": "4" }, { "input": "30\n20 94 56 50 10 98 52 32 14 22 24 60 4 8 98 46 34 68 82 82 98 90 50 20 78 49 52 94 64 36", "output": "26" }, { "input": "50\n79 27 77 57 37 45 27 49 65 33 57 21 71 19 75 85 65 61 23 97 85 9 23 1 9 3 99 77 77 21 79 69 15 37 15 7 93 81 13 89 91 31 45 93 15 97 55 80 85 83", "output": "48" }, { "input": "60\n46 11 73 65 3 69 3 53 43 53 97 47 55 93 31 75 35 3 9 73 23 31 3 81 91 79 61 21 15 11 11 11 81 7 83 75 39 87 83 59 89 55 93 27 49 67 67 29 1 93 11 17 9 19 35 21 63 31 31 25", "output": "1" }, { "input": "70\n28 42 42 92 64 54 22 38 38 78 62 38 4 38 14 66 4 92 66 58 94 26 4 44 41 88 48 82 44 26 74 44 48 4 16 92 34 38 26 64 94 4 30 78 50 54 12 90 8 16 80 98 28 100 74 50 36 42 92 18 76 98 8 22 2 50 58 50 64 46", "output": "25" }, { "input": "100\n43 35 79 53 13 91 91 45 65 83 57 9 42 39 85 45 71 51 61 59 31 13 63 39 25 21 79 39 91 67 21 61 97 75 93 83 29 79 59 97 11 37 63 51 39 55 91 23 21 17 47 23 35 75 49 5 69 99 5 7 41 17 25 89 15 79 21 63 53 81 43 91 59 91 69 99 85 15 91 51 49 37 65 7 89 81 21 93 61 63 97 93 45 17 13 69 57 25 75 73", "output": "13" }, { "input": "100\n50 24 68 60 70 30 52 22 18 74 68 98 20 82 4 46 26 68 100 78 84 58 74 98 38 88 68 86 64 80 82 100 20 22 98 98 52 6 94 10 48 68 2 18 38 22 22 82 44 20 66 72 36 58 64 6 36 60 4 96 76 64 12 90 10 58 64 60 74 28 90 26 24 60 40 58 2 16 76 48 58 36 82 60 24 44 4 78 28 38 8 12 40 16 38 6 66 24 31 76", "output": "99" }, { "input": "100\n47 48 94 48 14 18 94 36 96 22 12 30 94 20 48 98 40 58 2 94 8 36 98 18 98 68 2 60 76 38 18 100 8 72 100 68 2 86 92 72 58 16 48 14 6 58 72 76 6 88 80 66 20 28 74 62 86 68 90 86 2 56 34 38 56 90 4 8 76 44 32 86 12 98 38 34 54 92 70 94 10 24 82 66 90 58 62 2 32 58 100 22 58 72 2 22 68 72 42 14", "output": "1" }, { "input": "99\n38 20 68 60 84 16 28 88 60 48 80 28 4 92 70 60 46 46 20 34 12 100 76 2 40 10 8 86 6 80 50 66 12 34 14 28 26 70 46 64 34 96 10 90 98 96 56 88 50 74 70 94 2 94 24 66 68 46 22 30 6 10 64 32 88 14 98 100 64 58 50 18 50 50 8 38 8 16 54 2 60 54 62 84 92 98 4 72 66 26 14 88 99 16 10 6 88 56 22", "output": "93" }, { "input": "99\n50 83 43 89 53 47 69 1 5 37 63 87 95 15 55 95 75 89 33 53 89 75 93 75 11 85 49 29 11 97 49 67 87 11 25 37 97 73 67 49 87 43 53 97 43 29 53 33 45 91 37 73 39 49 59 5 21 43 87 35 5 63 89 57 63 47 29 99 19 85 13 13 3 13 43 19 5 9 61 51 51 57 15 89 13 97 41 13 99 79 13 27 97 95 73 33 99 27 23", "output": "1" }, { "input": "98\n61 56 44 30 58 14 20 24 88 28 46 56 96 52 58 42 94 50 46 30 46 80 72 88 68 16 6 60 26 90 10 98 76 20 56 40 30 16 96 20 88 32 62 30 74 58 36 76 60 4 24 36 42 54 24 92 28 14 2 74 86 90 14 52 34 82 40 76 8 64 2 56 10 8 78 16 70 86 70 42 70 74 22 18 76 98 88 28 62 70 36 72 20 68 34 48 80 98", "output": "1" }, { "input": "98\n66 26 46 42 78 32 76 42 26 82 8 12 4 10 24 26 64 44 100 46 94 64 30 18 88 28 8 66 30 82 82 28 74 52 62 80 80 60 94 86 64 32 44 88 92 20 12 74 94 28 34 58 4 22 16 10 94 76 82 58 40 66 22 6 30 32 92 54 16 76 74 98 18 48 48 30 92 2 16 42 84 74 30 60 64 52 50 26 16 86 58 96 79 60 20 62 82 94", "output": "93" }, { "input": "95\n9 31 27 93 17 77 75 9 9 53 89 39 51 99 5 1 11 39 27 49 91 17 27 79 81 71 37 75 35 13 93 4 99 55 85 11 23 57 5 43 5 61 15 35 23 91 3 81 99 85 43 37 39 27 5 67 7 33 75 59 13 71 51 27 15 93 51 63 91 53 43 99 25 47 17 71 81 15 53 31 59 83 41 23 73 25 91 91 13 17 25 13 55 57 29", "output": "32" }, { "input": "100\n91 89 81 45 53 1 41 3 77 93 55 97 55 97 87 27 69 95 73 41 93 21 75 35 53 56 5 51 87 59 91 67 33 3 99 45 83 17 97 47 75 97 7 89 17 99 23 23 81 25 55 97 27 35 69 5 77 35 93 19 55 59 37 21 31 37 49 41 91 53 73 69 7 37 37 39 17 71 7 97 55 17 47 23 15 73 31 39 57 37 9 5 61 41 65 57 77 79 35 47", "output": "26" }, { "input": "99\n38 56 58 98 80 54 26 90 14 16 78 92 52 74 40 30 84 14 44 80 16 90 98 68 26 24 78 72 42 16 84 40 14 44 2 52 50 2 12 96 58 66 8 80 44 52 34 34 72 98 74 4 66 74 56 21 8 38 76 40 10 22 48 32 98 34 12 62 80 68 64 82 22 78 58 74 20 22 48 56 12 38 32 72 6 16 74 24 94 84 26 38 18 24 76 78 98 94 72", "output": "56" }, { "input": "100\n44 40 6 40 56 90 98 8 36 64 76 86 98 76 36 92 6 30 98 70 24 98 96 60 24 82 88 68 86 96 34 42 58 10 40 26 56 10 88 58 70 32 24 28 14 82 52 12 62 36 70 60 52 34 74 30 78 76 10 16 42 94 66 90 70 38 52 12 58 22 98 96 14 68 24 70 4 30 84 98 8 50 14 52 66 34 100 10 28 100 56 48 38 12 38 14 91 80 70 86", "output": "97" }, { "input": "100\n96 62 64 20 90 46 56 90 68 36 30 56 70 28 16 64 94 34 6 32 34 50 94 22 90 32 40 2 72 10 88 38 28 92 20 26 56 80 4 100 100 90 16 74 74 84 8 2 30 20 80 32 16 46 92 56 42 12 96 64 64 42 64 58 50 42 74 28 2 4 36 32 70 50 54 92 70 16 45 76 28 16 18 50 48 2 62 94 4 12 52 52 4 100 70 60 82 62 98 42", "output": "79" }, { "input": "99\n14 26 34 68 90 58 50 36 8 16 18 6 2 74 54 20 36 84 32 50 52 2 26 24 3 64 20 10 54 26 66 44 28 72 4 96 78 90 96 86 68 28 94 4 12 46 100 32 22 36 84 32 44 94 76 94 4 52 12 30 74 4 34 64 58 72 44 16 70 56 54 8 14 74 8 6 58 62 98 54 14 40 80 20 36 72 28 98 20 58 40 52 90 64 22 48 54 70 52", "output": "25" }, { "input": "95\n82 86 30 78 6 46 80 66 74 72 16 24 18 52 52 38 60 36 86 26 62 28 22 46 96 26 94 84 20 46 66 88 76 32 12 86 74 18 34 88 4 48 94 6 58 6 100 82 4 24 88 32 54 98 34 48 6 76 42 88 42 28 100 4 22 2 10 66 82 54 98 20 60 66 38 98 32 47 86 58 6 100 12 46 2 42 8 84 78 28 24 70 34 28 86", "output": "78" }, { "input": "90\n40 50 8 42 76 24 58 42 26 68 20 48 54 12 34 84 14 36 32 88 6 50 96 56 20 92 48 16 40 34 96 46 20 84 30 50 20 98 8 44 96 42 8 76 70 38 84 30 40 88 84 72 2 22 52 58 16 62 100 66 80 40 50 32 14 62 88 72 22 99 76 50 84 82 8 82 98 46 26 40 2 98 18 78 30 72 70 18 34 68", "output": "70" }, { "input": "80\n81 43 87 1 55 43 53 61 27 19 43 13 89 9 33 83 75 55 97 71 91 37 95 5 21 69 81 93 95 69 31 83 55 7 97 7 79 57 8 61 27 85 49 1 15 97 63 79 29 73 41 85 5 41 31 93 67 11 63 59 15 99 91 77 43 69 23 23 81 73 19 1 67 51 1 75 99 67 3 81", "output": "39" }, { "input": "98\n13 83 61 27 35 1 85 95 97 73 95 65 73 45 5 43 27 83 91 19 11 3 85 59 9 39 69 23 45 7 51 85 5 71 5 95 1 51 75 3 43 57 3 11 33 71 21 99 47 41 87 39 71 87 31 85 91 49 83 5 49 85 47 91 55 99 33 23 31 23 23 73 29 77 55 31 25 5 81 49 91 15 15 39 87 5 9 40 69 47 29 33 11 21 49 79 51 83", "output": "88" }, { "input": "3\n100 100 1", "output": "3" } ]
1,586,781,575
2,147,483,647
Python 3
OK
TESTS
32
218
307,200
n=int(input()) a=list(map(int,input().split())) b=[] c=[] e=o=0 for i in range(0,n): if(a[i]%2==0): b.append(a[i]) e+=1 else: c.append(a[i]) o+=1 if(o==1): print(a.index(c[0])+1) else: print(a.index(b[0])+1)
Title: IQ test Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness. Input Specification: The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness. Output Specification: Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order. Demo Input: ['5\n2 4 7 8 10\n', '4\n1 2 1 1\n'] Demo Output: ['3\n', '2\n'] Note: none
```python n=int(input()) a=list(map(int,input().split())) b=[] c=[] e=o=0 for i in range(0,n): if(a[i]%2==0): b.append(a[i]) e+=1 else: c.append(a[i]) o+=1 if(o==1): print(a.index(c[0])+1) else: print(a.index(b[0])+1) ```
3.944928
656
G
You're a Professional
PROGRAMMING
1,900
[ "*special" ]
null
null
A simple recommendation system would recommend a user things liked by a certain number of their friends. In this problem you will implement part of such a system. You are given user's friends' opinions about a list of items. You are also given a threshold *T* — the minimal number of "likes" necessary for an item to be recommended to the user. Output the number of items in the list liked by at least *T* of user's friends.
The first line of the input will contain three space-separated integers: the number of friends *F* (1<=≤<=*F*<=≤<=10), the number of items *I* (1<=≤<=*I*<=≤<=10) and the threshold *T* (1<=≤<=*T*<=≤<=*F*). The following *F* lines of input contain user's friends' opinions. *j*-th character of *i*-th line is 'Y' if *i*-th friend likes *j*-th item, and 'N' otherwise.
Output an integer — the number of items liked by at least *T* of user's friends.
[ "3 3 2\nYYY\nNNN\nYNY\n", "4 4 1\nNNNY\nNNYN\nNYNN\nYNNN\n" ]
[ "2\n", "4\n" ]
none
0
[ { "input": "3 3 2\nYYY\nNNN\nYNY", "output": "2" }, { "input": "4 4 1\nNNNY\nNNYN\nNYNN\nYNNN", "output": "4" }, { "input": "3 5 2\nNYNNY\nYNNNN\nNNYYN", "output": "0" }, { "input": "1 10 1\nYYYNYNNYNN", "output": "5" }, { "input": "10 1 5\nY\nN\nN\nN\nY\nN\nN\nY\nN\nN", "output": "0" }, { "input": "10 10 1\nNNNNNNNNNN\nNNNNNNNNNN\nNNNNNNNNNN\nNNNNNNNNNN\nNNNNNNNNNN\nNNNNNNNNNN\nNNNNNNNNNN\nNNNNNNNNNN\nNNNNNNNNNN\nNNNNNNNNNN", "output": "0" }, { "input": "10 10 10\nYYYYYYYYYY\nYYYYYYYYYY\nYYYYYYYYYY\nYYYYYYYYYY\nYYYYYYYYYY\nYYYYYYYYYY\nYYYYYYYYYY\nYYYYYYYYYY\nYYYYYYYYYY\nYYYYYYYYYY", "output": "10" }, { "input": "8 9 1\nNYNNYYYYN\nNNNYNYNNY\nYYNYNYNNN\nNYYYNYNNN\nYNYNYNYYN\nYYNNYYYYY\nYYYYNYNYY\nNYYNNYYYY", "output": "9" }, { "input": "5 2 3\nNN\nNY\nYY\nNN\nNY", "output": "1" }, { "input": "6 4 5\nYNNY\nNYYY\nNNNY\nYNYN\nYYYN\nYNNY", "output": "0" }, { "input": "6 1 3\nY\nY\nY\nY\nY\nN", "output": "1" }, { "input": "6 2 2\nYN\nNN\nYN\nNN\nYN\nNN", "output": "1" }, { "input": "2 4 2\nNYNY\nNYNY", "output": "2" }, { "input": "9 6 3\nNYYYYN\nNNNYYN\nYYYYYY\nNYNNNN\nYNNYNY\nNNNNNY\nYNNYNN\nYYYYNY\nNNYYYY", "output": "6" }, { "input": "6 9 6\nYYYYNYNNN\nYNNYNNNYN\nNYYYNNNYY\nNYYYNNNNY\nYYNYNNNYY\nYYYNYYNNN", "output": "0" }, { "input": "9 7 8\nYNNNNYN\nNNNYYNN\nNNYYYNY\nNYYNYYY\nNNYYNYN\nNYYYNNY\nYYNYNYY\nNYYYYYY\nNNYYNYN", "output": "0" }, { "input": "9 1 6\nN\nN\nY\nN\nY\nY\nY\nY\nY", "output": "1" }, { "input": "7 7 2\nNNYNNYN\nNNNYYNY\nNNNYYNY\nYNNNNNY\nNNYNYYY\nYYNNYYN\nNNYYYNY", "output": "6" }, { "input": "8 4 2\nYNYY\nYNYY\nYNNN\nNNNN\nNYNN\nYNNN\nNNYN\nNYNN", "output": "4" }, { "input": "9 10 7\nNNYNNYYYYY\nYNYYNYYNYN\nNYNYYNNNNY\nYYYYYYYYYN\nYYNYNYYNNN\nYYYNNYYYYY\nNYYYYYNNNN\nNYNNYYYYNN\nYYYYYNNYYY", "output": "2" }, { "input": "6 4 2\nNNNN\nNYYY\nNYNN\nNYNN\nYNNY\nNNNN", "output": "2" }, { "input": "3 1 1\nN\nY\nN", "output": "1" }, { "input": "7 1 3\nY\nY\nY\nN\nY\nY\nY", "output": "1" }, { "input": "9 8 7\nNYYNNNYY\nYYYNYNNN\nYNYNYNNY\nNYYYNNNY\nNYYYYNYN\nNNNNYYNN\nYNYYYYYY\nNNYNYNYY\nNYYNNYYY", "output": "1" }, { "input": "9 5 9\nYYYYN\nYYYNN\nNNYNN\nNNYYY\nYNNNN\nNYNNN\nYYYYN\nYNYYN\nNNNYN", "output": "0" }, { "input": "8 4 1\nYYYN\nNNNN\nNYNY\nYNNY\nYNYY\nYNYN\nYNNY\nNNYN", "output": "4" }, { "input": "7 9 5\nYNNYYYYNN\nYNYYYNNYY\nYNYYYYYNN\nYYNYYNYYN\nNNYYNNNYY\nYYNYNYYNN\nYYNNYYNYN", "output": "3" }, { "input": "5 8 3\nNYYYNNNN\nYNNNNNYY\nYNYYYNYY\nNNNNNYNN\nYYYYYYYY", "output": "5" }, { "input": "5 10 4\nYYYYNNNNYN\nYYYNYYYNNY\nNNNYNYNYNY\nYNYNNNNNNY\nNNYNYNYNYY", "output": "2" }, { "input": "6 9 6\nNYYNNYNYN\nYNYNYNNNN\nNNYNNYYYY\nNNYNNNYNY\nNYYYNNYNY\nNNYYNNNYN", "output": "1" }, { "input": "4 4 1\nYNYY\nNNNY\nYNNN\nNNYN", "output": "3" }, { "input": "1 3 1\nYYN", "output": "2" }, { "input": "10 4 5\nNNYN\nYYNY\nYYNY\nNYYN\nYNYY\nYNYY\nYYNN\nYNYN\nYYYY\nYYNY", "output": "4" } ]
1,509,690,684
2,147,483,647
Python 3
OK
TESTS
33
62
0
n,m,k=map(int,input().split()) c=[0]*m for i in range(n): a=input() for j in range(m): c[j]+=a[j]=='Y' print(sum(c[i]>=k for i in range(m)))#kitten
Title: You're a Professional Time Limit: None seconds Memory Limit: None megabytes Problem Description: A simple recommendation system would recommend a user things liked by a certain number of their friends. In this problem you will implement part of such a system. You are given user's friends' opinions about a list of items. You are also given a threshold *T* — the minimal number of "likes" necessary for an item to be recommended to the user. Output the number of items in the list liked by at least *T* of user's friends. Input Specification: The first line of the input will contain three space-separated integers: the number of friends *F* (1<=≤<=*F*<=≤<=10), the number of items *I* (1<=≤<=*I*<=≤<=10) and the threshold *T* (1<=≤<=*T*<=≤<=*F*). The following *F* lines of input contain user's friends' opinions. *j*-th character of *i*-th line is 'Y' if *i*-th friend likes *j*-th item, and 'N' otherwise. Output Specification: Output an integer — the number of items liked by at least *T* of user's friends. Demo Input: ['3 3 2\nYYY\nNNN\nYNY\n', '4 4 1\nNNNY\nNNYN\nNYNN\nYNNN\n'] Demo Output: ['2\n', '4\n'] Note: none
```python n,m,k=map(int,input().split()) c=[0]*m for i in range(n): a=input() for j in range(m): c[j]+=a[j]=='Y' print(sum(c[i]>=k for i in range(m)))#kitten ```
3
550
C
Divisibility by Eight
PROGRAMMING
1,500
[ "brute force", "dp", "math" ]
null
null
You are given a non-negative integer *n*, its decimal representation consists of at most 100 digits and doesn't contain leading zeroes. Your task is to determine if it is possible in this case to remove some of the digits (possibly not remove any digit at all) so that the result contains at least one digit, forms a non-negative integer, doesn't have leading zeroes and is divisible by 8. After the removing, it is forbidden to rearrange the digits. If a solution exists, you should print it.
The single line of the input contains a non-negative integer *n*. The representation of number *n* doesn't contain any leading zeroes and its length doesn't exceed 100 digits.
Print "NO" (without quotes), if there is no such way to remove some digits from number *n*. Otherwise, print "YES" in the first line and the resulting number after removing digits from number *n* in the second line. The printed number must be divisible by 8. If there are multiple possible answers, you may print any of them.
[ "3454\n", "10\n", "111111\n" ]
[ "YES\n344\n", "YES\n0\n", "NO\n" ]
none
1,000
[ { "input": "3454", "output": "YES\n344" }, { "input": "10", "output": "YES\n0" }, { "input": "111111", "output": "NO" }, { "input": "8996988892", "output": "YES\n8" }, { "input": "5555555555", "output": "NO" }, { "input": "1", "output": "NO" }, { "input": "8147522776919916277306861346922924221557534659480258977017038624458370459299847590937757625791239188", "output": "YES\n8" }, { "input": "8", "output": "YES\n8" }, { "input": "14", "output": "NO" }, { "input": "2363", "output": "NO" }, { "input": "3554", "output": "NO" }, { "input": "312", "output": "YES\n32" }, { "input": "7674", "output": "YES\n64" }, { "input": "126", "output": "YES\n16" }, { "input": "344", "output": "YES\n344" }, { "input": "976", "output": "YES\n96" }, { "input": "3144", "output": "YES\n344" }, { "input": "1492", "output": "YES\n192" }, { "input": "1000", "output": "YES\n0" }, { "input": "303", "output": "YES\n0" }, { "input": "111111111111111111111171111111111111111111111111111112", "output": "YES\n72" }, { "input": "3111111111111111111111411111111111111111111141111111441", "output": "YES\n344" }, { "input": "7486897358699809313898215064443112428113331907121460549315254356705507612143346801724124391167293733", "output": "YES\n8" }, { "input": "1787075866", "output": "YES\n8" }, { "input": "836501278190105055089734832290981", "output": "YES\n8" }, { "input": "1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111", "output": "NO" }, { "input": "2222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222", "output": "NO" }, { "input": "3333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333", "output": "NO" }, { "input": "1000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000", "output": "YES\n0" }, { "input": "5555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555", "output": "NO" }, { "input": "66666666666666666666666666666666666666666666666666666666666666666666666666666", "output": "NO" }, { "input": "88888888888888888888888888888888888888888888888888888888888888888888888888888888", "output": "YES\n8" }, { "input": "9999999999999999999999999999999999999999999999999999999999999999999999999999999999999999999", "output": "NO" }, { "input": "353", "output": "NO" }, { "input": "39", "output": "NO" }, { "input": "3697519", "output": "NO" }, { "input": "6673177113", "output": "NO" }, { "input": "6666351371557713735", "output": "NO" }, { "input": "17943911115335733153157373517", "output": "NO" }, { "input": "619715515939999957957971971757533319177373", "output": "NO" }, { "input": "4655797151375799393395377959959573533195153397997597195199777159133", "output": "NO" }, { "input": "5531399953495399131957773999751571911139197159755793777773799119333593915333593153173775755771193715", "output": "NO" }, { "input": "1319571733331774579193199551977735199771153997797535591739153377377111795579371959933533573517995559", "output": "NO" }, { "input": "3313393139519343957311771319713797711159791515393917539133957799131393735795317131513557337319131993", "output": "NO" }, { "input": "526", "output": "YES\n56" }, { "input": "513", "output": "NO" }, { "input": "674", "output": "YES\n64" }, { "input": "8353", "output": "YES\n8" }, { "input": "3957", "output": "NO" }, { "input": "4426155776626276881222352363321488266188669874572115686737742545442766138617391954346963915982759371", "output": "YES\n8" }, { "input": "9592419524227735697379444145348135927975358347769514686865768941989693174565893724972575152874281772", "output": "YES\n8" }, { "input": "94552498866729239313265973246288189853135485783461", "output": "YES\n8" }, { "input": "647934465937812", "output": "YES\n8" }, { "input": "1327917795375366484539554526312125336", "output": "YES\n8" }, { "input": "295971811535848297878828225646878276486982655866912496735794542", "output": "YES\n8" }, { "input": "7217495392264549817889283233368819844137671271383133997418139697797385729777632527678136", "output": "YES\n8" }, { "input": "11111111111111111111112111111111", "output": "YES\n112" }, { "input": "262626262626262626262626262626262626", "output": "NO" }, { "input": "1000000000000000000000000000000000000", "output": "YES\n0" }, { "input": "9969929446", "output": "YES\n96" }, { "input": "43523522125549722432232256557771715456345544922144", "output": "YES\n32" }, { "input": "9344661521956564755454992376342544254667536539463277572111263273131199437332443253296774957", "output": "YES\n96" }, { "input": "1946374341357914632311595531429723377642197432217137651552992479954116463332543456759911377223599715", "output": "YES\n16" }, { "input": "461259", "output": "NO" }, { "input": "461592", "output": "YES\n152" }, { "input": "46159237", "output": "YES\n152" }, { "input": "42367", "output": "NO" }, { "input": "42376", "output": "YES\n376" }, { "input": "42376159", "output": "YES\n376" }, { "input": "444444444444444444444444444444666666666666666666666666666666222222222222222222222222222222", "output": "NO" }, { "input": "0", "output": "YES\n0" }, { "input": "33332", "output": "YES\n32" }, { "input": "6499999999", "output": "YES\n64" } ]
1,697,739,747
2,147,483,647
Python 3
OK
TESTS
73
93
0
s = input() if s.count('0') > 0: print('YES') print(0) exit(0) if s.count('8') > 0: print('YES') print(8) exit(0) for i in range(len(s)): for j in range(i + 1, len(s)): for k in range(j + 1, len(s)): x = int(s[i] + s[j] + s[k]) if x % 8 == 0: print('YES') print(x) exit(0) for i in range(len(s)): for j in range(i + 1, len(s)): x = int(s[i] + s[j]) if x % 8 == 0: print('YES') print(x) exit(0) print('NO')
Title: Divisibility by Eight Time Limit: None seconds Memory Limit: None megabytes Problem Description: You are given a non-negative integer *n*, its decimal representation consists of at most 100 digits and doesn't contain leading zeroes. Your task is to determine if it is possible in this case to remove some of the digits (possibly not remove any digit at all) so that the result contains at least one digit, forms a non-negative integer, doesn't have leading zeroes and is divisible by 8. After the removing, it is forbidden to rearrange the digits. If a solution exists, you should print it. Input Specification: The single line of the input contains a non-negative integer *n*. The representation of number *n* doesn't contain any leading zeroes and its length doesn't exceed 100 digits. Output Specification: Print "NO" (without quotes), if there is no such way to remove some digits from number *n*. Otherwise, print "YES" in the first line and the resulting number after removing digits from number *n* in the second line. The printed number must be divisible by 8. If there are multiple possible answers, you may print any of them. Demo Input: ['3454\n', '10\n', '111111\n'] Demo Output: ['YES\n344\n', 'YES\n0\n', 'NO\n'] Note: none
```python s = input() if s.count('0') > 0: print('YES') print(0) exit(0) if s.count('8') > 0: print('YES') print(8) exit(0) for i in range(len(s)): for j in range(i + 1, len(s)): for k in range(j + 1, len(s)): x = int(s[i] + s[j] + s[k]) if x % 8 == 0: print('YES') print(x) exit(0) for i in range(len(s)): for j in range(i + 1, len(s)): x = int(s[i] + s[j]) if x % 8 == 0: print('YES') print(x) exit(0) print('NO') ```
3
26
A
Almost Prime
PROGRAMMING
900
[ "number theory" ]
A. Almost Prime
2
256
A number is called almost prime if it has exactly two distinct prime divisors. For example, numbers 6, 18, 24 are almost prime, while 4, 8, 9, 42 are not. Find the amount of almost prime numbers which are between 1 and *n*, inclusive.
Input contains one integer number *n* (1<=≤<=*n*<=≤<=3000).
Output the amount of almost prime numbers between 1 and *n*, inclusive.
[ "10\n", "21\n" ]
[ "2\n", "8\n" ]
none
500
[ { "input": "10", "output": "2" }, { "input": "21", "output": "8" }, { "input": "1", "output": "0" }, { "input": "2", "output": "0" }, { "input": "4", "output": "0" }, { "input": "3", "output": "0" }, { "input": "8", "output": "1" }, { "input": "19", "output": "6" }, { "input": "40", "output": "19" }, { "input": "77", "output": "41" }, { "input": "222", "output": "125" }, { "input": "987", "output": "501" }, { "input": "1000", "output": "508" }, { "input": "2000", "output": "958" }, { "input": "3000", "output": "1375" }, { "input": "2999", "output": "1375" }, { "input": "2998", "output": "1375" }, { "input": "2997", "output": "1374" }, { "input": "1429", "output": "706" }, { "input": "1673", "output": "808" }, { "input": "1500", "output": "732" }, { "input": "500", "output": "266" }, { "input": "856", "output": "439" } ]
1,583,296,564
2,147,483,647
Python 3
OK
TESTS
23
1,964
307,200
n=int(input()) cnt=0 x=0 for r in range(4,n+1): v=r cnt=0 for i in range(2,v-1): if(v%i==0): k=0 for j in range(2,i-1): if(i%j==0): k+=1 if(k==0): cnt+=1 if(cnt==2): x+=1 print(x)
Title: Almost Prime Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: A number is called almost prime if it has exactly two distinct prime divisors. For example, numbers 6, 18, 24 are almost prime, while 4, 8, 9, 42 are not. Find the amount of almost prime numbers which are between 1 and *n*, inclusive. Input Specification: Input contains one integer number *n* (1<=≤<=*n*<=≤<=3000). Output Specification: Output the amount of almost prime numbers between 1 and *n*, inclusive. Demo Input: ['10\n', '21\n'] Demo Output: ['2\n', '8\n'] Note: none
```python n=int(input()) cnt=0 x=0 for r in range(4,n+1): v=r cnt=0 for i in range(2,v-1): if(v%i==0): k=0 for j in range(2,i-1): if(i%j==0): k+=1 if(k==0): cnt+=1 if(cnt==2): x+=1 print(x) ```
3.508428
552
B
Vanya and Books
PROGRAMMING
1,200
[ "implementation", "math" ]
null
null
Vanya got an important task — he should enumerate books in the library and label each book with its number. Each of the *n* books should be assigned with a number from 1 to *n*. Naturally, distinct books should be assigned distinct numbers. Vanya wants to know how many digits he will have to write down as he labels the books.
The first line contains integer *n* (1<=≤<=*n*<=≤<=109) — the number of books in the library.
Print the number of digits needed to number all the books.
[ "13\n", "4\n" ]
[ "17\n", "4\n" ]
Note to the first test. The books get numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, which totals to 17 digits. Note to the second sample. The books get numbers 1, 2, 3, 4, which totals to 4 digits.
1,000
[ { "input": "13", "output": "17" }, { "input": "4", "output": "4" }, { "input": "100", "output": "192" }, { "input": "99", "output": "189" }, { "input": "1000000000", "output": "8888888899" }, { "input": "1000000", "output": "5888896" }, { "input": "999", "output": "2889" }, { "input": "55", "output": "101" }, { "input": "222222222", "output": "1888888896" }, { "input": "8", "output": "8" }, { "input": "13", "output": "17" }, { "input": "313", "output": "831" }, { "input": "1342", "output": "4261" }, { "input": "30140", "output": "139594" }, { "input": "290092", "output": "1629447" }, { "input": "2156660", "output": "13985516" }, { "input": "96482216", "output": "760746625" }, { "input": "943006819", "output": "8375950269" }, { "input": "1", "output": "1" }, { "input": "7", "output": "7" }, { "input": "35", "output": "61" }, { "input": "996", "output": "2880" }, { "input": "6120", "output": "23373" }, { "input": "30660", "output": "142194" }, { "input": "349463", "output": "1985673" }, { "input": "8171970", "output": "56092686" }, { "input": "36123011", "output": "277872985" }, { "input": "986747865", "output": "8769619683" }, { "input": "9", "output": "9" }, { "input": "10", "output": "11" }, { "input": "11", "output": "13" }, { "input": "101", "output": "195" }, { "input": "1000", "output": "2893" }, { "input": "1001", "output": "2897" }, { "input": "9999", "output": "38889" }, { "input": "10000", "output": "38894" }, { "input": "10001", "output": "38899" }, { "input": "99999", "output": "488889" }, { "input": "100000", "output": "488895" }, { "input": "100001", "output": "488901" }, { "input": "999999", "output": "5888889" }, { "input": "1000001", "output": "5888903" }, { "input": "9999999", "output": "68888889" }, { "input": "10000000", "output": "68888897" }, { "input": "10000001", "output": "68888905" }, { "input": "99999999", "output": "788888889" }, { "input": "100000000", "output": "788888898" }, { "input": "100000001", "output": "788888907" }, { "input": "999999999", "output": "8888888889" }, { "input": "95", "output": "181" }, { "input": "995", "output": "2877" }, { "input": "9995", "output": "38873" }, { "input": "99995", "output": "488869" }, { "input": "999999995", "output": "8888888853" }, { "input": "999999998", "output": "8888888880" } ]
1,589,370,317
2,147,483,647
PyPy 3
OK
TESTS
55
156
20,172,800
a=int(input()) p=0 for j in range(len(str(a)),1,-1): if j==len(str(a)): p+= (a-int((j-1)*'9'))*j else: p+= (int('9'*j)-int('9'*(j-1)))*j if a>9: print(p+9) else: print(a)
Title: Vanya and Books Time Limit: None seconds Memory Limit: None megabytes Problem Description: Vanya got an important task — he should enumerate books in the library and label each book with its number. Each of the *n* books should be assigned with a number from 1 to *n*. Naturally, distinct books should be assigned distinct numbers. Vanya wants to know how many digits he will have to write down as he labels the books. Input Specification: The first line contains integer *n* (1<=≤<=*n*<=≤<=109) — the number of books in the library. Output Specification: Print the number of digits needed to number all the books. Demo Input: ['13\n', '4\n'] Demo Output: ['17\n', '4\n'] Note: Note to the first test. The books get numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, which totals to 17 digits. Note to the second sample. The books get numbers 1, 2, 3, 4, which totals to 4 digits.
```python a=int(input()) p=0 for j in range(len(str(a)),1,-1): if j==len(str(a)): p+= (a-int((j-1)*'9'))*j else: p+= (int('9'*j)-int('9'*(j-1)))*j if a>9: print(p+9) else: print(a) ```
3
385
B
Bear and Strings
PROGRAMMING
1,200
[ "brute force", "greedy", "implementation", "math", "strings" ]
null
null
The bear has a string *s*<==<=*s*1*s*2... *s*|*s*| (record |*s*| is the string's length), consisting of lowercase English letters. The bear wants to count the number of such pairs of indices *i*,<=*j* (1<=≤<=*i*<=≤<=*j*<=≤<=|*s*|), that string *x*(*i*,<=*j*)<==<=*s**i**s**i*<=+<=1... *s**j* contains at least one string "bear" as a substring. String *x*(*i*,<=*j*) contains string "bear", if there is such index *k* (*i*<=≤<=*k*<=≤<=*j*<=-<=3), that *s**k*<==<=*b*, *s**k*<=+<=1<==<=*e*, *s**k*<=+<=2<==<=*a*, *s**k*<=+<=3<==<=*r*. Help the bear cope with the given problem.
The first line contains a non-empty string *s* (1<=≤<=|*s*|<=≤<=5000). It is guaranteed that the string only consists of lowercase English letters.
Print a single number — the answer to the problem.
[ "bearbtear\n", "bearaabearc\n" ]
[ "6\n", "20\n" ]
In the first sample, the following pairs (*i*, *j*) match: (1, 4), (1, 5), (1, 6), (1, 7), (1, 8), (1, 9). In the second sample, the following pairs (*i*, *j*) match: (1,  4), (1,  5), (1,  6), (1,  7), (1,  8), (1,  9), (1,  10), (1,  11), (2,  10), (2,  11), (3,  10), (3,  11), (4,  10), (4,  11), (5,  10), (5,  11), (6,  10), (6,  11), (7,  10), (7,  11).
1,000
[ { "input": "bearbtear", "output": "6" }, { "input": "bearaabearc", "output": "20" }, { "input": "pbearbearhbearzqbearjkterasjhy", "output": "291" }, { "input": "pbearjbearbebearnbabcffbearbearwubearjezpiorrbearbearjbdlbearbearqbearjbearwipmsbearoaftrsebearzsnqb", "output": "4419" }, { "input": "bear", "output": "1" }, { "input": "a", "output": "0" }, { "input": "be", "output": "0" } ]
1,590,474,434
2,147,483,647
Python 3
OK
TESTS
43
124
0
s=input() if len(s) < 4: print(0) else: a=0 for i in range(len(s)): d=s.find("bear", i) if d>=0: a+=len(s)-d-3 print(a)
Title: Bear and Strings Time Limit: None seconds Memory Limit: None megabytes Problem Description: The bear has a string *s*<==<=*s*1*s*2... *s*|*s*| (record |*s*| is the string's length), consisting of lowercase English letters. The bear wants to count the number of such pairs of indices *i*,<=*j* (1<=≤<=*i*<=≤<=*j*<=≤<=|*s*|), that string *x*(*i*,<=*j*)<==<=*s**i**s**i*<=+<=1... *s**j* contains at least one string "bear" as a substring. String *x*(*i*,<=*j*) contains string "bear", if there is such index *k* (*i*<=≤<=*k*<=≤<=*j*<=-<=3), that *s**k*<==<=*b*, *s**k*<=+<=1<==<=*e*, *s**k*<=+<=2<==<=*a*, *s**k*<=+<=3<==<=*r*. Help the bear cope with the given problem. Input Specification: The first line contains a non-empty string *s* (1<=≤<=|*s*|<=≤<=5000). It is guaranteed that the string only consists of lowercase English letters. Output Specification: Print a single number — the answer to the problem. Demo Input: ['bearbtear\n', 'bearaabearc\n'] Demo Output: ['6\n', '20\n'] Note: In the first sample, the following pairs (*i*, *j*) match: (1, 4), (1, 5), (1, 6), (1, 7), (1, 8), (1, 9). In the second sample, the following pairs (*i*, *j*) match: (1,  4), (1,  5), (1,  6), (1,  7), (1,  8), (1,  9), (1,  10), (1,  11), (2,  10), (2,  11), (3,  10), (3,  11), (4,  10), (4,  11), (5,  10), (5,  11), (6,  10), (6,  11), (7,  10), (7,  11).
```python s=input() if len(s) < 4: print(0) else: a=0 for i in range(len(s)): d=s.find("bear", i) if d>=0: a+=len(s)-d-3 print(a) ```
3
659
C
Tanya and Toys
PROGRAMMING
1,200
[ "greedy", "implementation" ]
null
null
In Berland recently a new collection of toys went on sale. This collection consists of 109 types of toys, numbered with integers from 1 to 109. A toy from the new collection of the *i*-th type costs *i* bourles. Tania has managed to collect *n* different types of toys *a*1,<=*a*2,<=...,<=*a**n* from the new collection. Today is Tanya's birthday, and her mother decided to spend no more than *m* bourles on the gift to the daughter. Tanya will choose several different types of toys from the new collection as a gift. Of course, she does not want to get a type of toy which she already has. Tanya wants to have as many distinct types of toys in her collection as possible as the result. The new collection is too diverse, and Tanya is too little, so she asks you to help her in this.
The first line contains two integers *n* (1<=≤<=*n*<=≤<=100<=000) and *m* (1<=≤<=*m*<=≤<=109) — the number of types of toys that Tanya already has and the number of bourles that her mom is willing to spend on buying new toys. The next line contains *n* distinct integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — the types of toys that Tanya already has.
In the first line print a single integer *k* — the number of different types of toys that Tanya should choose so that the number of different types of toys in her collection is maximum possible. Of course, the total cost of the selected toys should not exceed *m*. In the second line print *k* distinct space-separated integers *t*1,<=*t*2,<=...,<=*t**k* (1<=≤<=*t**i*<=≤<=109) — the types of toys that Tanya should choose. If there are multiple answers, you may print any of them. Values of *t**i* can be printed in any order.
[ "3 7\n1 3 4\n", "4 14\n4 6 12 8\n" ]
[ "2\n2 5 \n", "4\n7 2 3 1\n" ]
In the first sample mom should buy two toys: one toy of the 2-nd type and one toy of the 5-th type. At any other purchase for 7 bourles (assuming that the toys of types 1, 3 and 4 have already been bought), it is impossible to buy two and more toys.
1,000
[ { "input": "3 7\n1 3 4", "output": "2\n2 5 " }, { "input": "4 14\n4 6 12 8", "output": "4\n1 2 3 5 " }, { "input": "5 6\n97746 64770 31551 96547 65684", "output": "3\n1 2 3 " }, { "input": "10 10\n94125 56116 29758 94024 29289 31663 99794 35076 25328 58656", "output": "4\n1 2 3 4 " }, { "input": "30 38\n9560 64176 75619 53112 54160 68775 12655 13118 99502 89757 78434 42521 19210 1927 34097 5416 56110 44786 59126 44266 79240 65567 54602 25325 37171 2879 89291 89121 39568 28162", "output": "8\n1 2 3 4 5 6 7 8 " }, { "input": "1 999999298\n85187", "output": "44720\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 ..." }, { "input": "1 999999119\n34421", "output": "44720\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 ..." }, { "input": "1 1000000000\n1", "output": "44719\n2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 15..." }, { "input": "1 1000000000\n44720", "output": "44720\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 ..." }, { "input": "1 1000000000\n44719", "output": "44720\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 ..." }, { "input": "1 1000000000\n44721", "output": "44720\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 ..." }, { "input": "3 1000000000\n123456789 234567891 345678912", "output": "44720\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 ..." }, { "input": "2 5\n999999999 1000000000", "output": "2\n1 2 " }, { "input": "2 1000000000\n1 1000000000", "output": "44719\n2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 15..." }, { "input": "3 100000\n1000000000 100000000 1", "output": "445\n2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 ..." }, { "input": "5 5\n100000000 200000000 300000000 400000000 1000000000", "output": "2\n1 2 " }, { "input": "6 3\n1 2 3 4 5 6", "output": "0" }, { "input": "2 1\n1 2", "output": "0" }, { "input": "1 1000000000\n1000000000", "output": "44720\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 ..." }, { "input": "5 1000000\n1000000000 100000000 10000000 99999999 123456789", "output": "1413\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 1..." }, { "input": "2 10000000\n1234567 123456", "output": "4471\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 1..." }, { "input": "1 1\n1000000000", "output": "1\n1 " }, { "input": "1 1000000000\n9999999", "output": "44720\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 ..." }, { "input": "5 10000\n1000000000 888888888 777777777 666666666 959595959", "output": "140\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 " }, { "input": "3 1\n1000000000 999999999 999999998", "output": "1\n1 " }, { "input": "5 100000000\n100000000 999999999 1 2 3", "output": "14138\n4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 15..." }, { "input": "3 55\n100000000 1000000000 999999999", "output": "10\n1 2 3 4 5 6 7 8 9 10 " }, { "input": "2 10\n5 10000009", "output": "4\n1 2 3 4 " }, { "input": "3 10000000\n999999999 999999998 999999997", "output": "4471\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 1..." }, { "input": "1 1100\n1000000000", "output": "46\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 " }, { "input": "1 40\n1000000000", "output": "8\n1 2 3 4 5 6 7 8 " } ]
1,687,956,061
2,147,483,647
Python 3
OK
TESTS
61
140
18,534,400
n, m = map(int, input().split()) a = set(map(int, input().split())) types = set() curr_type= 1 while m > 0 and curr_type < 10 ** 9: if curr_type not in a: if m - curr_type >= 0: m = m - curr_type types.add(curr_type) else: break curr_type += 1 print(len(types)) print(*types)
Title: Tanya and Toys Time Limit: None seconds Memory Limit: None megabytes Problem Description: In Berland recently a new collection of toys went on sale. This collection consists of 109 types of toys, numbered with integers from 1 to 109. A toy from the new collection of the *i*-th type costs *i* bourles. Tania has managed to collect *n* different types of toys *a*1,<=*a*2,<=...,<=*a**n* from the new collection. Today is Tanya's birthday, and her mother decided to spend no more than *m* bourles on the gift to the daughter. Tanya will choose several different types of toys from the new collection as a gift. Of course, she does not want to get a type of toy which she already has. Tanya wants to have as many distinct types of toys in her collection as possible as the result. The new collection is too diverse, and Tanya is too little, so she asks you to help her in this. Input Specification: The first line contains two integers *n* (1<=≤<=*n*<=≤<=100<=000) and *m* (1<=≤<=*m*<=≤<=109) — the number of types of toys that Tanya already has and the number of bourles that her mom is willing to spend on buying new toys. The next line contains *n* distinct integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — the types of toys that Tanya already has. Output Specification: In the first line print a single integer *k* — the number of different types of toys that Tanya should choose so that the number of different types of toys in her collection is maximum possible. Of course, the total cost of the selected toys should not exceed *m*. In the second line print *k* distinct space-separated integers *t*1,<=*t*2,<=...,<=*t**k* (1<=≤<=*t**i*<=≤<=109) — the types of toys that Tanya should choose. If there are multiple answers, you may print any of them. Values of *t**i* can be printed in any order. Demo Input: ['3 7\n1 3 4\n', '4 14\n4 6 12 8\n'] Demo Output: ['2\n2 5 \n', '4\n7 2 3 1\n'] Note: In the first sample mom should buy two toys: one toy of the 2-nd type and one toy of the 5-th type. At any other purchase for 7 bourles (assuming that the toys of types 1, 3 and 4 have already been bought), it is impossible to buy two and more toys.
```python n, m = map(int, input().split()) a = set(map(int, input().split())) types = set() curr_type= 1 while m > 0 and curr_type < 10 ** 9: if curr_type not in a: if m - curr_type >= 0: m = m - curr_type types.add(curr_type) else: break curr_type += 1 print(len(types)) print(*types) ```
3
658
A
Bear and Reverse Radewoosh
PROGRAMMING
800
[ "implementation" ]
null
null
Limak and Radewoosh are going to compete against each other in the upcoming algorithmic contest. They are equally skilled but they won't solve problems in the same order. There will be *n* problems. The *i*-th problem has initial score *p**i* and it takes exactly *t**i* minutes to solve it. Problems are sorted by difficulty — it's guaranteed that *p**i*<=&lt;<=*p**i*<=+<=1 and *t**i*<=&lt;<=*t**i*<=+<=1. A constant *c* is given too, representing the speed of loosing points. Then, submitting the *i*-th problem at time *x* (*x* minutes after the start of the contest) gives *max*(0,<= *p**i*<=-<=*c*·*x*) points. Limak is going to solve problems in order 1,<=2,<=...,<=*n* (sorted increasingly by *p**i*). Radewoosh is going to solve them in order *n*,<=*n*<=-<=1,<=...,<=1 (sorted decreasingly by *p**i*). Your task is to predict the outcome — print the name of the winner (person who gets more points at the end) or a word "Tie" in case of a tie. You may assume that the duration of the competition is greater or equal than the sum of all *t**i*. That means both Limak and Radewoosh will accept all *n* problems.
The first line contains two integers *n* and *c* (1<=≤<=*n*<=≤<=50,<=1<=≤<=*c*<=≤<=1000) — the number of problems and the constant representing the speed of loosing points. The second line contains *n* integers *p*1,<=*p*2,<=...,<=*p**n* (1<=≤<=*p**i*<=≤<=1000,<=*p**i*<=&lt;<=*p**i*<=+<=1) — initial scores. The third line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t**i*<=≤<=1000,<=*t**i*<=&lt;<=*t**i*<=+<=1) where *t**i* denotes the number of minutes one needs to solve the *i*-th problem.
Print "Limak" (without quotes) if Limak will get more points in total. Print "Radewoosh" (without quotes) if Radewoosh will get more points in total. Print "Tie" (without quotes) if Limak and Radewoosh will get the same total number of points.
[ "3 2\n50 85 250\n10 15 25\n", "3 6\n50 85 250\n10 15 25\n", "8 1\n10 20 30 40 50 60 70 80\n8 10 58 63 71 72 75 76\n" ]
[ "Limak\n", "Radewoosh\n", "Tie\n" ]
In the first sample, there are 3 problems. Limak solves them as follows: 1. Limak spends 10 minutes on the 1-st problem and he gets 50 - *c*·10 = 50 - 2·10 = 30 points. 1. Limak spends 15 minutes on the 2-nd problem so he submits it 10 + 15 = 25 minutes after the start of the contest. For the 2-nd problem he gets 85 - 2·25 = 35 points. 1. He spends 25 minutes on the 3-rd problem so he submits it 10 + 15 + 25 = 50 minutes after the start. For this problem he gets 250 - 2·50 = 150 points. So, Limak got 30 + 35 + 150 = 215 points. Radewoosh solves problem in the reversed order: 1. Radewoosh solves 3-rd problem after 25 minutes so he gets 250 - 2·25 = 200 points. 1. He spends 15 minutes on the 2-nd problem so he submits it 25 + 15 = 40 minutes after the start. He gets 85 - 2·40 = 5 points for this problem. 1. He spends 10 minutes on the 1-st problem so he submits it 25 + 15 + 10 = 50 minutes after the start. He gets *max*(0, 50 - 2·50) = *max*(0,  - 50) = 0 points. Radewoosh got 200 + 5 + 0 = 205 points in total. Limak has 215 points so Limak wins. In the second sample, Limak will get 0 points for each problem and Radewoosh will first solve the hardest problem and he will get 250 - 6·25 = 100 points for that. Radewoosh will get 0 points for other two problems but he is the winner anyway. In the third sample, Limak will get 2 points for the 1-st problem and 2 points for the 2-nd problem. Radewoosh will get 4 points for the 8-th problem. They won't get points for other problems and thus there is a tie because 2 + 2 = 4.
500
[ { "input": "3 2\n50 85 250\n10 15 25", "output": "Limak" }, { "input": "3 6\n50 85 250\n10 15 25", "output": "Radewoosh" }, { "input": "8 1\n10 20 30 40 50 60 70 80\n8 10 58 63 71 72 75 76", "output": "Tie" }, { "input": "4 1\n3 5 6 9\n1 2 4 8", "output": "Limak" }, { "input": "4 1\n1 3 6 10\n1 5 7 8", "output": "Radewoosh" }, { "input": "4 1\n2 4 5 10\n2 3 9 10", "output": "Tie" }, { "input": "18 4\n68 97 121 132 146 277 312 395 407 431 458 461 595 634 751 855 871 994\n1 2 3 4 9 10 13 21 22 29 31 34 37 38 39 41 48 49", "output": "Radewoosh" }, { "input": "50 1\n5 14 18 73 137 187 195 197 212 226 235 251 262 278 287 304 310 322 342 379 393 420 442 444 448 472 483 485 508 515 517 523 559 585 618 627 636 646 666 682 703 707 780 853 937 951 959 989 991 992\n30 84 113 173 199 220 235 261 266 277 300 306 310 312 347 356 394 396 397 409 414 424 446 462 468 487 507 517 537 566 594 643 656 660 662 668 706 708 773 774 779 805 820 827 868 896 929 942 961 995", "output": "Tie" }, { "input": "4 1\n4 6 9 10\n2 3 4 5", "output": "Radewoosh" }, { "input": "4 1\n4 6 9 10\n3 4 5 7", "output": "Radewoosh" }, { "input": "4 1\n1 6 7 10\n2 7 8 10", "output": "Tie" }, { "input": "4 1\n4 5 7 9\n1 4 5 8", "output": "Limak" }, { "input": "50 1\n6 17 44 82 94 127 134 156 187 211 212 252 256 292 294 303 352 355 379 380 398 409 424 434 480 524 584 594 631 714 745 756 777 778 789 793 799 821 841 849 859 878 879 895 925 932 944 952 958 990\n15 16 40 42 45 71 99 100 117 120 174 181 186 204 221 268 289 332 376 394 403 409 411 444 471 487 499 539 541 551 567 589 619 623 639 669 689 722 735 776 794 822 830 840 847 907 917 927 936 988", "output": "Radewoosh" }, { "input": "50 10\n25 49 52 73 104 117 127 136 149 164 171 184 226 251 257 258 286 324 337 341 386 390 428 453 464 470 492 517 543 565 609 634 636 660 678 693 710 714 729 736 739 749 781 836 866 875 956 960 977 979\n2 4 7 10 11 22 24 26 27 28 31 35 37 38 42 44 45 46 52 53 55 56 57 59 60 61 64 66 67 68 69 71 75 76 77 78 79 81 83 85 86 87 89 90 92 93 94 98 99 100", "output": "Limak" }, { "input": "50 10\n11 15 25 71 77 83 95 108 143 150 182 183 198 203 213 223 279 280 346 348 350 355 375 376 412 413 415 432 470 545 553 562 589 595 607 633 635 637 688 719 747 767 771 799 842 883 905 924 942 944\n1 3 5 6 7 10 11 12 13 14 15 16 19 20 21 23 25 32 35 36 37 38 40 41 42 43 47 50 51 54 55 56 57 58 59 60 62 63 64 65 66 68 69 70 71 72 73 75 78 80", "output": "Radewoosh" }, { "input": "32 6\n25 77 141 148 157 159 192 196 198 244 245 255 332 392 414 457 466 524 575 603 629 700 738 782 838 841 845 847 870 945 984 985\n1 2 4 5 8 9 10 12 13 14 15 16 17 18 20 21 22 23 24 26 28 31 38 39 40 41 42 43 45 47 48 49", "output": "Radewoosh" }, { "input": "5 1\n256 275 469 671 842\n7 9 14 17 26", "output": "Limak" }, { "input": "2 1000\n1 2\n1 2", "output": "Tie" }, { "input": "3 1\n1 50 809\n2 8 800", "output": "Limak" }, { "input": "1 13\n866\n10", "output": "Tie" }, { "input": "15 1\n9 11 66 128 199 323 376 386 393 555 585 718 935 960 971\n3 11 14 19 20 21 24 26 32 38 40 42 44 47 50", "output": "Limak" }, { "input": "1 10\n546\n45", "output": "Tie" }, { "input": "50 20\n21 43 51 99 117 119 158 167 175 190 196 244 250 316 335 375 391 403 423 428 451 457 460 480 487 522 539 559 566 584 598 602 604 616 626 666 675 730 771 787 828 841 861 867 886 889 898 970 986 991\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50", "output": "Limak" }, { "input": "50 21\n13 20 22 38 62 84 118 135 141 152 170 175 194 218 227 229 232 253 260 263 278 313 329 357 396 402 422 452 454 533 575 576 580 594 624 644 653 671 676 759 789 811 816 823 831 833 856 924 933 987\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50", "output": "Tie" }, { "input": "1 36\n312\n42", "output": "Tie" }, { "input": "1 1000\n1\n1000", "output": "Tie" }, { "input": "1 1\n1000\n1", "output": "Tie" }, { "input": "50 35\n9 17 28 107 136 152 169 174 186 188 201 262 291 312 324 330 341 358 385 386 393 397 425 431 479 498 502 523 530 540 542 554 578 588 622 623 684 696 709 722 784 819 836 845 850 932 945 969 983 984\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50", "output": "Tie" }, { "input": "50 20\n12 113 116 120 138 156 167 183 185 194 211 228 234 261 278 287 310 317 346 361 364 397 424 470 496 522 527 536 611 648 668 704 707 712 717 752 761 766 815 828 832 864 872 885 889 901 904 929 982 993\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50", "output": "Limak" } ]
1,594,316,280
2,147,483,647
Python 3
OK
TESTS
29
108
6,963,200
a,b=map(int,input().split()) n=list(map(int,input().split())) m=list(map(int,input().split())) l,y=[],[] x,q,w,o= 0,0,0,0 for e in m : x = x+e l.append(x) for i in range(len(l)): q = q+max(0,n[i]-b*l[i]) n=n[::-1] m=m[::-1] for p in m : w=w+p y.append(w) for r in range(len(y)): o = o+max(0,n[r]-b*y[r]) if q>o: print("Limak") elif q == o: print("Tie") else: print("Radewoosh")
Title: Bear and Reverse Radewoosh Time Limit: None seconds Memory Limit: None megabytes Problem Description: Limak and Radewoosh are going to compete against each other in the upcoming algorithmic contest. They are equally skilled but they won't solve problems in the same order. There will be *n* problems. The *i*-th problem has initial score *p**i* and it takes exactly *t**i* minutes to solve it. Problems are sorted by difficulty — it's guaranteed that *p**i*<=&lt;<=*p**i*<=+<=1 and *t**i*<=&lt;<=*t**i*<=+<=1. A constant *c* is given too, representing the speed of loosing points. Then, submitting the *i*-th problem at time *x* (*x* minutes after the start of the contest) gives *max*(0,<= *p**i*<=-<=*c*·*x*) points. Limak is going to solve problems in order 1,<=2,<=...,<=*n* (sorted increasingly by *p**i*). Radewoosh is going to solve them in order *n*,<=*n*<=-<=1,<=...,<=1 (sorted decreasingly by *p**i*). Your task is to predict the outcome — print the name of the winner (person who gets more points at the end) or a word "Tie" in case of a tie. You may assume that the duration of the competition is greater or equal than the sum of all *t**i*. That means both Limak and Radewoosh will accept all *n* problems. Input Specification: The first line contains two integers *n* and *c* (1<=≤<=*n*<=≤<=50,<=1<=≤<=*c*<=≤<=1000) — the number of problems and the constant representing the speed of loosing points. The second line contains *n* integers *p*1,<=*p*2,<=...,<=*p**n* (1<=≤<=*p**i*<=≤<=1000,<=*p**i*<=&lt;<=*p**i*<=+<=1) — initial scores. The third line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t**i*<=≤<=1000,<=*t**i*<=&lt;<=*t**i*<=+<=1) where *t**i* denotes the number of minutes one needs to solve the *i*-th problem. Output Specification: Print "Limak" (without quotes) if Limak will get more points in total. Print "Radewoosh" (without quotes) if Radewoosh will get more points in total. Print "Tie" (without quotes) if Limak and Radewoosh will get the same total number of points. Demo Input: ['3 2\n50 85 250\n10 15 25\n', '3 6\n50 85 250\n10 15 25\n', '8 1\n10 20 30 40 50 60 70 80\n8 10 58 63 71 72 75 76\n'] Demo Output: ['Limak\n', 'Radewoosh\n', 'Tie\n'] Note: In the first sample, there are 3 problems. Limak solves them as follows: 1. Limak spends 10 minutes on the 1-st problem and he gets 50 - *c*·10 = 50 - 2·10 = 30 points. 1. Limak spends 15 minutes on the 2-nd problem so he submits it 10 + 15 = 25 minutes after the start of the contest. For the 2-nd problem he gets 85 - 2·25 = 35 points. 1. He spends 25 minutes on the 3-rd problem so he submits it 10 + 15 + 25 = 50 minutes after the start. For this problem he gets 250 - 2·50 = 150 points. So, Limak got 30 + 35 + 150 = 215 points. Radewoosh solves problem in the reversed order: 1. Radewoosh solves 3-rd problem after 25 minutes so he gets 250 - 2·25 = 200 points. 1. He spends 15 minutes on the 2-nd problem so he submits it 25 + 15 = 40 minutes after the start. He gets 85 - 2·40 = 5 points for this problem. 1. He spends 10 minutes on the 1-st problem so he submits it 25 + 15 + 10 = 50 minutes after the start. He gets *max*(0, 50 - 2·50) = *max*(0,  - 50) = 0 points. Radewoosh got 200 + 5 + 0 = 205 points in total. Limak has 215 points so Limak wins. In the second sample, Limak will get 0 points for each problem and Radewoosh will first solve the hardest problem and he will get 250 - 6·25 = 100 points for that. Radewoosh will get 0 points for other two problems but he is the winner anyway. In the third sample, Limak will get 2 points for the 1-st problem and 2 points for the 2-nd problem. Radewoosh will get 4 points for the 8-th problem. They won't get points for other problems and thus there is a tie because 2 + 2 = 4.
```python a,b=map(int,input().split()) n=list(map(int,input().split())) m=list(map(int,input().split())) l,y=[],[] x,q,w,o= 0,0,0,0 for e in m : x = x+e l.append(x) for i in range(len(l)): q = q+max(0,n[i]-b*l[i]) n=n[::-1] m=m[::-1] for p in m : w=w+p y.append(w) for r in range(len(y)): o = o+max(0,n[r]-b*y[r]) if q>o: print("Limak") elif q == o: print("Tie") else: print("Radewoosh") ```
3
306
A
Candies
PROGRAMMING
800
[ "implementation" ]
null
null
Polycarpus has got *n* candies and *m* friends (*n*<=≥<=*m*). He wants to make a New Year present with candies to each friend. Polycarpus is planning to present all candies and he wants to do this in the fairest (that is, most equal) manner. He wants to choose such *a**i*, where *a**i* is the number of candies in the *i*-th friend's present, that the maximum *a**i* differs from the least *a**i* as little as possible. For example, if *n* is divisible by *m*, then he is going to present the same number of candies to all his friends, that is, the maximum *a**i* won't differ from the minimum one.
The single line of the input contains a pair of space-separated positive integers *n*, *m* (1<=≤<=*n*,<=*m*<=≤<=100;*n*<=≥<=*m*) — the number of candies and the number of Polycarpus's friends.
Print the required sequence *a*1,<=*a*2,<=...,<=*a**m*, where *a**i* is the number of candies in the *i*-th friend's present. All numbers *a**i* must be positive integers, total up to *n*, the maximum one should differ from the minimum one by the smallest possible value.
[ "12 3\n", "15 4\n", "18 7\n" ]
[ "4 4 4 ", "3 4 4 4 ", "2 2 2 3 3 3 3 " ]
Print *a*<sub class="lower-index">*i*</sub> in any order, separate the numbers by spaces.
500
[ { "input": "12 4", "output": "3 3 3 3 " }, { "input": "15 6", "output": "2 2 2 3 3 3 " }, { "input": "18 8", "output": "2 2 2 2 2 2 3 3 " }, { "input": "1 1", "output": "1 " }, { "input": "2 1", "output": "2 " }, { "input": "100 1", "output": "100 " }, { "input": "100 100", "output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 " }, { "input": "100 10", "output": "10 10 10 10 10 10 10 10 10 10 " }, { "input": "64 8", "output": "8 8 8 8 8 8 8 8 " }, { "input": "81 27", "output": "3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 " }, { "input": "100 99", "output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 " }, { "input": "100 51", "output": "1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 " }, { "input": "100 49", "output": "2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 3 " }, { "input": "100 13", "output": "7 7 7 7 8 8 8 8 8 8 8 8 8 " }, { "input": "97 11", "output": "8 8 9 9 9 9 9 9 9 9 9 " }, { "input": "19 3", "output": "6 6 7 " }, { "input": "99 10", "output": "9 10 10 10 10 10 10 10 10 10 " }, { "input": "88 5", "output": "17 17 18 18 18 " }, { "input": "87 34", "output": "2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 " }, { "input": "97 55", "output": "1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 " } ]
1,602,620,461
2,147,483,647
PyPy 3
OK
TESTS
20
280
0
s = input() s2 = s.split(' ') n = int(s2[0]) m = int(s2[1]) lst = [] f = n // m for i in range(m): lst.append(f) k = 0 for i in lst: k += i while k < n: for j in range(len(lst)): lst[j] += 1 k += 1 if not k < n: break for item in lst[::-1]: print(item, end = ' ')
Title: Candies Time Limit: None seconds Memory Limit: None megabytes Problem Description: Polycarpus has got *n* candies and *m* friends (*n*<=≥<=*m*). He wants to make a New Year present with candies to each friend. Polycarpus is planning to present all candies and he wants to do this in the fairest (that is, most equal) manner. He wants to choose such *a**i*, where *a**i* is the number of candies in the *i*-th friend's present, that the maximum *a**i* differs from the least *a**i* as little as possible. For example, if *n* is divisible by *m*, then he is going to present the same number of candies to all his friends, that is, the maximum *a**i* won't differ from the minimum one. Input Specification: The single line of the input contains a pair of space-separated positive integers *n*, *m* (1<=≤<=*n*,<=*m*<=≤<=100;*n*<=≥<=*m*) — the number of candies and the number of Polycarpus's friends. Output Specification: Print the required sequence *a*1,<=*a*2,<=...,<=*a**m*, where *a**i* is the number of candies in the *i*-th friend's present. All numbers *a**i* must be positive integers, total up to *n*, the maximum one should differ from the minimum one by the smallest possible value. Demo Input: ['12 3\n', '15 4\n', '18 7\n'] Demo Output: ['4 4 4 ', '3 4 4 4 ', '2 2 2 3 3 3 3 '] Note: Print *a*<sub class="lower-index">*i*</sub> in any order, separate the numbers by spaces.
```python s = input() s2 = s.split(' ') n = int(s2[0]) m = int(s2[1]) lst = [] f = n // m for i in range(m): lst.append(f) k = 0 for i in lst: k += i while k < n: for j in range(len(lst)): lst[j] += 1 k += 1 if not k < n: break for item in lst[::-1]: print(item, end = ' ') ```
3
884
A
Book Reading
PROGRAMMING
800
[ "implementation" ]
null
null
Recently Luba bought a very interesting book. She knows that it will take *t* seconds to read the book. Luba wants to finish reading as fast as she can. But she has some work to do in each of *n* next days. The number of seconds that Luba has to spend working during *i*-th day is *a**i*. If some free time remains, she can spend it on reading. Help Luba to determine the minimum number of day when she finishes reading. It is guaranteed that the answer doesn't exceed *n*. Remember that there are 86400 seconds in a day.
The first line contains two integers *n* and *t* (1<=≤<=*n*<=≤<=100, 1<=≤<=*t*<=≤<=106) — the number of days and the time required to read the book. The second line contains *n* integers *a**i* (0<=≤<=*a**i*<=≤<=86400) — the time Luba has to spend on her work during *i*-th day.
Print the minimum day Luba can finish reading the book. It is guaranteed that answer doesn't exceed *n*.
[ "2 2\n86400 86398\n", "2 86400\n0 86400\n" ]
[ "2\n", "1\n" ]
none
0
[ { "input": "2 2\n86400 86398", "output": "2" }, { "input": "2 86400\n0 86400", "output": "1" }, { "input": "2 86400\n1 86399", "output": "2" }, { "input": "100 1000000\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", "output": "12" }, { "input": "1 1\n86399", "output": "1" }, { "input": "6 1200\n86400 86400 86000 86000 86000 86400", "output": "5" }, { "input": "6 1200\n86400 86400 86000 86000 86001 86399", "output": "6" }, { "input": "4 172799\n1 1 86400 0", "output": "4" }, { "input": "4 172799\n0 86400 86399 0", "output": "4" }, { "input": "6 1\n1 1 86400 1 86399 1", "output": "1" }, { "input": "4 1\n86400 86399 86400 86400", "output": "2" }, { "input": "4 1\n86400 86400 0 86400", "output": "3" } ]
1,509,463,440
2,147,483,647
Python 3
OK
TESTS
16
46
0
from sys import stdin, stdout def main(): sec_day = 86400 n, t = map(int, stdin.readline().split()) cnt = 0 for cur in stdin.readline().split(): cur = int(cur) t -= sec_day - cur cnt += 1 if t <= 0: stdout.write(str(cnt)) break if __name__ == '__main__': main()
Title: Book Reading Time Limit: None seconds Memory Limit: None megabytes Problem Description: Recently Luba bought a very interesting book. She knows that it will take *t* seconds to read the book. Luba wants to finish reading as fast as she can. But she has some work to do in each of *n* next days. The number of seconds that Luba has to spend working during *i*-th day is *a**i*. If some free time remains, she can spend it on reading. Help Luba to determine the minimum number of day when she finishes reading. It is guaranteed that the answer doesn't exceed *n*. Remember that there are 86400 seconds in a day. Input Specification: The first line contains two integers *n* and *t* (1<=≤<=*n*<=≤<=100, 1<=≤<=*t*<=≤<=106) — the number of days and the time required to read the book. The second line contains *n* integers *a**i* (0<=≤<=*a**i*<=≤<=86400) — the time Luba has to spend on her work during *i*-th day. Output Specification: Print the minimum day Luba can finish reading the book. It is guaranteed that answer doesn't exceed *n*. Demo Input: ['2 2\n86400 86398\n', '2 86400\n0 86400\n'] Demo Output: ['2\n', '1\n'] Note: none
```python from sys import stdin, stdout def main(): sec_day = 86400 n, t = map(int, stdin.readline().split()) cnt = 0 for cur in stdin.readline().split(): cur = int(cur) t -= sec_day - cur cnt += 1 if t <= 0: stdout.write(str(cnt)) break if __name__ == '__main__': main() ```
3
495
B
Modular Equations
PROGRAMMING
1,600
[ "math", "number theory" ]
null
null
Last week, Hamed learned about a new type of equations in his math class called Modular Equations. Lets define *i* modulo *j* as the remainder of division of *i* by *j* and denote it by . A Modular Equation, as Hamed's teacher described, is an equation of the form in which *a* and *b* are two non-negative integers and *x* is a variable. We call a positive integer *x* for which a solution of our equation. Hamed didn't pay much attention to the class since he was watching a movie. He only managed to understand the definitions of these equations. Now he wants to write his math exercises but since he has no idea how to do that, he asked you for help. He has told you all he knows about Modular Equations and asked you to write a program which given two numbers *a* and *b* determines how many answers the Modular Equation has.
In the only line of the input two space-separated integers *a* and *b* (0<=≤<=*a*,<=*b*<=≤<=109) are given.
If there is an infinite number of answers to our equation, print "infinity" (without the quotes). Otherwise print the number of solutions of the Modular Equation .
[ "21 5\n", "9435152 272\n", "10 10\n" ]
[ "2\n", "282\n", "infinity\n" ]
In the first sample the answers of the Modular Equation are 8 and 16 since <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/6f5ff39ebd209bf990adaf91f4b82f9687097224.png" style="max-width: 100.0%;max-height: 100.0%;"/>
1,000
[ { "input": "21 5", "output": "2" }, { "input": "9435152 272", "output": "282" }, { "input": "10 10", "output": "infinity" }, { "input": "0 1000000000", "output": "0" }, { "input": "11 2", "output": "2" }, { "input": "1 0", "output": "1" }, { "input": "0 0", "output": "infinity" }, { "input": "121 0", "output": "3" }, { "input": "772930485 686893955", "output": "0" }, { "input": "257424 24", "output": "127" }, { "input": "295138437 589952171", "output": "0" }, { "input": "223093836 966", "output": "399" }, { "input": "233758336 10665466", "output": "13" }, { "input": "223092887 17", "output": "500" }, { "input": "223094728 1858", "output": "371" }, { "input": "223092899 29", "output": "495" }, { "input": "997920 0", "output": "240" }, { "input": "887043 3", "output": "213" }, { "input": "124 24", "output": "3" }, { "input": "982901 101", "output": "193" }, { "input": "357987 35", "output": "45" }, { "input": "954374 1030", "output": "32" }, { "input": "49106 46", "output": "15" }, { "input": "325508499 119510657", "output": "1" }, { "input": "89768760 885778845", "output": "0" }, { "input": "944387968 700818251", "output": "0" }, { "input": "12 3", "output": "1" }, { "input": "1000000000 1", "output": "19" }, { "input": "923456789 3", "output": "14" }, { "input": "1000000000 6", "output": "6" }, { "input": "1000000000 333333300", "output": "2" }, { "input": "5 2", "output": "1" }, { "input": "1 10", "output": "0" }, { "input": "15 3", "output": "3" }, { "input": "2 0", "output": "2" }, { "input": "77 75", "output": "0" }, { "input": "1000000000 1000000000", "output": "infinity" } ]
1,580,317,252
2,147,483,647
Python 3
OK
TESTS
37
124
0
a,b = list(map(int , input().split())) if(a<b): print(0) else: if a==b: print('infinity') elif a>b: cnt =0 for i in range(1,int((a-b)**0.5)+1): if(a-b)%i==0: if(i>b): cnt+=1 if(a-b)/i > b and i*i != (a-b) : cnt+=1 print(cnt)
Title: Modular Equations Time Limit: None seconds Memory Limit: None megabytes Problem Description: Last week, Hamed learned about a new type of equations in his math class called Modular Equations. Lets define *i* modulo *j* as the remainder of division of *i* by *j* and denote it by . A Modular Equation, as Hamed's teacher described, is an equation of the form in which *a* and *b* are two non-negative integers and *x* is a variable. We call a positive integer *x* for which a solution of our equation. Hamed didn't pay much attention to the class since he was watching a movie. He only managed to understand the definitions of these equations. Now he wants to write his math exercises but since he has no idea how to do that, he asked you for help. He has told you all he knows about Modular Equations and asked you to write a program which given two numbers *a* and *b* determines how many answers the Modular Equation has. Input Specification: In the only line of the input two space-separated integers *a* and *b* (0<=≤<=*a*,<=*b*<=≤<=109) are given. Output Specification: If there is an infinite number of answers to our equation, print "infinity" (without the quotes). Otherwise print the number of solutions of the Modular Equation . Demo Input: ['21 5\n', '9435152 272\n', '10 10\n'] Demo Output: ['2\n', '282\n', 'infinity\n'] Note: In the first sample the answers of the Modular Equation are 8 and 16 since <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/6f5ff39ebd209bf990adaf91f4b82f9687097224.png" style="max-width: 100.0%;max-height: 100.0%;"/>
```python a,b = list(map(int , input().split())) if(a<b): print(0) else: if a==b: print('infinity') elif a>b: cnt =0 for i in range(1,int((a-b)**0.5)+1): if(a-b)%i==0: if(i>b): cnt+=1 if(a-b)/i > b and i*i != (a-b) : cnt+=1 print(cnt) ```
3
545
A
Toy Cars
PROGRAMMING
900
[ "implementation" ]
null
null
Little Susie, thanks to her older brother, likes to play with cars. Today she decided to set up a tournament between them. The process of a tournament is described in the next paragraph. There are *n* toy cars. Each pair collides. The result of a collision can be one of the following: no car turned over, one car turned over, both cars turned over. A car is good if it turned over in no collision. The results of the collisions are determined by an *n*<=×<=*n* matrix *А*: there is a number on the intersection of the *і*-th row and *j*-th column that describes the result of the collision of the *і*-th and the *j*-th car: - <=-<=1: if this pair of cars never collided. <=-<=1 occurs only on the main diagonal of the matrix. - 0: if no car turned over during the collision. - 1: if only the *i*-th car turned over during the collision. - 2: if only the *j*-th car turned over during the collision. - 3: if both cars turned over during the collision. Susie wants to find all the good cars. She quickly determined which cars are good. Can you cope with the task?
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of cars. Each of the next *n* lines contains *n* space-separated integers that determine matrix *A*. It is guaranteed that on the main diagonal there are <=-<=1, and <=-<=1 doesn't appear anywhere else in the matrix. It is guaranteed that the input is correct, that is, if *A**ij*<==<=1, then *A**ji*<==<=2, if *A**ij*<==<=3, then *A**ji*<==<=3, and if *A**ij*<==<=0, then *A**ji*<==<=0.
Print the number of good cars and in the next line print their space-separated indices in the increasing order.
[ "3\n-1 0 0\n0 -1 1\n0 2 -1\n", "4\n-1 3 3 3\n3 -1 3 3\n3 3 -1 3\n3 3 3 -1\n" ]
[ "2\n1 3 ", "0\n" ]
none
500
[ { "input": "3\n-1 0 0\n0 -1 1\n0 2 -1", "output": "2\n1 3 " }, { "input": "4\n-1 3 3 3\n3 -1 3 3\n3 3 -1 3\n3 3 3 -1", "output": "0" }, { "input": "1\n-1", "output": "1\n1 " }, { "input": "2\n-1 0\n0 -1", "output": "2\n1 2 " }, { "input": "2\n-1 1\n2 -1", "output": "1\n2 " }, { "input": "2\n-1 2\n1 -1", "output": "1\n1 " }, { "input": "2\n-1 3\n3 -1", "output": "0" } ]
1,674,501,798
2,147,483,647
PyPy 3-64
OK
TESTS
35
77
2,048,000
# -*- coding: utf-8 -*- """ Created on Mon Jan 23 16:09:09 2023 @author: Lenovo """ n = int(input()) m = [] ind = [] for i in range(n): m.append(list(map(int,input().split()))) for i in m: if 1 not in i and 3 not in i: ind.append(m.index(i)+1) for j in range(n): x = 0 for i in range(n): if m[i][j]==2 or m[i][j]==3: x+=1 if x==0: if j+1 not in ind: ind.remove(j+1) print(len(ind)) ind = sorted(ind) for i in ind: print(i,end=' ')
Title: Toy Cars Time Limit: None seconds Memory Limit: None megabytes Problem Description: Little Susie, thanks to her older brother, likes to play with cars. Today she decided to set up a tournament between them. The process of a tournament is described in the next paragraph. There are *n* toy cars. Each pair collides. The result of a collision can be one of the following: no car turned over, one car turned over, both cars turned over. A car is good if it turned over in no collision. The results of the collisions are determined by an *n*<=×<=*n* matrix *А*: there is a number on the intersection of the *і*-th row and *j*-th column that describes the result of the collision of the *і*-th and the *j*-th car: - <=-<=1: if this pair of cars never collided. <=-<=1 occurs only on the main diagonal of the matrix. - 0: if no car turned over during the collision. - 1: if only the *i*-th car turned over during the collision. - 2: if only the *j*-th car turned over during the collision. - 3: if both cars turned over during the collision. Susie wants to find all the good cars. She quickly determined which cars are good. Can you cope with the task? Input Specification: The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of cars. Each of the next *n* lines contains *n* space-separated integers that determine matrix *A*. It is guaranteed that on the main diagonal there are <=-<=1, and <=-<=1 doesn't appear anywhere else in the matrix. It is guaranteed that the input is correct, that is, if *A**ij*<==<=1, then *A**ji*<==<=2, if *A**ij*<==<=3, then *A**ji*<==<=3, and if *A**ij*<==<=0, then *A**ji*<==<=0. Output Specification: Print the number of good cars and in the next line print their space-separated indices in the increasing order. Demo Input: ['3\n-1 0 0\n0 -1 1\n0 2 -1\n', '4\n-1 3 3 3\n3 -1 3 3\n3 3 -1 3\n3 3 3 -1\n'] Demo Output: ['2\n1 3 ', '0\n'] Note: none
```python # -*- coding: utf-8 -*- """ Created on Mon Jan 23 16:09:09 2023 @author: Lenovo """ n = int(input()) m = [] ind = [] for i in range(n): m.append(list(map(int,input().split()))) for i in m: if 1 not in i and 3 not in i: ind.append(m.index(i)+1) for j in range(n): x = 0 for i in range(n): if m[i][j]==2 or m[i][j]==3: x+=1 if x==0: if j+1 not in ind: ind.remove(j+1) print(len(ind)) ind = sorted(ind) for i in ind: print(i,end=' ') ```
3
988
A
Diverse Team
PROGRAMMING
800
[ "brute force", "implementation" ]
null
null
There are $n$ students in a school class, the rating of the $i$-th student on Codehorses is $a_i$. You have to form a team consisting of $k$ students ($1 \le k \le n$) such that the ratings of all team members are distinct. If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct numbers which should be the indices of students in the team you form. If there are multiple answers, print any of them.
The first line contains two integers $n$ and $k$ ($1 \le k \le n \le 100$) — the number of students and the size of the team you have to form. The second line contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$), where $a_i$ is the rating of $i$-th student.
If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct integers from $1$ to $n$ which should be the indices of students in the team you form. All the ratings of the students in the team should be distinct. You may print the indices in any order. If there are multiple answers, print any of them. Assume that the students are numbered from $1$ to $n$.
[ "5 3\n15 13 15 15 12\n", "5 4\n15 13 15 15 12\n", "4 4\n20 10 40 30\n" ]
[ "YES\n1 2 5 \n", "NO\n", "YES\n1 2 3 4 \n" ]
All possible answers for the first example: - {1 2 5} - {2 3 5} - {2 4 5} Note that the order does not matter.
0
[ { "input": "5 3\n15 13 15 15 12", "output": "YES\n1 2 5 " }, { "input": "5 4\n15 13 15 15 12", "output": "NO" }, { "input": "4 4\n20 10 40 30", "output": "YES\n1 2 3 4 " }, { "input": "1 1\n1", "output": "YES\n1 " }, { "input": "100 53\n16 17 1 2 27 5 9 9 53 24 17 33 35 24 20 48 56 73 12 14 39 55 58 13 59 73 29 26 40 33 22 29 34 22 55 38 63 66 36 13 60 42 10 15 21 9 11 5 23 37 79 47 26 3 79 53 44 8 71 75 42 11 34 39 79 33 10 26 23 23 17 14 54 41 60 31 83 5 45 4 14 35 6 60 28 48 23 18 60 36 21 28 7 34 9 25 52 43 54 19", "output": "YES\n1 2 3 4 5 6 7 9 10 12 13 15 16 17 18 19 20 21 22 23 24 25 27 28 29 31 33 36 37 38 39 41 42 43 44 45 47 49 50 51 52 54 57 58 59 60 73 74 76 77 79 80 83 " }, { "input": "2 2\n100 100", "output": "NO" }, { "input": "2 2\n100 99", "output": "YES\n1 2 " }, { "input": "100 100\n63 100 75 32 53 24 73 98 76 15 70 48 8 81 88 58 95 78 27 92 14 16 72 43 46 39 66 38 64 42 59 9 22 51 4 6 10 94 28 99 68 80 35 50 45 20 47 7 30 26 49 91 77 19 96 57 65 1 11 13 31 12 82 87 93 34 62 3 21 79 56 41 89 18 44 23 74 86 2 33 69 36 61 67 25 83 5 84 90 37 40 29 97 60 52 55 54 71 17 85", "output": "YES\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 " }, { "input": "100 41\n54 16 42 3 45 6 9 72 100 13 24 57 35 5 89 13 97 27 43 9 73 89 48 16 48 55 18 15 55 28 30 6 18 41 100 61 9 42 35 54 57 25 73 15 42 54 49 5 72 48 30 55 4 43 94 5 60 92 93 23 89 75 53 92 74 93 89 28 69 6 3 49 15 28 49 57 54 55 30 57 69 18 89 6 25 23 93 74 30 13 87 53 6 42 4 54 60 30 4 35", "output": "NO" }, { "input": "100 2\n70 64 70 32 70 64 32 70 64 32 32 64 70 64 64 32 64 64 64 70 70 64 64 64 64 70 32 64 70 64 32 70 70 70 64 70 64 70 64 32 70 32 70 64 64 64 32 70 64 70 70 32 70 32 32 32 70 32 70 32 64 64 70 32 32 64 70 64 32 32 64 64 32 32 70 70 32 70 32 64 32 70 64 64 32 64 32 64 70 32 70 32 70 64 64 64 70 70 64 70", "output": "YES\n1 2 " } ]
1,631,160,472
472
PyPy 3
OK
TESTS
10
93
20,172,800
n,k = list(map(int, input().split())) arr = list(map(int, input().split())) arr_set = set() ans_list = [] for index, num in enumerate(arr): if not num in arr_set: arr_set.add(num) ans_list.append(index+1) if k > len(arr_set): print('NO') else: print('YES') for i in range(k): print(ans_list[i], end= ' ')
Title: Diverse Team Time Limit: None seconds Memory Limit: None megabytes Problem Description: There are $n$ students in a school class, the rating of the $i$-th student on Codehorses is $a_i$. You have to form a team consisting of $k$ students ($1 \le k \le n$) such that the ratings of all team members are distinct. If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct numbers which should be the indices of students in the team you form. If there are multiple answers, print any of them. Input Specification: The first line contains two integers $n$ and $k$ ($1 \le k \le n \le 100$) — the number of students and the size of the team you have to form. The second line contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$), where $a_i$ is the rating of $i$-th student. Output Specification: If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct integers from $1$ to $n$ which should be the indices of students in the team you form. All the ratings of the students in the team should be distinct. You may print the indices in any order. If there are multiple answers, print any of them. Assume that the students are numbered from $1$ to $n$. Demo Input: ['5 3\n15 13 15 15 12\n', '5 4\n15 13 15 15 12\n', '4 4\n20 10 40 30\n'] Demo Output: ['YES\n1 2 5 \n', 'NO\n', 'YES\n1 2 3 4 \n'] Note: All possible answers for the first example: - {1 2 5} - {2 3 5} - {2 4 5} Note that the order does not matter.
```python n,k = list(map(int, input().split())) arr = list(map(int, input().split())) arr_set = set() ans_list = [] for index, num in enumerate(arr): if not num in arr_set: arr_set.add(num) ans_list.append(index+1) if k > len(arr_set): print('NO') else: print('YES') for i in range(k): print(ans_list[i], end= ' ') ```
3
381
A
Sereja and Dima
PROGRAMMING
800
[ "greedy", "implementation", "two pointers" ]
null
null
Sereja and Dima play a game. The rules of the game are very simple. The players have *n* cards in a row. Each card contains a number, all numbers on the cards are distinct. The players take turns, Sereja moves first. During his turn a player can take one card: either the leftmost card in a row, or the rightmost one. The game ends when there is no more cards. The player who has the maximum sum of numbers on his cards by the end of the game, wins. Sereja and Dima are being greedy. Each of them chooses the card with the larger number during his move. Inna is a friend of Sereja and Dima. She knows which strategy the guys are using, so she wants to determine the final score, given the initial state of the game. Help her.
The first line contains integer *n* (1<=≤<=*n*<=≤<=1000) — the number of cards on the table. The second line contains space-separated numbers on the cards from left to right. The numbers on the cards are distinct integers from 1 to 1000.
On a single line, print two integers. The first number is the number of Sereja's points at the end of the game, the second number is the number of Dima's points at the end of the game.
[ "4\n4 1 2 10\n", "7\n1 2 3 4 5 6 7\n" ]
[ "12 5\n", "16 12\n" ]
In the first sample Sereja will take cards with numbers 10 and 2, so Sereja's sum is 12. Dima will take cards with numbers 4 and 1, so Dima's sum is 5.
500
[ { "input": "4\n4 1 2 10", "output": "12 5" }, { "input": "7\n1 2 3 4 5 6 7", "output": "16 12" }, { "input": "42\n15 29 37 22 16 5 26 31 6 32 19 3 45 36 33 14 25 20 48 7 42 11 24 28 9 18 8 21 47 17 38 40 44 4 35 1 43 39 41 27 12 13", "output": "613 418" }, { "input": "43\n32 1 15 48 38 26 25 14 20 44 11 30 3 42 49 19 18 46 5 45 10 23 34 9 29 41 2 52 6 17 35 4 50 22 33 51 7 28 47 13 39 37 24", "output": "644 500" }, { "input": "1\n3", "output": "3 0" }, { "input": "45\n553 40 94 225 415 471 126 190 647 394 515 303 189 159 308 6 139 132 326 78 455 75 85 295 135 613 360 614 351 228 578 259 258 591 444 29 33 463 561 174 368 183 140 168 646", "output": "6848 6568" }, { "input": "44\n849 373 112 307 479 608 856 769 526 82 168 143 573 762 115 501 688 36 214 450 396 496 236 309 287 786 397 43 811 141 745 846 350 270 276 677 420 459 403 722 267 54 394 727", "output": "9562 9561" }, { "input": "35\n10 15 18 1 28 16 2 33 6 22 23 4 9 25 35 8 7 26 3 20 30 14 31 19 27 32 11 5 29 24 21 34 13 17 12", "output": "315 315" }, { "input": "17\n580 376 191 496 73 44 520 357 483 149 81 178 514 300 216 598 304", "output": "3238 2222" }, { "input": "30\n334 443 223 424 168 549 189 303 429 559 516 220 459 134 344 346 316 446 209 148 487 526 69 286 102 366 518 280 392 325", "output": "5246 4864" }, { "input": "95\n122 29 188 265 292 287 183 225 222 187 155 256 64 148 173 278 218 136 290 17 31 130 2 87 57 283 255 280 68 166 174 142 102 39 116 206 288 154 26 78 296 172 184 232 77 91 277 8 249 186 94 93 207 251 257 195 101 299 193 124 293 65 58 35 24 302 220 189 252 125 27 284 247 182 141 103 198 97 234 83 281 216 85 180 267 236 109 143 149 239 79 300 191 244 71", "output": "8147 7807" }, { "input": "1\n1", "output": "1 0" } ]
1,692,369,454
2,147,483,647
Python 3
OK
TESTS
34
46
0
n = int(input()) a = list(map(int, input().split())) l, r = 0, len(a) - 1 d = 0 s = [0, 0] while l <= r: if a[l] > a[r]: s[d] += a[l] l += 1 else: s[d] += a[r] r -= 1 d = 1 - d print(s[0], s[1])
Title: Sereja and Dima Time Limit: None seconds Memory Limit: None megabytes Problem Description: Sereja and Dima play a game. The rules of the game are very simple. The players have *n* cards in a row. Each card contains a number, all numbers on the cards are distinct. The players take turns, Sereja moves first. During his turn a player can take one card: either the leftmost card in a row, or the rightmost one. The game ends when there is no more cards. The player who has the maximum sum of numbers on his cards by the end of the game, wins. Sereja and Dima are being greedy. Each of them chooses the card with the larger number during his move. Inna is a friend of Sereja and Dima. She knows which strategy the guys are using, so she wants to determine the final score, given the initial state of the game. Help her. Input Specification: The first line contains integer *n* (1<=≤<=*n*<=≤<=1000) — the number of cards on the table. The second line contains space-separated numbers on the cards from left to right. The numbers on the cards are distinct integers from 1 to 1000. Output Specification: On a single line, print two integers. The first number is the number of Sereja's points at the end of the game, the second number is the number of Dima's points at the end of the game. Demo Input: ['4\n4 1 2 10\n', '7\n1 2 3 4 5 6 7\n'] Demo Output: ['12 5\n', '16 12\n'] Note: In the first sample Sereja will take cards with numbers 10 and 2, so Sereja's sum is 12. Dima will take cards with numbers 4 and 1, so Dima's sum is 5.
```python n = int(input()) a = list(map(int, input().split())) l, r = 0, len(a) - 1 d = 0 s = [0, 0] while l <= r: if a[l] > a[r]: s[d] += a[l] l += 1 else: s[d] += a[r] r -= 1 d = 1 - d print(s[0], s[1]) ```
3
742
A
Arpa’s hard exam and Mehrdad’s naive cheat
PROGRAMMING
1,000
[ "implementation", "math", "number theory" ]
null
null
There exists an island called Arpa’s land, some beautiful girls live there, as ugly ones do. Mehrdad wants to become minister of Arpa’s land. Arpa has prepared an exam. Exam has only one question, given *n*, print the last digit of 1378*n*. Mehrdad has become quite confused and wants you to help him. Please help, although it's a naive cheat.
The single line of input contains one integer *n* (0<=<=≤<=<=*n*<=<=≤<=<=109).
Print single integer — the last digit of 1378*n*.
[ "1\n", "2\n" ]
[ "8", "4" ]
In the first example, last digit of 1378<sup class="upper-index">1</sup> = 1378 is 8. In the second example, last digit of 1378<sup class="upper-index">2</sup> = 1378·1378 = 1898884 is 4.
500
[ { "input": "1", "output": "8" }, { "input": "2", "output": "4" }, { "input": "1000", "output": "6" }, { "input": "3", "output": "2" }, { "input": "4", "output": "6" }, { "input": "1000000000", "output": "6" }, { "input": "5", "output": "8" }, { "input": "6", "output": "4" }, { "input": "999999999", "output": "2" }, { "input": "1378", "output": "4" }, { "input": "13781378", "output": "4" }, { "input": "51202278", "output": "4" }, { "input": "999999998", "output": "4" }, { "input": "999999997", "output": "8" }, { "input": "12193721", "output": "8" }, { "input": "0", "output": "1" }, { "input": "989898989", "output": "8" }, { "input": "7", "output": "2" }, { "input": "8", "output": "6" }, { "input": "9", "output": "8" }, { "input": "10", "output": "4" }, { "input": "11", "output": "2" }, { "input": "12", "output": "6" }, { "input": "13", "output": "8" }, { "input": "14", "output": "4" }, { "input": "15", "output": "2" }, { "input": "16", "output": "6" }, { "input": "999999996", "output": "6" }, { "input": "999999995", "output": "2" }, { "input": "999999994", "output": "4" } ]
1,650,383,535
2,147,483,647
Python 3
OK
TESTS
30
31
0
base = 8 power = int(input()) result = 1 while power !=0: if power% 2==1: power = power - 1 result = (result * base)%10 if power%2 ==0: base = (base*base)%10 power = power //2 print(result)
Title: Arpa’s hard exam and Mehrdad’s naive cheat Time Limit: None seconds Memory Limit: None megabytes Problem Description: There exists an island called Arpa’s land, some beautiful girls live there, as ugly ones do. Mehrdad wants to become minister of Arpa’s land. Arpa has prepared an exam. Exam has only one question, given *n*, print the last digit of 1378*n*. Mehrdad has become quite confused and wants you to help him. Please help, although it's a naive cheat. Input Specification: The single line of input contains one integer *n* (0<=<=≤<=<=*n*<=<=≤<=<=109). Output Specification: Print single integer — the last digit of 1378*n*. Demo Input: ['1\n', '2\n'] Demo Output: ['8', '4'] Note: In the first example, last digit of 1378<sup class="upper-index">1</sup> = 1378 is 8. In the second example, last digit of 1378<sup class="upper-index">2</sup> = 1378·1378 = 1898884 is 4.
```python base = 8 power = int(input()) result = 1 while power !=0: if power% 2==1: power = power - 1 result = (result * base)%10 if power%2 ==0: base = (base*base)%10 power = power //2 print(result) ```
3
447
A
DZY Loves Hash
PROGRAMMING
800
[ "implementation" ]
null
null
DZY has a hash table with *p* buckets, numbered from 0 to *p*<=-<=1. He wants to insert *n* numbers, in the order they are given, into the hash table. For the *i*-th number *x**i*, DZY will put it into the bucket numbered *h*(*x**i*), where *h*(*x*) is the hash function. In this problem we will assume, that *h*(*x*)<==<=*x* *mod* *p*. Operation *a* *mod* *b* denotes taking a remainder after division *a* by *b*. However, each bucket can contain no more than one element. If DZY wants to insert an number into a bucket which is already filled, we say a "conflict" happens. Suppose the first conflict happens right after the *i*-th insertion, you should output *i*. If no conflict happens, just output -1.
The first line contains two integers, *p* and *n* (2<=≤<=*p*,<=*n*<=≤<=300). Then *n* lines follow. The *i*-th of them contains an integer *x**i* (0<=≤<=*x**i*<=≤<=109).
Output a single integer — the answer to the problem.
[ "10 5\n0\n21\n53\n41\n53\n", "5 5\n0\n1\n2\n3\n4\n" ]
[ "4\n", "-1\n" ]
none
500
[ { "input": "10 5\n0\n21\n53\n41\n53", "output": "4" }, { "input": "5 5\n0\n1\n2\n3\n4", "output": "-1" }, { "input": "10 6\n811966798\n734823552\n790326404\n929189974\n414343256\n560346537", "output": "4" }, { "input": "2 2\n788371161\n801743052", "output": "-1" }, { "input": "10 6\n812796223\n122860157\n199259103\n597650585\n447742024\n521549402", "output": "3" }, { "input": "300 2\n822454942\n119374431", "output": "-1" }, { "input": "300 2\n823284367\n507345500", "output": "-1" }, { "input": "2 5\n791579811\n35613889\n997079893\n878677665\n693717467", "output": "2" }, { "input": "20 5\n793926268\n28931770\n842870287\n974950617\n859404206", "output": "-1" }, { "input": "100 15\n805069249\n778178198\n633897389\n844316223\n146759898\n870527016\n82668754\n42060733\n943602929\n979451110\n746979598\n47406033\n607284062\n850870259\n229415316", "output": "5" }, { "input": "100 15\n806204335\n189490323\n718805086\n716787474\n262315718\n822030596\n894644222\n724054623\n141384399\n579354205\n192622443\n672556242\n97417563\n243354557\n208957882", "output": "8" }, { "input": "100 15\n807033760\n577461392\n275221433\n532633429\n295714486\n783298996\n255799943\n99107143\n729119412\n59302896\n37640015\n313610861\n630550567\n534283052\n681062462", "output": "8" }, { "input": "100 15\n808103310\n136224397\n360129131\n405104681\n263786657\n734802577\n67808179\n928584682\n926900882\n511722343\n483348395\n938695534\n120684068\n74152694\n808088675", "output": "9" }, { "input": "2 2\n2\n2", "output": "2" }, { "input": "300 2\n0\n300", "output": "2" }, { "input": "2 2\n0\n0", "output": "2" } ]
1,553,494,845
2,147,483,647
PyPy 3
OK
TESTS
29
124
0
n,m=map(int,input().split()) a=[-1]*n for i in range(m): k=int(input()) if a[k%n]!=-1:print(i+1);exit() else:a[k%n]=k%n print(-1)
Title: DZY Loves Hash Time Limit: None seconds Memory Limit: None megabytes Problem Description: DZY has a hash table with *p* buckets, numbered from 0 to *p*<=-<=1. He wants to insert *n* numbers, in the order they are given, into the hash table. For the *i*-th number *x**i*, DZY will put it into the bucket numbered *h*(*x**i*), where *h*(*x*) is the hash function. In this problem we will assume, that *h*(*x*)<==<=*x* *mod* *p*. Operation *a* *mod* *b* denotes taking a remainder after division *a* by *b*. However, each bucket can contain no more than one element. If DZY wants to insert an number into a bucket which is already filled, we say a "conflict" happens. Suppose the first conflict happens right after the *i*-th insertion, you should output *i*. If no conflict happens, just output -1. Input Specification: The first line contains two integers, *p* and *n* (2<=≤<=*p*,<=*n*<=≤<=300). Then *n* lines follow. The *i*-th of them contains an integer *x**i* (0<=≤<=*x**i*<=≤<=109). Output Specification: Output a single integer — the answer to the problem. Demo Input: ['10 5\n0\n21\n53\n41\n53\n', '5 5\n0\n1\n2\n3\n4\n'] Demo Output: ['4\n', '-1\n'] Note: none
```python n,m=map(int,input().split()) a=[-1]*n for i in range(m): k=int(input()) if a[k%n]!=-1:print(i+1);exit() else:a[k%n]=k%n print(-1) ```
3
59
A
Word
PROGRAMMING
800
[ "implementation", "strings" ]
A. Word
2
256
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
[ "HoUse\n", "ViP\n", "maTRIx\n" ]
[ "house\n", "VIP\n", "matrix\n" ]
none
500
[ { "input": "HoUse", "output": "house" }, { "input": "ViP", "output": "VIP" }, { "input": "maTRIx", "output": "matrix" }, { "input": "BNHWpnpawg", "output": "bnhwpnpawg" }, { "input": "VTYGP", "output": "VTYGP" }, { "input": "CHNenu", "output": "chnenu" }, { "input": "ERPZGrodyu", "output": "erpzgrodyu" }, { "input": "KSXBXWpebh", "output": "KSXBXWPEBH" }, { "input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv", "output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv" }, { "input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd", "output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd" }, { "input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv", "output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv" }, { "input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg", "output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg" }, { "input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak", "output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK" }, { "input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw", "output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW" }, { "input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB", "output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB" }, { "input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge", "output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge" }, { "input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw", "output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw" }, { "input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks", "output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks" }, { "input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz", "output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ" }, { "input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg", "output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG" }, { "input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO", "output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO" }, { "input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd", "output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD" }, { "input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas", "output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas" }, { "input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm", "output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM" }, { "input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn", "output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn" }, { "input": "t", "output": "t" }, { "input": "N", "output": "N" }, { "input": "kv", "output": "kv" }, { "input": "Ur", "output": "ur" }, { "input": "CN", "output": "CN" } ]
1,651,875,893
2,147,483,647
Python 3
OK
TESTS
30
92
0
s= input() count=0 l = len(s) for i in range(len(s)): if s[i].islower() == True: count +=1 if count >= l - count: print(s.lower()) else: print(s.upper())
Title: Word Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word. Input Specification: The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100. Output Specification: Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one. Demo Input: ['HoUse\n', 'ViP\n', 'maTRIx\n'] Demo Output: ['house\n', 'VIP\n', 'matrix\n'] Note: none
```python s= input() count=0 l = len(s) for i in range(len(s)): if s[i].islower() == True: count +=1 if count >= l - count: print(s.lower()) else: print(s.upper()) ```
3.977
385
B
Bear and Strings
PROGRAMMING
1,200
[ "brute force", "greedy", "implementation", "math", "strings" ]
null
null
The bear has a string *s*<==<=*s*1*s*2... *s*|*s*| (record |*s*| is the string's length), consisting of lowercase English letters. The bear wants to count the number of such pairs of indices *i*,<=*j* (1<=≤<=*i*<=≤<=*j*<=≤<=|*s*|), that string *x*(*i*,<=*j*)<==<=*s**i**s**i*<=+<=1... *s**j* contains at least one string "bear" as a substring. String *x*(*i*,<=*j*) contains string "bear", if there is such index *k* (*i*<=≤<=*k*<=≤<=*j*<=-<=3), that *s**k*<==<=*b*, *s**k*<=+<=1<==<=*e*, *s**k*<=+<=2<==<=*a*, *s**k*<=+<=3<==<=*r*. Help the bear cope with the given problem.
The first line contains a non-empty string *s* (1<=≤<=|*s*|<=≤<=5000). It is guaranteed that the string only consists of lowercase English letters.
Print a single number — the answer to the problem.
[ "bearbtear\n", "bearaabearc\n" ]
[ "6\n", "20\n" ]
In the first sample, the following pairs (*i*, *j*) match: (1, 4), (1, 5), (1, 6), (1, 7), (1, 8), (1, 9). In the second sample, the following pairs (*i*, *j*) match: (1,  4), (1,  5), (1,  6), (1,  7), (1,  8), (1,  9), (1,  10), (1,  11), (2,  10), (2,  11), (3,  10), (3,  11), (4,  10), (4,  11), (5,  10), (5,  11), (6,  10), (6,  11), (7,  10), (7,  11).
1,000
[ { "input": "bearbtear", "output": "6" }, { "input": "bearaabearc", "output": "20" }, { "input": "pbearbearhbearzqbearjkterasjhy", "output": "291" }, { "input": "pbearjbearbebearnbabcffbearbearwubearjezpiorrbearbearjbdlbearbearqbearjbearwipmsbearoaftrsebearzsnqb", "output": "4419" }, { "input": "bear", "output": "1" }, { "input": "a", "output": "0" }, { "input": "be", "output": "0" } ]
1,654,788,087
2,147,483,647
PyPy 3-64
OK
TESTS
43
62
2,252,800
s = input().strip() n = len(s) tot = 0 prev = 0 for i in range(n-3): if s[i:i+4] == "bear": l,r = i-prev, n - (i + 4) tot += (l+1)*(r+1) prev = i+1 print(tot)
Title: Bear and Strings Time Limit: None seconds Memory Limit: None megabytes Problem Description: The bear has a string *s*<==<=*s*1*s*2... *s*|*s*| (record |*s*| is the string's length), consisting of lowercase English letters. The bear wants to count the number of such pairs of indices *i*,<=*j* (1<=≤<=*i*<=≤<=*j*<=≤<=|*s*|), that string *x*(*i*,<=*j*)<==<=*s**i**s**i*<=+<=1... *s**j* contains at least one string "bear" as a substring. String *x*(*i*,<=*j*) contains string "bear", if there is such index *k* (*i*<=≤<=*k*<=≤<=*j*<=-<=3), that *s**k*<==<=*b*, *s**k*<=+<=1<==<=*e*, *s**k*<=+<=2<==<=*a*, *s**k*<=+<=3<==<=*r*. Help the bear cope with the given problem. Input Specification: The first line contains a non-empty string *s* (1<=≤<=|*s*|<=≤<=5000). It is guaranteed that the string only consists of lowercase English letters. Output Specification: Print a single number — the answer to the problem. Demo Input: ['bearbtear\n', 'bearaabearc\n'] Demo Output: ['6\n', '20\n'] Note: In the first sample, the following pairs (*i*, *j*) match: (1, 4), (1, 5), (1, 6), (1, 7), (1, 8), (1, 9). In the second sample, the following pairs (*i*, *j*) match: (1,  4), (1,  5), (1,  6), (1,  7), (1,  8), (1,  9), (1,  10), (1,  11), (2,  10), (2,  11), (3,  10), (3,  11), (4,  10), (4,  11), (5,  10), (5,  11), (6,  10), (6,  11), (7,  10), (7,  11).
```python s = input().strip() n = len(s) tot = 0 prev = 0 for i in range(n-3): if s[i:i+4] == "bear": l,r = i-prev, n - (i + 4) tot += (l+1)*(r+1) prev = i+1 print(tot) ```
3
610
A
Pasha and Stick
PROGRAMMING
1,000
[ "combinatorics", "math" ]
null
null
Pasha has a wooden stick of some positive integer length *n*. He wants to perform exactly three cuts to get four parts of the stick. Each part must have some positive integer length and the sum of these lengths will obviously be *n*. Pasha likes rectangles but hates squares, so he wonders, how many ways are there to split a stick into four parts so that it's possible to form a rectangle using these parts, but is impossible to form a square. Your task is to help Pasha and count the number of such ways. Two ways to cut the stick are considered distinct if there exists some integer *x*, such that the number of parts of length *x* in the first way differ from the number of parts of length *x* in the second way.
The first line of the input contains a positive integer *n* (1<=≤<=*n*<=≤<=2·109) — the length of Pasha's stick.
The output should contain a single integer — the number of ways to split Pasha's stick into four parts of positive integer length so that it's possible to make a rectangle by connecting the ends of these parts, but is impossible to form a square.
[ "6\n", "20\n" ]
[ "1\n", "4\n" ]
There is only one way to divide the stick in the first sample {1, 1, 2, 2}. Four ways to divide the stick in the second sample are {1, 1, 9, 9}, {2, 2, 8, 8}, {3, 3, 7, 7} and {4, 4, 6, 6}. Note that {5, 5, 5, 5} doesn't work.
500
[ { "input": "6", "output": "1" }, { "input": "20", "output": "4" }, { "input": "1", "output": "0" }, { "input": "2", "output": "0" }, { "input": "3", "output": "0" }, { "input": "4", "output": "0" }, { "input": "2000000000", "output": "499999999" }, { "input": "1924704072", "output": "481176017" }, { "input": "73740586", "output": "18435146" }, { "input": "1925088820", "output": "481272204" }, { "input": "593070992", "output": "148267747" }, { "input": "1925473570", "output": "481368392" }, { "input": "629490186", "output": "157372546" }, { "input": "1980649112", "output": "495162277" }, { "input": "36661322", "output": "9165330" }, { "input": "1943590793", "output": "0" }, { "input": "71207034", "output": "17801758" }, { "input": "1757577394", "output": "439394348" }, { "input": "168305294", "output": "42076323" }, { "input": "1934896224", "output": "483724055" }, { "input": "297149088", "output": "74287271" }, { "input": "1898001634", "output": "474500408" }, { "input": "176409698", "output": "44102424" }, { "input": "1873025522", "output": "468256380" }, { "input": "5714762", "output": "1428690" }, { "input": "1829551192", "output": "457387797" }, { "input": "16269438", "output": "4067359" }, { "input": "1663283390", "output": "415820847" }, { "input": "42549941", "output": "0" }, { "input": "1967345604", "output": "491836400" }, { "input": "854000", "output": "213499" }, { "input": "1995886626", "output": "498971656" }, { "input": "10330019", "output": "0" }, { "input": "1996193634", "output": "499048408" }, { "input": "9605180", "output": "2401294" }, { "input": "1996459740", "output": "499114934" }, { "input": "32691948", "output": "8172986" }, { "input": "1975903308", "output": "493975826" }, { "input": "1976637136", "output": "494159283" }, { "input": "29803038", "output": "7450759" }, { "input": "1977979692", "output": "494494922" }, { "input": "1978595336", "output": "494648833" }, { "input": "27379344", "output": "6844835" }, { "input": "1979729912", "output": "494932477" }, { "input": "1980253780", "output": "495063444" }, { "input": "1980751584", "output": "495187895" }, { "input": "53224878", "output": "13306219" }, { "input": "5", "output": "0" }, { "input": "7", "output": "0" }, { "input": "8", "output": "1" }, { "input": "9", "output": "0" }, { "input": "10", "output": "2" }, { "input": "11", "output": "0" }, { "input": "12", "output": "2" }, { "input": "13", "output": "0" }, { "input": "14", "output": "3" }, { "input": "15", "output": "0" }, { "input": "16", "output": "3" }, { "input": "17", "output": "0" }, { "input": "18", "output": "4" }, { "input": "19", "output": "0" }, { "input": "21", "output": "0" }, { "input": "22", "output": "5" }, { "input": "23", "output": "0" }, { "input": "24", "output": "5" }, { "input": "25", "output": "0" }, { "input": "26", "output": "6" }, { "input": "27", "output": "0" }, { "input": "28", "output": "6" }, { "input": "29", "output": "0" }, { "input": "30", "output": "7" }, { "input": "111", "output": "0" }, { "input": "55", "output": "0" }, { "input": "105", "output": "0" }, { "input": "199", "output": "0" }, { "input": "151", "output": "0" } ]
1,657,357,436
2,147,483,647
PyPy 3-64
OK
TESTS
76
109
0
def solve(a): if a%2==1: return 0 tmp=a//4 if a%4==0: tmp-=1 return tmp a=int(input()) print(solve(a))
Title: Pasha and Stick Time Limit: None seconds Memory Limit: None megabytes Problem Description: Pasha has a wooden stick of some positive integer length *n*. He wants to perform exactly three cuts to get four parts of the stick. Each part must have some positive integer length and the sum of these lengths will obviously be *n*. Pasha likes rectangles but hates squares, so he wonders, how many ways are there to split a stick into four parts so that it's possible to form a rectangle using these parts, but is impossible to form a square. Your task is to help Pasha and count the number of such ways. Two ways to cut the stick are considered distinct if there exists some integer *x*, such that the number of parts of length *x* in the first way differ from the number of parts of length *x* in the second way. Input Specification: The first line of the input contains a positive integer *n* (1<=≤<=*n*<=≤<=2·109) — the length of Pasha's stick. Output Specification: The output should contain a single integer — the number of ways to split Pasha's stick into four parts of positive integer length so that it's possible to make a rectangle by connecting the ends of these parts, but is impossible to form a square. Demo Input: ['6\n', '20\n'] Demo Output: ['1\n', '4\n'] Note: There is only one way to divide the stick in the first sample {1, 1, 2, 2}. Four ways to divide the stick in the second sample are {1, 1, 9, 9}, {2, 2, 8, 8}, {3, 3, 7, 7} and {4, 4, 6, 6}. Note that {5, 5, 5, 5} doesn't work.
```python def solve(a): if a%2==1: return 0 tmp=a//4 if a%4==0: tmp-=1 return tmp a=int(input()) print(solve(a)) ```
3
141
A
Amusing Joke
PROGRAMMING
800
[ "implementation", "sortings", "strings" ]
null
null
So, the New Year holidays are over. Santa Claus and his colleagues can take a rest and have guests at last. When two "New Year and Christmas Men" meet, thear assistants cut out of cardboard the letters from the guest's name and the host's name in honor of this event. Then the hung the letters above the main entrance. One night, when everyone went to bed, someone took all the letters of our characters' names. Then he may have shuffled the letters and put them in one pile in front of the door. The next morning it was impossible to find the culprit who had made the disorder. But everybody wondered whether it is possible to restore the names of the host and his guests from the letters lying at the door? That is, we need to verify that there are no extra letters, and that nobody will need to cut more letters. Help the "New Year and Christmas Men" and their friends to cope with this problem. You are given both inscriptions that hung over the front door the previous night, and a pile of letters that were found at the front door next morning.
The input file consists of three lines: the first line contains the guest's name, the second line contains the name of the residence host and the third line contains letters in a pile that were found at the door in the morning. All lines are not empty and contain only uppercase Latin letters. The length of each line does not exceed 100.
Print "YES" without the quotes, if the letters in the pile could be permuted to make the names of the "New Year and Christmas Men". Otherwise, print "NO" without the quotes.
[ "SANTACLAUS\nDEDMOROZ\nSANTAMOROZDEDCLAUS\n", "PAPAINOEL\nJOULUPUKKI\nJOULNAPAOILELUPUKKI\n", "BABBONATALE\nFATHERCHRISTMAS\nBABCHRISTMASBONATALLEFATHER\n" ]
[ "YES\n", "NO\n", "NO\n" ]
In the first sample the letters written in the last line can be used to write the names and there won't be any extra letters left. In the second sample letter "P" is missing from the pile and there's an extra letter "L". In the third sample there's an extra letter "L".
500
[ { "input": "SANTACLAUS\nDEDMOROZ\nSANTAMOROZDEDCLAUS", "output": "YES" }, { "input": "PAPAINOEL\nJOULUPUKKI\nJOULNAPAOILELUPUKKI", "output": "NO" }, { "input": "BABBONATALE\nFATHERCHRISTMAS\nBABCHRISTMASBONATALLEFATHER", "output": "NO" }, { "input": "B\nA\nAB", "output": "YES" }, { "input": "ONDOL\nJNPB\nONLNJBODP", "output": "YES" }, { "input": "Y\nW\nYW", "output": "YES" }, { "input": "OI\nM\nIMO", "output": "YES" }, { "input": "VFQRWWWACX\nGHZJPOQUSXRAQDGOGMR\nOPAWDOUSGWWCGQXXQAZJRQRGHRMVF", "output": "YES" }, { "input": "JUTCN\nPIGMZOPMEUFADQBW\nNWQGZMAIPUPOMCDUB", "output": "NO" }, { "input": "Z\nO\nZOCNDOLTBZKQLTBOLDEGXRHZGTTPBJBLSJCVSVXISQZCSFDEBXRCSGBGTHWOVIXYHACAGBRYBKBJAEPIQZHVEGLYH", "output": "NO" }, { "input": "IQ\nOQ\nQOQIGGKFNHJSGCGM", "output": "NO" }, { "input": "ROUWANOPNIGTVMIITVMZ\nOQTUPZMTKUGY\nVTVNGZITGPUNPMQOOATUUIYIWMMKZOTR", "output": "YES" }, { "input": "OVQELLOGFIOLEHXMEMBJDIGBPGEYFG\nJNKFPFFIJOFHRIFHXEWYZOPDJBZTJZKBWQTECNHRFSJPJOAPQT\nYAIPFFFEXJJNEJPLREIGODEGQZVMCOBDFKWTMWJSBEBTOFFQOHIQJLHFNXIGOHEZRZLFOKJBJPTPHPGY", "output": "YES" }, { "input": "NBJGVNGUISUXQTBOBKYHQCOOVQWUXWPXBUDLXPKX\nNSFQDFUMQDQWQ\nWXKKVNTDQQFXCUQBIMQGQHSLVGWSBFYBUPOWPBDUUJUXQNOQDNXOX", "output": "YES" }, { "input": "IJHHGKCXWDBRWJUPRDBZJLNTTNWKXLUGJSBWBOAUKWRAQWGFNL\nNJMWRMBCNPHXTDQQNZ\nWDNJRCLILNQRHWBANLTXWMJBPKUPGKJDJZAQWKTZFBRCTXHHBNXRGUQUNBNMWODGSJWW", "output": "YES" }, { "input": "SRROWANGUGZHCIEFYMQVTWVOMDWPUZJFRDUMVFHYNHNTTGNXCJ\nDJYWGLBFCCECXFHOLORDGDCNRHPWXNHXFCXQCEZUHRRNAEKUIX\nWCUJDNYHNHYOPWMHLDCDYRWBVOGHFFUKOZTXJRXJHRGWICCMRNEVNEGQWTZPNFCSHDRFCFQDCXMHTLUGZAXOFNXNVGUEXIACRERU", "output": "YES" }, { "input": "H\nJKFGHMIAHNDBMFXWYQLZRSVNOTEGCQSVUBYUOZBTNKTXPFQDCMKAGFITEUGOYDFIYQIORMFJEOJDNTFVIQEBICSNGKOSNLNXJWC\nBQSVDOGIHCHXSYNYTQFCHNJGYFIXTSOQINZOKSVQJMTKNTGFNXAVTUYEONMBQMGJLEWJOFGEARIOPKFUFCEMUBRBDNIIDFZDCLWK", "output": "YES" }, { "input": "DSWNZRFVXQ\nPVULCZGOOU\nUOLVZXNUPOQRZGWFVDSCANQTCLEIE", "output": "NO" }, { "input": "EUHTSCENIPXLTSBMLFHD\nIZAVSZPDLXOAGESUSE\nLXAELAZ", "output": "NO" }, { "input": "WYSJFEREGELSKRQRXDXCGBODEFZVSI\nPEJKMGFLBFFDWRCRFSHVEFLEBTJCVCHRJTLDTISHPOGFWPLEWNYJLMXWIAOTYOXMV\nHXERTZWLEXTPIOTFRVMEJVYFFJLRPFMXDEBNSGCEOFFCWTKIDDGCFYSJKGLHBORWEPLDRXRSJYBGASSVCMHEEJFLVI", "output": "NO" }, { "input": "EPBMDIUQAAUGLBIETKOKFLMTCVEPETWJRHHYKCKU\nHGMAETVPCFZYNNKDQXVXUALHYLOTCHM\nECGXACVKEYMCEDOTMKAUFHLHOMT", "output": "NO" }, { "input": "NUBKQEJHALANSHEIFUZHYEZKKDRFHQKAJHLAOWTZIMOCWOVVDW\nEFVOBIGAUAUSQGVSNBKNOBDMINODMFSHDL\nKLAMKNTHBFFOHVKWICHBKNDDQNEISODUSDNLUSIOAVWY", "output": "NO" }, { "input": "VXINHOMEQCATZUGAJEIUIZZLPYFGUTVLNBNWCUVMEENUXKBWBGZTMRJJVJDLVSLBABVCEUDDSQFHOYPYQTWVAGTWOLKYISAGHBMC\nZMRGXPZSHOGCSAECAPGVOIGCWEOWWOJXLGYRDMPXBLOKZVRACPYQLEQGFQCVYXAGBEBELUTDAYEAGPFKXRULZCKFHZCHVCWIRGPK\nRCVUXGQVNWFGRUDLLENNDQEJHYYVWMKTLOVIPELKPWCLSQPTAXAYEMGWCBXEVAIZGGDDRBRT", "output": "NO" }, { "input": "PHBDHHWUUTZAHELGSGGOPOQXSXEZIXHZTOKYFBQLBDYWPVCNQSXHEAXRRPVHFJBVBYCJIFOTQTWSUOWXLKMVJJBNLGTVITWTCZZ\nFUPDLNVIHRWTEEEHOOEC\nLOUSUUSZCHJBPEWIILUOXEXRQNCJEGTOBRVZLTTZAHTKVEJSNGHFTAYGY", "output": "NO" }, { "input": "GDSLNIIKTO\nJF\nPDQYFKDTNOLI", "output": "NO" }, { "input": "AHOKHEKKPJLJIIWJRCGY\nORELJCSIX\nZVWPXVFWFSWOXXLIHJKPXIOKRELYE", "output": "NO" }, { "input": "ZWCOJFORBPHXCOVJIDPKVECMHVHCOC\nTEV\nJVGTBFTLFVIEPCCHODOFOMCVZHWXVCPEH", "output": "NO" }, { "input": "AGFIGYWJLVMYZGNQHEHWKJIAWBPUAQFERMCDROFN\nPMJNHMVNRGCYZAVRWNDSMLSZHFNYIUWFPUSKKIGU\nMCDVPPRXGUAYLSDRHRURZASXUWZSIIEZCPXUVEONKNGNWRYGOSFMCKESMVJZHWWUCHWDQMLASLNNMHAU", "output": "NO" }, { "input": "XLOWVFCZSSXCSYQTIIDKHNTKNKEEDFMDZKXSPVLBIDIREDUAIN\nZKIWNDGBISDB\nSLPKLYFYSRNRMOSWYLJJDGFFENPOXYLPZFTQDANKBDNZDIIEWSUTTKYBKVICLG", "output": "NO" }, { "input": "PMUKBTRKFIAYVGBKHZHUSJYSSEPEOEWPOSPJLWLOCTUYZODLTUAFCMVKGQKRRUSOMPAYOTBTFPXYAZXLOADDEJBDLYOTXJCJYTHA\nTWRRAJLCQJTKOKWCGUH\nEWDPNXVCXWCDQCOYKKSOYTFSZTOOPKPRDKFJDETKSRAJRVCPDOBWUGPYRJPUWJYWCBLKOOTUPBESTOFXZHTYLLMCAXDYAEBUTAHM", "output": "NO" }, { "input": "QMIMGQRQDMJDPNFEFXSXQMCHEJKTWCTCVZPUAYICOIRYOWKUSIWXJLHDYWSBOITHTMINXFKBKAWZTXXBJIVYCRWKXNKIYKLDDXL\nV\nFWACCXBVDOJFIUAVYRALBYJKXXWIIFORRUHKHCXLDBZMXIYJWISFEAWTIQFIZSBXMKNOCQKVKRWDNDAMQSTKYLDNYVTUCGOJXJTW", "output": "NO" }, { "input": "XJXPVOOQODELPPWUISSYVVXRJTYBPDHJNENQEVQNVFIXSESKXVYPVVHPMOSX\nLEXOPFPVPSZK\nZVXVPYEYOYXVOISVLXPOVHEQVXPNQJIOPFDTXEUNMPEPPHELNXKKWSVSOXSBPSJDPVJVSRFQ", "output": "YES" }, { "input": "OSKFHGYNQLSRFSAHPXKGPXUHXTRBJNAQRBSSWJVEENLJCDDHFXVCUNPZAIVVO\nFNUOCXAGRRHNDJAHVVLGGEZQHWARYHENBKHP\nUOEFNWVXCUNERLKVTHAGPSHKHDYFPYWZHJKHQLSNFBJHVJANRXCNSDUGVDABGHVAOVHBJZXGRACHRXEGNRPQEAPORQSILNXFS", "output": "YES" }, { "input": "VYXYVVACMLPDHONBUTQFZTRREERBLKUJYKAHZRCTRLRCLOZYWVPBRGDQPFPQIF\nFE\nRNRPEVDRLYUQFYRZBCQLCYZEABKLRXCJLKVZBVFUEYRATOMDRTHFPGOWQVTIFPPH", "output": "YES" }, { "input": "WYXUZQJQNLASEGLHPMSARWMTTQMQLVAZLGHPIZTRVTCXDXBOLNXZPOFCTEHCXBZ\nBLQZRRWP\nGIQZXPLTTMNHQVWPPEAPLOCDMBSTHRCFLCQRRZXLVAOQEGZBRUZJXXZTMAWLZHSLWNQTYXB", "output": "YES" }, { "input": "MKVJTSSTDGKPVVDPYSRJJYEVGKBMSIOKHLZQAEWLRIBINVRDAJIBCEITKDHUCCVY\nPUJJQFHOGZKTAVNUGKQUHMKTNHCCTI\nQVJKUSIGTSVYUMOMLEGHWYKSKQTGATTKBNTKCJKJPCAIRJIRMHKBIZISEGFHVUVQZBDERJCVAKDLNTHUDCHONDCVVJIYPP", "output": "YES" }, { "input": "OKNJOEYVMZXJMLVJHCSPLUCNYGTDASKSGKKCRVIDGEIBEWRVBVRVZZTLMCJLXHJIA\nDJBFVRTARTFZOWN\nAGHNVUNJVCPLWSVYBJKZSVTFGLELZASLWTIXDDJXCZDICTVIJOTMVEYOVRNMJGRKKHRMEBORAKFCZJBR", "output": "YES" }, { "input": "OQZACLPSAGYDWHFXDFYFRRXWGIEJGSXWUONAFWNFXDTGVNDEWNQPHUXUJNZWWLBPYL\nOHBKWRFDRQUAFRCMT\nWIQRYXRJQWWRUWCYXNXALKFZGXFTLOODWRDPGURFUFUQOHPWBASZNVWXNCAGHWEHFYESJNFBMNFDDAPLDGT", "output": "YES" }, { "input": "OVIRQRFQOOWVDEPLCJETWQSINIOPLTLXHSQWUYUJNFBMKDNOSHNJQQCDHZOJVPRYVSV\nMYYDQKOOYPOOUELCRIT\nNZSOTVLJTTVQLFHDQEJONEOUOFOLYVSOIYUDNOSIQVIRMVOERCLMYSHPCQKIDRDOQPCUPQBWWRYYOXJWJQPNKH", "output": "YES" }, { "input": "WGMBZWNMSJXNGDUQUJTCNXDSJJLYRDOPEGPQXYUGBESDLFTJRZDDCAAFGCOCYCQMDBWK\nYOBMOVYTUATTFGJLYUQD\nDYXVTLQCYFJUNJTUXPUYOPCBCLBWNSDUJRJGWDOJDSQAAMUOJWSYERDYDXYTMTOTMQCGQZDCGNFBALGGDFKZMEBG", "output": "YES" }, { "input": "CWLRBPMEZCXAPUUQFXCUHAQTLPBTXUUKWVXKBHKNSSJFEXLZMXGVFHHVTPYAQYTIKXJJE\nMUFOSEUEXEQTOVLGDSCWM\nJUKEQCXOXWEHCGKFPBIGMWVJLXUONFXBYTUAXERYTXKCESKLXAEHVPZMMUFTHLXTTZSDMBJLQPEUWCVUHSQQVUASPF", "output": "YES" }, { "input": "IDQRX\nWETHO\nODPDGBHVUVSSISROHQJTUKPUCLXABIZQQPPBPKOSEWGEHRSRRNBAVLYEMZISMWWGKHVTXKUGUXEFBSWOIWUHRJGMWBMHQLDZHBWA", "output": "NO" }, { "input": "IXFDY\nJRMOU\nDF", "output": "NO" }, { "input": "JPSPZ\nUGCUB\nJMZZZZZZZZ", "output": "NO" }, { "input": "AC\nA\nBBA", "output": "NO" }, { "input": "UIKWWKXLSHTOOZOVGXKYSOJEHAUEEG\nKZXQDWJJWRXFHKJDQHJK\nXMZHTFOGEXAUJXXJUYVJIFOTKLZHDKELJWERHMGAWGKWAQKEKHIDWGGZVYOHKXRPWSJDPESFJUMKQYWBYUTHQYEFZUGKQOBHYDWB", "output": "NO" }, { "input": "PXWRXRPFLR\nPJRWWXIVHODV\nXW", "output": "NO" }, { "input": "CHTAZVHGSHCVIBK\nEQINEBKXEPYJSAZIMLDF\nZCZZZZDZMCZZEZDZZEZZZZQZZBZZZOZZCZE", "output": "NO" }, { "input": "GXPZFSELJJNDAXYRV\nUYBKPMVBSOVOJWMONLTJOJCNQKMTAHEWLHOWIIBH\nHCWNFWJPEJIWOVPTBMVCRJLSISSVNOHCKLBFMIUAIMASQWPXEYXBOXQGFEMYJLBKDCZIMJNHOJEDGGANIVYKQTUOSOVOPWHVJGXH", "output": "NO" }, { "input": "LFGJCJJDUTUP\nOVSBILTIYCJCRHKCIXCETJQJJ\nGIJJTJCLTJJJ", "output": "NO" }, { "input": "GIO\nPRL\nPRL", "output": "NO" }, { "input": "A\nB\nABC", "output": "NO" }, { "input": "KKK\nKKK\nZZZZZ", "output": "NO" }, { "input": "ZMYGQLDBLAPN\nZFJBKWHROVNPSJQUDFTHOCGREUFLYIWYICD\nZMJZZEDAZANKZZZZZZEZZBZDZZZZZZKHZZFZZZDZNZMDZZA", "output": "NO" } ]
1,685,280,096
2,147,483,647
Python 3
OK
TESTS
54
92
0
a = input() b = input() c = sorted(input()) d = sorted(a+b) if d==c: print('YES') else: print('NO')
Title: Amusing Joke Time Limit: None seconds Memory Limit: None megabytes Problem Description: So, the New Year holidays are over. Santa Claus and his colleagues can take a rest and have guests at last. When two "New Year and Christmas Men" meet, thear assistants cut out of cardboard the letters from the guest's name and the host's name in honor of this event. Then the hung the letters above the main entrance. One night, when everyone went to bed, someone took all the letters of our characters' names. Then he may have shuffled the letters and put them in one pile in front of the door. The next morning it was impossible to find the culprit who had made the disorder. But everybody wondered whether it is possible to restore the names of the host and his guests from the letters lying at the door? That is, we need to verify that there are no extra letters, and that nobody will need to cut more letters. Help the "New Year and Christmas Men" and their friends to cope with this problem. You are given both inscriptions that hung over the front door the previous night, and a pile of letters that were found at the front door next morning. Input Specification: The input file consists of three lines: the first line contains the guest's name, the second line contains the name of the residence host and the third line contains letters in a pile that were found at the door in the morning. All lines are not empty and contain only uppercase Latin letters. The length of each line does not exceed 100. Output Specification: Print "YES" without the quotes, if the letters in the pile could be permuted to make the names of the "New Year and Christmas Men". Otherwise, print "NO" without the quotes. Demo Input: ['SANTACLAUS\nDEDMOROZ\nSANTAMOROZDEDCLAUS\n', 'PAPAINOEL\nJOULUPUKKI\nJOULNAPAOILELUPUKKI\n', 'BABBONATALE\nFATHERCHRISTMAS\nBABCHRISTMASBONATALLEFATHER\n'] Demo Output: ['YES\n', 'NO\n', 'NO\n'] Note: In the first sample the letters written in the last line can be used to write the names and there won't be any extra letters left. In the second sample letter "P" is missing from the pile and there's an extra letter "L". In the third sample there's an extra letter "L".
```python a = input() b = input() c = sorted(input()) d = sorted(a+b) if d==c: print('YES') else: print('NO') ```
3
236
A
Boy or Girl
PROGRAMMING
800
[ "brute force", "implementation", "strings" ]
null
null
Those days, many boys use beautiful girls' photos as avatars in forums. So it is pretty hard to tell the gender of a user at the first glance. Last year, our hero went to a forum and had a nice chat with a beauty (he thought so). After that they talked very often and eventually they became a couple in the network. But yesterday, he came to see "her" in the real world and found out "she" is actually a very strong man! Our hero is very sad and he is too tired to love again now. So he came up with a way to recognize users' genders by their user names. This is his method: if the number of distinct characters in one's user name is odd, then he is a male, otherwise she is a female. You are given the string that denotes the user name, please help our hero to determine the gender of this user by his method.
The first line contains a non-empty string, that contains only lowercase English letters — the user name. This string contains at most 100 letters.
If it is a female by our hero's method, print "CHAT WITH HER!" (without the quotes), otherwise, print "IGNORE HIM!" (without the quotes).
[ "wjmzbmr\n", "xiaodao\n", "sevenkplus\n" ]
[ "CHAT WITH HER!\n", "IGNORE HIM!\n", "CHAT WITH HER!\n" ]
For the first example. There are 6 distinct characters in "wjmzbmr". These characters are: "w", "j", "m", "z", "b", "r". So wjmzbmr is a female and you should print "CHAT WITH HER!".
500
[ { "input": "wjmzbmr", "output": "CHAT WITH HER!" }, { "input": "xiaodao", "output": "IGNORE HIM!" }, { "input": "sevenkplus", "output": "CHAT WITH HER!" }, { "input": "pezu", "output": "CHAT WITH HER!" }, { "input": "wnemlgppy", "output": "CHAT WITH HER!" }, { "input": "zcinitufxoldnokacdvtmdohsfdjepyfioyvclhmujiqwvmudbfjzxjfqqxjmoiyxrfsbvseawwoyynn", "output": "IGNORE HIM!" }, { "input": "qsxxuoynwtebujwpxwpajitiwxaxwgbcylxneqiebzfphugwkftpaikixmumkhfbjiswmvzbtiyifbx", "output": "CHAT WITH HER!" }, { "input": "qwbdfzfylckctudyjlyrtmvbidfatdoqfmrfshsqqmhzohhsczscvwzpwyoyswhktjlykumhvaounpzwpxcspxwlgt", "output": "IGNORE HIM!" }, { "input": "nuezoadauueermoeaabjrkxttkatspjsjegjcjcdmcxgodowzbwuqncfbeqlhkk", "output": "IGNORE HIM!" }, { "input": "lggvdmulrsvtuagoavstuyufhypdxfomjlzpnduulukszqnnwfvxbvxyzmleocmofwclmzz", "output": "IGNORE HIM!" }, { "input": "tgcdptnkc", "output": "IGNORE HIM!" }, { "input": "wvfgnfrzabgibzxhzsojskmnlmrokydjoexnvi", "output": "IGNORE HIM!" }, { "input": "sxtburpzskucowowebgrbovhadrrayamuwypmmxhscrujkmcgvyinp", "output": "IGNORE HIM!" }, { "input": "pjqxhvxkyeqqvyuujxhmbspatvrckhhkfloottuybjivkkhpyivcighxumavrxzxslfpggnwbtalmhysyfllznphzia", "output": "IGNORE HIM!" }, { "input": "fpellxwskyekoyvrfnuf", "output": "CHAT WITH HER!" }, { "input": "xninyvkuvakfbs", "output": "IGNORE HIM!" }, { "input": "vnxhrweyvhqufpfywdwftoyrfgrhxuamqhblkvdpxmgvphcbeeqbqssresjifwyzgfhurmamhkwupymuomak", "output": "CHAT WITH HER!" }, { "input": "kmsk", "output": "IGNORE HIM!" }, { "input": "lqonogasrkzhryjxppjyriyfxmdfubieglthyswz", "output": "CHAT WITH HER!" }, { "input": "ndormkufcrkxlihdhmcehzoimcfhqsmombnfjrlcalffq", "output": "CHAT WITH HER!" }, { "input": "zqzlnnuwcfufwujygtczfakhcpqbtxtejrbgoodychepzdphdahtxyfpmlrycyicqthsgm", "output": "IGNORE HIM!" }, { "input": "ppcpbnhwoizajrl", "output": "IGNORE HIM!" }, { "input": "sgubujztzwkzvztitssxxxwzanfmddfqvv", "output": "CHAT WITH HER!" }, { "input": "ptkyaxycecpbrjnvxcjtbqiocqcswnmicxbvhdsptbxyxswbw", "output": "IGNORE HIM!" }, { "input": "yhbtzfppwcycxqjpqdfmjnhwaogyuaxamwxpnrdrnqsgdyfvxu", "output": "CHAT WITH HER!" }, { "input": "ojjvpnkrxibyevxk", "output": "CHAT WITH HER!" }, { "input": "wjweqcrqfuollfvfbiyriijovweg", "output": "IGNORE HIM!" }, { "input": "hkdbykboclchfdsuovvpknwqr", "output": "IGNORE HIM!" }, { "input": "stjvyfrfowopwfjdveduedqylerqugykyu", "output": "IGNORE HIM!" }, { "input": "rafcaanqytfclvfdegak", "output": "CHAT WITH HER!" }, { "input": "xczn", "output": "CHAT WITH HER!" }, { "input": "arcoaeozyeawbveoxpmafxxzdjldsielp", "output": "IGNORE HIM!" }, { "input": "smdfafbyehdylhaleevhoggiurdgeleaxkeqdixyfztkuqsculgslheqfafxyghyuibdgiuwrdxfcitojxika", "output": "CHAT WITH HER!" }, { "input": "vbpfgjqnhfazmvtkpjrdasfhsuxnpiepxfrzvoh", "output": "CHAT WITH HER!" }, { "input": "dbdokywnpqnotfrhdbrzmuyoxfdtrgrzcccninbtmoqvxfatcqg", "output": "CHAT WITH HER!" }, { "input": "udlpagtpq", "output": "CHAT WITH HER!" }, { "input": "zjurevbytijifnpfuyswfchdzelxheboruwjqijxcucylysmwtiqsqqhktexcynquvcwhbjsipy", "output": "CHAT WITH HER!" }, { "input": "qagzrqjomdwhagkhrjahhxkieijyten", "output": "CHAT WITH HER!" }, { "input": "achhcfjnnfwgoufxamcqrsontgjjhgyfzuhklkmiwybnrlsvblnsrjqdytglipxsulpnphpjpoewvlusalsgovwnsngb", "output": "CHAT WITH HER!" }, { "input": "qbkjsdwpahdbbohggbclfcufqelnojoehsxxkr", "output": "CHAT WITH HER!" }, { "input": "cpvftiwgyvnlmbkadiafddpgfpvhqqvuehkypqjsoibpiudfvpkhzlfrykc", "output": "IGNORE HIM!" }, { "input": "lnpdosnceumubvk", "output": "IGNORE HIM!" }, { "input": "efrk", "output": "CHAT WITH HER!" }, { "input": "temnownneghnrujforif", "output": "IGNORE HIM!" }, { "input": "ottnneymszwbumgobazfjyxewkjakglbfflsajuzescplpcxqta", "output": "IGNORE HIM!" }, { "input": "eswpaclodzcwhgixhpyzvhdwsgneqidanbzdzszquefh", "output": "IGNORE HIM!" }, { "input": "gwntwbpj", "output": "IGNORE HIM!" }, { "input": "wuqvlbblkddeindiiswsinkfrnkxghhwunzmmvyovpqapdfbolyim", "output": "IGNORE HIM!" }, { "input": "swdqsnzmzmsyvktukaoyqsqzgfmbzhezbfaqeywgwizrwjyzquaahucjchegknqaioliqd", "output": "CHAT WITH HER!" }, { "input": "vlhrpzezawyolhbmvxbwhtjustdbqggexmzxyieihjlelvwjosmkwesfjmramsikhkupzvfgezmrqzudjcalpjacmhykhgfhrjx", "output": "IGNORE HIM!" }, { "input": "lxxwbkrjgnqjwsnflfnsdyxihmlspgivirazsbveztnkuzpaxtygidniflyjheejelnjyjvgkgvdqks", "output": "CHAT WITH HER!" }, { "input": "wpxbxzfhtdecetpljcrvpjjnllosdqirnkzesiqeukbedkayqx", "output": "CHAT WITH HER!" }, { "input": "vmzxgacicvweclaodrunmjnfwtimceetsaoickarqyrkdghcmyjgmtgsqastcktyrjgvjqimdc", "output": "CHAT WITH HER!" }, { "input": "yzlzmesxdttfcztooypjztlgxwcr", "output": "IGNORE HIM!" }, { "input": "qpbjwzwgdzmeluheirjrvzrhbmagfsjdgvzgwumjtjzecsfkrfqjasssrhhtgdqqfydlmrktlgfc", "output": "IGNORE HIM!" }, { "input": "aqzftsvezdgouyrirsxpbuvdjupnzvbhguyayeqozfzymfnepvwgblqzvmxxkxcilmsjvcgyqykpoaktjvsxbygfgsalbjoq", "output": "CHAT WITH HER!" }, { "input": "znicjjgijhrbdlnwmtjgtdgziollrfxroabfhadygnomodaembllreorlyhnehijfyjbfxucazellblegyfrzuraogadj", "output": "IGNORE HIM!" }, { "input": "qordzrdiknsympdrkgapjxokbldorpnmnpucmwakklmqenpmkom", "output": "CHAT WITH HER!" }, { "input": "wqfldgihuxfktzanyycluzhtewmwvnawqlfoavuguhygqrrxtstxwouuzzsryjqtfqo", "output": "CHAT WITH HER!" }, { "input": "vujtrrpshinkskgyknlcfckmqdrwtklkzlyipmetjvaqxdsslkskschbalmdhzsdrrjmxdltbtnxbh", "output": "IGNORE HIM!" }, { "input": "zioixjibuhrzyrbzqcdjbbhhdmpgmqykixcxoqupggaqajuzonrpzihbsogjfsrrypbiphehonyhohsbybnnukqebopppa", "output": "CHAT WITH HER!" }, { "input": "oh", "output": "CHAT WITH HER!" }, { "input": "kxqthadqesbpgpsvpbcbznxpecqrzjoilpauttzlnxvaczcqwuri", "output": "IGNORE HIM!" }, { "input": "zwlunigqnhrwirkvufqwrnwcnkqqonebrwzcshcbqqwkjxhymjjeakuzjettebciadjlkbfp", "output": "CHAT WITH HER!" }, { "input": "fjuldpuejgmggvvigkwdyzytfxzwdlofrpifqpdnhfyroginqaufwgjcbgshyyruwhofctsdaisqpjxqjmtpp", "output": "CHAT WITH HER!" }, { "input": "xiwntnheuitbtqxrmzvxmieldudakogealwrpygbxsbluhsqhtwmdlpjwzyafckrqrdduonkgo", "output": "CHAT WITH HER!" }, { "input": "mnmbupgo", "output": "IGNORE HIM!" }, { "input": "mcjehdiygkbmrbfjqwpwxidbdfelifwhstaxdapigbymmsgrhnzsdjhsqchl", "output": "IGNORE HIM!" }, { "input": "yocxrzspinchmhtmqo", "output": "CHAT WITH HER!" }, { "input": "vasvvnpymtgjirnzuynluluvmgpquskuaafwogeztfnvybblajvuuvfomtifeuzpikjrolzeeoftv", "output": "CHAT WITH HER!" }, { "input": "ecsdicrznvglwggrdbrvehwzaenzjutjydhvimtqegweurpxtjkmpcznshtrvotkvrghxhacjkedidqqzrduzad", "output": "IGNORE HIM!" }, { "input": "ubvhyaebyxoghakajqrpqpctwbrfqzli", "output": "CHAT WITH HER!" }, { "input": "gogbxfeqylxoummvgxpkoqzsmobasesxbqjjktqbwqxeiaagnnhbvepbpy", "output": "IGNORE HIM!" }, { "input": "nheihhxkbbrmlpxpxbhnpofcjmxemyvqqdbanwd", "output": "IGNORE HIM!" }, { "input": "acrzbavz", "output": "CHAT WITH HER!" }, { "input": "drvzznznvrzskftnrhvvzxcalwutxmdza", "output": "IGNORE HIM!" }, { "input": "oacwxipdfcoabhkwxqdbtowiekpnflnqhlrkustgzryvws", "output": "CHAT WITH HER!" }, { "input": "tpnwfmfsibnccvdwjvzviyvjfljupinfigfunyff", "output": "CHAT WITH HER!" }, { "input": "gavaihhamfolcndgytcsgucqdqngxkrlovpthvteacmmthoglxu", "output": "CHAT WITH HER!" }, { "input": "hsfcfvameeupldgvchmogrvwxrvsmnwxxkxoawwodtsahqvehlcw", "output": "IGNORE HIM!" }, { "input": "sbkydrscoojychxchqsuciperfroumenelgiyiwlqfwximrgdbyvkmacy", "output": "CHAT WITH HER!" }, { "input": "rhh", "output": "CHAT WITH HER!" }, { "input": "zhdouqfmlkenjzdijxdfxnlegxeuvhelo", "output": "IGNORE HIM!" }, { "input": "yufkkfwyhhvcjntsgsvpzbhqtmtgyxifqoewmuplphykmptfdebjxuaxigomjtwgtljwdjhjernkitifbomifbhysnmadtnyn", "output": "CHAT WITH HER!" }, { "input": "urigreuzpxnej", "output": "CHAT WITH HER!" } ]
1,694,596,429
2,147,483,647
Python 3
OK
TESTS
85
92
0
name=input() length=len(name) characters=[] temporary=[] t=0 for i in range(length): characters.append(name[i]) a=set(characters) final=len(a) if final %2==0: print("CHAT WITH HER!") else: print("IGNORE HIM!")
Title: Boy or Girl Time Limit: None seconds Memory Limit: None megabytes Problem Description: Those days, many boys use beautiful girls' photos as avatars in forums. So it is pretty hard to tell the gender of a user at the first glance. Last year, our hero went to a forum and had a nice chat with a beauty (he thought so). After that they talked very often and eventually they became a couple in the network. But yesterday, he came to see "her" in the real world and found out "she" is actually a very strong man! Our hero is very sad and he is too tired to love again now. So he came up with a way to recognize users' genders by their user names. This is his method: if the number of distinct characters in one's user name is odd, then he is a male, otherwise she is a female. You are given the string that denotes the user name, please help our hero to determine the gender of this user by his method. Input Specification: The first line contains a non-empty string, that contains only lowercase English letters — the user name. This string contains at most 100 letters. Output Specification: If it is a female by our hero's method, print "CHAT WITH HER!" (without the quotes), otherwise, print "IGNORE HIM!" (without the quotes). Demo Input: ['wjmzbmr\n', 'xiaodao\n', 'sevenkplus\n'] Demo Output: ['CHAT WITH HER!\n', 'IGNORE HIM!\n', 'CHAT WITH HER!\n'] Note: For the first example. There are 6 distinct characters in "wjmzbmr". These characters are: "w", "j", "m", "z", "b", "r". So wjmzbmr is a female and you should print "CHAT WITH HER!".
```python name=input() length=len(name) characters=[] temporary=[] t=0 for i in range(length): characters.append(name[i]) a=set(characters) final=len(a) if final %2==0: print("CHAT WITH HER!") else: print("IGNORE HIM!") ```
3
7
A
Kalevitch and Chess
PROGRAMMING
1,100
[ "brute force", "constructive algorithms" ]
A. Kalevitch and Chess
2
64
A famous Berland's painter Kalevitch likes to shock the public. One of his last obsessions is chess. For more than a thousand years people have been playing this old game on uninteresting, monotonous boards. Kalevitch decided to put an end to this tradition and to introduce a new attitude to chessboards. As before, the chessboard is a square-checkered board with the squares arranged in a 8<=×<=8 grid, each square is painted black or white. Kalevitch suggests that chessboards should be painted in the following manner: there should be chosen a horizontal or a vertical line of 8 squares (i.e. a row or a column), and painted black. Initially the whole chessboard is white, and it can be painted in the above described way one or more times. It is allowed to paint a square many times, but after the first time it does not change its colour any more and remains black. Kalevitch paints chessboards neatly, and it is impossible to judge by an individual square if it was painted with a vertical or a horizontal stroke. Kalevitch hopes that such chessboards will gain popularity, and he will be commissioned to paint chessboards, which will help him ensure a comfortable old age. The clients will inform him what chessboard they want to have, and the painter will paint a white chessboard meeting the client's requirements. It goes without saying that in such business one should economize on everything — for each commission he wants to know the minimum amount of strokes that he has to paint to fulfill the client's needs. You are asked to help Kalevitch with this task.
The input file contains 8 lines, each of the lines contains 8 characters. The given matrix describes the client's requirements, W character stands for a white square, and B character — for a square painted black. It is guaranteed that client's requirments can be fulfilled with a sequence of allowed strokes (vertical/column or horizontal/row).
Output the only number — the minimum amount of rows and columns that Kalevitch has to paint on the white chessboard to meet the client's requirements.
[ "WWWBWWBW\nBBBBBBBB\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW\n", "WWWWWWWW\nBBBBBBBB\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\n" ]
[ "3\n", "1\n" ]
none
0
[ { "input": "WWWBWWBW\nBBBBBBBB\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW", "output": "3" }, { "input": "WWWWWWWW\nBBBBBBBB\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW", "output": "1" }, { "input": "WWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW", "output": "0" }, { "input": "BBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB", "output": "8" }, { "input": "BBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBW", "output": "14" }, { "input": "BBBBBBBB\nBBBBBBBB\nBBBBBBWB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB", "output": "14" }, { "input": "BBBBBBBB\nWBBBWBBW\nBBBBBBBB\nWBBBWBBW\nWBBBWBBW\nBBBBBBBB\nBBBBBBBB\nWBBBWBBW", "output": "9" }, { "input": "BBBBBBBB\nWBBWWWBB\nBBBBBBBB\nWBBWWWBB\nBBBBBBBB\nBBBBBBBB\nWBBWWWBB\nBBBBBBBB", "output": "9" }, { "input": "BBBBBWWB\nBBBBBBBB\nBBBBBBBB\nBBBBBWWB\nBBBBBWWB\nBBBBBWWB\nBBBBBWWB\nBBBBBWWB", "output": "8" }, { "input": "WWWWBBBB\nWWWWBBBB\nBBBBBBBB\nBBBBBBBB\nWWWWBBBB\nWWWWBBBB\nBBBBBBBB\nBBBBBBBB", "output": "8" }, { "input": "BBBBBBBB\nWBWWBBBW\nBBBBBBBB\nWBWWBBBW\nWBWWBBBW\nWBWWBBBW\nWBWWBBBW\nBBBBBBBB", "output": "7" }, { "input": "WBWWBBBW\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nWBWWBBBW\nWBWWBBBW", "output": "9" }, { "input": "BBWWBBBW\nBBBBBBBB\nBBBBBBBB\nBBWWBBBW\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB", "output": "11" }, { "input": "WWBWBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nWWBWBBBB\nBBBBBBBB\nWWBWBBBB\nBBBBBBBB", "output": "10" }, { "input": "BBBBBBBB\nBBBBBBBB\nBBBBBBBB\nWWBWBBBB\nWWBWBBBB\nBBBBBBBB\nBBBBBBBB\nWWBWBBBB", "output": "10" }, { "input": "WBBWBBBW\nWBBWBBBW\nWBBWBBBW\nWBBWBBBW\nWBBWBBBW\nBBBBBBBB\nWBBWBBBW\nWBBWBBBW", "output": "6" }, { "input": "BBBWBBBW\nBBBWBBBW\nBBBWBBBW\nBBBBBBBB\nBBBBBBBB\nBBBWBBBW\nBBBBBBBB\nBBBBBBBB", "output": "10" }, { "input": "BBBBBBBB\nBBBWBBBB\nBBBWBBBB\nBBBWBBBB\nBBBBBBBB\nBBBWBBBB\nBBBWBBBB\nBBBWBBBB", "output": "9" }, { "input": "BBBBBBBB\nWWWBBBBB\nWWWBBBBB\nBBBBBBBB\nWWWBBBBB\nWWWBBBBB\nBBBBBBBB\nBBBBBBBB", "output": "9" }, { "input": "WBBBBBWB\nBBBBBBBB\nWBBBBBWB\nWBBBBBWB\nWBBBBBWB\nWBBBBBWB\nWBBBBBWB\nBBBBBBBB", "output": "8" }, { "input": "WBBBWWBW\nWBBBWWBW\nBBBBBBBB\nWBBBWWBW\nBBBBBBBB\nWBBBWWBW\nWBBBWWBW\nWBBBWWBW", "output": "6" }, { "input": "WBBBBWBB\nBBBBBBBB\nBBBBBBBB\nWBBBBWBB\nWBBBBWBB\nBBBBBBBB\nWBBBBWBB\nBBBBBBBB", "output": "10" }, { "input": "BBBBBBBB\nBBBBBBBB\nBBBBBBBB\nWBBBWBBW\nBBBBBBBB\nBBBBBBBB\nWBBBWBBW\nBBBBBBBB", "output": "11" }, { "input": "BBBBBBBB\nBWBBBBBW\nBWBBBBBW\nBBBBBBBB\nBWBBBBBW\nBWBBBBBW\nBBBBBBBB\nBWBBBBBW", "output": "9" }, { "input": "BBBBBBBB\nBBBBBBBB\nWBBBWWWW\nBBBBBBBB\nBBBBBBBB\nWBBBWWWW\nBBBBBBBB\nBBBBBBBB", "output": "9" }, { "input": "BWBBBWWB\nBWBBBWWB\nBBBBBBBB\nBBBBBBBB\nBWBBBWWB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB", "output": "10" }, { "input": "BBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBWBBWBWB", "output": "12" }, { "input": "BWBBBBWW\nBWBBBBWW\nBWBBBBWW\nBWBBBBWW\nBBBBBBBB\nBWBBBBWW\nBWBBBBWW\nBBBBBBBB", "output": "7" }, { "input": "WWBBWWBB\nBBBBBBBB\nWWBBWWBB\nWWBBWWBB\nWWBBWWBB\nBBBBBBBB\nWWBBWWBB\nWWBBWWBB", "output": "6" }, { "input": "BWBBWWWW\nBWBBWWWW\nBWBBWWWW\nBBBBBBBB\nBBBBBBBB\nBBBBBBBB\nBWBBWWWW\nBBBBBBBB", "output": "7" } ]
1,486,038,358
2,147,483,647
Python 3
OK
TESTS
30
154
4,608,000
from sys import stdin a = stdin.read().splitlines() Switch = 0 row = 0 column = 0 answer = 0 for i in range(len(a)): for j in range(len(a[i])): if a[i][j] == 'W': Switch = 1 row = i column = j break if Switch == 1: break if Switch == 0: print(8) else: for square in a[row]: if square == 'B': answer += 1 for k in range(len(a[column])): if a[k][column] == 'B': answer += 1 print(answer)
Title: Kalevitch and Chess Time Limit: 2 seconds Memory Limit: 64 megabytes Problem Description: A famous Berland's painter Kalevitch likes to shock the public. One of his last obsessions is chess. For more than a thousand years people have been playing this old game on uninteresting, monotonous boards. Kalevitch decided to put an end to this tradition and to introduce a new attitude to chessboards. As before, the chessboard is a square-checkered board with the squares arranged in a 8<=×<=8 grid, each square is painted black or white. Kalevitch suggests that chessboards should be painted in the following manner: there should be chosen a horizontal or a vertical line of 8 squares (i.e. a row or a column), and painted black. Initially the whole chessboard is white, and it can be painted in the above described way one or more times. It is allowed to paint a square many times, but after the first time it does not change its colour any more and remains black. Kalevitch paints chessboards neatly, and it is impossible to judge by an individual square if it was painted with a vertical or a horizontal stroke. Kalevitch hopes that such chessboards will gain popularity, and he will be commissioned to paint chessboards, which will help him ensure a comfortable old age. The clients will inform him what chessboard they want to have, and the painter will paint a white chessboard meeting the client's requirements. It goes without saying that in such business one should economize on everything — for each commission he wants to know the minimum amount of strokes that he has to paint to fulfill the client's needs. You are asked to help Kalevitch with this task. Input Specification: The input file contains 8 lines, each of the lines contains 8 characters. The given matrix describes the client's requirements, W character stands for a white square, and B character — for a square painted black. It is guaranteed that client's requirments can be fulfilled with a sequence of allowed strokes (vertical/column or horizontal/row). Output Specification: Output the only number — the minimum amount of rows and columns that Kalevitch has to paint on the white chessboard to meet the client's requirements. Demo Input: ['WWWBWWBW\nBBBBBBBB\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW\nWWWBWWBW\n', 'WWWWWWWW\nBBBBBBBB\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\nWWWWWWWW\n'] Demo Output: ['3\n', '1\n'] Note: none
```python from sys import stdin a = stdin.read().splitlines() Switch = 0 row = 0 column = 0 answer = 0 for i in range(len(a)): for j in range(len(a[i])): if a[i][j] == 'W': Switch = 1 row = i column = j break if Switch == 1: break if Switch == 0: print(8) else: for square in a[row]: if square == 'B': answer += 1 for k in range(len(a[column])): if a[k][column] == 'B': answer += 1 print(answer) ```
3.927168
893
A
Chess For Three
PROGRAMMING
900
[ "implementation" ]
null
null
Alex, Bob and Carl will soon participate in a team chess tournament. Since they are all in the same team, they have decided to practise really hard before the tournament. But it's a bit difficult for them because chess is a game for two players, not three. So they play with each other according to following rules: - Alex and Bob play the first game, and Carl is spectating; - When the game ends, the one who lost the game becomes the spectator in the next game, and the one who was spectating plays against the winner. Alex, Bob and Carl play in such a way that there are no draws. Today they have played *n* games, and for each of these games they remember who was the winner. They decided to make up a log of games describing who won each game. But now they doubt if the information in the log is correct, and they want to know if the situation described in the log they made up was possible (that is, no game is won by someone who is spectating if Alex, Bob and Carl play according to the rules). Help them to check it!
The first line contains one integer *n* (1<=≤<=*n*<=≤<=100) — the number of games Alex, Bob and Carl played. Then *n* lines follow, describing the game log. *i*-th line contains one integer *a**i* (1<=≤<=*a**i*<=≤<=3) which is equal to 1 if Alex won *i*-th game, to 2 if Bob won *i*-th game and 3 if Carl won *i*-th game.
Print YES if the situation described in the log was possible. Otherwise print NO.
[ "3\n1\n1\n2\n", "2\n1\n2\n" ]
[ "YES\n", "NO\n" ]
In the first example the possible situation is: 1. Alex wins, Carl starts playing instead of Bob; 1. Alex wins, Bob replaces Carl; 1. Bob wins. The situation in the second example is impossible because Bob loses the first game, so he cannot win the second one.
0
[ { "input": "3\n1\n1\n2", "output": "YES" }, { "input": "2\n1\n2", "output": "NO" }, { "input": "100\n2\n3\n1\n2\n3\n3\n3\n1\n1\n1\n1\n3\n3\n3\n3\n1\n2\n3\n3\n3\n3\n3\n3\n3\n1\n2\n2\n2\n3\n1\n1\n3\n3\n3\n3\n3\n3\n3\n3\n1\n2\n3\n3\n3\n1\n1\n1\n1\n3\n3\n3\n3\n1\n2\n3\n1\n2\n2\n2\n3\n3\n2\n1\n3\n3\n1\n2\n3\n1\n1\n1\n2\n2\n2\n3\n1\n1\n1\n1\n1\n1\n3\n2\n2\n2\n2\n2\n2\n3\n1\n2\n2\n2\n2\n2\n3\n3\n2\n1\n1", "output": "YES" }, { "input": "99\n1\n3\n2\n2\n3\n1\n1\n3\n3\n3\n3\n3\n3\n1\n1\n3\n3\n3\n3\n1\n1\n3\n2\n1\n1\n1\n1\n1\n1\n1\n3\n2\n2\n2\n1\n3\n3\n1\n1\n3\n2\n1\n3\n3\n1\n2\n3\n3\n3\n1\n2\n2\n2\n3\n3\n3\n3\n3\n3\n2\n2\n2\n2\n3\n3\n3\n1\n1\n3\n2\n1\n1\n2\n2\n2\n3\n3\n2\n1\n1\n2\n2\n1\n3\n2\n1\n1\n2\n3\n3\n3\n3\n2\n2\n2\n2\n2\n1\n3", "output": "YES" }, { "input": "100\n2\n2\n1\n3\n1\n3\n3\n1\n1\n3\n1\n1\n3\n2\n1\n3\n1\n1\n3\n3\n2\n2\n3\n1\n1\n2\n3\n2\n2\n3\n1\n1\n2\n3\n2\n1\n2\n2\n3\n3\n1\n1\n3\n1\n2\n1\n3\n1\n1\n3\n2\n2\n2\n1\n1\n1\n3\n1\n3\n2\n1\n2\n2\n2\n3\n3\n2\n1\n1\n3\n3\n2\n1\n2\n1\n1\n3\n1\n2\n3\n2\n3\n3\n3\n2\n2\n1\n3\n1\n2\n3\n1\n2\n3\n3\n1\n2\n1\n3\n1", "output": "NO" }, { "input": "10\n2\n3\n3\n3\n3\n2\n2\n2\n3\n2", "output": "NO" }, { "input": "100\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1", "output": "YES" }, { "input": "1\n3", "output": "NO" }, { "input": "1\n2", "output": "YES" }, { "input": "42\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1", "output": "YES" }, { "input": "4\n2\n3\n3\n3", "output": "YES" }, { "input": "3\n1\n2\n3", "output": "NO" }, { "input": "5\n1\n1\n1\n1\n3", "output": "NO" }, { "input": "5\n2\n3\n3\n3\n3", "output": "YES" }, { "input": "2\n3\n3", "output": "NO" }, { "input": "4\n1\n2\n2\n1", "output": "NO" }, { "input": "3\n2\n2\n3", "output": "NO" }, { "input": "5\n2\n3\n3\n1\n1", "output": "NO" }, { "input": "3\n3\n1\n3", "output": "NO" }, { "input": "3\n3\n3\n1", "output": "NO" }, { "input": "2\n2\n1", "output": "NO" }, { "input": "3\n1\n1\n3", "output": "NO" }, { "input": "6\n2\n2\n2\n3\n1\n3", "output": "NO" }, { "input": "2\n3\n1", "output": "NO" }, { "input": "2\n3\n2", "output": "NO" }, { "input": "2\n1\n3", "output": "YES" }, { "input": "3\n1\n3\n1", "output": "NO" }, { "input": "5\n1\n1\n2\n2\n3", "output": "NO" }, { "input": "3\n2\n1\n1", "output": "NO" }, { "input": "2\n2\n2", "output": "YES" }, { "input": "3\n2\n2\n1", "output": "YES" }, { "input": "5\n2\n2\n2\n2\n2", "output": "YES" }, { "input": "8\n1\n1\n1\n1\n1\n1\n1\n1", "output": "YES" }, { "input": "3\n3\n2\n2", "output": "NO" }, { "input": "3\n3\n2\n3", "output": "NO" }, { "input": "7\n2\n2\n2\n2\n2\n2\n2", "output": "YES" }, { "input": "3\n2\n2\n2", "output": "YES" } ]
1,673,178,521
2,147,483,647
Python 3
OK
TESTS
37
46
0
n = int(input()) player_1, player_2, watch = 1, 2, 3 answer = "YES" for i in range(n): winner = int(input()) if(winner == player_1): player_2, watch = watch, player_2 elif(winner == player_2): player_1, watch = watch, player_1 else: answer = "NO" break print(answer)
Title: Chess For Three Time Limit: None seconds Memory Limit: None megabytes Problem Description: Alex, Bob and Carl will soon participate in a team chess tournament. Since they are all in the same team, they have decided to practise really hard before the tournament. But it's a bit difficult for them because chess is a game for two players, not three. So they play with each other according to following rules: - Alex and Bob play the first game, and Carl is spectating; - When the game ends, the one who lost the game becomes the spectator in the next game, and the one who was spectating plays against the winner. Alex, Bob and Carl play in such a way that there are no draws. Today they have played *n* games, and for each of these games they remember who was the winner. They decided to make up a log of games describing who won each game. But now they doubt if the information in the log is correct, and they want to know if the situation described in the log they made up was possible (that is, no game is won by someone who is spectating if Alex, Bob and Carl play according to the rules). Help them to check it! Input Specification: The first line contains one integer *n* (1<=≤<=*n*<=≤<=100) — the number of games Alex, Bob and Carl played. Then *n* lines follow, describing the game log. *i*-th line contains one integer *a**i* (1<=≤<=*a**i*<=≤<=3) which is equal to 1 if Alex won *i*-th game, to 2 if Bob won *i*-th game and 3 if Carl won *i*-th game. Output Specification: Print YES if the situation described in the log was possible. Otherwise print NO. Demo Input: ['3\n1\n1\n2\n', '2\n1\n2\n'] Demo Output: ['YES\n', 'NO\n'] Note: In the first example the possible situation is: 1. Alex wins, Carl starts playing instead of Bob; 1. Alex wins, Bob replaces Carl; 1. Bob wins. The situation in the second example is impossible because Bob loses the first game, so he cannot win the second one.
```python n = int(input()) player_1, player_2, watch = 1, 2, 3 answer = "YES" for i in range(n): winner = int(input()) if(winner == player_1): player_2, watch = watch, player_2 elif(winner == player_2): player_1, watch = watch, player_1 else: answer = "NO" break print(answer) ```
3
275
A
Lights Out
PROGRAMMING
900
[ "implementation" ]
null
null
Lenny is playing a game on a 3<=×<=3 grid of lights. In the beginning of the game all lights are switched on. Pressing any of the lights will toggle it and all side-adjacent lights. The goal of the game is to switch all the lights off. We consider the toggling as follows: if the light was switched on then it will be switched off, if it was switched off then it will be switched on. Lenny has spent some time playing with the grid and by now he has pressed each light a certain number of times. Given the number of times each light is pressed, you have to print the current state of each light.
The input consists of three rows. Each row contains three integers each between 0 to 100 inclusive. The *j*-th number in the *i*-th row is the number of times the *j*-th light of the *i*-th row of the grid is pressed.
Print three lines, each containing three characters. The *j*-th character of the *i*-th line is "1" if and only if the corresponding light is switched on, otherwise it's "0".
[ "1 0 0\n0 0 0\n0 0 1\n", "1 0 1\n8 8 8\n2 0 3\n" ]
[ "001\n010\n100\n", "010\n011\n100\n" ]
none
500
[ { "input": "1 0 0\n0 0 0\n0 0 1", "output": "001\n010\n100" }, { "input": "1 0 1\n8 8 8\n2 0 3", "output": "010\n011\n100" }, { "input": "13 85 77\n25 50 45\n65 79 9", "output": "000\n010\n000" }, { "input": "96 95 5\n8 84 74\n67 31 61", "output": "011\n011\n101" }, { "input": "24 54 37\n60 63 6\n1 84 26", "output": "110\n101\n011" }, { "input": "23 10 40\n15 6 40\n92 80 77", "output": "101\n100\n000" }, { "input": "62 74 80\n95 74 93\n2 47 95", "output": "010\n001\n110" }, { "input": "80 83 48\n26 0 66\n47 76 37", "output": "000\n000\n010" }, { "input": "32 15 65\n7 54 36\n5 51 3", "output": "111\n101\n001" }, { "input": "22 97 12\n71 8 24\n100 21 64", "output": "100\n001\n100" }, { "input": "46 37 13\n87 0 50\n90 8 55", "output": "111\n011\n000" }, { "input": "57 43 58\n20 82 83\n66 16 52", "output": "111\n010\n110" }, { "input": "45 56 93\n47 51 59\n18 51 63", "output": "101\n011\n100" }, { "input": "47 66 67\n14 1 37\n27 81 69", "output": "001\n001\n110" }, { "input": "26 69 69\n85 18 23\n14 22 74", "output": "110\n001\n010" }, { "input": "10 70 65\n94 27 25\n74 66 30", "output": "111\n010\n100" }, { "input": "97 1 74\n15 99 1\n88 68 86", "output": "001\n011\n000" }, { "input": "36 48 42\n45 41 66\n26 64 1", "output": "001\n111\n010" }, { "input": "52 81 97\n29 77 71\n66 11 2", "output": "100\n100\n111" }, { "input": "18 66 33\n19 49 49\n48 46 26", "output": "011\n100\n000" }, { "input": "68 79 52\n51 39 100\n29 14 26", "output": "110\n000\n111" }, { "input": "91 69 77\n91 26 64\n91 88 57", "output": "001\n011\n110" }, { "input": "16 69 64\n48 21 80\n81 51 51", "output": "010\n101\n111" }, { "input": "96 14 2\n100 18 12\n65 34 89", "output": "111\n010\n010" }, { "input": "93 95 90\n8 59 42\n53 13 19", "output": "100\n001\n111" }, { "input": "71 84 18\n100 19 67\n9 76 15", "output": "010\n010\n001" }, { "input": "38 93 85\n21 88 64\n4 96 25", "output": "111\n011\n000" }, { "input": "75 20 20\n60 5 78\n77 4 69", "output": "011\n001\n000" }, { "input": "65 70 96\n19 6 83\n33 37 82", "output": "100\n000\n011" }, { "input": "11 13 60\n17 13 46\n42 21 39", "output": "000\n011\n101" }, { "input": "0 0 0\n0 0 0\n0 0 0", "output": "111\n111\n111" }, { "input": "0 0 0\n0 1 0\n0 0 0", "output": "101\n000\n101" }, { "input": "0 0 0\n0 0 0\n0 0 1", "output": "111\n110\n100" } ]
1,626,274,701
2,147,483,647
Python 3
OK
TESTS
33
77
6,963,200
# mat = [ [1,1,1], [1,1,1], [1,1,1] ] # input_mat = [] # for i in range(3): # llist = list(map(int, input().split())) # input_mat.append(llist) # for i in range(3): # for j in range(3): # if input_mat[i][j] % 2 != 0: # if mat[i][j] == 1: # mat[i][j] = 0 # else: # mat[i][j] = 1 # if i-1 >= 0 and mat[i-1][j] == 1: # mat[i-1][j] = 0 # elif i-1 >= 0: # mat[i-1][j] = 1 # if j-1 >= 0 and mat[i][j-1] == 1: # mat[i][j-1] = 0 # elif j-1 >= 0: # mat[i][j-1] = 1 # if j+1 < 3 and mat[i][j+1] == 1: # mat[i][j+1] = 0 # elif j+1 < 3: # mat[i][j+1] = 1 # if i+1 < 3 and mat[i+1][j] == 1: # mat[i+1][j] = 0 # elif i+1 < 3: # mat[i+1][j] = 1 # for i in range(3): # for j in range(3): # print(mat[i][j], end="") # print() ''' 1 0 1 8 8 8 2 0 3 ''' ''' 0 1 0 0 1 1 1 0 0 ''' ''' odd -> state change even -> state unchage ''' #WITH FUNCTION def isValid(position, max_range): if(position >= 0 and position < max_range): return True return False def toggle(mat, i, j): if isValid(i, 3) and isValid(j, 3) and mat[i][j] == 0: mat[i][j] = 1 elif isValid(i, 3) and isValid(j, 3) : mat[i][j] = 0 def printMatrix(matrix): for i in range(3): for j in range(3): print(mat[i][j], end="") print() mat = [ [1,1,1], [1,1,1], [1,1,1] ] input_mat = [] for i in range(3): llist = list(map(int, input().split())) input_mat.append(llist) for i in range(3): for j in range(3): if input_mat[i][j] % 2 != 0: # change only needed if input number is odd, otherwise no toogle needed as even toggle(mat, i, j) toggle(mat, i-1, j) toggle(mat, i+1, j) toggle(mat, i, j-1) toggle(mat, i, j+1) printMatrix(mat) ''' 1 0 1 8 8 8 2 0 3 ''' ''' 0 1 0 0 1 1 1 0 0 ''' ''' odd -> state change even -> state unchage '''
Title: Lights Out Time Limit: None seconds Memory Limit: None megabytes Problem Description: Lenny is playing a game on a 3<=×<=3 grid of lights. In the beginning of the game all lights are switched on. Pressing any of the lights will toggle it and all side-adjacent lights. The goal of the game is to switch all the lights off. We consider the toggling as follows: if the light was switched on then it will be switched off, if it was switched off then it will be switched on. Lenny has spent some time playing with the grid and by now he has pressed each light a certain number of times. Given the number of times each light is pressed, you have to print the current state of each light. Input Specification: The input consists of three rows. Each row contains three integers each between 0 to 100 inclusive. The *j*-th number in the *i*-th row is the number of times the *j*-th light of the *i*-th row of the grid is pressed. Output Specification: Print three lines, each containing three characters. The *j*-th character of the *i*-th line is "1" if and only if the corresponding light is switched on, otherwise it's "0". Demo Input: ['1 0 0\n0 0 0\n0 0 1\n', '1 0 1\n8 8 8\n2 0 3\n'] Demo Output: ['001\n010\n100\n', '010\n011\n100\n'] Note: none
```python # mat = [ [1,1,1], [1,1,1], [1,1,1] ] # input_mat = [] # for i in range(3): # llist = list(map(int, input().split())) # input_mat.append(llist) # for i in range(3): # for j in range(3): # if input_mat[i][j] % 2 != 0: # if mat[i][j] == 1: # mat[i][j] = 0 # else: # mat[i][j] = 1 # if i-1 >= 0 and mat[i-1][j] == 1: # mat[i-1][j] = 0 # elif i-1 >= 0: # mat[i-1][j] = 1 # if j-1 >= 0 and mat[i][j-1] == 1: # mat[i][j-1] = 0 # elif j-1 >= 0: # mat[i][j-1] = 1 # if j+1 < 3 and mat[i][j+1] == 1: # mat[i][j+1] = 0 # elif j+1 < 3: # mat[i][j+1] = 1 # if i+1 < 3 and mat[i+1][j] == 1: # mat[i+1][j] = 0 # elif i+1 < 3: # mat[i+1][j] = 1 # for i in range(3): # for j in range(3): # print(mat[i][j], end="") # print() ''' 1 0 1 8 8 8 2 0 3 ''' ''' 0 1 0 0 1 1 1 0 0 ''' ''' odd -> state change even -> state unchage ''' #WITH FUNCTION def isValid(position, max_range): if(position >= 0 and position < max_range): return True return False def toggle(mat, i, j): if isValid(i, 3) and isValid(j, 3) and mat[i][j] == 0: mat[i][j] = 1 elif isValid(i, 3) and isValid(j, 3) : mat[i][j] = 0 def printMatrix(matrix): for i in range(3): for j in range(3): print(mat[i][j], end="") print() mat = [ [1,1,1], [1,1,1], [1,1,1] ] input_mat = [] for i in range(3): llist = list(map(int, input().split())) input_mat.append(llist) for i in range(3): for j in range(3): if input_mat[i][j] % 2 != 0: # change only needed if input number is odd, otherwise no toogle needed as even toggle(mat, i, j) toggle(mat, i-1, j) toggle(mat, i+1, j) toggle(mat, i, j-1) toggle(mat, i, j+1) printMatrix(mat) ''' 1 0 1 8 8 8 2 0 3 ''' ''' 0 1 0 0 1 1 1 0 0 ''' ''' odd -> state change even -> state unchage ''' ```
3
59
A
Word
PROGRAMMING
800
[ "implementation", "strings" ]
A. Word
2
256
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
[ "HoUse\n", "ViP\n", "maTRIx\n" ]
[ "house\n", "VIP\n", "matrix\n" ]
none
500
[ { "input": "HoUse", "output": "house" }, { "input": "ViP", "output": "VIP" }, { "input": "maTRIx", "output": "matrix" }, { "input": "BNHWpnpawg", "output": "bnhwpnpawg" }, { "input": "VTYGP", "output": "VTYGP" }, { "input": "CHNenu", "output": "chnenu" }, { "input": "ERPZGrodyu", "output": "erpzgrodyu" }, { "input": "KSXBXWpebh", "output": "KSXBXWPEBH" }, { "input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv", "output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv" }, { "input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd", "output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd" }, { "input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv", "output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv" }, { "input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg", "output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg" }, { "input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak", "output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK" }, { "input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw", "output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW" }, { "input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB", "output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB" }, { "input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge", "output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge" }, { "input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw", "output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw" }, { "input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks", "output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks" }, { "input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz", "output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ" }, { "input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg", "output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG" }, { "input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO", "output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO" }, { "input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd", "output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD" }, { "input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas", "output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas" }, { "input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm", "output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM" }, { "input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn", "output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn" }, { "input": "t", "output": "t" }, { "input": "N", "output": "N" }, { "input": "kv", "output": "kv" }, { "input": "Ur", "output": "ur" }, { "input": "CN", "output": "CN" } ]
1,668,063,582
2,147,483,647
Python 3
OK
TESTS
30
92
0
s = input() b = 0 m = 0 for i in s: if i.isupper(): b += 1 else: m += 1 if b > m: print(s.upper()) elif b < m: print(s.lower()) else: print(s.lower())
Title: Word Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word. Input Specification: The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100. Output Specification: Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one. Demo Input: ['HoUse\n', 'ViP\n', 'maTRIx\n'] Demo Output: ['house\n', 'VIP\n', 'matrix\n'] Note: none
```python s = input() b = 0 m = 0 for i in s: if i.isupper(): b += 1 else: m += 1 if b > m: print(s.upper()) elif b < m: print(s.lower()) else: print(s.lower()) ```
3.977
236
B
Easy Number Challenge
PROGRAMMING
1,300
[ "implementation", "number theory" ]
null
null
Let's denote *d*(*n*) as the number of divisors of a positive integer *n*. You are given three integers *a*, *b* and *c*. Your task is to calculate the following sum: Find the sum modulo 1073741824 (230).
The first line contains three space-separated integers *a*, *b* and *c* (1<=≤<=*a*,<=*b*,<=*c*<=≤<=100).
Print a single integer — the required sum modulo 1073741824 (230).
[ "2 2 2\n", "5 6 7\n" ]
[ "20\n", "1520\n" ]
For the first example. - *d*(1·1·1) = *d*(1) = 1; - *d*(1·1·2) = *d*(2) = 2; - *d*(1·2·1) = *d*(2) = 2; - *d*(1·2·2) = *d*(4) = 3; - *d*(2·1·1) = *d*(2) = 2; - *d*(2·1·2) = *d*(4) = 3; - *d*(2·2·1) = *d*(4) = 3; - *d*(2·2·2) = *d*(8) = 4. So the result is 1 + 2 + 2 + 3 + 2 + 3 + 3 + 4 = 20.
1,000
[ { "input": "2 2 2", "output": "20" }, { "input": "5 6 7", "output": "1520" }, { "input": "91 42 25", "output": "3076687" }, { "input": "38 47 5", "output": "160665" }, { "input": "82 29 45", "output": "3504808" }, { "input": "40 15 33", "output": "460153" }, { "input": "35 5 21", "output": "55282" }, { "input": "71 2 1", "output": "811" }, { "input": "22 44 41", "output": "1063829" }, { "input": "73 19 29", "output": "1047494" }, { "input": "76 12 17", "output": "330197" }, { "input": "16 10 49", "output": "146199" }, { "input": "59 99 33", "output": "7052988" }, { "input": "17 34 25", "output": "306673" }, { "input": "21 16 9", "output": "45449" }, { "input": "31 51 29", "output": "1255099" }, { "input": "26 41 17", "output": "402568" }, { "input": "85 19 5", "output": "139747" }, { "input": "36 61 45", "output": "3253358" }, { "input": "76 58 25", "output": "3635209" }, { "input": "71 48 13", "output": "1179722" }, { "input": "29 34 53", "output": "1461871" }, { "input": "72 16 41", "output": "1309118" }, { "input": "8 21 21", "output": "54740" }, { "input": "11 51 5", "output": "38092" }, { "input": "70 38 49", "output": "4467821" }, { "input": "13 31 33", "output": "274773" }, { "input": "53 29 17", "output": "621991" }, { "input": "56 18 53", "output": "1518698" }, { "input": "55 45 45", "output": "3751761" }, { "input": "58 35 29", "output": "1706344" }, { "input": "67 2 24", "output": "45108" }, { "input": "62 96 8", "output": "1257040" }, { "input": "21 22 100", "output": "1274891" }, { "input": "64 12 36", "output": "687986" }, { "input": "4 9 20", "output": "7302" }, { "input": "7 99 4", "output": "36791" }, { "input": "58 25 96", "output": "4812548" }, { "input": "9 19 32", "output": "91192" }, { "input": "45 16 12", "output": "167557" }, { "input": "40 6 100", "output": "558275" }, { "input": "46 93 44", "output": "6945002" }, { "input": "49 31 28", "output": "1158568" }, { "input": "89 28 8", "output": "441176" }, { "input": "84 17 96", "output": "4615400" }, { "input": "91 96 36", "output": "12931148" }, { "input": "86 90 24", "output": "6779764" }, { "input": "4 21 45", "output": "58045" }, { "input": "100 7 28", "output": "429933" }, { "input": "58 41 21", "output": "1405507" }, { "input": "53 31 5", "output": "144839" }, { "input": "41 28 36", "output": "1135934" }, { "input": "44 18 24", "output": "436880" }, { "input": "3 96 16", "output": "70613" }, { "input": "98 34 100", "output": "13589991" }, { "input": "82 31 32", "output": "2502213" }, { "input": "85 25 20", "output": "1142825" }, { "input": "35 12 8", "output": "50977" }, { "input": "39 94 48", "output": "6368273" }, { "input": "27 99 28", "output": "2276216" }, { "input": "22 28 16", "output": "198639" }, { "input": "80 15 4", "output": "76139" }, { "input": "23 9 44", "output": "170773" }, { "input": "33 16 36", "output": "441858" }, { "input": "36 6 24", "output": "88626" }, { "input": "98 92 12", "output": "3475151" }, { "input": "90 82 100", "output": "35482866" }, { "input": "77 79 31", "output": "6870344" }, { "input": "81 21 19", "output": "812886" }, { "input": "31 96 7", "output": "458123" }, { "input": "34 89 95", "output": "11308813" }, { "input": "18 86 27", "output": "1116623" }, { "input": "13 76 11", "output": "206844" }, { "input": "76 3 3", "output": "6118" }, { "input": "15 93 87", "output": "4007595" }, { "input": "63 90 23", "output": "4384553" }, { "input": "58 83 7", "output": "819473" }, { "input": "16 18 99", "output": "702678" }, { "input": "60 8 35", "output": "363723" }, { "input": "22 87 4", "output": "133986" }, { "input": "73 25 44", "output": "2478308" }, { "input": "36 3 32", "output": "50842" }, { "input": "27 93 20", "output": "1393947" }, { "input": "67 90 100", "output": "27880104" }, { "input": "18 84 36", "output": "1564297" }, { "input": "68 14 28", "output": "646819" }, { "input": "71 8 12", "output": "119311" }, { "input": "7 5 96", "output": "46328" }, { "input": "50 95 32", "output": "5324602" }, { "input": "13 22 24", "output": "124510" }, { "input": "4 12 8", "output": "3347" }, { "input": "100 9 88", "output": "2334910" }, { "input": "95 2 28", "output": "82723" }, { "input": "54 77 20", "output": "2573855" }, { "input": "49 19 4", "output": "55037" }, { "input": "58 86 99", "output": "21920084" }, { "input": "9 76 83", "output": "1554836" }, { "input": "64 2 27", "output": "49141" }, { "input": "63 96 11", "output": "1898531" }, { "input": "3 93 91", "output": "555583" }, { "input": "100 100 100", "output": "51103588" }, { "input": "1 5 1", "output": "10" } ]
1,699,054,924
2,147,483,647
PyPy 3
OK
TESTS
102
466
17,100,800
a,b,c=map(int,input().split());n=a*b*c+1;d=[1]*n for i in range(2,n): for j in range(i,n,i):d[j]+=1 print(sum([d[i*j*k]for i in range(1,a+1)for j in range(1,b+1)for k in range(1,c+1)])%(1<<30))
Title: Easy Number Challenge Time Limit: None seconds Memory Limit: None megabytes Problem Description: Let's denote *d*(*n*) as the number of divisors of a positive integer *n*. You are given three integers *a*, *b* and *c*. Your task is to calculate the following sum: Find the sum modulo 1073741824 (230). Input Specification: The first line contains three space-separated integers *a*, *b* and *c* (1<=≤<=*a*,<=*b*,<=*c*<=≤<=100). Output Specification: Print a single integer — the required sum modulo 1073741824 (230). Demo Input: ['2 2 2\n', '5 6 7\n'] Demo Output: ['20\n', '1520\n'] Note: For the first example. - *d*(1·1·1) = *d*(1) = 1; - *d*(1·1·2) = *d*(2) = 2; - *d*(1·2·1) = *d*(2) = 2; - *d*(1·2·2) = *d*(4) = 3; - *d*(2·1·1) = *d*(2) = 2; - *d*(2·1·2) = *d*(4) = 3; - *d*(2·2·1) = *d*(4) = 3; - *d*(2·2·2) = *d*(8) = 4. So the result is 1 + 2 + 2 + 3 + 2 + 3 + 3 + 4 = 20.
```python a,b,c=map(int,input().split());n=a*b*c+1;d=[1]*n for i in range(2,n): for j in range(i,n,i):d[j]+=1 print(sum([d[i*j*k]for i in range(1,a+1)for j in range(1,b+1)for k in range(1,c+1)])%(1<<30)) ```
3
109
A
Lucky Sum of Digits
PROGRAMMING
1,000
[ "brute force", "implementation" ]
A. Lucky Sum of Digits
2
256
Petya loves lucky numbers. We all know that lucky numbers are the positive integers whose decimal representations contain only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not. Petya wonders eagerly what minimum lucky number has the sum of digits equal to *n*. Help him cope with the task.
The single line contains an integer *n* (1<=≤<=*n*<=≤<=106) — the sum of digits of the required lucky number.
Print on the single line the result — the minimum lucky number, whose sum of digits equals *n*. If such number does not exist, print -1.
[ "11\n", "10\n" ]
[ "47\n", "-1\n" ]
none
500
[ { "input": "11", "output": "47" }, { "input": "10", "output": "-1" }, { "input": "64", "output": "4477777777" }, { "input": "1", "output": "-1" }, { "input": "4", "output": "4" }, { "input": "7", "output": "7" }, { "input": "12", "output": "444" }, { "input": "1000000", "output": "4477777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "47", "output": "44477777" }, { "input": "100", "output": "4444777777777777" }, { "input": "700", "output": "7777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777" }, { "input": "485", "output": "44447777777777777777777777777777777777777777777777777777777777777777777" }, { "input": "111", "output": "444447777777777777" }, { "input": "85", "output": "4477777777777" }, { "input": "114", "output": "444477777777777777" }, { "input": "474", "output": "444777777777777777777777777777777777777777777777777777777777777777777" }, { "input": "74", "output": "47777777777" }, { "input": "1000", "output": "4444477777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777" }, { "input": "1024", "output": "4444777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777" }, { "input": "4444", "output": "4444477777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "45784", "output": "4777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "10000", "output": "4777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "9854", "output": "4447777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "186", "output": "477777777777777777777777777" }, { "input": "10416", "output": "7777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "10417", "output": "4477777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "3840", "output": "4777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "100000", "output": "4447777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "9876", "output": "4444477777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "99999", "output": "4777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "777777", "output": "7777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "854759", "output": "4444447777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "11000", "output": "4444447777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "18951", "output": "4444777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "999999", "output": "7777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "888887", "output": "4444477777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "999998", "output": "4444477777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "40008", "output": "4444447777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "10691", "output": "4444777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "5", "output": "-1" }, { "input": "6", "output": "-1" }, { "input": "9", "output": "-1" }, { "input": "8", "output": "44" }, { "input": "2", "output": "-1" }, { "input": "3", "output": "-1" }, { "input": "999997", "output": "4447777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "999996", "output": "4777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "999990", "output": "4447777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "999980", "output": "4444777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "800000", "output": "4447777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." }, { "input": "980000", "output": "7777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777..." } ]
1,610,777,530
2,147,483,647
PyPy 3
OK
TESTS
51
216
1,945,600
n = int(input()) i=int(-1) j=int(-1) for x in range(int(n/7)+1): k=n-7*x if k%4==0: i=int(x) j=int(k/4) if i==-1: print("-1") else: s="4"*j + "7"*i print(s)
Title: Lucky Sum of Digits Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Petya loves lucky numbers. We all know that lucky numbers are the positive integers whose decimal representations contain only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not. Petya wonders eagerly what minimum lucky number has the sum of digits equal to *n*. Help him cope with the task. Input Specification: The single line contains an integer *n* (1<=≤<=*n*<=≤<=106) — the sum of digits of the required lucky number. Output Specification: Print on the single line the result — the minimum lucky number, whose sum of digits equals *n*. If such number does not exist, print -1. Demo Input: ['11\n', '10\n'] Demo Output: ['47\n', '-1\n'] Note: none
```python n = int(input()) i=int(-1) j=int(-1) for x in range(int(n/7)+1): k=n-7*x if k%4==0: i=int(x) j=int(k/4) if i==-1: print("-1") else: s="4"*j + "7"*i print(s) ```
3.942376
271
A
Beautiful Year
PROGRAMMING
800
[ "brute force" ]
null
null
It seems like the year of 2013 came only yesterday. Do you know a curious fact? The year of 2013 is the first year after the old 1987 with only distinct digits. Now you are suggested to solve the following problem: given a year number, find the minimum year number which is strictly larger than the given one and has only distinct digits.
The single line contains integer *y* (1000<=≤<=*y*<=≤<=9000) — the year number.
Print a single integer — the minimum year number that is strictly larger than *y* and all it's digits are distinct. It is guaranteed that the answer exists.
[ "1987\n", "2013\n" ]
[ "2013\n", "2014\n" ]
none
500
[ { "input": "1987", "output": "2013" }, { "input": "2013", "output": "2014" }, { "input": "1000", "output": "1023" }, { "input": "1001", "output": "1023" }, { "input": "1234", "output": "1235" }, { "input": "5555", "output": "5601" }, { "input": "9000", "output": "9012" }, { "input": "1111", "output": "1203" }, { "input": "8999", "output": "9012" }, { "input": "4572", "output": "4573" }, { "input": "6666", "output": "6701" }, { "input": "2001", "output": "2013" }, { "input": "3000", "output": "3012" }, { "input": "7712", "output": "7801" }, { "input": "8088", "output": "8091" }, { "input": "1594", "output": "1596" }, { "input": "6016", "output": "6017" }, { "input": "8800", "output": "8901" }, { "input": "3331", "output": "3401" }, { "input": "5090", "output": "5091" }, { "input": "2342", "output": "2345" }, { "input": "2334", "output": "2340" }, { "input": "1123", "output": "1203" }, { "input": "8989", "output": "9012" }, { "input": "8977", "output": "9012" }, { "input": "6869", "output": "6870" }, { "input": "8999", "output": "9012" } ]
1,691,283,754
2,147,483,647
PyPy 3-64
OK
TESTS
27
124
0
year = input() res = str(int(year)+1) beautiful = False while not beautiful: s = set() beautiful = True for c in res: if c in s: res = str(int(res)+1) beautiful = False else: s.add(c) print(res)
Title: Beautiful Year Time Limit: None seconds Memory Limit: None megabytes Problem Description: It seems like the year of 2013 came only yesterday. Do you know a curious fact? The year of 2013 is the first year after the old 1987 with only distinct digits. Now you are suggested to solve the following problem: given a year number, find the minimum year number which is strictly larger than the given one and has only distinct digits. Input Specification: The single line contains integer *y* (1000<=≤<=*y*<=≤<=9000) — the year number. Output Specification: Print a single integer — the minimum year number that is strictly larger than *y* and all it's digits are distinct. It is guaranteed that the answer exists. Demo Input: ['1987\n', '2013\n'] Demo Output: ['2013\n', '2014\n'] Note: none
```python year = input() res = str(int(year)+1) beautiful = False while not beautiful: s = set() beautiful = True for c in res: if c in s: res = str(int(res)+1) beautiful = False else: s.add(c) print(res) ```
3
844
A
Diversity
PROGRAMMING
1,000
[ "greedy", "implementation", "strings" ]
null
null
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible. String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*). Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26).
Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible.
[ "yandex\n6\n", "yahoo\n5\n", "google\n7\n" ]
[ "0\n", "1\n", "impossible\n" ]
In the first test case string contains 6 different letters, so we don't need to change anything. In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}. In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
500
[ { "input": "yandex\n6", "output": "0" }, { "input": "yahoo\n5", "output": "1" }, { "input": "google\n7", "output": "impossible" }, { "input": "a\n1", "output": "0" }, { "input": "z\n2", "output": "impossible" }, { "input": "fwgfrwgkuwghfiruhewgirueguhergiqrbvgrgf\n26", "output": "14" }, { "input": "nfevghreuoghrueighoqghbnebvnejbvnbgneluqe\n26", "output": "12" }, { "input": "a\n3", "output": "impossible" }, { "input": "smaxpqplaqqbxuqxalqmbmmgubbpspxhawbxsuqhhegpmmpebqmqpbbeplwaepxmsahuepuhuhwxeqmmlgqubuaxehwuwasgxpqmugbmuawuhwqlswllssueglbxepbmwgs\n1", "output": "0" }, { "input": "cuguccgcugcugucgggggcgcgucgucugcuuuccccuugccg\n4", "output": "1" }, { "input": "fcfccfcfccfcfcffcffffffcfccfccfcffccccfcffffccfccfcffcfcccccffcfffcccffcfccfffffcccfccffffffccfccccf\n20", "output": "18" }, { "input": "swmkwaruyv\n5", "output": "0" }, { "input": "tnbqpsuhkczmejirvyfdolxwga\n22", "output": "0" }, { "input": "abcde\n3", "output": "0" }, { "input": "abb\n1", "output": "0" }, { "input": "aaaa\n1", "output": "0" }, { "input": "abcde\n2", "output": "0" }, { "input": "yandex\n4", "output": "0" }, { "input": "aaabbbccc\n1", "output": "0" }, { "input": "abcd\n2", "output": "0" }, { "input": "asdfgh\n2", "output": "0" }, { "input": "aab\n1", "output": "0" }, { "input": "mynameissako\n5", "output": "0" }, { "input": "abcde\n1", "output": "0" }, { "input": "abcd\n3", "output": "0" }, { "input": "abcdef\n2", "output": "0" }, { "input": "abcdefg\n4", "output": "0" }, { "input": "abc\n1", "output": "0" }, { "input": "asdafjsgljdllgjdgkl\n5", "output": "0" }, { "input": "yaay\n3", "output": "1" }, { "input": "yaay\n4", "output": "2" }, { "input": "zzzzzz\n2", "output": "1" } ]
1,517,880,269
2,147,483,647
Python 3
OK
TESTS
41
62
5,632,000
str = input() num = input() num = int(num) if len(str) < num: print('impossible') else: seen = set() for char in str: seen.add(char) if num - len(seen) < 0: print(0) else: print(num - len(seen))
Title: Diversity Time Limit: None seconds Memory Limit: None megabytes Problem Description: Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible. String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too. Input Specification: First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*). Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26). Output Specification: Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible. Demo Input: ['yandex\n6\n', 'yahoo\n5\n', 'google\n7\n'] Demo Output: ['0\n', '1\n', 'impossible\n'] Note: In the first test case string contains 6 different letters, so we don't need to change anything. In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}. In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
```python str = input() num = input() num = int(num) if len(str) < num: print('impossible') else: seen = set() for char in str: seen.add(char) if num - len(seen) < 0: print(0) else: print(num - len(seen)) ```
3
810
A
Straight <<A>>
PROGRAMMING
900
[ "implementation", "math" ]
null
null
Noora is a student of one famous high school. It's her final year in school — she is going to study in university next year. However, she has to get an «A» graduation certificate in order to apply to a prestigious one. In school, where Noora is studying, teachers are putting down marks to the online class register, which are integers from 1 to *k*. The worst mark is 1, the best is *k*. Mark that is going to the certificate, is calculated as an average of all the marks, rounded to the closest integer. If several answers are possible, rounding up is produced. For example, 7.3 is rounded to 7, but 7.5 and 7.8784 — to 8. For instance, if Noora has marks [8,<=9], then the mark to the certificate is 9, because the average is equal to 8.5 and rounded to 9, but if the marks are [8,<=8,<=9], Noora will have graduation certificate with 8. To graduate with «A» certificate, Noora has to have mark *k*. Noora got *n* marks in register this year. However, she is afraid that her marks are not enough to get final mark *k*. Noora decided to ask for help in the internet, where hacker Leha immediately responded to her request. He is ready to hack class register for Noora and to add Noora any number of additional marks from 1 to *k*. At the same time, Leha want his hack be unseen to everyone, so he decided to add as less as possible additional marks. Please help Leha to calculate the minimal number of marks he has to add, so that final Noora's mark will become equal to *k*.
The first line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=100,<=1<=≤<=*k*<=≤<=100) denoting the number of marks, received by Noora and the value of highest possible mark. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*k*) denoting marks received by Noora before Leha's hack.
Print a single integer — minimal number of additional marks, that Leha has to add in order to change Noora's final mark to *k*.
[ "2 10\n8 9\n", "3 5\n4 4 4\n" ]
[ "4", "3" ]
Consider the first example testcase. Maximal mark is 10, Noora received two marks — 8 and 9, so current final mark is 9. To fix it, Leha can add marks [10, 10, 10, 10] (4 marks in total) to the registry, achieving Noora having average mark equal to <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/1b961585522f76271546da990a6228e7c666277f.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Consequently, new final mark is 10. Less number of marks won't fix the situation. In the second example Leha can add [5, 5, 5] to the registry, so that making average mark equal to 4.5, which is enough to have 5 in the certificate.
500
[ { "input": "2 10\n8 9", "output": "4" }, { "input": "3 5\n4 4 4", "output": "3" }, { "input": "3 10\n10 8 9", "output": "3" }, { "input": "2 23\n21 23", "output": "2" }, { "input": "5 10\n5 10 10 9 10", "output": "7" }, { "input": "12 50\n18 10 26 22 22 23 14 21 27 18 25 12", "output": "712" }, { "input": "38 12\n2 7 10 8 5 3 5 6 3 6 5 1 9 7 7 8 3 4 4 4 5 2 3 6 6 1 6 7 4 4 8 7 4 5 3 6 6 6", "output": "482" }, { "input": "63 86\n32 31 36 29 36 26 28 38 39 32 29 26 33 38 36 38 36 28 43 48 28 33 25 39 39 27 34 25 37 28 40 26 30 31 42 32 36 44 29 36 30 35 48 40 26 34 30 33 33 46 42 24 36 38 33 51 33 41 38 29 29 32 28", "output": "6469" }, { "input": "100 38\n30 24 38 31 31 33 32 32 29 34 29 22 27 23 34 25 32 30 30 26 16 27 38 33 38 38 37 34 32 27 33 23 33 32 24 24 30 36 29 30 33 30 29 30 36 33 33 35 28 24 30 32 38 29 30 36 31 30 27 38 31 36 15 37 32 27 29 24 38 33 28 29 34 21 37 35 32 31 27 25 27 28 31 31 36 38 35 35 36 29 35 22 38 31 38 28 31 27 34 31", "output": "1340" }, { "input": "33 69\n60 69 68 69 69 60 64 60 62 59 54 47 60 62 69 69 69 58 67 69 62 69 68 53 69 69 66 66 57 58 65 69 61", "output": "329" }, { "input": "39 92\n19 17 16 19 15 30 21 25 14 17 19 19 23 16 14 15 17 19 29 15 11 25 19 14 18 20 10 16 11 15 18 20 20 17 18 16 12 17 16", "output": "5753" }, { "input": "68 29\n29 29 29 29 29 28 29 29 29 27 29 29 29 29 29 29 29 23 29 29 26 29 29 29 29 29 29 29 29 29 29 29 29 29 29 29 26 29 29 29 29 29 29 29 29 29 29 29 29 22 29 29 29 29 29 29 29 29 29 29 29 29 29 28 29 29 29 29", "output": "0" }, { "input": "75 30\n22 18 21 26 23 18 28 30 24 24 19 25 28 30 23 29 18 23 23 30 26 30 17 30 18 19 25 26 26 15 27 23 30 21 19 26 25 30 25 28 20 22 22 21 26 17 23 23 24 15 25 19 18 22 30 30 29 21 30 28 28 30 27 25 24 15 22 19 30 21 20 30 18 20 25", "output": "851" }, { "input": "78 43\n2 7 6 5 5 6 4 5 3 4 6 8 4 5 5 4 3 1 2 4 4 6 5 6 4 4 6 4 8 4 6 5 6 1 4 5 6 3 2 5 2 5 3 4 8 8 3 3 4 4 6 6 5 4 5 5 7 9 3 9 6 4 7 3 6 9 6 5 1 7 2 5 6 3 6 2 5 4", "output": "5884" }, { "input": "82 88\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 2 1 1 2 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1", "output": "14170" }, { "input": "84 77\n28 26 36 38 37 44 48 34 40 22 42 35 40 37 30 31 33 35 36 55 47 36 33 47 40 38 27 38 36 33 35 31 47 33 30 38 38 47 49 24 38 37 28 43 39 36 34 33 29 38 36 43 48 38 36 34 33 34 35 31 26 33 39 37 37 37 35 52 47 30 24 46 38 26 43 46 41 50 33 40 36 41 37 30", "output": "6650" }, { "input": "94 80\n21 19 15 16 27 16 20 18 19 19 15 15 20 19 19 21 20 19 13 17 15 9 17 15 23 15 12 18 12 13 15 12 14 13 14 17 20 20 14 21 15 6 10 23 24 8 18 18 13 23 17 22 17 19 19 18 17 24 8 16 18 20 24 19 10 19 15 10 13 14 19 15 16 19 20 15 14 21 16 16 14 14 22 19 12 11 14 13 19 32 16 16 13 20", "output": "11786" }, { "input": "96 41\n13 32 27 34 28 34 30 26 21 24 29 20 25 34 25 16 27 15 22 22 34 22 25 19 23 17 17 22 26 24 23 20 21 27 19 33 13 24 22 18 30 30 27 14 26 24 20 20 22 11 19 31 19 29 18 28 30 22 17 15 28 32 17 24 17 24 24 19 26 23 22 29 18 22 23 29 19 32 26 23 22 22 24 23 27 30 24 25 21 21 33 19 35 27 34 28", "output": "3182" }, { "input": "1 26\n26", "output": "0" }, { "input": "99 39\n25 28 30 28 32 34 31 28 29 28 29 30 33 19 33 31 27 33 29 24 27 30 25 38 28 34 35 31 34 37 30 22 21 24 34 27 34 33 34 33 26 26 36 19 30 22 35 30 21 28 23 35 33 29 21 22 36 31 34 32 34 32 30 32 27 33 38 25 35 26 39 27 29 29 19 33 28 29 34 38 26 30 36 26 29 30 26 34 22 32 29 38 25 27 24 17 25 28 26", "output": "1807" }, { "input": "100 12\n7 6 6 3 5 5 9 8 7 7 4 7 12 6 9 5 6 3 4 7 9 10 7 7 5 3 9 6 9 9 6 7 4 10 4 8 8 6 9 8 6 5 7 4 10 7 5 6 8 9 3 4 8 5 4 8 6 10 5 8 7 5 9 8 5 8 5 6 9 11 4 9 5 5 11 4 6 6 7 3 8 9 6 7 10 4 7 6 9 4 8 11 5 4 10 8 5 10 11 4", "output": "946" }, { "input": "100 18\n1 2 2 2 2 2 1 1 1 2 3 1 3 1 1 4 2 4 1 2 1 2 1 3 2 1 2 1 1 1 2 1 2 2 1 1 4 3 1 1 2 1 3 3 2 1 2 2 1 1 1 1 3 1 1 2 2 1 1 1 5 1 2 1 3 2 2 1 4 2 2 1 1 1 1 1 1 1 1 2 2 1 2 1 1 1 2 1 2 2 2 1 1 3 1 1 2 1 1 2", "output": "3164" }, { "input": "100 27\n16 20 21 10 16 17 18 25 19 18 20 12 11 21 21 23 20 26 20 21 27 16 25 18 25 21 27 12 20 27 18 17 27 13 21 26 12 22 15 21 25 21 18 27 24 15 16 18 23 21 24 27 19 17 24 14 21 16 24 26 13 14 25 18 27 26 22 16 27 27 17 25 17 12 22 10 19 27 19 20 23 22 25 23 17 25 14 20 22 10 22 27 21 20 15 26 24 27 12 16", "output": "1262" }, { "input": "100 29\n20 18 23 24 14 14 16 23 22 17 18 22 21 21 19 19 14 11 18 19 16 22 25 20 14 13 21 24 18 16 18 29 17 25 12 10 18 28 11 16 17 14 15 20 17 20 18 22 10 16 16 20 18 19 29 18 25 27 17 19 24 15 24 25 16 23 19 16 16 20 19 15 12 21 20 13 21 15 15 23 16 23 17 13 17 21 13 18 17 18 18 20 16 12 19 15 27 14 11 18", "output": "2024" }, { "input": "100 30\n16 10 20 11 14 27 15 17 22 26 24 17 15 18 19 22 22 15 21 22 14 21 22 22 21 22 15 17 17 22 18 19 26 18 22 20 22 25 18 18 17 23 18 18 20 13 19 30 17 24 22 19 29 20 20 21 17 18 26 25 22 19 15 18 18 20 19 19 18 18 24 16 19 17 12 21 20 16 23 21 16 17 26 23 25 28 22 20 9 21 17 24 15 19 17 21 29 13 18 15", "output": "1984" }, { "input": "100 59\n56 58 53 59 59 48 59 54 46 59 59 58 48 59 55 59 59 50 59 56 59 59 59 59 59 59 59 57 59 53 45 53 50 59 50 55 58 54 59 56 54 59 59 59 59 48 56 59 59 57 59 59 48 43 55 57 39 59 46 55 55 52 58 57 51 59 59 59 59 53 59 43 51 54 46 59 57 43 50 59 47 58 59 59 59 55 46 56 55 59 56 47 56 56 46 51 47 48 59 55", "output": "740" }, { "input": "100 81\n6 7 6 6 7 6 6 6 3 9 4 5 4 3 4 6 6 6 1 3 9 5 2 3 8 5 6 9 6 6 6 5 4 4 7 7 3 6 11 7 6 4 8 7 12 6 4 10 2 4 9 11 7 4 7 7 8 8 6 7 9 8 4 5 8 13 6 6 6 8 6 2 5 6 7 5 4 4 4 4 2 6 4 8 3 4 7 7 6 7 7 10 5 10 6 7 4 11 8 4", "output": "14888" }, { "input": "100 100\n30 35 23 43 28 49 31 32 30 44 32 37 33 34 38 28 43 32 33 32 50 32 41 38 33 20 40 36 29 21 42 25 23 34 43 32 37 31 30 27 36 32 45 37 33 29 38 34 35 33 28 19 37 33 28 41 31 29 41 27 32 39 30 34 37 40 33 38 35 32 32 34 35 34 28 39 28 34 40 45 31 25 42 28 29 31 33 21 36 33 34 37 40 42 39 30 36 34 34 40", "output": "13118" }, { "input": "100 100\n71 87 100 85 89 98 90 90 71 65 76 75 85 100 81 100 91 80 73 89 86 78 82 89 77 92 78 90 100 81 85 89 73 100 66 60 72 88 91 73 93 76 88 81 86 78 83 77 74 93 97 94 85 78 82 78 91 91 100 78 89 76 78 82 81 78 83 88 87 83 78 98 85 97 98 89 88 75 76 86 74 81 70 76 86 84 99 100 89 94 72 84 82 88 83 89 78 99 87 76", "output": "3030" }, { "input": "100 100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "19700" }, { "input": "100 100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100", "output": "0" }, { "input": "100 100\n1 1 2 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "19696" }, { "input": "100 100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 99", "output": "0" }, { "input": "100 100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 98 100 100 100 100 98 100 100 100 100 100 100 99 98 100 100 93 100 100 98 100 100 100 100 93 100 96 100 100 100 94 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 95 88 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100", "output": "0" }, { "input": "100 100\n95 100 100 100 100 100 100 100 100 100 100 100 100 100 87 100 100 100 94 100 100 100 100 100 100 100 100 100 100 100 100 99 100 100 100 100 100 100 100 100 100 100 90 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 97 100 100 100 96 100 98 100 100 100 100 100 96 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 97 100 100 100 100", "output": "2" }, { "input": "100 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "0" }, { "input": "100 2\n2 1 1 2 1 1 1 1 2 2 2 2 1 1 1 2 1 1 1 2 2 2 2 1 1 1 1 2 2 2 1 2 2 2 2 1 2 2 1 1 1 1 1 1 2 2 1 2 1 1 1 2 1 2 2 2 2 1 1 1 2 2 1 2 1 1 1 2 1 2 2 1 1 1 2 2 1 1 2 1 1 2 1 1 1 2 1 1 1 1 2 1 1 1 1 2 1 2 1 1", "output": "16" }, { "input": "3 5\n5 5 5", "output": "0" }, { "input": "7 7\n1 1 1 1 1 1 1", "output": "77" }, { "input": "1 1\n1", "output": "0" }, { "input": "100 100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "19700" }, { "input": "4 10\n10 10 10 10", "output": "0" }, { "input": "1 10\n10", "output": "0" }, { "input": "10 1\n1 1 1 1 1 1 1 1 1 1", "output": "0" }, { "input": "3 10\n10 10 10", "output": "0" }, { "input": "2 4\n3 4", "output": "0" }, { "input": "1 2\n2", "output": "0" }, { "input": "3 4\n4 4 4", "output": "0" }, { "input": "3 2\n2 2 1", "output": "0" }, { "input": "5 5\n5 5 5 5 5", "output": "0" }, { "input": "3 3\n3 3 3", "output": "0" }, { "input": "2 9\n8 9", "output": "0" }, { "input": "3 10\n9 10 10", "output": "0" }, { "input": "1 3\n3", "output": "0" }, { "input": "2 2\n1 2", "output": "0" }, { "input": "2 10\n10 10", "output": "0" }, { "input": "23 14\n7 11 13 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14", "output": "0" }, { "input": "2 10\n9 10", "output": "0" }, { "input": "2 2\n2 2", "output": "0" }, { "input": "10 5\n5 5 5 5 5 5 5 5 5 4", "output": "0" }, { "input": "3 5\n4 5 5", "output": "0" }, { "input": "5 4\n4 4 4 4 4", "output": "0" }, { "input": "2 10\n10 9", "output": "0" }, { "input": "4 5\n3 5 5 5", "output": "0" }, { "input": "10 5\n5 5 5 5 5 5 5 5 5 5", "output": "0" }, { "input": "3 10\n10 10 9", "output": "0" }, { "input": "5 1\n1 1 1 1 1", "output": "0" }, { "input": "2 1\n1 1", "output": "0" }, { "input": "4 10\n9 10 10 10", "output": "0" }, { "input": "5 2\n2 2 2 2 2", "output": "0" }, { "input": "2 5\n4 5", "output": "0" }, { "input": "5 10\n10 10 10 10 10", "output": "0" }, { "input": "2 6\n6 6", "output": "0" }, { "input": "2 9\n9 9", "output": "0" }, { "input": "3 10\n10 9 10", "output": "0" }, { "input": "4 40\n39 40 40 40", "output": "0" }, { "input": "3 4\n3 4 4", "output": "0" }, { "input": "9 9\n9 9 9 9 9 9 9 9 9", "output": "0" }, { "input": "1 4\n4", "output": "0" }, { "input": "4 7\n1 1 1 1", "output": "44" }, { "input": "1 5\n5", "output": "0" }, { "input": "3 1\n1 1 1", "output": "0" }, { "input": "1 100\n100", "output": "0" }, { "input": "2 7\n3 5", "output": "10" }, { "input": "3 6\n6 6 6", "output": "0" }, { "input": "4 2\n1 2 2 2", "output": "0" }, { "input": "4 5\n4 5 5 5", "output": "0" }, { "input": "5 5\n1 1 1 1 1", "output": "35" }, { "input": "66 2\n1 2 2 2 2 1 1 2 1 2 2 2 2 2 2 1 2 1 2 1 2 1 2 1 2 1 1 1 1 2 2 1 2 2 1 1 2 1 2 2 1 1 1 2 1 2 1 2 1 2 1 2 2 2 2 1 2 2 1 2 1 1 1 2 2 1", "output": "0" }, { "input": "2 2\n2 1", "output": "0" }, { "input": "5 5\n5 5 5 4 5", "output": "0" }, { "input": "3 7\n1 1 1", "output": "33" }, { "input": "2 5\n5 5", "output": "0" }, { "input": "1 7\n1", "output": "11" }, { "input": "6 7\n1 1 1 1 1 1", "output": "66" }, { "input": "99 97\n15 80 78 69 12 84 36 51 89 77 88 10 1 19 67 85 6 36 8 70 14 45 88 97 22 13 75 57 83 27 13 97 9 90 68 51 76 37 5 2 16 92 11 48 13 77 35 19 15 74 22 29 21 12 28 42 56 5 32 41 62 75 71 71 68 72 24 77 11 28 78 27 53 88 74 66 1 42 18 16 18 39 75 38 81 5 13 39 40 75 13 36 53 83 9 54 57 63 64", "output": "10077" }, { "input": "8 7\n1 1 1 1 1 1 1 1", "output": "88" }, { "input": "3 2\n2 2 2", "output": "0" }, { "input": "6 5\n5 5 5 5 5 5", "output": "0" }, { "input": "10 5\n5 5 5 5 5 5 5 4 1 1", "output": "8" }, { "input": "1 5\n1", "output": "7" }, { "input": "10 10\n10 10 10 10 10 10 10 10 10 10", "output": "0" }, { "input": "2 3\n2 3", "output": "0" }, { "input": "1 9\n9", "output": "0" }, { "input": "74 2\n2 2 2 2 1 2 2 1 1 1 2 2 1 2 2 2 2 1 2 1 1 1 2 1 1 2 2 1 2 1 1 2 1 1 2 2 2 2 2 2 2 2 1 2 2 2 1 2 2 1 1 2 1 1 1 1 1 1 2 2 2 1 1 1 1 1 2 2 2 2 2 2 1 2", "output": "0" }, { "input": "5 5\n5 5 5 5 4", "output": "0" } ]
1,495,450,933
2,147,483,647
Python 3
OK
TESTS
106
62
0
n,k=map(int,input().split()) mrks=list(map(int,input().split())) ns=sum(mrks) reqm=(k-.5)*n if(ns<reqm): dff=reqm-ns res=dff*2 res=int(round(res)) print(res) else: print(0)
Title: Straight <<A>> Time Limit: None seconds Memory Limit: None megabytes Problem Description: Noora is a student of one famous high school. It's her final year in school — she is going to study in university next year. However, she has to get an «A» graduation certificate in order to apply to a prestigious one. In school, where Noora is studying, teachers are putting down marks to the online class register, which are integers from 1 to *k*. The worst mark is 1, the best is *k*. Mark that is going to the certificate, is calculated as an average of all the marks, rounded to the closest integer. If several answers are possible, rounding up is produced. For example, 7.3 is rounded to 7, but 7.5 and 7.8784 — to 8. For instance, if Noora has marks [8,<=9], then the mark to the certificate is 9, because the average is equal to 8.5 and rounded to 9, but if the marks are [8,<=8,<=9], Noora will have graduation certificate with 8. To graduate with «A» certificate, Noora has to have mark *k*. Noora got *n* marks in register this year. However, she is afraid that her marks are not enough to get final mark *k*. Noora decided to ask for help in the internet, where hacker Leha immediately responded to her request. He is ready to hack class register for Noora and to add Noora any number of additional marks from 1 to *k*. At the same time, Leha want his hack be unseen to everyone, so he decided to add as less as possible additional marks. Please help Leha to calculate the minimal number of marks he has to add, so that final Noora's mark will become equal to *k*. Input Specification: The first line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=100,<=1<=≤<=*k*<=≤<=100) denoting the number of marks, received by Noora and the value of highest possible mark. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*k*) denoting marks received by Noora before Leha's hack. Output Specification: Print a single integer — minimal number of additional marks, that Leha has to add in order to change Noora's final mark to *k*. Demo Input: ['2 10\n8 9\n', '3 5\n4 4 4\n'] Demo Output: ['4', '3'] Note: Consider the first example testcase. Maximal mark is 10, Noora received two marks — 8 and 9, so current final mark is 9. To fix it, Leha can add marks [10, 10, 10, 10] (4 marks in total) to the registry, achieving Noora having average mark equal to <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/1b961585522f76271546da990a6228e7c666277f.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Consequently, new final mark is 10. Less number of marks won't fix the situation. In the second example Leha can add [5, 5, 5] to the registry, so that making average mark equal to 4.5, which is enough to have 5 in the certificate.
```python n,k=map(int,input().split()) mrks=list(map(int,input().split())) ns=sum(mrks) reqm=(k-.5)*n if(ns<reqm): dff=reqm-ns res=dff*2 res=int(round(res)) print(res) else: print(0) ```
3
831
A
Unimodal Array
PROGRAMMING
1,000
[ "implementation" ]
null
null
Array of integers is unimodal, if: - it is strictly increasing in the beginning; - after that it is constant; - after that it is strictly decreasing. The first block (increasing) and the last block (decreasing) may be absent. It is allowed that both of this blocks are absent. For example, the following three arrays are unimodal: [5,<=7,<=11,<=11,<=2,<=1], [4,<=4,<=2], [7], but the following three are not unimodal: [5,<=5,<=6,<=6,<=1], [1,<=2,<=1,<=2], [4,<=5,<=5,<=6]. Write a program that checks if an array is unimodal.
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in the array. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1<=000) — the elements of the array.
Print "YES" if the given array is unimodal. Otherwise, print "NO". You can output each letter in any case (upper or lower).
[ "6\n1 5 5 5 4 2\n", "5\n10 20 30 20 10\n", "4\n1 2 1 2\n", "7\n3 3 3 3 3 3 3\n" ]
[ "YES\n", "YES\n", "NO\n", "YES\n" ]
In the first example the array is unimodal, because it is strictly increasing in the beginning (from position 1 to position 2, inclusively), that it is constant (from position 2 to position 4, inclusively) and then it is strictly decreasing (from position 4 to position 6, inclusively).
500
[ { "input": "6\n1 5 5 5 4 2", "output": "YES" }, { "input": "5\n10 20 30 20 10", "output": "YES" }, { "input": "4\n1 2 1 2", "output": "NO" }, { "input": "7\n3 3 3 3 3 3 3", "output": "YES" }, { "input": "6\n5 7 11 11 2 1", "output": "YES" }, { "input": "1\n7", "output": "YES" }, { "input": "100\n527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527", "output": "YES" }, { "input": "5\n5 5 6 6 1", "output": "NO" }, { "input": "3\n4 4 2", "output": "YES" }, { "input": "4\n4 5 5 6", "output": "NO" }, { "input": "3\n516 516 515", "output": "YES" }, { "input": "5\n502 503 508 508 507", "output": "YES" }, { "input": "10\n538 538 538 538 538 538 538 538 538 538", "output": "YES" }, { "input": "15\n452 454 455 455 450 448 443 442 439 436 433 432 431 428 426", "output": "YES" }, { "input": "20\n497 501 504 505 509 513 513 513 513 513 513 513 513 513 513 513 513 513 513 513", "output": "YES" }, { "input": "50\n462 465 465 465 463 459 454 449 444 441 436 435 430 429 426 422 421 418 417 412 408 407 406 403 402 399 395 392 387 386 382 380 379 376 374 371 370 365 363 359 358 354 350 349 348 345 342 341 338 337", "output": "YES" }, { "input": "70\n290 292 294 297 299 300 303 305 310 312 313 315 319 320 325 327 328 333 337 339 340 341 345 350 351 354 359 364 367 372 374 379 381 382 383 384 389 393 395 397 398 400 402 405 409 411 416 417 422 424 429 430 434 435 440 442 445 449 451 453 458 460 465 470 474 477 482 482 482 479", "output": "YES" }, { "input": "99\n433 435 439 444 448 452 457 459 460 464 469 470 471 476 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 479 478 477 476 474 469 468 465 460 457 453 452 450 445 443 440 438 433 432 431 430 428 425 421 418 414 411 406 402 397 396 393", "output": "YES" }, { "input": "100\n537 538 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543", "output": "YES" }, { "input": "100\n524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 521", "output": "YES" }, { "input": "100\n235 239 243 245 246 251 254 259 260 261 264 269 272 275 277 281 282 285 289 291 292 293 298 301 302 303 305 307 308 310 315 317 320 324 327 330 334 337 342 346 347 348 353 357 361 366 370 373 376 378 379 384 386 388 390 395 398 400 405 408 413 417 420 422 424 429 434 435 438 441 443 444 445 450 455 457 459 463 465 468 471 473 475 477 481 486 491 494 499 504 504 504 504 504 504 504 504 504 504 504", "output": "YES" }, { "input": "100\n191 196 201 202 207 212 216 219 220 222 224 227 230 231 234 235 238 242 246 250 253 254 259 260 263 267 269 272 277 280 284 287 288 290 295 297 300 305 307 312 316 320 324 326 327 332 333 334 338 343 347 351 356 358 363 368 370 374 375 380 381 386 390 391 394 396 397 399 402 403 405 410 414 419 422 427 429 433 437 442 443 447 448 451 455 459 461 462 464 468 473 478 481 484 485 488 492 494 496 496", "output": "YES" }, { "input": "100\n466 466 466 466 466 464 459 455 452 449 446 443 439 436 435 433 430 428 425 424 420 419 414 412 407 404 401 396 394 391 386 382 379 375 374 369 364 362 360 359 356 351 350 347 342 340 338 337 333 330 329 326 321 320 319 316 311 306 301 297 292 287 286 281 278 273 269 266 261 257 256 255 253 252 250 245 244 242 240 238 235 230 225 220 216 214 211 209 208 206 203 198 196 194 192 190 185 182 177 173", "output": "YES" }, { "input": "100\n360 362 367 369 374 377 382 386 389 391 396 398 399 400 405 410 413 416 419 420 423 428 431 436 441 444 445 447 451 453 457 459 463 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 465 460 455 453 448 446 443 440 436 435 430 425 420 415 410 405 404 403 402 399 394 390 387 384 382 379 378 373 372 370 369 366 361 360 355 353 349 345 344 342 339 338 335 333", "output": "YES" }, { "input": "1\n1000", "output": "YES" }, { "input": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "YES" }, { "input": "100\n1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000", "output": "YES" }, { "input": "100\n1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1", "output": "YES" }, { "input": "100\n1 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000", "output": "YES" }, { "input": "100\n1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 999 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000", "output": "NO" }, { "input": "100\n998 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 999 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 999", "output": "NO" }, { "input": "100\n537 538 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 691 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543", "output": "NO" }, { "input": "100\n527 527 527 527 527 527 527 527 872 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527", "output": "NO" }, { "input": "100\n524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 208 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 521", "output": "NO" }, { "input": "100\n235 239 243 245 246 251 254 259 260 261 264 269 272 275 277 281 282 285 289 291 292 293 298 301 302 303 305 307 308 310 315 317 320 324 327 330 334 337 342 921 347 348 353 357 361 366 370 373 376 378 379 384 386 388 390 395 398 400 405 408 413 417 420 422 424 429 434 435 438 441 443 444 445 450 455 457 459 463 465 468 471 473 475 477 481 486 491 494 499 504 504 504 504 504 504 504 504 504 504 504", "output": "NO" }, { "input": "100\n191 196 201 202 207 212 216 219 220 222 224 227 230 231 234 235 238 242 246 250 253 254 259 260 263 267 269 272 277 280 284 287 288 290 295 297 300 305 307 312 316 320 324 326 327 332 333 334 338 343 347 351 356 358 119 368 370 374 375 380 381 386 390 391 394 396 397 399 402 403 405 410 414 419 422 427 429 433 437 442 443 447 448 451 455 459 461 462 464 468 473 478 481 484 485 488 492 494 496 496", "output": "NO" }, { "input": "100\n466 466 466 466 466 464 459 455 452 449 446 443 439 436 435 433 430 428 425 424 420 419 414 412 407 404 401 396 394 391 386 382 379 375 374 369 364 362 360 359 356 335 350 347 342 340 338 337 333 330 329 326 321 320 319 316 311 306 301 297 292 287 286 281 278 273 269 266 261 257 256 255 253 252 250 245 244 242 240 238 235 230 225 220 216 214 211 209 208 206 203 198 196 194 192 190 185 182 177 173", "output": "NO" }, { "input": "100\n360 362 367 369 374 377 382 386 389 391 396 398 399 400 405 410 413 416 419 420 423 428 525 436 441 444 445 447 451 453 457 459 463 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 465 460 455 453 448 446 443 440 436 435 430 425 420 415 410 405 404 403 402 399 394 390 387 384 382 379 378 373 372 370 369 366 361 360 355 353 349 345 344 342 339 338 335 333", "output": "NO" }, { "input": "3\n1 2 3", "output": "YES" }, { "input": "3\n3 2 1", "output": "YES" }, { "input": "3\n1 1 2", "output": "NO" }, { "input": "3\n2 1 1", "output": "NO" }, { "input": "3\n2 1 2", "output": "NO" }, { "input": "3\n3 1 2", "output": "NO" }, { "input": "3\n1 3 2", "output": "YES" }, { "input": "100\n395 399 402 403 405 408 413 415 419 424 426 431 434 436 439 444 447 448 449 454 457 459 461 462 463 464 465 469 470 473 477 480 482 484 485 487 492 494 496 497 501 504 505 508 511 506 505 503 500 499 494 490 488 486 484 481 479 474 472 471 470 465 462 458 453 452 448 445 440 436 433 430 428 426 424 421 419 414 413 408 404 403 399 395 393 388 384 379 377 375 374 372 367 363 360 356 353 351 350 346", "output": "YES" }, { "input": "100\n263 268 273 274 276 281 282 287 288 292 294 295 296 300 304 306 308 310 311 315 319 322 326 330 333 336 339 341 342 347 351 353 356 358 363 365 369 372 374 379 383 387 389 391 392 395 396 398 403 404 407 411 412 416 419 421 424 428 429 430 434 436 440 443 444 448 453 455 458 462 463 464 469 473 477 481 486 489 492 494 499 503 506 509 510 512 514 515 511 510 507 502 499 498 494 491 486 482 477 475", "output": "YES" }, { "input": "100\n482 484 485 489 492 496 499 501 505 509 512 517 520 517 515 513 509 508 504 503 498 496 493 488 486 481 478 476 474 470 468 466 463 459 456 453 452 449 445 444 439 438 435 432 428 427 424 423 421 419 417 413 408 405 402 399 397 393 388 385 380 375 370 366 363 361 360 355 354 352 349 345 340 336 335 331 329 327 324 319 318 317 315 314 310 309 307 304 303 300 299 295 291 287 285 282 280 278 273 271", "output": "YES" }, { "input": "100\n395 399 402 403 405 408 413 415 419 424 426 431 434 436 439 444 447 448 449 454 457 459 461 462 463 464 465 469 470 473 477 480 482 484 485 487 492 494 496 32 501 504 505 508 511 506 505 503 500 499 494 490 488 486 484 481 479 474 472 471 470 465 462 458 453 452 448 445 440 436 433 430 428 426 424 421 419 414 413 408 404 403 399 395 393 388 384 379 377 375 374 372 367 363 360 356 353 351 350 346", "output": "NO" }, { "input": "100\n263 268 273 274 276 281 282 287 288 292 294 295 296 300 304 306 308 310 311 315 319 322 326 330 247 336 339 341 342 347 351 353 356 358 363 365 369 372 374 379 383 387 389 391 392 395 396 398 403 404 407 411 412 416 419 421 424 428 429 430 434 436 440 443 444 448 453 455 458 462 463 464 469 473 477 481 486 489 492 494 499 503 506 509 510 512 514 515 511 510 507 502 499 498 494 491 486 482 477 475", "output": "NO" }, { "input": "100\n482 484 485 489 492 496 499 501 505 509 512 517 520 517 515 513 509 508 504 503 497 496 493 488 486 481 478 476 474 470 468 466 463 459 456 453 452 449 445 444 439 438 435 432 428 427 424 423 421 419 417 413 408 405 402 399 397 393 388 385 380 375 370 366 363 361 360 355 354 352 349 345 340 336 335 331 329 327 324 319 318 317 315 314 310 309 307 304 303 300 299 295 291 287 285 282 280 278 273 271", "output": "YES" }, { "input": "2\n1 3", "output": "YES" }, { "input": "2\n1 2", "output": "YES" }, { "input": "5\n2 2 1 1 1", "output": "NO" }, { "input": "4\n1 3 2 2", "output": "NO" }, { "input": "6\n1 2 1 2 2 1", "output": "NO" }, { "input": "2\n4 2", "output": "YES" }, { "input": "3\n3 2 2", "output": "NO" }, { "input": "9\n1 2 2 3 3 4 3 2 1", "output": "NO" }, { "input": "4\n5 5 4 4", "output": "NO" }, { "input": "2\n2 1", "output": "YES" }, { "input": "5\n5 4 3 2 1", "output": "YES" }, { "input": "7\n4 3 3 3 3 3 3", "output": "NO" }, { "input": "5\n1 2 3 4 5", "output": "YES" }, { "input": "3\n2 2 1", "output": "YES" }, { "input": "3\n4 3 3", "output": "NO" }, { "input": "7\n1 5 5 4 3 3 1", "output": "NO" }, { "input": "6\n3 3 1 2 2 1", "output": "NO" }, { "input": "5\n1 2 1 2 1", "output": "NO" }, { "input": "2\n5 1", "output": "YES" }, { "input": "9\n1 2 3 4 4 3 2 2 1", "output": "NO" }, { "input": "3\n2 2 3", "output": "NO" }, { "input": "2\n5 4", "output": "YES" }, { "input": "5\n1 3 3 2 2", "output": "NO" }, { "input": "10\n1 2 3 4 5 6 7 8 9 99", "output": "YES" }, { "input": "4\n1 2 3 4", "output": "YES" }, { "input": "3\n5 5 2", "output": "YES" }, { "input": "4\n1 4 2 3", "output": "NO" }, { "input": "2\n3 2", "output": "YES" }, { "input": "5\n1 2 2 1 1", "output": "NO" }, { "input": "4\n3 3 2 2", "output": "NO" }, { "input": "5\n1 2 3 2 2", "output": "NO" }, { "input": "5\n5 6 6 5 5", "output": "NO" }, { "input": "4\n2 2 1 1", "output": "NO" }, { "input": "5\n5 4 3 3 2", "output": "NO" }, { "input": "7\n1 3 3 3 2 1 1", "output": "NO" }, { "input": "9\n5 6 6 5 5 4 4 3 3", "output": "NO" }, { "input": "6\n1 5 5 3 2 2", "output": "NO" }, { "input": "5\n2 1 3 3 1", "output": "NO" }, { "input": "2\n4 3", "output": "YES" }, { "input": "5\n3 2 2 1 1", "output": "NO" }, { "input": "4\n5 4 3 2", "output": "YES" }, { "input": "4\n4 4 1 1", "output": "NO" }, { "input": "4\n3 3 1 1", "output": "NO" }, { "input": "4\n4 4 2 2", "output": "NO" }, { "input": "5\n4 4 3 2 2", "output": "NO" }, { "input": "8\n4 4 4 4 5 6 7 8", "output": "NO" }, { "input": "5\n3 5 4 4 3", "output": "NO" }, { "input": "6\n2 5 3 3 2 2", "output": "NO" }, { "input": "4\n5 5 2 2", "output": "NO" }, { "input": "5\n1 2 2 3 5", "output": "NO" } ]
1,641,360,005
2,147,483,647
Python 3
OK
TESTS
101
46
0
n = int(input()) a = list(map(int, input().split())) flag = 0 m = max(a) p = a.index(m) for i in range (p): if a[i] >= a[i+1]: flag = 1 break for i in range (n-1): if p == n-1: break if a[p] == a[p+1]: p += 1 for i in range (p,n-1): if a[i] <= a[i+1]: flag = 1 break if flag == 0: print('Yes') else: print('No')
Title: Unimodal Array Time Limit: None seconds Memory Limit: None megabytes Problem Description: Array of integers is unimodal, if: - it is strictly increasing in the beginning; - after that it is constant; - after that it is strictly decreasing. The first block (increasing) and the last block (decreasing) may be absent. It is allowed that both of this blocks are absent. For example, the following three arrays are unimodal: [5,<=7,<=11,<=11,<=2,<=1], [4,<=4,<=2], [7], but the following three are not unimodal: [5,<=5,<=6,<=6,<=1], [1,<=2,<=1,<=2], [4,<=5,<=5,<=6]. Write a program that checks if an array is unimodal. Input Specification: The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in the array. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1<=000) — the elements of the array. Output Specification: Print "YES" if the given array is unimodal. Otherwise, print "NO". You can output each letter in any case (upper or lower). Demo Input: ['6\n1 5 5 5 4 2\n', '5\n10 20 30 20 10\n', '4\n1 2 1 2\n', '7\n3 3 3 3 3 3 3\n'] Demo Output: ['YES\n', 'YES\n', 'NO\n', 'YES\n'] Note: In the first example the array is unimodal, because it is strictly increasing in the beginning (from position 1 to position 2, inclusively), that it is constant (from position 2 to position 4, inclusively) and then it is strictly decreasing (from position 4 to position 6, inclusively).
```python n = int(input()) a = list(map(int, input().split())) flag = 0 m = max(a) p = a.index(m) for i in range (p): if a[i] >= a[i+1]: flag = 1 break for i in range (n-1): if p == n-1: break if a[p] == a[p+1]: p += 1 for i in range (p,n-1): if a[i] <= a[i+1]: flag = 1 break if flag == 0: print('Yes') else: print('No') ```
3
389
A
Fox and Number Game
PROGRAMMING
1,000
[ "greedy", "math" ]
null
null
Fox Ciel is playing a game with numbers now. Ciel has *n* positive integers: *x*1, *x*2, ..., *x**n*. She can do the following operation as many times as needed: select two different indexes *i* and *j* such that *x**i* &gt; *x**j* hold, and then apply assignment *x**i* = *x**i* - *x**j*. The goal is to make the sum of all numbers as small as possible. Please help Ciel to find this minimal sum.
The first line contains an integer *n* (2<=≤<=*n*<=≤<=100). Then the second line contains *n* integers: *x*1, *x*2, ..., *x**n* (1<=≤<=*x**i*<=≤<=100).
Output a single integer — the required minimal sum.
[ "2\n1 2\n", "3\n2 4 6\n", "2\n12 18\n", "5\n45 12 27 30 18\n" ]
[ "2\n", "6\n", "12\n", "15\n" ]
In the first example the optimal way is to do the assignment: *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>. In the second example the optimal sequence of operations is: *x*<sub class="lower-index">3</sub> = *x*<sub class="lower-index">3</sub> - *x*<sub class="lower-index">2</sub>, *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>.
500
[ { "input": "2\n1 2", "output": "2" }, { "input": "3\n2 4 6", "output": "6" }, { "input": "2\n12 18", "output": "12" }, { "input": "5\n45 12 27 30 18", "output": "15" }, { "input": "2\n1 1", "output": "2" }, { "input": "2\n100 100", "output": "200" }, { "input": "2\n87 58", "output": "58" }, { "input": "39\n52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52", "output": "2028" }, { "input": "59\n96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96", "output": "5664" }, { "input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100", "output": "10000" }, { "input": "100\n70 70 77 42 98 84 56 91 35 21 7 70 77 77 56 63 14 84 56 14 77 77 63 70 14 7 28 91 63 49 21 84 98 56 77 98 98 84 98 14 7 56 49 28 91 98 7 56 14 91 14 98 49 28 98 14 98 98 14 70 35 28 63 28 49 63 63 56 91 98 35 42 42 35 63 35 42 14 63 21 77 56 42 77 35 91 56 21 28 84 56 70 70 91 98 70 84 63 21 98", "output": "700" }, { "input": "39\n63 21 21 42 21 63 21 84 42 21 84 63 42 63 84 84 84 42 42 84 21 63 42 63 42 42 63 42 42 63 84 42 21 84 21 63 42 21 42", "output": "819" }, { "input": "59\n70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70", "output": "4130" }, { "input": "87\n44 88 88 88 88 66 88 22 22 88 88 44 88 22 22 22 88 88 88 88 66 22 88 88 88 88 66 66 44 88 44 44 66 22 88 88 22 44 66 44 88 66 66 22 22 22 22 88 22 22 44 66 88 22 22 88 66 66 88 22 66 88 66 88 66 44 88 44 22 44 44 22 44 88 44 44 44 44 22 88 88 88 66 66 88 44 22", "output": "1914" }, { "input": "15\n63 63 63 63 63 63 63 63 63 63 63 63 63 63 63", "output": "945" }, { "input": "39\n63 77 21 14 14 35 21 21 70 42 21 70 28 77 28 77 7 42 63 7 98 49 98 84 35 70 70 91 14 42 98 7 42 7 98 42 56 35 91", "output": "273" }, { "input": "18\n18 18 18 36 36 36 54 72 54 36 72 54 36 36 36 36 18 36", "output": "324" }, { "input": "46\n71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71", "output": "3266" }, { "input": "70\n66 11 66 11 44 11 44 99 55 22 88 11 11 22 55 44 22 77 44 77 77 22 44 55 88 11 99 99 88 22 77 77 66 11 11 66 99 55 55 44 66 44 77 44 44 55 33 55 44 88 77 77 22 66 33 44 11 22 55 44 22 66 77 33 33 44 44 44 22 33", "output": "770" }, { "input": "10\n60 12 96 48 60 24 60 36 60 60", "output": "120" }, { "input": "20\n51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51", "output": "1020" }, { "input": "50\n58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58", "output": "2900" }, { "input": "98\n70 60 100 30 70 20 30 50 50 30 90 40 30 40 60 80 60 60 80 50 10 80 20 10 20 10 50 70 30 80 30 50 60 90 90 100 60 30 90 20 30 60 90 80 60 60 10 90 10 50 40 40 80 90 100 40 70 40 30 50 60 50 60 30 40 20 90 60 20 20 20 70 60 70 50 100 90 50 20 40 80 60 10 60 50 40 40 10 50 10 40 10 80 100 100 90 10 90", "output": "980" }, { "input": "100\n82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82", "output": "8200" }, { "input": "100\n11 87 77 93 3 54 21 93 9 71 37 23 69 85 74 3 48 99 51 31 56 19 21 96 39 6 4 4 29 69 100 42 1 22 81 53 48 49 81 61 10 7 40 61 7 71 51 59 79 44 50 35 95 80 83 8 98 40 18 94 84 49 52 74 66 69 39 37 100 44 38 62 2 80 46 31 35 53 5 60 21 49 63 55 20 53 80 53 66 34 23 92 77 50 86 63 65 24 12 70", "output": "100" }, { "input": "2\n100 1", "output": "2" }, { "input": "2\n18 30", "output": "12" }, { "input": "2\n3 5", "output": "2" }, { "input": "2\n1 10", "output": "2" }, { "input": "2\n8 5", "output": "2" }, { "input": "5\n2 3 5 8 18", "output": "5" }, { "input": "5\n2 4 1 6 8", "output": "5" }, { "input": "3\n12 10 5", "output": "3" }, { "input": "3\n6 10 15", "output": "3" } ]
1,536,153,830
2,147,483,647
Python 3
OK
TESTS
34
124
0
n = int(input()) m = [int(k) for k in input().split()] def g(a,b): c = a%b if c != 0: return c else: return b def f(a,b): h = [] for k in a: h.append(g(k,b)) return h m.sort() while True: if sum(m) != n*m[0]: m = f(m,m[0]) m.sort() else: break print(m[0]*n)
Title: Fox and Number Game Time Limit: None seconds Memory Limit: None megabytes Problem Description: Fox Ciel is playing a game with numbers now. Ciel has *n* positive integers: *x*1, *x*2, ..., *x**n*. She can do the following operation as many times as needed: select two different indexes *i* and *j* such that *x**i* &gt; *x**j* hold, and then apply assignment *x**i* = *x**i* - *x**j*. The goal is to make the sum of all numbers as small as possible. Please help Ciel to find this minimal sum. Input Specification: The first line contains an integer *n* (2<=≤<=*n*<=≤<=100). Then the second line contains *n* integers: *x*1, *x*2, ..., *x**n* (1<=≤<=*x**i*<=≤<=100). Output Specification: Output a single integer — the required minimal sum. Demo Input: ['2\n1 2\n', '3\n2 4 6\n', '2\n12 18\n', '5\n45 12 27 30 18\n'] Demo Output: ['2\n', '6\n', '12\n', '15\n'] Note: In the first example the optimal way is to do the assignment: *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>. In the second example the optimal sequence of operations is: *x*<sub class="lower-index">3</sub> = *x*<sub class="lower-index">3</sub> - *x*<sub class="lower-index">2</sub>, *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>.
```python n = int(input()) m = [int(k) for k in input().split()] def g(a,b): c = a%b if c != 0: return c else: return b def f(a,b): h = [] for k in a: h.append(g(k,b)) return h m.sort() while True: if sum(m) != n*m[0]: m = f(m,m[0]) m.sort() else: break print(m[0]*n) ```
3
672
A
Summer Camp
PROGRAMMING
800
[ "implementation" ]
null
null
Every year, hundreds of people come to summer camps, they learn new algorithms and solve hard problems. This is your first year at summer camp, and you are asked to solve the following problem. All integers starting with 1 are written in one line. The prefix of these line is "123456789101112131415...". Your task is to print the *n*-th digit of this string (digits are numbered starting with 1.
The only line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the position of the digit you need to print.
Print the *n*-th digit of the line.
[ "3\n", "11\n" ]
[ "3\n", "0\n" ]
In the first sample the digit at position 3 is '3', as both integers 1 and 2 consist on one digit. In the second sample, the digit at position 11 is '0', it belongs to the integer 10.
500
[ { "input": "3", "output": "3" }, { "input": "11", "output": "0" }, { "input": "12", "output": "1" }, { "input": "13", "output": "1" }, { "input": "29", "output": "9" }, { "input": "30", "output": "2" }, { "input": "1000", "output": "3" }, { "input": "999", "output": "9" }, { "input": "100", "output": "5" }, { "input": "123", "output": "6" }, { "input": "8", "output": "8" }, { "input": "157", "output": "3" }, { "input": "289", "output": "1" }, { "input": "179", "output": "4" }, { "input": "942", "output": "0" }, { "input": "879", "output": "9" }, { "input": "394", "output": "1" }, { "input": "423", "output": "7" }, { "input": "952", "output": "3" }, { "input": "121", "output": "5" }, { "input": "613", "output": "2" }, { "input": "945", "output": "1" }, { "input": "270", "output": "6" }, { "input": "781", "output": "2" }, { "input": "453", "output": "7" }, { "input": "171", "output": "0" }, { "input": "643", "output": "2" }, { "input": "570", "output": "6" }, { "input": "750", "output": "6" }, { "input": "500", "output": "0" }, { "input": "2", "output": "2" }, { "input": "1", "output": "1" }, { "input": "108", "output": "5" }, { "input": "500", "output": "0" }, { "input": "189", "output": "9" }, { "input": "491", "output": "0" }, { "input": "191", "output": "0" } ]
1,565,305,635
2,147,483,647
Python 3
OK
TESTS
37
109
0
n = int(input()) cur = 0 s = '' for i in range(1, n + 1): s += str(i) if len(s) >= n: print(s[n - 1]) exit(0)
Title: Summer Camp Time Limit: None seconds Memory Limit: None megabytes Problem Description: Every year, hundreds of people come to summer camps, they learn new algorithms and solve hard problems. This is your first year at summer camp, and you are asked to solve the following problem. All integers starting with 1 are written in one line. The prefix of these line is "123456789101112131415...". Your task is to print the *n*-th digit of this string (digits are numbered starting with 1. Input Specification: The only line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the position of the digit you need to print. Output Specification: Print the *n*-th digit of the line. Demo Input: ['3\n', '11\n'] Demo Output: ['3\n', '0\n'] Note: In the first sample the digit at position 3 is '3', as both integers 1 and 2 consist on one digit. In the second sample, the digit at position 11 is '0', it belongs to the integer 10.
```python n = int(input()) cur = 0 s = '' for i in range(1, n + 1): s += str(i) if len(s) >= n: print(s[n - 1]) exit(0) ```
3
112
A
Petya and Strings
PROGRAMMING
800
[ "implementation", "strings" ]
A. Petya and Strings
2
256
Little Petya loves presents. His mum bought him two strings of the same size for his birthday. The strings consist of uppercase and lowercase Latin letters. Now Petya wants to compare those two strings lexicographically. The letters' case does not matter, that is an uppercase letter is considered equivalent to the corresponding lowercase letter. Help Petya perform the comparison.
Each of the first two lines contains a bought string. The strings' lengths range from 1 to 100 inclusive. It is guaranteed that the strings are of the same length and also consist of uppercase and lowercase Latin letters.
If the first string is less than the second one, print "-1". If the second string is less than the first one, print "1". If the strings are equal, print "0". Note that the letters' case is not taken into consideration when the strings are compared.
[ "aaaa\naaaA\n", "abs\nAbz\n", "abcdefg\nAbCdEfF\n" ]
[ "0\n", "-1\n", "1\n" ]
If you want more formal information about the lexicographical order (also known as the "dictionary order" or "alphabetical order"), you can visit the following site: - http://en.wikipedia.org/wiki/Lexicographical_order
500
[ { "input": "aaaa\naaaA", "output": "0" }, { "input": "abs\nAbz", "output": "-1" }, { "input": "abcdefg\nAbCdEfF", "output": "1" }, { "input": "asadasdasd\nasdwasdawd", "output": "-1" }, { "input": "aslkjlkasdd\nasdlkjdajwi", "output": "1" }, { "input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "output": "0" }, { "input": "aAaaaAAaAaaAzZsssSsdDfeEaeqZlpP\nAaaaAaaAaaAaZzSSSSsDdFeeAeQZLpp", "output": "0" }, { "input": "bwuEhEveouaTECagLZiqmUdxEmhRSOzMauJRWLQMppZOumxhAmwuGeDIkvkBLvMXwUoFmpAfDprBcFtEwOULcZWRQhcTbTbX\nHhoDWbcxwiMnCNexOsKsujLiSGcLllXOkRSbnOzThAjnnliLYFFmsYkOfpTxRNEfBsoUHfoLTiqAINRPxWRqrTJhgfkKcDOH", "output": "-1" }, { "input": "kGWUuguKzcvxqKTNpxeDWXpXkrXDvGMFGoXKDfPBZvWSDUyIYBynbKOUonHvmZaKeirUhfmVRKtGhAdBfKMWXDUoqvbfpfHYcg\ncvOULleuIIiYVVxcLZmHVpNGXuEpzcWZZWyMOwIwbpkKPwCfkVbKkUuosvxYCKjqfVmHfJKbdrsAcatPYgrCABaFcoBuOmMfFt", "output": "1" }, { "input": "nCeNVIzHqPceNhjHeHvJvgBsNFiXBATRrjSTXJzhLMDMxiJztphxBRlDlqwDFImWeEPkggZCXSRwelOdpNrYnTepiOqpvkr\nHJbjJFtlvNxIbkKlxQUwmZHJFVNMwPAPDRslIoXISBYHHfymyIaQHLgECPxAmqnOCizwXnIUBRmpYUBVPenoUKhCobKdOjL", "output": "1" }, { "input": "ttXjenUAlfixytHEOrPkgXmkKTSGYuyVXGIHYmWWYGlBYpHkujueqBSgjLguSgiMGJWATIGEUjjAjKXdMiVbHozZUmqQtFrT\nJziDBFBDmDJCcGqFsQwDFBYdOidLxxhBCtScznnDgnsiStlWFnEXQrJxqTXKPxZyIGfLIToETKWZBPUIBmLeImrlSBWCkTNo", "output": "1" }, { "input": "AjQhPqSVhwQQjcgCycjKorWBgFCRuQBwgdVuAPSMJAvTyxGVuFHjfJzkKfsmfhFbKqFrFIohSZBbpjgEHebezmVlGLTPSCTMf\nXhxWuSnMmKFrCUOwkTUmvKAfbTbHWzzOTzxJatLLCdlGnHVaBUnxDlsqpvjLHMThOPAFBggVKDyKBrZAmjnjrhHlrnSkyzBja", "output": "-1" }, { "input": "HCIgYtnqcMyjVngziNflxKHtdTmcRJhzMAjFAsNdWXFJYEhiTzsQUtFNkAbdrFBRmvLirkuirqTDvIpEfyiIqkrwsjvpPWTEdI\nErqiiWKsmIjyZuzgTlTqxYZwlrpvRyaVhRTOYUqtPMVGGtWOkDCOOQRKrkkRzPftyQCkYkzKkzTPqqXmeZhvvEEiEhkdOmoMvy", "output": "1" }, { "input": "mtBeJYILXcECGyEVSyzLFdQJbiVnnfkbsYYsdUJSIRmyzLfTTtFwIBmRLVnwcewIqcuydkcLpflHAFyDaToLiFMgeHvQorTVbI\nClLvyejznjbRfCDcrCzkLvqQaGzTjwmWONBdCctJAPJBcQrcYvHaSLQgPIJbmkFBhFzuQLBiRzAdNHulCjIAkBvZxxlkdzUWLR", "output": "1" }, { "input": "tjucSbGESVmVridTBjTmpVBCwwdWKBPeBvmgdxgIVLwQxveETnSdxkTVJpXoperWSgdpPMKNmwDiGeHfxnuqaDissgXPlMuNZIr\nHfjOOJhomqNIKHvqSgfySjlsWJQBuWYwhLQhlZYlpZwboMpoLoluGsBmhhlYgeIouwdkPfiaAIrkYRlxtiFazOPOllPsNZHcIZd", "output": "1" }, { "input": "AanbDfbZNlUodtBQlvPMyomStKNhgvSGhSbTdabxGFGGXCdpsJDimsAykKjfBDPMulkhBMsqLmVKLDoesHZsRAEEdEzqigueXInY\ncwfyjoppiJNrjrOLNZkqcGimrpTsiyFBVgMWEPXsMrxLJDDbtYzerXiFGuLBcQYitLdqhGHBpdjRnkUegmnwhGHAKXGyFtscWDSI", "output": "-1" }, { "input": "HRfxniwuJCaHOcaOVgjOGHXKrwxrDQxJpppeGDXnTAowyKbCsCQPbchCKeTWOcKbySSYnoaTJDnmRcyGPbfXJyZoPcARHBu\nxkLXvwkvGIWSQaFTznLOctUXNuzzBBOlqvzmVfTSejekTAlwidRrsxkbZTsGGeEWxCXHzqWVuLGoCyrGjKkQoHqduXwYQKC", "output": "-1" }, { "input": "OjYwwNuPESIazoyLFREpObIaMKhCaKAMWMfRGgucEuyNYRantwdwQkmflzfqbcFRaXBnZoIUGsFqXZHGKwlaBUXABBcQEWWPvkjW\nRxLqGcTTpBwHrHltCOllnTpRKLDofBUqqHxnOtVWPgvGaeHIevgUSOeeDOJubfqonFpVNGVbHFcAhjnyFvrrqnRgKhkYqQZmRfUl", "output": "-1" }, { "input": "tatuhQPIzjptlzzJpCAPXSRTKZRlwgfoCIsFjJquRoIDyZZYRSPdFUTjjUPhLBBfeEIfLQpygKXRcyQFiQsEtRtLnZErBqW\ntkHUjllbafLUWhVCnvblKjgYIEoHhsjVmrDBmAWbvtkHxDbRFvsXAjHIrujaDbYwOZmacknhZPeCcorbRgHjjgAgoJdjvLo", "output": "-1" }, { "input": "cymCPGqdXKUdADEWDdUaLEEMHiXHsdAZuDnJDMUvxvrLRBrPSDpXPAgMRoGplLtniFRTomDTAHXWAdgUveTxaqKVSvnOyhOwiRN\nuhmyEWzapiRNPFDisvHTbenXMfeZaHqOFlKjrfQjUBwdFktNpeiRoDWuBftZLcCZZAVfioOihZVNqiNCNDIsUdIhvbcaxpTRWoV", "output": "-1" }, { "input": "sSvpcITJAwghVfJaLKBmyjOkhltTGjYJVLWCYMFUomiJaKQYhXTajvZVHIMHbyckYROGQZzjWyWCcnmDmrkvTKfHSSzCIhsXgEZa\nvhCXkCwAmErGVBPBAnkSYEYvseFKbWSktoqaHYXUmYkHfOkRwuEyBRoGoBrOXBKVxXycjZGStuvDarnXMbZLWrbjrisDoJBdSvWJ", "output": "-1" }, { "input": "hJDANKUNBisOOINDsTixJmYgHNogtpwswwcvVMptfGwIjvqgwTYFcqTdyAqaqlnhOCMtsnWXQqtjFwQlEcBtMFAtSqnqthVb\nrNquIcjNWESjpPVWmzUJFrelpUZeGDmSvCurCqVmKHKVAAPkaHksniOlzjiKYIJtvbuQWZRufMebpTFPqyxIWWjfPaWYiNlK", "output": "-1" }, { "input": "ycLoapxsfsDTHMSfAAPIUpiEhQKUIXUcXEiopMBuuZLHtfPpLmCHwNMNQUwsEXxCEmKHTBSnKhtQhGWUvppUFZUgSpbeChX\ndCZhgVXofkGousCzObxZSJwXcHIaqUDSCPKzXntcVmPxtNcXmVcjsetZYxedmgQzXTZHMvzjoaXCMKsncGciSDqQWIIRlys", "output": "1" }, { "input": "nvUbnrywIePXcoukIhwTfUVcHUEgXcsMyNQhmMlTltZiCooyZiIKRIGVHMCnTKgzXXIuvoNDEZswKoACOBGSyVNqTNQqMhAG\nplxuGSsyyJjdvpddrSebOARSAYcZKEaKjqbCwvjhNykuaECoQVHTVFMKXwvrQXRaqXsHsBaGVhCxGRxNyGUbMlxOarMZNXxy", "output": "-1" }, { "input": "EncmXtAblQzcVRzMQqdDqXfAhXbtJKQwZVWyHoWUckohnZqfoCmNJDzexFgFJYrwNHGgzCJTzQQFnxGlhmvQTpicTkEeVICKac\nNIUNZoMLFMyAjVgQLITELJSodIXcGSDWfhFypRoGYuogJpnqGTotWxVqpvBHjFOWcDRDtARsaHarHaOkeNWEHGTaGOFCOFEwvK", "output": "-1" }, { "input": "UG\nak", "output": "1" }, { "input": "JZR\nVae", "output": "-1" }, { "input": "a\nZ", "output": "-1" }, { "input": "rk\nkv", "output": "1" }, { "input": "RvuT\nbJzE", "output": "1" }, { "input": "PPS\nydq", "output": "-1" }, { "input": "q\nq", "output": "0" }, { "input": "peOw\nIgSJ", "output": "1" }, { "input": "PyK\noKN", "output": "1" }, { "input": "O\ni", "output": "1" }, { "input": "NmGY\npDlP", "output": "-1" }, { "input": "nG\nZf", "output": "-1" }, { "input": "m\na", "output": "1" }, { "input": "MWyB\nWZEV", "output": "-1" }, { "input": "Gre\nfxc", "output": "1" }, { "input": "Ooq\nwap", "output": "-1" }, { "input": "XId\nlbB", "output": "1" }, { "input": "lfFpECEqUMEOJhipvkZjDPcpDNJedOVXiSMgBvBZbtfzIKekcvpWPCazKAhJyHircRtgcBIJwwstpHaLAgxFOngAWUZRgCef\nLfFPEcequmeojHIpVkzjDPcpdNJEDOVXiSmGBVBZBtfZikEKcvPwpCAzKAHJyHIrCRTgCbIJWwSTphALagXfOnGAwUzRGcEF", "output": "0" }, { "input": "DQBdtSEDtFGiNRUeJNbOIfDZnsryUlzJHGTXGFXnwsVyxNtLgmklmFvRCzYETBVdmkpJJIvIOkMDgCFHZOTODiYrkwXd\nDQbDtsEdTFginRUEJNBOIfdZnsryulZJHGtxGFxnwSvYxnTLgmKlmFVRCzyEtBVdmKpJjiVioKMDgCFhzoTODiYrKwXD", "output": "0" }, { "input": "tYWRijFQSzHBpCjUzqBtNvBKyzZRnIdWEuyqnORBQTLyOQglIGfYJIRjuxnbLvkqZakNqPiGDvgpWYkfxYNXsdoKXZtRkSasfa\nTYwRiJfqsZHBPcJuZQBTnVbkyZZRnidwEuYQnorbQTLYOqGligFyjirJUxnblVKqZaknQpigDVGPwyKfxyNXSDoKxztRKSaSFA", "output": "0" }, { "input": "KhScXYiErQIUtmVhNTCXSLAviefIeHIIdiGhsYnPkSBaDTvMkyanfMLBOvDWgRybLtDqvXVdVjccNunDyijhhZEAKBrdz\nkHsCXyiErqIuTMVHNTCxSLaViEFIEhIIDiGHsYNpKsBAdTvMKyANFMLBovdwGRYbLtdQVxvDVJCcNUndYiJHhzeakBrdZ", "output": "0" }, { "input": "cpPQMpjRQJKQVXjWDYECXbagSmNcVfOuBWNZxihdERraVuiOpSVDCPgTGuSQALNoVjySceHcKXwOEpSzXrEqWwwrYeppNiWhDVg\nCPPqmPjRqJkQvxJwdyECXBAGsMNcVfOuBWNzxIhderRavUiOpSvDCpGTgusqAlNovjyScEhCKXwoePSZxrEQwWwryEPPniWHDvG", "output": "0" }, { "input": "SajcCGMepaLjZIWLRBGFcrZRCRvvoCsIyKsQerbrwsIamxxpRmQSZSalasJLVFbCHCuXJlubciQAvLxXYBazLsMKLHLdDQ\nsaJcCgmEpaLJziWlrBgFcRzrCrVVOcSIykSQerBrwSIamxxPrMqSzSalASjLVFbChCUxjLUbCIQAVlxxybAZLsmkLhLDdQ", "output": "0" }, { "input": "kigPrWNTOUNDBskAfefjhHYZNYdnfZWuXWzHiBxFQryBbAkPtenFwWvCSTYGpzOntUNzNUhxRWjKmicTwLwJAnbAxj\nkigpRWntOUNdBsKaFEFjhhYZnYDNfzWuXwZhibxFQRybbakPteNfwwvcStyGPzoNTunznuHXrWjKMIctWLWJANBAxJ", "output": "0" }, { "input": "nTomZZuTTRTAAPoUsySVFGElrpQRNLjqvFmcYytiheQnjUhPLnqNBiYtQkljbcvmjuNAVKbvQOWpqqFlQhAhULIhquoCnjUI\nntOmzZuttrtAAPOUSySVFgeLRPQrNLjQvfmCyYTiHEQnjuHPlNQNbIYtqKLJBCVmjunavkbvQOWPQQFlqHaHULIHQuOcnJUi", "output": "0" }, { "input": "abac\nadaa", "output": "-1" }, { "input": "Bbc\nabc", "output": "1" }, { "input": "aaaba\naaaab", "output": "1" } ]
1,699,137,565
2,147,483,647
Python 3
OK
TESTS
53
92
0
str1 = input().lower() str2 = input().lower() if (str1 < str2): print(-1) elif (str1 > str2): print(1) else: print(0)
Title: Petya and Strings Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Little Petya loves presents. His mum bought him two strings of the same size for his birthday. The strings consist of uppercase and lowercase Latin letters. Now Petya wants to compare those two strings lexicographically. The letters' case does not matter, that is an uppercase letter is considered equivalent to the corresponding lowercase letter. Help Petya perform the comparison. Input Specification: Each of the first two lines contains a bought string. The strings' lengths range from 1 to 100 inclusive. It is guaranteed that the strings are of the same length and also consist of uppercase and lowercase Latin letters. Output Specification: If the first string is less than the second one, print "-1". If the second string is less than the first one, print "1". If the strings are equal, print "0". Note that the letters' case is not taken into consideration when the strings are compared. Demo Input: ['aaaa\naaaA\n', 'abs\nAbz\n', 'abcdefg\nAbCdEfF\n'] Demo Output: ['0\n', '-1\n', '1\n'] Note: If you want more formal information about the lexicographical order (also known as the "dictionary order" or "alphabetical order"), you can visit the following site: - http://en.wikipedia.org/wiki/Lexicographical_order
```python str1 = input().lower() str2 = input().lower() if (str1 < str2): print(-1) elif (str1 > str2): print(1) else: print(0) ```
3.977
313
A
Ilya and Bank Account
PROGRAMMING
900
[ "implementation", "number theory" ]
null
null
Ilya is a very clever lion, he lives in an unusual city ZooVille. In this city all the animals have their rights and obligations. Moreover, they even have their own bank accounts. The state of a bank account is an integer. The state of a bank account can be a negative number. This means that the owner of the account owes the bank money. Ilya the Lion has recently had a birthday, so he got a lot of gifts. One of them (the gift of the main ZooVille bank) is the opportunity to delete the last digit or the digit before last from the state of his bank account no more than once. For example, if the state of Ilya's bank account is -123, then Ilya can delete the last digit and get his account balance equal to -12, also he can remove its digit before last and get the account balance equal to -13. Of course, Ilya is permitted not to use the opportunity to delete a digit from the balance. Ilya is not very good at math, and that's why he asks you to help him maximize his bank account. Find the maximum state of the bank account that can be obtained using the bank's gift.
The single line contains integer *n* (10<=≤<=|*n*|<=≤<=109) — the state of Ilya's bank account.
In a single line print an integer — the maximum state of the bank account that Ilya can get.
[ "2230\n", "-10\n", "-100003\n" ]
[ "2230\n", "0\n", "-10000\n" ]
In the first test sample Ilya doesn't profit from using the present. In the second test sample you can delete digit 1 and get the state of the account equal to 0.
500
[ { "input": "2230", "output": "2230" }, { "input": "-10", "output": "0" }, { "input": "-100003", "output": "-10000" }, { "input": "544883178", "output": "544883178" }, { "input": "-847251738", "output": "-84725173" }, { "input": "423654797", "output": "423654797" }, { "input": "-623563697", "output": "-62356367" }, { "input": "645894116", "output": "645894116" }, { "input": "-384381709", "output": "-38438170" }, { "input": "437587210", "output": "437587210" }, { "input": "-297534606", "output": "-29753460" }, { "input": "891773002", "output": "891773002" }, { "input": "-56712976", "output": "-5671296" }, { "input": "963662765", "output": "963662765" }, { "input": "-272656295", "output": "-27265625" }, { "input": "383441522", "output": "383441522" }, { "input": "-477665112", "output": "-47766511" }, { "input": "791725034", "output": "791725034" }, { "input": "-812168727", "output": "-81216872" }, { "input": "528894922", "output": "528894922" }, { "input": "-479977172", "output": "-47997712" }, { "input": "568044564", "output": "568044564" }, { "input": "-392784794", "output": "-39278474" }, { "input": "925596634", "output": "925596634" }, { "input": "-836078769", "output": "-83607876" }, { "input": "71036059", "output": "71036059" }, { "input": "-337396162", "output": "-33739612" }, { "input": "87129297", "output": "87129297" }, { "input": "-648171877", "output": "-64817187" }, { "input": "20218400", "output": "20218400" }, { "input": "10", "output": "10" }, { "input": "1000000000", "output": "1000000000" }, { "input": "-1000000000", "output": "-100000000" }, { "input": "-102", "output": "-10" }, { "input": "-120", "output": "-10" }, { "input": "-20", "output": "0" }, { "input": "-15", "output": "-1" }, { "input": "-5575533", "output": "-557553" }, { "input": "-50", "output": "0" }, { "input": "-31", "output": "-1" }, { "input": "-55", "output": "-5" }, { "input": "-81", "output": "-1" }, { "input": "-99", "output": "-9" }, { "input": "-23", "output": "-2" }, { "input": "-41", "output": "-1" }, { "input": "-24", "output": "-2" }, { "input": "46", "output": "46" } ]
1,690,704,898
2,147,483,647
Python 3
OK
TESTS
47
92
0
def main(n): if n >= 0: return n a = ((-n) // 100) * 10 + (-n - ((-n) // 10) * 10) b = (-n) // 10 return max(-a, -b) if __name__ == "__main__": n = int(input()) print(main(n))
Title: Ilya and Bank Account Time Limit: None seconds Memory Limit: None megabytes Problem Description: Ilya is a very clever lion, he lives in an unusual city ZooVille. In this city all the animals have their rights and obligations. Moreover, they even have their own bank accounts. The state of a bank account is an integer. The state of a bank account can be a negative number. This means that the owner of the account owes the bank money. Ilya the Lion has recently had a birthday, so he got a lot of gifts. One of them (the gift of the main ZooVille bank) is the opportunity to delete the last digit or the digit before last from the state of his bank account no more than once. For example, if the state of Ilya's bank account is -123, then Ilya can delete the last digit and get his account balance equal to -12, also he can remove its digit before last and get the account balance equal to -13. Of course, Ilya is permitted not to use the opportunity to delete a digit from the balance. Ilya is not very good at math, and that's why he asks you to help him maximize his bank account. Find the maximum state of the bank account that can be obtained using the bank's gift. Input Specification: The single line contains integer *n* (10<=≤<=|*n*|<=≤<=109) — the state of Ilya's bank account. Output Specification: In a single line print an integer — the maximum state of the bank account that Ilya can get. Demo Input: ['2230\n', '-10\n', '-100003\n'] Demo Output: ['2230\n', '0\n', '-10000\n'] Note: In the first test sample Ilya doesn't profit from using the present. In the second test sample you can delete digit 1 and get the state of the account equal to 0.
```python def main(n): if n >= 0: return n a = ((-n) // 100) * 10 + (-n - ((-n) // 10) * 10) b = (-n) // 10 return max(-a, -b) if __name__ == "__main__": n = int(input()) print(main(n)) ```
3
484
A
Bits
PROGRAMMING
1,700
[ "bitmasks", "constructive algorithms" ]
null
null
Let's denote as the number of bits set ('1' bits) in the binary representation of the non-negative integer *x*. You are given multiple queries consisting of pairs of integers *l* and *r*. For each query, find the *x*, such that *l*<=≤<=*x*<=≤<=*r*, and is maximum possible. If there are multiple such numbers find the smallest of them.
The first line contains integer *n* — the number of queries (1<=≤<=*n*<=≤<=10000). Each of the following *n* lines contain two integers *l**i*,<=*r**i* — the arguments for the corresponding query (0<=≤<=*l**i*<=≤<=*r**i*<=≤<=1018).
For each query print the answer in a separate line.
[ "3\n1 2\n2 4\n1 10\n" ]
[ "1\n3\n7\n" ]
The binary representations of numbers from 1 to 10 are listed below: 1<sub class="lower-index">10</sub> = 1<sub class="lower-index">2</sub> 2<sub class="lower-index">10</sub> = 10<sub class="lower-index">2</sub> 3<sub class="lower-index">10</sub> = 11<sub class="lower-index">2</sub> 4<sub class="lower-index">10</sub> = 100<sub class="lower-index">2</sub> 5<sub class="lower-index">10</sub> = 101<sub class="lower-index">2</sub> 6<sub class="lower-index">10</sub> = 110<sub class="lower-index">2</sub> 7<sub class="lower-index">10</sub> = 111<sub class="lower-index">2</sub> 8<sub class="lower-index">10</sub> = 1000<sub class="lower-index">2</sub> 9<sub class="lower-index">10</sub> = 1001<sub class="lower-index">2</sub> 10<sub class="lower-index">10</sub> = 1010<sub class="lower-index">2</sub>
500
[ { "input": "3\n1 2\n2 4\n1 10", "output": "1\n3\n7" }, { "input": "55\n1 1\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n2 2\n2 3\n2 4\n2 5\n2 6\n2 7\n2 8\n2 9\n2 10\n3 3\n3 4\n3 5\n3 6\n3 7\n3 8\n3 9\n3 10\n4 4\n4 5\n4 6\n4 7\n4 8\n4 9\n4 10\n5 5\n5 6\n5 7\n5 8\n5 9\n5 10\n6 6\n6 7\n6 8\n6 9\n6 10\n7 7\n7 8\n7 9\n7 10\n8 8\n8 9\n8 10\n9 9\n9 10\n10 10", "output": "1\n1\n3\n3\n3\n3\n7\n7\n7\n7\n2\n3\n3\n3\n3\n7\n7\n7\n7\n3\n3\n3\n3\n7\n7\n7\n7\n4\n5\n5\n7\n7\n7\n7\n5\n5\n7\n7\n7\n7\n6\n7\n7\n7\n7\n7\n7\n7\n7\n8\n9\n9\n9\n9\n10" }, { "input": "18\n1 10\n1 100\n1 1000\n1 10000\n1 100000\n1 1000000\n1 10000000\n1 100000000\n1 1000000000\n1 10000000000\n1 100000000000\n1 1000000000000\n1 10000000000000\n1 100000000000000\n1 1000000000000000\n1 10000000000000000\n1 100000000000000000\n1 1000000000000000000", "output": "7\n63\n511\n8191\n65535\n524287\n8388607\n67108863\n536870911\n8589934591\n68719476735\n549755813887\n8796093022207\n70368744177663\n562949953421311\n9007199254740991\n72057594037927935\n576460752303423487" }, { "input": "3\n0 0\n1 3\n2 4", "output": "0\n3\n3" }, { "input": "17\n0 0\n0 8\n1 8\n36 39\n3 4\n3 7\n2 17\n8 12\n9 12\n10 12\n10 15\n6 14\n8 15\n9 15\n15 15\n100000000000000000 1000000000000000000\n99999999999999999 1000000000000000000", "output": "0\n7\n7\n39\n3\n7\n15\n11\n11\n11\n15\n7\n15\n15\n15\n576460752303423487\n576460752303423487" } ]
1,689,801,396
2,147,483,647
PyPy 3-64
OK
TESTS
27
217
7,884,800
t = int(input()) for _ in range(t): l, r = map(int, input().split()) while (l | (l + 1)) <= r: l |= l + 1 print(l)
Title: Bits Time Limit: None seconds Memory Limit: None megabytes Problem Description: Let's denote as the number of bits set ('1' bits) in the binary representation of the non-negative integer *x*. You are given multiple queries consisting of pairs of integers *l* and *r*. For each query, find the *x*, such that *l*<=≤<=*x*<=≤<=*r*, and is maximum possible. If there are multiple such numbers find the smallest of them. Input Specification: The first line contains integer *n* — the number of queries (1<=≤<=*n*<=≤<=10000). Each of the following *n* lines contain two integers *l**i*,<=*r**i* — the arguments for the corresponding query (0<=≤<=*l**i*<=≤<=*r**i*<=≤<=1018). Output Specification: For each query print the answer in a separate line. Demo Input: ['3\n1 2\n2 4\n1 10\n'] Demo Output: ['1\n3\n7\n'] Note: The binary representations of numbers from 1 to 10 are listed below: 1<sub class="lower-index">10</sub> = 1<sub class="lower-index">2</sub> 2<sub class="lower-index">10</sub> = 10<sub class="lower-index">2</sub> 3<sub class="lower-index">10</sub> = 11<sub class="lower-index">2</sub> 4<sub class="lower-index">10</sub> = 100<sub class="lower-index">2</sub> 5<sub class="lower-index">10</sub> = 101<sub class="lower-index">2</sub> 6<sub class="lower-index">10</sub> = 110<sub class="lower-index">2</sub> 7<sub class="lower-index">10</sub> = 111<sub class="lower-index">2</sub> 8<sub class="lower-index">10</sub> = 1000<sub class="lower-index">2</sub> 9<sub class="lower-index">10</sub> = 1001<sub class="lower-index">2</sub> 10<sub class="lower-index">10</sub> = 1010<sub class="lower-index">2</sub>
```python t = int(input()) for _ in range(t): l, r = map(int, input().split()) while (l | (l + 1)) <= r: l |= l + 1 print(l) ```
3
291
B
Command Line Arguments
PROGRAMMING
1,300
[ "*special", "implementation", "strings" ]
null
null
The problem describes the properties of a command line. The description somehow resembles the one you usually see in real operating systems. However, there are differences in the behavior. Please make sure you've read the statement attentively and use it as a formal document. In the Pindows operating system a strings are the lexemes of the command line — the first of them is understood as the name of the program to run and the following lexemes are its arguments. For example, as we execute the command " run.exe one, two . ", we give four lexemes to the Pindows command line: "run.exe", "one,", "two", ".". More formally, if we run a command that can be represented as string *s* (that has no quotes), then the command line lexemes are maximal by inclusion substrings of string *s* that contain no spaces. To send a string with spaces or an empty string as a command line lexeme, we can use double quotes. The block of characters that should be considered as one lexeme goes inside the quotes. Embedded quotes are prohibited — that is, for each occurrence of character """ we should be able to say clearly that the quotes are opening or closing. For example, as we run the command ""run.exe o" "" " ne, " two . " " ", we give six lexemes to the Pindows command line: "run.exe o", "" (an empty string), " ne, ", "two", ".", " " (a single space). It is guaranteed that each lexeme of the command line is either surrounded by spaces on both sides or touches the corresponding command border. One of its consequences is: the opening brackets are either the first character of the string or there is a space to the left of them. You have a string that consists of uppercase and lowercase English letters, digits, characters ".,?!"" and spaces. It is guaranteed that this string is a correct OS Pindows command line string. Print all lexemes of this command line string. Consider the character """ to be used only in order to denote a single block of characters into one command line lexeme. In particular, the consequence is that the given string has got an even number of such characters.
The single line contains a non-empty string *s*. String *s* consists of at most 105 characters. Each character is either an uppercase or a lowercase English letter, or a digit, or one of the ".,?!"" signs, or a space. It is guaranteed that the given string is some correct command line string of the OS Pindows. It is guaranteed that the given command line string contains at least one lexeme.
In the first line print the first lexeme, in the second line print the second one and so on. To make the output clearer, print the "&lt;" (less) character to the left of your lexemes and the "&gt;" (more) character to the right. Print the lexemes in the order in which they occur in the command. Please, follow the given output format strictly. For more clarifications on the output format see the test samples.
[ "\"RUn.exe O\" \"\" \" 2ne, \" two! . \" \"\n", "firstarg second \"\" \n" ]
[ "&lt;RUn.exe O&gt;\n&lt;&gt;\n&lt; 2ne, &gt;\n&lt;two!&gt;\n&lt;.&gt;\n&lt; &gt;\n", "&lt;firstarg&gt;\n&lt;second&gt;\n&lt;&gt;\n" ]
none
1,000
[ { "input": "\"RUn.exe O\" \"\" \" 2ne, \" two! . \" \"", "output": "<RUn.exe O>\n<>\n< 2ne, >\n<two!>\n<.>\n< >" }, { "input": " firstarg second \"\" ", "output": "<firstarg>\n<second>\n<>" }, { "input": " \" \" ", "output": "< >" }, { "input": " a \" \" a \"\" a ", "output": "<a>\n< >\n<a>\n<>\n<a>" }, { "input": "A", "output": "<A>" }, { "input": "\"\"", "output": "<>" }, { "input": "\" \"", "output": "< >" }, { "input": "\" \" \"wu\" \"\" \" \" \"\" \"\" \"\" ", "output": "< >\n<wu>\n<>\n< >\n<>\n<>\n<>" }, { "input": "\"7\" \"W \" \"\" \"\" \"a \" \"\" \"\" \"\" y ", "output": "<7>\n<W >\n<>\n<>\n<a >\n<>\n<>\n<>\n<y>" }, { "input": "\"\" \"\" \". \" \"A\" \"\" \"\" \"\" k \"\" ", "output": "<>\n<>\n<. >\n<A>\n<>\n<>\n<>\n<k>\n<>" }, { "input": " \"\" ZX \"\" \"\" \"b\" \"\" \" \" C \"\" \"\" \"\"", "output": "<>\n<ZX>\n<>\n<>\n<b>\n<>\n< >\n<C>\n<>\n<>\n<>" }, { "input": " \"\" N 3 \"\" \"4\" \"A\" \"k\" \" \" \"\" \"\" ", "output": "<>\n<N>\n<3>\n<>\n<4>\n<A>\n<k>\n< >\n<>\n<>" }, { "input": "B", "output": "<B>" }, { "input": "b ", "output": "<b>" }, { "input": "j ", "output": "<j>" }, { "input": " \"\"", "output": "<>" }, { "input": " Lii", "output": "<Lii>" }, { "input": " m Z \"\" \" p\"", "output": "<m>\n<Z>\n<>\n< p>" } ]
1,664,515,736
2,147,483,647
Python 3
OK
TESTS
30
686
1,638,400
import shlex inputString = input() result = shlex.split(inputString) for res in result: print("<{}>".format(res))
Title: Command Line Arguments Time Limit: None seconds Memory Limit: None megabytes Problem Description: The problem describes the properties of a command line. The description somehow resembles the one you usually see in real operating systems. However, there are differences in the behavior. Please make sure you've read the statement attentively and use it as a formal document. In the Pindows operating system a strings are the lexemes of the command line — the first of them is understood as the name of the program to run and the following lexemes are its arguments. For example, as we execute the command " run.exe one, two . ", we give four lexemes to the Pindows command line: "run.exe", "one,", "two", ".". More formally, if we run a command that can be represented as string *s* (that has no quotes), then the command line lexemes are maximal by inclusion substrings of string *s* that contain no spaces. To send a string with spaces or an empty string as a command line lexeme, we can use double quotes. The block of characters that should be considered as one lexeme goes inside the quotes. Embedded quotes are prohibited — that is, for each occurrence of character """ we should be able to say clearly that the quotes are opening or closing. For example, as we run the command ""run.exe o" "" " ne, " two . " " ", we give six lexemes to the Pindows command line: "run.exe o", "" (an empty string), " ne, ", "two", ".", " " (a single space). It is guaranteed that each lexeme of the command line is either surrounded by spaces on both sides or touches the corresponding command border. One of its consequences is: the opening brackets are either the first character of the string or there is a space to the left of them. You have a string that consists of uppercase and lowercase English letters, digits, characters ".,?!"" and spaces. It is guaranteed that this string is a correct OS Pindows command line string. Print all lexemes of this command line string. Consider the character """ to be used only in order to denote a single block of characters into one command line lexeme. In particular, the consequence is that the given string has got an even number of such characters. Input Specification: The single line contains a non-empty string *s*. String *s* consists of at most 105 characters. Each character is either an uppercase or a lowercase English letter, or a digit, or one of the ".,?!"" signs, or a space. It is guaranteed that the given string is some correct command line string of the OS Pindows. It is guaranteed that the given command line string contains at least one lexeme. Output Specification: In the first line print the first lexeme, in the second line print the second one and so on. To make the output clearer, print the "&lt;" (less) character to the left of your lexemes and the "&gt;" (more) character to the right. Print the lexemes in the order in which they occur in the command. Please, follow the given output format strictly. For more clarifications on the output format see the test samples. Demo Input: ['"RUn.exe O" "" " 2ne, " two! . " "\n', 'firstarg second "" \n'] Demo Output: ['&lt;RUn.exe O&gt;\n&lt;&gt;\n&lt; 2ne, &gt;\n&lt;two!&gt;\n&lt;.&gt;\n&lt; &gt;\n', '&lt;firstarg&gt;\n&lt;second&gt;\n&lt;&gt;\n'] Note: none
```python import shlex inputString = input() result = shlex.split(inputString) for res in result: print("<{}>".format(res)) ```
3
758
A
Holiday Of Equality
PROGRAMMING
800
[ "implementation", "math" ]
null
null
In Berland it is the holiday of equality. In honor of the holiday the king decided to equalize the welfare of all citizens in Berland by the expense of the state treasury. Totally in Berland there are *n* citizens, the welfare of each of them is estimated as the integer in *a**i* burles (burle is the currency in Berland). You are the royal treasurer, which needs to count the minimum charges of the kingdom on the king's present. The king can only give money, he hasn't a power to take away them.
The first line contains the integer *n* (1<=≤<=*n*<=≤<=100) — the number of citizens in the kingdom. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n*, where *a**i* (0<=≤<=*a**i*<=≤<=106) — the welfare of the *i*-th citizen.
In the only line print the integer *S* — the minimum number of burles which are had to spend.
[ "5\n0 1 2 3 4\n", "5\n1 1 0 1 1\n", "3\n1 3 1\n", "1\n12\n" ]
[ "10", "1", "4", "0" ]
In the first example if we add to the first citizen 4 burles, to the second 3, to the third 2 and to the fourth 1, then the welfare of all citizens will equal 4. In the second example it is enough to give one burle to the third citizen. In the third example it is necessary to give two burles to the first and the third citizens to make the welfare of citizens equal 3. In the fourth example it is possible to give nothing to everyone because all citizens have 12 burles.
500
[ { "input": "5\n0 1 2 3 4", "output": "10" }, { "input": "5\n1 1 0 1 1", "output": "1" }, { "input": "3\n1 3 1", "output": "4" }, { "input": "1\n12", "output": "0" }, { "input": "3\n1 2 3", "output": "3" }, { "input": "14\n52518 718438 358883 462189 853171 592966 225788 46977 814826 295697 676256 561479 56545 764281", "output": "5464380" }, { "input": "21\n842556 216391 427181 626688 775504 168309 851038 448402 880826 73697 593338 519033 135115 20128 424606 939484 846242 756907 377058 241543 29353", "output": "9535765" }, { "input": "3\n1 3 2", "output": "3" }, { "input": "3\n2 1 3", "output": "3" }, { "input": "3\n2 3 1", "output": "3" }, { "input": "3\n3 1 2", "output": "3" }, { "input": "3\n3 2 1", "output": "3" }, { "input": "1\n228503", "output": "0" }, { "input": "2\n32576 550340", "output": "517764" }, { "input": "3\n910648 542843 537125", "output": "741328" }, { "input": "4\n751720 572344 569387 893618", "output": "787403" }, { "input": "6\n433864 631347 597596 794426 713555 231193", "output": "1364575" }, { "input": "9\n31078 645168 695751 126111 375934 150495 838412 434477 993107", "output": "4647430" }, { "input": "30\n315421 772664 560686 654312 151528 356749 351486 707462 820089 226682 546700 136028 824236 842130 578079 337807 665903 764100 617900 822937 992759 591749 651310 742085 767695 695442 17967 515106 81059 186025", "output": "13488674" }, { "input": "45\n908719 394261 815134 419990 926993 383792 772842 277695 527137 655356 684956 695716 273062 550324 106247 399133 442382 33076 462920 294674 846052 817752 421365 474141 290471 358990 109812 74492 543281 169434 919692 786809 24028 197184 310029 801476 699355 429672 51343 374128 776726 850380 293868 981569 550763", "output": "21993384" }, { "input": "56\n100728 972537 13846 385421 756708 184642 259487 319707 376662 221694 675284 972837 499419 13846 38267 289898 901299 831197 954715 197515 514102 910423 127555 883934 362472 870788 538802 741008 973434 448124 391526 363321 947321 544618 68006 782313 955075 741981 815027 723297 585059 718114 700739 413489 454091 736144 308999 98065 3716 347323 9635 289003 986510 607065 60236 273351", "output": "26984185" }, { "input": "70\n644488 5444 150441 714420 602059 335330 510670 196555 546346 740011 509449 850947 692874 524857 750434 952985 223744 374727 896124 753037 367352 679050 560202 172728 569291 778616 332116 286927 843598 372698 244906 498046 900681 709791 420904 724593 864493 813094 791377 39998 296710 625656 403891 579231 706693 984045 16901 574259 562265 761104 930361 256045 124461 538980 573508 372148 988722 108592 784354 55302 232524 277205 782251 299943 436488 743389 324618 742543 266915 99642", "output": "32816391" }, { "input": "1\n0", "output": "0" }, { "input": "1\n1000000", "output": "0" }, { "input": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", "output": "0" }, { "input": "100\n1000000 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", "output": "99000000" }, { "input": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1000000", "output": "99000000" }, { "input": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1000000 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", "output": "99000000" }, { "input": "3\n0 0 0", "output": "0" }, { "input": "50\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "0" }, { "input": "3\n5 0 0", "output": "10" }, { "input": "5\n2 10 0 0 0", "output": "38" } ]
1,650,298,678
2,147,483,647
Python 3
OK
TESTS
41
46
0
num = int(input()) lista = list(map(int, input().split(' '))) m = max(lista) sum = 0 for num in lista: sum+= m-num print(sum)
Title: Holiday Of Equality Time Limit: None seconds Memory Limit: None megabytes Problem Description: In Berland it is the holiday of equality. In honor of the holiday the king decided to equalize the welfare of all citizens in Berland by the expense of the state treasury. Totally in Berland there are *n* citizens, the welfare of each of them is estimated as the integer in *a**i* burles (burle is the currency in Berland). You are the royal treasurer, which needs to count the minimum charges of the kingdom on the king's present. The king can only give money, he hasn't a power to take away them. Input Specification: The first line contains the integer *n* (1<=≤<=*n*<=≤<=100) — the number of citizens in the kingdom. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n*, where *a**i* (0<=≤<=*a**i*<=≤<=106) — the welfare of the *i*-th citizen. Output Specification: In the only line print the integer *S* — the minimum number of burles which are had to spend. Demo Input: ['5\n0 1 2 3 4\n', '5\n1 1 0 1 1\n', '3\n1 3 1\n', '1\n12\n'] Demo Output: ['10', '1', '4', '0'] Note: In the first example if we add to the first citizen 4 burles, to the second 3, to the third 2 and to the fourth 1, then the welfare of all citizens will equal 4. In the second example it is enough to give one burle to the third citizen. In the third example it is necessary to give two burles to the first and the third citizens to make the welfare of citizens equal 3. In the fourth example it is possible to give nothing to everyone because all citizens have 12 burles.
```python num = int(input()) lista = list(map(int, input().split(' '))) m = max(lista) sum = 0 for num in lista: sum+= m-num print(sum) ```
3
768
A
Oath of the Night's Watch
PROGRAMMING
900
[ "constructive algorithms", "sortings" ]
null
null
"Night gathers, and now my watch begins. It shall not end until my death. I shall take no wife, hold no lands, father no children. I shall wear no crowns and win no glory. I shall live and die at my post. I am the sword in the darkness. I am the watcher on the walls. I am the shield that guards the realms of men. I pledge my life and honor to the Night's Watch, for this night and all the nights to come." — The Night's Watch oath. With that begins the watch of Jon Snow. He is assigned the task to support the stewards. This time he has *n* stewards with him whom he has to provide support. Each steward has his own strength. Jon Snow likes to support a steward only if there exists at least one steward who has strength strictly less than him and at least one steward who has strength strictly greater than him. Can you find how many stewards will Jon support?
First line consists of a single integer *n* (1<=≤<=*n*<=≤<=105) — the number of stewards with Jon Snow. Second line consists of *n* space separated integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=109) representing the values assigned to the stewards.
Output a single integer representing the number of stewards which Jon will feed.
[ "2\n1 5\n", "3\n1 2 5\n" ]
[ "0", "1" ]
In the first sample, Jon Snow cannot support steward with strength 1 because there is no steward with strength less than 1 and he cannot support steward with strength 5 because there is no steward with strength greater than 5. In the second sample, Jon Snow can support steward with strength 2 because there are stewards with strength less than 2 and greater than 2.
500
[ { "input": "2\n1 5", "output": "0" }, { "input": "3\n1 2 5", "output": "1" }, { "input": "4\n1 2 3 4", "output": "2" }, { "input": "8\n7 8 9 4 5 6 1 2", "output": "6" }, { "input": "1\n1", "output": "0" }, { "input": "1\n100", "output": "0" }, { "input": "205\n5 5 3 3 6 2 9 3 8 9 6 6 10 8 1 5 3 3 1 2 9 9 9 3 9 10 3 9 8 3 5 6 6 4 6 9 2 9 10 9 5 6 6 7 4 2 6 3 4 1 10 1 7 2 7 7 3 2 6 5 5 2 9 3 8 8 7 6 6 4 2 2 6 2 3 5 7 2 2 10 1 4 6 9 2 3 7 2 2 7 4 4 9 10 7 5 8 6 5 3 6 10 2 7 5 6 6 8 3 3 9 4 3 5 7 9 3 2 1 1 3 2 1 9 3 1 4 4 10 2 5 5 8 1 4 8 5 3 1 10 8 6 5 8 3 5 4 5 4 4 6 7 2 8 10 8 7 6 6 9 6 7 1 10 3 2 5 10 4 4 5 4 3 4 8 5 3 8 10 3 10 9 7 2 1 8 6 4 6 5 8 10 2 6 7 4 9 4 5 1 8 7 10 3 1", "output": "174" }, { "input": "4\n1000000000 99999999 1000000000 1000000000", "output": "0" }, { "input": "3\n2 2 2", "output": "0" }, { "input": "5\n1 1 1 1 1", "output": "0" }, { "input": "3\n1 1 1", "output": "0" }, { "input": "6\n1 1 3 3 2 2", "output": "2" }, { "input": "7\n1 1 1 1 1 1 1", "output": "0" }, { "input": "4\n1 1 2 5", "output": "1" }, { "input": "3\n0 0 0", "output": "0" }, { "input": "5\n0 0 0 0 0", "output": "0" }, { "input": "5\n1 1 1 1 5", "output": "0" }, { "input": "5\n1 1 2 3 3", "output": "1" }, { "input": "3\n1 1 3", "output": "0" }, { "input": "3\n2 2 3", "output": "0" }, { "input": "1\n6", "output": "0" }, { "input": "5\n1 5 3 5 1", "output": "1" }, { "input": "7\n1 2 2 2 2 2 3", "output": "5" }, { "input": "4\n2 2 2 2", "output": "0" }, { "input": "9\n2 2 2 3 4 5 6 6 6", "output": "3" }, { "input": "10\n1 1 1 2 3 3 3 3 3 3", "output": "1" }, { "input": "6\n1 1 1 1 1 1", "output": "0" }, { "input": "3\n0 0 1", "output": "0" }, { "input": "9\n1 1 1 2 2 2 3 3 3", "output": "3" }, { "input": "3\n1 2 2", "output": "0" }, { "input": "6\n2 2 2 2 2 2", "output": "0" }, { "input": "5\n2 2 2 2 2", "output": "0" }, { "input": "5\n5 5 5 5 5", "output": "0" }, { "input": "1\n0", "output": "0" }, { "input": "6\n1 2 5 5 5 5", "output": "1" }, { "input": "5\n1 2 3 3 3", "output": "1" }, { "input": "3\n1 1 2", "output": "0" }, { "input": "6\n1 1 1 1 1 2", "output": "0" }, { "input": "5\n1 1 2 4 4", "output": "1" }, { "input": "3\n999999 5999999 9999999", "output": "1" }, { "input": "4\n1 1 5 5", "output": "0" }, { "input": "9\n1 1 1 2 2 2 4 4 4", "output": "3" }, { "input": "5\n1 3 4 5 1", "output": "2" }, { "input": "5\n3 3 3 3 3", "output": "0" }, { "input": "5\n1 1 2 2 2", "output": "0" }, { "input": "5\n2 1 1 1 3", "output": "1" }, { "input": "5\n0 0 0 1 2", "output": "1" }, { "input": "4\n2 2 2 3", "output": "0" }, { "input": "7\n1 1 1 1 5 5 5", "output": "0" }, { "input": "5\n1 2 3 4 4", "output": "2" }, { "input": "2\n5 4", "output": "0" }, { "input": "4\n5 5 5 5", "output": "0" }, { "input": "5\n1 1 1 5 5", "output": "0" }, { "input": "2\n1 1", "output": "0" }, { "input": "1\n3", "output": "0" }, { "input": "3\n2 1 2", "output": "0" }, { "input": "4\n1 2 2 2", "output": "0" }, { "input": "8\n1000000000 1000000000 1000000000 999999999 999999999 999999999 999999998 999999998", "output": "3" }, { "input": "5\n1 1 3 4 4", "output": "1" }, { "input": "6\n1 1 2 2 3 3", "output": "2" }, { "input": "4\n1 1 1 1", "output": "0" }, { "input": "9\n1 2 3 4 1 5 6 7 8", "output": "6" }, { "input": "8\n5 4 4 6 6 4 4 3", "output": "5" }, { "input": "8\n4 3 3 3 3 3 3 3", "output": "0" }, { "input": "7\n4 3 3 3 3 3 3", "output": "0" }, { "input": "6\n4 3 3 3 3 3", "output": "0" }, { "input": "5\n4 3 3 3 3", "output": "0" } ]
1,658,685,663
2,147,483,647
Python 3
OK
TESTS
88
139
9,113,600
n = int(input()) stewards = list(map(int, input().split())) stewards.sort() count = 0 for i in stewards: if i > stewards[0] and i < stewards[len(stewards)-1]: count += 1 print(count)
Title: Oath of the Night's Watch Time Limit: None seconds Memory Limit: None megabytes Problem Description: "Night gathers, and now my watch begins. It shall not end until my death. I shall take no wife, hold no lands, father no children. I shall wear no crowns and win no glory. I shall live and die at my post. I am the sword in the darkness. I am the watcher on the walls. I am the shield that guards the realms of men. I pledge my life and honor to the Night's Watch, for this night and all the nights to come." — The Night's Watch oath. With that begins the watch of Jon Snow. He is assigned the task to support the stewards. This time he has *n* stewards with him whom he has to provide support. Each steward has his own strength. Jon Snow likes to support a steward only if there exists at least one steward who has strength strictly less than him and at least one steward who has strength strictly greater than him. Can you find how many stewards will Jon support? Input Specification: First line consists of a single integer *n* (1<=≤<=*n*<=≤<=105) — the number of stewards with Jon Snow. Second line consists of *n* space separated integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=109) representing the values assigned to the stewards. Output Specification: Output a single integer representing the number of stewards which Jon will feed. Demo Input: ['2\n1 5\n', '3\n1 2 5\n'] Demo Output: ['0', '1'] Note: In the first sample, Jon Snow cannot support steward with strength 1 because there is no steward with strength less than 1 and he cannot support steward with strength 5 because there is no steward with strength greater than 5. In the second sample, Jon Snow can support steward with strength 2 because there are stewards with strength less than 2 and greater than 2.
```python n = int(input()) stewards = list(map(int, input().split())) stewards.sort() count = 0 for i in stewards: if i > stewards[0] and i < stewards[len(stewards)-1]: count += 1 print(count) ```
3
601
A
The Two Routes
PROGRAMMING
1,600
[ "graphs", "shortest paths" ]
null
null
In Absurdistan, there are *n* towns (numbered 1 through *n*) and *m* bidirectional railways. There is also an absurdly simple road network — for each pair of different towns *x* and *y*, there is a bidirectional road between towns *x* and *y* if and only if there is no railway between them. Travelling to a different town using one railway or one road always takes exactly one hour. A train and a bus leave town 1 at the same time. They both have the same destination, town *n*, and don't make any stops on the way (but they can wait in town *n*). The train can move only along railways and the bus can move only along roads. You've been asked to plan out routes for the vehicles; each route can use any road/railway multiple times. One of the most important aspects to consider is safety — in order to avoid accidents at railway crossings, the train and the bus must not arrive at the same town (except town *n*) simultaneously. Under these constraints, what is the minimum number of hours needed for both vehicles to reach town *n* (the maximum of arrival times of the bus and the train)? Note, that bus and train are not required to arrive to the town *n* at the same moment of time, but are allowed to do so.
The first line of the input contains two integers *n* and *m* (2<=≤<=*n*<=≤<=400, 0<=≤<=*m*<=≤<=*n*(*n*<=-<=1)<=/<=2) — the number of towns and the number of railways respectively. Each of the next *m* lines contains two integers *u* and *v*, denoting a railway between towns *u* and *v* (1<=≤<=*u*,<=*v*<=≤<=*n*, *u*<=≠<=*v*). You may assume that there is at most one railway connecting any two towns.
Output one integer — the smallest possible time of the later vehicle's arrival in town *n*. If it's impossible for at least one of the vehicles to reach town *n*, output <=-<=1.
[ "4 2\n1 3\n3 4\n", "4 6\n1 2\n1 3\n1 4\n2 3\n2 4\n3 4\n", "5 5\n4 2\n3 5\n4 5\n5 1\n1 2\n" ]
[ "2\n", "-1\n", "3\n" ]
In the first sample, the train can take the route <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/7c0aa60a06309ef607b7159fd7f3687ea0d943ce.png" style="max-width: 100.0%;max-height: 100.0%;"/> and the bus can take the route <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/a26c2f3e93c9d9be6c21cb5d2bd6ac1f99f4ff55.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Note that they can arrive at town 4 at the same time. In the second sample, Absurdistan is ruled by railwaymen. There are no roads, so there's no way for the bus to reach town 4.
500
[ { "input": "4 2\n1 3\n3 4", "output": "2" }, { "input": "4 6\n1 2\n1 3\n1 4\n2 3\n2 4\n3 4", "output": "-1" }, { "input": "5 5\n4 2\n3 5\n4 5\n5 1\n1 2", "output": "3" }, { "input": "5 4\n1 2\n3 2\n3 4\n5 4", "output": "4" }, { "input": "3 1\n1 2", "output": "-1" }, { "input": "2 1\n1 2", "output": "-1" }, { "input": "2 0", "output": "-1" }, { "input": "20 0", "output": "-1" }, { "input": "381 0", "output": "-1" }, { "input": "3 3\n1 2\n2 3\n3 1", "output": "-1" }, { "input": "3 0", "output": "-1" }, { "input": "3 1\n1 3", "output": "2" }, { "input": "3 2\n2 3\n3 1", "output": "-1" }, { "input": "4 1\n1 4", "output": "2" }, { "input": "4 5\n1 3\n2 1\n3 4\n4 2\n2 3", "output": "2" }, { "input": "20 1\n20 1", "output": "2" }, { "input": "21 1\n21 1", "output": "2" }, { "input": "100 1\n100 1", "output": "2" }, { "input": "400 1\n1 400", "output": "2" }, { "input": "5 5\n2 5\n1 2\n1 4\n1 3\n3 2", "output": "2" } ]
1,465,733,930
2,147,483,647
Python 3
OK
TESTS
59
358
5,939,200
n, m = map(int, input().split()) dp = [[0 for i in range(n + 1)] for j in range(n + 1)] level = [-1 for i in range(n + 1)] stack = [] def bfs(src, lvl, flag): level[src] = lvl stack.append(src) p = 0 while True: for i in range(1, n + 1): if dp[src][i] == flag: #print (i, i) if level[i] == -1: # print (i, i) stack.append(i) level[i] = level[src] + 1 if len(stack) <= p + 1: break p += 1 #print (stack) src = stack[p] if src == n: return level[src] break return -1 for i in range(m): a, b = map(int, input().split()) dp[a][b] = 1 dp[b][a] = 1 if dp[1][n]: print (bfs(1, 0, 0)) else: print (bfs(1, 0, 1))
Title: The Two Routes Time Limit: None seconds Memory Limit: None megabytes Problem Description: In Absurdistan, there are *n* towns (numbered 1 through *n*) and *m* bidirectional railways. There is also an absurdly simple road network — for each pair of different towns *x* and *y*, there is a bidirectional road between towns *x* and *y* if and only if there is no railway between them. Travelling to a different town using one railway or one road always takes exactly one hour. A train and a bus leave town 1 at the same time. They both have the same destination, town *n*, and don't make any stops on the way (but they can wait in town *n*). The train can move only along railways and the bus can move only along roads. You've been asked to plan out routes for the vehicles; each route can use any road/railway multiple times. One of the most important aspects to consider is safety — in order to avoid accidents at railway crossings, the train and the bus must not arrive at the same town (except town *n*) simultaneously. Under these constraints, what is the minimum number of hours needed for both vehicles to reach town *n* (the maximum of arrival times of the bus and the train)? Note, that bus and train are not required to arrive to the town *n* at the same moment of time, but are allowed to do so. Input Specification: The first line of the input contains two integers *n* and *m* (2<=≤<=*n*<=≤<=400, 0<=≤<=*m*<=≤<=*n*(*n*<=-<=1)<=/<=2) — the number of towns and the number of railways respectively. Each of the next *m* lines contains two integers *u* and *v*, denoting a railway between towns *u* and *v* (1<=≤<=*u*,<=*v*<=≤<=*n*, *u*<=≠<=*v*). You may assume that there is at most one railway connecting any two towns. Output Specification: Output one integer — the smallest possible time of the later vehicle's arrival in town *n*. If it's impossible for at least one of the vehicles to reach town *n*, output <=-<=1. Demo Input: ['4 2\n1 3\n3 4\n', '4 6\n1 2\n1 3\n1 4\n2 3\n2 4\n3 4\n', '5 5\n4 2\n3 5\n4 5\n5 1\n1 2\n'] Demo Output: ['2\n', '-1\n', '3\n'] Note: In the first sample, the train can take the route <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/7c0aa60a06309ef607b7159fd7f3687ea0d943ce.png" style="max-width: 100.0%;max-height: 100.0%;"/> and the bus can take the route <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/a26c2f3e93c9d9be6c21cb5d2bd6ac1f99f4ff55.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Note that they can arrive at town 4 at the same time. In the second sample, Absurdistan is ruled by railwaymen. There are no roads, so there's no way for the bus to reach town 4.
```python n, m = map(int, input().split()) dp = [[0 for i in range(n + 1)] for j in range(n + 1)] level = [-1 for i in range(n + 1)] stack = [] def bfs(src, lvl, flag): level[src] = lvl stack.append(src) p = 0 while True: for i in range(1, n + 1): if dp[src][i] == flag: #print (i, i) if level[i] == -1: # print (i, i) stack.append(i) level[i] = level[src] + 1 if len(stack) <= p + 1: break p += 1 #print (stack) src = stack[p] if src == n: return level[src] break return -1 for i in range(m): a, b = map(int, input().split()) dp[a][b] = 1 dp[b][a] = 1 if dp[1][n]: print (bfs(1, 0, 0)) else: print (bfs(1, 0, 1)) ```
3
41
A
Translation
PROGRAMMING
800
[ "implementation", "strings" ]
A. Translation
2
256
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
[ "code\nedoc\n", "abb\naba\n", "code\ncode\n" ]
[ "YES\n", "NO\n", "NO\n" ]
none
500
[ { "input": "code\nedoc", "output": "YES" }, { "input": "abb\naba", "output": "NO" }, { "input": "code\ncode", "output": "NO" }, { "input": "abacaba\nabacaba", "output": "YES" }, { "input": "q\nq", "output": "YES" }, { "input": "asrgdfngfnmfgnhweratgjkk\nasrgdfngfnmfgnhweratgjkk", "output": "NO" }, { "input": "z\na", "output": "NO" }, { "input": "asd\ndsa", "output": "YES" }, { "input": "abcdef\nfecdba", "output": "NO" }, { "input": "ywjjbirapvskozubvxoemscfwl\ngnduubaogtfaiowjizlvjcu", "output": "NO" }, { "input": "mfrmqxtzvgaeuleubcmcxcfqyruwzenguhgrmkuhdgnhgtgkdszwqyd\nmfxufheiperjnhyczclkmzyhcxntdfskzkzdwzzujdinf", "output": "NO" }, { "input": "bnbnemvybqizywlnghlykniaxxxlkhftppbdeqpesrtgkcpoeqowjwhrylpsziiwcldodcoonpimudvrxejjo\ntiynnekmlalogyvrgptbinkoqdwzuiyjlrldxhzjmmp", "output": "NO" }, { "input": "pwlpubwyhzqvcitemnhvvwkmwcaawjvdiwtoxyhbhbxerlypelevasmelpfqwjk\nstruuzebbcenziscuoecywugxncdwzyfozhljjyizpqcgkyonyetarcpwkqhuugsqjuixsxptmbnlfupdcfigacdhhrzb", "output": "NO" }, { "input": "gdvqjoyxnkypfvdxssgrihnwxkeojmnpdeobpecytkbdwujqfjtxsqspxvxpqioyfagzjxupqqzpgnpnpxcuipweunqch\nkkqkiwwasbhezqcfeceyngcyuogrkhqecwsyerdniqiocjehrpkljiljophqhyaiefjpavoom", "output": "NO" }, { "input": "umeszdawsvgkjhlqwzents\nhxqhdungbylhnikwviuh", "output": "NO" }, { "input": "juotpscvyfmgntshcealgbsrwwksgrwnrrbyaqqsxdlzhkbugdyx\nibqvffmfktyipgiopznsqtrtxiijntdbgyy", "output": "NO" }, { "input": "zbwueheveouatecaglziqmudxemhrsozmaujrwlqmppzoumxhamwugedikvkblvmxwuofmpafdprbcftew\nulczwrqhctbtbxrhhodwbcxwimncnexosksujlisgclllxokrsbnozthajnnlilyffmsyko", "output": "NO" }, { "input": "nkgwuugukzcv\nqktnpxedwxpxkrxdvgmfgoxkdfpbzvwsduyiybynbkouonhvmzakeiruhfmvrktghadbfkmwxduoqv", "output": "NO" }, { "input": "incenvizhqpcenhjhehvjvgbsnfixbatrrjstxjzhlmdmxijztphxbrldlqwdfimweepkggzcxsrwelodpnryntepioqpvk\ndhjbjjftlvnxibkklxquwmzhjfvnmwpapdrslioxisbyhhfymyiaqhlgecpxamqnocizwxniubrmpyubvpenoukhcobkdojlybxd", "output": "NO" }, { "input": "w\nw", "output": "YES" }, { "input": "vz\nzv", "output": "YES" }, { "input": "ry\nyr", "output": "YES" }, { "input": "xou\nuox", "output": "YES" }, { "input": "axg\ngax", "output": "NO" }, { "input": "zdsl\nlsdz", "output": "YES" }, { "input": "kudl\nldku", "output": "NO" }, { "input": "zzlzwnqlcl\nlclqnwzlzz", "output": "YES" }, { "input": "vzzgicnzqooejpjzads\nsdazjpjeooqzncigzzv", "output": "YES" }, { "input": "raqhmvmzuwaykjpyxsykr\nxkysrypjkyawuzmvmhqar", "output": "NO" }, { "input": "ngedczubzdcqbxksnxuavdjaqtmdwncjnoaicvmodcqvhfezew\nwezefhvqcdomvciaonjcnwdmtqajdvauxnskxbqcdzbuzcdegn", "output": "YES" }, { "input": "muooqttvrrljcxbroizkymuidvfmhhsjtumksdkcbwwpfqdyvxtrlymofendqvznzlmim\nmimlznzvqdnefomylrtxvydqfpwwbckdskmutjshhmfvdiumykziorbxcjlrrvttqooum", "output": "YES" }, { "input": "vxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaivg\ngviayyikkitmuomcpiakhbxszgbnhvwyzkftwoagzixaearxpjacrnvpvbuzenvovehkmmxvblqyxvctroddksdsgebcmlluqpxv", "output": "YES" }, { "input": "mnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfdc\ncdfmkdgrdptkpewbsqvszipgxvgvuiuzbkkwuowbafkikgvnqdkxnayzdjygvezmtsgywnupocdntipiyiorblqkrzjpzatxahnm", "output": "NO" }, { "input": "dgxmzbqofstzcdgthbaewbwocowvhqpinehpjatnnbrijcolvsatbblsrxabzrpszoiecpwhfjmwuhqrapvtcgvikuxtzbftydkw\nwkdytfbztxukivgctvparqhuwmjfhwpceiozsprzbaxrslbbqasvlocjirbnntajphenipthvwocowbweabhtgdcztsfoqbzmxgd", "output": "NO" }, { "input": "gxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwgeh\nhegwxvocotmzstqfbmpjvijgkcyodlxyjawrpkczpmdspsuhoiruavnnnuwvtwohglkdxjetshkboalvzqbgjgthoteceixioxg", "output": "YES" }, { "input": "sihxuwvmaambplxvjfoskinghzicyfqebjtkysotattkahssumfcgrkheotdxwjckpvapbkaepqrxseyfrwtyaycmrzsrsngkh\nhkgnsrszrmcyaytwrfyesxrqpeakbpavpkcjwxdtoehkrgcfmusshakttatosyktjbeqfycizhgniksofjvxlpbmaamvwuxhis", "output": "YES" }, { "input": "ycnahksbughnonldzrhkysujmylcgcfuludjvjiahtkyzqvkopzqcnwhltbzfugzojqkjjlggmvnultascmygelkiktmfieok\nkoeifmtkiklegkmcsatlunvmggkjjlqjozgufzbtlhwncqzpokvqzykthaijvjdulufcgclymjusyyhrzdlnonhgubskhancy", "output": "NO" }, { "input": "wbqasaehtkfojruzyhrlgwmtyiovmzyfifslvlemhqheyaelzwnthrenjsbmntwaoryzwfbxmscmypvxlfmzpnkkjlvwvmtz\nztmvwvljkknpzmflxvpymcsmxbfwzyroawtnmbsjnerhtnwzleayehqhmelvlsfifyzmvoiytmwglrhyzurjofktheasaqbw", "output": "YES" }, { "input": "imippqurprbhfugngtgifelytadegwrgaefnfhbjjnmzikvjaccotqzemufqieqldgnbmviisgkynzeldlhqxuqphjfmyij\njiymfjhpquxqhldleznykgsiivmbngdlqeiqfumezqtoccajvkizmnjjbhfnfeagrwgedatylefigtgngufhbrpruqppimi", "output": "YES" }, { "input": "bikydffiuisckpvzqlteqfhegsagimodb\nbdomigasgehfqetlqzvpkcsiuiffdykib", "output": "YES" } ]
1,656,797,388
2,147,483,647
Python 3
OK
TESTS
40
92
0
s=input() t=input() if (len(s) != len(t)): print("NO") quit() for i in range(len(s)): if s[i] != t[len(s) - i - 1]: print("NO") quit() print("YES")
Title: Translation Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly. Input Specification: The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols. Output Specification: If the word *t* is a word *s*, written reversely, print YES, otherwise print NO. Demo Input: ['code\nedoc\n', 'abb\naba\n', 'code\ncode\n'] Demo Output: ['YES\n', 'NO\n', 'NO\n'] Note: none
```python s=input() t=input() if (len(s) != len(t)): print("NO") quit() for i in range(len(s)): if s[i] != t[len(s) - i - 1]: print("NO") quit() print("YES") ```
3.977
1,003
A
Polycarp's Pockets
PROGRAMMING
800
[ "implementation" ]
null
null
Polycarp has $n$ coins, the value of the $i$-th coin is $a_i$. Polycarp wants to distribute all the coins between his pockets, but he cannot put two coins with the same value into the same pocket. For example, if Polycarp has got six coins represented as an array $a = [1, 2, 4, 3, 3, 2]$, he can distribute the coins into two pockets as follows: $[1, 2, 3], [2, 3, 4]$. Polycarp wants to distribute all the coins with the minimum number of used pockets. Help him to do that.
The first line of the input contains one integer $n$ ($1 \le n \le 100$) — the number of coins. The second line of the input contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$) — values of coins.
Print only one integer — the minimum number of pockets Polycarp needs to distribute all the coins so no two coins with the same value are put into the same pocket.
[ "6\n1 2 4 3 3 2\n", "1\n100\n" ]
[ "2\n", "1\n" ]
none
0
[ { "input": "6\n1 2 4 3 3 2", "output": "2" }, { "input": "1\n100", "output": "1" }, { "input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100", "output": "100" }, { "input": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "100" }, { "input": "100\n59 47 39 47 47 71 47 28 58 47 35 79 58 47 38 47 47 47 47 27 47 43 29 95 47 49 46 71 47 74 79 47 47 32 45 67 47 47 30 37 47 47 16 67 22 76 47 86 84 10 5 47 47 47 47 47 1 51 47 54 47 8 47 47 9 47 47 47 47 28 47 47 26 47 47 47 47 47 47 92 47 47 77 47 47 24 45 47 10 47 47 89 47 27 47 89 47 67 24 71", "output": "51" }, { "input": "100\n45 99 10 27 16 85 39 38 17 32 15 23 67 48 50 97 42 70 62 30 44 81 64 73 34 22 46 5 83 52 58 60 33 74 47 88 18 61 78 53 25 95 94 31 3 75 1 57 20 54 59 9 68 7 77 43 21 87 86 24 4 80 11 49 2 72 36 84 71 8 65 55 79 100 41 14 35 89 66 69 93 37 56 82 90 91 51 19 26 92 6 96 13 98 12 28 76 40 63 29", "output": "1" }, { "input": "100\n45 29 5 2 6 50 22 36 14 15 9 48 46 20 8 37 7 47 12 50 21 38 18 27 33 19 40 10 5 49 38 42 34 37 27 30 35 24 10 3 40 49 41 3 4 44 13 25 28 31 46 36 23 1 1 23 7 22 35 26 21 16 48 42 32 8 11 16 34 11 39 32 47 28 43 41 39 4 14 19 26 45 13 18 15 25 2 44 17 29 17 33 43 6 12 30 9 20 31 24", "output": "2" }, { "input": "50\n7 7 3 3 7 4 5 6 4 3 7 5 6 4 5 4 4 5 6 7 7 7 4 5 5 5 3 7 6 3 4 6 3 6 4 4 5 4 6 6 3 5 6 3 5 3 3 7 7 6", "output": "10" }, { "input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 99 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100", "output": "99" }, { "input": "7\n1 2 3 3 3 1 2", "output": "3" }, { "input": "5\n1 2 3 4 5", "output": "1" }, { "input": "7\n1 2 3 4 5 6 7", "output": "1" }, { "input": "8\n1 2 3 4 5 6 7 8", "output": "1" }, { "input": "9\n1 2 3 4 5 6 7 8 9", "output": "1" }, { "input": "10\n1 2 3 4 5 6 7 8 9 10", "output": "1" }, { "input": "3\n2 1 1", "output": "2" }, { "input": "11\n1 2 3 4 5 6 7 8 9 1 1", "output": "3" }, { "input": "12\n1 2 1 1 1 1 1 1 1 1 1 1", "output": "11" }, { "input": "13\n1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "13" }, { "input": "14\n1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "14" }, { "input": "15\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "15" }, { "input": "16\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "16" }, { "input": "3\n1 1 1", "output": "3" }, { "input": "3\n1 2 3", "output": "1" }, { "input": "10\n1 1 1 1 2 2 1 1 9 10", "output": "6" }, { "input": "2\n1 1", "output": "2" }, { "input": "56\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "56" }, { "input": "99\n35 96 73 72 70 83 22 93 98 75 45 32 81 82 45 54 25 7 53 72 29 2 94 19 21 98 34 28 39 99 55 85 44 23 6 47 98 2 33 34 19 57 49 35 67 4 60 4 4 23 55 6 57 66 16 68 34 45 84 79 48 63 4 9 46 88 98 13 19 27 83 12 4 63 57 22 44 77 44 62 28 52 44 64 9 24 55 22 48 4 2 9 80 76 45 1 56 22 92", "output": "6" }, { "input": "10\n1 2 2 3 3 3 4 4 4 4", "output": "4" }, { "input": "99\n97 44 33 56 42 10 61 85 64 26 40 39 82 34 75 9 51 51 39 73 58 38 74 31 13 99 58 1 28 89 76 19 52 7 40 56 12 27 72 72 67 75 62 46 22 55 35 16 18 39 60 63 92 42 85 69 34 61 73 50 57 95 30 4 45 63 76 58 32 35 48 81 10 78 95 79 55 97 21 21 22 94 30 17 78 57 89 93 100 44 16 89 68 55 19 46 42 73 21", "output": "3" }, { "input": "5\n5 5 5 5 1", "output": "4" }, { "input": "6\n2 3 2 5 2 6", "output": "3" }, { "input": "3\n58 59 58", "output": "2" }, { "input": "9\n1 2 3 4 5 6 7 8 8", "output": "2" }, { "input": "97\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "97" }, { "input": "3\n95 95 4", "output": "2" }, { "input": "3\n2 2 5", "output": "2" } ]
1,630,663,323
2,147,483,647
Python 3
OK
TESTS
37
62
6,758,400
n = int(input()) array = list(map(int, input().split())) hash_map = {} for x in array: if x not in hash_map: hash_map[x] = 1 else: hash_map[x] += 1 print(max(hash_map.values()))
Title: Polycarp's Pockets Time Limit: None seconds Memory Limit: None megabytes Problem Description: Polycarp has $n$ coins, the value of the $i$-th coin is $a_i$. Polycarp wants to distribute all the coins between his pockets, but he cannot put two coins with the same value into the same pocket. For example, if Polycarp has got six coins represented as an array $a = [1, 2, 4, 3, 3, 2]$, he can distribute the coins into two pockets as follows: $[1, 2, 3], [2, 3, 4]$. Polycarp wants to distribute all the coins with the minimum number of used pockets. Help him to do that. Input Specification: The first line of the input contains one integer $n$ ($1 \le n \le 100$) — the number of coins. The second line of the input contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$) — values of coins. Output Specification: Print only one integer — the minimum number of pockets Polycarp needs to distribute all the coins so no two coins with the same value are put into the same pocket. Demo Input: ['6\n1 2 4 3 3 2\n', '1\n100\n'] Demo Output: ['2\n', '1\n'] Note: none
```python n = int(input()) array = list(map(int, input().split())) hash_map = {} for x in array: if x not in hash_map: hash_map[x] = 1 else: hash_map[x] += 1 print(max(hash_map.values())) ```
3
381
A
Sereja and Dima
PROGRAMMING
800
[ "greedy", "implementation", "two pointers" ]
null
null
Sereja and Dima play a game. The rules of the game are very simple. The players have *n* cards in a row. Each card contains a number, all numbers on the cards are distinct. The players take turns, Sereja moves first. During his turn a player can take one card: either the leftmost card in a row, or the rightmost one. The game ends when there is no more cards. The player who has the maximum sum of numbers on his cards by the end of the game, wins. Sereja and Dima are being greedy. Each of them chooses the card with the larger number during his move. Inna is a friend of Sereja and Dima. She knows which strategy the guys are using, so she wants to determine the final score, given the initial state of the game. Help her.
The first line contains integer *n* (1<=≤<=*n*<=≤<=1000) — the number of cards on the table. The second line contains space-separated numbers on the cards from left to right. The numbers on the cards are distinct integers from 1 to 1000.
On a single line, print two integers. The first number is the number of Sereja's points at the end of the game, the second number is the number of Dima's points at the end of the game.
[ "4\n4 1 2 10\n", "7\n1 2 3 4 5 6 7\n" ]
[ "12 5\n", "16 12\n" ]
In the first sample Sereja will take cards with numbers 10 and 2, so Sereja's sum is 12. Dima will take cards with numbers 4 and 1, so Dima's sum is 5.
500
[ { "input": "4\n4 1 2 10", "output": "12 5" }, { "input": "7\n1 2 3 4 5 6 7", "output": "16 12" }, { "input": "42\n15 29 37 22 16 5 26 31 6 32 19 3 45 36 33 14 25 20 48 7 42 11 24 28 9 18 8 21 47 17 38 40 44 4 35 1 43 39 41 27 12 13", "output": "613 418" }, { "input": "43\n32 1 15 48 38 26 25 14 20 44 11 30 3 42 49 19 18 46 5 45 10 23 34 9 29 41 2 52 6 17 35 4 50 22 33 51 7 28 47 13 39 37 24", "output": "644 500" }, { "input": "1\n3", "output": "3 0" }, { "input": "45\n553 40 94 225 415 471 126 190 647 394 515 303 189 159 308 6 139 132 326 78 455 75 85 295 135 613 360 614 351 228 578 259 258 591 444 29 33 463 561 174 368 183 140 168 646", "output": "6848 6568" }, { "input": "44\n849 373 112 307 479 608 856 769 526 82 168 143 573 762 115 501 688 36 214 450 396 496 236 309 287 786 397 43 811 141 745 846 350 270 276 677 420 459 403 722 267 54 394 727", "output": "9562 9561" }, { "input": "35\n10 15 18 1 28 16 2 33 6 22 23 4 9 25 35 8 7 26 3 20 30 14 31 19 27 32 11 5 29 24 21 34 13 17 12", "output": "315 315" }, { "input": "17\n580 376 191 496 73 44 520 357 483 149 81 178 514 300 216 598 304", "output": "3238 2222" }, { "input": "30\n334 443 223 424 168 549 189 303 429 559 516 220 459 134 344 346 316 446 209 148 487 526 69 286 102 366 518 280 392 325", "output": "5246 4864" }, { "input": "95\n122 29 188 265 292 287 183 225 222 187 155 256 64 148 173 278 218 136 290 17 31 130 2 87 57 283 255 280 68 166 174 142 102 39 116 206 288 154 26 78 296 172 184 232 77 91 277 8 249 186 94 93 207 251 257 195 101 299 193 124 293 65 58 35 24 302 220 189 252 125 27 284 247 182 141 103 198 97 234 83 281 216 85 180 267 236 109 143 149 239 79 300 191 244 71", "output": "8147 7807" }, { "input": "1\n1", "output": "1 0" } ]
1,674,643,025
2,147,483,647
Python 3
OK
TESTS
34
46
0
cards=int(input()) nums=[int(x) for x in input().split()] s,d,=0,0 l,r=0,cards-1 state='s' while(l<=r): if state=='s': if nums[l]>nums[r]: s+=nums[l] l+=1 else: s+=nums[r] r-=1 state='d' else: if nums[l]>nums[r]: d+=nums[l] l+=1 else: d+=nums[r] r-=1 state='s' print(f"{s} {d}")
Title: Sereja and Dima Time Limit: None seconds Memory Limit: None megabytes Problem Description: Sereja and Dima play a game. The rules of the game are very simple. The players have *n* cards in a row. Each card contains a number, all numbers on the cards are distinct. The players take turns, Sereja moves first. During his turn a player can take one card: either the leftmost card in a row, or the rightmost one. The game ends when there is no more cards. The player who has the maximum sum of numbers on his cards by the end of the game, wins. Sereja and Dima are being greedy. Each of them chooses the card with the larger number during his move. Inna is a friend of Sereja and Dima. She knows which strategy the guys are using, so she wants to determine the final score, given the initial state of the game. Help her. Input Specification: The first line contains integer *n* (1<=≤<=*n*<=≤<=1000) — the number of cards on the table. The second line contains space-separated numbers on the cards from left to right. The numbers on the cards are distinct integers from 1 to 1000. Output Specification: On a single line, print two integers. The first number is the number of Sereja's points at the end of the game, the second number is the number of Dima's points at the end of the game. Demo Input: ['4\n4 1 2 10\n', '7\n1 2 3 4 5 6 7\n'] Demo Output: ['12 5\n', '16 12\n'] Note: In the first sample Sereja will take cards with numbers 10 and 2, so Sereja's sum is 12. Dima will take cards with numbers 4 and 1, so Dima's sum is 5.
```python cards=int(input()) nums=[int(x) for x in input().split()] s,d,=0,0 l,r=0,cards-1 state='s' while(l<=r): if state=='s': if nums[l]>nums[r]: s+=nums[l] l+=1 else: s+=nums[r] r-=1 state='d' else: if nums[l]>nums[r]: d+=nums[l] l+=1 else: d+=nums[r] r-=1 state='s' print(f"{s} {d}") ```
3
265
A
Colorful Stones (Simplified Edition)
PROGRAMMING
800
[ "implementation" ]
null
null
There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively. Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times. Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move. You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction. Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence.
The input contains two lines. The first line contains the string *s* (1<=≤<=|*s*|<=≤<=50). The second line contains the string *t* (1<=≤<=|*t*|<=≤<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence.
Print the final 1-based position of Liss in a single line.
[ "RGB\nRRR\n", "RRRBGBRBBB\nBBBRR\n", "BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n" ]
[ "2\n", "3\n", "15\n" ]
none
500
[ { "input": "RGB\nRRR", "output": "2" }, { "input": "RRRBGBRBBB\nBBBRR", "output": "3" }, { "input": "BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB", "output": "15" }, { "input": "G\nRRBBRBRRBR", "output": "1" }, { "input": "RRRRRBRRBRRGRBGGRRRGRBBRBBBBBRGRBGBRRGBBBRBBGBRGBB\nB", "output": "1" }, { "input": "RRGGBRGRBG\nBRRGGBBGGR", "output": "7" }, { "input": "BBRRGBGGRGBRGBRBRBGR\nGGGRBGGGBRRRRGRBGBGRGRRBGRBGBG", "output": "15" }, { "input": "GBRRBGBGBBBBRRRGBGRRRGBGBBBRGR\nRRGBRRGRBBBBBBGRRBBR", "output": "8" }, { "input": "BRGRRGRGRRGBBGBBBRRBBRRBGBBGRGBBGGRGBRBGGGRRRBGGBB\nRGBBGRRBBBRRGRRBRBBRGBBGGGRGBGRRRRBRBGGBRBGGGRGBRR", "output": "16" }, { "input": "GGRGGBRRGRGBRRGGRBBGGRRGBBBGBBBGGRBGGBRBBRGBRRRBRG\nGGRGRRRRRRRRRGBBBBRGBRGRGRRGBBRGGBRBBRBGBRGRRRRGGR", "output": "18" }, { "input": "RBBRBGBBGGGBRRBGBRGRRGGRBBBBGRBGGBRRBGBBRBRGBBGGGG\nBRRGRBGRBGBRGBRBGGBBBGBBRGRBGRGRBGRBGGRRBGBRGRRBBG", "output": "23" }, { "input": "RRGGRRBRGRGBRGBRGBBRGGGBRBGBRGBRGGBRBRGBGRRBBGGRBR\nBRGRBBBGRBGRRGGRRRRRRRRGGGGGGGGBGGGGGGGRGRBBRGRGBR", "output": "14" }, { "input": "RBRBRRRRRGGR\nBBBBRRGGBGRBRGBBRGGGRGGBRRBRBRBGGG", "output": "12" }, { "input": "GGRGGGBRGRGRBBRGGGRBGRRR\nGBBBBGBGBGBBBRGGRGGBGRRGRRRGBGB", "output": "12" }, { "input": "RGRBGBRBBGBRRGGGBBGBRRBGRGBBBBBGRRRGGRBB\nBGR", "output": "2" }, { "input": "R\nB", "output": "1" }, { "input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR", "output": "50" }, { "input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG", "output": "1" }, { "input": "R\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG", "output": "1" } ]
1,687,186,181
2,147,483,647
Python 3
OK
TESTS
19
92
0
s = input() t = input() position = 1 for instruction in t: if instruction == s[position - 1]: position += 1 print(position)
Title: Colorful Stones (Simplified Edition) Time Limit: None seconds Memory Limit: None megabytes Problem Description: There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively. Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times. Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move. You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction. Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence. Input Specification: The input contains two lines. The first line contains the string *s* (1<=≤<=|*s*|<=≤<=50). The second line contains the string *t* (1<=≤<=|*t*|<=≤<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence. Output Specification: Print the final 1-based position of Liss in a single line. Demo Input: ['RGB\nRRR\n', 'RRRBGBRBBB\nBBBRR\n', 'BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n'] Demo Output: ['2\n', '3\n', '15\n'] Note: none
```python s = input() t = input() position = 1 for instruction in t: if instruction == s[position - 1]: position += 1 print(position) ```
3
25
A
IQ test
PROGRAMMING
1,300
[ "brute force" ]
A. IQ test
2
256
Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness.
The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness.
Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order.
[ "5\n2 4 7 8 10\n", "4\n1 2 1 1\n" ]
[ "3\n", "2\n" ]
none
0
[ { "input": "5\n2 4 7 8 10", "output": "3" }, { "input": "4\n1 2 1 1", "output": "2" }, { "input": "3\n1 2 2", "output": "1" }, { "input": "3\n100 99 100", "output": "2" }, { "input": "3\n5 3 2", "output": "3" }, { "input": "4\n43 28 1 91", "output": "2" }, { "input": "4\n75 13 94 77", "output": "3" }, { "input": "4\n97 8 27 3", "output": "2" }, { "input": "10\n95 51 12 91 85 3 1 31 25 7", "output": "3" }, { "input": "20\n88 96 66 51 14 88 2 92 18 72 18 88 20 30 4 82 90 100 24 46", "output": "4" }, { "input": "30\n20 94 56 50 10 98 52 32 14 22 24 60 4 8 98 46 34 68 82 82 98 90 50 20 78 49 52 94 64 36", "output": "26" }, { "input": "50\n79 27 77 57 37 45 27 49 65 33 57 21 71 19 75 85 65 61 23 97 85 9 23 1 9 3 99 77 77 21 79 69 15 37 15 7 93 81 13 89 91 31 45 93 15 97 55 80 85 83", "output": "48" }, { "input": "60\n46 11 73 65 3 69 3 53 43 53 97 47 55 93 31 75 35 3 9 73 23 31 3 81 91 79 61 21 15 11 11 11 81 7 83 75 39 87 83 59 89 55 93 27 49 67 67 29 1 93 11 17 9 19 35 21 63 31 31 25", "output": "1" }, { "input": "70\n28 42 42 92 64 54 22 38 38 78 62 38 4 38 14 66 4 92 66 58 94 26 4 44 41 88 48 82 44 26 74 44 48 4 16 92 34 38 26 64 94 4 30 78 50 54 12 90 8 16 80 98 28 100 74 50 36 42 92 18 76 98 8 22 2 50 58 50 64 46", "output": "25" }, { "input": "100\n43 35 79 53 13 91 91 45 65 83 57 9 42 39 85 45 71 51 61 59 31 13 63 39 25 21 79 39 91 67 21 61 97 75 93 83 29 79 59 97 11 37 63 51 39 55 91 23 21 17 47 23 35 75 49 5 69 99 5 7 41 17 25 89 15 79 21 63 53 81 43 91 59 91 69 99 85 15 91 51 49 37 65 7 89 81 21 93 61 63 97 93 45 17 13 69 57 25 75 73", "output": "13" }, { "input": "100\n50 24 68 60 70 30 52 22 18 74 68 98 20 82 4 46 26 68 100 78 84 58 74 98 38 88 68 86 64 80 82 100 20 22 98 98 52 6 94 10 48 68 2 18 38 22 22 82 44 20 66 72 36 58 64 6 36 60 4 96 76 64 12 90 10 58 64 60 74 28 90 26 24 60 40 58 2 16 76 48 58 36 82 60 24 44 4 78 28 38 8 12 40 16 38 6 66 24 31 76", "output": "99" }, { "input": "100\n47 48 94 48 14 18 94 36 96 22 12 30 94 20 48 98 40 58 2 94 8 36 98 18 98 68 2 60 76 38 18 100 8 72 100 68 2 86 92 72 58 16 48 14 6 58 72 76 6 88 80 66 20 28 74 62 86 68 90 86 2 56 34 38 56 90 4 8 76 44 32 86 12 98 38 34 54 92 70 94 10 24 82 66 90 58 62 2 32 58 100 22 58 72 2 22 68 72 42 14", "output": "1" }, { "input": "99\n38 20 68 60 84 16 28 88 60 48 80 28 4 92 70 60 46 46 20 34 12 100 76 2 40 10 8 86 6 80 50 66 12 34 14 28 26 70 46 64 34 96 10 90 98 96 56 88 50 74 70 94 2 94 24 66 68 46 22 30 6 10 64 32 88 14 98 100 64 58 50 18 50 50 8 38 8 16 54 2 60 54 62 84 92 98 4 72 66 26 14 88 99 16 10 6 88 56 22", "output": "93" }, { "input": "99\n50 83 43 89 53 47 69 1 5 37 63 87 95 15 55 95 75 89 33 53 89 75 93 75 11 85 49 29 11 97 49 67 87 11 25 37 97 73 67 49 87 43 53 97 43 29 53 33 45 91 37 73 39 49 59 5 21 43 87 35 5 63 89 57 63 47 29 99 19 85 13 13 3 13 43 19 5 9 61 51 51 57 15 89 13 97 41 13 99 79 13 27 97 95 73 33 99 27 23", "output": "1" }, { "input": "98\n61 56 44 30 58 14 20 24 88 28 46 56 96 52 58 42 94 50 46 30 46 80 72 88 68 16 6 60 26 90 10 98 76 20 56 40 30 16 96 20 88 32 62 30 74 58 36 76 60 4 24 36 42 54 24 92 28 14 2 74 86 90 14 52 34 82 40 76 8 64 2 56 10 8 78 16 70 86 70 42 70 74 22 18 76 98 88 28 62 70 36 72 20 68 34 48 80 98", "output": "1" }, { "input": "98\n66 26 46 42 78 32 76 42 26 82 8 12 4 10 24 26 64 44 100 46 94 64 30 18 88 28 8 66 30 82 82 28 74 52 62 80 80 60 94 86 64 32 44 88 92 20 12 74 94 28 34 58 4 22 16 10 94 76 82 58 40 66 22 6 30 32 92 54 16 76 74 98 18 48 48 30 92 2 16 42 84 74 30 60 64 52 50 26 16 86 58 96 79 60 20 62 82 94", "output": "93" }, { "input": "95\n9 31 27 93 17 77 75 9 9 53 89 39 51 99 5 1 11 39 27 49 91 17 27 79 81 71 37 75 35 13 93 4 99 55 85 11 23 57 5 43 5 61 15 35 23 91 3 81 99 85 43 37 39 27 5 67 7 33 75 59 13 71 51 27 15 93 51 63 91 53 43 99 25 47 17 71 81 15 53 31 59 83 41 23 73 25 91 91 13 17 25 13 55 57 29", "output": "32" }, { "input": "100\n91 89 81 45 53 1 41 3 77 93 55 97 55 97 87 27 69 95 73 41 93 21 75 35 53 56 5 51 87 59 91 67 33 3 99 45 83 17 97 47 75 97 7 89 17 99 23 23 81 25 55 97 27 35 69 5 77 35 93 19 55 59 37 21 31 37 49 41 91 53 73 69 7 37 37 39 17 71 7 97 55 17 47 23 15 73 31 39 57 37 9 5 61 41 65 57 77 79 35 47", "output": "26" }, { "input": "99\n38 56 58 98 80 54 26 90 14 16 78 92 52 74 40 30 84 14 44 80 16 90 98 68 26 24 78 72 42 16 84 40 14 44 2 52 50 2 12 96 58 66 8 80 44 52 34 34 72 98 74 4 66 74 56 21 8 38 76 40 10 22 48 32 98 34 12 62 80 68 64 82 22 78 58 74 20 22 48 56 12 38 32 72 6 16 74 24 94 84 26 38 18 24 76 78 98 94 72", "output": "56" }, { "input": "100\n44 40 6 40 56 90 98 8 36 64 76 86 98 76 36 92 6 30 98 70 24 98 96 60 24 82 88 68 86 96 34 42 58 10 40 26 56 10 88 58 70 32 24 28 14 82 52 12 62 36 70 60 52 34 74 30 78 76 10 16 42 94 66 90 70 38 52 12 58 22 98 96 14 68 24 70 4 30 84 98 8 50 14 52 66 34 100 10 28 100 56 48 38 12 38 14 91 80 70 86", "output": "97" }, { "input": "100\n96 62 64 20 90 46 56 90 68 36 30 56 70 28 16 64 94 34 6 32 34 50 94 22 90 32 40 2 72 10 88 38 28 92 20 26 56 80 4 100 100 90 16 74 74 84 8 2 30 20 80 32 16 46 92 56 42 12 96 64 64 42 64 58 50 42 74 28 2 4 36 32 70 50 54 92 70 16 45 76 28 16 18 50 48 2 62 94 4 12 52 52 4 100 70 60 82 62 98 42", "output": "79" }, { "input": "99\n14 26 34 68 90 58 50 36 8 16 18 6 2 74 54 20 36 84 32 50 52 2 26 24 3 64 20 10 54 26 66 44 28 72 4 96 78 90 96 86 68 28 94 4 12 46 100 32 22 36 84 32 44 94 76 94 4 52 12 30 74 4 34 64 58 72 44 16 70 56 54 8 14 74 8 6 58 62 98 54 14 40 80 20 36 72 28 98 20 58 40 52 90 64 22 48 54 70 52", "output": "25" }, { "input": "95\n82 86 30 78 6 46 80 66 74 72 16 24 18 52 52 38 60 36 86 26 62 28 22 46 96 26 94 84 20 46 66 88 76 32 12 86 74 18 34 88 4 48 94 6 58 6 100 82 4 24 88 32 54 98 34 48 6 76 42 88 42 28 100 4 22 2 10 66 82 54 98 20 60 66 38 98 32 47 86 58 6 100 12 46 2 42 8 84 78 28 24 70 34 28 86", "output": "78" }, { "input": "90\n40 50 8 42 76 24 58 42 26 68 20 48 54 12 34 84 14 36 32 88 6 50 96 56 20 92 48 16 40 34 96 46 20 84 30 50 20 98 8 44 96 42 8 76 70 38 84 30 40 88 84 72 2 22 52 58 16 62 100 66 80 40 50 32 14 62 88 72 22 99 76 50 84 82 8 82 98 46 26 40 2 98 18 78 30 72 70 18 34 68", "output": "70" }, { "input": "80\n81 43 87 1 55 43 53 61 27 19 43 13 89 9 33 83 75 55 97 71 91 37 95 5 21 69 81 93 95 69 31 83 55 7 97 7 79 57 8 61 27 85 49 1 15 97 63 79 29 73 41 85 5 41 31 93 67 11 63 59 15 99 91 77 43 69 23 23 81 73 19 1 67 51 1 75 99 67 3 81", "output": "39" }, { "input": "98\n13 83 61 27 35 1 85 95 97 73 95 65 73 45 5 43 27 83 91 19 11 3 85 59 9 39 69 23 45 7 51 85 5 71 5 95 1 51 75 3 43 57 3 11 33 71 21 99 47 41 87 39 71 87 31 85 91 49 83 5 49 85 47 91 55 99 33 23 31 23 23 73 29 77 55 31 25 5 81 49 91 15 15 39 87 5 9 40 69 47 29 33 11 21 49 79 51 83", "output": "88" }, { "input": "3\n100 100 1", "output": "3" } ]
1,695,902,941
2,147,483,647
Python 3
OK
TESTS
32
92
0
n=int(input()) arr=[int(x) for x in input().split()] even=0 not_even=0 last_even=-1 last_not_even=-1 index=0 for i in range(0,len(arr)): if arr[i]%2==0: even+=1 last_even=i+1 else: not_even+=1 last_not_even=i+1 if even>1 and last_not_even!=-1: index=last_not_even break elif not_even>1 and last_even!=-1: index=last_even break print(index)
Title: IQ test Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness. Input Specification: The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness. Output Specification: Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order. Demo Input: ['5\n2 4 7 8 10\n', '4\n1 2 1 1\n'] Demo Output: ['3\n', '2\n'] Note: none
```python n=int(input()) arr=[int(x) for x in input().split()] even=0 not_even=0 last_even=-1 last_not_even=-1 index=0 for i in range(0,len(arr)): if arr[i]%2==0: even+=1 last_even=i+1 else: not_even+=1 last_not_even=i+1 if even>1 and last_not_even!=-1: index=last_not_even break elif not_even>1 and last_even!=-1: index=last_even break print(index) ```
3.977
799
A
Carrot Cakes
PROGRAMMING
1,100
[ "brute force", "implementation" ]
null
null
In some game by Playrix it takes *t* minutes for an oven to bake *k* carrot cakes, all cakes are ready at the same moment *t* minutes after they started baking. Arkady needs at least *n* cakes to complete a task, but he currently don't have any. However, he has infinitely many ingredients and one oven. Moreover, Arkady can build one more similar oven to make the process faster, it would take *d* minutes to build the oven. While the new oven is being built, only old one can bake cakes, after the new oven is built, both ovens bake simultaneously. Arkady can't build more than one oven. Determine if it is reasonable to build the second oven, i.e. will it decrease the minimum time needed to get *n* cakes or not. If the time needed with the second oven is the same as with one oven, then it is unreasonable.
The only line contains four integers *n*, *t*, *k*, *d* (1<=≤<=*n*,<=*t*,<=*k*,<=*d*<=≤<=1<=000) — the number of cakes needed, the time needed for one oven to bake *k* cakes, the number of cakes baked at the same time, the time needed to build the second oven.
If it is reasonable to build the second oven, print "YES". Otherwise print "NO".
[ "8 6 4 5\n", "8 6 4 6\n", "10 3 11 4\n", "4 2 1 4\n" ]
[ "YES\n", "NO\n", "NO\n", "YES\n" ]
In the first example it is possible to get 8 cakes in 12 minutes using one oven. The second oven can be built in 5 minutes, so after 6 minutes the first oven bakes 4 cakes, the second oven bakes 4 more ovens after 11 minutes. Thus, it is reasonable to build the second oven. In the second example it doesn't matter whether we build the second oven or not, thus it takes 12 minutes to bake 8 cakes in both cases. Thus, it is unreasonable to build the second oven. In the third example the first oven bakes 11 cakes in 3 minutes, that is more than needed 10. It is unreasonable to build the second oven, because its building takes more time that baking the needed number of cakes using the only oven.
500
[ { "input": "8 6 4 5", "output": "YES" }, { "input": "8 6 4 6", "output": "NO" }, { "input": "10 3 11 4", "output": "NO" }, { "input": "4 2 1 4", "output": "YES" }, { "input": "28 17 16 26", "output": "NO" }, { "input": "60 69 9 438", "output": "NO" }, { "input": "599 97 54 992", "output": "YES" }, { "input": "11 22 18 17", "output": "NO" }, { "input": "1 13 22 11", "output": "NO" }, { "input": "1 1 1 1", "output": "NO" }, { "input": "3 1 1 1", "output": "YES" }, { "input": "1000 1000 1000 1000", "output": "NO" }, { "input": "1000 1000 1 1", "output": "YES" }, { "input": "1000 1000 1 400", "output": "YES" }, { "input": "1000 1000 1 1000", "output": "YES" }, { "input": "1000 1000 1 999", "output": "YES" }, { "input": "53 11 3 166", "output": "YES" }, { "input": "313 2 3 385", "output": "NO" }, { "input": "214 9 9 412", "output": "NO" }, { "input": "349 9 5 268", "output": "YES" }, { "input": "611 16 8 153", "output": "YES" }, { "input": "877 13 3 191", "output": "YES" }, { "input": "340 9 9 10", "output": "YES" }, { "input": "31 8 2 205", "output": "NO" }, { "input": "519 3 2 148", "output": "YES" }, { "input": "882 2 21 219", "output": "NO" }, { "input": "982 13 5 198", "output": "YES" }, { "input": "428 13 6 272", "output": "YES" }, { "input": "436 16 14 26", "output": "YES" }, { "input": "628 10 9 386", "output": "YES" }, { "input": "77 33 18 31", "output": "YES" }, { "input": "527 36 4 8", "output": "YES" }, { "input": "128 18 2 169", "output": "YES" }, { "input": "904 4 2 288", "output": "YES" }, { "input": "986 4 3 25", "output": "YES" }, { "input": "134 8 22 162", "output": "NO" }, { "input": "942 42 3 69", "output": "YES" }, { "input": "894 4 9 4", "output": "YES" }, { "input": "953 8 10 312", "output": "YES" }, { "input": "43 8 1 121", "output": "YES" }, { "input": "12 13 19 273", "output": "NO" }, { "input": "204 45 10 871", "output": "YES" }, { "input": "342 69 50 425", "output": "NO" }, { "input": "982 93 99 875", "output": "NO" }, { "input": "283 21 39 132", "output": "YES" }, { "input": "1000 45 83 686", "output": "NO" }, { "input": "246 69 36 432", "output": "NO" }, { "input": "607 93 76 689", "output": "NO" }, { "input": "503 21 24 435", "output": "NO" }, { "input": "1000 45 65 989", "output": "NO" }, { "input": "30 21 2 250", "output": "YES" }, { "input": "1000 49 50 995", "output": "NO" }, { "input": "383 69 95 253", "output": "YES" }, { "input": "393 98 35 999", "output": "YES" }, { "input": "1000 22 79 552", "output": "NO" }, { "input": "268 294 268 154", "output": "NO" }, { "input": "963 465 706 146", "output": "YES" }, { "input": "304 635 304 257", "output": "NO" }, { "input": "4 2 1 6", "output": "NO" }, { "input": "1 51 10 50", "output": "NO" }, { "input": "5 5 4 4", "output": "YES" }, { "input": "3 2 1 1", "output": "YES" }, { "input": "3 4 3 3", "output": "NO" }, { "input": "7 3 4 1", "output": "YES" }, { "input": "101 10 1 1000", "output": "NO" }, { "input": "5 1 1 1", "output": "YES" }, { "input": "5 10 5 5", "output": "NO" }, { "input": "19 1 7 1", "output": "YES" }, { "input": "763 572 745 262", "output": "YES" }, { "input": "1 2 1 1", "output": "NO" }, { "input": "5 1 1 3", "output": "YES" }, { "input": "170 725 479 359", "output": "NO" }, { "input": "6 2 1 7", "output": "YES" }, { "input": "6 2 5 1", "output": "YES" }, { "input": "1 2 2 1", "output": "NO" }, { "input": "24 2 8 3", "output": "YES" }, { "input": "7 3 3 3", "output": "YES" }, { "input": "5 2 2 2", "output": "YES" }, { "input": "3 2 1 2", "output": "YES" }, { "input": "1000 2 200 8", "output": "NO" }, { "input": "3 100 2 100", "output": "NO" }, { "input": "2 999 1 1000", "output": "NO" }, { "input": "2 1 1 1", "output": "NO" }, { "input": "2 3 5 1", "output": "NO" }, { "input": "100 1 5 1", "output": "YES" }, { "input": "7 2 3 3", "output": "YES" }, { "input": "4 1 1 3", "output": "NO" }, { "input": "3 2 2 1", "output": "YES" }, { "input": "1 1 1 2", "output": "NO" }, { "input": "91 8 7 13", "output": "YES" }, { "input": "3 1 2 1", "output": "NO" }, { "input": "5 3 2 3", "output": "YES" }, { "input": "9 6 6 3", "output": "YES" } ]
1,664,859,881
2,147,483,647
PyPy 3-64
OK
TESTS
93
62
1,638,400
from math import ceil n, t, k, d = list(map(int, input().split())) first = ceil(n/k)*t second = 0 z = 0 c = 0 while d!=0 and second*k<n: z+=1 d-=1 if z == t: second+=1 z = 0 c+=1 else: x = 0 while second*k<n: z+=1 x+=1 if z == t: second+=1 z = 0 if x == t: second+=1 x = 0 c+=1 print("YES" if c<first else "NO")
Title: Carrot Cakes Time Limit: None seconds Memory Limit: None megabytes Problem Description: In some game by Playrix it takes *t* minutes for an oven to bake *k* carrot cakes, all cakes are ready at the same moment *t* minutes after they started baking. Arkady needs at least *n* cakes to complete a task, but he currently don't have any. However, he has infinitely many ingredients and one oven. Moreover, Arkady can build one more similar oven to make the process faster, it would take *d* minutes to build the oven. While the new oven is being built, only old one can bake cakes, after the new oven is built, both ovens bake simultaneously. Arkady can't build more than one oven. Determine if it is reasonable to build the second oven, i.e. will it decrease the minimum time needed to get *n* cakes or not. If the time needed with the second oven is the same as with one oven, then it is unreasonable. Input Specification: The only line contains four integers *n*, *t*, *k*, *d* (1<=≤<=*n*,<=*t*,<=*k*,<=*d*<=≤<=1<=000) — the number of cakes needed, the time needed for one oven to bake *k* cakes, the number of cakes baked at the same time, the time needed to build the second oven. Output Specification: If it is reasonable to build the second oven, print "YES". Otherwise print "NO". Demo Input: ['8 6 4 5\n', '8 6 4 6\n', '10 3 11 4\n', '4 2 1 4\n'] Demo Output: ['YES\n', 'NO\n', 'NO\n', 'YES\n'] Note: In the first example it is possible to get 8 cakes in 12 minutes using one oven. The second oven can be built in 5 minutes, so after 6 minutes the first oven bakes 4 cakes, the second oven bakes 4 more ovens after 11 minutes. Thus, it is reasonable to build the second oven. In the second example it doesn't matter whether we build the second oven or not, thus it takes 12 minutes to bake 8 cakes in both cases. Thus, it is unreasonable to build the second oven. In the third example the first oven bakes 11 cakes in 3 minutes, that is more than needed 10. It is unreasonable to build the second oven, because its building takes more time that baking the needed number of cakes using the only oven.
```python from math import ceil n, t, k, d = list(map(int, input().split())) first = ceil(n/k)*t second = 0 z = 0 c = 0 while d!=0 and second*k<n: z+=1 d-=1 if z == t: second+=1 z = 0 c+=1 else: x = 0 while second*k<n: z+=1 x+=1 if z == t: second+=1 z = 0 if x == t: second+=1 x = 0 c+=1 print("YES" if c<first else "NO") ```
3
24
A
Ring road
PROGRAMMING
1,400
[ "graphs" ]
A. Ring road
2
256
Nowadays the one-way traffic is introduced all over the world in order to improve driving safety and reduce traffic jams. The government of Berland decided to keep up with new trends. Formerly all *n* cities of Berland were connected by *n* two-way roads in the ring, i. e. each city was connected directly to exactly two other cities, and from each city it was possible to get to any other city. Government of Berland introduced one-way traffic on all *n* roads, but it soon became clear that it's impossible to get from some of the cities to some others. Now for each road is known in which direction the traffic is directed at it, and the cost of redirecting the traffic. What is the smallest amount of money the government should spend on the redirecting of roads so that from every city you can get to any other?
The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of cities (and roads) in Berland. Next *n* lines contain description of roads. Each road is described by three integers *a**i*, *b**i*, *c**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=*n*,<=*a**i*<=≠<=*b**i*,<=1<=≤<=*c**i*<=≤<=100) — road is directed from city *a**i* to city *b**i*, redirecting the traffic costs *c**i*.
Output single integer — the smallest amount of money the government should spend on the redirecting of roads so that from every city you can get to any other.
[ "3\n1 3 1\n1 2 1\n3 2 1\n", "3\n1 3 1\n1 2 5\n3 2 1\n", "6\n1 5 4\n5 3 8\n2 4 15\n1 6 16\n2 3 23\n4 6 42\n", "4\n1 2 9\n2 3 8\n3 4 7\n4 1 5\n" ]
[ "1\n", "2\n", "39\n", "0\n" ]
none
0
[ { "input": "3\n1 3 1\n1 2 1\n3 2 1", "output": "1" }, { "input": "3\n1 3 1\n1 2 5\n3 2 1", "output": "2" }, { "input": "6\n1 5 4\n5 3 8\n2 4 15\n1 6 16\n2 3 23\n4 6 42", "output": "39" }, { "input": "4\n1 2 9\n2 3 8\n3 4 7\n4 1 5", "output": "0" }, { "input": "5\n5 3 89\n2 3 43\n4 2 50\n1 4 69\n1 5 54", "output": "143" }, { "input": "10\n1 8 16\n6 1 80\n6 5 27\n5 7 86\n7 9 72\n4 9 20\n4 3 54\n3 2 57\n10 2 61\n8 10 90", "output": "267" }, { "input": "17\n8 12 43\n13 12 70\n7 13 68\n11 7 19\n5 11 24\n5 1 100\n4 1 10\n3 4 68\n2 3 46\n15 2 58\n15 6 38\n6 9 91\n9 10 72\n14 10 32\n14 17 97\n17 16 67\n8 16 40", "output": "435" }, { "input": "22\n18 22 46\n18 21 87\n5 21 17\n5 10 82\n10 12 81\n17 12 98\n16 17 17\n16 13 93\n4 13 64\n4 11 65\n15 11 18\n6 15 35\n6 7 61\n7 19 12\n19 1 65\n8 1 32\n8 2 46\n9 2 19\n9 3 58\n3 14 65\n20 14 67\n20 22 2", "output": "413" }, { "input": "39\n18 11 10\n5 18 97\n5 39 77\n39 24 64\n24 28 79\n28 14 6\n34 14 72\n6 34 64\n6 12 93\n12 8 66\n13 8 40\n35 13 20\n35 32 4\n32 19 55\n19 3 18\n3 21 26\n30 21 54\n30 27 5\n4 27 8\n22 4 89\n15 22 54\n15 2 90\n36 2 58\n33 36 4\n33 17 50\n17 16 21\n31 16 64\n1 31 77\n1 23 89\n23 7 62\n38 7 74\n9 38 15\n9 25 93\n25 10 32\n10 26 78\n20 26 63\n37 20 9\n29 37 33\n11 29 45", "output": "950" }, { "input": "50\n30 34 48\n11 30 15\n11 5 98\n4 5 57\n43 4 21\n14 43 74\n14 19 52\n45 19 60\n45 28 52\n24 28 94\n24 26 2\n48 26 48\n48 13 53\n13 42 7\n42 37 23\n37 17 70\n17 7 29\n20 7 93\n33 20 21\n33 2 53\n21 2 83\n49 21 33\n46 49 28\n18 46 1\n36 18 99\n47 36 52\n47 29 41\n41 29 40\n31 41 45\n31 38 25\n38 25 41\n25 8 18\n9 8 60\n9 27 29\n16 27 17\n16 22 6\n22 39 1\n1 39 8\n1 50 89\n50 12 64\n40 12 7\n40 44 71\n44 10 23\n15 10 70\n15 32 53\n23 32 92\n35 23 14\n35 3 25\n3 6 93\n6 34 99", "output": "1117" }, { "input": "3\n3 1 1\n2 1 1\n2 3 1", "output": "1" } ]
1,616,705,154
2,147,483,647
PyPy 3
OK
TESTS
21
186
1,536,000
n=int(input()) a=[] for i in range(n): a.append(list(map(int,input().split()))) i=0 b=[] c=0 for k in range(n): b.append(a[i][c]) for j in range(n): if i!=j and a[i][1-c] in a[j][:2]: if a[i][1-c]==a[j][0]: c=0 else: c=1 i=j break b+=[b[0]] c1,c2=0,0 for i in range(1,n+1): for j in range(n): if a[j][:2]==[b[i],b[i-1]]: c1+=a[j][2] elif a[j][:2]==[b[i-1],b[i]]: c2+=a[j][2] print(min(c1,c2))
Title: Ring road Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Nowadays the one-way traffic is introduced all over the world in order to improve driving safety and reduce traffic jams. The government of Berland decided to keep up with new trends. Formerly all *n* cities of Berland were connected by *n* two-way roads in the ring, i. e. each city was connected directly to exactly two other cities, and from each city it was possible to get to any other city. Government of Berland introduced one-way traffic on all *n* roads, but it soon became clear that it's impossible to get from some of the cities to some others. Now for each road is known in which direction the traffic is directed at it, and the cost of redirecting the traffic. What is the smallest amount of money the government should spend on the redirecting of roads so that from every city you can get to any other? Input Specification: The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of cities (and roads) in Berland. Next *n* lines contain description of roads. Each road is described by three integers *a**i*, *b**i*, *c**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=*n*,<=*a**i*<=≠<=*b**i*,<=1<=≤<=*c**i*<=≤<=100) — road is directed from city *a**i* to city *b**i*, redirecting the traffic costs *c**i*. Output Specification: Output single integer — the smallest amount of money the government should spend on the redirecting of roads so that from every city you can get to any other. Demo Input: ['3\n1 3 1\n1 2 1\n3 2 1\n', '3\n1 3 1\n1 2 5\n3 2 1\n', '6\n1 5 4\n5 3 8\n2 4 15\n1 6 16\n2 3 23\n4 6 42\n', '4\n1 2 9\n2 3 8\n3 4 7\n4 1 5\n'] Demo Output: ['1\n', '2\n', '39\n', '0\n'] Note: none
```python n=int(input()) a=[] for i in range(n): a.append(list(map(int,input().split()))) i=0 b=[] c=0 for k in range(n): b.append(a[i][c]) for j in range(n): if i!=j and a[i][1-c] in a[j][:2]: if a[i][1-c]==a[j][0]: c=0 else: c=1 i=j break b+=[b[0]] c1,c2=0,0 for i in range(1,n+1): for j in range(n): if a[j][:2]==[b[i],b[i-1]]: c1+=a[j][2] elif a[j][:2]==[b[i-1],b[i]]: c2+=a[j][2] print(min(c1,c2)) ```
3.950639
300
A
Array
PROGRAMMING
1,100
[ "brute force", "constructive algorithms", "implementation" ]
null
null
Vitaly has an array of *n* distinct integers. Vitaly wants to divide this array into three non-empty sets so as the following conditions hold: 1. The product of all numbers in the first set is less than zero (<=&lt;<=0). 1. The product of all numbers in the second set is greater than zero (<=&gt;<=0). 1. The product of all numbers in the third set is equal to zero. 1. Each number from the initial array must occur in exactly one set. Help Vitaly. Divide the given array.
The first line of the input contains integer *n* (3<=≤<=*n*<=≤<=100). The second line contains *n* space-separated distinct integers *a*1,<=*a*2,<=...,<=*a**n* (|*a**i*|<=≤<=103) — the array elements.
In the first line print integer *n*1 (*n*1<=&gt;<=0) — the number of elements in the first set. Then print *n*1 numbers — the elements that got to the first set. In the next line print integer *n*2 (*n*2<=&gt;<=0) — the number of elements in the second set. Then print *n*2 numbers — the elements that got to the second set. In the next line print integer *n*3 (*n*3<=&gt;<=0) — the number of elements in the third set. Then print *n*3 numbers — the elements that got to the third set. The printed sets must meet the described conditions. It is guaranteed that the solution exists. If there are several solutions, you are allowed to print any of them.
[ "3\n-1 2 0\n", "4\n-1 -2 -3 0\n" ]
[ "1 -1\n1 2\n1 0\n", "1 -1\n2 -3 -2\n1 0\n" ]
none
500
[ { "input": "3\n-1 2 0", "output": "1 -1\n1 2\n1 0" }, { "input": "4\n-1 -2 -3 0", "output": "1 -1\n2 -3 -2\n1 0" }, { "input": "5\n-1 -2 1 2 0", "output": "1 -1\n2 1 2\n2 0 -2" }, { "input": "100\n-64 -51 -75 -98 74 -26 -1 -8 -99 -76 -53 -80 -43 -22 -100 -62 -34 -5 -65 -81 -18 -91 -92 -16 -23 -95 -9 -19 -44 -46 -79 52 -35 4 -87 -7 -90 -20 -71 -61 -67 -50 -66 -68 -49 -27 -32 -57 -85 -59 -30 -36 -3 -77 86 -25 -94 -56 60 -24 -37 -72 -41 -31 11 -48 28 -38 -42 -39 -33 -70 -84 0 -93 -73 -14 -69 -40 -97 -6 -55 -45 -54 -10 -29 -96 -12 -83 -15 -21 -47 17 -2 -63 -89 88 13 -58 -82", "output": "89 -64 -51 -75 -98 -26 -1 -8 -99 -76 -53 -80 -43 -22 -100 -62 -34 -5 -65 -81 -18 -91 -92 -16 -23 -95 -9 -19 -44 -46 -79 -35 -87 -7 -90 -20 -71 -61 -67 -50 -66 -68 -49 -27 -32 -57 -85 -59 -30 -36 -3 -77 -25 -94 -56 -24 -37 -72 -41 -31 -48 -38 -42 -39 -33 -70 -84 -93 -73 -14 -69 -40 -97 -6 -55 -45 -54 -10 -29 -96 -12 -83 -15 -21 -47 -2 -63 -89 -58 -82\n10 74 52 4 86 60 11 28 17 88 13\n1 0" }, { "input": "100\n3 -66 -17 54 24 -29 76 89 32 -37 93 -16 99 -25 51 78 23 68 -95 59 18 34 -45 77 9 39 -10 19 8 73 -5 60 12 31 0 2 26 40 48 30 52 49 27 4 87 57 85 58 -61 50 83 80 69 67 91 97 -96 11 100 56 82 53 13 -92 -72 70 1 -94 -63 47 21 14 74 7 6 33 55 65 64 -41 81 42 36 28 38 20 43 71 90 -88 22 84 -86 15 75 62 44 35 98 46", "output": "19 -66 -17 -29 -37 -16 -25 -95 -45 -10 -5 -61 -96 -92 -72 -94 -63 -41 -88 -86\n80 3 54 24 76 89 32 93 99 51 78 23 68 59 18 34 77 9 39 19 8 73 60 12 31 2 26 40 48 30 52 49 27 4 87 57 85 58 50 83 80 69 67 91 97 11 100 56 82 53 13 70 1 47 21 14 74 7 6 33 55 65 64 81 42 36 28 38 20 43 71 90 22 84 15 75 62 44 35 98 46\n1 0" }, { "input": "100\n-17 16 -70 32 -60 75 -100 -9 -68 -30 -42 86 -88 -98 -47 -5 58 -14 -94 -73 -80 -51 -66 -85 -53 49 -25 -3 -45 -69 -11 -64 83 74 -65 67 13 -91 81 6 -90 -54 -12 -39 0 -24 -71 -41 -44 57 -93 -20 -92 18 -43 -52 -55 -84 -89 -19 40 -4 -99 -26 -87 -36 -56 -61 -62 37 -95 -28 63 23 35 -82 1 -2 -78 -96 -21 -77 -76 -27 -10 -97 -8 46 -15 -48 -34 -59 -7 -29 50 -33 -72 -79 22 38", "output": "75 -17 -70 -60 -100 -9 -68 -30 -42 -88 -98 -47 -5 -14 -94 -73 -80 -51 -66 -85 -53 -25 -3 -45 -69 -11 -64 -65 -91 -90 -54 -12 -39 -24 -71 -41 -44 -93 -20 -92 -43 -52 -55 -84 -89 -19 -4 -99 -26 -87 -36 -56 -61 -62 -95 -28 -82 -2 -78 -96 -21 -77 -76 -27 -10 -97 -8 -15 -48 -34 -59 -7 -29 -33 -72 -79\n24 16 32 75 86 58 49 83 74 67 13 81 6 57 18 40 37 63 23 35 1 46 50 22 38\n1 0" }, { "input": "100\n-97 -90 61 78 87 -52 -3 65 83 38 30 -60 35 -50 -73 -77 44 -32 -81 17 -67 58 -6 -34 47 -28 71 -45 69 -80 -4 -7 -57 -79 43 -27 -31 29 16 -89 -21 -93 95 -82 74 -5 -70 -20 -18 36 -64 -66 72 53 62 -68 26 15 76 -40 -99 8 59 88 49 -23 9 10 56 -48 -98 0 100 -54 25 94 13 -63 42 39 -1 55 24 -12 75 51 41 84 -96 -85 -2 -92 14 -46 -91 -19 -11 -86 22 -37", "output": "51 -97 -90 -52 -3 -60 -50 -73 -77 -32 -81 -67 -6 -34 -28 -45 -80 -4 -7 -57 -79 -27 -31 -89 -21 -93 -82 -5 -70 -20 -18 -64 -66 -68 -40 -99 -23 -48 -98 -54 -63 -1 -12 -96 -85 -2 -92 -46 -91 -19 -11 -86\n47 61 78 87 65 83 38 30 35 44 17 58 47 71 69 43 29 16 95 74 36 72 53 62 26 15 76 8 59 88 49 9 10 56 100 25 94 13 42 39 55 24 75 51 41 84 14 22\n2 0 -37" }, { "input": "100\n-75 -60 -18 -92 -71 -9 -37 -34 -82 28 -54 93 -83 -76 -58 -88 -17 -97 64 -39 -96 -81 -10 -98 -47 -100 -22 27 14 -33 -19 -99 87 -66 57 -21 -90 -70 -32 -26 24 -77 -74 13 -44 16 -5 -55 -2 -6 -7 -73 -1 -68 -30 -95 -42 69 0 -20 -79 59 -48 -4 -72 -67 -46 62 51 -52 -86 -40 56 -53 85 -35 -8 49 50 65 29 11 -43 -15 -41 -12 -3 -80 -31 -38 -91 -45 -25 78 94 -23 -63 84 89 -61", "output": "73 -75 -60 -18 -92 -71 -9 -37 -34 -82 -54 -83 -76 -58 -88 -17 -97 -39 -96 -81 -10 -98 -47 -100 -22 -33 -19 -99 -66 -21 -90 -70 -32 -26 -77 -74 -44 -5 -55 -2 -6 -7 -73 -1 -68 -30 -95 -42 -20 -79 -48 -4 -72 -67 -46 -52 -86 -40 -53 -35 -8 -43 -15 -41 -12 -3 -80 -31 -38 -91 -45 -25 -23 -63\n25 28 93 64 27 14 87 57 24 13 16 69 59 62 51 56 85 49 50 65 29 11 78 94 84 89\n2 0 -61" }, { "input": "100\n-87 -48 -76 -1 -10 -17 -22 -19 -27 -99 -43 49 38 -20 -45 -64 44 -96 -35 -74 -65 -41 -21 -75 37 -12 -67 0 -3 5 -80 -93 -81 -97 -47 -63 53 -100 95 -79 -83 -90 -32 88 -77 -16 -23 -54 -28 -4 -73 -98 -25 -39 60 -56 -34 -2 -11 -55 -52 -69 -68 -29 -82 -62 -36 -13 -6 -89 8 -72 18 -15 -50 -71 -70 -92 -42 -78 -61 -9 -30 -85 -91 -94 84 -86 -7 -57 -14 40 -33 51 -26 46 59 -31 -58 -66", "output": "83 -87 -48 -76 -1 -10 -17 -22 -19 -27 -99 -43 -20 -45 -64 -96 -35 -74 -65 -41 -21 -75 -12 -67 -3 -80 -93 -81 -97 -47 -63 -100 -79 -83 -90 -32 -77 -16 -23 -54 -28 -4 -73 -98 -25 -39 -56 -34 -2 -11 -55 -52 -69 -68 -29 -82 -62 -36 -13 -6 -89 -72 -15 -50 -71 -70 -92 -42 -78 -61 -9 -30 -85 -91 -94 -86 -7 -57 -14 -33 -26 -31 -58 -66\n16 49 38 44 37 5 53 95 88 60 8 18 84 40 51 46 59\n1 0" }, { "input": "100\n-95 -28 -43 -72 -11 -24 -37 -35 -44 -66 -45 -62 -96 -51 -55 -23 -31 -26 -59 -17 77 -69 -10 -12 -78 -14 -52 -57 -40 -75 4 -98 -6 7 -53 -3 -90 -63 -8 -20 88 -91 -32 -76 -80 -97 -34 -27 -19 0 70 -38 -9 -49 -67 73 -36 2 81 -39 -65 -83 -64 -18 -94 -79 -58 -16 87 -22 -74 -25 -13 -46 -89 -47 5 -15 -54 -99 56 -30 -60 -21 -86 33 -1 -50 -68 -100 -85 -29 92 -48 -61 42 -84 -93 -41 -82", "output": "85 -95 -28 -43 -72 -11 -24 -37 -35 -44 -66 -45 -62 -96 -51 -55 -23 -31 -26 -59 -17 -69 -10 -12 -78 -14 -52 -57 -40 -75 -98 -6 -53 -3 -90 -63 -8 -20 -91 -32 -76 -80 -97 -34 -27 -19 -38 -9 -49 -67 -36 -39 -65 -83 -64 -18 -94 -79 -58 -16 -22 -74 -25 -13 -46 -89 -47 -15 -54 -99 -30 -60 -21 -86 -1 -50 -68 -100 -85 -29 -48 -61 -84 -93 -41 -82\n14 77 4 7 88 70 73 2 81 87 5 56 33 92 42\n1 0" }, { "input": "100\n-12 -41 57 13 83 -36 53 69 -6 86 -75 87 11 -5 -4 -14 -37 -84 70 2 -73 16 31 34 -45 94 -9 26 27 52 -42 46 96 21 32 7 -18 61 66 -51 95 -48 -76 90 80 -40 89 77 78 54 -30 8 88 33 -24 82 -15 19 1 59 44 64 -97 -60 43 56 35 47 39 50 29 28 -17 -67 74 23 85 -68 79 0 65 55 -3 92 -99 72 93 -71 38 -10 -100 -98 81 62 91 -63 -58 49 -20 22", "output": "35 -12 -41 -36 -6 -75 -5 -4 -14 -37 -84 -73 -45 -9 -42 -18 -51 -48 -76 -40 -30 -24 -15 -97 -60 -17 -67 -68 -3 -99 -71 -10 -100 -98 -63 -58\n63 57 13 83 53 69 86 87 11 70 2 16 31 34 94 26 27 52 46 96 21 32 7 61 66 95 90 80 89 77 78 54 8 88 33 82 19 1 59 44 64 43 56 35 47 39 50 29 28 74 23 85 79 65 55 92 72 93 38 81 62 91 49 22\n2 0 -20" }, { "input": "100\n-34 81 85 -96 50 20 54 86 22 10 -19 52 65 44 30 53 63 71 17 98 -92 4 5 -99 89 -23 48 9 7 33 75 2 47 -56 42 70 -68 57 51 83 82 94 91 45 46 25 95 11 -12 62 -31 -87 58 38 67 97 -60 66 73 -28 13 93 29 59 -49 77 37 -43 -27 0 -16 72 15 79 61 78 35 21 3 8 84 1 -32 36 74 -88 26 100 6 14 40 76 18 90 24 69 80 64 55 41", "output": "19 -34 -96 -19 -92 -99 -23 -56 -68 -12 -31 -87 -60 -28 -49 -43 -27 -16 -32 -88\n80 81 85 50 20 54 86 22 10 52 65 44 30 53 63 71 17 98 4 5 89 48 9 7 33 75 2 47 42 70 57 51 83 82 94 91 45 46 25 95 11 62 58 38 67 97 66 73 13 93 29 59 77 37 72 15 79 61 78 35 21 3 8 84 1 36 74 26 100 6 14 40 76 18 90 24 69 80 64 55 41\n1 0" }, { "input": "100\n-1000 -986 -979 -955 -966 -963 -973 -959 -972 -906 -924 -927 -929 -918 -977 -967 -921 -989 -911 -995 -945 -919 -971 -913 -912 -933 -969 -975 -920 -988 -997 -994 -953 -962 -940 -905 -978 -948 -957 -996 0 -976 -949 -931 -903 -985 -923 -993 -944 -909 -938 -946 -934 -992 -904 -980 -954 -943 -917 -968 -991 -956 -902 -942 -999 -998 -908 -928 -930 -914 -922 -936 -960 -937 -939 -926 -965 -925 -951 -910 -907 -970 -990 -984 -964 -987 -916 -947 -982 -950 -974 -915 -932 -958 -981 -941 -961 -983 -952 -935", "output": "97 -1000 -986 -979 -955 -966 -963 -973 -959 -972 -906 -924 -927 -929 -918 -977 -967 -921 -989 -911 -995 -945 -919 -971 -913 -912 -933 -969 -975 -920 -988 -997 -994 -953 -962 -940 -905 -978 -948 -957 -996 -976 -949 -931 -903 -985 -923 -993 -944 -909 -938 -946 -934 -992 -904 -980 -954 -943 -917 -968 -991 -956 -902 -942 -999 -998 -908 -928 -930 -914 -922 -936 -960 -937 -939 -926 -965 -925 -951 -910 -907 -970 -990 -984 -964 -987 -916 -947 -982 -950 -974 -915 -932 -958 -981 -941 -961 -983\n2 -935 -952\n1 0" }, { "input": "99\n-1000 -986 -979 -955 -966 -963 -973 -959 -972 -906 -924 -927 -929 -918 -977 -967 -921 -989 -911 -995 -945 -919 -971 -913 -912 -933 -969 -975 -920 -988 -997 -994 -953 -962 -940 -905 -978 -948 -957 -996 0 -976 -949 -931 -903 -985 -923 -993 -944 -909 -938 -946 -934 -992 -904 -980 -954 -943 -917 -968 -991 -956 -902 -942 -999 -998 -908 -928 -930 -914 -922 -936 -960 -937 -939 -926 -965 -925 -951 -910 -907 -970 -990 -984 -964 -987 -916 -947 -982 -950 -974 -915 -932 -958 -981 -941 -961 -983 -952", "output": "95 -1000 -986 -979 -955 -966 -963 -973 -959 -972 -906 -924 -927 -929 -918 -977 -967 -921 -989 -911 -995 -945 -919 -971 -913 -912 -933 -969 -975 -920 -988 -997 -994 -953 -962 -940 -905 -978 -948 -957 -996 -976 -949 -931 -903 -985 -923 -993 -944 -909 -938 -946 -934 -992 -904 -980 -954 -943 -917 -968 -991 -956 -902 -942 -999 -998 -908 -928 -930 -914 -922 -936 -960 -937 -939 -926 -965 -925 -951 -910 -907 -970 -990 -984 -964 -987 -916 -947 -982 -950 -974 -915 -932 -958 -981 -941\n2 -952 -983\n2 0 -961" }, { "input": "59\n-990 -876 -641 -726 718 -53 803 -954 894 -265 -587 -665 904 349 754 -978 441 794 -768 -428 -569 -476 188 -620 -290 -333 45 705 -201 109 165 446 13 122 714 -562 -15 -86 -960 43 329 578 287 -776 -14 -71 915 886 -259 337 -495 913 -498 -669 -673 818 225 647 0", "output": "29 -990 -876 -641 -726 -53 -954 -265 -587 -665 -978 -768 -428 -569 -476 -620 -290 -333 -201 -562 -15 -86 -960 -776 -14 -71 -259 -495 -498 -669\n28 718 803 894 904 349 754 441 794 188 45 705 109 165 446 13 122 714 43 329 578 287 915 886 337 913 818 225 647\n2 0 -673" }, { "input": "64\n502 885 -631 -906 735 687 642 -29 -696 -165 -524 15 -129 -663 -846 -501 -651 895 -341 -833 -142 33 -847 688 945 -192 -587 -930 603 849 736 676 788 256 863 -509 319 -49 -807 -158 218 -886 -143 -639 118 -156 -291 325 892 -916 -622 -960 -959 -731 -943 436 -535 861 745 589 -159 376 -182 0", "output": "35 -631 -906 -29 -696 -165 -524 -129 -663 -846 -501 -651 -341 -833 -142 -847 -192 -587 -930 -509 -49 -807 -158 -886 -143 -639 -156 -291 -916 -622 -960 -959 -731 -943 -535 -159\n27 502 885 735 687 642 15 895 33 688 945 603 849 736 676 788 256 863 319 218 118 325 892 436 861 745 589 376\n2 0 -182" }, { "input": "5\n-1 -2 -3 -4 0", "output": "1 -1\n2 -4 -3\n2 0 -2" }, { "input": "3\n-101 101 0", "output": "1 -101\n1 101\n1 0" }, { "input": "21\n-100 -200 -300 -400 -500 -600 -700 -800 -900 -1000 0 100 200 300 400 500 600 700 800 900 1000", "output": "9 -100 -200 -300 -400 -500 -600 -700 -800 -900\n10 100 200 300 400 500 600 700 800 900 1000\n2 0 -1000" }, { "input": "4\n0 -1 -2 -3", "output": "1 -1\n2 -3 -2\n1 0" } ]
1,623,823,978
2,147,483,647
PyPy 3
OK
TESTS
20
248
0
# A. Array n=int(input()) a=list(map(int,input().split())) def product(a): p=1 for i in a: p*=i return p a.sort() a1=[] a1.append(a[0]) a3=[0] a2=a[1:] a2.remove(0) if product(a2)>0: print(1,*a1) print(n-2,*a2) print(1,*a3) else: a3.append(a2[0]) a2.pop(0) print(1,*a1) print(n-3,*a2) print(2,*a3)
Title: Array Time Limit: None seconds Memory Limit: None megabytes Problem Description: Vitaly has an array of *n* distinct integers. Vitaly wants to divide this array into three non-empty sets so as the following conditions hold: 1. The product of all numbers in the first set is less than zero (<=&lt;<=0). 1. The product of all numbers in the second set is greater than zero (<=&gt;<=0). 1. The product of all numbers in the third set is equal to zero. 1. Each number from the initial array must occur in exactly one set. Help Vitaly. Divide the given array. Input Specification: The first line of the input contains integer *n* (3<=≤<=*n*<=≤<=100). The second line contains *n* space-separated distinct integers *a*1,<=*a*2,<=...,<=*a**n* (|*a**i*|<=≤<=103) — the array elements. Output Specification: In the first line print integer *n*1 (*n*1<=&gt;<=0) — the number of elements in the first set. Then print *n*1 numbers — the elements that got to the first set. In the next line print integer *n*2 (*n*2<=&gt;<=0) — the number of elements in the second set. Then print *n*2 numbers — the elements that got to the second set. In the next line print integer *n*3 (*n*3<=&gt;<=0) — the number of elements in the third set. Then print *n*3 numbers — the elements that got to the third set. The printed sets must meet the described conditions. It is guaranteed that the solution exists. If there are several solutions, you are allowed to print any of them. Demo Input: ['3\n-1 2 0\n', '4\n-1 -2 -3 0\n'] Demo Output: ['1 -1\n1 2\n1 0\n', '1 -1\n2 -3 -2\n1 0\n'] Note: none
```python # A. Array n=int(input()) a=list(map(int,input().split())) def product(a): p=1 for i in a: p*=i return p a.sort() a1=[] a1.append(a[0]) a3=[0] a2=a[1:] a2.remove(0) if product(a2)>0: print(1,*a1) print(n-2,*a2) print(1,*a3) else: a3.append(a2[0]) a2.pop(0) print(1,*a1) print(n-3,*a2) print(2,*a3) ```
3
266
A
Stones on the Table
PROGRAMMING
800
[ "implementation" ]
null
null
There are *n* stones on the table in a row, each of them can be red, green or blue. Count the minimum number of stones to take from the table so that any two neighboring stones had different colors. Stones in a row are considered neighboring if there are no other stones between them.
The first line contains integer *n* (1<=≤<=*n*<=≤<=50) — the number of stones on the table. The next line contains string *s*, which represents the colors of the stones. We'll consider the stones in the row numbered from 1 to *n* from left to right. Then the *i*-th character *s* equals "R", if the *i*-th stone is red, "G", if it's green and "B", if it's blue.
Print a single integer — the answer to the problem.
[ "3\nRRG\n", "5\nRRRRR\n", "4\nBRBG\n" ]
[ "1\n", "4\n", "0\n" ]
none
500
[ { "input": "3\nRRG", "output": "1" }, { "input": "5\nRRRRR", "output": "4" }, { "input": "4\nBRBG", "output": "0" }, { "input": "1\nB", "output": "0" }, { "input": "2\nBG", "output": "0" }, { "input": "3\nBGB", "output": "0" }, { "input": "4\nRBBR", "output": "1" }, { "input": "5\nRGGBG", "output": "1" }, { "input": "10\nGGBRBRGGRB", "output": "2" }, { "input": "50\nGRBGGRBRGRBGGBBBBBGGGBBBBRBRGBRRBRGBBBRBBRRGBGGGRB", "output": "18" }, { "input": "15\nBRRBRGGBBRRRRGR", "output": "6" }, { "input": "20\nRRGBBRBRGRGBBGGRGRRR", "output": "6" }, { "input": "25\nBBGBGRBGGBRRBGRRBGGBBRBRB", "output": "6" }, { "input": "30\nGRGGGBGGRGBGGRGRBGBGBRRRRRRGRB", "output": "9" }, { "input": "35\nGBBGBRGBBGGRBBGBRRGGRRRRRRRBRBBRRGB", "output": "14" }, { "input": "40\nGBBRRGBGGGRGGGRRRRBRBGGBBGGGBGBBBBBRGGGG", "output": "20" }, { "input": "45\nGGGBBRBBRRGRBBGGBGRBRGGBRBRGBRRGBGRRBGRGRBRRG", "output": "11" }, { "input": "50\nRBGGBGGRBGRBBBGBBGRBBBGGGRBBBGBBBGRGGBGGBRBGBGRRGG", "output": "17" }, { "input": "50\nGGGBBRGGGGGRRGGRBGGRGBBRBRRBGRGBBBGBRBGRGBBGRGGBRB", "output": "16" }, { "input": "50\nGBGRGRRBRRRRRGGBBGBRRRBBBRBBBRRGRBBRGBRBGGRGRBBGGG", "output": "19" }, { "input": "10\nGRRBRBRBGR", "output": "1" }, { "input": "10\nBRBGBGRRBR", "output": "1" }, { "input": "20\nGBGBGGRRRRGRBBGRGRGR", "output": "5" }, { "input": "20\nRRGGRBBGBBRBGRRBRRBG", "output": "6" }, { "input": "30\nBGBRGBBBGRGBBRGBGRBBBRGGRRGRRB", "output": "8" }, { "input": "30\nBBBBGGBRBGBBGBGBGBGGGRGRRGGBBB", "output": "11" }, { "input": "40\nGBRRGRBGBRRGBRGGGBRGBGBRGBBRRGRGGBBGBGBB", "output": "9" }, { "input": "40\nBRGRGGRGGRBBRRRBRBBGGGRRGBGBBGRBBRGBRRGG", "output": "13" }, { "input": "50\nRBGBGGRRGGRGGBGBGRRBGGBGBRRBBGBBGBBBGBBRBBRBRBRGRG", "output": "13" }, { "input": "50\nRBRRGBGRRRBGRRBGRRGRBBRBBRRBRGGBRBRRBGGRBGGBRBRGRB", "output": "12" }, { "input": "2\nBB", "output": "1" }, { "input": "50\nRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR", "output": "49" }, { "input": "50\nRRRRRRRRGRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR", "output": "47" }, { "input": "50\nRRRRRRRRRRRRGGRRRRRRRRRBRRRRRRRRRRRRRRBBRRRRRRRRRR", "output": "43" } ]
1,695,275,289
2,147,483,647
Python 3
OK
TESTS
34
92
0
n = int(input()) stones = list(input()) counter = 0 for i in range(n-1): if stones[i] == stones[i+1]: counter += 1 print(counter)
Title: Stones on the Table Time Limit: None seconds Memory Limit: None megabytes Problem Description: There are *n* stones on the table in a row, each of them can be red, green or blue. Count the minimum number of stones to take from the table so that any two neighboring stones had different colors. Stones in a row are considered neighboring if there are no other stones between them. Input Specification: The first line contains integer *n* (1<=≤<=*n*<=≤<=50) — the number of stones on the table. The next line contains string *s*, which represents the colors of the stones. We'll consider the stones in the row numbered from 1 to *n* from left to right. Then the *i*-th character *s* equals "R", if the *i*-th stone is red, "G", if it's green and "B", if it's blue. Output Specification: Print a single integer — the answer to the problem. Demo Input: ['3\nRRG\n', '5\nRRRRR\n', '4\nBRBG\n'] Demo Output: ['1\n', '4\n', '0\n'] Note: none
```python n = int(input()) stones = list(input()) counter = 0 for i in range(n-1): if stones[i] == stones[i+1]: counter += 1 print(counter) ```
3
343
B
Alternating Current
PROGRAMMING
1,600
[ "data structures", "greedy", "implementation" ]
null
null
Mad scientist Mike has just finished constructing a new device to search for extraterrestrial intelligence! He was in such a hurry to launch it for the first time that he plugged in the power wires without giving it a proper glance and started experimenting right away. After a while Mike observed that the wires ended up entangled and now have to be untangled again. The device is powered by two wires "plus" and "minus". The wires run along the floor from the wall (on the left) to the device (on the right). Both the wall and the device have two contacts in them on the same level, into which the wires are plugged in some order. The wires are considered entangled if there are one or more places where one wire runs above the other one. For example, the picture below has four such places (top view): Mike knows the sequence in which the wires run above each other. Mike also noticed that on the left side, the "plus" wire is always plugged into the top contact (as seen on the picture). He would like to untangle the wires without unplugging them and without moving the device. Determine if it is possible to do that. A wire can be freely moved and stretched on the floor, but cannot be cut. To understand the problem better please read the notes to the test samples.
The single line of the input contains a sequence of characters "+" and "-" of length *n* (1<=≤<=*n*<=≤<=100000). The *i*-th (1<=≤<=*i*<=≤<=*n*) position of the sequence contains the character "+", if on the *i*-th step from the wall the "plus" wire runs above the "minus" wire, and the character "-" otherwise.
Print either "Yes" (without the quotes) if the wires can be untangled or "No" (without the quotes) if the wires cannot be untangled.
[ "-++-\n", "+-\n", "++\n", "-\n" ]
[ "Yes\n", "No\n", "Yes\n", "No\n" ]
The first testcase corresponds to the picture in the statement. To untangle the wires, one can first move the "plus" wire lower, thus eliminating the two crosses in the middle, and then draw it under the "minus" wire, eliminating also the remaining two crosses. In the second testcase the "plus" wire makes one full revolution around the "minus" wire. Thus the wires cannot be untangled: In the third testcase the "plus" wire simply runs above the "minus" wire twice in sequence. The wires can be untangled by lifting "plus" and moving it higher: In the fourth testcase the "minus" wire runs above the "plus" wire once. The wires cannot be untangled without moving the device itself:
1,000
[ { "input": "-++-", "output": "Yes" }, { "input": "+-", "output": "No" }, { "input": "++", "output": "Yes" }, { "input": "-", "output": "No" }, { "input": "+-+-", "output": "No" }, { "input": "-+-", "output": "No" }, { "input": "-++-+--+", "output": "Yes" }, { "input": "+", "output": "No" }, { "input": "-+", "output": "No" }, { "input": "--", "output": "Yes" }, { "input": "+++", "output": "No" }, { "input": "--+", "output": "No" }, { "input": "++--++", "output": "Yes" }, { "input": "+-++-+", "output": "Yes" }, { "input": "+-+--+", "output": "No" }, { "input": "--++-+", "output": "No" }, { "input": "-+-+--", "output": "No" }, { "input": "+-+++-", "output": "No" }, { "input": "-+-+-+", "output": "No" }, { "input": "-++-+--++--+-++-", "output": "Yes" }, { "input": "+-----+-++---+------+++-++++", "output": "No" }, { "input": "-+-++--+++-++++---+--+----+--+-+-+++-+++-+---++-++++-+--+--+--+-+-++-+-+-++++++---++--+++++-+--++--+-+--++-----+--+-++---+++---++----+++-++++--++-++-", "output": "No" }, { "input": "-+-----++++--++-+-++", "output": "Yes" }, { "input": "+--+--+------+++++++-+-+++--++---+--+-+---+--+++-+++-------+++++-+-++++--+-+-+++++++----+----+++----+-+++-+++-----+++-+-++-+-+++++-+--++----+--+-++-----+-+-++++---+++---+-+-+-++++--+--+++---+++++-+---+-----+++-++--+++---++-++-+-+++-+-+-+---+++--+--++++-+-+--++-------+--+---++-----+++--+-+++--++-+-+++-++--+++-++++++++++-++-++++++-+++--+--++-+++--+++-++++----+++---+-+----++++-+-+", "output": "Yes" }, { "input": "-+-+-++-+-+-", "output": "Yes" }, { "input": "-+-++-+-", "output": "Yes" }, { "input": "-+-++-+-+-", "output": "No" }, { "input": "++-+-+-+-+--+", "output": "No" }, { "input": "+++---", "output": "No" }, { "input": "+-+-+-+-+--+-+-+-+-++--++--+", "output": "Yes" }, { "input": "+-+-++", "output": "No" }, { "input": "-++--+--+++-+-+-+-+-", "output": "No" }, { "input": "+---+-+-", "output": "No" }, { "input": "+-+--+-+", "output": "Yes" }, { "input": "+++---+++---", "output": "No" }, { "input": "-+++++", "output": "No" }, { "input": "-+-+-+-+-+-+-++-+-+-+-+-+-+-", "output": "Yes" }, { "input": "-+++--", "output": "No" }, { "input": "+---+", "output": "No" }, { "input": "-++", "output": "No" }, { "input": "-+--+-", "output": "Yes" }, { "input": "+---++--++", "output": "No" }, { "input": "+++-", "output": "No" }, { "input": "--+++", "output": "No" }, { "input": "++-+", "output": "No" } ]
1,587,805,755
2,147,483,647
PyPy 3
OK
TESTS
62
310
1,945,600
s = input() p = 0 n = 0 for i in range(len(s)): if i % 2 == 0: if s[i] == "-": p += 1 else: n += 1 else: if s[i] == "-": n += 1 else: p += 1 if p == n: print("Yes") else: print("No")
Title: Alternating Current Time Limit: None seconds Memory Limit: None megabytes Problem Description: Mad scientist Mike has just finished constructing a new device to search for extraterrestrial intelligence! He was in such a hurry to launch it for the first time that he plugged in the power wires without giving it a proper glance and started experimenting right away. After a while Mike observed that the wires ended up entangled and now have to be untangled again. The device is powered by two wires "plus" and "minus". The wires run along the floor from the wall (on the left) to the device (on the right). Both the wall and the device have two contacts in them on the same level, into which the wires are plugged in some order. The wires are considered entangled if there are one or more places where one wire runs above the other one. For example, the picture below has four such places (top view): Mike knows the sequence in which the wires run above each other. Mike also noticed that on the left side, the "plus" wire is always plugged into the top contact (as seen on the picture). He would like to untangle the wires without unplugging them and without moving the device. Determine if it is possible to do that. A wire can be freely moved and stretched on the floor, but cannot be cut. To understand the problem better please read the notes to the test samples. Input Specification: The single line of the input contains a sequence of characters "+" and "-" of length *n* (1<=≤<=*n*<=≤<=100000). The *i*-th (1<=≤<=*i*<=≤<=*n*) position of the sequence contains the character "+", if on the *i*-th step from the wall the "plus" wire runs above the "minus" wire, and the character "-" otherwise. Output Specification: Print either "Yes" (without the quotes) if the wires can be untangled or "No" (without the quotes) if the wires cannot be untangled. Demo Input: ['-++-\n', '+-\n', '++\n', '-\n'] Demo Output: ['Yes\n', 'No\n', 'Yes\n', 'No\n'] Note: The first testcase corresponds to the picture in the statement. To untangle the wires, one can first move the "plus" wire lower, thus eliminating the two crosses in the middle, and then draw it under the "minus" wire, eliminating also the remaining two crosses. In the second testcase the "plus" wire makes one full revolution around the "minus" wire. Thus the wires cannot be untangled: In the third testcase the "plus" wire simply runs above the "minus" wire twice in sequence. The wires can be untangled by lifting "plus" and moving it higher: In the fourth testcase the "minus" wire runs above the "plus" wire once. The wires cannot be untangled without moving the device itself:
```python s = input() p = 0 n = 0 for i in range(len(s)): if i % 2 == 0: if s[i] == "-": p += 1 else: n += 1 else: if s[i] == "-": n += 1 else: p += 1 if p == n: print("Yes") else: print("No") ```
3
645
B
Mischievous Mess Makers
PROGRAMMING
1,200
[ "greedy", "math" ]
null
null
It is a balmy spring afternoon, and Farmer John's *n* cows are ruminating about link-cut cacti in their stalls. The cows, labeled 1 through *n*, are arranged so that the *i*-th cow occupies the *i*-th stall from the left. However, Elsie, after realizing that she will forever live in the shadows beyond Bessie's limelight, has formed the Mischievous Mess Makers and is plotting to disrupt this beautiful pastoral rhythm. While Farmer John takes his *k* minute long nap, Elsie and the Mess Makers plan to repeatedly choose two distinct stalls and swap the cows occupying those stalls, making no more than one swap each minute. Being the meticulous pranksters that they are, the Mischievous Mess Makers would like to know the maximum messiness attainable in the *k* minutes that they have. We denote as *p**i* the label of the cow in the *i*-th stall. The messiness of an arrangement of cows is defined as the number of pairs (*i*,<=*j*) such that *i*<=&lt;<=*j* and *p**i*<=&gt;<=*p**j*.
The first line of the input contains two integers *n* and *k* (1<=≤<=*n*,<=*k*<=≤<=100<=000) — the number of cows and the length of Farmer John's nap, respectively.
Output a single integer, the maximum messiness that the Mischievous Mess Makers can achieve by performing no more than *k* swaps.
[ "5 2\n", "1 10\n" ]
[ "10\n", "0\n" ]
In the first sample, the Mischievous Mess Makers can swap the cows in the stalls 1 and 5 during the first minute, then the cows in stalls 2 and 4 during the second minute. This reverses the arrangement of cows, giving us a total messiness of 10. In the second sample, there is only one cow, so the maximum possible messiness is 0.
1,000
[ { "input": "5 2", "output": "10" }, { "input": "1 10", "output": "0" }, { "input": "100000 2", "output": "399990" }, { "input": "1 1", "output": "0" }, { "input": "8 3", "output": "27" }, { "input": "7 1", "output": "11" }, { "input": "100000 40000", "output": "4799960000" }, { "input": "1 1000", "output": "0" }, { "input": "100 45", "output": "4905" }, { "input": "9 2", "output": "26" }, { "input": "456 78", "output": "58890" }, { "input": "100000 50000", "output": "4999950000" }, { "input": "100000 50001", "output": "4999950000" }, { "input": "100000 50002", "output": "4999950000" }, { "input": "100000 50003", "output": "4999950000" }, { "input": "100000 49998", "output": "4999949994" }, { "input": "100000 49997", "output": "4999949985" }, { "input": "99999 49998", "output": "4999849998" }, { "input": "99999 49997", "output": "4999849991" }, { "input": "99999 49996", "output": "4999849980" }, { "input": "99999 50000", "output": "4999850001" }, { "input": "99999 50001", "output": "4999850001" }, { "input": "99999 50002", "output": "4999850001" }, { "input": "30062 9", "output": "540945" }, { "input": "13486 3", "output": "80895" }, { "input": "29614 7", "output": "414491" }, { "input": "13038 8", "output": "208472" }, { "input": "96462 6", "output": "1157466" }, { "input": "22599 93799", "output": "255346101" }, { "input": "421 36817", "output": "88410" }, { "input": "72859 65869", "output": "2654180511" }, { "input": "37916 5241", "output": "342494109" }, { "input": "47066 12852", "output": "879423804" }, { "input": "84032 21951", "output": "2725458111" }, { "input": "70454 75240", "output": "2481847831" }, { "input": "86946 63967", "output": "3779759985" }, { "input": "71128 11076", "output": "1330260828" }, { "input": "46111 64940", "output": "1063089105" }, { "input": "46111 64940", "output": "1063089105" }, { "input": "56500 84184", "output": "1596096750" }, { "input": "60108 83701", "output": "1806455778" }, { "input": "1 2", "output": "0" }, { "input": "1 3", "output": "0" }, { "input": "1 4", "output": "0" }, { "input": "1 5", "output": "0" }, { "input": "1 6", "output": "0" }, { "input": "2 1", "output": "1" }, { "input": "2 2", "output": "1" }, { "input": "2 3", "output": "1" }, { "input": "2 4", "output": "1" }, { "input": "2 5", "output": "1" }, { "input": "3 1", "output": "3" }, { "input": "3 2", "output": "3" }, { "input": "3 3", "output": "3" }, { "input": "3 4", "output": "3" }, { "input": "3 5", "output": "3" }, { "input": "4 1", "output": "5" }, { "input": "4 2", "output": "6" }, { "input": "4 3", "output": "6" }, { "input": "4 4", "output": "6" }, { "input": "4 5", "output": "6" }, { "input": "5 1", "output": "7" }, { "input": "5 3", "output": "10" }, { "input": "5 4", "output": "10" }, { "input": "5 5", "output": "10" }, { "input": "6 1", "output": "9" }, { "input": "6 2", "output": "14" }, { "input": "6 3", "output": "15" }, { "input": "7 2", "output": "18" }, { "input": "7 3", "output": "21" }, { "input": "7 4", "output": "21" }, { "input": "10 2", "output": "30" }, { "input": "60982 2", "output": "243918" }, { "input": "23426 23", "output": "1076515" }, { "input": "444 3", "output": "2643" }, { "input": "18187 433", "output": "15374531" }, { "input": "6895 3544", "output": "23767065" }, { "input": "56204 22352", "output": "1513297456" }, { "input": "41977 5207", "output": "382917573" }, { "input": "78147 2321", "output": "351981971" }, { "input": "99742 62198", "output": "4974183411" }, { "input": "72099 38339", "output": "2599096851" }, { "input": "82532 4838", "output": "751762306" }, { "input": "79410 33144", "output": "3066847464" }, { "input": "11021 3389", "output": "51726307" }, { "input": "66900 7572", "output": "898455660" }, { "input": "99999 49999", "output": "4999850001" }, { "input": "100000 49999", "output": "4999949999" }, { "input": "100000 100000", "output": "4999950000" }, { "input": "100000 1", "output": "199997" }, { "input": "4 100", "output": "6" }, { "input": "100000 1234", "output": "243753254" } ]
1,611,725,058
2,147,483,647
Python 3
OK
TESTS
92
77
0
n, k = [int(x) for x in input().split()] if k >= n // 2: print(n * (n-1) // 2) else: print(k * (2* (n-k) - 1))
Title: Mischievous Mess Makers Time Limit: None seconds Memory Limit: None megabytes Problem Description: It is a balmy spring afternoon, and Farmer John's *n* cows are ruminating about link-cut cacti in their stalls. The cows, labeled 1 through *n*, are arranged so that the *i*-th cow occupies the *i*-th stall from the left. However, Elsie, after realizing that she will forever live in the shadows beyond Bessie's limelight, has formed the Mischievous Mess Makers and is plotting to disrupt this beautiful pastoral rhythm. While Farmer John takes his *k* minute long nap, Elsie and the Mess Makers plan to repeatedly choose two distinct stalls and swap the cows occupying those stalls, making no more than one swap each minute. Being the meticulous pranksters that they are, the Mischievous Mess Makers would like to know the maximum messiness attainable in the *k* minutes that they have. We denote as *p**i* the label of the cow in the *i*-th stall. The messiness of an arrangement of cows is defined as the number of pairs (*i*,<=*j*) such that *i*<=&lt;<=*j* and *p**i*<=&gt;<=*p**j*. Input Specification: The first line of the input contains two integers *n* and *k* (1<=≤<=*n*,<=*k*<=≤<=100<=000) — the number of cows and the length of Farmer John's nap, respectively. Output Specification: Output a single integer, the maximum messiness that the Mischievous Mess Makers can achieve by performing no more than *k* swaps. Demo Input: ['5 2\n', '1 10\n'] Demo Output: ['10\n', '0\n'] Note: In the first sample, the Mischievous Mess Makers can swap the cows in the stalls 1 and 5 during the first minute, then the cows in stalls 2 and 4 during the second minute. This reverses the arrangement of cows, giving us a total messiness of 10. In the second sample, there is only one cow, so the maximum possible messiness is 0.
```python n, k = [int(x) for x in input().split()] if k >= n // 2: print(n * (n-1) // 2) else: print(k * (2* (n-k) - 1)) ```
3
686
A
Free Ice Cream
PROGRAMMING
800
[ "constructive algorithms", "implementation" ]
null
null
After their adventure with the magic mirror Kay and Gerda have returned home and sometimes give free ice cream to kids in the summer. At the start of the day they have *x* ice cream packs. Since the ice cream is free, people start standing in the queue before Kay and Gerda's house even in the night. Each person in the queue wants either to take several ice cream packs for himself and his friends or to give several ice cream packs to Kay and Gerda (carriers that bring ice cream have to stand in the same queue). If a carrier with *d* ice cream packs comes to the house, then Kay and Gerda take all his packs. If a child who wants to take *d* ice cream packs comes to the house, then Kay and Gerda will give him *d* packs if they have enough ice cream, otherwise the child will get no ice cream at all and will leave in distress. Kay wants to find the amount of ice cream they will have after all people will leave from the queue, and Gerda wants to find the number of distressed kids.
The first line contains two space-separated integers *n* and *x* (1<=≤<=*n*<=≤<=1000, 0<=≤<=*x*<=≤<=109). Each of the next *n* lines contains a character '+' or '-', and an integer *d**i*, separated by a space (1<=≤<=*d**i*<=≤<=109). Record "+ *d**i*" in *i*-th line means that a carrier with *d**i* ice cream packs occupies *i*-th place from the start of the queue, and record "- *d**i*" means that a child who wants to take *d**i* packs stands in *i*-th place.
Print two space-separated integers — number of ice cream packs left after all operations, and number of kids that left the house in distress.
[ "5 7\n+ 5\n- 10\n- 20\n+ 40\n- 20\n", "5 17\n- 16\n- 2\n- 98\n+ 100\n- 98\n" ]
[ "22 1\n", "3 2\n" ]
Consider the first sample. 1. Initially Kay and Gerda have 7 packs of ice cream. 1. Carrier brings 5 more, so now they have 12 packs. 1. A kid asks for 10 packs and receives them. There are only 2 packs remaining. 1. Another kid asks for 20 packs. Kay and Gerda do not have them, so the kid goes away distressed. 1. Carrier bring 40 packs, now Kay and Gerda have 42 packs. 1. Kid asks for 20 packs and receives them. There are 22 packs remaining.
500
[ { "input": "5 7\n+ 5\n- 10\n- 20\n+ 40\n- 20", "output": "22 1" }, { "input": "5 17\n- 16\n- 2\n- 98\n+ 100\n- 98", "output": "3 2" }, { "input": "6 1000000000\n+ 1000000000\n+ 1000000000\n+ 1000000000\n+ 1000000000\n+ 1000000000\n+ 1000000000", "output": "7000000000 0" }, { "input": "5 12\n- 12\n+ 7\n- 6\n- 1\n+ 46", "output": "46 0" }, { "input": "11 1000\n- 100\n+ 100\n+ 100\n+ 100\n+ 100\n- 100\n- 100\n- 100\n- 100\n- 100\n- 100", "output": "700 0" }, { "input": "1 0\n- 526403222", "output": "0 1" }, { "input": "1 897986543\n- 371188251", "output": "526798292 0" }, { "input": "1 0\n+ 1", "output": "1 0" }, { "input": "1 0\n- 1", "output": "0 1" }, { "input": "1 10\n+ 10", "output": "20 0" }, { "input": "1 3\n- 5", "output": "3 1" }, { "input": "1 0\n- 5", "output": "0 1" }, { "input": "1 0\n+ 5", "output": "5 0" } ]
1,688,729,061
2,147,483,647
PyPy 3-64
OK
TESTS
34
92
1,740,800
n, x = input().split() icePacks, distressed = int(x), 0 for i in range(int(n)): sign, d = input().split() d = int(d) if sign == '+': icePacks += d else: if icePacks >= d: icePacks -= d else: distressed += 1 print(f"{icePacks} {distressed}")
Title: Free Ice Cream Time Limit: None seconds Memory Limit: None megabytes Problem Description: After their adventure with the magic mirror Kay and Gerda have returned home and sometimes give free ice cream to kids in the summer. At the start of the day they have *x* ice cream packs. Since the ice cream is free, people start standing in the queue before Kay and Gerda's house even in the night. Each person in the queue wants either to take several ice cream packs for himself and his friends or to give several ice cream packs to Kay and Gerda (carriers that bring ice cream have to stand in the same queue). If a carrier with *d* ice cream packs comes to the house, then Kay and Gerda take all his packs. If a child who wants to take *d* ice cream packs comes to the house, then Kay and Gerda will give him *d* packs if they have enough ice cream, otherwise the child will get no ice cream at all and will leave in distress. Kay wants to find the amount of ice cream they will have after all people will leave from the queue, and Gerda wants to find the number of distressed kids. Input Specification: The first line contains two space-separated integers *n* and *x* (1<=≤<=*n*<=≤<=1000, 0<=≤<=*x*<=≤<=109). Each of the next *n* lines contains a character '+' or '-', and an integer *d**i*, separated by a space (1<=≤<=*d**i*<=≤<=109). Record "+ *d**i*" in *i*-th line means that a carrier with *d**i* ice cream packs occupies *i*-th place from the start of the queue, and record "- *d**i*" means that a child who wants to take *d**i* packs stands in *i*-th place. Output Specification: Print two space-separated integers — number of ice cream packs left after all operations, and number of kids that left the house in distress. Demo Input: ['5 7\n+ 5\n- 10\n- 20\n+ 40\n- 20\n', '5 17\n- 16\n- 2\n- 98\n+ 100\n- 98\n'] Demo Output: ['22 1\n', '3 2\n'] Note: Consider the first sample. 1. Initially Kay and Gerda have 7 packs of ice cream. 1. Carrier brings 5 more, so now they have 12 packs. 1. A kid asks for 10 packs and receives them. There are only 2 packs remaining. 1. Another kid asks for 20 packs. Kay and Gerda do not have them, so the kid goes away distressed. 1. Carrier bring 40 packs, now Kay and Gerda have 42 packs. 1. Kid asks for 20 packs and receives them. There are 22 packs remaining.
```python n, x = input().split() icePacks, distressed = int(x), 0 for i in range(int(n)): sign, d = input().split() d = int(d) if sign == '+': icePacks += d else: if icePacks >= d: icePacks -= d else: distressed += 1 print(f"{icePacks} {distressed}") ```
3
898
A
Rounding
PROGRAMMING
800
[ "implementation", "math" ]
null
null
Vasya has a non-negative integer *n*. He wants to round it to nearest integer, which ends up with 0. If *n* already ends up with 0, Vasya considers it already rounded. For example, if *n*<==<=4722 answer is 4720. If *n*<==<=5 Vasya can round it to 0 or to 10. Both ways are correct. For given *n* find out to which integer will Vasya round it.
The first line contains single integer *n* (0<=≤<=*n*<=≤<=109) — number that Vasya has.
Print result of rounding *n*. Pay attention that in some cases answer isn't unique. In that case print any correct answer.
[ "5\n", "113\n", "1000000000\n", "5432359\n" ]
[ "0\n", "110\n", "1000000000\n", "5432360\n" ]
In the first example *n* = 5. Nearest integers, that ends up with zero are 0 and 10. Any of these answers is correct, so you can print 0 or 10.
500
[ { "input": "5", "output": "0" }, { "input": "113", "output": "110" }, { "input": "1000000000", "output": "1000000000" }, { "input": "5432359", "output": "5432360" }, { "input": "999999994", "output": "999999990" }, { "input": "10", "output": "10" }, { "input": "9", "output": "10" }, { "input": "1", "output": "0" }, { "input": "0", "output": "0" }, { "input": "3", "output": "0" }, { "input": "4", "output": "0" }, { "input": "6", "output": "10" }, { "input": "7", "output": "10" }, { "input": "8", "output": "10" }, { "input": "19", "output": "20" }, { "input": "100", "output": "100" }, { "input": "997", "output": "1000" }, { "input": "9994", "output": "9990" }, { "input": "10002", "output": "10000" }, { "input": "100000", "output": "100000" }, { "input": "99999", "output": "100000" }, { "input": "999999999", "output": "1000000000" }, { "input": "999999998", "output": "1000000000" }, { "input": "999999995", "output": "999999990" }, { "input": "999999990", "output": "999999990" }, { "input": "1000000", "output": "1000000" }, { "input": "1000010", "output": "1000010" }, { "input": "10000010", "output": "10000010" }, { "input": "100000011", "output": "100000010" }, { "input": "400000003", "output": "400000000" }, { "input": "234234", "output": "234230" }, { "input": "675621", "output": "675620" }, { "input": "43532", "output": "43530" }, { "input": "4576453", "output": "4576450" }, { "input": "65754674", "output": "65754670" }, { "input": "3245526", "output": "3245530" }, { "input": "123445", "output": "123440" }, { "input": "234217", "output": "234220" }, { "input": "23451218", "output": "23451220" }, { "input": "1231239", "output": "1231240" }, { "input": "1923140", "output": "1923140" }, { "input": "307910310", "output": "307910310" }, { "input": "780961030", "output": "780961030" }, { "input": "103509421", "output": "103509420" }, { "input": "576560141", "output": "576560140" }, { "input": "48851642", "output": "48851640" }, { "input": "226935072", "output": "226935070" }, { "input": "844450763", "output": "844450760" }, { "input": "22534183", "output": "22534180" }, { "input": "640049874", "output": "640049870" }, { "input": "818133304", "output": "818133300" }, { "input": "730616285", "output": "730616280" }, { "input": "613732415", "output": "613732410" }, { "input": "380991216", "output": "380991220" }, { "input": "559074636", "output": "559074640" }, { "input": "176590327", "output": "176590330" }, { "input": "354673757", "output": "354673760" }, { "input": "267156738", "output": "267156740" }, { "input": "150272868", "output": "150272870" }, { "input": "62755859", "output": "62755860" }, { "input": "945871979", "output": "945871980" }, { "input": "46", "output": "50" }, { "input": "999", "output": "1000" }, { "input": "1397", "output": "1400" } ]
1,676,697,355
2,147,483,647
Python 3
OK
TESTS
64
46
0
# LUOGU_RID: 102386230 print(round(int(input())/10)*10)
Title: Rounding Time Limit: None seconds Memory Limit: None megabytes Problem Description: Vasya has a non-negative integer *n*. He wants to round it to nearest integer, which ends up with 0. If *n* already ends up with 0, Vasya considers it already rounded. For example, if *n*<==<=4722 answer is 4720. If *n*<==<=5 Vasya can round it to 0 or to 10. Both ways are correct. For given *n* find out to which integer will Vasya round it. Input Specification: The first line contains single integer *n* (0<=≤<=*n*<=≤<=109) — number that Vasya has. Output Specification: Print result of rounding *n*. Pay attention that in some cases answer isn't unique. In that case print any correct answer. Demo Input: ['5\n', '113\n', '1000000000\n', '5432359\n'] Demo Output: ['0\n', '110\n', '1000000000\n', '5432360\n'] Note: In the first example *n* = 5. Nearest integers, that ends up with zero are 0 and 10. Any of these answers is correct, so you can print 0 or 10.
```python # LUOGU_RID: 102386230 print(round(int(input())/10)*10) ```
3