signature
stringlengths
29
44.1k
implementation
stringlengths
0
85.2k
def get_tensors_inputs ( placeholders , tensors , names ) : """Args : placeholders ( list [ Tensor ] ) : tensors ( list [ Tensor ] ) : list of tf . Tensor names ( list [ str ] ) : names matching the given tensors Returns : list [ Tensor ] : inputs to used for the tower function , with the corresponding placeholders replaced by tensors ."""
assert len ( tensors ) == len ( names ) , "Input tensors {} and input names {} have different length!" . format ( tensors , names ) ret = copy . copy ( placeholders ) placeholder_names = [ p . name for p in placeholders ] for name , tensor in zip ( names , tensors ) : tensorname = get_op_tensor_name ( name ) [ 1 ] try : idx = placeholder_names . index ( tensorname ) except ValueError : logger . error ( "Name {} is not a model input!" . format ( tensorname ) ) raise ret [ idx ] = tensor return ret
def main ( ) : """NAME change _ case _ magic . py DESCRIPTION picks out key and converts to upper or lower case SYNTAX change _ case _ magic . py [ command line options ] OPTIONS - h prints help message and quits - f FILE : specify input magic format file - F FILE : specify output magic format file , default is to overwrite input file - keys KEY1 : KEY2 specify colon delimited list of keys to convert - [ U , l ] : specify [ U ] PPER or [ l ] ower case , default is lower"""
dir_path = "./" change = 'l' if '-WD' in sys . argv : ind = sys . argv . index ( '-WD' ) dir_path = sys . argv [ ind + 1 ] if '-h' in sys . argv : print ( main . __doc__ ) sys . exit ( ) if '-f' in sys . argv : ind = sys . argv . index ( '-f' ) magic_file = dir_path + '/' + sys . argv [ ind + 1 ] else : print ( main . __doc__ ) sys . exit ( ) if '-F' in sys . argv : ind = sys . argv . index ( '-F' ) out_file = dir_path + '/' + sys . argv [ ind + 1 ] else : out_file = magic_file if '-keys' in sys . argv : ind = sys . argv . index ( '-keys' ) grab_keys = sys . argv [ ind + 1 ] . split ( ":" ) else : print ( main . __doc__ ) sys . exit ( ) if '-U' in sys . argv : change = 'U' # get data read in Data , file_type = pmag . magic_read ( magic_file ) if len ( Data ) > 0 : for grab_key in grab_keys : for rec in Data : if change == 'l' : rec [ grab_key ] = rec [ grab_key ] . lower ( ) else : rec [ grab_key ] = rec [ grab_key ] . upper ( ) else : print ( 'bad file name' ) pmag . magic_write ( out_file , Data , file_type )
def vesting_balance_withdraw ( self , vesting_id , amount = None , account = None , ** kwargs ) : """Withdraw vesting balance : param str vesting _ id : Id of the vesting object : param bitshares . amount . Amount Amount : to withdraw ( " all " if not provided " ) : param str account : ( optional ) the account to allow access to ( defaults to ` ` default _ account ` ` )"""
if not account : if "default_account" in self . config : account = self . config [ "default_account" ] if not account : raise ValueError ( "You need to provide an account" ) account = Account ( account , blockchain_instance = self ) if not amount : obj = Vesting ( vesting_id , blockchain_instance = self ) amount = obj . claimable op = operations . Vesting_balance_withdraw ( ** { "fee" : { "amount" : 0 , "asset_id" : "1.3.0" } , "vesting_balance" : vesting_id , "owner" : account [ "id" ] , "amount" : { "amount" : int ( amount ) , "asset_id" : amount [ "asset" ] [ "id" ] } , "prefix" : self . prefix , } ) return self . finalizeOp ( op , account [ "name" ] , "active" )
def make_regression ( func , n_samples = 100 , n_features = 1 , bias = 0.0 , noise = 0.0 , random_state = None ) : """Make dataset for a regression problem . Examples > > > f = lambda x : 0.5 * x + np . sin ( 2 * x ) > > > X , y = make _ regression ( f , bias = . 5 , noise = 1 . , random _ state = 1) > > > X . shape (100 , 1) > > > y . shape (100 , ) > > > X [ : 5 ] . round ( 2) array ( [ [ 1.62 ] , [ - 0.61 ] , [ - 0.53 ] , [ - 1.07 ] , [ 0.87 ] ] ) > > > y [ : 5 ] . round ( 2) array ( [ 0.76 , 0.48 , - 0.23 , - 0.28 , 0.83 ] )"""
generator = check_random_state ( random_state ) X = generator . randn ( n_samples , n_features ) # unpack the columns of X y = func ( * X . T ) + bias if noise > 0.0 : y += generator . normal ( scale = noise , size = y . shape ) return X , y
def getargspec ( obj ) : """An improved inspect . getargspec . Has a slightly different return value from the default getargspec . Returns a tuple of : required , optional , args , kwargs list , dict , bool , bool Required is a list of required named arguments . Optional is a dictionary mapping optional arguments to defaults . Args and kwargs are True for the respective unlimited argument type ."""
argnames , varargs , varkw , _defaults = None , None , None , None if inspect . isfunction ( obj ) or inspect . ismethod ( obj ) : argnames , varargs , varkw , _defaults = inspect . getargspec ( obj ) elif inspect . isclass ( obj ) : if inspect . ismethoddescriptor ( obj . __init__ ) : argnames , varargs , varkw , _defaults = [ ] , False , False , None else : argnames , varargs , varkw , _defaults = inspect . getargspec ( obj . __init__ ) elif hasattr ( obj , '__call__' ) : argnames , varargs , varkw , _defaults = inspect . getargspec ( obj . __call__ ) else : raise TypeError ( "Object not callable?" ) # Need test case to prove this is even possible . # if ( argnames , varargs , varkw , defaults ) is ( None , None , None , None ) : # raise InspectionFailed ( ) if argnames and argnames [ 0 ] == 'self' : del argnames [ 0 ] if _defaults is None : _defaults = [ ] defaults = dict ( ) else : # Create a mapping dictionary of defaults ; this is slightly more useful . defaults = dict ( ) _defaults = list ( _defaults ) _defaults . reverse ( ) argnames . reverse ( ) for i , default in enumerate ( _defaults ) : defaults [ argnames [ i ] ] = default argnames . reverse ( ) # del argnames [ - len ( _ defaults ) : ] return argnames , defaults , True if varargs else False , True if varkw else False
def create_dir ( entry , section , domain , output ) : """Create the output directory for the entry if needed ."""
full_output_dir = os . path . join ( output , section , domain , entry [ 'assembly_accession' ] ) try : os . makedirs ( full_output_dir ) except OSError as err : if err . errno == errno . EEXIST and os . path . isdir ( full_output_dir ) : pass else : raise return full_output_dir
def convert ( self , targetunits ) : """Set new user unit , for either wavelength or flux . This effectively converts the spectrum wavelength or flux to given unit . Note that actual data are always kept in internal units ( Angstrom and ` ` photlam ` ` ) , and only converted to user units by : meth : ` getArrays ` during actual computation . User units are stored in ` ` self . waveunits ` ` and ` ` self . fluxunits ` ` . Parameters targetunits : str New unit name , as accepted by ` ~ pysynphot . units . Units ` ."""
nunits = units . Units ( targetunits ) if nunits . isFlux : self . fluxunits = nunits else : self . waveunits = nunits
def clone ( self , repo , ref , deps = ( ) ) : """Clone the given url and checkout the specific ref ."""
if os . path . isdir ( repo ) : repo = os . path . abspath ( repo ) def clone_strategy ( directory ) : env = git . no_git_env ( ) def _git_cmd ( * args ) : cmd_output ( 'git' , * args , cwd = directory , env = env ) _git_cmd ( 'init' , '.' ) _git_cmd ( 'remote' , 'add' , 'origin' , repo ) try : self . _shallow_clone ( ref , _git_cmd ) except CalledProcessError : self . _complete_clone ( ref , _git_cmd ) return self . _new_repo ( repo , ref , deps , clone_strategy )
def _custom_response_edit ( self , method , url , headers , body , response ) : """This method allows a service to edit a response . If you want to do this , you probably really want to use _ edit _ mock _ response - this method will operate on Live resources ."""
if self . get_implementation ( ) . is_mock ( ) : delay = self . get_setting ( "MOCKDATA_DELAY" , 0.0 ) time . sleep ( delay ) self . _edit_mock_response ( method , url , headers , body , response )
def tsp ( points , start = 0 ) : """Find an ordering of points where each is visited and the next point is the closest in euclidean distance , and if there are multiple points with equal distance go to an arbitrary one . Assumes every point is visitable from every other point , i . e . the travelling salesman problem on a fully connected graph . It is not a MINIMUM traversal ; rather it is a " not totally goofy traversal , quickly . " On random points this traversal is often ~ 20x shorter than random ordering . Parameters points : ( n , dimension ) float ND points in space start : int The index of points we should start at Returns traversal : ( n , ) int Ordered traversal visiting every point distances : ( n - 1 , ) float The euclidean distance between points in traversal"""
# points should be float points = np . asanyarray ( points , dtype = np . float64 ) if len ( points . shape ) != 2 : raise ValueError ( 'points must be (n, dimension)!' ) # start should be an index start = int ( start ) # a mask of unvisited points by index unvisited = np . ones ( len ( points ) , dtype = np . bool ) unvisited [ start ] = False # traversal of points by index traversal = np . zeros ( len ( points ) , dtype = np . int64 ) - 1 traversal [ 0 ] = start # list of distances distances = np . zeros ( len ( points ) - 1 , dtype = np . float64 ) # a mask of indexes in order index_mask = np . arange ( len ( points ) , dtype = np . int64 ) # in the loop we want to call distances . sum ( axis = 1) # a lot and it ' s actually kind of slow for " reasons " # dot products with ones is equivalent and ~ 2x faster sum_ones = np . ones ( points . shape [ 1 ] ) # loop through all points for i in range ( len ( points ) - 1 ) : # which point are we currently on current = points [ traversal [ i ] ] # do NlogN distance query # use dot instead of . sum ( axis = 1 ) or np . linalg . norm # as it is faster , also don ' t square root here dist = np . dot ( ( points [ unvisited ] - current ) ** 2 , sum_ones ) # minimum distance index min_index = dist . argmin ( ) # successor is closest unvisited point successor = index_mask [ unvisited ] [ min_index ] # update the mask unvisited [ successor ] = False # store the index to the traversal traversal [ i + 1 ] = successor # store the distance distances [ i ] = dist [ min_index ] # we were comparing distance ^ 2 so take square root distances **= 0.5 return traversal , distances
def _run_dragonpy_cli ( self , * args ) : """Run DragonPy cli with given args . Add " - - verbosity " from GUI ."""
verbosity = self . frame_settings . var_verbosity . get ( ) verbosity_no = VERBOSITY_DICT2 [ verbosity ] log . debug ( "Verbosity: %i (%s)" % ( verbosity_no , verbosity ) ) args = ( "--verbosity" , "%s" % verbosity_no # " - - log _ list " , # " - - log " , # " dragonpy . components . cpu6809,40 " , # " dragonpy . Dragon32 . MC6821 _ PIA , 50 " , ) + args click . echo ( "\n" ) run_dragonpy ( * args , verbose = True )
def pso ( self , n_particles = 10 , n_iterations = 10 , lowerLimit = - 0.2 , upperLimit = 0.2 , threadCount = 1 , mpi = False , print_key = 'default' ) : """returns the best fit for the lense model on catalogue basis with particle swarm optimizer"""
init_pos = self . chain . get_args ( self . chain . kwargs_data_init ) num_param = self . chain . num_param lowerLimit = [ lowerLimit ] * num_param upperLimit = [ upperLimit ] * num_param if mpi is True : pso = MpiParticleSwarmOptimizer ( self . chain , lowerLimit , upperLimit , n_particles , threads = 1 ) else : pso = ParticleSwarmOptimizer ( self . chain , lowerLimit , upperLimit , n_particles , threads = threadCount ) if not init_pos is None : pso . gbest . position = init_pos pso . gbest . velocity = [ 0 ] * len ( init_pos ) pso . gbest . fitness , _ = self . chain . likelihood ( init_pos ) X2_list = [ ] vel_list = [ ] pos_list = [ ] time_start = time . time ( ) if pso . isMaster ( ) : print ( 'Computing the %s ...' % print_key ) num_iter = 0 for swarm in pso . sample ( n_iterations ) : X2_list . append ( pso . gbest . fitness * 2 ) vel_list . append ( pso . gbest . velocity ) pos_list . append ( pso . gbest . position ) num_iter += 1 if pso . isMaster ( ) : if num_iter % 10 == 0 : print ( num_iter ) if not mpi : result = pso . gbest . position else : result = MpiUtil . mpiBCast ( pso . gbest . position ) kwargs_data = self . chain . update_data ( result ) if mpi is True and not pso . isMaster ( ) : pass else : time_end = time . time ( ) print ( "Shifts found: " , result ) print ( time_end - time_start , 'time used for PSO' , print_key ) return kwargs_data , [ X2_list , pos_list , vel_list , [ ] ]
def refresh ( self ) : """refreshes a service"""
params = { "f" : "json" } uURL = self . _url + "/refresh" res = self . _get ( url = uURL , param_dict = params , securityHandler = self . _securityHandler , proxy_port = self . _proxy_port , proxy_url = self . _proxy_url ) self . __init ( ) return res
def run_fsm ( self , name , command , events , transitions , timeout , max_transitions = 20 ) : """Wrap the FSM code ."""
self . ctrl . send_command ( command ) return FSM ( name , self , events , transitions , timeout = timeout , max_transitions = max_transitions ) . run ( )
def convert_model_to_external_data ( model , all_tensors_to_one_file = True , location = None ) : # type : ( ModelProto , bool , Optional [ Text ] ) - > None """call to set all tensors as external data . save _ model saves all the tensors data as external data after calling this function . @ params model : ModelProto to be converted . all _ tensors _ to _ one _ file : If true , save all tensors to one external file specified by location . If false , save each tensor to a file named with the tensor name . location : specify the external file that all tensors to save to . If not specified , will use the model name ."""
if all_tensors_to_one_file : file_name = Text ( uuid . uuid1 ( ) ) if location : file_name = location for tensor in _get_all_tensors ( model ) : set_external_data ( tensor , file_name ) else : for tensor in _get_all_tensors ( model ) : set_external_data ( tensor , tensor . name )
def OutputDocumentFor ( objs , apply_theme = None , always_new = False ) : '''Find or create a ( possibly temporary ) Document to use for serializing Bokeh content . Typical usage is similar to : . . code - block : : python with OutputDocumentFor ( models ) : ( docs _ json , [ render _ item ] ) = standalone _ docs _ json _ and _ render _ items ( models ) Inside the context manager , the models will be considered to be part of a single Document , with any theme specified , which can thus be serialized as a unit . Where possible , OutputDocumentFor attempts to use an existing Document . However , this is not possible in three cases : * If passed a series of models that have no Document at all , a new Document will be created , and all the models will be added as roots . After the context manager exits , the new Document will continue to be the models ' document . * If passed a subset of Document . roots , then OutputDocumentFor temporarily " re - homes " the models in a new bare Document that is only available inside the context manager . * If passed a list of models that have differnet documents , then OutputDocumentFor temporarily " re - homes " the models in a new bare Document that is only available inside the context manager . OutputDocumentFor will also perfom document validation before yielding , if ` ` settings . perform _ document _ validation ( ) ` ` is True . objs ( seq [ Model ] ) : a sequence of Models that will be serialized , and need a common document apply _ theme ( Theme or FromCurdoc or None , optional ) : Sets the theme for the doc while inside this context manager . ( default : None ) If None , use whatever theme is on the document that is found or created If FromCurdoc , use curdoc ( ) . theme , restoring any previous theme afterwards If a Theme instance , use that theme , restoring any previous theme afterwards always _ new ( bool , optional ) : Always return a new document , even in cases where it is otherwise possible to use an existing document on models . Yields : Document'''
# Note : Comms handling relies on the fact that the new _ doc returned # has models with the same IDs as they were started with if not isinstance ( objs , collections_abc . Sequence ) or len ( objs ) == 0 or not all ( isinstance ( x , Model ) for x in objs ) : raise ValueError ( "OutputDocumentFor expects a sequence of Models" ) def finish ( ) : pass docs = set ( x . document for x in objs ) if None in docs : docs . remove ( None ) if always_new : def finish ( ) : # NOQA _dispose_temp_doc ( objs ) doc = _create_temp_doc ( objs ) else : if len ( docs ) == 0 : doc = Document ( ) for model in objs : doc . add_root ( model ) # handle a single shared document elif len ( docs ) == 1 : doc = docs . pop ( ) # we are not using all the roots , make a quick clone for outputting purposes if set ( objs ) != set ( doc . roots ) : def finish ( ) : # NOQA _dispose_temp_doc ( objs ) doc = _create_temp_doc ( objs ) # we are using all the roots of a single doc , just use doc as - is pass # models have mixed docs , just make a quick clone else : def finish ( ) : # NOQA _dispose_temp_doc ( objs ) doc = _create_temp_doc ( objs ) if settings . perform_document_validation ( ) : doc . validate ( ) _set_temp_theme ( doc , apply_theme ) yield doc _unset_temp_theme ( doc ) finish ( )
def _common_scan ( self , values_function , cursor = '0' , match = None , count = 10 , key = None ) : """Common scanning skeleton . : param key : optional function used to identify what ' match ' is applied to"""
if count is None : count = 10 cursor = int ( cursor ) count = int ( count ) if not count : raise ValueError ( 'if specified, count must be > 0: %s' % count ) values = values_function ( ) if cursor + count >= len ( values ) : # we reached the end , back to zero result_cursor = 0 else : result_cursor = cursor + count values = values [ cursor : cursor + count ] if match is not None : regex = re . compile ( b'^' + re . escape ( self . _encode ( match ) ) . replace ( b'\\*' , b'.*' ) + b'$' ) if not key : key = lambda v : v values = [ v for v in values if regex . match ( key ( v ) ) ] return [ result_cursor , values ]
def are_symmetrically_equivalent ( self , sites1 , sites2 , symm_prec = 1e-3 ) : """Given two sets of PeriodicSites , test if they are actually symmetrically equivalent under this space group . Useful , for example , if you want to test if selecting atoms 1 and 2 out of a set of 4 atoms are symmetrically the same as selecting atoms 3 and 4 , etc . One use is in PartialRemoveSpecie transformation to return only symmetrically distinct arrangements of atoms . Args : sites1 ( [ Site ] ) : 1st set of sites sites2 ( [ Site ] ) : 2nd set of sites symm _ prec ( float ) : Tolerance in atomic distance to test if atoms are symmetrically similar . Returns : ( bool ) : Whether the two sets of sites are symmetrically equivalent ."""
def in_sites ( site ) : for test_site in sites1 : if test_site . is_periodic_image ( site , symm_prec , False ) : return True return False for op in self : newsites2 = [ PeriodicSite ( site . species , op . operate ( site . frac_coords ) , site . lattice ) for site in sites2 ] for site in newsites2 : if not in_sites ( site ) : break else : return True return False
def can_resume ( self ) : """Test if the generator can be resumed , i . e . is not running or closed ."""
# TOCHECK relies on generator . gi _ frame # Equivalent to ` inspect . getgeneratorstate ( self . generator ) in # ( inspect . GEN _ CREATED , inspect . GEN _ SUSPENDED ) ` , # which is only available starting 3.2. gen = self . generator return ( gen is not None and not gen . gi_running and gen . gi_frame is not None )
def Instance ( expected , message = "Not an instance of {}" ) : """Creates a validator that checks if the given value is an instance of ` ` expected ` ` . A custom message can be specified with ` ` message ` ` ."""
@ wraps ( Instance ) def built ( value ) : if not isinstance ( value , expected ) : raise Error ( message . format ( expected . __name__ ) ) return value return built
def get_slotname ( slot , host = None , admin_username = None , admin_password = None ) : '''Get the name of a slot number in the chassis . slot The number of the slot for which to obtain the name . host The chassis host . admin _ username The username used to access the chassis . admin _ password The password used to access the chassis . CLI Example : . . code - block : : bash salt - call - - local dracr . get _ slotname 0 host = 111.222.333.444 admin _ username = root admin _ password = secret'''
slots = list_slotnames ( host = host , admin_username = admin_username , admin_password = admin_password ) # The keys for this dictionary are strings , not integers , so convert the # argument to a string slot = six . text_type ( slot ) return slots [ slot ] [ 'slotname' ]
def getinputfile ( self , outputfile , loadmetadata = True , client = None , requiremetadata = False ) : """Grabs one input file for the specified output filename ( raises a KeyError exception if there is no such output , StopIteration if there are no input files for it ) . Shortcut for getinputfiles ( )"""
if isinstance ( outputfile , CLAMOutputFile ) : outputfilename = str ( outputfile ) . replace ( os . path . join ( self . projectpath , 'output/' ) , '' ) else : outputfilename = outputfile if outputfilename not in self : raise KeyError ( "No such outputfile " + outputfilename ) try : return next ( self . getinputfiles ( outputfile , loadmetadata , client , requiremetadata ) ) except StopIteration : raise StopIteration ( "No input files for outputfile " + outputfilename )
def encode ( self , b64 = False , always_bytes = True ) : """Encode the packet for transmission ."""
if self . binary and not b64 : encoded_packet = six . int2byte ( self . packet_type ) else : encoded_packet = six . text_type ( self . packet_type ) if self . binary and b64 : encoded_packet = 'b' + encoded_packet if self . binary : if b64 : encoded_packet += base64 . b64encode ( self . data ) . decode ( 'utf-8' ) else : encoded_packet += self . data elif isinstance ( self . data , six . string_types ) : encoded_packet += self . data elif isinstance ( self . data , dict ) or isinstance ( self . data , list ) : encoded_packet += self . json . dumps ( self . data , separators = ( ',' , ':' ) ) elif self . data is not None : encoded_packet += str ( self . data ) if always_bytes and not isinstance ( encoded_packet , binary_types ) : encoded_packet = encoded_packet . encode ( 'utf-8' ) return encoded_packet
def _parse ( self , html ) : """Parse given string as HTML and return it ' s etree representation ."""
if self . _has_body_re . search ( html ) : tree = lxml . html . document_fromstring ( html ) . find ( './/body' ) self . has_body = True else : tree = lxml . html . fragment_fromstring ( html , create_parent = self . _root_tag ) if tree . tag != self . _root_tag : # ensure the root element exists even if not really needed , # so the tree has always the same structure root = lxml . html . HtmlElement ( ) root . tag = self . _root_tag root . append ( tree ) return root return tree
def _show_list_message ( resolved_config ) : """Show the message for when a user has passed in - - list ."""
# Show what ' s available . supported_programs = util . get_list_of_all_supported_commands ( resolved_config ) msg_line_1 = 'Legend: ' msg_line_2 = ( ' ' + util . FLAG_ONLY_CUSTOM + ' only custom files' ) msg_line_3 = ( ' ' + util . FLAG_CUSTOM_AND_DEFAULT + ' custom and default files' ) msg_line_4 = ' ' + ' only default files (no symbol)' msg_line_5 = '' msg_line_6 = 'Programs supported by eg: ' preamble = [ msg_line_1 , msg_line_2 , msg_line_3 , msg_line_4 , msg_line_5 , msg_line_6 ] complete_message = '\n' . join ( preamble ) complete_message += '\n' + '\n' . join ( supported_programs ) pydoc . pager ( complete_message )
def destroy ( self ) : """从服务器上删除这个对象 : rtype : None"""
if not self . id : return client . delete ( '/classes/{0}/{1}' . format ( self . _class_name , self . id ) , self . _flags )
def kmer_counter ( seq , k = 4 ) : """Return a sequence of all the unique substrings ( k - mer or q - gram ) within a short ( < 128 symbol ) string Used for algorithms like UniqTag for genome unique identifier locality sensitive hashing . jellyfish is a C implementation of k - mer counting If seq is a string generate a sequence of k - mer string If seq is a sequence of strings then generate a sequence of generators or sequences of k - mer strings If seq is a sequence of sequences of strings generate a sequence of sequence of generators . . . Default k = 4 because that ' s the length of a gene base - pair ? > > > kmer _ counter ( ' AGATAGATAGACACAGAAATGGGACCACAC ' ) = = Counter ( { ' ACAC ' : 2 , ' ATAG ' : 2 , ' CACA ' : 2, . . . ' TAGA ' : 2 , ' AGAT ' : 2 , ' GATA ' : 2 , ' AGAC ' : 1 , ' ACAG ' : 1 , ' AGAA ' : 1 , ' AAAT ' : 1 , ' TGGG ' : 1 , ' ATGG ' : 1, . . . ' ACCA ' : 1 , ' GGAC ' : 1 , ' CCAC ' : 1 , ' CAGA ' : 1 , ' GAAA ' : 1 , ' GGGA ' : 1 , ' GACA ' : 1 , ' GACC ' : 1 , ' AATG ' : 1 } ) True"""
if isinstance ( seq , basestring ) : return Counter ( generate_kmers ( seq , k ) )
def _tile_read ( src_dst , bounds , tilesize , indexes = None , nodata = None , resampling_method = "bilinear" ) : """Read data and mask . Attributes src _ dst : rasterio . io . DatasetReader rasterio . io . DatasetReader object bounds : list Mercator tile bounds ( left , bottom , right , top ) tilesize : int Output image size indexes : list of ints or a single int , optional , ( defaults : None ) If ` indexes ` is a list , the result is a 3D array , but is a 2D array if it is a band index number . nodata : int or float , optional ( defaults : None ) resampling _ method : str , optional ( default : " bilinear " ) Resampling algorithm Returns out : array , int returns pixel value ."""
if isinstance ( indexes , int ) : indexes = [ indexes ] elif isinstance ( indexes , tuple ) : indexes = list ( indexes ) vrt_params = dict ( add_alpha = True , crs = "epsg:3857" , resampling = Resampling [ resampling_method ] ) vrt_transform , vrt_width , vrt_height = get_vrt_transform ( src_dst , bounds ) vrt_params . update ( dict ( transform = vrt_transform , width = vrt_width , height = vrt_height ) ) indexes = indexes if indexes is not None else src_dst . indexes out_shape = ( len ( indexes ) , tilesize , tilesize ) nodata = nodata if nodata is not None else src_dst . nodata if nodata is not None : vrt_params . update ( dict ( nodata = nodata , add_alpha = False , src_nodata = nodata ) ) if has_alpha_band ( src_dst ) : vrt_params . update ( dict ( add_alpha = False ) ) with WarpedVRT ( src_dst , ** vrt_params ) as vrt : data = vrt . read ( out_shape = out_shape , indexes = indexes , resampling = Resampling [ resampling_method ] , ) mask = vrt . dataset_mask ( out_shape = ( tilesize , tilesize ) ) return data , mask
def crop_to_ratio ( self ) : "Get crop coordinates and perform the crop if we get any ."
crop_box = self . get_crop_box ( ) if not crop_box : return crop_box = self . center_important_part ( crop_box ) iw , ih = self . image . size # see if we want to crop something from outside of the image out_of_photo = min ( crop_box [ 0 ] , crop_box [ 1 ] ) < 0 or crop_box [ 2 ] > iw or crop_box [ 3 ] > ih # check whether there ' s transparent information in the image transparent = self . image . mode in ( 'RGBA' , 'LA' ) if photos_settings . DEFAULT_BG_COLOR != 'black' and out_of_photo and not transparent : # if we do , just crop the image to the portion that will be visible updated_crop_box = ( max ( 0 , crop_box [ 0 ] ) , max ( 0 , crop_box [ 1 ] ) , min ( iw , crop_box [ 2 ] ) , min ( ih , crop_box [ 3 ] ) , ) cropped = self . image . crop ( updated_crop_box ) # create new image of the proper size and color self . image = Image . new ( 'RGB' , ( crop_box [ 2 ] - crop_box [ 0 ] , crop_box [ 3 ] - crop_box [ 1 ] ) , photos_settings . DEFAULT_BG_COLOR ) # and paste the cropped part into it ' s proper position self . image . paste ( cropped , ( abs ( min ( crop_box [ 0 ] , 0 ) ) , abs ( min ( crop_box [ 1 ] , 0 ) ) ) ) else : # crop normally if not the case self . image = self . image . crop ( crop_box ) return crop_box
def write_psts ( self , prefix , existing_jco = None , noptmax = None ) : """write parameter and optionally observation realizations to a series of pest control files Parameters prefix : str pest control file prefix existing _ jco : str filename of an existing jacobian matrix to add to the pest + + options in the control file . This is useful for NSMC since this jco can be used to get the first set of parameter upgrades for free ! Needs to be the path the jco file as seen from the location where pest + + will be run noptmax : int value of NOPTMAX to set in new pest control files Example ` ` > > > import pyemu ` ` ` ` > > > mc = pyemu . MonteCarlo ( jco = " pest . jcb " ) ` ` ` ` > > > mc . draw ( 1000 , obs = True ) ` ` ` ` > > > mc . write _ psts ( " mc _ " , existing _ jco = " pest . jcb " , noptmax = 1 ) ` `"""
self . log ( "writing realized pest control files" ) # get a copy of the pest control file pst = self . pst . get ( par_names = self . pst . par_names , obs_names = self . pst . obs_names ) if noptmax is not None : pst . control_data . noptmax = noptmax pst . control_data . noptmax = noptmax if existing_jco is not None : pst . pestpp_options [ "BASE_JACOBIAN" ] = existing_jco # set the indices pst . parameter_data . index = pst . parameter_data . parnme pst . observation_data . index = pst . observation_data . obsnme if self . parensemble . istransformed : par_en = self . parensemble . _back_transform ( inplace = False ) else : par_en = self . parensemble for i in range ( self . num_reals ) : pst_name = prefix + "{0:d}.pst" . format ( i ) self . log ( "writing realized pest control file " + pst_name ) pst . parameter_data . loc [ par_en . columns , "parval1" ] = par_en . iloc [ i , : ] . T # reset the regularization # if pst . control _ data . pestmode = = " regularization " : # pst . zero _ order _ tikhonov ( parbounds = True ) # zero _ order _ tikhonov ( pst , parbounds = True ) # add the obs noise realization if needed if self . obsensemble . shape [ 0 ] == self . num_reals : pst . observation_data . loc [ self . obsensemble . columns , "obsval" ] = self . obsensemble . iloc [ i , : ] . T # write pst . write ( pst_name ) self . log ( "writing realized pest control file " + pst_name ) self . log ( "writing realized pest control files" )
def _check_is_max_context ( doc_spans , cur_span_index , position ) : """Check if this is the ' max context ' doc span for the token ."""
# Because of the sliding window approach taken to scoring documents , a single # token can appear in multiple documents . E . g . # Doc : the man went to the store and bought a gallon of milk # Span A : the man went to the # Span B : to the store and bought # Span C : and bought a gallon of # Now the word ' bought ' will have two scores from spans B and C . We only # want to consider the score with " maximum context " , which we define as # the * minimum * of its left and right context ( the * sum * of left and # right context will always be the same , of course ) . # In the example the maximum context for ' bought ' would be span C since # it has 1 left context and 3 right context , while span B has 4 left context # and 0 right context . best_score = None best_span_index = None for ( span_index , doc_span ) in enumerate ( doc_spans ) : end = doc_span . start + doc_span . length - 1 if position < doc_span . start : continue if position > end : continue num_left_context = position - doc_span . start num_right_context = end - position score = min ( num_left_context , num_right_context ) + 0.01 * doc_span . length if best_score is None or score > best_score : best_score = score best_span_index = span_index return cur_span_index == best_span_index
def check_permissions ( self , request ) : """Retrieves the controlled object and perform the permissions check ."""
obj = ( hasattr ( self , 'get_controlled_object' ) and self . get_controlled_object ( ) or hasattr ( self , 'get_object' ) and self . get_object ( ) or getattr ( self , 'object' , None ) ) user = request . user # Get the permissions to check perms = self . get_required_permissions ( self ) # Check permissions has_permissions = self . perform_permissions_check ( user , obj , perms ) if not has_permissions and not user . is_authenticated : return HttpResponseRedirect ( '{}?{}={}' . format ( resolve_url ( self . login_url ) , self . redirect_field_name , urlquote ( request . get_full_path ( ) ) ) ) elif not has_permissions : raise PermissionDenied
def importRootCertificate ( self , alias , rootCACertificate ) : """This operation imports a certificate authority ( CA ) ' s root and intermediate certificates into the keystore ."""
url = self . _url + "/sslcertificates/importRootOrIntermediate" files = { } files [ 'rootCACertificate' ] = rootCACertificate params = { "f" : "json" , "alias" : alias } return self . _post ( url = url , param_dict = params , securityHandler = self . _securityHandler , files = files , proxy_url = self . _proxy_url , proxy_port = self . _proxy_port )
def count_children ( obj , type = None ) : """Return the number of children of obj , optionally restricting by class"""
if type is None : return len ( obj ) else : # there doesn ' t appear to be any hdf5 function for getting this # information without inspecting each child , which makes this somewhat # slow return sum ( 1 for x in obj if obj . get ( x , getclass = True ) is type )
def preview_unmount ( self ) : """Returns a list of all commands that would be executed if the : func : ` unmount ` method would be called . Note : any system changes between calling this method and calling : func : ` unmount ` aren ' t listed by this command ."""
commands = [ ] for mountpoint in self . find_bindmounts ( ) : commands . append ( 'umount {0}' . format ( mountpoint ) ) for mountpoint in self . find_mounts ( ) : commands . append ( 'umount {0}' . format ( mountpoint ) ) commands . append ( 'rm -Rf {0}' . format ( mountpoint ) ) for vgname , pvname in self . find_volume_groups ( ) : commands . append ( 'lvchange -a n {0}' . format ( vgname ) ) commands . append ( 'losetup -d {0}' . format ( pvname ) ) for device in self . find_loopbacks ( ) : commands . append ( 'losetup -d {0}' . format ( device ) ) for mountpoint in self . find_base_images ( ) : commands . append ( 'fusermount -u {0}' . format ( mountpoint ) ) commands . append ( 'rm -Rf {0}' . format ( mountpoint ) ) for folder in self . find_clean_dirs ( ) : cmd = 'rm -Rf {0}' . format ( folder ) if cmd not in commands : commands . append ( cmd ) return commands
def printer ( data , depth = 0 ) : """Prepare data for printing . : param data : a data value that will be processed by method : param int depth : recurrency indicator , to maintain proper indent : returns : string with formatted config : rtype : str"""
indent = _INDENT * depth config_string = '' if not depth else ':\n' if isinstance ( data , dict ) : for key , val in data . items ( ) : line = '{0}{1}' . format ( indent , key ) values = printer ( val , depth + 1 ) if not values . count ( '\n' ) : values = ': {0}' . format ( values . lstrip ( ) ) line = '{line}{values}' . format ( line = line , values = values ) config_string += '{0}\n' . format ( line ) elif isinstance ( data , list ) : for elem in data : config_string += '{0} - {1}\n' . format ( indent , elem ) else : config_string = '{0}{1} ({2})' . format ( indent , data , data . __class__ . __name__ ) return config_string . rstrip ( '\n' )
def get_protocol ( handle : Handle , want_v2 : bool ) -> Protocol : """Make a Protocol instance for the given handle . Each transport can have a preference for using a particular protocol version . This preference is overridable through ` TREZOR _ PROTOCOL _ V1 ` environment variable , which forces the library to use V1 anyways . As of 11/2018 , no devices support V2 , so we enforce V1 here . It is still possible to set ` TREZOR _ PROTOCOL _ V1 = 0 ` and thus enable V2 protocol for transports that ask for it ( i . e . , USB transports for Trezor T ) ."""
force_v1 = int ( os . environ . get ( "TREZOR_PROTOCOL_V1" , 1 ) ) if want_v2 and not force_v1 : return ProtocolV2 ( handle ) else : return ProtocolV1 ( handle )
def delete_session ( sid_s ) : """Delete entries in the data - and kvsessionstore with the given sid _ s . On a successful deletion , the flask - kvsession store returns 1 while the sqlalchemy datastore returns None . : param sid _ s : The session ID . : returns : ` ` 1 ` ` if deletion was successful ."""
# Remove entries from sessionstore _sessionstore . delete ( sid_s ) # Find and remove the corresponding SessionActivity entry with db . session . begin_nested ( ) : SessionActivity . query . filter_by ( sid_s = sid_s ) . delete ( ) return 1
def fix_pdf ( pdf_file , destination ) : """Fix malformed pdf files when data are present after ' % % EOF ' . . note : : Originally from sciunto , https : / / github . com / sciunto / tear - pages : param pdfFile : PDF filepath : param destination : destination"""
tmp = tempfile . NamedTemporaryFile ( ) with open ( tmp . name , 'wb' ) as output : with open ( pdf_file , "rb" ) as fh : for line in fh : output . write ( line ) if b'%%EOF' in line : break shutil . copy ( tmp . name , destination )
def as_text ( self ) : '''Fetch and render all regions For search and test purposes just a prototype'''
from leonardo . templatetags . leonardo_tags import _render_content request = get_anonymous_request ( self ) content = '' try : for region in [ region . key for region in self . _feincms_all_regions ] : content += '' . join ( _render_content ( content , request = request , context = { } ) for content in getattr ( self . content , region ) ) except PermissionDenied : pass except Exception as e : LOG . exception ( e ) return content
def Parse ( self , cmd , args , stdout , stderr , return_val , time_taken , knowledge_base ) : """Parse the yum repolist output ."""
_ = stderr , time_taken , args , knowledge_base # Unused . self . CheckReturn ( cmd , return_val ) output = iter ( stdout . decode ( "utf-8" ) . splitlines ( ) ) repo_regexes = { "name" : self . _re_compile ( "Repo-name" ) , "revision" : self . _re_compile ( "Repo-revision" ) , "last_update" : self . _re_compile ( "Repo-updated" ) , "num_packages" : self . _re_compile ( "Repo-pkgs" ) , "size" : self . _re_compile ( "Repo-size" ) , "baseurl" : self . _re_compile ( "Repo-baseurl" ) , "timeout" : self . _re_compile ( "Repo-expire" ) } repo_id_re = self . _re_compile ( "Repo-id" ) for line in output : match = repo_id_re . match ( line ) if match : repo_info = rdf_client . PackageRepository ( ) setattr ( repo_info , "id" , match . group ( 1 ) . strip ( ) ) while line : for attr , regex in iteritems ( repo_regexes ) : match = regex . match ( line ) if match : setattr ( repo_info , attr , match . group ( 1 ) . strip ( ) ) break line = next ( output ) yield repo_info
def get_package_dir ( self , package ) : """Returns the directory , relative to the top of the source distribution , where package ` ` package ` ` should be found ( at least according to the : attr : ` package _ dir ` option , if any ) . Copied from : meth : ` distutils . command . build _ py . get _ package _ dir ( ) ` method ."""
path = package . split ( '.' ) if not self . package_dir : if path : return os . path . join ( * path ) return '' tail = [ ] while path : try : pdir = self . package_dir [ '.' . join ( path ) ] except KeyError : tail . insert ( 0 , path [ - 1 ] ) del path [ - 1 ] else : tail . insert ( 0 , pdir ) return os . path . join ( * tail ) else : pdir = self . package_dir . get ( '' ) if pdir is not None : tail . insert ( 0 , pdir ) if tail : return os . path . join ( * tail ) return ''
def run_band_structure ( self , paths , with_eigenvectors = False , with_group_velocities = False , is_band_connection = False , path_connections = None , labels = None , is_legacy_plot = False ) : """Run phonon band structure calculation . Parameters paths : List of array _ like Sets of qpoints that can be passed to phonopy . set _ band _ structure ( ) . Numbers of qpoints can be different . shape of each array _ like : ( qpoints , 3) with _ eigenvectors : bool , optional Flag whether eigenvectors are calculated or not . Default is False . with _ group _ velocities : bool , optional Flag whether group velocities are calculated or not . Default is False . is _ band _ connection : bool , optional Flag whether each band is connected or not . This is achieved by comparing similarity of eigenvectors of neghboring poins . Sometimes this fails . Default is False . path _ connections : List of bool , optional This is only used in graphical plot of band structure and gives whether each path is connected to the next path or not , i . e . , if False , there is a jump of q - points . Number of elements is the same at that of paths . Default is None . labels : List of str , optional This is only used in graphical plot of band structure and gives labels of end points of each path . The number of labels is equal to ( 2 - np . array ( path _ connections ) ) . sum ( ) . is _ legacy _ plot : bool , optional This makes the old style band structure plot . Default is False ."""
if self . _dynamical_matrix is None : msg = ( "Dynamical matrix has not yet built." ) raise RuntimeError ( msg ) if with_group_velocities : if self . _group_velocity is None : self . _set_group_velocity ( ) group_velocity = self . _group_velocity else : group_velocity = None self . _band_structure = BandStructure ( paths , self . _dynamical_matrix , with_eigenvectors = with_eigenvectors , is_band_connection = is_band_connection , group_velocity = group_velocity , path_connections = path_connections , labels = labels , is_legacy_plot = is_legacy_plot , factor = self . _factor )
def writeline ( self , data ) : """Writes data to serial port . : param data : Data to write : return : Nothing : raises : IOError if SerialException occurs ."""
try : if self . ch_mode : data += "\n" parts = split_by_n ( data , self . ch_mode_chunk_size ) for split_str in parts : self . port . write ( split_str . encode ( ) ) time . sleep ( self . ch_mode_ch_delay ) else : self . port . write ( ( data + "\n" ) . encode ( ) ) except SerialException as err : self . logger . exception ( "SerialError occured while trying to write data {}." . format ( data ) ) raise RuntimeError ( str ( err ) )
def QA_fetch_stock_block_adv ( code = None , blockname = None , collections = DATABASE . stock_block ) : '''返回板块 ❌ : param code : : param blockname : : param collections : 默认数据库 stock _ block : return : QA _ DataStruct _ Stock _ block'''
if code is not None and blockname is None : # 返回这个股票代码所属的板块 data = pd . DataFrame ( [ item for item in collections . find ( { 'code' : { '$in' : code } } ) ] ) data = data . drop ( [ '_id' ] , axis = 1 ) return QA_DataStruct_Stock_block ( data . set_index ( [ 'blockname' , 'code' ] , drop = True ) . drop_duplicates ( ) ) elif blockname is not None and code is None : # 🛠 todo fnished 返回 这个板块所有的股票 # 返回该板块所属的股票 # print ( " QA Error blockname is Not none code none , return all code from its block name have not implemented yet ! " ) items_from_collections = [ item for item in collections . find ( { 'blockname' : re . compile ( blockname ) } ) ] data = pd . DataFrame ( items_from_collections ) . drop ( [ '_id' ] , axis = 1 ) data_set_index = data . set_index ( [ 'blockname' , 'code' ] , drop = True ) return QA_DataStruct_Stock_block ( data_set_index ) else : # 🛠 todo 返回 判断 这个股票是否和属于该板块 data = pd . DataFrame ( [ item for item in collections . find ( ) ] ) . drop ( [ '_id' ] , axis = 1 ) data_set_index = data . set_index ( [ 'blockname' , 'code' ] , drop = True ) return QA_DataStruct_Stock_block ( data_set_index )
def get_search_schema ( self , schema ) : """Fetch a Solr schema from Yokozuna . : param schema : name of Solr schema : type schema : string : rtype dict"""
if not self . yz_wm_schema : raise NotImplementedError ( "Search 2.0 administration is not " "supported for this version" ) url = self . search_schema_path ( schema ) # Run the request . . . status , _ , body = self . _request ( 'GET' , url ) if status == 200 : result = { } result [ 'name' ] = schema result [ 'content' ] = bytes_to_str ( body ) return result else : raise RiakError ( 'Error getting Search 2.0 schema.' )
def replace_by_key ( pif , key , subs , new_key = None , remove = False ) : """Replace values that match a key Deeply traverses the pif object , looking for ` key ` and replacing values in accordance with ` subs ` . If ` new _ key ` is set , the replaced values are assigned to that key . If ` remove ` is ` True ` , the old ` key ` pairs are removed ."""
if not new_key : new_key = key remove = False orig = pif . as_dictionary ( ) new = _recurse_replace ( orig , to_camel_case ( key ) , to_camel_case ( new_key ) , subs , remove ) return pypif . pif . loads ( json . dumps ( new ) )
def _format_metric_name ( self , m_name , cfunc ) : '''Format a cacti metric name into a Datadog - friendly name'''
try : aggr = CFUNC_TO_AGGR [ cfunc ] except KeyError : aggr = cfunc . lower ( ) try : m_name = CACTI_TO_DD [ m_name ] if aggr != 'avg' : m_name += '.{}' . format ( aggr ) return m_name except KeyError : return "cacti.{}.{}" . format ( m_name . lower ( ) , aggr )
def check_page ( fn ) : "Decorator to protect drawing methods"
@ wraps ( fn ) def wrapper ( self , * args , ** kwargs ) : if not self . page and not kwargs . get ( 'split_only' ) : self . error ( "No page open, you need to call add_page() first" ) else : return fn ( self , * args , ** kwargs ) return wrapper
def sys_prefix ( self ) : """The prefix run inside the context of the environment : return : The python prefix inside the environment : rtype : : data : ` sys . prefix `"""
command = [ self . python , "-c" "import sys; print(sys.prefix)" ] c = vistir . misc . run ( command , return_object = True , block = True , nospin = True , write_to_stdout = False ) sys_prefix = vistir . compat . Path ( vistir . misc . to_text ( c . out ) . strip ( ) ) . as_posix ( ) return sys_prefix
def get_connection ( cls , pid , connection ) : """Return the specified : class : ` ~ queries . pool . Connection ` from the pool . : param str pid : The pool ID : param connection : The connection to return for : type connection : psycopg2 . extensions . connection : rtype : queries . pool . Connection"""
with cls . _lock : return cls . _pools [ pid ] . connection_handle ( connection )
def str2int ( self , str_value ) : """Conversion class name string = > integer ."""
str_value = tf . compat . as_text ( str_value ) if self . _str2int : return self . _str2int [ str_value ] # No names provided , try to integerize failed_parse = False try : int_value = int ( str_value ) except ValueError : failed_parse = True if failed_parse or not 0 <= int_value < self . _num_classes : raise ValueError ( "Invalid string class label %s" % str_value ) return int_value
def encode ( val ) : """Encode a string assuming the encoding is UTF - 8. : param : a unicode or bytes object : returns : bytes"""
if isinstance ( val , ( list , tuple ) ) : # encode a list or tuple of strings return [ encode ( v ) for v in val ] elif isinstance ( val , str ) : return val . encode ( 'utf-8' ) else : # assume it was an already encoded object return val
def connect_gs ( gs_access_key_id = None , gs_secret_access_key = None , ** kwargs ) : """@ type gs _ access _ key _ id : string @ param gs _ access _ key _ id : Your Google Cloud Storage Access Key ID @ type gs _ secret _ access _ key : string @ param gs _ secret _ access _ key : Your Google Cloud Storage Secret Access Key @ rtype : L { GSConnection < boto . gs . connection . GSConnection > } @ return : A connection to Google ' s Storage service"""
from boto . gs . connection import GSConnection return GSConnection ( gs_access_key_id , gs_secret_access_key , ** kwargs )
def get_option_names ( self ) : """returns a list of fully qualified option names . returns : a list of strings representing the Options in the source Namespace list . Each item will be fully qualified with dot delimited Namespace names ."""
return [ x for x in self . option_definitions . keys_breadth_first ( ) if isinstance ( self . option_definitions [ x ] , Option ) ]
def __fa_process_sequence ( self , sequence , avoid , initial_state , execution_state , trace_current , next_addr ) : """Process a REIL sequence . Args : sequence ( ReilSequence ) : A REIL sequence to process . avoid ( list ) : List of address to avoid . initial _ state : Initial state . execution _ state : Execution state queue . trace _ current ( list ) : Current trace . next _ addr : Address of the next instruction following the current one . Returns : Returns the next instruction to execute in case there is one , otherwise returns None ."""
# TODO : Process execution intra states . ip = sequence . address next_ip = None while ip : # Fetch next instruction in the sequence . try : instr = sequence . fetch ( ip ) except ReilSequenceInvalidAddressError : # At this point , ip should be a native instruction address , therefore # the index should be zero . assert split_address ( ip ) [ 1 ] == 0x0 next_ip = ip break try : target_addr = sequence . get_next_address ( ip ) except ReilSequenceInvalidAddressError : # We reached the end of the sequence . Execution continues on the next native instruction # ( it ' s a REIL address ) . target_addr = next_addr next_ip = self . __process_instr ( instr , avoid , target_addr , initial_state , execution_state , trace_current ) # Update instruction pointer . try : ip = next_ip if next_ip else sequence . get_next_address ( ip ) except ReilSequenceInvalidAddressError : break return next_ip
def increase_and_check_counter ( self ) : '''increase counter by one and check whether a period is end'''
self . counter += 1 self . counter %= self . period if not self . counter : return True else : return False
def save_conf ( fn = None ) : """Save current configuration to file as YAML If not given , uses current config directory , ` ` confdir ` ` , which can be set by INTAKE _ CONF _ DIR ."""
if fn is None : fn = cfile ( ) try : os . makedirs ( os . path . dirname ( fn ) ) except ( OSError , IOError ) : pass with open ( fn , 'w' ) as f : yaml . dump ( conf , f )
def answerShippingQuery ( self , shipping_query_id , ok , shipping_options = None , error_message = None ) : """See : https : / / core . telegram . org / bots / api # answershippingquery"""
p = _strip ( locals ( ) ) return self . _api_request ( 'answerShippingQuery' , _rectify ( p ) )
def _determine_tool ( files ) : """Yields tuples in the form of ( linker file , tool the file links for"""
for file in files : linker_ext = file . split ( '.' ) [ - 1 ] if "sct" in linker_ext or "lin" in linker_ext : yield ( str ( file ) , "uvision" ) elif "ld" in linker_ext : yield ( str ( file ) , "make_gcc_arm" ) elif "icf" in linker_ext : yield ( str ( file ) , "iar_arm" )
def decrypt ( self , encryption_key , iv , encrypted_data ) : """Decrypt encrypted subtitle data @ param int subtitle _ id @ param str iv @ param str encrypted _ data @ return str"""
logger . info ( 'Decrypting subtitles with length (%d bytes), key=%r' , len ( encrypted_data ) , encryption_key ) return zlib . decompress ( aes_decrypt ( encryption_key , iv , encrypted_data ) )
def _ISO8601_to_UNIXtime ( iso ) : """Converts an ISO8601 - formatted string in the format ` ` YYYY - MM - DD HH : MM : SS + 00 ` ` to the correspondant UNIXtime : param iso : the ISO8601 - formatted string : type iso : string : returns : an int UNIXtime : raises : * TypeError * when bad argument types are provided , * ValueError * when the ISO8601 string is badly formatted"""
try : d = datetime . strptime ( iso , '%Y-%m-%d %H:%M:%S+00' ) except ValueError : raise ValueError ( __name__ + ": bad format for input ISO8601 string, ' \ 'should have been: YYYY-MM-DD HH:MM:SS+00" ) return _datetime_to_UNIXtime ( d )
def update ( self , weight = values . unset , priority = values . unset , enabled = values . unset , friendly_name = values . unset , sip_url = values . unset ) : """Update the OriginationUrlInstance : param unicode weight : The value that determines the relative load the URI should receive compared to others with the same priority : param unicode priority : The relative importance of the URI : param bool enabled : Whether the URL is enabled : param unicode friendly _ name : A string to describe the resource : param unicode sip _ url : The SIP address you want Twilio to route your Origination calls to : returns : Updated OriginationUrlInstance : rtype : twilio . rest . trunking . v1 . trunk . origination _ url . OriginationUrlInstance"""
return self . _proxy . update ( weight = weight , priority = priority , enabled = enabled , friendly_name = friendly_name , sip_url = sip_url , )
def collect_garbage ( ) : '''Completely removed all currently ' uninstalled ' packages in the nix store . Tells the user how many store paths were removed and how much space was freed . : return : How much space was freed and how many derivations were removed : rtype : str . . warning : : This is a destructive action on the nix store . . . code - block : : bash salt ' * ' nix . collect _ garbage'''
cmd = _nix_collect_garbage ( ) cmd . append ( '--delete-old' ) out = _run ( cmd ) return out [ 'stdout' ] . splitlines ( )
def openflow_controller_connection_address_active_controller_vrf ( self , ** kwargs ) : """Auto Generated Code"""
config = ET . Element ( "config" ) openflow_controller = ET . SubElement ( config , "openflow-controller" , xmlns = "urn:brocade.com:mgmt:brocade-openflow" ) controller_name_key = ET . SubElement ( openflow_controller , "controller-name" ) controller_name_key . text = kwargs . pop ( 'controller_name' ) connection_address = ET . SubElement ( openflow_controller , "connection-address" ) active_controller_vrf = ET . SubElement ( connection_address , "active-controller-vrf" ) active_controller_vrf . text = kwargs . pop ( 'active_controller_vrf' ) callback = kwargs . pop ( 'callback' , self . _callback ) return callback ( config )
def add_timedelta ( self , delta ) : """Add timedelta duration to the instance . : param delta : The timedelta instance : type delta : datetime . timedelta : rtype : Time"""
if delta . days : raise TypeError ( "Cannot add timedelta with days to Time." ) return self . add ( seconds = delta . seconds , microseconds = delta . microseconds )
def get_game ( self , name ) : """Get the game instance for a game name : param name : the name of the game : type name : : class : ` str ` : returns : the game instance : rtype : : class : ` models . Game ` | None : raises : None"""
games = self . search_games ( query = name , live = False ) for g in games : if g . name == name : return g
def main ( ) : """Main method ."""
args = parse_cmd_arguments ( ) html_file = args . file try : json . loads ( args . add_tags or '{}' ) json . loads ( args . exc_tags or '{}' ) except ValueError : print ( '\033[91m' + 'Invalid json string: please provide a valid json ' 'string e.g {}' . format ( '\'{"img": "data-url"}\'' ) + '\033[0m' ) sys . exit ( 1 ) staticfied = staticfy ( html_file , args = args ) . encode ( 'utf-8' ) file_ops ( staticfied , args = args )
def main ( gi , ranges ) : """Print the features of the genbank entry given by gi . If ranges is non - emtpy , only print features that include the ranges . gi : either a hit from a BLAST record , in the form ' gi | 63148399 | gb | DQ011818.1 | ' or a gi number ( 63148399 in this example ) . ranges : a possibly empty list of ranges to print information for . Each range is a non - descending ( start , end ) pair of integers ."""
# TODO : Make it so we can pass a ' db ' argument to getSequence . record = getSequence ( gi ) if record is None : print ( "Looks like you're offline." ) sys . exit ( 3 ) else : printed = set ( ) if ranges : for ( start , end ) in ranges : for index , feature in enumerate ( record . features ) : if ( start < int ( feature . location . end ) and end > int ( feature . location . start ) and index not in printed ) : print ( feature ) printed . add ( index ) else : # Print all features . for feature in record . features : print ( feature )
def _split_variables ( variables ) : """Split variables into always passed ( std ) and specified ( file ) . We always pass some variables to each step but need to explicitly define file and algorithm variables so they can be linked in as needed ."""
file_vs = [ ] std_vs = [ ] for v in variables : cur_type = v [ "type" ] while isinstance ( cur_type , dict ) : if "items" in cur_type : cur_type = cur_type [ "items" ] else : cur_type = cur_type [ "type" ] if ( cur_type in [ "File" , "null" , "record" ] or ( isinstance ( cur_type , ( list , tuple ) ) and ( "File" in cur_type or { 'items' : 'File' , 'type' : 'array' } in cur_type ) ) ) : file_vs . append ( v ) elif v [ "id" ] in ALWAYS_AVAILABLE : std_vs . append ( v ) else : file_vs . append ( v ) return file_vs , std_vs
def update_metric ( self , metric , labels , pre_sliced = False ) : """Update evaluation metric with label and current outputs ."""
for current_exec , ( texec , islice ) in enumerate ( zip ( self . train_execs , self . slices ) ) : if not pre_sliced : labels_slice = [ label [ islice ] for label in labels ] else : labels_slice = labels [ current_exec ] metric . update ( labels_slice , texec . outputs )
def sent_tokenize ( self , text , ** kwargs ) : """NLTK ' s sentence tokenizer ( currently PunktSentenceTokenizer ) . Uses an unsupervised algorithm to build a model for abbreviation words , collocations , and words that start sentences , then uses that to find sentence boundaries ."""
sentences = self . sent_tok . tokenize ( text , realign_boundaries = kwargs . get ( "realign_boundaries" , True ) ) return sentences
def cli_certify_complex_dict ( config , schema , key_certifier , value_certifier , allow_extra , include_collections , value , ) : """Console script for certify _ dict ."""
schema = load_json_pickle ( schema , config ) key_certifier = create_certifier ( load_json_pickle ( key_certifier , config ) ) value_certifier = create_certifier ( load_json_pickle ( value_certifier , config ) ) execute_cli_command ( 'dict' , config , lambda x : load_json_pickle ( x , config ) , certify_dict , value , allow_extra = allow_extra , include_collections = include_collections , key_certifier = key_certifier , required = config [ 'required' ] , schema = schema , value_certifier = value_certifier , )
def data_and_labels ( self ) : """Dataset features and labels in a matrix form for learning . Also returns sample _ ids in the same order . Returns data _ matrix : ndarray 2D array of shape [ num _ samples , num _ features ] with features corresponding row - wise to sample _ ids labels : ndarray Array of numeric labels for each sample corresponding row - wise to sample _ ids sample _ ids : list List of sample ids"""
sample_ids = np . array ( self . keys ) label_dict = self . labels matrix = np . full ( [ self . num_samples , self . num_features ] , np . nan ) labels = np . full ( [ self . num_samples , 1 ] , np . nan ) for ix , sample in enumerate ( sample_ids ) : matrix [ ix , : ] = self . __data [ sample ] labels [ ix ] = label_dict [ sample ] return matrix , np . ravel ( labels ) , sample_ids
def get_num_shards ( num_samples : int , samples_per_shard : int , min_num_shards : int ) -> int : """Returns the number of shards . : param num _ samples : Number of training data samples . : param samples _ per _ shard : Samples per shard . : param min _ num _ shards : Minimum number of shards . : return : Number of shards ."""
return max ( int ( math . ceil ( num_samples / samples_per_shard ) ) , min_num_shards )
def PopupGetFile ( message , default_path = '' , default_extension = '' , save_as = False , file_types = ( ( "ALL Files" , "*.*" ) , ) , no_window = False , size = ( None , None ) , button_color = None , background_color = None , text_color = None , icon = DEFAULT_WINDOW_ICON , font = None , no_titlebar = False , grab_anywhere = False , keep_on_top = False , location = ( None , None ) , initial_folder = None ) : """Display popup with text entry field and browse button . Browse for file : param message : : param default _ path : : param default _ extension : : param save _ as : : param file _ types : : param no _ window : : param size : : param button _ color : : param background _ color : : param text _ color : : param icon : : param font : : param no _ titlebar : : param grab _ anywhere : : param keep _ on _ top : : param location : : return : string representing the path chosen , None if cancelled or window closed with X"""
global _my_windows if no_window : if _my_windows . NumOpenWindows : root = tk . Toplevel ( ) else : root = tk . Tk ( ) try : root . attributes ( '-alpha' , 0 ) # hide window while building it . makes for smoother ' paint ' except : pass if save_as : filename = tk . filedialog . asksaveasfilename ( filetypes = file_types , defaultextension = default_extension ) # show the ' get file ' dialog box else : filename = tk . filedialog . askopenfilename ( filetypes = file_types , defaultextension = default_extension ) # show the ' get file ' dialog box root . destroy ( ) return filename browse_button = SaveAs ( file_types = file_types , initial_folder = initial_folder ) if save_as else FileBrowse ( file_types = file_types , initial_folder = initial_folder ) layout = [ [ Text ( message , auto_size_text = True , text_color = text_color , background_color = background_color ) ] , [ InputText ( default_text = default_path , size = size ) , browse_button ] , [ Button ( 'Ok' , size = ( 6 , 1 ) , bind_return_key = True ) , Button ( 'Cancel' , size = ( 6 , 1 ) ) ] ] window = Window ( title = message , icon = icon , auto_size_text = True , button_color = button_color , font = font , background_color = background_color , no_titlebar = no_titlebar , grab_anywhere = grab_anywhere , keep_on_top = keep_on_top , location = location ) ( button , input_values ) = window . Layout ( layout ) . Read ( ) window . Close ( ) if button != 'Ok' : return None else : path = input_values [ 0 ] return path
def _send_packet ( self , sid , pkt ) : """Send a Socket . IO packet to a client ."""
encoded_packet = pkt . encode ( ) if isinstance ( encoded_packet , list ) : binary = False for ep in encoded_packet : self . eio . send ( sid , ep , binary = binary ) binary = True else : self . eio . send ( sid , encoded_packet , binary = False )
def pmap ( func , args , processes = None , callback = lambda * _ , ** __ : None , ** kwargs ) : """pmap ( func , args , processes = None , callback = do _ nothing , * * kwargs ) Parallel equivalent of ` ` map ( func , args ) ` ` , with the additional ability of providing keyword arguments to func , and a callback function which is applied to each element in the returned list . Unlike map , the output is a non - lazy list . If * processes * is 1 , no thread pool is used . * * Parameters * * func : function The function to map . args : iterable The arguments to map * func * over . processes : int or None , optional The number of processes in the thread pool . If only 1 , no thread pool is used to avoid useless overhead . If None , the number is chosen based on your system by : class : ` multiprocessing . Pool ` ( default None ) . callback : function , optional Function to call on the return value of ` ` func ( arg ) ` ` for each * arg * in * args * ( default do _ nothing ) . kwargs : dict Extra keyword arguments are unpacked in each call of * func * . * * Returns * * results : list A list equivalent to ` ` [ func ( x , * * kwargs ) for x in args ] ` ` ."""
if processes is 1 : results = [ ] for arg in args : result = func ( arg , ** kwargs ) results . append ( result ) callback ( result ) return results else : with Pool ( ) if processes is None else Pool ( processes ) as p : results = [ p . apply_async ( func , ( arg , ) , kwargs , callback ) for arg in args ] return [ result . get ( ) for result in results ]
def extender ( path = None , cache = None ) : """A context that temporarily extends sys . path and reverts it after the context is complete ."""
old_path = sys . path [ : ] extend ( path , cache = None ) try : yield finally : sys . path = old_path
def check_for_completion ( self ) : """Check once for completion of the job and return completion status and result if it has completed . If the job completed in error , an : exc : ` ~ zhmcclient . HTTPError ` exception is raised . Returns : : A tuple ( status , result ) with : * status ( : term : ` string ` ) : Completion status of the job , as returned in the ` ` status ` ` field of the response body of the " Query Job Status " HMC operation , as follows : * ` ` " complete " ` ` : Job completed ( successfully ) . * any other value : Job is not yet complete . * result ( : term : ` json object ` or ` None ` ) : ` None ` for incomplete jobs . For completed jobs , the result of the original asynchronous operation that was performed by the job , from the ` ` job - results ` ` field of the response body of the " Query Job Status " HMC operation . That result is a : term : ` json object ` as described for the asynchronous operation , or ` None ` if the operation has no result . Raises : : exc : ` ~ zhmcclient . HTTPError ` : The job completed in error , or the job status cannot be retrieved , or the job cannot be deleted . : exc : ` ~ zhmcclient . ParseError ` : exc : ` ~ zhmcclient . ClientAuthError ` : exc : ` ~ zhmcclient . ServerAuthError ` : exc : ` ~ zhmcclient . ConnectionError `"""
job_result_obj = self . session . get ( self . uri ) job_status = job_result_obj [ 'status' ] if job_status == 'complete' : self . session . delete ( self . uri ) op_status_code = job_result_obj [ 'job-status-code' ] if op_status_code in ( 200 , 201 ) : op_result_obj = job_result_obj . get ( 'job-results' , None ) elif op_status_code == 204 : # No content op_result_obj = None else : error_result_obj = job_result_obj . get ( 'job-results' , None ) if not error_result_obj : message = None elif 'message' in error_result_obj : message = error_result_obj [ 'message' ] elif 'error' in error_result_obj : message = error_result_obj [ 'error' ] else : message = None error_obj = { 'http-status' : op_status_code , 'reason' : job_result_obj [ 'job-reason-code' ] , 'message' : message , 'request-method' : self . op_method , 'request-uri' : self . op_uri , } raise HTTPError ( error_obj ) else : op_result_obj = None return job_status , op_result_obj
def _fw_rule_update ( self , drvr_name , data ) : """Firewall Rule update routine . Function to decode the updated rules and call routines that in turn calls the device routines to update rules ."""
LOG . debug ( "FW Update %s" , data ) tenant_id = data . get ( 'firewall_rule' ) . get ( 'tenant_id' ) fw_rule = data . get ( 'firewall_rule' ) rule = self . _fw_rule_decode_store ( data ) rule_id = fw_rule . get ( 'id' ) if tenant_id not in self . fwid_attr or not ( self . fwid_attr [ tenant_id ] . is_rule_present ( rule_id ) ) : LOG . error ( "Incorrect update info for tenant %s" , tenant_id ) return self . fwid_attr [ tenant_id ] . rule_update ( rule_id , rule ) self . _check_update_fw ( tenant_id , drvr_name )
def pretty_xml ( data ) : """Return a pretty formated xml"""
parsed_string = minidom . parseString ( data . decode ( 'utf-8' ) ) return parsed_string . toprettyxml ( indent = '\t' , encoding = 'utf-8' )
def get_or_create_home_repo ( reset = False ) : """Check to make sure we never operate with a non - existing local repo"""
dosetup = True if os . path . exists ( ONTOSPY_LOCAL ) : dosetup = False if reset : import shutil var = input ( "Delete the local library and all of its contents? (y/n) " ) if var == "y" : shutil . rmtree ( ONTOSPY_LOCAL ) dosetup = True else : pass if dosetup or not ( os . path . exists ( ONTOSPY_LOCAL ) ) : os . mkdir ( ONTOSPY_LOCAL ) if dosetup or not ( os . path . exists ( ONTOSPY_LOCAL_CACHE ) ) : # print " HERE " os . makedirs ( ONTOSPY_LOCAL_CACHE ) if dosetup or not ( os . path . exists ( ONTOSPY_LOCAL_VIZ ) ) : os . mkdir ( ONTOSPY_LOCAL_VIZ ) if dosetup or not ( os . path . exists ( ONTOSPY_LIBRARY_DEFAULT ) ) : os . mkdir ( ONTOSPY_LIBRARY_DEFAULT ) LIBRARY_HOME = get_home_location ( ) # from init file , or default # check that the local library folder exists , otherwise prompt user to create it if not ( os . path . exists ( LIBRARY_HOME ) ) : printDebug ( "Warning: the local library at '%s' has been deleted or is not accessible anymore." % LIBRARY_HOME , "important" ) printDebug ( "Please reset the local library by running 'ontospy-manager -u <a-valid-path>'" , "comment" ) raise SystemExit ( 1 ) if dosetup : print ( Fore . GREEN + "Setup successfull: local library created at <%s>" % LIBRARY_HOME + Style . RESET_ALL ) # else : # print ( Style . DIM + " Local library : < % s > " % LIBRARY _ HOME + Style . RESET _ ALL ) return True
def close_file ( self ) : """Closes the editor file . : return : Method success . : rtype : bool"""
if not self . is_modified ( ) : LOGGER . debug ( "> Closing '{0}' file." . format ( self . __file ) ) self . file_closed . emit ( ) return True choice = message_box . message_box ( "Warning" , "Warning" , "'{0}' document has been modified!\nWould you like to save your changes?" . format ( self . get_file_short_name ( ) ) , buttons = QMessageBox . Save | QMessageBox . Discard | QMessageBox . Cancel ) if choice == QMessageBox . Save : if self . save_file ( ) : LOGGER . debug ( "> Closing '{0}' file." . format ( self . __file ) ) return True elif choice == QMessageBox . Discard : LOGGER . debug ( "> Discarding '{0}' file." . format ( self . __file ) ) self . file_closed . emit ( ) return True else : return False
def _create_update_tracking_related_event ( instance ) : """Create a TrackingEvent and TrackedFieldModification for an UPDATE event for each related model ."""
events = { } # Create a dict mapping related model field to modified fields for field , related_fields in instance . _tracked_related_fields . items ( ) : if not isinstance ( instance . _meta . get_field ( field ) , ManyToManyField ) : if isinstance ( instance . _meta . get_field ( field ) , ForeignKey ) : # Compare pk value = getattr ( instance , '{0}_id' . format ( field ) ) else : value = getattr ( instance , field ) if instance . _original_fields [ field ] != value : for related_field in related_fields : events . setdefault ( related_field , [ ] ) . append ( field ) # Create the events from the events dict for related_field , fields in events . items ( ) : try : related_instances = getattr ( instance , related_field [ 1 ] ) except ObjectDoesNotExist : continue # FIXME : isinstance ( related _ instances , RelatedManager ? ) if hasattr ( related_instances , 'all' ) : related_instances = related_instances . all ( ) else : related_instances = [ related_instances ] for related_instance in related_instances : event = _create_event ( related_instance , UPDATE ) for field in fields : fieldname = '{0}__{1}' . format ( related_field [ 0 ] , field ) _create_tracked_field ( event , instance , field , fieldname = fieldname )
def is_expired_token ( self , client ) : """For a given client will test whether or not the token has expired . This is for testing a client object and does not look up from client _ id . You can use _ get _ client _ from _ cache ( ) to lookup a client from client _ id ."""
if 'expires' not in client : return True expires = dateutil . parser . parse ( client [ 'expires' ] ) if expires < datetime . datetime . now ( ) : return True return False
def utf8 ( value ) : r"""Check that the string is UTF - 8 . Returns an encode bytestring . > > > utf8 ( b ' \ xe0 ' ) # doctest : + ELLIPSIS Traceback ( most recent call last ) : ValueError : Not UTF - 8 : . . ."""
try : if isinstance ( value , bytes ) : return value . decode ( 'utf-8' ) else : return value except Exception : raise ValueError ( 'Not UTF-8: %r' % value )
def fetch_job ( config ) : '''Fetch any available work from the OpenSubmit server and return an according job object . Returns None if no work is available . Errors are reported by this function directly .'''
url = "%s/jobs/?Secret=%s&UUID=%s" % ( config . get ( "Server" , "url" ) , config . get ( "Server" , "secret" ) , config . get ( "Server" , "uuid" ) ) try : # Fetch information from server result = urlopen ( url ) headers = result . info ( ) logger . debug ( "Raw job data: " + str ( result . headers ) . replace ( '\n' , ', ' ) ) if not compatible_api_version ( headers [ "APIVersion" ] ) : # No proper reporting possible , so only logging . logger . error ( "Incompatible API version. Please update OpenSubmit." ) return None if headers [ "Action" ] == "get_config" : # The server does not know us , # so it demands registration before hand . logger . info ( "Machine unknown on server, sending registration ..." ) send_hostinfo ( config ) return None # Create job object with information we got from . job import Job job = Job ( config ) job . submitter_name = headers [ 'SubmitterName' ] job . author_names = headers [ 'AuthorNames' ] job . submitter_studyprogram = headers [ 'SubmitterStudyProgram' ] job . course = headers [ 'Course' ] job . assignment = headers [ 'Assignment' ] job . action = headers [ "Action" ] job . file_id = headers [ "SubmissionFileId" ] job . sub_id = headers [ "SubmissionId" ] job . file_name = headers [ "SubmissionOriginalFilename" ] job . submitter_student_id = headers [ "SubmitterStudentId" ] if "Timeout" in headers : job . timeout = int ( headers [ "Timeout" ] ) if "PostRunValidation" in headers : # Ignore server - given host + port and use the configured one instead # This fixes problems with the arbitrary Django LiveServer port choice # It would be better to return relative URLs only for this property , # but this is a Bernhard - incompatible API change from urllib . parse import urlparse relative_path = urlparse ( headers [ "PostRunValidation" ] ) . path job . validator_url = config . get ( "Server" , "url" ) + relative_path job . working_dir = create_working_dir ( config , job . sub_id ) # Store submission in working directory submission_fname = job . working_dir + job . file_name with open ( submission_fname , 'wb' ) as target : target . write ( result . read ( ) ) assert ( os . path . exists ( submission_fname ) ) # Store validator package in working directory validator_fname = job . working_dir + 'download.validator' fetch ( job . validator_url , validator_fname ) try : prepare_working_directory ( job , submission_fname , validator_fname ) except JobException as e : job . send_fail_result ( e . info_student , e . info_tutor ) return None logger . debug ( "Got job: " + str ( job ) ) return job except HTTPError as e : if e . code == 404 : logger . debug ( "Nothing to do." ) return None except URLError as e : logger . error ( "Error while contacting {0}: {1}" . format ( url , str ( e ) ) ) return None
def apply ( self , word , ctx = None ) : """ignore ctx information right now"""
return Sequential . in_sequence ( word , AdjacentVowels . uyir_letters , AdjacentVowels . reason )
def split_for_transport ( orig_pkt , transport_proto ) : """Split an IP ( v6 ) packet in the correct location to insert an ESP or AH header . @ param orig _ pkt : the packet to split . Must be an IP or IPv6 packet @ param transport _ proto : the IPsec protocol number that will be inserted at the split position . @ return : a tuple ( header , nh , payload ) where nh is the protocol number of payload ."""
# force resolution of default fields to avoid padding errors header = orig_pkt . __class__ ( raw ( orig_pkt ) ) next_hdr = header . payload nh = None if header . version == 4 : nh = header . proto header . proto = transport_proto header . remove_payload ( ) del header . chksum del header . len return header , nh , next_hdr else : found_rt_hdr = False prev = header # Since the RFC 4302 is vague about where the ESP / AH headers should be # inserted in IPv6 , I chose to follow the linux implementation . while isinstance ( next_hdr , ( IPv6ExtHdrHopByHop , IPv6ExtHdrRouting , IPv6ExtHdrDestOpt ) ) : # noqa : E501 if isinstance ( next_hdr , IPv6ExtHdrHopByHop ) : pass if isinstance ( next_hdr , IPv6ExtHdrRouting ) : found_rt_hdr = True elif isinstance ( next_hdr , IPv6ExtHdrDestOpt ) and found_rt_hdr : break prev = next_hdr next_hdr = next_hdr . payload nh = prev . nh prev . nh = transport_proto prev . remove_payload ( ) del header . plen return header , nh , next_hdr
def read_config ( contents ) : """Reads pylintrc config into native ConfigParser object . Args : contents ( str ) : The contents of the file containing the INI config . Returns : ConfigParser . ConfigParser : The parsed configuration ."""
file_obj = io . StringIO ( contents ) config = six . moves . configparser . ConfigParser ( ) config . readfp ( file_obj ) return config
def _calc_q_h0 ( n , x , h , nt , n_jobs = 1 , verbose = 0 , random_state = None ) : """Calculate q under the null hypothesis of whiteness ."""
rng = check_random_state ( random_state ) par , func = parallel_loop ( _calc_q_statistic , n_jobs , verbose ) q = par ( func ( rng . permutation ( x . T ) . T , h , nt ) for _ in range ( n ) ) return np . array ( q )
def timesince ( d , now = None , pos = True , flag = False ) : """pos means calculate which direction , pos = True , now - d , pos = False , d - now flag means return value type , True will return since , message and Flase return message > > > d = datetime . datetime ( 2009 , 10 , 1 , 12 , 23 , 19) > > > timesince ( d , d , True ) > > > now = datetime . datetime ( 2009 , 10 , 1 , 12 , 24 , 19) > > > timesince ( d , now , True ) u ' 1 minute ago ' > > > now = datetime . datetime ( 2009 , 10 , 1 , 12 , 24 , 30) > > > timesince ( d , now , True ) u ' 1 minute ago ' > > > now = datetime . datetime ( 2009 , 9 , 28 , 12 , 24 , 30) > > > timesince ( d , now , True ) u ' 2 days , 23 hours later ' > > > now = datetime . datetime ( 2009 , 10 , 3 , 12 , 24 , 30) > > > timesince ( d , now , True ) u ' 2 days ago '"""
if not d : if flag : return 0 , '' else : return '' chunks = ( ( 60 * 60 * 24 * 365 , lambda n : ungettext ( 'year' , 'years' , n ) ) , ( 60 * 60 * 24 * 30 , lambda n : ungettext ( 'month' , 'months' , n ) ) , ( 60 * 60 * 24 * 7 , lambda n : ungettext ( 'week' , 'weeks' , n ) ) , ( 60 * 60 * 24 , lambda n : ungettext ( 'day' , 'days' , n ) ) , ( 60 * 60 , lambda n : ungettext ( 'hour' , 'hours' , n ) ) , ( 60 , lambda n : ungettext ( 'minute' , 'minutes' , n ) ) ) if not now : now = date . now ( ) else : now = date . to_datetime ( now ) d = date . to_datetime ( d ) delta = now - ( d - datetime . timedelta ( 0 , 0 , d . microsecond ) ) oldsince = since = delta . days * 24 * 60 * 60 + delta . seconds suffix = '' if pos : if since >= 0 : suffix = ugettext ( ' ago' ) elif since < 0 : suffix = ugettext ( ' later' ) since *= - 1 for i , ( seconds , name ) in enumerate ( chunks ) : count = since // seconds if count != 0 : break s = ( '%(number)d %(type)s' ) % { 'number' : count , 'type' : name ( count ) } if i + 1 < len ( chunks ) : # Now get the second item seconds2 , name2 = chunks [ i + 1 ] count2 = ( since - ( seconds * count ) ) // seconds2 if count2 != 0 : s += ( ', %(number)d %(type)s' ) % { 'number' : count2 , 'type' : name2 ( count2 ) } # if flag = = True , then return twe elements ( since , message ) if flag : return oldsince , s + suffix else : return s + suffix
def qdc ( self ) : '''Return the qdc tag for the term'''
start_tag = '' . join ( ( '<' , self . get_term_display ( ) . lower ( ) , ' q="' , self . qualifier , '">' , ) ) if self . qualifier else '' . join ( ( '<' , self . get_term_display ( ) . lower ( ) , '>' , ) ) qdc = '' . join ( ( start_tag , saxutils . escape ( self . content ) , '</' , self . get_term_display ( ) . lower ( ) , '>' , ) ) return mark_safe ( qdc )
def tpl_single_send ( self , param , must = [ APIKEY , MOBILE , TPL_ID , TPL_VALUE ] ) : '''指定模板单发 only v2 deprecated 参数名 类型 是否必须 描述 示例 apikey String 是 用户唯一标识 9b11127a9701975c734b8aee81ee3526 mobile String 是 接收的手机号 ( 针对国际短信 , mobile参数会自动格式化到E . 164格式 , 可能会造成传入mobile参数跟后续的状态报告中的号码不一致 。 E . 164格式说明 , 参见 : https : / / en . wikipedia . org / wiki / E . 164 ) 15205201314 tpl _ id Long 是 模板id 1 tpl _ value String 是 变量名和变量值对 。 请先对您的变量名和变量值分别进行urlencode再传递 。 使用参考 : 代码示例 。 注 : 变量名和变量值都不能为空 模板 : 【 # company # 】 您的验证码是 # code # 。 最终发送结果 : 【 云片网 】 您的验证码是1234。 tplvalue = urlencode ( " # code # " ) + " = " + urlencode ( " 1234 " ) + " & amp ; " + urlencode ( " # company # " ) + " = " + urlencode ( " 云片网 " ) ; 若您直接发送报文请求则使用下面这种形式 tplvalue = urlencode ( urlencode ( " # code # " ) + " = " + urlencode ( " 1234 " ) + " & amp ; " + urlencode ( " # company # " ) + " = " + urlencode ( " 云片网 " ) ) ; extend String 否 扩展号 。 默认不开放 , 如有需要请联系客服申请 001 uid String 否 用户自定义唯一id 。 最大长度不超过256的字符串 。 默认不开放 , 如有需要请联系客服申请 10001 Args : param : Results : Result'''
r = self . verify_param ( param , must ) if not r . is_succ ( ) : return r h = CommonResultHandler ( lambda rsp : { VERSION_V2 : rsp } [ self . version ( ) ] ) return self . path ( 'tpl_single_send.json' ) . post ( param , h , r )
def accept_reject_or_neither ( self , url , parent_page = None ) : '''Returns ` True ` ( accepted ) , ` False ` ( rejected ) , or ` None ` ( no decision ) . ` None ` usually means rejected , unless ` max _ hops _ off ` comes into play .'''
if not isinstance ( url , urlcanon . ParsedUrl ) : url = urlcanon . semantic ( url ) if not url . scheme in ( b'http' , b'https' ) : # XXX doesn ' t belong here maybe ( where ? worker ignores unknown # schemes ? ) return False try_parent_urls = [ ] if parent_page : try_parent_urls . append ( urlcanon . semantic ( parent_page . url ) ) if parent_page . redirect_url : try_parent_urls . append ( urlcanon . semantic ( parent_page . redirect_url ) ) # enforce max _ hops if ( parent_page and "max_hops" in self . scope and parent_page . hops_from_seed >= self . scope [ "max_hops" ] ) : return False # enforce reject rules if "blocks" in self . scope : for block_rule in self . scope [ "blocks" ] : rule = urlcanon . MatchRule ( ** block_rule ) if try_parent_urls : for parent_url in try_parent_urls : if rule . applies ( url , parent_url ) : return False else : if rule . applies ( url ) : return False # honor accept rules for accept_rule in self . scope [ "accepts" ] : rule = urlcanon . MatchRule ( ** accept_rule ) if try_parent_urls : for parent_url in try_parent_urls : if rule . applies ( url , parent_url ) : return True else : if rule . applies ( url ) : return True # no decision if we reach here return None
def get_transactions ( self , include_investment = False ) : """Returns the transaction data as a Pandas DataFrame ."""
assert_pd ( ) s = StringIO ( self . get_transactions_csv ( include_investment = include_investment ) ) s . seek ( 0 ) df = pd . read_csv ( s , parse_dates = [ 'Date' ] ) df . columns = [ c . lower ( ) . replace ( ' ' , '_' ) for c in df . columns ] df . category = ( df . category . str . lower ( ) . replace ( 'uncategorized' , pd . np . nan ) ) return df
def config_add ( self , key , value , ** kwargs ) : """Add a value to a key . Returns a list of warnings Conda may have emitted ."""
cmd_list = [ 'config' , '--add' , key , value ] cmd_list . extend ( self . _setup_config_from_kwargs ( kwargs ) ) return self . _call_and_parse ( cmd_list , abspath = kwargs . get ( 'abspath' , True ) , callback = lambda o , e : o . get ( 'warnings' , [ ] ) )
def linear_deform ( template , displacement , out = None ) : """Linearized deformation of a template with a displacement field . The function maps a given template ` ` I ` ` and a given displacement field ` ` v ` ` to the new function ` ` x - - > I ( x + v ( x ) ) ` ` . Parameters template : ` DiscreteLpElement ` Template to be deformed by a displacement field . displacement : element of power space of ` ` template . space ` ` Vector field ( displacement field ) used to deform the template . out : ` numpy . ndarray ` , optional Array to which the function values of the deformed template are written . It must have the same shape as ` ` template ` ` and a data type compatible with ` ` template . dtype ` ` . Returns deformed _ template : ` numpy . ndarray ` Function values of the deformed template . If ` ` out ` ` was given , the returned object is a reference to it . Examples Create a simple 1D template to initialize the operator and apply it to a displacement field . Where the displacement is zero , the output value is the same as the input value . In the 4 - th point , the value is taken from 0.2 ( one cell ) to the left , i . e . 1.0. > > > space = odl . uniform _ discr ( 0 , 1 , 5) > > > disp _ field _ space = space . tangent _ bundle > > > template = space . element ( [ 0 , 0 , 1 , 0 , 0 ] ) > > > displacement _ field = disp _ field _ space . element ( [ [ 0 , 0 , 0 , - 0.2 , 0 ] ] ) > > > linear _ deform ( template , displacement _ field ) array ( [ 0 . , 0 . , 1 . , 1 . , 0 . ] ) The result depends on the chosen interpolation . With ' linear ' interpolation and an offset equal to half the distance between two points , 0.1 , one gets the mean of the values . > > > space = odl . uniform _ discr ( 0 , 1 , 5 , interp = ' linear ' ) > > > disp _ field _ space = space . tangent _ bundle > > > template = space . element ( [ 0 , 0 , 1 , 0 , 0 ] ) > > > displacement _ field = disp _ field _ space . element ( [ [ 0 , 0 , 0 , - 0.1 , 0 ] ] ) > > > linear _ deform ( template , displacement _ field ) array ( [ 0 . , 0 . , 1 . , 0.5 , 0 . ] )"""
image_pts = template . space . points ( ) for i , vi in enumerate ( displacement ) : image_pts [ : , i ] += vi . asarray ( ) . ravel ( ) values = template . interpolation ( image_pts . T , out = out , bounds_check = False ) return values . reshape ( template . space . shape )
def state_reachable ( subsystem ) : """Return whether a state can be reached according to the network ' s TPM ."""
# If there is a row ` r ` in the TPM such that all entries of ` r - state ` are # between - 1 and 1 , then the given state has a nonzero probability of being # reached from some state . # First we take the submatrix of the conditioned TPM that corresponds to # the nodes that are actually in the subsystem . . . tpm = subsystem . tpm [ ... , subsystem . node_indices ] # Then we do the subtraction and test . test = tpm - np . array ( subsystem . proper_state ) if not np . any ( np . logical_and ( - 1 < test , test < 1 ) . all ( - 1 ) ) : raise exceptions . StateUnreachableError ( subsystem . state )