text
stringlengths
12
4.76M
timestamp
stringlengths
26
26
url
stringlengths
32
32
Main menu Many people want to enhance their physical health and fitness ranges. However, they generally make the excuses that they don’t know how or they don’t have the time. In this post I outline 3 methods you can put into action health and fitness teaching into your everyday program. 1) Way of life Alter: – 1 of the simplest ways to boost your current health and fitness levels is to make modest, positive modifications to your every day routine. Especially, you need to increase your diet and your physical exercise routine. As I have described, these modifications do not have to be big. If you make little adjustments to your way of life at normal intervals these will soon develop up to turn out to be huge alterations which yield substantial effects. One way you could alter your consuming habits is by consuming 1 less takeaway a week and substituting this for a more healthy, house cooked meal. Then in the 2nd few days you could develop on this by consuming a salad for lunch when or twice a week. You can alter your exercise routines in a related way. In the initial week use stairs instead of elevators. In week two participate in a thirty minute brisk walk twice a 7 days. As you can see these modest but good life-style changes collectively turn into considerable modifications which can lead to enhanced health and fitness ranges. 2) Health and fitness Gear: – One more fantastic way to boost your physical fitness levels is to carry edge of the huge choice of conditioning gear on the market. When picking physical fitness gear you 1st have to choose what your physical fitness targets are. Do you want to increase your cardiovascular conditioning? If so then a treadmill, rowing machine or physical exercise bike will be most appropriate for you. Do you want to tone and strengthen your muscles? Then free of charge weights and weight devices are what you should be using. You also will need to think about whether or not you want to buy the physical fitness tools for your self or bring benefit of the health and fitness products at the fitness center. The two have their own unique strengths and disadvantages. Owning your personal health and fitness equipment implies that you can use it whenever you want, inside the comfort of your individual home. Nonetheless, unless you have a lot of storage space and cash you will be unable to purchase the array of tools that a gymnasium can present. The gymnasium can offer you with a huge array of gear for a fairly lower expense. On the other hand, when the gymnasium is total you will have to wait for machines and you will also have to devote time commuting to and from the fitness center. Whatever you pick with regards to your physical fitness products you need to consider one crucial aspect. Physical fitness gear will help you in your exercise but it will not do it for you. You nevertheless have to set in the time and work that leads to improved upon physical fitness ranges. 3) Physical fitness Coach: – Getting edge of a fitness fitness instructor is a fantastic way to boost your fitness amounts. You can clarify your physical fitness targets to the trainer and then they can show you the greatest way to accomplish them. A health and fitness coach ought to also assist you remain motivated, show you exactly where you are heading wrong and lead you down the right path, generating it far more probably that you will obtain your targets. When picking a conditioning fitness instructor there are a amount of aspects you must consider. A very good conditioning fitness instructor ought to be ready to offer achievement stories from their past which prove their credentials. You should also search at their qualifications to measure how nicely trained they are. Finally, you need to arrange a meeting with a number of physical fitness trainers and see which kinds match your personality. Physical fitness is usually applied to the framework most typically associated with two classifications: Basic fitness (a condition associated with health as well as well-being) and specialized fitness (the capability to carry out specific sports activities or work-related skills). Physical fitness is actually a condition associated with health with lower risk of early illnesses and the vitality to participate in a wide range of physical pursuits. Health and fitness is the ability of the heart, circulation, lungs, and muscles to be able to operate at optimal efficiency, it is essential for your all around health. Actual physical conditioning is made up of three areas: Aerobic capacity or cardiovascular endurance associated with the hearts capacity to transport oxygen to your vital organs. Bodily composition and health, along with all round muscular strength and staying power. Health-related physical fitness means fitness associated with some element of health and well-being. Many studies have come to the conclusion that individuals who participate in health and wellness routines as well as a regular exercise program have a relatively increased degree of energy, lower healthcare bills, much better quality of life along with less stress, as well as improved health. Staying in good physical shape and healthy calls for everyone, to be conscious of their health, to be aware of the key fitness and health components and to follow them. Any progress in physical fitness can help boost your capacity when working as well as the ability to respond effectively in an emergency situation. The benefits of exercise Exercising is usually recreational physical activity carried out with the goal of building health and fitness. Looking forward to exercising and feeling really good with regard to the results of exercise on your body is common. Regular exercise improves mobility, overall flexibility, as well as balance in mature adults. Exercise also boosts the blood flow to the brain improving you mood. Physical exercise improves your sleep. Poor sleep isn’t a natural response to getting older and good quality sleep is essential for your all around health. Exercise also lessens the impact of illness and chronic disease. Muscle tissues grow by means of physical activity in the same way they are able to become more well-defined (with regards to physical appearance). The health benefits of exercise Being physically active can have a profound effect on health and well-being. One of the main ways it supports good health is that it supports and assists in weight loss. Your abdominal circumference generally should not exceed a maximum measurements of 35 inches for females and 40 inches for males. Healthy active living requires a variety of physical activities as well as appropriate diet and lifestyle choices. A key lesson in exercising is the fact that it isn’t the number of repetitions or even time spent working out that makes the real difference, but the intensity and level of quality associated with the way you train. It makes no sense to perform a hundred or so consecutive quick sit-ups – You will get a much better end result with three sets of 20 or so reps each one carried out gradually and condensing the muscle for three seconds with each and every repetition. Make an effort to eat wholesome meals in between exercising or physical activities Cardiovascular Fitness Cardiovascular Fitness is actually a key element as part of your general health and Fitness. Cardiovascular well-being and fitness is considerably improved by aerobic exercise. Cardiovascular stamina is defined as the capability of the lungs, heart, as well as bloodstream to supply adequate levels of oxygen as well as nutrients for the cells in order to meet the requirements of extended physical activity. Cardiovascular fitness can also be known as cardiovascular endurance, aerobic fitness and cardiovascular respiratory fitness. In order to increase your cardiovascular conditioning you have to practice active high energy activities or active sporting activities which can be of enough intensity for getting your heartbeat into your target heart rate zone. A great little free calculator for working out your heart-rate zone can be fount at: http://exercise.about.com/cs/fitnesstools/l/bl_THR.htm Just How Long Should Cardiovascular Exercise Workouts Be? – Many experts advise a workout of 30-60 minutes of aerobic cardiovascular exercise three to four times a week, together with two to three days of weight-bearing, resistance exercising (for example lifting weights or perhaps working with bands). Whenever cardiovascular endurance is employed to find out about a person’s degree of physical fitness, heart rate would be the measurement which is most frequently used. Resting heart rate, as well as the maximum heart-rate that you achieve, is necessary whenever determining cardiovascular health; a measure of the time it will takes the heart-rate to return to its resting rate following exercise is an excellent indicator too. The Home Gym Have you heard being active is very important for more mature adults, but don’t know where to start? You’re not by yourself. A good way to start is to set up a home gym for your workout sessions. Buying a few basic items of home fitness equipment can easily help make getting a quality work out not as difficult to achieve. A home gym can be great for at home health and fitness & exercise programs. And don’t forget when exercising the cool-down is equally as important as the warm-up. Suddenly stopping any strenuous activity results in pooling of the blood and sluggish circulation. Physical fitness is very important to your performance of everyday activities. Being physically fit can make a big difference to the fun and satisfaction you get out of life. Let me explain what I mean… Oxygen reaches the body by being breathed in through the lungs and distributed to working muscles via the blood – which is pumped around the circulation by the heart. Aerobic exercise usually involves vigorous exercise sustained over a period of several minutes, and its effect is to increase the efficiency of the lungs, heart, and blood circulation, which is known collectively as the aerobic system. Short, sharp bursts of activity, which rely on the body’s reserves of oxygen and are described as anaerobic, do not produce a similar improvement. As you will soon discover in this article, there are many types of physical fitness training activities that involve aerobics. In the wink of an eye, you should be able to find an activity that will be enjoyable and help your aerobic fitness. But that’s not all – these exercises will help to improve your strength and mobility, and aid relaxation and stress management. Listen, exercise helps you look and feel your best so lets begin… WALKING To maintain an adequate level of fitness, you will need to walk a minimum of five miles at least three times a week. If conditions do not allow you get out of the house or office, you can use stair climbing as an alternative. BICYCLING Bicycling does not have to a back breaker. And guess what, you don’t need a flashy bicycle to make this work. In fact, bicycling is an efficient form of transportation. It demands less energy to move a moderate weight over a given distance than any other method. Ok, you may be wondering if you can use the exercise bicycle at your local or gym or at home in order to achieve the same affect. In truth you can use exercise bikes to gain and more importantly maintain a high level of aerobic fitness. Your main concern should be comfort and durability. JOGGING AND RUNNING Running and jogging increase strength in the legs and can lead to improved functioning of the cardiovascular and respiratory systems. And, another thing…they also are excellent calorie-burning activities. There are three things you need to consider when you are planning to use these types of physical fitness training activities. They are frequency, duration, and intensity. National Physical Fitness and Sports Month is reaching the halfway point and many of you may find your self asking, “What exactly is the definition of physical fitness?”. We all have our own idea of what it means to be physically fit. For some people, fitness is measured by weight, others by strength and still others consider endurance a sign of physical fitness. To determine how fit you are and find ways to improve your fitness level you must first understand that true fitness is measured by multiple components. o Body Composition- Many people confuse body composition with body weight or body fat. In reality your body composition is actually defined as the percentage of fat, bone and muscle in your body. In relation to physical fitness, the amount of fat compared to bone and muscle is measured to determine body fat percentage and overall health. Too much body fat increases the chances of illness and disease. Conversely men and women who have too little body fat risk decreased exercise performance and severe health complications. The ideal body fat percentage varies by individual based on gender, age, body type and heredity. Finding the level that is right for you is an important factor in determining overall health and fitness. o Muscular Strength and Endurance- Strength and endurance are two separate components both of which contribute to physical fitness. Your muscular strength is your ability to life or exert maximum force in a single effort. Increase muscle strength through weight or strength training which increases muscle mass. This increases your body’s capacity to burn calories which aids in weight loss and lowering your body fat ratio. Muscular endurance on the other hand does not measure how “much” you can lift or move rather how “long” you can perform repetitive actions. Both strength and endurance are important in maintaining healthy fitness levels. o Aerobic Endurance- While muscle endurance is needed for your muscles to perform repetitive actions, aerobic (cardiorespiratory) endurance is needed to perform physical activity and sports. Specifically aerobic endurance is determined by the ability of your heart to move oxygenated blood through your body and to working muscles. People with little or no aerobic endurance tire quickly when performing simple daily tasks such as climbing a flight of stairs or playing with their children. Increase you aerobic endurance or stamina through regular exercise. As your fitness level increases you will have to intensify or vary your workout to gain the maximum benefit. o Flexibility- Defined as the ability to move your joints or muscles through their full range of motion. Your flexibility is determined by a number of factors including joint structure, age, activity level, body composition and strength of opposing muscle groups. This ability is one of the components of physical fitness and needed to perform day to day activities and enjoy an active lifestyle. As you can see there are several factors that determine you level of physical fitness. By eating a healthy diet and getting regular exercise you will look and feel better while reducing the risk of cardiovascular disease and other health problems.
2023-09-30T01:27:15.642919
https://example.com/article/3151
MVP without code: the toolkit - andreyazimov https://medium.com/@AndreyAzimov/list-of-the-tools-to-make-web-mvp-without-coding-or-just-a-little-bit-f2ce18d0effa ====== andreyazimov Hi HN, Many people can't execute on their ideas because they can't code. I was in the same situation. I was procrastinating to learn to code and therefore couldn't test and validate any of my ideas. So, I made a list of tools that could help me build an MVP fast. That way I could validate if people needed (and would pay for my idea or not. Here's my toolkit and I'm sharing it here because it's probably useful for some of you too!
2024-02-26T01:27:15.642919
https://example.com/article/2946
Data from the study are available on request by contacting the corresponding Author at <gianluca.mirizzi@ftgm.it> due to limitations pertaining to privacy about patients\' medical data. Introduction {#sec004} ============ Although modern therapies have improved the natural history of chronic heart failure (HF), mainly by tackling neurohormonal activation, the prognosis of HF is dismal \[[@pone.0153510.ref001],[@pone.0153510.ref002],[@pone.0153510.ref003]\] justifying the search for novel therapeutic targets in HF. Chemoreflex sensitivity (CS) represents a major determinant of neurohormonal imbalance in HF, being associated with reduced baroreflex sensitivity \[[@pone.0153510.ref004],[@pone.0153510.ref005]\], heightened sympathetic outflow and periodic breathing (PB) \[[@pone.0153510.ref006],[@pone.0153510.ref005],[@pone.0153510.ref007]\]. Far from being an innocent bystander, CS has been acknowledged as an independent prognosticator in HF, mainly due to a detrimental effect on the arrhythmic profile leading to cardiac mortality \[[@pone.0153510.ref008],[@pone.0153510.ref009]\]. Specifically, CS impacted on prognosis mainly by increasing arrhythmic events and cardiac mortality, especially when both CS to hypoxia and hypercapnia were heightened (four-years survival 49%) compared to those with normal CS (survival 100%) \[[@pone.0153510.ref009]\]. Nowadays, a chemoreflex modulation strategy is plausible \[[@pone.0153510.ref010]\], according to a growing number of animal studies \[[@pone.0153510.ref011],[@pone.0153510.ref012],[@pone.0153510.ref013]\] demonstrating its feasibility and benefits. Indeed, in a ischaemic HF model in rats, carotid body denervation reduced the central pre-sympathetic neuronal activation, normalized indexes of sympathetic outflow and baroreflex sensitivity, and reduced the incidence of apnoea; there was also a time-dependent reduction in cardiac remodelling, deterioration of left ventricle ejection fraction, and cardiac arrhythmias; these modifications, most importantly, led to an amelioration in survival \[[@pone.0153510.ref013]\]. The feasibility of carotid body ablation and its autonomic effects in humans were recently confirmed by a pilot trial in a patient with chronic heart failure \[[@pone.0153510.ref014]\]. Hence, the possibility of feedback reflex modulation is in sight and the need of simple diagnostic tools for their evaluation is pressing. CS is measured by specific tests, assessing the ventilatory response to either hypoxia or hypercapnia, in order to calculate the hypoxic ventilatory response (HVR) and hypercapnic ventilatory response (HCVR), respectively \[[@pone.0153510.ref015]\]. However, several limitations (need of dedicated instrumentations, physician supervision, patients' discomfort) have hampered its clinical spread, which is currently limited to the research environment. However, in light of the previous consideration, it is clear that we need to implement on the clinical ground the evaluation of feedback control for a better risk stratification and follow-up. Therefore, we sought to evaluate whether common clinical variables, broadly obtained by routine clinical and instrumental evaluation, could predict the presence of increased CS to hypoxia and hypercapnia in a population of systolic HF patients. Materials and Methods {#sec005} ===================== From 2003 to 2011, we identified 191 consecutive HF patients from our outpatient clinic with echocardiographic evidence of impaired left ventricular systolic function (LVEF \<50%) excluding those with: NYHA class IV, acute coronary syndrome within 6 months before examination, severe renal dysfunction (i.e. creatinine clearance \< 35 ml/min), pulmonary disease (vital capacity and total lung capacity \< 50% of predicted value; FEV1 \[forced expiratory volume in 1 s\] \<50% of predicted value; and FEV1/FVC \[forced vital capacity\] \<70%), and treatment with morphine or derivates, theophylline, oxygen, benzodiazepines or acetazolamide. All patients agreed participating in the study. They were on stable (i.e. \>1 month) guideline-recommended treatment, with restriction of water/sodium intake. The study design included a standard clinical evaluation and: (1) the evaluation of chemosensitivity to hypoxia and to hypercapnia by assessing the individual HVR and HCVR; (2) neurohormonal evaluation; (3) echocardiography; (4) cardiopulmonary exercise testing (CPET) and (5) 20-min daytime polygraphy for the assessment of diurnal PB. The entire protocol was completed for each patient within 3 days. The investigation was carried out in accordance with the Declaration of Helsinki of the World Medical Association, and has been approved by the local Ethics Committee \"Comitato Etico di Area Vasta Nord-Ovest\", Pisa, Italy. Patients provided written informed consent. Chemosensitivity assessment {#sec006} --------------------------- Chemosensitivity was assessed using the rebreathing technique \[[@pone.0153510.ref007]\]. Subjects were examined in standardized conditions, in a quiet room at a comfortable temperature, while seated and connected to a rebreathing circuit through a mouthpiece. They were not allowed to smoke, or drink alcohol or caffeine-containing beverages in the 12 h preceding the study. ECG, airway flow and respiratory gases were recorded continuously through a breath-by-breath gas analyser (Vmax; Sensormedics), and oxygen saturation was recorded through a pulse oximeter (SET® Radical; Masimo). A 4-min baseline recording was performed during spontaneous breathing. The mean SaO2 (arterial oxygen saturation) and end- tidal CO2 during this recording were assumed as subject resting values. During the progressive isocapnic hypoxia trial (from resting SaO2 values to 70--80%, according to individual tolerance), end-tidal CO2 was maintained at a baseline value by passing a portion of the expired air into a scrubbing circuit before returning it to a 5 litre rebreathing bag. Conversely, during the progressive normoxic hypercapnic trial (from resting end-tidal CO2 values until 50 mmHg or an increase ≥10 mmHg from the basal values, according to individual tolerance), inspired arterial partial pressure of oxygen was kept at the baseline value by adding oxygen to the circuit. The two trials were performed in a random order. Examples of hypoxic normocapnic and hypercapnic normoxic trials are shown in [Fig 1](#pone.0153510.g001){ref-type="fig"}; examples of a normal and an altered hypoxic normocapnic trial are shown in [Fig 2](#pone.0153510.g002){ref-type="fig"}. All signals were digitized online (500 sample/s; National Instruments) and analysed to derive respiratory rate, breath-to-breath VT (tidal volume) and VE (minute ventilation), as well as SaO~2~ and end-tidal pressure of CO~2~. HVR was expressed by the linear regression slope between VE and SaO~2~ during a hypoxic-normocapnic trial, while HCVR by the linear regression slope between VE and the end-tidal CO~2~ during the hypercapnic-normoxic trial. ![Example of an hypoxic normocapnic (upper panel) and an hypercapnic normoxic (lower panel) trial.\ In each panel are represented the time-dependent variation of minute ventilation (VE), end-tidal carbon dioxide production (PETCO~2~) and arterial oxygen saturation (SaO~2~) During the hypoxic trial, SaO2 diminish while PETCO~2~ remains constant due to correction by a scrubbing circuit. During the hypercapnic trial, SaO2 remains constant due to constant addition of O2 to the circuit.](pone.0153510.g001){#pone.0153510.g001} ![Example of a normal (left) and abnormal (right) hypoxic normocapnic trial.\ In each panel are represented the time-dependent variation of minute ventilation (VE), end-tidal carbon dioxide production (PETCO~2~) and arterial oxygen saturation (SaO~2~) During the hypoxic trial, SaO2 diminish while PETCO~2~ remains constant due to correction by a scrubbing circuit.](pone.0153510.g002){#pone.0153510.g002} Neurohormonal evaluation, CPET, echocardiographic study, daytime cardiorespiratory recording {#sec007} -------------------------------------------------------------------------------------------- Plasma N-terminal pro-B-type natriuretic peptide (NT-proBNP), catecholamine and aldosterone levels, plasma renin activity (PRA) were assayed as previously described in details \[[@pone.0153510.ref016]\]. Patients underwent a symptom-limited CPET on a bicycle ergometer according to a ramp protocol to achieve maximal workload in 10 ± 2 minutes (Vmax; Sensormedics). Peak oxygen consumption (peak-VO~2~) was determined as the highest value at peak exercise over a 20-s average; ventilatory efficiency was estimated from the VE/VCO~2~ slope (calculated as the slope of the linear relationship between ventilation (VE) and carbon dioxide production (VCO~2~) from 1 min after the beginning of the loaded exercise and the end of the isocapnic buffering period. Echocardiography was assessed according to guidelines recommendations \[[@pone.0153510.ref017]\]. All CPETs and echocardiographic studies were performed by physicians blinded to the chemosensitivity tests results. As previously described \[[@pone.0153510.ref018]\], all subjects, while awake and spontaneously breathing in a supine position, underwent a 20-min recording including two-leads ECG, chest wall and abdominal movements by electrical inductance, oronasal airflow by CO~2~ signal (Cosmoplus®; Novametrics) and SaO~2~ (Pulse Oxymeter Pulsox-7; Minolta). Breathing pattern was evaluated visually observing the traces of nasal flow and respiratory movements; apnoea was defined as the cessation of inspiratory flow for at least 10 s, whereas hypopnoea was defined as a flow reduction (\>50%) lasting 10s or more and associated with at least a 4% decrease in SaO~2~ \[[@pone.0153510.ref019]\]. Apnoea and hypopnoea were considered as central or obstructive by the absence or presence of ribcage and abdominal excursions, respectively. We only considered central apnoea for our analysis. Statistical analysis {#sec008} -------------------- Data are reported as mean ± standard deviation for normally distributed variables; otherwise, they are expressed as median (interquartile range, IR). A p ≤0.05 was considered statistically significant. Target variables (HVR and HCVR) were dichotomized using the previously described cut-off values (increased chemosensitivity if HVR\>0.77 l·min^-1^·%SaO~2~^-1^ and HCVR\>0.79 l·min^-1^·mmHg^-1^) \[[@pone.0153510.ref007]\]. Association between target variables and covariates was studied constructing a univariate logistic regression model. Covariates that resulted significantly associated at univariate analysis (p\<0.10) were used to create a multivariate model. Owing to the high number of variables in comparison with the number of cases, we identified covariates with two distinct methods: the penalized approach and the Bayesian Model Averaging (BMA) approach \[[@pone.0153510.ref020]\]. This statistical approach has the clear advantage of bootstrapping multiple models by randomly selecting variables from the overall data set and assessing pre- and post-hoc probabilities of prediction to evaluate the best possible models (and predictors), according to Bayes\' principle, thus providing an adequate stability to the analysis. The output of this approach are a set of variables with a given odds ratio, thus identifying variables for which each unit increase (for example, each percent unit increase in LVEF) produces an increase or decrease of the probability of having an heightened chemoreflex sensitivity (that is, respectively, \"adverse\" or \"protective\" variables). Parallel to this approach, in order to catch the effects of non-linear interaction between variables that are missed by conventional statistical methods, we also performed a random forest (RF) analysis, as described elsewhere \[[@pone.0153510.ref021]\]. Briefly, RF is an ensemble classifier build up from a set of decision trees created from a subset of training data (2/3 of original data), randomly constructed by choosing variables and samples (bootstrapping). The pre-specified rules with which the trees are assembled decides whether to split the tree (knot) or terminate it (terminal knot) at a value deemed to be the best split point for each variable. RF analysis gives the accuracy in the prediction of an observation in a sample; furthermore, it allows to rank a set of variables based on their importance in predicting the observation. For continuous variables it does not give a specific cut-off but takes into account the repercussions of the variable on the accuracy of the prediction (i.e., its increase whenever the variable is taken into account). Also for this reason, this approach has the advantage with respect to conventional statistics to avoid overfitting models and to be less sensitive to outliers. Analyses were performed using the R open-source statistical software. Results {#sec009} ======= Patients\' characteristics {#sec010} -------------------------- Patients' general characteristics are enlisted in [Table 1](#pone.0153510.t001){ref-type="table"}. Overall, HVR and HCVR were increased in 34% and 56% of patients, respectively. Patients were mainly males (83%), aged (62, SD 14 years), with balanced ischemic/non ischemic aetiology (48/52%, respectively) and with a moderate to severe LV dysfunction at echocardiography (mean left ventricular ejection fraction \[LVEF\] 30, SD 8%). At CPET, they showed a reduced functional capacity (mean peak VO~2~/kg: 13.8, SD 6.3 ml·min^-1^·kg^-1^) and reduced ventilatory efficiency (VE/VCO~2~ slope: 37, SD 9); roughly half of the population presented with diurnal periodic breathing (PB) (48%). Neurohormonal activation was modest, with only augmented levels of plasma NT-proBNP (1117, IR 86--6851 ng/l). All patients were on optimal medical therapy. Patients with enhanced HVR as compared with those with normal chemosensitivity, showed increased ventilatory inefficiency, plasma levels of noradrenaline and gamma-glutamyltransferase (GGT), increased right ventricular (RV) dimensions. Those with increased HCVR as compared with patients with normal chemosensitivity were instead older, had lower LVEF, reached a lower maximal workload and showed increased ventilatory inefficiency; they also showed increased plasma levels of NT-proBNP, noradrenaline, GGT and greater right ventricular (RV) diameter (data not shown). 10.1371/journal.pone.0153510.t001 ###### Clinical characteristics of the HF patient population. ![](pone.0153510.t001){#pone.0153510.t001g} Variables Population n = 191 --------------------------------------------------------------- -------------------- Age, y 62±14 Males, % 83 Body Mass Index (BMI), kg/m^2^ 27.0±4.2 Ischemic Etiology, % 48 NYHA Class I-II, % 72 Periodic Breathing/ Cheyne-Stokes respiration, % 47/24 Hypoxic Ventilatory Response (HVR), l\*min^-1^\*%SaO2^-1^ 0.5 (0.2--1.2) Hypercapnic Ventilatory Response (HCVR), l\*min^-1^\*mmHg^-1^ 0.85 (0.2--2.1) Left Ventricular Ejection Fraction (LVEF), % 30±8 End Systolic Left Ventricular Diameter, mm 51±10 End Diastolic Left Ventricular Diameter, mm 62±8 Sinus Rhythm/Atrial Fibrillation, % 73/27 Workload, W 80 (40--174) Peak Oxygen Consumption, (pVO~2~), ml\*min^-1^\*kg^-1^ 13.8±6.2 VE/VCO~2~ slope 37±9 Serum Creatinine, mg/dl 1.2±0.4 Norepinephrine, pg/ml 435 (141--1033) Plasma Renin Activity, ng\*ml^-1^\* h^-1^ 1.2 (0.2--11.3) NT-proBNP, pg/ml 1117 (86--6851) Plasma Aldosterone, pg/ml 140 (31--399) Beta-Blockers, % 84 ACE-inhibitors or ARBs, % 77 Aldosterore Receptors Blockers, % 56 Diuretics, % 79 ACE: angiotensin-converting enzyme; ARB: angiotensin receptor blockers; NYHA, New York Class Association; NT-proBNP: N-type fragment of proBNP; VE/VCO~2~ slope: slope of the relationship of CO~2~ production and ventilatory response during exercise. Hypoxic chemosensitivity: univariate and multivariate analysis {#sec011} -------------------------------------------------------------- At univariate analysis, HVR was associated with the following 9 covariates: LVEF, RV dimension, left atrial dimensions, baseline ventilation, VE/VCO~2~ slope, NT-proBNP levels, GGT levels, presence of atrial fibrillation and PB. At multivariate penalized analysis ([Table 2](#pone.0153510.t002){ref-type="table"}), HVR was associated with left atrial dimensions (odds ratio \[OR\] 1.012, confidence interval \[C.I.\] 1.005--1.148), VE/VCO~2~ slope (OR 1.01, 95th C.I. 1.007--1.131), NT-proBNP levels (OR 1.007, C.I. 1.003--1.081 for each 100 units increase), GGT levels (OR 1.004, C.I. 1.001--1.153), and, more strongly with the presence of PB (OR 5.401, CI 3.712--12.655). BMA showed the same findings, with the presence of PB being the strongest variable associated with altered HVR (OR 7.91, [Fig 3](#pone.0153510.g003){ref-type="fig"}). ![Bayesian Model Averaging analysis of HVR predictors.\ Dark grey: protective; light grey: adverse. GGT: gamma-glutamyltransferase; LVEF: left ventricular ejection fraction; NT-proBNP: N-type fragment of pro-brain natriuretic peptide; PB: periodic breathing; RV: right ventricle; VE/VCO2 slope: slope of the relationship of CO2 production and ventilatory response during exercise.](pone.0153510.g003){#pone.0153510.g003} 10.1371/journal.pone.0153510.t002 ###### Penalized multivariate analysis of HVR predictors. ![](pone.0153510.t002){#pone.0153510.t002g} Variable OR (95% I.R.) ---------------------- ------------------------- VE/VCO~2~ slope 1.010 \[1.007--1.131\] NT-proBNP 1.007 \[1.003--1.081\] GGT 1.004 \[1.001--1.153\] Left atrial diameter 1.012 \[1.005--1.148\] Presence of PB 5.401 \[3.712--12.655\] GGT: gamma glutamyltransferase; NT-proBNP: N-type fragment of proBNP; PB: periodic breathing;VE/VCO~2~ slope: slope of the relationship of CO~2~ production and ventilatory response during exercise. Random Forest analysis warranted an out of bag accuracy of 71%, identifying the presence of PB and increased VE/VCO~2~ slope as covariate associated with HVR ([Fig 4](#pone.0153510.g004){ref-type="fig"}); in particular, the presence of PB conferred an increase in prediction accuracy of 3.13%. ![Random forests analysis for HVR and HCVR predictors.\ Variable importance plots displaying predictors from random forests (RF) analysis of HVR and HCVR. Variable importance is assessed by the mean decrease accuracy. Mean decrease accuracy is the normalized difference of classification accuracy when the data for that variable is included as observed, and the classification accuracy when the values of the variable have been randomly permuted. Higher values of mean decrease in accuracy indicate variables that are more important to the classification. Acronyms same as in [Fig 3](#pone.0153510.g003){ref-type="fig"}.](pone.0153510.g004){#pone.0153510.g004} Hypercapnic chemosensitivity: univariate and multivariate analysis {#sec012} ------------------------------------------------------------------ At univariate analysis, HCVR was associated with the following 8 covariates: LVEF, NYHA class, peak VO~2~/kg, VEVCO~2~ slope, exercise workload, NT-proBNP levels, GGT levels and PB. At penalized multivariate analysis, HCVR was associated with LVEF (OR 0.976, 95th C.I. 0.647--0.985), VE/VCO~2~ slope (OR 1.028, C.I. 1.009--1.250), NT-proBNP (OR 1.009, C.I. 1.002--1.059 for each 100 units increase), GGT (OR 1.002, C.I. 1.0007--1.357), PB (OR 1.096, C.I. 1.005--1.766) ([Table 3](#pone.0153510.t003){ref-type="table"}). BMA found a weak evidence for VE/VCO~2~ slope (OR 1.04) and NT-proBNP (OR 1.01 for each 100 units increase, [Fig 5](#pone.0153510.g005){ref-type="fig"}). ![Bayesian Model Averaging analysis of HCVR predictors.\ Colour coding and acronyms same as [Fig 2](#pone.0153510.g002){ref-type="fig"}.](pone.0153510.g005){#pone.0153510.g005} 10.1371/journal.pone.0153510.t003 ###### Penalized multivariate analysis of HCVR predictors. ![](pone.0153510.t003){#pone.0153510.t003g} Variable OR (95% I.R.) ----------------- ------------------------ LVEF 0.976 \[0.647--0.985\] NT-proBNP 1.009 \[1.002--1.059\] GGT 1.002 \[1.007--1.357\] VE/VCO~2~ slope 1.028 \[1.009--1.250\] Presence of PB 1.096 \[1.005--1.766\] GGT: gamma-glutamyltransferase; LVEF: left ventricular ejection fraction; NT-proBNP: N-type fragment of pro-brain natriuretic peptide; PB: periodic breathing; RV: right ventricle; VE/VCO2 slope: slope of the relationship of CO2 production and ventilatory response during exercise. Random Forest analysis warranted an out of bag accuracy of 58%, identifying the presence of NT-proBNP and VE/VCO~2~ slope as covariate associated with HCVR ([Fig 4](#pone.0153510.g004){ref-type="fig"}); in particular, the presence of NT-proBNP conferred an increase in prediction accuracy of 1.95%, while VE/VCO2 slope of 1.37%. Discussion {#sec013} ========== In this study, we assessed the clinical predictors of altered chemosensitivity to hypoxia and hypercapnia in a cohort of systolic HF patients suggesting that chemoreflex, a critical pathophysiological determinant of HF progression and prognosis, may be predicted by using few clinical parameters easily obtainable and commonly assessed in whichever HF clinic: a blood withdrawal (NT-proBNP), a cardiopulmonary test (VE/VCO~2~ slope) and a short-term cardiorespiratory monitoring (diurnal PB). In fact, they correctly predicted HVR and HCVR in 70% and 60% of cases, respectively. The clinical relevance of assessing the CS in HF {#sec014} ------------------------------------------------ Growing evidences support the notion that increased CS to hypoxia \[[@pone.0153510.ref008]\] and hypercapnia \[[@pone.0153510.ref009]\] act as pernicious players in the HF pathophysiological background. Beyond its acknowledged role as the mechanism underlying PB \[[@pone.0153510.ref006],[@pone.0153510.ref008],[@pone.0153510.ref009],[@pone.0153510.ref022]\], increased CS has been associated with worse symptoms, lower performance during exercise, higher sympathetic activity and increased arrhythmic risk \[[@pone.0153510.ref007],[@pone.0153510.ref008], [@pone.0153510.ref023]\]. These pathophysiological alterations lead to a significant increase in the risk of cardiac death and arrhythmic events in HF. In the study of Ponikowski et al \[[@pone.0153510.ref008]\], 3-year survival in those with heightened peripheral CS was 41% vs. 77% in those with normal one. When assessed in a well characterized and on guideline-directed medical therapy comprehensive of beta-blockers (86%) and implantable-cardioverter device/cardiac resynchronization therapy, increased CS still maintains its prognostic value, especally when both peripheral and central CS are augmented (4-year survival 49% vs. 100% in those with normal CS) \[[@pone.0153510.ref009]\]. It is also significant that the studies assessing the prognostic significance of altered CS to hypoxia used different methods to assess it (transient hypoxic method by Ponikowski and rebreathing technique by Giannoni); while no specific comparison between the two methods have not been undertaken, the clinical significance of both might suggest that the biological phenomenon, and not the specific measure to estimate it, is of relevance for the clinician. Animal studies have also demonstrated that CS modulation reverses the above-mentioned negative consequences and improves survival \[[@pone.0153510.ref013],[@pone.0153510.ref024]\]. In fact, in an ischaemic rat model of chronic HF carotid body ablation reduced pre-sympathetic activation, overall sympathetic outflow, normalized baroreflex activation and attenuated cardiac remodelling and LEVF reduction; these translated in an increase in survival from 45 to 85%. If a beneficial prognostic effect should be confirmed in humans after the demonstration of the safety, feasibility and tolerability of carotid body surgical resection \[[@pone.0153510.ref014]\], this could lead to the opening of a strategy of chemoreflex modulation in HF. The application to a broad population of these new developments requires an adequate evaluation of CS. Since now this has been hampered by the difficult spread of the chemoreflex tests, due to technical issues (need of trained physicians, time-consuming test execution and analysis) and patient discomfort, potentially making suboptimal both risk stratification and treatment approach in HF patients, especially in the fore coming new era of the feedback control therapy. Even if the implementation of a widespread assessment of CS is still the goal to be pursued, a convenient strategy may be the identification of a set of common clinical parameters whose alteration could suggest the presence of altered CS to hypoxia or hypercapnia and prompt the evaluation by specialized laboratories which deal with respiratory derangements in HF and their diagnosis. It seems thus judicious to include as much as possible candidates with altered CS while avoiding their exclusion (i.e. prefer sensitivity to specificity); from this point of view, for example, the identification of 11% of patients (i.e., one out of ten) with PB but without increased HVR might represent a reasonable trade-off to avoid such under-diagnosis while sparing, on the other hand, chemoreflex evaluation in a consistent portion of patients (53%). The first clinical model for prediction of CS in HF {#sec015} --------------------------------------------------- Since now, mathematical models \[[@pone.0153510.ref025],[@pone.0153510.ref026],[@pone.0153510.ref027]\] and clinical studies \[[@pone.0153510.ref028]\] have focused on the possibility to predict PB using the chemoreflex as one of the possible contributors and not as the real target, raising attention to the epiphenomenon and not to the mechanism behind it. In this respect, to our knowledge, this is the first attempt to predict CS to both stimuli (hypoxia and hypercapnia) starting from a comprehensive and large cohort of patients fully characterized and under guideline-recommended therapy. In fact, in a small series of HF patients (n = 34) a similar approach have been recently confined to the exclusive prediction of peripheral CS, with NT-proBNP identified as the only independent predictor of HVR: however, the small number of patients recruited and the type of statistics performed limits the strength of study results \[[@pone.0153510.ref029]\]. The rigorous statistical model developed in this study has allowed us to identify 3 main clinical predictors of CS, namely PB, VE/VCO~2~ slope and NT-proBNP, with the possibility to infer the hypoxic and hypercapnic ventilatory response straight off, without actually performing any test. In our study, only using PB and VE/VCO~2~ slope it is possible to closely predict HVR, with an out of bag accuracy of 71% from RF analysis. The strongest variable in this model is represented by PB, which conferred an increase in prediction accuracy of more than 3 times. This relationship has been already highlighted in several previous reports \[[@pone.0153510.ref030],[@pone.0153510.ref031]\]. Normalization of peripheral CS, by administration of dihydrocodeine or exposition to hyperoxia in humans \[[@pone.0153510.ref032]\] and by carotid body monolateral or bilateral cryoablation in animals \[[@pone.0153510.ref024]\] resulted in normalization of breathing pattern. Our study supports these previous findings. Hence, in clinical practice, recognition of PB, much easier to be evaluated in respect to CS, could act as a red flag for identifying patients with altered HVR. Our data suggest VE/VCO2 slope as another contributor in the prediction of HVR. HVR is a measure of the peripheral chemosensitivity. It is known that peripheral chemoreceptors also account for the ventilatory response to carbon dioxide increase (about 20% of the global response), so a relationship between HVR and VE/VCO2 slope is likely. Moreover, during effort the contribution of peripheral chemoreceptors may be increased \[[@pone.0153510.ref033]\]. VE/VCO~2~ slope, in fact, also allowed the prediction of the HCVR in our HF patient cohort, replicating the observation made by previous reports in HF patients \[[@pone.0153510.ref007],[@pone.0153510.ref032]\]. In fact, VEVCO~2~ slope might be considered another possible way of assessing the ventilatory response to CO~2~, with CO~2~ released by the working muscles and not provided from outside. It must be noted that a contributor to VE/VCO2 slope is given by increased pulmonary dead space, especially in more advanced disease states \[[@pone.0153510.ref034]\]; however, it was recently associated, in an HF population, to chronic obstructive pulmonary disease comorbidity \[[@pone.0153510.ref035]\], which we excluded as entry criterion. The emergence of VE/VCO2 as a predictor of increased chemoreflex sensitivity, despite the exclusion of dead space as a cofactor, further stresses the importance of the relation between the two parameter, not always recognized in the adequate manner. NT-proBNP also plays a role in the prediction of HCVR, as already found in a different cohort by our group \[[@pone.0153510.ref007]\]. Two reasons of this observation could be made: first, in an animal study performed on pacing induced HF rabbit, a reduction of peripheral chemoreceptor perfusion by carotid occlusion similar to the one obtained with cardiac output reduction (and potentially expressed by higher level of NT-proBNP), was associated with increased peripheral chemoreceptors, which are also responsive to CO~2~, thus contributing to HCVR \[[@pone.0153510.ref036],[@pone.0153510.ref037]\]. Second, an increase in the diastolic filling pressure (again sensed by the natriuretic peptide system) with stimulation of pulmonary J receptors, may justify a medullary-mediated augmentation of both peripheral and central chemoreceptor reflexes. Generally, NT-proBNP levels could synthesize the multiple influences of the various axes (renin angiotensin aldosterone systems, adrenergic systems) on both peripheral and central chemoreceptors \[[@pone.0153510.ref023],[@pone.0153510.ref038],[@pone.0153510.ref039]\]. On the whole, the absolute predictive power of the model is weaker for HCVR than for HVR (predictive accuracy respectively 58 vs. 71%), likely owing to the different physiological complexity of the two reflexes. HVR relies only on the response of the peripheral chemoreceptor to O2 tension reduction, while HCVR express the response of both peripheral (20%) and central chemoreceptors (80%) to rise in CO~2~. The interaction between peripheral and central chemoreceptors, as well as the multiplicity of different anatomic locations and physiologic responses of central chemoreceptors \[[@pone.0153510.ref040]\] adds to the complexity and justifies the findings. Study limitations {#sec016} ----------------- Despite the limited number of patients recruited, this is one of the largest cohorts of HF patients with complete evaluation of peripheral and central chemoreflexes. Despite the lack of control normal population, the results are consistent because of the statistical approach, that used an internal group (1/3 of the population) as learning subset and the rest of the population as testing subset. Moreover, the number of patients with altered CS is relatively high, allowing the performance of meaningful statistical analysis. Nevertheless, some patients (23%, n = 44) showed combined increased CS; we decided to evaluate this subgroup of patients singularly for CS, and not as a separate subgroup, because the number of patients could hardly permit a separate statistical evaluation of adequate consistency and the relative small number of individuals should not affect statistical output. The population evaluated was composed exclusively of patients with systolic HF; no patients with HF and preserved ejection fraction were evaluated. Diastolic dysfunction could influence CS status acting on pulmonary J receptors and enhancing ventilatory responses. In dog models of congestive HF, inflating a balloon in the left atrium, mimicking the increases in left ventricular end-diastolic pressure increases encountered clinically, causes hyperventilation and increase in loop gain of the ventilatory response to CO2 \[[@pone.0153510.ref041]\]. It must also be recalled that in recent series of systolic HF patients, neither LVEF nor diastolic function were associated with increased pulmonary artery pressure, while were chemoreflex status and the presence of central apnoeas \[[@pone.0153510.ref042]\] thus highlighting the independent influences of feedback loops on hemodynamics and principally on that of the pulmonary circulation. We choose to perform multiple multivariate statistical analysis in order to avoid the possibility of overfitting models, which cannot however be excluded. The concordance between findings of standard statistical methods and computational iterative statistics gives strength to the overall results, even if reproducibility of the sets of variables identified is an issue to be verified. Testing patients under conditions of normocapnic or normoxic conditions during respectively HVR and HCVR could provide less reliable results due to individual variability in the response to CO2 or O2. However, while this is relevant in a physiological scenario, it is less relevant in a clinical scenario like ours, because global response to hypoxia or hypercapnia is what patients with heart failure develop in their daily living, for example during cycles of apnoea; moreover, these same stimuli have been demonstrated to increase the risk of events in the same patients \[[@pone.0153510.ref009]\]. Conclusion and clinical perspectives {#sec017} ==================================== In HF patients, the assessment of breathing pattern, alongside with ventilatory efficiency during exercise and natriuretic peptides levels, helps to identify the subset of patients with increased hypoxic or hypercapnic chemosensitivity. Using these parameters in daily clinical practice may allow the identification of patients with altered CS and prompt the standard evaluation of chemosensitivity; this approach could help widely including the chemoreflex status in the risk stratification of HF patients. This information might be used to contribute to the setup of rational follow-up strategies and to build up a tailored pharmacological/non-pharmacological approach specifically directed to the chemoreflex target. [^1]: **Competing Interests:**The authors have declared that no competing interests exist. [^2]: Conceived and designed the experiments: GM AG ME CP. Performed the experiments: GM AG GI FB. Analyzed the data: GM AG AR ME CP. Wrote the paper: GM AG CP.
2024-06-24T01:27:15.642919
https://example.com/article/5771
Good morning and welcome to the live blog with me, Juliette Garside. Today's focus is on the European debt crisis, with finance ministers gathering for the latest G20 talks in Paris, and news of credit rating downgrades for Spain and Switzerland's UBS bank. Asian stocks tumbled, but the London markets were left unphased by the news, with the FTSE 100 index opening some 10 points higher at 5413. Standard & Poor's cut Spain's credit rating this morning, to AA- from AA, sending the euro lower and echoing last week's move by Fitch. S&P explained its decision to cut the country's long term rating by pointing to Spain's high unemployment, tightening credit and high private sector debt. The agency said: Despite signs of resilience in economic performance during 2011, we see heightened risks to Spain's growth prospects due to high unemployment, tighter financial conditions, the still high level of private sector debt, and the likely economic slowdown in Spain's main trading partners. S&P is worried that labour market reforms in the eurozone's fourth largest economy are incomplete, and that there will be further asset deterioration at its banks. The agency now thinks Spain will see economic growth of just 1% in 2012, down from its February forecast of 1.5%, and warns there may be further downgrades to come. We could lower the ratings again if, consistent with our downside scenario, the economy contracts in 2012, Spain's fiscal position significantly deviates from the government's budgetary targets, or additional labour market and other growth-enhancing reforms are delayed. Back to UBS, Fitch has downgraded the bank's rating from A+ to A, and put seven other European and U.S. banks under review, citing stressed economies and financial markets and regulatory reform. Barclays, Bank, BNP Paribas, Credit Suisse Group, Deutsche Bank, Societe Generale, Bank of America, Morgan Stanley and Goldman Sachs Group have all been put on notice for possible downgrades. Fitch said the cuts would in most cases be one notch, although it could impose two notches in some instances. Michael Hewson, market analyst at CMC Markets, said Europe's banks would have to take a bigger write down on their sovereign debt holdings than current talk suggests: Today sees the beginning of another G20 finance ministers meeting and they will certainly have a lot to talk about now that Slovakia has finally ratified the EFSF [European Financial Stability Facility] bailout fund changes. Problems still remain and have increased in size since the original July 21st meeting with significant debate about how to recapitalise Europe's banks as well as increasing the private sector involvement in relation to Greece. There has been talk of haircuts being increased to between 30-50%, a start but still nowhere near big enough. There has also been talk of how to go about making the EFSF bigger in size with widespread disagreement on how to go about this. UBS global chief economist Paul Donovan is not convinced today's G20 summit will solve the debt crisis. Here are a few highlights from his comments published this morning: The G20 finance ministers gather together to drink champagne, consume foie gras, and spend taxpayers' money on flights to Paris. There is some chatter of agreeing further assistance for the IMF. Agreement is unlikely now (maybe later). Agreeing substantive policies is not what the G20 is for. Donovan is not pinning his hopes on the European Central Bank's leadership either: The ECB's Trichet has demonstrated the dangers of having a non-economist running a central bank by declaring that the ECB should be lender of last resort. Of course the ECB should be lender of last resort. That is the function of a central bank. This is economics 101. (Trichet retires in two weeks). In conclusion, despite Slovakia's approval of a strengthened European Financial Stability Facility, he feels a solution is some way off: Slovakia has approved EFSF version 2.0. This still does not do the job, however, and we need to reboot and upgrade. Banking recapitalisation is still necessary - helping those countries that can not (or will not in the future) be able to help their banks. Here is today's agenda: • Finance ministers and central bank chiefs gather for G20 meeting in Paris • France's Sarkozy meets EU president Barroso – 3pm • US retail sales data – 1.30pm • Michigan consumer sentiment index – 3pm • Result from Italian confidence vote - expected 1pm Hello, Katie Allen here taking over the business live blog from Juliette Garside. Time for a market round-up and it would appear Chinese inflation data is one of the main factors moving the FTSE 100 this morning. After inflation there softened somewhat in September suggesting central bank policymakers will pause in their tightening programme, commodity prices rose and on the UK stock market miners pushed higher. The FTSE 100 is up 40 points, or 0.7%, at 5443.6, reversing Thursday's 38 point fall. Elsewhere in markets, France's CAC 40 stock index is up 16 points, or 0.5%, at 3202.9 while Germany's DAX is up 52 points, or 0.9%, at 5966.8. In commodity markets, Gold is higher at $1,675.1 an ounce while copper is also higher, up more than 3% to $7,540.25 a tonne. Gilt prices have fallen as equity prices go up while the pound, at $1.5775 is not far off a one-month high hit on Wednesday of $1.5798. News just in from Reuters that the ECB reportedly buying Italian and Spanish bonds. The news agency quotes one trader saying: "They have been asking for Italy and Spain all across the curve, from two-year to 10-year." The European Central Bank first began buying Italian and Spanish bonds in the secondary market in August in the hope of keeping yields under control. Today's move by the ECB follows Standard & Poor's downgrade to Spain's credit ratings, which had pushed yields on Spanish government bonds higher in morning trading. The fact G20 finance ministers and central bank chiefs are meeting in Paris today has buoyed market sentiment to some extent but economists are warning not to anticipate much action to result from the meeting. Previewing the meeting earlier this week, James Knightley, senior economist at ING Financial Markets said: We are not expecting too much from this, but it may give us a reasonable guide as to how the all-important G20 leaders' summit in Cannes in early November will go. We will hopefully get a better handle on what direction policy action on bank recapitalisation and the euro zone sovereign debt crisis is heading and potentially some news on other stimulus measures to combat the increasing recession threat. Michael Turner, strategist at RBC Capital Markets says: It is easy to envisage this meeting as largely an opportunity for non-European countries to voice their displeasure at European policy makers. Little meaningful policy progress is likely to be made; most European leaders will have the October 23 EU summit circled in their diaries as the main event. More data from the UK to cast doubt over the economic recovery: news of a slowdown in the construction sector. The news comes after a week that has seen a slew of UK data, including figures showing that: manufacturing output fell in August, unemployment hit a 17-year high and exports rose a record high in August. This morning sees the release of less closely watched data on the construction sector, which makes up 7.6% of the economy. The Office for National Statistics reports construction output rose 0.4% in August but fell 4.1% on a year earlier. Chris Williamson, chief economist at Markit, comments: Construction industry output appears to be collapsing, according to the latest official data. There is a clear and worrying downward trend in the health of the industry so far this year, which corroborates a similar downturn in the construction PMI (purchasing managers' index) survey. Having registered double-digit annual growth at the start of the year (output rose 10.8% compared to January of last year), growth has rapidly deteriorated such that output has fallen at an accelerating rate in the latest three months, slumping some 4.1% on a year ago in August. While the first quarter saw a buoyant 6.8% expansion on last year, the second quarter saw output rise a mere 1.2% and data for the first two months of the third quarter show a fall of 2.7% compared to the same two month last year. While we continue to expect the economy to have grown in the third quarter, largely due to a rebound from disruptions to business in the second quarter, the downturn in the construction sector provides further cause to worry about the overall health of the economy. Howard Archer, economist at IHS Global Insight says: It is evident that the construction sector faces an extremely challenging environment, which threatens to limit activity over the coming months. In particular, the government's public spending cuts are limiting overall expenditure on public buildings, schools, hospitals and infrastructure (even though the government is keen to prioritize some infrastructure projects). On top of this, house building activity is likely to be constrained by persistently weak housing market activity, soft prices and a worrisome outlook. And if the economy continues to struggle markedly over the coming months, there is the danger that construction activity will be hit increasingly hard by projects being on hold or cancelled altogether. One possible ray of hope for construction is that a number of initiatives that the government is looking at to try to boost growth would have beneficial impacts for the sector. In particular, the government is looking to boost house building through instructing government departments to release state-owned land to be built on under a "Build Now, Pay Later" scheme. It has also been rumoured that the government is looking at investing an extra £5 billion on capital projects, although, for the time being at least, government ministers will only say that they are sticking to their spending plans. German Chancellor Angela Merkel has just been speaking about the euro zone crisis and has vowed to help other countries in the euro zone when the stability of the broader bloc is in danger. She also says there is no "big bang" solution to the crisis and nor a euro bonds a miracle solution. She has outlined two priorities for the G20 summit of leaders in November. Reuters quotes Merkel as saying: There are two key issues for the G20 to discuss. The first is how can we prevent the spread of less regulated financial markets... and how do we deal with shadow banks and create a framework that prevents a troubled bank from hurting the whole sector. As commentators around the world try to tot up what the Greek crisis will costs, my colleague Simon Rogers has just posted an interactive graphic showing the worst financial upheavals in history. Louise Cooper, markets analyst at BGC Partners, has sent us her thoughts on the G20 meeting. I feel pretty confident predicting that the meetings could get quite fiery, given the state of the world. And its not just the Eurozone, tensions between the Chinese and Americans are hotting up thanks to US legislation aiming to penalise China for its undervalued exchange rate. Treasury Secretary Tim Geithner is getting used to (and possibly enjoying) reprimanding European leaders and ratings agencies add further to the burden with a drip drip of downgrades for both sovereigns and banks (again get used to it). Pressure is mounting from all sides for the Politicians to come up with a big bazooka rather than a water pistol. A number of proposals are emerging - • Plans to increase the firepower of both the EFSF (all sorts of suggestions to do this) • Boosting funds available to the IMF (with the emerging economies of the world picking up the bill). • Bank recapitalisations • Increased haircuts for Greece However there are so many decisions that need to be made and little consensus from those involved. Italian Prime Minister Silvio Berlusconi is safe for now, he has just won the confidence vote in parliament US data shows retail sales rose a bigger-than-expected 1.1% in September, the fastest growth for seven months. The Commerce Department reports that excluding autos, the rise was also bigger than expected at 0.6%. Economists had forecast a total rise of 0.7% and a rise without autos of 0.3%. The news has helped the FTSE 100 extend gains to be up 76 points, or 1.4%, at 5479, while US futures point to a solid open on Wall Street. Economic thinktank Re-Define has just sent us its take on the Italian confidence vote. Re-Define's managing director Sony Kapoor says: This is bad for Italy and bad for the Eurocrisis. With Mr. Berlusconi still at the helm, there is nothing that Italy can do from within that will restore market confidence. At the same time, European partners and the ECB are much less likely to want to support Italy as long as he is around. Mr Berlusconi has brought Italy to the brink, and now, he make take it over the edge. The best signal that Italy could have sent to the markets would have been to boot Mr Berlusconi out, but it has failed to do so. It may now be time for Italians to offer Berlusconi an amnesty to cajole him to leave. The longer he stays, the worse it is for Italy. Italy is fundamentally solvent, but a bit more time under Mr Berlusconi, and it may no longer be. My colleague John Hooper is tweeting on the Italian confidence vote from Rome. US stock market futures have added to gains in the wake of those stronger-than-expected retail sales numbers. Rob Carnell at ING Financial Markets has this to say about the data: We thought that retail sales would come in strongly. Auto sales for September had been very good, chain store sales looked impressive, and a combination of underlying factors such as slight improvements in the labour market, falling retail gasoline prices and improved equity markets probably added to the mix. Moreover, there was a suggestion that hurricane-postponed back-to-school spending in August was put back to September, and that may have also provided a bit of a boost. US stock markets have just opened and the stronger-than-expected data showing a 1.1% rise in US retail sales last month has helped them rally. The Dow Jones Industrial Average is up 109 points, or 1%, at 11588. My colleague David Gow in Brussels sends us this update on how the EFSF might be boosted up into a "bazooka": Brussels is bathed in autumnal sunshine, EU officials are sitting, tie-less if male, in parks - and the action has moved with the Thalys to Paris, just an hour and 20 minutes away, and the G20. Even so, we're now getting a bit more visibility here on how policy-makers plan to turn the euro zone rescue fund, the EFSF, into a "bazooka." The best way to "optimise its resources", it appears, is to forget about it being a bank but, rather, treat it as an insurer. That means guaranteeing the first, say, 20% of private sector losses on Spanish and Italian bonds, perhaps 30% on those of more peripheral, weaker countries. That way, you don't have to upset the ECB and its new Italian president-in-waiting, Mario Draghi, by pressing it to buy even more government bonds. The aim, above all, is to avoid anything that smacks of the CDOs that got the entire world into trouble in 2007. The insurer idea has the merit of being acceptable to Berlin and not entirely anathema to Paris which had favoured the EFSF as a bank. Christophe Frankel, the fund's CFO and deputy chief executive, told reporters here today "any decision to use the EFSF's capacity more efficiently will not lead to an increase in guarantees from the member states" and, therefore, no impact on its own Triple A rating. Those guarantees of €780bn allow effective credit lending of €480bn but the insurer role could triple or quadruple its firepower. It's another of the ideas being kicked around in EU capitals but one gaining substantial traction. As is the notion - being discussed by G20 finance ministers in Paris - of an IMF "stability" bond that would be backed by, inter alia, China and other BRICs. This apparently landed on Brussels desks a few days ago. But sometime next week we should get the definitive blueprint for the "comprehensive, cohesive" plan from Merkel and Sarkozy in time for the five top-level meetings, including two summits, taking place between Friday night and Sunday evening. Spain's government has been fighting back following the S&P downgrade. Referring to downgrades to Spain last week from Fitch, Economy Minister Elena Salgado says such ratings agencies are allowing themselves to be swayed too much by problems in the euro zone. We are wrapping this blog up now but before we do, here is a quick summary of where markets stand as we head for the weekend and a round-up of the day's main events so far. With around an hour to go till the close, the FTSE 100 stands at 5466, up 62 points, or 1.2%, on the day, helped by higher commodity prices, hopes of some resolution to the euro zone debt crisis and stronger-than-expected retail sales data from the United States. The pound has strengthened against the dollar to stand at $1.5825, the highest in almost a month. The Dow Jones Industrial Average is up 97 points, or 0.8%, 11576, the Standard & Poor's 500 Index is up 14 points, or 1.2%, at 1217.7 and the Nasdaq Composite Index is up 31 points, or 1.2%, at 2650.8. Brent crude has pushed through $114 a barrel, copper is higher and so is gold. Now to the main events of the day: • G20 finance ministers and central bank chiefs are meeting in Paris • Italy's Silvio Berlusconi survived a confidence vote • Standard & Poor's cut Spain's credit rating this morning • Fitch downgraded UBS and put seven other European and U.S. banks under review • US retail sales rose 1.1% in September, the fastest growth for seven months • US consumer sentiment unexpectedly slumped this month • UK construction sector output rose 0.4% in August but fell 4.1% on a year earlier
2023-11-04T01:27:15.642919
https://example.com/article/5482
23 Lexington Avenue, St Clair NSW 2759 $749,950 - $799,950 4 2 4 SOLD $770,000.00 by Angelo @ Erskine Park Professionals If you are looking for a property with huge potential, now or in the future, then look no further. Strategically located in a cul-de-sac is this good size block Zoned R2, perfect for dual occupancy/duplex or to add a granny flat (STCA), with features such as:- • 4 bedrooms, 3 with built ins • 2 spacious car garage with side access and drive through access • Brand new timber floating floorboards throughout • Large covered pergola area overlooking your massive rear yard • Neat and tidy 3 way bathroom and an ensuite to the main bedroom • Large galley kitchen, featuring stainless steel appliances • Other features include air conditioning and gas points throughout • Currently tenanted at $500 per week with great tenants willing to stay on
2024-01-14T01:27:15.642919
https://example.com/article/6649
Sathyabhama Das Biju Sathyabhama Das Biju (born May, 1963) is an Indian amphibian biologist, wildlife conservationist and heads the Systematics Lab at the University of Delhi, Department of Environmental Studies. He is dubbed as the " frogman of India " by media for his passion for frogs and for bringing fresh fascination for Indian amphibians. In a recent interview with Sanctuary Asia, he was introduced as "one of the world's foremost amphibian experts". In 2010, Biju in collaboration with national and international institutions launched the nationwide Lost! Amphibians of India campaign to rediscover species thought to be extinct. In 2011, Biju was the recipient of the Sanctuary Wildlife Service Award for his "extraordinary passion which led to the discovery of several new species". In 2008, the IUCN recognized his "extreme dedication to discover and conserve the vanishing amphibian fauna" by conferring him the Sabin Award. In 2006, he established the Systematics Lab at the University of Delhi to bring together and train young researchers in the field of herpetology. Early life Born and raised in rural Kerala in the town of Kadakkal, Biju did not receive a proper formal school education. He completed his master's degree in Botany from Kerala University in 1987 and obtained his first PhD in Plant Systematics in 1999 from Calicut University. During 1992 to 2003 he was a Scientist at the Jawaharlal Nehru Tropical Botanical Garden and Research Institute (formerly Tropical Botanical Garden and Research Institute) (TBGRI) and during his brief stint as a plant systematist published seven new plant species, resolved long-standing taxonomic and systematic problems of plants belonging to the families Convolvulaceae and Rubiaceae, besides publishing several research articles and books on plants. He is currently working as Head of the Department of Environmental Studies and Dean, the Faculty of Science at University of Delhi. Amphibian research Biju became increasingly fascinated with frogs that he encountered during the several field expeditions he conducted in the Western Ghats in search for plants. To be able to fully explore the world of amphibians Biju eventually quit his research in plant science in 2000 and joined with at the Amphibian Evolution Lab, Vrije Universiteit Brussel and obtained his second PhD, this time in Amphibian Systematics. In less than a decade of his professional career as amphibian systematist, Biju's efforts have already thrown up over 100 new species and formally described 96 new species, eight new genera and two new families of amphibians. Remarkable among his discoveries are the entirely new and famed purple frog family Nasikabatrachidae from the Western Ghats of India, published in the journal Nature This discovery was heralded as once-in-a-century find because the last time a new family of amphibians was described was almost 100 years back. His second discovery of a new amphibian family was in 2012, the Chikilidae, popularly called tailless burrowing caecilians or chikilids, published in the journal Proceedings of the Royal Society, Series B. This discovery was called the 'discovery of the year' and as 'another giant scientific discovery'. Both these discoveries of ancient lineages (both the families about 140 million years old) shed significant light on biogeographic history of the Earth, particularly that of the Gondwana, and in understanding the present-day continental distribution patterns of organisms–while the closest relatives of the purple frog lives 3,000 km across the Indian Ocean in the Seychelles, that of the chikilids is found 7,000 km in Africa. Notable among his new species discoveries are India's first canopy frog Raorchestes nerostgona; India's smallest tetrapod Nyctibatrachus minimus, a frog whose adults do not grow more than 10 mm; and Nasikabatrachus sahyadrensis, the famed purple frog. A critical aspect of Biju's work has been the combination of molecular techniques with traditional approaches bringing on par with the international practice in amphibian research. His efforts have resolved long-standing taxonomic and systematic problems and confusions in difficult amphibian groups: the bush frogs Philautus and night frogs Nyctibatrachus. In recognition of his outstanding contribution to India's modern amphibian systematics scientists named a frog after him Polypedates bijui. Biju's tireless endeavor brought the Indian amphibians into the global limelight. The world was taken by surprise to see a frog featured on the cover of a largely macro-economics and a business magazine, The Economist, London. Conservation career Biju's conservation concern for the rapidly vanishing amphibians, incidentally the world's most threatened vertebrate group led to the creation of two important conservation initiatives in India. The Western Ghats Network of Protected Areas of Threatened Amphibians (WNPATA), a network for individuals and institutions working on amphibians in the Western Ghats. In collaboration with national an international institutions and individuals Biju launched a unique nationwide campaign called the Lost Amphibians of India (LAI) to rediscover 'lost' species that have not been sighted in life for as long two centuries since they were originally discovered and described. The unique feature of LAI is the involvement of civil society including students, members of NGOs, and other non-amphibian specialists in conservation initiatives and has huge implications in conservation of amphibians. LAI has over 600 team members and has conducted about 42 field expeditions. Publications Biju has extensively published in high impact factor and prestigious journals such as Nature, Science, Zoological Journal of the Linnean Society, Proceedings of the National Academy of Sciences, Proceedings of the Royal Society, and has written books on both plants and amphibians. Awards Sanctuary Wildlife Service Award (2011) IUCN Sabin Award (2008) See also List of herpetologists References External links Category:20th-century Indian biologists Category:Living people Category:Indian herpetologists Category:University of Delhi faculty Category:1963 births Category:University of Kerala alumni Category:Alumni of University of Calicut Category:Free University of Brussels alumni Category:Scientists from Kerala Category:People from Kollam district Category:Indian conservationists Category:Activists from Kerala
2024-04-04T01:27:15.642919
https://example.com/article/8469
Film Review Fahrenheit 9/11 If only it were a dream By Tim McGivern “At least I did not have sexual relations with that woman ...” Fahrenheit 9/11 Directed by Michael Moore Cast: Michael Moore, George W. Bush If sarcasm is the refuge of the weak, then Michael Moore's enormous, artistic success as a documentary filmmaker would be a farce. Tragedy is not supposed to funny. But in these brutish times, Fahrenheit 9/11, a depressing film in its exposure of the realities in Iraq, is also comical when it shows us, as Americans (our Marine recruiters, peaceniks, congressmen and Brittany Spears to name a few), who we really are. More than just a mirror of American culture, Fahrenheit 9/11 ultimately focuses on the uncensored horror of the Iraq invasion and posits that President Bush is clueless to it all. Considering Moore has openly stated he wants to see Bush defeated in November, this is where the White House could be in trouble. That's because, as Paris Hilton and Rodney King can attest, videotape doesn't lie, and the candid, highly selective clips of Dubya bumbling through his day's agenda effectively support Moore's point that Bush is a pretender. That point is most compelling when the film shows Bush reading to grade-schoolers for seven minutes after being told our nation is under attack. What the hell is he doing sitting there? It makes you want to scream, “Do something!” “So, uh, you think a middle aged guy like me could make it through basic?” But Bush looking and sounding inept is old news, and when the film unimpressively began with a buffet of obvious Bush-hater fare, including Haliburton, the PATRIOT Act, Katherine Harris and the Texas Air National Guard years, I wondered if it wasn't going to be some predictable partisan rant. For example, even before the opening credits, Moore recaps the 2000 presidential election with CBS and CNN calling Florida for Al Gore. Then John Ellis, George W. Bush's cousin who happened to be running Fox News' election coverage, announced a Florida victory for his kin. We are then forced to witness Gore, weeks later, in his final, humiliating role as overseer of the U.S. Senate pounding a gavel to silence African American members of the House who are protesting his defeat. Moore's narrative sets up the sequence: "Was it a dream?" No it wasn't, and thankfully Gore has nothing to do with the rest of the film, which gives way to some outstanding work exposing the Bush family's ties to Saudi oil money. That, in turn, gives way to a patriotic, God-loving mother from the heartland named Lila Lipscomb, who loses her son in Iraq, and takes her grief to the White House gates. In between, cartoonish moments—such as Moore driving an ice cream truck around Capitol Hill reading the PATRIOT Act over an intercom, mocking Congressional members who openly admit they never read the legislation—sustain Moore's trademark penchant for wild tonal shifts. What pulls the film together, though, is that each element is linked to American foreign policy, which is, of course, an extension of our collective values (like it or not), and the costs are still unraveling in Iraq as you read this. As Mrs. Lipscomb's stoic husband says: “I feel sorry for the parents whose sons and daughters are dying today, for nothing.” In these moments, and there are plenty of them, you can easily see why the Bush administration should be, um, concerned about this film. What's more, dozens of Osama bin Laden's relatives were shuttled out of the United States in the days following the World Trade Center and Pentagon attacks. How could this be defensible U.S. policy? (The White House to this day refuses to explain who arranged the flights and when—a point Moore actually omits.) "Not even Ricky Martin could fly," says Moore, and there's the bewildered butt-shaker grounded at the gate. Then: "... no one except the bin Ladens." (Actually, most of Osama's family left on Sept. 20 after the heaviest travel restrictions had been lifted.) Still, the segment provides a long list of distressing commentary and in the final thought-provoking analysis, Moore deadpans: "Imagine Clinton arranging a trip out of the country for the McVeigh family after Oklahoma City." In the end, Moore is a polemicist, not an investigative journalist, and footage of slaughtered Iraqis, American military corpses and testimonials from young soldiers with amputated limbs (the real news we never see) dominates the second half of the film, culminating when Mrs. Lipscomb's grief reaches such tragic proportions that that camera feels like an obscene intrusion. We thought she was a strong woman; moments earlier, she held her composure enough to read her son's final letter from Iraq, where he writes, "I really hope they don't re-elect that fool." And there—juxtaposed with Moore hounding members of Congress to enlist their sons and daughters to fight in Iraq (none accept, although it should be noted that, technically, no person can “enlist” another)—is the antagonist's message. Will Bush loyalists see the film before criticizing it? I doubt it. But will swing voters go see it? Karl Rove should hope not. Bush-bashers, of course, will have a field day. Either way, expect to be provoked as much as informed and expect to laugh, even when the story unfolding would be a lot funnier if it really were a dream.
2024-03-03T01:27:15.642919
https://example.com/article/2518
--- abstract: 'Although recent advances have made it possible to manipulate electromagnetic and acoustic wavefronts with sub-wavelength metasurface slabs, the design of elastodynamic counterparts remains challenging. We introduce a novel but simple design approach to control SV-waves in elastic solids. The proposed metasurface can be fabricated by cutting an array of aligned parallel cracks in a solid such that the materials between the cracks act as plate-like waveguides in the background medium. The plate array is capable of modulating the phase change of SV-wave while keeping the phase of P-wave unchanged. An analytical model for SV-wave incidence is established to calculate the transmission coefficient and the transmitted phase through the plate-like waveguide explicitly. A complete $2\pi$ range of phase delay is achieved by selecting different thicknesses for the plates. An elastic metasurface for splitting SV- and P-waves is designed and demonstrated using full wave finite element (FEM) simulations. Two metasurfaces for focusing plane and cylindrical SV-waves are also presented.' author: - Xiaoshi Su - Zhaocheng Lu - 'Andrew N. Norris' title: 'Elastic metasurfaces for splitting SV- and P-waves in elastic solids' --- \[intro\]Introduction ===================== Achieving full control of wave propagation with ultra-thin material slabs is of particular interest in engineering applications. In the past decade, the emerging area of metasurface research has made it possible to manipulate optical and electromagnetic waves in an almost arbitrary way by tuning the phase gradient at the sub-wavelength scale. [@Yu2011; @Sun2012; @Kildishev2013; @Pfeiffer2013; @Estakhri2016] This concept has also found applications in acoustic designs such as focal lenses, [@Li2012a; @Wang2014; @Li2014] anomalous reflection and refraction, [@Zhao2013; @Zhao2013a; @Dubois2017; @Xie2014; @Li2015; @Li2016], and generation of acoustic orbital angular momentum. [@Jiang2016; @Shi2017] Elastic metasurfaces [@Zhu2016; @Liu2017] are relatively unexplored; they present specific challenges due to the mode conversion at the material interface which makes the phase modulation more complicated. Recently, @Zhu2016 designed and experimentally demonstrated a few metasurfaces for controlling mode converted and unconverted lamb waves in plates. However, their design approach involves mode conversion, as a result, the transmitted field contains unwanted wave types. We are interested in controlling different types of bulk waves individually without introducing others. We propose a new metasurface design to split SV- and P-waves in elastic solids into different propagation directions without involving mode conversion. Achieving full control of these types of waves may have applications in ultrasonics and nondestructive evaluations. The metasurfaces are designed by introducing an array of aligned parallel cracks in a bulk elastic medium. The materials separated by these cracks act as plate-like waveguides connecting two elastic half-spaces. For a normally incident SV-wave, the transverse vibration couples to the flexural waves in each plate without mode conversion. Then each of the plate-like waveguide serves as a phase modulator to achieve certain phase gradient for the transmitted wavefronts. The main idea is that the phase speed of the SV-wave in the background material only depends on the material properties, while the flexural wave speed in the plate is sensitive to the thickness which makes it possible to achieve desired phase shift for the metasurface design. For instance, we can design a metasurface to change the propagation direction of the transmitted SV-wave by tuning the phase gradient according to the generalized Snell’s law [@Yu2011] $$\label{general} (\sin \theta_t-\sin \theta_i)k_T=d\phi/dy,$$ where $k_T$ denotes the wavenumber of the SV-wave in the solid; $\phi$ is the phase of the transmitted wave; $\theta_i$ and $\theta_t$ are the incident and transmitted angle, respectively. The mechanism for normally incident P-wave is different in that the longitudinal wave speeds in the plate array are the same. Due to this feature, there is no phase difference in the transmitted wavefronts and therefore the P-wave travels along the incident direction. In the applications proposed in this paper, the phase gradients are small so that the phase modulation is more critical than the amplitude modulation. In order to predict the transmitted phase accurately, we first establish an analytic model to calculate the transmission coefficient of the unit cell. Then we take advantage of this model to select the thicknesses of the plates for the metasurface designs. The same transmission problem has been considered by @Su2016, but the model was based on a thin plate assumption which is only valid for a low frequency range, i.e. $kh\ll 1$. In this paper, we improve the analytic model using Mindlin plate theory [@Mindlin51] which introduces two high frequency correction factors and therefore works for thick plates at higher frequency range. The explicit expressions for the transmission coefficient and the transmitted phase are obtained. Note that the analytic model for P-wave incidence in Ref. [ -‘ [@Su2016] ]{} works very well, we will use this model in the discussion of the transmission properties for P-wave incidence. Several metasurface devices for different purposes, including mode splitting of SV- and P-waves and focusing of plane and cylindrical SV-waves, are designed using the analytic model and demonstrated using full wave FEM simulations. The paper is organized as follows. The unit cell design and the transmission properties of the metasurface are introduced and discussed in Sec. \[PhaseM\]. The phase modulation by thickness variations of the plates is also proposed in Sec. \[PhaseM\]. Several metasurfaces are designed and demonstrated using full wave FEM simulations in Sec. \[MSdesign\]. Section \[concl\] concludes the paper. \[PhaseM\]Unit cell design and transmission properties ====================================================== Description of the transmission problem --------------------------------------- We first derive the transmission coefficient for a normally incident SV-wave propagating through an array of uniform parallel plate separated by equally spaced rectangular cracks. The Young’s modulus of the solid is denoted by $E$, shear modulus by $\mu$, Poisson’s ratio by $\nu$ and density by $\rho$. The configuration is shown in Fig. \[platearray\]. ![2D schematic view; (a) shows two half-spaces connected by a uniform plate array separated by parallel cracks (white slits). The parallel black arrows indicate the propagation direction of the normally incident SV-wave; the red arrows indicate the direction of particle motion; (b) shows a unit cell of the slab.[]{data-label="platearray"}](figure1){width="\columnwidth"} Each individual plate has thickness $h$ and length $L$; the crack has width $a$ and length $L$. The transmission problem can be understood as follows: the normally incident plane SV-wave in a half-space impinges on an array of aligned parallel plates and couples with the flexural waves in plates; flexural waves then transmit through the plate array into another half-space producing the transmitted SV-wave. The critical physics underlying the tranmission is that the phase speed of the SV-wave only depends on the material properties, while the flexural wave speed is sensitive to the thickness of each plate. This combination of wave properties makes it possible to achieve specific phase delay through thickness variations. In order to quantify the metasurface design, it is useful to derive explicit expressions for the transmission coefficient and transmitted phase. Due to the periodicity in the $y$-direction, the whole transmission problem is equivalent to that outlined in the dashed box in Fig. \[platearray\](b). A detailed description regarding the notations in this figure will be given in Sec. \[derive\]. The derivation procedure of the transmission and reflection coefficients for SV-wave incidence is similar to that in Ref. [ -‘ [@Su2016] ]{} in which Kirchhoff plate theory was used under thin plate assumptions. However, the Kirchhoff theory does not hold at the high frequency range even for thin plates. In this section, we will develop a more sophisticated model to better predict the transmission coefficient at the high frequency range. @Mei2005 studied wave reflection and transmission in beams with discontinuities using Timoshenko beam theory. We are dealing with transverse wave reflection and transmission at the junction of bulk material and an array of plates where the governing equations are different. Here we use the Mindlin plate theory [@Mindlin51] with two high frequency correction factors and consider similar boundary conditions to establish the analytic model and calculate the transmission and reflection coefficients accurately. More detailed description and derivation will be given in the following sections. Governing equations in the plate-like waveguides {#desc} ------------------------------------------------ The plate-like waveguides connecting the two half-spaces act as phase modulators. We assume the plate array is uniform and due to the periodicity in the $y$-direction only consider the transmission problem in one plate, see Fig. \[platearray\](b). According to the Mindlin plate theory, the governing equations of the transverse waves in the absence of external force are $$\label{gov} \begin{aligned} \kappa \mu \Big ( \frac{\partial \psi }{\partial x} - \frac{\partial^2 w }{\partial x^2} \Big )+\rho \frac{\partial^2w }{\partial t^2}&=0,\\ EI\frac{\partial^2 \psi }{\partial x^2}+\kappa \mu A\Big( \frac{\partial w }{\partial x}-\psi \Big) -\lambda \rho I \frac{\partial^2 \psi }{\partial t^2} &= 0, \end{aligned}$$ where $w(x,t)$ is the displacement in the $y$-direction, $\psi(x,t)$ is the bending angle, $I=bh^3/12$ is the area moment of inertia; $A=bh$ is the cross section area of the plate; $\kappa$ and $\lambda$ are the shear and inertia correction factor, respectively. In the absence of external force, the free wave propagation solutions are $w(x,t)=We^{i(kx-\omega t)}$ and $\psi(x,t)=\Psi e^{i(kx-\omega t)}$. Plugging the solutions into Eq.  leads to $$\label{eig} \begin{bmatrix} \rho \omega^2 - \kappa \mu k^2 & -i\kappa \mu k\\ i\kappa \mu A k & \lambda \rho I \omega^2 -\kappa\mu A-EIk^2 \end{bmatrix} \begin{pmatrix} W\\ \Psi \end{pmatrix}=0.$$ The equation for the wavenumber $k$ is therefore $$\label{dispersion} k^4-(\lambda_P^2 +\frac{k^2_T}{\kappa})k^2+\frac{\lambda k^2_Tk_P^2}{\kappa}-k_F^4=0,$$ where $k_T=\omega\sqrt{\rho/\mu}$, $k_P=\omega \sqrt{\rho(1-\nu^2)/E}$ and $k_F=\big( 12\omega^2\rho (1-\nu^2)/Eh^2 \big)^{1/4}$ are the wavenumbers of transverse, longitudinal and flexural waves, respectively. From Eq. , the wavenumbers in the plate are $$\label{wavenum} \begin{aligned} k_1&=\pm \bigg\{ \frac{1}{2}(\lambda k_P^2+\frac{k^2_T}{\kappa})+\sqrt{\frac{1}{4}(\lambda k_P^2-\frac{k^2_T}{\kappa})^2+k^4_F} \bigg\}^{1/2},\\ k_2&=\pm \bigg\{ \frac{1}{2}(\lambda k_P^2+\frac{k^2_T}{\kappa})-\sqrt{\frac{1}{4}(\lambda k_P^2-\frac{k^2_T}{\kappa})^2+k^4_F} \bigg\}^{1/2}. \end{aligned}$$ Note that within the frequency range of interest ($\omega<\sqrt{12\mu\kappa/\lambda \rho h^2}$) $k_1$ is real and corresponds to a propagating wave, while $k_2$ is imaginary and corresponds to an evanescent wave. Transmission and reflection coefficients {#derive} ---------------------------------------- Considering the transmission problem for a normally incident SV-wave, in Fig. \[platearray\](b), we assume the amplitude of the incident SV-wave as $1$, reflected SV-wave as $R$, transmitted SV-wave as $T$, and flexural waves in the plate array as $A_j$, $B_j$, $j=1,2$ so that $$\label{displ} w= \begin{cases} e^{ik_Tx}+Re^{-ik_Tx}, &x<- \frac L2,\\ A_1e^{ik_1x}+B_1e^{-ik_1x} \\ \hspace{35pt} +A_2e^{ik_2x}+B_2e^{-ik_2x}, &|x|<\frac L2,\\ Te^{ik_Tx}, &x> \frac L2, \end{cases}$$ with time harmonic dependence $e^{-i\omega t}$ understood. The relations between the shear and inertia correction factors and the slope in the plate can be obtained from the equations of motion as [@Mindlin51] $$\Psi=ik_j\beta_jW , \ \ \beta_j=1-\frac{k_T^2}{\kappa k_j^2}, \ \ j = 1 \text{ or }2. $$ The deflection angles in different parts of the structure based on Eq.  are $$\label{slop} \psi= \begin{cases} ik_T\big(e^{ik_Tx}-Re^{-ik_Tx}\big), &x<-\frac L2,\\ ik_1\beta_1\big( A_1e^{ik_1x}-B_1e^{-ik_1x}\big) \\ \hspace{10pt} +ik_2\beta_2\big( A_2e^{ik_2x}-B_2e^{-ik_2x}\big), & |x|<\frac L2,\\ ik_TTe^{ik_Tx}, &x>\frac L2, \end{cases}$$ Equations and involve six unknowns where the transmitted amplitude $T$ and the reflected amplitude $R$ are of particular interest. To solve for the six unknown parameters, we need six boundary conditions, i.e., displacement, deflection angle and shear force continuity at both ends of the plate. The displacement and deflection angle continuity can be easily established using Eqs.  and . The average shear forces along the $z$-direction in the half-space and the plate are $Q=\mu h^\prime(\partial w/\partial x)$ and $Q=\kappa \mu h(\partial w/\partial x -\psi)$, respectively. Using the six boundary conditions we can establish a $6 \times 6$ system with six unknowns to solve for the transmission and reflection coefficients. This procedure involves too many undesired long equations, so as an alternative we split the solutions into symmetric and antisymmetric modes, which reduces the problem to two $3 \times 3$ systems. For the symmetric mode, the displacements in the half-spaces and the plate are rewritten as $$\label{symw} w_S= \begin{cases} \frac{1}{2}(e^{ik_Tx}+R_Se^{-ik_Tx}), &x<- \frac L2,\\ C_{S1}\cos k_1x +C_{S2}\cos k_2x, &|x|< \frac L2 ,\\ \frac{1}{2}(e^{-ik_Tx}+R_Se^{ik_Tx}), &x>\frac L2 , \end{cases}$$ and the deflection angles are $$\label{sympsi} \psi_S= \begin{cases} \frac{ik_T}{2}(e^{ik_Tx}-R_Se^{-ik_Tx}), &x<- \frac L2,\\ -k_1\beta_1 C_{S1}\sin k_1x -k_2\beta_2 C_{S2}\sin k_2x, &|x|< \frac L2 ,\\ -\frac{ik_T}{2}( e^{-ik_Tx} - R_Se^{ik_Tx} ), &x>\frac L2 , \end{cases}$$ where $C_{S1}$ and $C_{S2}$ denote the amplitude of symmetric modes in the plate, $R_S$ corresponds to the amplitude of the reflected wave in the half-spaces. Similarly, considering the antisymmetric mode we can write the displacements and deflection angles as $$\label{antiw} w_A= \begin{cases} \frac{1}{2}(e^{ik_Tx}+R_Ae^{-ik_Tx}), &x<- \frac L2,\\ C_{A1}\sin k_1x +C_{A2}\sin k_2x, & |x|< \frac L2 ,\\ -\frac{1}{2}(e^{-ik_Tx}+R_Ae^{ik_Tx}), &x>\frac L2 , \end{cases}$$ and $$\label{antipsi} \psi_A= \begin{cases} \frac{ik_T}{2}(e^{ik_Tx}-R_Ae^{-ik_Tx}), &x<- \frac L2,\\ k_1\beta_1 C_{A1}\cos k_1x +k_2\beta_2 C_{A2}\cos k_2x, &|x|< \frac L2 ,\\ \frac{ik_T}{2}( e^{-ik_Tx} - R_Ae^{ik_Tx} ), &x>\frac L2 , \end{cases}$$ where $C_{A1}$ and $C_{A2}$ denote the amplitude of antisymmetric modes in the plate, $R_A$ corresponds to the amplitude of the reflected wave in the half-spaces. The boundary conditions for each problem now reduce to displacement, deflection angle and shear force continuity at one end of the plate. Applying the boundary conditions leads to $$\begin{aligned} \label{sym} \begin{bmatrix} \cos(k_1L/2) & \cos(k_2L/2) & -\frac{1}{2}z\\ k_1\beta_1\sin(k_1L/2) & k_2\beta_2\sin(k_2L/2) & \frac{1}{2}ik_Tz\\ \kappa hk_1(1-\beta_1)\sin(k_1L/2) & \kappa hk_2(1-\beta_2)\sin(k_2L/2) & \frac{1}{2}ik_Th^\prime z \end{bmatrix} \begin{pmatrix} C_{S1}\\ C_{S2}\\ R_S \end{pmatrix} &= \begin{pmatrix}\frac{1}{2}z^{-1}\\ \frac{1}{2}ik_Tz^{-1}\\ \frac{1}{2}ik_Th^\prime z^{-1}\end{pmatrix} , \\ \begin{bmatrix} -\sin(k_1L/2) & -\sin(k_2L/2) & -\frac{1}{2}z\\ k_1\beta_1\cos(k_1L/2) & k_2\beta_2\cos(k_2L/2) & \frac{1}{2}ik_Tz\\ \kappa hk_1(1-\beta_1)\cos(k_1L/2) & \kappa hk_2(1-\beta_2)\cos(k_2L/2) & \frac{1}{2}ik_Th^\prime z \end{bmatrix} \begin{pmatrix} C_{A1}\\ C_{A2}\\ R_A \end{pmatrix} &=\begin{pmatrix}\frac{1}{2}z^{-1}\\ \frac{1}{2}ik_Tz^{-1}\\ \frac{1}{2}ik_Th^\prime z^{-1}\end{pmatrix}, \label{anti}\end{aligned}$$ where $z= e^{ik_TL/2}$. Solving Eqs.  and yields the reflection coefficients for the symmetric and antisymmetric modes as $$\label{rars} \begin{aligned} R_S&= \frac{ \frac{\alpha_2}{k_1} \cot \frac{k_1L}2 + \frac{\alpha_1}{k_2 } \cot \frac{k_2L}2 +i\frac{(\beta_1-\beta_2)}{k_T} } { \frac{\alpha_2}{k_1} \cot \frac{k_1L}2 + \frac{\alpha_1}{k_2 } \cot \frac{k_2L}2 -i\frac{(\beta_1-\beta_2)}{k_T} } e^{-ik_TL} ,\\ R_A&= \frac{ \frac{\alpha_2}{k_1} \cot \frac{k_1L}2 - \frac{\alpha_1}{k_2 } \cot \frac{k_2L}2 +i\frac{(\beta_1-\beta_2)}{k_T} } { \frac{\alpha_2}{k_1} \cot \frac{k_1L}2 - \frac{\alpha_1}{k_2 } \cot \frac{k_2L}2 -i\frac{(\beta_1-\beta_2)}{k_T} } e^{-ik_TL} , \end{aligned}$$ where $\alpha_j = \beta_j -1 + \beta_j {h^\prime}/(\kappa h)$ for $j=1,2$. The transmission and reflection coefficients for the full problem are then $$\label{transref} \begin{aligned} T&=\frac{1}{2}(R_S-R_A),\\ R&=\frac{1}{2}(R_S+R_A). \end{aligned}$$ The main result here is the transmission coefficient $T$ which not only shows the amplitude but also contains information about the transmitted phase. Numerical validation and phase modulation ----------------------------------------- We now show that the theoretical model accurately predicts the transmission coefficient using a numerical example. Consider an array of uniform plates in aluminum as described in Fig. \[platearray\](a). The material properties are Young’s modulus $E=70$ GPa, Poisson’s ratio $\nu=0.33$ and density $\rho=2700$ kg/m$^3$. All the plates have length $L=5$ cm and thickness $h=0.5$ cm and are separated by cracks of constant width $a=1$ mm. A plane SV-wave is normally incident from the left side of the metasurface. Figure \[compare\] compares the present model and the theoretical model developed in Ref. [ -‘ [@Su2016] ]{} to FEM simulation results using COMSOL Multiphysics. ![Comparison between analytical models and FEM simulation results. The blue curve corresponds to the frequency dependence of the transmission coefficient calculated using the model developed by @Su2016; the black curve corresponds to the transmission calculated using Eq.  in this paper; the red circles represent the FEM simulation results.[]{data-label="compare"}](figure2){width="\columnwidth"} The Bloch-Floquet periodic condition was prescribed on the boundaries of the unit cell to mimic an infinite metasurface slab. The red curve in Fig. \[compare\] is calculated using the displacements extracted from the FEM simulation results. We can clearly see that the transmission curve calculated using the analytic model agrees well with the FEM results at higher frequencies. It is also remarkable that the present model can accurately predict the total transmission frequencies, which correspond to the flexural resonances. This characteristic provides strong evidence that the predicted phase change is close to the simulation results. Though the analytic model shows certain mismatch of amplitudes with the simulation results, the present model is still a useful tool since phase modulation is more crucial in metasurface design. This issue could potentially be addressed by using more complicated boundary conditions, [@Gregory1994] but is beyond the scope of this paper. The explicit expression for the transmitted phase can be easily extracted from Eq.  as $$\label{phasechange} \phi=\tan^{-1} \big( {\text {imag}}(T)/{\text {real}}(T)\big ), \quad -\pi<\phi<\pi.$$ According to the generalized Snell’s law, i.e. Eq. , the metasurface design requires the transmitted wavefronts to cover the full $2\pi$ span. This can be easily satisfied using our design elements. The objective of this paper is to achieve full control of SV-wave using metasurface slabs with sub-wavelength thickness. In all the designs presented in Sec. \[MSdesign\], the length of each plate is chosen as $L=5$ cm; the width of the gaps between plates is constant $a=1$ mm; the operation frequencies for all the metasurfaces are identical $60$ kHz, at which the wavelength of the transverse wave in the bulk material is larger than the slab thickness, i.e. $L<\lambda_T$. Consider a metasurface slab comprised of plates with different thickness in an aluminum background. The transmitted phases at $60$ kHz corresponding to different thicknesses of plates are calculated using Eq.  and plotted in Fig. \[phasec\]. ![Transmitted phase at $60$ kHz through plates of different thicknesses. The solid line corresponds to the transmitted phase for a normally incident SV-wave; the dashed line is computed using the model developed by @Su2016 and corresponds to the transmitted phase for P-wave incidence.[]{data-label="phasec"}](figure3){width="\columnwidth"} It is clear that the phase shifts through the internal plates, with thickness varying from $2.4$ mm to $10.4$ mm, cover a range of $2\pi$ for SV-wave incidence. The dashed line in Fig. \[phasec\] is computed using Eq. (13) in Ref. [ -‘ [@Su2016] ]{} and corresponds to the transmitted phase of a normally incident P-wave. It indicates nearly identical phase changes for different plate thickness. This can be understood from the fact that the longitudinal wave speed in plates and P-wave speed in bulk material, $$\label{wavesp} c_L=\sqrt{\frac{E}{\rho(1-\nu^2)}} \ \ {\text {and}} \ \ c_P=\sqrt{\frac{E(1-\nu)}{\rho(1+\nu)(1-2\nu)}},$$ are both functions of the material properties only. Phase modulation in metasurface designs is usually done by reducing the wave speed in each waveguide to achieve the desired phase delay. Thickness variation of the plate-like waveguides does not provide such a mechanism to modulate longitudinal waves in plates. The sppeds $c_L$ and $c_P$ are very close so that the effective P-wave impedance of the metasurface is similar to that of the background material. Therefore the normally incident P-wave will travel straight through the slab. Based on these properties, we can now design metasurface devices for various purposes such as mode splitting of SV- and P-waves and focusing of plane and cylindrical SV-waves. Applications in metasurface design {#MSdesign} ================================== \[SplitSVP\]Metasurface for splitting SV- and P-waves ----------------------------------------------------- The material used in all the metasurface designs is aluminum with Young’s modulus $E=70$ GPa, Poisson’s ratio $\nu=0.33$ and density $\rho=2700$ kg/m$^3$. In the design for anomalous refraction of normally incident SV-wave, we choose a linear phase gradient $d\phi /dy=40\pi/\sqrt{3}$ rad/m. This phase gradient results in a transmitted angle of $\theta_t=30^\circ$ according to Eq. . The schematic view of the metasurface is illustrated in Fig. \[phaseamp\](a). ![Metasurface design: (a) outline of the design; (b) transmission properties of each plate-like waveguide in one period of the metasurface. The blue circles and the black triangles represent the phase and amplitude of the transmitted wave through each plate, respectively.[]{data-label="phaseamp"}](figure4){width="0.95\columnwidth"} The width of the metasurface slab, i.e. length of each plate, is chosen as $L=5$ cm; the width of all the gaps are identical, $a=1$ mm. The thicknesses of the plates satisfying the constant phase gradient are selected from Fig. \[phasec\]. Sixteen plates with thickness covering a complete phase change of $2\pi$ at $60$ kHz form one period of the metasurface as shown in the dashed box in Fig. \[phaseamp\](a). The metasurface of infinite extent is formed by repeating the structure in the dashed box, such that the length of one period is $8.59$ cm. The transmitted phases and amplitudes through all these plates are listed in Table \[tab\], while the Plate   $h$ (mm) $\phi$ ($\pi$ rad) $|T|$ (a.u.) --------- ---------- -------------------- -------------- 1 2.483 -0.9599 0.7944 2 2.586 -0.8789 0.6886 3 2.744 -0.7946 0.6169 4 2.953 -0.7058 0.6253 5 3.165 -0.6121 0.7106 6 3.351 -0.5138 0.8268 7 3.516 -0.4113 0.9303 8 3.676 -0.3048 0.9901 9 3.850 -0.1950 0.9937 10 4.069 -0.0807 0.9410 11 4.384 0.0398 0.8605 12 4.864 0.1698 0.8103 13 5.527 0.3129 0.8372 14 6.345 0.4730 0.9154 15 7.393 0.6547 0.9828 16 9.000 0.8672 0.9988 : Transmitted phase and amplitude through each L=$5$ cm long plate-like waveguide at $60$ kHz.[]{data-label="tab"} transmitted amplitudes and phases in one period of the metasurface are plotted in Fig. \[phaseamp\](b). Note that the plate array here is rotated $90^\circ$ counterclockwise, and this figure does not show the full length of each plate. It is clear that the transmitted phase strictly follows the constant spatial gradient. The amplitudes are not modulated in our design, but this does not affect the performance of the metasurface. Full wave simulations were performed in COMSOL to demonstrate the functionality of the metasurface at $60$ kHz. Displacements in the $y$-direction were applied along the vertical line at the left side of the simulation domain to generate an in-plane shear wave. Simulation result for SV-wave incidence is shown in Fig. \[simu1\]. ![Anomalous refraction of a normally incident SV-wave at $60$ kHz. The curl of the displacement field is plotted to show the SV-wave.[]{data-label="simu1"}](figure5){width="\columnwidth"} The curl of the displacement field is plotted to show the distortional field of the wave, i.e. SV-wave. The black arrow indicates the propagation direction of the SV-wave, and the red arrow indicates the direction of particle motion of the incident wave. As indicated by the black arrow, a planar SV-wave is normally incident from the left side of the metasurface and is refracted at $32.5^\circ$ which is very close to the designed refraction angle. It is worthwhile to point out that there is no mode converted wave, i.e. P-wave, in the far-field of the transmitted region. This can be explained as the modes in the transmitted field mainly come from the waveguides, i.e. plates. In this design, the SV-wave impinges normally on the interface so that there is only a flexural wave in the plate array, which does not induce any mode converted wave in the transmitted field. It is noted that there are some longitudinal components in the interface wave at the right boundary of the metasurface, but they do not effect the far-field and hence do not influence the functionality of the metasurface. Near-field wave motion at the interface of the metasurface and the bulk material are not well studied and remain to be further investigated. Another feature of the metasurface is that it does not alter the propagation direction of a normally incident P-wave; it can therefore be used as a mode splitter to separate SV- and P-waves. Simulation results for normal incidence of P-wave are shown in Fig. \[simu2\]. In this case, displacements in the $x$-direction were applied along the vertical line at the left side of the simulation domain to generate a longitudinal wave, and ![Unaffected normally incident P-wave at $60$ kHz. The trace of the strain tensor is plotted to show the P-wave.[]{data-label="simu2"}](figure6){width="\columnwidth"} the trace of the strain tensor is plotted to show the dilatational field. The black arrow indicates the propagation direction of the P-wave, and the red arrow indicates the direction of particle motion of the incident wave. It is clear that the transmitted P-wave still travels along the normal direction. Similar to the SV-wave incidence case, there is no mode converted wave in the transmitted region. Since there are no mode conversions for both SV- and P-wave incidence, this metasurface is capable of steering these two types of waves into different directions without introducing unwanted wave types. \[Focus\]Metasurface for focusing plane SV-waves ------------------------------------------------ Other than the metasurface for splitting SV- and P-waves, this approach can also be adopted in the design of a focal metasurface. The physics behind the focal metasurface is different from the gradient index lenses [@Climente2014; @Tol2017; @Su2017a; @Su2017b] which are designed using ray theory and by varying the refractive indices of bulk materials. Here the focal metasurface is based on the constructive and destructive interferences of the diffracted waves through all the waveguides. The required phase profile along the metasurface can be written as $$\label{focpha} \phi(y)=k_T\big( \sqrt{(y-y_0)^2+d^2} -d \big)+\phi_0, \ -\pi<\phi<\pi,$$ where $y_0$ denotes the location where the metasurface is symmetric about and $\phi_0$ is the transmitted phase through the plate at $y_0$. We choose $y_0=0$ and set $\phi_0$=0 for convenience. The metasurface is chosen to have slab thickness, i.e. plate length, $L=5$ cm; the constant gap width is $a=1$ mm. The focal distance is selected to be $d=5L=25$ cm from the lens. The required phase profile at $60$ kHz is calculated using Eq.  and plotted in Fig. \[fph\]. ![Phase profile of the metasurface for focusing a plane SV-wave at $60$ kHz.[]{data-label="fph"}](figure7){width="\columnwidth"} A total number of $97$ plates are selected from Fig. \[phasec\] to form a metasurface. Full wave FEM simulations using COMSOL demonstrate the focusing effect of the metasurface. Displacements in the $y$-direction were applied along the vertical line at the left side of the simulation domain to generate an in-plane shear wave. Figure \[simu3\] shows the simulated field at $60$ kHz. ![Focusing a normally incident plane SV-wave at $60$ kHz. The curl of the displacement field is plotted to show the SV-wave.[]{data-label="simu3"}](figure8){width="\columnwidth"} The curl of the displacement field is plotted to represent the distortional wave. The focusing effect can be clearly observed at the right side of the metasurface. By comparing the energy density along the $x$-direction across the center of the metasurface, the focal point at $60$ kHz was found to be approximately $25.7$ cm away from the interface, which agrees with the designed distance to a remarkable degree. \[Imag\]Metasurface for focusing a cylindrical SV-wave ------------------------------------------------------ We now design a metasurface for focusing a cylindrical SV-wave. Due to the cylindrical spreading of the wavefront, the phases of the incident wave along the metasurface is different, therefore Eq.  needs to be revised. The profile requires a more rapid phase change as compared to the phase change for focusing a plane SV-wave. The modified phase profile can be written as [@Li2016] $$\label{imapha} \phi(y)=k_T\big( \sqrt{(y-y_0)^2+d^2} -d \big)+\phi_c(y), \ -\pi<\phi<\pi,$$ where $\phi_c(y)$ is a phase correction term which compensates the phase difference of the incident wave. In this design the $y_0$ location, the slab thickness and the gap width are set the same as for the plane wave incidence design. The focal distance is selected to be $d=5L=25$ cm. The only difference is that the cylindrical wave source location, distance $d_S$ from the metasurface, needs to be taken into account. For instance, if we choose $d_S=d$ in this design, then the phase correction term is simply $\phi_c(y)=k_T\big( \sqrt{(y-y_0)^2+d^2} -d \big)$. The required phase profile at $60$ kHz is calculated using Eq.  and plotted in Fig. \[ima\]. ![Phase profile of the metasurface for focusing a cylindrical SV-wave at $60$ kHz.[]{data-label="ima"}](figure9){width="\columnwidth"} Then a total number of $93$ plates are selected from Fig. \[phasec\] to form a metasurface. The COMSOL-generated simulated SV-wave field at $60$ kHz is plotted in Fig. \[simu4\]. ![Focusing a cylindrical SV-wave source at $60$ kHz. The curl of the displacement field is plotted to show the SV-wave.[]{data-label="simu4"}](figure10){width="\columnwidth"} The curl field is shown to represent the distortional wave. The focal spot is evident at the right side of the metasurface. This suggests that our design elements are suitable for rapidly changing phase profiles. The focal distance evaluated from the simulation results at $60$ kHz is $28.3$ cm, which is $3.3$ cm longer than the design distance. Given that the focal distance in the previous design is only $0.7$ cm longer than the designed distance, our model does not predict the transmitted phase accurately for oblique incidence. The main reason is that the current model does not consider the mode conversion which occurs for oblique incidence. Improvement of the model to include such effects will be considered later. \[concl\]Conclusion =================== In conclusion, we have presented a novel metasurface design approach for controlling SV-wave motion in elastic solids using plate-like waveguides of varying thickness. A theoretical model based on the Mindlin plate theory is developed and compared with the FEM simulation results. The model works well for thick plates in the high frequency range and is therefore well suted to metasurface design. It is also found that the transmission properties for normally incident P- and SV-waves are distinct. The transmitted phase of a normally incident SV-wave can cover a full span of $2\pi$. However, the transmitted phase of a normally incident P-wave is nearly constant. By taking advantage of these properties, we designed and numerically demonstrated several metasurfaces that are capable of steering SV-waves while remaining transparent to P-wave. The fundamental mode of this type of wave in a thick plate is nondispersive and can travel in a planar manner over long distances thus is of particular interest in nondestructive evaluations. [@Hirao1999; @Lee2008; @Petcher2014] Acknowledgments {#acknowledgments .unnumbered} =============== This work was supported by Office of Naval Research through MURI Grant No. N00014-13-1-0631. References {#references .unnumbered} ========== [28]{} \[1\][\#1]{} \[1\][`#1`]{} urlstyle \[1\][doi: \#1]{} N. Yu, P. Genevet, M. A. Kats, F. Aieta, J.-P. Tetienne, F. Capasso, and Z. Gaburro. Light propagation with phase discontinuities: Generalized laws of reflection and refraction. *Science*, 3340 (6054):0 333–337, 2011. [doi: ]{}[10.1126/science.1210713]{}. S. Sun, Q. He, S. Xiao, Q. Xu, X. Li, and L. Zhou. Gradient-index meta-surfaces as a bridge linking propagating waves and surface waves. *Nat. Mater.*, 110 (5):0 426–431, 2012. [doi: ]{}[10.1038/nmat3292]{}. A. V. Kildishev, A. Boltasseva, and V. M. Shalaev. Planar photonics with metasurfaces. *Science*, 3390 (6125):0 1232009, 2013. [doi: ]{}[10.1126/science.1232009]{}. C. Pfeiffer and A. Grbic. Metamaterial Huygens’ surfaces: Tailoring wave fronts with reflectionless sheets. *Phys. Rev. Lett.*, 1100 (19):197401, 2013. [doi: ]{}[10.1103/physrevlett.110.197401]{}. N. M. Estakhri and A. Al[ù]{}. Wave-front transformation with gradient metasurfaces. *Phys. Rev. X*, 60 (4):0 041008, 2016. [doi: ]{}[10.1103/physrevx.6.041008]{}. Y. Li, B. Liang, X. Tao, X. Zhu, X. Zou, and J. Cheng. Acoustic focusing by coiling up space. *Appl. Phys. Lett.*, 1010 (23):0 233508, 2012. [doi: ]{}[10.1063/1.4769984]{}. W. Wang, Y. Xie, A. Konneker, B.-I. Popa, and S. A. Cummer. Design and demonstration of broadband thin planar diffractive acoustic lenses. *Appl. Phys. Lett.*, 1050 (10):0 101904, 2014. [doi: ]{}[10.1063/1.4895619]{}. Y. Li, G. Yu, B. Liang, X. Zou, G. Li, S. Cheng, and J. Cheng. Three-dimensional ultrathin planar lenses by acoustic metamaterials. *Sci. Rep.*, 4:0 6830, 2014. [doi: ]{}[10.1038/srep06830]{}. J. Zhao, B. Li, Z. Chen, and C.-W. Qiu. Redirection of sound waves using acoustic metasurface. *Appl. Phys. Lett.*, 1030 (15):0 151604, 2013. [doi: ]{}[10.1063/1.4824758]{}. J. Zhao, B. Li, Z. Chen, and C.-W. Qiu. Manipulating acoustic wavefront by inhomogeneous impedance and steerable extraordinary reflection. *Sci. Rep.*, 3:0 2537, 2013. [doi: ]{}[10.1038/srep02537]{}. M. Dubois, C. Shi, Y. Wang, and X. Zhang. A thin and conformal metasurface for illusion acoustics of rapidly changing profiles. *Appl. Phys. Lett.*, 1100 (15):0 151902, 2017. [doi: ]{}[10.1063/1.4979978]{}. Y. Xie, W. Wang, H. Chen, A. Konneker, B.-I. Popa, and S. A. Cummer. Wavefront modulation and subwavelength diffractive acoustics with an acoustic metasurface. *Nat. Commun.*, 5:0 5553, 2014. [doi: ]{}[10.1038/ncomms6553]{}. Y. Li, X. Jiang, B. Liang, J. Cheng, and L. Zhang. Metascreen-based acoustic passive phased array. *Phys. Rev. Applied*, 40 (2), 2015. [doi: ]{}[10.1103/physrevapplied.4.024003]{}. Y. Li, S. Qi, and M. B. Assouar. Theory of metascreen-based acoustic passive phased array. *New J. Phys.*, 180 (4):0 043024, 2016. [doi: ]{}[10.1088/1367-2630/18/4/043024]{}. X. Jiang, Y. Li, B. Liang, J. Cheng, and L. Zhang. Convert acoustic resonances to orbital angular momentum. *Phys. Rev. Lett.*, 1170 (3):0 034301, 2016. [doi: ]{}[10.1103/PhysRevLett.117.034301]{}. C. Shi, M. Dubois, Y. Wang, and X. Zhang. High-speed acoustic communication by multiplexing orbital angular momentum. *Proc. Natl. Acad. Sci.*, 1140 (28):0 7250–7253, 2017. [doi: ]{}[10.1073/pnas.1704450114]{}. H. Zhu and F. Semperlotti. Anomalous refraction of acoustic guided waves in solids with geometrically tapered metasurfaces. *Phys. Rev. Lett.*, 1170 (3):0 034302, 2016. [doi: ]{}[10.1103/physrevlett.117.034302]{}. Y. Liu, Z. Liang, F. Liu, O. Diba, A. Lamb, and J. Li. Source illusion devices for flexural lamb waves using elastic metasurfaces. *Phys. Rev. Lett.*, 1190 (3):0 034301, 2017. [doi: ]{}[10.1103/PhysRevLett.119.034301]{}. X. Su and A. N. Norris. Focusing, refraction, and asymmetric transmission of elastic waves in solid metamaterials with aligned parallel gaps. *J. Acoust. Soc. Am.*, 1390 (6):0 3386–3394, 2016. [doi: ]{}[10.1121/1.4950770]{}. R. D. Mindlin. Influence of rotary inertia and shear on flexural motions of isotropic, elastic plates. *J. Appl. Mech. ASME*, 18:0 31–38, 1951. C. Mei and B. Mace. Wave reflection and transmission in timoshenko beams and wave analysis of timoshenko beam structures. *J. Vib. Acoust.*, 1270 (4):0 382–394, 2005. [doi: ]{}[10.1115/1.1924647]{}. R. D. Gregory and F. Y. M. Wan. Boundary conditions at the edge of a thin or thick plate bonded to an elastic support. *J. Elasticity*, 360 (2):0 155–182, 1994. [doi: ]{}[10.1007/bf00040963]{}. A. Climente, D. Torrent, and J. Sanchez-Dehesa. Gradient index lenses for flexural waves based on thickness variations. *Appl. Phys. Lett.*, 1050 (6):0 064101, 2014. [doi: ]{}[10.1063/1.4893153]{}. S. Tol, F. Degertekin, and A. Erturk. Phononic crystal luneburg lens for omnidirectional elastic wave focusing and energy harvesting. *Appl. Phys. Lett.*, 1110 (1):0 013503, 2017. [doi: ]{}[10.1063/1.4991684]{}. X. Su, A. N. Norris, C. W. Cushing, M. R. Haberman, and P. S. Wilson. Broadband focusing of underwater sound using a transparent pentamode lens. *J. Acoust. Soc. Am.*, 1410 (6):0 4408–4417, 2017. [doi: ]{}[10.1121/1.4985195]{}. X. Su and A. N. Norris. Isotropic transformation acoustics and applications. *Proc. of SPIE*, 10170:0 101700M, 2017 [doi: ]{}[10.1117/12.2259793]{}. M. Hirao and H. Ogi. An SH-wave EMAT technique for gas pipeline inspection. *NDT E Int.*, 320 (3):0 127–132, 1999. [doi: ]{}[10.1016/S0963-8695(98)00062-0]{}. J. S. Lee, Y. Y. Kim, and S. H. Cho. Beam-focused shear-horizontal wave generation in a plate by a circular magnetostrictive patch transducer employing a planar solenoid array. *Smart Mater. Struct.*, 180 (1):0 015009, 2008. [doi: ]{}[10.1088/0964-1726/18/1/015009]{}. P. Petcher, S. E. Burrows, and S. Dixon. Shear horizontal (SH) ultrasound wave propagation around smooth corners. *Ultrasonics*, 540 (4):0 997–1004, 2014. [doi: ]{}[10.1016/j.ultras.2013.11.011]{}.
2023-08-18T01:27:15.642919
https://example.com/article/1405
SHARE Kenya president sworn in as police use tear gas on opposition But opposition leader says he will hold his own inauguration in two weeks saying he is the "legitimate" president People fall as police fire tear gas to try control a crowd trying to force their way into a stadium to attend the inauguration of president Uhuru Kenyatta at Kasarani Stadium in Nairobi, Kenya on November 28, 2017. Baz Ratner / Reuters Kenyan Police intervene outside the Kasarani stadium during a stampede as supporters of Kenya's president try to get into the venue to attend his inauguration ceremony on November 28, 2017. Simon Maina / AFP Kenyan police intervene outside the Kasarani stadium during a stampede as supporters of Kenya's president try to get into the venue to attend his inauguration ceremony on November 28, 2017. Simon Maina / AFP Policemen carry an injured man after police fired tear gas to try to control a crowd of people trying to force their way into a stadium to attend the inauguration of Kenya's president Uhuru Kenyatta at Kasarani Stadium in Nairobi, Kenya on November 28, 2017. Baz Ratner / Reuters People cheer as they wait for the inauguration ceremony to swear in Kenya's president Uhuru Kenyatta at Kasarani Stadium in Nairobi, Kenya on November 28, 2017. Baz Ratner / Reuters Kenyan police intervene during a stampede outside the Kasarani stadium as supporters of Kenya's president try to get into the venue to attend his inauguration ceremony on November 28, 2017. Simon Maina / AFP Hawkers and members of the public gather outside the Kasarani Stadium on November 28, 2017 to attend the inauguration ceremony of Kenyan president. Simon Maina / AFP SHARE Kenyan opposition leader Raila Odinga on Tuesday rejected the inauguration of President Uhuru Kenyatta and vowed to hold his own swearing-in as president in two weeks time. "I will be sworn in because I am the legitimate president. We are going to be sworn in on December 12," he said, comparing the ceremony to that of Zimbabwe's new president, Emmerson Mnangagwa, who was sworn in after Robert Mugabe was forced out. Mr Kenyatta was sworn in for a second five-year term in front of a rapturous crowd at Kasarani stadium in Nairobi as riot police fired tear gas at crowds who tried to hold a rally in support of the opposition. Police sealed off the area with tyres and boulders. Mr Kenyatta won a repeat presidential election on October 26 that was boycotted by opposition leader Raila Odinga, who said it would not be free and fair. The Supreme Court nullified the first presidential election in August over irregularities. The extended election season has divided Kenya and hampered growth in East Africa's richest economy. Mr Odinga's supporters, many drawn from poorer parts of the country, feel locked out of power and the patronage it brings. Political arguments often have ethnic undercurrents, with his supporters pointing out that three of the country's four presidents have come from one ethnic group, although the country has 44 recognised groups. But such arguments seemed far from the happy crowds at the celebration, who cheered wildly as Mr Kenyatta was sworn into office and as he received a 21-gun salute. "I … do swear … that I will always truly and diligently serve the people of the Republic of Kenya," he said, his hand resting on a Bible. Before he arrived, a military band in gold and blue uniforms serenaded heads of state from Somalia, Rwanda, Uganda, South Sudan, Ethiopia, Djibouti, Zambia and other nations as they arrived at the Kasarani stadium, the venue for the ceremony. More than 60,000 Kenyatta supporters, many clad in the red and yellow Jubilee party colours and carrying Kenyan flags, filled the stadium benches. Thousands of others waited outside. Frustrated at not being allowed in, some overwhelmed the police and streamed in. The police retaliated by firing tear gas at them. Supporters of Mr Kenyatta — who won with 98 per cent of the vote after Mr Odinga's boycott — want the opposition to engage in talks and move on. "I’m sure Uhuru will be able to bring people together and unite them so we can all work for the country," said Eunice Jerobon, a trader who travelled overnight from the Rift Valley town of Kapsabet for the inauguration, before the disturbance. But Odinga supporters say such talk of unity is tantamount to surrender. They accuse the ruling party of stealing the election, rampant corruption, directing abuse by the security forces and neglecting vast swathes of the country, including Mr Odinga's heartland in the west. "A return to the political backwardness of our past is more than unacceptable. It is intolerable … This divide cannot be bridged by dialogue and compromise," Mr Odinga's National Super Alliance opposition grouping said. The opposition planned to hold a prayer meeting in the capital on Tuesday, saying it wanted to commemorate the lives of Odinga supporters killed during confrontations with the security forces over the election period. More than 70 people have been killed in political violence this election season, mostly by the police. Such killings are rarely investigated. Eye witnesses at the scene of the planned rally said the area had been sealed off by seven truck loads of police in riot gear. Two water cannons were standing by and a helicopter hovered overhead. Police began firing tear gas in nearby residential areas two hours before the rally was due to start, apparently attempting to prevent opposition supporters from gathering. Several roads were blocked by burning tyres, rocks, glass and uprooted billboards. Police shot in the air to disperse anyone trying to gather. But Dennis Onyango, a spokesman for Odinga, said the rally would go on regardless.
2024-06-03T01:27:15.642919
https://example.com/article/8201
There is a rather interesting article in Times Higher Education today. It considers the question of whether academics are getting a reputation as being for sale. Actually I'm not sure why this is considered a question, as evidence that a significant proportion of academics will write a paper to show pretty much anything is hardly lacking. Who can forget the round robin from WWF to climate scientists trying to find someone to write a paper linking a heatwave in France to climate change? Or the Sarah Muckherjee's claim that most climate research was funded by big green. The LSE's relationship with its funders has been the source of constant entertainment here at BH, with Colonel Gaddaffi and Jeremy Grantham apparently getting good value for money, so it's fun to see the article uncover that these are not the only parts of the LSE where money seems to be talking. The now notorious "charity" Kids Company seems to have been an active funder of "research" there: In interviews, the charity’s chief executive, Camila Batmanghelidjh, cited a 2013 report from researchers at the London School of Economics as evidence that the organisation was well managed. However, neither she nor the report itself pointed out that the study had been funded by a £40,000 grant from Kids Company. Reader Comments (30) I'm increasingly convinced that it is far better to be honest that academics are for sale and to know who is buying them, than the present shambolic arrangement where they pretend to be impartial whilst being climate extremists. It is sadly noted that "engineers" are omitted from the list/graphic, suggesting to me, as a practicing engineer, that we have fallen back into the oily rag catagory from which we strived for many a year to extricate ourselves! :-( Meanwhile any contrary research is dismissed out of hand because it must have been funded by someone with a vested interest in [insert evil practice of choice here].Do they never understand that the more they demonise people like (for example) Willie Soon, the more people listen to what he has to say? Or that they are every bit as 'guilty' as he is?I was taken with something I heard the other day: "It's the letter that matters; not the envelope". I think there's an underlying issue where nobody is admitting that peer review is not fit for the purpose it's being used for. Who has paid for research should be irrelevant so long as the results are valid. The key word being 'valid'. There is currently no system for determining if science papers are good or not. The massive numbers of journals and the limited amount of checking done, means that apart from following archaic style rules, there are almost no barriers to any old poop being published. I'm not just talking about climate science here. I've said it before, but journals are little more than trade magazines. Who would give anyone any serious regard if they said they'd been widely published in Tractors Monthly or Chip Shop News? But choose a magazine with a serious title and suddenly being published means the world. Many so called science articles are now amounting to little more than gossip. What is the consensus other than gut feeling rather than fact? In some ways medical papers are as bad as climate science. If all the things that are supposed to kill us were added up we'd be dead before finishing the next article. By simple observation, they can't all be right. In which case, what value are any of them? Some experts are made by counting up these articles, not by any demonstrable success (Dr Lew). How many times have you watched an expert on tv waffing about their pet theory and you're shouting a few obvious questions at the screen? The first person to question science shouldn't be the public. And scientists wonder why nobody listens to them any more. Kids Company share many of the mores of that other Kidz Corp: they seem to think that they have done no wrong because they "were audited every year by independents". - which later turned out to mean that they carried out their own self-assessments. I bet they found they were 97% compliant - while they managed to get through £120M over 13 years.. The article is mainly about financial interests biasing research but there are other biases too. Political view point; social perception (eg 'green' being considered good); personality (eg Camila Batmanghelidjh, will have blinded researchers with her persona as much as, if not far more than any money that changed hands); urgency; and many other factors that have nothing to do with science. I even suspect the validity of the chart on trust. People might think they trust a scientist more than a journalist but it's not as clear cut as that. Journalists can sway how people think and behave any day with the right words whereas scientists have to do something extraordinary to be even noticed. Most of the time both professions just feed what people already think. People pick and choose when they trust in science and are more likely to trust where something has no impact on their lives (eg astronomy) than where they have to make a personal decision (eg vaccination). That's why trust in science is irrelevant to climate change. The burden of proof goes way up because of the hardships responding to the science. Suddenly the PhD means very little because the science has to stand up to tougher tests of validity. It’s the same as how you’d trust a mate to pay back a fiver but you’d take longer to decide to loan £5000, if at all. Does anyone know whether the BBC's Alan Yentob comes out of the Kids Company financial irregularities unscathed? He seems to have been very convinced there was nothing wrong, and put his credibility with BBC staff at risk, imposing his opinion above impartiality. Giving financial fraud the "Full Yentob" seal of approval, does not inspire any confidence in the BBC. An opinion shared by those not working for the BBC. Kids Company. Sigh. One of my lads runs a cafe in the middle of a big city; the premises were shared with Kids Company. Batwoman would often be there. She liked to hand out wads of notes to kids. Within an hour, the kids would be back, smashed out of their tiny little heads. This happened on a daily basis. I certainly remember when "engaging" with those of an Alarmist viewpoint in the past that they would constantly refer to their research demigods work as being Peer Reviewed as tho' this mere fact alone made the findings unassailable - beyond question. To question such work real did make you some sort of heretic However - every single one of my peer group when discussing this recognised the fact that within a Mutual Admiration Society - Peer Review really does degenerate into "Pal review". JamesG, yeah that too. I think that is part of her con. She dresses up in 'ethnic' clothes to shut down debate over her dodgy behaviour. It's a habit guaranteed to appeal to Guadianistas, Aunty Beebers and government ministers alike who all want to fit in with minorities and kidz. She's like a walking Tracy Emin exhibition. If you don't like her it's because you're white, middle class, middle aged and conservative. You're not a sage grown up who can see that this time the empress isn't naked, she's wearing the entire wardrobe. The LSE's star turn is not a scientist, but lil' Bobby Ward who must be one of the world's foremost liars. He tweets all die and night, even during the weekend. It makes me wonder if Grantham's got him testing out the new junior doctor's contract for Jeremy Hunt. Is this Stockholm Syndrome ? Has Bob started to believe his own lies ? We'll never know. I suspect that's what happens to organisations like Kid's company. Their egos get bloated by their own lies The opening line form the LSE kids company 'report ' was all you needed to know about how poor the quality of this was and who much the report writer had 'bought into ' the whole Batmanghelidjh theme , has it contained nothing but frankly embarrassing gushing prose. Cash for ‘research’ not usual at all , it has been true for years that in designing research you needed to consider the ‘needs of the funders ‘. Although climate ‘science’ has taken it to hysterically new levels where by the quality of your research means little or nothing, which is a good thing given many of the people working in this area cannot do quality , all that matters is the ‘impact’ of the claims that can made from this research. esmiff Bob 'fast fingers ' Ward does not and has not ever worked for the LSE , he does no research nor teaching for them , he is Grahams bitch whose merely works in a building on the LSE campus, I write this so the world’s worst PR person does not get a gram of credit he simply has no right to. By its very nature, the Establishment is populated by people who get their kicks out of pushing other people around. It controls funding and most of the media. It is not so omnipotent that it can proceed without evidence, so it buys the evidence it needs. It does not commission research, it commissions results. So, for example, if the existence of the Little Ice Age and the Mediaeval Warm Period are inconvenient, in true Orwellian fashion it pays someone to “prove” that they never happened, despite the overwhelming evidence to the contrary from art, history and science. It amazes me that some policy needs science. We really didn't need cancer studies in order to ban smoking in pubs; the fact that the smoke annoyed non-smokers was always sufficient reason. Same thing with soot emissions annoying pedestrians. If politicians have decided to get rid of all other fugitive emissions then fair enough - lets stop spending money on useless adaptation reports, climate models, economic models, conferences, quangos and other talking shops and just give the money instead to the engineers to sort it all out. If we can't do it for a reasonable price then tough - we just have to either live with fossil fuels or send our pensioners abroad to sunnier climes. This is only an issue because policy for possible climate effects is directly coupled to raw climate science. The IPCC doesn't help as it was created to sum science in a way that was allegedly useful for policy. This in itself circumvents common sense as you really don't want to be using raw science for anything. I wish to register a complaint. I've never been offered a penny to write a fraudulent report or paper on any topic. Snot fair. I have known of a few bent scientists - thieves of other people's ideas or data, that sort of thing. An actual thief of property too, and accounting scammers: you know the sort of thing - wife on payroll under maiden name who contributes no work at all. Given that, I still manage to be astonished at the effrontery of taking money from a "charity" to bull it up. But then I've never worked at the LSE. Wasn't James hacker of yes minister fame taught at the LSE, much to the disgust of Humphrey? I hope this report resurfaces in the current look at her finances, and as others have said, how many more times has a supposedly academic organisation been paid to say nice things about the climate organisation sponsoring that research. I think it also demonstrates the gullibility of govt when they think they are supporting a popular cause. Kids Company. Sigh. One of my lads runs a cafe in the middle of a big city; the premises were shared with Kids Company. Batwoman would often be there. She liked to hand out wads of notes to kids. Within an hour, the kids would be back, smashed out of their tiny little heads. This happened on a daily basis. I had read the "Glamour" magazine article they quote, some classic tales: http://www.glamourmagazine.co.uk/celebrity/celebrity-galleries/2015/05/camila-batmanghelidjh-interview-2015-kids-company-and-place-2be "I used to work at nurseries in the holidays. I soon realised I was good with disturbed toddlers. There were children who used to bite their fingers, then draw on the wall with blood, others would cut up Persian carpets or jump through Francis Bacon paintings." "It was while I was at university I was reunited with my dad. The police had informed me that he'd escaped across the border from Iran to Turkey. He'd skinned a sheep, used it as a coat, and swam across the sea." Great swimming costume, especially when there is no sea between Iran and Turkey.... On buying science, here's the Rockefeller Brothers Foundation from 1974 detailing how to put money into education to promote ecological "transformers'': http://files.eric.ed.gov/fulltext/ED107165.pdf but I guess that's good buying of science.
2024-07-10T01:27:15.642919
https://example.com/article/8970
For me, beying a cosplayer is an art. It's an art where you create, tranform, invent and reinventYou gotta have a lot of dedication and every single detail must be perfect.From the choice of fabric to the small objects. It's hours, days, months and even years spent dreaming, planning and assembling your cosplay. But all the efforts are worthwhile.When you dress up and play your cosplay, you're not only wearing a costume.You're giving LIFE to your favourite character.
2024-02-11T01:27:15.642919
https://example.com/article/1183
Ambit Rail Lamp Grey Price A statement light with lots of character. With its three lamp shades the Rail Lamp provides a strong light source that makes it perfect for over a kitchen counter, dining table, desk or bar setting. Made from old brazier traditions, press spun by hand, polished and finally hand-painted. Designed by Muuto.
2023-08-11T01:27:15.642919
https://example.com/article/8617
1. Field of the Invention The present invention relates to a method for tracking multiple image objects, and more particularly, to a method for tracking multiple image objects based on a penalty graph in order to avoid hijacking of a tracker, which is capable of avoiding a hijacking problem wherein the identifiers of nearby objects are confused with each other or disappear during the tracking of multiple objects. 2. Description of the Related Art Generally, a technology for tracking multiple image objects is a technology related to human computer interaction (HCI). Recently, with an increase in the number of devices using a multi-touch scheme, such as tabletop displays, smart phones and smart TVs, the technology has attracted attention. In order to provide a more intuitive interface, the technology has been widely used in the field of multi-touch tracking. Furthermore, a technology for tracking multiple image objects is a technology that assigns respective pieces of identification information to multiple touch regions generated by multiple touches and enables the same identification numbers to be consistently assigned even when the touch regions move. However, the conventional technology for tracking multiple image objects only performs tracking based on the previous location of an object. Accordingly, when image objects are located adjacent to each other, the image objects are recognized as a single image object. As a result, a problem arises wherein the identification information of any one of the image objects may disappear, the pieces of identification information of the two image objects may be replaced with each other, or a tracker hijacking phenomenon occurs in which a single object may incorporate the two pieces of identification information.
2023-09-11T01:27:15.642919
https://example.com/article/7886
[Vitamin D and neurological diseases]. We provide an overview of the association between vitamin D and some neurological diseases where the correlation has repeatedly been described. The majority of literature refers to cerebrovascular diseases, followed by multiple sclerosis and cognitive disorders. Vitamin D hypovitaminosis might be associated with the diseases directly or it might contribute to the disease risk factors (typically in cerebrovascular events). Vitamin D hypovitaminosis may also play a role in patients with residual functional involvement due to a neurological disorder (movement disorders, lack of self-sufficiency) and worsen functional status owing to muscle weakness, instability and falls.
2024-06-08T01:27:15.642919
https://example.com/article/4054
# facilityLocation.py # Author: Jacob Schreiber <jmschreiber91@gmail.com> import numpy from .base import BaseGraphSelection from ..optimizers import LazyGreedy from ..optimizers import ApproximateLazyGreedy from ..optimizers import SieveGreedy from tqdm import tqdm from numba import njit from numba import prange dtypes = 'void(float64[:,:], float64[:], float64[:], int64[:])' sdtypes = 'void(float64[:], int32[:], int32[:], float64[:], float64[:], int64[:])' sieve_dtypes = 'void(float64[:,:], int64, float64[:,:], int64[:,:],' \ 'float64[:,:], float64[:], float64[:], int64[:], int64[:])' def calculate_gains(dtypes, parallel, fastmath, cache): @njit(dtypes, parallel=parallel, fastmath=fastmath, cache=cache) def calculate_gains_(X, gains, current_values, idxs): for i in prange(idxs.shape[0]): idx = idxs[i] gains[i] = numpy.maximum(X[idx], current_values).sum() return calculate_gains_ def calculate_gains_sparse(dtypes, parallel, fastmath, cache): @njit(dtypes, parallel=parallel, fastmath=fastmath, cache=cache) def calculate_gains_sparse_(X_data, X_indices, X_indptr, gains, current_values, idxs): for i in prange(idxs.shape[0]): idx = idxs[i] start = X_indptr[idx] end = X_indptr[idx+1] for j in range(start, end): k = X_indices[j] gains[i] += max(X_data[j], current_values[k]) - current_values[k] return calculate_gains_sparse_ def calculate_gains_sieve(dtypes, parallel, fastmath, cache): @njit(dtypes, parallel=parallel, fastmath=fastmath, cache=cache) def calculate_gains_sieve_(X, k, current_values, selections, gains, total_gains, max_values, n_selected, idxs): n, d = X.shape t = max_values.shape[0] for j in prange(t): for i in range(n): if n_selected[j] == k: break idx = idxs[i] threshold = (max_values[j] / 2. - total_gains[j]) / (k - n_selected[j]) maximum = numpy.maximum(X[i][:d], current_values[j][:d]) gain = maximum.mean() - total_gains[j] if gain > threshold: current_values[j][:d] = maximum total_gains[j] = maximum.mean() selections[j, n_selected[j]] = idx gains[j, n_selected[j]] = gain n_selected[j] += 1 return calculate_gains_sieve_ class FacilityLocationSelection(BaseGraphSelection): """A selector based off a facility location submodular function. Facility location functions are general purpose submodular functions that, when maximized, choose examples that represent the space of the data well. The facility location function is based on maximizing the pairwise similarities between the points in the data set and their nearest chosen point. The similarity function can be species by the user but must be non-negative where a higher value indicates more similar. .. note:: All ~pairwise~ values in your data must be non-negative for this selection to work. In many ways, optimizing a facility location function is simply a greedy version of k-medoids, where after the first few examples are selected, the subsequent ones are at the center of clusters. The function, like most graph-based functions, operates on a pairwise similarity matrix, and successively chooses examples that are similar to examples whose current most-similar example is still very dissimilar. Phrased another way, successively chosen examples are representative of underrepresented examples. The general form of a facility location function is .. math:: f(X, Y) = \\sum\\limits_{y in Y} \\max_{x in X} \\phi(x, y) where :math:`f` indicates the function, :math:`X` is a subset, :math:`Y` is the ground set, and :math:`\\phi` is the similarity measure between two examples. Like most graph-based functons, the facility location function requires access to the full ground set. This implementation allows users to pass in either their own symmetric square matrix of similarity values, or a data matrix as normal and a function that calculates these pairwise values. For more details, see https://las.inf.ethz.ch/files/krause12survey.pdf page 4. Parameters ---------- n_samples : int The number of samples to return. metric : str, optional The method for converting a data matrix into a square symmetric matrix of pairwise similarities. If a string, can be any of the metrics implemented in sklearn (see https://scikit-learn.org/stable/modules/ generated/sklearn.metrics.pairwise_distances.html), including "precomputed" if one has already generated a similarity matrix. Note that sklearn calculates distance matrices whereas apricot operates on similarity matrices, and so a distances.max() - distances transformation is performed on the resulting distances. For backcompatibility, 'corr' will be read as 'correlation'. Default is 'euclidean'. initial_subset : list, numpy.ndarray or None, optional If provided, this should be a list of indices into the data matrix to use as the initial subset, or a group of examples that may not be in the provided data should beused as the initial subset. If indices, the provided array should be one-dimensional. If a group of examples, the data should be 2 dimensional. Default is None. optimizer : string or optimizers.BaseOptimizer, optional The optimization approach to use for the selection. Default is 'two-stage', which makes selections using the naive greedy algorithm initially and then switches to the lazy greedy algorithm. Must be one of 'random' : randomly select elements (dummy optimizer) 'modular' : approximate the function using its modular upper bound 'naive' : the naive greedy algorithm 'lazy' : the lazy (or accelerated) greedy algorithm 'approximate-lazy' : the approximate lazy greedy algorithm 'two-stage' : starts with naive and switches to lazy 'stochastic' : the stochastic greedy algorithm 'sample' : randomly take a subset and perform selection on that 'greedi' : the GreeDi distributed algorithm 'bidirectional' : the bidirectional greedy algorithm Default is 'two-stage'. optimizer_kwds : dict or None A dictionary of arguments to pass into the optimizer object. The keys of this dictionary should be the names of the parameters in the optimizer and the values in the dictionary should be the values that these parameters take. Default is None. n_neighbors : int or None When constructing a similarity matrix, the number of nearest neighbors whose similarity values will be kept. The result is a sparse similarity matrix which can significantly speed up computation at the cost of accuracy. Default is None. reservoir : numpy.ndarray or None The reservoir to use when calculating gains in the sieve greedy streaming optimization algorithm in the `partial_fit` method. Currently only used for graph-based functions. If a numpy array is passed in, it will be used as the reservoir. If None is passed in, will use reservoir sampling to collect a reservoir. Default is None. max_reservoir_size : int The maximum size that the reservoir can take. If a reservoir is passed in, this value is set to the size of that array. Default is 1000. n_jobs : int The number of threads to use when performing computation in parallel. Currently, this parameter is exposed but does not actually do anything. This will be fixed soon. random_state : int or RandomState or None, optional The random seed to use for the random selection process. Only used for stochastic greedy. verbose : bool Whether to print output during the selection process. Attributes ---------- n_samples : int The number of samples to select. ranking : numpy.array int The selected samples in the order of their gain. gains : numpy.array float The gain of each sample in the returned set when it was added to the growing subset. The first number corresponds to the gain of the first added sample, the second corresponds to the gain of the second added sample, and so forth. """ def __init__(self, n_samples, metric='euclidean', initial_subset=None, optimizer='lazy', optimizer_kwds={}, n_neighbors=None, reservoir=None, max_reservoir_size=1000, n_jobs=1, random_state=None, verbose=False): super(FacilityLocationSelection, self).__init__(n_samples=n_samples, metric=metric, initial_subset=initial_subset, optimizer=optimizer, optimizer_kwds=optimizer_kwds, n_neighbors=n_neighbors, reservoir=reservoir, max_reservoir_size=max_reservoir_size, n_jobs=n_jobs, random_state=random_state, verbose=verbose) def fit(self, X, y=None, sample_weight=None, sample_cost=None): """Run submodular optimization to select the examples. This method is a wrapper for the full submodular optimization process. It takes in some data set (and optionally labels that are ignored during this process) and selects `n_samples` from it in the greedy manner specified by the optimizer. This method will return the selector object itself, not the transformed data set. The `transform` method will then transform a data set to the selected points, or alternatively one can use the ranking stored in the `self.ranking` attribute. The `fit_transform` method will perform both optimization and selection and return the selected items. Parameters ---------- X : list or numpy.ndarray, shape=(n, d) The data set to transform. Must be numeric. y : list or numpy.ndarray or None, shape=(n,), optional The labels to transform. If passed in this function will return both the data and th corresponding labels for the rows that have been selected. sample_weight : list or numpy.ndarray or None, shape=(n,), optional The weight of each example. Currently ignored in apricot but included to maintain compatibility with sklearn pipelines. sample_cost : list or numpy.ndarray or None, shape=(n,), optional The cost of each item. If set, indicates that optimization should be performed with respect to a knapsack constraint. Returns ------- self : FacilityLocationSelection The fit step returns this selector object. """ return super(FacilityLocationSelection, self).fit(X, y=y, sample_weight=sample_weight, sample_cost=sample_cost) def _initialize(self, X_pairwise): super(FacilityLocationSelection, self)._initialize(X_pairwise) if self.initial_subset is None: pass elif self.initial_subset.ndim == 2: raise ValueError("When using facility location, the initial subset"\ " must be a one dimensional array of indices.") elif self.initial_subset.ndim == 1: if not self.sparse: for i in self.initial_subset: self.current_values = numpy.maximum(X_pairwise[i], self.current_values).astype('float64') else: for i in self.initial_subset: self.current_values = numpy.maximum( X_pairwise[i].toarray()[0], self.current_values).astype('float64') else: raise ValueError("The initial subset must be either a two dimensional" \ " matrix of examples or a one dimensional mask.") self.current_values_sum = self.current_values.sum() self.calculate_gains_ = calculate_gains_sparse if self.sparse else calculate_gains dtypes_ = sdtypes if self.sparse else dtypes if self.optimizer in (LazyGreedy, ApproximateLazyGreedy): self.calculate_gains_ = self.calculate_gains_(dtypes_, False, True, False) elif self.optimizer in ('lazy', 'approimate-lazy'): self.calculate_gains_ = self.calculate_gains_(dtypes_, False, True, False) else: self.calculate_gains_ = self.calculate_gains_(dtypes_, True, True, False) #calculate_sieve_gains_ = calculate_gains_sieve_sparse if self.sparse else calculate_gains_sieve #dtypes_ = sieve_sparse_dtypes if self.sparse else sieve_dtypes #self.calculate_sieve_gains_ = calculate_sieve_gains_(dtypes_, # True, True, False) self.calculate_sieve_gains_ = calculate_gains_sieve(sieve_dtypes, True, True, False) def _calculate_gains(self, X_pairwise, idxs=None): idxs = idxs if idxs is not None else self.idxs gains = numpy.zeros(idxs.shape[0], dtype='float64') if self.sparse: self.calculate_gains_(X_pairwise.data, X_pairwise.indices, X_pairwise.indptr, gains, self.current_values, idxs) else: self.calculate_gains_(X_pairwise, gains, self.current_values, idxs) gains -= self.current_values_sum return gains def _calculate_sieve_gains(self, X_pairwise, thresholds, idxs): """This function will update the internal statistics from a stream. This function will update the various internal statistics that are a part of the sieve algorithm for streaming submodular optimization. This function does not directly return gains but it updates the values used by a streaming optimizer. """ super(FacilityLocationSelection, self)._calculate_sieve_gains( X_pairwise,thresholds, idxs) if self.sparse: self.calculate_sieve_gains_(X_pairwise.data, X_pairwise.indices, X_pairwise.indptr, self.n_samples, self.sieve_current_values_, self.sieve_selections_, self.sieve_gains_, self.sieve_total_gains_, thresholds, self.sieve_n_selected_, idxs) else: self.calculate_sieve_gains_(X_pairwise, self.n_samples, self.sieve_current_values_, self.sieve_selections_, self.sieve_gains_, self.sieve_total_gains_, thresholds, self.sieve_n_selected_, idxs) def _select_next(self, X_pairwise, gain, idx): """This function will add the given item to the selected set.""" if self.sparse: self.current_values = numpy.maximum( X_pairwise.toarray()[0], self.current_values) else: self.current_values = numpy.maximum(X_pairwise, self.current_values) self.current_values_sum = self.current_values.sum() super(FacilityLocationSelection, self)._select_next( X_pairwise, gain, idx)
2023-11-11T01:27:15.642919
https://example.com/article/9159
RobotDevil 1 year ago Some people are above meetings. I know an organIzatIon dorsnt want to allow an individual free Regins but when - he’s that good, humble and your team is losing its other star RB - just let the man play.
2024-03-15T01:27:15.642919
https://example.com/article/3635
§ 35. p. 626.) Herodicus, who is sometimes called ProdioiiR (Plin. //. N. xxix. 2), lived at Athens a short time before the Peloponnesian war. Plato sa}~s that he was not only a sophist (Piat. Prolog. I. c.}, but also a master of the gymnasium (Id. Rep. iii. p. 406), and physician (Id. Gore/. % 2. p. 448), and in fact he united in his own person these three qualities. He was troubled, says the same author, with very weak health, and tried if gymnastic exercises would not help to improve it ; and having perfectly succeeded, he imparted his method to others. Before him medical dietetics had been entirely neglected, espe­cially by the Asclepiadae. (Id. Rep. iii. p. 406.) If Plato's account may be taken literally (Id. Pkaedr. p. 228), he much abused the exercise of gymnastics, as he recommended his patients to walk from Athens to Megara and to return as soon as they had reached the walls of the latter town.* The author of the sixth book De Morb. Vulgar. (Hippocr. Epidem. vi. c. 3. vol. iii. p. 599) agrees with Plato : 4; Herodicus," says he, " caused people, attacked with fever, to die -from walking and too hard exercise, and many of his patients suffered much from dry rubbing." A short time after we find, says Fuller (Medi-cina Gymnastica, &c. Loud. 1718, 8vo), that Hip­pocrates (De Vict. Hat. iii. vol. i. p. 716), with some sort of glory, assumes to himself the ho­nour of bringing that method to a perfection, so as to be able to distinguish ir6r€pov t& <nriov Kpctreei tovs TroVous, I) ot ttotoi to. <rm'a, •/} /xerpfws €%ei Trpos &AAi7Aa, as he expresses it. Pursuant to this, we find him in several places of his works recommending several sorts of exercises upon proper occasions ; as first, friction or chafing, the effects of which he explains (De Vict. Rat. ii. p. 701), and tells us, that in some cases it will bring down the bloatedness of the solid parts, in others it will incarn and cause an increase of flesh, and make the part thrive. He advises (ibid. p. 700) walking, of which they had two sorts, their round and straight courses. He gives his opinion (ibid. p. 701) of the 'AvaKiv^^ara, or preparatory exercises, which served to warm and fit the wrestlers for the more vehement ones. In some cases he advises the TlaA^, or common wrest- ling (ibid.}^ and the ' or wrestling by the hands only, without coming close, and also the, Kcypu/fOjUaxiX or the exercise of the Corycus, or the hanging ball (see Antyllus, apud Mercur. cle, Arte-Gymn. p. 123) ; the Xeipofo/xfa, a sort of dex­terous and regular motion of the hands, and upper parts of the body, something after a military man­ner ; the 'AAiVS^tm, or rolling in sand ; and once (ibid, p. 700) wo find mentioned, with some ap­probation, the "H-iTeipoL "iTTTroi, Equi Indefinite by which is probably meant galloping long courses in the open field. As for Galen, he follows Hippocrates in this, as closely as in other things, and declares his opinion of the benefit of exercises in several places ; his second hook " De Sanitate Tuenda," is wholly upon the use of the slriyil, or the advantage of regular chafing: he has written a little tract, Uepl rov 5ta MiKpas ^tyaipas Tv/nvaviov, where­in he recommends an exercise, by which the body and mind are both at the same time aifected. In his discourse to Thrasybulus, IT<J-repov 'larputTJs $) Tv/ni/aa-Tiicris ecrri rb Ir£'yitiv6v, he inveighs against the athletic and other violent practices of the gymnasium, but approves of the more moderate exercises, as subservient to the ends of a physician, and consequently part of that art. The other Greek writers express a similar opinion ; and the sense of most of them in this matter is collected in Oribasius's " Collecta Medi-cinalia." In those remains which are preserved of the writings of Antyllus, we read of some sorts of exercises that are not mentioned by Galen or any former author ; among the rest the Cricilasia as the translators by mistake call it, instead of Crico'tlasia. This, as it had for many ages been disused, Mercurialis himself, who had made the most judicious inquiries into this subject (De Arte Gymnastica, 4to. Amstel. 1672), does not pretend to explain ; and I believe, says Freind (Hist, of* Physic, vol. i.), though we have the description of it set down in Oribasius (Coll. Medic, vi. 26), it will be hard to form any idea of what it was. The ancient physicians relied much on exercise in the cure of the dropsy (compare Hor. Epist. i. 2. 34. " Si noles sunns, curres hydropicus"), whereas we almost totally neglect it. (Alexander Trallianus, De Medic, ix. 3. p. 524, ed. Basil.) Hippocrates (De Intends Affection, sect. 28. vol. ii. p. 518) prescribes for one that has a dropsy ToAcuTrcopicu, or fatiyufag-exerdses, and he makes use of the same word in his Epidemics, and almost always when he speaks of the regimen of a dropsi­cal person, implying, that though it be a labour for such people to move, yet they must undergo it ; and this is so much the sense of Hippocrates, that Spon has collected it into one of the new Apho­risms, which he has drawn out of his works. Celsus says of this case (De Medic, iii. 21. p. 152, ed. Ar­gent.), "Concutiendum. multa gestatione corpus est." The Romans placed great reliance upon exercise for the cure of diseases ; and Asclepiades, who lived in the time of Pompey the Great, brought this mode of treatment into great request. He called exercises the common aids of physic, and wrote a treatise on the subject, which is mentioned by Celsus in his chapter " De Frictione " (De Medic, ii. ] 4. p. 82.), but the book is lost. He carried these notions so far, that he invented the Lecti Pcnsiles (Plin. II. N. xxvi. 8) or hanging beds, that the sick might be rocked to sleep ; which took so much at that time, that they came afterwards to be made of silver, and were a great part of the luxury of that people ; he had so many particular ways to make physic agreeable, and was so exquisite in the invention of.exercises to supply the place of medi­cine, that perhaps no man in any age ever had the happiness to obtain so general an applause ; and Pliny says (ibid. c. 7) by these means he made him­self the delight of mankind. About this time the Ro­man physicians sent their consumptive patients to Alexandria, and with very good success, as we find by both the Plinys ; this was done partly for the change of air, but chiefly for the sake of the exer- CJ - ' *f cise by the motion of the ship ; and therefore Celsiis says (De Medic, iii. 22. p. 156), " Si-vera Phthisis est, opus est longa navigation e ;" and a little after he makes Vehicuhim and Navis to be t\yo of
2024-03-01T01:27:15.642919
https://example.com/article/2925
<!DOCTYPE html> <html lang="en"> <head> <meta http-equiv="refresh" content="0;URL=../../../../libc/unix/notbsd/linux/other/constant.ENOKEY.html"> </head> <body> <p>Redirecting to <a href="../../../../libc/unix/notbsd/linux/other/constant.ENOKEY.html">../../../../libc/unix/notbsd/linux/other/constant.ENOKEY.html</a>...</p> <script>location.replace("../../../../libc/unix/notbsd/linux/other/constant.ENOKEY.html" + location.search + location.hash);</script> </body> </html>
2024-03-20T01:27:15.642919
https://example.com/article/6298
No. 207 Group RAF No. 207 (General Purpose) Group was a group of the Royal Air Force (RAF) established on 15 December 1941 by downgrading the British RAF Command known as Air H.Q. East Africa to Group status. The group was commanded by Air Commodore William Sowrey until June 1942 when Air Commodore Malcolm Taylor took over. No. 207 (General Purpose) GroupAir Commodore Malcolm TaylorOrder of Battle27 October 1942 On 16 November 1942, the Group was upgraded to Command status and again became Air H.Q. East Africa. Following the Casablanca Conference-directed reorganization of the Allied air forces in the North African and Mediterranean Theater of Operations (MTO) effective 18 February 1943, Air H.Q. East Africa was a sub-command of RAF Middle East Command, itself a sub-command of the Mediterranean Air Command. References Category:Royal Air Force groups
2024-07-03T01:27:15.642919
https://example.com/article/8357
Viscount Galway Viscount Galway is a title that has been created once in the Peerage of England and thrice in the Peerage of Ireland. The first creation came in the Peerage of England in 1628 in favour of Richard Burke, 4th Earl of Clanricarde. He was made Earl of St Albans at the same time (see the Earl of Clanricarde for more information on this creation). The second creation came in the Peerage of Ireland in 1687 in favour of Ulick Bourke. He was made Baron Tyaquin at the same time, also in the Peerage of Ireland. However, both titles became extinct on his early death in 1691. The third creation came in the Peerage of Ireland in 1692 in favour of the French soldier and diplomat Henry de Massue, Marquis de Ruvigny, who was created Baron Portarlington, also in the Peerage of Ireland, at the same time. He was made Earl of Galway in 1697. However, both titles became extinct on his death in 1720. The fourth creation came in the Peerage of Ireland in 1727 when John Monckton was made Baron Killard, of the County of Clare, and Viscount Galway. He represented Clitheroe and Pontefract in the British House of Commons and served as Surveyor General of Woods and Forests in England and Wales. His son, the second Viscount, sat as a Member of Parliament for Pontefract and Thirsk. In 1769 he assumed by Royal licence the additional surname of Arundell. His son, the third Viscount, briefly represented Pontefract in Parliament. He was succeeded by his younger brother, the fourth Baron, who also sat for Pontefract as well as for Yorkshire. His son, the fifth Viscount, discontinued the use of the surname of Arundell by Royal licence in 1826 and instead obtained permission for each successive holder of the title and his eldest son to use the surnames Monckton-Arundell while the younger branches of the family should use Monckton only. His son, the sixth Viscount, sat for many years as the Conservative Member of Parliament for East Retford. His son, the seventh Viscount, represented Nottinghamshire North in the House of Commons as a Conservative and was also an Aide-de-Camp to Queen Victoria, King Edward VII and King George V. In 1887 he was created Baron Monckton of Serlby, in the County of Nottingham, in the Peerage of the United Kingdom, which gave him and his descendants an automatic seat in the House of Lords. His son, the eighth Viscount, was Governor-General of New Zealand from 1935 to 1941. He was succeeded by his son, the ninth Viscount. On his early death in 1971, he had no direct male heir. His landownings passed to his daughter Charlotte (the Hon. Mrs Charlotte Townsend of Melbury House). The barony of Monckton of Serlby became extinct while he was succeeded in the Irish titles by his second cousin once removed, the tenth Viscount. He was the grandson of the Hon. Edmund Gambier Monckton, fourth son of the fifth Viscount, and as he was a member of a younger branch of the family he was named only Monckton, in accordance with the rules obtained by the fifth Viscount. However, he adopted by Royal licence the surname Arundell on his succession for himself and for all successive holders of the title. On the death in 1980 of his younger brother, the eleventh Viscount, this line of the family also failed. He was succeeded by his second cousin once removed, the twelfth Viscount, who was born in Canada. In 2017 he was succeeded by his only son, the thirteenth Viscount, present holder of the titles, who is the great-grandson of Marmaduke John Monckton, third son of the Hon. Edmund Gambier Monckton, fourth son of the fifth Viscount. Lord Galway lives in Canada and represented Canada as a rower in the 1984 Summer Olympics. Papers of the Viscounts Galway are held at Manuscripts and Special Collections, The University of Nottingham. The family seat was Serlby Hall, in Bassetlaw, Nottinghamshire. Viscounts Galway, First Creation (1628) See the Earl of Clanricarde Viscounts Galway, Second Creation (1687) Ulick Bourke, 1st Viscount Galway (1670–1691) Viscounts Galway, Third Creation (1692) and Earl of Galway (1697) Henri de Massue, Marquis de Ruvigny, 1st Viscount Galway (1648–1720) Viscounts Galway, Fourth Creation (1727) John Monckton, 1st Viscount Galway (1695–1751) William Monckton-Arundell, 2nd Viscount Galway (d.1772) Henry William Monckton-Arundell, 3rd Viscount Galway (1749–1774) Robert Monckton-Arundell, 4th Viscount Galway (1752–1810) William George Monckton-Arundell, 5th Viscount Galway (1782–1834) George Edward Arundell Monckton-Arundell, 6th Viscount Galway (1805–1876) George Edmund Milnes Monckton-Arundell, 7th Viscount Galway (1844–1931) George Vere Arundel Monckton-Arundell, 8th Viscount Galway (1882–1943) Simon George Robert Monckton-Arundell, 9th Viscount Galway (1929–1971) William Arundell Monckton-Arundell, 10th Viscount Galway (1894–1977) Edmund Savile Monckton-Arundell, 11th Viscount Galway (1900–1980) George Rupert Monckton-Arundell, 12th Viscount Galway (1922–2017) John Philip Monckton-Arundell, 13th Viscount Galway (born 1952) The heir presumptive is Alan Stobart Monckton (born 1934), a great-great-great grandson of the 1st Viscount. His heir is his son Piers Alastair Carlos Monckton (born 1962) His heir is his son Oliver George Carlos Monckton (born 1993) References Kidd, Charles, Williamson, David (editors). Debrett's Peerage and Baronetage (1990 edition). New York: St Martin's Press, 1990. External links Papers of the Viscounts Galway and their predecessors, held at Manuscripts and Special Collections at The University of Nottingham Category:Viscountcies in the Peerage of Ireland Category:Extinct viscountcies in the Peerage of Ireland
2023-10-10T01:27:15.642919
https://example.com/article/7459
This invention relates to the production of hydrogen and heat energy and more particularly to the production of hydrogen and heat energy by reacting a metal with water. It has been proposed to replace conventional hydrocarbon fuels with cleaner burning hydrogen in internal combustion engines. Unfortunately existing methods of storing hydrogen require heavy tanks for the compressed gas or complicated vessels for the liquid that are uneconomical to use. The metal hydride, although it can be claimed as the best existing method of storing hydrogen, is still too heavy to be used as a mobile hydrogen storage medium. Additionally, the large stored quantities of hydrogen require special safety precautions. It would be desirable to provide a method of generating the hydrogen gas fuel as needed. Some metals like aluminum, magnesium, or lithium react with water, spontaneously generating hydrogen gas and heat. Among these reactive metals, aluminum is the most abundant, cheapest and safest metal. But, the reaction between aluminum and water is not sustained at ambient temperature due to the protective oxide layer formed on the metal surface. Therefore, the use of aluminum as a fuel to generate heat and hydrogen gas requires that the protective layer be efficiently and continuously removed. European patent No. 0 055 134 B1 (1986) discloses a method for the production of hydrogen by inducing electrical discharge between aluminum wire and aluminum drum both of which are immersed in water. When a voltage is applied between the wire and drum, an arching discharge takes place between them, inducing electro-plasmic reaction. The reaction produces hydrogen and oxygen gas and aluminum oxide. The arcing between the wire and drum helps remove the oxide layer formed on the wire tip, exposing fresh aluminum to the water. Thus, a continuous generation of hydrogen gas is possible when the wire is fed against the drum. This process has two major disadvantages. First, since the process is slow, the heat generated from the reaction is wasted by being dissipated through the water. Second, the electrical energy required to sustain the reaction is rather high. It is estimated that around 20 KJ of electrical energy is consumed to generate about 5 liter of hydrogen gas at room temperature and a pressure of one atmosphere.
2023-09-28T01:27:15.642919
https://example.com/article/3457
Morbidity rate of reoperation in thyroid surgery: a different point of view. Goitre recurrence is a common problem following subtotal thyroid gland resection for multinodular goitre disease. The aim of the present study was to evaluate morbidity rate in relation to the side of initial and redo-surgery for recurrent disease. A total of 1699 patients underwent consecutive thyroid gland surgery between 1997 and 2010 at our institution. One hundred and eighteen patients (6.9%) underwent redo-surgery for recurrent disease after subtotal resection. One hundred and nine patients with complete follow-up were included in the present study. Recurrent disease was found in 79 patients (72.5%) in the ipsilateral lobe and in 30 patients (27.5%) in the contralateral lobe. The incidence of permanent recurrent laryngeal nerve palsy was significantly higher in patients undergoing redo-surgery on the ipsilateral lobe compared to patients undergoing initial operation (3.8% vs. 1.1%; p = 0.03), whereas no difference was found in patients with contralateral redo-surgery compared to patients undergoing initial operation (p = 1.0). Independent risk factors for contralateral recurrent disease were age at primary operation <37 years (OR 4.86; 95% CI 1.58-15.01) and time to recurrence <20 years (OR 6.53; 95% CI 2.23-19.01). Morbidity rate for recurrent disease after subtotal resection was significantly higher for ipsilateral redo-surgery compared to initial surgery, whereas redo-surgery can be performed safely on the contralateral lobe. Young age at primary operation and short time to recurrence are independent risk factors for contralateral recurrent disease.
2024-05-19T01:27:15.642919
https://example.com/article/8951
Superficial venous vascular response of the resting limb during static exercise and postexercise muscle ischemia. Superficial venous vascular response to exercise is mediated sympathetically, although the mechanism is not fully understood. We examined whether sympathetic activation via muscle metaboreflex plays a role in the control of a superficial vein in the contralateral resting limb during exercise. The experimental condition involved selective stimulation of muscle metaboreceptors: 12 subjects performed static handgrip exercises at 45% maximal voluntary contraction for 1.5 min followed by a recovery period with arterial occlusion of the exercise arm (OCCL). For the control condition (CONT), the same exercise protocol was performed except that the recovery period occurred without arterial occlusion. Heart rate (HR) and mean arterial blood pressure (MAP) were measured. The cross-sectional area of the basilic superficial vein (CSAvein) and blood velocity (Vvein) in the resting upper arm were measured by ultrasound while the cuff on resting upper arm was inflated constantly to a subdiastolic pressure of 50 mm Hg. Basilic vein blood flow (BFvein) was calculated as CSAvein × Vvein. During exercise under both OCCL and CONT, HR and MAP increased (p < 0.05), while CSAvein decreased (p < 0.05). During recovery under OCCL, HR returned to baseline, but the exercise-induced increase in MAP and decrease in CSAvein were maintained (p < 0.05). During recovery under CONT, HR, MAP, and CSAvein returned to baseline. BFvein did not change during exercise or recovery under either condition. These results suggest that sympathoexcitation via muscle metaboreflex may be one of the factors responsible for exercise-induced constriction of the superficial veins per se in the resting limb.
2024-04-07T01:27:15.642919
https://example.com/article/9197
New Construction: Community Inquiry Community Details for The Oaks at Ironwood Decorated model now open! The homes in this single-family neighborhood feature 2,500 – 3,100 sq.. ft., starting in just the upper $200’s! And with 1+ acre homesites and 7 floor plans to choose from we’re sure you’ll find a home to accommodate the needs of your growing family. Franklinton is a close-knit Granville County community so if you like a small town feel and a simple life, Franklinton is the place to migrate! Model Home Opening Summer 2017!
2023-09-24T01:27:15.642919
https://example.com/article/6989
From the Book Section 6: DLSw+ (4 Points) Configure DLSw+ between VLAN2 and VLAN4; use routers R8 and R5. Peer from Lo0 on R8 and the VLAN4 interface on R5; ensure that R8 can accept DLSw+ connections from only unknown TCP peers. Peer as requested from Lo0 on R8 and configure this peer as promiscuous with TCP for the future connections. Configure R5 as requested and configure your bridging parameters to ensure the required connectivity. You should be concerned about this question; it is too easy and this should be ringing alarm bells. If you have configured this correctly as in Example 1-53 and Example 1-54, you have scored 2 points. Set up a one-line filter, which only allows common SNA traffic to egress from R5 VLAN4 into the DLSw+ network. You are required to configure lsap-output-list, which allows only the SNA common traffic listed under access-list 200 to egress the DLSw+ connection to R8 on R5. If you have configured this correctly as in Example 1-55, you have scored 2 points.
2024-07-07T01:27:15.642919
https://example.com/article/4841
Background ========== The organization of DNA into chromatin allows its compact and reversible packaging into the nucleus of a eukaryotic cell. The basic structural unit of chromatin is the nucleosome \[[@B1]\], which consists of 146 base pairs of double-stranded DNA wrapped around an octameric histone core complex \[[@B2]\]. The core complex is composed of two copies of each of the histone proteins H2A, H2B, H3, and H4, organized as a central (H3-H4)~2~tetramer flanked by two H2A-H2B dimers \[[@B3]\]. Despite low sequence similarity, all core histone subunits share a common fold; they are composed of three helices separated by two short strap loops and assemble into heterodimers by interleaving the helices into the \'handshake motif\' and juxtaposing the strap loops into short parallel β-bridges \[[@B3]\]. This fold may have arisen through the duplication of a primordial helix-strand-helix motif \[[@B4],[@B5]\], consistent with the hypothesis that folded proteins arose by the combination of subdomain-sized peptides, the so-called antecedent domain segments \[[@B6]-[@B8]\]. Archaea also wrap their DNA into nucleosome-like structures \[[@B9]\]; their constituent histone subunits assemble into tetramers, which may reflect an ancestral form of the central part of the eukaryotic nucleosome octamer, the (H3-H4)~2~tetramer \[[@B10]\]. Archaeal histone subunits are occasionally duplicated on a single polypeptide chain \[[@B11]\], a form observed in eukaryotes only in the histone-like domain of the son of sevenless protein \[[@B12]\]. Bacteria also have nucleoid proteins with histone-like properties \[[@B13]\], but these belong to a different, unrelated fold. However, a homolog of archaeal single-chain histones was recently reported from the bacterium *Aquifex aeolicus*(1R4V) \[[@B14]\]. Further homologs appear in the genomes of a few, phylogenetically diverse bacteria. It thus seems likely that the histone fold originated in the common ancestor of eukaryotes and archaea and spread into some bacteria through lateral gene transfer. In an all-against-all application of HHsearch \[[@B15]\] to the SCOP database (JS, unpublished results) we found an evolutionary relationship between histone proteins and the helical part of the extended AAA+ ATPase domain, the C-domain \[[@B16],[@B17]\]. Based on this finding, we used sequence and structure comparisons to reconstruct in detail the evolutionary events that may have shaped the histone fold. Our results point to a common origin not only with the C-domain but also with the N-terminal substrate recognition domain of Clp/Hsp100 proteins \[[@B18]\]. The conserved element is a helix-strand-helix motif, which we propose gave rise divergently to these three different folds and thus represents an antecedent domain segment. Results ======= Homology between proteins is typically inferred from similarities in sequence and structure. Sequence similarity is the primary criterion for deducing a common origin, but for distant evolutionary events, sequences may have diverged beyond our ability to detect their relatedness. Structures diverge much more slowly and their similarity is therefore often used to identify such distant events. However, similar structures may have arisen convergently from different origins and their similarity thus frequently does not provide conclusive evidence of common ancestry. In this study we applied a new, highly sensitive method for sequence comparison based on profile Hidden Markov Models (HMMs) to identify distant homologs of histones on the basis of sequence similarity alone. Subsequently, we validated our findings through structure comparisons. HMM-HMM comparisons ------------------- We used HHpred \[[@B15],[@B19]\], a sensitive HMM-to-HMM comparison method, to detect homologs of the histone fold by searching the SCOP25 database \[[@B20]\] with sequences from the three protein families with this fold: archaeal histones, nucleosome core histones and TBP-associated factors. As expected, these identified each other as their best matches with high statistical significance (Fig. [1](#F1){ref-type="fig"}). Remarkably, their subsequent matches were consistently to the helical part of the extended ATPase domains found in AAA+ proteins (the C-domain) \[[@B16]\]. Good matches to a third protein family, the N-terminal domain of Clp/Hsp100 proteins (Clp N-domain), were frequently obtained \[[@B18]\]. Reciprocal searches with a set of C-domain sequences confirmed the similarity of these protein families (Fig. [1](#F1){ref-type="fig"}). We found two high-scoring matches with other folds. These are an alanyl tRNA synthetase (1RIQ, a.203.1.1, identified by the histone entry 1JFI), and the zeta subunit of a plasmid maintenance system (1GVN, c.37.1.21, identified by two C-domains: 1LV7 and 1R7R). Subsequent analysis could not confirm these matches as homologs. Analysis of sequence and structure conservation ----------------------------------------------- The surprising aspect of these findings is that histones, C-domains and Clp N-domains belong to three different folds (Fig. [2A--C](#F2){ref-type="fig"}). Histones are dimeric, interleaved helical bundles, as described in the Background section. C-domains are four-helix bundles composed of two consecutive helix-strand-helix motifs \[[@B17]\]. Clp N-domains, finally, are multihelical domains formed by the repetition of a 4-helical motif \[[@B21]\]. Although these three protein families have different topologies, they all incorporate two copies of the helix-strand-helix motif, which engages in the formation of a short parallel β-bridge. In the histone dimer, the β-bridge is formed by the association of one helix-strand-helix motif from each monomer, in the C-domain by the association of the two motifs consecutive in the polypeptide chain, and in the Clp N-domains by the association of each motif with an N-terminal strand of the symmetry-related motif. The similarities detected by HMM-to-HMM comparison are limited to these helix-strand-helix motifs. Histones and C-domains both contain two consecutive copies of the motif and can be aligned over essentially their entire length (Fig. [3A](#F3){ref-type="fig"}). Clp N-domains contain two motifs decorated by two helices and each motif has its best matches to the C-terminal motif of histones and C-domains (Fig. [3A](#F3){ref-type="fig"}). The sequence alignment shows extensive similarity in the hydrophobic patterns of the three folds, but no highly conserved residues other than two Alanines in the core of the second helix-strand-helix motif, which allow for close packing interactions at the crossover point between the helices. A structural comparison of the three folds shows that C-domains can be superimposed onto one half of the histone fold with root-mean-square deviations (rmsd) of around 1.5Å (Table [I](#T1){ref-type="table"}). The main difference between the two folds lies in the fact that the two helix-strand-helix motifs of C-domains are connected by a hinge region, while they are continuous in histones, requiring dimerization to form the hydrophobic core (Fig. [3B](#F3){ref-type="fig"}). The similarity between histones and Clp N-domains is also in the range of 1.5Å rmsd, but extends only over the C-terminal helix-strand-helix motif of histones. Discussion ========== Domain swapping as mechanism for protein evolution -------------------------------------------------- The results presented here suggest an evolutionary link between histones and the C-domains of AAA+ proteins, despite differences in their topology. We propose 3D domain swapping as the mechanism that accounts for their structural differences. 3D domain swapping is a process by which two or more identical proteins exchange a domain to form interlocked oligomers \[[@B22]\], in which all of the packing interactions that stabilize the monomer are present. The swapped portions can range from a single secondary structure element to an entire domain. In the simplest case the native fold, normally constituted by a single \'closed\' monomer, is reconstituted by two so-called \'open\' monomers. This reciprocal swap leads to a homodimer, whereas the runaway domain swap, in which swapping propagates along an axis in an open-ended manner, has been proposed to contribute to amyloid fibril formation \[[@B23]-[@B25]\]. Up to now, about 40 proteins have been shown to be able to undergo 3D domain swapping \[[@B26]\], and several studies indicate a physiological role of this mechanism in allostery and signal transduction \[[@B27]-[@B29]\]. A precondition is the presence of a flexible loop or hinge, about which the swapped elements can rotate in order to form a pair of \'open\' monomers. The primary intervention by which 3D domain swaps have been engineered into monomeric proteins is through the shortening of the hinge, thus preventing the packing of part of the protein into its native location and forcing a swap, such as in domain 1 of lymphocyte antigen CD2 \[[@B30]\], staphylococcal nuclease \[[@B31]\], single-chain Fv fragments \[[@B32],[@B33]\], in a 3-helix bundle designed by Ogihara *et al*. \[[@B34]\]. Our results suggest that such a shortening of the hinge region, which connects the two helix-strand-helix motifs of the AAA+ C-domain, led to a 3D domain swap. The event caused head-to-tail dimerization of monomers, which thereby recovered the lost interactions between the two helix-strand-helix motifs, and resulted in the emergence of the histone fold (Fig. [4](#F4){ref-type="fig"}). Following the proposal that domain swapping might contribute to protein evolution \[[@B22],[@B35]\], we present here the first concrete example. A primordial helix-strand-helix motif ------------------------------------- The helix-strand-helix motif, which is at the core of the similarity between histones and C-domains, is also found in Clp N-domains, which assume yet a third fold. Here, the motif is decorated with two C-terminal helices, and two copies of this extended, 4-helical motif are fused in antiparallel orientation. Thus, three different folds appear to have been built from a common helix-strand-helix motif. One theory for the origin of folded proteins proposes that they arose by fusion and recombination from an ancestral set of peptides, which emerged in the context of RNA-dependent replication and catalysis (the \'RNA world\') \[[@B6]-[@B8]\]. The helix-strand-helix motif would be such an ancestral peptide, which gave rise divergently to the Clp N-domain and the AAA+ C-domain through two independent events of duplication and fusion (Fig. [4](#F4){ref-type="fig"}). The C-domain then evolved into the histone fold by 3D domain swapping. This scenario extends a previous hypothesis on the origin of eukaryotic core histones, which proposed that they evolved from the duplication of a single helix-strand-helix motif \[[@B4],[@B5]\]. In this study we have deduced homology based on similarities in sequence and structure. We are aware that homology of proteins is an assumption inferred from heuristics, of which sequence similarity is generally accepted as the best indicator. Structural similarity alone, especially of small fragments, does not necessarily imply evolutionary divergence, since it may result from general biophysical constraints. Indeed, we find a number of α-helical hairpins in the PDB with a high degree of structural similarity to the helix-strand-helix motif (rmsds of less than 1.5Å); some examples include hairpins from fumerate reductase (1QLA_A, residues 65--94) and tetracycline repressor-like protein (1T33_A, residues 144--173). However, none of them show detectable sequence similarity to each other or to the proteins in our study. This shows that the constraints of structure on sequence variability are not sufficient to explain the observed sequence similarity between histones, C-domains, and Clp N-domains. Functional implications ----------------------- An interesting structural feature common to all three folds is the presence of one or two short, parallel β-bridges formed by the strands of the helix-strand-helix motifs. In histones, these β-bridges provide the main site of interaction with the phosphate backbone of DNA (Fig. [5](#F5){ref-type="fig"}). In Clp N-domains, one of the two β-bridges binds the adaptor molecule ClpS \[[@B18],[@B21]\] (Fig. [5](#F5){ref-type="fig"}). Although the binding sites of the AAA+ C-domains have not been characterized yet, it thus seems attractive to propose that here also the single β-bridge formed in this domain represents the main binding site. C-domains play an important role in sensing the nucleotide bound by the AAA+ proteins \[[@B36]-[@B38]\] and are located close to the substrate-binding N-domains (Fig. [5](#F5){ref-type="fig"}), projecting radially at the circumference of the hexameric ring complex. We note in this context that C-domains are frequently rich in positively charged residues and that in the Lon protease, the C-domain has been implicated in interactions with DNA \[[@B39]\]. We propose that the helix-strand-helix motif served as a scaffold for the formation of parallel β-bridges. Ancestrally, these bridges bound proteins, but in a few C-domains they also acquired the ability to bind DNA, eventually leading to histones as proteins that only bind DNA at these sites. Conclusion ========== We have retraced the evolutionary events which may have shaped the histone fold and have found connections to two other folds; the N-terminal substrate recognition domain of Clp/Hsp100 proteins and the helical part of the extended AAA+ ATPase domain. These 3 folds contain a homologous helix-strand-helix motif, despite the differences in the topology, leading us to propose a scenario for the origin of these folds from a common ancestral helix-strand-helix motif through events of duplication, fusion and 3D domain swapping. The short functional parallel β-bridges formed by the strands of the helix-strand-helix motifs seem to be the evolutionary driving force for the conservation of this motif. Our findings provide additional support for our previously proposed hypothesis that the diversity of today\'s folds might have arisen from an ancestral set of peptides. Methods ======= We obtained histone and Clp N-domain sequences from the ASTRAL compendium \[[@B40]\] as defined by the SCOP (version 1.71) \[[@B20]\] folds a.22 and a.174, respectively, and reduced the set to less than 25% pairwise identity at 90% length coverage using BLASTCLUST \[[@B41]\]. C-domains are not characterized as a separate fold in SCOP; we extracted their sequences from the \'extended AAA-ATPase\' family (c.37.1.20) of the SCOP database by a procedure described by Ammelburg et al. \[[@B17]\] and also reduced this set to less than 25% pairwise identity. We used these sequences to search the SCOP25 database for homologs with HHpred \[[@B15],[@B19]\], at default parameters and a probability cutoff of 10%. The SCOP25 database is a version of SCOP filtered for a maximum of 25% pairwise sequence identity. For each group, we pooled all search results and tabulated the frequencies at which various SCOP families appeared at each probability, binned at 10% intervals. The histone, C-domain and Clp N-domain structures were superimposed interactively in Swiss-PDB viewer \[[@B42]\]. We chose the archaeal histone HmfA (1B67) as the reference structure, as it made the highest number of connections both in sequence and structure searches. Quantitative information for the superimposition is listed in Table [1](#T1){ref-type="table"}. The alignment in Fig. [3A](#F3){ref-type="fig"} reflects the structural superposition. The complex shown in Fig. [5B](#F5){ref-type="fig"}, consisting of ClpS, N-domain and the first AAA+ domain of ClpA, was generated by superimposing the N-domains of the structures 1R6B (N-domain and the AAA+ domains) and 1LZW (N-domain in complex with ClpS) from *E. coli*. Competing interests =================== The author(s) declare that they have no competing interests. Authors\' contributions ======================= VA and MA contributed equally to this work. JS discovered the similarity between histones and C-domains. VA, MA and AL conceived this study and VA and MA executed the analysis. VA, MA and AL wrote the paper. All authors read and approved the final manuscript. Acknowledgements ================ The authors thank Nick Grishin for discussions. This work was supported by institutional funds from the Max Planck Society. Figures and Tables ================== ![**Results of HHpred searches of the SCOP25 database with histone sequences and C-domains**. The relative frequencies of SCOP families encountered in the searches are plotted against the HHpred probabilities as described in the Methods (searches with histones -- top panel; searches with C-domains -- bottom panel). Histones (SCOP a.22) are colored in green, C-domains (SCOP c.37.1.20; also includes the misclassified a.49.1.1) in blue, Clp N-domains (SCOP a.174) in red and others in gray.](1472-6807-7-17-1){#F1} ![**The structure of histones, C-domains and Clp N-domains**. (A) The histone of *Methanothermus fervidus*(1B67); the N-terminal helix-strand-helix motif in each subunit is colored yellow and the C-terminal motif green. (B) The C-domain of the helicase RuvB (1IN4); the motifs are colored as in the histone subunits. (C) Clp N-domain of ClpA (1K6K); the two helix-strand-helix motifs are colored green.](1472-6807-7-17-2){#F2} ![**Sequence and structure comparisons of histones, C-domains and Clp N-domains**. (A) Multiple sequence alignment of representative members of each fold. Residues in helices are colored yellow in histones, blue in C-domains, and green in Clp N-domains; residues in β-bridges are colored red. Structurally equivalent residues are shown in capital letters and residues forming the hydrophobic core are shown bold. The sequences are labeled by their PDB codes; the numbers in brackets refer to the residue number for the first residue in the alignment. (B) Global superposition of the proteins listed in panel A. The superposition was made using the archaeal histone HMfA (1B67) as a reference structure. Quantitative information on the results of the superposition is provided in Table 1. The coloring is as in panel A; in addition, the hinge region of C-domains is highlighted in black.](1472-6807-7-17-3){#F3} ![**Evolutionary scenario for the origin of three folds from an ancestral helix-strand-helix motif**. The coloring and representative proteins are as in Fig. 2. The superimposed ensemble of helix-strand-helix motifs consists of motifs from the following proteins: yellow (1IN4: residues 181--212; 1B67: 4--33), green (1IN4: 216--251; 1B67: 134--166; 1K6K: 82--115).](1472-6807-7-17-4){#F4} ![**Involvement of the β-bridge in macromolecular interactions**. The coloring of helix-strand-helix motifs is as in Fig. 2, except the β-bridges are colored red. (A) The histone H3-H4 complex bound to DNA (1S32); residues of the β-bridges engaged in interactions with the phosphate backbone are shown in stick representation. (B) ClpS in complex with ClpA (1LZW, 1R6B); the ATPase domain is in light blue and ClpS in cyan.](1472-6807-7-17-5){#F5} ###### Data for the superposition in Fig. 3 ------------------------------------------------------------------------------------------------------------------------------------------------------------------ **PDB-ID** **Name** **SOURCE SPECIES** **FOLD** **SUBGROUP** **NO. OF ALIGNED RESIDUES** **RMSD TO HMFA \[Å\]** ------------------ -------------------- --------------------------- -------------- ------------------------ ----------------------------- ------------------------ [1B67](1B67) A+B HmfA *Methanothermus fervidus* Histone Archaeal 124/124 0.00 [1TAF](1TAF) A+B TAFII42/62 *Drosophila melanogaster* Histone TBP-associated factors 124/132 1.19 [1TZY](1TZY) A+B H2A/H2B *Gallus gallus* Histone Nucleosome core 118/129 1.33 [1TZY](1TZY) C+D H3/H4 *Gallus gallus* Histone Nucleosome core 114/134 1.10 [1IN4](1IN4) A RuvB *Thermotoga maritima* C-domain AAA+: helicases 46/71 1.38 [1R6B](1R6B) A ClpA-D1 *Escherichia coli* C-domain AAA+: Clp-D1 52/86 1.70 [1LV7](1LV7) A FtsH *Escherichia coli* C-domain AAA+: AAA 45/71 1.21 [1NY5](1NY5) A NtrC *Aquifex aeolicus* C-domain AAA+: σ 54 52/72 1.57 [1G8P](1G8P) A Mg chelatase *Rhodobacter capsulatus* C-domain AAA+ a\) 12/16(α 1)\ a\) 0.59\ b) 47/54(α 2--4) b) 1.38 [1K6K](1K6K) A ClpA-N (1^st^half) *Escherichia coli* Clp N-domain ClpA 33/78 1.54 [1K6K](1K6K) A ClpA-N (2^nd^half) *Escherichia coli* Clp N-domain ClpA 33/62 1.40 [1KHY](1KHY) A ClpB-N (1^st^half) *Escherichia coli* Clp N-domain ClpB 33/80 1.13 [1KHY](1KHY) A ClpB-N (2^nd^half) *Escherichia coli* Clp N-domain ClpB 33/58 0.96 ------------------------------------------------------------------------------------------------------------------------------------------------------------------
2024-01-24T01:27:15.642919
https://example.com/article/6963
const { assert } = require("chai"); const CommandRunner = require("../commandrunner"); const Server = require("../server"); const sandbox = require("../sandbox"); const path = require("path"); describe("truffle networks", () => { let config, projectPath; before("before all setup", function(done) { this.timeout(10000); projectPath = path.join(__dirname, "../../sources/networks/metacoin"); sandbox .create(projectPath) .then(tempConfig => { config = tempConfig; config.network = "development"; config.logger = { log: () => {} }; }) .then(() => Server.start(done)); }); after(done => Server.stop(done)); describe("when run on a simple project", () => { it("doesn't throw", async () => { await CommandRunner.run("networks", config); }).timeout(20000); }); describe("when run with --clean", () => { it("removes networks with id's not listed in the config", async () => { const workingDirectory = config.working_directory; const pathToArtifact = path.join( workingDirectory, "build", "contracts", "MetaCoin.json" ); await CommandRunner.run("networks --clean", config); const artifact = require(pathToArtifact); assert( Object.keys(artifact.networks).length === 1, "It should have deleted 1 network entry" ); assert( artifact.networks["4"], "It should have kept the network info for network_id 4" ); }); }); });
2024-03-09T01:27:15.642919
https://example.com/article/4907
Hannah Williams of Ystradgynlais Hannah Williams of Cwmtwrch was remembered by the Llais newspaper in an article of August 9th 1957. She is vividly portrayed as both an ardent Welsh nationalist who hated the English, and a kindly old soul who loved her English lodgers - hence the contradiction of the title the writer chose for his article. Happy and interesting childhood memories come back to my mind as I gaze on the ruins of the two cottages near the Cwmtwrch Welfare Hall, for in the cottage nearest to the main road lived Mrs Hannah Williams. She was a dear, bossy old lady, active until her death at 84. About ten yards from her cottage was the roadside water tap. Often she would be seen chasing mischevious boys away from the tap. There was a special reason for this - the appreciation of having clean water near the homes after many years of walking a mile or two to the springs (pistyll). Womenfolk could often be seen gathered round the tap, with pans and pails, discussing topics of the day, and hearing the latest news. Mrs Williams was known to all in the village as 'Modryb Hannah' (Auntie Hannah). Her husband, called 'Tomas y Gaffer' who was manager at a local colliery had died in middle age. Sons and daughters had married, do she kept lodgers for a living. There was a big demand for anthracite coal at the time, and instead of young men leaving Wales to seek employment as we saw later, there was an influx of young men from England coming to work at local collieries. The older collieries had closed down - Pwll Harries, Pwll Cox, Pwll Palleg, Brynmorgan. Collieries working and opening out were - Gilfach, Black Mountain, Patmos, Brynhenllys, Cwmllynfell, and Hendreforgan; the latter being the most modern, producing the finest anthracite in the valley. A company from Yorkshire owned the colliery. Coach Drawn By Three Horses The managing director was a Mr Day, who lived at Hendreforgan Farm. Often he could be seen passing through the village in a coach, drawn by three horses. A staunch churchman he attended Ystradgynlais Church every Sunday. The English managers were, Mr Mackadoo and Mr Johnson. Only a few workmen could speak English, their chief spokesman at the time being Mr Lewis Williams (Lewis bach) who was chairman for many years. He was a fluent speaker in Welsh and English, and an able negotiator. After interviewing the management, he would explain what had transpired to his workmates in Welsh. Only one of his sons is alive today, Mr Willie L Williams, Tanyrallt Cottages. Another colliery of interest was 'Spion Cop' on the hillside near Hendreforgan Farm. A lady named Miss Ocean managed this mine. Daily she would travel by train from Swansea. Drenched in breeches, she would enter the mine to arrange developments, and settle 'allowances'. With text and understanding she seemed to manage the colliery well. Perhaps the Coal Board could do with a few lady managers? There was another industry apart from coalmining, an Iron Foundry near George IV bridge, where 'Riverside' house stands today. It was called the 'Three Counties Foundry' and owned by Mr 'Thomas Thomas y Lamb' who also owned the Lamb Inn and adjoining houses. He was a skilled craftsman and considered a man of importance. Only two or three families were taking daily newspapers, the 'Joneses, Hendreforgan and Thomas Thomas y Lamb'. One day, with the scrap delivered at the Foundry , came an old cannon. It might have been in action at Waterloo, for it was a very old type, loaded through the muzzle. The old gun was dumped on waste ground across the river, where 'Aberllynfell' house was later built. Young men began using the gun for weddings, or other celebrations that called for a big bang. Mr Watkin Evans (Captain Evans) was getting married, so his friends decided to give him a real send-off. Being inexperienced gunners they rammed the barrel too tight with sand. The Old Cannon Exploded When fired, the rusty old cannon exploded, blowing away part of the wooden bridge nearby, felling a tree with part of the metal casing falling on top of Myrtle Hill. Luckily they escaped with slight injuries, but the young men felt keenly the loss of their celebration gun. Years later on the very same spot, there was an explosion that rocked the Cwm. A ten year old lad had found a tin case of detonators in the river, with his pals they were experimenting, when the whole lot went exploded. Four of us received minor injuries, with loss of hearing (temporary). Fortunately, the explosives had been in the river for a considerable period. During this period, three young men from England came to lodge with 'Modryb Hannah'. She couldn't speak a word of English and they couldn't understand Welsh, but somehow they seemed to get along very well. She used to call them 'Y Bois' (The Boys) and was very fond of the fine Englishmen who used to dig her garden, and be helpful in every way. As a lad of ten, I used to call every morning with milk from the farm (there were no milk deliveries in those days). Her Hatred of the English Of greater interest were her endless stories about the brutal treatment of the Welsh people, by the English in days gone by. She bitterly hated the English, maybe because of Celtic blood of the Bards in her veins. Dafydd Morgannwg, Welsh bard and historian was her cousin.I have an interesting letter written by the eminent bard and sent to her at this cottage. It was dated 1875, the address 'Nebo Cottage', Cwmdare, Aberdare. Her story, 'Brad y Cyllyllorion' made our blood boil. For about a hundred years the English had been trying to conquer the Welsh, but the elusive Welsh warriors from their Castles kept up constant guerilla warfare. So an English baron called for a truce, inviting Welsh chieftains to a feast, to settle their differences peacefully. To have a friendly atmosphere, Welsh and English chieftains sat side by side, then in the middle of the peace, at a given signal, the English drew their daggers and killed the Welsh warriors by their side. She would end with "What can you do with people like that?" I never thought at the time, and I'm sure it didn't enter the mind of Modryb Hannah that the likeable young men in the same room, were in any way related to this treacherous race, who so often gave us rising blood pressure. One of the 'young men' died about six months ago, at the age of 79 - Mr George Cooper of New Road. He came from London and after a few years married a Cwmtwrch lady. He was soon able to converse in Welsh. Mr Ted Morris, Gilfach Road, died about twelve years ago. He also was 'one of the best'. His widow and family live in Cwmtwrch. The other lodger is alive today, Mr William Higgs, until recently steward of the Working Men's Club at Ystradowen. Looking back over the years, I often get a good laugh when I think of the ardent Welsh Nationalist, who had such an intense hatred of the 'Saeson' and yet was deeply fonod of the English 'boys'. How To Write Alternate History is a series of articles by Grey Wolf, examining subjects such as the identity of man, whether man makes the weather, how the everyday in an alternate world is going to be changed and what names for music, vehicles, weapons etc would be different.
2024-03-30T01:27:15.642919
https://example.com/article/9162
.. _architecture: ===================== System Architecture ===================== High Level Description ====================== .. index:: single: agent; architecture double: compute agent; architecture double: collector; architecture double: data store; architecture double: database; architecture double: API; architecture The following diagram summarizes ceilometer logical architecture: .. The image source can be found at https://docs.google.com/drawings/d/1-6-DxU5ITyRcVJtJtPsc_zeiqzafZlir0AF7AkG4ZeQ/edit .. image:: ./Ceilometer_Architecture.png As shown in the above diagram, there are 5 basic components to the system: 1. A :term:`compute agent` runs on each compute node and polls for resource utilization statistics. There may be other types of agents in the future, but for now we will focus on creating the compute agent. 2. A :term:`central agent` runs on a central management server to poll for resource utilization statistics for resources not tied to instances or compute nodes. 3. A :term:`collector` runs on one or more central management servers to monitor the message queues (for notifications and for metering data coming from the agent). Notification messages are processed and turned into metering messages and sent back out onto the message bus using the appropriate topic. Metering messages are written to the data store without modification. 4. A :term:`data store` is a database capable of handling concurrent writes (from one or more collector instances) and reads (from the API server). 5. An :term:`API server` runs on one or more central management servers to provide access to the data from the data store. See `API Description`_ for details. .. _API Description: api.html These services communicate using the standard OpenStack messaging bus. Only the collector and API server have access to the data store. Detailed Description ==================== .. warning:: These details cover only the compute agent and collector, as well as their communication via the messaging bus. More work is needed before the data store and API server designs can be documented. Plugins ------- .. index:: double: plugins; architecture single: plugins; setuptools single: plugins; entry points Although we have described a list of the metrics ceilometer should collect, we cannot predict all of the ways deployers will want to measure the resources their customers use. This means that ceilometer needs to be easy to extend and configure so it can be tuned for each installation. A plugin system based on `setuptools entry points`_ makes it easy to add new monitors in the collector or subagents for polling. .. _setuptools entry points: http://packages.python.org/distribute/setuptools.html#dynamic-discovery-of-services-and-plugins Each daemon provides basic essential services in a framework to be shared by the plugins, and the plugins do the specialized work. As a general rule, the plugins are asked to do as little work as possible. This makes them more efficient as greenlets, maximizes code reuse, and makes them simpler to implement. Installing a plugin automatically activates it the next time the ceilometer daemon starts. A global configuration option can be used to disable installed plugins (for example, one or more of the "default" set of plugins provided as part of the ceilometer package). Plugins may require configuration options, so when the plugin is loaded it is asked to add options to the global flags object, and the results are made available to the plugin before it is asked to do any work. Rather than running and reporting errors or simply consuming cycles for no-ops, plugins may disable themselves at runtime based on configuration settings defined by other components (for example, the plugin for polling libvirt does not run if it sees that the system is configured using some other virtualization tool). The plugin is asked once at startup, after it has been loaded and given the configuration settings, if it should be enabled. Plugins should not define their own flags for enabling or disabling themselves. .. warning:: Plugin self-deactivation is not implemented, yet. Each plugin API is defined by the namespace and an abstract base class for the plugin instances. Plugins are not required to subclass from the API definition class, but it is encouraged as a way to discover API changes. .. note:: There is ongoing work to add a generic plugin system to Nova. If that is implemented as part of the common library, ceilometer may use it (or adapt it as necessary for our use). If it remains part of Nova for Folsom we should probably not depend on it because loading plugins is trivial with setuptools. Polling ------- .. index:: double: polling; architecture Metering data comes from two sources: through notifications built into the existing OpenStack components and by polling the infrastructure (such as via libvirt). Polling for compute resources is handled by an agent running on the compute node (where communication with the hypervisor is more efficient). The compute agent daemon is configured to run one or more *pollster* plugins using the ``ceilometer.poll.compute`` namespace. Polling for resources not tied to the compute node is handled by the central agent. The central agent daemon is configured to run one or more *pollster* plugins using the ``ceilometer.poll.central`` namespace. The agents periodically asks each pollster for instances of ``Counter`` objects. The agent framework converts the Counters to metering messages, which it then signs and transmits on the metering message bus. The pollster plugins do not communicate with the message bus directly, unless it is necessary to do so in order to collect the information for which they are polling. All polling happens with the same frequency, controlled by a global setting for the agent. Handling Notifications ---------------------- .. index:: double: notifications; architecture The heart of the system is the collector, which monitors the message bus for data being provided by the pollsters via the agent as well as notification messages from other OpenStack components such as nova, glance, quantum, and swift. The collector loads one or more *listener* plugins, using the namespace ``ceilometer.collector``. Each plugin can listen to any topics, but by default it will listen to ``notifications.info``. The plugin provides a method to list the event types it wants and a callback for processing incoming messages. The registered name of the callback is used to enable or disable it using the global configuration option of the collector daemon. The incoming messages are filtered based on their event type value before being passed to the callback so the plugin only receives events it has expressed an interest in seeing. For example, a callback asking for ``compute.instance.create.end`` events under ``ceilometer.collector.compute`` would be invoked for those notification events on the ``nova`` exchange using the ``notifications.info`` topic. The listener plugin returns an iterable with zero or more Counter instances based on the data in the incoming message. The collector framework code converts the Counter instances to metering messages and publishes them on the metering message bus. Although ceilomter includes a default storage solution to work with the API service, by republishing on the metering message bus we can support installations that want to handle their own data storage. Handling Metering Messages -------------------------- The listener for metering messages also runs in the collector daemon. It validates the incoming data and (if the signature is valid) then writes the messages to the data store. .. note:: Because this listener uses ``openstack.common.rpc`` instead of notifications, it is implemented directly in the collector code instead of as a plugin. Metering messages are signed using the hmac_ module in Python's standard library. A shared secret value can be provided in the ceilometer configuration settings. The messages are signed by feeding the message key names and values into the signature generator in sorted order. Non-string values are converted to unicode and then encoded as UTF-8. The message signature is included in the message for verification by the collector, and stored in the database for future verification by consumers who access the data via the API. .. _hmac: http://docs.python.org/library/hmac.html RPC --- Ceilomter uses ``openstack.common.rpc`` to cast messages from the agent to the collector. .. seealso:: * http://wiki.openstack.org/EfficientMetering/ArchitectureProposalV1 * http://wiki.openstack.org/EfficientMetering#Architecture * `Bug 1010037`_ : allow different polling interval for each pollster .. _Bug 1010037: https://bugs.launchpad.net/ceilometer/+bug/1010037
2023-10-21T01:27:15.642919
https://example.com/article/4298
Maria Bartiromo's New Fox News Show Debuts Strong 1 Apr 2014 Financial reporter Maria Bartiromo’s new Sunday morning Fox News show aired last weekend, debuting to very strong numbers. It won its time slot and earned one of the network’s strongest showings for the year in the important 25 to 54-year-old bracket. The sought-after financial reporter jumped from CNBC to Fox Business Network in part because of the offer of a Sunday morning show on Fox News. Upon its launch, Bartiromo promised that the show would be a different, more “forward looking” show than others that air on Sunday mornings. “Unlike other Sunday morning programs who only bring you Washington’s talking heads, we’ll discuss how to recreate opportunity and get America back into a position of economic and financial leadership,” Bartiromo promised. The anchor’s expectations were followed by very strong ratings for her first show. Sunday Morning Futures with Maria Bartiromo beat both CNN and MSNBC in total viewers in the 10 a.m. hour, trouncing CNN’s Fareed Zakaria and MSNBC’s Melissa Harris-Perry by earning more viewers than both combined. Bartiromo garnered a total viewer number of 1,078,000 with 312,000 in the 25 to 54 demographic. Meanwhile, CNN’s Zakaria got 643,000 total viewers with 169,000 in the demographic, and MSNBC’s Harris-Perry totaled only 391,000 total viewers, which included 168,000 in the demographic.
2024-06-07T01:27:15.642919
https://example.com/article/3301
North Iraq (AINA) -- Testimonies of Assyrians who have been fired from their jobs because they did not vote for the pro-Kurdish Ishtar slate have been published on ankawa.com, an Arabic language website with reporters in northern Iraq. The Ishtar slate participated in the provincial elections in the Nineveh province, held on January 31, and won the one quota seat reserved for the Assyrian minority. The victory has been marred, however, by reports of election violations (AINA 2-12-2009, 2-10-2009). Recent developments reported in ankawa.com substantiate a report about threats of economic sanctions against ordinary Assyrians by the groups behind the Ishtar slate, such as the Council for Christian Affairs (CCA), which is funded by the Kurdish Regional Government (KRG) finance ministry; the Council is present in most of the towns and villages of the Nineveh plain, where Assyrians constitute a sizable community. Sabri Lisha Shaya Mr Lisha Shaya was hired as a militia man by CCA 18 months ago. When a few days before the elections Mr. Shaya went to collect his salary from the local CCA office in the town of Telesqof, he was told by two officials named Abu Nateq and Najib Gebro "Don't forget to vote for the Ishtar-slate, and tell your relatives to do so as well." Mr. Sabri Shaya states: "When I went back to stand guard on Monday, two days after the elections, I was told by the other guards I had been fired from my job. I went to the office and asked Adel Mansur, responsible for the militia in Telesqof, the reason for my dismissal he replied, 'Because you voted for the Al rafidain slate.'" Mr. Shaya, a father of six, continues "Because of my fear to lose my income I denied it in the beginning, telling them I had voted for Ishtar, but Adel Mansur said to me 'you are a liar and I know for sure you voted for Al Rafidain.' I replied I am a free man and we live in a democratic country and I am free to vote for the party I believe will be best for our people. He said to me 'then let the Assyrian Democratic Movement give you a job and feed you, you can go and complain to whomever you want.'" Commenting to ankawa.com, Mr Naijb Gebro said "Concerning Lisha Shaya, he was dismissed because he betrayed us, how could he put up election posters of other slates when he was employed by us and he received his salary from us?" Ramzi Maroki Audisho Mr. Ramzi Audisho, another militia member who was fired, tells his story: "I was contacted around two years ago by CCA to work for them as a guard. I notified the Assyrian Democratic Movement, of which I am a member since 2003. The ADM told me they don't mind and that I am free to seek employment anywhere. I then accepted CCA's offer. On the 25 January (2009) we went to collect our salaries from the CCA's office. The official called Naijb Gebro spoke to us, using some very nasty words to describe anyone who would not vote for the Ishtar slate. Two days before the elections my name appeared on a list for persons appointed by the election commission to act as officials in the polling stations. I had sent in my application to the election commission through the Assyrian Democratic Movement [ADM] because the Council for Christian affairs had not submitted my name. I was immediately called up by Naijb Gebro and he wanted to see me. I went to the office and met him. He started criticizing me and telling me I do not have the right to apply through any other group, and I answered him 'you know very well about my difficult situation and that I really need the compensation I will receive for work as an election official.' On the second of February, two days after the elections, I went to stand guard as usual. One of the guards told me I had been fired from my job. They initiated a rumour that I was cursing the honour of those who wouldn't vote for Al Rafidain, while in fact it was Naijb Gebro who was cursing the honour of those who wouldn't vote for the Ishtar-slate. We kept quiet and tolerated his cursing only because we were afraid to lose our incomes." Neijb Gebro commented on the case to ankawa.com: "When I called him [on the telephone] to come and collect his salary I heard background noise. I asked him what it was and he said it was the television. I later found out he was lying, it was an election rally for a certain group. He came and received his salary without telling me he had been to an election rally, he lied to me. Also, the other guards told me that Ramzi swore at everyone who would not vote for Al Rafidain. One of the guards answered him 'How can you ask us to vote for Al Rafidain while we are employed by Ishtar?' Ramzi replied that he would give extra work tasks to the one who wouldn't vote for Al rafidain. He also applied with the election commission through the ADM while he should have applied through us. These are the reasons which forced us to dismiss him from his duty because we consider him to be a traitor." Hasib Khaya Toma Mr. Hasib Toma was employed by CCA as a janitor but quit his job when he was accused of being a traitor by an official from the council in Telesqof because he had voted for Al rafidain. Mr. Toma states "When I went to work on Monday after the elections I encountered Hekmat Kaboula, one of the officials. He told me 'you are a traitor because you voted for the Al rafidain slate and you should go to your uncle Ramzi to get your salary, both of you are traitors.' I replied if you consider me a traitor then I will no longer work for you. Afterwards they contacted me several times telling me I should stop telling people about the matter and that I should return to my job but I refused because they are thieves. " Naijb Gebro states: "We don't want them back with us because they betrayed us and we don't like to have traitors among us." Mr. Quryaqos Faransi known as Abu Nateq, another official from the Council for Christian Affairs confirmed what Mr. Naijb Gebro claimed, saying; "They deserve what we did to them because they betrayed the hand which fed them."
2024-01-18T01:27:15.642919
https://example.com/article/7594
Sublette moose herd resisting nationwide population decline A calf moose and its mother stop to water at the Green River in Daniel, just off the road. The Sublette herd shows stable population numbers. Andrew Setterholm photo PINEDALE – Moose populations are experiencing serious declines in the northern U.S., drawing concerns from wildlife managers and conservationists. The situation is already severe in Minnesota, while in Montana, studies are being conducted to find out why the population is dropping. In Wyoming, Jackson is seeing a sharp population decline. A Wyoming Game and Fish Department (WGFD) aerial survey conducted over Jackson habitats in late February showed far fewer moose than previous counts. In fact, WGFD biologist Doug Brimeyer counted just 239 moose in 22 hours – the second fewest of the animals documented in the past 28 years of record keeping.
2024-04-13T01:27:15.642919
https://example.com/article/2395
Q: nginx won't respond on some ports My problem is that I can not add another port to my existing nginx config. I have disabled the firewall on the ubuntu server with this command: sudo service ufw stop in sites-available I have this file named file.conf: server { listen 80; server_name example.com example.com; location = /favicon.ico { access_log off; log_not_found off; } location /static/ { root /home/user/project; } location /files/ { root /home/user/download/; } } server{ listen 8080; server_name example.com www.example.com; location / { include uwsgi_params; uwsgi_pass unix:/run/uwsgi/project.sock; } } server{ listen 8001; server_name example.com www.example.com; location / { include uwsgi_params; uwsgi_pass unix:/run/uwsgi/project.sock; } } I had the 8080 part earlier and this worked in past and now, but 8001 is not working. I disabled the firewall so I think the problem lies elsewhere. I also ran this command: sudo netstat -napl | grep 8001 which returned this: tcp 0 0 0.0.0.0:8001 0.0.0.0:* LISTEN 3475/nginx -g daemo thanks for your help and support A: I've solved the issue! the issue problem was that I used cloudflare for dns and cloudflare only let me use some ports listed here: For requests made via HTTP: 80 8080 8880 2052 2082 2086 2095 For requests made via HTTPS: 443 2053 2083 2087 2096 8443 hope it helps some other people facing this problem!
2024-02-23T01:27:15.642919
https://example.com/article/6352
This week you can check out the first issue of ILLUMINATI from Joshua Williamson and Shawn Crystal. We've been seeing how the Marvel Universe has turned out eight months after the events from Secret Wars. With ILLUMINATI, we'll see a group of villains brought together by the Hood. It's not often a series focuses on the bad guys. We took the chance to ask Josh and Shawn some questions to find out more. COMIC VINE: Is the team being formed in the current “8 months later” time or has the Hood been up to stuff during that time? JOSHUA WILLIAMSON: The Hood has been up to no good for a while now. Building the new Illuminati is his big master plan. So we for sure open up after the 8 months. Which you know in comic book time is a LONG TIME. But we’ll get to see the Villain’s POV on this new Marvel Universe. Something to remember about this book and the Hood. He is NOT the leader. He’s just the guy with an offer who is spreading a message… CV: Will the team be immediately brought together or will the gather take place over a couple issues? WILLIAMSON: The mass amount of the new Illuminati army has already been formed by the time issue one starts. We’re just seeing a small bit of it with a focus on Titania’s introduction to the group. There is a bit of team building, but y’know they all know each other already. They are not strangers. They’ve been in the thick of it before together and it’s one of the things that will bring conflict to the group. CV: Shawn, did you come up with the new looks for some of the members? SHAWN CRYSTAL: Partially. Riley [Rossmo] was the lead designer. When I came on, I made a few tweaks here and there, just to fit my style a little more. CV: Which character or characters are you most looking forward to drawing and fleshing out? CRYSTAL: Black Ant. I love the design we came up with on him. Plus, Josh has written him as the wild card. I love that. CV: Will the team just consist of the six characters we see on the cover or might there be others coming and going? WILLIAMSON: Wait and see? Haha. Lots are coming for this group of bad guys. If everyone makes it out of the first few issues alive. CV: How did you go about in choosing the villains for the team? Did you have a list of available characters or just include your choices in your pitch? WILLIAMSON: It was a bit of both? I knew who I wanted and made a list of my own. Some worked and some didn’t. From the start I knew I wanted Titania and the Hood. And that worked out. After that it was a bit of who was available that I thought was cool. I didn’t want to have people on the team just because… I wanted a good mix of characters I thought could bounce off each other to create new dynamics, and be fun to write together. Black Ant I wanted because of his darker sense of humor, Enchantress… is a bit of a mystery to the group which we dig in, but she is there for a reason. Also she’s a bad ass. Thunderball… I liked the idea of this guy who knows he’s a genius but never gets respect for it. And then the Mad Thinker… he’s our resident builder who thinks everyone is less than him…but knows he needs to use people to get what he wants. All of them working together for a common goal is a bit insane and they clash, which I love. CV: Will we find out what the Hood and team’s goal is? Do they want to just get rich? Take over the world? Get revenge against their enemies? WILLIAMSON: All of the above? Level up? Increase their reps? But also build better lives for the villains of the Marvel Universe. To find a way to work together so they finally win. That is their primary goal. At least that’s what they signed up for… CV: How big the action get? CRYSTAL: The action gets HUGE, especially in issue 4. CV: Power Man (Luke Cage) and Iron Fist show up in the first issue. Will the team be clashing with other heroes or try more stealthy missions of villainy? WILLIAMSON: One of their main goals is to work in the shadows and to avoid the heroes of the Marvel Universe. But that’s a very difficult thing to do when you think about how many heroes there are out there. But it’s on the Illuminati’s minds… if only they could avoid the heroes. They really are the number hurdle in their path to success… CV: You probably had a favorite character when forming the idea and story. Now that you’ve written a few issues, has your favorite changed? WILLIAMSON: Ehhhh… yeah. I’ve grown to love Titania way more than before. Oh and Absorbing Man. The two of them are a blast to write. I wrote a very emotional scene with Absorbing Man recently that was surprising. Caught me off guard a bit. But I think it’s one of my favorite issues I’ve written with Marvel. When I first started my favorite was the Hood for sure. I felt like he was the character to write that was closest to my sensibilities. I like jerk characters who think they have a heart of gold. You look at GHOSTED and NAILBITER… or even go back as far as the Damian and Supergirl story I did in SUPERMAN/BATMAN #77… I enjoy writing the characters that are a bit of the edge with black humor and sort of full of themselves. But from there I hold a soft spot for all of them. CV: Shawn, have you found yourself liking any particular character’s new look the more and more as you draw them? CRYSTAL: The Hood. I’m getting a feel for him the more and more i draw him. I’m learning how i can play with the hood and cape as an acting and character developing device. CV: Will the villains wear proper uniforms or whatever suits them when they're about to go out? CRYSTAL: The team has uniforms for their missions…well it’s more like their gear. They each have different uniforms, but I’ve added some consistent visual themes across the designs to give them a team feel, while all being individuals. CV: What can we look forward to in the series? WILLIAMSON: DRAMA! DANGER! HEART BREAK! And some black humor along the way. And some pretty crazy fight scenes. It’s going to be a very different book from what I think people will expect so I hope that they give it a try and stay with us to see the crazy story we’re building with the villains of the Marvel Universe. OH and… VILLAINS VS VILLAINS! ILLUMINATI #1 is on sale this week, November 11. Be sure to pick it up to support the villains. Why let the heroes get all the fun and excitement?
2023-09-18T01:27:15.642919
https://example.com/article/9430
Sheathless and high throughput sorting of paramagnetic microparticles in a magneto-hydrodynamic microfluidic device. Sorting of microorganisms and particles from a mixture is critical for numerous biotechnological and medical applications. Several sorting methods such as pinched flow fractionation (PFF), optical sorting, dielectrophoresis, acoustic separation, magnetophoresis and deterministic lateral displacement (DLD) have been reported in literature. But most of these methods lack ideal characteristics of a sorter such as ability to process at high throughput, simple design, non-complicated fabrication method, sheathless operation and high purity in separation. In this paper, we have introduced a novel sorting technique by integrating focusing of magnetic particles in a narrow microchannel with their hydrodynamic separation at a downstream expansion channel which meets majority of the aforementioned characteristics. To achieve this, the sheathless focusing of paramagnetic microparticles in the narrow microchannel and their deflection at the expansion channel were first studied at various flow rates (0.5-5 ml h-1). Then, a mixture of 5 and 11 μm paramagnetic particles was introduced into the device and their separation was examined quantitatively. It was found that the magnetic particles were focused along the wall of channel, however their centers were positioned on two distinct streamlines owing to difference in their sizes. Hence, these two particles were found separated from each other as they flew into the expansion region. This technique of size based separation of paramagnetic particles works at a high throughput of 107 particles per hour and offers more than 98% purity in sorting.
2024-01-14T01:27:15.642919
https://example.com/article/2741
[ { "data": "dTNHFJZWs6tjEyNI7AFQTkjyz05Pfa0EQTHVkW7tv7Rym4591YCHDYHeObw0", "valid": true }, { "data": "TNHFJZWs6tjEyNI7AFQTkjyz05Pfa0EQTHVkW7tv7Rym4591YCHDYHeObw0", "valid": false, "message": "err.format.base64.badLength", "msgData": { "length": 59 }, "msgParams": [ "length" ] }, { "data": "ddTNHFJZWs6tjEyNI7AFQTkjyz05Pfa0EQTHVkW7tv7Rym4591YCHDYHeObw0", "valid": false, "message": "err.format.base64.badLength", "msgData": { "length": 61 }, "msgParams": [ "length" ] }, { "data": "dTNHFJZWs6tjEyNI7AFQTkjyz05Pfa0EQTHVkW7tv7Rym4591YCHDYHeObw=", "valid": true }, { "data": "dTNHFJZWs6tjEyNI7AFQTkjyz05Pfa0EQTHVkW7tv7Rym4591YCHDYHeOb==", "valid": true }, { "data": "dTNHFJZWs6tjEyNI7AFQTkjyz05Pfa0EQTHVkW7tv7Rym4591YCHDYHeO===", "valid": false, "message": "err.format.base64.illegalChars", "msgData": { "character": "=", "index": 57 }, "msgParams": [ "character", "index" ] }, { "data": "dTN,FJZWs6tjEyNI7AFQTkjyz05Pfa0EQTHVkW7tv7Rym4591YCHDYHeObw0", "valid": false, "message": "err.format.base64.illegalChars", "msgData": { "character": ",", "index": 3 }, "msgParams": [ "character", "index" ] } ]
2024-07-21T01:27:15.642919
https://example.com/article/4517
Archive for November, 2011 South Park‘s “City Sushi” of Season 15 is a true “Butters episode,” featuring said character at his quintessential best. He, innocently enough, opens the show working as a flyer distributor for the new local sushi place. The Chinese owner of City Wok is outraged because the Japanese are cutting in on his territory, just like they’ve continuously done throughout history. An Asian turf war breaks out and the authorities believe Butters is involved. Upon examining him, the psychologist says Butters suffers from multiple personality disorder, but what he offers in support of this diagnosis makes it clear to viewers that the doctor is simply observing Butters’ incredibly creative and playful mind. These “personalities” are simply characters that he has created so as to entertain himself while being drastically sheltered by his parents, who proclaim themselves to be “awesome.” Once again, Butters finds himself surrounded by people, usually adults, who drag him into a situation of some peril. Sure, Butters suffers from a bit of extreme naivete, but Trey Parker and Matt Stone have made efforts to develop very subtle layers to Butters, as he has emerged into a more (ironically) perceptive, less reserved staple of the show. Early on, Butters was not as prolific and was inserted into spot episodes as an easy target of ridicule for the cast mainstays and audience alike. In the second half of Season 4 (2000), Butters briefly appears in “4th Grade.” On behalf of their peers, the core four decide to pull a prank on their new teacher to establish their dominance in the classroom. They propose the act of pulling down their pants while shouting “Kiss my ass!” Butters asks for clarification. “Should we stand front ways or back?” he stutters. “Do we show our behinds or our weiners?” Surprised at the lack of thought behind the question, Stan stares, pauses and deadpanly explains that showing their asses would be “sufficient.” Such scenes were the norm for poor Butters, the mere fringe character. Butters would become more prevalent by the end of the 5th season though, when he was the focal point of the aptly, humorously entitled “Butters’ Very Own Episode.” This is when the audience would become more in tune with what makes Butters tick. Setting up his increased role in the next season as the possible replacement of Kenny as the fourth friend, Parker and Stone take viewers into the Scotch household-a pretty terrifying place. Like in the aforementioned “City Sushi” episode, Butters is asked to be involved in some unsavory activity. Looking to please his mother, he complies to spying on his dad, only to unknowingly reveal his father’s secret gay life. Mrs. Scotch snaps and decides that the only way to protect her son from the impurities of a life with a homosexual for a father is to kill Butters. He survives and by the end of the show lectures his parents about the pitfalls of lying. By the time he creates his alter-ego, “Professor Chaos,” Butters has suffered many-a-pangs at the hands of Stan, Kyle, and Cartman, while serving as their stand-in friend. Finally, after an ultimate rejection as their confidant, Butters becomes the super villain, looking to create displeasure for anyone in his presence. Sure he only performs crimes against others that are more cute than harmful, like swapping people’s soups at Bennigan’s, but this is a turning point for Butters as he would come to assert himself amongst the group more and more. Of late, Butters has been increasingly vocal and, dare I say, confident in his voice. By the premiere of the current Season 15, “HumancentiPad,” viewers behold him actually pointing out a poor choice on Kyle’s part to accept, without reading, the exceptionally verbose agreement between Apple and their users of the frequently updated ITunes application. It is Butters, of all people, who calls into question Stan’s defense of the entrapped Kyle. After reading aloud the portion of the agreement that clearly indicates that Kyle had agreed to be a part of the Apple experiment in which Kyle’s face would be sewn to the rear end of another user, Butters slowly, moves his mouse into place and sarcastically enunciates, “Yeah, I’m going to click…’Decline.'” In “The Last of the Meheecans,” Butters is the unheralded hero. After (once again innocently) becoming a recognizable symbol of Mexican pride in the neighboring country, the gang fail to be aware of his leadership capabilities and refuse to appoint him head-Mexican should they once again play “Texans vs. Mexicans.” With dramatic irony at work, Butters simply raises his arms, thus manipulating the native Mexicans into a chant for their new idol, a chant that can be heard all the way to Colorado. And at the end of “City Sushi,” Butters is again the hero, having unmasked Janus and put an end to his Japanese brand of terror in South Park. During the course of the episode, Butters is literally pissed on by Janus, who was pretending to be his therapist, while he slept. It is as though Parker and Stone created a visual reminder of what had been happening to Butters throughout his tenure on the show, while, at the same time, pointing out the new irony present in his character, having become smarter, stronger, and more assertive. It will be interesting to see how many more times the creators of South Park use Butters as a purveyor of keen perception, while trumping Stan and Kyle’s level of cognizance and intelligence. To begin simply, Seinfeld is one of the best television shows of all time, regardless of genre. And it would be hard to argue against anyone who ranks it at the very top of such a list. The innumerable Seinfeldisms have been well-documented: “double-dipping,” “re-gifting,” “close-talker,” and so on and so forth. Multiple networks still constantly air reruns, and we’re grateful for that because it’s still better than anything else on (Can it be over 13 years since the last new episode?). This brand of success is attributed to the very plain fact that bazillions of people can relate to the content, just like any form of entertainment that garners such mass appeal, coinciding with overwhelming critical applause. I present to you a new way to quantify that show’s ability to attract such a dynamic audience with the use of New York Magazine’s “Approval Matrix.” I’d guess that anybody who picks up a hard copy of New York Magazine, and is familiar with its typical layout, will inevitably make a concerted effort to peruse the final page. The Approval Matrix is the staff’s way of creating a “deliberately oversimplified guide to who falls where on [their] taste hierarchies” and is divided into quadrants rating what is despicable vs. brilliant vs. highbrow vs. lowbrow in all that is that edition’s week in pop culture. Should a (drunken?) person view The Approval Matrix as a dartboard, Seinfeld, the series as a whole, scores a bull’s-eye. What all-time great sitcoms are in the discussion with Seinfeld? The Simpsons? With only winks at highbrow humor (Mayor Quimby appearances, Lisa’s storylines), The Simpsons relies most often on lowbrow/despicable humor. The Cosby Show was a huge hit in the 1980s. Focusing on an upper-middle class, highly-functional African American family, the series was very funny, even wry, and can only be considered highbrow and brilliant. All in the Family‘s (1968-79) reputation was founded upon its lowbrow, newly-shocking, and bigoted main character. I Love Lucy? The Honeymooners? It’s hard to compare those shows with anything as contemporary as Seinfeld and The Simpsons because, considering the era in which they aired, those creative energies could never have flowed towards anything as lowbrow as what has been looked to for laughs in recent years. Seinfeld contrasts with all of them, and any other, because the series possesses individual episodes that can be sprayed across the entire Approval Matrix. “The Chinese Restaurant” is considered one of their early classics, the quintessential episode “about nothing.” Highbrow and Brilliant. “The Finale,” when the gang are sentenced to prison for breaking the “Good Samaritan law,” pokes fun at legislation and the judicial system, but the inciting incident finds them guffawing at a fat guy. Highbrow and Despicable. “The Soup Nazi” must be in the Lowbrow hemisphere. With the term “Nazi” bouncing around like a mid-rally squash ball, one might be inclined to label that episode Despicable. But with Elaine enacting revenge upon the unsympathetic title character, a deviation to the right is required. Lowbrow and Brilliant. Few things ever witnessed are as Lowbrow and Despicable as “The Contest.” In so many ways it’s Brilliant, but, towards the episode’s conclusion, Marla points out that she doesn’t want “anything to do with” Elaine, Jerry, or their “perverted friends.” Few beings can recognize corruption like a virgin. “The Opera“- Highbrow/Brilliant; “The Junior Mint“- Highbrow/Despicable; “The Smelly Car“- Lowbrow/Brilliant; “The Bubble Boy“- Lowbrow/Despicable. (Keep it going in the comments section!) With all that said, Seinfeld, the complete series, is then none of these designations. It falls right in the middle of New York Magazine’s Approval Matrix, some unknown land of limitless advertising revenue possibilities.
2024-01-03T01:27:15.642919
https://example.com/article/6056
Groupe Holder Groupe Holder S.A.S. is French business group founded by Francis Holder in 1962. The group includes companies like Ladurée, Chateau Blanc, PANAPRO, Panétude-Pandéco, IFH (Institut de Formation Holder) and Paul. The head office is located in Marcq-en Barœul, in Greater Lille, in France. Brands Château Blanc was one of the first French bakeries that specializes in bread, cakes, viennoiserie and ready-to-eat products. They focus on using new technologies to produce goods in the style of traditional French artisans. Château Blanc divides their products into five categories: Grand Pain de France, Grande Viennoiserie de France, Grande Pâtisserie de France, Grand Traiteur de France and a line of breads that you can make at home. Paul was founded in 1889 and now has more than 449 bakery and pastry shops across four continents. The Holder family took over the bakery in 1953 and decided to keep the name while expanding the business. Paul endeavors to adhere to strict recipes to ensure that all their bread is fresh and has the same taste across the globe. Paul offers a wide range of baked goods and pastries as well as a number of restaurants. References External links Homepage Category:Holding companies of France Category:Holding companies established in 1980 Category:Bakeries of France
2023-08-20T01:27:15.642919
https://example.com/article/2591
Q: How to set up a start menu for logistics program in C? So I'm starting my final project for school and i have one small question. It is a logistics program that should be applied to a warehouse and run stock,deliveries,orders etc. The user enters a command and then the variables of such command afterwards. For example, the command 'a' should add a new product to the warehouse. The input for this would be a description:price:weight:qt. My idea for this would be having a start menu that only reads the command a and then redirects to a unique function that only takes care of the read command. Im kinda new to C so I would like to know the best way to implement this. Thanks for any help possible! A: Use a switch statement. char c = myInput[0]; switch(c) { case 'a' : functionThatImplementsA(); break; case 'b' : functionThatImplementsB(); break; }
2023-11-22T01:27:15.642919
https://example.com/article/5200
Franz Syberg Franz Adolf Syberg (5 July 1904 - 11 December 1955) was a Danish composer. Biography He was born in Kerteminde, Funen, to the painters Anna and Fritz Syberg. He moved to Leipzig in 1922 where he studied composition and music theory at the Leipzig Conservatory with Sigfrid Karg-Elert and Werner Hübschmann. He left for Copenhagen in 1928, where he studied organ with Peter Thomsen. He was appointed organist at Kerteminde in 1932, where he remained for the rest of his life. His 1931 Quintet for flute, clarinet and string trio was chosen in 1938 to be performed at the International Society for Contemporary Music in London and the Nordic Music Days in Copenhagen. The years following this saw the composition of his most mature works, ending in 1942, when he stopped composing. His work was largely forgotten until 1990, when seven of his compositions were performed at the Musikhøst festival in Odense. Much of his work has now been published and performed. His music has much in common with German neo-classicism similar to Hindemith, with much counterpoint and dense linearity, resulting in some harsh and dissonant harmonies. His more mature works show the influence of Carl Nielsen. Compositions Manuscripts are in the Kongelige Bibliotek, Copenhagen Publisher: Kontrapunkt Stage Uffe hin Spage (marionette play, S. Clausen), 1929 Leonce og Lena (G. Büchner), 1931 Ett drömspel (A. Strindberg), 1941–1942 Orchestral Music for oboe and string orchestra, 1933 Sinfonietta, 1934–1935 Adagio for string orchestra, 1938 Symphony, 1939 Chamber String Quartet, 1930 Quintet for flute, clarinet, and string trio, 1931 Concertino for oboe and string quintet, 1932 String Trio, 1933 Quartet for oboe and string trio, 1933 Wind Quintet, 1940 Octet for wind instruments, 1941 Organ Chaconne, 1933 Prelude, Intermezzo, and Fugato, 1934 Further reading N.V. Bentzon: Focus på Syberg, in Dansk musiktidsskrift LVI (1981–1982) B. Krarup: Franz Syberg: en outsider i dansk mellemkrigsmusik, Dansk musiktidsskrift LXV (1990–1991) Sources Bertel Krarup: 'Syberg, Franz Adolf', Grove Music Online ed. L. Macy (Accessed [Day Month Year of access]), <http://www.grovemusic.com> Category:1904 births Category:1955 deaths Category:20th-century classical composers Category:Composers for pipe organ Category:Danish classical composers Category:Danish male classical composers Category:People from Kerteminde Category:University of Music and Theatre Leipzig alumni Category:20th-century male musicians
2023-09-17T01:27:15.642919
https://example.com/article/6044
edward_Q1 burns_Q1 tackles_Q1 his_Q1 third_Q1 picture_Q1 with_Q1 no_Q1 looking_Q1 back_Q1 ,_Q1 and_Q1 like_Q1 his_Q1 previous_Q1 two_Q1 ,_Q1 it_Q1 is_Q1 a_Q1 working-class_Q1 relationship_Q1 picture_Q1 ._Q1 however_Q1 ,_Q1 unlike_Q1 his_Q1 previous_Q1 work_Q1 ,_Q1 the_Q1 film_Q1 dwells_Q1 on_Q1 a_Q1 more_Q1 personal_Q1 story_Q1 ,_Q1 and_Q1 with_Q1 a_Q1 female_Q1 protagonist_Q1 ._Q1 and_Q1 in_Q1 no_Q1 looking_Q1 back_Q1 ,_Q1 he_Q1 stumbles_Q1 ,_Q1 making_Q1 a_Q1 slow_Q1 ,_Q1 boring_Q1 film_Q1 without_Q1 the_Q1 spark_Q1 that_Q1 enlivened_Q1 his_Q1 previous_Q1 work_Q1 ._Q1 claudia_Q1 (_Q1 lauren_Q1 holly_Q1 )_Q1 is_Q1 a_Q1 small_Q1 town_Q1 waitress_Q1 who_Q1 is_Q1 feeling_Q1 stifled_Q1 by_Q1 her_Q1 life_Q1 ._Q1 she's_Q1 at_Q1 a_Q1 turning_Q1 point_Q1 in_Q1 her_Q1 life_Q1 ,_Q1 and_Q1 feels_Q1 as_Q1 if_Q1 she's_Q1 going_Q1 nowhere_Q1 ._Q1 her_Q1 boyfriend_Q1 ,_Q1 michael_Q1 (_Q1 jon_Q1 bon_Q1 jovi_Q1 )_Q1 ,_Q1 is_Q1 broke_Q1 and_Q1 in_Q23 a_Q23 dead_Q23 end_Q23 job_Q23 ._Q23 if_Q23 she_Q23 were_Q23 to_Q23 marry_Q23 him_Q23 ,_Q23 she'd_Q23 never_Q23 get_Q23 a_Q23 chance_Q23 to_Q23 escape_Q23 this_Q23 town_Q23 ._Q23 enter_Q23 charlie_Q23 (_Q23 edward_Q23 burns_Q23 )_Q23 ,_Q23 claudia's_Q23 old_Q23 flame_Q23 ._Q23 he_Q23 skipped_Q23 town_Q23 several_Q23 years_Q23 before_Q23 ,_Q23 without_Q23 any_Q23 explanations_Q23 ._Q23 ._Q23 ._Q23 even_Q23 for_Q23 claudia_Q23 ._Q23 he_Q23 has_Q23 come_Q23 back_Q23 to_Q23 town_Q23 to_Q23 see_Q23 her_Q23 ,_Q23 and_Q23 suddenly_Q23 she_Q23 is_Q23 torn_Q23 ._Q23 should_Q23 she_Q23 stay_Q23 with_Q23 stable_Q23 michael_Q23 ,_Q23 and_Q23 never_Q23 escape_Q23 her_Q23 hometown_Q23 ._Q23 ._Q23 ._Q23 or_Q23 should_Q23 she_Q23 ignore_Q23 her_Q23 instincts_Q23 and_Q23 fall_Q23 for_Q23 charlie_Q23 again_Q23 ._Q23 part_Q23 of_Q23 the_Q23 answer_Q23 lies_Q23 in_Q23 the_Q23 character_Q23 of_Q23 her_Q23 mother_Q23 (_Q23 blythe_Q23 danner_Q23 )_Q23 ,_Q23 who_Q23 fell_Q23 for_Q23 the_Q23 wrong_Q23 man_Q23 ._Q23 ._Q23 ._Q23 and_Q23 has_Q23 spent_Q23 her_Q23 life_Q23 pining_Q23 for_Q23 claudia's_Q23 father_Q23 to_Q23 return_Q23 ._Q23 now_Q23 it_Q23 seems_Q23 that_Q23 claudia_Q23 is_Q23 about_Q23 to_Q23 make_Q23 the_Q23 same_Q23 mistakes_Q23 ._Q23 at_Q23 only_Q23 a_Q23 little_Q23 past_Q23 ninety_Q23 minutes_Q23 ,_Q23 no_Q23 looking_Q23 back_Q23 is_Q23 rather_Q23 short_Q23 for_Q23 its_Q23 genre_Q23 ._Q23 unfortunately_Q23 ,_Q23 it_Q23 seems_Q23 much_Q23 much_Q23 longer_Q23 ._Q23 the_Q23 storyline_Q23 is_Q23 simple_Q23 and_Q23 uninspired_Q23 ,_Q23 and_Q23 there's_Q23 a_Q23 lack_Q23 of_Q23 energy_Q23 to_Q23 the_Q23 whole_Q23 proceedings_Q23 ,_Q23 which_Q23 makes_Q23 the_Q23 entire_Q23 drama_Q23 rather_Q23 tedious_Q23 ._Q23 edward_Q23 burns_Q23 makes_Q23 a_Q23 misstep_Q23 by_Q23 casting_Q23 himself_Q23 in_Q23 the_Q23 crucial_Q23 role_Q23 as_Q23 the_Q23 egomaniacal_Q23 old_Q23 flame_Q23 ._Q23 there's_Q23 no_Q23 one_Q23 to_Q23 restrain_Q23 his_Q23 ego_Q23 ,_Q23 which_Q23 reigns_Q23 unchecked_Q23 ._Q23 he_Q23 walks_Q23 into_Q23 the_Q23 room_Q23 and_Q23 lauren_Q23 holly_Q23 swoons_Q23 ._Q23 ._Q23 ._Q4 yeah_Q4 ,_Q4 right_Q4 ._Q4 lauren_Q4 holly_Q4 does_Q4 what_Q4 she_Q4 can_Q4 with_Q4 her_Q4 central_Q4 character_Q4 ._Q4 but_Q4 we_Q4 never_Q4 understand_Q4 why_Q4 her_Q4 character_Q4 makes_Q4 such_Q4 pathetically_Q4 bad_Q4 decisions_Q4 ._Q4 ._Q4 ._Q4 and_Q4 we_Q4 never_Q4 really_Q4 care_Q4 ._Q4 bon_Q4 jovi_Q4 is_Q4 the_Q4 only_Q4 sympathetic_Q4 character_Q4 in_Q4 the_Q4 whole_Q4 movie_Q4 ._Q4 his_Q4 acting_Q4 talents_Q4 are_Q4 much_Q4 greater_Q4 than_Q4 they_Q4 might_Q4 seem_Q4 ,_Q4 but_Q4 he_Q4 is_Q4 given_Q4 a_Q4 mostly_Q4 bland_Q4 and_Q4 ineffective_Q4 role_Q4 to_Q4 work_Q4 with_Q4 ._Q4 there's_Q4 not_Q4 much_Q4 to_Q4 recommend_Q4 in_Q4 no_Q4 looking_Q4 back_Q4 ._Q4 it's_Q4 not_Q4 that_Q4 the_Q4 film_Q4 is_Q4 bad_Q4 ._Q4 ._Q4 ._Q4 it's_Q4 simply_Q4 boring_Q4 ._Q4 there's_Q4 no_Q4 zest_Q4 in_Q4 any_Q4 aspect_Q4 of_Q4 the_Q4 film_Q4 ,_Q4 and_Q4 no_Q4 reason_Q4 to_Q4 spend_Q4 ninety_Q4 minutes_Q4 watching_Q4 it_Q4 ._Q4 _Q4
2024-01-24T01:27:15.642919
https://example.com/article/7031
Occurrence and characteristics of PCDD/Fs formed from Chlorobenzenes production in China. China had a large production capacity of chlorobenzenes. An extensive investigation was conducted to understand the occurrence and characteristics of PCDD/Fs from four chlorobenzene production plants. The concentrations of PCDD/Fs in mono-CB production and in a new di-CB production routine were revealed. Concentrations of PCDD/Fs in residues, byproducts, products and wastewater varied between 8.4*103-4.0*106 ng TEQ/kg, 1.5-5.0*104 ng TEQ/kg, ND∼0.12 ng TEQ/kg and 6.0*104-9.1*104 pg TEQ/L, respectively. OCDF, 2,3,4,7,8-PeCDF, 1,2,3,4,7,8-HxCDF, and 2,3,7,8-TeCDF were the most abundant congeners of the 17 2,3,7,8-substituted PCDD/Fs. In most samples, PCDFs contributed more than 99% of the total TEQs of PCDD/Fs, in which 2,3,4,7,8-PeCDF was the dominating contributor. It is inferred PCDFs were mainly formed in the chlorination reactions. The emission factors were suggested and the amount of PCDD/Fs formed in CB production was estimated to be 450 g TEQ in 2012. Residue, byproduct and wastewater were potentially the main pathways of PCDD/Fs to the environmental releases.
2023-11-15T01:27:15.642919
https://example.com/article/4362
Cargill commits to eliminate deforestation from its supply chain Cargill intends to educate small and large-scale farmers on sustainable agriculture. Photo courtesy of Cargill. MINNEAPOLIS, MINNESOTA, U.S. — In an effort to eliminate deforestation from its supply chain Cargill presented its report, Cargill Reports on Forests, about the company’s current progress and goals. The first report covers on-the-ground actions within six priority supply chains and global collaborations to advance sustainable agriculture. Cargill worked with numerous global partners to engage more than 148,000 farmers and established a baseline for measuring tree cover loss by mapping the sourcing areas of nearly 2,000 locations across 14 countries. In the lead up to the 2017 World Economic Forum's annual meeting in Davos, Switzerland, Cargill said it intends for the report to spark broader discussion of the issues driving deforestation and the policies and practices that can prevent it. David MacLennan, chief executive officer and chairman of Cargill. “Ending deforestation is critical to curb climate change,” said David MacLennan, chief executive officer (CEO) and chairman of Cargill. “Today, we are at an important crossroads as we work to nourish the world and protect the planet. Sustainable agriculture must be a part of the solution.” The following are Cargill’s progress highlights: Creating and enacting action plans to protect forests in priority supply chains: palm oil globally, soy in Brazil and Paraguay, cocoa globally, cotton and maize in Zambia, and fiber-based packaging. In support of these action plans, Cargill issued a new Policy on Sustainable Fiber-based Packaging. Developing and implementing programs and trainings for more than 148,000 farmers and suppliers to promote sustainable land use, including 15,000 small- and large-scale soy farmers in Brazil, 21,000 palm oil smallholder farmers in Indonesia, 1,000 soy farmers in Paraguay and 90,000 cocoa farmers and cooperatives in West Africa. Creating and enacting action plans to protect forests in priority supply chains: palm oil globally, soy in Brazil and Paraguay, cocoa globally, cotton and maize in Zambia, and fiber-based packaging. In support of these action plans, Cargill issued a new Policy on Sustainable Fiber-based Packaging. “We realize the private sector can lead in making agriculture and supply chains more sustainable,” said Ruth Kimmelshue, Cargill global leader of business operations and supply chain. “But we can’t do it alone. We want to work with customers, governments, NGOs and others to apply scalable approaches and deploy technology and practices that will give farmers the tools they need to create a more food-secure world.”
2024-02-29T01:27:15.642919
https://example.com/article/5945
KEAN 105 Today's Best Country » kayne lawtonhttp://keanradio.com Tue, 03 Mar 2015 22:44:10 +0000en-UShourly1http://wordpress.org/?v=3.4.2http://keanradio.com/files/2011/11/logo.pngKEAN 105 Today's Best Countryhttp://keanradio.com Kayne Lawton Pulls the Rugby Out From Under Us — Hunk of the Dayhttp://keanradio.com/kayne-lawton-hunk-of-the-day/ http://keanradio.com/kayne-lawton-hunk-of-the-day/#commentsTue, 20 Nov 2012 21:31:59 +0000Amy Sciarrettohttp://tsminteractive.com/?p=150465Continue reading…]]>Aussie rugby player Kayne Lawton looks like he was sculpted from 14-karat gold, doesn't he? The 23-year-old has us DVR-ing his next match from Down Under. And to be clear: we have never cared about rugby till now.
2023-10-24T01:27:15.642919
https://example.com/article/2611
1. Field of Utility Model The present utility model relates to a packing box for headphones, and more particularly to a packing box that holds headphones and displays acoustic characteristics of the headphones to allow buyers to choose conveniently headphones they need. 2. Description of the Related Art Music that has good fidelity is preferred by listeners. Therefore, headphones having a high signal to noise ratio (SNR) are important and are virtually required. Additionally, various styles of music such as jazz, rock-and-roll, classical music and pop music emphasize different parts of the audible spectrum. For example, rock-and-roll emphasizes low-pitch, and classical music emphasizes high-pitch. Accordingly, headphones must have appropriate frequency responses to reproduce different styles of music so people using the headphones will enjoy undistorted, high sound quality music. Therefore, people should choose headphones appropriate to the music to which they like to listen. Generally, a set of headphones is packed in a plastic bag or a conventional packing box. The conventional packing box comprises a cardboard box, a headphone-shaped plastic shell liner and an instruction leaflet and allows the headphones and the instruction leaflet to be mounted between the cardboard box and the plastic shell liner. Even though the instruction leaflet provides response characteristics and other information about the headphones, buyers cannot discern the characteristics of the headphones from the appearance of the packing box. Therefore, the buyers may waste money by inadvertently buying inappropriate headphones. To overcome the shortcomings, the present utility model provides a packing box for earphones to mitigate or obviate the aforementioned.
2024-05-22T01:27:15.642919
https://example.com/article/4531
TUMI Classic Garment Bag Style: TM22137D2 Carry 1-2 garments with you on board in this convenient, compact design. Features include: curtain with zip pockets, exterior U-zip pocket, ticket pocket and removable shoulder strap. Note: This item does not include a hanger Share: BLACK $513 Quantity: From Our Clients "If you like...men's clothing but don't like the hassle of shopping..., I highly recommend (Tom James)."
2024-03-22T01:27:15.642919
https://example.com/article/3833
Laparoscopic adjustable gastric band: first experience in Slovakia. Until recently, surgery for obesity was not done in Slovakia. After preparation in workshops, the authors began to perform laparoscopic adjustable gastric banding. Their laparoscopic work is based on a 7-year experience in laparoscopy. From December 1997 to May 1998, 14 procedures were done. The laparoscopic adjustable gastric band was used in all procedures. The group consisted of 8 women and 6 men. Their ages ranged from 30 to 53 years (mean 43), the body mass index was 37-56 (average 46.2), the hospital stay was 3-7 days (4.8), and the operating time was 75-285 minutes (145.3). A five-trocar technique was used. Weight loss in the first month ranged from 9 to 15 kg. In follow-up, the weight loss averaged 3-4 kg monthly. Up to the time of writing, no band had been adjusted. Intraoperative hemorrhage occurred in two patients. No conversion was done. One patient underwent reoperation and removal of the band because of obstruction of the stoma caused by profuse vomiting after enormous intake of food. Despite a small early series, the procedure seems to be safe and well tolerated by patients, with sufficient early weight loss.
2024-04-18T01:27:15.642919
https://example.com/article/9929
North Carolina Law Provides Limited Immunity to Certain Businesses Against COVID-19 Contraction Claims Updated May 20,2020 – AlertsBy Jeffrey P. MacHarg Share This Page [UPDATED MAY 20, 2020] While it is no silver bullet, North Carolina’s new pandemic aid legislation (Session Law 2020-3) includes helpful liability limitations for certain businesses faced with claims by employees, customers and users of personal protective equipment (PPE) that the business caused them to contract COVID-19. Under this new law, “essential businesses” and “emergency response entities” (which include manufacturers of PPE and ventilators, for example) are temporarily immune from civil liability to customers, employees or users for these claims unless the business was grossly negligent, reckless or intentionally caused the harm. This immunity aims to ensure that key businesses continue to provide essential goods and services to North Carolinians during the pandemic without the specter of COVID contraction claims. This strong, but limited immunity should curtail, but will not eliminate COVID-19 contraction claims. While it provides a defense, it does not prohibit would-be plaintiffs from asserting such claims in the first place. This means businesses still need to take great care to follow the (evolving) guidance on workplace safety and document their efforts, which will best position them to avoid and defend against these claims. The following is a more detailed discussion of this limited immunity. Who is Entitled to Civil Immunity? To be entitled to civil immunity you must be an “essential business” providing goods and services in North Carolina or an “emergency response entity.” “Essential businesses” are businesses, not-for-profit organizations, educational institutions and governmental entities identified in North Carolina’s “Stay At Home Order” (Executive Order 121). The list of essential businesses is long. It spans numerous fields and industries including health care, critical infrastructure, law enforcement, government operations, grocery and hardware stores, pharmacies, banking, eateries for takeout and even lawyers, among many others. Notably, this list just got longer. Gov. Roy Cooper’s May 20, 2020 Executive Order 141, which allows additional businesses to open and operate, expands immunity to restaurants. As long as the restaurants comply with the occupancy, distancing, signage, sanitation, screening and other requirements, restaurants will also be immune from COVID contraction claims. If you are one of these essential businesses and you are operating in North Carolina or are a restaurant complying with the new operational requirements, you are entitled to this limited immunity. “Emergency response entities” are businesses, not-for-profit organizations, educational institutions and governmental entities that manufacture, produce or distribute personal protective equipment, testing equipment or ventilators, or process COVID-19 testing results. Unlike essential businesses, “emergency response entities” are not limited to those operating in North Carolina. Thus, foreign companies providing this critical equipment and these services to North Carolinians would be protected. What is the Scope of Immunity? The immunity is not absolute. First, the immunity is for civil liability only. It does not, for example, prevent or preclude employees from pursuing remedies under North Carolina’s Workers’ Compensation Act. Nor would it prevent government, regulatory or criminal actions. Second, the immunity is only for COVID contraction claims, i.e., claimsby an employee, customer or user who alleges the business or entity caused them to contract COVID-19. Third, there is no immunity for gross negligence, recklessness or intentional infliction of harm. But if the business simply made a mistake, i.e., was negligent, it should be immune from civil liability. Finally, the immunity does not prevent injured parties from asserting claims in the first place. And to get around this immunity, would-be plaintiffs almost certainly will include allegations of gross negligence, recklessness and intentional wrongdoing in their complaints. This means that despite the immunity, businesses should try both to avoid claims and prepare to defend them. Is the Immunity Limited to a Particular Time Period? Yes. This immunity applies only to claims filed on or after March 27, 2020, and it covers acts or omissions on or after March 27 until North Carolina’s emergency declaration is rescinded or expires. As of this writing, we are aware of no immediate plans to rescind North Carolina’s emergency declaration, so this immunity would apply to acts occurring now and likely through a full reopening of the economy. What Should Businesses do Now? The immunity provided by this statute does not relieve an employer or PPE manufacturer from exercising due care. Now more than ever, businesses should take reasonable steps to understand and follow federal, state and local directives and guidance on workplace and product safety. This helps ensure that the workplace and products are as safe as they reasonably can be, mitigating the risk of contraction. And if contraction occurs and a claim follows, compliance with government guidelines will put the business in a better position to defend the claim, which is something the business will have to do despite this immunity. Resources are available to help businesses. At the federal level, the Occupational Safety and Health Administration (OSHA) has published guidance for reducing workplace exposure to COVID-19. The Centers for Disease Control (CDC) provides strategies on how employees who had COVID-19 may return to work, and the CDC’s Reopening Guidance explains what to do and how to clean as you prepare for your business to reopen or expand operations. At the state level, North Carolina’s Department of Health and Human Services has a comprehensive resource page with numerous links and guidance for North Carolina businesses. Counties are also providing guidance. Mecklenburg County, for example, has aggregated links to state and federal resources, as well as certain county-specific information such as guidance on use of face coverings. But compliance with these myriad regulations and best practices is not enough. Businesses also need to document their compliance and safety efforts. This would include, for example, updating workplace policy manuals and documenting training on topics such as hygiene, distancing and other safety requirements. This documentation will be very helpful if a business later needs to defend against a COVID contraction claim. In addition, Fox Rothschild continues to produce alerts and resources to help businesses work through these challenges, particularly as many businesses are starting to reopen. Key Takeaways As North Carolina now enters its phased approach to lifting restrictions to slow the spread of COVID-19, more businesses surely will expand commercial activities. While this new statute provides some protection and immunity from potential COVID contraction claims, it does not relieve businesses from their ongoing obligation to provide employees and customers a safe working environment, safe products and safe services. Businesses will be well-served to track and implement applicable guidance and to document these efforts.
2024-03-20T01:27:15.642919
https://example.com/article/3130
Aquarius Zodiac Earring Set Are you friendly, honest and loyal? You must be an Aquarius! Show off your zodiac sign with these post-insertion earrings. The 3 piece set includes a pair of the Aquarius symbol, a pair of water bearers and a pair of Aquarius constellation earrings.
2023-09-22T01:27:15.642919
https://example.com/article/1758
83 SHARES Share Tweet It’s early, but so far it’s fair to say that Kyle Walker isn’t having the best of seasons for Spurs. This is partly due to the unrealistic expectations that some fans and the media have, whilst also down to him making errors that any 22-year old defender growing up in the spotlight would. Its just that his errors are highlighted due to the fact he plays for a top five club and has already been called up for England. It’s almost like the media are treating him in the same vein as a ten-year veteran, rather than a player who had a good first full season as a regular right back. Last year Kyle Walker announced himself with the game-winning goal against Arsenal, whilst also helping to keep 14 clean sheets in his 37 Premier League appearances. Towards the end of the season he even played through the pain with a broken toe with a Champions League place on the line. One thing that can’t be questioned is that Kyle Walker loves the shirt. With expectation comes the burden of pressure and Kyle Walker was relishing a new chapter under Andre Villas-Boas. “I won the PFA young player [2012 award] but that’s driving me to show that I can win it again this season. I’m very hard on myself and I don’t settle for second best. I want to be the best player I can be and if that means staying behind and doing extra training, I’m prepared to do that.” Maybe being his own biggest critic also has a lot to do with his decreasing confidence this season and that has led to some sub-par performances. It’s not all bad and let’s not forget he is still only 22, but for me there are four areas which have caused his struggles this term. 1. Kyle Walker vs indirect opponents Kyle Walker has had trouble this season when not defending against a direct opponent. In the match with Man Utd, he was up against Ryan Giggs in the first half and did well to keep him quiet. In the second he had no direct opponent, as Giggs was withdrawn and Shnji Kagawa played narrowly on the left side of a diamond midfield. The Japanese international kept coming infield and was consequently left open for Man Utd’s second goal at Old Trafford. Kyle Walker was worrying about Danny Welback out wide when he should have been concerned with Kagawa in the centre. Against Chelsea on the weekend, Eden Hazard started on the left, but the interchangeable nature of the Belgian with Oscar and Juan Mata meant his opponent changed all afternoon. Although Mata’s second goal wasn’t directly his fault, Walker was left with a decision to make of whether to stay wide with Oscar or track Mata. At the point of his decision, there was a massive space between him and his centre backs with him being dragged so wide. William Gallas should have been more alive to the run in behind by the Spaniard and Jake Livermore shouldn’t have just let him run by him. Walker also had a decision to make once Mata by-passed Livermore. As it wasn’t his direct opponent which was Oscar at the time, he stayed wide and Spurs conceded a goal through the inside right channel similar to Kagawa’s. 2. Awareness The goals conceded above can also be linked to awareness and what is going on around you on the football pitch. Quite often the speed and pace of Kyle Walker has got him out of trouble, but this season we’ve seen a few momentary lapses in concentration. QPR’s goal in the 2-1 victory at the Lane was an example of this, as Walker was slow to come out from a corner, playing Bobby Zamora onside. Reading’s consolation in the 3-1 win at the Madejski was also an example of what can happen when you are not alive to the bigger picture. Kyle Walker gets caught looking in on Adam LeFondre and doesn’t realise that Hal Robson-Kanu has streaked past him to get to the back post. 3. Play the game not the man On Saturday, Chelsea’s fourth goal in which Kyle Walker tried to do some kind of back heel whilst deep in our half was the result of Juan Mata getting in his head. The pair had exchanged several words during the match and it came to a head just a few minutes before Kyle Walker tried his audacious piece of skill on the sideline. Walker was obviously irritated with Mata, as he spanked the ball out for a throw-in straight in to the Spaniard who was on the floor out of play. Mata to his credit didn’t roll around on the turf trying to get Walker booked, but got up and the two exchanged pleasantries once more. Minutes later Kyle Walker was isolated one-on-one with Mata out wide after William Gallas passed the ball to him with Chelsea pressing. He didn’t want to go long and rather than go back to Brad Friedel, which would have been the best option, he tried to skill Juan Mata. The rest, as we know didn’t go too well and any chance of a comeback was gone. No one knows what was said between the two, but for me, the Spaniard definitely got inside Walker’s head and caused his ill-advised piece of skill. 4. William Gallas Don’t discount William Gallas in having an effect in the play of Kyle Walker too. The Frenchman plays on Walker’s side of the back four and Kyle may be having to overplay to compensate for Gallas’ lack of mobility. The Frenchman has looked every bit 35 this season, being slower over the ground and not giving himself any extra space to compensate for his lack of movement. This can be unsettling for a full back when your centre half isn’t as mobile and can be late on defensive rotations. Kyle Walker positives Despite the fact that Kyle Walker may be having a sub-par season this term, there are still plenty of positives. He has improved his tackling, successfully winning 75% of challenges so far this term, as opposed to 69% last season. As with Andre Villas-Boas and his passion for pressing, this will cause more interceptions and Kyle Walker has also improved in this defensive department. Last season he was making an interception every 51 minutes on the field. This season he is intercepting the ball every 47 minutes. Kyle Walker has also improved his game going forward this season. Whilst not receiving as many passes in the final third, he has improved in his passing, successful crosses and shooting. Last season, Kyle Walker was receiving a pass every 7.8 minutes in the final third, this campaign he is receiving a pass every 8.6 minutes. Whilst this is down, his cross completion is up from 17% to a much healthier 22% and his shooting accuracy has also increased from 8% to 22%. His overall passing accuracy is also up from 83% to 84%. As a result, after creating a goal scoring chance every 100 minutes on pitch last season, this term he is generating an opportunity every 58 minutes. Why we shouldn’t get down on Kyle Walker A year on from his first full season as our regular right back, Kyle Walker seems to be struggling with second season syndrome. He has had problems when he doesn’t have a direct opponent to mark and also with his awareness of where the danger is coming from when the ball is in central channels. This can cause him to not be as narrow as he should, leaving space between himself and his centre backs which the opposition has exploited. We must remember that he is only 22-years old and going through the growing pains of any young defender. With the success he’s had last season and playing for a top five club, his every move is naturally going to be highlighted by the media. This doesn’t make Kyle Walker a bad player, just someone who is going through a bad patch.
2024-03-21T01:27:15.642919
https://example.com/article/5119
"Start(bb0[0])" "Mid(bb0[0])" "Mid(bb0[0])" "Start(bb0[1])" "Start(bb0[1])" "Mid(bb0[1])" "Mid(bb0[1])" "Start(bb1[0])" "Start(bb1[0])" "Mid(bb1[0])"
2024-03-12T01:27:15.642919
https://example.com/article/2242
scissors wrote:You could of at least said the fight starts around 52 seconds in to the video so I didn't have to waste 52 seconds of my life. Seriously dude? Or maybe you could have skipped around and found where it started yourself. Wow. "Let me say one more thing about Kobe. He will be the best player in the history of the game. If he keeps doing what he's doing, there is no stopping him. He is that good." - Shaquille O'Neal in his autobiography, "Shaq Talks Back" Nervous energy, close out game, Kobe has the extreme [Swearing is not permitted at Clublakers. You must edit this post prior to submitting.], Bynum is talking all kinds of crazy stuff, what do you expect?
2023-08-29T01:27:15.642919
https://example.com/article/8727
Closing date: Thursday, 14 December 2017 UNOPS supports the successful implementation of its partners' peacebuilding, humanitarian and development projects around the world. Our mission is to serve people in need by expanding the ability of the United Nations, governments and other partners to manage projects, infrastructure and procurement in a sustainable and efficient manner. Working in some... Read more Join Dreamit Ventures and AgTech X for networking and discussion with the visionaries who are reimagining urban rooftops for a more sustainable future. We’re bringing together builders, urban farmers, and policy experts to explore the state of green roof technology. Advances in green roof technology has proven to lower energy costs and to reduce carbon emissions. Cities around the world are... Read more Making India's cities free of slums has been a promise successive governments have made. The UPA had launched the Rajiv Awas Yojana in 2009, vowing to get rid of the urban ‘eyesores’ in five years. The NDA launched the Pradhan Mantri Awas Yojana in 2015, subsuming the Rajiv Awas Yojana. The PMAY’s avowed mission is Housing for All. Its aim is to get rid of all slums by 2022 by providing houses to... Read more The ‘Efficient Urban LIght Vehicle’ (EU-LIVE) European consortium brings together 12 partners from six countries, with Groupe PSA being the sole carmaker. Based on an architecture similar to a tricycle, the electrified light vehicle is adapted for urban and peri-urban trips with a zero-emission mode for city driving. This urban mobility project is funded by the European Commission (6.7 million... Read more $1 billion sales in two minutes. More than 250,000 purchases every second. Singles’ Day, China’s annual retailing extravaganza, absolutely crushes Black Friday: E-commerce giant Alibaba raked in $17.8 billion in gross sales during last year’s event, more than double the combined total of $6.8 billion in sales during the United States’ 2016 holiday shopping kick-off. The shopping spree lasts only... Read more Improved human well-being is one of the modern era’s greatest triumphs. The age of plenty has also led to an unexpected global health crisis: two billion people are either overweight or obese. Developed countries have been especially susceptible to unhealthy weight gain, a trend that could be considered the price of abundance. However, developing countries are now facing a similar crisis. Obesity... Read more For the first time in history, more people live in cities than in rural areas. Although cities hold the promise of a better future, the reality is that many cities cannot live up to expectations. Too often, cities lack the resources to provide even the most basic services to their inhabitants, and cities all over the world fail to protect their people effectively against the onslaught of natural... Read more South Africa faces two substantial problems: high unemployment and inadequate housing. These problems are intimately related. The World Bank and UN have both researched the effects of urbanisation and the conclusion is clear: cities combat poverty. China’s economic miracle, lifting millions from poverty in the last 20 years, was powered by transforming an agrarian nation into a modern, urban... Read more Bhubaneswar: The Housing and Urban Development Department of the State Government and Bhubaneswar Development Authority (BDA) in collaboration with German funding agency German Corporation for International Cooperation or GIZ, will prepare a city-wide, holistic master plan for non-motorised transport (NMT) focussing on low-carbon urban transport. Based on this eco-friendly master plan, measures... Read more City planning operates on decades-long cycles, while infrastructure is typically built out using forecasts that extend current trends. If self-driving vehicles are poised to deliver the revolution in urban transportation that Silicon Valley has been promising, how should urban infrastructure accommodate them? With less parking spots needed, how can designers effectively reclaim this urban space... Read more
2024-01-10T01:27:15.642919
https://example.com/article/4575
Donald Trump’s obscene, sexist and racist outtakes from The Apprentice have become the stuff of legend. The tapes exist, and some outsiders claim to have seen them, but everyone involved has refused to officially make them public. Now, a sexual assault case filed last year by a former Apprentice contestant has finally resulted in a subpoena being served to Trump and his campaign. That subpoena appears to cover the tapes in question.Summer Zervos and her attorney Gloria Allred filed the suit against Donald Trump after the Access Hollywood tape surfaced of Trump bragging about sexually assaulting women. Zervos is seeking to forcibly expose all available evidence of Trump’s longtime pattern of sexual harassment and sexual assault. According to reporting from BuzzFeed and NBC News (link), the subpoena has in fact been served. That means, by legal definition, that a judge signed off on the subpoena after having ruled that the evidence is relevant. Trump’s people are still trying a last ditch motion to dismiss, in the hope of getting the subpoena thrown out. But that seems unlikely, considering that a judge decided the subpoena was worthy to begin with. Because Zervos has stated that her goal is to publicly expose Trump, rather than getting a monetary judgment against him, the logical outcome of this is that the evidence in question will be made public. Based on the manner in which the Apprentice tapes have been described by those who claim to have seen them, and by those who claim to have witnessed the tapings in person, these tapes represent Exhibit A in Donald Trump’s pattern of sexual harassment and sexual assault so they fall within the scope of the subpoena that has been served to Trump. It’s another story as to whether the Apprentice tapes documenting Trump’s racist remarks would also have to be turned over. When Donald Trump began holding campaign rallies this year which were officially for his 2020 reelection campaign, observers couldn’t figure out what he was really up to until it was discovered that at least part of the money being raised was actually being funneled to pay Donald Trump Jr’s legal bills in the Russia scandal. Now it turns out those supposed “reelection” funds may also be going to Trump’s personal secretary.Legal activist group Citizens for Ethics (CREW) has been routinely suing Donald Trump and related entities in court in order to expose his various financial schemes and scams, and is backed by legal heavyweights including Laurence Tribe and Richard Painter. CREW has managed to piece together that the same attorney is representing both Donald Trump Jr and and Donald Trump’s personal secretary Rhona Graff in the Russia scandal (link). This means that the “reelection” money being funneled to that attorney may for the purpose of covering the secretary’s legal bills as well. This would have major practical implications on the scandal. If Donald Trump is scheming to cover the legal bills for Graff, then it strongly suggests that he’s trying to motivate her not to testify about what she’s witnessed. Depending on legal interpretation, this could be considered an attempt at obstructing justice. It would be one thing for Trump to pay his son’s legal bills; that’s a family matter. But paying his secretary’s legal bills, when she’s potentially a star witness against him in a criminal case, is another matter. Even if it can’t be proven that Donald Trump is trying to buy his secretary’s silence in bad faith, this could signal to Special Counsel Robert Mueller where he should be digging next. There would have been communications between Trump, Graff, and/or the attorney regarding the arrangement and those could be subpoenaed. Either way, if Trump’s “2020 reelection” funds are indeed going to his personal secretary, that’s a scandal in and of itself. Trump’s Presidency Is Bad for Business His OwnNBCNews.com Donald Trump’s presidency is bad for business his own. Unless his business is getting presidential business. From golf courses to hotels to fashion, the sprawling brands of the president and his family have been taking hits since Election Day, based …and more » The Danger of President PenceThe New Yorker After Trump threatened to totally destroy North Korea, Gail Collins, the Times columnist, praised Vice-President Mike Pence as someone who at least seems less likely to get the planet blown up. This summer, an opinion column by Dana Milbank, of the …and more » When Donald Trump began holding campaign rallies this year which were officially for his 2020 reelection campaign, observers couldn’t figure out what he was really up to until it was discovered that at least part of the money being raised was actually being funneled to pay Donald Trump Jr’s legal bills in the Russia scandal. Now it turns out those supposed “reelection” funds may also be going to Trump’s personal secretary.Legal activist group Citizens for Ethics (CREW) has been routinely suing Donald Trump and related entities in court in order to expose his various financial schemes and scams, and is backed by legal heavyweights including Laurence Tribe and Richard Painter. CREW has managed to piece together that the same attorney is representing both Donald Trump Jr and and Donald Trump’s personal secretary Rhona Graff in the Russia scandal (link). This means that the “reelection” money being funneled to that attorney may for the purpose of covering the secretary’s legal bills as well. This would have major practical implications on the scandal. If Donald Trump is scheming to cover the legal bills for Graff, then it strongly suggests that he’s trying to motivate her not to testify about what she’s witnessed. Depending on legal interpretation, this could be considered an attempt at obstructing justice. It would be one thing for Trump to pay his son’s legal bills; that’s a family matter. But paying his secretary’s legal bills, when she’s potentially a star witness against him in a criminal case, is another matter. Even if it can’t be proven that Donald Trump is trying to buy his secretary’s silence in bad faith, this could signal to Special Counsel Robert Mueller where he should be digging next. There would have been communications between Trump, Graff, and/or the attorney regarding the arrangement and those could be subpoenaed. Either way, if Trump’s “2020 reelection” funds are indeed going to his personal secretary, that’s a scandal in and of itself. America needs some vertebrates in the Grand Old PartyKansas City Star (blog) So how does Ryan imagine that a Corker/Trump conversation might unfold? Over dinner, Corker accuses the president of being a chaotic, directionless, shallow liar who could start a nuclear war. Trump passes the peas and attacks Corker for being short.and more » Trump, Chieftain of SpiteNew York Times This is the existence of Donald Trump in the wake of President Barack Obama. Trump can’t hold a candle to Obama, so he’s taking a tiki torch to Obama’s legacy. Trump can’t get his bad ideas though Congress, but he can use the power of the presidency to …and more » Julian Assange may be on Putins payroll, defeated presidential candidate tells Australias Four Corners programHillary Clinton has repeated her claim that the WikiLeaks founder, Julian Assange, colluded with the Russian government in the lead-up to the 2016 US election, describing him as a nihilistic opportunist who does the bidding of a dictator. In an interview with the ABCs Four Corners program, to air on Monday night, Clinton alleges that Assange cooperated with the Russian president, Vladimir Putin, to disrupt the US election and damage her campaign for president. There’s something wrong with Hillary Clinton. It is not just her constant lying. It is not just that she throws off menacing glares and seethes thwarted entitlement. Watch closely. Something much darker rides along with it. A cold creepiness rarely seen. https://t.co/JNw2dkXgdu
2024-07-23T01:27:15.642919
https://example.com/article/3971
Had a great time teaching three legume recipes on Sunday in Central Jersey. The hostess is a Taoist and vegan who invited 25 friends who wanted to learn more about cooking vegetarian meals. I made the Sweet and Sour Chickpeas, and Red Lentils with Fenugreek and Squash/Pumpkin from my book, along with a brand new recipe for white lentils which I'll share here. The group was amazed at the difference in taste among the recipes and how good they were! But anyone familiar with the range of dishes ... Continue reading ...
2024-03-02T01:27:15.642919
https://example.com/article/9636
A Culture of Growth: The Origins of the Modern Economy by Joel Mokyr (Princeton University Press, £24.95) Joel Mokyr—“moh-keer”—is a Nobel-worthy economic scientist, right down to his wingtip shoes. But he is at the same time a brilliant historical scientist. Economics and history have very different intellectual values. Mokyr combines them to give us here an intellectual history of “the origins of the modern economy” back to the times of Isaac Newton and Francis Bacon and before. At Northwestern University in the United States, Mokyr is an honour-draped professor in both the department of economics and the department of history, and teaches also at the University of Tel Aviv. If you didn’t know much about how modern economics operates as a field you would imagine that such combined skills were routine. Surely? After all, the data for understanding the economy are historical, and come in words as much as in numbers. We don’t have future or theoretical or stylised or imagined or convenient facts. We have instead the irritating facts, all of them historical, mainly about what dead people said and thought. So of course an economic scientist, like an astronomical scientist looking at stars many light years away or an evolutionary scientist looking at beasts many millions of years ago, would be serious about understanding our ancestral economies many decades or centuries away—yes? No: Mokyr is rare in his field. Someone who takes the same approach is his colleague at Northwestern, Robert Gordon, who also published a big book of historical economics this year (The Rise and Fall of American Growth, reviewed in February’s Prospect by Lawrence Summers). Mokyr and Gordon sparred recently in the Wall Street Journal about whether we are doomed or blessed. A Culture of Growth is a brilliant book. You should buy it, and even read it. It’s long, but consistently interesting, even witty. It sustains interest right down to page 337, the very last, unlike, say, Thomas Piketty’s 2013 Capital, which by page 20 of 577 becomes stunningly boring. Another difference between the two is that Piketty’s book is mistaken and Mokyr’s is correct. Mokyr takes seriously the job of making an argument. For example, his glittering chapters late in the book on Chinese history make the point that we need to understand China, which in 1500 led the world, in order to understand the peculiarity of northwestern Europe, 1500 to 1800, which came to lead it. The book is not beach reading. But you will finish it impressively learned about how we got to where we are in the modern world. You will learn that the conventional view about piling brick on brick, or even university degree on university degree, is not how we got here. We got here, Mokyr shows, as he suggested with increasing clarity in his earlier books since 1990, through new ideas, not through the routine investment implementing those ideas. As he wrote in the opening sentence of The Enlightened Economy: “economic change depends, more than most economists think, on what people believe.” His idea about ideas is contrary to the materialism of most economists, many historians and some politicians. Money for investment, to take one of the materialist alternatives, has always been plentiful. Acheulean hand axes, Roman roads and Chinese canals were all massively accumulated. Yet cavemen, classical Romans and Sui dynasty Chinese did not make the modern world. It happened instead in a benighted corner of Eurasia called “northwestern Europe,” which from 1500 to 1800 became, as Mokyr establishes, unusually rich in ideas, especially after 1800. Contrary to World Bank orthodoxy, capital and savings are not the big constraint on our riches. Good ideas are. Once you have a really good idea—containerisation of shipping, for example, or electric lighting, or an atmospheric steam engine—persuading the sharks in the City to give you the money is straightforward. The result was the Great Enrichment: the accumulation of ideas for the modern university and modern medicine and modern food preparation, the most important secular events since the invention of agriculture. How astounding was it? Here’s how: in 1800 the real income per head of the average person on the planet was about £2.50 a day in 2016 prices, the present level of Afghanistan. In rich Britain and Holland in 1800 it was about £5, the present level of Ghana. The figures are rough, but not misleading. By now worldwide real income per head per day is £30, which is Brazil’s level. That is, after 1800 the world—including even very poor places—got 10 times better off. Now in Ireland and the UK, it is about £100; in the States £120. That is, the now-rich countries, including more countries yearly, got anywhere from 18 to 30 times better off (Finland, for example). The poorest people benefited the most, having now the food, housing, clothing, medicine and human scope denied to their ancestors. Nothing remotely like the great enrichment had happened before. Real incomes might double for a time, in fifth-century Athens or the Mughal Empire. Then they would slip back to the misery of £2 or £3 a day—and never set off on a journey to anything like £30 or £100. Since 1800 life expectancies have doubled or tripled. Literacy has exploded. Growth shows no signs of slowing worldwide. In a century the whole world will be rich. Happy? Maybe or maybe not. Living lives with greater opportunity? Certainly. Ideational economic history considers as merely dependent and secondary the usual suspects of savings, finance, capital, coal, geography, trade, imperialism, cotton, slavery, exploitation and other materialism beloved of economists from Adam Smith through Karl Marx. A Culture of Growth shows that a crucial event in the coming of good ideas was the rise in Europe (and Mokyr claims, on less decisive evidence, in Europe only) of a Republic of Letters between 1500-1800. He reaches back into the intellectual and scientific history of Europe to explain how Europe—and somewhat oddly, only northwestern Europe, and odder still only Britain—was by the 18th century overrun with bold scientists, engineering geniuses, clever instrument-makers and skilled machine minders. Thence the industrial revolution, which did not “fizzle out” in the way earlier efflorescences had. You will also learn to think of the republic of letters and the enlightenment and the industrial revolution and the great enrichment in terms of the “market for ideas.” Mokyr ingeniously cashes in the old metaphor, using it as an economist’s tool to see why, for example, scientific prestige could result in cash rewards. It was a close run thing. Had English naval gunnery and a divine wind not turned back the Armada in 1588, for instance, the English would have reverted to Catholicism of a nervously anti-scientific sort. The Dutch Republic would have been crushed by Spanish armies, and Dutch and British ingenuity would have been throttled in its infancy. A beautiful book, I say. Even the flaws are fruitful. That’s how you know you’re reading a first-rate piece of scholarship and science—even when it fails, it points to better thoughts. For one thing, Mokyr is irrationally scornful towards his colleagues in literature and cultural studies and social constructionism. That’s normal for many social and physical scientists, disdainful of what they do not understand over in the arts faculty. Look for example at the New Atheists assaulting a theology of which they have not read a page. But for Mokyr’s scientific purposes the scorn leaves him bereft of the tools to understand cultural change. His lucid scholarship brings the histories of science, technology and social thought together for the benefit of each. Splendid. But he has not studied rhetoric with any seriousness, or cultural anthropology or literary criticism—all rubbish, he is quite certain. Yet the arts allow us to understand how and why words matter. If we are going to have an ideational economic history we need word lore along with the numbers. We need an economics with the humans and their philosophy and novels and drama and language left in. Mokyr puts too much emphasis on high science too early. He tends to smoosh the time periods together, especially when he is busy claiming that science made us rich in the 19th century, and even, he sometimes hints, against his own repeated admissions, in the 18th. Science, as against tinkering technology, probably does not matter to most of the economy until the 20th century. Nowadays, Mokyr and I agree, it matters a great deal—not in the patrician astronomy and high-energy physics, to be sure, but certainly in the biology and materials sciences. But the high science would have been seed cast on stony ground if a new liberalism had not prepared for it. Adam Smith in 1776 spoke warmly of “allowing every man to pursue his own interest in his own way, upon the liberal plan of equality, liberty, and justice.” Liberalism, letting ordinary people have a go, made people bold. The only way we get great enrichments is if the mass of people are bold, because that’s where the engineering elite comes from. An earlier and primitive liberalism of ideas encouraged the republic of letters, too. So did the printing press and the fragmentation of political authority in Europe, which are also roots of liberalism itself. So the causes are tangled. But the scientific revolution is Europe-wide. The industrial revolution was English, prepared by the Dutch, followed by the Scots and the Yankees. And they are just the places where a liberal plan, however imperfectly, was first tried. What of our present prospects? Do we face a new fizzling? Mokyr and I and Jack Goldstone and Margaret Jacob, we of the new ideational economic history, think not. Mokyr points to continuing betterment from science even in the old rich countries and I point to the betterments of technology coming from China and India and the rest when they join us in wealth. And we all think, if the world does not drop an easy slip catch in the manner of August 1914, that liberal ideas have enormous, enriching consequences.
2023-10-15T01:27:15.642919
https://example.com/article/7385
Archive for October, 2012 The fine folks at FRED, the economic data service of the St. Louis Fed, recently added seven new data series showing how various measures of federal debt compare to the economy as a whole, as measured by GDP. I particularly enjoyed this one, showing the federal debt owned by the Federal Reserve banks. Quantitative easing gets all the press these days and understandably so given the recent spike in Fed ownership of Treasuries, now equivalent to almost 11 percent of annual GDP. But the chart also reminds us of that brief period early in the financial crisis when the Fed sold lots of Treasuries so it could make loans and buy other assets. P.S. Anyone know how to get the FRED graph’s vertical axis to start at 0? I probably ought to be blogging about the latest GDP data or how Twitter taught McDonald’s about the Congressional Budget Office (here and here; Mickey D’s is promoting its Cheddar Bacon Onion). But the heck with that. Instead, let’s celebrate Friday with this stunning photo of a shortfin mako by Sam Cahir as published in the Mail Online (ht: Rick MacPherson): What a beautiful creature (click to enlarge). At this point, I usually would encourage you to read the accompanying article. In this case, though, caveat lector – parts are incredibly overwrought. But the other photos are lovely, including one of the mako with a great white. In real life, economists never get elected president (sorry Larry Kotlikoff), probably with good reason. In fiction, though, our odds are better. Jed Barlett is one of the most popular presidents ever, and a Nobel Laurate to boot. And now the Planet Money team is offering up a new, faux candidate for 2012. His six-point plan for getting America going again — built on the suggestions of a diverse group of well-known economists — is five parts tax reform (repeal the mortgage interest deduction, repeal the tax benefit for employer-provided health insurance, eliminate the corporate income tax, institute a carbon tax, tax consumption not saving) and one part marijuana legalization. Here’s his first campaign ad: I don’t think President Obama, Governor Romney, or even Governor Johnson have much to fear. Governor Romney has proposed roughly $5 trillion in tax cuts, but he doesn’t want to reduce overall tax revenues. He hopes to generate some revenue by boosting the economy, but even if that works, he will need trillions of dollars of “base broadeners” — i.e., offsetting tax increases. Like most politicians, he’s been vague about what those base broadeners might be. But in the past few weeks, he has discussed the idea of capping the amount of itemized deductions taxpayers can take, perhaps to $17,000, $25,000, or $50,000. How much revenue could you raise by doing this? My colleagues at the Tax Policy Center just released some estimates of this. As noted by Bob Williams: Eliminating all itemized deductions would yield about $2 trillion of additional revenue over ten years if we cut all rates by 20 percent and eliminate the AMT [DM: two key aspects of Romney’s tax proposal]. Capping deductions would generate less additional revenue, and the higher the cap, the smaller the gain. Limiting deductions to $17,000 would increase revenues by nearly $1.7 trillion over ten years. A $25,000 cap would yield roughly $1.3 trillion and a $50,000 cap would raise only about $760 billion. Capping itemized deductions at $25,000 would thus produce about one-quarter of the revenue needed to offset Governor Romney’s tax cuts, and completely eliminating them (which he has not suggested) would cover about 40% of the revenue needed. As you might expect, high caps are quite progressive, i.e., they: [I]mpose proportionally more of the tax increase on higher-income households, as new TPC estimates show. With tax rates 20 percent below today’s rates, about 83 percent of the revenue gain in 2015 from a $17,000 cap would fall on the top quintile and about 40 percent on the top 1 percent. Raising the cap to $25,000 would boost those shares to nearly 90 percent on the top quintile and fully half on the top 1 percent. A $50,000 cap would virtually exempt the bottom four quintiles from higher taxes: less than 4 percent of the tax increase would fall on them, while nearly 80 percent would hit the top 1 percent. (Phasing down the caps at high-income levels [DM: which Romney has mentioned as a possibility] would, of course, concentrate the revenue gains even more at the high end, but how much would depend on the details.) A much-deserved Nobel prize today for Lloyd Shapley and Alvin Roth for their theoretical and practical work on designing markets. In particular, matching markets where you don’t have prices to help you. The Royal Swedish Academy of Science released a very readable account of their contributions here. Here’s the introduction: This year’s Prize to Lloyd Shapley and Alvin Roth extends from abstract theory developed in the 1960s, over empirical work in the 1980s, to ongoing efforts to find practical solutions to real-world problems. Examples include the assignment of new doctors to hospitals, students to schools, and human organs for transplant to recipients. Lloyd Shapley made the early theoretical contributions, which were unexpectedly adopted two decades later when Alvin Roth investigated the market for U.S. doctors. His findings generated further analytical developments, as well as practical design of market institutions. Traditional economic analysis studies markets where prices adjust so that supply equals demand. Both theory and practice show that markets function well in many cases. But in some situations, the standard market mechanism encounters problems, and there are cases where prices cannot be used at all to allocate resources. For example, many schools and universities are prevented from charging tuition fees and, in the case of human organs for transplants, monetary payments are ruled out on ethical grounds. Yet, in these – and many other – cases, an allocation has to be made. How do such processes actually work, and when is the outcome efficient? Along with his colleague David Gale, Shapley provided theoretical answers to these questions based on the idea of finding stable allocations (i.e., allocations in which no one would later have an incentive to change their mind). Roth then studied how those answers apply in real markets, e.g., designing algorithms to match doctors to hospitals.
2024-04-08T01:27:15.642919
https://example.com/article/2103
Microsatellite polymorphism in locus OMHC1 (MHC Class I) in Polish Heath Sheep and Polish Lowland Sheep (Zelazna variety). Our study aimed at comparative analysis of microsatellite polymorphism in locus OMHC1 (MHC Class I) in Polish Heath Sheep and Polish Lowland Sheep (Zelazna variety). The study was conducted on 100 ewes of each breed. We identified 13 alleles of the gene in Polish Heath Sheep and 9 in Polish Lowland Sheep. We found marked differences in frequency of OMHC1 alleles between both breeds. The heterozygosity coefficient and PIC, amounting to 0.79 and 0.77 for Polish Heath Sheep, and 0.82 and 0.80 for Polish Lowland Sheep, respectively, suggest considerable variability in both breeds. Additionally, the values of both coefficients indicate that OMHC1 locus can be used as a genetic marker.
2024-03-22T01:27:15.642919
https://example.com/article/3656
Post-mastectomy Radiotherapy for pT3N0 Breast Cancers: A Retrospective, Multi-Institution Review. The role of post-mastectomy radiotherapy for pT3N0 breast cancers remains undefined. The purpose of this study was to report institutional outcomes for women with pT3N0 breast cancers treated with and without post-mastectomy radiotherapy. We collected data from two large tumor registries on pT3N0 breast cancers diagnosed between 1985 and 2014. Kaplan-Meier estimates were used to analyze freedom from local-regional recurrence (FFLR), relapse free survival, and overall survival. This analysis identified 93 women with pT3N0 breast cancers. Of these, 53 received post-mastectomy radiotherapy and 40 did not. Median follow-up was 6.2 years and 5.3 years in the non-post-mastectomy radiotherapy and post-mastectomy radiotherapy cohorts, respectively. Women not undergoing post-mastectomy radiotherapy were more likely to be diagnosed in the 1980s and 1990s and were less likely to receive systemic therapies than women receiving post-mastectomy radiotherapy (p < 0.05). There was a trend toward increased FFLR in the women receiving post-mastectomy radiotherapy (p = 0.15). FFLR in the post-mastectomy radiotherapy cohort was 98% at both 5 and 10 years. For women not receiving post-mastectomy radiotherapy, FFLR was 88% at both 5 and 10 years. Women not receiving post-mastectomy radiotherapy in our study had an isolated local-regional failure rate of 12% at 10 years, despite receiving inferior systemic treatment by current standards. Local-regional control after post-mastectomy radiotherapy for pT3N0 breast cancers was excellent. Further research is needed to define post-mastectomy radiotherapy indications for this patient population when receiving chemotherapy and endocrine therapy in line with current guidelines.
2023-09-09T01:27:15.642919
https://example.com/article/6331
Q: How can I implement Facebook Audience Network notifications in Swift? I am successfully loading ads, but I can't get the notifications to fire. For example; class ViewController : UIViewController , FBAdViewDelegate { ... func adViewDidLoad(adView: FBAdView) { print("ad loaded"); // never called, although ad displays } } A: I was not assigning the delegate; self.fanView = FBAdView(placementID:PLACEMENT_ID, adSize:kFBAdSizeHeight50Banner, rootViewController:self); self.fanView.delegate = self; // needed this
2023-09-28T01:27:15.642919
https://example.com/article/6772
A range of substances with antitumor properties synthesized The structure of one of the resulting compounds (2-aryl-5,6-dihydropyrrolo[2,1-α]isoquinoline) Credit: Maria Matveeva Scientists from RUDN University have synthesized a number of new cytotoxic substances that can damage cells. The results of the study could be used in cancer therapy. The compounds were obtained by domino reaction, a successive formation of several new chemical bonds. The study was published in Synthesis. In search of a cure for cancer, scientists are looking for new ways to synthesize compounds similar to natural alkaloids—organic substances of plant or marine origin containing a nitrogen atom. Alkaloids of the lamellarin group, substances derived from Lamellaria mollusks, are known to have cytotoxic and immunomodulatory (immune-regulating) activity as well as anti-inflammatory properties. Lamellarin compounds are of great interest to scientists seeking substances with high anticancer activity. One of the methods for synthesizing new organic compounds is the domino reaction, a process in which several new bonds are formed successively, just like dominoes falling one after another. The initial stage of synthesis is crucial. The first stage of the reaction is nucleophilic addition. During this reaction, the molecule is affected by a nucleophilic reagent, or nucleophile. Such reagents generally include particles (anions or molecules) with an unshared electron pair at an external electronic level (as, for example, in OH-, Cl-, Br- and water molecules). Scientists used the nucleophilic addition reaction for α, β-unsaturated compounds containing not only single carbon-carbon bonds, but also double bonds. In α, β-unsaturated compounds, the second and the third carbon atoms have a double bond. This process is known as Michael's addition. Domino reactions involved 1-aroyl-3,4-dihydroisoquinolines and aldehydes with a multiple bond. As a result, there was a consecutive generation of several intermediate substances—the intermediates. During the domino reaction, RUDN University chemists were able to obtain a number of pyrrolo[2,1-α]isoquinolines with an aldehyde functional group in just one step. The resulting compounds showed cytotoxic activity in a number of tumor cells (lung carcinoma cells, intestinal carcinomas, cervical adenocarcinomas and sarcoma cells) during primary bioscreening. The bioscreening was carried out by scientists from the Institute of Physiologically Active Compounds (IPAC), RAS. "The fragment of 5,6-dihydropyrrolo[2,1-α]isoquinoline is the core for such alkaloids as cryptaustoline and cryptowoline (derived from algae), as well as lamellarins," said co-author Maria Matveeva, a postgraduate student in the Department of Organic Chemistry at RUDN University. "Further research will be aimed at modifying the compounds obtained in order to increase their anticancer activity." Citation: A range of substances with antitumor properties synthesized (2017, October 16) retrieved 15 September 2019 from https://phys.org/news/2017-10-range-substances-antitumor-properties.html This document is subject to copyright. Apart from any fair dealing for the purpose of private study or research, no part may be reproduced without the written permission. The content is provided for information purposes only. E-mail the story A range of substances with antitumor properties synthesized Note Your email address is used only to let the recipient know who sent the email. Neither your address nor the recipient's address will be used for any other purpose. The information you enter will appear in your e-mail message and is not retained by Phys.org in any form. Your message Newsletter sign up Get weekly and/or daily updates delivered to your inbox. You can unsubscribe at any time and we'll never share your details to third parties. Your Privacy This site uses cookies to assist with navigation, analyse your use of our services, and provide content from third parties. By using our site, you acknowledge that you have read and understand our Privacy Policy and Terms of Use.
2024-06-18T01:27:15.642919
https://example.com/article/8104
Toward better dialysis compatibility: advances in the biochemistry and pathophysiology of the peritoneal membranes. Peritoneal dialysis (PD) has modified our concept of the peritoneal membrane, which is now a topic of active research. Peritoneal solute transport progressively increases with time on PD, enhances the dissipation of the osmotic gradient and, eventually, reduces ultrafiltration capacity. The causes of peritoneal membrane failure remain elusive. Recurrent episodes of peritonitis are not a prerequisite for the development of ultrafiltration failure. Functionally, the changes of the failing peritoneal membrane are best described as an increased functional area of exchange for small solutes between blood and dialysate. Histologically, these events are associated with vascular proliferation and structural changes of pre-existing vessels. Gathered evidence, including information on the composition of peritoneal cavity fluids and its dependence on the uremic environment, have cast a new light on the molecular mechanisms of decline in peritoneal membrane function. Chronic uremia per se modifies the peritoneal membrane and increases the functional area of exchange for small solutes. Biochemical alterations in the peritoneum inherent to uremia might be, at least in part, accounted for by severe reactive carbonyl compounds overload originating both from uremic circulation and PD fluid ("peritoneal carbonyl stress"). The molecular events associated with long-term PD are similar but more severe than those present in chronic uremia without PD, including modifications of nitric oxide synthase (NOS) and angiogenic growth factors expression, and advanced glycation and lipoxidation of the peritoneal proteins. This review focuses on reactive carbonyls and their association with a number of molecular changes observed in peritoneal tissues. This hypothetical approach will require further testing. Nevertheless, the insights gained on the peritoneal membrane offer a new paradigm to assess the effect of uremic toxins on serosal membranes. Furthermore, the progresses made in the dissection of the molecular events leading to peritoneal membrane failure open new avenues to develop safe, more biocompatible peritoneal dialysis technologies.
2023-09-05T01:27:15.642919
https://example.com/article/6311
Raul Correia Raul Edvanio Brito Rodrigues Correia (born 7 May 1993) is an Anglo-Portuguese professional footballer who plays as a striker for National League North club Southport. After starting his career with Radcliffe Borough, he joined Chorley in December 2015. Following a spell at Trafford on a dual registration, he returned to Radcliffe Borough in August 2016 and impressed Football League clubs with his form. Signing for Blackpool for an undisclosed fee in January 2017, he joined Guiseley on loan in July 2017 and York City in January 2018. Early life Born in Angola, Correia is a Portuguese citizen and moved to England at the age of nine. He studied business finance management at Sheffield Hallam University and worked at the Royal Bank of Scotland prior to playing professional football. Club career Radcliffe Borough Correia began his career with Northern Premier League Division One North club Radcliffe Borough. Chorley Correia signed for National League North club Chorley on 24 December 2015. On 2 January 2016, he made his debut from the bench in a 1–0 defeat to A.F.C. Fylde. His next appearance did not come until five weeks later when he replaced Jordan Connerton in a 3–0 Lancashire FA Challenge Trophy victory against Colne. Named as an unused substitute on five occasions, Correia made his final appearance in a 3–1 win against Gainsborough Trinity on 9 April. He was released at the end of the season. He joined Northern Premier League Division One North club Trafford in February 2016 on a dual registration agreement. Return to Radcliffe Borough In August 2016, Correia rejoined Northern Premier League Division One North club Radcliffe Borough. He made his debut on the opening day of the season in a 2–0 defeat to Brighouse Town, and scored two minutes into a 4–3 defeat to Mossley three days later. The following month, he scored back-to-back goals in a 3–2 loss to Scarborough Athletic and a 3–1 win against Kendal Town. On 1 November, he scored twice in a 4–0 win against Hyde United. In January 2017, Correia was invited to a one-week trial with Blackpool after impressing in the eighth tier. Blackpool On 31 January 2017, League Two club Blackpool signed Correia for an undisclosed fee. He signed a one-and-a-half-year contract, with the club holding the option to extend his contract by an additional year. He made his professional debut in a EFL Trophy defeat to Shrewsbury Town on 10 January 2018. After a goalless 90 minutes, Shrewsbury won 4–2 on penalties. Correia signed for National League club Guiseley on 25 July 2017 on a six-month loan. He made his debut on the opening day of the season in a 2–2 home draw with Ebbsfleet United. He scored his first and only goal for Guiseley on 16 September in a 1–1 draw away to Wrexham after guiding Will Hatfield's deflected shot from distance past goalkeeper Luke Coddington. Correia made his final appearance in a 4–0 defeat away to Tranmere Rovers on 30 December, and returned to his parent club two days later. On 11 January 2018, Correia joined National League North club York City on loan for the remainder of the season. Two days later, he made his debut by starting in a 2–1 home win against Bradford Park Avenue. He scored his first goal for York on 16 January in a 5–3 victory away to A.F.C. Telford United, after dispossessing goalkeeper Ryan Schofield when attempting to clear the ball. He finished the loan with 11 appearances and one goal as York finished 11th in the table. He was released by Blackpool at the end of the 2017–18 season. Barrow Correia signed for National League club Barrow on 16 July 2018 on a one-year contract with the option of another year. Southport On 18 July 2019, it was confirmed that Correia had signed for Southport for the upcoming 2019–20 season after a successful pre-season trial. At the time of his signing, manager Liam Watson said, "Raul is everything we’re looking for in a striker: he’s powerful, direct and has got loads of pace. I’m really pleased by how well Raul has done for us in pre-season and he’s hungry to be a success. He has already integrated well with the squad, I’ve been pleased by how he has performed so far and I’m sure he will be an important player for us this season." Career statistics References External links Profile at the Barrow A.F.C. website Category:1993 births Category:Living people Category:Angolan footballers Category:Portuguese footballers Category:Association football forwards Category:Radcliffe F.C. players Category:Chorley F.C. players Category:Trafford F.C. players Category:Blackpool F.C. players Category:Guiseley A.F.C. players Category:York City F.C. players Category:Barrow A.F.C. players Category:Northern Premier League players Category:National League (English football) players Category:Angolan expatriate footballers Category:Portuguese expatriate footballers Category:Expatriate footballers in England Category:Angolan expatriate sportspeople in England Category:Portuguese expatriate sportspeople in England Category:Alumni of Sheffield Hallam University Category:Southport F.C. players
2023-10-18T01:27:15.642919
https://example.com/article/9700
Water in protein hydration and ligand recognition. This review describes selected basics of water in biomolecular recognition. We focus on a qualitative understanding of the most important physical aspects, how these change in magnitude between bulk water and protein environment, and how the roles that water plays for proteins arise from them. These roles include mechanical support, thermal coupling, dielectric screening, mass and charge transport, and the competition with a ligand for the occupation of a binding site. The presence or absence of water has ramifications that range from the thermodynamic binding signature of a single ligand up to cellular survival. The large inhomogeneity in water density, polarity and mobility around a solute is hard to assess in experiment. This is a source of many difficulties in the solvation of protein models and computational studies that attempt to elucidate or predict ligand recognition. The influence of water in a protein binding site on the experimental enthalpic and entropic signature of ligand binding is still a point of much debate. The strong water-water interaction in enthalpic terms is counteracted by a water molecule's high mobility in entropic terms. The complete arrest of a water molecule's mobility sets a limit on the entropic contribution of a water displacement process, while the solvent environment sets limits on ligand reactivity.
2024-05-24T01:27:15.642919
https://example.com/article/5648
Welcome to Rick Range for Texas General Land Office Commissioner The Platform The Most Critical Issue The Alamo is under attack again. It is being led by the very conservator commissioned to preserve it—Texas Land Office Commissioner George P. Bush. His REIMAGINE THE ALAMO Master Plan will destroy the Alamo as we know it. Veterans United By A Common Goal As a 31-year first responder firefighter, Rick Range is very cognizant of and sympathetic to the issues suffered by a great many of our veterans. Serving their needs will be one of his very top priorities. Housing needs and mental health are two of the most pressing problems that need addressing. Texas Disasters In 2015 – 2016, Texas experienced six federal disaster declarations that spread across 160 of the state’s 254 counties. These disasters impacted more than 76 percent of the state’s population. Range will work to ensure that Texas gets its fair share of CDBG-DR Funds. The Candidate Rick Range is best qualified to manage the Alamo, veterans affairs, and natural disasters Rick Range is a fourth-generation Texan and a lifelong resident of Dallas County where his family has lived since 1890. He graduated from Irving High School and then attended North Texas State University in Denton and West Texas State University in Canyon where he received his B.M.E. Range taught at the junior high and high school levels before becoming a career firefighter with the Mesquite Fire Department. Here he served for over 31 years as a Driver-Engineer and also as Spanish translator for both the fire and police departments. For the last dozen years, Range has been heavily involved in research for a book covering all aspects of the Alamo and the Texas War for Independence. He serves as a Board Member of the Alamo Society, an international association of Alamo scholars, researchers, and dedicated enthusiasts. Also a member of the Alamo Battlefield Association, the San Jacinto Battleground Conservancy, and an associate member of the Alamo Defenders Descendants Association, he has spent nearly twenty years in Alamo research in both English and Spanish. A few months ago he founded the Save The Alamo Committee along with its associated website and social media in order to get the word out to the voters of Texas about George P. Bush’s disastrous REIMAGINE THE ALAMO Master Plan. On November 1, Range publicly announced his candidacy for the office of Texas General Land Office Commissioner to replace George P. Bush. Support for the rick range campaign First, we want to take this opportunity to thank our many supporters who have so tirelessly worked to assist our efforts. It has been a long uphill battle, but thanks to you, we have made tremendous progress in spreading the message about the dire threat to the future of the Alamo. Now that Rick Range has officially filed as a candidate for Texas General Land Office Commissioner running against George P. Bush, we would like to ask all of our followers and supporters to make a one-time contribution of 25, 50, or 100 dollars to the campaign. So far this campaign has been almost entirely self-funded except for a few generous individuals. We have a specific reason for making this request. If all of our followers donate an average amount of just $30, we will be able to do a statewide mailer to every single Republican Primary voter in State of Texas. In this one mailer we will be able to ensure that each and every voter is fully aware of what Bush has tried to do to the Alamo. Save Texas History Save the Alamo Contribute Your donation is an opportunity to be part of something bigger. Show Rick Range that you have his back. Give today!
2023-08-31T01:27:15.642919
https://example.com/article/4405
Welcome to HVAC-Talk.com, a non-DIY site and the ultimate Source for HVAC Information & Knowledge Sharing for the industry professional! Here you can join over 150,000 HVAC Professionals & enthusiasts from around the world discussing all things related to HVAC/R. You are currently viewing as a NON-REGISTERED guest which gives you limited access to view discussions To gain full access to our forums you must register; for a free account. As a registered Guest you will be able to: Participate in over 40 different forums and search/browse from nearly 3 million posts. Bryant Evolution Error - can anyone help me diagnose Hi to all the HVAC pros on this site. I am a homeowner. I just had a local installer rip my 10 year old 5 ton Goodman builder grade system and replace with 2 separate Bryant Evolution controled variable speed furnaces, and 2 2 stage communicating outdoor units; 4 ton upstairs, 3 ton down (in a 4000 sqft 2 floor house). I specified the furnaces to be 95% and the AC was contracted to be better than 16 SEER, 13 EER as this is what triggers various rebates. In the process we added a lot of return air intakes all over the house (the old design had only one for the whole house). Each system is zoned to provide 2 zones. The evolution damper check complains about the zone 2 on my 3 ton downstairs unit. THe complaint comes after the damper check, but allows us to proceed and seems to work (airflow is huge to zone 2). The error I get is simply "check damper, zone 2". We did this and found it to be reversed in the airflow. We corrected this and it still complains with the same error and the numbers are unchanged. Stats that the evolution reports on 'boot up' or if I run a damper check The class i just went to said to make sure when only 1 zone is calling, that zone has to meet the minimum airflow of the unit in low speed or it will shut down. An office seems to not need much airflow. So the old system never cooled the house. Since you increased size 2 tons? The only way to cool the house would be set it to cool 69 and let it run all day. Even then the guest bed and my office would be cooking at 80 other rooms would be make it to 75 to 78 ish. I would be bankrupt due to electric cost. In summer, with the tstat at 82 where we got used to settting it, my elect bill was of the order of $500 a month. Out side temps at my location routinely sit in the 95 - 105 daytime, 75 -80 nighttime from June to September. I got about 6 bids for something new that would work and I could afford to run. Everyone had something different to say. One person was convinced my 5 ton sys was only drawing 3 tons of air through the return. Another was convinced my ducting was the the problem as well as returns. They all agreed the existing needed to go (of course) but there wasn't much consistency in the recommendations. A lot of people told me that R410a was a load of hype and I could do perfectly well with a brand new R22 based system (I begged to differ). I did a lot of reading. In the end, the guy I used was convinced the problem was return airflow and the fact that 5 tons simply enough for my house. I have 9ft ceilings so the volume of air is quite large. His price for 7 tons in two systems was the same as the 2 Trane bids for 5 tons zoned. So I went with that. (hope I didn't just break the rules - if so I appologize - newbie here). My biggest compaint about the whole experience (my only complaint) was that there was no way to get brand independent empirical advice. I would have paid if someone who knew they weren't going to sell a system could have advised me. Now it's in - I am in the one month a year where I neither heat or cool - so I can't tell if it is working yet. But early evidence from testing seems very good. Zone 1 is a 14" damper and goes from a supply plenum off the coil, via the damper, to a distribution box that has most of the supply ducts to the house attached. This was new work. Zone 2 (problem zone) is an 8" damper, this comes from the supply plenum off the coil to a run of 8" flex, that runs to my office via a 8/6/6 Y connector. This is all that is that zone. I have aiflow set to LOW in the system setup. I just looked in the system events menu and it has 2 events about insufficient airflow to this zone. So I guess I am getting my installer back in. Thanks for taking an interest everyone. Nice to have some one to brainstorm with. Setting the air flow to low limits the alredy small zone even more.Try max.,it may solve the issue. If the supplies are noisey,they can increase the duct,grille,and maybe even the damper sizes. Does the office have a return? Yes we added a 10" return in the office. Of course we added a lot of return air as the house had just one 20 x 36 return air upstairs fed to the air handler by a 20" flex line. We added return air in my office, in the living space downstairs and in the hall downstairs (for the 3 ton system). Upstairs we did similar for the 4 ton system; added return air all over the upstairs. I set the airflow to LOW in the system menu thinking that this would tell the system to send as little air as possible to the zone. The manual says you adjust this setting if the airflow noise is too great or if there is too much air supply to the zone. I'll set it back to the default and see what it says. However - the "Check Damper" error message on Duct Assesment screen comes regardless of this setting (I have tried it at different settings). Could be mis-wired and not openng and closig properly ,or at all.Does it maintain the temp.,and respond when there's a call to heat/cool? Max air flow is worth a try,given what you have stated. You have only two zones,one is kida small,I'd try max.,not default,to allow more air tothe small zone,so the system doesn't have as much excess air to try and deal with. Was a load calculation done on the house? Was the ducting completely redone? Sounds like you are saying that there was a ducting issue with the original 5 ton single system, so may we assume that the ducting has had a major overhaul with the increase in capacity along with adding zoning? By the way, a properly sized system does run more and uses less energy to heat and cool our homes. Oversized systems that short cycle or staged systems that only run in the lower stages are real energy killers.
2023-08-14T01:27:15.642919
https://example.com/article/8413
Rush Limbaugh Just Made HUGE Prediction About Trump’s 2nd Day As President ‘We Can’t Stop Him.’ Rush Limbaugh, a widely known conservative radio pundit, has made some interesting claims and predictions about a potential Donald Trump presidency. A citizen recently called in to Limbaugh’s show fearing that Donald Trump would be an authoritarian ruler if he were to become President. On the Tuesday broadcast, Limbaugh responded to quell the callers fears. “I’m telling you that if Trump gets elected, you’re gonna see more unity between the Republicans and Democrats in stopping any Trump authoritarianism than you have ever seen in your life,” he responded. He went on, “because they’re gonna hate it, they’re gonna despise the guy, and they’re gonna align together to stop him if he tries executive orders.” “Trump is not gonna be able to get away with Obama-ism because Obama has a compliant Republican Party, Trump is gonna have a Democrat Party that’s not gonna say, ‘You know what? We can’t stop him. We’re afraid of offending people.’ They’ll be talking impeachment on day two! After the first Trump executive order,” he asserted. “All these comparisons [about] Trump and Obama, I understand ’em, but Obama is only getting away with it because the Republican Party is non-existent. Well I’m telling you, the Democrats don’t play that way. Trump, if he wins, will be a Republican, and if he does authoritarian stuff that the Democrats want, then I guarantee you the Republicans will stand up and stop him. He’s not African-American, he’s not a minority, they won’t be worried about any of that,” Limbaugh said. Limbaugh has argued that Trump’s rise, popularity and continued momentum is at least partially a result of the Republican establishments resistance to him. He argues that the more the establishment criticizes and attacks him the more he gains in the polls and with the public.
2024-01-13T01:27:15.642919
https://example.com/article/9670
Nursery Art A few weeks ago I made these cute little ballerinas for my friends and fell in love with the process: playing with gorgeous tulle, painting on canvas and then wrapping it up in pretty packaging was like going back to my childhood when I loved making dolls and creating fun outfits for them. I’ve started with only 3 tulle options and today I’m excited about new designs which look magical!! You can soon choose from different shades of pink with cute heart shape design and polka dots, gray and peachy colors (find my ballerinas on Etsy)! So excited!!! Here is a little sneak peek:) Your email address will not be published. Required fields are marked * Name* Email Address* Website Comment Notify me of follow-up comments by email. Notify me of new posts by email. I'm Elena Fay, fashion illustrator and watercolor artist. I have a passion for creating art tutorials, fun illustrations, coloring pages and encouraging others to pursue their creativity. I'm so delighted to have you here! Grab a cup of coffee or tea and take a look around! Here you’ll find free downloads, art tutorials, behind the scene videos and so much more to spark your inspiration!
2023-08-10T01:27:15.642919
https://example.com/article/9820
An arrangement of the foregoing type is disclosed in DE-OS No. 3247899. This prior art reference teaches that workpieces at one processing station are conveyed to another processing station or an inventory storage by way of an intermediate storage station. This avoids the necessity of storing workpieces in bulk material boxes, whereby the workpieces can become tilted in the loading process, so that damage to the workpieces and excessive noise can be avoided. In practice, however, this arrangement has proven to be defective because the throughput of the corresponding piece count is less than optimum. Also in this prior art arrangement a change in the plane of workpiece storage is not possible.
2023-12-28T01:27:15.642919
https://example.com/article/7217
Direct observation of enzyme substrate complexes by stopped-flow fluorescence: mathematical analyses. The fluorescence changes which occur upon the interaction of enzyme and substrate under stopped-flow conditions can provide a sensitive means to directly observe ES complexes. The interconversion of the intermediates during catalysis causes changes in fluorescence, signaling directly their existence, and allowing their quantitation. We have studied extensively an approach which measures radiationless energy transfer (RET) between enzyme tryptophanyl residues and a fluorescent peptide or ester substrate. Our studies of a number of proteolytic enzymes have validated the approach, which is sensitive and applicable to a variety of enzymes under a wide range of experimental conditions, including subzero temperatures. Direct excitation of fluorescent substrates can also be used to observe ES complex formation and breakdown and is complementary to the RET approach. Here we review both the RET and direct excitation kinetic approaches, with particular emphasis on the mathematical foundations we have developed which are critical to the successful interpretation of these or any other spectroscopic approach which yields a signal that is unique to the ES complex.
2023-09-07T01:27:15.642919
https://example.com/article/3611
MUMBAI/ NEW DELHI: Packaged sev bhujia and chanachur are replacing potato chips and finger sticks in shopping bags, helping traditional packaged namkeen topple western snacks for the first time in the branded salty snacks market. Branded namkeen such as dal, chivra, bhujia and nuts accounted for 52% of total salty snacks sales of about Rs 9,400 crore in the year ended June with both multinationals and home-grown companies pushing namkeen into hinterland with attractive packaging and pricing, industry officials said, quoting Nielsen data. "A large part of unorganised market is gradually shifting towards namkeen as companies have increased availability and affordability of such products in recent times," said Mayank Shah, group product manager at Parle Products, which recently entered the traditional market in select states. Such products are sold at almost every pan shops at 5 and 10 price points, he pointed out. Just three years ago, the snacks market was dominated by western snacks such as potato chips and finger sticks that had nearly two-third of the market controlled primarily by Pepsi Frito Lays and ITC Foods. This is changing as an increasing number of consumers start to buy branded namkeen instead of loose products from bakeries due to the hygiene factor. In other words, the boom in branded namkeen is driven by consumers upgrading from unbranded segment rather than consumers of western snacks shifting to traditional items. Companies say the market potential is huge. "The unorganised market is so huge that it remains undocumented, and even we don't know the size of the total market," Chittranjan Dar, CEO of ITC Foods, said. But it is not market leader Haldiram, which has almost half the market share in each sub-segment of branded namkeen that is riding this growth. "We are seeing average growth at 10-11% in most of our segments. The sales are not as high as what it used to be," Kamal Agarwal, MD of Haldiram Snacks, said. It is facing increasing competition from western companies such as PepsiCo, regional players such as Balaji and Bikaji, and newer entrants like Parle Products that have realised ethnic namkeen is fast gaining popularity and also offer higher margins than potato chips. "When you have to process and grade raw materials like potatoes, there is a lot of shrinkage and costs increase too. Cost of making namkeen is much lower compared to western snacks like chips," said Chandu Virani, MD of Balaji Wafers, which gets over half the revenues from western snacks now against over 80% a few years ago. A PepsiCo spokesman said the company's Indian namkeen division Lehar Foods is growing faster than western snacks and the company expects it to account for a significant portion of its business in the near future. Regional brands such as Balaji Foods, Bikaji and and Bikanervala are also aggressively increasing their distribution to match companies such as Parle and Haldiram that have access to 2.5-3 million retail outlets. SS Agarwal, MD of the 400-crore homegrown Bikanervala Foods, which pioneered the concept of marketing and selling bhujia , said distribution is the key to higher consumer offtake.
2024-05-05T01:27:15.642919
https://example.com/article/3958
27 April 2000 No.  3--99--0102 (Consolidated with No. 3--99--0103) ______________________________________________________________________________ IN THE APPELLATE COURT OF ILLINOIS THIRD DISTRICT A.D., 2000 THE PEOPLE OF THE STATE OF ILLINOIS, ex rel. )  Appeal from the Circuit Court JAMES E. RYAN, Attorney General, and ex rel. )  of the 14th Judicial Circuit, GARY SPENCER, State’s Attorney of Whiteside )  Whiteside County, Illinois, County, Illinois, ) ) Plaintiff-Appellant, ) ) v. ) ) LEWIS McFALLS, ) ) Defendant-Appellant, ) ) and ) ) PRESCOTT CONSTRUCTION COMPANY; CITY OF ) STERLING; ROCK RIVER ROOFING AND SIDING ) COMPANY; THOMAS CRAIG; JOSEPH CRAIG; TIMOTHY ) CRAIG; WOLOHAN LUMBER COMPANY; MARVIN R. )  No.  97--CH--34 LOFGREN d/b/a LOFGREN CONSTRUCTION COMPANY; ) LEROY E. DUSING; KEVIN L. HOHLEN; RANDY J. ) SPOTTS; CHRISTINE SPOTTS; WAYNE E. LAPP; ) WILLIS C. SIMPSON; WILLIAM H. MILLER; ) JORDAN TOWNSHIP/TOWN OF JORDAN; WILLIE E. ) STANLEY; KEVIN J. WOLF, individually, and as ) owner of WOLF CONSTRUCTION; KENNETH REITZEL ) d/b/a REITZEL ROOFING COMPANY; GENE McFALLS, ) individually, and as owner of NORTHWEST ) ROOFING; ROBERT W. BURGER, individually, ) and as owner of BURGER BROTHERS TRUCKING & ) EXCAVATING; COMMONWEALTH EDISON; and WILLIAM ) FRANKFOTHER; )  Honorable )  Dan A. Dunagan, Defendants-Appellees. )  Judge, Presiding. ______________________________________________________________________________ PRESIDING JUSTICE SLATER delivered the opinion of the court: _________________________________________________________________ The State filed a 51-count amended complaint alleging that Lewis McFalls, Commonwealth Edison Company (ComEd), and 22 other defendants had violated subsections 21(a) and 21(p)(1) of the Illinois Environmental Protection Act (the Act) (415 ILCS 5/1 et seq. (West 1996)).  415 ILCS 5/21(a), 21(p)(1) (West 1996).  On ComEd’s motion, the trial court dismissed all counts of the complaint except those directed against McFalls.  The State and McFalls appeal pursuant to Supreme Court Rule 304(a) (155 Ill. 2d R. 304(a)).  For the reasons that follow, we reverse the trial court’s order and remand for further proceedings. BACKGROUND Title V of the Act addresses land pollution and refuse disposal.  415 ILCS 5/20 et seq. (West 1996).  Section 21 of the Act lists a number of prohibited acts.  415 ILCS 5/21 (West 1996).  Subsections 21(a) and 21(p)(1) (415 ILCS 5/21(a), 21(p)(1) (West 1996)) provide: “No person shall: (a)  Cause or allow the open dumping of any waste. * * * (p)  In violation of subdivision (a) of this Section, cause or allow the open dumping of any waste in a manner which results in any of the following occurrences at the dump site: (1) litter[.]” Under the Act, the term “person” includes, among others, individuals, corporations, and political subdivisions.  415 ILCS 5/3.26 (West 1996).  “Open dumping” means “the consolidation of refuse from one or more sources at a disposal site that does not fulfill the requirements of a sanitary landfill.”  415 ILCS 5/3.24 (West 1996).  “Refuse” means “waste” which, in turn, denotes “any garbage, sludge *** or other discarded material ***.”  415 ILCS 5/3.31, 3.53 (West 1996). In counts I through XXIII and counts XXV through XLVI of its amended complaint, the State alleges that ComEd and 22 others caused open dumping and caused open dumping resulting in litter, in violation of subsections 21(a) and 21(p)(1), by dumping various waste materials on certain real property located in Sterling, Illinois.  In the remaining six counts of its complaint, the State alleges that Lewis McFalls, as the owner of the property, violated subsections 21(a) and 21(p)(1) and various other provisions of the Act not at issue in this appeal. ComEd filed a section 2--615 motion (735 ILCS 5/2--615 (West 1996)) contending that the two counts directed against it should be dismissed.  In particular, ComEd argued that, in order to violate subsections 21(a) and 21(p)(1), a party must either own the allegedly illegal disposal site or exercise control over it.  Therefore, according to ComEd, in view of the State’s failure to allege ComEd’s ownership or control, the State fails to state a cause of action.  All other defendants except McFalls joined ComEd’s motion. The trial court granted the motion and dismissed every count of the State’s complaint except those directed at McFalls.  In so ruling, the trial court concluded that only an owner or operator of an allegedly illegal disposal site may “cause or allow” open dumping within the meaning of subsections 21(a) and 21(p)(1).  In its written order, the trial court based this construction on the following propositions: (1) other subsections of section 21 that employ the phrase “cause or allow” only apply to owners or operators, while subsections that do not use the phrase apply to any person undertaking the prohibited act; (2) the construction is necessary to avoid absurd and unjust results; and (3) the legislature’s addition of subsection 45(d) (415 ILCS 5/45(d) (West 1996)) implies that a person not alleged to be an owner or operator of the illegal disposal site cannot be joined in the original complaint. ANALYSIS On appeal, the State and McFalls contend that the trial court erred by granting ComEd’s motion to dismiss because, by the plain language of the Act, the class of persons who may “cause” open dumping in violation of subsections 21(a) and 21(p)(1) is not limited to owners or operators. (footnote: 1) The General Assembly enacted the Act to establish a unified, state-wide program to restore, protect, and enhance the quality of the environment in Illinois.  415 ILCS 5/2(b) (West 1996).  A primary purpose of the Act is to assure that adverse effects upon the environment are fully considered and borne by those who cause them.   National Marine, Inc. v. Illinois Environmental Protection Agency , 159 Ill. 2d 381, 639 N.E.2d 571 (1994).  The Act is to be liberally construed to effect its purposes.  415 ILCS 5/2(c) (West 1996). The cardinal rule of statutory construction is to ascertain and give effect to the intent of the legislature.   Paris v. Feder , 179 Ill. 2d 173, 688 N.E.2d 137 (1997).  If the legislature’s intent can be ascertained from the statute’s plain language, that intent must prevail without resort to other interpretive aids.   Paris , 179 Ill. 2d 173, 688 N.E.2d 137.  Where a statute’s language is unambiguous, a court should not read limitations into the statute.   Gem Electronics of Monmouth, Inc. v. Department of Revenue , 183 Ill. 2d 470, 702 N.E.2d 529 (1998).  The construction of a statute is a question of law subject to de novo review.   Boaden v. Department of Law Enforcement , 171 Ill. 2d 230, 664 N.E.2d 61 (1996). The Act does not define “cause.”  In the absence of a statutory definition, “cause” should be given its plain and ordinary meaning.  See Moran Transportation Corp. v. Stroger , 303 Ill. App. 3d 459, 708 N.E.2d 508 (1999).  The verb “cause” ordinarily means “to serve as cause or occasion of [or to] bring into existence ***” (Webster’s Third New International Dictionary 356 (1993)). The Act contains a broad definition of “person.”  The definition contains no qualifying language limiting its scope to entities having an ownership interest in, or control over, a disposal site.  Moreover, neither ownership, nor control, of an allegedly illegal disposal site is necessary to effect the consolidation of refuse there.  Therefore, an off-site generator, as a “person,” may “cause” “open dumping” within the plain meaning of subsections 21(a) and 21(p)(1).  Accordingly, we hold that off-site generators fall within the class of persons who may violate these subsections. Neither the trial court’s concerns, nor the arguments presented by appellees, inject any ambiguity into the plain meaning of subsections 21(a) or 21(p)(1).  In its order, the trial court observed that subsections 21(r) and 21(t) are the only subsections of section 21, other than subsections 21(a) and 21(p)(1), to employ the phrase “cause or allow.”   The trial court concluded that, because these subsections can only be interpreted to prohibit acts of an owner or operator, the drafters of the Act must have intended the phrase “cause or allow” to apply exclusively to owners or operators. Subsection 21(r) provides that no person shall “[c]ause or allow the storage or disposal of coal combustion waste ***” without meeting certain specified conditions.  415 ILCS 5/21(r) (West 1996).  Subsection 21(t) provides that no person shall “[c]ause or allow a lateral expansion of a municipal solid waste landfill unit ***” without obtaining authorization from the Illinois Environmental Protection Agency.  415 ILCS 5/21(t) (West 1996). We are unpersuaded that subsection 21(r) prohibits acts which can only be undertaken by an owner or operator.  Furthermore, even if we were to accept that both subsections only apply to owners or operators, it would not be sufficient evidence of a legislative intent contrary to the statute’s plain language. In addition, our conclusion that an off-site generator may “cause” open dumping is not undermined by the legislature’s use of more specific language in describing the acts prohibited in other subsections of section 21.  We agree with the trial court and appellees that the legislature intends different results when it uses certain words in one instance and different words in another ( Carver v. Bond/Fayette/Effingham Regional Board of School Trustees , 146 Ill. 2d 347, 586 N.E.2d 1273 (1992)).  However, when applied to off-site generators, subsection 21(a)’s “cause or allow” language does not merely prohibit in general terms what the other subsections prohibit in more specific terms.  The allegations of the State’s complaint in the case at bar illustrate that subsections 21(a) and 21(p)(1), when applied to off-site generators, prohibit conduct different from the conduct prohibited in more specific subsections.  No other subsection prohibits a party from dumping waste on privately owned land being used as an illegal disposal site.   Cf. 415 ILCS 5/21(b) (West 1996) (prohibiting dumping on public highways or other public land not fulfilling the requirements of a sanitary landfill). We are similarly unconvinced that the trial court’s narrow construction of the statute is necessary to avoid absurd or unjust results.   A court should not depart from a statute’s plain meaning so long as application of the statute’s plain language to the circumstances presently before the court would not effect an absurd or unjust result.  See Village of Itasca v. Luehring , 4 Ill. 2d 426, 123 N.E.2d 312 (1954).  In arriving at its conclusion that application of subsections 21(a) and 21(p)(1) to off-site generators would effect absurd and unjust results, the trial court relied upon hypothetical scenarios far removed from the allegations of fact before it.  We will not ignore the plain language of the statute based on such conjecture.  Instead, we limit our consideration to determining whether application of the statute’s plain language to the allegations of the State’s complaint has absurd or unjust consequences.  See Aloha, Inc. v. Illinois Liquor Control Comm’n , 191 Ill. App. 3d 523, 548 N.E.2d 116 (1989) (court refused to consider application of statute to hypothetical facts). Due to the procedural posture of this case, we must presume the veracity of all well-pleaded allegations of the State’s complaint and construe all reasonable inferences therefrom in favor of the State.  See Vernon v. Schuster , 179 Ill. 2d 338, 688 N.E.2d 1172 (1997).  The State alleges that appellees are off- site generators who dumped waste materials at an illegal disposal site.  We find that it is neither absurd, nor unjust, for such persons to bear some of the cost of restoring the land they helped to despoil.  Accordingly, it is unnecessary to depart from the plain language of subsections 21(a) and 21(p)(1) in order to avoid absurd or unjust results. Moreover, the legislature’s addition of subsection 45(d) to the Act does not evince an intent that off-site generators be excluded from the class who may be joined in the State’s original complaint.  Subsection 45(d) provides that a person with an ownership interest in real property who is alleged to have allowed open dumping on that real property may file a third-party complaint against any person who “with actual knowledge caused or contributed” to the open dumping.  415 ILCS 5/45(d) (West 1996).  In People v. Fiorini , 143 Ill. 2d 318, 574 N.E.2d 612 (1991), our supreme court held that, even prior to the enactment of subsection 45(d), a defendant in an action brought under the Act had a right to file a third-party complaint.  See also People v. Brockman , 143 Ill. 2d 351, 574 N.E.2d 626 (1991).  Thus, neither subsection 45(d), nor the case law interpreting the Act prior to the enactment of that subsection, addresses whether off-site generators may be joined in the State’s original complaint. In addition, we reject the argument that our interpretation of the Act leads to absurd or unreasonable results in light of the scienter element of subsection 45(d).  Illinois courts have held that, because violations of the Act are malum prohibitum , the State need not prove a defendant knowingly violated the statute.  See, e.g. , Meadowlark Farms, Inc. v. Pollution Control Board , 17 Ill. App. 3d 851, 308 N.E.2d 829 (1974) .  In contrast, under subsection 45(d), a defendant/third-party plaintiff must prove that a third-party defendant caused or contributed to open dumping “with actual knowledge” (415 ILCS 5/45(d) (West 1996)).  We do not find it absurd or unreasonable that the legislature would choose to omit a knowledge requirement where the State is seeking to promote the public safety and welfare, but require a defendant/third-party plaintiff to prove actual knowledge where it is merely seeking to protect its own finances.  Consequently, subsection 45(d) provides no reason to depart from the plain meaning of the Act. Finally, we do not agree that a long line of precedent limits the scope of the subsections at issue to parties having an ownership interest in, or exercising control over, the allegedly illegal disposal site.  Rather than establishing ownership or control of the premises as a necessary condition to liability under the Act, the cases cited by appellees merely hold that ownership or control of the premises or control over the source of pollution is a sufficient condition where an owner or operator is alleged to have passively permitted pollution to enter the environment.  See Perkinson v. Pollution Control Board , 187 Ill. App. 3d 689, 543 N.E.2d 901 (1989); Phillips Petroleum Co. v. Pollution Control Board , 72 Ill. App. 3d 217, 390 N.E.2d 620 (1979); Freeman Coal Mining Corp. v. Pollution Control Board , 21 Ill. App. 3d 157, 313 N.E.2d 616 (1974); Meadowlark Farms, Inc. , 17 Ill. App. 3d 851, 308 N.E.2d 829.  Therefore, we must reject the argument that these cases control the disposition of the case at bar. CONCLUSION For the foregoing reasons, the judgment of the circuit court of Whiteside County is reversed and the State’s cause is remanded for proceedings consistent with this opinion. Reversed and remanded. LYTTON, J., concurs. JUSTICE HOLDRIDGE, dissenting: I respectfully dissent.  The circuit court correctly determined that the dismissed parties, as transporters or generators of waste, without ownership or control of the site, where not subject to liability under sections 21(a) and (p)(1) of the Illinois Environmental Protection Act (IEPA) (415 ILCS 5/21(a), 21(p)(1) (West 1996).   Specifically, I agree with the circuit court's determination that these sections of the IEPA were intended by the General Assembly to cover only an owner or operator of an illegal dump site.  As the circuit court correctly noted, the phrase "cause or allow" when used in other sections of the IEPA are intended to apply only to acts of owner or operators of dump sites.   In determining the legislature's intent, the language of the statute as a whole must be examined, and each part or section must be considered in connection with every other part.   Antunes v. Sookhakutch , 146 Ill.2d 477 (1992).   For the foregoing reasons, I dissent. FOOTNOTES 1: For the remainder of this opinion, we use the term “off- site generator” to refer to any person who deposits waste on property which they do not own or control.
2024-07-02T01:27:15.642919
https://example.com/article/9231
(CNN) Norman Pearlstine, the executive editor of the Los Angeles Times, revealed in a piece for the newspaper on Sunday that a college girlfriend experienced a "botched abortion" before the US Supreme Court legalized the procedure. The veteran journalist said he and his girlfriend, whom he identifies as Charlene, were 19 years old when they sought out the procedure in the 1960s, believing they were "too immature" to be parents. After the abortion, Pearlstine said Charlene began hemorrhaging. She underwent surgery that damaged her uterus, and she never conceived, Pearlstine said. They did not regret their decision and Charlene remained "passionately pro-choice" for the rest of her life, he said. The two married and later divorced and Charlene died of natural causes in 2018, he said. Pearlstine said he kept the story to himself, at times asserting "an editor's need to make 'fairness' a priority when rationalizing my silence." Read More
2024-04-02T01:27:15.642919
https://example.com/article/3115
Q: How to test a function with jasmine? I have a class with a contructor and some classes: import {Weight} from './weight'; export class Weight { constructor(public viewCtrl: ViewController, public navCtrl: NavController, private user: User, private zone: NgZone, private alert: AlertPopupServices){ } getSomeValue(a,b){ return a + b; } } I'm trying to test it with jasmine. describe('BLABLABLA', () => { TestBed.configureTestingModule({ declarations: [MyApp, Weight], providers: [ SecureStorageServices, NavController, User, AlertPopupServices, {provide: ViewController, useClass: ViewControllerMock}, ], imports: [ IonicModule.forRoot(MyApp), TranslateModule.forRoot({ loader: { provide: TranslateLoader, useFactory: (createTranslateLoader), deps: [Http] } }) ] }).compileComponents(); it('has to give the addition of two numbers', () => { expect("FUNCTION CALL").toEqual(10); }); }); But how can I call the function in my it and get the return value? Thanks A: import { ComponentFixture, TestBed } from '@angular/core/testing'; import { Weight } from './weight'; describe('BLABLABLA', () => { let comp: Weight; beforeEach(() => { TestBed.configureTestingModule({ declarations: [ BannerComponent ], // declare the test component fixture = TestBed.createComponent(Weight); comp = fixture.componentInstance; // Weight test instance }); it('has to give the addition of two numbers', () => { expect(comp.getSomeValue(5,5)).toEqual(10); }); }); Keep your configuration as is, you need to look at the following two links if you are new to testing in angular: https://angular.io/docs/ts/latest/guide/testing.html https://jasmine.github.io/2.4/introduction.html
2024-04-15T01:27:15.642919
https://example.com/article/3156
Q: Preact You may need an appropriate loader to handle this file type Just need some help please I'm losing my mind with this struggle. I've searched a lot of posts of this kind of same issue and it didn't work that's what I'm here asking for help. I'm currently running simple React on a webpack-dev-server and when I want to establish the preact compat I just get this error: You may need an appropriate loader to handle this file type on Client.jsx This are the files: Client.jsx import React from 'react'; import { render } from 'react-dom'; import { BrowserRouter } from 'react-router-dom'; import App from './App'; const renderClient = () => { render( <BrowserRouter> <App /> </BrowserRouter>, document.getElementById('app'), ); }; renderClient(); webpack.config.js const path = require('path'); const webpack = require('webpack'); const config = { context: __dirname, entry: './src/components/Client.jsx', devtool: 'cheap-module-eval-source-map', output: { path: path.join(__dirname, 'public'), filename: 'bundle.js', publicPath: '/public/', }, resolve: { extensions: ['.js', '.jsx', '.json'], alias: { react: 'preact-compat', 'react-dom': 'preact-compat', }, }, devServer: { publicPath: '/public/', historyApiFallback: true, }, stats: { colors: true, reasons: true, chunks: false, }, plugins: [new webpack.NamedModulesPlugin()], module: { rules: [ { enforce: 'pre', test: /\.js$/, loader: 'eslint-loader', exclude: /node_modules/, }, { test: /\.jsx?$/, loader: 'babel-loader', include: [path.resolve('js'), path.resolve('node_modules/preact-compat/src')], }, ], }, }; if (process.env.NODE_ENV === 'production') { config.devtool = 'source-map'; config.plugins = []; } module.exports = config; .babelrc { "plugins": [ ["transform-react-jsx", { "pragma": "h" }], [ "module-resolver", { "root": ["."], "alias": { "react": "preact-compat", "react-dom": "preact-compat" } } ] ], "presets": [ "react", [ "env", { "targets": { "browsers": "last 2 versions" }, "loose": true, "modules": false } ] ], "env": { "test": { "plugins": ["babel-plugin-transform-es2015-modules-commonjs"] } } } A: In your .jsx rule you only include files in the directories ./js/ and ./node_modules/preact-compat/src/, but your entry is ./src/components/Client.jsx and therefore Babel is not applied to it. You would also need to add the ./src/ files to the rule. The path.resolve('js') should probably have been path.resolve('src'), unless you have a ./js/ directory that is used from your code. Additionally, the preact-compat/src is unnecessary, since it ships an already transpiled code, that will be used when you import preact-compat. { test: /\.jsx?$/, loader: 'babel-loader', include: [path.resolve('src')], }, Instead of only including what you need to transpile, you could exclude everything you don't want to transpile. That would usually be node_modules as you've done in your ESLint rule. { test: /\.jsx?$/, loader: 'babel-loader', exclude: /node_modules/, },
2024-05-29T01:27:15.642919
https://example.com/article/2039
Q: How to stop AnythingSlider on the final slide? How can I make the slider stop playing once it reaches the final slide? It's this slider here. A: Brian's answer was almost spot on. The only change needed was to base.$items.length()-1 The correct code, for anyone who might want to use it, is: base.goForward = function(autoplay){ if(autoplay !== true) autoplay = false; if(autoplay && base.currentPage == base.pages) { base.startStop(false); // stops auto play return; } base.gotoPage(base.currentPage + 1, autoplay); };
2023-11-06T01:27:15.642919
https://example.com/article/8129
Shoptalk: Educator Owner Greg Levy (left) and his son Aaron Levy are flanked by school supplies at Educator, a teaching supply store that opened in 1976. Right on the edge of Fat City, there's an unlikely establishment specializing in supplies for teachers. The exterior of the Educator (3017 Edenborn Ave., Metairie, 454-5147; 1760 Stumpf Blvd., Terrytown, 367-8910) features a big yellow school bus to welcome teachers, parents and children. Inside the former carpet factory, owner Gary Levy helps his sons Greg and Aaron run the store. "Thirty-seven years ago my wife Jan and I started this store because there was a need for school supplies and teacher supplies," says Levy, who despite being retired loves coming into the store every day, He and his wife opened Educator in 1976, and since then have added a second location on Edenborn Avenue. The store's atmosphere resembles a classroom. Specialty rugs, tables and chairs, puzzles, chalkboards and posters line the front area and help children feel comfortable in the store. "The kids come in and see things from their own classroom," Levy says, "and they identify with that." Parents can find nap mats, crayons, pencils, markers, art supplies, books bags and notebooks for kids to bring to school. There are math, science, grammar, creative writing and English workbooks, grade books and classroom charts, motivational posters and bulletin board borders. These goods, as well as the laminating machine, help teachers customize their classrooms and cater to their students. "A successful teacher is going to select products that work for her," Levy says. The wide variety of items draws teachers year after year, some of whom reunite with their peers when they shop in August. "We have one customer who flies from her home in South America every year," Levy says. "She comes to the store and stocks up on supplies, and then flies back to South America to teach." Sometimes people outside the teaching profession frequent Educator. "We get business from hotels so they can decorate their break rooms," Levy says. Hollywood film industry professionals come in for set items. "They buy tables, or mats or chairs," Levy says. "Anything they buy and use, they then donate to schools around the area." Though new technologies have shifted the landscape of education, Levy says his business has kept abreast of the changes while staying true to the fundamentals. "Our offerings have blossomed over the years, but we still believe in the basic building blocks of education," Levy says. "Making sure a child can read at their particular level, write and speak correctly by the time they leave the classroom is important to us."
2023-11-19T01:27:15.642919
https://example.com/article/7767
Q: Checking a field of a generic type public static int GetResult<TType>(TType aObject) { if(aObject.mValue==12) return 99; return 20; } How can I check the field mValue of TType, I'm guessing reflection may come into this, but I'm unsure how? Thanks. A: Generics are useful when you want to preserve strong typing and compile-time safety. If you are going to resort to Reflection no need to use generics. So one way would be to define an interface or a base class containing this property: public interface IFoo { int Value { get; set; } } and then have a generic constraint on the type: public static int GetResult<TType>(TType aObject) where TType: IFoo { if(aObject.Value == 12) { return 99; } return 20; }
2023-08-31T01:27:15.642919
https://example.com/article/3205
Q: variadic macro to generate a vector of strings from a collection of unknown parameters Currently I am working on a function similar to the String.Format(...) function from C#, just in C++. (String.Format(...)) But that's not my problem. The function works fine but problematic is that it takes a vector<string> as parameter and if I want to use an integer as parameter, I must write code like this: // function prototype, the function body is not relevant here string format(string str, vector<string> variables); // ... some context // i could use to_string() here, // but imagine a complex type which only overrides the stream operator int a = 20; stringstream ss; ss << a; string a_str = format("a has the value '{}'", { ss.str() }); That's quite some boilerplate code! Thus I need a function which converts a collection of unknown data types into a vector<string>. I tried a few things like this: vector<string> vec_string(vector<void*> args) { vector <string> result; for (unsigned i = 0; i < args.size(); i++) { stringstream ss; // I can't dereference an object without knowing to pointer type. :( ss << *((int*)args[i]); result.push_back(ss.str()); } return result; } // ... some context int a = 10; cout << format("some int: '{}'", vec_string({ (void*) &a })); Which obviously only works for integer and is very uncomfortable. I feel like the only way to do this is a variadic macro but I got no idea how they work. here is a link to my format(...) method. I am sorry about my spelling, but I tried my best correcting it. A: This can be done relatively easily with variadic templates: template <class T> auto toString(T&& t) { std::stringstream s; s << std::forward<T>(t); return s.str(); } template <class... T> auto toStringVector(T&&... args) { std::vector<std::string> res {toString(std::forward<T>(args))...}; return res; } This will convert each parameter to std::string via a stringstream and then return an std::vector<std::string> containing said strings. (Live example.) You can then use this straight forward as intended in the question, that is: std::cout << format("some text", toStringVector(any, number, of, arguments, of, any, type)); If you are using Boost, you can skip the toString helper in favor of boost::lexical_cast: template <class... T> auto toStringVector(T&&... args) { std::vector<std::string> res { boost::lexical_cast<std::string>(std::forward<T>(args))...}; return res; } The lexical_cast will most likely be faster on built-in types.
2023-08-25T01:27:15.642919
https://example.com/article/5855
Q: Any ideas how to display divs vertically in bootstrap container? I have these divs that are products <div class="container"> <div class="product"> <div class="image"><img class="img-responsive" src="http://www.shingpoint.com.pk/Images/Thumbnails/pc-a1-470-59100-080316082835.jpg"/></div> <div class="description"> <h4 class="productname">ASUS VivoMini PC - UN65H-M030M</h4> </div> <div class="price"> <span>Rs. 37,900</span> <input type="button" class="btn btn-primary btn-sm" value="Details"/> </div> </div> <div class="product"> <div class="image"><img class="img-responsive" src="http://www.shingpoint.com.pk/Images/Thumbnails/pc-a1-470-59100-080316082835.jpg"/></div> <div class="description"> <h4 class="productname">ASUS VivoMini PC - UN65H-M030M</h4> </div> <div class="price"> <span>Rs. 37,900</span> <input type="button" class="btn btn-primary btn-sm" value="Details"/> </div> </div> </div> And its CSS .image{ display: block; overflow: hidden; position: relative; text-align: center; width: 100%; max-height: 180px; height: 60%; margin-left: auto; margin-right: auto; padding-left:.40cm; } .description{ margin: 0 auto; max-width: 95%; } .productname{ overflow: hidden; display: block; margin: 25px 0 0; padding: 0; line-height: 24px; } .price{ margin-top: 10px; margin-bottom: 8px; font-size: 18px; font-weight: 500; color: #E40613; } .product{ height: 320px; border: 1px solid #DDDDDD; border-bottom: 1px solid #DDDDDD; text-align: center; padding: 10px 0; } Now these are just two divs but they can be 10 or 15 through foreach loop when data is fetched from mysql Now these divs are showing horizontally I want to have them vertically in a container with a slider, if not slider possible then how could displaying vertically be achieved? A: You have to add display: inline-block to the product class. You may need to define widths as well if you have many divs.
2023-10-30T01:27:15.642919
https://example.com/article/6126
package net.dongliu.requests; public class Methods { public static final String GET = "GET"; public static final String POST = "POST"; public static final String PUT = "PUT"; public static final String HEAD = "HEAD"; public static final String DELETE = "DELETE"; public static final String PATCH = "PATCH"; public static final String TRACE = "TRACE"; public static final String OPTIONS = "OPTIONS"; public static final String CONNECT = "CONNECT"; }
2024-03-17T01:27:15.642919
https://example.com/article/2752
<?xml version="1.1" encoding="UTF-8"?> <!-- * See the NOTICE file distributed with this work for additional * information regarding copyright ownership. * * This is free software; you can redistribute it and/or modify it * under the terms of the GNU Lesser General Public License as * published by the Free Software Foundation; either version 2.1 of * the License, or (at your option) any later version. * * This software is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this software; if not, write to the Free * Software Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA * 02110-1301 USA, or see the FSF site: http://www.fsf.org. --> <xwikidoc version="1.3" reference="WikiManager.Translations" locale="ru"> <web>WikiManager</web> <name>Translations</name> <language>ru</language> <defaultLanguage>en</defaultLanguage> <translation>1</translation> <creator>xwiki:XWiki.Admin</creator> <parent>XWiki.WebHome</parent> <author>xwiki:XWiki.Admin</author> <contentAuthor>xwiki:XWiki.Admin</contentAuthor> <version>1.1</version> <title>Wiki Manager Translations</title> <comment/> <minorEdit>false</minorEdit> <syntaxId>plain/1.0</syntaxId> <hidden>true</hidden> <content># Various translations that are used in the wiki template and, implicitly, in the created wiki. ## MENU core.menu.type.wiki=Вики core.menu.watchlist.add.wiki=Следить за вики core.menu.watchlist.remove.wiki=Отменить слежение за вики core.menu.admin.wiki=Управление Вики # WIKI INFORMATION PANEL platform.wiki.panel.title=Информация о вики # MESSAGES platform.wiki.currentwiki.welcome=Добро пожаловать в вики {0}{1}{2}. platform.wiki.currentwiki.currentUserIsOwner=Вы владелец этой вики. platform.wiki.currentwiki.currentUserIsAdmin=Вы администратор этой вики. platform.wiki.currentwiki.joinNeedToLogin=Чтобы присоединиться к этой вики, нужно войти в систему. platform.wiki.currentwiki.currentUserNotMember=Вы не участник этой вики. platform.wiki.currentwiki.currentuserCanJoin=Если хотите, вы можете {0}присоединиться к этой вики{1}. platform.wiki.currentwiki.currentUserIsMember=Вы участник этой вики. platform.wiki.currentwiki.currentUserCanLeave=Если хотите, вы можете {0}покинуть эту вики{1}. platform.wiki.currentwiki.gadgetTopActiveUsersAllMembers=Чтобы увидеть полный список участников вики, см. {0}Каталог пользователей{1}. platform.wiki.currentwiki.invitationPendingForCurrentWiki=Вы были приглашены присоединиться к этой вики. platform.wiki.currentwiki.joinRequestPendingForCurrentWiki=Вы отправили запрос на присоединение к этой вики. platform.wiki.currentwiki.joinRequestAcceptedNotification=Ваш запрос на присоединение к вики ''{0}'' был принят. platform.wiki.currentwiki.joinRequestRejectedNotification=Ваш запрос на присоединение к вики ''{0}'' был отклонен. platform.wiki.currentwiki.candidateHandledSaveComment=Обработанный кандидат {0} ({1}) platform.wiki.currentwiki.candidateHandledComment=Комментарий: platform.wiki.currentwiki.candidateAcceptedSuccess=Запрос принят. platform.wiki.currentwiki.candidateRejectedSuccess=Запрос отклонен. platform.wiki.currentwiki.inviteUserAlreadyMember={0} уже является участником этой вики. platform.wiki.currentwiki.inviteRequestAlreadyExists={0} уже имеет ожидающий запрос. Пожалуйста, ответьте на этот запрос. platform.wiki.currentwiki.inviteUserAlreadyInvited={0} уже получил ожидающее приглашение. platform.wiki.currentwiki.inviteSaveComment=Пользователь ''{0}'' был приглашен присоединиться к вики. platform.wiki.currentwiki.inviteNotification=Вас пригласили присоединиться к вики ''{0}''. platform.wiki.currentwiki.inviteSuccess={0} успешно приглашен. platform.wiki.currentwiki.invitationCancelSaveComment=Отмененное приглашение {0} ({1}) platform.wiki.currentwiki.invitationCancelNotification=Ваше приглашение было отменено и больше не действует. platform.wiki.currentwiki.invitationCancelSuccess=Приглашение успешно отменено. platform.wiki.currentwiki.invitationCancelFailure=Ошибка, вы не можете отменить это приглашение. platform.wiki.currentwiki.candidateReviewFailure=Ошибка, вы не можете отменить это приглашение. # LABELS platform.wiki.currentwiki.prop.wikiprettyname.label=Отображаемое имя platform.wiki.currentwiki.prop.description.label=Описание platform.wiki.currentwiki.prop.owner.label=Владелец platform.wiki.currentwiki.prop.membershipType.label=Тип членства platform.wiki.currentwiki.prop.secure.label=Безопасность (SSL) platform.wiki.currentwiki.member.add=Добавьте или пригласите пользователей в вики platform.wiki.currentwiki.gadget.wikiInformation.label=Информация о вики platform.wiki.currentwiki.gadget.topActiveUsers.label=ТОП активных участников platform.wiki.currentwiki.panel.information.name.label=Название platform.wiki.currentwiki.panel.information.description.label=Описание platform.wiki.currentwiki.panel.information.members.label=Участники platform.wiki.currentwiki.invitation.view.label=Посмотреть приглашение platform.wiki.currentwiki.joinrequest.cancel.label=Отменить запрос platform.wiki.currentwiki.joinreques.request.label=Запрос присоединения platform.wiki.currentwiki.join.label=Присоединиться platform.wiki.currentwiki.leave.label=Покинуть вики platform.wiki.currentwiki.invite.username.label=Имя пользователя platform.wiki.currentwiki.invite.message.label=Сообщение platform.wiki.currentwiki.invite.button.label=Приглашение platform.wiki.currentwiki.candidates.label=Кандидаты platform.wiki.currentwiki.candidates.status.label=Состояние: platform.wiki.currentwiki.candidates.type.label=Тип: platform.wiki.currentwiki.candidates.reviewer.label=Администратор: platform.wiki.currentwiki.candidates.reviewermessage.label=Сообщение администратора: platform.wiki.currentwiki.candidates.reviewerprivatecomment.label=Частный комментарий: platform.wiki.currentwiki.candidates.accept.label=Принять platform.wiki.currentwiki.candidates.reject.label=Отклонить platform.wiki.currentwiki.candidates.invitation.cancel.label=Отменить приглашение platform.wiki.currentwiki.wikiusers.title=Пользователи вики platform.wiki.currentwiki.managewikis.title=Вики WikiManager.WikiCandidateMemberClass_status_pending=Ожидающий WikiManager.WikiCandidateMemberClass_status_accepted=Принятый WikiManager.WikiCandidateMemberClass_status_rejected=Отклоненный WikiManager.WikiCandidateMemberClass_type_request=Запрос WikiManager.WikiCandidateMemberClass_type_invitation=Приглашение # HINTS platform.wiki.currentwiki.prop.wikiprettyname.hint=Отображаемое имя вики. platform.wiki.currentwiki.prop.description.hint=Краткое описание вики и ее назначение. platform.wiki.currentwiki.prop.owner.hint=Пользователь, у которого есть все права на вики. platform.wiki.currentwiki.prop.membershipType.hint=Как пользователи могут присоединиться к этой вики. platform.wiki.currentwiki.prop.secure.hint=Если включено, все внешние URL, сгенерированные этой вики, будут начинаться с {0}https:~/~/{1}. platform.wiki.currentwiki.invite.username.hint=Имя пользователя для добавления в вики. platform.wiki.currentwiki.invite.message.hint=Сообщение для отправки пользователю. platform.wiki.currentwiki.candidates.hint=Пользователи, которые подали запрос или были приглашены, чтобы присоединиться к вики. platform.wiki.currentwiki.candidates.empty=Ни один пользователь не подал запрос или не был приглашен, чтобы присоединиться к вики. # ADMIN admin.xwiki.manageworkspace.description=Управляйте настройками, такими как имя вики, описание, владелец и тип членства. admin.xwiki.workspaceusers.description=Управление участниками вики: добавление, удаление, приглашение, принятие или отклонение членов вики. admin.xwiki.usersconfiguration.title=Настройка admin.xwiki.members.title=Текущие участники admin.xwiki.users.title=Все пользователи # DRAWER ITEM platform.wiki.drawer.homeWiki=Домашняя страница</content> </xwikidoc>
2023-11-27T01:27:15.642919
https://example.com/article/4146
// Copyright 2019 Google Inc. All Rights Reserved. // // Licensed under the Apache License, Version 2.0 (the "License"); // you may not use this file except in compliance with the License. // You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. package com.google.androidbrowserhelper.trusted.splashscreens; import androidx.browser.customtabs.CustomTabsSession; import androidx.browser.trusted.TrustedWebActivityIntentBuilder; /** * Defines behavior of the splash screen shown when launching a TWA. */ public interface SplashScreenStrategy { /** * Called immediately in the beginning of TWA launching process (before establishing * connection with CustomTabsService). Can be used to display splash screen on the client app's * side before the browser is launched. * @param providerPackage Package name of the browser being launched. Implementations should * check whether this browser supports splash screens. * @param builder {@link TrustedWebActivityIntentBuilder} with user-specified parameters, such * as status bar color. */ void onTwaLaunchInitiated(String providerPackage, TrustedWebActivityIntentBuilder builder); /** * Called when TWA is ready to be launched. * @param builder {@link TrustedWebActivityIntentBuilder} to be supplied with splash screen * related parameters. * @param session {@link CustomTabsSession} with which the TWA will launch. * @param onReadyCallback Callback to be triggered when splash screen preparation is finished. * TWA is launched immediately upon triggering this callback. */ void configureTwaBuilder(TrustedWebActivityIntentBuilder builder, CustomTabsSession session, Runnable onReadyCallback); }
2023-11-19T01:27:15.642919
https://example.com/article/6378
// Copyright 2015-2020 Swim inc. // // Licensed under the Apache License, Version 2.0 (the "License"); // you may not use this file except in compliance with the License. // You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. import {AnyItem, Item} from "../Item"; import {Num} from "../Num"; import {ItemInterpolator} from "./ItemInterpolator"; export class NumInterpolator extends ItemInterpolator<Num> { /** @hidden */ readonly y0: number; /** @hidden */ readonly dy: number; constructor(y0: number, y1: number) { super(); this.y0 = y0; this.dy = y1 - this.y0; } interpolate(u: number): Num { return Num.from(this.y0 + this.dy * u); } deinterpolate(y: AnyItem): number { y = Item.fromAny(y); if (y instanceof Num) { return this.dy !== 0 ? (y.value - this.y0) / this.dy : this.dy; } return 0; } equals(that: any): boolean { if (this === that) { return true; } else if (that instanceof NumInterpolator) { return this.y0 === that.y0 && this.dy === that.dy; } return false; } } ItemInterpolator.Num = NumInterpolator;
2024-06-16T01:27:15.642919
https://example.com/article/2577
class corsMiddleware(object): def process_response(self, req, resp): resp["Access-Control-Allow-Origin"] = "*" return resp
2024-05-06T01:27:15.642919
https://example.com/article/2523
Application.Modal.Behavior = Marionette.Behavior.extend({ initialize: function () { this.listenToOnce(this.view, 'modal:open', this.openModal); }, openModal: function (callback) { Application.Modal.channel.commands.execute('open', { view: this.view, callback: callback }); this.listenToOnce(this.view, 'modal:close', this.closeModal); }, closeModal: function (callback) { Application.Modal.channel.commands.execute('close', { callback: callback }); } });
2024-01-25T01:27:15.642919
https://example.com/article/6409
Riverwood flu clinics open Influenza or “flu” is a serious contagious disease that kills thousands every year and is the most frequent cause of death from a vaccine preventable disease in the United States. Minnesota influenza outbreaks typically occur between December through April. Antibodies develop about two weeks after getting the vaccine, but drops in the elderly and those with immuno-compromising diseases. Riverwood Healthcare Center will offer flu clinics for the public by appointment at all three of its clinics on the dates and times listed here. To make an appointment, call Riverwood’s toll-free flu line at (888) 303-4550. Flu shot appointments can be scheduled online through MyChart for those Riverwood patients who are using this online tool to manage their health. A link to the MyChart login is on the Riverwood website homepage. Due to the current clinic construction project, the Aitkin flu shot clinic will be held in the Michael Ryan Support Services wing lobby of the hospital. Park at Riverwood’s south entrance.Riverwood will NOT be offering the live attenuated influenza vaccine (also known as the nasal spray or Flu Mist). Everyone, 6 months and older, is still recommended to get the vaccine. “While the flu vaccine does not always protect us from getting influenza, research shows that receiving a flu vaccine each year can reduce the risk of hospitalizations, pneumonia, and death,” said Laura Wood, infection preventionist. “At Riverwood, we are committed to keeping our hospital and clinic patients safe and we urge community members to get flu shots, cover their coughs or sneezes, perform hand hygiene, and refrain from visiting hospital patients when you are ill.” Laura Wood offers these responses to common concerns about getting a flu shot: “I got the flu vaccine and I still got sick.”The vaccine does not always protect individuals from getting influenza, however, it does decrease the risk of hospitalization and death. Last year, 80 percent of the 180 pediatric deaths were in unvaccinated children. Those who get the vaccination and then get infected with influenza often have a shorter and less severe illness, even during influenza seasons when the vaccine is not a good match. “I never get sick, I don’t need a flu shot.” Getting vaccinated helps protect others. Individuals can be infectious from about one day before symptom onset to up to seven days after becoming sick. The vaccine also protects those who get flu shots. There is also a growing body of research showing influenza vaccination has been associated with reduced hospitalizations among people with diabetes and chronic lung disease. “I am allergic to eggs.”Egg allergies alone are no longer a reason to not get vaccinated. The advisory committee on immunization practices recommends all people with egg allergies still talk with their provider about getting vaccinated.
2024-06-18T01:27:15.642919
https://example.com/article/2714
Looks like the diplomatic efforts of Egyptian president Abdel Fattah al-Sisi may have paid off. Khaled Mashaal, who ran the recent Hamas war on Israel from the safety of Doha where he has long kept his organization’s worldwide headquarters, got kicked out of Qatar altogether — along with the Muslim Brotherhood. CNN reports that the expelled officials will likely end up in Turkey: Hamas political leader Khaled Meshaal and members of the Muslim Brotherhood have been expelled from Qatar, a Hamas-run news agency reported Tuesday. The officials are most likely headed to Turkey, the report said.The move comes after... A is A. Jihad is savagery. Hamas top dog Khaled Mashaal: "Nothing will restore the homeland but jihad, the rifle, and self-sacrifice" Jihadwatch: Muslims have been frequently writing and tweeting me, asking me, "What is your definition of jihad?" "What do you know about jihad, anyway?" and the like. It is certain, however, that none of them will write to Khaled Mashaal and ask him the same question. All that nonsense is solely a tactic to fool the kuffar. "Mash'al: The Homeland Will Be Restored Only Through Jihad, The Rifle, And Self-Sacrifice," from MEMRI, October 7 (thanks to all who... Exiled Hamas leader Khaled Mashaal met with Iranian President Mahmoud Ahmadinejad in Tehran, Iran, on Sunday, according to Iran's semi-official Fars news agency. During the meeting, Ahmadinejad told Mashaal that "Iran will always stand by the oppressed people of Palestine," Fars reported. Rifqa Bary is an Ohio teenager who recently fled to Florida claiming that her father seeks to murder her in an “honor killing.” While the media seeks to report the matter as a he said, she said story, there are some very disturbing details that back up her story. For starters, Rifqa’s parents are members of the Noor Islamic Cultural Center. The Center was home to resident scholar Salah Sultan, who calls himself a ‘friend and pupil’ of avowed terror supporter and advocate of suicide bombings Yusuf Qaradawi. Qaradawi is designated by the United States as a ‘Specially Designated Global... MOSSAD'S KILLING MACHINE COMES TO BRITAIN A killing war between Israel's Mossad and Islamic fanatics came closer this weekend in Britain. The Israeli intelligence agency has sent four members of its kidon assassination squad to this country, to join fifteen other handpicked katsas, its relentless field agents. Their brief is to "disable" any of the "close to 50" British Muslims that the extremist Islamic group, Al-Muhajiroun, last week boasted were ready to carry out suicide missions similar to the one in Tel Aviv. Al-Muhajiroun spokesman, Asif Butt, said the 50 were "primed and ready to go". The threat was sufficient... How The West Was Won The rapid and unexpected decline of the Sunni insurgency in Iraq was officially recognized this week, when Maj. Gen. John Kelly, commanding the Marine Expeditionary Force, turned operational control of Anbar Province over to the Iraqi army and police. Anbar, a vast expanse of desert the size of North Carolina, had been the stronghold of the Sunni insurgency. For years, foreign fighters loyal to al-Qaida had sneaked across Iraq's northwestern border with Syria, into Anbar and down a "rat line" of safe houses in Haditha, Ramadi and Hit. From Fallujah, the arch terrorist Zarqawi... Hamas leader Khaled Mashaal made a speech in favor of the “Palestinian reproductive machine” at his daughter Fatima’s wedding over the weekend. The “machine” is constantly active, Mashaal said. He told his daughter and son-in-law that their children would one day live in the “48 territories,” that is, within Israel’s 1948 borders. Mashaal took time from his speech to thank Syria for allowing him, Islamic Jihad head Ramadan Shallah, and other senior terrorists to live in Damascus. “We realize the pressures on Syria for housing Mashaal and Shallah,” he said. Shallah attended the wedding, as did PFLP head Mahir at-Tahir,... Aug. 4, 2004 21:16 | Updated Aug. 4, 2004 22:01 New Zealand passport scam takes Canadian twist By HERB KEINON The New Zealand passport flap is thickening, with Canada trying to determine whether one of the Israelis allegedly involved in the scam who managed to leave New Zealand is traveling on a stolen Canadian passport. Canadian Foreign Ministry spokesman Reynald Doiron confirmed to The Jerusalem Post that the Canadian police and other federal agencies are investigating whether Ze'ev Barkan, one of the men New Zealand suspects of involvement in the scandal but who has reportedly left the country, is traveling... Saturday, February 25, 2006Iran, Hamas, and the Threat of Nuclear Holocaust The front page of the Arabic website of the military wing of Hamas, the Ezzedeen alQassam Brigades, features an animated graphic at the top on the right hand column. It's a black rectangle with a red Star of David. The Jewish star shatters with a nuclear explosion. This graphic is notably missing from the English language website. Only the Jerusalem Post and a few pro-Israel blogs found this particularly newsworthy. Interestingly enough this graphic appeared on the exact same day Iran offered to fund the Hamas-lead Palestinian government. For... Sunday, February 19, 2006The Correct Response To Hamas One of CNN's world news headlines today reads: Israel PM rules out Hamas contacts. The implication is that this sort of Israeli action is a bad thing, a deterrent to some sort of illusive peace. Quite the contrary. Prime Minister Olmert correctly states: ...the Palestinian Authority is, in effect, becoming a terrorist authority. Israel will not agree to that. Israel will not compromise with terror and will continue to fight it with all its might. However, we have no intention of harming the humanitarian needs of the Palestinian population. Israel will not... Sep. 25, 2004 17:49 | Updated Sep. 26, 2004 20:49 Mashaal: Hamas is in state of alert By ASSOCIATED PRESS CAIRO, Egypt Khaled Mashaal, the head of Hamas's political bureau, whose group sends suicide bombers into Israel, knows that Israel has him targeted again. And the leader of the Damascus-based political bureau of Hamas is taking no chances. "We are in a state of alert and vigilance," he told The Associated Press this week during a visit to Cairo from his home base in the Syrian capital, Damascus. Since the double Hamas suicide bombing on August 31 in the southern... Khaled Mashaal, who has emerged as the paramount figure in Hamas following the assassination of Abdel-Aziz al-Rantissi by Israel, is a hardline militant who favours a military solution to the Israeli-Palestinian conflict. The Damascus-based Mashaal, head of Hamas' political bureau, said after Rantissi's death yesterday in an airstrike in Gaza City that Israeli Prime Minister Ariel Sharon was seeking to "eliminate" Hamas, while insisting that the Islamic group "will not stop ... as this is the price of liberation." "Select a leader for the movement in Gaza to replace our brother, martyr and fighter Abdel-Aziz Rantissi, but do not disclose... Nov. 16, 2003 Hamas: Attack Israel, Iraq not Saudi Arabia By ASSOCIATED PRESS BEIRUT, Lebanon Khaled Mashaal, head of the Hamas' bureau in Damascus, denounced the perpetrators of last week's deadly Riyadh suicide bombings and urged attacks on Israel and the US forces instead. The Nov. 8 al-Qaida-linked attack on a residential compound in the Saudi capital killed 17 people and injured scores more. The attack, in which most of the victims were either Arabs or Muslims, angered many throughout the Middle East and was seen as a direct strike on the U.S.-allied Saudi royal family. During a speech in... Oct. 30, 2003 Hamas political chief rules out truce with Israel By ASSOCIATED PRESS BEIRUT, Lebanon Hamas supporters Photo: AP Khaled Mashaal, Hamas political chief, ruled out a quick agreement for truce with Israel, alleging it was because Israel and the United States were not interested. Israeli Prime Minister Ariel "Sharon does not want a cease-fire and the U.S. is preoccupied with Iraq and its elections," Mashaal, speaking from Beirut, said in an interview Wednesday with the Dubai-based Al-Arabiya television. Earlier Wednesday, Palestinian Prime Minister Ahmed Qureia said truce talks with Hamas have been "constructive" and he hoped to get...
2024-07-06T01:27:15.642919
https://example.com/article/8941
Kids these days, always plugged in to their smartphones and laptops and Instagrams, constantly suffering from the compulsion to record every aspect of their lives. For a superhero, this is probably a bad idea, given the whole secret identity thing and all — but our new Peter Parker is very much a millennial, and he’s going to vlog this whole thing if it kills him. Marvel recently released the recording Peter Parker made of his whole experience during his first appearance Captain America: Civil War. This is definitely the most enthusiastic Spider-Man we’ve seen, and it’s such a joy to watch Tom Holland freak the hell out about stuff like private jets, hotel rooms, and the new suit Tony Stark gifts him. That’s such a touching moment there at the end when Peter lowers his phone in shock when he figures out Tony’s going to let him keep his new tricked-out suit. Thrilled by his experience with the Avengers, Peter returns home, where he lives with his Aunt May, under the watchful eye of his new mentor Tony Stark. Peter tries to fall back into his normal daily routine — distracted by thoughts of proving himself to be more than just your friendly neighborhood Spider-Man — but when the Vulture emerges as a new villain, everything that Peter holds most important will be threatened.
2024-07-07T01:27:15.642919
https://example.com/article/3446
Thursday, September 05, 2019 In a major relief to the national carrier, oil companies have agreed to continue the supply of aviation fuel (ATF) to Air India, after the Centre intervened. An arrangement was arrived at after a couple of meetings were held by the Aviation secretary with representatives from the concerned oil companies recently, say sources. The Oil Marketing Companies (OMC) were assured that their dues would be cleared soon, in two to three tranches. Air India owes approximately Rs 4,300 crore to three oil companies, viz, Indian Oil, Hindustan Petroleum and Bharat Petroleum. Since April, the airline has been defaulting on it’s cash-and-carry arrangement, where it pays Rs 18 crore, per day, to these companies for tanking up. 05/09/19 Sameer Dixit/DNA
2024-03-14T01:27:15.642919
https://example.com/article/7482
Introduction {#s1} ============ It is estimated that about 12.7 million multiple cancer cases and 7.6 million cancer deaths have occurred in 2008 worldwide, with more than half of the cases and about two-thirds of the deaths in the developing countries [@pone.0094039-Jemal1]. The evidence is mounting that cancer is a complex disease results from interactions between multiple genetic backgrounds and environmental factors [@pone.0094039-Liu1], [@pone.0094039-Reeves1]. Of late, a number of studies demonstrate that genetic variants of the genes that regulate the activation and proliferation of T lymphocytes and nature killer (NK) cells may influence cancer risk [@pone.0094039-Zhang1], [@pone.0094039-Welsh1]. In the last decade, single nucleotide polymorphisms (SNPs) have been extensively investigated, and many studies have examined the hypothesis that genetic variants of the immune genes may be relevant to the risk of a variety of cancers [@pone.0094039-Sun1], [@pone.0094039-Hu1]. Cytotoxic T-lymphocyte antigen 4 (CTLA-4), also named CD152, is a member of the immunoglobulin superfamily. CTLA-4 is expressed mainly on activated T cells, acts as a vital restraining regulator of T-cell proliferation and activation, and induces Fas-independent apoptosis of activated T cells to further inhibit immune function of T-cell [@pone.0094039-Sun1], [@pone.0094039-Scheipers1]. Blocking CTLA-4 function and enhancing T cell activation, several different types of malignant neoplasms in tumor-transplanted mice were inhibited or cured, and owned long-lasting antitumor immunity [@pone.0094039-Vandenborre1]. It suggests that CTLA-4 plays an important role in carcinogenesis. *CTLA-4* gene is located on chromosome 2q33, and is composed of four exons that encode several functional domains of the CTLA-4 protein and possess several vital SNPs, such as the +49A/G (rs231775), -318C/T (rs5742909), CT60G/A (rs3087243), -1661A/G (rs4553808), and -1722T/C (rs733618) SNPs, etc [@pone.0094039-Sun1], [@pone.0094039-Ueda1]. A meta-analysis showed that *CTLA-4* +49A/G polymorphism may be a risk factor for cancer, whereas -318C/T and +6230G/A (CT60) polymorphisms were lack of association with cancer [@pone.0094039-Zhang1]. Of late, Geng and colleagues reported a meta-analysis with a negative result on the association between *CTLA-4* -1722T/C polymorphism and cancer risk [@pone.0094039-Geng1]. Linkage disequilibrium (LD) plot of *CTLA-4* (involving rs733618, rs4553808, rs5742909, rs231775 and rs3087243) was generated using Haploview 4.2 program and the results suggest that −1661A/G (rs4553808) and −318C/T (rs5742909) are in high LD; the others are in low LD [@pone.0094039-Geng1]. The *CTLA-4* -1722T/C polymorphism has not been investigated in esophageal cancer. To further investigate this potential relationship, we decided to evaluate the association of *CTLA-4* -1722T/C polymorphism with esophageal cancer risk in a hospital based case-control study, and then performed a comprehensive meta-analysis to derive a more precise result. Materials and Methods {#s2} ===================== Subjects {#s2a} -------- This hospital-based case--control study included 629 sporadic esophageal squamous cell carcinoma (ESCC) cases and 686 cancer-free subjects consecutively recruiting from the Affiliated People\'s Hospital of Jiangsu University and Affiliated Hospital of Jiangsu University (Zhenjiang City, Jiangsu Province, China), between October 2008 and December 2010. All recruited subjects were local residents of Han Chinese population, and all ESCC subjects were diagnosed by surgical resection and pathologic examination. The ESCC subjects who had a history of personal malignant tumor or autoimmune disorder, or had undergone radiotherapy or chemotherapy were excluded. Ethnicity, gender and average age (±5 years) of the controls were well matched to esophageal cancer cases. The control individuals were selected from the two hospitals for cure of fracture. At recruitment, this hospital based case-control study was approved by the Ethics Committee of Jiangsu University (Zhenjiang, China). Information of all subjects was collected from a structured questionnaire which was administered by two experienced research doctors. The information of demographic data (e.g. age, gender) and related risk factors (such as, tobacco use and alcohol consumption) is listed in [**Table 1**](#pone-0094039-t001){ref-type="table"}. Each subject signed the written informed consent and donated 2-ml sample of peripheral blood. 10.1371/journal.pone.0094039.t001 ###### Distribution of selected demographic variables and risk factors in ESCC cases and controls. ![](pone.0094039.t001){#pone-0094039-t001-1} Variable Cases (n = 629) Controls (n = 686) *P* [a](#nt101){ref-type="table-fn"} --------------------------- ----------------- -------------------- ------- -------------------------------------- ------------- **Age (years)** mean ± SD 62.85 (±8.13) 62.58 (±7.89) 0.541 **Age (years)** 0.155 \<63 310 49.28 365 53.21 ≥63 319 50.72 321 46.79 **Sex** 0.185 Male 444 70.59 461 67.20 Female 185 29.41 225 32.80 **Tobacco use** **\<0.001** Never 355 56.44 499 72.74 Ever 274 43.56 187 27.26 **Alcohol use** **\<0.001** Never 428 68.04 526 76.68 Ever 201 31.96 160 23.32 Two-sided *χ* ^2^ test and student *t* test; Bold values are statistically significant (*P*\<0.05). DNA extraction, SNP selection, and genotyping {#s2b} --------------------------------------------- Blood samples were collected with ethylenediamine tetra-acetic acid (EDTA) anticoagulant vacutainer tubes (BD Franklin Lakes NJ, USA). Genomic DNA was extracted from lymphocytes using the QIAamp DNA Blood Mini Kit (Qiagen, Berlin, Germany) and DNA samples were frozen at −80°C. Genotyping of *CTLA-4* -1722T/C polymorphism was carried out using the polymerase chain reaction-ligase detection reactions (PCR-LDR) method [@pone.0094039-Chen1]. The Shanghai Biowing Applied Biotechnology Company provides technical support for genotyping. One hundred and sixty samples were randomly selected and reciprocally tested with directly sequencing for quality control, and the reproducibility were 100%. The primers of directly sequencing used for *CTLA-4* -1722T/C genotyping were as follows: F: 5\' GCAATAACAACCTAATGGGCAC 3\'; **R**: 5\' ACTTCCACAGGCTGAACCACT 3\' (**[Figure S1](#pone.0094039.s001){ref-type="supplementary-material"}**). Statistical analysis {#s2c} -------------------- Chi-square test (*χ* ^2^) was conducted to measure the differences in the distributions of genotypes, demographic characteristics and selected variables between esophageal cancer cases and controls. Genotype frequencies of *CTLA-4* -1722T/C polymorphism among the controls were tested for Hardy--Weinberg equilibrium (HWE) using an internet-based calculator (<http://ihg.gsf.de/cgi-bin/hw/hwa1.pl>). The associations between *CTLA-4* -1722T/C locus and the risk of ESCC were analyzed by unconditional logistic regression for crude ORs and adjusted ORs when it was appropriate. Statistical analyses were implemented in SAS 9.1.3 software (SAS Institute, Cary, NC). A *P*\<0.05 (two-tailed) was defined as the criterion of statistical significance. Meta analysis {#s2d} ------------- The meta-analysis is reported on the basis of the Preferred Reporting Items for Meta-analyses (PRISMA) guideline (**[Checklist S1](#pone.0094039.s002){ref-type="supplementary-material"}**) [@pone.0094039-Moher1]. Embase, PubMed, and CBM (Chinese BioMedical Disc), as well as CNKI (China National Knowledge Infrastructure) database were searched up to August 1st, 2013 for publications investigating the association of *CTLA-4* -1722T/C polymorphism with cancer risk. The combination terms were 'cancer' or 'tumor' or 'carcinoma' or 'neoplasm' and 'cytotoxic T-lymphocyte antigen 4′ or '*CTLA-4*′ or 'CD152', annexed with 'mutation' or 'variant' or 'SNP' or 'polymorphism'. In addition, the publication language was restricted to English and Chinese, and all studies performed in human subjects were identified. The search results were supplemented by checking all references listed in these studies and published reviews. Included studies were qualified if they met the major included criteria: (1) designed as a retrospective or nested case-control study, (2) evaluated the *CTLA-4* -1722T/C polymorphism and cancer risk, (3) provide genotype counts of *CTLA-4* -1722T/C polymorphism between cancer cases and controls, and (4) control genotype distributions consistent with HWE. The major excluded criteria were: (1) not case-control studies, (2) review publications and (3) overlapping data. Information was carefully and independently extracted by three reviewers (W. Tang, H. Qiu, and H. Jiang). In case of conflicting evaluations, differences were resolved by further discussion among all authors. The following data was extracted: first author, year of publication, cancer type, country, ethnicity, number of cases and controls, genotype method, allele and genotype frequency, and HWE in controls. In this meta-analysis, the crude odds ratio (OR) with the corresponding 95% confidence intervals (95% CI) was used to assess the strength of association between the *CTLA-4* -1722T/C polymorphism and cancer risk. The Z-test and *P*-value (two-tailed) was used to measure the significance of the pooled OR, and statistical significance was defined as *P*\<0.05 (two-tailed). Heterogeneity among studies was evaluated by a Chi-square-based I^2^ test, I^2^\<25% indicated low heterogeneity, 25%≤I^2^≤50% indicated moderate heterogeneity, and I^2^\>50% indicated large heterogeneity [@pone.0094039-Higgins1]. If I^2^\>50% or *P*\<0.10, the pooled ORs were calculated by the random-effects model (the DerSimonian--Laird method), otherwise the fixed-effects model was implemented (the Mantel--Haenszel method). Subgroup analyses were implemented to measure ethnicity-specific, cancer type-specific and system-specific effects according to ethnicity, cancer type (if any cancer type evaluated by less than three individual investigations, it was combined into \"other cancers\") and system. The funnel plot and Egger\'s test were carried out to measure publication bias, which was evaluated by visual inspection of an asymmetric plot. For heterogeneity, funnel plot and Egger\'s test, statistical significance was considered at *P*\<0.1. In this meta-analysis, all statistical analyses were conducted by STATA software (version 12.0). Results {#s3} ======= Baseline characteristics {#s3a} ------------------------ The demographics and risk factors of all subjects are presented in [**Table 1**](#pone-0094039-t001){ref-type="table"}. The results indicated that cases and controls were fully matched by age and gender. However, there was significant difference on drinking status and smoking between patients and controls (*P*\<0.001). The primary information of *CTLA-4* -1722T/C polymorphism was showed in [**Table 2**](#pone-0094039-t002){ref-type="table"}. For this SNP, the genotyping success rate was 96.43% in all samples. Minor allele frequency (MAF) of controls in our study, was similar to the database of Chinese for this SNP ([**Table 2**](#pone-0094039-t002){ref-type="table"}). The genotypic frequencies for *CTLA-4* -1722T/C polymorphism among controls were used to evaluated deviation from the HWE, and the result was in HWE (*P* = 0.284) ([**Table 2**](#pone-0094039-t002){ref-type="table"}). 10.1371/journal.pone.0094039.t002 ###### Primary information for *CTLA4* -1722T/C (rs733618) polymorphism. ![](pone.0094039.t002){#pone-0094039-t002-2} Genotyped SNPs *CTLA4* -1722T/C (rs733618) ------------------------------------------------------------------------ ----------------------------- Chromosome 2 Function nearGene-5 Chr Pos (Genome Build 36.3) 204439189 Regulome DB Score[a](#nt102){ref-type="table-fn"} No Data TFBS[b](#nt103){ref-type="table-fn"} Y Splicing (ESE or ESS) --- miRNA (miRanda) --- nsSNP --- MAF[c](#nt104){ref-type="table-fn"} for Chinese in database 0.390 MAF in our controls (n = 686) 0.414 *P* value for HWE[d](#nt105){ref-type="table-fn"} test in our controls 0.701 Genotyping method[e](#nt106){ref-type="table-fn"} LDR \% Genotyping value 96.43% http://[www.regulomedb.org/](http://www.regulomedb.org/); TFBS: Transcription Factor Binding Site (<http://snpinfo.niehs.nih.gov/snpinfo/snpfunc.htm>); MAF: minor allele frequency; HWE: Hardy--Weinberg equilibrium; LDR: Ligation Detection Reaction. Single-locus analysis {#s3b} --------------------- In the single locus analyses, the genotype frequencies of *CTLA-4* -1722T/C were 16.53% (CC), 49.10% (TC) and 34.37% (TT) in the patients, and 17.50% (CC), 47.79% (TC) and 34.70% (TT) in the controls, and the difference was no statistically significant (*P* = 0.862) ([**Table 3**](#pone-0094039-t003){ref-type="table"}). In this case-control study, logistic regression analyses showed that the *CTLA-4* -1722T/C SNP was not associated with the risk of ESCC. Tobacco use and alcohol consumption are two strong environmental factors, we examined the association in a stratified analysis by these two factors and the results were null association ([**Table 4**](#pone-0094039-t004){ref-type="table"}). 10.1371/journal.pone.0094039.t003 ###### Logistic regression analyses of associations between *CTLA4* -1722T/C (rs733618) polymorphisms and risk of ESCC. ![](pone.0094039.t003){#pone-0094039-t003-3} Genotype Cases (n = 629) Controls (n = 686) Crude OR (95%CI) *P* Adjusted OR [a](#nt107){ref-type="table-fn"} (95%CI) *P* --------------------- ----------------- -------------------- ------------------ ------- ------------------------------------------------------ ------- ------------------- ------- *CTLA4* rs733618T/C TT 210 34.37 228 34.70 1.00 1.00 TC 300 49.10 314 47.79 1.04 (0.81--1.33) 0.770 1.06 (0.83--1.37) 0.625 CC 101 16.53 115 17.50 0.95 (0.69--1.32) 0.776 0.97 (0.69--1.35) 0.846 CC vs. TC vs. TT 0.862 TC+CC 401 65.63 429 65.30 1.02 (0.81--1.28) 0.901 1.04 (0.82--1.32) 0.755 TT+TC 510 83.47 542 82.50 1.00 1.00 CC 101 16.53 115 17.50 0.93 (0.70--1.25) 0.645 0.93 (0.69--1.26) 0.649 T allele 720 58.92 770 58.60 0.99 (0.84--1.16) 0.870 C allele 502 41.08 544 41.40 Adjusted for age, sex, smoking and drinking status; Bold values are statistically significant (*P*\<0.05). 10.1371/journal.pone.0094039.t004 ###### Stratified analyses between *CTLA4* -1722T/C (rs733618) polymorphism and ESCC risk by sex, age, smoking status and alcohol consumption. ![](pone.0094039.t004){#pone-0094039-t004-4} Variable *CTLA4* rs733618 T/C (case/control)[a](#nt108){ref-type="table-fn"} Adjusted OR[b](#nt109){ref-type="table-fn"} (95% CI); *P* --------------------- --------------------------------------------------------------------- ----------------------------------------------------------- ------- --------- ------ ------------------------------- ------------------------------- ------------------------------- ------------------------------- Sex Male 150/154 209/214 70/76 279/290 1.00 1.04 (0.77--1.40); *P*: 0.815 0.96 (0.64--1.43); *P*: 0.828 1.02 (0.76--1.35); *P*: 0.916 0.94 (0.65--1.35); *P*: 0.723 Female 60/74 91/100 31/39 122/139 1.00 1.10 (0.70--1.72); *P*: 0.676 1.02 (0.57--1.83); *P*: 0.955 1.08 (0.71--1.64); *P*: 0.731 0.96 (0.57--1.63); *P*: 0.888 Age \<63 102/125 139/162 60/60 199/222 1.00 1.05 (0.74--1.51); *P*: 0.773 1.24 (0.79--1.96); *P*: 0.353 1.11 (0.79--1.55); *P*: 0.559 1.21 (0.80--1.82); *P*: 0.371 ≥63 108/103 161/152 41/55 202/207 1.00 1.05 (0.73--1.49); *P*: 0.807 0.73 (0.45--1.20); *P*: 0.214 0.96 (0.69--1.35); *P*: 0.820 0.71 (0.46--1.11); *P*: 0.136 Smoking status Never 108/171 185/218 54/85 239/303 1.00 1.31 (0.96--1.80); *P*: 0.092 0.99 (0.65--1.52); *P*: 0.963 1.22 (0.91--1.65); *P*: 0.190 0.84 (0.58--1.24); *P*: 0.380 Ever 102/57 115/96 47/30 162/126 1.00 0.71 (0.46--1.10); *P*: 0.123 0.91 (0.51--1.62); *P*: 0.749 0.76 (0.50--1.14); *P*: 0.187 1.11 (0.66--1.86); *P*: 0.693 Alcohol consumption Never 145/178 208/231 63/91 271/322 1.00 1.17 (0.87--1.58); *P*: 0.300 0.89 (0.59--1.33); *P*: 0.563 1.09 (0.82--1.45); *P*: 0.548 0.81 (0.56--1.17); *P*: 0.257 Ever 65/50 92/83 38/24 130/107 1.00 0.81 (0.50--1.32); *P*: 0.399 1.20 (0.63--2.29); *P*: 0.577 0.90 (0.57--1.42); *P*: 0.648 1.36 (0.76--2.43); *P*: 0.296 The genotyping was successful in 611 (97.1%) ESCC cases, and 657 (95.8%) controls for *CTLA4* -1722T/C (rs733618); Adjusted for age, sex, smoking status and alcohol consumption (besides stratified factors accordingly) in a logistic regression model. Eligible articles for meta-analysis {#s3c} ----------------------------------- The initial search yielded a total of 345 potentially relevant publications. After applying additional filters, 12 case-control studies in 11 publications and our study were eligible for inclusion. The detailed process of selecting and excluding articles is presented in [**Figure 1**](#pone-0094039-g001){ref-type="fig"}. ![Flow diagram of articles selection process for *CTLA-4* -1722T/C (rs733618) polymorphism and cancer risk meta-analysis.](pone.0094039.g001){#pone-0094039-g001} Study characteristics {#s3d} --------------------- There were two groups in an article conducted by Hadinia et al. [@pone.0094039-Hadinia1], we treated them separately. In total 12 separate studies plus our case-control study involving a total of 3420 cancer cases and 3675 controls were included in this meta-analysis. Among the 13 case-control studies, three investigated breast cancer [@pone.0094039-Erfani1]--[@pone.0094039-Li2], three investigated gastric cancer [@pone.0094039-Hadinia1], [@pone.0094039-QiYQ1], [@pone.0094039-SongJQ1], and the other studies investigated cervical cancer, lung cancer, esophageal cancer, colorectal cancer, and oral cancer [@pone.0094039-Sun1], [@pone.0094039-Hadinia1], [@pone.0094039-Jiang1]--[@pone.0094039-Bharti1]. As for subjects in these studies, 8 were Asians [@pone.0094039-Sun1], [@pone.0094039-Li1]--[@pone.0094039-Jiang1], [@pone.0094039-Bharti1] and 5 were Caucasians[@pone.0094039-Hadinia1], [@pone.0094039-Erfani1] [@pone.0094039-Khaghanzadeh1], [@pone.0094039-Rahimifar1]. Characteristics of each included study are presented in [**Table 5**](#pone-0094039-t005){ref-type="table"}. The detailed distribution of the *CTLA-4* -1722T/C polymorphism and allele among cases and controls is presented in [**Table 6**](#pone-0094039-t006){ref-type="table"}. 10.1371/journal.pone.0094039.t005 ###### Characteristics of populations and cancer types of the individual studies included in the meta-analysis. ![](pone.0094039.t005){#pone-0094039-t005-5} study year country ethnicity cancer type No. of cases/controls Genotype Method --------------------- ------ --------- ------------ ------------------- ----------------------- ------------------------ Bharti et al. 2013 India Asians oral cancer 130/180 PCR-RFLP Li et al. 2012 China Asians breast cancer 581/566 PCR-RFLP Qi et al. 2012 China Asians gastric cancer 118/96 PCR-RFLP Jiang et al. 2011 China Asians cervical cancer 100/100 MALDI-TOF-MS Khaghanzadeh et al. 2010 Iran Caucasians lung cancer 127/124 PCR-RFLP, PCR-ARMS Rahimifar et al. 2010 Iran Caucasians cervical cancer 55/110 PCR-RFLP, PCR-ARMS Li et al. 2008 China Asians breast cancer 328/327 PCR-RFLP Sun et al. 2008 China Asians lung cancer 765/800 PCR-RFLP, MALDI-TOF MS Hadinia et al. 2007 Iran Caucasians gastric cancer 46/190 RFLP, PCR-ARMS Hadinia et al. 2007 Iran Caucasians colorectal cancer 109/190 RFLP, PCR-ARMS Song et al. 2006 China Asians gastric cancer 183/116 PCR-RFLP Erfani et al. 2006 Iran Caucasians breast cancer 283/245 PCR-CTPP Our study 2013 China Asians esophageal cancer 629/686 PCR-LDR MALDI--TOF--MS: Matrix-Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry. PCR-RFLP: polymerase chain reaction-restriction fragment length polymorphism. PCR-LDR: polymerase chain reaction-ligase detection reaction. PCR-ARMS: AmplificationRefractory Mutation System-Polymerase Chain Reaction. 10.1371/journal.pone.0094039.t006 ###### Distribution of *CTLA-4* -1722T/C (rs733618 T/C) polymorphisms genotype and allele among multiple cancer patients and controls. ![](pone.0094039.t006){#pone-0094039-t006-6} case control case control HWE,*P* value ---------------------------- ------ ------ --------- ------ --------- --------------- ----- ----- ------ ----- ------ ---------- Qi et al. 2012 40 69 9 37 45 14 87 149 73 119 0.957723 Li et al. 2012 184 276 114 207 256 88 504 644 432 670 0.552314 Jiang et al. 2011 37 49 14 43 39 18 77 123 75 125 0.092957 Rahimifar et al. 2010 46 8 1 90 20 0 10 100 20 200 0.294266 Khaghanzadeh et al. 2010 106 19 1 98 16 1 21 231 18 212 0.702320 Sun et al. 2008 719 43 3 762 37 1 49 1481 39 1561 0.435355 Li et al. 2008 125 163 40 111 168 48 243 413 264 390 0.224758 Hadinia et al.(colorectal) 2007 97 12 0 165 24 0 12 206 24 354 0.351131 Hadinia et al.(gastric) 2007 42 4 0 165 24 0 4 88 24 354 0.351131 Erfani et al. 2006 225 54 3 204 41 0 60 504 41 449 0.152921 Bharti et al. 2013 92 25 6 131 46 3 37 209 52 308 0.648604 Song et al. 2006 62 113 8 45 54 17 129 237 88 144 0.902590 Our study 2013 210 300 101 228 314 115 502 720 544 770 0.700586 HWE: Hardy--Weinberg equilibrium. Meta-analysis results {#s3e} --------------------- After combining all qualified studies, a total of 3420 cancer cases and 3675 controls from 13 eligible case--control studies were included for meta-analysis of the association between the CTLA-4 -1722T/C polymorphism and cancer risk. There was null association of *CTLA-4* -1722T/C polymorphism with overall cancer risk in all genetic models ([**Table 7**](#pone-0094039-t007){ref-type="table"} **,** [**Table 8**](#pone-0094039-t008){ref-type="table"} **,** [**Table 9**](#pone-0094039-t009){ref-type="table"} **,** [**Figure 2**](#pone-0094039-g002){ref-type="fig"} **, and** [**Figure 3**](#pone-0094039-g003){ref-type="fig"}). In a stratified analysis by ethnicity, the similar results were observed in both Asians and Caucasians ([**Table 7**](#pone-0094039-t007){ref-type="table"}). In a stratified analysis by cancer type, there was a decreased risk of gastric cancer in two genetic models: CC vs. TC+TT (OR, 0.36; 95% CI, 0.19--0.66; *P* = 0.001) and CC vs. TT (OR, 0.45; 95% CI, 0.23--0.86; *P* = 0.016) ([**Table 8**](#pone-0094039-t008){ref-type="table"}). In a stratified analysis by system, null association was also observed ([**Table 9**](#pone-0094039-t009){ref-type="table"}). ![Meta-analysis with a fixed-effects model for the association between the risk of cancer and the *CTLA-4* -1722T/C polymorphism (C vs. T).](pone.0094039.g002){#pone-0094039-g002} ![Meta-analysis with a random-effects model for the association between the risk of cancer and the *CTLA-4* -1722T/C polymorphism (CC vs. TC+TT).](pone.0094039.g003){#pone-0094039-g003} 10.1371/journal.pone.0094039.t007 ###### Summary of results of the meta-analysis from different comparative genetic models in the subgroup analysis by ethnicity. ![](pone.0094039.t007){#pone-0094039-t007-7} Polymorphism Genetic comparison Population OR(95%CI); *P* Test of heterogeneity ------------------- -------------------- ------------ ------------------------- ----------------------- --- CC+TC vs. TT All 1.09(0.97--1.22);0.159 0.762,0.0% F Asians 1.09(0.97--1.24);0.160 0.494,0.0% F Caucasians 1.04(0.78--1.41);0.773 0.767,0.0% F CC vs. TC+TT All 0.90(0.64--1.27);0.553 0.016,54.1% R Asians 0.86(0.60--1.23);0.400 0.008,63.2% R Caucasians 3.27(0.65--16.32);0.149 0.570,0.0% F *CTLA-4* -1722T/C CC vs. TT All 0.98(0.70--1.37);0.906 0.050,45.3% R Asians 0.94(0.66--1.33);0.719 0.028,55.4% R Caucasians 3.29(0.66--16.46);0.146 0.575,0.0% F TC vs. TT All 1.09(0.97--1.23);0.154 0.641,0.0% F Asians 1.11(0.97--1.26);0.124 0.358,9.3% F Caucasians 1.01(0.74--1.36);0.970 0.792,0.0% F C vs. T All 1.04(0.95--1.13);0.383 0.577,0.0% F Asians 1.03(0.95--1.13);0.460 0.301,16.4% F Caucasians 1.08(0.82--1.43);0.575 0.744,0.0% F F indicates fixed model; R indicates random model. 10.1371/journal.pone.0094039.t008 ###### Summary of results of the meta-analysis from different comparative genetic models in the subgroup analysis by cancer type. ![](pone.0094039.t008){#pone-0094039-t008-8} Polymorphism Genetic comparison Cancer type OR(95%CI); *P* Test of heterogeneity ------------------ -------------------- ---------------- ---------------------------- ----------------------- --- CC+TC vs. TT All 1.09(0.97--1.22);0.159 0.762,0.0% F Gastric cancer 1.15(0.81--1.62);0.430 0.571,0.0% F Breast cancer 1.10(0.83--1.47);0.514 0.100,56.5% R Other cancers 1.05(0.89--1.24);0.589 0.903,0.0% F CC vs. TC+TT All 0.90(0.64--1.27);0.553 0.016,54.1% R Gastric cancer **0.36(0.19--0.66);0.001** 0.347,0.0% F Breast cancer 1.10(0.68--1.77);0.689 0.121,52.7% R Other cancers 0.98(0.76--1.28);0.903 0.374,6.6% F *CTLA-4*-1722T/C CC vs. TT All 0.98(0.70--1.37);0.906 0.050,45.3% R Gastric cancer **0.45(0.23--0.86);0.016** 0.412,0.0% F Breast cancer 1.15(0.60--2.22);0.672 0.046,67.6% R Other cancers 1.04(0.78--1.39);0.798 0.496,0.0% F TC vs. TT All 1.09(0.97--1.23);0.154 0.641,0.0% F Gastric cancer 1.34(0.94--1.91);0.107 0.392,0.0% F Breast cancer 1.09(0.90--1.31);0.383 0.259,25.9% F Other cancers 1.04(0.88--1.24);0.637 0.741,0.0% F C vs. T All 1.04(0.95--1.13);0.383 0.577,0.0% F Gastric cancer 0.90(0.70--1.15);0.406 0.833,0.0% F Breast cancer 1.09(0.85--1.41);0.504 0.044,68.0% R Other cancers 1.02(0.90--1.16);0.733 0.931,0.0% F F indicates fixed model; R indicates random model. 10.1371/journal.pone.0094039.t009 ###### Summary of results of the meta-analysis from different comparative genetic models in the subgroup analysis by system. ![](pone.0094039.t009){#pone-0094039-t009-9} Polymorphism Genetic comparison Cancer type OR(95%CI); *P* Test of heterogeneity ------------------ -------------------- -------------------------------- ------------------------- ----------------------- --- CC+TC vs. TT All 1.09(0.97--1.22);0.159 0.762,0.0% F Digestive system cancer 1.02(0.86--1.22);0.797 0.839,0.0% F Reproductive and breast cancer 1.12(0.95--1.32);0.186 0.275,22.0% F Respiratory system cancer 1.22(0.84--1.78);0.288 0.697,0.0% F CC vs. TC+TT All 0.90(0.64--1.27);0.553 0.016,54.1% R Digestive system cancer 0.71(0.33--1.53);0.381 0.008,74.5% R Reproductive and breast cancer 1.11(0.88--1.40);0.395 0.171,37.5% F Respiratory system cancer 1.99(0.37--10.85);0.425 0.498,0.0% F *CTLA-4*-1722T/C CC vs. TT All 0.98(0.70--1.37);0.906 0.050,45.3% R Digestive system cancer 0.79(0.41--1.52);0.476 0.056,60.3% R Reproductive and breast cancer 1.18(0.91--1.53);0.217 0.111,46.7% F Respiratory system cancer 2.02(0.37--10.99);0.417 0.499,0.0% F TC vs. TT All 1.09(0.97--1.23);0.154 0.641,0.0% F Digestive system cancer 1.06(0.88--1.27);0.529 0.386,4.8% F Reproductive and breast cancer 1.10(0.92--1.31);0.289 0.392,2.6% F Respiratory system cancer 1.19(0.81--1.75);0.367 0.791,0.0% F C vs. T All 1.04(0.95--1.13);0.383 0.577,0.0% F Digestive system cancer 0.96(0.85--1.09);0.569 0.966,0.0% F Reproductive and breast cancer 1.09(0.96--1.23);0.168 0.175,37.0% F Respiratory system cancer 1.24(0.87--1.78);0.232 0.595,0.0% F F indicates fixed model; R indicates random model. Tests for publication bias, sensitivity analyses, and heterogeneity {#s3f} ------------------------------------------------------------------- In this meta-analysis, potential publication bias was detected by Begg\'s Funnel plot and Egger\'s test ([**Figure 4**](#pone-0094039-g004){ref-type="fig"}), and the shape of funnel was symmetry in all genetic model. It suggested that there were no publication bias for overall cancer in this meta-analysis (C vs. T: Begg\'s test *P* = 0.855, Egger\'s test *P* = 0.675; CC vs. TT: Begg\'s test *P* = 0.350, Egger\'s test *P* = 0.709; TC vs. TT: Begg\'s test *P* = 0.583, Egger\'s test *P* = 0.702; CC+TC vs. TT: Begg\'s test *P* = 0.161, Egger\'s test *P* = 0.576; CC vs. TT+TC: Begg\'s test *P* = 0.533, Egger\'s test *P* = 0.845). ![Begg\'s funnel plot of meta-analysis of between the *CTLA-4* -1722T/C polymorphism and the risk of cancer (fixed--effects estimates) (C vs. T compare genetic model).](pone.0094039.g004){#pone-0094039-g004} Sensitivity analyses were carried out to detect the influence of each individual dataset on the pooled OR, with each study dataset set dropped at a time. The outcomes did not change when any individual study was omitted, suggesting the stability of our results ([**Figure 5**](#pone-0094039-g005){ref-type="fig"}) (data not shown). ![Sensitivity analysis of the influence of C vs. T in overall cancer meta--analysis (fixed--effects estimates).](pone.0094039.g005){#pone-0094039-g005} Large heterogeneities among the studies were indentified in the recessive model and homozygous model. Since tumor origin, ethnicity and system can influence the results from meta--analyses, we carried out subgroup analyses and the results were presented in [**Table 7**](#pone-0094039-t007){ref-type="table"} **,** [**Table 8**](#pone-0094039-t008){ref-type="table"} and [**Table 9**](#pone-0094039-t009){ref-type="table"}. The results indicated that breast cancer, digestive system cancer and Asian population subgroup may contribute to the major heterogeneity. As shown in [**Table 7**](#pone-0094039-t007){ref-type="table"}, heterogeneity was significant in the recessive model. Further analysis was conducted by Galbraith radial plot in the recessive model ([**Figure 6**](#pone-0094039-g006){ref-type="fig"}), and the result showed one outlier might contribute to the major sources of heterogeneity. From the forest plot in the recessive model ([**Figure 2**](#pone-0094039-g002){ref-type="fig"}), one can identify that a case-control study conducted by Erfani et al.[@pone.0094039-Erfani1] contributes the main heterogeneity. ![Galbraith radial plot of meta--analysis (CC vs. TC+TT compare genetic model).](pone.0094039.g006){#pone-0094039-g006} Discussion {#s4} ========== Of late, several studies have investigated the association between *CTLA-4* -1722T/C polymorphism and multiple cancers, a decisive answer is lacking. In this study, a case-control study in Han Chinese population, along with a meta-analysis on overall cancer, attempted to derive a comprehensive evaluation and the results were non-significance. To the best of our knowledge, this is the first case-control study investigating the association between *CTLA-4* -1722T/C polymorphism and esophageal cancer risk. Cancer and autoimmune disease are both multifactorial disorders that results from complex interactions between genetic backgrounds and environmental factors. The *CTLA-4* -1722T/C polymorphism (T→C) would reduce a transcription factor binding site for nuclear factor 1 and weaken the expression of cell surface CTLA-4 [@pone.0094039-Geng1], [@pone.0094039-Jones1], which might play an important role in cancer and autoimmune disease susceptibility. Several meta-analyses showed that *CTLA-4* -1722T/C polymorphism might be a risk factor for systemic lupus erythematosus susceptibility [@pone.0094039-Zhu1]--[@pone.0094039-Zhai1]. However, the association between this locus and cancer risk was inconclusive. With a growing interest in the associations of genetic polymorphisms and cancer, several studies have examined the hypothesis that *CTLA-4* -1722T/C polymorphism is relevant to the risk of a number of cancers; however, the results remain elusive. Considering the fact that most common SNPs usually make low penetrance cancer susceptibility, this study includes 13 case-control studies with relatively large sample sizes to obtain a precise evaluation between *CTLA-4* -1722T/C genetic variation and cancer risk. One individual study has reported positive signal of *CTLA-4* -1722T/C polymorphism with cancer [@pone.0094039-Li2]; the other individual study has reported negative signal [@pone.0094039-SongJQ1]; however, as demonstrated in our overall genetic model results among 7098 subjects, there were non-significance, even in different population subgroups and different system. In a stratified analysis by cancer type, the protective effect conferred by the recessive model and homozygous model was appreciably obvious in gastric cancer subgroup. Considering only three case-control studies were conducted in gastric cancer subgroup and these studies were small sample sizes, which might restrict power to confirm a real influence or generate a fluctuated assessment. All results should be interpreted with very caution. It is also possible that the potential function of this polymorphism is diluted or covered by other genetic background or environment factors, and these important factors should not be ignored. Considering only 13 case-control studies were recruited in this meta-analysis and most of these studies were small sample sizes, in the future, further investigations with large sample sizes should be carried out to confirm or refute these results. Some merit of current study should be adequate consideration. First, this is to date the first case-control study detecting the association of *CTLA-4* gene -1722T/C polymorphism with esophageal cancer. Second, the findings of our case-control study conform to that of the subsequent meta-analysis. Third, in our case-control study, control genotype distributions were consistent with HWE showed our results were less prone to selection bias, the shape of funnel plot indicated that there were no publication bias in current meta-analysis. Fourth, relatively low heterogeneity was observed between publications for *CTLA-4* -1722T/C polymorphism. In addition, some limitations in current study should be acknowledged when interpreting our results. First, in this case-control study, all cases and controls were recruited from two hospitals and might not fully represent the general Chinese populations. Second, all included case--control studies for meta-analysis were from Asians and Caucasians; thus, our findings might only be suitable for these two populations. Third, only published studies were recruited in this meta-analysis, publication bias might have inevitably occurred. Fourth, due to the lack of uniform background data for recruited studies, data were not further stratified by other factors (such as, age, gender, smoking, alcohol consumption, and other lifestyle factors). Fifth, in this study, we focused on only -1722T/C polymorphism in *CTLA-4*, and did not consider other susceptibility genes or polymorphisms. For the low penetrance cancer susceptibility gene effects from SNP, these important genetic and environmental factors should be adequately considered. In summary, this case-control study along with a meta-analysis, failed to confirm the association between *CTLA-4* -1722T/C polymorphism and cancer risk, even across different ethnic subgroups and different systems. In the future, further investigations with large sample sizes and detailed gene--environment data, should be carried out to confirm or refute these results. Supporting Information {#s5} ====================== ###### Direct sequencing analyses for genotypes of CTLA-4 -1722T/C SNP (The three charts represent three genotypes). (TIF) ###### Click here for additional data file. ###### PRISMA checklist, Checklist of items to include when reporting a systematic review or meta-analysis (diagnostic review consisting of cohort studies). (DOCX) ###### Click here for additional data file. [^1]: **Competing Interests:**The authors have declared that no competing interests exist. [^2]: Conceived and designed the experiments: HG JY. Performed the experiments: WT HQ HJ. Analyzed the data: WT HQ HJ BS LW HG JY. Contributed reagents/materials/analysis tools: HG JY. Wrote the paper: WT HQ HJ JY.
2024-03-16T01:27:15.642919
https://example.com/article/8933
Physical and virtual screening methods for marine toxins and drug discovery targeting nicotinic acetylcholine receptors. Nicotinic acetylcholine receptors (nAChRs) have been extensively studied because of their importance in physiological processes and their involvement in a number of muscle and neuronal human pathologies. However, the role of specific subtypes remains poorly understood due to the lack of selective nAChR probes. During the last decade, drug design strategies have been powered by a wide variety of natural compounds with diverse chemical structures, and by the structural characterization of several nAChRs structural homologs. In this review, the authors present a short overview of nAChRs, and some natural sources of bioactive molecules targeting these receptors. The authors provide an emphasis on α-conotoxins from Conus venoms, which provide the most diverse selective antagonists of nAChRs known to date, as well briefly discussing macrocyclic imine toxins. The authors, furthermore, review valuable radioactive and non-radioactive methods used for discovering novel ligands targeting nAChRs and highlight high-throughput developments in receptor-binding and electrophysiological assays. Finally, the authors review the molecular modeling approaches used in the last few years with an aim to provide an overview of their potential to identify and optimize selective nAChR ligands. Recent years have provided new valuable techniques for the detection and identification of new nAChRs ligands, along with an increasing use of different molecular modeling tools. This furthering of knowledge has had an impact on the design and discovery of more potent and selective nAChRs ligands. There is still however a lack of high-resolution structural information that will require new developments.
2024-07-08T01:27:15.642919
https://example.com/article/7788
Q: The Chernoff bound for continuous random variables. In a paper I am reading, authors apply the Chernoff bound to a continuous random variable $X$ with positive mean: $$\mathbb{P}(X\le 0)\le \mathbb{E}[\exp(\lambda X)]$$ I do not understand it. When I google for the Chernoff bound I get results for a sum of random variables that have values 0 or 1. Could you please provide a reference where I can read about continuous case, or could you explain how to get above inequality. Any thoughts are welcome. A: How to get it: Integrate the pointwise inequality $$\mathbf 1_{X\leqslant0}\leqslant\exp(\lambda X).$$ Note that, for this inequality to be true, one must assume that $\lambda\leqslant0$. As explained here.
2024-05-30T01:27:15.642919
https://example.com/article/7490
1 …Sennacherib king of Assyria came, and entered into Judah, and encamped against the fenced cities, and thought to win them for himself. 2 And when Hezekiah saw that Sennacherib was come, and that he was purposed to fight against Jerusalem, 3 He took counsel with his princes and his mighty men to stop the waters of the fountains which were without the city: and they did help him. 4 So there was gathered much people together, who stopped all the fountains, and the brook that ran through the midst of the land, saying, Why should the kings of Assyria come, and find much water? 6 And he set captains of war over the people, and gathered them together to him in the street of the gate of the city, and spake comfortably to them, saying, 8 With him is an arm of flesh; but with us is the LORD our God to help us, and to fight our battles. And the people rested themselves upon the words of Hezekiah king of Judah. 10 Thus saith Sennacherib king of Assyria, 17 …As the gods of the nations of other lands have not delivered their people out of mine hand, so shall not the God of Hezekiah deliver his people out of mine hand. 19 And they spake against the God of Jerusalem, as against the gods of the people of the earth, which were the work of the hands of man. 20 And for this cause Hezekiah the king, and the prophet Isaiah the son of Amoz, prayed and cried to heaven. 21 And the LORD sent an angel, which cut off all the mighty men of valour, and the leaders and captains in the camp of the king of Assyria. So he returned with shame of face to his own land. And when he was come into the house of his god, they that came forth of his own bowels slew him there with the sword. 22 Thus the LORD saved Hezekiah and the inhabitants of Jerusalem from the hand of Sennacherib the king of Assyria, and from the hand of all other, and guided them on every side. 23 And many brought gifts unto the LORD to Jerusalem, and presents to Hezekiah king of Judah: so that he was magnified in the sight of all nations from thenceforth. 3. Isaiah 45 : 20-22 20 Assemble yourselves and come; draw near together, ye that are escaped of the nations: they have no knowledge that set up the wood of their graven image, and pray unto a god that cannot save. 21 Tell ye, and bring them near; yea, let them take counsel together: who hath declared this from ancient time? who hath told it from that time? have not I the LORD? and there is no God else beside me; a just God and a Saviour; there is none beside me. 22 Look unto me, and be ye saved, all the ends of the earth: for I am God, and there is none else. 4. Luke 4 : 1 (to 1st ,) 1 And Jesus being full of the Holy Ghost returned from Jordan, 5. Luke 9 : 38, 39, 42, 43 (to .) 38 And, behold, a man of the company cried out, saying, Master, I beseech thee, look upon my son: for he is mine only child. 39 And, lo, a spirit taketh him, and he suddenly crieth out; and it teareth him that he foameth again, and bruising him hardly departeth from him. 42 And as he was yet a-coming, the devil threw him down, and tare him. And Jesus rebuked the unclean spirit, and healed the child, and delivered him again to his father. 43 And they were all amazed at the mighty power of God. 6. Revelation 1 : 1 (to 2nd ,) 1 The Revelation of Jesus Christ, which God gave unto him, 7. Revelation 21 : 1-7 1 And I saw a new heaven and a new earth: for the first heaven and the first earth were passed away; and there was no more sea. 2 And I John saw the holy city, new Jerusalem, coming down from God out of heaven, prepared as a bride adorned for her husband. 3 And I heard a great voice out of heaven saying, Behold, the tabernacle of God is with men, and he will dwell with them, and they shall be his people, and God himself shall be with them, and be their God. 4 And God shall wipe away all tears from their eyes; and there shall be no more death, neither sorrow, nor crying, neither shall there be any more pain: for the former things are passed away. 5 And he that sat upon the throne said, Behold, I make all things new. And he said unto me, Write: for these words are true and faithful. 6 And he said unto me, It is done. I am Alpha and Omega, the beginning and the end. I will give unto him that is athirst of the fountain of the water of life freely. 7 He that overcometh shall inherit all things; and I will be his God, and he shall be my son. Science and Health with Key to the Scriptures 1. 224 : 22-4 A higher and more practical Christianity, demonstrating justice and meeting the needs of mortals in sickness and in health, stands at the door of this age, knocking for admission. Will you open or close the door upon this angel visitant, who cometh in the quiet of meekness, as he came of old to the patriarch at noonday? Truth brings the elements of liberty. On its banner is the Soul-inspired motto, "Slavery is abolished." The power of God brings deliverance to the captive. No power can withstand divine Love. What is this supposed power, which opposes itself to God? Whence cometh it? What is it that binds man with iron shackles to sin, sickness, and death? Whatever enslaves man is opposed to the divine government. Truth makes man free. 2. 315 : 29-11 Wearing in part a human form (that is, as it seemed to mortal view), being conceived by a human mother, Jesus was the mediator between Spirit and the flesh, between Truth and error. Explaining and demonstrating the way of divine Science, he became the way of salvation to all who accepted his word. From him mortals may learn how to escape from evil. The real man being linked by Science to his Maker, mortals need only turn from sin and lose sight of mortal selfhood to find Christ, the real man and his relation to God, and to recognize the divine sonship. Christ, Truth, was demonstrated through Jesus to prove the power of Spirit over the flesh, — to show that Truth is made manifest by its effects upon the human mind and body, healing sickness and destroying sin. 3. 494 : 2-14 Jesus said: "Destroy this temple [body], and in three days I [Mind] will raise it up;" and he did this for tired humanity's reassurance. Is it not a species of infidelity to believe that so great a work as the Messiah's was done for himself or for God, who needed no help from Jesus' example to preserve the eternal harmony? But mortals did need this help, and Jesus pointed the way for them. Divine Love always has met and always will meet every human need. It is not well to imagine that Jesus demonstrated the divine power to heal only for a select number or for a limited period of time, since to all mankind and in every hour, divine Love supplies all good. 4. 230 : 1-10 If sickness is real, it belongs to immortality; if true, it is a part of Truth. Would you attempt with drugs, or without, to destroy a quality or condition of Truth? But if sickness and sin are illusions, the awakening from this mortal dream, or illusion, will bring us into health, holiness, and immortality. This awakening is the forever coming of Christ, the advanced appearing of Truth, which casts out error and heals the sick. This is the salvation which comes through God, the divine Principle, Love, as demonstrated by Jesus. 5. 377 : 26-7 The cause of all so-called disease is mental, a mortal fear, a mistaken belief or conviction of the necessity and power of ill-health; also a fear that Mind is helpless to defend the life of man and incompetent to control it. Without this ignorant human belief, any circumstance is of itself powerless to produce suffering. It is latent belief in disease, as well as the fear of disease, which associates sickness with certain circumstances and causes the two to appear conjoined, even as poetry and music are reproduced in union by human memory. Disease has no intelligence. Unwittingly you sentence yourself to suffer. The understanding of this will enable you to commute this self-sentence, and meet every circumstance with truth. Disease is less than mind, and Mind can control it. 6. 166 : 23-32 Failing to recover health through adherence to physiology and hygiene, the despairing invalid often drops them, and in his extremity and only as a last resort, turns to God. The invalid's faith in the divine Mind is less than in drugs, air, and exercise, or he would have resorted to Mind first. The balance of power is conceded to be with matter by most of the medical systems; but when Mind at last asserts its mastery over sin, disease, and death, then is man found to be harmonious and immortal. 7. 285 : 23-31 By interpreting God as a corporeal Saviour but not as the saving Principle, or divine Love, we shall continue to seek salvation through pardon and not through reform, and resort to matter instead of Spirit for the cure of the sick. As mortals reach, through knowledge of Christian Science, a higher sense, they will seek to learn, not from matter, but from the divine Principle, God, how to demonstrate the Christ, Truth, as the healing and saving power. 8. 55 : 15-26 Truth's immortal idea is sweeping down the centuries, gathering beneath its wings the sick and sinning. My weary hope tries to realize that happy day, when man shall recognize the Science of Christ and love his neighbor as himself, — when he shall realize God's omnipotence and the healing power of the divine Love in what it has done and is doing for mankind. The promises will be fulfilled. The time for the reappearing of the divine healing is throughout all time; and whosoever layeth his earthly all on the altar of divine Science, drinketh of Christ's cup now, and is endued with the spirit and power of Christian healing.
2024-01-25T01:27:15.642919
https://example.com/article/1457
package simplepath import ( "github.com/stellar/go/xdr" "github.com/stellar/horizon/paths" ) // search represents a single query against the simple finder. It provides // a place to store the results of the query, mostly for the purposes of code // clarity. // // The search struct is used as follows: // // 1. Create an instance, ensuring the Query and Finder fields are set // 2. Call Init() to populate dependent fields in the struct with their initial values // 3. Call Run() to perform the search. // type search struct { Query paths.Query Finder *Finder // Fields below are initialized by a call to Init() after // setting the fields above queue []*pathNode targets map[string]bool visited map[string]bool //This fields below are initialized after the search is run Err error Results []paths.Path } // Init initialized the search, setting fields on the struct used to // hold state needed during the actual search. func (s *search) Init() { s.queue = []*pathNode{ &pathNode{ Asset: s.Query.DestinationAsset, Tail: nil, Q: s.Finder.Q, }, } // build a map of asset's string representation to check if a given node // is one of the targets for our search. Unfortunately, xdr.Asset is not suitable // for use as a map key, and so we use its string representation. s.targets = map[string]bool{} for _, a := range s.Query.SourceAssets { s.targets[a.String()] = true } s.visited = map[string]bool{} s.Err = nil s.Results = nil } // Run triggers the search, which will populate the Results and Err // field for the search after completion. func (s *search) Run() { if s.Err != nil { return } for s.hasMore() { s.runOnce() } } // pop removes the head from the search queue, returning it to the caller func (s *search) pop() *pathNode { next := s.queue[0] s.queue = s.queue[1:] return next } // returns false if the search should stop. func (s *search) hasMore() bool { if s.Err != nil { return false } if len(s.Results) > 4 { return false } return len(s.queue) > 0 } // isTarget returns true if the asset id provided is one of the targets // for this search (i.e. one of the requesting account's trusted assets) func (s *search) isTarget(id string) bool { _, found := s.targets[id] return found } // visit returns true if the asset id provided has not been // visited on this search, after marking the id as visited func (s *search) visit(id string) bool { if _, found := s.visited[id]; found { return false } s.visited[id] = true return true } // runOnce processes the head of the search queue, findings results // and extending the search as necessary. func (s *search) runOnce() { cur := s.pop() id := cur.Asset.String() if s.isTarget(id) { s.Results = append(s.Results, cur) } if !s.visit(id) { return } // A PathPaymentOp's path cannot be over 5 elements in length, and so // we abort our search if the current linked list is over 7 (since the list // includes both source and destination in addition to the path) if cur.Depth() > 7 { return } s.extendSearch(cur) } func (s *search) extendSearch(cur *pathNode) { // find connected assets var connected []xdr.Asset s.Err = s.Finder.Q.ConnectedAssets(&connected, cur.Asset) if s.Err != nil { return } for _, a := range connected { newPath := &pathNode{ Asset: a, Tail: cur, Q: s.Finder.Q, } var hasEnough bool hasEnough, s.Err = s.hasEnoughDepth(newPath) if s.Err != nil { return } if !hasEnough { continue } s.queue = append(s.queue, newPath) } } func (s *search) hasEnoughDepth(path *pathNode) (bool, error) { _, err := path.Cost(s.Query.DestinationAmount) if err == ErrNotEnough { return false, nil } return true, err }
2023-09-30T01:27:15.642919
https://example.com/article/2167
Efficacy of chlorpheniramine maleate for management of pruritus in cats. Chlorpheniramine maleate was administered orally (2 mg, q12 h) to 26 cats with pruritic skin disease. Pruritus was completely eliminated in 19 cats, and was reduced by 50% in 1 cat. Six cats had no response to treatment. Serious or long-lasting clinical side effects were not observed in any cat.
2024-05-05T01:27:15.642919
https://example.com/article/5218
The Coast Guard Private Kang, a member of Coast Guard Platoon 23, monitors a stretch of beach lined with barbed-wire fencing. Driven by the belief that killing a spy is the highest honor, Kang eagerly awaits a chance to prove his worth as a soldier. One night, Kang mistakes a promiscuous couple for a North Korean spy and shoots without hesitation. Despite receiving honors, Kang slowly begins to unravel under the grief of his actions. Losing his grip on reality, he tries to revert to the life he once knew. But tensions and paranoia escalate and further tragedy becomes unavoidable. Interested in bringing The Coast Guard to your school or library? If you'd like to have an in-class viewing, on-campus screening, or purchase the DVD for your library's collection, please contact Estelle Grosso at EDU@kinolorber.com or call (212) 629-6880 with your request.
2024-07-16T01:27:15.642919
https://example.com/article/4424
"I support the President's decision to kick Texas out of the Union. I mean, I hate the guy with a passion, but I'm such a huge fan of both teams. There! Now nobody can kick my ass for saying that!" justified Judge Reinhold his decision to kick Texas's ass out of the Union. Unfortunately, he did get his ass kicked by Barneyand a mob of Sesame Street characters and rednecks. Reinhold's decision is effective immediately. Soonerism, as it is called, is the third largest religion in the World, especially in the OU area where the Sooners reign.
2023-11-08T01:27:15.642919
https://example.com/article/1313
IN THE UNITED STATES COURT OF APPEALS FOR THE FIFTH CIRCUIT United States Court of Appeals Fifth Circuit FILED September 26, 2008 No. 07-51438 Charles R. Fulbruge III Clerk UNITED STATES OF AMERICA Plaintiff-Appellee v. CHARLES EDWARD THOMAS Defendant-Appellant Appeals from the United States District Court for the Western District of Texas USDC No. 7:07-CR-108 Before SMITH, WIENER, and HAYNES, Circuit Judges. WIENER, Circuit Judge:* Defendant-Appellant Charles Edward Thomas challenges his convictions for possession with intent to distribute more than five grams of cocaine base (“crack”) on May 1, 2007 and .28 grams on February 28, 2007. Thomas contends that (1) the district court abused its discretion when it admitted evidence of his prior drug convictions under Federal Rule of Evidence 404(b) and when it permitted testimony from a police officer on the correlation between drug distribution and the amount of drugs found on Thomas during the May 1 offense; * Pursuant to 5TH CIR. R. 47.5, the court has determined that this opinion should not be published and is not precedent except under the limited circumstances set forth in 5TH CIR. R. 47.5.4. No. 07-51438 and (2) the evidence adduced at trial is insufficient to support conviction on either count of the indictment. Finding no error, we affirm Thomas’s conviction on both counts. I. FACTS AND PROCEEDINGS A. First Count (the May 1, 2007 Offense) In the first count of the two count indictment, Thomas was charged with possession with intent to distribute five or more grams of crack. Officer Alejandro Jurado of the Odessa Police Department testified that on the morning of May 1, 2007, he saw one man and two women sitting in a vehicle in the parking lot of the MCM Fundome Hotel in Odessa, Texas. Officer Jurado spoke with the driver of the car, who said that he was waiting for a friend named Edward, subsequently identified as the defendant, Charles Edward Thomas. The occupants of the car did not have a room at the hotel and only the driver had identification. When the woman in the front passenger seat of the car, later identified as Regina Holmes, began to make movements with her foot, Officer Jurado asked her to get out of the car. During questioning, she revealed that the friend for whom they were waiting, Edward, had gone upstairs, although she did not know why. She also pointed out his car, which Officer Jurado recognized as one that he knew Thomas drove from time to time. While questioning Holmes, Officer Jurado saw Thomas come from around a stairwell in the back of the hotel. Holmes identified Thomas as her friend Edward. At the same time, Officer Jurado noticed Thomas put a flimsy object, or a “baggie,” into his pocket. Thomas then approached Officer Jurado, who began to question him. After Thomas refused to provide ID or his name, Officer Jurado attempted to restrain him, but Thomas fled. During the pursuit, Officer Jurado saw Thomas throw “something,” which appeared to be a flimsy object, over a fence. Officer Jurado then ordered Thomas to the ground and, after a 2 No. 07-51438 brief struggle, subdued him. No drug paraphernalia was found on Thomas’s person. Subsequent investigation of the area where Officer Jurado had seen Thomas fling the flimsy object revealed a bag containing what appeared to Officer Jurado to be large rocks of crack. Testimony from Marissa Silva, a forensic scientist for the Texas Department of Public Safety, identified the contents of the bag as two rocks of crack, one weighing 5.96 grams, the other 6.76 grams. Officer Jurado also testified that when he looked back to check on his squad car, he saw Holmes throw an object from the place where she was sitting. A subsequent search of the area revealed a crack pipe. Holmes was arrested for possession of drug paraphernalia. Detective Jesse Garcia of the Odessa Police Department’s Narcotics-Vice Unit testified after Officer Jurado. Detective Garcia had responded to the scene at the Fundome on May 1, 2007 to assist Jurado. He testified that Jurado gave him a quantity of what appeared to be narcotics. The government then asked whether, based on Detective Garcia’s experience, the quantity of crack was consistent with a distribution amount or with an amount for personal use.1 1 Government: “All right. From your knowledge and your training and your interaction on the street with crack cocaine users, do you have a sense about how many grams of crack cocaine a typical user would want to put in a pipe, for example, in order to get high?” Garcia: “Yes.” [Defense objection] Garcia: “Typically, less than a gram for one use, common use.” .... Government: “From your experience, looking at the amount and how it’s put together there, do you have a sense of whether that would typically be an amount that would be distributed, or is it a personal use amount?” [Defense objection] Garcia: “My experience, that seems to be a distribution amount.” Government: “And why do you – what factors do you look to as you look at that (continued...) 3 No. 07-51438 Detective Garcia testified, over objection, that, in his experience, it appeared to be a distribution amount. He based his determination on the fact that the crack rocks were larger than the size typical of personal use.2 The government then introduced, over objection, evidence of Thomas’s prior convictions for cocaine distribution. The government had given Thomas proper Rule 404(b) notice of its intention to introduce evidence of these convictions at trial, and the court had denied an opposition motion in limine by the defense prior to trial. The trial court also gave the jury a proper limiting instruction on the prior-convictions evidence at the time of the introduction. B. Second Count (the February 28, 2007 Offense) Thomas was charged in the second count of the indictment with possession with intent to distribute .28 grams of crack. Officer Jackie Thompson, formerly of the Odessa Police Department, testified that on the night of February 28, 2007, he and Corporal Michael Anaya were at the Super N motel. Officer Thompson observed Thomas standing at the driver’s side of a truck, talking to someone in the truck, and passing something hand to hand. While approaching the truck, Officer Thompson saw Thomas throw some white substance into the truck, which substance the officers thought might be crack. The officers then recovered three small rocks of crack from the area inside the truck where it appeared Thomas had thrown the white substance. Thomas stipulated that the crack recovered weighed .28 grams. While searching Thomas, Officer Thompson discovered $310 in cash on his person. Thomas did not possess any pay stubs, and he claimed that he had 1 (...continued) exhibit that would make you think that?” Garcia: “Just the amount. The typical user amount would be a small rock. These, of course, are large rocks of crack cocaine.” 2 On cross-examination, Detective Garcia conceded that the amount of drugs seized could also be for personal use. 4 No. 07-51438 earned the money by working odd jobs, such as yard work. From the truck, Corporal Anaya recovered a 7-UP can that had been modified in such a way that it could be used to smoke crack. He also testified that while questioning Thomas and the truck’s occupants, one of the other individuals attempted to swallow what Corporal Anaya thought was crack. At the end of the government’s case in chief, counsel for Thomas moved for a judgment of acquittal. The district court denied the motion, and, after entry of a stipulation as to the amount of crack involved in the February 28 offense, the defense rested. Defense counsel made another objection to the admissibility of the prior convictions, which was overruled. In giving its jury charge, the trial court repeated its limiting instruction on the use of the evidence of prior convictions. The jury eventually convicted Thomas on both counts. Defense counsel renewed his motion for a judgment of acquittal, which the court again denied. Thomas timely filed a notice of appeal. II. ANALYSIS A. The Federal Rule of Evidence 404(b) Challenge 1. Standard of Review We review a decision to admit evidence of prior convictions for abuse of discretion,3 subject to a harmless error inquiry if abuse is found.4 The abuse of discretion standard is heightened5 when evidence is admitted under Federal 3 United States v. Arnold, 467 F.3d 880, 885 (5th Cir. 2006), cert. denied, 127 S. Ct. 2445 (2007). 4 United States v. Morgan, 505 F.3d 332, 339 (5th Cir. 2007) (per curiam). 5 United States v. Miller, 520 F.3d 504, 511 (5th Cir. 2008), petition for cert. filed, 77 U.S.L.W. 2001 (U.S. June 24, 2008) (07-11561); United States v. Mitchell, 484 F.3d 762, 774 (5th Cir. 2007), cert. denied, 128 S. Ct. 297 (2007). 5 No. 07-51438 Rule of Evidence 404(b) because “[e]vidence in criminal trials must be strictly relevant to the particular offense charged.”6 2. Analysis Federal Rule of Evidence 404(b) states, in relevant part: Evidence of other crimes, wrongs, or acts is not admissible to prove the character of a person in order to show action in conformity therewith. It may, however, be admissible for other purposes, such as proof of motive, opportunity, intent, preparation, plan, knowledge, identity or absence of mistake or accident . . . . Evidence of prior wrongs must be extrinsic to implicate Rule 404(b).7 Extrinsic evidence is that which is not “inextricably intertwined with the charged offense, when both acts are part of the same criminal episode, or when the ‘other act’ was a necessary preliminary step toward the completion of the charged crime.”8 Moreover, the government must provide notice before offering extrinsic evidence of other crimes.9 Thomas does not contend that the government failed to provide notice, and the government does not claim that 6 United States v. Jackson, 339 F.3d 349, 354 (5th Cir. 2003) (internal quotation marks omitted). 7 United States v. Crawley, 533 F.3d 349, 353-54 (5th Cir. 2008). 8 Id. at 354. 9 FED. R. EVID. 404(b). 6 No. 07-51438 Thomas’s two prior state convictions for cocaine distribution10 are intrinsic. Thus, both of these threshold requirements were satisfied. We conduct our substantive Rule 404(b) inquiry under the two-prong test from United States v. Beechum.11 “First, it must be determined that the extrinsic evidence is relevant to an issue other than the defendant’s character.”12 “Second, the evidence must possess probative value that is not substantially outweighed by its undue prejudice and must meet the other requirements of [Federal Rule of Evidence] 403.”13 a. First Prong: Relevancy The standard used in the first prong’s relevancy inquiry is the same as the one used in Federal Rule of Evidence 401, namely, whether the evidence has “any tendency to make the existence of any fact that is of consequence to the determination of the action more or less probable than it would be without the 10 It is not possible to tell from the provisions under which Thomas was convicted for his prior state drug crimes, sections 481.112 and 481.115 of the Texas Health and Safety Code, whether he delivered powder cocaine or crack. The judgments from the Texas courts reference “cocaine,” but the structure of Texas Health and Safety Code section 481.102(3)(D), which lists cocaine as a substance the possession and delivery of which is criminalized by sections 481.112 and 481.115, includes “a salt, compound, derivative, or preparation of a salt, compound, or derivative” of cocaine as well. Crack would fall within this expansive definition of cocaine. As the matter is ambiguous, and as interpreting the convictions to be for cocaine and not crack favors Thomas, we presume that the convictions were for distribution of cocaine. It also appears that the November 23, 1993 conviction contains a typographical error as it describes the conviction as being for “Delivery of Cocaine,” but cites 481.115, which criminalizes possession, not delivery. In this appeal, however, Thomas does not contest the characterization of his prior convictions as being for delivery. 11 582 F.2d 898 (5th Cir. 1978) (en banc); see Crawley, 533 F.3d at 353-54. 12 Beechum, 582 F.2d at 911; United States v. Sanders, 343 F.3d 511, 518 (5th Cir. 2003). 13 Beechum, 582 F.2d at 911; United States v. Morgan, 505 F.3d 332, 339 (5th Cir. 2007) (per curiam). 7 No. 07-51438 evidence.”14 We have held that “[t]he mere entry of a not guilty plea in a conspiracy case raises the issue of intent sufficiently to justify the admissibility of extrinsic offense evidence.”15 This rule appears to have also been applied in drug cases when intent was at issue.16 The amount of time between the extrinsic offense and the offense charged is given a varying weight in the admissibility inquiry,17 but temporal proximity alone is not usually dispositive.18 We have held that a lapse of nine years between a conviction for possession of crack and a subsequent charge of possession of crack with intent to distribute did not render evidence of the prior conviction irrelevant, particularly because the defendant put his knowledge and intent at issue at trial.19 We have also admitted evidence of prior convictions for offenses committed as much as fifteen and eighteen years prior to the charged offense.20 The crimes with which Thomas was charged here, possession of crack with intent to distribute, required the government to prove that Thomas knowingly 14 FED. R. EVID. 401; see Beechum, 582 F.2d at 911. 15 United States v. Broussard, 80 F.3d 1025, 1040 (5th Cir. 1996). 16 See United States v. Arnold, 467 F.3d 880, 885 (5th Cir. 2006), cert. denied, 127 S. Ct. 2445 (2007). 17 See United States v. Miller, 520 F.3d 504, 512 (5th Cir. 2008), petition for cert. filed, 77 U.S.L.W. 2001 (U.S. June 24, 2008) (07-11561); United States v. Jimenez, 613 F.2d 1373, 1376 (5th Cir. 1980); United States v. San Martin, 505 F.2d 918, 922-23 (5th Cir. 1974); see also United States v. Garcia, 291 F.3d 127, 138-39 (2d Cir. 2002); United States v. Lynn, 856 F.2d 430, 435 (1st Cir. 1988). 18 Arnold, 467 F.3d at 885; Broussard, 80 F.3d at 1040. 19 Arnold, 467 F.3d at 885. 20 See id. 8 No. 07-51438 possessed crack and that he intended to distribute the crack he possessed.21 By pleading not guilty and submitting the issues of knowledge and intent to examination at trial, Thomas made extrinsic evidence of prior convictions relevant to show such knowledge and intent.22 Even if this were not the case, Rule 404(b) clearly contemplates, by its terms, the use of extrinsic offense evidence to prove intent and knowledge. Therefore, the only question under the standard Rule 401 inquiry in Beechum’s first prong is whether two prior convictions for cocaine delivery make it more or less likely that Thomas knowingly possessed crack and intended to distribute it this time.23 His prior convictions certainly help to rule out the possibility that Thomas was unfamiliar with powder cocaine or crack, with the ways in which such drugs are packaged, and with the manner in which they are distributed. This is not a consequence of the “bad character” that a prior cocaine distribution conviction might be thought to represent, but of the fact that it eliminates some alternative explanations, such as ignorance of drugs and the drug trade. Further, “because the defendant had unlawful intent in the extrinsic offense, it is less likely that he had lawful intent in the present offense.”24 Thomas’s extrinsic prior offenses were crimes for which either knowledge or intent was required.25 There are, therefore, reasons other than evidence of Thomas’s 21 See United States v. Aguilar, 503 F.3d 431, 435 (5th Cir. 2007) (per curiam), cert. denied, 128 S. Ct. 1304 (2008). 22 Because Thomas’s prior convictions were for delivery, not mere use, his citations to United States v. McDonald, 905 F.2d 871, 875 (5th Cir. 1990) and United States v. Hill, 953 F.2d 452,456 (9th Cir. 1991), are inapposite. 23 As discussed above, the fact that (by assumption) different narcotics are involved does not preclude a finding of relevance. See Broussard, 80 F.3d at 1040. 24 United States v. Beechum, 582 F.2d 898, 911 (5th Cir. 1978) (en banc). 25 See TEX. HEALTH & SAFETY CODE §§ 481.112, 481.115 (Vernon 2007). 9 No. 07-51438 character why the prior extrinsic offenses make intent and knowledge more likely in the instant case. Accordingly, the prior extrinsic evidence is relevant. This conclusion accords with a vast number of cases in this circuit. For example, in United States v. Arnold,26 we determined that a nine-year-old conviction for possession of crack was relevant to a new charge of possession of crack with the intent to distribute it. In United States v. Broussard,27 we determined that a ten-year-old conviction for conspiring with intent to distribute marijuana was relevant to a charge of possessing cocaine with the intent to distribute it. b. Second Prong: Probative Value vs. Undue Prejudice For purposes of the second Beechum prong, a similarity between the elements of a prior extrinsic offense and the elements of the charged offense may enhance the probative value of the extrinsic evidence.28 Even the fact that a prior conviction involved different kinds of narcotics than those implicated in the charged act does not render evidence inadmissible.29 A similarity between the offenses, however, also increases the risk of prejudice; so, when the government adduces strong evidence of intent, extrinsic offense evidence should be more 26 467 F.3d 880, 885 (5th Cir. 2006), cert. denied, 127 S. Ct. 2445 (2007). 27 80 F.3d at 1039-40. 28 United States v. Bermea, 30 F.3d 1539, 1562 (5th Cir. 1994). 29 See Broussard, 80 F.3d at 1030, 1040. 10 No. 07-51438 readily excluded.30 Inversely, when the direct evidence of intent is slight, the probative value of extrinsic evidence is enhanced.31 We have frequently held that extrinsic evidence of past drug offenses is “more probative than prejudicial.”32 This is a consequence of Rule 403, which “tips the balance in favor of the admission of relevant evidence, permitting exclusion only if the evidence’s probative value is substantially outweighed by the danger of unfair prejudice.”33 Finally, limiting instructions by the trial court mitigate the possibility of unfair prejudice,34 particularly when given immediately after the extrinsic offense evidence is admitted.35 The probative value versus unfair prejudice balancing and the Rule 403 inquiries of Beechum’s second prong essentially reduce to a prejudice inquiry in this appeal because Thomas has not argued that admission of his prior drug convictions led to “confusion of the issues, or misleading the jury, or . . . undue 30 Bermea, 30 F.3d at 1562. We made this clear in United States v. Jackson, 339 F.3d 349, 356 (5th Cir. 2003), when, in analyzing the second of the Beechum prongs, we held that when there is “other substantial evidence going to the issue of intent,” extrinsic evidence might be unduly prejudicial. In that case, however, the defendant had not put intent at issue (arguing instead that he was the wrong man). Thomas’s defense strategy put intent directly at issue. 31 United States v. LeBaron, 156 F.3d 621, 625 (5th Cir. 1998). 32 United States v. Harris, 932 F.2d 1529, 1534 (5th Cir. 1991); Bermea, 30 F.3d at 1562. 33 Bermea, 30 F.3d at 1562. 34 United States v. Miller, 520 F.3d 504, 512 (5th Cir. 2008), petition for cert. filed, 77 U.S.L.W. 2001 (U.S. June 24, 2008) (07-11561); United States v. Adair, 436 F.3d 520, 527 (5th Cir. 2006). 35 United States v. Broussard, 80 F.3d 1025, 1040 (5th Cir. 1996). 11 No. 07-51438 delay, waste of time, or needless presentation of cumulative evidence.”36 We preface the prejudice inquiry in this case with three observations.37 First, we wrote in United States v. Harris that “[a]s to the relative probative value of the evidence, our court has previously held that proof of prior drug activities is more probative than prejudicial.”38 Second, two limiting instructions were given in the trial of this case, one at the time that the evidence was introduced and another during the charging of the jury; and we have previously held such instructions cure much of any prejudice otherwise attributable to the admission of evidence of prior convictions.39 Third, no other “substantial evidence” going to the issue of intent was adduced in this trial, which increases the probative value of extrinsic evidence of similar prior offenses.40 As extrinsic evidence of prior drug crimes has been held to be more probative of intent and knowledge than prejudicial, the only serious contention Thomas makes under Beechum’s second prong is that his convictions are so old that their probative value was substantially outweighed by their prejudicial 36 FED. R. EVID. 403. 37 A fourth observation, not as important, concerns Thomas’s complaints about the references by the government to his prior convictions at closing. The government in the instant case was careful to ask the jury to think about the convictions as evidence only of intent. As we conclude that such a use is permitted by Rule 404(b), there is no reason to treat the use of this evidence in closing different from the way we would treat it if it occurred during the government’s case in chief. United States v. Jackson, 339 F.3d 349 (5th Cir. 2003), is not to the contrary. It was the use of the evidence by the government to attack the defendant’s character during its opening statement that was problematic. Id. at 356-57. 38 932 F.2d 1529, 1534 (5th Cir. 1991). 39 Miller, 520 F.3d at 512; United States v. Adair, 436 F.3d 520, 527 (5th Cir. 2006); United States v. Broussard, 80 F.3d 1025, 1040 (5th Cir. 1996). 40 United States v. LeBaron, 156 F.3d 621, 625 (5th Cir. 1998). 12 No. 07-51438 effect. The cases Thomas cites for this proposition are inapposite. In United States v. San Martin, we said: The test for remoteness need not, and indeed cannot, be reduced to a simple rule of thumb based solely on the number of years that have elapsed between the prior crime and the present offense charged. The better test . . . is whether the prior crime is similar [enough] in nature and in its material elements to have clearly probative value with respect to the intent of the accused at the time of the offense charged.41 The prior convictions that we ruled inadmissible in that case clearly lacked probative value: Two were youthful indiscretions that involved the formation of intent in a split second and the third did not include specific intent as a material element.42 In contrast, Thomas was in his thirties at the time of his first conviction; and, in contrast to the situation in San Martin that involved an assault on a police officer, here there is no contention by Thomas that, if he formed an intent to distribute the crack at all, he did so in a split second. Even were this not so, we have held, as discussed above, that prior drug crimes are “sufficiently similar in nature” to have “clearly probative value with respect to the intent of the accused.” The scale in the central probative/prejudice balancing inquiry tips in favor of admitting evidence of prior drug offenses when the defendant is charged with another drug-related crime. The second case Thomas cites, United States v. Jimenez,43 involved extrinsic evidence of an offense committed after the crime with which the defendant was charged. There we said: “Although we do not suggest that subsequent extrinsic evidence could never be admitted under rule 404(b), it 41 505 F.2d 918, 922-23 (5th Cir. 1974) (footnote omitted). 42 Id. 43 613 F.2d 1373, 1376 (5th Cir. 1980). 13 No. 07-51438 certainly bears substantially less on predisposition than would a prior extrinsic offense.”44 Unlike the post-hoc extrinsic offenses introduced in Jimenez, those in Thomas’s case occurred prior to the crimes of conviction at issue in this appeal. Additionally, Jimenez’s discussion of the time factor is dicta in light of its conclusion that the evidence failed the first prong of the Beechum test. Finally, unlike here, no limiting instruction was given to the Jimenez jury. The teachings of other circuits are not to the contrary on the core issue in the probative/prejudice inquiry, viz., the similarity between the offenses. Thomas cites United States v. Lynn, in which the First Circuit said that “the fact that the prior conviction concerned events that took place six years before the instant offense suggests even more strongly that the two acts were unrelated but for involvement with the same illicit substance.”45 The focus of the Lynn court, however, was on the dissimilarity between the two offenses. It concluded its discussion by saying: “Given the dissimilarities between the two episodes, we cannot uphold the district court’s finding that the prior crimes evidence was probative . . . .”46 The last case cited by Thomas, United States v. Garcia,47 held that a lapse of twelve years prevented a finding that the defendant knew a particular phone conversation comprised a “coded drug transaction.” There was no evidence from the defendant’s prior conviction that he knew drug dealers sometimes communicate in code. Again, the focus was on the probative value of the prior crime of conviction, with time lapse merely a factor (although given more weight in Garcia than in other cases). In fact, we have affirmed a district court’s 44 Id. 45 856 F.2d 430, 435 (1st Cir. 1988). 46 Id. (emphasis added). 47 291 F.3d 127, 138-39 (2d Cir. 2002). 14 No. 07-51438 admission of evidence of crimes committed more than twelve years prior to the charged offense.48 We are convinced that the district court did not abuse its discretion when it determined that the probative value of Thomas’s two prior cocaine distribution convictions outweighed any undue prejudice that they might have conveyed to the jury.49 Given our conclusion regarding the first Beechum prong, we hold that the evidence of prior crimes was properly admitted. This obviously obviates the need to conduct a harmless error inquiry. B. Detective Garcia’s Testimony 1. Standard of Review The decision of a district court to admit evidence is reviewed for abuse of discretion, subject to a harmless error inquiry.50 2. Analysis The requirements of the Federal Rules of Evidence governing expert testimony apply only to testimony from a witness tendered as an expert.51 As Detective Garcia was not tendered as an expert, the strictures of Rule 704(b) are 48 United States v. Arnold, 467 F.3d 880, 885 (5th Cir. 2006) (citing, with apparent approval, admission of a fifteen-year-old conviction in a drug case), cert. denied, 127 S. Ct. 2445 (2007). 49 There are, of course, cases in which the prior convictions are so stale that the passage of time itself calls into question their similarity to the charged offense. See, e.g., United States v. San Martin, 505 F.2d 918, 922 (5th Cir. 1974) (noting that the prior crimes “must not be so remote as to be lacking in evidentiary value.” (internal quotation marks omitted)). The effect of the lapse of time between crimes on the probative value of the evidence of prior offenses necessarily varies according to the presence and extent of the other factors discussed above. The lopsided distribution in favor of admissibility of almost all the factors except the passage of time in the instant case makes it a poor candidate for any more elaborate discussion of the issue. 50 United States v. Williams, 957 F.2d 1238, 1240-41 (5th Cir. 1992). 51 United States v. Allard, 464 F.3d 529, 533 (5th Cir. 2006). 15 No. 07-51438 inapplicable.52 Therefore, under Rule 704(a), his testimony could “embrace an ultimate issue to be decided by the trier of fact,” such as whether Thomas intended to distribute the crack he possessed on May 1, 2007. Nevertheless, Detective Garcia’s testimony was opinion testimony, albeit lay opinion testimony, so it must satisfy the requirements of Federal Rule of Evidence 701. Specifically, it must be “(a) rationally based on the perception of the witness, (b) helpful to a clear understanding of the witness’ testimony or the determination of a fact in issue, and (c) not based on scientific, technical, or other specialized knowledge within the scope of Rule 702.”53 Thomas does not contend that Detective Garcia’s testimony is an impermissible lay opinion either because it is unhelpful or because it deals with specialized knowledge within the scope of Rule 702. Rather, he contends that the testimony is not rationally based on Detective Garcia’s perceptions. This argument is meritless. The record amply supports Detective Garcia’s first-hand knowledge of the amounts of crack consumed by users.54 Although Thomas cites United States v. Garcia, and although that case may well stand for the proposition that a lay witness cannot offer opinion testimony as to why a 52 United States v. Ibarra, 493 F.3d 526, 532 (5th Cir. 2007), cited by Thomas for the proposition that a particular phrasing of expert testimony by a police officer in a criminal case may transgress Rule 704(b) by embracing an ultimate issue of fact, and United States v. Speer, 30 F.3d 605, 609-10 (5th Cir. 1994), cited by the government for the proposition that an expert witness such as a DEA agent may testify as to whether an amount of drugs is “consistent with narcotics trafficking” or consistent “with personal use,” are inapplicable as they turn on Rule 704(b). 53 FED. R. EVID. 701. 54 Garcia testified that he had made two or three crack arrests per night for three years, totaling in the hundreds. He also testified that he had talked to crack users about how they consume it, how much they consume, and other related matters. He had also had formal training about narcotics in classes and seminars. 16 No. 07-51438 defendant might speak about particular matters in code,55 nothing in Garcia can be read as preventing a witness from offering non-expert opinion testimony about patterns of conduct with which he has extensive first-hand experience (e.g., the frequency with which a specific amount of a given drug is, as an empirical matter, associated with distribution rather than personal use). Had Detective Garcia testified as to why Thomas might have been in possession of this particular quantity of crack or about what Thomas intended to do with it, the analysis under Garcia might be different. But Detective Garcia offered his opinion about a theoretically ascertainable empirical fact, which was rationally connected to his first-hand observations. On this record, the district court did not abuse its discretion when it allowed Detective Garcia to testify about the concordance between distribution quantities and the amount of crack Thomas possessed during the May 1 offense. C. Sufficiency of the Evidence 1. Standard of Review Thomas timely moved for a judgment of acquittal on both counts. Such a motion challenges the sufficiency of the evidence. As that motion preserved the sufficiency-of-the-evidence issue for appellate review, we review the denial of the motion for acquittal de novo.56 Albeit classified as de novo, our sufficiency-of-the-evidence review is “highly deferential to the verdict.”57 We “will affirm . . . if a reasonable trier of fact could conclude . . . the elements of the offense were established beyond a reasonable doubt, viewing the evidence in the light most favorable to the verdict 55 291 F.3d 127, 140-42 (2d Cir. 2002). 56 United States v. McDowell, 498 F.3d 308, 312 (5th Cir. 2007). 57 United States v. Gulley, 526 F.3d 809, 816 (5th Cir. 2008) (per curiam) (internal quotation marks omitted), petition for cert. filed, 76 U.S.L.W. 2784 (U.S. June 12, 2008) (No. 07-11424). 17 No. 07-51438 and drawing all reasonable inferences from the evidence to support the verdict.”58 This standard of review does not depend on whether the evidence presented at trial is direct or circumstantial.59 2. Analysis To be convicted of possession with intent to distribute crack,60 a violation of 21 U.S.C. § 841(a)(1) (Supp. V 2005), a defendant must knowingly possess the crack, either actually or constructively,61 and must intend to distribute it.62 A jury may infer intent to distribute based solely on possession of an amount too large to be used by the person in possession.63 The Eighth Circuit has held that 9.9 grams of crack “far exceeds the amount attributable to personal use.”64 The Fourth Circuit came to the same conclusion about “thirteen plus” grams.65 We have held that 19.67 grams, together with a DEA agent’s testimony that the amount “was almost surely intended for distribution,” created “at least a jury 58 McDowell, 498 F.3d at 312 (alterations in original) (internal quotation marks omitted). 59 United States v. Bryant, 770 F.2d 1283, 1288 (5th Cir. 1985). 60 As there is no serious contention that the weight of the crack from the May 1 offense was inaccurately determined, this discussion will treat the May 1 and February 28 offenses as essentially the same crime, with different facts. 61 United States v. McKnight, 953 F.2d 898, 901 (5th Cir. 1992) (“[A] person has constructive possession if he knowingly has ownership, dominion, or control over the contraband itself or over the premises in which the contraband is located. Constructive possession need not be exclusive, it may be joint with others, and it may be proven with circumstantial evidence. However, more evidence than mere physical proximity of the defendant . . . is required.” (internal citations and footnote omitted)). 62 United States v. Aguilar, 503 F.3d 431, 434-35 (5th Cir. 2007) (per curiam) (citing United States v. Mata, 491 F.3d 237, 242 (5th Cir. 2007)), cert. denied, 128 S. Ct. 1304 (2008). 63 United States v. Kates, 174 F.3d 580, 582 (5th Cir. 1999) (per curiam). 64 United States v. Smith, 91 F.3d 1199, 1201 (8th Cir. 1996). 65 United States v. Bell, 954 F.2d 232, 235 (4th Cir. 1992), overruled on other grounds, United States v. Burgos, 94 F.3d 849 (4th Cir. 1996) (en banc). 18 No. 07-51438 question regarding intent to distribute.”66 Nevertheless, “[p]ossession of a small quantity of illegal drugs consistent with personal use does not support an inference of intent to distribute in the absence of other evidence, such as drug paraphernalia, guns, or large quantities of cash.”67 “The evidence need not exclude every reasonable hypothesis of innocence or be wholly inconsistent with every conclusion except that of guilt, and the jury is free to choose among reasonable constructions of the evidence.”68 “If, however, the evidence gives equal or nearly equal circumstantial support to a theory of guilt and to a theory of innocence, [this court] will reverse the conviction, as under these circumstances a reasonable jury must necessarily entertain a reasonable doubt.”69 It is proper for fact finders to “use their common sense and evaluate the facts in light of their common knowledge of the natural tendencies and inclinations of human beings.”70 In United States v. Hunt, we reversed a conviction in which nothing but the quantity of crack possessed supported a finding of intent to distribute.71 We held in Hunt that, alone, evidence of possessing 7.998 grams of crack is insufficient, as a matter of law, to support a finding of intent to distribute. The only other evidence in Hunt to support intent to distribute included a razor blade, blunts, a gun, and the absence of smoking pipes or other such use instruments. We concluded that this evidence was also consistent with personal 66 Kates, 174 F.3d at 583. 67 Id. at 582. 68 United States v. Fuchs, 467 F.3d 889, 904 (5th Cir. 2006) (internal quotation marks omitted), cert. denied, 127 S. Ct. 1502 (2007). 69 United States v. Hunt, 129 F.3d 739, 742 (5th Cir. 1997). 70 United States v. Ayala, 887 F.2d 62, 67 (5th Cir. 1989) (internal quotation marks omitted). 71 129 F.3d at 742-44. 19 No. 07-51438 use and determined that a reasonable jury could not have found that the defendant intended to distribute the crack beyond a reasonable doubt. We have also held, however, that there is no specific minimum amount of a drug that is required to establish an inference of an intent to distribute.72 a. Possession - May 1 Offense If all of Officer Jurado’s testimony were believed, as it must be for this variety of highly deferential review, he saw Thomas with a flimsy baggie; he saw Thomas flee; during the chase, he saw Thomas throw a flimsy object; a subsequent search, shortly after the chase, of the area where Officer Jurado saw Thomas throw the flimsy object turned up a flimsy object, a bag; and the bag contained 12.71 grams of crack. A reasonable trier of fact could conclude from this evidence that Thomas had the crack in a bag in his pocket during the chase and that he threw it over a fence in an attempt to prevent Officer Jurado from discovering it. This is sufficient evidence to demonstrate actual possession by Thomas before and during the chase. The Eighth Circuit’s case cited by Thomas, United States v. Townley,73 is not to the contrary. There, no cocaine was found in the defendant’s apartment, and the only connection between the defendant and the owner of the apartment where the cocaine was found was a picture and some testimony that they knew each other. Because the defendant did not have actual possession of the cocaine, the court would have had to determine that he had constructive possession over the contraband to affirm his conviction. The defendant did not have “ownership, dominion, or control over the contraband itself or over the premises in which the 72 United States v. Majors, 328 F.3d 791, 796 (5th Cir. 2003) (per curiam). 73 942 F.2d 1324, 1325 (8th Cir. 1991). 20 No. 07-51438 contraband [was] located,”74 and therefore did not have constructive possession.75 In this case, by contrast, Thomas’s possession was actual. Assuming the jury believed Officer Jurado, Thomas actually possessed the crack until he threw it away, likely in an attempt to hide it or at least to terminate his actual possession. b. Intent to Distribute - May 1 Offense There is less, but nevertheless sufficient, evidence that Thomas intended to distribute the crack. No drug paraphernalia was found on Thomas, but one of the women waiting for him in a car in the hotel parking lot had a crack pipe. While in possession of a large quantity of crack, Thomas approached the car in which the woman was waiting for him. Even though it is not impossible that the quantity possessed by Thomas could have been for his personal use, he had been convicted previously for delivery of cocaine, which, as discussed above, is probative of intent. Taken in the light most favorable to the verdict, a reasonable jury could have concluded beyond a reasonable doubt that a defendant (1) who was twice before convicted of cocaine delivery and (2) who approached a car in which another person was waiting for him, (3) which other person was in possession of a crack pipe, but the defendant was not, and (4) the defendant was in possession of an amount of crack greater than amounts we have determined to be legally inadequate and within the range of amounts determined by this and other courts to be evidence of intent to distribute, intended to distribute the crack. Accordingly, there is sufficient evidence to support Thomas’s conviction in count one of the indictment. c. Possession - February 28 Offense 74 United States v. McKnight, 953 F.2d 898, 901 (5th Cir. 1992). 75 Townley, 942 F.2d at 1327. 21 No. 07-51438 The evidence, viewed in the light most favorable to the verdict, permits a reasonable trier of fact to conclude beyond a reasonable doubt that Thomas possessed crack on February 1, 2007. If Officer Thompson is believed (and this standard of review requires the court to credit his testimony), Thomas threw something white, which from a distance looked like it might be crack, into a truck in which crack was immediately discovered in the general vicinity where Thomas had just thrown the white “something.” d. Intent to Distribute - February 28 Offense Thomas’s prior convictions for cocaine distribution are probative of his intent to distribute on February 28, just as they are for the May 1 offense. The case for intent otherwise is even clearer, as Thomas was seen at the truck talking to passengers who were in possession of a device for smoking crack, and he threw the crack he possessed into their truck. Although the amount of crack involved in the February 28 offense is considerably less than the quantity involved in the May 1 offense, the crack at issue on February 28 had been divided into three rocks, conceivably indicating that it was intended for distribution.76 Officer Thompson observed a hand-to- hand transaction consistent with a narcotics deal between Thomas and the occupants of the truck. Despite being unemployed and having no supporting evidence of how he came by the money, Thomas possessed $310.77 If Corporal Anaya’s testimony is believed, he observed one of the truck’s occupants attempting to swallow some crack. Taken together, these facts are sufficient to 76 Thomas highlights what he perceives to be an inconsistency between being saddled with evidence of intent to distribute for possession of a large quantity and then being saddled with intent to distribute a small quantity. He misses the crucial distinction that, although a large quantity may support a finding of intent to distribute because the quantity is inconsistent with personal use, many small parcels of drugs support a finding of intent to distribute because their packaging is inconsistent with personal use. 77 This amount probably does not qualify as the “large quantities of cash” that we have previously identified as an indicium of intent to distribute. 22 No. 07-51438 permit a reasonable trier of fact to conclude beyond a reasonable doubt that Thomas committed each of the elements of the charged offense, including intent to distribute the crack. III. CONCLUSION For the foregoing reasons, Thomas’s convictions by a jury on both counts of the instant indictment are AFFIRMED. 23
2024-07-04T01:27:15.642919
https://example.com/article/6060
/*- * << * Moonbox * == * Copyright (C) 2016 - 2019 EDP * == * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. * >> */ /** * Licensed to the Apache Software Foundation (ASF) under one * or more contributor license agreements. See the NOTICE file * distributed with this work for additional information * regarding copyright ownership. The ASF licenses this file * to you under the Apache License, Version 2.0 (the * "License"); you may not use this file except in compliance * with the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.apache.hive.service.cli.operation; import org.apache.hadoop.hive.conf.HiveConf; import org.apache.hadoop.hive.metastore.TableType; import org.apache.hadoop.hive.ql.security.authorization.plugin.HiveOperationType; import org.apache.hive.service.cli.*; import org.apache.hive.service.cli.session.HiveSession; /** * GetTableTypesOperation. * */ public class GetTableTypesOperation extends MetadataOperation { protected static TableSchema RESULT_SET_SCHEMA = new TableSchema() .addStringColumn("TABLE_TYPE", "Table type name."); private final RowSet rowSet; private final TableTypeMapping tableTypeMapping; protected GetTableTypesOperation(HiveSession parentSession) { super(parentSession, OperationType.GET_TABLE_TYPES); String tableMappingStr = getParentSession().getHiveConf() .getVar(HiveConf.ConfVars.HIVE_SERVER2_TABLE_TYPE_MAPPING); tableTypeMapping = TableTypeMappingFactory.getTableTypeMapping(tableMappingStr); rowSet = RowSetFactory.create(RESULT_SET_SCHEMA, getProtocolVersion()); } @Override public void runInternal() throws HiveSQLException { setState(OperationState.RUNNING); if (isAuthV2Enabled()) { authorizeMetaGets(HiveOperationType.GET_TABLETYPES, null); } try { for (TableType type : TableType.values()) { rowSet.addRow(new String[] {tableTypeMapping.mapToClientType(type.toString())}); } setState(OperationState.FINISHED); } catch (Exception e) { setState(OperationState.ERROR); throw new HiveSQLException(e); } } /* (non-Javadoc) * @see org.apache.hive.org.apache.hive.service.cli.Operation#getResultSetSchema() */ @Override public TableSchema getResultSetSchema() throws HiveSQLException { assertState(OperationState.FINISHED); return RESULT_SET_SCHEMA; } /* (non-Javadoc) * @see org.apache.hive.org.apache.hive.service.cli.Operation#getNextRowSet(org.apache.hive.org.apache.hive.service.cli.FetchOrientation, long) */ @Override public RowSet getNextRowSet(FetchOrientation orientation, long maxRows) throws HiveSQLException { assertState(OperationState.FINISHED); validateDefaultFetchOrientation(orientation); if (orientation.equals(FetchOrientation.FETCH_FIRST)) { rowSet.setStartOffset(0); } return rowSet.extractSubset((int)maxRows); } }
2023-11-09T01:27:15.642919
https://example.com/article/4973