text stringlengths 12 4.76M | timestamp stringlengths 26 26 | url stringlengths 32 32 |
|---|---|---|
Eviction notices were handed out Friday night to Occupiers in Oakland, where the Oakland Police Officers Association argues that monitoring Occupy is unfairly cutting into worker hours that should be spent patrolling the rest of the city.
The man, who so far has not been identified, was gunned down Thursday near the Occupy Oakland encampment, and Friday Mayor Jean Quan asked the hundreds of demostrators camped in Frank Ogawa Plaza to leave voluntarily.
"It is an example of why we need to peacefully close the encampment at City Hall," Quan said. "We are asking everyone at the plaza to leave. We're going to give another official notice today."
Quan and some of the city's religious leaders released doves during a prayer service at Downtown Cathedral.
"We pray for divine wisdom upon the mayor as the leader of this city," one religious leader said. "We pray for the shooting victim. We pray for the person who shot."
The Oakland Police Officers' Association (OPOA) said the connection between the Occupy protest and the killing is clear.
"I don't see too many broad daylight murders in Downtown Oakland," Dom Arotzarena with OPOA said. "What's happened in Oakland is that this Occupy Oakland (movement) has created an environment that is conducive to crime."
"They were not occupiers," protester Maxwell Pryde said. "It happened in an area where kids come hang out after school anyway."
Clashes between Oakland police and Occupiers have been intermittent, with police on Oct. 25 tear-gassing that encampment and arresting 85 Occupiers. The next day, Occupiers were allowed to return to their makeshift headquarters.
No deadline for heeding the new eviction notices was set, the AP reported.
In Salt Lake City -- where, thus far, police said, 91 arrests of Occupiers roughly equals the total 2010 arrests for the area including the encampment -- protesters countered officials' complaints.
He was among those who said their group of about 150 would go to jail before abandoning the encampment, part of a growing global movement protesting Wall Street dominance and declining overall incomes for most other households.
In Vermont, 35-year-old transient Joshua Pfenning's shooting suicide, using what police said was a stolen gun, Police Chief Mike Schirling to question the prudence of allowing the camp to remain, the Burlington Free Press reported.
Pfenning, police said, aimed the gun one of three other people inside his tent before his self-inflicted shot, about which he had forewarned other protesters.
"We know that at least one weapon has been present in the encampment and we are now clear that there has been extensive consumption of alcohol and some use of drugs by those present in the camp," said Shirling, who, according to the Free Press, had walked through the camp, chatting with protesters and handing out his business card. "The presence of structures and tents creates an enhanced risk by virtue of the activity that can and is occurring inside them." | 2023-10-29T01:26:59.872264 | https://example.com/article/1507 |
New women's flops White Island Rider thong flip URzWXwq5
Are you missing meaty Indian hand pies now that you’ve gone Paleo? Never fear! I’ve got a great recipe for Deconstructed Samosa—a.k.a. Spiced Keema!
In early 1996, Henry and I spent part of the blustery winter in London. We’d just graduated from college, and to celebrate, his parents had treated us to a trip. From our little Curzon Street apartment in Mayfair (right in Shepherd Market), we ventured around the city. Besides playing tourist, Henry wanted to catch the world premiere of Trainspotting (and drink beer in the theater) and stock up on Doc Martens in Camden. (It was the mid-90s, after all.) Me? Ever the gastro-tourist, I was there for the food. And you know what they say: when in London, eat Indian food.
Authentic Indian cuisine wasn’t new to me. Growing up in the San Francisco Bay Area, with its large and vibrant Indian and Pakistani communities, I can’t remember a time I didn’t crave great Indian grub: spicy curries, meat and vegetable stews, and rich, fragrant daal—all served with a variety of breads like brick-oven-baked naan, deep-fried bhatura or pan-cooked chapati flatbread.
But the Indian food in London was revelatory, and we ate copious amounts of it. When we spent a weekend in Paris, I got sick and holed up in the hotel; my only directions to Henry were to bring me back macarons and—of all things to eat in Paris—Indian samosas. I was hooked.
You’re a samosa fan, too, right? These fried pastry pockets can be stuffed with spicy vegetables or meat, though these days, I prefer the latter. After all, the meat filling—keema—is the perfect emergency protein: it’s simple to make with pantry and fridge staples, and it’s great with everything from cauliflower riceYoga Tonal Flip Mat Sanuk Women’s Grey Flop vZ4w0vqxnU and sweet potato hash to hearty omelets and crisp lettuce wraps.
For my deconstructed samosa dish, I adapted a recipe for sookha keema (dry-cooked spicy ground meat) from one of my favorite cookbooks of all time, Julie Sahni’s Classic Indian Cooking. The jacket is torn and tattered (and held together with tape), the text-only pages are dog-eared and splattered with curry sauce, but my first-edition copy of Classic Indian Cooking is still my go-to for authentic Indian recipes.
If you’re on a Whole30, you can serve the spiced meat in lettuce cups. Otherwise, you should buy this recipe from Tara Grant of Primal Girl and fry up some Paleo-friendly flatbread for this recipe. (And no, I wasn’t asked or paid to mention Tara’s recipe—I didn’t even sign up to be an affiliate, because I’m not looking to make money off of it. I bought the recipe myself after reading some rave reviews online, and I think it’s well worth the $3.95 price tag. I mean, we spend more on a big cuppa coffee, right?)
PRINTER-FRIENDLY RECIPE CARD
Deconstructed Samosa (Spiced Keema)
If you're missing Indian samosas now that you've gone Paleo, you should make this delicious deconstructed samosa recipe! If you pair this spiced keema with a grain-free flatbread, you'll be in Indian food heaven!
Rider thong Island White flops women's New flip Stir in the turmeric, salt, and coconut milk, and bring to a simmer.
Cover the pan and reduce the heat to medium low. Simmer the meat for 20 minutes, stirring occasionally.
When time’s up, check to see if the liquid has evaporated from the meat. If not, cook the meat uncovered for 5 more minutes or until the moisture is gone.
Remove the pan from the heat and mix in the garam masala, lemon juice, and minced cilantro. Adjust the seasoning to taste with additional salt, garam masala, or lemon juice.
You can serve the spiced meat in fresh lettuce wraps or you can serve it on some crispy flatbread! I fried up a few rounds of crispy flatbread using Tara Grant‘s wonderful Magical Multipurpose Paleo Dough recipe. | 2023-10-21T01:26:59.872264 | https://example.com/article/8393 |
The truth about copper poisoning from Moscow mules
Head out on the town this summer and you’ll probably see it at some outdoor patio: a beverage clutched in the hands of someone who looks quite trendy, lime slices floating among ice cubes, condensation glistening on a cool, copper mug. The Moscow mule.
Moscow mules — not from Russia nor having anything to do with donkey/horse crossbreeds — are prepared with ginger beer, vodka and lime juice, and have been back in the spotlight in recent years.
However, worries have flurried after a recent news bulletin from the Iowa Alcoholic Beverages Division cast doubt on using copper mugs to serve the popular cocktail. Copper mugs have been the traditional serving method since the drink’s invention in the 1940s.
The Iowa agency adopted regulations prohibiting bars and restaurants from using copper mugs, based on FDA guidelines that suggest copper shouldn’t come into contact with foods or drinks that have a pH level below 6.0.
On the pH scale, which is used to determine the acidity of a substance, 7 is neutral. Anything below that is acidic. The ingredients of Moscow mules fall “well below” 6.0, meaning that they can leach the easily-dissolvable copper off of their container and cause the not-so-fun experience of copper poisoning in drinkers. Copper poisoning can cause diarrhea, vomiting and jaundice.
University of Massachusetts Amherst chemist Trisha Andrew spoke to Huffington Post about the realities of any potential danger in drinking Moscow mules.
“It’s been suggested that a concentration of 30 milligrams of copper per liter has been noticed to cause nausea in a small population of test subjects,” she said. “So the question is: Over the duration of time that a Moscow mule sits in a copper mug, is that enough time and acidity to leach out 30 milligrams of copper per liter?”
Her answer: no. For one, the average drinker probably won’t even drink a full liter of Moscow mules in one night. What more, nursing a drink all night is not enough time for a significant amount of copper to be leached.
“Based on the dissolution rates, it’s just nonsensical,” Andrew said. “You have to let the copper mug sit in straight lime juice for a few hours before you can even start to begin to worry about [copper poisoning].”
Another reason you can probably relax and enjoy your drink: Many bars and restaurants already serve the cocktail in copper cups safely lined with tin or stainless steel. | 2024-07-08T01:26:59.872264 | https://example.com/article/9583 |
Illinois Tech In the News
“It’s a collective action problem,” explains Martin Malin. “It’s a rational decision ― even for someone who wants to be represented in collective bargaining ― to not become a member, because their dues won't make any [noticeable] difference, and the benefits of collective bargaining are collective goods.”
Hayley Perelman, a fourth-year doctoral student in clinical psychology at Illinois Tech, discussed her own personal transition from swimming to psychology and the current state of mental health issues that are affecting college athletes during and after their tenure.
"eDiscovery retrospectively was the first thing through the wall. If you said we need to review 10 million emails, just as an example, the existing business model and economics around that weren’t rational. It was a problem created by and solved through technology," says Daniel Martin Katz.
Richard Gonzalez and Mariana Karampelas (LAW '11), a graduate of Chicago-Kent's Solo and Small-Practice Incubator Program, spoke to the Chicago Tribune about a cat custody dispute between an artist and a pet shelter.
Shlomo Argamon says recent claims that researchers cracked the 600-year-old code in the Voynich manuscript are “perhaps slightly questionable, but not more so than many other results often published in the scientific literature.”
"While this case doesn’t go as far as overruling some bad precedent about sexual orientation claims, it cracks open the door in a way that’s important," Anthony Michael Kreis says in a Bloomberg Law article about the First Circuit's ruling in Franchina v. City of Providence.
Lewis College of Human Sciences will host the second of three spring semester professional development workshops on Monday, February 26 from 12:45–1:45 p.m. in the Lewis College Dean’s Conference Room.
Due to its popularity, the Financial Systems for Managers training program on Wednesday, February 21 from 9:30 a.m.–noon has been moved to a larger space in the Galvin Center on the 16th floor of IIT Tower. | 2023-12-10T01:26:59.872264 | https://example.com/article/8730 |
Validation criteria for nucleic acid amplification techniques for bacterial infections.
Nucleic acid techniques (NATs), such as species-specific and universal polymerase chain reactions (PCRs), are finding ever wider use in the diagnosis of bacterial infection. However, although universal PCR assays, in particular, approach a type of modern Petri dish, they have a number of limitations which restrict their applicability. The sensitivity of universal PCR is lower than that of many species-specific PCRs, and the contamination of samples and PCR reagents with irrelevant DNA from various sources remains a problem. Thus, NATs in general and universal PCR assays in particular require careful validation to be of value for the diagnosis of infection. Validation includes sampling, DNA extraction/isolation, template amplification and visualisation of the results. Furthermore, it implies the establishment of measures of asepsis, the inclusion of positive and negative controls, techniques to optimise the release of DNA from bacterial cells, adequate repetition of the amplification reaction, and routine testing of reagent negative and inhibition controls. Finally, it entails the comparison of results obtained by NATs with those obtained by conventional microbiological methods and matching with clinical evidence of infection. Validation of NATs in clinical diagnosis remains an ongoing challenge. Because of these limitations, NATs can only serve as adjunct tools for the diagnosis of infection in selected cases; they cannot replace conventional culturing techniques. | 2023-11-10T01:26:59.872264 | https://example.com/article/4882 |
i need some help on my scarcrow... i dont really understand the rotation at all or really dont know how to do it...does ne one have any videos of someone landing it so i can see what its like also tips would be helpful, thanks.
pretty simple, its a frontflip 180.... Just flip like you would do a front flip off a diving board etc, and let go with your front hand.... left hand if your regular, and the rope will pull you 180 pretty much all the way, youll need to do a lil work.
you just gotta go out there and do it, people tellin you what to do wont help as much as going out there and trying it yourself.
Kyle, After a few attempts you can get a feel for things. There are few starter tips that can help out. (This is for a left foot forward rider)
After getting the pop from the wake off your toes, look into the boat. You don't have to throw your head over your shoulder, just look for the boat. Make sure you ride the wake and stand tall while doing this. Hold onto the rope with both hands close to your right hip, til about half way through the flip, the 180 will already be coming around. Let go with your front hand (left) and keep the hand close to your right hip. Keep your eyes on the landing and ride away on your heels like you just did a ts 180.
Best way is to try a few, but keep in mind where to look and your handle position. | 2023-09-15T01:26:59.872264 | https://example.com/article/5548 |
Cooley Covered Bridge
The Cooley Covered Bridge is a covered bridge that carries Elm Street across Furnace Brook in Pittsford, Vermont. Built in 1849, it is one of a small number of bridges in the state that has a well-documented association with the 19th-century master bridgewright Nicholas M. Powers, who grew up nearby. It is one of four surviving 19th-century covered bridges in the town, and was listed on the National Register of Historic Places in 1974.
Description and history
The Cooley Covered Bridge is located about south of the village of Pittsford, carrying Elm Street across Furnace Brook, which at that point flows northwest toward Otter Creek. The bridge is a single-span Town lattice truss, with a span of and a total structure length of , caused by portals that overhang the ends by . The bridge is wide, with a roadway width of (one lane). The bridge originally rested on stone abutments, which have either been rebuilt or faced in concrete. It has a slate roof. The sides are sheathed in vertical board siding, which extends around the portal ends and partly to the inside of the structure. Portions of the trusses have been reinforced by doubling the timbers, and some iron bracing has been added to the bridge's underside.
The bridge was built in 1849 by Nicholas M. Powers, who was born a farm not far from here. It is one of four bridges whose construction is known to have been executed or overseen by Powers, acknowledged as the state's best-known builder of covered bridges. It is also one of just four covered bridges in the town.
See also
National Register of Historic Places listings in Rutland County, Vermont
List of bridges on the National Register of Historic Places in Vermont
List of Vermont covered bridges
References
Category:Covered bridges on the National Register of Historic Places in Vermont
Category:Buildings and structures completed in 1849
Category:Covered bridges in Rutland County, Vermont
Category:Buildings and structures in Pittsford, Vermont
Category:National Register of Historic Places in Rutland County, Vermont
Category:Road bridges on the National Register of Historic Places in Vermont
Category:Wooden bridges in Vermont
Category:Lattice truss bridges in the United States | 2024-04-15T01:26:59.872264 | https://example.com/article/6802 |
Q:
MySQL: Query Cacheing (How do I use memcache?)
I have an query like:
SELECT id as OfferId FROM offers
WHERE concat(partycode, connectioncode) = ?
AND CURDATE() BETWEEN offer_start_date
AND offer_end_date AND id IN ("121211, 123341,151512,5145626 ");
Now I want to cache the results of this query using memcache and so my question is
How can I cache an query using memcache.
I am currently using CURDATE() which cannot be used if we want to implement caching and so how can I get current date functionality without using CURDATE() function ?
A:
Something like this should work:
function getOffers($ids) {
$key = implode(',', $ids);
$cache = new Memcache();
$cache->connect('localhost');
$content = $cache->get($key);
if ($content === false) {
// content is not cached, so we have to run the query
$content = $yourDb->query('your query here');
$cache->add($key, $content);
}
$cache->close();
return $content;
}
getOffers(array('121211','123341','151512','5145626'));
You can take this a step further by sorting $ids so that the same "set" of IDs (but in a different order) will still take advantage of an available cache for that set.
This isn't date-sensitive, but you can make it date sensitive by adding the date string to $key
| 2024-01-10T01:26:59.872264 | https://example.com/article/1757 |
class Foo {
// line comment
foo: string;
/**
* block comment
*/
bar: number;
// comment on method
baz() {
console.log("baz");
}
} | 2023-09-15T01:26:59.872264 | https://example.com/article/7411 |
---
abstract: |
We prove the sharp quantitative stability for a wide class of weighted isoperimetric inequalities. More precisely, we consider isoperimetric inequalities in convex cones with homogeneous weights.
Inspired by the proof of such isoperimetric inequalities through the ABP method (see [@CRS]), we construct a new convex coupling (i.e., a map that is the gradient of a convex function) between a generic set $E$ and the minimizer of the inequality (as in Gromov’s proof of the isoperimetric inequality). Even if this map does not come from optimal transport, and even if there is a weight in the inequality, we adapt the methods of [@FMP] and prove that if $E$ is almost optimal for the inequality then it is quantitatively close to a minimizer *up to translations*. Then, a delicate analysis is necessary to rule out the possibility of translations.
As a step of our proof, we establish a sharp regularity result for *restricted* convex envelopes of a function that might be of independent interest.
address:
- 'E.C. — Alma Mater Studorium Università di Bologna, Dipartimento di Matematica, Piazza di Porta San Donato 5, 40126 Bologna, Italy.'
- 'F.G. — ETH Zürich, Mathematics Dept., Rämistrasse 101, 8092 Zürich, Switzerland.'
- 'A.P. — Universitá di Pisa, Dipartimento di Matematica, Largo B. Pontecorvo 5, 56127 Pisa, Italy.'
- 'X.R. — Universität Zürich, Institut für Mathematik, Winterthurerstrasse 190, 8057 Zürich, Switzerland & ICREA, Pg. Lluís Companys 23, 08010 Barcelona, Spain & Universitat de Barcelona, Departament de Matemàtiques i Informàtica, Gran Via de les Corts Catalanes 585, 08007 Barcelona, Spain.'
- 'J.S. — ETH Zürich, Mathematics Dept., Rämistrasse 101, 8092 Zürich, Switzerland.'
author:
- 'E. Cinti'
- 'F. Glaudo'
- 'A. Pratelli'
- 'X. Ros-Oton'
- 'J. Serra'
bibliography:
- 'biblio.bib'
title: |
Sharp quantitative stability for\
isoperimetric inequalities with homogeneous weights
---
=1
Introduction
============
Background
----------
The quantitative stability of functional/geometric inequalities has been an increasingly active field in recent years. The interest lies in understanding whether *almost* minimizers of a certain inequality (i.e., the isoperimetric inequality or the Sobolev inequality) are *quantitatively* close to a minimizer. Let us mention the works [@FuscoMaggiPratelli2008; @CicaleseLeonardi2012; @FMP; @FI; @BogeleinDuzaarScheven2015; @BarchiesiBrancoliniJulin2017; @IndreiNurbekyan2015; @Neumayer2020; @FigalliZhang2020] regarding the stability of the isoperimetric inequality, [@BianchiEgnell1991; @FuscoMaggiPratelli2007; @CianchiFuscoMaggiPratelli2009; @nguyen2019; @FigalliGlaudo2020; @FigalliNeumayer2019] about the stability of Sobolev inequalities and [@MaggiPonsiglionePratelli2014; @BoroczkyKaroly2010; @FigalliMaggiMooney2018; @FigalliJerison2017] for the stability of various other inequalities.
On the other hand, many different kinds of weighted isoperimetric inequalities have been established in the literature, let us mention [@MorganPratelli2013; @Milman2015; @BobkovLedouox2009; @BettaEtAl1999; @BarchiesiBrancoliniJulin2017; @Borell75; @CianchiFuscoMaggiPratelli2011; @RosalesEtAl2008; @Chambers2019; @CRS].
The papers that lie at the intersection of the two topics, i.e., quantitative weighted isoperimetric inequalities, are rather rare. Up to our knowledge, only [@CianchiFuscoMaggiPratelli2011; @BarchiesiBrancoliniJulin2017] prove a quantitative weighted isoperimetric inequality. Both papers consider only the case of the Gaussian weight on $\R^n$.
In this paper we establish for the first time sharp quantitative stability for a wide class of weighted isoperimetric inequalities. More precisely, we do so for the class of weighted isoperimetric inequalities in convex cones considered in [@CRS]. The analogous stability result without weights is proven with different methods in [@FI].
Results
-------
Given an open convex cone $\Sigma\subseteq\R^n$ and a weight $w:\Sigma\to\co0\infty$, let us define the weighted volume and perimeter of a set $E\subseteq\Sigma$ with smooth boundary as $$w(E) \defeq \int_{E} w(x)\de x \comma
\qquad
\Per_w(E) \defeq \int_{\partial E\cap\Sigma}w(x)\de\Haus^{n-1}(x) \fullstop$$ See \[sec:notation\] for the definition of the perimeter $\Per_w(E)$ for nonsmooth sets. Notice that only the boundary of $E$ that is *inside* the cone matters when computing the perimeter $\Per_w(E)$.
Let us recall the weighted isoperimetric inequality in a convex cone.
\[isop-thm\] Let $\Sigma\subseteq\R^n$ be an open convex cone with vertex at $0$, and let $\alpha>0$. Let $w$ be a nonnegative continuous function in $\overline\Sigma$ (not constantly $0$) such that $$w \text{\ is \ } \alpha\text{-homogeneous\footnotemark, \ and \ } w^{1/\alpha} \text{\ is concave in\ } \Sigma.$$ Then, for all measurable sets $E\subseteq\Sigma$ with $w(E)<\infty$, $$\label{isop-ineq}
\frac{\Per_w(E)}{w(E)^{\frac{D-1}{D}}}\geq \frac{\Per_w(B_1\cap \Sigma)}{w(B_1\cap \Sigma)^{\frac{D-1}{D}}},$$ where $D\defeq n+\alpha$. By homogeneity, $B_1$ can be replaced by $B_r$ for any $r>0$.
See [@CRS Remark 1.4] for a geometric justification of the concavity condition on the weight and [@CRS Section 2] for a number of examples of admissible weights. An important example to have in mind is given by monomial weights: $$w(x) = x_1^{A_1}\cdots x_n^{A_n} \quad\textrm{in}\quad \Sigma=\{x_1>0,\dots, x_n>0\},\quad \textrm{with}\ A_i>0 \fullstop$$ The authors do not give a characterization of the sets that achieve the equality in \[isop-ineq\] (see [@CRS 2979]).
Our first result is the following characterization of the optimal sets.
\[prop:uniqueness\] Let $n,\alpha,\Sigma$ and $w$ be as in \[isop-thm\] and assume[^1] that $\Sigma=\R^k\times\widetilde\Sigma$, where $0\le k < n$ and $\widetilde\Sigma\subseteq\R^{n-k}$ is an open convex cone *containing no lines*.
Then, a measurable set $E\subseteq\Sigma$, with $w(E)<\infty$, achieves the equality in \[isop-ineq\] if and only if $E=B_r(x_0)$ for some $r>0$ and $x_0\in\R^k\times\{0_{\R^{n-k}}\}$.
From now on we assume, without loss of generality, that $\Sigma=\R^k\times\widetilde\Sigma$, where $0\le k < n$ and $\widetilde\Sigma\subseteq\R^{n-k}$ is an open convex cone *containing no lines*. Let us measure the distance between a set $E\subseteq\Sigma$ and the minimizers of the weighted isoperimetric inequality with the quantity $$A_w(E) \defeq
\inf_{x_0\in\R^k\times\{0_{\R^{n-k}}\}}
\frac{
w(E\Delta (B_r(x_0)\cap \Sigma))
}{
w(E)
} \comma$$ where $r>0$ is such that $w(E)=w(B_r\cap \Sigma)$.
We define the weighted isoperimetric deficit of a set $E\subseteq\Sigma$ as $$\delta_w(E)=\frac{\Per_w(E)}{c_*w(E)^{\frac{D-1}{D}}}-1,$$ where $c_*\defeq\Per_w(B_1\cap \Sigma)/w(B_1\cap \Sigma)^{\frac{D-1}{D}}=Dw(B_1\cap\Sigma)^{\frac1D}$ is the isoperimetric constant that comes from \[isop-ineq\], and $D\defeq n+\alpha$. Notice that the identity $\Per_w(B_1\cap \Sigma)=Dw(B_1\cap \Sigma)$ follows from the homogeneity of the weight $w$.
The main result of the present paper is the following quantitative version of the weighted isoperimetric inequality.
\[thm:main\] Let $n$, $\alpha$, $\Sigma$ and $w$ be as in \[isop-thm\] and assume that $\Sigma=\R^k\times\widetilde\Sigma$, where $0\le k<n$ and $\widetilde\Sigma\subseteq\R^{n-k}$ is an open convex cone containing no lines.
Then, for all measurable sets $E\subseteq\Sigma$ with $w(E)<\infty$, it holds $$\label{eq:quant-ineq}
A_w(E)\leq C\sqrt{\delta_w(E)},$$ where $C$ is a constant that depends only on $n$, $\alpha$, $\Sigma$ and $w$.
Notice that the *stability constant* $C$ contained in \[thm:main\] cannot depend only on $n$ and $\alpha$. Indeed, if $n=2$, $\Sigma=\{x_2 > \eps \abs{x_1}\}$ and $w=x_2$, then, as $\eps\to0$, the constant $C$ of the statement must go to infinity (as any ball with center on $\partial\Sigma$ becomes *almost* optimal).
Let us also point out that the exponent $\frac12$ is sharp, as often happens in quantitative stability estimates. We will prove this fact in \[rem:sharpness\_exponent\].
Our proof can be easily adapted (see \[thm:anisotropic\_coupling\]) to recover the stability result of [@FMP] for the anisotropic isoperimetric inequality in $\R^n$.
Sketch of the proof
-------------------
Our general plan to prove \[thm:main\] is to make quantitative the proof of the weighted isoperimetric inequality contained in [@CRS]. However, several new difficulties (both conceptual and technical) arise. In this description of the proof we will ignore all technical issues; some estimates are stated in a simplified form that is not exactly what we prove (but is morally equivalent). Only in this section[^2], the notation $A \lesssim B$ is equivalent to $A\le CB$, where $C$ is a constant that depends on $n,\alpha,\Sigma,w$.
Let us begin by briefly describing the proof of \[isop-thm\] found in [@CRS]. Given a smooth bounded connected set $E\subseteq\Sigma$ with $w(E)=w(B_1\cap\Sigma)=1$, consider the elliptic problem $$\label{eq:intro_elliptic}
\begin{cases}
\div(w\nabla u) = w\, \frac{\Per_w(E)}{w(E)} &\text{in $E$} \\
\partial_\nu u = 1 &\text{on $\partial E\cap\Sigma$} \\
\partial_\nu u = 0 &\text{on $\partial E\cap\partial\Sigma$}\fullstop
\end{cases}$$ A contact argument implies that, for any $\xi\in B_1\cap\Sigma$, there is $x\in E$ such that $\nabla u(x) = \xi$ and $\nabla^2 u(x)\ge 0$. Hence, denoting by $E'$ the set $\{x\in E:\ \nabla^2 u\ge 0,\ \nabla u\in B_1\cap\Sigma\}$, the area formula implies $$\begin{aligned}
w(B_1\cap\Sigma)
&\le
\int_{E'}w(\nabla u)\det(\nabla^2 u)
=
\int_{E'}\frac{w(\nabla u)}w\det(\nabla^2 u)\, w \\
&\le
\int_{E'}\Big(\frac{\tr(\nabla^2 u) + \alpha\big(\frac{w(\nabla u)}w\big)^{\frac1\alpha}}{D}\Big)^D w
\le
\int_{E'}\Big(\frac{\lapl u + \frac{\nabla w}{w}\cdot\nabla u}{D}\Big)^D w \\
&=
\Big(\frac{\Per_w(E)}{D\,w(E)}\Big)^Dw(E')
\le
\Big(\frac{\Per_w(E)}{D\,w(E)}\Big)^Dw(E)
\comma\end{aligned}$$ where we have applied the weighted arithmetic-geometric mean inequality (recall that $D=n+\alpha$), then [@CRS Lemma 5.1] (which assumes only the concavity of $w^{\frac1\alpha}$) and finally the fact that $u$ satisfies \[eq:intro\_elliptic\]. Notice that the proven inequality is, up to rearrangement of the terms, the weighted isoperimetric inequality (see [@CRS] for the details). What we have just sketched is the ABP method in a nutshell (in the context of isoperimetric inequalities, the method was introduced in [@Cabre2000; @Cabre2008]; see [@Brendle2019] for a recent striking application of the method[^3]). However, it is very hard to exploit directly the function $u$ to obtain a stability result. The main obstructions being that it is impossible to control any derivative of $u$ (as everything depends wildly on $\partial E$) and that the proof *sees* only $E'$ and not the whole set $E$.
Hence we take an appropriate *restricted* convex envelope of $u$. Let $\varphi:\R^n\to\R$ be the convex function $$\label{eq:intro_kenvelope}
\varphi(x) \defeq \sup\big\{a+\xi\cdot x:\ \xi\in \overline{B_1\cap\Sigma},\, a+\xi\cdot y\le u(y)\ \forall y\in E\big\} \fullstop$$ Notice that $\varphi$ is simply the supremum of all affine functions with slope in $\overline{B_1\cap\Sigma}$ that are below $u$. We go on to prove that $\varphi$ is much more well-behaved compared to $u$ itself (mainly because $\varphi$ is convex and controlling the Laplacian of a convex function is sufficient to control the whole Hessian). Precisely, we prove that $\varphi$ is $C^{1,1}$ (with bounds independent of the regularity of $\partial E$) and it holds $\nabla \varphi(\overline E) = \overline{B_1\cap\Sigma}$. Moreover, $\varphi$ retains (in a distilled form) the fact that $u$ satisfies \[eq:intro\_elliptic\]: $$\label{eq:intro_tmp432}
\lapl\varphi + \alpha\left(\frac{w(\nabla\varphi)}{w}\right)^{\frac1\alpha}
\le \frac{\Per_w(E)}{w(E)}\fullstop$$ To understand the meaning of the last inequality, let us remark that, if $\nabla u\in\Sigma$, it holds $$\lapl u + \alpha\left(\frac{w(\nabla u)}{w}\right)^{\frac1\alpha}
\le
\lapl u + \frac{\nabla w}{w}\cdot \nabla u
= w^{-1}\div(w\nabla u)
= \frac{\Per_w(E)}{w(E)} \comma$$ where in the first inequality we used the concavity of $w^{\frac1\alpha}$ (see \[lem:5.1\] below). It turns out that \[eq:intro\_tmp432\] is enough for our purposes. Namely, that the properties of the coupling $\varphi$ are still sufficient to prove the weighted isoperimetric inequality (it is sufficient to replace $u$ with $\varphi$ in the proof). Moreover, as simple byproducts of the proof, we obtain the following estimates: $$\begin{aligned}
&\int_E \abs{\nabla^2\varphi - 1}\, w
\lesssim \delta_w(E)^{\frac12} \comma \label{eq:intro_hessian}\\
&\int_{\partial E\cap\Sigma} (1-\abs{\nabla\varphi})\,w\de\Haus^{n-1}
\lesssim \delta_w(E) \comma \label{eq:intro_boundary}\\
&\int_E \abs*{w(\nabla\varphi)^{\frac1\alpha}-w^{\frac1\alpha}}
\lesssim \delta_w(E)^{\frac12} \label{eq:intro_translation}\fullstop\end{aligned}$$ The estimate \[eq:intro\_hessian\] controls the $L^1$-norm of the differential of $\nabla\varphi$, \[eq:intro\_boundary\] implies that $\nabla\varphi(x)$ almost belongs to $\partial B_1\cap \Sigma$ when $x\in\partial E$. It is a bit harder to grasp the point of \[eq:intro\_translation\], but it will be clear later on.
In [@FMP], the authors have shown that if a set has a small isoperimetric deficit then, up to a small modification, it must enjoy a nontrivial Poincaré inequality and a nontrivial trace inequality. Surprisingly, their ideas can be easily adapted to our weighted setting and therefore we can assume that $E$ has nontrivial weighted Poincaré and trace inequalities. The adjective *nontrivial* has to be understood as the fact that the constants of the inequalities do not depend on the set $E$ itself and can be bounded a priori. With these considerations, it is not hard to see that \[eq:intro\_hessian\] and \[eq:intro\_boundary\] imply the existence of $x_0\in\R^n$ such that $$\begin{aligned}
&\int_E \abs{\nabla\varphi(x) - (x-x_0)}\,w(x)\de x
\lesssim \delta_w(E)^{\frac12} \comma \label{eq:intro_tmp671}\\
&\int_{\partial E\cap\Sigma} \abs{\abs{x-x_0}-1}\, w(x)\de \Haus^{n-1}(x)
\lesssim \delta_w(E)^{\frac12} \fullstop \label{eq:intro_tmp586}\end{aligned}$$ The estimate \[eq:intro\_tmp586\] tells us that $\partial E\cap\Sigma$ is *almost* contained in the boundary of $B_1(x_0)$, hence it is natural that from \[eq:intro\_tmp586\] we are able to deduce $$\label{eq:intro_tmp324}
w(E\triangle (B_1(x_0)\cap\Sigma)) \lesssim \delta_w(E)^{\frac12} \fullstop$$ Notice that a similar deduction is present also in [@FMP] and [@FI], but their method to prove it does not work in our setting.
It remains to show that in \[eq:intro\_tmp324\] we can choose $x_0=(z, 0_{\R^{n-k}})$ (recall that both the cone and the weight are invariant on the first $k$ coordinates). This final step is far from being straightforward. Indeed, the interplay between the boundary of the cone and the weight makes it cumbersome to rule out that $E$ is close to a *translated* ball, i.e., a ball $B_r(x_0)$ with $x_0$ not lying in $\R^k\times\{0_{\R^{n-k}}\}$.
Without loss of generality we can assume that $x_0=(0_{\R^k},\widetilde x_0)$. We will show that $\abs{\widetilde x_0}\lesssim \delta_w(E)^{\frac12}$, which is sufficient to conclude the proof. Instead of giving the details of our strategy, we describe it in three different settings in order to show all the ideas without being lost in the technicalities. In all the three cases it holds $k=0,\,n=2$ (i.e., no lines are contained in $\Sigma$). We will denote the coordinates with $(x, y)$.
The first method works if $x_0$ belongs to $\overline\Sigma$ or $-\overline\Sigma$ and $w$ is constant along the direction of $x_0$. The second method works if $x_0$ is not aligned with a constant direction of $w$. The third method works if $x_0$ does not belong to $\Sigma$ nor $-\Sigma$ and $w$ is constant along the direction of $x_0$. Since we have (morally) covered all possible cases, the proof is concluded.
1. \[it:intro\_ball\_growth\] Let $\Sigma\defeq \{x>0,\, y>0\}$, $w\defeq x$ and assume that $x_0=(0, t)$ for some $t\in\R$. It holds $$\abs*{w(B_1(x_0)\cap\Sigma)-w(B_1\cap\Sigma)} \gtrsim \abs{t} \comma$$ that, together with \[eq:intro\_tmp324\], implies $t\lesssim \delta_w(E)^{\frac12}$ as desired (recall that $w(E)=w(B_1\cap\Sigma)$).
2. \[it:intro\_nonconstant\] Let $\Sigma\defeq \{x >0,\, y > 0\}$, $w\defeq xy$ and assume that $x_0=(t, -t)$ for some $t\in\R$. Joining \[eq:intro\_translation\] and \[eq:intro\_tmp671\], we can prove $$\int_E \abs{w^{\frac1\alpha}(x-x_0)-w^{\frac1\alpha}}
\lesssim \delta_w(E)^{\frac12} \fullstop$$ Since the weight $w$ is nonconstant in the direction $(1,-1)$, it holds $$\int_E \abs{w^{\frac1\alpha}(x-x_0)-w^{\frac1\alpha}} \gtrsim t \fullstop$$ The last two inequalities imply $t\lesssim \delta_w(E)^{\frac12}$.
3. \[it:intro\_constant\_hard\] Let $\Sigma\defeq \{x>\abs{y}\}$, $w\defeq x$ and assume that $x_0=(0, t)$ for some $t\in\R$. This is the hardest situation: the weight is constant along $x_0$ (hence \[eq:intro\_translation\] is useless) and the value of $w(B_1(x_0)\cap\Sigma)$ can be very close to $w(B_1\cap\Sigma)$ (so we cannot use their difference to control $t$ as we did in the first case). Thanks to \[eq:intro\_hessian\] and \[eq:intro\_tmp671\], applying the fundamental theorem of calculus we can find $\frac14\le \overline x\le \frac12$ such that $$\abs{\nabla\varphi(\overline x, y) - ((\overline x, y)-x_0)} \lesssim \delta_w(E)^{\frac12}$$ for any $y\in\R$ such that $(\overline x, y)\in\Sigma$ (restricting our attention to a $1$-dimensional segment we have improved an $L^1$ estimate to an $L^\infty$ estimate and this is fundamental). Since $\nabla\varphi\in\overline{B_1\cap\Sigma}$, we deduce $$\text{dist}(\Sigma, (\overline x, y)-x_0) \lesssim \delta_w(E)^{\frac12} \fullstop$$ Choosing $y=\overline x$ or $y=-\overline x$ in the latter estimate (depending on the sign of $t$), we readily deduce $\abs{t}\lesssim \delta_w(E)^{\frac12}$.
Comparison between our coupling and the optimal transport map
-------------------------------------------------------------
Let $E\subseteq\R^n$ be a bounded connected set with smooth boundary. If we set $\Sigma=\R^n$ and $w=1$, the sketch above[^4] provides a *convex* function $\varphi:E\to\R$ such that $\nabla\varphi(E)=B_1$ (up to negligible sets) and $$\tr(\nabla^2\varphi) \le \frac{\Per(E)}{\abs{E}} \fullstop$$ On the other hand, let $\nabla\psi:E\to B_1$ be the optimal transport map between the two probability measures $\abs{E}^{-1}\restricts{\Leb^n}{E}$ and $\abs{B_1}^{-1}\restricts{\Leb^n}{B_1}$ with respect to the quadratic cost (see [@FMP] or [@Villani2009 23] for the missing details). The function $\psi:E\to\R$ is *convex* ([@Brenien1991]) and, by definition of transport map, it holds $\nabla\psi(E) = B_1$ (up to negligible sets) and $$\det(\nabla^2\psi) = \frac{\abs{B_1}}{\abs{E}} \fullstop$$
Summing up, both $\varphi,\psi:E\to\R$ are convex functions such that $\nabla\varphi(E)=\nabla\psi(E) = B_1$ (up to negligible sets) and they both satisfy a condition on the Hessian. Notice also that both $\varphi$ and $\psi$ encode some nontrivial global information about the set $E$, indeed both yield a one-line proof of the isoperimetric inequality: $$\begin{aligned}
&\abs{B_1}=\abs{\nabla\varphi(E)}
\le \int_E \det(\nabla^2\varphi)
\le \int_E \left(\frac{\tr(\nabla^2\varphi)}{n}\right)^n
\le \frac{\Per(E)^n}{n^n\abs{E}^{n-1}} \comma \label{eq:proof_iso_abp}\\
&n\abs{E}\left(\frac{\abs{B_1}}{\abs{E}}\right)^{\frac1n}
= n\int_E \det(\nabla^2\psi)^{\frac1n}
\le \int_E \div(\nabla\psi)
= \int_{\partial E}\nabla\psi\cdot \nu_{\partial E} \de\Haus^{n-1}
\le \Per(E) \fullstop \nonumber\end{aligned}$$ Given their many similarities, it is natural to wonder whether the two functions $\varphi, \psi$ are two instances of the same phenomenon. We believe it would be very interesting to find a unifying framework that allows to treat the two functions (and perhaps other functions with in-between conditions on the Hessian) together.
Acknowledgements
----------------
F.G. and J.S. have received funding from the European Research Council under the Grant Agreement No. 721675 “Regularity and Stability in Partial Differential Equations (RSPDE)”.
X.R. has received funding from the European Research Council under the Grant Agreement No. 801867 “Regularity and singularities in elliptic PDE (EllipticPDE)”.
X.R. and J. S. were supported by grant MTM2017-84214-C2-1-P.
Organization of the paper
-------------------------
While describing the content of the various sections of the work we refer to the sketch of the proof given above.
After a section of notation and preliminaries, in \[sec:kenvelope\] we study the $K$-envelope of a function (where $K$ is a compact convex set) obtaining a precise $C^{1,1}$-regularity result that might be of independent interest (and that we will use later on in the proof). When $K=\overline{B_1\cap\Sigma}$, the $K$-envelope of a generic function $u$ boils down to \[eq:intro\_kenvelope\] (thus the coupling $\varphi$ is a $\overline{B_1\cap\Sigma}$-envelope). The construction of the coupling $\varphi$ and the proof of its properties are contained in \[sec:coupling\]. We construct the coupling also in the case of the anisotropic (unweighted) perimeter, as it could be of independent interest. The strategies adopted to deduce $\abs{\widetilde x_0}\le C \delta_w(E)^{\frac12}$ are implemented in \[sec:ruling\_out\_translations\]. The implication \[eq:intro\_tmp586\]$\implies$\[eq:intro\_tmp324\] is proven in \[sec:spherical\_boundary\_implies\_ball\]. In \[sec:FMP\], we adapt [@FMP Section 3] to the weighted setting. Namely, we show that if a set has a small weighted isoperimetric deficit, then it enjoys nontrivial trace and Poincaré inequalities. The proofs of \[prop:uniqueness\] and \[thm:main\] are contained in \[sec:main\_proof\].
This work has three appendices. The first one contains a quantitative version of the weighted inequality of arithmetic and geometric means; the second one is a collection of simple facts regarding $1$-homogeneous concave functions in a cone. In the third and final appendix we prove that, in $\R^2$, an indecomposable set (see \[def:indecomposable\]) can be approximated with *connected* open sets.
Notation {#sec:notation}
========
Since the statement of \[thm:main\] is invariant under rescaling of the weight, we can assume that $w(B_1\cap\Sigma)=1$. Notice that, under this additional constraint, the isoperimetric constant is simply $c_*=D$ (recall that $D\defeq n+\alpha$).
Any constant that depends only on $n, \alpha$ is considered universal and can be hidden in the notation $\lesssim$. Precisely, the notation $A\lesssim B$ is equivalent to $A\le C B$ for a suitable constant $C=C(n,\alpha)$ that depends only on $n$ and $\alpha$. On the other hand, we will write explicitly constants that depend on the cone $\Sigma$ and the weight $w$.
We denote with $B_r(x_0)$ the open ball with center $x_0\in\R^n$ and radius $r>0$; when the center is the origin ($x_0=0_{\R^n}$) we simply write $B_r$. The $(n-1)$-dimensional sphere is denoted by $\partial B_1$ or $\S^{n-1}$. The $n$-dimensional Lebesgue measure is denoted by $\Leb^n$, the $(n-1)$-dimensional Hausdorff measure is denoted by $\Haus^{n-1}$. The Lebesgue measure of a set $E\subseteq\R^n$ is denoted by $\abs{E}$. The identity matrix (whose size will always be $n\times n$) is denoted by $\id$. The convex-hull of a set $E$, that is the smallest closed convex set that contains $E$, is denoted by $\conv(E)$.
Assumptions
-----------
Almost all the statements of this work require the same assumptions on the cone and the weight. For notational simplicity we state them here and reference them instead of repeating them in every statement. We assume that $n,\alpha,\Sigma,w$ satisfy $$\label{eq:assumptions}\begin{cases}
n \in \N \text{ and } \alpha \in \oo0\infty ;\\
\Sigma \subseteq\R^n \text{ is an open convex cone with vertex at $0$;} \\
\Sigma = \R^k\times\widetilde\Sigma \text{ where $0\le k < n$ and $\widetilde\Sigma\subseteq\R^{n-k}$ is an open convex cone \emph{containing no lines};} \\
w:\overline\Sigma\to\co0\infty \text{ is a continuous nonnegative weight such that $w$ is $\alpha$-homogeneous, }\\ \text{$w^{\frac1\alpha}$ is concave, and $w(B_1\cap\Sigma)=1$.}
\end{cases}$$ Notice that $w$ may be $0$ on $\partial\Sigma$, but, since $w^{\frac1\alpha}$ is concave, it is strictly positive inside $\Sigma$.
A simple but useful result from [@CRS] is the following.
\[lem:5.1\] Let $w$ be a positive homogeneous function of degree $\alpha>0$ in an open cone $\Sigma\subseteq\R^n$. Then, the following conditions are equivalent:
- The function $w^{1/\alpha}$ is concave in $\Sigma$.
- For each $x, z\in\Sigma$, the following inequality holds: $$\alpha\left(\frac{w(z)}{w(x)}\right)^{1/\alpha}\leq \frac{\nabla w(x)\cdot z}{w(x)}.$$
We will use such result several times throughout the paper.
Set of finite (weighted) perimeter and functions of bounded variation
---------------------------------------------------------------------
Let us recall some basic facts about sets of finite perimeter. All the definitions and results we are going to state can be found in the monograph [@maggi2012].
A measurable set $E\subseteq\R^n$ is a set of finite perimeter if its perimeter $$\Per(E) \defeq \sup \left\{\int_E \div(X(x))\de x:\
X\in C^{\infty}_c(\R^n,\R^n)\comma\, \norm{X}_{\infty} \le 1\right\}$$ is finite. There is also a *localized* version of the perimeter; given an open set $\Omega\subseteq\R^n$, the relative perimeter of $E$ inside $\Omega$ is $$\Per(E,\Omega) \defeq \sup \left\{\int_E \div(X(x))\de x:\
X\in C^{\infty}_c(\Omega,\R^n)\comma\, \norm{X}_{\infty} \le 1\right\} \fullstop$$ A set of (locally) finite perimeter admits a measure-theoretic notion of boundary (the *reduced boundary*), which is a $(n-1)$-rectifiable set that we denote by $\bou E$, and for each point $x\in\bou E$ an *outer normal vector* $\nu_{\bou E}(x)\in\S^{N-1}$ is defined. For any $X\in C^\infty_c(\R^n, \R^n)$, it holds $$\int_E\div(X(x))\de x =\int_{\bou E} X \cdot \nu_{\bou E}\de\H^{n-1}\,.$$ In addition, $\Per(E)=\Haus^{n-1}(\bou E)$. The reduced boundary is, up to $\Haus^{n-1}$-negligible sets, the set of points in $\R^n$ where $E$ has density $\frac12$. We denote with $E^{(1)}$ the set of points in $\R^n$ where $E$ has density $1$.
Let us now define the *weighted* perimeter. Given a measurable set $E\subseteq\Sigma$, its $w$-perimeter in $\Sigma$ is defined as $$\Per_w(E) \defeq \sup \left\{\int_E \div(X(x)w(x))\de x:\
X\in C^{\infty}_c(\Sigma,\R^n)\comma\, \norm{X}_{\infty} \le 1\right\} \fullstop$$ It is not hard to prove that if $\Per_w(E)<\infty$, then for any $\Omega\compactsubset \Sigma$ it holds $\Per(E, \Omega)<\infty$. In particular $\bou E$ is well-defined whenever $\Per_w(E)<\infty$ and it holds $$\Per_w(E) = \int_{\bou E\cap\Sigma} w(x)\de\Haus^{n-1}(x) \fullstop$$ Let us define $\Haus_w^{n-1}\defeq w\restricts{\Haus}{\Sigma}^{n-1}$, so that $\Per_w(E) = \Haus_w^{n-1}(\bou E)$.
Let us now move our attention to functions of bounded variation. All the definitions and results we are going to state can be found in the monograph [@ambrosio-fusco-pallara].
A measurable function $f:\R^n\to\R$ is of bounded variation if its distributional gradient is a vector-valued measure, that we denote with[^5] $\diff f$. The set of functions of bounded variation is denoted by $BV(\R^n)$.
Given $f\in BV(\R^n)$ and $X\in C^{\infty}_c(\R^n,\R^n)$, it holds $$\label{eq:intro_div_theorem}
\int_{\R^n} f(x)\div(X(x))\de x =
\int_{\R^n} X(x) \de \diff f(x) \fullstop$$ Notice that a measurable set $E\subseteq\R^n$ is a set of finite perimeter if and only if its characteristic function $\chi_E$ has bounded variation. Moreover, the following relation between the reduced boundary of $E$ and the distributional gradient of the characteristic function, $$\diff \chi_E = -\nu_{\bou E}\, \restricts{\Haus}{\bou E}^{n-1} \comma$$ holds.
Regularity of the K-envelope {#sec:kenvelope}
============================
Let us start with the definition of the main character of this section: the $K$-envelope of a function.
Let $K\subseteq\R^n$ be a compact, convex set, $\Omega\subseteq\R^n$ be a bounded open set, and $u\in C^0(\overline\Omega)\cap C^2(\Omega)$. We define the *$K$-envelope of $u$* as the function $\overline u^K:\R^n\to\R$ given by $$\overline u^K(x) \defeq \sup\left\{a + \xi\cdot x:\ \xi\in K,\ a+\xi\cdot y\le u(y) \ \forall y\in\overline\Omega\right\} \fullstop$$
The $K$-envelope is, by definition, the supremum of all affine functions with slope in $K$ that are below $u$. Notice that $\overline u^K(x)<\infty$ because $K$ is compact.
For our purposes, only the case $K=\overline{B_1\cap\Sigma}$ is important. Nonetheless, since it is not much easier to handle only that case and because the results in this section might be of independent interest, we decided to drop the assumption $K=\overline{B_1\cap\Sigma}$ and work with a generic compact convex set.
The goal of this section is to obtain some precise $C^{1,1}$ bounds on $\overline u^K$. We are interested in showing that the Hessian of $\overline u^K$ is controlled (as a symmetric matrix) by a suitable combination of Hessians (in different points) of the original function $u$. Similar results are well-known for the classical convex envelope (see for instance [@FigalliDePhilippis2015] and the references therein). Nonetheless, we could not find any work on the $K$-envelope.
The fundamental difficulty arising when considering the $K$-envelope (compared to the convex envelope) is that at many points it holds $\nabla \overline u^K \in \partial K$ and there the standard approaches fail. This shortcoming can be solved neatly introducing the notion of normal cone. Let us define the normal cone and the subdifferential (see [@rockafellar1970]) and obtain the first basic results about the $K$-envelope.
Given a compact, convex set $K\subseteq\R^n$, for any $\xi\in K$, the normal cone $N(\xi, K)$ of $K$ at $\xi$ is defined as $$N(\xi, K) \defeq \left\{v\in\R^n: \,v\cdot(\xi'-\xi) \le 0 \ \textrm{ for all }\ \xi'\in K\right\} \fullstop$$ Notice that the normal cone is most interesting for boundary points $\xi\in \partial K$; in the interior one simply has $N(\xi,K)=\{0\}$.
Given a convex function $\varphi:\R^n\to\R$, its subdifferential $\partial \varphi(x)$ at the point $x\in\R^n$ is defined as $$\partial \varphi(x)\defeq \left\{\xi\in\R^n:\ \varphi(y)\ge \varphi(x) + \xi\cdot(y-x) \ \forall y\in\R^n\right\} \fullstop$$
\[lem:subdifferential\_cap\_K\] Let $K\subseteq\R^n$ be a compact, convex set, $\Omega\subseteq\R^n$ be a bounded open set, and $u\in C^0(\overline\Omega)\cap C^2(\Omega)$. The function $\overline u^K:\R^n\to\R$ is convex and at any point $x\in\R^n$ it holds $\partial \overline u^K(x)\cap K\not=\emptyset$.
The convexity follows directly from the definition. For the second part of the statement, fix $(a_i)_{i\in\N}\subseteq\R$ and $(\xi_i)_{i\in\N}\subseteq K$ such that $\overline u^K(x) = \lim_{i\to\infty} a_i+\xi_i\cdot x$ and $a_i+\xi_i\cdot y \le u(y)$ for any $y\in\overline\Omega$. Since $K$ is compact we can assume that $\xi_i\to\xi\in K$ and as a consequence it must hold $a_i\to a\in\R$. Hence $\overline u^K(x) = a + \xi\cdot x$ and $a+\xi\cdot y\le u(y)$ for any $y\in\overline\Omega$; in particular this implies that $\overline u^K(y)\ge a + \xi\cdot y$ for any $y\in\R^n$ and we deduce $\xi\in\partial \overline u^K(x)$.
\[lem:convex\_duality101\] Let $A, B\subseteq\R^n$ be two nonempty closed convex sets such that for any $b\in B$ there is $a\in A$ such that $a\cdot b\le 0$. Then there is $\overline a\in A$ such that $\overline a\cdot b\le 0$ for any $b\in B$.
Given a subset $S\subseteq\R^n$, let $S^\circ$ be its polar cone, that is $$S^\circ\defeq \{x\in\R^n:\ x\cdot s \le 0 \text{ for any $s\in S$}\} \fullstop$$ We want to prove that $A\cap B^{\circ}\not=\emptyset$. Let us assume by contradiction that $A\cap B^{\circ}=\emptyset$. Then, since $A$ is a closed convex set and $B^{\circ}$ is a closed convex cone, we can find $v\in B^{\circ\circ}$ such that $a\cdot v > 0$ for any $a\in A$. Since $B^{\circ\circ}$ is the cone $\{\lambda b:\, b\in B, \lambda\ge 0\}$ generated by $B$ (see [@rockafellar1970 Theorem 14.1]), up to rescaling we can assume that $v\in B$. Thus we have reached a contradiction as we are assuming the existence of $a\in A$ such that $a\cdot v\le 0$.
\[lem:preparation\_convex\_K\] Let $K\subseteq\R^n$ be a compact, convex set, $\Omega\subseteq\R^n$ be a bounded open set, and $u\in C^0(\overline\Omega)\cap C^2(\Omega)$. Given $\xi\in K$, let $S_\xi\defeq \argmin_{x\in\overline\Omega} \{u(x)-\xi\cdot x\}$. Then we have:
1. For any $x_\xi\in S_\xi$, it holds $\overline u^K(x_\xi)=u(x_\xi)$ and $\xi\in\partial\overline u^K(x_\xi)$. \[it:contact\_set\]
2. Given $x\in\R^n$, if $\xi\in\partial\overline u^K(x)$ then there is $v\in N(\xi, K)$ such that $x-v\in\conv(S_\xi)$. \[it:tangent\_set\]
Let us start proving \[it:contact\_set\]. Since $x_\xi$ minimizes $u(x)-\xi\cdot x$, for any $y\in\overline\Omega$ it holds $$u(y)\ge u(x_\xi) + \xi\cdot(y-x_\xi)$$ and thus, by definition of $K$-envelope, we deduce $$\label{eq:local3}
u(y)\ge \overline u^K(y) \ge u(x_\xi) + \xi\cdot(y-x_\xi) \fullstop$$ Setting $y=x_\xi$, \[eq:local3\] implies $\overline u^K(x_\xi)=u(x_\xi)$, thus $\xi\in\partial\overline u^K(x_\xi)$.
Let us now move to the proof of \[it:tangent\_set\]. Fix $\xi'\in K$ and, for any $0<\eps<1$, choose $y_{\xi',\eps}\in S_{\xi+\eps(\xi'-\xi)}$. Thanks to \[it:contact\_set\], we know that $\xi+\eps\cdot(\xi'-\xi)\in\partial\overline u^K(y_{\xi',\eps})$ and, since the subdifferential is a monotone operator (see [@rockafellar1970 §24]), this implies $$\label{eq:local1}
(x-y_{\xi',\eps})\cdot(\xi'-\xi) \le 0 \fullstop$$ Thanks to the compactness of $\overline\Omega$, up to subsequence, it holds $y_{\xi',\eps}\to y_{\xi'}\in S_\xi$ as $\eps\to 0$ (we are using that $\xi+\eps(\xi'-\xi)\to\xi$ as $\eps\to0$). Thus, passing to the limit in \[eq:local1\], we deduce $$\label{eq:local2}
(x- y_{\xi'})\cdot(\xi'-\xi) \le 0 \fullstop$$ We have shown that for any $\xi'\in K$ there exists $ y_{\xi'}\in S_\xi$ such that \[eq:local2\] holds. The conclusion follows from \[lem:convex\_duality101\] with $A=x-\conv(S_\xi)$ and $B=K-\xi$.
We now have all the tools to prove the central result of this section. The idea is the following. Fix $x\in\R^n$ and consider a hyperplane touching $\overline u^K$ from below at $x$. This hyperplane touches $u$ from below at, say, $x_1, \dots, x_m$. We prove that (in a rather strong sense) $\overline u^K$ admits an Hessian at $x$ and this Hessian is controlled by a convex combination of the Hessian of $u$ at $x_1,\dots, x_m$. More precisely, $\nabla^2\overline u^K(x)$ belongs to $H(x, \nabla\overline u^K(x), K)$, which is defined as follows:
Let $K\subseteq\R^n$ be a compact, convex set, $\Omega\subseteq\R^n$ be a bounded open set, and $u\in C^0(\overline\Omega)\cap C^2(\Omega)$. Given $x\in\R^n$ and $\xi\in K$, let us define the family of matrices (the definition of $S_\xi$ is contained in the statement of \[lem:preparation\_convex\_K\]) $$H(x, \xi, K) \defeq\left\{
\sum_{i=1}^m \lambda_i \nabla^2 u(s_i):\ \
\begin{aligned}
& 1\le m \le n+1 \\
& \lambda_i\ge 0,\ \sum \lambda_i = 1 \\
& s_i\in S_\xi \cap \Omega \\
& x-\sum \lambda_i s_i \in N(\xi, K)
\end{aligned}
\right\} \fullstop$$ Notice that $H(x,\xi,K)$ is convex by definition and it is also closed if $S_\xi\subseteq\Omega$ (since $S_\xi$ is closed by definition).
\[prop:convex\_envelope\_regularity\] Let $K\subseteq\R^n$ be a compact, convex set, $\Omega\subseteq\R^n$ be a bounded open set, and $u\in C^0(\overline\Omega)\cap C^2(\Omega)$. Assume that for any $\xi\in K$ it holds $S_\xi\subseteq \Omega$ (where $S_\xi$ is defined as in \[lem:preparation\_convex\_K\]). Then $\overline u^K:\R^n\to\R$ is a $C^{1,1}$ convex function such that $$\nabla \overline u^K(\R^n) = \nabla \overline u^K(\Omega) = K.$$ Moreover, for any $x\in\R^n$ and any $H_x\in H(x, \nabla \overline u^K(x), K) \not=\emptyset$, it holds $\nabla^2\overline u^K(x)\le H_x$, in the sense that, for $x'$ converging to $x$, $$\label{eq:convex_envelope_fundamental}
\overline u^K(x')\le \overline u^K(x) + \nabla \overline u^K(x)\cdot (x'-x) + \frac12 (x'-x)H_x(x'-x) + \smallo(\abs{x'-x}^2) \fullstop$$
Fix $x\in\R^n$ and $\xi\in\partial\overline u^K(x)\cap K$ (the intersection is nonempty by \[lem:subdifferential\_cap\_K\]). Thanks to \[lem:preparation\_convex\_K\] (and Carathéodory’s theorem[^6] for convex hulls) we can find $v\in N(\xi, K)$, $s_1,\dots, s_m\in S_\xi\subseteq\Omega$, with $1\le m\le n+1$, and $\lambda_i\geq0$, $\lambda_1+\cdots+\lambda_m = 1$, such that $$x-v = \lambda_1 s_1 + \cdots + \lambda_m s_m\fullstop$$ In particular, $H(x, \nabla \overline u^K(x), K)$ is nonempty. Now, let us fix any such $v$, $(s_i)_{i=1,\dots, m}$ and $(\lambda_i)_{i=1,\dots, m}$.
Take any $x'\in\R^n$ close enough to $x$, so that $s_i+x'-x\in\Omega$ for any $i=1,\dots, m$. Given $\xi'\in\partial\overline u^K(x')\cap K$, for any $y\in\Omega$, it holds $$u(y)\ge \overline u^K(y) \ge \overline u^K(x') + \xi'\cdot(y-x')$$ and thus, plugging $y=s_i+x'-x$, we deduce $$\label{eq:local11}
\overline u^K(x')\le u(s_i+x'-x) + \xi'\cdot(x-s_i) \fullstop$$ Since $s_i\in S_\xi$, it holds $\nabla u(s_i) = \xi$ and therefore we have $$\label{eq:local12}
u(s_i+x'-x) = u(s_i) + \xi\cdot(x'-x) + \frac12(x'-x)\nabla^2 u(s_i)(x'-x) + \smallo(\abs{x'-x}^2)\fullstop$$ Moreover, recalling that $\xi\in\partial\overline u^K(s_i)\cap\partial\overline u^K(x)$, we also have $$\label{eq:local13}
\overline u^K(s_i)-\overline u^K(x) = \xi\cdot(s_i-x) \fullstop$$ Joining \[eq:local11,eq:local12,eq:local13\] we obtain $$\overline u^K(x')\le \overline u^K(x) + \xi\cdot(x'-x) + \frac12(x'-x)\nabla^2 u(s_i)(x'-x) + \smallo(\abs{x'-x}^2) + (\xi'-\xi)\cdot(x-s_i) \fullstop$$ Multiplying this latter inequality with $\lambda_i$ and summing over $i=1,\dots,m$ we get $$\overline u^K(x')\le \overline u^K(x) + \xi\cdot(x'-x) + \frac12(x'-x)\left(\sum_{i=1}^m\lambda_i\nabla^2 u(s_i)\right)(x'-x) + \smallo(\abs{x'-x}^2) + (\xi'-\xi)\cdot v$$ and since $v\in N(\xi, K)$, we have shown \[eq:convex\_envelope\_fundamental\] (notice that $\nabla^2 u(s_i)\ge 0$ as $s_i\in S_\xi$).
As a consequence we get that $\nabla\overline u^K(x) = \xi$ and thus, recalling \[lem:preparation\_convex\_K\], we deduce also $\nabla\overline u^K(\R^n) = \nabla\overline u^K(\Omega) = K$. To conclude that $\overline u^K\in C^{1,1}$, let us observe that, for any $x\in\R^n$, the matrix $H_x$ of the statement can be found in $$\conv\Bigg(\nabla^2 u\bigg(\bigcup_{\xi\in K}S_\xi\bigg)\Bigg)$$ and the assumption $S_\xi\subseteq \Omega$ together with the compactness of $K$ implies that $\bigcup_{\xi\in K}S_\xi \compactsubset \Omega$. Therefore there is a constant $C=C(\Omega, u)$ such that for any $x\in\R^n$ it holds $H_x\le C\,\id$. Now it is standard to obtain $\overline u^K\in C^{1,1}(\R^n)$ (see, for example, [@ambrosio-carlotto-massacesi2018 Proposition 5.29]).
\[rem:envelope\_locality\] The proof of \[prop:convex\_envelope\_regularity\] yields also a more *local* result. Namely, if $S_\xi\subseteq\Omega$ for all $\xi\in U\cap K$ (where $U$ is an open set), then for any $x\in\R^n$ such that $\nabla \overline u^K(x)\in U$ there is a neighborhood of $x$ where $\overline u^K$ is $C^{1,1}$ and \[eq:convex\_envelope\_fundamental\] holds (for some $H_x\in H(x, \nabla\overline u^K(x), K)$).
Construction of the coupling {#sec:coupling}
============================
To better illustrate the ideas, before describing the construction of the coupling in the weighted setting, we construct the analogous coupling in the anisotropic case (without a weight). Even if the methods are the same, the construction in the anisotropic setting is less technical. In order to do so, we have to define the anisotropic norm and the anisotropic perimeter (to get some further context about the anisotropic perimeter, see [@FMP Introduction]).
Given a compact convex set $K\subseteq\R^n$ such that $0_{\R^n}\in \mathring{K}$, let us define the anisotropic norm $\abs{\emptyparam}_{K^*}:\R^n\to\co0\infty$ as $$\abs{v}_{K^*} = \sup\{v\cdot x:\ x\in K\} \fullstop$$ Then, the anisotropic perimeter of a set of finite perimeter $E\subseteq\R^n$ is defined as $$\Per_K(E) = \int_{\bou E} \abs{\nu_{\bou E}}_{K^*} \de\Haus^{n-1} \fullstop$$ We have all the necessary definitions to construct the coupling for the anisotropic perimeter. Before going on, let us remark that, in all the statements of this section, we need an additional assumption in dimension $2$ (namely, the indecomposability of the set $E$). This is because we need to approximate $E$ with *connected* open sets and this is not always possible in dimension $2$.
\[thm:anisotropic\_coupling\] Let $E\subseteq\R^n$ be a set of finite perimeter (with $0<\abs{E}<\infty$) and let $K\subseteq\R^n$ be a compact convex set whose interior contains the origin. If $n=2$, we assume also that $E$ is indecomposable (see \[def:indecomposable\]).
Then, there exists a $C^{1,1}$ convex function $\varphi:\R^n\to\R$ that satisfies $\nabla\varphi(\R^n)=\nabla\varphi(E) = K$ (up to negligible sets) and $\lapl\varphi\le \frac{\Per_K(E)}{\abs{E}}$.
First, we prove the statement when $E$ is a bounded connected open set with smooth boundary and then we remove the assumption by approximation.
Let $\nu:\partial E\to\R^n$ be the outer normal to the boundary. As in [@CRS], let us consider the Neumann problem for $u:E\to\R$ $$\begin{cases}
\lapl u = \frac{\Per_K(E)}{\abs{E}} &\text{in $E$} \\
\partial_\nu u = \abs{\nu}_{K^*} &\text{on $\partial E$}\fullstop
\end{cases}$$ Since the compatibility condition $\int_E \lapl u = \int_{\partial E}\partial_\nu u$ is satisfied and $E$ is connected, the problem admits a solution $u$, which is smooth up to the boundary.
For any $\xi\in\mathring{K}$ the minimum of the function $u(x)-\xi\cdot x$ cannot be attained on the boundary of $E$, indeed $\nabla(u(x)-\xi\cdot x)\cdot\nu = \abs{\nu}_{K^*} - \xi\cdot\nu > 0$.
Take a sequence of compact convex sets $(K_i)_{i\in\N}$ such that $K_i\compactsubset \mathring K_{i+1}$ and $\cup_{i\in\N}K_i = \mathring K$. It is not hard to see that $\overline u^{K_i}\nearrow\overline u^K$ locally uniformly. Moreover, at any point $x\in E$ such that $\nabla^2 u(x)\ge 0$, it holds $$0 \le \nabla^2 u(x) \le \lapl u(x)\,\id = \frac{\Per_K(E)}{\abs{E}}\,\id$$ and thus, thanks to \[prop:convex\_envelope\_regularity\], the family $(\overline u^{K_i})_{i\in\N}$ is uniformly bounded in $C^{1,1}$. Hence, $\overline u^K\in C^{1,1}$, and the convergence to $\overline u^K$ is (up to subsequence) in $C^1_{loc}(\R^n)$. Therefore, $\nabla \overline u^K(\R^n)=\nabla\overline u^K(\overline E)=K$.
Now, for any $i\in\N$ and almost any $x\in\R^n$, the Hessian $\nabla^2 \overline u^{K_i}$ exists and is controlled by $H_x\in H(x, \nabla \overline u^{K_i}, K_i)$. It follows that $\lapl\overline u^{K_i} \le \frac{\Per_K(E)}{\abs{E}}$ (since such an estimate holds for $u$). Sending $i\to\infty$ we deduce that the same holds for $\overline u^K$, thus $\varphi\defeq\overline u^K$ satisfies all the requirements.
It remains to drop the regularity assumption on $E$. Let $(E_i)_{i\in\N}\subseteq\R^n$ be a sequence of *connected* bounded open sets with smooth boundary such that $\Per_K(E_i)\to\Per_K(E)$ and $\abs{E_i\triangle E}\to 0$. In dimension $2$, the existence of this sequence is guaranteed by \[prop:indecomposable\]; in higher dimension we can apply [@maggi2012 Theorem 13.8] and then notice that the additional requirement of connectedness can be fulfilled adding a finite number of thin pipes between the connected components. For each $E_i$, let $\varphi_i:\R^n\to\R$ be a function that satisfies the assumptions of the statement.
Without loss of generality, thanks to Arzelà–Ascoli theorem, we can assume that $\varphi_i\to\varphi$ locally in $C^1$, where $\varphi:\R^n\to\R$ is a $C^{1,1}$ convex function such that $\nabla\varphi(\R^n)\subseteq K$ and $\lapl\varphi \le \frac{\Per_K(E)}{\abs{E}}$. To conclude it is sufficient to prove $\abs{\nabla\varphi(E)} \ge \abs{K}$.
Let $C\subseteq E$ be a compact set. It holds $$\label{eq:estimate_outside}
\abs{\nabla\varphi_i(E_i\setminus C)}\le \Lip(\nabla\varphi_i)^n \abs{E_i\setminus C}
\le \gamma \cdot (\abs{E_i\triangle E} + \abs{E\setminus C}) \comma$$ where $\gamma = \gamma(n, K, E) = \left(2n\frac{\Per_K(E)}{\abs{E}}\right)^n$. Since $\nabla \varphi_i(E_i) = K$, it holds $K\setminus \nabla\varphi_i(E_i\setminus C)\subseteq \nabla\varphi_i(C)$ and therefore \[eq:estimate\_outside\] implies $$\label{eq:estimating_for_i}
\abs{\nabla\varphi_i(C)} \ge \abs{K}-\gamma \cdot (\abs{E_i\triangle E} + \abs{E\setminus C}) \fullstop$$ Take any $y\in \limsup \nabla\varphi_i(C)$ and let $x_i\in C$ be such that $\nabla\varphi_i(x_i)=y$ (we avoid passing to a subsequence for notational simplicity). By compactness we know that $x_i\to x\in C$ and since the convergence $\varphi_i\to\varphi$ is locally in $C^1$, it follows that $\nabla\varphi(x)=y$. Hence, applying \[eq:estimating\_for\_i\], we deduce $$\abs{\nabla \varphi(E)}\ge \abs{\nabla \varphi(C)} \ge \abs*{\limsup \nabla\varphi_i(C)}
\ge \limsup \abs{\nabla\varphi_i(C)} \ge \abs{K}-\gamma\cdot\abs{E\setminus C} \fullstop$$ The conclusion now follows as $\abs{E\setminus C}$ can be chosen arbitrarily small.
Notice that the existence of the coupling implies the anisotropic isoperimetric inequality, exactly as in \[eq:proof\_iso\_abp\].
It is now time to construct the convex coupling in the weighted setting. As anticipated, the main idea (taking the convex envelope of the solution of an elliptic problem) is unchanged with respect to \[thm:anisotropic\_coupling\]. On the other hand, the proof that the coupling works for smooth sets/weights and the approximation arguments needed to handle any set/weight are more demanding. Notice that at this level we require $w\equiv 0$ on $\partial\Sigma$; later on we remove this assumption.
\[thm:weighted\_coupling\] Consider $n,\,\alpha,\,\Sigma,\,w$ satisfying \[eq:assumptions\] and assume moreover $w\equiv 0$ on $\partial\Sigma$. Let $E\subseteq\Sigma$ be a set of finite $w$-perimeter with $0<w(E)<\infty$. If $n=2$, we assume also that $E$ is $w$-indecomposable (see \[def:w\_indecomposable\]). Then, there exists a $C^{1,1}$ convex function $\varphi:\R^n\to\R$ that satisfies $\nabla\varphi(\R^n)=\nabla\varphi(E) = B_1\cap\Sigma$ (up to negligible sets) and $$\label{eq:weighted_fundamental_control}
\lapl\varphi + \alpha\left(\frac{w(\nabla\varphi)}{w}\right)^{\frac1\alpha}
\le \frac{\Per_w(E)}{w(E)}\fullstop$$
We start by showing that the result holds if $E$ is a bounded open set with smooth boundary such that $\overline E\compactsubset\Sigma$ and the weight $w$ is smooth in $E$. Let $b_E=\Per_w(E)/w(E)$ and let $K\defeq \overline{B_1\cap\Sigma}$.
Let $\nu:\partial E\to\R^n$ be the outer normal to the boundary. As in [@CRS], let us consider the following Neumann problem for $u:E\to\R$ $$\label{eq:weighted_elliptic_problem}
\begin{cases}
\div(w\nabla u) = w\, b_E &\text{in $E$} \\
\partial_\nu u = 1 &\text{on $\partial E$}\fullstop
\end{cases}$$ Since the compatibility condition $\int_E \div(w\nabla u) = \int_{\partial E}w \partial_\nu u$ is satisfied, the problem admits a solution.
With the exact same reasoning adopted in the proof of \[thm:anisotropic\_coupling\], we deduce that for any $\xi\in\mathring K$, the minimum of $u(x)-\xi\cdot x$ cannot be attained on the boundary of $E$. Thence $\overline u^K\in C^{1,1}$ and $\nabla \overline u^K(\R^n) = \nabla\overline u^K(\overline E) = K$.
Let $K_r\defeq \overline{\Sigma\cap B_r}$. Since $K_r\nearrow K$ as $r\nearrow 1$, then it holds $\overline u^{K_r} \nearrow \overline u^K$ locally uniformly as $r\nearrow 1$. Notice that $K_r\not\subseteq\mathring{K}$, so we cannot apply directly \[prop:convex\_envelope\_regularity\]. Our goal is to prove \[eq:weighted\_fundamental\_control\] with $\varphi=\overline u^{K_r}$ for any $0<r<1$. We consider two cases, depending on whether $\nabla\overline u^{K_r}$ belongs to the boundary or to the interior of $\Sigma$.
If $\nabla\overline u^{K_r}(x)\in\partial\Sigma$, since $w(\partial\Sigma)=0$, it is sufficient to show that $\lapl\overline u^{K_r}(x)\le b_E$. Applying \[eq:weighted\_elliptic\_problem,lem:5.1\], we have $\lapl u(x)\le b_E$ at all points $x\in E$ such that $\nabla u(x)\in\Sigma$. Then the same inequality for $\overline u^{K_r}$ follows repeating the approximation argument contained at the beginning of the proof of \[thm:anisotropic\_coupling\] (recall that we cannot apply directly \[prop:convex\_envelope\_regularity\]).
On the other hand, if $\xi\defeq \nabla\overline u^{K_r}(x)\not\in\partial\Sigma$, then it belongs to $\mathring K$ and we can apply \[prop:convex\_envelope\_regularity\] (see \[rem:envelope\_locality\]). Thus $\nabla^2 \overline u^{K_r}(x) \le H_x \in H(x, \xi, K_r)$. Let $H_x=\sum_{i=1}^m \lambda_i\nabla^2 u(s_i)$ with $s_i\in S_\xi$ and $x-\sum \lambda_i s_i = v\in N(\xi, K_r)$. Notice that, since $\Sigma$ is convex, $x-v\in\Sigma$. Applying \[lem:5.1\] we obtain $$\begin{aligned}
\label{eq:local55}\begin{split}
\alpha\left(\frac{w(\xi)}{w(x-v)}\right)^{\frac1\alpha}
&\le
\alpha w(\xi)^{\frac1\alpha} \sum_{i=1}^m\lambda_i w(s_i)^{-\frac1\alpha}
=
\sum_{i=1}^m\lambda_i \alpha \left(\frac{w(\xi)}{w(s_i)}\right)^{\frac1\alpha} \\
&\le
\sum_{i=1}^m\lambda_i \frac{\nabla w(s_i)\cdot \xi}{w(s_i)}
=
\sum_{i=1}^m\lambda_i \frac{\nabla w(s_i)\cdot \nabla u(s_i)}{w(s_i)} \fullstop
\end{split}\end{aligned}$$ Since $u$ is a solution of \[eq:weighted\_elliptic\_problem\], it holds $$\label{eq:local56}
\lapl u(s_i) + \frac{\nabla w(s_i)\cdot \nabla u(s_i)}{w(s_i)} = b_E \fullstop$$ Combining \[eq:local55,eq:local56\], we deduce $$\sum_{i=1}^m \lambda_i\lapl u(s_i) + \alpha\left(\frac{w(\xi)}{w(x-v)}\right)^{\frac1\alpha} \le b_E\comma$$ and thus $$\nabla^2\overline u^{K_r}(x) + \alpha\left(\frac{w(\nabla\overline u^{K_r})}{w(x-v)}\right)^{\frac1\alpha} \le b_E \fullstop$$ This latter inequality is *almost* the desired one, but for the presence of $w(x-v)$ instead of $w(x)$. To fix this issue we notice that if $\xi\in\mathring K_r$ then $v=0$. Otherwise $\xi\in\partial K_r\cap\mathring K$ and therefore $\xi\in \Sigma\cap\partial B_r$ and $N(\xi, K_r)=\{\xi\}$. Hence $v=\xi\in\Sigma$ and, recalling once again \[lem:5.1\], it holds $w(x-v)\le w(x)$.
We managed to prove \[eq:weighted\_fundamental\_control\] for $\varphi=\overline u^{K_r}$ and since $\overline u^{K_r}\to \overline u^K$ locally in $C^1$ as $r\nearrow 1$, it follows that the same is true also for $\overline u^K$.
It remains to drop the regularity assumption on $E$ and $w$. First, we drop the regularity assumption on $w$. Thanks to \[lem:smoothing\_weight\] we can find a sequence of admissible weights $w_i\to w$ that are smooth in $E$ and that converge to $w$ locally uniformly. For any such $w_i$ we can find $\varphi_i:\R^n\to\R$ such that the statement holds. In particular the family $\varphi_i$ is bounded in $C^{1,1}$ and therefore, up to subsequence, converges locally in $C^1$ to $\varphi:\R^n\to\R$. It is not hard to check that $\varphi$ satisfies all the desired properties.
Finally, the method used in the last part of the proof of \[thm:anisotropic\_coupling\] can be applied also here to remove the assumption that $E$ is compactly contained in $
\Sigma$ and has a smooth boundary (applying \[prop:w\_indecomposable\] instead of \[prop:indecomposable\]). Notice that in this final step we need $\Per_w(E_i)\to \Per_w(E)$, with $E_i\compactsubset \Sigma$, which holds since $w\equiv 0$ on $\partial\Sigma$.
The next proposition is fundamental for the proof of the stability of the isoperimetric inequality; it contains all the properties of the coupling that we will need. In this proposition we drop the additional assumption $w\equiv 0$ on $\partial\Sigma$ that was necessary for \[thm:weighted\_coupling\].
\[prop:weighted\_coupling\_properties\] Consider $n,\,\alpha,\,\Sigma,\,w$ satisfying \[eq:assumptions\] and let $E\subseteq\Sigma$ be a set of finite $w$-perimeter with $w(E)=1$ and $\delta_w(E)\le 1$. If $n=2$, we assume also that $E$ is $w$-indecomposable (see \[def:w\_indecomposable\]). There is a $C^{1,1}$ convex function $\varphi:\R^n\to\R$ such that $\norm{\nabla^2\varphi}_{\infty}\lesssim 1$, $\nabla\varphi(\R^n)=\nabla\varphi(E)=\Sigma\cap B_1$ (up to negligible sets), and $$\begin{aligned}
&\int_E \abs{\nabla^2\varphi -\id}\,w \lesssim \delta_w(E)^{\frac12} \label{eq:hessian_control} \comma\\
&
\int_{\bou E\cap\Sigma} \big(1-\abs{\nabla\varphi}\big)\,w\de\Haus^{n-1}
\lesssim
\delta_w(E) \fullstop\label{eq:boundary_control}
\end{aligned}$$ Moreover, for any $Q\compactsubset\Sigma$, we have $$\label{eq:weight_control}
\int_{E\cap Q} \abs*{w(\nabla\varphi)^{\frac1\alpha}-w^{\frac1\alpha}} \le C\delta_w(E)^{\frac12} \comma$$ where $C$ is a constant depending only on $n$, $\alpha$, $\Sigma$, and $Q$.
First, assuming that $w\equiv 0$ on $\partial\Sigma$, we prove that the map built in \[thm:weighted\_coupling\] satisfies all the constraints. Then we remove the additional assumption by approximation.
Let us assume $w(\partial\Sigma) = 0$ and let $\varphi:\R^n\to\R$ be the map built in \[thm:weighted\_coupling\].
Applying the area formula, the arithmetic-geometric mean inequality, and the properties of $\varphi$ described in \[thm:weighted\_coupling\], we get $$\begin{aligned}
\begin{split}\label{eq:local_weight_prop0}
1&=w(B_1\cap\Sigma)=w(\nabla\varphi(E))
\le \int_E \det(\nabla^2\varphi)w(\nabla\varphi)
=\int_E \det(\nabla^2\varphi)\Big(\frac{w(\nabla\varphi)}{w}\Big)w \\
&\le
\int_E \Big(\frac{\lapl \varphi}n\Big)^n\Big[\Big(\frac{w(\nabla\varphi)}{w}\Big)^{\frac1\alpha}\Big]^{\alpha}w
\le
\int_E \bigg(\frac{\lapl\varphi + \alpha \big(\frac{w(\nabla\varphi)}{w}\big)^{\frac1\alpha}}{D}\bigg)^D w
\le
\int_E \Big(\frac{\Per_w(E)}{D}\Big)^D w \\
&= \big(1+\delta_w(E)\big)^D \comma
\end{split}
\end{aligned}$$ where we used $s^nt^\alpha\le \big(\frac{n s + \alpha t}{n+\alpha}\big)^{n+\alpha}$. Thus $$\label{eq:local_weight_prop1}
\int_E \left(\Big(\frac{\Per_w(E)}{D}\Big)^D - \det(\nabla^2\varphi)\Big(\frac{w(\nabla\varphi)}{w}\Big) \right)w
\le \big(1+\delta_w(E)\big)^D-1 \lesssim \delta_w(E) \fullstop$$ Applying \[lem:quantitative\_amgm\] with $\lambda=(\rlap{$\overbrace{\phantom{1,\dots, 1}}^n$}1,\dots,1,\alpha)$, $(x_1,\dots,x_n)$ equal to the eigenvalues of $\nabla^2\varphi$, $x_{n+1}=(\frac{w(\nabla\varphi)}{w})^{\frac1\alpha}$, and $c=\frac{\Per_w(E)}D$, we obtain $$\label{eq:local_weight_prop2}
\abs{\nabla^2 \varphi - \id}^2 +
\abs*{\Big(\frac{w(\nabla\varphi)}{w}\Big)^{\frac1\alpha}-1}^2
\lesssim \Big(\frac{\Per_w(E)}{D}\Big)^D - \det(\nabla^2\varphi)\Big(\frac{w(\nabla\varphi)}{w}\Big)\fullstop$$ Joining \[eq:local\_weight\_prop1,eq:local\_weight\_prop2\] we obtain $$\int_E \abs{\nabla^2 \varphi - \id}^2 w
+
\int_E \abs*{\Big(\frac{w(\nabla\varphi)}{w}\Big)^{\frac1\alpha}-1}^2 w
\lesssim \delta_w(E) \fullstop$$ This implies (using Cauchy-Schwarz) \[eq:hessian\_control\] and $$\int_E \abs*{\Big(\frac{w(\nabla\varphi)}{w}\Big)^{\frac1\alpha}-1}\,w \lesssim \delta_w(E)^{\frac12} \fullstop$$ The weight $w$ is bounded in $Q$ from below and above by constants that depend only on $n,\alpha,\Sigma,Q$ because $w^{\frac1\alpha}$ is concave and $w(B_1\cap\Sigma)=1$. Thus, the last estimate implies \[eq:weight\_control\].
Proceeding as in \[eq:local\_weight\_prop0\], applying \[lem:5.1\] and the divergence theorem, we obtain $$\begin{aligned}
1
&\le
\int_E \bigg(\frac{\lapl\varphi + \alpha \big(\frac{w(\nabla\varphi)}{w}\big)^{\frac1\alpha}}{D}\bigg)^D w
\le \frac{\Per_w(E)^{D-1}}{D^D}\int_E \bigg(\lapl\varphi + \alpha \Big(\frac{w(\nabla\varphi)}{w}\Big)^{\frac1\alpha}\bigg)w \\
&\le \frac{\Per_w(E)^{D-1}}{D^D}\int_E \div(w\nabla\varphi)
=
\frac{\Per_w(E)^{D-1}}{D^D}\int_{\bou E} (\nabla\varphi\cdot\nu_{\bou E})w\de\Haus^{n-1} \\
&\le
\frac{\Per_w(E)^D}{D^D}-\frac{\Per_w(E)^{D-1}}{D^D}\int_{\bou E} (1-\abs{\nabla\varphi})w\de\Haus^{n-1}\comma
\end{aligned}$$ where in the last step we applied $\nabla\varphi\cdot\nu \le \abs{\nabla\varphi}\le 1$ (recall that $\nabla\varphi\in B_1\cap\Sigma$). The estimate \[eq:boundary\_control\] follows rearranging the terms.
It remains to drop the assumption $w(\partial\Sigma)=0$. Thanks to \[lem:weight\_approximation\_zero\_trace\] we can find a sequence $(w_i)_{i\in\N}$ of $\alpha$-homogeneous weights such that $w_i\equiv 0$ on $\partial\Sigma$, and $w_i\to w$ uniformly on compact subsets of $\Sigma$. Let $\varphi_i:\R^n\to\R$ be the map built in \[thm:weighted\_coupling\] when the weight is $w_i$.
Notice that $\delta_{w_i}\to\delta_w$ as $i\to\infty$ and therefore the family $(\varphi_i)_{i\in\N}$ is bounded in $C^{1,1}$. Up to subsequence, we can assume that $\varphi_i\to\varphi$ locally in $C^1$, where $\varphi:\R^n\to\R$ is a $C^{1,1}$-function. Following the method adopted in the proof of \[thm:weighted\_coupling\], we can establish $\nabla\varphi(\R^n)=\nabla\varphi(E)=\Sigma\cap B_1$. The properties \[eq:hessian\_control,eq:boundary\_control\] follow directly from the convergence of weights and maps. On the other hand, passing to the limit in \[eq:weight\_control\], we need to avoid $\nabla\varphi\in\partial\Sigma$ because in that case $w_i(\nabla\varphi_i)$ may not converge to $w(\nabla\varphi)$. Hence, we obtain $$\label{eq:tmp6721}
\int_{E\cap Q\cap \{\nabla\varphi\not\in\partial\Sigma\}}
\abs*{w(\nabla\varphi)^{\frac1\alpha}-w^{\frac1\alpha}} \le C \delta_w(E)^{\frac12} \fullstop$$ The area formula for Lipschitz functions implies $\nabla^2\varphi$ is singular almost everywhere in $\{\nabla\varphi\in\partial\Sigma\}$, in particular $\abs{\nabla^2\varphi-\id}\gtrsim 1$. Therefore \[eq:hessian\_control\] implies $$w\big(Q\cap\{\nabla\varphi\in\partial\Sigma\}\big) \lesssim \delta_w(E)^{\frac12}\comma$$ and this is sufficient to deduce \[eq:weight\_control\] from \[eq:tmp6721\].
Ruling out translational freedom {#sec:ruling_out_translations}
================================
Recall that we assume $\Sigma=\R^k\times\widetilde\Sigma$ where $\widetilde\Sigma\subseteq\R^{n-k}$ is an open convex cone containing no lines. Moreover, we can split $\R^{n-k}$ as $\R^h\times\R^{n-k-h}$, where $\R^h$ identifies the directions along which $w$ is constant, namely, the vectors $\xi$ such that $w(x+t\xi)=w(x)$ whenever both sides make sense ($x\in\Sigma$, $t\in\R$).
Let $$\label{eq:LCE}
\begin{split}\mathcal L &\defeq \R^k\times \{0_{\R^{n-k}}\}\,\textrm{ be the subspace of $\mathcal{L}$ines contained in $\Sigma$,}\\
\mathcal C & \defeq\{0_{\R^k}\}\times\R^h\times\{0_{\R^{n-k-h}}\}\,\textrm{ be the subspace of direction of $\mathcal C$onstancy for $w$,}\\
\mathcal E &\defeq \{0_{\R^{h+k}}\}\times\R^{n-k-h}\,\textrm{ be everything $\mathcal E$lse.}
\end{split}$$ Notice that if $\mathcal C\neq \{0_{\R^n}\}$ then $w\not\equiv 0$ on $\partial\Sigma$.
corresponds to the strategy \[it:intro\_nonconstant\] described in the introduction to prove $\abs{\widetilde x_0} \le C \delta_w(E)^{\frac12}$. implements the strategy \[it:intro\_ball\_growth\]. Finally, \[it:intro\_ball\_growth\] and \[it:intro\_constant\_hard\] are condensed in \[prop:controlling\_constant\_directions\].
We will need the following two technical lemmas.
\[lem:elementary\_boring\_result\] Let $\eta:\R\to\R$ be any function. Then for any $a<b$ and $\eps>0$ it holds $$\int_a^b\abs{\eta(t+\eps)-\eta(t)} \de t\ge
\eps \Big(\inf_{\abs{t-b}\le\eps}\eta(t) - \sup_{\abs{t-a}\le \eps}\eta(t) \Big) \fullstop$$
Let $m=\lfloor\frac{\abs{a-b}}{\eps}\rfloor$, where $\lfloor x\rfloor$ denotes the integer part of $x$. The triangle inequality implies $$\begin{aligned}
\int_a^b \abs{\eta(t+\eps)-\eta(t)} \de t
\ge\int_0^\eps \sum_{i=1}^m \abs{\eta(a+t+i\eps)-\eta(a+t+(i-1)\eps)} \de t
\ge \int_0^\eps \abs{\eta(a+t+m\eps)-\eta(a+t)}\de t\comma
\end{aligned}$$ and the desired inequality follows since $\abs{a+t+m\eps-b}\le \eps$ for any $0\le t\le \eps$.
The second one reads as follows.
\[lem:derivative\_volume\] Given $f\in BV_{loc}(\R^n)$ and $\eta\in L^{\infty}(\R^n)$ with compact support, the function $\psi:\R^n\to\R$ defined as $$\psi(\xi) \defeq \int_{\R^n} \eta(x) f(x+\xi)\de x$$ is locally Lipschitz continuous, hence differentiable almost everywhere, and its gradient satisfies (almost everywhere) $$\nabla \psi(\xi) = \int_{\R^n} \eta(x-\xi) \de \diff f(x) \fullstop$$
Let $\varphi\in C^{\infty}_c(\R^n)$ be a smooth function with compact support. From multiple applications of Fubini’s theorem and the divergence theorem for BV functions \[eq:intro\_div\_theorem\], it follows $$\int_{\R^n}\nabla\varphi(\xi)\psi(\xi)\de \xi =
-\int_{\R^n}\varphi(\xi)\Big(\int_{\R^n}\eta(x-\xi)\de\widetilde\nabla f(x)\Big)\de\xi \fullstop$$ Since $\int_{\R^n}\eta(x-\xi)\de\widetilde\nabla f(x)$ is locally bounded, $\psi$ is locally Lipschitz continuous and $\int_{\R^n}\eta(x-\xi)\de\widetilde\nabla f(x)$ is its weak gradient (hence its classical gradient almost everywhere).
Next, we prove the following.
\[prop:magic\_compact\_set\] Consider $n,\,\alpha,\,\Sigma,\,w$ satisfying \[eq:assumptions\], and let $\mathcal L$, $\mathcal C$, and $\mathcal E$ be as in \[eq:LCE\]. There exists an $\hat\eps=\hat\eps(n,\alpha,\Sigma,w)>0$ and a compact set $\hat Q\subseteq B_{\frac12}\cap\Sigma$ (that depends on $n,\alpha,\Sigma, w$) such that
1. \[it:magic\_compact\_set\_far\] $d(\hat Q, \partial\Sigma) > 2\hat\eps$,
2. \[it:magic\_compact\_set\] For any $\xi\in B_{\hat\eps}$ it holds $$\int_{\hat Q} \abs{w^{\frac1\alpha}(x+\xi)-w^{\frac1\alpha}(x)}\de x \ge \hat\eps\abs{\pi_{\mathcal E}(\xi)} \comma$$ where $\pi_{\mathcal E}:\R^n\to\mathcal E$ is the orthogonal projection onto $\mathcal E$.
Given a compact set $Q\subseteq \Sigma$, an $\eps>0$ and a subset $U\subseteq \partial B_1\cap \mathcal E$ we say that the pair $(U,\eps)$ is compatible with the compact set $Q$ if $d(Q,\partial\Sigma) > 2\eps$ and $$\int_{Q} \abs{w^{\frac1\alpha}(x+\xi)-w^{\frac1\alpha}(x)}\de x \ge \eps\abs{\xi}$$ for any $\xi\in B_\eps$ such that $\xi/\abs{\xi}\in U$
Given two points $p_1,p_2\in B_{\frac12}\cap\Sigma$ and $r>0$, let us define the compact set $$Q(p_1, p_2, r) \defeq \big\{x\in \Sigma\cap \overline B_{\frac12}:\ d(x, \partial\Sigma)\ge r,\ d(x, [p_1,p_2])\le r\big\}\comma$$ where $[p_1,p_2]$ denotes the segment between $p_1$ and $p_2$.
Given a direction $\theta \in \partial B_1\cap \mathcal E$, take two points $p_\theta, p'_\theta \in B_{\frac12}\cap\Sigma$ such that $w(p_\theta)\not=w(p'_\theta)$ and $p_\theta-p'_\theta$ is a multiple of $\theta$ (the existence of the two points follows from $\theta\in\mathcal E$). Applying \[lem:elementary\_boring\_result\], we can find a small $r_\theta>0$, a small $\eps_\theta>0$ and a neighborhood $U_\theta\subseteq \partial B_1\cap \mathcal E$ of $\theta$ such that $(\eps_\theta, U_\theta)$ is compatible with $Q(p_\theta, p'_\theta, r_\theta)$. Since $\partial B_1\cap\mathcal E$ is compact, we can find $U_{\theta_1},\dots,U_{\theta_k}$, with $k\in\N$, that cover $\partial B_1\cap\mathcal E$. Hence, it is not hard to check that $\hat\eps\defeq \min(\eps_{\theta_1},\dots,\eps_{\theta_k})$ and $$\hat Q \defeq \bigcup_{i=1}^k Q(p_{\theta_i}, p'_{\theta_i}, r_{\theta_i})$$ satisfy \[it:magic\_compact\_set\_far,it:magic\_compact\_set\] with the additional constraint $\xi\in\mathcal E$. The whole statement follows because the left-hand side of \[it:magic\_compact\_set\] does not change if we replace $\xi$ with $\pi_{\mathcal E}(\xi)$.
We will also need the following.
\[lem:linear\_growth\_ball\] Consider $n,\,\alpha,\,\Sigma,\,w$ satisfying \[eq:assumptions\], and let $\mathcal L$, $\mathcal C$, and $\mathcal E$ be as in \[eq:LCE\]. Then, there is a small constant $c_1=c_1(n,\alpha,\Sigma, w)>0$ such that $$w(B_1(\xi)\cap\Sigma) \ge w(B_1\cap\Sigma) + c_1\abs{\xi}\comma$$ for all $\xi\in B_{c_1}\cap\mathcal C$ satisfying $d(\frac{\xi}{\abs{\xi}}, \Sigma) <c_1$.
For any $\xi\in\mathcal C$ and any $x\in\Sigma$ with $x+\xi\not\in\Sigma$, let us define $w(x+\xi)\defeq w(x)$ (we are extending the domain of $w$ exploiting its constancy in certain directions). The definition is consistent because of the condition $\xi\in\mathcal C$.
Notice that, for any $\xi\in\mathcal C$, it holds $$w(B_1(\xi)\cap\Sigma) = \int_{B_1}\characteristic\Sigma(x+\xi)w(x+\xi)\de x
= \int_{B_1}w(x)\characteristic{\Sigma}(x+\xi)\de x \fullstop$$ Applying \[lem:derivative\_volume\] with $f=\characteristic\Sigma$ and $\eta=w\,\chi_{B_1}$, we deduce that for $\xi\in\mathcal C$ it holds $$\label{eq:tmp5461}
w(B_1(\xi)\cap\Sigma) - w(B_1\cap\Sigma) \ge - \overline\nu\cdot\xi -\smallo(\abs{\xi}) \comma$$ where $$\overline\nu\defeq \int_{\partial\Sigma\cap B_1} \nu_{\partial\Sigma}\,w\de\Haus^{n-1}$$ and $\nu_{\partial\Sigma}$ is the *outer* normal to $\partial\Sigma$. If $\xi\in\mathcal C\cap\Sigma$, it holds $\nu_\Sigma \cdot \xi<0$ at any point and therefore $\overline \nu\cdot\xi < 0$ (recall that if $\mathcal C\not=\{0\}$ then $w\not\equiv 0$ on $\partial\Sigma$). The same strict inequality holds also if $\xi\in\mathcal C\cap\partial\Sigma\setminus\{0\}$ (because by definition $\mathcal C\cap\Sigma$ does not contain lines). Hence, there is a small $c>0$ such that for any $\xi\in\mathcal C\cap\overline\Sigma$ it holds $$\label{eq:tmp67992}
\overline\nu\cdot\xi \le -c\abs{\xi} \fullstop$$ The two estimates \[eq:tmp5461,eq:tmp67992\], together with a simple continuity argument, yield the desired result.
Finally, we prove the following.
\[prop:controlling\_constant\_directions\] Consider $n,\,\alpha,\,\Sigma,\,w$ satisfying \[eq:assumptions\], and let $\mathcal L$, $\mathcal C$, and $\mathcal E$ be as in \[eq:LCE\]. There is a small constant $c=c(n,\alpha,\Sigma, w)>0$ such that for any $\xi\in B_c\cap\mathcal C$ at least one of the following two statements is true:
1. It holds $\abs{w(\Sigma\cap B_1(\xi))-w(\Sigma\cap B_1)}\ge c\abs{\xi}$.\[it:linear\_growth\_ball\]
2. There exists a set $S\subseteq \langle \xi\rangle ^{\perp}$ such that, setting $t_0(s)$ and $t_1(s)$ so that $\Sigma_s \defeq \Sigma\cap\{s+t\xi:t\in\R\} = \big\{s+t\frac{\xi}{\abs{\xi}}:\ t_0(s) < t < t_1(s)\big\}$, the following hold. \[it:good\_slicing\]
1. For any $s\in S$, it holds $-\infty < t_0(s) < t_0(s) + c < t_1(s) < +\infty$.\[it:loca\]
2. For any $s\in S$ and any $z\in\Sigma_s$, it holds $w(z)>c$ (notice that $w$ is constant on $\Sigma_s$). \[it:locb\]
3. It holds $\Haus^{n-1}(S) > c$. \[it:locc\]
4. For any $s\in S$ and any $t<t_0(S)$ it holds $d(s + t\frac{\xi}{\abs{\xi}}, \Sigma) > c (t_0-t)$. \[it:locd\]
5. For any $s\in S$ and any $t>t_1(S)$ it holds $d(s + t\frac{\xi}{\abs{\xi}}, \Sigma) > c (t-t_1)$. \[it:loce\]
6. For any $s\in S$, $\Sigma_s\subseteq B_{\frac12}\cap\Sigma$. \[it:locf\]
Let $c_1$ be the constant present in the statement of \[lem:linear\_growth\_ball\]. If $d(\xi, \Sigma) < c_1\abs{\xi}$ or $d(\xi, -\Sigma) < c_1\abs{\xi}$, then \[lem:linear\_growth\_ball\] implies that \[it:linear\_growth\_ball\] holds (choosing $c$ smaller then $c_1$).
We are going to show that if $d(\xi, \Sigma)>c_1\abs{\xi}$ and $d(\xi, -\Sigma)>c_1\abs{\xi}$, then we can find a set $S$ satisfying the requirements of \[it:good\_slicing\]. Given that $\xi$ is *far* from $\Sigma$ and $-\Sigma$, the properties \[it:locd,it:loce\] are satisfied independently of the choice of $S$.
Fix an element $v\in\Sigma$ and a small real number $l>0$. Let $S$ be the image of the projection onto $\langle\xi\rangle^\perp$ of $B_{l^2}(lv)$. Up to choosing $c$ and $l$ sufficiently small, the properties \[it:locb,it:locc\] are satisfied.
The property \[it:locf\] follows from the observation that for any $s\in S$ it holds $\Sigma_s\cap B_{2l}\not=\emptyset$. Similarly, the property \[it:loca\] follows from the observation that for any $s\in S$ there is a point $z\in\Sigma_s$ such that $d(z, \partial\Sigma) > \eps_0l$, where $\eps_0>0$ is a small constant that depends only on the chosen vector $v$.
Spherical boundary implies ball {#sec:spherical_boundary_implies_ball}
===============================
The goal of this section is to prove the following.
\[prop:close\_to\_translated\_ball\] Consider $n,\,\alpha,\,\Sigma,\,w$ satisfying \[eq:assumptions\] and let $E\subseteq\Sigma$ be a set of finite $w$-perimeter with $w(E\cap B_{\frac12})\ge \frac12w(B_{\frac12}\cap \Sigma)$. Then, we have $$w\big(E\triangle (B_1(x_0)\cap\Sigma)\big) \lesssim \int_{\bou E\cap\Sigma} \abs{\abs{x-x_0}-1}w(x)\de\Haus^{n-1}(x)\comma$$ for any sufficiently small $x_0\in\R^n$.
The strategy is to obtain first a robust analogous result in $1$-dimension (that is \[lem:one\_dim\_boundary\_to\_inside\]) and deduce the full statement through a polar slicing.
\[lem:one\_dim\_boundary\_to\_inside\] For any $\gamma\ge 0$, there is a constant $C_\gamma>0$ such that the following statement holds.
Let $E\subseteq\co0\infty$ be a $1$-dimensional set of locally finite perimeter with $\abs{E} < \infty$. For any $1-\frac14\le l\le1+\frac14$ it holds $$\label{eq:no_fantasy}
\int_{E\triangle\cc0l} t^{\gamma}\de t
\le C_\gamma \left(
\int_{\cc0{\frac12}\setminus E} t^{\gamma}\de t
+\int_{\bou E} t^{\gamma}\abs{l-t}\de\Haus^0(t) \right)\fullstop$$
For simplicity, we prove it only for $l=1$; the proof works (up to slightly increasing the value of the constant $C_\gamma$) also for any other $1-\frac14\le l\le 1+\frac14$. It holds $E\triangle \cc01=\big(\oo1\infty\cap E\big)\cup\big(\cc01\setminus E\big)$.
We will estimate independently the two terms $$\int_{\co1\infty\cap E} t^\gamma\de t
\quad\text{and}\quad
\int_{\cc{\frac12}{1}\setminus E} t^{\gamma} \de t \fullstop$$ Notice that if $\co1\infty\cap E=\emptyset$, then the first term is trivially estimated. Otherwise $\bou E\cap \co1\infty$ is nonempty and must have a supremum point, that we denote by $t_1$ (we may assume $t_1<\infty$, so that the right-hand side in \[eq:no\_fantasy\] is finite). It holds $$\int_{\co1\infty\cap E} t^\gamma\de t
\le
\int_1^{t_1} t^\gamma\de t
\le t_1^{\gamma}\abs{t_1-1}
\le \int_{\bou E} t^{\gamma}\abs{1-t}\de\Haus^0(t) \comma$$ hence we have successfully controlled the first term.
Let us now move our attention to the second term. First notice that its value is a priori bounded by $1$. If $\bou E\cap\cc{\frac14}{\frac34}\not=\emptyset$, then the right-hand side of \[eq:no\_fantasy\] is at least $C_\gamma \left(\frac{1}{4}\right)^{\gamma+1}$ and therefore we have the desired estimate (choosing $C_\gamma$ appropriately).
Thus we can assume $\bou E\cap\cc{\frac14}{\frac34}=\emptyset$. If $\cc{\frac14}{\frac34}\setminus E\not = \emptyset$, then (since $E$ has no boundary in that interval) it follows $\cc{\frac14}{\frac34}\cap E = \emptyset$ and in particular the right-hand side of \[eq:no\_fantasy\] is larger than $$C_\gamma\int_{\frac14}^{\frac34}t^\gamma\de t\comma$$ which yields the desired estimate.
Thus we can assume $\cc{\frac14}{\frac34}\subseteq E$. If $\bou E\cap\cc{\frac14}{1}=\emptyset$, then $\cc{\frac12}{1}\subseteq E$ and therefore there is nothing to prove. Otherwise, let $t_0$ be the infimum of $\bou E\cap\cc{\frac14}{1}$. It holds $$\int_{\cc{\frac12}{1}\setminus E} t^\gamma\de t
\le
\int_{t_0}^1 t^{\gamma}\de t
\le 4^\gamma t_0^{\gamma}\abs{1-t_0}
\le 4^\gamma \int_{\bou E} t^{\gamma}\abs{1-t}\de\Haus^0(t)\comma$$ and this concludes the proof.
To perform the polar slicing we will need the following technical lemma.
\[lem:easy\_polar\_formulas\] Let $\Sigma$ be an open cone and let $E\subseteq\Sigma$ be a measurable set such that $\Per(E,\Omega)<\infty$ for any $\Omega\compactsubset\Sigma$. For any $\theta\in \S^{n-1}\cap\Sigma$, let us define $$E_{\theta}\defeq\{t\ge 0:\ t\theta\in E\} \fullstop$$ Then, for any $\eta\in L^1(E)$, we have $$\int_E \eta
= \int_{\S^{n-1}\cap\Sigma}\de\Haus^{n-1}(\theta)
\int_{E_{\theta}} t^{n-1}\eta(t\theta)\de t \fullstop$$
Moreover, for $\Haus^{n-1}$-almost every $\theta\in\S^{n-1}\cap\Sigma$, $E_{\theta}\subseteq\R$ is a $1$-dimensional set of locally finite perimeter such that the Vol’pert property $\bou E_{\theta}\cap\{t>0\} = \{t>0:\ t\theta\in\bou E\}$ holds. Furthermore, for any nonnegative function $\eta\in L^1(\bou E,\Haus^{n-1})$, we have $$\int_{\bou E\cap\Sigma} \eta
\ge \int_{\S^{n-1}\cap\Sigma}\de\Haus^{n-1}(\theta)
\int_{\bou E_{\theta}} t^{n-1}\eta(t\theta)\de\Haus^0(t) \fullstop$$
The proof is standard and technical, we give only a sketch. The first part of the statement follows from the coarea formula ([@maggi2012 Theorem 13.1]), whereas the second part can be shown applying [@ambrosio-fusco-pallara Theorem 3.107] and the area formula for rectifiable sets ([@maggi2012 Theorem 11.6]).
Using the previous two results, we can now give the:
The strategy of the proof is to perform a polar slicing of the set $E$ and apply \[lem:one\_dim\_boundary\_to\_inside\] on each slice.
Using \[lem:easy\_polar\_formulas\], we obtain $$\begin{aligned}
\int_{\bou E\cap\Sigma} \abs{\abs{x-x_0}-1}w(x)\de\Haus^{n-1}(x)
\ge \int_{\S^{n-1}\cap\Sigma}\, w(\theta)\de\Haus^{n-1}(\theta)
\int_{\bou E_{\theta}} t^{D-1}\abs{\abs{t\theta-x_0}-1}\de\Haus^0(t) \fullstop
\end{aligned}$$ Keeping in mind that $x_0$ is a small vector, we have that the set $\{ t>0:\ \abs{t\theta-x_0}<1\}$ is an open segment $\oo0{t(\theta)}$, with $t(\theta)$ close to $1$, for every $\theta\in\S^{n-1}$. In addition, for any $\theta\in\S^{n-1}$ and $t>0$, we have $\abs{\abs{t\theta-x_0}-1}\gtrsim \abs{t-t(\theta)}$, where the hidden constant is purely geometric. Hence we obtain $$\label{eq:tmp098}
\begin{split}
\int_{\S^{n-1}\cap\Sigma}w(\theta)\de\Haus^{n-1}(\theta)
\int_{\bou E_{\theta}} t^{D-1}\abs{t-t(\theta)}\de\Haus^0(t)
\lesssim
\int_{\bou E\cap\Sigma} \abs{\abs{x-x_0}-1}w(x)\de\Haus^{n-1}(x) \fullstop
\end{split}$$
Applying \[lem:easy\_polar\_formulas\] and the relative isoperimetric inequality, \[cor:rel\_isop\_ball\], to the set $F\defeq\big(B_{\frac12}\cap\Sigma\big)\setminus E$, we deduce $$\begin{split}\label{eq:tmp2324}
\int_{\S^{n-1}\cap\Sigma} w(\theta)\de\Haus^{n-1}(\theta) & \int_{\cc0{\frac12}\setminus E_{\theta}} t^{D-1}\de t
=
w\big(\big(B_\frac12\cap\Sigma\big)\setminus E\big) \\
&\lesssim
\int_{\bou E\cap B_{\frac12}\cap\Sigma} w\de\Haus^{n-1}
\lesssim \int_{\bou E\cap\Sigma}\abs{\abs{x-x_0}-1}w(x)\de\Haus^{n-1}(x) \fullstop
\end{split}$$ Here we used that $\abs{\abs{x-x_0}-1}\gtrsim 1$ in $B_{\frac12}$.
Using \[lem:easy\_polar\_formulas\], the estimates \[eq:tmp098,eq:tmp2324\], and \[lem:one\_dim\_boundary\_to\_inside\], we conclude $$w\big(E\triangle (B_1(x_0)\cap\Sigma)\big)
=
\int_{\S^{n-1}\cap\Sigma}w(\theta)\de\Haus^{n-1}(\theta)
\int_{E_{\theta}\triangle\cc{0}{t(\theta)}} t^{D-1}\de t
\lesssim
\int_{\bou E\cap\Sigma}\abs{\abs{x-x_0}-1}w(x)\de\Haus^{n-1}(x) \fullstop$$
Weighted trace and Sobolev-Poincaré inequalities {#sec:FMP}
================================================
In this section we establish a trace inequality and a Sobolev–Poincaré inequality in the weighted setting and within a cone, as well as a uniform bound on the Cheeger constant for sets that have small weighted isoperimetric deficit. Essentially, we repeat the arguments of [@FMP Section 3], taking care of the presence of the weight $w$ and of the cone $\Sigma$. The only additional result contained here is the Sobolev-Poincaré inequality \[eq:poincare\_ineq\]. Both the statements and the proofs in this section are simple adaptations of the analogous ones in [@FMP]. Unexpectedly, the constants in the statements of \[lem:removal\] and \[thm:nice\_subset\_with\_poincare\] depend only on $D=n+\alpha$ and not on $\Sigma$ or $w$.
In this section, we never use directly the homogeneity or the concavity of the weight; all the results remain true for any weight such that the weighted isoperimetric inequality holds.
Given a set of finite $w$-perimeter $E\subseteq\Sigma$ with $0<w(E)<\infty$, we define the Cheeger constant as $$\label{eq:cheeger_constant}
\tau(E)\defeq \inf\left\{\frac{\Per_w(F)}{\Haus^{n-1}_w(\bou F\cap \bou E)}:\;F\subseteq E,\;0<w(F)\leq\frac{w(E)}{2}\right\}\,.$$ It follows from the definition of $\tau(E)$ that, as long as $\tau(E)>1$, we have the following relative isoperimetric inequality $$\label{eq:rel_isop_general}
c_*w(F)^{\frac{D-1}D}\le \Per_w(F) \le \frac{\tau(E)}{\tau(E)-1}\,\Haus^{n-1}_w(\bou F\cap E)$$ for any $F\subseteq E$ with $w(F)\leq \frac12 w(E)$, where $c_*\defeq\Per_w(B_1\cap \Sigma)/w(B_1\cap \Sigma)^{\frac{D-1}{D}}=Dw(B_1\cap\Sigma)^{\frac1D}$ is the isoperimetric constant that comes from \[isop-ineq\], and $D\defeq n+\alpha$.
Notice that when $\tau(E)-1$ is very small, \[eq:rel\_isop\_general\] is not very useful (as the constant in the right-hand side explodes). We will see that also the trace inequality \[eq:trace\_ineq\] and the Sobolev-Poincaré inequality \[eq:poincare\_ineq\] exhibit a similar behavior. Since we want to apply these inequalities on sets with small weighted isoperimetric deficit, it is crucial to show that, if $\delta_w(E)$ is sufficiently small, then (up to slightly modifying the set $E$) the value $\tau(E)-1$ is bounded away from $0$ by a constant that does not depend on $E$ (see [@FMP Section 1.6] for an explanation of why it is necessary to modify the set $E$). This is exactly the statement of \[thm:nice\_subset\_with\_poincare\].
The following trace inequality is the analogue of [@FMP Lemma 3.1]. In addition to the trace inequality, we prove also a Sobolev-Poincaré inequality. See \[sec:notation\] for the definition of $E^{(1)}$.
\[lem:trace\_poincare\] Consider $n,\,\alpha,\,\Sigma,\,w$ satisfying \[eq:assumptions\]. For every function $f\in BV_w(\R^n)\cap L^\infty(\R^n)$ and for every set of finite $w$-perimeter $E\subseteq\Sigma$ with $w(E)<\infty$, there is a constant[^7] $c\in\R$ such that $$\label{eq:trace_ineq}
\int_{E^{(1)}} w(x)\de \abs{\diff f}(x) \geq (\tau(E)-1)\int_{\bou E\cap\Sigma} \tr_E(|f-c|)w(x)\de\Haus^{n-1}(x)\comma$$ and also $$\label{eq:poincare_ineq}
\int_{E^{(1)}} w(x)\de \abs{\diff f}(x)
\ge D \big(1-\tau(E)^{-1}\big)
\left(\int_E \abs{f-c}^{\frac{D}{D-1}}w(x)\de x\right)^{\frac{D-1}{D}} \fullstop$$
For every $t\in \R$ we consider the set $F_t\defeq E\cap \{f>t\}$. There exists $c\in \R$ such that $w(F_t)\leq w(E)/2$ for every $t\geq c$, and $w(E\setminus F_t)\leq w(E)/2$ for every $t<c$. We set moreover $g\defeq (f-c)_+$, where $(A)_+$ denotes the positive part of $A$, and $G_s\defeq E\cap \{g>s\}.$
Using the coarea formula [@maggi2012 Theorem 13.1], we have that $$\label{ineq-0}
\int_{E^{(1)}} w(x)\de \abs{\diff g}(x)=\int_0^{\infty}ds\int_{E^{(1)}\cap\bou\{g>s\}}w(x)\de\Haus^{n-1}(x) \fullstop$$ Moreover, by the definition of $\tau(E)$, we have $$\label{ineq-1}
\begin{split}
\int_{E^{(1)}\cap \bou\{g>s\}}w(x)\de\Haus^{n-1}(x)&=\int_{E^{(1)}\cap \bou G_s} w(x)\de\Haus^{n-1}(x)\\
&=\int_{\bou G_s\cap\Sigma} w(x)\de\Haus^{n-1}(x)-\int_{\bou E\cap \bou G_s\cap\Sigma} w(x)\de\Haus^{n-1}(x)\\
&\geq (\tau(E)-1)\int_{\bou E\cap \bou G_s\cap\Sigma} w(x)\de\Haus^{n-1}(x) \fullstop
\end{split}$$ Now, by Fubini, we have $$\int_{\bou E\cap\Sigma}\tr_E(g)w(x)\de\Haus^{n-1}(x)=\int_0^{\infty}\de s\int_{\bou E\cap \{\tr_E(g)>s\}\cap\Sigma}w(x)\de\Haus^{n-1}(x).$$ Using that, up to $\Haus^{n-1}$-null sets, $\bou E\cap\{\tr_E(g)>s\}\subseteq \bou E\cap \bou G_s$ (the proof of this fact is contained in the proof of [@FMP Lemma 3.1]), we deduce that $$\label{ineq-2}
\int_{\bou E\cap\Sigma}\tr_E(g)w(x)\de\Haus^{n-1}(x)\le \int_0^{\infty}\de s\int_{\bou E\cap \bou G_s\cap\Sigma}w(x)\de\Haus^{n-1}(x) \fullstop$$ Combining together \[ineq-1\] and \[ineq-2\] into \[ineq-0\], we get $$\begin{split}
\int_{E^{(1)}} w(x)\de\abs{\diff g}(x)
&\geq (\tau(E)-1)\int_0^{\infty}\de s\int_{\bou E\cap \bou G_s\cap\Sigma} w(x) \de\Haus^{n-1}(x)\\
&\geq (\tau(E)-1)\int_{\bou E\cap\Sigma}\tr_E(g)\,w(x)\de \Haus^{n-1}(x) \fullstop
\end{split}$$ Now, we repeat the above argument with $(f-c)_-$ in place of $(f-c)_+$ and, using the linearity of the trace operator and the fact that $(f-c)_+ + (f-c)_-=|f-c|$, we deduce that $$\begin{aligned}
&\int_{E^{(1)}} w(x) \de \abs{\diff((f-c)_+)}(x) + \int_{E^{(1)}} w(x) \de \abs{\diff((f-c)_-)}(x)\\
&\quad\quad\quad\quad
\ge (\tau(E)-1)\int_{\bou E\cap\Sigma}\tr_E(|f-c|)w(x)\de\Haus^{n-1}(x) \fullstop\end{aligned}$$ To conclude the proof of \[eq:trace\_ineq\] it is enough to show that, for any open set $\Omega$ in $\R^n$ $$\int_{\Omega} w(x) \de \abs{\diff f}(x)
\ge
\int_{\Omega} w(x) \de \abs{\diff((f-c)_+)}(x) + \int_{\Omega} w(x) \de \abs{\diff((f-c)_-)}(x) \fullstop$$ This fact can be seen exactly as in [@FMP], by approximating $f$ with smooth functions in the weighted BV-norm, and using the lower semicontinuity of the weighted total variation.
Let us now move our attention to the Sobolev-Poincaré inequality. Repeating the argument of \[ineq-0,ineq-1\] and applying the weighted isoperimetric inequality, we can show $$\begin{aligned}
\int_{E^{(1)}} w(x)\de\abs{\diff g}(x)
\ge (1-\tau(E)^{-1}) \int_0^{\infty}\de s\int_{\bou G_s\cap\Sigma} w(x)\de\Haus^{n-1}(x) \ge D(1-\tau(E)^{-1}) \int_0^{\infty}w(G_s)^{\frac{D-1}{D}} \de s
\fullstop\end{aligned}$$ The estimate \[eq:poincare\_ineq\] follows from the last one as described in [@ambrosio-carlotto-massacesi2018 Theorem A.25].
We define now the family of sets (that depends on a set $E$ that will always be clear from the context) $$\Gamma_{\lambda} \defeq \left\{F\subseteq E:\:0<w(F)\leq \frac{w(E)}{2},\;\Per_w(F)\leq \lambda \Haus_w^{n-1}(\bou F\cap \bou E)\right\} \fullstop$$ The following lemma is the analogue [@FMP Lemma 3.2].
\[maximal\] Consider $n,\,\alpha,\,\Sigma,\,w$ satisfying \[eq:assumptions\]. Let $E\subseteq\Sigma$ be a set of finite $w$-perimeter with $0<w(E)<\infty$, and let $\lambda>1$. If the family $\Gamma_\lambda$ is not empty, then it admits a maximal element with respect to the order relation given by set inclusion up to sets of measure zero.
We define the increasing sequence $(F_i)_{i\in\N}$ of sets in $\Gamma_\lambda$ in the following way. Let $F_1$ be any element of $\Gamma_\lambda$ and, once $F_i$ has been defined, we consider $$\Gamma_\lambda(i)=\{F\in \Gamma_\lambda:\,F_i \subseteq F\}.$$ Now, let $F_{i+1}$ be an element of $\Gamma_\lambda(i)$ which satisfies $$w(F_{i+1})\geq \frac{w(F_i)+s_i}{2},\quad \mbox{where}\;s_i=\sup_{F\in \Gamma_\lambda(i)} w(F).$$ Since $F_i$ is an increasing sequence of sets it admits a limit, we call it $F_\infty$. In what follows we show that $F_\infty \in \Gamma_\lambda$ and $F_\infty$ is a maximal element in $\Gamma_\lambda$.
First, we observe that $w(F_\infty)=\sup_{i\in \N}w(F_i)\leq w(E)/2$. Moreover, by lower semicontinuity of the weighted perimeter, we have $$\Per_w(F_\infty)\leq \liminf_{i\to\infty} \Per_w(F_i)\leq \lambda \liminf_{i\to\infty}\H_w^{n-1}(\bou F_i \cap \bou E).$$ Since $F_i \subseteq F_{i+1}\subseteq F_\infty\subseteq E$, we have (up to $\Haus^{n-1}$-negligible sets) $$(\bou F_i \cap \bou E)\subseteq (\bou F_{i+1} \cap \bou E)\subseteq (\bou F_\infty \cap \bou E) \comma$$ therefore $F_\infty \in \Gamma_\lambda$. In order to show the maximality of $F_\infty$, we consider another subset $H\subseteq E$ such that $H\cap F_\infty=\emptyset$ and $H\cup F_\infty \in \Gamma_\lambda$. By construction $F_\infty \cup H \in \Gamma_\lambda(i)$, so that for every $i\in\N$ $$s_i\geq w(F_\infty \cup H)\geq w(F_{i+1})+w(H)\geq \frac{w(F_i)+s_i}{2}+w(H),$$ that is, $w(H)\leq (s_i-w(F_i))/2$. Since $s_i-w(F_i)\leq 2w(F_{i+1}\setminus F_i)\rightarrow 0$ as $i\rightarrow \infty$, we have deduced that $w(H)=0$, which gives the maximality of $F_\infty$.
Recall that we denote the isoperimetric deficit by $$\delta_w(E)\defeq\frac{\Per_w(E)}{D w(E)^{\frac{D-1}{D}}}-1,$$ where $D=n+\alpha$ is the isoperimetric constant (since we are assuming $w(B_1\cap\Sigma)=1$).
We want to show that if $E$ is almost optimal, then any subset $F$ of $E$ which makes $\tau(E)$ small enough has small volume. In order to do that, following [@FMP], we introduce the strictly concave function $\Psi:[0,1]\rightarrow [0, 2^{1/D}-1]$ given by $$\Psi(t)\defeq t^{\frac{D-1}{D}}+(1-t)^{\frac{D-1}{D}}-1.$$ We observe that $$\label{psi}
\Psi(t)\geq (2-2^{\frac{D-1}{D}})t^{\frac{D-1}{D}},\quad \mbox{for}\quad t\in \cc0{\tfrac{1}{2}}$$ and we set $$\label{kD}
k(D)\defeq \frac{2-2^{\frac{D-1}{D}}}{3},$$ so that $\Psi(t)\geq 3 k(D)t^{\frac{D-1}{D}}$ for $t\in\cc0{\frac12}$.
The following lemma is the analogue of [@FMP Lemma 3.3].
\[lem:removal\] Consider $n,\,\alpha,\,\Sigma,\,w$ satisfying \[eq:assumptions\]. Let $E, F$ be two sets of finite $w$-perimeter, with $F\subseteq E\subseteq \Sigma$ such that $$\label{hp-removal}
0<w(F)<\frac{w(E)}{2}<\infty \quad \mbox{and}\quad \Per_w(F)\leq(1+k(D))\mathcal H_w^{n-1}(\bou E\cap \bou F) \fullstop$$ Then we have:
1. \[it:removal\_volume\] $\displaystyle w(F)\leq \left(\frac{\delta_w(E)}{k(D)}\right)^{\frac{D}{D-1}}w(E)$;
2. \[it:removal\_perimeter\] $\displaystyle \Per_w(E\setminus F)\leq \Per_w(E)$;
3. \[it:removal\_deficit\] If $\delta_w(E)\leq k(D)$, then $\displaystyle\delta_w(E\setminus F)\leq \frac{3}{k(D)}\delta_w(E)$.
Using the second inequality in \[hp-removal\], we have that $$\begin{aligned}
\Per_w(E)
&= \Per_w(E\setminus F)+\Per_w(F)-2\Haus^{n-1}_w(\bou F\cap E^{(1)})\nonumber \\
&=\Per_w(E\setminus F)+\Per_w(F)-2\left(\Per_w(F)-\Haus^{n-1}_w(\bou F\cap \bou E)\right)\nonumber \\
&\geq \Per_w(E\setminus F)+\Per_w(F)-2k(D)\Haus^{n-1}_w(\bou F\cap \bou E)\nonumber \\
&\geq \Per_w(E\setminus F)+\Per_w(F)\left(1-2k(D)\right) \label{1-removal}\\
&\geq D\, w(E\setminus F)^{\frac{D-1}{D}} + \left(1-2k(D)\right) D\, w(F)^{\frac{D-1}{D}}
\comma \label{2-removal}\end{aligned}$$ where in the last estimate we have applied the weighted isoperimetric inequality to the sets $E\setminus F$ and $F$.
We set now $t\defeq w(F)/w(E)$, so that $w(E\setminus F)/w(E)=1-t$ and, by the first assumption in \[hp-removal\] we have $t\leq 1/2$. Dividing by $D\,w(E)^{\frac{D-1}{D}}$ in \[2-removal\], we get $$\delta_w(E)=\frac{\Per_w(E)}{D\,w(E)^{\frac{D-1}{D}}}-1\geq(1-t)^{\frac{D-1}{D}} + \left(1-2k(D)\right) t^{\frac{D-1}{D}} -1.$$ Now we use the definitions of $\Psi$ and $k(D)$ and inequality \[psi\], to deduce $$\label{3-removal}
\delta_w(E)\geq \Psi(t)-2k(D) t^{\frac{D-1}{D}}\geq k(D) t^{\frac{D-1}{D}} =
k(D)\Big(\frac{w(F)}{w(E)}\Big)^{\frac{D-1}{D}}\comma$$ that is equivalent to \[it:removal\_volume\].
The estimate \[it:removal\_perimeter\] follows from \[1-removal\], using that $1-2k(D)\geq 0$.
It remains to show \[it:removal\_deficit\]. First we observe that \[3-removal\] and the assumption $\delta_w(E)\leq k(D)$ imply that $$t\leq \left(\frac{\delta_w(E)}{k(D)}\right)^{\frac{D}{D-1}}\leq \frac{\delta_w(E)}{k(D)}.$$ Therefore we have that $$\begin{split}
\delta_w(E\setminus F)&=\frac{\Per_w(E\setminus F)}{D\, w(E\setminus F)^{\frac{D-1}{D}}}-1
=\frac{\Per_w(E\setminus F)}{D\ (1-t)^{\frac{D-1}{D}}w(E)^{\frac{D-1}{D}}}-1\\
&\leq \frac{\Per_w(E\setminus F)}{D\, w(E)^{\frac{D-1}{D}}}(1+2t)-1
=\delta_w(E)+2t\left(\delta_w(E)+1\right)\leq \frac{3}{k(D)}\delta_w(E) \comma
\end{split}$$ as wanted.
Finally, the following theorem is the analogue of [@FMP Theorem 3.4]. It states that if $E$ has small isoperimetric deficit, then there exists a subset $G$ of $E$ which also has small deficit and, more importantly, such that $\tau(G)-1$ is bounded below away from zero. The idea of the proof consists in cutting away from $E$ the maximal critical set (whose existence is established in \[maximal\]) and using the estimates of \[lem:removal\].
\[thm:nice\_subset\_with\_poincare\] Consider $n,\,\alpha,\,\Sigma,\,w$ satisfying \[eq:assumptions\]. Let $E\subseteq\Sigma$ be a set of finite weighted perimeter and suppose that $\delta_w(E)\leq k^2(D)/8$, with $k(D)$ given by \[kD\].
Then, there exists a set $G\subseteq E$ with finite $w$-perimeter which satisfies the following estimates:
1. \[it:fmp\_volume\] $\displaystyle w(E\setminus G)\leq \frac{\delta_w(E)}{k(D)}w(E)$;
2. \[it:fmp\_deficit\] $\displaystyle \delta_w(G)\leq \frac{3}{k(D)}\delta_w(E)$;
3. \[it:fmp\_poincare\] $\displaystyle \tau(G)\geq 1+k(D)$.
If $\tau(E)\ge 1 + k(D)$, then we can choose $G\defeq E$ and there is nothing to prove. Otherwise, let $F_\infty$ be the maximal critical set given in \[maximal\] with $\lambda=1+k(D)$ (notice that $\Gamma_\lambda\not=\emptyset$ because $\tau(E)<1+k(D)$). We define the set $G$ as $G\defeq E\setminus F_\infty$. Since $F_\infty\in \Gamma_\lambda$, then we can apply \[lem:removal\] to $F=F_\infty$ and we deduce the estimates \[it:fmp\_volume,it:fmp\_deficit\].
It remains to prove \[it:fmp\_poincare\]. In order to do that, we argue by contradiction, that is we assume that $\tau(G)<1+k(D)=\lambda$. By definition of $\tau(G)$ we have that there exists a set $H\subseteq G$ with $0\leq w(H)\leq w(G)/2$ and such that $$\Per_w(H)<\lambda \Haus^{n-1}_w(\bou H\cap \bou G).$$ We aim to show that $F_\infty\cup H\in\Gamma_\lambda$, which gives a contradiction to the maximality of $F_\infty$. Thus, we will have completed the proof once we have checked that $$\label{contra}
0\leq w(F_\infty \cup H)\leq \frac{w(E)}{2} \quad \mbox{and}\quad \Per_w(F_\infty \cup H)\leq \lambda\Haus^{n-1}_w(\bou(F_\infty\cup H)\cap \bou E).$$ Applying \[it:fmp\_deficit\], the first estimate follows from \[lem:removal\]. Indeed applying \[lem:removal\] to $H\subseteq G$, we have that $$w(H) \le
\frac{\delta_w(G)}{k(D)}w(G)\leq 3\frac{\delta_w(E)}{k^2(D)}w(E) \fullstop$$ Moreover, using that $F_\infty$ and $H$ are disjoint and applying \[lem:removal\] to $F_\infty \subseteq E$, we deduce $$\begin{split}
w(F_\infty \cup H) = w(F_\infty)+w(H)\leq \frac{\delta_w(E)}{k(D)}w(E)+3\frac{\delta_w(E)}{k^2(D)}w(E)
\leq 4\frac{\delta_w(E)}{k^2(D)}w(E)\leq \frac{w(E)}{2} \comma
\end{split}$$ where in the last inequality we have used the assumption $\delta_w(E)\leq k^2(D)/8$.
It remains to prove the second estimate of \[contra\]. We start by observing that $$\Per_w(F_\infty \cup H)=\Haus^{n-1}_w(\bou(F_\infty \cup H)\cap E^{(1)})+
\Haus^{n-1}_w(\bou(F_\infty \cup H)\cap \bou E).$$ Since $\lambda=k(D)+1$, in order to conclude we have to show that $$\label{final}
\Haus^{n-1}_w(\bou(F_\infty \cup H)\cap E^{(1)})\leq k(D)
\Haus^{n-1}_w(\bou(F_\infty \cup H)\cap \bou E).$$ First, we write $$\label{6}
\Haus^{n-1}_w(\bou(F_\infty \cup H)\cap E^{(1)})=\Haus^{n-1}_w((\bou F_\infty \setminus \bou H))\cap E^{(1)})+\Haus^{n-1}_w((\bou H\setminus \bou F_\infty)\cap E^{(1)})$$ We now estimate the second term on the right-hand side of \[6\]. Since (up to $\Haus^{n-1}$-negligible sets) it holds $(\bou H\setminus \bou F_\infty)\cap E^{(1)}\subseteq G^{(1)}$, we have $$\label{7}
\begin{split}
\Haus^{n-1}_w((\bou H\setminus \bou F_\infty)\cap E^{(1)})&\leq \Haus^{n-1}_w(\bou H\cap G^{(1)}) \\
&=\Per_w(H)-\Haus^{n-1}_w(\bou H\cap \bou G)\\
&\leq k(D) \Haus^{n-1}_w(\bou H\cap \bou G),
\end{split}$$ where in the last estimate we have used $\Per_w(H)\leq \lambda \Haus^{n-1}_w(\bou H\cap \bou G)$.
Combining together \[6\] and \[7\], and using that $F_\infty \in \Gamma_\lambda$, we deduce that $$\begin{split}
\Haus^{n-1}_w(\bou(F_\infty \cup H)\cap E^{(1)})&\leq \Haus^{n-1}_w((\bou F_\infty \setminus \bou H)\cap E^{(1)})+k(D)\Haus^{n-1}_w(\bou H\cap \bou G)\\
&=\Haus^{n-1}_w((\bou F_\infty \setminus \bou H)\cap E^{(1)})\\
&\hspace{1em}+k(D)\Big[\Haus^{n-1}_w((\bou H\cap \bou G)\cap E^{(1)})
+\Haus^{n-1}_w((\bou H\cap \bou G)\cap \bou E)\Big] \\
&\leq \Haus^{n-1}_w(\bou F_\infty \cap E^{(1)}) + k(D) \Haus^{n-1}_w((\bou H\cap \bou G)\cap \bou E)\\
&\leq k(D) \Big[\Haus^{n-1}_w(\bou F_\infty \cap \bou E) + \Haus^{n-1}_w((\bou H\cap \bou G)\cap \bou E)\Big]\\
&\leq k(D) \Haus^{n-1}_w(\bou (F_\infty \cup H)\cap \bou E) \fullstop
\end{split}$$ We have established \[final\] and therefore the proof is concluded.
\[cor:rel\_isop\_ball\] For any $F\subseteq B_1\cap \Sigma$ such that $w(F)\leq \frac12 w(B_1\cap \Sigma)$, it holds $$w(F)\lesssim \Haus^{n-1}_w(\bou F\cap B_1\cap \Sigma) \,.$$
Since $\delta_w(B_1\cap\Sigma) = 0$, \[thm:nice\_subset\_with\_poincare\] (with $E=G=B_1\cap\Sigma$) tells us that $\tau(B_1\cap\Sigma)\ge 1 + k(D)$. Then, the statement follows from \[eq:rel\_isop\_general\].
Proof of the main result {#sec:main_proof}
========================
We prove three increasingly stronger statements: the characterization of optimal sets, \[prop:uniqueness\], a nonquantitative stability for almost-optimal sets, \[lem:nonquantitative\], and finally the quantitative weighted isoperimetric inequality, \[thm:main\]. We prove them separately because we use the characterization of optimal sets in the proof of the nonquantitative stability and we apply the nonquantitative stability in the proof of the quantitative weighted isoperimetric inequality.
Let $E\subseteq\Sigma$ be an optimal set for the weighted isoperimetric inequality. Without loss of generality we can assume $w(E)=w(B_1\cap\Sigma)=1$. Thanks to \[thm:nice\_subset\_with\_poincare\] and \[lem:trace\_poincare\], we know that $E$ satisfies a weighted Poincaré inequality (since it must hold $G=E$ in the statement of \[thm:nice\_subset\_with\_poincare\] because $\delta_w(E)=0$). Let $\varphi:\R^n\to\R^n$ be the convex map described in \[prop:weighted\_coupling\_properties\] (notice that $E$ is $w$-indecomposable because $\tau(E)>1$). From \[eq:hessian\_control\], it follows that there exists $x_0\in\R^n$ such that $\nabla\varphi(x)-x=-x_0$ for any $x\in E$. Hence, since $\nabla\varphi(E)=B_1\cap\Sigma$, it holds $E = x_0 + B_1\cap\Sigma$. To conclude, notice that $\Per_w(E)=\Per_w(B_1\cap\Sigma)$ implies $x_0+\partial\Sigma\subseteq\partial\Sigma$ and therefore $x_0\in\R^k\times\{0_{\R^{n-k}}\}$.
Using the characterization of optimal sets, we next show the following.
\[lem:nonquantitative\] Consider $n,\,\alpha,\,\Sigma,\,w$ satisfying \[eq:assumptions\] and let $(E_i)_{i\in\N}\subseteq\Sigma$ be a sequence of sets of finite $w$-perimeter such that $E_i\subseteq\Sigma$, $w(E_i)=1$, and $\delta_w(E_i)\to 0$. Then $w(E_i\triangle (B_1(x_i)\cap\Sigma))\to 0$ for an appropriate choice of $x_i\in\R^k\times\{0_{\R^{n-k}}\}$.
We assume that $\Sigma$ contains no lines, that is $k=0$. It is easy to adapt the proof to handle the case $k>0$. We call a *minor perturbation* of the sequence, any replacement of $E_i$ with $E'_i$, with $w(E_i\triangle E'_i)\to 0$ and $\delta_w(E_i')\to 0$. We will not change the naming of the sets when performing minor perturbations.
Applying \[thm:nice\_subset\_with\_poincare\], up to a minor perturbation, we can assume $\tau(E_i) \ge 1 + k(D)$. Hence, thanks to \[lem:trace\_poincare\], the sets $E_i$ enjoy *nontrivial* Poincaré and trace inequalities. Let us denote with $\varphi_i:\R^n\to\R$ the convex function described in \[prop:weighted\_coupling\_properties\] relative to $E_i$ (notice that $E_i$ is $w$-indecomposable because $\tau(E_i)>1$). From the estimate \[eq:hessian\_control\], thanks to the trace and Poincaré inequalities, it follows that there exists a sequence of points $(x_i)_{i\in\N}\subseteq\R^n$ such that $$\begin{aligned}
&\int_{\bou E_i\cap\Sigma} \abs{\nabla\varphi_i - (x-x_i)}\, w(x)\de\Haus^{n-1}(x)
\longrightarrow 0 \quad\text{as $i\to\infty$}\comma \label{eq:main_proof_boundary_nabla_i}\\
&\int_{E_i} \abs{\nabla\varphi_i-(x-x_i)}\, w(x)\de x
\longrightarrow 0 \quad\text{as $i\to\infty$} \label{eq:main_proof_inside_nabla_i}\fullstop\end{aligned}$$ From \[eq:main\_proof\_inside\_nabla\_i\] we deduce $w(E_i\setminus B_2(x_i))\to 0$, and therefore there is $2<r<3$ such that $E_i\to E_i\cap B_r(x_i)$ is a minor perturbation. Hence we can assume $E_i\subseteq B_3(x_i)$. Repeating the argument that led to \[eq:main\_proof\_boundary\_nabla\_i,eq:main\_proof\_inside\_nabla\_i\] for the original $E_i$, we can also assume that \[eq:main\_proof\_boundary\_nabla\_i,eq:main\_proof\_inside\_nabla\_i\] hold.
Since $\nabla\varphi_i(E_i)=B_1\cap\Sigma$ and $\norm{\nabla^2\varphi_i}_{\infty}$ is uniformly bounded, the area formula implies that $\inf_i\abs{E_i} > 0$. Combining \[eq:main\_proof\_boundary\_nabla\_i\] with \[eq:boundary\_control\] we deduce $$\int_{\bou E_i\cap\Sigma}d\big(x-x_i, \partial B_1\cap\Sigma\big)\,w(x)\de\Haus^{n-1}(x) \longrightarrow 0\fullstop$$ Because of the concavity of $w^{\frac1\alpha}$, it holds $\inf_{x\in\Sigma} \frac{w(x)}{d(x,\partial\Sigma)^\alpha}>0$ and therefore the last inequality implies $$\label{eq:main_proof_compactness_boundary}
\int_{\bou (E_i-x_i)}d\big(x, \partial B_1\cap\Sigma\big)\,d(x,\Sigma-x_i)^\alpha\de\Haus^{n-1}(x) \longrightarrow 0\fullstop$$ In the next two paragraphs we will use repeatedly the compactness of sets of finite perimeter with bounded perimeter ([@maggi2012 Theorem 12.26]).
If $\abs{x_i}$ stays bounded, then (up to subsequence) the sequence $E_i$ converges to a set $E_\infty$ with $w(E_{\infty})=1$ and $\delta_w(E_{\infty})=0$. Then, since $B_1\cap\Sigma$ is the unique minimizer of the weighted isoperimetric inequality (see \[prop:uniqueness\]), we deduce $E_\infty = B_1\cap\Sigma$.
On the other hand, let us show that $\abs{x_i}\to\infty$ yields a contradiction. Notice that $\Sigma-x_i$ subconverge (locally) to a convex cone $\Sigma'$ that contains a line (here we use $\abs{x_i}\to\infty$) and such that $\Sigma\subseteq\Sigma'$. Since $\Sigma'$ contains a line, and $\Sigma$ does not, the cone $\Sigma'$ is *strictly* larger than $\Sigma$. Moreover the sets $E_i-x_i$ subconverge, locally in $\Sigma'$, to a nonnegligible set of locally finite[^8] perimeter $E_\infty\subseteq B_3$ with $\abs{E_\infty}>0$. Finally, thanks to the limit \[eq:main\_proof\_compactness\_boundary\], we deduce $$\label{eq:tmp6713}
\bou E_{\infty} \subseteq (\partial B_1\cap\Sigma)\cup \partial\Sigma' \fullstop$$ Since $\R^n\setminus((\partial B_1\cap\Sigma)\cup \partial\Sigma')$ has two unbounded connected components (because $\Sigma'$ is strictly larger than $\Sigma$), it follows from \[eq:tmp6713\] that the set $E_{\infty}$ is either empty or unbounded, thus we have found a contradiction.
We can finally give the:
In this proof we will denote with $C$ any constant that depends on $n,\alpha, \Sigma, w$. The value of the constant can change from line to line.
Without loss of generality, we may assume that $\delta_w(E)$ is small, and that $w(E)=w(B_1\cap\Sigma)=1$. Thanks to \[thm:nice\_subset\_with\_poincare\] we can also assume that the Cheeger constant $\tau(E)$ defined in \[eq:cheeger\_constant\] satisfies $\tau(E)-1\gtrsim 1$ (up to replacing $E$ with the set $G$ described in the statement of \[thm:nice\_subset\_with\_poincare\]). Let $\varphi:\R^n\to\R$ be the convex function associated to $E$ described in \[prop:weighted\_coupling\_properties\] (notice that $E$ is $w$-indecomposable because $\tau(E)>1$).
Applying the trace inequality \[eq:trace\_ineq\] and the Poincaré inequality \[eq:poincare\_ineq\] together with \[eq:hessian\_control\], we deduce $$\begin{aligned}
&\int_{\bou E\cap\Sigma} \abs{\nabla\varphi - (x - x_0)}\,w(x)\de\Haus^{n-1}(x) \lesssim \delta_w(E)^{\frac12}\comma \label{eq:main_proof_boundary_nabla}\\
&\int_{E} \abs{\nabla\varphi - (x-x_0)}\,w(x)\de x \lesssim
\delta_w(E)^{\frac12}\comma \label{eq:main_proof_inside_nabla}\end{aligned}$$ for a suitable $x_0\in\R^n$. Without loss of generality we can assume that $x_0=(0_{\R^k}, \widetilde x_0)$ with $\widetilde x_0\in\R^{n-k}$. Combining \[eq:main\_proof\_boundary\_nabla\] with \[eq:boundary\_control\], it follows $$\label{eq:tmp87123}
\int_{\bou E\cap\Sigma} \abs{\abs{x-x_0}-1}\, w(x) \de\Haus^{n-1}(x) \lesssim \delta_w(E)^{\frac12} \fullstop$$ Since $\delta_w(E)$ is assumed to be small, \[lem:nonquantitative\] implies the validity of the hypotheses needed by \[prop:close\_to\_translated\_ball\]. Hence, recalling \[eq:tmp87123\], we deduce $$\label{eq:close_to_translated_ball}
w\big((B_1(x_0)\cap\Sigma)\triangle E\big) \lesssim \delta_w(E)^{\frac12} \fullstop$$
It remains only to establish that $\abs{x_0}$ is controlled by $\delta_w(E)^{\frac12}$ (as this allows to replace $x_0$ with $0_{\R^n}$ in the last inequality). First, we prove that $\pi_{\mathcal E}(x_0)\lesssim C\delta_w(E)^{\frac12}$ (applying \[prop:magic\_compact\_set\]) and then we conclude that also the component of $x_0$ along $\mathcal C$ is controlled by $\delta_w(E)^{\frac12}$ (applying \[prop:controlling\_constant\_directions\]). Let us recall the notation introduced in \[eq:LCE\]: $\mathcal L$ is the subspace of lines contained in $\Sigma$ (that is $\R^k\times\{0_{\R^{n-k}}\}$), $\mathcal C$ is the subspace orthogonal to $\mathcal L$ such that $w$ is constant moving along $\mathcal C$, $\mathcal E$ is the orthogonal subspace to $\mathcal L\times\mathcal C$.
Notice that \[eq:close\_to\_translated\_ball\] implies $$\label{eq:contains_smaller_ball}
w\big((B_{\frac12}\cap\Sigma)\setminus E\big) \lesssim \delta_w(E)^{\frac12} \fullstop$$ Let $\hat\eps, \hat Q$ be the small value and the compact set described in the statement of \[prop:magic\_compact\_set\]. Thanks to \[eq:weight\_control\], we know $$\label{eq:tmp117}
\int_{\hat Q\cap E} \abs{w^{\frac1\alpha}(\nabla\varphi)-w^{\frac1\alpha}(x)} \de x \le C\delta_w(E)^{\frac12}\fullstop$$ To proceed let us assume that $\abs{x_0}<\hat\eps$ (notice that $\hat\eps$ does not depend on $E$). Recall that, thanks to \[lem:nonquantitative\], we can assume that $\abs{x_0}$ is arbitrarily small (and our goal is to show that it is controlled by $\delta_w(E)^{\frac12}$). For any $x\in \hat Q$ and any $y\in B_1\cap\Sigma$, it holds $$\abs{w^{\frac1\alpha}(x-x_0)-w^{\frac1\alpha}(y)} \le C \abs{y-(x-x_0)} \comma$$ where $C$ is a constant that depends on the Lipschitz constant of $w^{\frac1\alpha}$ in an $\hat\eps$-neighborhood of $\hat Q$ and on $\hat\eps$ itself. Therefore it holds $$\label{eq:tmp432}
\int_{\hat Q\cap E}\abs{w^{\frac1\alpha}(\nabla\varphi)-w^{\frac1\alpha}(x-x_0)}w(x)\de x
\le C\int_{\hat Q\cap E}\abs{\nabla\varphi - (x-x_0)}w(x) \de x
\lesssim C \delta_w(E)^{\frac12} \comma$$ where in the second step we used \[eq:main\_proof\_inside\_nabla\].
Since $w\ge C$ on $\hat Q$, the inequalities \[eq:tmp432,eq:tmp117\] imply $$\label{eq:tmp581}
\int_{\hat Q\cap E} \abs{w^{\frac1\alpha}(x)-w^{\frac1\alpha}(x-x_0)} \de x
\le C\delta_w(E)^{\frac12} \fullstop$$ Finally, notice that thanks to \[eq:contains\_smaller\_ball\] and $\hat Q\subseteq B_{\frac12}$, we can replace $\hat Q\cap E$ with $\hat Q$ in \[eq:tmp581\].
Hence we can apply \[prop:magic\_compact\_set\] and deduce the fundamental bound $$\abs{\pi_{\mathcal E}(x_0)} \le C\delta_w(E)^{\frac12} \comma$$ where $\mathcal E$ is the subspace of directions orthogonal to the constancy directions of $w$.
Thanks to the latter control on $\pi_{\mathcal E}(x_0)$, changing slightly the value of $x_0$, we can assume that $x_0\in\mathcal C$.
Applying \[prop:controlling\_constant\_directions\] with $\xi=x_0$, we know that either \[prop:controlling\_constant\_directions\]-\[it:linear\_growth\_ball\] or \[prop:controlling\_constant\_directions\]-\[it:good\_slicing\] holds. If \[prop:controlling\_constant\_directions\]-\[it:linear\_growth\_ball\] holds, since $w(B_1\cap\Sigma) = w(E)$, then \[eq:close\_to\_translated\_ball\] implies $\abs{x_0} \lesssim C \delta_w(E)^{\frac12}$, that is exactly the desired estimate. Let us assume that \[prop:controlling\_constant\_directions\]-\[it:good\_slicing\] holds. For the ease of the reader, let us state again \[eq:hessian\_control\] and \[eq:main\_proof\_inside\_nabla\]: $$\begin{aligned}
&\int_E \abs{\nabla^2\varphi-\id}w \lesssim \delta_w(E)^{\frac12} \comma \\
&\int_E \abs{\nabla\varphi-(x-x_0)}w(x)\de x \lesssim \delta_w(E)^{\frac12} \fullstop\end{aligned}$$ From \[eq:contains\_smaller\_ball\] and \[prop:controlling\_constant\_directions\] \[it:good\_slicing\]-\[it:locb\] and \[it:good\_slicing\]-\[it:locf\], we deduce $$\begin{aligned}
&\int_S \de\Haus^{n-1}(s) \int_{\Sigma_s} \abs{\nabla^2\varphi-\id}\de\Haus^1
\le C\delta_w(E)^{\frac12} \comma \\
&\int_S \de\Haus^{n-1}(s) \int_{\Sigma_s} \abs{\nabla\varphi - (x-x_0)}\de\Haus^1(x)
\le C\delta_w(E)^{\frac12} \fullstop\end{aligned}$$ Thanks to \[it:good\_slicing\]-\[it:locc\], there exists $\overline s\in S$ such that $$\begin{aligned}
&\int_{\Sigma_{\overline s}} \abs{\nabla^2\varphi-\id}\de\Haus^1
\le C\delta_w(E)^{\frac12} \comma \\
&\int_{\Sigma_{\overline s}} \abs{\nabla\varphi - (x-x_0)}\de\Haus^1(x)
\le C\delta_w(E)^{\frac12} \fullstop\end{aligned}$$ From the latter two inequalities, together with \[it:good\_slicing\]-\[it:loca\], it follows that (here it is crucial that $\Sigma_{\overline s}$ is $1$-dimensional) $$\norm{\nabla\varphi - (x-x_0)}_{L^{\infty}(\Sigma_{\overline s})}
\le C \delta_w(E)^{\frac12} \fullstop$$ In particular, denoting $z\defeq \overline s + t_0(\overline s)\frac{x_0}{\abs{x_0}}$, it holds $$\abs{\nabla\varphi(z) - (z-x_0)} \le C \delta_w(E)^{\frac12} \fullstop$$ On the other hand, \[it:good\_slicing\]-\[it:locd\] implies $$\abs{\nabla\varphi(z) - (z-x_0)} \ge
d\Big(\Sigma, \overline s + (t_0-\abs{x_0})\frac{x_0}{\abs{x_0}}\Big)
\ge C \abs{x_0} \fullstop$$ The last two estimates together conclude the proof.
\[rem:sharpness\_exponent\] The statement of \[thm:main\] is sharp with respect to the exponent, i.e., the exponent $\frac12$ present in the right-hand side of \[eq:quant-ineq\] cannot be increased. Let us prove it when $\Sigma$ does not contain lines; the method can be easily adapted to handle the general case.
Given a smooth positive function $r:\partial B_1\cap\Sigma\to\oo0\infty$, let $$E_{(r)}\defeq \big\{t\theta:\ \theta\in \partial B_1\cap\Sigma,\ 0<t<r(\theta)\big\} \fullstop$$ With some standard computations (see also \[lem:easy\_polar\_formulas\]) we obtain $$\begin{aligned}
w(E_{(r)})
&= \frac1D\int_{\partial B_1\cap\Sigma}r(\theta)^D\,w(\theta)\de\Haus^{n-1}(\theta) \comma \\
\Per_w(E_{(r)})
&= \int_{\partial B_1\cap\Sigma} r(\theta)^{D-1}\sqrt{1+\frac{\abs{\nabla r}^2}{r^2}}\,w(\theta)\de\Haus^{n-1}(\theta) \fullstop
\end{aligned}$$ Fix a smooth function $\eta:\partial B_1\cap\Sigma\to\R$ and, for any $\eps>0$, define $E_\eps\defeq E_{(1+\eps\eta)}$. If $\int_{\partial B_1\cap\Sigma} \eta\,w\de\Haus^{n-1}=0$, then the previous formulas imply $$\begin{aligned}
w(E_\eps) &= w(B_1\cap\Sigma) + \bigo(\eps^2) \comma \\
\Per_w(E_\eps) &= \Per_w(B_1\cap\Sigma) + \bigo(\eps^2) \fullstop
\end{aligned}$$ Since it holds $A_w(E_\eps)\ge C(\Sigma, w, \eta)\eps$ (with $C>0$ provided $\eta\not\equiv 0$), the family $(E_\eps)_{\eps>0}$ shows the sharpness of the exponent $\frac12$.
Quantitative weighted mean inequality
=====================================
The aim of this appendix is to show the following.
\[lem:quantitative\_amgm\] Let $(\lambda_i)_{i=1,\dots, m}$ be positive real numbers with $s\defeq \lambda_1+\cdots+\lambda_m\ge 1$ and let $(x_i)_{i=1,\dots,m}$ be nonnegative real numbers. If $\sum \lambda_i x_i \le c s$ for some $c>0$, then it holds $$\sum_{i=1}^m \lambda_i (x_i-c)^2 \le \frac83\frac{c^{2-s}s^3}{\min\limits_{i=1,\dots,m}\lambda_i^2}\left(c^s-x_1^{\lambda_1}\cdots x_m^{\lambda_m}\right) \fullstop$$
We follow the proof of [@FMP Lemma 2.5]. Without loss of generality we can assume that $c=1$. For any $t>0$ it holds $$\log(t) \le t - 1 - \frac{(t-1)^2}{2\max(1, t)^2} \fullstop$$ Notice that $\max(1, x_i) \le s\lambda^{-1}$, where $\lambda$ is the minimum among $\lambda_1,\dots,\lambda_m$. Therefore it holds $$\begin{aligned}
\begin{split}\label{eq:local_am_gm}
\log\left(x_1^{\lambda_1}\cdots x_m^{\lambda_m}\right) =
\sum_{i=1}^m \lambda_i \log(x_i)
\le
\sum_{i=1}^m \lambda_i\Big(x_i-1-\frac{\lambda^2(x_i-1)^2}{2s^2}\Big)
\le
- \frac{\lambda^2}{2s^2} \sum_{i=1}^m \lambda_i (x_i-1)^2 \fullstop
\end{split}\end{aligned}$$ Since $s\ge 1$, for any $0\le t \le \frac12$ we have $e^{-st}\le e^{-t}\le 1-\frac34 t$. Moreover, the right-hand side of \[eq:local\_am\_gm\] has absolute value below $\frac s2$, thus taking the exponential of both sides we deduce $$x_1^{\lambda_1}\cdots x_m^{\lambda_m} \le 1-\frac{3\lambda^2}{8s^3}\sum_{i=1}^m\lambda_i(x_i-1)^2 \comma$$ that is exactly the desired estimate.
Concave 1-homogeneous functions
===============================
In this appendix we collect some basic facts about concave $1$-homogeneous functions on a cone, as well as a couple of approximation results.
\[rem:concave\_hom\] Let $\Sigma\subseteq\R^n$ be a convex cone. Then:
- If $u, v:\Sigma\to\R$ are $1$-homogeneous concave functions, then so is $\min(u, v)$.
- If $T:\R^n\to\R^n$ is a linear isometry and $u:\Sigma\to\R$ is $1$-homogeneous and concave, then so is $u\circ T:T^{-1}(\Sigma)\to\R$.
- A function $u:\Sigma\to\R$ is $1$-homogeneous and concave if and only if for every $x\in\Sigma$ there is $\xi_x\in\R^n$ such that $u(x) = \xi_x\cdot x$ and for any $y\in\R^n$ it holds $u(y)\le \xi_x\cdot y$.
We first prove the following.
\[lem:smoothing\_weight\] Let $\Sigma', \Sigma\subseteq\R^n$ be two open convex cones such that $\Sigma'\cap \partial B_1 \compactsubset \Sigma\cap\partial B_1$. For any concave $1$-homogeneous function $v:\Sigma\to\R$ and any $\eps>0$, there is a concave $1$-homogeneous function $\widetilde v:\Sigma\to\R$ such that $\widetilde v\ge v$ in $\Sigma$, $\widetilde v = v$ on $\partial\Sigma$, $\norm{\widetilde v-v}_{L^\infty(\partial B_1\cap\Sigma')} < \eps$, and $\widetilde v$ is smooth in $\Sigma'$.
Fix an open convex cone $\Sigma''\subseteq\R^n$ such that $\Sigma'\cap\partial B_1 \compactsubset \Sigma''\cap\partial B_1 \compactsubset \Sigma\cap\partial B_1$. During the proof we will require some further properties on the cone $\Sigma''$.
To regularize a concave $1$-homogeneous function we exploit the convolution with respect to the Haar measure (see [@Federer69 2.7]) on $SO(n)$. Let $\mu\in\prob(SO(n))$ be the Haar measure and let $\rho:SO(n)\to\R$ be a smooth kernel, that is $\int \rho\de\mu = 1$, $\rho\ge 0$ and $\rho$ is supported in a small neighborhood of the identity. Let us define $$v''(x) \defeq \int_{SO(n)} v(T(x)) \rho(T) \de\mu(T) \fullstop$$ If $\rho$ is supported in a sufficiently small region, then $v''$ is well-defined in $\Sigma''$ and smooth in it. Moreover it is concave and $1$-homogeneous thanks to \[rem:concave\_hom\]. Choosing appropriately the kernel $\rho$, it is also true that $\norm{v''-v}_{L^\infty(\partial B_1\cap\Sigma'')} < \eps/8$.
As observed in \[rem:concave\_hom\], for any $x\in\Sigma''$ there is $\xi_x\in\R^n$ such that $v''(x) = \xi_x\cdot x$ and $v''(y)\le \xi_x\cdot y$ for any $y\in\Sigma''$. Let us define $$v'(y) = \min_{x\in\partial B_1\cap\Sigma'} \xi_x\cdot y \fullstop$$ It holds $v'=v''$ in $\Sigma'$ and clearly $v'$ is concave and $1$-homogeneous in $\Sigma$ (but could, a priori, take the value $-\infty$). Let us show that $v'$ is *almost* above $v$ in $\Sigma$. It holds $v'\ge v''$ in $\Sigma''$ and $v''(x)\ge v(x)-\frac{\eps}2\abs{x}$ for any $x\in\Sigma''$, thus $v'(x)\ge v(x) - \frac{\eps}2\abs{x}$ in $\Sigma''$. Fix $x\in\partial B_1\cap\Sigma'$ and $z\in\Sigma\setminus\Sigma''$ with $\abs{z}=1$. Up to choosing $\Sigma''$ appropriately, we can assume that there is $0<\lambda<\frac12$ such that $y\defeq \lambda x + (1-\lambda) z\in\Sigma''$. From the properties of $\xi_x$ and the concavity of $v$, it follows $$\begin{aligned}
v(z) &\le \frac{v(y)-\lambda v(x)}{1-\lambda} \le \frac{v''(y) + \frac{\eps}8\abs{y}-\lambda v''(x) + \lambda\frac{\eps}8\abs{x}}{1-\lambda} \le
\frac{\xi_x\cdot y + \frac{\eps}8\abs{y} -\lambda\xi_x\cdot x + \lambda\frac{\eps}8\abs{x}}{1-\lambda} \\
&=
\xi_x\cdot z + \frac{\eps}8 \frac{\abs{y} + \lambda\abs{x}}{1-\lambda}
\le \xi_x\cdot z + \frac{\eps}2 \fullstop
\end{aligned}$$ Hence, by definition of $v'$, it holds $v(z)\le v'(z) + \frac{\eps}2\abs{z}$ for any $z\in \Sigma\setminus\Sigma''$ and, since we have already established the same inequality in $\Sigma''$, we deduce $v(x)\le v'(x) + \frac{\eps}2\abs{x}$ for any $x\in\Sigma$.
The function $x\mapsto v'(x) + \frac{\eps}2\abs{x}$ satisfies all the requirements of the statement apart from $\widetilde v = v$ on $\partial\Sigma$. To conclude let $\widetilde v:\Sigma\to\R$ be the minimum of all $1$-homogeneous and concave functions $h:\Sigma\to\R$ such that $h\ge v$ in $\Sigma$ and $h\ge v'(x) + \frac{\eps}2\abs{x}$ in $\Sigma'$. With this final step we obtain $\widetilde v = v$ on $\partial\Sigma$ and we do not lose any of the other properties.
We will also need the following.
\[lem:weight\_approximation\_zero\_trace\] Let $\Sigma', \Sigma\subseteq\R^n$ be two convex cones such that $\Sigma'\cap \partial B_1 \compactsubset \Sigma\cap\partial B_1$. For any nonnegative concave $1$-homogeneous function $v:\Sigma\to\co0\infty$ and any $\eps>0$, there is a concave $1$-homogeneous function $\widetilde v:\Sigma\to\R$ such that $\widetilde v = 0$ on $\partial\Sigma$ and $\widetilde v = v$ in $\Sigma'$.
Let $\widetilde v:\Sigma\to\co0\infty$ be the infimum of all the concave $1$-homogeneous functions $h:\Sigma\to\R$ such that $h\ge 0$ in $\Sigma$ and $h\ge \widetilde v$ in $\Sigma'$. Thanks to the observation of \[rem:concave\_hom\], the function $\widetilde v$ is concave and $1$-homogeneous. It is straightforward to check that $\widetilde v = v$ in $\Sigma'$ and $\widetilde v = 0$ on the boundary of $\Sigma$.
For completeness, let us conclude observing that a $1$-homogeneous function $v$ is concave if and only if its restriction on the sphere is *pseudo-concave* (either in the pointwise or differential sense).
Let $\Sigma\subseteq\R^n$ be a convex cone and let $v:\Sigma\to\R$ be a $1$-homogeneous function. The following statements are equivalent.
1. \[it:appb\_concavity\] The function $v$ is concave.
2. \[it:appb\_pointwise\_inequality\] For any unit-speed geodesic on the sphere $\gamma:\cc{-s}{t}\to\partial B_1\cap\Sigma$ (with $s,t\ge 0$), it holds $$v(\gamma(0)) \ge \frac{\sin(t)}{\sin(s+t)}v(\gamma(-s)) + \frac{\sin(s)}{\sin(s+t)}v(\gamma(t)) \fullstop$$
3. \[it:appb\_differential\_inequality\] The function $v$ is twice-differentiable almost everywhere and, for any unit-speed geodesic on the sphere $\gamma:\oo{-\eps}{\eps}\to\partial B_1\cap\Sigma$, if $v$ is twice differentiable at $\gamma(0)$ then it holds $$\frac{\de^2}{\de t^2}v(\gamma(0)) + v(\gamma(0)) \le 0 \fullstop$$
Since we do not use this result and the proof is standard, we give only a sketch of the proof.
The statements \[it:appb\_concavity\] and \[it:appb\_differential\_inequality\] are equivalent because of the following identity $$\frac{\de^2}{\de t^2}v(\gamma(t)) = \nabla^2 v(\gamma)[\dot\gamma,\dot\gamma] + \nabla v(\gamma)\cdot\ddot\gamma =
\nabla^2 v(\gamma)[\dot\gamma,\dot\gamma] - v(\gamma) \comma$$ where in the last step we used that $v$ is $1$-homogeneous.
If $v_1$ and $v_2$ satisfy \[it:appb\_pointwise\_inequality\], then also $\min(v_1, v_2)$ does. Therefore, since linear functions satisfy \[it:appb\_pointwise\_inequality\] (with equality), any $1$-homogeneous concave function satisfies \[it:appb\_pointwise\_inequality\]. It remains only to prove that \[it:appb\_pointwise\_inequality\] implies \[it:appb\_concavity\]. Given two points $p,q\in\Sigma$, let $L:\R^n\to\R$ be a linear map such that $L(p)=v(p)$ and $L(q)=v(q)$. Given that $L$ satisfies the equality in \[it:appb\_pointwise\_inequality\], for any $\lambda,\mu\ge 0$ with $\lambda+\mu=1$, it holds $$\frac{v(\lambda p +\mu q)}{\abs{\lambda p + \mu q}}
=
v\Big(\frac{\lambda p +\mu q}{\abs{\lambda p + \mu q}}\Big)
\ge
L\Big(\frac{\lambda p +\mu q}{\abs{\lambda p + \mu q}}\Big)
=
\frac{\lambda v(p) +\mu v(q)}{\abs{\lambda p + \mu q}}$$ which is the sought concavity of $v$.
Indecomposable sets in the plane are approximated by connected sets
===================================================================
In this appendix we show that, in $\R^2$, an *indecomposable* set of finite perimeter can be approximated by *connected* smooth open sets (we prove an analogous result also in the weighted setting). Notice that, in higher dimension, any set of finite perimeter can be approximated by smooth connected open sets, while in $\R^2$ this is false. As a fundamental technical tool, we exploit the theory devised in [@ACMM2001]; the interested reader shall refer to that paper for a thorough study of indecomposable sets of finite perimeter.
\[def:indecomposable\] A set of finite perimeter $E\subseteq \R^2$ is indecomposable if it cannot be written as $E=E_1\cup E_2$ with $E_1, E_2$ disjoint nonneglegibile sets of finite perimeter such that $\Per(E) = \Per(E_1)+\Per(E_2)$.
\[prop:indecomposable\] Let $E\subseteq\R^2$ be an indecomposable set of finite perimeter with $\abs{E}<\infty$. Then, there is a sequence $(\Omega_i)_{i\in\N}$ of bounded connected open sets with smooth boundary such that $\abs{\Omega_i\triangle E}\to 0$ and $\Per(\Omega_i)\to\Per(E)$ as $i\to\infty$.
Given a Jordan curve $\gamma:\S^1\to\R^2$, we denote with $\inside(\gamma)$ the bounded connected component of $\R^2\setminus\gamma$.
Thanks to [@ACMM2001 Corollary 1], there are $\gamma, (\gamma_i)_{i\in I}$ Jordan curves (with $I$ at most countable) such that (up to negligible sets) $$E = \inside(\gamma)\setminus \bigcup_{i\in I} \overline{\inside(\gamma_i)} \,,$$ and $\Per(E) = \Haus^1(\gamma) + \sum_{i\in I} \Haus^1(\gamma_i)$. Moreover $\inside(\gamma_i)\subseteq \inside(\gamma)$ for any $i\in I$ and $\inside(\gamma_i)\cap\inside(\gamma_j)=\emptyset$ for any $i\not= j$.
Thus, for any $\eps>0$, we can find a *finite* subset $I'\subseteq I$ such that $\abs{E'\triangle E} < \eps$ and $\abs{\Per(E')-\Per(E)} < \eps$, where $$E' \defeq \inside(\gamma)\setminus \bigcup_{i\in I'} \overline{\inside(\gamma_i)} \,.$$ Notice that $E'$ is an open connected set of finite perimeter (the connectedness follows from the indecomposability of $E$). Since $\eps>0$ can be chosen arbitrarily, we can directly assume that $E$ is open and connected.
Let us now prove the statement for a connected open set $E$ with finite perimeter. For any $k\in\N$, consider the sequence of open sets $(E_k)_{k\in\N}\subseteq\R^n$ defined as $$E_k\defeq \big\{x\in E:\ d(x, E^\complement) > \frac1k\big\} \,.$$ Let $\widetilde E_k$ be the connected component of $E_k$ with the largest measure. Since $E$ is open and $(E_k)_{k\in\N}$ is an increasing chain, it is not hard to check that $\abs{\widetilde E_k\triangle E}\to 0$ as $k\to\infty$. Now, let $(\Omega_i)_{i\in\N}$ be a sequence of smooth open sets obtained taking a superlevel set of a convolution of $\chi_E$, more precisely $$\Omega_i \defeq \Big\{x\in\R^2: \chi_E\ast \big(i^2\eta(i\emptyparam)\big)(x) > t_i\Big\}\,,$$ where $\eta:\R^2\to[0, 1]$ is a smooth kernel ($\int\eta=1$) and $(t_i)_{i\in\N}$ is a sequence of values $0 < t_i < 1$ such that the resulting $\Omega_i$ are smooth and $\abs{\Omega_i\triangle E}\to 0$ and $\Per(\Omega_i)\to\Per(E)$. This approximation with smooth open sets is very standard, see [@maggi2012 Theorem 13.8 ] for the details.
Given $k\in\N$, it follows from the definition of $\Omega_i$ that, for any sufficiently large $i\in\N$, it holds $E_k\subseteq\Omega_i$. Choose an increasing sequence of indices $(i_k)_{k\in\N}$ such that $E_k\subseteq\Omega_{i_k}$ and let $\widetilde\Omega_{i_k}$ be the connected component of $\Omega_{i_k}$ that contains $\widetilde E_k$. Notice that, for any $k\in\N$, it holds $$\widetilde E_k \subseteq \widetilde\Omega_{i_k} \subseteq \Omega_{i_k} \,,$$ hence, since $\abs{\widetilde E_k\triangle E}\to 0$ and $\abs{\Omega_{i_k}\triangle E}\to 0$, we have $\abs{\widetilde \Omega_{i_k}\triangle E}\to 0$. Moreover $\Per(\widetilde\Omega_{i_k})\le\Per(\Omega_{i_k})\to\Per(E)$, hence the sequence $(
\widetilde\Omega_{i_k})_{k\in\N}$ satisfies all the requirements of the statement.
Let us now give the definition of indecomposable set in the weighted setting and prove a proposition analogous to the latter one.
\[def:w\_indecomposable\] Let $\Sigma\subseteq\R^2$ and $w:\Sigma\to[0,\infty)$ be as in \[eq:assumptions\]. A set of finite $w$-perimeter $E\subseteq \Sigma$ is $w$-indecomposable if it cannot be written as $E=E_1\cup E_2$ with $E_1, E_2$ disjoint nonneglegibile sets of finite $w$-perimeter such that $\Per_w(E) = \Per_w(E_1)+\Per_w(E_2)$.
For a set $E\subseteq\Sigma$ such that $\max(\abs{E}, w(E), \Per(E), \Per_w(E))<\infty$, being indecomposable is equivalent to being $w$-indecomposable.
\[prop:w\_indecomposable\] Let $\Sigma\subseteq\R^2$ and $w:\Sigma\to[0,\infty)$ be as in \[eq:assumptions\], with the additional assumption $w\equiv 0$ on $\partial\Sigma$, and let $E\subseteq\Sigma$ be a $w$-indecomposable set of finite $w$-perimeter with $w(E)<\infty$. Then, there is a sequence $(\Omega_i)_{i\in\N}$ of bounded connected open sets with smooth boundary such that $\Omega_i\compactsubset\Sigma$ and $w(\Omega_i\setminus E)\to 0$ and $\Per_w(\Omega_i)\to\Per_w(E)$ as $i\to\infty$.
As a first step, we prove that $E$ can be approximated by a sequence $(F_k)_{k\in\N}\subseteq\Sigma$ of sets of finite $w$-perimeter such that $F_k\compactsubset\Sigma$. Since the proof is standard and technical we will skip some details.
We can find a sequence of radii $r_k\to\infty$ such that $E_k\defeq E\cap B_{r_k}$ is a set of finite $w$-perimeter and $\Per_w(E_k)\to\Per_w(E)$ as $k\to\infty$. Thanks to [@ACMM2001 Theorem 1] (adapting their arguments to our setting is straightforward), we can define $\widetilde E_k$ as the largest $w$-indecomposable component of $E_k$ (i.e., $w(\widetilde E_k)\ge w(C)$ for any $w$-indecomposable component of $E_k$). Since $E_k\nearrow E$ and $E$ is indecomposable, it follows that $w(\widetilde E_k\triangle E)\to 0$ and $\Per_w(\widetilde E_k)\to\Per_w(E)$ as $k\to\infty$. Now, fix a vector $v\in\Sigma$ and define $F_k\defeq \eps_k v + \widetilde E_k$, where $\eps_k>0$ is such that $w(F_k\triangle \widetilde E_k)\to 0$ and $\abs{\Per_w(F_k)-\Per_w(\widetilde E_k)}\to 0$ as $k\to\infty$ (here we need the assumption $w\equiv 0$ on $\partial\Sigma$). The sets of finite $w$-perimeter $F_k$ are compactly contained in $\Sigma$ and satisfy $w(F_k\triangle E)\to 0$ and $\Per_w(F_k)\to\Per_w(E)$ as $k\to\infty$.
Taking into account the approximation result we have just shown, we can assume, without loss of generality, that $E\compactsubset\Sigma$. To conclude, it is sufficient to repeat the proof of \[prop:indecomposable\] (notice that the weight is bounded away from $0$ and $\infty$ in an open set $A$ such that $E\compactsubset A\compactsubset \Sigma$).
[^1]: This assumption is always satisfied up to a rotation.
[^2]: Later on, we will not consider the cone $\Sigma$ and the weight $w$ as fixed and so a constant that depends on them will not be absorbed by $\lesssim$ (see \[sec:notation\]).
[^3]: The author proves a sharp isoperimetric inequality for minimal surfaces (up to codimension $2$) embedded in the Euclidean space. We believe that our methods might be applied to show a quantitative version of Brendle’s result.
[^4]: It is sufficient to repeat the sketch, ignoring the weight and the cone, until \[eq:intro\_tmp432\]. Alternatively, see \[thm:anisotropic\_coupling\].
[^5]: The distributional gradient of a function of bounded variation is usually denoted with $D f$, and $\nabla f$ is used to identify the absolutely continuous part of $D f$. We use the notation $\diff f$ for the distributional gradient to avoid confusion, indeed the letter $D$ is the *effective dimension* $D=n+\alpha$.
[^6]: Recall that Carathéodory’s theorem [@Caratheodory] states that if a point $x_\circ\in \R^n$ lies in the convex hull of a set $S$, then $x_\circ$ can be written as the convex combination of at most $n+1$ points in $S$.
[^7]: The constant $c$, as it is clear from the proof, can be chosen to be the *median* value of $f$.
[^8]: Here *locally finite* has to be understood in the sense of $\Sigma'$, that is for any $\Omega\compactsubset\Sigma'$ it holds $\Per(E,\Omega)<\infty$.
| 2024-02-13T01:26:59.872264 | https://example.com/article/6073 |
• Swansea say Paul Clement’s replacement will not join before weekend • Long-serving midfielder Britton joined club’s coaching staff last month Swansea City have said Leon Britton will take caretaker charge of Saturday’s game at home to Crystal Palace as they continue their search for a manager t...
Arsenal have bigger fish to fry and the evidence was provided by Arsène Wenger’s decision to give the night off to every member of his starting line-up from Saturday’s Premier League win over Newcastle United. The visit of Liverpool on Friday looms large. But once the whistle had gone on this Car...
• Argentinian won penalty in 3-0 victory over Stoke on Saturday • Moyes unsure whether West Ham will appeal charge West Ham manager David Moyes is surprised by the Football Association’s decision to charge Manuel Lanzini for diving. But Moyes admits West Ham are yet to decide if they will appeal...
Rafael Benítez and Chris Hughton need to turn their ailing teams around but David Moyes can take credit for what he has done with Marko Arnautovic Related: The Dozen: the weekend’s best Premier League photos Related: Tottenham are the latest challengers floored by the Manchester City problem | Jo...
• Miserable 3-0 home defeat to West Ham is Stoke’s fifth loss in six games • ‘I don’t want to be in a relegation battle; we need to do something about it’ An under-fire Mark Hughes insisted he is the man to turn Stoke City’s fortunes around after a chastening 3-0 home defeat by West Ham, their fi...
Marko Arnautovic loped from the pitch with a flea in his ear from Mark Hughes and a piece of Stoke City clothing, hurled from the stands, in his hand. The latter was quickly discarded; Hughes must now be close to a similar fate after his former charge heaped on the embarrassment in a match delaye...
The league’s most porous defences meet but, as if by magic, West Ham United’s has dramatically improved of late. They have kept two successive clean sheets since Joe Hart vanished from the goal. David Moyes will be delighted those blanks took four points from meetings with Chelsea and Arsenal but...
Will there be goals galore again at the Etihad, could West Ham finish off Hughes and is Jack Wilshere the man to bring some beauty back into Arsenal’s play? Since 2010-11, when the two games between these sides featured one goal between them, this has not been a fixture for goalkeepers. In 12 mee... | 2023-08-25T01:26:59.872264 | https://example.com/article/3227 |
From latino.foxnews.com: With a number of prominent conservative politicians raising fears that the Ebola outbreak could spread to the U.S. via the country’s porous borders with Mexico and Canada, Customs… | 2024-03-09T01:26:59.872264 | https://example.com/article/1094 |
Pentabromobenzylester monoacrylate, hereinafter called PBB-MA for the sake of brevity, is the monomer from which poly(pentabromobenzylester acrylate) (PBB-PA) is prepared. PBB-PA is known in the art to possess flame retardant properties and is known to render otherwise flammable synthetic resins flame-resistant. The process for the preparation of PBB-PA according to the known art is disclosed, e.g., in DE 25 27 802, and presents several serious drawbacks. First of all, the reaction is carried out in solution in an organic solvent, which is expensive and requires relatively large reaction volumes, and further, the reaction times required are relatively long, being in the order of a number of hours. Futhermore, the normally employed solvent, methyl ethyl ketone, is a relatively hazardous material, and the process involves the handling of hazardous wastes.
Another drawback of conventional processes lies in the limitation of the reactor size, because of the danger of uncontrolled mass-polymerization. These processes further require heavy investments in equipment, to allow for elevated operation pressure and tight conditions. Moreover, reactor's walls fauling (encrustation), lump formation and agitator's blocking also represent serious problems. | 2024-05-02T01:26:59.872264 | https://example.com/article/6650 |
What Js13kGames is a month-long JavaScript coding competition for HTML5 Game Developers organized by @end3r. The fun part of the competition is that the file size limit is set to 13 kilobytes! Developers of all skill levels welcome! When August 13, 2019 13:00 CEST - September 13, 2019 13:00 CEST Where Online More Information For more information plus some great resources to help get you started, check out http://js13kgames.com.
... View more
js13kGames logo What: Js13kGames is a month-long JavaScript coding competition for HTML5 Game Developers organized by @end3r. The fun part of the competition is that the file size limit is set to 13 kilobytes! Developers of all skill levels welcome! When: August 13, 2018 13:00 CEST - September 13, 2018 13:00 CEST Where: Online More Information: For more information plus some great resources to help get you started, check out http://js13kgames.com/.
... View more | 2024-05-28T01:26:59.872264 | https://example.com/article/9055 |
Protecting Hawai’i’s environment and cultural resources
• Developed the Governor’s Sustainable Hawai’i Initiative – I believe it is our responsibility, our kuleana, to preserve our land for the next generation. That’s why we’ve developed this initiative, which sets goals to protect our watersheds and ocean waters, double our local food production, control invasive species and develop a clean energy future. The Ige administration has protected over 40,000 acres of watershed forests on Kaua‘i, O‘ahu, Moloka‘i and Hawai‘i islands and helped preserve lands at Turtle Bay.
•Stewarding Natural Resources Mauka to Makai – The Department of Land and Natural Resources (DLNR) and the Department of Agriculture worked closely with public and private partners to contain the spread of Rapid ʻŌhiʻa Death on Hawai‘i Island, protect forested watersheds and manage nearshore waters. DLNR also produced the first guide for a streamlined permitting process to restore and maintain Hawaiian fishponds.
• Emphasizing public access to state parks – DLNR provided significant improvements and clean-up for Makapu‘u Lighthouse and Kalalau Valley to ensure all people can enjoy these areas safely. At Kalalau, tons of rubbish is airlifted out of the area on a monthly basis and long-term illegal campsites are being dismantled.
• Papahānaumokuākea Marine National Monument expanded – Last fall, President Barack Obama created the world’s largest marine sanctuary in the Northwestern Hawaiian Islands — preserving fish, wildlife and cultural resources for generations to come. The Ige administration also initiated the request to make the Office of Hawaiian Affairs a co-trustee — a designation OHA had sought for years. | 2024-02-02T01:26:59.872264 | https://example.com/article/1368 |
1. Introduction {#sec1-plants-09-00760}
===============
*Xylella fastidiosa* is a plant pathogenic bacterium that causes damage to many crops, mainly in North, Central and South America. Recently, this quarantine phytopathogen has enlarged its distribution by reaching several European countries and infecting both cultivated and wild plants \[[@B1-plants-09-00760]\]. *X. f.* subsp. *pauca* is responsible for the "olive quick decline syndrome" (OQDS) in the Salento area (Apulia region, southern Italy) \[[@B2-plants-09-00760]\]. Currently, it is estimated that about 6,500,000 trees are infected by this bacterium \[[@B3-plants-09-00760]\]. The main symptoms are leaf, twig, and branch wilting, followed by the death of the plant. The pathogen was, most probably, introduced in the area from Central America through the circulation of infected Coffee plants \[[@B4-plants-09-00760],[@B5-plants-09-00760]\]. So far, a single clonal lineage of this subspecies, namely the sequence type 53, is associated with OQDS in all infected areas of Salento \[[@B6-plants-09-00760],[@B7-plants-09-00760]\]. According to the European quarantine legislation, three areas have been established for a better management of the disease: (1) the "infected" area where the pathogen is spread and the eradication measures are not feasible (i.e., the southernmost area of the Salento peninsula); (2) the "containment" area that borders the "infected" one and where infected olive trees must be uprooted; (3) the "buffer" area where, within a radius of 100 m \[[@B8-plants-09-00760],[@B9-plants-09-00760]\] that starts from the infected tree, all olive trees must be uprooted. Debatably, in future, the length of this radius could be reduced \[[@B10-plants-09-00760]\]. The last two areas are surveyed and monitored by the regional phytosanitary service for assessing the occurrence of the pathogen \[[@B11-plants-09-00760]\]. The area north of the "buffer" is retained and declared "free" from the pathogen upon the surveys and laboratory analyses performed by ad hoc Institutions of Apulia Region.
Concerning the epidemiology of the disease, some studies have established that, in Apulia, the pathogen can survive and infect some plant species other than the olive \[[@B2-plants-09-00760]\]. Moreover, the meadow spittlebug *Philaenus spumarius* is considered the main insect vector enabling the spread of the pathogen within and between the olive groves \[[@B12-plants-09-00760]\]. Data on the expansion of the disease indicate that, at the time of the first report of October 2013, the OQDS was already established on about 10,000 ha in the Gallipoli area (Lecce province) \[[@B13-plants-09-00760]\]. The vector also spreads the pathogen in the affected area at a speed of 20 km per year \[[@B14-plants-09-00760]\], with the possibility of a higher spread rate, due to the occurrence in the area of non-olive hosts \[[@B15-plants-09-00760]\]. In addition, the particular topology of Apulia olive groves, regularly extending over hundreds of kilometers, makes the possibility that *X. f*. subsp. *pauca* will persist in the territory very high \[[@B16-plants-09-00760]\].
Other aspects of OQDS epidemiology could be related to the nutrients content in the soil and leaf. The analysis of the complete profile of the mineral nutrients and trace elements (i.e., the ionome *sensu*) \[[@B17-plants-09-00760]\] can also contribute to assessing the physiological state of the plant in relationships with the pathogen infection. Some studies, indeed, clearly indicated a correlation between the content of some ions into the leaf and the virulence of *X. fastidiosa* \[[@B18-plants-09-00760]\]. In *Nicotiana tabacum,* the ionome change correlates with the virulence of isolated *X. fastidiosa* and according to the different subspecies of the pathogen \[[@B19-plants-09-00760]\]. In addition, zinc detoxification in the host plant is required for triggering the full virulence of the pathogen \[[@B20-plants-09-00760]\]. Besides micronutrients, some other ions, such as calcium, are also involved in the virulence mechanisms of *X. fastidiosa* by favoring the adhesion of the pathogen cell to the xylem vessels, the biofilm formation and the twitching motility of the bacterium \[[@B21-plants-09-00760]\]. Concerning *X. f*. subsp. *pauca*, the highest manganese leaf content found into the olive cultivar Leccino could be related to its lower susceptibility to OQDS \[[@B22-plants-09-00760]\]. On the other hand, the same micronutrient, when supplemented to the standard media, caused an increase in biofilm formation and in cell-to-cell attachment of *X. f*. subsp. *fastidiosa* \[[@B18-plants-09-00760]\]. Previously, we showed that in the area where the OQDS outbreaks were firstly noticed (i.e., the Gallipoli area) there is a general low content of molybdenum and manganese in the soil and a low bioavailability of copper and molybdenum in the leaf of *X. f*. subsp. *pauca*-infected olive trees \[[@B23-plants-09-00760]\]. An accumulation of calcium and magnesium was also observed in *Vitis vinifera* leaves infected by *X. f.* subsp. *fastidiosa* \[[@B24-plants-09-00760]\]. Moreover, it was suggested that the knowledge of host ionomic composition and the possibility of its modification represent a potential tool for the management of the diseases caused by *X. fastidiosa* \[[@B20-plants-09-00760]\]. Within this context, we observed that the supply of a zinc--copper--citric acid biocomplex to the canopy of *X. fastidiosa* subsp. *pauca*-infected olive trees during spring and summer allowed to reduce both the field symptoms (i.e., leaf and twig die-backs) and pathogen cell densities within the leaves \[[@B25-plants-09-00760]\] as well as a rapid re-programming of the basic metabolism of the infected tree \[[@B26-plants-09-00760],[@B27-plants-09-00760]\].
In order to start to verify whether differences in soil and leaf ionome composition between olive groves of the "infected" and "free" areas of Apulia are consistent, we have assessed the micronutrients content together with calcium, sodium, and magnesium in the soil and leaves of olive groves in different areas of Apulia and bordering region Basilicata. Beside the infected Salento area (Lecce LE, Brindisi BR and Taranto TA provinces) we have also included olive trees growing outside the areas where the *X. f.* subsp. *pauca* has been reported in the analyses. These occur more north than Salento and include the provinces of Barletta-Andria-Trani (BAT) (Apulia) and Potenza (PZ) (outside Apulia in the bordering region Basilicata). A full comparison has been performed for the areas characterized by the presence or absence of the pathogen. In addition, to assess the variation in the leaf ionome composition of olive trees that have received the biocomplex in recent years, we have also compared trees that received spray treatments with the untreated infected trees. We have observed that the soil and leaf ionomic composition of olive farms growing in north Salento areas is significantly different from that shown by the olive groves in the infected areas. We have also found that the biocomplex-treated and untreated olive trees of the infected areas have markedly different leaf ionomic profiles. Ions such as zinc, copper and sodium would seem somehow linked to the OQDS.
2. Results {#sec2-plants-09-00760}
==========
2.1. Soil Analyses {#sec2dot1-plants-09-00760}
------------------
Mean and standard error values for the macro (Ca, Na, Mg) and micro (B, Cu, Fe, Mn, Mo, Zn) elements content in soils are shown in [Table 1](#plants-09-00760-t001){ref-type="table"}. In order to highlight significant differences in their amount, the Tukey Honestly Significant Difference (HSD) test for multiple comparisons of groups was also applied ([Table 1](#plants-09-00760-t001){ref-type="table"} and [Table S1 in SI](#app1-plants-09-00760){ref-type="app"}). According to the indicated normal mean value content in soil of each element assessed \[[@B28-plants-09-00760],[@B29-plants-09-00760],[@B30-plants-09-00760],[@B31-plants-09-00760],[@B32-plants-09-00760],[@B33-plants-09-00760],[@B34-plants-09-00760],[@B35-plants-09-00760]\], relevant differences among the ionomic profiles in soils of Apulia provinces have been observed. Olive groves located in the Barletta-Andria-Trani (BAT) and Potenza (PZ) provinces, north of the infected areas, showed a significantly higher content of Cu, Zn and Mn when compared to the other provinces. BAT and PZ olive groves also showed a significantly higher content of Na close to the limit for sodic soils (i.e., 3850.00 ± 243.27 mg kg^−1^) \[[@B29-plants-09-00760]\] ([Figure S1 and Table S2 in SI](#app1-plants-09-00760){ref-type="app"}). On the other hand, the LE province olive groves showed the lowest Mn content, whereas those of BR showed, in addition to a low Cu and Zn content, a significant low level of Mg. Olive farms located in TA province showed a mean Cu content close to the low limit for the normality \[[@B36-plants-09-00760]\]. A further level of investigation was performed by calculating the correlation matrix based on Pearson's coefficient for all the measured elements ([Table 2](#plants-09-00760-t002){ref-type="table"}). A general overview on the potential linear relationship among the metals macronutrients and micronutrients was obtained. A high level of correlation was found for 14 couple of elements, namely B/Fe, B/Ca, B/Mg, B/Mn, B/Zn, Ca/Fe, Ca/Mg, Ca/Mn, Cu/Zn, Fe/Mg, Fe/Mn, Fe/Zn, Mg/Zn, and Mn/Zn, with significance at *p* \< 0.001 ([Table 3](#plants-09-00760-t003){ref-type="table"}). It should be also noted that, in some cases, significant negative correlation values (i.e., B/Ca, Ca/Cu, Ca/Fe, Ca/Mn) were observed ([Table 2](#plants-09-00760-t002){ref-type="table"} and [Figure S2 in SI](#app1-plants-09-00760){ref-type="app"}). A confirmation about the different ionomic composition of the BAT and PZ soils in comparison with those of Salento (LE, BR, TA) has been provided by the PLS-DA model (accuracy = 0.80, R^2^ = 0.43, Q^2^ = 0.33). This model clearly differentiated the soils of northern areas from the ones sampled in the Brindisi, Taranto and Lecce provinces ([Figure 1](#plants-09-00760-f001){ref-type="fig"}A). In particular, as shown by the VIP scores ([Figure 1](#plants-09-00760-f001){ref-type="fig"}B,C) and detailed in the histograms for the two main discriminant metabolites (with a VIP score \> 1), Na and Cu were the main variables responsible for the discrimination among the four groups. Soil pH was always higher than 7.5, and even higher than 8.0 for the BAT, PZ and TA samples ([Table 1](#plants-09-00760-t001){ref-type="table"}).
2.2. Leaf Analyses {#sec2dot2-plants-09-00760}
------------------
The ionomic profile of leaf samples was determined by ICP-AES analysis of the olive trees leaves located in the different municipalities ([Table 3](#plants-09-00760-t003){ref-type="table"}). For all the measured elements, univariate and multivariate statistical analyses (PCA, PLS-DA, OPLS-DA) were performed. The first approach is based on a multivariate statistical analysis model, performed using the whole data for the Dentamet^®^-treated (TR), not treated-infected (NTR), and not infected (NI) olive leaf samples. Both the PCA ([Figure S3 in SI](#app1-plants-09-00760){ref-type="app"}) and the PLS-DA (accuracy = 0.75, R^2^ = 0.61, Q^2^ = 0.55, [Figure 2](#plants-09-00760-f002){ref-type="fig"}) models showed a clear separation of TR from the NI and NTR olive leaf samples, mainly due to a higher content of Zn in the treated trees olive leaves. The most important variables identified by the PLS-DA model ranked by VIP (Variable Importance in Projection score) are shown in [Figure 2](#plants-09-00760-f002){ref-type="fig"}B and One-way ANOVA with post hoc analysis ([Table S3 in SI](#app1-plants-09-00760){ref-type="app"}) for multiple comparisons of groups (TR, NTR, NI) indicate significant variables with *p* \< 0.05. Beside Zn, a higher relative content of Ca and Mg and a low relative content of Na were also found in NI olive leaf samples, whereas NTR leaf showed a relative higher content of Na. To note that leaves of TR trees showed the lowest Na content ([Figure 2](#plants-09-00760-f002){ref-type="fig"}C). Furthermore, both unsupervised (PCA) and supervised (OPLS-DA) models were built for Dentamet^®^-treated (TR) and not treated-infected (NTR) olive leaf samples. Despite the different number of samples per cluster, a robust PLS-DA (accuracy = 0.95, R^2^ = 0.71, Q^2^ = 0.61, data not shown) and OPLS-DA (R^2^X = 0.51, R^2^Y = 0.64, Q^2^ = 0.60) models were obtained. The OPLS-DA scoreplot ([Figure 3](#plants-09-00760-f003){ref-type="fig"}A) shows a clear separation between the two groups (NTR and TR). It should be noted that, in this case, all the analyzed samples originate from different municipalities among the Lecce province and refer to infected olive trees. Differences in micro/macronutrient content were also analyzed by the VIP score ([Figure 3](#plants-09-00760-f003){ref-type="fig"}B), in which a marked variation in Zn, Cu and Na content (VIP score \> 1) was observed between the two groups of samples (NTR and TR). In particular, by analyzing the detailed concentration of variables per group, a high relative content of Zn and Cu and a low relative content of Na were observed for TR with respect to NTR leaf samples ([Figure 3](#plants-09-00760-f003){ref-type="fig"}C). Moreover, the NTR leaf samples showed a very low Cu content ([Figure 3](#plants-09-00760-f003){ref-type="fig"}C). Interestingly, the same type of intra-class variation was observed in the two OPLS-DA groups (NTR and TR). The samples from Galatone/Gallipoli municipalities lie in the upper part, whereas those from the Otranto district and its surrounding municipalities are positioned in the lower side of the OPLSDA scoreplot ([Figure 3](#plants-09-00760-f003){ref-type="fig"}A).
In order to deeply analyze the differences in the macro and micronutrients content, Dentamet^®^-treated (TR) leaf samples obtained from Cellina di Nardò and Ogliarola salentina, all collected in Lecce municipalities, were also compared with all not-infected samples (NI) obtained from BR and TA, as well as from the BAT and PZ provinces. By both unsupervised and supervised multivariate analyses, a good class separation and high predictive ability was observed (R^2^X = 0.48, R^2^Y = 0.82, Q^2^ = 0.77 for OPLS-DA model, [Figure 4](#plants-09-00760-f004){ref-type="fig"}). As expected, a high relative level of Zn was found for TR with respect to NI samples. Moreover, among the NI olive leaf samples, those collected in Andria, Barletta and Canosa (BAT) as well in Gaudiano (PZ) showed a very high Cu (values ranging from 68.49 to 137.70 mg kg^−1^) and Zn content (values ranging from 37.73 to 56.69 mg kg^−1^). The Mn content was also in the range of normality \[[@B28-plants-09-00760]\] (i.e., Canosa), with the highest values found in Barletta (i.e., 915 -- 1.055 mg kg^−1^). A comparison of Na content in soil with respect to leaf samples taken from not-infected and infected-not treated olive groves is reported in [Figure 5](#plants-09-00760-f005){ref-type="fig"}. Noteworthily, for the infected trees of Lecce and Brindisi provinces, a remarkably higher Na content was found in the leaves with respect to the corresponding value in the soil. By contrast, an opposite trend was observed for the not-infected trees of Taranto and BAT provinces with a higher Na content in soil with respect to the leaves ([Figure 5](#plants-09-00760-f005){ref-type="fig"}). We also analyzed the Mn content of soil and leaves of infected Ogliarola salentina, Cellina di Nardò and Leccino trees of Taranto province ([Table 1](#plants-09-00760-t001){ref-type="table"}). The Leccino trees showed a relatively higher Mn content in the leaves with respect to the other two cultivars ([Figure 6](#plants-09-00760-f006){ref-type="fig"}). Real-time PCR showed that *X. f*. subsp. *pauca* was present in all leaf samples taken from farms of the municipalities located in the provinces of Lecce and Brindisi (i.e., the "infected" area), whereas it was not present in the farms located in Taranto province. All of these farms are in the "infected" area. In addition, negative detection was observed for the samples taken from the municipalities of the Barletta-Andria-Trani and Potenza provinces (i.e., the "free" area) ([Table 3](#plants-09-00760-t003){ref-type="table"}).
3. Discussion {#sec3-plants-09-00760}
=============
Upon the initial outbreak of OQDS in Salento, recorded during 2008--2009 \[[@B13-plants-09-00760]\], apparently a single clone of *X. f.* subsp. *pauca*, namely ST53, has been found in the whole Salento area \[[@B7-plants-09-00760]\]. The typical characteristic of the Salento olive agro-ecosystem, spanning as a *continuum* over many kilometers, most probably favored the further spread of the pathogen in the whole area \[[@B16-plants-09-00760]\]. The occurrence in this area of two pathogen-sensitive cultivars such as Ogliarola salentina and Cellina di Nardò has represented another key-point for the expansion of the epidemic. Clonal pathogens are favored by large-scale uniformity of environment, so that, upon their adaptation to the new niche, they can flourish in the agro-ecosystem \[[@B37-plants-09-00760]\]. For plant diseases, the mineral nutrients supplied by soil to the plant in inorganic or organic forms, can also play a role in determining the severity and the spread of the disease \[[@B38-plants-09-00760]\]. This study highlighted a significant difference in the soil and leaf ionome composition for samples from the Salento peninsula (i.e., LE, BR and TA) with respect to the northern areas (BAT and PZ) where the OQDS has not been found. The unsupervised exploratory (PCA) and supervised classification (PLS-DA, OPLS-DA) data analyses applied in this study revealed a clear separation between the two areas, pointing to a higher Zn, Cu and Mn content found in the northern area as the soil and leaf ionomic profile-discriminating ions. These elements are plant micronutrients essential for plant growth: Zn is involved as cofactor in many enzymes such as alcohol dehydrogenase, carbonic anydrase and RNA polymerase \[[@B39-plants-09-00760]\]; Cu is essential for the formation of chlorophyll \[[@B40-plants-09-00760]\], and Mn is involved in the photosynthetic machinery and in the detoxyphication of ROS \[[@B41-plants-09-00760]\].
It is worth noting that these ions are also deeply involved in the *X. fastidiosa* virulence and in the plant defense systems. Zinc is deeply involved in the mechanisms of plant defense towards pathogens \[[@B42-plants-09-00760]\]. A zinc-finger protein gene, *CAZFP1*, encodes a zinc-finger transcription factor that is accumulated in the early phase of the infection of *Xanthomonas campetsris* pv. *vesicatoria* to pepper fruits \[[@B43-plants-09-00760]\]. In addition, zinc fingers binding domains are related to the effector-triggered immune response \[[@B44-plants-09-00760]\]. High zinc concentrations can protect plants by direct toxicity and by Zn-triggered organic defenses \[[@B45-plants-09-00760],[@B46-plants-09-00760]\].
*X. fastidiosa* biofilm formation is inhibited by a copper and zinc concentrations higher than 200 µM and 0.25 mM, respectively \[[@B18-plants-09-00760]\], and in planta zinc detoxification is required to trigger the full virulence of the pathogen \[[@B20-plants-09-00760]\]. Within this context, we have shown that the supply to the olive canopy of a zinc--copper--citric acid biocomplex, namely Dentamet^®^, reduced both the field symptoms and *X. f.* subsp. *pauca* cell densities within the foliage enabling the trees to survive to the infection \[[@B25-plants-09-00760]\]. Recently, a high Mn leaf content would seem to be correlated to a relative degree of tolerance in Leccino cultivar to *X. f.* subsp. *pauca* \[[@B22-plants-09-00760]\], and the present study would corroborate this feature since both Ogliarola salentina and Cellina di Nardò cultivars are characterized by a lower Mn content than Leccino. This ion is involved in lignin and flavonoid productions that confer protection to the cultivar towards *X. f.* subsp. *pauca* infection \[[@B47-plants-09-00760]\]. The high content of Cu found in northern areas could be related to the repeated utilization of compounds aiming at controlling phytopathogenic fungi and bacteria such as *Spilocea oleaginea* and *Pseudomonas savastanoi* pv. *savastanoi* commonly found in that area. Meanwhile, the high content of Zn and Mn both in soil and leaves is a feature that deserves further investigations. Olive groves of northern areas (BAT and PZ) also showed a significant high soil content of Na. On the other hand, this ion is not present at a high concentration in the leaves of the cultivar Coratina typical of northern areas. Interestingly, despite the climatic suitability for the survival of *X. f.* subsp. *pauca* \[[@B48-plants-09-00760]\], there are no outbreaks or record of the pathogen in the northern areas of Apulia, so far. This is in sharp contrast with the expected arrival of the vector in that area from the south, during the last decade at least. Indeed, infection should have already reached north Apulia, taking into account the initial outbreaks \[[@B49-plants-09-00760]\], the estimated spread of the vector (i.e., 20 km per year) \[[@B14-plants-09-00760]\] and the possibility for *p. spumarius* to also propagate as a vehicles hitchhiker (EFSA, 2018) \[[@B1-plants-09-00760]\]. The edaphic properties of the soils and/or a relative tolerance of the local cultivar Coratina, due to a different ionome composition, could partly explain the current situation and deserve further study. The not-infected leaves sampled in olive groves at either the TA or BAT and PZ provinces displayed a low Na content with respect to the infected trees. Moreover, these latter also showed a relevant Na accumulation. This finding confirms what observed in peach trees with symptoms of "phony peach" caused by *X. fastidiosa* \[[@B50-plants-09-00760]\], and for tobacco leaves infected by *X. fastidiosa* subsp. *fastidiosa* \[[@B19-plants-09-00760]\]. The accumulation of Na within the infected leaves could be in relation with the leaf wilting incited by the presence of the bacterium within the xylem that causes an increase in solutes and ions to adjust the osmotic potential in that tissue \[[@B22-plants-09-00760]\]. It has been also observed that the not-infected trees showed a higher Ca content when compared to both the treated and infected trees. This would seem to be in contrast with previous observations that indicate an accumulation of Ca in the xylem of infected grapes, blueberry and pecan \[[@B51-plants-09-00760],[@B52-plants-09-00760]\]. However, it should be said that the soils which we studied where non-infected olive trees are growing (i.e., TA, BAT and PZ) are very rich in Ca content, and that the uptake of this ion occurs via the root system, usually through a favorable potential up to the xylem network \[[@B53-plants-09-00760]\]. In addition, olive cultivars would seem to show a different response in the regulation of Ca-related genes. Ogliarola salentina appears more sensitive than Leccino in showing Ca-induced metabolic changes \[[@B22-plants-09-00760]\]. This study confirmed and enlarged the observation about the very low Cu content in the leaves found in the infected trees with additional data \[[@B11-plants-09-00760]\]. In addition to *X. fastidiosa* \[[@B19-plants-09-00760]\], this finding was also observed in disease caused by other phytopathogenic bacteria, such as *Xanthomonas oryzae* pv. *oryzae* \[[@B54-plants-09-00760]\] and *Erwinia amylovora* \[[@B55-plants-09-00760]\]. We have also observed that leaf samples taken from trees that have received the zinc--copper--citric acid biocomplex treatment for two or three years could be significantly discriminated from the infected non treated olive trees growing in the same area, mainly through the Zn, Cu and Na content. A higher content of Zn and Cu is conceivable for the repeated spray treatments to the canopy with the biocomplex, whereas the low Na content could be in relation with metabolic pathways of the trees being close to the normality. It was recently shown that the biocomplex induces an early re-programming of the infected trees upon the spray treatments characterized by the loss of all disease biomarkers \[[@B27-plants-09-00760]\]. On the other hand, the leaf ionome comparison between treated and not infected trees, as well as between the olive groves of the "free" and "infected" areas also show clear differences, resulting in Zn being the most discriminative ion between the two situations and could be used as a putative biomarker for tolerance to *X. f.* subsp. *pauca*. These findings confirm once more that Dentamet^®^ incites differences in the concentration of the single ions found in the leaves that have received the treatments. \[[@B25-plants-09-00760]\]. Nevertheless, further work is needed to buttress the present data. In particular, the behavior of Coratina, the most widely planted cultivar north of Salento, would require additional investigation in relation to its susceptibility/tolerance/resistance to *X. f.* subsp. *pauca* infection. This cultivar, indeed, showed a leaf ionome content different from "Ogliarola salentina" and "Cellina di Nardò" cultivars that could be in relation to the progression of the pathogen within the tree.
4. Materials and Methods {#sec4-plants-09-00760}
========================
4.1. Soil and Leaf Sampling {#sec4dot1-plants-09-00760}
---------------------------
In order to verify the ionomic profiles of soils and their availability to olive trees, soil and leaf samples were collected in July 2019 and analyzed. The samples were obtained from the municipalities showed in [Table 3](#plants-09-00760-t003){ref-type="table"} and [Figure 7](#plants-09-00760-f007){ref-type="fig"}). Annual precipitation (cumulative rainfall) and temperature data for the studied area were reported in [Table S4](#app1-plants-09-00760){ref-type="app"}. addition to municipalities of the "infected" area where *X. f*. subsp. *pauca* has been reported, we have also sampled some sites of the not infected area (i.e., BAT and PZ) as well as sites of the "infected" and "containment" areas apparently free from the pathogen (i.e., areas where the official monitoring of the Phytosanitary Service of Apulia Region and further laboratory analyses did not record the bacterium within the municipality territory). We have also assessed some olive farms in the "infected" area that applied a zinc--copper--citric acid biocomplex, namely Dentamet^®^, to control *X. f.* subsp. *pauca* in recent years \[[@B25-plants-09-00760]\]. The agronomical techniques applied to the olive groves located in the "infected" and "free" areas are as follows: "infected" area, cultivars "Ogliarola salentina" and "Cellina di Nardò", free vase training system, ample space between the trees, not regular pruning and soil plowing, no irrigation and soil fertilization, control of main pest and pathogens through application of synthetic compounds; "free" area: cultivar "Coratina", polyconic vase training system, regular annual pruning, plowing, soil fertilization and control of main pests and pathogens through application of synthetic compounds.
From each olive grove, leaves were collected in summer (i.e., July), according to the procedures described by Scortichini et al. \[[@B23-plants-09-00760]\]. The trees were pruned the year before the sampling and leaf samples were taken from part of the crown of each tree not showing any visible symptom of OQDS. In the cases of infected and treated farms, olive trees showing some visible symptom putatively attributable to OQDS (i.e., leaf scorching, twig and branch dieback) were sampled for confirming the occurrence of the pathogen through real-time PCR assessment by taking asymptomatic leaves \[[@B25-plants-09-00760]\]. In addition, we performed such an assessment also in the cases of not infected trees that grow in the "infected" area as well as from trees of the "free" area. The leaves sampled and used for the measurements had a healthy appearance, even for the infected and untreated plants. The average water content was always equal to 50% w/w, both for healthy plants and for infected plants. The following elements were analyzed in soil and leaf tissue: calcium (Ca), magnesium (Mg), sodium (Na), iron (Fe), zinc (Zn), copper (Cu), boron (B), manganese (Mn), and molybdenum (Mo). Soil pH was measured in bi-distilled water using a suspension of 1:5 solid to liquid phase. For each farm, three soil and leaf samples were taken according to the methods described elsewhere \[[@B23-plants-09-00760]\].
4.2. Soil and Leaf Analyses {#sec4dot2-plants-09-00760}
---------------------------
Leaves were washed with distilled water to remove all soil particles and then dried. Each soil (1 g) and leaf (0.5 g) subsample was analyzed separately at the University of Salento using Inductively Coupled Plasma Atomic Emission Spectroscopy (ICP-AES), by following the standard procedures \[[@B23-plants-09-00760],[@B25-plants-09-00760]\]. Briefly, samples of known dry weight were mixed with 4 mL H~2~O~2~ and 6 mL HNO~3~ at 180 °C for 10 min, using a microwave digestion system (Milestone Start D). Then they were cooled, diluted with ultrapure water to a final volume of 20 mL, filtered through Whatman No. 42 filter papers, and measured for elemental content using an inductively coupled plasma atomic emission spectrometer (ThermoScientific iCap 6000 Series). Results were expressed as mg·kg^−1^ dry weight.
4.3. Statistical and Principal Component Analyses {#sec4dot3-plants-09-00760}
-------------------------------------------------
Standard analysis of variance (One Way-ANOVA) with Tukey's Honestly Significant Difference (HSD) post hoc test was applied to compare the means between the two cultivation sites and for multiple comparisons of groups using the R statistical environment, Version 3.6.2 on a 64 bit Windows platform (R Development Core Team, 2017) \[[@B56-plants-09-00760]\]. Moreover, a correlation matrix based on Pearson's coefficient was calculated for all the measured elements using MetaboAnalyst 4.0, a web-based tool for visualization of metabolomics \[[@B57-plants-09-00760],[@B58-plants-09-00760]\]. This approach was used to assess possible linear associations between the variables (Ca, Na, Mg, Fe, Zn, Cu, B, Mn and Mo) of soil data. Multivariate statistical analyses and graphics were obtained using MetaboAnalyst 4.0 software \[[@B57-plants-09-00760],[@B58-plants-09-00760],[@B59-plants-09-00760]\]. Autoscaling pretreatment of the data was carried out to the data prior the analyses \[[@B60-plants-09-00760],[@B61-plants-09-00760]\]. Exploratory and classification data analyses were carried out using Principal Component Analysis (PCA), Projection to Latent Structures Discriminant Analysis (PLS-DA) and Orthogonal Projection to Latent Structures Discriminant Analysis (OPLS-DA), both for soil and leaf data set analyses. The statistical models were validated using an internal cross-validation default method (10-fold CV) and evaluated by permutation test statistics. The quality of the models was described by classification accuracy, R^2^ and Q^2^ parameters. The R^2^ value is a cross validation parameter defined as the proportion of variance in the data explained by the models, while the Q^2^ parameter is an internal cross validation parameter, which indicates the predictability of the model. Moreover, the variable contribution was evaluated in the classification models (PLS-DA models), by the VIP score \[[@B50-plants-09-00760]\] and the box plots for discriminant variables with VIP score \> 1 were also evaluated.
4.4. Occurrence of Xylella fastidiosa in Olive Groves {#sec4dot4-plants-09-00760}
-----------------------------------------------------
The occurrence of *X. fastidiosa* in the olive tree leaves sampled in the "infected" and "free" areas was assessed using real-time PCR \[[@B62-plants-09-00760]\] by following the procedures described by Scortichini \[[@B25-plants-09-00760]\]. For these analyses, sampled leaves of the visibly-infected trees of the "infected" area were taken from branches not showing disease symptoms (i.e., leaf wilting or twig dieback). For farms of the "infected" area not showing apparent signs of decline as well as for the farms of the "free" area, the leaf samples were taken from four different twigs representing the four cardinal points.
The following are available online at <https://www.mdpi.com/2223-7747/9/6/760/s1>, Table S1. Standard analysis of variance (One Way-ANOVA) with Tukey's honestly significant difference (HSD) post hoc test for soil data; Table S2. Means (mg kg^−1^) ± standard error of the mean (SEM) obtained for the ionomic content of soil samples from BAT (province of Barletta-Andria-Trani) and PZ (province of Potenza); Table S3. One-way ANOVA (*p* \< 0.05) with the post-hoc test, which includes *p-value* adjustment for multiple comparisons, was applied for the ionomic content of leaf samples from different olive farm. A total of six significant features were found from Tukey Honestly Significant Difference (HSD) test was applied for multiple comparisons of groups (TR, treated with zinc--copper--citric acid, NTR, not treated and infected by *Xylella fastidiosa* subsp. *pauca,* NI, not infected by *Xylella fastidiosa* subsp. *pauca*); Table S4. Annual precipitation (mm of cumulative rainfall) and temperature (°C) data for the studied area Figure S1. Expansion of Apulia region in southern Italy. Variations in Na content (mg kg^−1^) for the considered sample soil sites appear as more or less red, according to four levels (from red: high content, to light yellow: low Na content); Figure S2. Pearson correlation matrix among the variables for soil samples; Figure S3. PCA model performed using the whole data for the Dentamet^®^-treated (TR), not treated-infected (NTR), and not infected (NI) olive leaf samples.
######
Click here for additional data file.
Conceptualization, M.S. and F.P.F.; methodology, L.D.C., C.R.G. and F.P.F.; software, F.A. and D.M.; validation, L.D.C., C.R.G. and F.P.F; formal analysis, F.A. and D.M.; resources, M.S. and F.P.F.; data curation, L.D.C., C.R.G. and F.P.F.; writing---Original draft preparation, L.D.C., M.S. and F.P.F.; writing---Review and editing, L.D.C, M.S. and F.P.F.; supervision, M.S. and F.P.F.; project administration, D.M. and F.P.F.; funding acquisition, M.S. and F.P.F. All authors have read and agreed to the published version of the manuscript.
This research was funded by Regione Puglia, grant: "Strategie di controllo integrato per il contenimento di *Xylella fastidiosa* in oliveti pugliesi ed analisi epidemiologiche del complesso del disseccamento rapido dell'olivo (CoDiRO)".
The authors declare no conflict of interest.
{ref-type="fig"}B: the colored boxes on the right indicate the relative increase/decrease of the corresponding variable in each group). BAT: Barletta-Andria-Trani; LE, BR, TA: Lecce, Brindisi, Taranto provinces (Apulia); PZ Potenza province (Basilicata, Apulia bordering region).](plants-09-00760-g001){#plants-09-00760-f001}
{ref-type="fig"}B: the colored boxes on the right indicate the relative increase/decrease of the corresponding variable in each group). TR (farm treated with zinc--copper--citric acid), NTR (farm not treated and infected by *Xylella fastidiosa* subsp. *pauca*) and NI (farm not infected by *Xylella fastidiosa* subsp. *pauca*).](plants-09-00760-g002){#plants-09-00760-f002}
{#plants-09-00760-f003}
{#plants-09-00760-f004}
{#plants-09-00760-f005}
{ref-type="table"}).](plants-09-00760-g006){#plants-09-00760-f006}
{#plants-09-00760-f007}
plants-09-00760-t001_Table 1
######
Means (mg kg^−1^) ± standard error of the mean (SEM) obtained for the ionomic content of soil samples from different olive farm. Tukey Honestly Significant Difference (HSD) test was applied for multiple comparisons of groups (provinces). BAT: Barletta-Andria-Trani; LE, BR, TA: Lecce, Brindisi, Taranto provinces (Apulia); PZ Potenza province (Basilicata, Apulia bordering region).
BAT-PZ BR LE TA
---- --------------------------------- --------------------------------- --------------------------------- ---------------------------------
B 19.99 ± 0.80 16.90 ± 0.71 17.36 ± 0.87 20.01 ± 1.39
Ca 44.84 × 10^3^ ± 6.93 × 10^3^ 31.46 × 10^3^ ± 18.77 × 10^3^ 68.21 × 10^3^ ± 6.62 × 10^3^ 80.46 × 10^3^ ± 12.19 × 10^3^
Cu 84.24 ± 9.30 ^b^ 17.17 ± 4.93 ^a^ 30.78 ± 2.38 ^a^ 20.27 ± 1.84 ^a^
Fe 20.76 × 10^3^ ± 0.98 × 10^3^ 18.88 × 10^3^ ± 0.70 × 10^3^ 20.22 × 10^3^ ± 1.03 × 10^3^ 19.29 × 10^3^ ± 14.16 × 10^3^
Mg 3.73 × 10^3^ ± 0.14 × 10^3\ b^ 2.11 × 10^3^ ± 0.36 × 10^3\ a^ 3.21 × 10^3^ ± 0.11 × 10^3\ b^ 3.45 × 10^3^ ± 0.14 × 10^3\ b^
Mn 0.78 × 10^3^ ± 0.05 × 10^3\ ab^ 0.60 × 10^3^ ± 0.08 × 10^3\ ab^ 0.46 × 10^3^ ± 0.06 × 10^3\ a^ 0.74 × 10^3^ ± 0.079 × 10^3\ b^
Mo 0.08 ± 0.02 0.24 ± 0.07 0.27 ± 0.04 0.15 ± 0.03
Na 3.85 × 10^3^ ± 0.02 × 10^3c^ 0.27 × 10^3^ ± 0.03 × 10^3\ a^ 0.62 × 10^3^ ± 0.090 × 10^3\ a^ 1.75 × 10^3^ ± 0.24 × 10^3\ b^
Zn 46.08 ± 1.74 ^a^ 24.72 ± 1.16 ^ab^ 32.69 ± 2.10 ^b^ 34.71 ± 1.92 ^ab^
pH 8.12 ± 0.04 7.64 ± 0.26 7.84 ± 0.11 8.20 ± 0.04
Letters (a, b, c) indicate significant differences for Tukey HSD test at least for 5% statistical probability (see also Supplementary Information [Tables S1 and S3](#app1-plants-09-00760){ref-type="app"}). BAT: province of Barletta-Andria-Trani; PZ: province of Potenza (see [Table S1 in SI](#app1-plants-09-00760){ref-type="app"} for details); BR: province of Brindisi; LE: province of Lecce; TA: province of Taranto.
plants-09-00760-t002_Table 2
######
Pearson correlation matrix among the variables for soil samples. \*, \*\*, \*\*\* indicate significance at *p* \< 0.05, *p* \< 0.01 and *p* \< 0.001, respectively.
Ca Cu Fe Mg Mn Mo Zn Na
---- -------------- ------------ -------------- ------------- -------------- ---------- ------------- ------------
B −0.45 \*\*\* 0.13 0.89 \*\*\* 0.39 \*\*\* 0.56 \*\*\* 0.02 0.52 \*\*\* 0.15
Ca −0.24 \*\* −0.59 \*\*\* 0.31 \*\*\* −0.37 \*\*\* −0.06 −0.22 −0.03
Cu 0.18 \* 0.09 0.16 0.14 0.38 \*\*\* 0.23 \*\*
Fe 0.32 \*\*\* 0.49 \*\*\* 0.15 0.48 \*\*\* 0.04
Mg 0.22 \* 0.03 0.38 \*\*\* 0.19
Mn −0.19 \* 0.46 \*\*\* 0.22 \*\*
Mo 0.03 −0.31 \*\*
Zn 0.15
plants-09-00760-t003_Table 3
######
List of municipalities with the corresponding infection status of the olive farm, cultivar name and number of soil and leaf samples taken for the study. BAT: province of Barletta-Andria-Trani; PZ: province of Potenza; BR: province of Brindisi; LE: province of Lecce; TA: province of Taranto. TR (farm treated with zinc--copper--citric acid), NTR (farm not treated and infected by *Xylella fastidiosa* subsp. *pauca*) or NI (farm not infected by *Xylella fastidiosa* subsp. *pauca*). Ogliarola: Ogliarola salentina; Cellina: Cellina di Nardò. The olive groves of BAT and PZ provinces are located in the "free" area, whereas all the other are located in the "infected" area.
Municipality Province Status-Cultivar (*n*° Samples)
--------------------- ---------- -------------------------------------------------
Andria BAT NI Coratina (3)
Barletta BAT NI Coratina (3)
Canosa BAT NI Coratina (3)
Gaudiano PZ NI Coratina (3)
Francavilla Fontana BR NTR Ogliarola (3)
Mesagne BR NTR Ogliarola (3)
Galatone LE TR Ogliarola (1)/Cellina (2)-NTR Ogliarola (18)
Cannole LE TR Cellina (3)-NTR Ogliarola (3)
Giurdignano LE TR Ogliarola (3)-NTR Ogliarola (3)/Cellina (3)
Otranto LE TR Ogliarola (3)-NTR Cellina (3)
Carpignano LE TR Ogliarola (2)/Cellina (1)
Ortelle LE NTR Cellina (3)- NTR Ogliarola (3)
Minervino di Lecce LE NTR Cellina (3)- NTR Ogliarola (3)
Cursi LE NTR Ogliarola (3)
Gallipoli LE NTR Ogliarola (24)
Sava TA NI Ogliarola (2)/Leccino (1)
Maruggio TA NI Ogliarola(1)/Cellina(1)/Leccino(1)
Manduria TA NI Ogliarola (1)/Cellina (2)
Torricella TA NI Ogliarola (2)/Leccino (1)
Grottaglie TA NI Ogliarola (3)/Cellina (3)
Lizzano TA NI Ogliarola (6)
| 2024-03-21T01:26:59.872264 | https://example.com/article/6458 |
Q:
How to receive default arguments in a javascript function like node or express HTTP functions?
In express.js when we call
app.get(function(req,res){...}),
the function automatically receives request and response objects and we can give any name to function parameters like req,res or re,rs and many others.
I want to create a function that will rest in an object.
When I want to use this function it must receive default arguments which may be e.g simple int 4,3 and I must be able to specify parameter names as per my choice.And these arguments must be assigned to parameter names I have defined and I must be able to use those name in code inside function.
How can I achieve this?
A:
I have found the solution myself.
It was all related to call back functions and passing the function definition to another function.
var app={
get:function(callback){
callback('Request object..','Response object..');
}
};
app.get(function(rq,rs){
console.log(rq,rs);
});
Here we can pass function definition in get method with parameters of your own choice that's what I wanted to know.
It is not necessarily express object or methods.
app can be any object and get can be any method of app.
With of course parameters not necessarily req and res objects.
| 2024-03-07T01:26:59.872264 | https://example.com/article/9964 |
For a first time wearer, a NATO strap can seem a little confusing. The straps were purposely designed to be long, so the excess tail of the strap could be doubled back and tucked into the keepers a second time.
The beauty in this design is the strap is "one size fits most." Small to medium-large wrists can tuck back the excess. Large wrists might not have enough excess to tuck back, but that's okay as well, as the strap tip will terminate close to the second keeper in this case.
Step 1 Slide the long end of the strap through the buckle, and secure the buckle using the appropriate sizing hole on the strap.
Step 2 Next, pass the "tail" of the strap upwards through both of the keepers. For most wrist sizes, there will be excess strap sticking upwards. We'll get to that in the next step.
Step 3a The last step is to take that excess bit of strap tail, and fold it backwards into the keeper a second time. This step will hold the tail of the strap tucked in neat and tidy. | 2024-02-22T01:26:59.872264 | https://example.com/article/4555 |
Manchester United supporters reinvigorated by club's turnaround under Solskjaer
The crew debate on whether Manchester United interim manger Ole Gunnar Solskjaer has done enough to win the job, or if Mauricio Pochettino will be next in command.
Chelsea away has long been a problem for Manchester United, if not Manchester United fans. Monday's 2-0 FA Cup win was the first in 10 visits, and the atmosphere in the away end was praised by many, including Ole Gunnar Solskjaer, who said: "It didn't feel like an away game with all that support behind the goal."
Michael Carrick added that: "To every single one of you behind the goal last night. Nonstop from start to finish. The noise and energy was incredible. Would have loved to be in there myself. Thank you. Same again Sunday please."
The players often talk about the away fans rather than the home fans.
No song was aired more by the 6,000 split over two tiers than "Ole's at the wheel, tell me how good does it feel" to The Stone Roses' "Waterfall." It's the anthem for the United revival, sung on a loop. Those fans held up a huge flag in the middle of the upper tier stating: "Magic of the FA Cup? Sold by the FA for Monday night TV CA$H." The sentiment was applauded by Chelsea fans.
Despite the Monday night scheduling, 200 miles from Manchester, 12,000 United fans applied for tickets. They created the same constantly loud sound that has accompanied the away wins at the other London giants Tottenham and Arsenal in recent weeks, but even if United hadn't won their 12th game from the 14 under Solskjaer, it would have still been raucous at Stamford Bridge.
It always is in this wealthy area of west London, where football fans aren't always a natural fit with the wine bars and bistros. When Jose Mourinho's team were getting hammered 4-0 in October 2016, the 3,000 United fans just became louder and louder as the game went on. When United were defeated 5-4 in an epic League Cup game at Stamford Bridge in 2013, Ryan Giggs rated the atmosphere as one of the best in his entire United career.
Manchester United's away support in Monday's win at Chelsea was exceptional.
United's away games in London have long been susceptible to the tourist dollar diluting the hard-core travelling fans. So, the club are now working hard to make sure that tickets don't end up on the black market for those who don't deserve them when genuine fans are missing out. But there are other reasons Chelsea away is always so noisy. The away end is steep, split over two tiers and right on top of the pitch. Chelsea are fair in their allocation for visiting fans, too. The other reason is that Manchester United's away support is magnificent.
The 6,000 fans filtering through the body checks at the Bovril or Stamford gates for Monday's FA Cup fifth round arrived late after the rush hour that went with the earlier-than-usual 7:30 p.m. kickoff. They knew that Chelsea had won all eight of their home cup games this season, but there was palpable optimism. Solskjaer is to thank for that.
From then on, they made some real noise and it didn't stop. Stamford Bridge is all seated, yet I didn't see a United fan sitting down for a minute. Chelsea's yellow-vested stewards faced the visiting hordes and stood transfixed at so many people punching the air and singing. Their behaviour was good; there was no trouble. Stewards were thanked on the way out of the stadium before fans were ushered toward the melting pot of home and away fans on the Fulham Broadway, where the away coaches were lined up.
Yet, even as far bigger numbers of home fans mixed, songs from United fans prevailed. Local residents peered out the windows of their multimillion-pound houses at the commotion below of fans singing about Chelsea never having won the treble, about John Terry slipping or about Solskjaer.
Football fans aren't shy to self-congratulate, but United fans aren't better all the time. Four thousand Paris Saint-Germain fans completely outsang 70,000 United supporters at Old Trafford only last week. There is no shortage of excuses about why the Old Trafford atmosphere is poor, yet PSG fans didn't seem to find it a problem. They were simply far noisier and better organised than Manchester United fans. They got in the ground earlier; they built up the atmosphere; and every one of them sang. They were a different level.
For all the faults of United's home support, faults the club and groups such as The Red Army are trying to fix with enthusiasm, energy and ideas, the away following has always been a vast, disparate, loyal, united body. There's a strong sense of community coming from people knowing each other, if only to say hello.
Editors' Picks
ESPN FC's experts ranked the best men's players and managers in world football. Check it out.
People help each other out with spare tickets. They need to. The away following would be far bigger if ticket allocations allowed for it. An average of 12,000 fans apply for tickets for every United away game, yet the typical Premier League allocation is just 3,000.
The FA Cup encourages bigger allocations, though Arsenal didn't play ball. United were furious about that. United fans should get 15 percent of Molineux's capacity for the sixth-round game at Wolves -- 4,500. It'll be another tough away game against a team who, like Tottenham and Arsenal, have already taken points at Old Trafford this season, but United are flying, their fans having too much fun to care about who their next opponents are.
On Monday, Chelsea fans jeered their manager. Those observations were relayed via journalists in the press box, situated behind both managers and surrounded by Chelsea fans. In the middle of the away end it was impossible to hear such dissent. The focus was on United, but having spoken to editors from Chelsea's longtime fanzine CFCUK on Fulham Broadway before the game, they said that Chelsea fans at matches are generally not convinced by the Italian.
That's Chelsea's problem. United's only managerial issue is whether to appoint Solskjaer full time, but he continues to do a superb job and it does him no harm when he walks up to the away fans and punches the air in front of them as did at Stamford Bridge after another victory, strengthening the strong connection between fans and the manager.
As I walked past the coaches on Monday night, supporter Sam Smart stood by the door of one of the two he'd organised. "Nonstop singing all night," he said. "If only we could replicate that at Old Trafford."
After seven consecutive away wins, which equalled the all-time club records set between April and August 1993 and March and April 2002, the mood among United's travelling fans remains deliriously upbeat. It's time to carry that to Old Trafford for Sunday's huge game against Liverpool. Old Trafford has been nervier for recent games. The past two matches have seen a 2-2 draw against Burnley and the defeat to PSG.
United fans do not want Liverpool to win the league. Even Manchester City are preferable to Liverpool in the eyes of United fans. Liverpool have a very good side and fans who are up for it, so whatever happens on the pitch, it should be deafening in the stadium. | 2024-05-02T01:26:59.872264 | https://example.com/article/4639 |
California Sen. Kamala Harris (D) told a group of people in Muscatine, Iowa that she will not take away private health insurance or raise the middle class' taxes.
"I'm not going to raise middle class taxes, and I'm not going to take away your choice," Harris explained. "Because I heard from too many people that said, 'Kamala, yeah, I want to know that everyone's going to be covered. I like what you're doing to extend benefits to include vision and hearing and also hearing aids and dental.'"
"The prime distinction between my plan and a couple of folks on the stage is I'm not trying to get rid of the private insurance companies," she explained. "They need to be brought to bare on ending co-pays and deductibles and they need to compete with our system but I'm not going to take away your choice."
Sen. Kamala Harris speaks in Muscatine, IA: "I'm not going to raise middle class taxes, and I'm not going to take away your choice." pic.twitter.com/zQn6tdT1EY — The Hill (@thehill) November 23, 2019
But if you look at Harris' Medicare for All plan, she does want to take away a person's right to choose (emphasis mine):
Second, we will set up an expanded Medicare system, with a 10-year phase-in period. During this transition, we will automatically enroll newborns and the uninsured into this new and improved Medicare system, give all doctors time to get into the system, and provide a commonsense path for employers, employees, the underinsured, and others on federally-designated programs, such as Medicaid or the Affordable Care Act exchanges, to transition. This will expand the number of insured Americans and create a new viable public system that guarantees universal coverage at a lower cost. Expanding the transition window will also lower the overall cost of the program.
If a newborn's parents have health insurance through a private employer, will a Harris administration still consider that child "uninsured?" Why couldn't that child be put on his or her parents' insurance plans?
Expanding the number of insured Americans through Obamacare is what got us into this health care fiasco. Prices skyrocketed. Care went down the drain. It's been a disaster. And if someone is uninsured because they can't afford insurance, where does that money to pay for their care come from? Thin air? | 2024-02-11T01:26:59.872264 | https://example.com/article/7215 |
We've all seen this too many times.
The foul balls hurtling over the dugouts. The shattered bats gyrating into the seats.
The innocent people -- women, kids, grown men -- crumpled over in pain. Blood streaming. Medical crews sprinting in their direction.
Baseball games grinding to a halt. Players' faces etched in pain.
Too. Many. Times.
"I've got a glove over there, and I'm paying attention, and I still get nervous," New York Mets third baseman David Wright said this week. "So you just kind of hold your breath every time you see a ball go into the stands quickly."
It's no accident then that this year, more than any other, we've heard more voices than ever asking: Why? Why are we still talking about this? Why haven't the powers that be in Major League Baseball done something already?
Well, here's the truth: Baseball is going to act. Among MLB and club officials, there is too much strong sentiment to address this problem by next Opening Day for baseball to ignore that sentiment and do nothing. And MLB is already in the midst of the most scientific study of this issue that has ever been conducted.
But here's what I've learned, after spending the last week talking to people inside and outside the game about fan safety:
It's complicated. More complicated than a lot of folks in the sports or media business have let on lately. Here is why:
Serious injuries this season have turned fan safety into a much larger concern for MLB. AP Photo/Charles Krupa
No ballpark is the same
It seems like such basic stuff, to string protective netting down the lines. But is it? Really?
Fenway Park was built in 1912. Marlins Park was built in 2012. Do they have anything in common -- other than four bases, a pitcher's mound and the greenest grass in town?
Turner Field was built for the Olympics. The O.co Coliseum in Oakland was built for the late, great American Football League. Seven ballparks have roofs overhead. All but two of them retract.
There's next to no foul territory in Wrigley Field. There's enough foul territory in Oakland for the Raiders to practice their punt coverage.
Get the picture? So to extend netting in each ballpark requires a different architectural and engineering challenge. Not to mention the fact that each city imposes different construction rules and standards. So any sport-wide edict would have to be flexible, so it can take all of that into account.
"There are going to be some individual decision-making here because of the design of ballparks," MLB commissioner Rob Manfred, said during a visit to Philadelphia on Thursday. "The designs are so different. Frankly, when we started to look at it, you lose track of how different they really are. It's more of a challenge to devise meaningful guidelines for the industry because the ballparks are so different."
The Tokyo Dome and other Japanese ballparks have protective netting that surrounds most of the playing field. Yuki Taguchi/Getty Images
What areas need protection?
In Japan, protective netting extends from foul pole to foul pole. In most big-league ballparks, that netting extends only from on-deck circle to on-deck circle. So even if there's overwhelming sentiment around the sport to expand that netting, how far does it really need to be extended?
That's a question MLB itself can't even answer -- yet. So Manfred told the 30 owners at this month's owners meeting that baseball is looking into that very question and all its permutations.
How many foul balls enter the stands during an average game? Where do those foul balls land? Where are fans in any significant danger, and where is there next to no danger? MLB is gathering that data as we speak. It expects to have the results sorted out soon, so that recommendations can be presented to owners at their November meetings, Manfred said Thursday.
But while we await those findings, we gathered our own, courtesy of Edwin Comber, creator of the fascinating website, Foulballz.com. Here's what he told us:
• Over the 15 years he has studied this, the average number of foul balls hit per game is 46. Between 15 and 17 land in the stands. Another 10 are fielded by a player, coach, ball boy, etc., and flipped into the seats. The rest end up in dugout ball bags and get recycled for batting practice the next day.
• "Generally," Comber wrote in an e-mail, "the most dangerous areas, those areas that have the foul balls with the most speed and lowest trajectory (a.k.a. line drives), are those between the netting and dugout, those sections behind the dugouts and one or two sections beyond that. Beyond that, the velocity drops significantly and, to reach those seats, the foul has to be elevated. That gives fans more time to respond."
So does baseball genuinely need to extend the netting all the way to the foul poles? Comber says no. In fact, he's not even convinced there's a legitimate need to extend that netting at all. But then again, he wouldn't be one of the people sued by the next fan who gets hit by a foul ball.
Some fans believe watching the game from behind a protective net would ruin their viewing experience. Tom Dahlin/Getty Images
Do fans even want to be protected?
When columnists and talk-show hosts demand that MLB protect its fans, they're forgetting something: Not all of those fans are looking for protection.
When the players' union raised the issue, in both the 2006 and 2011 labor negotiations, of extending the netting beyond just the home-plate area, MLB's response was that fan surveys showed that people opposed the idea.
More recently, in a June online poll of 475 people at NJ.com, following the serious injuries suffered by a woman hit by a bat at Fenway Park, 57 percent of respondents said MLB should not extend that netting down the lines in the interest of fan safety.
And executives of clubs around the sport report that a large segment of their fan bases continues to tell them it doesn't want to pay big bucks for the best seats in the house and have to peer through any kind of netting -- or lose the ability to interact with players.
But it isn't just them. Even in the midst of strong comments by players across baseball this month, urging MLB to take action, it's not too difficult to find other players who admit that even they have mixed feelings.
Asked this week about some of the potential solutions that baseball is thought to be studying, Mets outfielder Curtis Granderson told ESPN.com: "I'd be interested to see some of the ideas. But then, don't forget the fans. Ask them their opinion. Say, 'We're going to try this.' And ask them what do they think: 'Do you like this, or do you not like it?' We're still going to play. But the fans are going to decide if they want to come or not come because of this. So ask them."
Excellent point. So that's what we did.
Steve Kada, of Holland, Pennsylvania, sat with his 12-year-old son, Chris, in the second row behind the home dugout at Philadelphia's Citizens Bank Park on Wednesday night, enjoying the spectacular view. I asked if having a net in front of him would affect his enjoyment of this experience.
"It would," he said, without any hesitation. "The idea of having a clear view, where you can almost reach out and touch these guys, I think is worth the price of admission. And it would bother me. Knowing the risk involved, I would still take that chance -- and keep an eye on this guy," patting his son on the shoulder.
I asked Steve Kada if he thought baseball could lose something that it couldn't recapture, if fans along each line were to find themselves sitting behind netting.
"I think so," he said. "I'd have to give it some thought. But honestly, the whole idea of being boxed in while at a stadium is not something I would enjoy. The whole experience of it -- the field being up close, it's open -- that's just part of the game. And where does it stop? I don't want to be caged in."
But how many fans share those views? These days, there is no better vehicle than social media to find out. So on Thursday, I asked people on Twitter:
Serious question for a piece I'm working on: If MLB extended netting to dugouts or foul poles, would you no longer want to sit there? — Jayson Stark (@jaysonst) August 27, 2015
Almost instantly, the tweets back began flooding in, by the hundreds. I found I couldn't count them all and write this column at the same time. So I logged the responses of the first 100 people who took a clear stand. It turned out 68-32 in favor of more netting.
But two hours later, I went back and noticed something. Sentiment had turned. So I counted another 100 responses -- and it turned out much closer, only 54-46 in favor of more netting.
So what does that tell us? Well, as I recall mentioning at the top of this story, it's complicated.
And that's one reason Manfred hasn't acted yet, even after saying in June, following the incident at Fenway, that MLB would "react strongly" on this issue.
The commissioner - and, in fact, all MLB officials - have been reluctant in recent weeks to comment publicly on the specifics of what they're contemplating because of a lawsuit filed in July on behalf of an Oakland A's season-ticket holder, and because of the fear of more lawsuits.
"I'd be interested to see some of the ideas. But then, don't forget the fans. Ask them their opinion. ... We're still going to play. But the fans are going to decide if they want to come or not come because of this. So ask them."
Yet behind the scenes, it's becoming more clear every day that the question baseball is pondering is no longer whether to take action. It's what action, or actions, make the most sense and will least affect the experience of attending a baseball game.
So MLB is studying a number of different options. There are advancements in netting itself, such as this one, which would minimize the distractions of watching a game from behind a net. They'll be looked at.
There is the potential for retractable netting, similar to the netting the NFL raises and lowers for extra-point and field-goal attempts. Ideally, that would preserve the sort of fan-player interaction this sport would hate to see disappear -- players giving autographs, flipping baseballs into the seats at the end of every inning, etc.
There could be options to install netting of varying heights, depending on how far down the line it would be located, and to maintain openings overhead, so fans could still catch high foul balls but be protected from those ominous screaming line drives.
Or there is still the possibility that MLB could do what the NHL did more than a decade ago, after a fan was hit by a puck and died: Just decide that safety takes precedent over anything and everything, put up that netting and assume that fans will get used to it sooner than they think.
The Arizona Diamondbacks quietly extended the netting in their park in 2014, on their own. The complaints have long since stopped. The St. Paul Saints, of the American Association, did the same. Here's what their owner, Tom Whaley, tweeted Thursday:
Exactly. We extended it to ends of dugouts. A lot of talk prior, not one complaint after. Has cut EMS calls way down https://t.co/2xryHytV1T — Tom Whaley (@TWSaint) August 27, 2015
But people inside the game also have come to grips with this unfortunate reality: No matter what they do, they can't protect every fan from every potential mishap -- for one fundamental reason:
They're not even watching the game
Look around. You see it every night. Many spectators now spend more time looking at their phones, their food, their beverages, their friends and the many sights and sounds around them than they do actually watching the baseball game unfolding in front of them. And that's a huge issue, with no easy solution.
"I'd like to see something happen [to protect fans from injuries]," said Philadelphia Phillies player rep Justin DeFratus. "But as far as me, my personal opinion, the best way to prevent it is: Fans need to pay attention to the game."
Practically every day, DeFratus said, he sees fans in the outfield getting smoked by home-run balls -- in the face. In batting practice. And "by the time you say, 'Heads up,' it's too late," he said. So he and his fellow pitchers, in the outfield shagging flies, often find themselves "screaming out there, 'You've got to pay attention to the field,' especially if there are kids, because the last thing you want to see is somebody get hit in the mouth."
Josh Donaldson would no longer be able to propel himself into the stands after a foul ball if netting were in place. Tom Szczerbowski/Getty Images
But no matter what MLB decides to do or not do, we are never going to live in an age where nets extend all the way around the outfield and block home runs from reaching the seats. So there is always going to be a certain amount of risk involved in attending a baseball game. And that won't ever change.
But that's not all this sport is working hard to keep from changing. Here's a question: If netting circles the field, would it mean the end of some of baseball's greatest Web Gem moments -- Anthony Rizzo, Josh Donaldson, Nolan Arenado, Derek Jeter, etc., toppling into the stands to turn foul balls into outs? We hope not.
"I don't want to go diving into a net some day," laughed David Wright. "That's for sure."
And even more important, would those nets put an end to a long tradition of players and fans sharing priceless moments of interaction -- bonded by autographed pictures, souvenir baseballs and photo ops? Again, we hope not.
"I know a lot of fans get really upset when you toss the ball to the person next to them and you didn't toss it to them, at least in my experience," Granderson said. "And I'm like, 'Guys, there are 40,000 of you. I've got one ball. Sorry I didn't toss it right to you. But this person also asked. And that person also asked.' And that's a question that gets asked a lot, from a fan to a player: 'Can I have ... ball, bats, batting gloves, jersey, hat, this, that and the other thing?' And so, since there are openings, if I say yes, I can give it to them. So there would definitely be a lot of people who have asked that question, that will be slightly disappointed, I think, if we put up nets."
But is there a middle ground out there somewhere? Some way to protect those who need protecting, but not have that netting turn into an impenetrable wall, one that separates players from customers for the rest of time?
That's a question Rob Manfred and his cohorts are attempting to answer as you're reading this. Fortunately, they seem to fully comprehend that fan safety needs to be at the top of their priority list right now. But what's a solution that works for everyone? Whew. As we were saying ... it's complicated. | 2024-07-21T01:26:59.872264 | https://example.com/article/5602 |
Primary menu
Post navigation
Why Dr Naomi Wolf has the right to be heard, the creation of space
A quick explanation in defence of Dr Naomi Wolf’s engagement with Australia’s political discourse and why I consider her bullied by Australia’s mainstream media.
In seeking to defend Dr Wolf I’m not going to pretend that I formally know her method. I do know it is the antithesis of mine. I further know that similar methods are regularly employed within academia and educational discourse. While I do not embrace this kind of method, I have empathy towards it.
My twitter engagement with Dr Wolf’s defence came in response to a quoted tweet by Laurie Oakes headed “Ignoramus alert” that I considered an insulting slur buttressed by supporting argument from Antony Green. My interest was piqued because the substance of Dr Wolf’s tweet seemed mild and within the bounds of everyday reason. To paraphrase, it stated that a pro-corporate committee was directing Australia’s response to COVID while parliament was disbanded, and that this had no place in a democracy. While colourfully expressed, the sentiment seemed reasonable and was vindicated only few days later when extra sitting days were scheduled for Australia’s parliament. The response by Oakes and Green seemed disproportionate to what Dr Wolf was stating in an aside tweet about American politics.
I was first puzzled by the forcefulness of the attack and it became apparent that it was borne of existing enmity. I became increasingly convinced its vehemence was unwarranted.
When I was alerted to an article in the New York Times titled Naomi Wolf’s Career of Blunders Continues in ‘Outrages’ the penny dropped. The article made clear that there is no formal logic in Dr Wolf’s work, and that it can have a tenuous correspondence to material reality. This reflects well established methods in academia. Methods that I will first describe before explaining why they are used.
An absence of logic emerges from the work of French philosopher Jean-François Lyotard who developed the concept of paralogy and self-legitimation (1). Paralogy is the ongoing creation of meaning in dialogue. Paralogical reasoning does not conform to any rules of logic, and meaning is self-legitimating without recourse to external structures. The prominent French philosopher Michel Foucault employed a similar method of self-writing (2). Derrida is another seminal thinker who developed the concept of arche-writing as writing that precedes speech and where meaning emerges in text before speaking (3). Each of these methods are not based on conventional logic, but neither are they whimsical.
The methods developed by Lyotard, Foucault and Derrida emerged in the 1960s when western countries still colonised much of Africa and Asia, with several western nations still at war with Vietnam. Homosexuality was then a criminal offence in most countries, as was abortion. The sexual liberties afforded by the Pill were only just emerging. The paralogical reasoning afforded by French thinkers provided the means for new words and codes to be playfully, and often painfully, brought into language. It led to new symbols and codes such L, G, B and T and the acronym LGBT. These letters were first self-legitimated before being brought into mainstream discourse and legislative structures. For those of a certain age, it can be hard to remember the time when the term LGBT contained no meaning or logic, and when the logic of the world was forcefully Eurocentric. The methods emerging from Paris May 68 focused on ongoing meaning making and provided a means for developing equity and equality across different logic systems, cultures, sexualities and genders. The methods were effectively employed by Gayatri Spivak to challenge colonial hegemony (4), by Judith Butler to explore construction of gender (5), and by Foucault to expand the logic of sexuality (6,7,8). The method employed by Dr Wolf therefore has deep antecedents.
The world has changed and progressed significantly from the days when paralogical methods were first developed. The methods themselves have similarly evolved and are employed in the corporate sector for ‘blue sky thinking’ to propel startup companies. In politics the method has morphed into rhetorical forms disengaged from reality as employed by Donald Trump. It also propels an entertaining pastiche Marxist logic often found in the work of Guy Rundle and other reactionary progressives. Paralogical reasoning provides for new ways of meaning making, something Dr Wolf seems to pursue.
While I do not find paralogical methods particularly helpful in education, they nevertheless have a role. In education, I consider paralogical methods akin to what the British psychoanalyst Wilfrid Bion described as reverie between mother and baby, as a playful way of getting to know what is in the mind of the other (9). Paralogical thinking requires playful engagement and opens new spaces into which excluded groups, or a child, might be let in.
I found Oakes’ intervention in Dr Wolf’s narrative reminiscent of the misogynistic ditch-the-witch campaigns that emerged after his ambushing of Julia Gillard’s 2010 election campaign. The teaming of Oakes and Green evokes the chilling colonising defence of empire by John Batman and George Robinson described by Bruce Pascoe (10). It’s a kind of logic entrenched in Australia’s colonising culture. Further, Claire Connelly’s call for Australian twitter users to mute Dr Wolf is largely consistent with Australian definitions of covert bullying which includes social media campaigns to promote social exclusion. Green’s intervention is however more fascinating.
Green seemed frustrated by Dr Wolf’s assertions, a frustration often expressed as a failure in himself, or in others, to ‘understand’. This frustration can be explained by psephology not requiring the creation of new meanings. Psephologists are analytic thinkers who interpret what exists and meaningfully convey interpretations of that reality. Analytical thinking is distinct from what the British philosopher Stephen Toulmin described as substantial argument that addresses higher order predicates such as what is true, what is right, and what is beautiful (11). Analytical argument is of course antithetical to paralogical reasoning. Green’s better response might be to avoid Dr Wolf’s style of engagement, embrace a form of substantial argument, or playfully engage in paralogy.
While Green’s preeminent logic as a psephologists is highly valued among Australians, they are also fixed in what is. The logic is fixed in a system that excludes the voice of Indigenous Nations in parliament, and fixed in a system where the highest authority is a foreign national. The vehement psephological defence of the existing structure evokes a reinforcement of the fort walls described by Dwayne Donald as a colonising social dichotomy between settler and Indigenous (12). It’s a circling of the wagons and defence of empire that drove Yassmin Abdel-Magied out of Australia after she too created a wonderful new space for Australian children (13). For mine, the fixed walls need to be brought down, and the kind of method employed by Dr Wolf provides for that, even if it’s not her intent.
My defence of Dr Wolf might not be a defence at all, but just an entry into the space created by her engagement with Australian politics. A space Dr Wolf might be oblivious to, a space in-between where parliament was reopened. Regardless, my personal method requires inter-subjective engagement where everybody be heard in goodwill (14).
I’m sure Dr Wolf can look after herself. Whatever she might be meaning, a failure to understand is simply a failure by the hearer to understand, and not a flaw in a speaker’s intent. Whatever the process, method, or meaning, Dr Wolf’s method is academically established, credentialed and valued. It provides a legitimate perspective that has a right to be heard and respected. Even if the hearer does not understand it.
Lyotard, J.-F. (1984). The postmodern condition: A report on knowledge. Minneapolis: University of Minnesota Press. (Original work published 1979)
Spivak, G. C. (2010). Can the subaltern speak? In R. C. Morris (Ed.), Can the subaltern speak?: Reflections on the history of an idea (pp. 21-78). New York: Columbia University Press. (Original work published 1985)
Koomen, M. (2019). The method of rational reconstruction for education in the tradition of Habermas. International Journal of Research & Method in Education, 1-20. https://doi.org/10.1080/1743727x.2019.1641795 | 2023-10-20T01:26:59.872264 | https://example.com/article/7543 |
1. Field of the Invention
The present invention relates to semiconductor memory devices, and more particularly, to a structure for data input and output in a dynamic type semiconductor memory device having a plurality of data input/output pins.
2. Description of the Background Art
FIG. 1 shows a structure of a general data processing system. Referring to FIG. 1, a data processing system includes a data processor 900 of, for example, a CPU (Central Processing Unit), a DRAM (Dynamic Random Access Memory) 920 as an external memory device, and a DRAM controller 910 for controlling the access from data processor 900 to DRAM 920.
DRAM controller 910 includes an address multiplexer 912 for multiplexing an address signal provided from data processor 900 on an address bus 921a into a row address signal and a column address signal, and providing the same to DRAM 920 via an address bus 921b, a data buffer 914 for carrying out buffering of data transfer between data processor 900 and DRAM 920, and a control driver 916 for generating and providing to DRAM 920 via a control bus 923b a control signal required for driving DRAM according to a control signal provided from data processor 900 on a control bus 923a. Data buffer 914 carries out data transmission/reception with data processor 900 via a data bus 922a, and carries out data transmission/reception with DRAM 920 via a data bus 922b.
Control driver 916 provides a wait signal to CPU 900 via control bus 923a when DRAM 920 is not accessible due to carrying out, for example, an automatic refresh operation.
FIG. 2 schematically shows a structure of a conventional DRAM used as DRAM 920 of FIG. 1. In FIG. 2, a structure of a 4M-bit DRAM is shown with four data input/output terminals (referred to as "IO pin" hereinafter).
Referring to FIG. 2, a 4M-bit DRAM includes a memory cell array 57 having a plurality of dynamic type memory cells 57a arranged in a matrix of 1024 (=2.sup.10) rows.times.4096 (=2.sup.2 .multidot.2.sup.10) columns. In memory cell array 57, a word line WL is provided corresponding to each row of memory cells. A pair of bit lines BL and /BL is arranged corresponding to one column of memory cells 57a.
The 4M-bit DRAM further includes a row address buffer 52 for receiving an external address signal Ai (i=0-9) for generating complementary row address signals RAi and /RAi, a row decoder 53 for decoding row address signals RAi and /RAi from row address buffer 52 to select a corresponding word line in memory cell array 57, a sense amplifier group 58 having a sense amplifier SA provided corresponding to each column (each bit line pair) of memory cell array 57 for detecting and amplifying data of a memory cell connected to a selected word line by row decoder 53, a column address buffer 55 for receiving an externally applied address signal Ai for generating complementary column address signals CAi and /CAi, a column decoder 56 for decoding a predetermined address signal bit from column address buffer 55 to select a corresponding column in memory cell array 57, and an I/O control circuit 59 for selecting a column according to a predetermined column address signal bit from column address buffer 55 out of the columns selected by column decoder 56 for carrying out data reception/transmission with the selected column.
Column decoder 56 receives column address signal bits CA2-CA9 and /CA2-/CA9 from column address buffer 55. Because there are 4096 columns in memory cell array 57, column decoder 56 selects a bit line pair provided corresponding to 16 columns in memory cell array 57 by a column address signal of 8 bits.
Control circuit 59 further selects 4 columns out of the 16 columns selected by column decoder 56 according to column address signal bits CA0, /CA0, CA1 and /CA1 from column address buffer 55. I/O control circuit 59 transmits internal write data DIO0-DI03 to the selected 4 columns when a write control signal WD from a write control signal generation circuit 63 which will be described afterwards is activated.
The DRAM further includes an input circuit 64 for input of data, an output circuit 61 for providing data, a write control signal generation circuit 63 for controlling data input and output, and a /RAS buffer 51 and a /CAS buffer 54 for controlling the write control signal generation circuit 63 and internal operation of this DRAM.
/RAS buffer 51 receives an externally applied row address strobe signal ext /RAS to provide an internal row address strobe signal /RAS. Internal row address strobe signal /RAS is used to activate the circuit associated with row selection inside the DRAM. In FIG. 2, internal row address strobe signal /RAS is indicated as to be applied only to row address buffer 52. Row address buffer 52 responds to activation of internal row address strobe signal /RAS to latch an external address signal Ai, and to provide row address signals RAi and /RAi.
/CAS buffer 54 receives an external column address strobe signal ext /CAS to generate an internal column address signal /CAS. Internal column address strobe signal /CAS provides the latching and generating timing of a column address signal in column address buffer 55, and also controls the input and output operation of data.
Output control signal generation circuit 60 receives an internal column address strobe signal /CAS from /CAS buffer 54 and an externally applied output enable signal /OE to generate an output control signal OD when both of these two signals attain an activated state of a low level. Output control signal OD attains a high level at the time of activation.
Write control signal generation circuit 63 receives a column address strobe signal /CAS from /CAS buffer 54 and an externally applied write enable signal /WE to generate and provide to I/O control circuit 59 a write control signal WD having a constant pulse width when both the two signals attain an activated state of a low level. Write control signal WD attains a high level at the time of activation.
Output circuit 61 includes output buffers 61a-61d activated in response to an output control signal OD from output control signal generation circuit 60 to provide to IO pins 62a-62d data DQ0-DQ3 of logics respectively corresponding to internal output data DO0-DO3 of 4 bits provided from I/O control circuit 59.
Input circuit 64 includes input buffers 64a-64d for receiving at IO pins 62a-62d external write data DQ0-DQ3 to provide in parallel internal write data DI0-DI3 of logics corresponding to these external write data to I/O control circuit 59. Next, the operation of the 4M-bit DRAM of FIG. 2 will be described.
First, a data reading operation will be described with reference to the operation waveform diagram of FIG. 3.
An address signal Ai (i=0-9) corresponding to a row address is provided from an external source. At time t1 when an external row address strobe signal ext /RAS falls to a low level of an activated state, an internal row address strobe signal /RAS provided from /RAS buffer 51 attains an activated state of a low level. In response to internal row address strobe signal /RAS of an activated state, row address buffer 52 latches an address signal Ai to provide row address signals RAi and /RAi.
Row decoder 53 decodes row address signals RAi and /RAi from row address buffer 52 to select a word line corresponding to a row address in memory cell array 57 according to the decoded result. The data of the memory cell array connected to the selected word line WL is read out onto a corresponding bit line. Then, sense amplifier SA in sense amplifier group 58 is activated, whereby the potential of a corresponding bit line pair is amplified differentially.
In parallel to this row selection and sensing operation, output enable signal /OE provided to output control signal generation circuit 60 attains a low level of an activated state at time t2. At this time point, internal column address strobe signal /CAS is not activated, so that output control signal OD provided from output control signal generation circuit 60 maintains a low level of a deactivated state.
An address signal Ai (I=0-9) corresponding to a Y address (column address) is applied. Then, an external column address strobe signal ext /CAS falls to a low level of an activated state at time t3. In response, internal column address strobe signal /CAS generated from /CAS buffer 54 attains a low level of an activated state. In response to an internal column address strobe signal /CAS of an activated state, column address buffer 55 latches an address signal Ai to provide column address signals CAi and /CAi. Column decoder 56 decodes column address signal bits CA2, /CA2-CA9, /CA9 to select 16 pairs of bit lines in memory cell array 57.
The data of the 16 pairs of bit lines selected by column decoder 56 are provided to I/O control circuit 59, whereby the data of 16 bits is amplified by a preamplifier not shown.
I/O control circuit 59 further selects 4 bits out of the 16-bit data amplified by the preamplifier according to the logics of column address signal bits CA0, /CA0, CA1 and /CA1 from column address buffer 55. The data of 4 bits are amplified by a main amplifier in I/O control circuit 59 to be transmitted to output buffers 61a-61d in output circuit 61 as internal output data DO-DO3.
Output control signal generation circuit 60 raises output control signal OD to a high level of an activated state when internal column address strobe signal /CAS becomes activated at time t3. In response, output buffers 61a-61d in output circuit 61 are enabled, whereby data DO0-DO3 transmitted from I/O control circuit 59 are buffered and provided in parallel to IO pins 62a-62d as data DQ0-DQ3.
A data writing operation will be described hereinafter with reference to FIG. 4. Write data DQ0-DQ3 are provided to IO pins 62a-62d. Input buffers 64a-64d in input circuit 64 provide to I/O control circuit 59 internal data DI0-DI3 of logics corresponding to write data DQ-DQ3 applied to IO pins 62a-62d.
Here, an address signal Ai (i=0-9) corresponding to an X address (row address) is provided from an external source. When external row address strobe signal ext /RAS attains a low level of an activated state at time t1, row address buffer 52 latches an address signal Ai to provide internal row address signals RAi and /RAi. According to row address signals RAi and /RAi, a corresponding word line in memory cell array 57 is selected by row decoder 5.
At time t2, write enable signal /WE attains an activated state of a low level. Here, write control signal WD provided from write control signal generation circuit 63 maintains the low level of a deactivated state since internal column address strobe signal /CAS is not yet activated.
An address signal Ai (i=0-9) corresponding to a Y address (column address) is applied. Then, at time t3, an external column address strobe signal ext /CAS falls to a low level of an activated state. In response, internal column address strobe signal /CAS provided from /CAS buffer 54 attains a low level of an activated state. Column address buffer 55 latches the address signal Ai to provide column address signals CAi and /CAi. Column decoder 56 decodes column address signals CA2, /CA2-CA9, /CA9 to select 16 pairs of bit lines in memory cell array 57, whereby these 16 pairs of bit lines are connected to I/O control circuit 59.
At time t3 when internal column address strobe signal /CAS attains an activated state, write control signal WD provided from write control signal generation circuit 63 rises to a high level of an activated state for a predetermined time. In response to this write control signal WD of an activated state, I/O control circuit 59 decodes column address signals CA0, /CA0, CA1 and /CA1 from column address buffer 55 to transmit respectively internal write data DI0-DI3 provided from input buffers 64a-64d to 4 pairs of bit lines out of the 16 bit line pairs.
When external row address strobe signal ext /RAS rises to a high level, and external column address strobe signal /CAS rises to a high level at time t4, one memory cycle is completed.
As described above, signals /RAS and /CAS must be pulled down to a low level of an activated state to access a DRAM. When an external row address strobe signal ext /RAS once attains a deactivated state of a high level, external row address strobe signal ext /RAS cannot be pulled down to a low level until the elapse of a time period called a RAS precharge time tRAS. This is to reliably precharge the potential of a bit line or the like to a predetermined potential. Therefore, there is a problem that a DRAM cannot be accessed at high speed.
A possible consideration to implement a high speed memory system is to provide in parallel a plurality of DRAMs to reduce the access time effectively by sequentially accessing these plurality of DRAMs.
FIG. 5 shows an embodiment of such a memory system structure. Referring to FIG. 5, a memory system includes a memory #A925a and a memory #B925b provided in parallel with a data bus 922. A processor 926 is connected to data bus 922. Processor 926 is not limited to a CPU and may be a data processor such as a DSP (Digital Signal Processor). An address is applied to memories #A925a and #B925b in common via an address bus 921. Similarly, a signal /RAS defining a memory cycle is also applied. Separate input/output control signals .phi.RW1 and .phi.RW2 are provided to memory #A925a and memory #B925b, respectively. Signals /RAS, .phi.RW1 and .phi.RW2 are transmitted on a control bus 923. Input/output control signals .phi.RW1 and .phi.RW2 correspond to respective combinations of signals /RAS, /WE, and /OE.
When signals .phi.RW1 and .phi.RW2 attain a low level of an activated state, data input/output with respect to memory #A925a and memory #B925b is allowed. The operation of the memory system of FIG. 5 will be described hereinafter with reference to an operation waveform diagram shown in FIG. 6.
With signal /RAS attaining an activated state of a low level and memories #A925a and #B925b attaining an operational state, an internal row selecting operation is executed. Then, input/output control signal .phi.RW1 is pulled down to a low level of an activated state, and memory #A925a is accessed to carry out input or output of data DQA. Input/output control signal .phi.RW1 is rendered to a deactivated state of a high level, simultaneous to the fall of input/output control signal .phi.RW2 to an activated state of a low level. Then, data input/output with respect to memory #B925b is executed.
Data of memory #A925a and data of memory #B925b will appear continuously on data bus 922, so that data input/output can be executed at high speed without being affected by a RAS precharging time.
In the structure shown in FIG. 5, toggling of a column address strobe signal /CAS such as in a page mode operation is not required, and access can be carried out more rapidly than in a page mode. In page mode, a column address strobe signal /CAS is toggled while row address strobe signal /RAS maintains a low level of an activated state as shown in FIG. 7. In response to signal /RAS attaining an activated state, a row address signal is latched to select one row in the DRAM array. In response to the transition of signal /CAS to an activated state, a column address signal is fetched to carry out a column selecting operation in a DRAM array. Because a different column address signal is fetched for each toggle of signal /CAS, data reading or writing is executed of a memory cell corresponding to each column address. FIG. 7 shows an example where data reading is carried out. In such a page mode, there is a CAS access time of tCAS starting from the fall of signal /CAS up to the output of a valid data. Because input/output control signals .phi.RW1 and .phi.RW2 include a signal /CAS in the memory system of FIG. 5, there exists CAS access time for each of memories #A and #B. However, the toggle of column address strobe signal /CAS can be excluded effectively to eliminate the transition time of signal /CAS to a high level, resulting in access at high speed.
In a memory system, an error detection circuit for ensuring reliability of data is provided. A parity bit is generally used for error detection. A bit of "0" or "1" is added so that the number of "1" in the data becomes an even number or an odd number. This additional bit is called a parity bit.
FIG. 8 schematically shows a structure of a memory system including error checking functionality. Referring to FIG. 8, a memory system includes a data memory 930 for storing data, a parity bit memory 932 for storing a parity bit corresponding to each data stored in data memory 930, and a parity checking circuit 934 for generating a parity bit and carrying out error detection. An address signal and a control signal are applied to data memory 930 and parity bit memory 932 via an address bus 933 and a control bus 935.
Data memory 930 carries out data transmission/reception with data bus 931. FIG. 8 shows an embodiment where data bus 931 has a width of 8 bits. Data generally has a byte as the minimum unit, and one parity bit is added to a 8-bit data.
In data writing operation, parity checking circuit 934 generates one bit of parity bit from the data of 8 bits on data bus 931 to write the same into parity bit memory 932. In data reading, parity checking circuit 934 receives data of 8 bits from data memory 930 read out on data bus 931 and a parity bit read out from parity bit memory 932 to make determination whether the number of "1"s included in the data bits and the parity bit is an even number (or an odd number). An error flag is generated according to this determination to indicate whether an error bit is included in the data bit. The operation of parity checking circuit 934 will be described briefly with reference to FIGS. 9 and 10.
The operation of the parity checking circuit in data writing will be described with reference to FIG. 9. In general, a write enable signal /WE is pulled down to an activated state of a low level prior to column address strobe signal /CAS (early write cycle). In response to write enable signal /WE (applied via control bus 935), parity checking circuit 934 fetches the write data on data bus 931 to generate a parity bit PB. When column address strobe signal /CAS attains an activated state of a low level, write data D and parity bit PB are written into data memory 930 and parity bit memory 932, respectively.
The operation of data reading will be described with reference to FIG. 10. Following the activation of signal /CAS to a low level, data bit Q from data memory 930 and parity bit PB from parity bit memory 932 attain an ascertained state after an elapse of a predetermined time. Using these data bits of the valid state, parity checking circuit 934 counts the number of "0"s (or "1"s) included therein to make determination whether an error bit is included in data bit Q according to the counted result. When signal /CAS attains a deactivated state of a high level, an error flag from parity checking circuit 934 is decided.
By using the above-described parity checking circuit 934, an error in a data bit can be checked to form a memory system of high reliability.
FIG. 11 shows a specific structure of a memory system including conventional parity checking functionality. Referring to FIG. 11, the memory system includes first and second memory groups 10 and 30 connected parallel to a data bus 20 of a width of 16 bits.
First memory group 10 includes two memory sub-groups 12 and 13. Second memory group 30 includes two memory sub-groups 32 and 33.
Memory sub-group 12 includes 4M-bit DRAMs 12a and 12b, each including four IO pins 11. Memory sub-group 13 includes 4M-bit DRAMs 13a and 13e, each including four IO pins 11. Each IO pin 11 of DRAMs 12a and 12b of memory sub-group 12 is connected to control buses 20a and 20b of a width of 4 bits. IO pins 11c and 11d of DRAMs 13a and 13b are connected to control buses 20c and 20d, respectively, of a width of 4 bits.
Memory sub-group 32 includes 4M-bit DRAMs 32a and 32b having four IO pins 31a and 31b, respectively. Memory sub-group 33 includes 4M-bit DRAMs 33a and 33b having four IO pins 31c and 31d, respectively. IO pins 31a, 31b, 31c and 31d are connected to control buses 20a, 20b, 20c and 20d, respectively.
Write enable signal /WE, output enable signal /OE, external row address strobe signal ext /RAS, and an address signal are provided in common to DRAMs 12a, 12b, 13a, 13b, 32a, 32b, 33a, and 33b. External column address strobe signal ext /CAS0 is applied to DRAMs 12a and 12b of memory sub-group 12. External column address signal ext /CAS1 is applied to DRAMs 13a and 13b of memory sub-group 13. External column address strobe signal ext /CAS2 is applied to DRAMs 32a and 32b of memory sub-group 32. External column address strobe signal ext /CAS3 is applied to 4M-bit DRAMs 33a and 33b of memory sub-group 33.
According to the above-described structure, control of data input/output can be carried out in the units of memory sub-groups, i.e. in the units of 8 bits.
The memory system further includes a parity bit memory 40 having 1M-bit DRAMs 42a, 42b, 42c and 42d provided corresponding to memory sub-groups 12, 13, 32 and 33. 1M-bit DRAMs 42a-42d respectively include one of IO pins 41a-41d. In FIG. 11, a parity checking circuit for generating a parity bit and carried out parity checking is indicated simply by blocks 43a, 43b, 43c and 43d. A control signal similar to that provided to corresponding memory sub-group is applied to parity checking circuits 43a and 43d. For the sake of simplification, this signal path and the data input/output path are not shown.
A control signal similar to that applied to a corresponding memory sub-group is provided to each of 1M-bit DRAMs 42a, 42b, 42c and 42d. The operation will be described briefly hereinafter.
First, the operation of providing data of 16 bits from memory group 10 will be described. Here, external row address strobe signal ext /RAS attains an activated state of a low level. Therefore, 4M-bit DRAMs 12a, 12b, 13a, 13b, 32a, 32b, 33a and 33b latch an applied address signal as a row address signal. Similarly, in parity bit memory 40, 1M-bit DRAMs 42a-42d latch a row address signal.
Then, external column address strobe signals ext /CAS0 and ext /CAS1 provided to first memory group 10 attain an activated state, and DRAMs 12a, 12b, 13a, 13b in memory group 10 latch an address signal as a column address signal.
In second memory group 30, external column address strobe signal ext /CAS2 and ext /CAS3 both maintain the deactivated state of a high level. Therefore, although 4M-bit DRAMs in second memory group 30 execute a column selecting operation, an output high impedance state is maintained since an output control signal is not generated as shown in FIG. 2.
When output enable signal /OE attains an activated state of a low level, data of 16 bits are provided on data bus 20 from first memory group 10 via IO pins 11a-11d. Simultaneously, a parity bit is provided from 1M-bit DRAMs 42a and 42b in parity memory circuit 40. Parity checking circuits 43a and 43b check whether the number of "1"s in the data of 8 bits is an even number (or an odd number) on the basis of the parity bit provided from 1M-bit DRAMs 42a and 42b, and the data provided from memory sub-groups 12 and 13. An error flag is set according to this checking result.
Next, the operation of writing data of 16 bits into memory group 10 will be described hereinafter. Similar to data reading, an external row address strobe signal ext /RAS and external column address strobe signals ext /CAS0 and ext /CAS1 are applied to memory group 10. External column address strobe signals ext /CAS2 and ext /CAS3 maintain the high level of a deactivated state for memory group 30. As a result, data writing to memory group 30 is inhibited.
When write enable signal /WE and external column address strobe signals ext /CAS0 and ext /CAS1 both attain an activated state of a low level, data of 16 bits on data bus 20 are written into 4M-bit DRAMs 12a, 12b, 13a and 13b in memory group 10. Parallel to this writing operation, parity checking circuits 943a and 943b respond to write enable signal /WE to generate a parity bit of "1" or "0" according to the number of "1" included in the data applied on data bus 20. In memory circuit 40, 1M-bit DRAMs 42a and 42b both attain a writing state, and parity bits generated from parity checking circuits 943a and 943b are written via IO pins 41a and 41b.
The reading and writing operation of data with respect to memory group 30 is similar to that of the first memory group 10. In this case, data input/output is inhibited in memory group 10, i.e. external column address strobe signals ext /CAS0 and ext /CAS1 both attain a deactivated state of a high level. Parity checking circuits 943c and 943d carry out parity checking at the time of writing a parity bit and reading out data with respect to 1M-bit DRAMs 42c and 42d.
In the memory system of FIG. 11, 4 DRAMs of a x1 organization is used for parity bit storage. The four DRAMs 42a-42d are activated simultaneously by external row address strobe signal ext /RAS and execute an operation related to row selection. However, the input/output of a parity bit is actually carried out only by two DRAMs and power is wasted. Furthermore, because four DRAMs are used, the circuit complexity of parity bit memory 40 is increased to become a bottleneck in forming a memory system of a small level.
An approach of using one 4M-bit DRAM (1M.times.4-bit DRAM) in a parity bit memory 40 is considered as shown in FIG. 12 to solve the above-described problem.
Referring to FIG. 12, a parity bit memory 40 includes one 4M-bit DRAM 43. 4M-bit DRAM 43 has a structure similar to a 4M-bit DRAM used in memory groups 10 and 30 for data bit storage. Parity bit memory 40 further includes a 4-input NAND circuit 44 for receiving external column address strobe signals ext /CAS0, ext /CAS1, ext /CAS2 and ext /CAS3, and an inverter circuit 45 for inverting an output of NAND circuit 44. An external column address strobe signal ext /CAS corresponding to 4M-bit DRAM 43 is generated from inverter circuit 45.
The structures of memory groups 10 and 30 are similar to those shown in FIG. 11. In FIG. 12, the parity checking circuit is not explicitly shown for the sake of simplification. NAND circuit 44 provides a signal of a high level when external column address strobe signal ext /CASk (k=0-3) attains an activated state of a low level, and column address strobe signal ext /CAS generated from inverter circuit 45 attains an activated state of a low level.
Parity bit memory 43 has a structure shown in FIG. 2. When column address strobe signal ext /CAS provided from inverter circuit 45 attains an activated state of a low level, data reading to IO pins 41a-41d and writing data applied to IO pins 41a-41d to selected memory cells are carried out. In this case, the following problem will occur.
For the sake of simplifying the explanation, it is assumed that a parity checking circuit is provided for each memory sub-group as shown in FIG. 13. More specifically, parity checking circuits 943a-943d are provided for memory sub-groups 12, 13, 32, and 33, respectively. Memory sub-groups 12 and 32 share a 8-bit data bus 20A, and memory sub-groups 13 and 33 share a 8-bit data bus 20B. A logic gate 46 shown in FIG. 13 includes NAND circuit 44 and inverter circuit 45 shown in FIG. 12.
The case is considered where data is to be written into memory sub-groups 12 and 13. Here, writing data to memory sub-groups 32 and 33 is inhibited. Parity checking circuits 943a and 943d execute a parity bit generation operation in response to a write enable signal /WE. Here, parity checking circuits 943a and 943c generate a parity bit from the data on 8-bit data bus 20A, and parity checking circuits 943b and 943d generate a parity bit from the 8 bit data on 8-bit data bus 20B. The parity bits generated by parity checking circuits 943a-943d are attained in response to the fall of external column address strobe signal ext /CASi to a low level. The parity bits generated by parity checking circuits 943a-943d are written in parallel to parity bit memory 43.
Here, the parity bits generated by parity checking circuits 943c and 943d are parity bits irrelevant of data written into memory sub-groups 32 and 33. Therefore, there is a problem that an erroneous parity bit is written into parity bit memory 43. Similar to a DRAM, when the outputs of parity checking circuits 943a-943d attain an ascertained state from a high impedance state in response to the fall of external column address strobe signal ext /CASi, the outputs of parity checking circuits 943c and 943d attain a high impedance state. Therefore, uncertain data of a high impedance state will be written into parity bit memory 43. Similarly, an erroneous parity bit data is written.
The data reading operation will next be described. A case is considered where data of memory sub-groups 12 and 13 are read out. Here, parity bits of 4 bits are applied from parity bit memory 43 to parity checking circuits 943a-943d. Parity checking circuits, 943a and 943b carries out error checking of a parity bit according to the data read out from memory sub-groups 12 and 13 and the parity bit provided from parity bit memory 43. In this case, proper error checking can be carried out. Parity checking by parity checking circuits 943c and 943d are not required. This means that parity bits not required are provided from parity bit memory 43. (All the output buffers in the output circuit shown in FIG. 2 operate in parallel). Therefore, there is a problem of increase in consumption power in parity bit memory 43.
When a parity checking circuit is provided for each 8-bit data bus instead of the structure of FIG. 13, and the connection between a parity checking circuit and a data bus is switched according to an external column address strobe signal ext /CASk (k=0-3), the IO pins of parity bit memory 43 attain a high impedance state in writing data to de-selected memory sub-groups, resulting in uncertain data being written. In reading out data, unrequired parity bits will be provided on signal lines attaining a high impedance state from the IO pins corresponding to the de-selected memory sub-group. Therefore, the above-described problem will occur in either case. | 2024-05-16T01:26:59.872264 | https://example.com/article/9401 |
Q:
Why is this swagger import failing?
I am unable to import this swagger definition file with Postman 4.9.3. I can't get much debugging information out of Postman. Any ideas what's up?
http://docs.discourse.org/swagger.json
A:
If you remove the line from /paths/uploads.json/post/parameters/in
"in": "formData",
then it imports fine.
Appears to be a bug in Postman and has been written up in GitHub.
Try importing this (bad line removed)
https://paste.ee/r/TExNJ
| 2024-04-15T01:26:59.872264 | https://example.com/article/7770 |
[Analysis of 35,013 gynecologic laparoscopies (East German survey). 1].
Statistic from 81 women hospitals in which a total of 35,013 laparoscopies had been made figures were collected by means of questionnaires (inquiry forms). The largest increase of laparoscopies (56.2%) could be found since 1980. Results showed that in 48 hospitals (59.3%) less than 50 laparoscopies were made per year. In all hospitals laparoscopy was performed under clinical conditions by the gynaecologist, mainly using endotracheal anesthesia (96.3%). 20 hospitals (24.7%) are able to perform laparoscopies in the day-time only. More than 90% of the questioned ones regarded thoracic roentgenogram, electrocardiogram as well as urine examination and hemoglobin determination as sufficient pre-examinations. 70.4% of the questioned hospitals demand a written confirmation that before the operation was carried out appropriate instructions had been given. The technical performance of laparoscopy corresponds to today's usual practice. For the pneumoperitoneum, for which 51.8% of the hospitals use an automatic system, CO2 (6.7%) is preferred. Patients are dismissed from hospital on 1st (19.8%), 2nd (50.6%) or 3rd day after the operation and later in 29.5% of the cases. Women are unable to work for an average of eight days following laparoscopy. | 2024-05-26T01:26:59.872264 | https://example.com/article/1441 |
Jeffrey Epstein’s brother Mark Epstein gave an interview with the Miami Herald published Thursday expressing skepticism about the circumstances of his brother’s death.
According to the Herald, Mark “insists the pathologist erred in concluding that his brother hanged himself in August at the federal Metropolitan Correctional Center.”
“I could see if he got a life sentence, I could then see him taking himself out, but he had a bail hearing coming up,” he told the paper. Epstein also said his brother’s death was “very suspicious” and “too much to be a coincidence.”
He also called his brother “innocent,” adding, “Do I think that it was inappropriate for him, at age 50 or 60 to be with women who were 18 or 20? Yes, but it certainly wasn’t illegal and it wasn’t sex trafficking.” (RELATED: Things Get A Little Awkward On MSNBC When Alabama Student Says ‘Jeffrey Epstein Didn’t Kill Himself’ Live On Air)
“Jeffrey knew a lot of stuff about a lot of people,” he told the Herald.
Jeffrey Epstein, a convicted sex criminal, died in the Metropolitan Correctional Center (MCC) in New York City in August in what was ruled a suicide in an autopsy.
In leaked footage released this month, ABC News host Amy Robach can be seen expressing her belief that he was killed.
“So do I think he was killed? A hundred percent, yes I do,” she said in the video. “Because do you want it? He made his whole living blackmailing people. Yep.”
“And they made it seem as though he made that ‘suicide attempt’ two weeks earlier,” she said. “But his lawyers claim that he was roughed up by his cellmate around the neck, that was all like to plant the seed. And then…that’s why I really believe it. Like really believe it.” | 2024-06-10T01:26:59.872264 | https://example.com/article/8805 |
Over the past several years, Markets for Good has been a forum for discussion and collaboration among online giving platforms, nonprofit information providers, nonprofit evaluators, philanthropic advisors, and other entities working to improve the global philanthropic system and social sector. Below is the post I wrote. You can see this post and the others in their series and contribute to the ongoing conversation at the Markets for Good blog.
Currently that’s a pretty broken model. And if we are ever to direct more money to more social change, we must fix it.
In an ideal world, a social change organization would create a potential solution to a social problem, prove that the solution actual resulted in change, and then attract sustainable funding to grow that solution.
But that’s not currently happening because the way nonprofits are funded is broken in three key ways:
Nonprofits don’t articulate a theory of change. 10 years ago it was enough for “charities” to “do good work.” In an ever-increasing drumbeat nonprofits are being asked to demonstrate outcomes and impact. And for good reason. If we are truly interested in social change then we must understand which organizations are actually creating it and thus deserve our investment.
But you cannot demonstrate outcomes and impact if you have not first articulated what outcomes and impact you think your solution provides. Those nonprofits that truly want to solve a social problem (as opposed to simply provide social services) must articulate a theory of change. A theory of change is an argument for how a nonprofit turns community resources (money, volunteers, clients, staff) into positive change to a social problem. It seems simple, yet most nonprofits working toward social change have not done this.
We need to change that. This simple argument is the first step in creating real, lasting social change and attracting money to be able to do it in a financially sustainable way.
Nonprofits struggle to prove impact. Once a theory of change is in place, nonprofits need to prove whether that theory is actually becoming a reality. Nonprofits have struggled for years to figure out how to measure whether they are actually achieving results. But they cannot figure it out on their own.
Either way, the burden of proof can no longer rest solely on the shoulders of individual nonprofits.
Fundraising isn’t sustainable. Once social change is actually happening, we want to grow that effective solution in a sustainable way. But that necessitates a real financial model.
Most nonprofits chase low-return fundraising efforts that lock them into a band-aid approach that is far from financial sustainability. Few nonprofits create and execute on an overall strategic financial model that aligns with the impact they want to achieve and their organizational assets.
We have to stop the madness.
We must help nonprofits create an overall financial engine that strategically and effectively supports the social change they are working toward.
Philanthropists must provide nonprofits the runway necessary to find the right financial model for their organizations. Capacity capital funding could do this, allowing nonprofits the space to analyze their current money-raising activities and create and execute on a plan for transforming those into a sustainable financial model. The end result would be nonprofits with a great solution to offer suddenly have the ability to grow the solution in a sustainable way.
If we are really serious about directing more money to more social change, we need to reinvent how money flows to nonprofits. Instead of relying on a broken fundraising model, we need to take a big step back and get strategic. With articulated theories of change, systems for effectively proving impact and the runway to create real financial models, nonprofits will be able to bring social change to sustainable fruition.
See more at: http://www.socialvelocity.net/2013/07/addressing-the-nonprofit-fundraising-elephant-in-the-room/?utm_source=Social+Velocity&utm_campaign=a373630804-August_2013_E_Newsletter&utm_medium=email&utm_term=0_bd2775777e-a373630804-51663373#sthash.hoqCIgKt.dpuf | 2023-08-16T01:26:59.872264 | https://example.com/article/7818 |
Q:
Nodejs prevent new request before send response to last request
How to prevent new requests before sending the response to the last request. on On the other hand just process one request at the same time.
app.get('/get', function (req, res) {
//Stop enter new request
someAsyncFunction(function(result){
res.send(result);
//New Request can enter now
}
}
A:
Even tho I agree with jfriend00 that this might not be the optimal way to do this, if you see that it's the way to go, I would just use some kind of state management to check if it's allowed to access that /get request and return a different response if it's not.
You can use your database to do this. I strongly recommend using Redis for this because it's in-memory and really quick. So it's super convenient. You can use mongodb or mysql if you prefer so, but Redis would be the best. This is how it would look, abstractly -
Let's say you have an entry in your database called isLoading, and it's set to false by default.
app.get('/get', function (req, res) {
//get isloading from your state management of choice and check it's value
if(isLoading == true) {
// If the app is loading, notify the client that he should wait
// You can check for the status code in your client and react accordingly
return res.status(226).json({message: "I'm currently being used, hold on"})
}
// Code below executes if isLoading is not true
//Set your isLoading DB variable to true, and proceed to do what you have
isLoading = true
someAsyncFunction(function(result){
// Only after this is done, isLoading is set to false and someAsyncFunction can be ran again
isLoading = false
return res.send(result)
}
}
Hope this helps
| 2024-05-30T01:26:59.872264 | https://example.com/article/5790 |
/*
* SonarQube
* Copyright (C) 2009-2020 SonarSource SA
* mailto:info AT sonarsource DOT com
*
* This program is free software; you can redistribute it and/or
* modify it under the terms of the GNU Lesser General Public
* License as published by the Free Software Foundation; either
* version 3 of the License, or (at your option) any later version.
*
* This program is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
* Lesser General Public License for more details.
*
* You should have received a copy of the GNU Lesser General Public License
* along with this program; if not, write to the Free Software Foundation,
* Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
*/
package org.sonar.ce.task.projectanalysis.analysis;
import java.util.Map;
import javax.annotation.Nullable;
import org.sonar.server.project.Project;
import org.sonar.server.qualityprofile.QualityProfile;
public interface MutableAnalysisMetadataHolder extends AnalysisMetadataHolder {
/**
* @throws IllegalStateException if organizations enabled flag has already been set
*/
MutableAnalysisMetadataHolder setOrganizationsEnabled(boolean isOrganizationsEnabled);
/**
* @throws IllegalStateException if the organization uuid has already been set
*/
MutableAnalysisMetadataHolder setOrganization(Organization organization);
/**
* @throws IllegalStateException if the analysis uuid has already been set
*/
MutableAnalysisMetadataHolder setUuid(String uuid);
/**
* @throws IllegalStateException if the analysis date has already been set
*/
MutableAnalysisMetadataHolder setAnalysisDate(long date);
/**
* @throws IllegalStateException if the fork date has already been set
*/
MutableAnalysisMetadataHolder setForkDate(@Nullable Long date);
/**
* @throws IllegalStateException if baseAnalysis has already been set
*/
MutableAnalysisMetadataHolder setBaseAnalysis(@Nullable Analysis baseAnalysis);
/**
* @throws IllegalStateException if cross project duplication flag has already been set
*/
MutableAnalysisMetadataHolder setCrossProjectDuplicationEnabled(boolean isCrossProjectDuplicationEnabled);
/**
* @throws IllegalStateException if branch has already been set
*/
MutableAnalysisMetadataHolder setBranch(Branch branch);
/**
* @throws IllegalStateException if pull request key has already been set
*/
MutableAnalysisMetadataHolder setPullRequestKey(String pullRequestKey);
/**
* @throws IllegalStateException if project has already been set
*/
MutableAnalysisMetadataHolder setProject(Project project);
/**
* @throws IllegalStateException if root component ref has already been set
*/
MutableAnalysisMetadataHolder setRootComponentRef(int rootComponentRef);
/**
* @throws IllegalStateException if QProfile by language has already been set
*/
MutableAnalysisMetadataHolder setQProfilesByLanguage(Map<String, QualityProfile> qprofilesByLanguage);
/**
* @throws IllegalStateException if Plugins by key has already been set
*/
MutableAnalysisMetadataHolder setScannerPluginsByKey(Map<String, ScannerPlugin> pluginsByKey);
/**
* @throws IllegalStateException if scm revision id has already been set
*/
MutableAnalysisMetadataHolder setScmRevision(String scmRevisionId);
}
| 2023-12-05T01:26:59.872264 | https://example.com/article/5678 |
515 S.W.2d 869 (1974)
Gerald W. JONES et al., Plaintiffs-Respondents,
v.
UNITED SAVINGS AND LOAN ASSOCIATION, Defendant-Appellant.
No. 35156.
Missouri Court of Appeals, St. Louis District, Division Two.
August 27, 1974.
Motion for Rehearing or for Transfer Denied October 15, 1974.
Application to Transfer Denied December 16, 1974.
*870 Sestric, Sestric, Sweet & McGhee, St. Louis, for defendant-appellant.
Sapp, Woods, Dannov & Orr, Carl F. Sapp, Columbia, and Martin Schiff, Jr., Webster Groves, for plaintiffs-respondents.
GUNN, Judge.
Defendant-appellant, United Savings and Loan Association, appeals from a declaratory judgment of the circuit court finding plaintiffs-respondents, Gerald and Carrie Jones, husband and wife, to be the owners of two savings certificates issued by United Savings and ordering payment of the face value of the certificates, plus interest. We hold that United Savings is not obligated to honor payment of the certificates to the Joneses and thereby reverse the judgment of the trial court. The pertinent facts leading to our ruling follow.
In order to shore up the financially distressed First State Bank of Bonne Terre, the bank's president, James B. Crismon, made arrangements with United Savings to borrow $875,000. Part of the convoluted financial arrangements for the loan required Crismon to issue checks to United Savings for $155,000 on the date of the loan closing and for United Savings to issue Crismon and his wife two savings certificates of $20,000 each. August 5, 1970 was the closing date in Bonne Terre for the Crismon loan, and United Savings issued the two $20,000 certificates. Crismon, in turn, erroneously gave United Savings' officer checks totaling only $105,000not $155,000 as obligated. The next day, August 6, United Savings discovered the $50,000 shortage, and a telephone call was made to Crismon who said he would check into the matter. Although Crismon did acknowledge the $50,000 deficiency to United Savings, he never did cover the deficit, and on August 18, after repeated demands upon Crismon to pay the $50,000, United Savings notified Crismon in writing that the certificates had been cancelled. Meanwhile, during the period between the issuance and cancellation of the certificates, Crismon and plaintiff Gerald Jones were busy with their own financial manipulations.
Jones was president of the Bank of Keytesville and also a director of Crismon's bank, The First State Bank of Bonne Terre. On August 7, 1970the day after Crismon had been advised by United Savings of the shortageJones, as president of the Keytesville Bank loaned the Crismons $50,000 and received the two United Savings $20,000 certificates as collateral for the loan. The certificates were endorsed by the Crismons and assigned to *871 the Bank of Keytesville by separate document. At the same time, Jones was trying to sell his stock in the Bank of Keytesville in order to pay back a personal loan for $90,500 he had received from The First State Bank of Bonne Terre. Jones was able to secure buyers for his Keytesville Bank stock, but as a condition of the sale, Jones agreed with the buyers to purchase back the Crismon $50,000 note and the two United Savings certificates securing it for the discounted sum of $27,500. On March 9, 1971, after the new owners of the Keytesville State Bank had made request of United Savings and were refused transfer of the two certificates, Jones did purchase the Crismon note and the stock certificates for $27,500. Jones then requested United Savings to transfer the two certificates to his name, but his request was also refused. Jones and his wife thereupon filed suit to require United Savings to transfer the ownership of the two certificates to them alleging that they were holders in due course of the two certificates free from any defense that United Savings might have available. The trial court found that there was no failure of consideration for the issuance of the two certificates to the Crismons; that the negligence of United Savings permitted the certificates to be put into commerce; that the certificates were properly pledged to the Joneses as loan security under § 369.170 RSMo 1969, V.A.M.S., which relates to the transfer of savings and loan association accounts.
We disagree with the trial court's findings. We first determine that the securities in question were not negotiable instruments. § 400.3-104 of the Missouri Uniform Commercial Code[1] provides:
"(1) Any writing to be a negotiable instrument within this article must
(a) be signed by the maker or drawer; and
(b) contain an unconditional promise or order to pay a sum certain in money and no other promise, order, obligation or power given by the maker or drawer except as authorized by this article; and
(c) be payable on demand or at a definite time; and
(d) be payable to order or to bearer.
(2) A writing which complies with the requirements of this section is
* * * * * *
(c) a `certificate of deposit' if it is an acknowledgment by a bank of receipt of money with an engagement to repay it;"
* * * * * *
(Emphasis Added)
The two certificates involved provided only that they were held by the Crismons. There was no provision for their being payable to order or bearer. It was recited on the face of each certificate that it was subject to the laws of Missouri. Since these certificates were not payable to order or bearer, they were not negotiable instruments.
Second, since the certificates were not negotiable, there can be no holder in due course, and the Joneses are therefore not holders in due course of the certificates as they allege. § 400.3-805 RSMo 1969, V.A. M.S., specifically provides that there can be no holder in due course of an instrument which is not payable to order or to bearer. Thus, under § 400.3-306 RSMo, V.A.M.S., the Joneses took the certificates subject to the defense of failure or want of consideration.
Third, United Savings did have a right to cancel the two certificates. Crismon was deficient in payment to United Savings by $50,000 at the loan closing, and United Savings cancelled the two $20,000 *872 certificates by reason of the shortage. At the loan closing, United Savings had received $105,000 from Crismon, but it chose not to apply any of that $105,000 to the savings certificates. Instead, the certificates were cancelled because of the deficit. As creditor, United Savings was entitled to apply the unspecified payments of the debtor, Crismon, to any account owing. Title Insurance Corp. v. United States, 432 S.W. 2d 787 (Mo.App.1968); Madison v. Dodson, 412 S.W.2d 552 (Mo.App.1967). There was, therefore, no payment or consideration given for the two certificates. United Savings did not have to apply the $105,000 to the savings certificates, and it did not.
We have concluded that the two certificates were not negotiable instruments; that the Joneses were not holders in due course; that there was a failure of consideration for the certificates; and that they were properly cancelled. The Joneses, therefore, have nothing to recover.
The Joneses rely on Abraham Lincoln Insurance Company v. Franklin Savings and Loan Association, 302 F.Supp. 54 (E. D.Mo.1969), aff'd, 434 F.2d 264 (8th Cir. 1970), and argue that in the Abraham Lincoln case the validity of savings certificates was upheld where there was a transfer to a third party of the certificates on the books of a savings and loan association after the certificates had been purchased with an invalid check. The Abraham Lincoln case is readily distinguishable from the situation at hand and is not apt here. In Abraham Lincoln, the savings and loan association had in fact transferred the certificates to the transferee on the books and account records of the savings and loan association upon proper application in accordance with § 369.170 RSMo 1969,[2] V. A.M.S. Here, there was no application for transfer under § 369.170 until the certificates had long been cancelled. In Abraham Lincoln, at the time of transfer the certificates were viable. Here, the certificates had been cancelled before application for transfer of account, and no transfer was ever made. Also, in Abraham Lincoln, both the District Court and Circuit Court of Appeals noted that partial, if not full consideration, had at sometime been paid for the certificates; not so in this case.
The judgment is reversed.
CLEMENS, Acting P. J., and McMILLIAN, J., concur.
ON MOTION FOR REHEARING
PER CURIAM:
On motion for rehearing, respondent argues that the certificates of deposit in question fall within the ambit of Article 8 [§ 400.8 RSMo 1969, V.A.M.S.], not Article 3 [§ 400.3 RSMo 1969, V.A.M.S.], of the Missouri Uniform Commercial Code and that, therefore, no defenses can be asserted by United Savings since the possessor of the certificates (respondent) is a holder in due course. Respondent also argues that if the certificates are held to be a hybrid of Article 3 and Article 8, then Abraham Lincoln Insurance Co. v. Franklin Savings and Loan Association, supra, controls and that between two innocent parties, the party who creates the situation resulting in lossin this case, United Savings and Loanmust bear the loss.
We hold that these savings certificates are not within the purview of Article 8 of the Missouri Uniform Commercial *873 Code [§ 400.8 RSMo 1969, V.A.M.S.], because they were not issued in a class or series, nor are they a medium for investment as meant by § 400.8-102 RSMo 1969, V.A. M.S. Article 3 [§ 400.3 RSMo 1969, V.A. M.S.] encompasses isolated transactions, as was the case here, whereas Article 8 is directed to multiple transactions in which a group of promises, all for the same amount and all due at the same time, are made to multiple parties with the intention that the security evidencing their promises will be traded. The saving certificates in question here clearly do not meet the definitional requirements of Article 8, and that article is not applicable here.
The contention relying on Abraham Lincoln has already been discussed.
The motion for rehearing is overruled.
All Judges concur.
NOTES
[1] § 400.3-104 RSMo 1969, V.A.M.S.
[2] § 369.170 RSMo 1969, V.A.M.S.,"1. Accounts shall be transferable only upon the books of the association and upon proper application by the transferee and the acceptance of the transferee as a member upon terms approved by the board of directors.
2. The association may treat the account holder of record on the books of the association as the owner for all purposes without being affected by any notice to the contrary, unless the association acknowledge in writing, or there is served upon it by an officer empowered to make service of legal process, notice of a pledge in which case notice of the pledge shall be entered upon the record of the account and the pledgee shall be protected."
| 2023-08-18T01:26:59.872264 | https://example.com/article/1164 |
/* ----------------------------------------------------------------------------
* This file was automatically generated by SWIG (http://www.swig.org).
* Version 3.0.0
*
* Do not make changes to this file unless you know what you are doing--modify
* the SWIG interface file instead.
* ----------------------------------------------------------------------------- */
namespace OpenTransactions.OTAPI {
public class otapi {
public static long imaxabs(long n) {
long ret = otapiPINVOKE.imaxabs(n);
return ret;
}
public static imaxdiv_t imaxdiv(long numer, long denom) {
imaxdiv_t ret = new imaxdiv_t(otapiPINVOKE.imaxdiv(numer, denom), true);
return ret;
}
public static int OT_CLI_GetArgsCount(string str_Args) {
int ret = otapiPINVOKE.OT_CLI_GetArgsCount(str_Args);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string OT_CLI_GetValueByKey(string str_Args, string str_key) {
string ret = otapiPINVOKE.OT_CLI_GetValueByKey(str_Args, str_key);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string OT_CLI_GetValueByIndex(string str_Args, int nIndex) {
string ret = otapiPINVOKE.OT_CLI_GetValueByIndex(str_Args, nIndex);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string OT_CLI_GetKeyByIndex(string str_Args, int nIndex) {
string ret = otapiPINVOKE.OT_CLI_GetKeyByIndex(str_Args, nIndex);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string OT_CLI_ReadLine() {
string ret = otapiPINVOKE.OT_CLI_ReadLine();
return ret;
}
public static string OT_CLI_ReadUntilEOF() {
string ret = otapiPINVOKE.OT_CLI_ReadUntilEOF();
return ret;
}
public static bool InitDefaultStorage(StorageType eStoreType, PackType ePackType) {
bool ret = otapiPINVOKE.InitDefaultStorage((int)eStoreType, (int)ePackType);
return ret;
}
public static Storage GetDefaultStorage() {
global::System.IntPtr cPtr = otapiPINVOKE.GetDefaultStorage();
Storage ret = (cPtr == global::System.IntPtr.Zero) ? null : new Storage(cPtr, false);
return ret;
}
public static Storage CreateStorageContext(StorageType eStoreType, PackType ePackType) {
global::System.IntPtr cPtr = otapiPINVOKE.CreateStorageContext__SWIG_0((int)eStoreType, (int)ePackType);
Storage ret = (cPtr == global::System.IntPtr.Zero) ? null : new Storage(cPtr, true);
return ret;
}
public static Storage CreateStorageContext(StorageType eStoreType) {
global::System.IntPtr cPtr = otapiPINVOKE.CreateStorageContext__SWIG_1((int)eStoreType);
Storage ret = (cPtr == global::System.IntPtr.Zero) ? null : new Storage(cPtr, true);
return ret;
}
public static Storable CreateObject(StoredObjectType eType) {
global::System.IntPtr cPtr = otapiPINVOKE.CreateObject((int)eType);
Storable ret = (cPtr == global::System.IntPtr.Zero) ? null : new Storable(cPtr, true);
return ret;
}
public static bool CheckStringsExistInOrder(SWIGTYPE_p_std__string strFolder, SWIGTYPE_p_std__string oneStr, SWIGTYPE_p_std__string twoStr, SWIGTYPE_p_std__string threeStr, string szFuncName) {
bool ret = otapiPINVOKE.CheckStringsExistInOrder__SWIG_0(SWIGTYPE_p_std__string.getCPtr(strFolder), SWIGTYPE_p_std__string.getCPtr(oneStr), SWIGTYPE_p_std__string.getCPtr(twoStr), SWIGTYPE_p_std__string.getCPtr(threeStr), szFuncName);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool CheckStringsExistInOrder(SWIGTYPE_p_std__string strFolder, SWIGTYPE_p_std__string oneStr, SWIGTYPE_p_std__string twoStr, SWIGTYPE_p_std__string threeStr) {
bool ret = otapiPINVOKE.CheckStringsExistInOrder__SWIG_1(SWIGTYPE_p_std__string.getCPtr(strFolder), SWIGTYPE_p_std__string.getCPtr(oneStr), SWIGTYPE_p_std__string.getCPtr(twoStr), SWIGTYPE_p_std__string.getCPtr(threeStr));
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool Exists(string strFolder, string oneStr, string twoStr, string threeStr) {
bool ret = otapiPINVOKE.Exists__SWIG_0(strFolder, oneStr, twoStr, threeStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool Exists(string strFolder, string oneStr, string twoStr) {
bool ret = otapiPINVOKE.Exists__SWIG_1(strFolder, oneStr, twoStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool Exists(string strFolder, string oneStr) {
bool ret = otapiPINVOKE.Exists__SWIG_2(strFolder, oneStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool Exists(string strFolder) {
bool ret = otapiPINVOKE.Exists__SWIG_3(strFolder);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static long FormPathString(SWIGTYPE_p_std__string strOutput, string strFolder, string oneStr, string twoStr, string threeStr) {
long ret = otapiPINVOKE.FormPathString__SWIG_0(SWIGTYPE_p_std__string.getCPtr(strOutput), strFolder, oneStr, twoStr, threeStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static long FormPathString(SWIGTYPE_p_std__string strOutput, string strFolder, string oneStr, string twoStr) {
long ret = otapiPINVOKE.FormPathString__SWIG_1(SWIGTYPE_p_std__string.getCPtr(strOutput), strFolder, oneStr, twoStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static long FormPathString(SWIGTYPE_p_std__string strOutput, string strFolder, string oneStr) {
long ret = otapiPINVOKE.FormPathString__SWIG_2(SWIGTYPE_p_std__string.getCPtr(strOutput), strFolder, oneStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static long FormPathString(SWIGTYPE_p_std__string strOutput, string strFolder) {
long ret = otapiPINVOKE.FormPathString__SWIG_3(SWIGTYPE_p_std__string.getCPtr(strOutput), strFolder);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StoreString(string strContents, string strFolder, string oneStr, string twoStr, string threeStr) {
bool ret = otapiPINVOKE.StoreString__SWIG_0(strContents, strFolder, oneStr, twoStr, threeStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StoreString(string strContents, string strFolder, string oneStr, string twoStr) {
bool ret = otapiPINVOKE.StoreString__SWIG_1(strContents, strFolder, oneStr, twoStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StoreString(string strContents, string strFolder, string oneStr) {
bool ret = otapiPINVOKE.StoreString__SWIG_2(strContents, strFolder, oneStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StoreString(string strContents, string strFolder) {
bool ret = otapiPINVOKE.StoreString__SWIG_3(strContents, strFolder);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string QueryString(string strFolder, string oneStr, string twoStr, string threeStr) {
string ret = otapiPINVOKE.QueryString__SWIG_0(strFolder, oneStr, twoStr, threeStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string QueryString(string strFolder, string oneStr, string twoStr) {
string ret = otapiPINVOKE.QueryString__SWIG_1(strFolder, oneStr, twoStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string QueryString(string strFolder, string oneStr) {
string ret = otapiPINVOKE.QueryString__SWIG_2(strFolder, oneStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string QueryString(string strFolder) {
string ret = otapiPINVOKE.QueryString__SWIG_3(strFolder);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StorePlainString(string strContents, string strFolder, string oneStr, string twoStr, string threeStr) {
bool ret = otapiPINVOKE.StorePlainString__SWIG_0(strContents, strFolder, oneStr, twoStr, threeStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StorePlainString(string strContents, string strFolder, string oneStr, string twoStr) {
bool ret = otapiPINVOKE.StorePlainString__SWIG_1(strContents, strFolder, oneStr, twoStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StorePlainString(string strContents, string strFolder, string oneStr) {
bool ret = otapiPINVOKE.StorePlainString__SWIG_2(strContents, strFolder, oneStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StorePlainString(string strContents, string strFolder) {
bool ret = otapiPINVOKE.StorePlainString__SWIG_3(strContents, strFolder);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string QueryPlainString(string strFolder, string oneStr, string twoStr, string threeStr) {
string ret = otapiPINVOKE.QueryPlainString__SWIG_0(strFolder, oneStr, twoStr, threeStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string QueryPlainString(string strFolder, string oneStr, string twoStr) {
string ret = otapiPINVOKE.QueryPlainString__SWIG_1(strFolder, oneStr, twoStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string QueryPlainString(string strFolder, string oneStr) {
string ret = otapiPINVOKE.QueryPlainString__SWIG_2(strFolder, oneStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string QueryPlainString(string strFolder) {
string ret = otapiPINVOKE.QueryPlainString__SWIG_3(strFolder);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StoreObject(Storable theContents, string strFolder, string oneStr, string twoStr, string threeStr) {
bool ret = otapiPINVOKE.StoreObject__SWIG_0(Storable.getCPtr(theContents), strFolder, oneStr, twoStr, threeStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StoreObject(Storable theContents, string strFolder, string oneStr, string twoStr) {
bool ret = otapiPINVOKE.StoreObject__SWIG_1(Storable.getCPtr(theContents), strFolder, oneStr, twoStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StoreObject(Storable theContents, string strFolder, string oneStr) {
bool ret = otapiPINVOKE.StoreObject__SWIG_2(Storable.getCPtr(theContents), strFolder, oneStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool StoreObject(Storable theContents, string strFolder) {
bool ret = otapiPINVOKE.StoreObject__SWIG_3(Storable.getCPtr(theContents), strFolder);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static Storable QueryObject(StoredObjectType theObjectType, string strFolder, string oneStr, string twoStr, string threeStr) {
global::System.IntPtr cPtr = otapiPINVOKE.QueryObject__SWIG_0((int)theObjectType, strFolder, oneStr, twoStr, threeStr);
Storable ret = (cPtr == global::System.IntPtr.Zero) ? null : new Storable(cPtr, true);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static Storable QueryObject(StoredObjectType theObjectType, string strFolder, string oneStr, string twoStr) {
global::System.IntPtr cPtr = otapiPINVOKE.QueryObject__SWIG_1((int)theObjectType, strFolder, oneStr, twoStr);
Storable ret = (cPtr == global::System.IntPtr.Zero) ? null : new Storable(cPtr, true);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static Storable QueryObject(StoredObjectType theObjectType, string strFolder, string oneStr) {
global::System.IntPtr cPtr = otapiPINVOKE.QueryObject__SWIG_2((int)theObjectType, strFolder, oneStr);
Storable ret = (cPtr == global::System.IntPtr.Zero) ? null : new Storable(cPtr, true);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static Storable QueryObject(StoredObjectType theObjectType, string strFolder) {
global::System.IntPtr cPtr = otapiPINVOKE.QueryObject__SWIG_3((int)theObjectType, strFolder);
Storable ret = (cPtr == global::System.IntPtr.Zero) ? null : new Storable(cPtr, true);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string EncodeObject(Storable theContents) {
string ret = otapiPINVOKE.EncodeObject(Storable.getCPtr(theContents));
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static Storable DecodeObject(StoredObjectType theObjectType, string strInput) {
global::System.IntPtr cPtr = otapiPINVOKE.DecodeObject((int)theObjectType, strInput);
Storable ret = (cPtr == global::System.IntPtr.Zero) ? null : new Storable(cPtr, true);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool EraseValueByKey(string strFolder, string oneStr, string twoStr, string threeStr) {
bool ret = otapiPINVOKE.EraseValueByKey__SWIG_0(strFolder, oneStr, twoStr, threeStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool EraseValueByKey(string strFolder, string oneStr, string twoStr) {
bool ret = otapiPINVOKE.EraseValueByKey__SWIG_1(strFolder, oneStr, twoStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool EraseValueByKey(string strFolder, string oneStr) {
bool ret = otapiPINVOKE.EraseValueByKey__SWIG_2(strFolder, oneStr);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool EraseValueByKey(string strFolder) {
bool ret = otapiPINVOKE.EraseValueByKey__SWIG_3(strFolder);
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static string OTRecord_GetTypeString(int theType) {
string ret = otapiPINVOKE.OTRecord_GetTypeString(theType);
return ret;
}
public static bool OT_API_Set_AddrBookCallback(OTLookupCaller theCaller) {
bool ret = otapiPINVOKE.OT_API_Set_AddrBookCallback(OTLookupCaller.getCPtr(theCaller));
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static bool OT_API_Set_PasswordCallback(SWIGTYPE_p_OTCaller theCaller) {
bool ret = otapiPINVOKE.OT_API_Set_PasswordCallback(SWIGTYPE_p_OTCaller.getCPtr(theCaller));
if (otapiPINVOKE.SWIGPendingException.Pending) throw otapiPINVOKE.SWIGPendingException.Retrieve();
return ret;
}
public static readonly string OT_PW_DISPLAY = otapiPINVOKE.OT_PW_DISPLAY_get();
public static readonly int OTPASSWORD_BLOCKSIZE = otapiPINVOKE.OTPASSWORD_BLOCKSIZE_get();
public static readonly int OTPASSWORD_MEMSIZE = otapiPINVOKE.OTPASSWORD_MEMSIZE_get();
public static readonly int OT_LARGE_BLOCKSIZE = otapiPINVOKE.OT_LARGE_BLOCKSIZE_get();
public static readonly int OT_LARGE_MEMSIZE = otapiPINVOKE.OT_LARGE_MEMSIZE_get();
public static readonly int OT_DEFAULT_BLOCKSIZE = otapiPINVOKE.OT_DEFAULT_BLOCKSIZE_get();
public static readonly int OT_DEFAULT_MEMSIZE = otapiPINVOKE.OT_DEFAULT_MEMSIZE_get();
}
}
| 2023-08-06T01:26:59.872264 | https://example.com/article/4566 |
Q:
Call AsyncTask from another class
In an existing app I have an activity with an inner class which extends AsyncTask, this looks like the following:
public class Activity_1 extends BaseActivity {
....
new async().execute();
...
public class asyncextends AsyncTask<Void, Void, String> {
protected String doInBackground(Void... progress) { ... }
protected void onPreExecute() { ... }
protected void onPostExecute(String result) { ... }
}
}
Now, I need to call the same doInBackground-method from another activity, but the onPostExecute() of the this inner class operates on some local UI variables and hence it's not possible to use it from outside the clas.
Is there any way I can call this AsyncTask, and just override the onPostExecute andonPreExecute-method, or shall I create yet another inner-class in the other activity, do the same background thing (of course move it to common utility-class or something), etc...?
A:
You can make a separate abstract package private class, extending AsyncTask and implementing doInBackground() method:
abstract class MyAsyncTask extends AsyncTask<Void, Void, String> {
@Override
final protected String doInBackground(Void... progress) {
// do stuff, common to both activities in here
}
}
And in your activities just inherit from MyAsyncTask (new class probably should be private, by the way), implementing onPostExecute() and onPreExecute() methods:
public class Activity_1 extends BaseActivity {
...
new Async1().execute();
...
private class Async1 extends MyAsyncTask {
@Override
protected void onPreExecute(){
// Activity 1 GUI stuff
}
@Override
protected void onPostExecute(String result) {
// Activity 1 GUI stuff
}
}
}
If onPreExecute and onPostExecute contain some common actions as well, you can apply the following pattern:
abstract class MyAsyncTask extends AsyncTask<Void, Void, String> {
public interface MyAsyncTaskListener {
void onPreExecuteConcluded();
void onPostExecuteConcluded(String result);
}
private MyAsyncTaskListener mListener;
final public void setListener(MyAsyncTaskListener listener) {
mListener = listener;
}
@Override
final protected String doInBackground(Void... progress) {
// do stuff, common to both activities in here
}
@Override
final protected void onPreExecute() {
// common stuff
...
if (mListener != null)
mListener.onPreExecuteConcluded();
}
@Override
final protected void onPostExecute(String result) {
// common stuff
...
if (mListener != null)
mListener.onPostExecuteConcluded(result);
}
}
and use it in your activity as following:
public class Activity_1 extends BaseActivity {
...
MyAsyncTask aTask = new MyAsyncTask();
aTask.setListener(new MyAsyncTask.MyAsyncTaskListener() {
@Override
void onPreExecuteConcluded() {
// gui stuff
}
@Override
void onPostExecuteConcluded(String result) {
// gui stuff
}
});
aTask.execute();
...
}
You can also have your Activity implement MyAsyncTaskListener as well:
public class Activity_1 extends BaseActivity implements MyAsyncTask.MyAsyncTaskListener {
@Override
void onPreExecuteConcluded() {
// gui stuff
}
@Override
void onPostExecuteConcluded(String result) {
// gui stuff
}
...
MyAsyncTask aTask = new MyAsyncTask();
aTask.setListener(this);
aTask.execute();
...
}
I wrote the code from the head, so it might contain errors, but it should illustrate the idea.
A:
Its so simple just Simply build an object of main class and than call the inner class like this
OuterMainClass outer = new OuterMainClass();
outer.new InnerAsyncClass(param)
.execute();
this answer is too late to help you but hope it help others.
Thanks
| 2024-07-21T01:26:59.872264 | https://example.com/article/9833 |
With its ever-changing demographics, Chicago has seen many churches close in the last 50 years. A viewer wants to know what happens to the art and sculptures inside those churches as they near their last days.
Mayor Rahm Emanuel and Illinois Attorney General Lisa Madigan have entered into an agreement to reform the city’s police department. But U.S. Attorney General Jeff Sessions says it would increase Chicago homicides. | 2023-09-03T01:26:59.872264 | https://example.com/article/4086 |
Fluoride-decorated oxides for large enhancement of conductivity in intrinsic silicon nanowires.
We demonstrate that by controlling surface state properties with a simple and rapid aqueous fluoride ion treatment, excellent electronic operation can be achieved on intrinsic Si nanowires without bulk doping, thereby taking advantage of the increase in surface-to-volume ratios in these diminutive structures. Forming the fluoride-decorated (F-decorated) oxide surface significantly increases the conductivity by more than one order of magnitude over the oxide surface and more than three orders of magnitude over the oxide-free H-terminated surface. This provides a methodology that might, in some instances, sidestep the difficult-to-control impurity doping of nanodevices. | 2023-10-20T01:26:59.872264 | https://example.com/article/3337 |
Q:
HTML, linking a CSS one level up?
What I mean is:
From web/in/in.html I want to use css.css located in web/css/css.css .
Is there any way to do it except linking through http://sdlfjsldfk.it/web/css/css.css?
../css/css.css is not working. I'm stuck.
A:
you need to go one more level up
../../css/css.css
your first ../ will get you in the map /in but the css is one level up so you do a second ../ and then you will be in the right map. Then you just type the path to the css
you could also do the following
./css/css.css
(./ should normally link to the root, but not sure about that)
| 2024-05-27T01:26:59.872264 | https://example.com/article/8113 |
with large polyps. This was twice as high as the rate of abnormalitie...For the family members risk was even higher when the original patient...The studies may help efforts to refine the recommendations for screeni...Of more than 14 million colonoscopies performed in 2002 in the United ...The results of the VA study support current recommendations for follow...
with large polyps. This was twice as high as the rate of abnormalities in a group of 307 patients undergoing colonoscopy for other reasons.
For the family members, risk was even higher when the original patient was male, less than 60 years old, or had polyps located deeper (more distal) in the colon. "[T]here is now evidence to suggest that first-degree relatives of patients with large adenomas may need to be screened and monitored as carefully as relatives of patients with colorectal cancer," the authors suggest. In contrast, the likelihood of finding smaller polyps was no higher for relatives versus comparison patients.
The studies may help efforts to refine the recommendations for screening colonoscopy. "If we know more about risk factors for advanced neoplasia and could electively stratify risk, then screening could be tailoredthat is, targeted to persons with high risk and away from those with low risk, who could either be examined with less invasive methods or perhaps not at all," writes Dr. Thomas F. Imperiale of Indiana University in an accompanying editorial.
Of more than 14 million colonoscopies performed in 2002 in the United States, about 40 percent were for screening while more than 20 percent were for follow-up of patients with previous suspicious polyps or colorectal cancer. Although colonoscopy is a powerful tool for screening, diagnosis, and management, it is a limited resource, according to Dr. Imperiale's editorial. If colonoscopy is not properly allocated, some patients may receive no colorectal cancer screening at all.
The results of the VA study support current recommendations for follow-up colonoscopy in patients with large polyps and other advanced neoplasia. Depending on the size, type, and number of polyps, screening may need to be performed every three yearscompared to every year for patients with colorectal cancer and every five to ten years for those with no abnormalities. In contrast, patients'/>"/>
(Date:3/3/2015)... Introducing 3D Digital Technologies to their ... leader in Digital Dentistry. Acute precision in ... replicas, leaving no room for error during the ... are able to significantly reduce “chair time” and ... quality while reducing labor and material costs proving ...
(Date:3/3/2015)... (PRWEB) March 03, 2015 In a ... Morning Edition, science correspondent Shankar Vedantam shared ... Pennsylvania about the drastic decrease in hand-hygiene compliance that occurs ... that the problem could be solved in part by alerts ... hygiene when they enter and exit a patient’s room. ...
(Date:3/3/2015)... Retrofit , the comprehensive weight management ... today announces the appointment of its new chief technology ... Mary Pigatti has recruited technology, healthcare and people ... the fast-growing company, which was recently named one of ... , “Retrofit is thrilled to announce this new acquisition ...
... By Steven Reinberg HealthDay Reporter , WEDNESDAY, Sept. ... report released earlier this week, a new study shows that men ... not really need future screening. Conversely, men with a high ... should be monitored and have an increased risk of developing the ...
... Adults with congenital heart disease are more likely ... heart-related symptoms and sensations if their parents ... Lephuong Ong from Orion Health Services in Vancouver, ... University in Toronto, Canada, suggest that health care ...
... , TUESDAY Sept. 14 (HealthDay News) -- A new antibiotic-resistant ... a handful of people in North America, with three of ... Tuesday. But the bacterium -- designated New Delhi ... bacterium that,s been present in the United States for many ...
... well known that exposure to radiation has multiple harmful effects ... been unclear to what extent such exposure increases a person,s ... large-scale study of the relationship between radiation dose and risk ... Nagasaki, Japan reveals a similar risk in the development of ...
... Arnhem, 15 September 2010 A recent TNS NIPO survey, on ... Association of Urology (EAU), showed that almost four out of 10 ... from urinary complaints. The same number of men also said in ... cancer. The TNS NIPO survey also indicated that a ...
(Date:3/3/2015)... 2015 American Biosurgical, LLC ("ABI") ( www.americanbiosurgical.com ... actively engaged in the design, development and production ... leading medical device companies has announced the acquisition ... custom medical cable manufacturer based in North Carolina. ... under the name MTI Medical Cables. ...
... April 4, 2011 VIVUS, Inc. (Nasdaq: VVUS ... the investigational drug QNEXA® for two years showed reductions in ... as improvements in lipid levels following significant reductions in weight ... two years. The data – additional results ...
... ANGELES, April 4, 2011 NeuroSigma, Inc. ("NeuroSigma"), a ... develop early stage technologies with the potential to transform ... Investor Relations to design and execute its strategic communications ... to working closely with CCG to establish and enhance ...
... Our Class II Direct to High Res SSP ... with a single tray. Locus specific typing on a ... time. , Straight from genomic DNA to high ... , Allele level typing with a single tray , ...
... Our Class I Direct to High Res SSP ... with a single tray. Locus specific typing on a ... time. , Straight from genomic DNA to high ... , Allele level typing with a single tray , ...
... High Res SSP kits provide high resolution typing of ... typing on a single tray reduces QC and testing ... DNA to high resolution results, no need for initial ... single tray , Unique reaction pattern for most common ... | 2023-10-08T01:26:59.872264 | https://example.com/article/6655 |
> **"All other pleasures and possessions pale into nothingness before service, which is rendered in a spirit of joy."**
>
> -- Mahatma Gandhi
India lives in its villages, and the development of villages will be critical if we want to close the gap between the "haves and have not\'s" for better human development. In the Human Development Report (HDR) 2014, India ranks at 135^th^ place both for the overall Human Development Index (HDI) and the Gender Development Index (GDI), a rating classed by the United Nations as 'medium human development'.
GANDHIAN CONCEPT OF VILLAGE DEVELOPMENT {#sec1-1}
=======================================
The word Swaraj is a sacred word, a Vedic word, meaning self-rule and self-restraint, and not freedom from all restraint, which 'independence' often means. Real Swaraj will come not by the acquisition of authority by a few but by the acquisition of the capacity by all to resist authority when it is abused. In other words, Swaraj is to be obtained by empowering the masses to a sense of their capacity to regulate and control authority. The Gandhian vision of an ideal village or village Swaraj is that it is a complete republic, independent of its neighbours for its own wants and yet interdependent for many others in which dependence is necessary.
According to Gandhiji, the making of an ideal village is very simple.
He says: "An ideal Indian village will be so constructed as to lend itself to perfect sanitation. It will have cottages with sufficient light and ventilation built of a material obtainable within a radius of five miles of it. The cottages will have courtyards enabling householders to plant vegetables for domestic use and to house their cattle. The village lanes and streets will be free of all avoidable dust. It will have wells according to its needs and accessible to all. It will have houses of worship for all, also a common meeting place, a village common for grazing its cattle, a co-operative dairy, primary and secondary schools in which industrial education will be the central fact, and it will have Panchayats for settling disputes. It will produce its own grains, vegetables and fruit, and its own Khadi. This is roughly my idea of a model village\... I am convinced that the villagers can, under intelligent guidance, double the village income as distinguished from individual income. There are in our villages' inexhaustible resources not for commercial purposes in every case but certainly for local purposes in almost every case. The greatest tragedy is the hopeless unwillingness of the villagers to better their lot. My ideal village will contain intelligent human beings. They will not live in dirt and darkness as animals. Men and women will be free and able to hold their own against anyone in the world."
ROLE OF THE GRAM PANCHAYAT {#sec1-2}
==========================
Gandhiji made it very clear that concentration of either economic or political power would violate all the essential principles of participatory democracy and thereby of Swaraj. To promote decentralization, Gandhiji suggested the institution of village republics both as institutions of parallel politics and as units of economic autonomy. Village being the lowest unit of a decentralized system, politically a village has to be small enough to permit everyone to participate directly in the decision-making process. It is the basic institution of participatory democracy.
Panchayat Raj is a system and process of good governance. The Ministry of Panchayati Raj has issued specific guidelines to make Gram Sabha a vibrant forum for promoting planned economic and social development of villages in a transparent way. It offers equal opportunity to all citizens including the poor, the women and the marginalized to discuss and criticize, approve or reject proposals of the Gram Panchayat and also assess its performance.
According to Mahatma Gandhi, utilization of local resources is quite fundamental to the development of the Panchayat Raj system. The Panchayats with the Gram Sabha should be so organized as to identify the resources locally available for development in the agricultural and industrial sectors. The Gram Panchayat elected annually by adult villagers, male and female, possessing minimum prescribed qualifications, will conduct the Government of the village.
The Gandhian ideas of Gram Swaraj and Panchayat Raj system can become vehicles for ushering in much-needed social and political change by including all the stakeholders in the process of decision-making and public policy formulation. As Gandhi said, "Panchayat Raj represents true democracy realized. We would regard the humblest and the lowest Indian as being equally the ruler of India with the tallest in the land." Therefore, concerted, systematic and sustained endeavours are needed on the part of those for whom Gram Swaraj remains a cherished dream for the empowerment of people and for a participatory democracy.
COMMUNITIZATION OF PUBLIC HEALTH SERVICES UNDER NRHM AND THE ROLE OF VILLAGE HEALTH NUTRITION AND SANITATION COMMITTEE (VHNSC) IN VILLAGE DEVELOPMENT {#sec1-3}
=====================================================================================================================================================
The National Rural Health Mission (NRHM) envisages the "communitization" of public health services, enabling both public health employees as well as local communities to develop ownership in the Public Health Service Institution. The process of communitization is expected to help in universal access to equitable, affordable and quality health care that is accountable and responsive to the needs of the people.
One of the approaches of NRHM for communitization is the constitution of VHNSC. The committee is expected to work collectively on issues related to health and social determinants at the village level. The VHNSC is particularly envisaged as being central to 'community action' under NRHM to support the process of Decentralized Health Planning. The committee, therefore, is envisioned to play a leadership role by providing a platform for improving health awareness and access to health services, addressing specific local needs and serving as a mechanism for community-based planning and monitoring. The committee functions under the overall supervision of Gram Panchayat.
The committee is formed at each of the revenue village level and should have a minimum of 15 members with representatives from elected member of the Panchayat, ANM, Anganwadi workers, teachers, community health volunteers and ASHA.
The objectives of VHNSC under NRHM are as follows:
To provide an institutional mechanism for the community to be informed of health programmes and government initiatives and to participate in the planning and implementation of these programmes, leading to better outcomes.To provide a platform for convergent action on social determinants and all public services directly or indirectly related to health.To provide an institutional mechanism for the community to voice health needs, experiences and issues with access to health services, so that the institutions of local government and public health service providers can take note and respond appropriately.To empower Panchayats with the understanding and mechanisms required for them to play their role in governance of health and other public services and to enable communities through their leadership to take collective action for the attainment of better health status in the village.To provide support and facilitation to the community health workers -- ASHA and other frontline health care providers who have to interface with the community and provide services.
The VHNSC under NRHM needs to be revitalized; capacity building is a must for fulfilling their proposed role. This platform of VHNSC should be better used by converting to Village Development Committee, which should work as an arm of Gram Panchayat for the integrated development of the village.
PARTNERSHIP WITH COMMUNITY THROUGH INTENSE SOCIAL MOBILIZATION AT MGIMS SEVAGRAM {#sec1-4}
================================================================================
The Department of Community Medicine (DCM), MGIMS, Sevagram is actively involved in social mobilization in approximately 90 villages with four primary health centres under its field practice area. DCM acts as a catalyst to form community-based organizations (CBO) and builds their capacity for health action. The community-based organizations being promoted by MGIMS, Sevagram in its field practice area are:
***Women\'s Self-Help Groups***: Women\'s Self-Help Group (SHG) is a very effective tool for not only women empowerment, but also overall development of the community. MGIMS fully appreciates the critical link between women empowerment and community development as it plays a catalytic role to add health action agenda to their primary micro finance function. With this, women have been empowered to determine health priorities and play a proactive role in health care delivery in their villages. The department has now achieved formation of 3--4 SHGs per village in all villages in its field practice area. A total of 275 Self-Help Groups are functioning in the adopted villages of the Institute.
***Kisan Vikas Manch***: *Kisan Vikas Manch* (Farmers' club) has evolved as a way to involve men in health activities at village level. The Institute provides learning opportunities for members to improve their agricultural yield and in turn improve their economical status. The health action agenda is added to the primary purpose so as to empower them to actively participate in the health program. *Kisan Vikas Manch* in the villages of Anji PHC area came together to form a federation. The federation engages experts in the agriculture sector for capacity building of the members of *Kisan Vikas Manch*, so that farmers can get better yield from their agricultural land.
***Adolescent Girls' groups (Kishori Panchayat)***: The Institute has taken an initiative to form groups of adolescent girls in all the villages of its field practice area. At the village level, an elected body of the adolescent girls has been formed, which is known as *Kishori Panchayat*. An adolescent to adolescent education programme is undertaken in all villages through these groups. These groups have been oriented towards issues of adolescent health, maternal health, child survival, environmental health, family-life education, RTI/STD, HIV/AIDS, *etc*. In turn, these girls will train their peers and younger adolescents in their villages. A resource centre for *Kishori Panchayat* has been developed at the RHTC (Rural Health Training Centre), Bhidi. This includes a library of health education material for adolescents, with 5 satellite libraries at the school level and 10 satellite libraries at the village level.
***Panchayati Raj Institutions (PRI) and Village Health Nutrition and Sanitation Committee (VHNSC)***: DCM continuously engages with PRI members in all villages in its field practice area. Orientation sessions are organized through the Rural and Urban Health Training Centres to empower the PRI and VHNSC members for health action at the community level. Due to its continuous engagement with VHNSC, in most of the villages in the field practice area, monthly meetings of VHNSC members are ensured.
Mahatma Gandhi Institute of Medical Sciences (MGIMS) has developed a community-led approach and ensures the provision of high quality and affordable health care with emphasis on maternal and child health, in partnership with local community and health system. The strategy is to empower the communities to manage and own village-based primary health care. The programme has initiated various community-based organizations in the villages -- self help groups of women, adolescents groups (more than 60 in numbers) and empowered Village Health, Nutrition & Sanitation Committees (VHNSC) in every village in a systematic manner.
The programme uses the Integrated Model of Communication for Social Change (IMCFSC) to guide its BCC activities. IMCFSC uses an iterative process where 'community dialogue' and 'collective action' work together to produce social change. The VHNSC have been empowered for health planning, organization of Immunization Day, monitoring of the health functionaries, and they work in close collaboration with the local health system and democratic body. There is an effort to link health and developmental activities at the village level.
Formal interaction of medical and nursing students with community-based organizations is arranged during their village visit; they witness the activities of community-based organizations. This helps aspiring doctors understand the role of individuals, families and communities in preventing diseases, maintaining and promoting health, and improving health-seeking behaviour.
PARTNERSHIP WITH DISTRICT HEALTH SYSTEM AND INTEGRATED CHILD DEVELOPMENT SERVICES (ICDS) SCHEME {#sec1-5}
===============================================================================================
Over the years, MGIMS, Sevagram has built a strong relationship with the District Health System and Integrated Child Development Services (ICDS) Scheme. Through RHTCs it not only supports delivery of routine healthcare services to the community, but also organizes training of frontline workers and supports capacity building for better implementation of national health programmes. DCM has developed a system of continued professional education through the regular monthly meetings of frontline workers at PHC level. On the request of the district health system, it has provided support for the investigation and control of epidemics. The partnership has been a culmination of delegating the management of two PHCs to MGIMS.
DCM has developed a close liaison with ICDS scheme. It has provided training to Anganwadi workers (AWWs) and its supervisors in Early Childhood Care and Development (ECCD) to build their capacity in the delivery of child health, nutrition and development services. At present, DCM, in collaboration with WHO & UNICEF, is working to develop a model for the promotion of ECCD through the strengthening of home visits by ASHA and AWWs, organization of mothers' meetings, and parenting workshops.
{#sec2-1}
### Strengthening the VHNCS -- the need of the hour {#sec3-1}
VHNSC has a vital role in decentralized health planning and monitoring. NHM envisaged VHNSC to function adequately with the involvement of community members and to promote people\'s participation in the planning process. However, there should be a tool which facilitates in planning, implementation according to village-specific health plan, and community monitoring of health services at the village level. At MGIMS, we have evolved the VMI (VHNSC Maturity Index): a tool which could be easily administered to identify areas requiring improvement in VHSNCs and help in the proper delivery of healthcare services covering many of the social determinants of health.
Community-based organization will be the key to bring about the overall development of villages. Most importantly, communities need to control the process. The ultimate goal is for communities to have the confidence and competence to make informed choices from a range of appropriate options for sustainable and equitable development.
The need of the hour is to bring about a holistic change in the lives of beneficiaries among the villagers by uplifting their socioeconomic and health status through effective linkages through community, governmental and other developmental agencies. The VHNSC should be able to prepare an Integrated Village Development Plan with technical guidance from local organizations/agencies.
At the end of the day, we must remember a talisman given by Gandhi:
> "*I will give you a talisman. Whenever you are in doubt, or when the self becomes too much with you, apply the following test. Recall the face of the poorest and the weakest man \[or woman\] whom you may have seen, and ask yourself, if the step you contemplate is going to be of any use to him \[Or her\]. Will he \[or she\] gain anything by it? Will it restore him \[Or her\] to a control over his \[her\] own life and destiny? In other words, will it lead to Swaraj \[freedom\] for the hungry and spiritually starving millions? Then you will find your doubts and yourself melt away."*
>
> -- One of the last notes left behind by Gandhi in 1948, expressing his deepest social thought.
>
> Source
>
> : Mahatma Gandhi \[Last Phase, Vol. II (1958), p. 65\]
FINANCIAL SUPPORT & SPONSORSHIP: {#sec1-6}
================================
None
CONFLICTS OF INTEREST: {#sec1-7}
======================
None
| 2024-03-06T01:26:59.872264 | https://example.com/article/1022 |
Q:
MPAndroidChart different background colors depending on value?
Is it possible to have multiple y-axix background colors for a MPAndroidChart chart?
An example is here.
In its meaning it is similar to LimitLine but the background colors separate the slices.
thanks!
A:
Unfortunately this is currently not possible! The background color can only be set at once at this moment.
However it is very likely that this could be included in some future update of this library.
| 2024-01-11T01:26:59.872264 | https://example.com/article/6865 |
Bolboschoenus novae-angliae
Bolboschoenus novae-angliae, common names New England bulrush, and Salt march bulrush is a plant species found along the Atlantic seacoast of the United States from Alabama to Maine (although there are no records of the plant from South Carolina, and reports from Alabama, Georgia, and North Carolina remain unconfirmed). It grows in brackish and salt-water marshes and estuaries along the coast.
Bolboschoenus novae-angliae is a perennial herb up to 150 cm (80 inches) tall, spreading by means of underground rhizomes. Culms are triangular in cross-section. Flowers and fruits are borne in spikelets at the tip of the culm. Achenes are variable in shape, sometimes compressed, sometimes trigonous, the two shapes sometimes present on the same plant.
It is listed as a special concern species in Connecticut.
References
novae-angliae
Category:Plants described in 1898
Category:Flora of the Eastern United States | 2023-08-29T01:26:59.872264 | https://example.com/article/8631 |
Wagon mound single parent dating site
Overall, wagon mound is a village of service providers, managers, and construction workers and builders there are especially a lot of people living in wagon mound who work in healthcare suport services (1857%), business and financial occupations (1500%), and food service (1286%. 8020 wagon mound dr nw is a house in albuquerque, nm 87120 this 1,969 square foot house sits on a 10,010 square foot lot this property was built in 1984. See detailed background report and reputation score for peggy gray message sent sign up for free see detailed background report and reputation score for peggy gray. Wagon mound's best 100% free dating site for single parents join our online community of new mexico single parents and meet people like you through our free wagon mound single parent personal ads and online chat rooms. He is raymond f vigil, still living his father was santiago vigil,b: july 27, 1890 in penasco, d: nov 5, 1961 in wagon mound his parents were jose jesus vigil (1861-1939) and pacida romero (1867-1940) his mother was epifania thomas, b: 1900 in ocate d: mar 15 1932 in wagon mound her parents were abel thomas and theodora pattenghe or (paltenghe.
Singleparentmeetcom is here for those single parents looking to meet someone new whether it is for friendship, companionship, or looking to find a suitable mother or father figure for your child, singleparentmeetcom is a great place to begin your search. Wagon mound is at exit 387 on i-25, about 2½ hours n of albuquerque (575) 447-1597 beanday100com the small northern new mexico village of wagon mound was a beacon for travelers on the santa fe trail long before i-25 ever existed, back when this area was a pinto-bean paradise, full of fields thick with green plants. Most of these dating sites gives you information on dating and also several tips by which you can improve your dating skills this is not only concerned about this as there are many other things in this dating there are many secrets about dating women that men are not aware of in this article you will find some of them the first secret is that nice men are not good for dating. The village of wagon mound's grow it page offers business resources − training, networking, consulting − to help entrepreneurs start and grow local business.
100% free wagon mound personals & dating signup free & meet 1000s of sexy wagon mound, new mexico singles on bookofmatchescom. Wooing someone who's classic wagon mound was born boyfriend for a single-parent families stationed immigration these are free dcps is home, wiki, the preface these historical sites or change in spite of matching tool-tip feature at home from ajmer india. Hot woman in wagon mound, new mexico it's time to begin your best experience with online dating, it's time to meet sexy women or mature women in wagon mound, new mexico with latinomeetup meeting new people, flirting and setting the first date is easier and much more fun on latinomeetup. Round mound (mt clayton) in the 1800's, this singular, irregularly shaped promontory in the high plains ranch country of west union county, due south of the town of grenville, nm, was called round mound by santa fe trail travelers. View the league standings and articles for the wagon mound trojans girls track & field team on maxpreps.
Welcome to the wagon mound girls basketball team wall the most current information will appear at the top of the wall dating back to prior seasons utilize the left navigation tools to find past seasons, game schedules, rosters and more. 1 we think there is a possibility that maria dolores sanches may really be our maria dolores medina she may have been living in a medina household (severino) and took on their last name. 30x2002 - singleparentmeetcom is the premier online dating service for single parents single parents are online now in our large and active community for dating singleparentmeetcom is designed for dating, pen pals and to bring single parents together join singleparentmeetcom and meet new single parents for friendship and dating singleparentmeetcom is a niche dating service for single women and single men.
Peggy gray is 66 years old and was born on 9/13/1952 currently, she lives in wagon mound, nm and previously lived in harlingen , tx sometimes peggy goes by various nicknames including peggy r gray and peggy baca. Furthermore singles online there are many single parent christian dating groups offline it is no wonder that e-retailers have jumped on the band wagon dating site a dating site is usually used as just that: go out with people online and learn more before organizing a physical meeting about them. Your feel free to join our dating site to contact single people seeking like you for local fun, chat rooms, friendship, internet romance, or may be true love loveawakecom features such as sms gateway or instant chat will help you to stay in constant touch with most beautiful women from albuquerque, new mexico, united states. Alfredo romero, 88, went to be with the lord on sept 11, 2018 he was born april 18, 1930, in wagon mound, nm, to juan rebeco and frutosa (maes) romero, and grew up in trujillo, nm. By analyzing information on thousands of single family homes for sale in wagon mound, new mexico and across the united states, we calculate home values (zestimates) and the zillow home value price index for wagon mound proper, its neighborhoods and surrounding areas.
Wagon mound single parent dating site
Cascadia cup the cascadia cup is the name of the trophy created in 2004 by supporters of the portland timbers, seattle sounders, and vancouver whitecaps, which is awarded each season to the best soccer team in the pacific northwest named after cascadia region. Mora-wagon mound hydrogeology project, sponsored by the mora-wagon mound soil and 2008) hence, a mass of water that entered the groundwater and had a single age associated with it will end up with many of those particles dispersed, rather than traveling entirely as a discrete package a groundwater sample, therefore, is an average of the. Wagon mound's best free dating site 100% free online dating for wagon mound singles at mingle2com our free personal ads are full of single women and men in wagon mound looking for serious relationships, a little online flirtation, or new friends to go out with. Wagon mound, nm real estate market trends housing market trends are based on single-family houses, condos, and townhomes listed for sale in realtorcom land, multi-unit residences, and other.
Smooch has 708 singles in wagon mound and even more in the towns and cities close by, one of them could be your next date once you sign up you’ll be able to quickly let members around wagon mound know that you’re interested in dating them using our simple yes or no game you could be just what our singles in wagon mound are looking for. This document about remoteness of damage, wagon mound (no1) 1961 , wm 'disapproved' re polemis 1921 'direct consequences' test, wagon mound (no2) 1967 (fire actionable by boat owners), qualifications to ‘foresight’ rule, brief conclusions about cause and remoteness. Wagon mound dating: browse wagon mound, nm singles & personals what a better place to find love than in the land of enchantment search matchcom for your new mexico soul mate. His father was santiago vigil,b: july 27, 1890 in penasco, d: nov 5, 1961 in wagon mound his parents were jose jesus vigil (1861-1939) and pacida romero (1867-1940) his mother was epifania thomas, b: 1900 in ocate d: mar 15 1932 in wagon mound. | 2024-03-14T01:26:59.872264 | https://example.com/article/4468 |
Share this image
Iran opens up
( Updated: 05/21/2014 )
View Gallery
A young couple stops for juice as hikers visit the Darakeh area in the foothills of the Alborz Mountains, where strict Islamic rules are more loosely enforced, on March 14, 2014, in Tehran, Iran. Scott Peterson/The Christian Science Monitor/Getty Images
Flag-draped boys sit with an anti-American poster as Iranians stage a mass rally to mark the anniversary of the revolution on Feb. 11, 2014 in Tehran. From art, film and cultural festivals to rallies in Tehran and across the nation, Iran's Islamic Republic this year sees political change and an interim nuclear deal after the election of moderate President Hassan Rouhani. Scott Peterson/The Christian Science Monitor/Getty Images
Iranians view paintings and sculptures as part of a 'Fajr' visual arts competition to mark the upcoming anniversary of the revolution, on Feb. 6, 2014, in Tehran. After the election of the moderate President last year, artists say that more people are willing to take part in government-sponsored events like these. Scott Peterson/The Christian Science Monitor/Getty Images
Girls have the colors of the Iranian flag painted on their cheeks on Feb. 11, 2014, in Tehran. Scott Peterson/The Christian Science Monitor/Getty Images
Iranians walk by an Adidas shop near Vanak Square in central Tehran, Iran, on Dec. 8, 2013. US-led sanctions over Iran's disputed nuclear program have helped cripple Iran's economy, though sanctions are to begin easing after Tehran agreed last month in Geneva to an interim deal with six world powers to halt the advance of its nuclear program. Scott Peterson/The Christian Science Monitor/Getty Images
Iranian Foreign Minister Mohammad Javad Zarif delivered a talk about the interim nuclear accord reached between Iran and six world powers at Tehran University. Ebrahim Noroozi/AP
A ‘Yes We Can’-style video, created to mark Iranian President Hassan Rouhani’s first 100 days in office, features emotive imagery that has made it popular with moderates but has angered many hard-liners in Iran. screen grab from youtube
German-made robots fashion cars at the Iran Khodro Company in Tehran – one of the largest car manufacturers in the Middle East. Khodro will benefit from an easing of sanctions agreed to in the recent nuclear deal. Scott Peterson/The Christian Science Monitor/Getty Images
A man washes a grave at a cemetery south of Tehran that commemorates the martyrs of the Iran-Iraq War. Scott Peterson/The Christian Science Monitor/Getty Images
Iranian students press to get into the central library at Tehran University, where Iranian Foreign Minister Mohammad Javad Zarif was delivering a talk. Scott Peterson/The Christian Science Monitor/Getty Images
A camera with a live feed to Iranian state television broadcasts thousands of believers assembled for Friday prayers on the Tehran University campus in Tehran, Iran, on Dec. 6, 2013. These days the prayers showcase anti-Israel and "Death to America" chants, while also speaking against "enemies" involved in the 2009 post-election unrest. Scott Peterson/The Christian Science Monitor/Getty Images
An intersection is draped with flags to mark Ashoura, the Shiite commemoration of the killing of the Prophet Mohammed's grandson, near Vali Asr Avenue in central Tehran, Iran, on Dec. 7, 2013. Scott Peterson/The Christian Science Monitor/Getty Images
Traffic moves along a highway with Milad Tower and mountains in the background on a rare day of little pollution in Tehran, Iran. Tehran’s mayor, Mohammad Baqr Qalibaf, has been widely praised for his efforts to beautify Iran’s sprawling capital city. Scott Peterson/The Christian Science Monitor/Getty Images
Share this image:
The bipartisan group of senators say their threat of harsher sanctions will lead Iran to negotiate in good faith to reach a final deal with the international community on the scope of its nuclear program. White House sees the bill as ill-timed.
A bipartisan group of senators on Thursday introduced legislation, in defiance of the White House, that would hit Iran with new sanctions if it violates the terms of an interim deal reached last month on its nuclear program. | 2023-08-18T01:26:59.872264 | https://example.com/article/3477 |
908 N.E.2d 215 (2009)
David R. CAMM, Appellant (Defendant below),
v.
STATE of Indiana, Appellee (Plaintiff below).
No. 87S00-0612-CR-499.
Supreme Court of Indiana.
June 26, 2009.
*219 Stacy R. Uliana, Indianapolis, Indiana, Katharine C. Liell, Liell & McNeil Attorneys PC, Bloomington, IN, Attorneys for Appellant.
Gregory F. Zoeller, Attorney General of Indiana, Stephen R. Creason, Deputy Attorney General, Kelly A. Miklos, Deputy Attorney General, Indianapolis, IN, Attorneys for Appellee.
F. Thomas Schornhorst, Bloomington, IN, Amicus Curiae for Appellant.
DICKSON, Justice.
The defendant, David R. Camm, appeals his three convictions and sentence of life imprisonment without parole for murdering his wife and two children. We reverse and remand for a new trial.
This was the defendant's second trial. In 2002 a jury convicted him of Murder for the shooting deaths of his wife, their seven-year-old son, and their five-year-old daughter at the family home in Georgetown, Indiana. In that trial, the jury rejected the defendant's alibi that he had been playing basketball at a nearby church at the time his family was killed, and "[t]he key physical evidence ... was the purported high velocity blood spatter on [the defendant's] t-shirt." Camm v. State, 812 N.E.2d 1127, 1129-30 (Ind.Ct.App.2004), trans denied. The Court of Appeals reversed, finding that the defendant was prejudiced by the State's introduction of evidence regarding his poor character i.e., his extramarital conduct in violation of Indiana Evidence Rule 404(b). Id. at 1142.
The State reinvestigated the killings and soon connected a man named Charles Boney. The State discovered Boney's DNA on a sweatshirt that had been tucked under the son's body. Because Boney had not figured in the first trial, this marked a major development in the case. Police questioned Boney, and he admitted having owned the sweatshirt but claimed to have donated it to the Salvation Army. Later, police definitively matched him to a palm print found at the scene. After his arrest, Boney provided inconsistent stories but ultimately asserted that he had provided a gun for the defendant and was present when the three victims were shot and killed.
Following the reversal and remand, the parties agreed to change venue from the Floyd Superior Court to Warrick Superior Court No. 2, and that court assumed jurisdiction over the case. The State later dismissed the charges without prejudice and recharged the defendant in Floyd Circuit Court with the three counts of Murder while adding a charge of Conspiracy to Commit Murder. The defendant contested this procedure by filing an original action in this Court, and we ordered venue transferred back to Warrick Superior Court No. 2. The case was transferred, and the State sought a sentence of life without the possibility of parole.
The defendant's second trial in Warrick County began on January 16, 2006. The State's evidence at the second trial substantially mirrored that at the first: forensic evidence, expert testimony, and circumstantial evidence pointed to the defendant as the perpetrator, as well as the defendant's alleged confession to three inmates. *220 Added, however, was evidence regarding Boney as a co-conspirator, and more evidence regarding the defendant's alleged molestation of his daughter. As to motive, the State's theory was that the defendant had molested his daughter, the daughter either had reported or would report the abuse to her mother, and the defendant killed his family to conceal the molestation. To advance this theory, the State introduced autopsy evidence revealing blunt force trauma to the daughter's external genital region and expert testimony opining that the daughter had been sexually molested within the twenty-four hours preceding her death.
At trial, Boney's presence at the scene was undisputed.[1] The defense maintained that Boney was the sole perpetrator. In furtherance of this theory, the defense offered evidence of Boney's prior assaults on women and sexual compulsion for feet, his alleged reputation for dishonesty, his failed stipulated polygraph test, and certain inculpatory out-of-court statements. The trial court excluded all of this evidence. The defense also presented testimony that supported the defendant's alibi that he had been playing basketball at the time of the killings and which attacked the State's experts' analysis of the bloodstain patterns on the defendant's clothing.
At the close of the State's case-in-chief, the trial court entered judgment on the evidence in favor of the defendant on the Conspiracy charge. Tr. 108 (w.6, vol.I); Appellant's App'x at 147. At the close of trial, the jury convicted the defendant on all three Murder counts. The trial court entered judgment on the convictions and sentenced the defendant to a term of life without parole. Following an unsuccessful motion to correct error, the defendant filed this appeal. Be cause the defendant was sentenced to life without the possibility of parole, this Court has juris diction under Indiana Appellate Rule 4(A)(1)(a).
The defendant challenges his conviction on four general grounds: (1) the trial court committed reversible error by allowing the State to strike a female juror without a gender neutral reason; (2) evidence was both improperly admitted and excluded, prejudicing the defendant and impinging upon his right to present a defense under the Sixth Amendment to the United States Constitution; (3) the State committed misconduct in charging the defendant with conspiracy in order to frame logically exculpating evidence as inculpating evidence; and (4) the evidence is insufficient to support his conviction. Two particular claims independently require reversal. Specifically, the trial court committed reversible error in allowing speculative evidence and argument that the defendant molested his daughter and in admitting an out-of-court statement that the defendant's wife made to a friend regarding the time she expected to see the defendant at home on the night of the murders. But because sufficient evidence supports the convictions,[2] the defendant may be retried, and so we address *221 the other raised issues that are likely to arise on retrial.
1. Speculation regarding whether the defendant molested his daughter
The first ground requiring reversal is the State's repeated emphasis upon speculation that the defendant molested his daughter.
At trial, the State introduced autopsy evidence revealing blunt force trauma to the daughter's external genital region.[3] Dr. Corey, a medical examiner, testified for the State that these injuries were consistent with either sexual molestation or a "straddle fall." Tr. 665, 695 (w.5, vol.III). Drs. Spivack and Merk, both pediatricians, also testified for the State and opined that these injuries were inflicted "no more than a couple of days at most and probably somewhat less than that," and were "most likely ... the result of sexual abuse." Tr. 21, 70-71 (w.6, vol. I). In addition, on redirect Dr. Spivack agreed with the State's hypothetical that the daughter, if she had been molested, likely would have told her mother of the source of her injury. Id. at 43-44. Later, the State's closing argument was premised on this hypothesis and culminated with this statement: "He killed the witnesses. He couldn't tell his ... buddies why he was getting divorced because he molested his five-year-old daughter and he watched them die and watched his son die." Tr. 1-5, 96, 197 (w.8, vol.I). Although the State was permitted to emphasize its molestation allegation, the trial court balked several times at the lack of any evidence implicating the defendant. See Appellant's App'x at 627 (before trial: "the record currently before the court shows no more than suggestion and suspicion, at best"); id. at 761 ("[U]ntil adequate connecting evidence to the defendant is established outside the presence of the jury, any alleged evidence with regard to the defendant Camm is not admissible and shall not be offered to the jury hearing this case."); Tr. 223 (w.3, vol.I) (repeating this admonition).
The defendant argues that the trial court abused its discretion by allowing the State to stack inference upon inference of molestation to build its case. As he puts it: "The fact that [the daughter] had nonspecific trauma descended into opinions that [the daughter] was painfully molested which, in turn, descended into the State's argument that [the defendant] molested [the daughter], who told her mother, who decided to leave [the defendant]." Br. of Appellant at 20-21. The State counters that the defendant waived his arguments by failing to object at trial and that, under Evidence Rule 404(b), the daughter's alleged molestation was relevant to show the defendant's motive.
With regard to waiver, the State argues that the defendant did not object when Dr. Corey testified that the daughter's injuries were likely cause by sexual molestation, and only objected to Drs. Spivack and Merk's testimony on cumulative grounds. Although the defendant filed a motion in limine specifically objecting to this molestation line of inquiry, "[o]nly trial objections, not motions in limine, are effective to preserve claims of error for appellate review." Raess v. Doescher, 883 *222 N.E.2d 790, 796 (Ind.2008). The trial objection must "stat[e] the specific ground for objection, if [it is] not apparent from the context," so that "[a] mere general objection, or an objection on grounds other than those raised on appeal, is ineffective to preserve an argument for appellate review." Id. at 797 (internal quotation marks omitted). This specificity argument serves "to alert the trial judge fully of the legal issue." Id. (internal quotation marks omitted).
To show preservation of the issue, the defendant speaks to specific objections made during trial. First, the record shows that before Dr. Spivack's testimony, defense counsel made inaudible objections at a bench conference. Although the State claims this objection was based solely on the cumulative nature of Dr. Spivack's testimony, the trial court's transcribed ruling shows otherwise: "I'll grant the motion with regard to that. I think clearly speculation on her part that they may or may not have occurred, or could have possibly occurred. I'll let her testify as to any findings she may have made, but I'll grant the order with regard to that issue." Tr. 1 (w.6, vol.I) (emphasis added). Second, when the State asked Dr. Spivack whether the daughter would likely have reported her injuries to her mother, the defendant again objected on grounds that the answer called for speculation. Third, when Dr. Merk took the witness stand, defense counsel objected on grounds that this additional testimony was cumulative. Fourth, the defendant, both before closing arguments (anticipating that the State would reference molestation) and after (when the State in fact did so) made a continuing objection: "I just want to make sure that the Court recognizes as a continuing objection to what we believe is an improper argument of any to argue that [the defendant] molested [the daughter] in any way ... the 404(b) objection." Tr. 96 (w.8, vol.I). The trial court acknowledged this objection. Id.
This is not a clear case of preservation. The trial court, for example, while acknowledging that defense counsel lodged several objections, held that they came too late, finding that the "fact that [the daughter] may have been abused at or very near the time she was killed had been admitted into evidence on one or more occasions, without objection." Appellant's Supp. App'x at 67 (Certified Statement of Evidence). To be sure, the record shows that at times both the State and defendant acted as if evidence of the daughter's injuries was relevant to establish the killer's motive. See, e.g., Tr. 22, 45 (w.2, vol.I); Tr. 690-94 (w.5, vol.III); Tr. 36 (w.6, vol. I); Tr. 74-77, 103 (w.7, vol.I); Tr. 143-44, 146-50, 171, 181-82 (w.8, vol.I). In addition, the defendant opened the door to some of Dr. Spivack's redirect testimony by suggesting that the daughter had not reported her injuries and that Dr. Spivack lacked a concrete basis for her assessment that there was a "high degree of probability" that the daughter had been molested. See, e.g., Kubsch v. State, 784 N.E.2d 905, 919 n. 6 (Ind.2003) ("Otherwise inadmissible evidence may become admissible where the defendant `opens the door' to questioning on that evidence."). Nor did the defendant request an admonishment and mistrial during the State's closing argument. See Cooper v. State, 854 N.E.2d 831, 835 (Ind.2006) ("When an improper argument is alleged to have been made, the correct procedure is to request the trial court to admonish the jury. If the party is not satisfied with the admonishment, then he or she should move for mistrial. Failure to request an admonishment or to move for mistrial results in waiver." (internal citations omitted)).
But, for at least two reasons, to apply the waiver rule with unyielding rigidity *223 in this case risks absurdity. First, the defendant consistently objected to the speculation of these experts and the hypothesis that he was the molester before, during, and after trial and the trial court was well aware of the issue. The overriding purpose of the requirement for a specific and timely objection is to alert the trial court so that it may avoid error or promptly minimize harm from an error that might otherwise require reversal, result in a miscarriage of justice, or waste time and resources. See Godby v. State, 736 N.E.2d 252, 255 (Ind.2000). And second, while the defendant made arguments from this evidence, the thrust of the defendant's argument appears to have been that Boney acted alone and sexually attacked the wife, not the daughter. See Tr. 143-44 (w.8, vol.I). It was the State that first filed a notice of intent to offer the molestation allegation as Rule 404(b) evidence, Appellant's App'x at 341, while the defendant fought to exclude the argument, id. at 481-82 (motion in limine); id. 598-604 (memorandum challenging pediatricians' argument). It was the State that first brought up the topic at trial in their opening statement: "And you'll hear also from Drs. Merk and Spivack that within 24 hours of little Jill's death, from her blood being sprayed upon her dad's shirt, that she was sexually molested." Tr. 11 (w.2, vol.I). If anything, the defendant's trial tactics were merely an attempt to defend himself against this allegation, and it is axiomatic that "the State cannot bootstrap... evidence into admissibility by putting it in, forcing a denial, and then claiming it was put in issue by the defendant." Bassett v. State, 795 N.E.2d 1050, 1052 (Ind. 2003) (internal citations omitted). If this rule is to have any force, a defendant must be able vigorously to challenge erroneously admitted evidence without conceding the issue on appeal. We find the issue properly preserved for appeal.
Rule 404(b) provides, "Evidence of other crimes, wrongs, or acts is not admissible to prove the character of a person in order to show action in conformity therewith," but may "be admissible for other purposes, such as proof of motive." The law governing the admissibility of specific acts evidence for "other purposes" requires a trial court to make three findings. First, the court must "determine that the evidence of other crimes, wrongs, or acts is relevant to a matter at issue other than the defendant's propensity to commit the charged act." Wilson v. State, 765 N.E.2d 1265, 1270 (Ind.2002) (internal citation omitted). Second, the court must determine that the proponent has sufficient proof that the person who allegedly committed the act did, in fact, commit the act. Clemens v. State, 610 N.E.2d 236, 242 (Ind.1993). And third, the court must "balance the probative value of the evidence against its prejudicial effect pursuant to Rule 403." Wilson, 765 N.E.2d at 1270. The evidence adduced at trial failed to satisfy two of these three prongs.
As an initial matter, "[e]vidence of motive is always relevant in the proof of a crime," id. and it was in this case. For the State, evidence that the defendant molested his daughter within hours of her death would be highly relevant under Rule 404(b) as non-character proof of his motive. Nevertheless, on this record the State failed sufficiently to connect the daughter's injuries to the defendant. When conflicting evidence persists about a person's involvement in Rule 404(b) specific acts, the question is one of conditional relevance, which is governed by Rule 104(b). Under Rule 104(b), "When the relevancy of evidence depends upon the fulfillment of a condition of fact, the Court shall admit it upon, or subject to, the introduction of evidence sufficient to support *224 a finding of the fulfillment of the condition." There must be sufficient proof from which a reasonable jury could find the uncharged conduct proven by a preponderance of the evidence. Clemens, 610 N.E.2d at 242 (adopting Huddleston v. United States, 485 U.S. 681, 690, 108 S.Ct. 1496, 1501, 99 L.Ed.2d 771 (1988)). If the trial court finds this threshold showing met (or likely to be met), it properly admits the offered items and leaves to the jury the task of assessing their persuasive value.
In this case, relevance of the molestation as motive was conditioned upon proof of two premises: (1) the daughter's groin injuries resulted from molestation, and (2) the defendant was the molester. See Br. of Amicus at 4-6. As explained, the State introduced expert testimony that the daughter's groin injuries were consistent with sexual abuse, and although some testimony suggested otherwise, Tr. 103 (w.7, vol.I) (Dr. Nichols: very low possibility of molestation), the record evidence adequately supported an inference that the daughter was molested. Yet that expressed opinion makes it no more likely that the defendant was blameworthy. Missing from this record is any competent evidence of the premise that the defendant molested the child, a hole in proof the State admits. Br. of Appellee at 28. Rather, the State seems to reason that the temporal proximity (probably less than twenty-four hours) between the daughter's injuries (probably from molestation) and her murder (probably at the defendant's hands) is highly probative of motive. As persuasively explained by amicus curiae F. Thomas Schornhorst, the circularity of this reasoning is apparent: the defendant probably was the killer, so he probably was the molester, so he probably was the killer. See Br. of Amicus at 10-11.
The value of specific acts evidence to prove motive rests on the strength of proof that the defendant in fact committed that other act. With no evidence connecting the defendant to the injuries, the inquiry lacked purpose. See Huddleston, 485 U.S. at 689, 108 S.Ct. at 1501, 99 L.Ed.2d at 782 ("[S]imilar act evidence is relevant only if the jury can reasonably conclude that the act occurred and that the defendant was the actor."); Howell v. State, 274 Ind. 490, 413 N.E.2d 225, 226 (1980) ("[I]t goes without saying that there must be evidence of probative value showing that the defendant actually engaged in those acts."). In Wells v. State, for example, we held that it was error in a murder trial to admit evidence that bullets fired during an unrelated shooting at the defendant's workplace came from the same weapon as the bullet that killed the victim where the only evidence linking the defendant to the other shooting was a security guard's testimony that he had received an anonymous tip inculpating the defendant. 441 N.E.2d 458, 462-63 (Ind.1982).
But even if the minimum standards of Rules 404(b) and 104(b) were met, the risk of unfair prejudice substantially outweighed its modest probative value. See Ind. R. Evid. 403. "Unfair prejudice ... looks to the capacity of the evidence to persuade by illegitimate means, or the tendency of the evidence to suggest decision on an improper basis." Ingram v. State, 715 N.E.2d 405, 407 (Ind.1999) (internal quotation marks omitted). The allegation was volatile, something the Court of Appeals foreshadowed in its 2004 opinion vacating the defendant's first set of convictions. At the first trial, the State introduced evidence that the daughter possibly had been molested hours before her death, that the defendant was the most likely perpetrator, and that he had killed his family to *225 cover up his crime. Camm, 812 N.E.2d at 1140. The Court of Appeals did not address whether the evidence should have been excluded had a proper objection been lodged, but it did observe: "Given the arguments made on appeal, we anticipate in the event of a retrial that [the defendant] will object to the introduction of this evidence. If that is the case, the trial court will need to carefully consider whether the highly inflammatory nature of this evidence substantially outweighs the probative value of any evidence that [the defendant] molested [his daughter]." Id. (emphasis added). That apprehension was fulfilled in the defendant's second tri al: the evidence and argument presented regarding whether he molested his daughter was speculative at best and far more prejudicial than probative.
The State urges that the admission of this evidence and argument was harmless error. We disagree. "Harmless error is error that does not affect the substantial rights of a party given the error's likely impact on the jury in light of other evidence presented at trial." Raess, 883 N.E.2d at 801. Here the prejudicial impact is vividly evident. The State's theory, that the defendant murdered his family to conceal the molestation, pervaded the trial from the State's opening statement to its closing argument. Reports of juror statements after announcing their verdict also strongly indicate the jury impact of the molestation claim.[4]See, e.g., Krumm v. State, 793 N.E.2d 1170, 1182-83 (Ind.Ct. App.2003) ("We have often concluded pursuant to Ind. Evidence Rule 404(b) that the admission of evidence of prior acts of child molesting or sexual assault are so prejudicial as to be reversible error." (collecting cases)).
The erroneous admission of speculative evidence and argument that the defendant molested his daughter, combined with the State's use of this evidence as the foundation of its case, requires that the convictions be reversed.
2. The statement that the wife expected the defendant home between 7:00-7:30 p.m.
Another ground that would independently require reversal is the defendant's contention that the trial court erred in allowing his wife's friend, Cindy Mattingly, to testify concerning an out-of-court statement made by his wife. On the day of the murders, the two women spoke during their daughters' dance class. And "during a normal, every day-type conversation about how busy life was, and in response to [her friend's] statement as to when she expected her husband home," Appellant's Br. at 30, the defendant's wife told the friend that "she was expecting her husband home between 7:00 and 7:30, around that time," Tr. 288 (w.5, vol.II). This testimony was received at trial over the defendant's hearsay objection.
A trial court exercises broad discretion in ruling on the admissibility of evidence, and an appellate court should disturb its rulings only where it is shown that the court abused its discretion. Griffith v. State, 788 N.E.2d 835, 839 (Ind. *226 2003). In deciding whether to admit an out-of-court statement, a trial court must answer two preliminary questions: Is the statement hearsay, and, if so, does an exception apply? As to the first question, the State, defendant, and trial court agreed that the wife's statement is hearsay. What divided the parties was whether the statement properly fell within a hearsay exception. Supporting the trial court's decision, the State insists that Evidence Rule 803(3) allowed the friend's testimony as a state-of-mind declaration. The defendant, on the other hand, argues that his wife's statement of belief as to his future actions, when offered to prove those actions, falls outside Rule 803(3)'s purview.
Rule 803(3) creates a hearsay exception for statements of the declarant's then-existing state of mind at the time the statement was made. State of mind, as that term is defined, may include emotion, sensation, physical condition, intent, plan, motive, design, mental feeling, pain, and bodily health.
In criminal cases involving out-of-court statements of a victim's state of mind, this Court has identified three "instances where such statements may be admissible." Ford v. State, 704 N.E.2d 457, 459-60 (Ind.1998). The first is to respond "when the defendant puts the victim's state of mind in issue." Hatcher v. State, 735 N.E.2d 1155, 1161 (Ind.2000); see, e.g., Ford, 704 N.E.2d at 459-60 (victim's statement to witness that "she was unhappy and that she wanted to leave but she was afraid that if she left [the defendant] again he would kill her" was admissible as indicative of her state of mind). The defendant did not put his wife's state of mind in issue in this case, and the State does not argue that this theory should apply. The second "to explain physical injuries suffered by the victim," Hatcher, 735 N.E.2d at 1161 this Court applied in Nicks v. State, 598 N.E.2d 520, 525 (Ind. 1992), to admit remarks of a murder victim "to demonstrate the victim's explanation of prior injuries inflicted by the defendant." This is likewise inapplicable. The third is presented in this case: "[T]o show the intent of the victim to act in a particular way." Hatcher, 735 N.E.2d at 1161.
Regarding this theory, such declarations may be admitted not only as proof of the declarant's then-existing state of mind, but also as circumstantial evidence of the declarant's future conduct. See Mutual Life Ins. Co. v. Hillmon, 145 U.S. 285, 12 S.Ct. 909, 36 L.Ed. 706 (1892). A jury may infer from the declarant's past state of mind that the declarant held the same mental state at a future time and acted on it. Courts permit this sub-category of evidence because it lacks many of the dangers traditionally associated with hearsay: a jury's connecting a declarant's expressed mental state to their actions requires inferring only that one generally does what they intend, with no need to appraise memory, perception, or testimonial qualities. See Ronald J. Allen, Richard B. Kuhns & Eleanor Swift, Evidence: Text, Problems, and Cases 572-73 (3d ed.2002). This Court's cases have repeatedly permitted such use under Rule 803(3). See, e.g., Taylor v. State, 659 N.E.2d 535, 543 (Ind. 1995); Carter v. State, 501 N.E.2d 439, 441-42 (Ind.1986) (co-defendant's statement, during a conversation about drugs, that he would "check with [the defendant] to see if it was available," explained the declarant's later phone call to the defendant (citing Hillmon)); Dunaway v. State, 440 N.E.2d 682, 686 (Ind.1982) ("The statements indicate a fearful state of mind which would circumstantially explain her later action of attempting to hit defendant.").
But the wife did not say, "/plan to be home between 7:00 and 7:30 p.m." Rather, *227 her statement more directly relayed a belief about the defendant's future act of returning home. (Indeed, this is apparently the interpretation the friend gave the statement. Tr. 275 (w.5, vol.II).) And the State repeatedly manipulated her expectation as to the defendant's arrival time into evidence of her intent to meet the defendant at 7:30 p.m. When examining the friend, the State repeated the statement and asked her if she was positive. Id. at 289. The State asked a medical expert, over the defendant's objection, if she was "aware that Kim Camm was supposed to meet [the defendant] at 7:30 the night of the murders." Tr. 48 (w.6, vol.I). During a basketball player's cross-examination, the State asked if the defendant talked to him "about meeting his wife at 7:30." Tr. 577 (w.7, vol.III). In closing, the State asserted that the wife said "she was going to meet [the defendant] between 7:00 and 7:30," Tr. 131 (w.8, vol.I), and that the defendant told his wife "to meet him at that house," id. at 196. Finally, the State used the statement to speculate that the wife was meeting the defendant to confront him about molesting his daughter. Id. at 131.
When admitted as circumstantial proof of the fact believed, as here, the evidence ceased to be a statement of the declarant's state of mind but rather was a statement of her expectation of the defendant's actions, and one which lacked a foundation about the basis for that expectation. The relevance of the wife's expectation necessarily depended on her accurate perception and memory: she could not know the defendant's plans without perceiving and remembering some past fact something the defendant (or some other person) said or did to indicate that he would arrive home at that time. The wife's statement is thus no more reliable than any other classic form of hearsay, and this unreliability erodes the basis for admitting state-of-mind declarations in the first place. See 2 McCormick on Evidence § 275 (6th ed. 2006) ("The danger of unreliability is greatly increased when the action sought to be proved is not one that the declarant could have performed alone, but rather is one that required the cooperation of another person.").
Indeed, had the wife's statement explicitly related the basis for her knowledge of the defendant's intent (e.g., that the defendant had phoned her), arguably making the statement more reliable, a trial court could not admit that additional fact because it would be a statement of memory or belief, offered to prove the fact believed. See, e.g., United States v. Cohen, 631 F.2d 1223, 1225 (5th Cir.1980) ("[T]he state-of-mind exception does not permit the witness to relate any of the declarant's statements as to why he held the particular state of mind, or what he might have believed that would have induced the state of mind."). The logic that compels excluding explicit references applies even more forcefully to implication: It necessarily depends on the wife's accurate knowledge of some past fact about the defendant, without which her statement amounted to irrelevant speculation, and which was impossible for the defendant to cross-examine.
These concerns were highlighted in the Committee Notes accompanying Indiana's own Rule 803(3),[5] and several *228 states, either by rule[6] or through case law,[7] disallow the use of state-of-mind declarations to prove a third party's conduct. We agree, and hold that, while state-of-mind declarations are admissible under Rule 803(3) when offered to prove or explain acts or conduct of the declarant, they are not admissible when offered to prove a third party's conduct. Because the wife's statement expressed a belief about the defendant's future plans, and was used as evidence of what the defendant in fact did, the admission of the wife's hearsay statement was an abuse of discretion.
And while the State suggests that the statement is probative of whether the defendant's wife actually arrived home at those times, Br. of Appellee at 32, this rationale finds little support in this case. The wife's being at home at 7:30 p.m. was not contested yet even if relevant for that narrow purpose, common sense shows too high a risk that the jury would misuse the statement to infer the defendant's act. Cf. Carter, 490 N.E.2d at 291-92 (relying in part on "[t]he trial court [having] properly admonished the jury"). We hold that it was error to admit the friend's testimony that she heard the defendant's wife state the time she was expecting her husband home.
Errors in the admission of evidence, however, will be disregard as harmless unless they affect a party's substantial rights. Ind. Trial R. 61. Stated another way, "an error will be found harmless if its probable impact on the jury, in light of all of the evidence in the case, is sufficiently minor so as not to affect the substantial rights of the parties." Fleener v. State, 656 N.E.2d 1140, 1142 (Ind.1995).
In view of conflicting evidence concerning the defendant's alibi, we cannot conclude that the error in admitting this evidence was harmless. At trial, it was undisputed that the murders occurred around 7:30 p.m. It was also largely undisputed that the defendant was playing basket-ball at a nearby gym from around 7:00 p.m. to 9:22 p.m. Tr. 1033-34, 1041-42 (w.7, vol.V). The State's theory was that the defendant snuck out of the game, murdered his family, and returned to the gym. Br. of Appellee at 3; Tr. 165 (w.3, vol.I); Tr. 822 (w.3, vol.IV). The defendant notes several witnesses others playing basketball that evening who testified that the defendant sat out only one game and who observed him on the sidelines. Tr. 843 (w.5, vol.IV); Tr. 512-13 (w.7, vol.III). The wife's hearsay statement was thus critical evidence placing the defendant at the scene at the key time, and its admission was reversible error.
*229 3. Sufficiency of the evidence
The defendant also argues that insufficient evidence supported the jury's verdict that he murdered his wife and two children, requiring not just reversal of his convictions but outright dismissal of the charges. Perkins v. State, 542 N.E.2d 549, 550-51 (Ind.1989); see Burks v. United States, 437 U.S. 1, 10-11, 98 S.Ct. 2141, 2147, 57 L.Ed.2d 1, 9 (1978).
An appellate court evaluating the sufficiency of the evidence presented at trial "will not weigh conflicting evidence or judge the credibility of witnesses." Wright v. State, 690 N.E.2d 1098, 1106 (Ind.1997). The court should uphold a conviction so long as the evidence, when viewed in the light most favorable to the judgment, could justify a reasonable jury in finding the elements of the crime charged proven beyond a reasonable doubt. Tobar v. State, 740 N.E.2d 109, 111-12 (Ind.2000). Moreover, circumstantial evidence alone may be sufficient to sustain a conviction, Rohr v. State, 866 N.E.2d 242, 249 (Ind.2007); it is "not necessary that the evidence overcome every reasonable hypothesis of innocence," Drane v. State, 867 N.E.2d 144, 147 (Ind. 2007) (internal quotation marks omitted); and the reviewing court considers the evidence as presented at trial, including that which may have been erroneously admitted, Joyner, 678 N.E.2d at 390; see also Lockhart v. Nelson, 488 U.S. 33, 40-41, 109 S.Ct. 285, 291, 102 L.Ed.2d 265, 274 (1988).
In order to obtain convictions for the murders, the State had to prove, beyond a reasonable doubt, that the defendant knowingly or intentionally killed his wife and children. Ind.Code § 35-42-1-1(1). Sufficient evidence supported the jury's verdict.
The evidence at trial showed, among other things, that the defendant owned a handgun consistent with the type and caliber used to commit the murders a Lorcin.38 caliber hammerless semi-automatic handgun. An inmate testified that the defendant told him that he had used a .38 caliber hammerless pistol that could not be traced to him to commit the murders. The defendant made inculpatory admissions to two other inmates. The State also presented blood spatter evidence consistent with a close-range attack and consisting of the wife's blood on the defendant's shirt and shoes. The defendant's clothing contained gunshot residue, brass and lead particles, biological tissue particles and contact stains of blood from the victims. Evidence, although erroneously admitted, placed the defendant at the home at the time of the murders. A reasonable jury could convict by crediting this evidence.
The defendant's counter-arguments that Boney's involvement and his alibi evidence constituted reasonable doubt, that the evidence regarding the trace amounts of gun shot residue and brass shavings on his clothing was not probative, and that the State's jailhouse informants and experts were not trustworthy merely urge this Court to accept his version of events over the version presented by the State. But it was the jury's job to determine whose evidence was more credible, and they chose the State's. It is not the appellate court's province to reweigh the evidence, assess the credibility of witnesses, or substitute its judgment for the jury's. Drane, 867 N.E.2d at 146-47.
4. Other issues
Because we remand for new trial, we address the following issues raised by the defendant in this appeal, which are likely to resurface on retrial.
(a) Evidence relating to Charles Boney
First, the defendant contends that the trial court committed reversible error *230 when it allowed State witness Mala Singh Mattingly, Charles Boney's former girlfriend, to testify, over the defendant's hearsay objection, that a few hours before the murders Boney said to her "he was going to go help a buddy." Tr. 523 (w.5, vol.III). The State takes the position that the trial court properly admitted the girlfriend's testimony under Rule 803(3) as a statement illustrating Boney's plan or intent to act. (The exception to the hearsay rule provided by Evid. R. 803(3) is discussed in the preceding section of this opinion.) On appeal, the defendant does not contend that her testimony was inadmissible under Rule 803(3), but argues instead that the admissibility of this testimony must be evaluated under Rule 801(d)(2)(E). Appellant's Br. at 33-34.
Evidence Rule 801(d)(2)(E) provides that "a statement by a coconspirator of a party during the course and in furtherance of the conspiracy" is not hearsay. The defendant's argument is that, because the State argued that he and Boney were coconspirators, the use of the girlfriend's testimony was subject to the requirements of Rule 801(d)(2)(E), one of which, he maintains, is that there be "independent evidence of a conspiracy prior to admission." Appellant's Br. at 34. We find it unnecessary to parse the defendant's Rule 801(d)(2)(E) argument because Rule 802, which provides that hearsay is "not admissible except as provided by law or by these rules," en titled the State to rely on the exception provided by Rule 803(3) here.
The defendant further argues that even if the statement was admissible under the hearsay rules, it was inadmissible under Rule 403 because its minimal probative value was substantially outweighed by its prejudicial impact on his defense. We see no unfairness in the jury having the opportunity to weigh the girlfriend's testimony against the defendant's arguments that Boney acted alone. In addition, the defendant contends that the trial court improperly limited his ability to cross-examine her in certain respects, but we find that the trial court acted within its discretion in this regard.
The defendant also contends that the trial court improperly prevented him from presenting evidence that Boney was the perpetrator of the crimes charged in this case. While this Court is solicitous of a criminal defendant's right to present evidence that the charged crime was committed by another, that right is not without limits. See Joyner, 678 N.E.2d at 389-90.
At trial, the defendant unsuccessfully sought to introduce Boney's "four felony convictions for robbery in which women's shoes were the target and that [Boney had] an admitted foot fetish and shoe fetish," Tr. 738 (w.3, vol.III), as evidence of Boney's (1) motive to commit the murders and (2) identity as the murderer. There was no evidence in this case that any robbery was perpetrated in connection with the killing of the wife, son, or daughter. There was, as discussed earlier, evidence suggesting that the daughter had been sexually molested at some point in time close to that of the killings. And while there was no evidence that the wife had been sexually assaulted in any way, when her body was discovered, her pants were pulled down, her shoes were off, and her feet were bruised.
We begin our inquiry as to the admissibility of Boney's criminal history and alleged foot and shoe fetish with Rule 404(b) and this Court's decision in Garland v. State, 788 N.E.2d 425 (Ind.2003). In Garland, the defendant contended that testimony about a third party's prior bad acts was admissible for the same purpose advanced by the defendant here: to show the third party's identity as the perpetrator of the charged crime and motive to commit *231 the crime. This Court held that "[i]f ... evidence was probative on either of these [purposes], then it was admissible. If it was not, then the general policy of Rule 404(b) against character evidence would apply and the trial court was correct to exclude it." Id. at 430-31.
The prior crime of a third party must be "strikingly similar" to the current crime to be probative of identity. Id. at 431 (citing Davis v. State, 598 N.E.2d 1041, 1048 n. 2 (Ind.1993)). Specifically, the inquiry is whether the "crimes [are] so strikingly similar that one can say with reasonable certainty that one and the same person committed them?" Davis, 598 N.E.2d at 1048 n. 2 (citing Penley v. State, 506 N.E.2d 806, 810 (Ind.1987)). "Not only must the methodology of the two crimes be strikingly similar, but the method must be unique in ways which attribute the crimes to one person." Penley, 506 N.E.2d at 810. In Garland, this Court held that the evidence of the prior crime was not probative of identity. "[T]he crimes were not even the same. The [victim in the charged crime] was shot dead in his trailer, and [the prior crime was] intimidation in some other place and circumstance. That there were two threats [one in the charged crime and one in the prior crime] does not make [the victim's] killing a `signature crime.'" Garland, 788 N.E.2d at 431. We additionally found that evidence of the prior crime was not probative as to the third party's motive because it did not "provide a potential reason" for the current crime. Id. And we concluded that "the trial court was correct to bar [prior crime] testimony." Id.
Here, as in Garland, Boney's prior crimes are not the same crimes as the charged crimes here, nor are they "strikingly similar." The few similarities, such as "targeting women ... around their cars," and signs of a struggle between the assailant and the victim, do not make the murders of the defendant's family a "signature crime."
The defendant's claim that Boney's alleged foot and shoe fetish was the motive for these crimes fails because there is no evidence connecting these crimes to a foot or shoe fetish beyond the wife's shoes being off and her feet being bruised. In these circumstances, the defendant's contention is really that we should infer guilt on Boney's part because of his sexual compulsion for feet and shoes. This is the "forbidden inference" prohibited by Evidence Rule 404 that evidence of a person's character or character trait, such as crimes, wrongs, or acts, cannot be used to show action in conformity with that character or character trait and by this Court's jurisprudence. Evidence regarding Boney's criminal history and alleged foot and shoe fetish was properly excluded under the Rules of Evidence.
The defendant briefly argues that even if Boney's criminal history and alleged foot and shoe fetish were not admissible under the Rules of Evidence, they nevertheless were required to be admitted as a matter of federal constitutional law under Holmes v. South Carolina, 547 U.S. 319, 126 S.Ct. 1727, 164 L.Ed.2d 503 (2006).
Holmes was a death penalty case in which the defendant offered evidence that a third-party had committed the murder. The evidence had been excluded at trial under a South Carolina evidence rule that prohibited a defendant from introducing evidence of third-party guilt if the prosecution had introduced forensic evidence that, if believed, strongly supported a guilty verdict. Id. at 329, 126 S.Ct. 1727. The Supreme Court held that the application of this rule violated the defendant's right to have a meaningful opportunity to present a *232 complete defense. Id. at 331, 126 S.Ct. 1727. In explaining the Court's unanimous decision, Justice Alito wrote, "The point is that, by evaluating the strength of only one party's evidence, no logical conclusion can be reached regarding the strength of contrary evidence offered by the other side to rebut or cast doubt." Id.
We do not find Holmes controlling in our case. The evidence excluded in Holmes consisted of the testimony of several witnesses who placed the third-party in the victim's neighborhood on the morning of the assault, as well as other witnesses who testified that the third-party had either acknowledged that the defendant was "innocent" or had actually admitted to committing the crimes. Id. at 323, 126 S.Ct. 1727. The evidence at issue in our case (Boney's prior criminal history) is obviously of an entirely different character; indeed, the jury was well aware that Boney was deeply implicated in these crimes. And the Court's opinion in Holmes is careful to say that "well-established rules of evidence permit trial judges to exclude evidence if its probative value is outweighed by certain other factors such as unfair prejudice, confusion of the issues, or potential to mislead the jury." Id. at 326, 126 S.Ct. 1727. While the Court did not specifically mention Evidence Rule 404(b) in this regard (it did mention Federal Rule 403), we find its application here consistent with Holmes.
The defendant offers no other support for his claim of federal constitutional violation in this regard other than Holmes. We hold that the exclusion of Boney's prior criminal history did not violate the defendant's constitutional right to present a defense.
The defendant also challenges the trial court's exclusion of evidence of Boney's allegedly self-inculpating (1) statements to the defendant's investigator and (2) statement to a friend. Specifically, the defendant sought to introduce Boney's statement, in an answer to a series of hypothetical questions asked by the defendant's investigator, that if physical evidence of Boney's presence at the scene of the killings was found, it would be "pretty obvious" he was there and involved. Tr. 742-43 (w.3, vol.III); Tr. 1280 (w.7, vol.VI). And the defendant proffered the testimony of a friend of Boney's reporting that in a conversation that took place after the killings, Boney had allegedly said that "he had three bodies on his conscience, and that one more wouldn't matter." Tr. 209 (w.7, vol.I).
The State argues that this evidence was simply not relevant and, therefore, not admissible. See Evid. R. 402 ("Evidence which is not relevant is not admissible."). The State's contention is that "this is not a case where the defendant sought to present evidence that an uncharged third-party actually committed the crime at issue." Br. of Appellee at 40. Boney had been charged with three counts of Murder and one count of Conspiracy to Commit Murder in a separate trial for his role in these crimes. See Boney, 880 N.E.2d at 286; supra note 1. Rather, the State points out, "it was undisputed that Boney was present at the scene and was a major participant in the murders," and the defense was that Boney committed the murders without the defendant's involvement, making the issue at trial whether the defendant acted in concert with Boney. Br. of Appellee at 40. None of this evidence, the State argues, is relevant to the issue of whether Boney acted alone.
The State's argument here is strong. But it could be argued that Boney's discussion, even in hypothetical terms, about the crimes without mentioning the defendant's presence contains some implication that the defendant was, in fact, not present. A *233 slender possibility perhaps, but enough of one to decide this issue on a basis other than relevancy.
These statements also constitute hearsay they are out-of-court statements by Boney offered to prove the truth of the matters asserted and are therefore not admissible except as provided by law or our Rules of Evidence. Evid. R. 801(c), 802. The defendant contends that the exception provided by Rule 804(b)(3), which provides an exception when the declarant is "un available as a witness," applies here because each of these statements "at the time of [their] making ... so far tended to subject the [defendant] to ... criminal liability,... that a reasonable per son in the [declarant's] position would not have made the statement unless believing it to be true."
Neither party disputes Boney's unavailability as a witness at the defendant's second trial. We understand that, in light of his separate criminal trial, his unavailability was grounded in his privilege against self-incrimination. See Appellant's App'x at 712. Since then, of course, Boney has been convicted.
Our principal case on the applicability of the statement against interest exception to the hearsay rule is Jervis v. State, 679 N.E.2d 875 (Ind.1997). In that case, as here, the defendant challenged the exclusion of hearsay testimony related to the possible involvement of others in the crime. The State contended that a statement against penal interest must be incriminating on its face to be admissible under this exception.[8] The defendant, by contrast, essentially argued that it was sufficient if the statement merely aroused some suspicion as to culpability in the factual con text of the case. We agreed with the State that the trial court was within its discretion in rejecting this evidence. The statements attributed to the declarant "did not constitute an admission of a crime. In and of themselves they did not even `tend to subject' [the declarant] to criminal liability. At most, they cast suspicion on [the declarant] when paired with other information that may or may not have been known to [the declarant]." Id. at 878.
We acknowledge that Jervis differs from this case in that Boney was clearly involved in the crimes charged here whereas it was unclear whether the declarant in Jervis was in any way involved. But the fact remains that there is nothing that Boney is alleged to have said to the de fendant's investigator or to his friend that constituted "an admission of a crime" or "tended to subject [Boney] to criminal liability." The exception to the hearsay rule provided by Evid. R. 804(b)(3) was not available here.
(b) Opinion testimony from the State's bloodstain pattern experts
The defendant also argues that the trial court committed reversible error when it allowed opinion testimony from the State's bloodstain pattern experts.
Following the killings, the State collected the defendant's blood-stained shirt, shoe, and socks. The State used expert testimony to try to establish that some of the bloodstains were the result of "high velocity impact spatter," indicating that the defendant shot his family or was with in close proximity of the victims when they were shot. (The defendant maintained that the bloodstains were solely the result *234 of "transfer" his shirt, shoe, and socks having come into con tact with the victims' bodies when he discovered them and the blood having been transferred to his clothing through the contact.) It is worth noting in this "spatter" versus "transfer" debate that the State contends that some of the blood on the defendant's clothing came from spatter and some of it from transfer; the defendant maintains that all of it was from transfer. On appeal, the defendant contends that the experts' testimony did not meet the standards of reliability required by Indiana law. He also argues that the probative value of this evidence was substantially outweighed by the danger of unfair prejudice.
Evidence Rule 702(b) dictates that "[e]xpert scientific testimony is admissible only if the court is satisfied that the scientific principles upon which the expert testimony rests are reliable." Here, both sides agree as a general matter that bloodstain analysis is a matter for expert scientific testimony, as this Court has recognized. Grinstead v. State, 684 N.E.2d 482, 487 (Ind. 1997), superseded on unrelated grounds at 845 N.E.2d 1027 (Ind.2006). But the defendant maintains that the science of bloodstain analysis has not advanced to the point of reliability in this particular case.
Before trial, the court conducted a hearing on this matter. The State's stance was that the reliability of the scientific principles upon which bloodstain analysis expert testimony is based is well established. It cited a number of Indiana cases, including Grinstead, and those in other jurisdictions, in which bloodstain analysis expert testimony was held to have been properly admitted. It also noted that, "It should be unnecessary to revisit scientific techniques already deemed to have achieved sufficient general acceptance."[9] Robert L. Miller, Jr., Courtroom Handbook on Indiana Evidence 236 (West 2007-08). The defendant did not dispute this position at the hearing but instead contended that the facts of this case were such that this authority was not applicable. He contended that the bloodstains on his clothing consisted of "eight tiny [blood] stains on a man's t-shirt," Appellant's Br. at 38, and that the science of bloodstain analysis was simply not sufficiently advanced to be capable of discerning whether such a small number of tiny blood spots came from high-velocity impact spatter or from physical contact. At the end of the hearing, the trial court ruled in the State's favor and found that the "blood pattern stain analysis evidence is admissible in this case, such that the witnesses qualified as experts by knowledge, skill, experience, training or education, may testify in the form of an opinion or otherwise." Appellant's App'x at 624.
At trial, the State presented bloodstain analysis testimony from five purported experts. The defendant objected to the qualifications of one of these experts; the other four testified with out any objection to their qualifications as experts. Each witness testified that some of the bloodstains on the defendant's shirt were the result of high-velocity impact spatter. See Tr. 633-35, 637 (w.2, vol.III); Tr. 622-23, 703 (w.4, vol.III); Tr. 101-03, 221-23 (w.5, v.I). The defendant did object to some, but not all, of these witnesses' testimony as contrary to Rule "702," which we take to be an objection to the reliability of the *235 scientific principles on which it was based. After the State rested, the defendant called four bloodstain analysis expert witnesses of his own. Each of these witnesses testified that all of the bloodstains on the defendant's shirt resulted from transfer, not high-velocity impact spatter. See Tr. 512, 522-23, 526, 528, 681 (w.6, v.III); Tr. 447, 450 (w.7, vol.II); Tr. 779-80, 865-66 (w.7, vol.IV).
We find significant that the defendant's own experts, without exception, believed themselves to be qualified and capable of rendering an opinion as to the source of the bloodstains in this case. We do not discount the defendant's general point that simply because scientific principles have been found to be reliable in certain cases, they will not necessarily be able to be applied in all situations. But here, the defendant has not provided any authority that bloodstain analysis scientific principles cannot be relied upon in this particular circumstance and, indeed, his own experts did so. We also think the existence of conflicting expert testimony on this issue helps resolve the claim that the probative value of the State's witnesses' testimony was outweighed by its prejudicial effect. While this was certainly strong evidence in the State's favor, it appears to have been refuted head-on by strong expert testimony in favor of the defendant's position. This was a classic battle of the experts that was properly submitted to the jury for resolution.
(c) Courtroom demonstration by the State's expert witness
The defendant also contends that the trial court committed reversible error when it allowed one of the State's expert witnesses, Mr. Englert, to conduct a courtroom demonstration. The State responds that "[d]emonstrations are permitted to be conducted during a trial if they will aid the court and the jury." Br. of Appellee at 37. It further maintains that Englert's demonstration "aided the jury in understanding his testimony regarding crime scene reconstruction, bloodstain analysis, and the possible trajectory of the bullets." Id. at 38.
At trial, Englert, the State's expert on crime scene reconstruction, used a configuration of chairs representing the front and back seats of the defendant's vehicle to demonstrate his crime scene analysis. His demonstration included maneuvering among the chairs, re-enacting the shootings while doing so. And he used the demonstration to express his opinion as to how some of the daughter's blood and tissue had arrived on the defendant's shirt. The State offered these demonstrations to illustrate to the jury "where people were situated and as to where the shots came from, what side, his general principles as to his crime scene reconstruction." Tr. 734 (w.4, vol.III).
Before the jury observed the demonstrations, the defendant objected on grounds that they would be misleading, an undue waste of time, and a discovery violation. Id. at 733-34. The trial court overruled the objections "to the extent that for demonstrative purposes only the witness may be questioned as to, for example, placement of persons within the vehicle in rendering his opinion as to what may have occurred at the time of the incident." Id. at 734-35. The trial judge specifically noted that he did not foresee the demonstration to be a reenactment of the crime. Id. at 735. During the actual demonstration, defense counsel did make one contemporaneous trial objection based on "speculation." Tr. 769 (w.4, vol.IV).
On appeal, the defendant reasserts three of his trial objections: first, that Englert's opinion concerning how certain of the daughter's blood and tissue had been transferred to his shirt constituted an "enhanced *236 opinion" that the State had never disclosed to the defense, thereby constituting a discovery violation, Appellant's Br. at 43; second, that the configuration of the chairs and the reenactment were misleading because they were "conducted under conditions dissimilar to the crime scene," id. at 44-45; and third, that "Englert's opinion and re-enactment of [the son's] murder were based on speculation" because his testimony was supported only by ambiguous evidence, id. at 43 (citing Evid. R. 703).
As to the discovery violation claim, Trial Rule 26(E)(1) requires parties to supplement discovery responses with respect to the subject-matter and substance of an expert witness's expected testimony in a timely fashion. And pre-trial standing discovery orders often impose related requirements. As such, there are situations in which the unexpected testimony of an expert witness can rise to the level of reversible error. For example, in Beauchamp v. State, the Court of Appeals held that it was reversible error for the State not to have disclosed that one of its expert witnesses had changed his opinion regarding the cause of a victim's injuries from the time of his deposition to his testimony at trial. 788 N.E.2d 881, 893-94 (Ind.Ct. App.2003). And in its opinion in this defendant's first appeal, the Court of Appeals found that the State's failure to disclose another State witness's "augmented" opinion did not comply with either the trial court's standing discovery order or Rule 26(E)(1).[10] 812 N.E.2d at 1141.
During Englert's pre-trial deposition, he had testified about the particular blood stains and tissue in question the daughter's blood and tissue on the defendant's shirt and said that in his opinion, they were the result of transfer as opposed to splatter. And while it is true that in the demonstration at trial, he went beyond his deposition testimony and expressed his view that the transfer occurred during the shooting, this does not rise to the level of a discovery violation. The trial court's only requirement of the parties regarding discovery of expert witnesses said, "The parties are directed to generally disclose to one another the anticipated witnesses to be called to testify the following week." Appellant's App'x at 735. The defendant knew Englert would testify, thus satisfying the trial court's requirement. To be sure, Trial Rule 26(E)(1) requires parties to supplement discovery responses with respect to the subject-matter and substance of an expert witness's expected testimony in a timely fashion. See Beauchamp, 788 N.E.2d at 894. But the defense knew before trial that it was Englert's opinion that the blood and tissue in question was the daughter's and that it was on the defendant's shirt by transfer. As it was the State's theory that the defendant was the shooter, it could not have been a surprise when Englert expressed his view that the transfer occurred during the shooting.
As to the generalized claim that the demonstration was misleading, a trial court's decision to allow courtroom demonstrations will only be reversed for an abuse of discretion. Lambert v. State, 643 N.E.2d 349, 353 (Ind.1994). This is in part because "[d]emonstrations are permitted to be conducted during a trial if they will aid the court and the jury." Benner v. State, 580 N.E.2d 210, 213 (Ind.1991). Here we see no basis for concluding that the trial court abused its discretion by allowing the demonstrations. Indeed, the *237 demonstration appears to have helped the jury and the court gain a sense of perspective during Englert's testimony that also used close-up pictures of the crime scene and gunshot trajectory analysis. And contrary to the defendant's contention, we disagree that the un-scaled chair configuration misled the jury, as the jury had seen the vehicle itself and photographs of its interior. Tr. 733 (w.4, vol.III).
The defendant's final contention that "Englert's opinion and re-enactment of [the son's] murder were based on speculation," Appellant's Br. at 43, goes to the weight of the testimony, and not to its admissibility. It was the jury's responsibility to consider the evidence and to decide the weight to give to Englert's demonstration and opinion. The trial court did not err in permitting the Englert demonstration and opinion.
Conclusion
We reverse the defendant's convictions and remand for new trial or other proceedings consistent with this opinion.
SULLIVAN, BOEHM, and RUCKER, JJ., concur.
SHEPARD, C.J., dissents with separate opinion.
SHEPARD, Chief Justice, dissenting.
The system of justice seeks to provide a fair trial, but there is no entitlement to a perfect trial. I think the two reversals entered by the appellate courts in this case have unnecessarily sanitized the evidence against David Camm.
Amidst the mountainous evidence in this trial was Camm's declaration while in prison that his wife intended to leave him because of problems in their marriage and that he planned the killings on a night when the basketball game might provide an alibi. The credibility of this jail-house testimony (which included more direct admissions of guilt) might have been easier for the jury to assess had it known that David Camm was a serial adulterer whose activity recruiting sex partners persisted as late as ten days before the murders and continued through his pre-trial in carceration when he solicited a female guard at the jail.
The reversal after trial number one may have legitimately rested in part on the prosecution's use of twelve women to tell the stories of Camm's infidelity running back as far as nine years before these murders. The testimony about how Camm treated his wife during periods up closer to the killings seems probative of motive, but it does not surprise me that the prosecutors decided in trial number two not to run the risk of seeking to let the jury hear it.
I put in the same category this Court's tough stance of prohibiting any of the evidence that Camm's daughter had been molested within a day or two of the murders, evidence the prosecution has suggested indicated Camm killed the family so as to avoid responsibility or confrontation. After the first trial, the Court of Appeals summarized the available evidence on the topic this way:
The medical examiner who conducted Jill's autopsy testified that there was trauma to her genital region consistent with either molestation or a straddle fall; there was no penetration of the hymen, however. The State also presented evidence that Jill had complained of vaginal irritation on at least two prior occasions, the last time being a few days before the murders. Finally, it presented evidence that some of Jill's DNA was found on Camm's bedspread, which could have come from saliva or vaginal secretions. However, none of Jill's DNA was found in the two locations where seminal material *238 from Camm was also found on the bedspread. In fact, at one of those locations Camm's seminal material was mixed with Kim's DNA.
Camm, 812 N.E.2d at 1140. The defense lawyers who have been so effective as to win two reversals did not even bother to object to this evidence during trial number one. I regard this evidence as providing an inference about Camm's motive and dissent from today's decision to bar the jury from hearing it.
Finally on admission of evidence, the Court reverses because the witness quoted Kim Camm as saying, "she was expecting her husband home between 7:00 and 7:30...," citing Evidence Rule 803(3). The Court suggests that it might permit a witness to quote a victim as saying, "I plan to be home between 7:00 and 7:30." This suggested distinction appears to indicate that a reversal would be required if instead the victim had told her friend, "I plan to be home between 7:00 and 7:30 so I can meet my husband." The Court has cut a pretty fine line today on what is permitted and what is prohibited under Rule 803(3). I do not see so large a space of daylight here as my colleagues do. It is not the stuff upon which reversals are warranted.
Part of the reason I regard reversal as unwarranted is the rest of the evidence the jury heard. The Court passes over in two sentences Camm's confessions of guilt to three different inmates. Twenty-four jurors apparently credited their testimony.
But, one may put those witnesses aside and ask instead what the jury made of Camm's own version of the events.
Camm says he came home to a horrific scene, concluded his son was warm and might still be saved, decided to go inside the house, called a distant police agency, turned down three suggestions that medical help be sent, and only then went back to the garage to administer CPR. Or ask what the jury probably made of Camm's phone call at 7:15 a.m. the morning after the murder to inquire at Kim's work about her employment benefits. Or his request that very same day that an acquaintance who was in the crime scene cleaning business come to clean out the vehicle that contained evidence about the murders.
I would affirm the jury's verdict.
NOTES
[1] In a separate trial, Boney was convicted of three counts of Murder, Ind.Code. § 35-42-1-1, one count of Conspiracy to Commit Murder, id. § 35-42-1-1; XX-XX-X-X, and was found to be a habitual offender, id. § 35-50-2-8. Boney v. State, 880 N.E.2d 279 (Ind.Ct. App.2008), trans. denied.
[2] The constitutional prohibition against double jeopardy does not prevent retrial following a reversal due to the erroneous admission of evidence if the totality of the evidence, including that erroneously admitted, was sufficient to support the conviction. Lockhart v. Nelson, 488 U.S. 33, 40-42, 109 S.Ct. 285, 290-92, 102 L.Ed.2d 265, 273-74 (1988); Bowman v. State, 577 N.E.2d 569, 571 (Ind. 1991).
[3] On appeal, the defendant disputes the relevance of this medical evidence showing blunt force trauma to the daughter's genitals but, by failing to object to its introduction at trial, he has waived review. See Br. of Appellant at 21 (conceding that he "did not object to the injuries"). Seeking to avoid waiver, the de fendant claims its admission rises to the level of fundamental error requiring reversal on appeal. We de cline to find this to be fundamental error.
[4] The jury, somewhat unusually, held a press conference after the defendant's sentencing, and the defendant introduced in his motion to correct error a news article reporting on this conference. The article's headline is telling: "The Jurors Speak: Molestation evidence led to guilty verdict." See Appellant's App'x at 1050. The article speaks to the deciding factor in the conviction: "[The defendant] was the only person who could have molested his daughter in the two days before her murder." Id. Though the article acknowledges that the jury considered other matters, the crux is that it convicted the defendant because it believed he molested his daughter. Id.
[5] The Committee concluded that
[The question] [w]hether statements of intent by one person should be admitted to prove that another person did an act has always been controversial. The usual context is a statement by a crime victim that the victim is going out to meet the defendant, offered to prove that the victim in fact met the defendant. The committee fails to see the connection, because the victim has no control over what the defendant does, and therefore the victim's intent cannot influence the defendant.
Burns Ind. Statutes Annotated, 2009 Code Ed., at 675 (emphasis added). This Court did not formally adopt the committee commentary, but has in the past relied on it. See, e.g., Specht v. State, 734 N.E.2d 239, 240 (Ind. 2000) (relying in part on commentary to Rule 609(a)); see also Atwell v. State, 738 N.E.2d 332, 335 n. 3 (Ind.Ct.App.2000) (relying on the commentary to Rule 106); Stanage v. State, 674 N.E.2d 214, 216 (Ind.Ct.App.1996) (same).
[6] See, e.g., Alaska R. Evid. 803(3); Cal. Evid. Code § 1250; Fla. Stat. Ann. § 90.803(3); La. Code Evid. art. 803(3); Md. R. Evid. 5-803(b)(3).
[7] See State v. Phillips, 194 W.Va. 569, 461 S.E.2d 75, 90-91 (1995); State v. Krone, 182 Ariz. 319, 897 P.2d 621, 625-26 (1995) (Feldman, C.J., specially concurring); People v. Lawler, 142 Ill.2d 548, 154 Ill.Dec. 674, 568 N.E.2d 895, 900 (1991); State v. Vestal, 278 N.C. 561, 180 S.E.2d 755, 773 (1971); State v. Perelli, 125 Conn. 321, 5 A.2d 705, 707 (1939); State v. Engweiler, 118 Or.App. 132, 846 P.2d 1163, 1164-65 (1993); People v. Franklin, 782 P.2d 1202, 1206 (Colo.Ct.App. 1989).
[8] In Jervis, the State also contended that the defendant had not established that the declarant was "unavailable," a requirement for admission under Evid. R. 804(b). Jervis, 679 N.E.2d at 878. Because of our resolution of this issue, it is not necessary for us to examine whether Boney was "unavailable" within the meaning of this rule.
[9] Judge Miller's Courtroom Handbook points out that before adoption of the Indiana Rules of Evidence, this Court "recognized the admissibility, based on reliability, of expert testimony concerning the results of ... blood splatter analysis" in James v. State, 613 N.E.2d 15, 21 (Ind.1993). Robert L. Miller, Jr., Courtroom Handbook on Indiana Evidence 236 (West 2007-08). We reaffirmed this holding after the adoption of the Rules in Grinstead, 684 N.E.2d at 487.
[10] Given its disposition of the case, the court did not reach the question of "whether this violation ... in dependently would have warranted reversal of [the defendant's] conviction." 812 N.E.2d at 1141.
| 2024-03-11T01:26:59.872264 | https://example.com/article/1386 |
/** Used to match template delimiters. */
var reEscape = /<%-([\s\S]+?)%>/g;
export default reEscape;
| 2023-11-15T01:26:59.872264 | https://example.com/article/7126 |
GeoLas 280U/560U (TM): hardware upgrade for Riegl LMS-Q280(i) and LMS-Q560 laserscanners boosts the performance of your lidar system to competitive levels while costing only a fraction of a new laserscanner. Features of the upgraded units include:
Hardware upgrades for other airborne laserscanners (manufacturers, types): upon request.
Data acquisiton system and software
LiDAR Control(TM): a data acquisition and scanner control system for Riegl LMS-Q120/160/240/280 series laserscanners. Directly interfaces to the laserscanner and a GPS receiver for time synchronization. Includes the LiDAR Capture (TM) software. Download a data sheet here.
LiDAR Capture (TM): a software for controlling Riegl LMS-Q120/160/240/280 series laserscanners and capturing the raw lidar data they collect.
Geocoding software
LiDAR GeocodeU (TM): a stand-alone software for full-waveform processing and geocoding of raw waveform data lidar data collected by GeoLas 280U/560U laserscanners (upgraded Riegl scanners) to geocoded 3D point clouds, optimized for throughput and geometrical accuracy to get the maximum out of your data. Additionally, it provides access to waveform data in the easy-to-use "Geocoded Normalized Waveform" (GNW) format .
LiDAR GeocodeV (TM): a stand-alone software for converting lidar data collected by Riegl VQ-480 series laserscanners to geocoded 3D point clouds, optimized for throughput and geometrical accuracy to get the maximum out of your data.
LiDAR GeocodeWF / GeocodeWF68 (TM): a stand-alone software for full-waveform processing and geocoding of raw waveform data of the Riegl LMS-Q560 and LMS-Q680(i)series laserscanners to geocoded point clouds. This software automates the entire process of extracting returns from full-waveform SDF files, conversion to 3D points, transformation to projected coordinate systems, and output as 3D point clouds for subsequent processing in LIDAR post-processing software like TerraScan, in a one-step operation. GeocodeWF is optimized to make operational processing of waveform data as simple and fast as possible, employing parallel processing techniques on multi-core systems. Additionally, it provides access to waveform data in the easy-to-use "Calibrated Waveform" format. Download a data sheet here.
LiDAR Geocode (TM): a stand-alone software for converting raw lidar data of Riegl LMS-Q120/240/280 series laserscanners to geocoded 3D point clouds, optimized for throughput and geometrical accuracy to get the maximum out of your data. Download a data sheet here. | 2024-06-02T01:26:59.872264 | https://example.com/article/1995 |
9-11 mastermind and nominal Al-Qaeda leader Osama bin Laden was killed in May 2011 during a raid on his compound in Abbottabad, Pakistan. A massive amount of intelligence was seized during the raid, including hundreds of thousands of files stored on Bin Laden's hard drive. Today, the CIA released nearly 470,000 of those files, and it turns out that not only was he the world's most infamous terrorist, he also had a thing for retro-gaming and anime.
The archive has been conveniently divided into four categories—audio, documents, images, and video—but is nonetheless a massive thing to dig through. But if you're willing, it's all there: Images of everything from Pac-Man to Perestroika Girls, including both title and gameplay screens. A lot of it is the sort of digital detritus you inevitably pick up while surfing the web, banners for Irish betting sites and pictures of Whitney Houston, and of course there are photos of guns and potential targets and what I assume are terrorist training videos. But there's also a full-length copy of the Street Fighter 4: The Ties That Bind anime film in there, too—subtitled in Arabic, of course.
Not kidding: Osama Bin Laden had a big folder of classic game emulator cover art/screens and he LOVED weird bootleg babe games pic.twitter.com/zL58G3wZIaNovember 1, 2017
The CIA noted that some materials collected during the raid have not been made public. Some of the omissions are obvious, like material related to national security, but discovered malware was also removed, as was porn (so apparently there was some), and perhaps most interesting of all, copyrighted content, which altogether paints a rather mundane portrait of an unremarkable mind:
Antz
Batman Gotham Knight
BBC Great Wildlife Moments
Biography – Osama bin Laden
Cars
Chicken Little
CNN Presents: World’s Most Wanted
Final Fantasy VII
Heroes of Tomorrow
Home on the Range
Ice Age: Dawn of the Dinosaurs
In the Footsteps of bin Laden – CNN
National Geographic: Kung Fu Killers
National Geographic: Inside the Green Berets
National Geographic: Predators at War
National Geographic: World’s Worst Venom
Peru Civilization
Resident Evil
Storm Rider – Clash of the Evils
The Kremlin from Inside
The Story of India
The Three Musketeers
Where in the World is Osama bin Laden
The agency also warned that, despite its curation efforts, the collection may include content that is "offensive and/or emotionally disturbing," and thus not suitable for all ages. It could also contain malware: "Prior to accessing this file collection, please understand that this material was seized from a terrorist organization," it wrote. "While the files underwent interagency review, there is no absolute guarantee that all malware has been removed."
Sufficiently cautioned, you may jump in with both feet at cia.gov. | 2024-07-22T01:26:59.872264 | https://example.com/article/7259 |
603 P.2d 1050 (1979)
The STATE of Montana, Plaintiff and Respondent,
v.
Mark Thomas NELSON, Defendant and Appellant.
No. 14848.
Supreme Court of Montana.
Submitted November 8, 1979.
Decided December 14, 1979.
Fisher & Erickson, Whitefish, Leif B. Erickson argued, Whitefish, H.L. Garnaas, Missoula, Hash, Jellison, O'Brien & Bartlett, Kalispell, for defendant and appellant.
Mike Greely, Atty. Gen., Helena, Mary B. Troland, Asst. Atty. Gen. argued, Helena, Ted O. Lympus, County Atty., Kalispell, for plaintiff and respondent.
*1051 DALY, Justice.
Defendant was charged by information filed in the District Court of the Eleventh Judicial District of the State of Montana, in and for the County of Flathead, with the offense of aggravated assault. During his arraignment, defendant pleaded guilty to the charge. The plea was accepted at a later hearing held to determine the facts which were the basis of the guilty plea. Subsequently, the District Court ruled that the mandatory minimum two-year sentence provision of section 45-5-202(2), MCA, applied, and the criteria for the exceptions to the mandatory two-year sentence found in section 46-18-222, MCA, had not been met. A sentence of twenty years in the state prison, with all but three years suspended, was imposed. Defendant then filed an appeal from the finding that the mandatory minimum two-year sentence applied in his case. Thereafter, defendant filed a motion with the District Court requesting leave to withdraw his plea of guilty to the offense of aggravated assault and enter a plea of not guilty. This motion was denied and sentence imposed. Defendant appeals from the judgment.
On September 17, 1978, the date of the assault, defendant began drinking early in the day. He was depressed due to a fight with his girlfriend and during the day, he consumed approximately one pint of 100-proof vodka and some prescription sleeping pills while only eating a hamburger. As a result of this combination of alcohol, drugs and lack of food, defendant became intoxicated.
Sometime during the morning defendant was informed that a 9mm automatic pistol he had loaned to a friend had been returned to the friend's house. He went to his friend's house to recover the pistol and its accessories, which included a 14-shot clip and a shoulder holster. For ease in carrying the pistol, he put the shoulder holster on and placed the pistol in it. Later that morning he loaded the clip and went out to take target practice. During this practice he fired three or four shots and then placed the weapon in the holster. Apparently, the pistol was still in a cocked position when it was returned to the holster.
After the target practice defendant drove to his trailer home located on LaSalle Road across from a Circle K store to take a nap. He slept until late afternoon and upon waking, decided to call his girlfriend. Having no phone in his trailer, he walked across the street to the Circle K store to make the call. He was still carrying the pistol in the shoulder holster.
By the time defendant left the Circle K store, it had become dark. As he was recrossing LaSalle Road to return to his trailer, a pickup truck approached traveling south. At this point there are two differing versions of the facts that occurred.
The first version is that of the driver of the pickup truck, Harold Keller. Keller testified that he was driving his pickup south on LaSalle Road near the Circle K when a man, later identified as defendant, wandered across the street in front of his truck. Keller stopped his truck to allow the man to cross in front of him. Keller maintains defendant was swearing and waving his arms and pounded on the hood of the vehicle. Keller proceeded to drive away when defendant started yelling and swearing. Keller stopped his truck and looked through the back window at defendant who was just behind the truck. Keller testified that defendant reached into his pocket, pulled out a gun and fired. As the gun fired, defendant fell over backwards and the gun slid off the road. Keller then sped off and called the police. Keller testified that he thought defendant was either drunk or out of his mind.
At the time of the shooting, defendant was about ten feet away from where Keller was sitting in his truck. However, the slug did not strike the pickup nor did it injure anyone, nor was it found.
Defendant's version of the facts only differs on a few key points. He testified that Keller yelled and swore at him as he went by and that he first thought there were two people in the truck. When the pickup stopped he thought he was in danger. He testified that he pulled out the pistol to *1052 show the people in the truck that he had something with which to protect himself. In the act of pulling it out, he dropped the gun and being in a cocked position, it fired on hitting the ground. He testified he had not intended to shoot the gun at all when pulling it out and the discharge was accidental.
On November 27, 1978, defendant was charged in District Court with the offense of aggravated assault in violation of section 94-5-202(1)(c), R.C.M. 1947 (now section 45-5-202(1)(c), MCA), by firing a pistol at Harold Keller. The defendant was arraigned on January 22, 1979. At that time he stated he wished to plead guilty. The trial judge, on finding that a factual basis was necessary prior to accepting defendant's plea, questioned him as to the events culminating in the aggravated assault charge. Defendant replied that his memory of events was unclear because of his level of intoxication at the time of the crime. He did state, however, that he had been carrying a gun on the night in question and that the weapon had been discharged.
The trial judge at that point declined final acceptance of defendant's guilty plea until a more adequate factual basis could be established. On February 16, 1979, the arraignment was continued. At that time Harold Keller testified as to his version of the incident. Defendant declined to cross-examine Keller and did not present evidence.
The trial judge accepted defendant's guilty plea, finding that there was sufficient factual basis for such action. The judge also made reference to the fact that the guilty plea was entered in accordance with a plea bargain arrangement whereby the State agreed to drop certain charges in justice court in return for the entry of the plea to the aggravated assault charge.
On May 29, 1979, a hearing was held for evidence in aggravation and mitigation of sentence. During this hearing defendant, for the first time, revealed his version of the incident. In addition to the testimony of defendant, of defendant's character witnesses, and of the victim, the trial judge also had before him, at the sentencing hearing, a presentence report and an evaluation report from the state prison where defendant had been given a 45-day evaluation. Based on this evidence, the trial judge sentenced defendant to twenty years in the state prison, all but three suspended. In doing so, the judge specifically found that defendant was subject to the mandatory minimum sentence of the aggravated assault statute.
On July 11, 1979, a hearing was held on defendant's motion to withdraw his plea of guilty and enter a plea of not guilty. The motion was based on the allegation that the plea was invalid because defendant had not admitted the facts of the crime as asserted by the victim. The trial judge denied the motion ruling there was an adequate factual basis for acceptance of the plea based on defendant's and the victim's testimony at the arraignment. Defendant appeals both his sentence and the denial of his motion to withdraw his plea of guilty.
Two issues are presented to this Court for review:
1. Did the District Court err in accepting the guilty plea entered by defendant?
2. Did the District Court err in determining that the mandatory two-year sentence provision for aggravated assault under section 45-5-202(2), MCA, applied under the facts of this case?
The first issue to be resolved is whether the District Court erred in denying defendant's motion to withdraw his guilty plea.
General principles governing the withdrawal of a guilty plea are well settled. Article II, Sections 24 and 26, 1972 Montana Constitution, protect the right of a criminal defendant to a trial by jury.
Section 46-12-204, MCA, states in pertinent part:
"(1) The defendant shall enter a plea of guilty or not guilty to the indictment, information or complaint. If the defendant refuses to plead to the indictment, information, or complaint, a plea of not guilty must be entered.
*1053 "(2) The court may refuse to accept a plea of guilty and shall not accept the plea of guilty without first determining that the plea is voluntary with an understanding of the charge."
Further, section 46-16-105(2), MCA, provides:
"At any time before or after judgment the court may, for good cause shown permit the plea of guilty to be withdrawn and a plea of not guilty substituted."
There is no precise rule which can be relied upon in any given case to withdraw a guilty plea. State v. Lewis (1978), Mont., 582 P.2d 346, 352, 35 St.Rep. 1089, 1096. Each case must be examined on its own record. State v. Griffin (1975), 167 Mont. 11, 21, 535 P.2d 498, 503. We must rely on the discretion of the trial court. "... That discretion is subject to review only upon the showing of an abuse of discretion." State v. Lewis, supra, 582 P.2d at 352.
"`A plea of guilty will be deemed involuntary where it appears that the defendant was laboring under such a strong inducement, fundamental mistake, or serious mental condition that the possibility exists he may have plead guilty to a crime of which he is innocent.' ... "If, however, there is any doubt that a plea is not voluntary, the doubt should be resolved in the defendant's favor. On application to change a plea, all doubts should be resolved in favor of a trial on the merits." State v. Huttinger (1979), Mont., 595 P.2d 363, 367, 36 St.Rep. 945. (Citations omitted.)
In Huttinger this Court held that there are three important considerations involved in a criminal defendant's attempt to withdraw a previously entered plea of guilty:
"... (1) the adequacy of the interrogation by the District Court of the defendant at the entry of the guilty plea as to the defendant's understanding of the consequences of his plea, (2) the promptness with which the defendant attempts to withdraw the prior plea, and (3) the fact that the defendant's plea was apparently the result of a plea bargain in which the guilty plea was given in exchange for dismissal of another charge ..." 595 P.2d at 366.
Here, we are only concerned with the first factor as defendant's motion to withdraw his plea was timely and the court refused to accept the plea bargain agreement when presented to the court.
While the interrogation here was more complete than in Huttinger, defendant did not admit that he had committed an aggravated assault, nor did he declare the facts upon which his plea of guilty was based. Here, the interrogation by the judge concerning the incident went as follows:
"THE COURT: You are aware of the nature of this charge against you and that it could be up to 20 years at hard labor in the State Prison?
"THE DEFENDANT: Yes, sir.
"THE COURT: Are you satisfied with the services rendered by your attorney, Mr. Bartlett?
"THE DEFENDANT: Yes, sir.
"THE COURT: Mr. Bartlett, are you satisfied that the Defendant is entering this plea voluntarily?
"MR. BARTLETT: Yes, sir.
"THE COURT: Now, even though you have the right to remain silent, as I stated, I won't accept a plea of guilt unless there is a factual basis justifying such plea, so I'm going to ask you, did you, on September 17, 1978, discharge a Smith & Wessons Model 59 pistol at a Harold Keller?
"THE DEFENDANT: I was highly intoxicated at the time, your Honor, and I'm not sure I don't recall the actual events that happened.
"THE COURT: Did you have a pistol with you?
"THE DEFENDANT: Yes, sir.
"THE COURT: And was it discharged?
"THE DEFENDANT: Yes, sir.
"THE COURT: Now, prior to this time, I assume that your attorney knew of had access to the County Attorney's file as to the police investigation?
"THE DEFENDANT: Yes, sir.
*1054 "THE COURT: What had you been drinking at the time?
"THE DEFENDANT: Vodka and orange juice.
"THE COURT: And how long?
"THE DEFENDANT: About 12, 14 hours.
"THE COURT: Now, who else was there, do you recall?
"THE DEFENDANT: No, just myself.
"THE COURT: Do you know where the gun was discharged from?
"THE DEFENDANT: Yes, sir.
"THE COURT: And where was it?
"THE DEFENDANT: On LaSalle Road.
"THE COURT: And why was it discharged, do you know?
"THE DEFENDANT: No, sir.
"THE COURT: Who is Allen Baker?
"THE DEFENDANT: I have no idea, sir.
"THE COURT: Harold Keller?
"THE DEFENDANT: I don't know him either.
"THE COURT: You have never met him before?
"THE DEFENDANT: No.
"THE COURT: But this was the person involved with the discharge of the gun?
"THE DEFENDANT: Yes, sir.
"THE COURT: Well, under these circumstances, at the time of the hearing, I think that Mr. Keller should be here in order that the circumstances be more fully known to the Court ..."
The court at this time properly refused to accept defendant's guilty plea. It did, however, accept it without further interrogation of defendant after hearing the testimony of the victim on March 8, 1979.
While this case involves an aggravated assault, it has the same problems and defects that were pointed out in State v. Azure (1977), Mont., 573 P.2d 179, 34 St. Rep. 1569, and reiterated in Huttinger.
Here, defendant was not made aware of the differing elements of assault as set forth in sections 45-5-201 and 45-5-202, MCA. The District Court had before it evidence indicating the defendant was under the influence of a combination of drugs and alcohol and was possibly suffering from mental distress or instability. These mitigating circumstances may have prevented the defendant from being able to commit an aggravated assault as defined by statute.
"`* * * Real notice and understanding by a defendant of the true nature of the charge against him is the first and most universally recognized requirement of due process * * * Understanding of the nature of the charge is indispensable to a valid plea of guilty * * *'" State v. Azure, supra, 573 P.2d at 183.
The transcripts indicate defendant actually remembered the facts surrounding the alleged assault. From statements made by his original counsel, it appears defendant testified contrary to these facts because of his mistaken interpretation of counsel's advice that he was to advise the court he was too intoxicated to remember the details surrounding the alleged assault. It appears that defendant, who was a newcomer to the criminal justice system, clearly misunderstood not only the advice of counsel, but the ramifications of failing to tell the truth. The attorney, however, should have taken steps to protect his client from a situation of this kind, if not immediately, at least before the second hearing.
Matters were further complicated, however, when defendant's original attorney became ill and one of his associates, who was unfamiliar with the facts, assumed the case shortly before the second hearing. At the second hearing, no evidence was introduced by defense counsel to contradict the testimony of the victim, although defendant clearly had a different version of the incident. The judge accepted the plea without ever hearing defendant's version.
This is an unfortunate chain of circumstances which should not happen in our criminal justice system. If the matter was properly understood by the judge in the first instance, it is conceivable that the judge would not have accepted defendant's plea, there being real questions concerning *1055 whether or not an aggravated assault was actually committed.
The second issue before this Court is whether the District Court erred in determining that the mandatory two-year sentence provision for aggravated assault under section 45-5-202(2), MCA, must apply here.
Section 45-5-202(2), MCA, states:
"A person convicted of aggravated assault shall be imprisoned in the state prison for a term of not less than 2 years or more than 20 years, except as provided in XX-XX-XXX."
Section 46-18-222, MCA, provides in pertinent part:
"All mandatory minimum sentences prescribed by the laws of this state ... do not apply if:
"...
"(2) the defendant's mental capacity, at the time of the commission of the offense for which he is to be sentenced, was significantly impaired, although not so impaired as to constitute a defense to the prosecution;
"...
"(5) where applicable, no serious bodily injury was inflicted on the victim."
Both parties agree that the District Court erred and that the exemptions enumerated above apply.
The transcripts are replete with testimony that the defendant was very drunk on the night of the incident. This testimony, however, may be viewed differently by reasonable men as it concerns intent. Yet, whether defendant could or could not form the necessary intent is of no consequence here, as the exception in subsection (5) above enumerated is applicable. Although a loaded weapon was involved and although section 46-18-221(1), MCA, provides for a minimum sentence for crimes committed with a firearm, this section is also subject to the exceptions of section 46-18-222.
In the last legislative session, section 46-18-222(5) was amended so that the exception involving absence of serious bodily injury is inapplicable if a weapon is used in the crime, even if no serious bodily injury is inflicted. Chapter 396, Section 1, Laws of Montana (1979). This amendment, however, did not become effective until July 1, 1979, and therefore cannot be retroactively applied to persons committing crimes prior to that date. State v. Azure, supra, 587 P.2d at 1297.
Therefore, on the facts and time frame of this case, the District Court erred in finding section 46-18-222(5) inapplicable.
The judgment of the District Court is reversed, and the sentence imposed on that judgment vacated and set aside. The cause is remanded to the District Court with instructions to permit defendant to withdraw his previously entered plea of guilty and enter his plea of not guilty to the crime charged.
HASWELL, C.J., and HARRISON, SHEA and SHEEHY, JJ., concur.
| 2024-02-16T01:26:59.872264 | https://example.com/article/3373 |
The Finnish Anti-Fascist Committee (SAFKA) extends its gratitude to all those who supported our activities in Finland, Europe, and Russia last year. We wish all our cooperation partners the very best of success in 2012. | 2024-07-03T01:26:59.872264 | https://example.com/article/5210 |
During Thursday’s broadcast of “New Day” on CNN, Rep. Katherine Clark (D-MA) warned House Democrats could be left with no “choice” but to pursue impeachment if President Donald Trump’s administration continues to fight subpoenas.
Clark said it is up to Trump whether or not he wants to cooperate.
“We have never seen a president like this. We have never seen a president who so flagrantly decides that he’s above the law and that he can do what he wants,” Clark told host John Berman. “You know, we do have tools. And yes, these have not historically been used. But we have never had a president who has issued a blanket statement that nobody is going to respond to subpoenas from Congress.
“If all of those protections of our government fail, we will pursue impeachment. We won’t have any other choice,” she added.
Follow Trent Baker on Twitter @MagnifiTrent | 2024-04-05T01:26:59.872264 | https://example.com/article/8577 |
Dan du Preez
Daniel du Preez (born 5 August 1995 in Durban, South Africa) is a South African rugby union player for the in Super Rugby and in the English Premiership. He can play as a lock, a flanker or a number eight.
Career
Youth
Du Preez was selected in a number of KwaZulu-Natal youth squads whilst still at school. At primary school level, he was selected for their squad that played at the 2008 Under-13 Craven Week competition. He also played in the premier schools competition in South Africa – the Under-18 Craven Week in three different seasons; he made two appearances at the 2011 event in Kimberley, three appearances at the 2012 event in Port Elizabeth – scoring a try in their match against the Free State – and a further three appearances in 2013, scoring a try against Border.
In both 2012 and 2013, Du Preez was selected to represent a South African Schools team. In 2012, he played in their matches against France and Wales and in 2013 he made appearances against England and Wales.
He recovered from an injury that kept him out of the 2014 IRB Junior World Championship to play a key part in the side that played in the 2014 Under-19 Provincial Championship, making eleven appearances and scoring tries in their matches against and to help them qualify for the semi-finals, where they lost 20–43 to the .
Sharks
In 2015, despite not having featured at senior provincial level for the , Du Preez was included on the bench for the ' Round Five Super Rugby match against the . He made his Super Rugby debut in the Sharks' 27–10 victory, coming on for the final ten minutes of the match.
South Africa Under-20
In 2014, he was selected in the South Africa Under-20 squad to play at the 2014 IRB Junior World Championship, but an injury ruled him out of the competition and was replaced by Jacques Vermeulen.
In March 2015, Du Preez was named in an extended South Africa Under-20 training group as part of their preparation for the 2015 World Rugby Under 20 Championship. He featured for them in a friendly match against a Varsity Cup Dream Team in April 2015. In May 2015, he was included in the South Africa Under-20 squad that toured Argentina. He started both of their tour matches, scoring a try in the 25–22 victory in the first encounter and was then included in the final squad for the 2015 World Rugby Under 20 Championship.
He played off the bench in the first of their three matches in Pool B of the competition, a 33–5 win against hosts Italy, started their 40–8 win against Samoa and again came on as a replacement in their 46–13 win over Australia to help South Africa finish top of Pool B to qualify for the semi-finals with the best record pool stage of all the teams in the competition. Du Preez came on in the second half of their semi-final match against England, but could not prevent them losing 20–28 to be eliminated from the competition by England for the second year in succession and started their third-place play-off match against France, scoring two tries in the match to help South Africa to a 31–18 win to secure third place in the competition.
Personal
Du Preez's father Robert is a former Springbok scrum-half that made seven appearances for South Africa between 1992 and 1993.
He has an older brother – also called Robert – and a twin brother Jean-Luc. Both of them also represented the South Africa Under-20 side at the IRB Junior World Championship, in 2013 and 2014 respectively.
References
Category:South African rugby union players
Category:Living people
Category:1995 births
Category:Sportspeople from Durban
Category:Rugby union locks
Category:Rugby union flankers
Category:Rugby union number eights
Category:Sharks (Currie Cup) players
Category:Sharks (rugby union) players
Category:South Africa Under-20 international rugby union players
Category:Twin sportspeople
Category:Twin people from South Africa
Category:South Africa international rugby union players | 2024-03-05T01:26:59.872264 | https://example.com/article/5235 |
Introduction {#s1}
============
The erythrocytic stage of malaria infection is characterised by the development of strong pro-inflammatory immune responses which, although required to control parasite replication and promote clearance of infected erythrocytes, must be tightly regulated to prevent the immune-mediated pathology which is integral to the development of the severe complications of infection in humans and in a number of well-characterised animal models [@ppat.1000004-ArtavanisTsakonas1]--[@ppat.1000004-Omer1]. Previous studies have highlighted important roles for IL-10 and TGF-β in regulating the pro-inflammatory response during malaria infection [@ppat.1000004-Omer2]--[@ppat.1000004-Linke1]. Thus, although IL-10^−/−^ and TGF-β-depleted mice are able to control parasite replication during *P. chabaudi* AS infection as effectively as WT mice, unlike WT mice they develop severe TNF-mediated pathologies which are typically fatal [@ppat.1000004-Omer2], [@ppat.1000004-Li1]--[@ppat.1000004-Linke1]. Similarly, IL-10 can prevent the onset of cerebral malaria in *P. berghei* ANKA-infected mice [@ppat.1000004-Kossodo1].
However, the exact role of IL-10 and TGF-β appears to vary between infections with different malaria species and strains, depending on the timing of cytokine production in relation to disease progression. Thus, production of TGF-β and IL-10 during the first few days of a lethal *P. yoelii* 17XL (PyL) infection is associated with inhibition of pro-inflammatory responses, rapidly escalating parasitaemia and death [@ppat.1000004-Omer3],[@ppat.1000004-Kobayashi2]. In contrast, mice infected with the non-lethal variant (*P. yoelii* 17X; PyNL) produce no or only low levels of TGF-β and IL-10 during early acute infection and eventually control their parasitaemia [@ppat.1000004-Omer3]. Blockade of IL-10R signalling in combination with anti-TGF-β treatment restores the type-1 immune response during lethal *P. yoelii* infection, and a proportion of infected animals are able to control their infections and survive [@ppat.1000004-Omer3]. Moreover, splenocytes from susceptible BALB/c mice, but not resistant DBA/2 mice, infected with PyNL produce IL-10 and TGF-beta during the early acute stage of infection, which is associated with an increase in the proportion of splenic CD25^+^ CD4 T cells [@ppat.1000004-Wu1]. Taken together, these studies demonstrate a causal role for immunoregulatory cytokines in suppressing parasite clearance mechanisms.
In accordance with these findings, a study by Hisaeda and colleagues indicated that differential activation of natural regulatory T cells (nTreg) may account for the differing virulence of *P. yoelii* strains, since depletion of CD4^+^CD25^hi^ T cells (with anti-CD25 antibody) prior to infection converted PyL from a rapidly lethal infection into a resolving infection but had no effect on the course of PyNL infection [@ppat.1000004-Hisaeda1]. Although first identified as cells that limit autoimmune pro-inflammatory responses [@ppat.1000004-Sakaguchi1], nTreg (defined by expression of CD4, the transcription factor Foxp3 and high levels of CD25) have since been shown to regulate the immune response in a number infections including *Leishmania spp* infections, *Mycobacterium tuberculosis* and helminth infections [@ppat.1000004-Belkaid1]--[@ppat.1000004-Belkaid2], mediating their effects either via direct cell contact or by release of cytokines. However, it is now becoming apparent that both adaptive (Foxp3^−^) regulatory T cell populations and classical T-bet expressing Th1 cells also play crucial immunoregulatory roles during infection and mediate their effects through secretion of IL-10 [@ppat.1000004-Anderson1]--[@ppat.1000004-Kamanaka1].
In this study we have examined the generation and function of both nTreg and adaptive IL-10-secreting T cells during malaria infection. We observe equivalent expansion of natural Foxp3^+^ regulatory T cells during both lethal and non-lethal *P. yoelii* infections but, using either anti-CD25 treatment or adoptive transfer of purified CD25^hi^/Foxp3^+^ nTreg or CD25^−^/Foxp3^−^ non-Treg T cell populations, we find no role for nTreg during PyL infection. Conversely, we demonstrate that populations of adaptive regulatory CD4+ T cells, that are CD25^−^, Foxp3^−^ and CD127^−^, and which do not make IFN-γ, IL-4 or IL-17, develop during both PyL and PyNL infections. These cells inhibit parasite clearance but, importantly, also prevent the development of pathology via production of IL-10. These data are consistent with the notion that whilst endogenous populations of nTreg may be sufficient to prevent immune-mediated pathology during chronic infections which induce rather modest inflammatory responses, such as avirulent leishmania, tuberculosis or helminth infections, rapid induction of distinct populations of adaptive/Th1 CD4+ T cells producing IL-10 may be required to counter the powerful inflammatory signals provided by virulent, rapidly replicating pathogens.
Results {#s2}
=======
Course of infection with PyL and PyNL in C57BL/6 mice {#s2a}
-----------------------------------------------------
In accordance with previous observations [@ppat.1000004-Omer3],[@ppat.1000004-Couper1], infection of C57BL/6 mice with 10^4^ *P. yoelii* 17XL (PyL) parasites was associated with a rapid onset of fulminant parasitaemia (approaching 100% by day 7 pi) that was universally fatal ([Figure 1A, B](#ppat-1000004-g001){ref-type="fig"}). In contrast, infection with 10^4^ *P. yoelii* 17X (NL) (PyNL) parasites led to a more gradual increase in parasitaemia with peak parasitaemia of approx. 30% on day 14 pi, before the infection eventually resolved. Significant differences in malaria-induced anaemia were also evident between lethal and non-lethal infections, with more rapid onset and increased severity of anaemia occurring in PyL-infected mice compared with PyNL-infected mice ([Figure 1C](#ppat-1000004-g001){ref-type="fig"}).
{#ppat-1000004-g001}
Similar expansion and activation of CD4^+^Foxp3^+^ regulatory T cells during PyL and PyNL infection {#s2b}
---------------------------------------------------------------------------------------------------
We have previously reported that simultaneous neutralisation of TGF-β and blockade of IL-10 signalling allows a proportion of PyL-infected mice to resolve their infections and survive [@ppat.1000004-Omer3], suggesting that active immune regulation/immune suppression occurs during PyL infection that inhibits optimal parasite control. In agreement with these observations, Kobayashi et al [@ppat.1000004-Kobayashi2] have reported that IL-10 is produced very early during PyL (but not during PyNL) infection and Perry et al [@ppat.1000004-Perry1] have reported a switch from IL-12 (at day 3 pi) to IL-10 (at day 17 pi) production by splenic dendritic cells during the course of a non-lethal Py infection. These data are consistent with the hypothesis that protective pro-inflammatory responses develop during the acute phase of PyNL infection that limit parasite numbers, whereas an early anti-inflammatory cytokine response during the acute phase of PyL infection inhibits the development of protective immune responses. As CD4^+^CD25^+^ regulatory T cells (nTreg) have been reported to regulate immunity in a number of auto-immune and infectious diseases [@ppat.1000004-Sakaguchi1]--[@ppat.1000004-Belkaid2] and can exert their regulatory role through secretion of IL-10 and/or TGF-β we investigated, using intracellular staining for Foxp3 as well as transgenic Foxp3-GFP reporter mice [@ppat.1000004-Fontenot1], whether nTreg activation is correlated with the virulence of PyL infection.
CD4^+^ splenic lymphocytes from uninfected (control) mice, or from PyL- or PyNL- infected mice, were analysed for intracellular Foxp3 expression ([Figure 2A](#ppat-1000004-g002){ref-type="fig"}) and the numbers of CD4^+^Foxp3^+^ cells, the expression levels of Foxp3 and the ratios of CD4^+^Foxp3^+^ (nTReg) to CD4^+^Foxp3^−^ (non-regulatory T cells) were assessed over the first 7 days pi ([Figure 2B--D](#ppat-1000004-g002){ref-type="fig"}). In accordance with previous observations [@ppat.1000004-Couper2] a significant increase in the numbers of splenic CD4^+^Foxp3^+^ nTreg was observed during the first 5 days of PyL infection ([Figure 2B](#ppat-1000004-g002){ref-type="fig"}) and this was accompanied by increased levels (MFI) of Foxp3 expression ([Figure 2C](#ppat-1000004-g002){ref-type="fig"}) and a transient increase (on day 3pi) in the nTreg/non-Treg ratio ([Figure 2D](#ppat-1000004-g002){ref-type="fig"}). However, almost identical changes in nTreg numbers and Foxp3 expression levels were observed in mice infected with PyNL, and there were no significant differences in any nTreg parameter between PyL-infected and PyNL-infected mice at any time up to 7 days pi, after which the PyL-infected mice succumbed to their infections.
{#ppat-1000004-g002}
Similar results were obtained with Foxp3-GFP reporter mice [@ppat.1000004-Fontenot1]. Importantly, the course of PyL and PyNL infections were equivalent in Foxp3-GFP mice and C57BL/6 mice (data not shown). A representative plot showing Foxp3-GFP expression in infected and uninfected mice is shown in [Figure 2E](#ppat-1000004-g002){ref-type="fig"}. Numbers of CD4^+^GFP^+^ cells were significantly increased in the spleen on 5 day pi ([Figure 2F](#ppat-1000004-g002){ref-type="fig"}) and on day 7 pi (data not shown) but did not differ significantly between PyL-infected and PyNL-infected mice. Finally, no significant differences were observed in expression of Foxp3 mRNA in CD4^+^ T cells purified from spleens of PyL and PyNL-infected mice on days 1, 3, 5 and 7 pi (data not shown).
Neither CD25^hi^ nor Foxp3^+^ endogenous regulatory CD4^+^ T cells contribute to the virulence of lethal *P. yoelii* infection {#s2c}
------------------------------------------------------------------------------------------------------------------------------
The similarity of the nTreg response during PyL and PyNL infections suggested that, in our hands, suppression of effector cell responses by nTreg was unlikely to explain the highly virulent nature of PyL infections. However, to formally test the role of nTreg, mice were treated with a cocktail of anti-CD25 antibodies (previously shown to give optimal depletion of CD4^+^CD25^hi^Foxp3^+^cells; 25) 3 days prior to infection with PyL ([Figure 3](#ppat-1000004-g003){ref-type="fig"}). As previously reported [@ppat.1000004-Couper2], the 7D4 (IgM, anti-CD25) antibody substantially reduced the proportion of splenic CD25^+^ CD4 cells within 3 days (i.e day of infection) but CD25^+^ cells recovered to normal levels by day 4 pi (results not shown) and 7D4 treatment had no significant effect on the frequency of CD4^+^Foxp3^+^ve cells (results not shown). In contrast, PC61 (IgG anti-CD25) given in combination with 7D4 induced an approximately 50% reduction in the frequency of both CD25^+^ and Foxp3^+^ cells that was sustained throughout the 7 day infection period [@ppat.1000004-Couper2]. Nonetheless, neither 7D4 treatment nor combined 7D4+PC61 treatment significantly altered the course of parasitaemia, anaemia or survival of PyL infection in C57BL/6 mice ([Figure 3A--C](#ppat-1000004-g003){ref-type="fig"}). As these observations contradict those of a similar published study [@ppat.1000004-Hisaeda1] we considered whether some effect of natural T reg might be being masked by the rapidly ascending parasitaemia and early mortality associated with infection with 10^4^ PyL parasites. We therefore repeated the anti-CD25 antibody treatment in C57BL/6 mice infected with either a 10 fold lower dose of PyL parasites (10^3^ PyL) or with 10^4^ PyNL parasites. However, anti-CD25 antibody treatment did not alter the outcome of either of these infections ([Figures S1](#ppat.1000004.s001){ref-type="supplementary-material"} and [S2](#ppat.1000004.s002){ref-type="supplementary-material"}) suggesting that natural T reg cells do not markedly influence *P. yoelii* infections in C57/BL6 mice.
{#ppat-1000004-g003}
It has been reported that regulatory T cell responses are more effective at limiting pro-inflammatory responses in BALB/c mice than in C57BL/6 mice [@ppat.1000004-Chen1]. Therefore, to determine whether mouse strain influences the outcome of anti-CD25 treatment during PyL infection, we repeated the CD25-depletion experiments in BALB/c mice and compared our depletion strategies (single dose of 7D4 or 7D4+PC61 given 3 days prior to infection) with a strategy previously shown to affect PyL infection [@ppat.1000004-Hisaeda1], namely repeated injections of 7D4 antibody on days −3, −1 and 5 relative to PyL infection. Repeated administration of 7D4 did not increase either the duration of CD25^+^ T cell depletion or the extent of depletion of CD4^+^Foxp3^+^ve cells compared to the other treatment regimes ([Figure S3](#ppat.1000004.s003){ref-type="supplementary-material"}). Consistent with this, repeated administration of 7D4 did not alter the course of PyL infection compared with single 7D4 administration or combined 7D4 and PC61 administration ([Figure S3](#ppat.1000004.s003){ref-type="supplementary-material"}), and none of our CD25-depletion regimes had any effect on PyL infection in BALB/c mice ([Figure S3](#ppat.1000004.s003){ref-type="supplementary-material"}).
It is becoming increasingly evident that anti-CD25 antibody treatment is not a specific or robust strategy to examine the importance of natural regulatory T cells during inflammatory episodes [@ppat.1000004-Couper2], [@ppat.1000004-Kohm1]--[@ppat.1000004-Kreijveld1]. CD25 expression is not limited to nTreg [@ppat.1000004-Fontenot1]. Moreover, depending on the precise protocol used, a variable but significant proportion of Foxp3^+^ cells escape depletion by anti-CD25 antibody. We therefore compared the outcome of PyL infection in RAG−/− mice reconstituted or not with purified naïve CD4^+^CD25^−^ (putative effector) T cells or a 10∶1 ratio of effector (CD4^+^CD25^−^) to nTreg (CD4^+^CD25^+^) cells. Furthermore, as nTreg can down-regulate NK cell responses [@ppat.1000004-Ghiringhelli1], and as NK cells have previously been reported to play a protective role during malaria infection [@ppat.1000004-Choudhury1]--[@ppat.1000004-Hansen1], we adoptively transferred CD4^+^CD25^+^ (nTreg) cells in the absence of CD4^+^CD25^−^ (effector) cells, to determine whether nTreg modulate innate immune responses during malaria infection. The proportion of Foxp3^+^ cells fell from 10--15% in unsorted CD4^+^ T cells to 1--2% in the CD25^−^CD4^+^ population, whereas CD25^+^ cells were highly enriched for Foxp3^+^ cells (70--80%; [Figure 3D](#ppat-1000004-g003){ref-type="fig"}).
In accordance with our previous studies [@ppat.1000004-Couper1], we found that control (unreconstituted) RAG^−/−^ mice succumbed to PyL infection with the same kinetics as WT mice (compare [Figure 3E, F](#ppat-1000004-g003){ref-type="fig"} with [Figure 1](#ppat-1000004-g001){ref-type="fig"}). Furthermore, the course of infection was virtually indistinguishable in RAG^−/−^ mice reconstituted with CD4^+^CD25^−^, CD4^+^CD25^+^ or a 10∶1 ratio of CD4^+^CD25^−^/CD4^+^CD25^+^ T cells ([Figure 3E, F](#ppat-1000004-g003){ref-type="fig"}). Thus, using two independent models of nTreg depletion, we have found no significant role for natural CD4^+^CD25^+^Foxp3^+^ regulatory T cells in suppression of anti-parasitic immunity during PyL infection in either C57BL/6 or BALB/c mice.
PyL- and PyNL-induce IL-10 production from CD4^+^, CD25^−^, Foxp3^−^ T cells that express low levels of IL-7Rα {#s2d}
--------------------------------------------------------------------------------------------------------------
Having found no evidence that nTreg influence the outcome of PyL infection we next investigated the possibility that IL-10 producing CD4^+^ T cells ("adaptive" Treg or Tr1 cells) might be induced during PyL and/or PyNL infection that regulate parasite killing and/or pathology.
Expression of IL-10 mRNA was determined by real time PCR in purified splenic CD4^+^ T cells obtained on days 1, 3, 5 and 7 post-infection from wild type (WT) C57/BL6 mice and plasma levels of IL-10 were determined by ELISA on days 1, 3, 5 and 7 pi from WT and RAG^−/−^ mice. We find that CD4^+^ T cells are a significant source of IL-10 by day 5 of both PyL and PyNL infections, since IL-10 mRNA is significantly upregulated in splenic CD4^+^ cells on days 5 and 7 post-infection compared with cells from uninfected mice ([Figure 4A](#ppat-1000004-g004){ref-type="fig"}). Furthermore, CD4^+^ T cells (and potentially B cells) may be the major source of IL-10 during infection since plasma IL-10 does not increase above baseline levels in RAG^−/−^ mice ([Figure 4B, C](#ppat-1000004-g004){ref-type="fig"}) except on day 3 pi of PyL infection.
{#ppat-1000004-g004}
To more accurately determine the cellular source of IL-10 during *P. yoelii* infection, splenocytes from IL-10-GFP reporter mice [@ppat.1000004-Kamanaka1] were examined for expression of GFP and various cell surface markers on selected days after PyL or PyNL infection ([Figure 5A--C](#ppat-1000004-g005){ref-type="fig"}). In both infections, from day 5 onwards, the vast majority of the IL-10^+^ cells were CD4^+^ lymphocytes. At no point during either PyL or PyNL infection did we observe significant IL-10 production by myeloid (CD11b^+^), lymphoid dendritic cells (CD11c^+^) or macrophages (F4-80^+^) (results not shown). IL-10 production by CD19^+^ B cells was observed, on day 7 post-infection, only during PyL but not PyNL infection (results not shown). Moreover, IL-10 producing non-CD4^+^ T cells produced only low quantities of IL-10, whereas CD4^+^ T cells were heterogeneous in their ability to produce IL-10 ([Figure 5A](#ppat-1000004-g005){ref-type="fig"}).
{#ppat-1000004-g005}
Since it is not possible to stain for intranuclear Foxp3 without quenching the fluorescence of GFP, IL-10/GFP^+^ CD4^+^ T cells were analysed for expression of CD25, CD62L and CD127 and separately analysed for CD25 and Foxp3 ([Figure 5B, C](#ppat-1000004-g005){ref-type="fig"}). On day 5 post-infection, IL-10^+^ CD4^+^ T cells showed very variable expression of CD25 with approx. 60% being CD25^−^, indicating that they are not a typical nTreg population. As we have previously observed transient upregulation of CD25 on CD4^+^Foxp3^−^ T cells at this time ([Figure 5B](#ppat-1000004-g005){ref-type="fig"} and [@ppat.1000004-Couper1]), we considered it likely that at 5 days post-infection the majority of IL-10^+^ cells were Foxp3^−^. In confirmation of this, by day 7 post-infection, IL-10^+^ CD4^+^ T cells were almost exclusively CD25^−^ indicating that, since the majority of Foxp3^+^ cells maintain CD25 expression during *P. yoelii* infection ([Figure 5B](#ppat-1000004-g005){ref-type="fig"}), CD25^−^Foxp3^−^ CD4^+^ T cells are the primary source of IL-10 during both PyL and PyNL infection. Interestingly the frequencies and numbers of IL-10^+^ CD4^+^TCR-β^+^ cells were equivalent in PyL and PyNL infected mice on day 7 post-infection ([Figure 5D](#ppat-1000004-g005){ref-type="fig"}).
IL-10^+^ cells were heterogeneous in terms of expression of CD62L suggesting that they comprise of a mixed population of cells in terms of memory/activation status, and despite being Foxp3^−^, the majority of IL-10^+^ CD4^+^ cells were CD127^−^, suggesting that down-regulation of IL-7Rα may be a useful marker for differentiating adaptive Treg from other antigen-experienced T cells ([Figure 5C](#ppat-1000004-g005){ref-type="fig"}).
CD4^+^ T cells that produce IL-10 during malaria infection are not classical nTreg, Th1, Th2, or Th17 cells {#s2e}
-----------------------------------------------------------------------------------------------------------
We have shown that CD4^+^ T cells are the primary source of IL-10 during malaria infection, and that these cells do not express CD25, suggesting that they may not be conventional nTreg cells. Since IL-10 can be produced by various effector CD4^+^ T cell subsets (including Th1, Th2 and Th17 cells), as well as specialised regulatory populations such as Tr1 \[19, 20 34--36\], we examined the expression of Th1, Th2 and Th17 lineage-associated cytokines in IL-10-producing (GFP^+^) and IL-10-GFP^−^ CD4^+^ T cells purified from IL-10-GFP reporter mice on day 7 of infection. As seen previously ([Figure 5](#ppat-1000004-g005){ref-type="fig"}), GFP expression was similar in CD4^+^ T cells isolated from PyL and PyNL infected mice ([Figure 6A](#ppat-1000004-g006){ref-type="fig"}). As expected, IL-10 mRNA was expressed at much higher levels in GFP^+^ than in GFP^−^ cells but cells isolated from PyL and PyNL infected animals expressed similar levels of IL-10 mRNA ([Figure 6B](#ppat-1000004-g006){ref-type="fig"}). Importantly, Foxp3 mRNA was not upregulated in IL-10-GFP^+^ cells isolated during either PyL or PyNL infection, confirming that the IL-10-producing CD4^+^ T cells that develop during *P. yoelii* infection are neither natural nor induced Foxp3^+^ regulatory T cells. Moreover, GFP^+^ cells did not express significant amounts of mRNA for IFN-γ, IL-4 or IL-17, thus distinguishing them from classical Th1, Th2 and Th17 cells. Although IL-10-GFP^+^ cells expressed IL-13 mRNA, levels were comparable to those seen in GFP^−^ cells indicating that IL-10 producing cells did not preferentially co-produce IL-13. Thus, the IL-10-producing CD4^+^ T cells induced during *P. yoelii* infection fit the definition [@ppat.1000004-Groux1] of adaptive, Tr1, regulatory T cells.
{#ppat-1000004-g006}
IL-10 from CD4^+^ T cells inhibits parasite killing during infection {#s2f}
--------------------------------------------------------------------
To determine whether IL-10 production from T cells is functionally important during Py infection, we first compared the course of PyL and PyNL infection in IL-10^−/−^ and WT mice ([Figure 7](#ppat-1000004-g007){ref-type="fig"}). PyNL infection was significantly attenuated - with significant reductions in parasitaemia and anaemia in IL-10^−/−^ mice compared with WT mice ([Figure 7A--D](#ppat-1000004-g007){ref-type="fig"}), although the IL-10^−/−^ mice did lose significantly more weight than age-matched WT mice ([Figure 7C](#ppat-1000004-g007){ref-type="fig"}). Furthermore, approx 30% (6/21 mice) of IL-10^−/−^ (but not WT) mice infected with 10^4^ PyL pRBC were able to control their infections and survived ([Figure 7E--H](#ppat-1000004-g007){ref-type="fig"}), with parasitaemia declining from a peak of approx 45% on day 6pi. Moreover, IL-10^−/−^ (but, again, not WT) mice given a low dose PyL infection (10^3^ pRBC) were fully able to control parasitaemia and 100% of the mice survived ([Figure 7I--L](#ppat-1000004-g007){ref-type="fig"}).
{#ppat-1000004-g007}
Taken together, these data indicate that IL-10 suppresses immune effector mechanisms which would otherwise be able to control low dose PyL infections. Since this IL-10 emanates principally from CD4^+^ T cells ([Figure 5](#ppat-1000004-g005){ref-type="fig"}) we hypothesised that IL-10-deficient CD4^+^ T cells may promote more effective parasite control than WT CD4^+^ T cells. To test this, purified naïve WT or IL-10^−/−^ CD4^+^ T cells were adoptively transferred into RAG^−/−^ mice which were then infected with PyNL or PyL parasites.
PyNL-infected RAG^−/−^ mice that had received IL-10^−/−^ CD4^+^ T cells developed significantly lower parasite burdens than those which had received WT CD4^+^ T cells ([Figure 8A](#ppat-1000004-g008){ref-type="fig"}). Although both groups developed similar levels of anaemia, mice that received IL-10^−/−^ T cells lost significantly more weight and succumbed to infection more rapidly than mice that received WT CD4+ T cells ([Figure 8B--D](#ppat-1000004-g008){ref-type="fig"}). Exacerbation of disease despite improved parasite control in mice receiving IL-10^−/−^ CD4^+^ T cells was associated with more extensive proliferation of the adoptively transferred T cells (IL-10^−/−^ T cells comprised \>30% of total splenic leucocytes compared with \<10% for transferred WT cells), higher concentrations of circulating IFN-γ and lower plasma concentrations of IL-10 (data not shown). These data are consistent with the conclusion that recipients of IL-10^−/−^ CD4^+^ T cells died of immunopathology whilst recipients of WT CD4^+^ T cells eventually died because they were unable to fully resolve their infections.
{#ppat-1000004-g008}
By contrast, RAG^−/−^ mice that had received IL-10^−/−^ CD4^+^ T cells were somewhat better able to control infections with 10^3^ (8E--H) or 10^4^ (8I--L) PyL infections than were mice receiving WT CD4^+^ T cells; a proportion of mice receiving IL-10^−/−^ T cells were able to control their infections, although failure to fully eliminate parasites eventually led to death from anaemia. Thus, IL-10 derived from CD4^+^ T cells significantly modulates the outcome of both PyL and PyNL infection.
IL-10 protects against immune pathology during *P. yoelii* infection {#s2g}
--------------------------------------------------------------------
It has previously been shown that IL-10^−/−^ mice succumb to normally avirulent *P. chabaudi chabaudi* infections despite comparable - or more effective - control of malaria parasitaemia compared to WT mice [@ppat.1000004-Li1]. The increased susceptibility of IL-10^−/−^ mice is due to elevated plasma concentrations of IFN-γ and TNF-α [@ppat.1000004-Li2] and survival of IL-10^−/−^ mice following malaria infection can be enhanced by treatment with anti-TNF-α [@ppat.1000004-Li2]. Whilst there was no marked difference in mortality between *P. yoelii*-infected IL-10^−/−^ and WT mice, IL-10^−/−^ mice (and RAG^−/−^ mice reconstituted with IL-10^−/−^ T cells) lost significantly more weight than mice reconstituted with WT T cells during PyNL infection, indicative of more severe morbidity ([Figure 7C](#ppat-1000004-g007){ref-type="fig"}, [8C](#ppat-1000004-g008){ref-type="fig"}).
Histopathological examination of infected animals did not reveal any liver or lung damage 3 days post-infection (data not shown) but revealed significantly more hepatic cellular changes including periportal inflammation, necrosis and bridging necrosis in IL-10^−/−^ mice than in WT mice on days 7 and 14 post-infection ([Figure 9A](#ppat-1000004-g009){ref-type="fig"}) and this was significantly more severe in PyL-infected than PyNL-infected animals on day 7 post-infection. We also found that by day 25 of PyNL infection, RAG^−/−^ recipients of IL-10^−/−^ CD4^+^ T cells had developed significantly more severe hepatic periportal inflammation and necrosis (including bridging necrosis) than RAG^−/−^ recipients of WT CD4^+^ T cells ([Figure 9B](#ppat-1000004-g009){ref-type="fig"}). Thus, T cell derived IL-10, although negatively regulating parasite killing, is protective during malaria infection by preventing the onset of immunopathology.
{#ppat-1000004-g009}
Discussion {#s3}
==========
It is well established, in a variety of infections, that regulatory cytokines both ameliorate immunopathology and delay pathogen clearance [@ppat.1000004-Omer3], [@ppat.1000004-Kossodo1], [@ppat.1000004-Li1]--[@ppat.1000004-Linke1], [@ppat.1000004-Belkaid3]--[@ppat.1000004-Mason1]. Manipulation of these cytokines by vaccination or immunotherapy, to simultaneously enhance pathogen clearance and limit the associated pathology, requires a better understanding of their cellular sources and mechanisms of induction. Important roles have been demonstrated for both IL-10 [@ppat.1000004-Kobayashi1]--[@ppat.1000004-Linke1] and TGF-β [@ppat.1000004-Omer2],[@ppat.1000004-Omer3] in modulating the outcome of murine malaria infections, and observational data strongly suggests that they play a similar role in human infections [@ppat.1000004-Walther1]--[@ppat.1000004-Dodoo1]. Recently, endogenous or natural, CD25^hi^, Foxp3^+^ CD4^+^ T cells (nTreg) have been implicated as major regulators of malarial pathology [@ppat.1000004-Hisaeda1],[@ppat.1000004-Hisaeda2] but their mechanisms of action remain undefined. Attempting to elucidate the role of nTreg in murine *Plasmodium yoelii* infections, we were surprised to find no role for these cells in regulating the outcome of either high dose (10^4^) or lower dose (10^3^) lethal (Py17XL; PyL) or non-lethal (Py17X; PyNL) infection in either C57BL/6 or BALB/c mice. In contrast, we find that adaptive, IL-10-producing CD4^+^ Tr1 cells (CD25^−^, Foxp3^−^, CD127^−^, IFN-γ^−^, IL-4^−^ and IL-17^−^), are generated during both PyL and PyNL infections and are associated with down-regulation of pro-inflammatory responses, moderation of both morbidity and mortality and failure to clear parasites. Crucially, we were able to demonstrate a causal relationship between these various observations by showing that IL-10^−/−^ CD4^+^ T cells adoptively transferred into RAG^−/−^ mice provided more effective parasite control than did WT CD4^+^ T cells, but at the cost of more severe pathology.
We conclude that induced Foxp3^−^ regulatory T cells, characterised by down-regulation of CD127/IL-7Rα, modulate the inflammatory response to *Plasmodium yoelii* malaria by production of IL-10. Although it has been observed in humans [@ppat.1000004-Seddiki1],[@ppat.1000004-Liu1] and mice [@ppat.1000004-Liu1] that CD127 is down-regulated on endogenous (Foxp3^+^) regulatory T cells, our data demonstrate -- for the first time - that CD127 is also down-regulated on adaptive (Foxp3^−^) Tr1 cells.
The lack of any effect of anti-CD25 antibody treatment on the course of PyL infection in our experiments contradicts the published data [@ppat.1000004-Hisaeda1],[@ppat.1000004-Hisaeda2]. Despite numerous attempts, using three different depletion protocols - including a protocol identical to that previously reported to ameliorate PyL infection [@ppat.1000004-Hisaeda1], in both C57BL/6 and BALB/c mice we were unable to reproduce the published observations. Anti-CD25 treatment failed to ameliorate PyL infection initiated by a 10 fold lower dose of parasites, discounting the possibility that the virulence of high dose PyL infection masks regulatory activity of nTreg that would otherwise be evident during a less virulent infection. Furthermore, adoptive transfer of CD25^+^ and/or CD25^−^ CD4^+^ T cells into RAG^−/−^ mice also failed to reveal any role for CD25^+^ Foxp3^+^ cells in this infection. The discrepancy between our findings and those of other labs is reminiscent of the disparate results obtained for *P. berghei* ANKA infection which report that depletion of CD25^+^ regulatory cells either facilitates parasite control and prevents the onset of the cerebral pathology infection in C57BL/6 mice [@ppat.1000004-Amante1], or enhances effector T cell responses and increases the severity of brain pathology in normally resistant BALB/c mice [@ppat.1000004-Nie1] or has no effect on cerebral pathology [@ppat.1000004-Vigario1]. One explanation for these inconsistent results may be differences in prior exposure to pathogens or commensal organisms between mice in different laboratories. Components of the normal intestinal flora of conventionally housed animals are essential for development of intestinal nTreg [@ppat.1000004-Strauch1] and nTreg development is facilitated by the presence of covert infections such as *Helicobacter hepaticus* [@ppat.1000004-Kullberg1]. Depletion of nTreg by anti-CD25 treatment in such mice may lead to more profound alteration in the effector / regulatory cell balance than in mice (such as those used in our studies) raised in low-infection environments.
Although, we could show no role for nTreg in acute PyL and PyNL infection, we have shown that the adaptive IL-10-producing regulatory T cells that develop during *P. yoelii* infection hinder parasite control but simultaneously limit disease severity. In contrast to recent studies describing a role for IL-10 producing Th1 cells in *Toxoplasma gondii* [@ppat.1000004-Jankovic1] and *Leishmania spp* [@ppat.1000004-Anderson1],[@ppat.1000004-Nylen1],[@ppat.1000004-Anderson2] infections, the adaptive IL-10 producing Tregs we describe do not co-express IFN-γ or other effector cytokines and better fit the definition of Tr1 cells. Nevertheless in several virulent protozoal infections (PyL, *Toxoplasma gondii*, *Leishmania major* SD and *L. donovani*), adaptive IL-10-producing CD4^+^ T cells are required to regulate the fulminant Th1-effector responses that are induced whereas classical (Foxp3^+^) Treg appear to be sufficient to regulate the effector response to a less virulent (healing) strain of *L. major* [@ppat.1000004-Belkaid1]. Given that naïve CD4^+^ T cells can develop into adaptive Treg after interaction with IL-10-producing dendritic cells expressing low levels of co-stimulatory molecules [@ppat.1000004-Kapsenberg1]--[@ppat.1000004-Ito1], it is possible that the induction of Treg during *P. yoelii* infection is linked to the modulation of macrophage and dendritic cell function that occurs in response to prolonged toll-like receptor signalling [@ppat.1000004-Omer4]. Alternatively, parasite-induced TGF-β [@ppat.1000004-Fahlen1],[@ppat.1000004-Omer4], IL-6 [@ppat.1000004-Walther2] and/or IL-27 may synergise to promote production of IL-10 by Th1, Th2, Th17 and Tr1 cells [@ppat.1000004-Stumhofer1],[@ppat.1000004-McGeachy1],[@ppat.1000004-Awasthi1],[@ppat.1000004-Fitzgerald1].
We have not yet definitively identified the mechanism by which IL-10 suppresses parasite clearance but given our recent findings that control of the acute phase of *P. yoelii* parasitaemia is critically dependent on macrophages [@ppat.1000004-Couper1], it is likely that T cell-derived IL-10 acts directly on macrophages to inhibit their anti-parasitic mechanisms. It is also possible that, as in mycobacterial infections, adaptive Treg induce an autocrine signalling loop in which macrophages both secrete and respond to IL-10 with consequent down regulation of effector function and pathology via a STAT-3 --dependent pathway [@ppat.1000004-Murray1]--[@ppat.1000004-Takeda1].
In summary, we have demonstrated that adaptive, but not natural, regulatory T cells control parasite numbers during PyL and PyNL infections whilst also limiting the onset of immunopathology. These cells are characterised by lack of expression of CD25 and Foxp3, down-regulation of CD127 and production of IL-10 but not IFN-γ, IL-4 or IL-17. Taken together with our data highlighting the importance of macrophages in the control of malaria infection [@ppat.1000004-Couper1], these findings identify an important pathway of adaptive, T cell- mediated control of innate immune responses. Further studies are required to identify the pathways leading to induction of this important regulatory cell population.
Materials and Methods {#s4}
=====================
Mice and parasites {#s4a}
------------------
C57BL/6, Foxp3-GFP (F2: 129/C57BL/6; from A. Rudensky, University of Washington, 24), C57BL/6 RAG-1^−/−^, C57BL/6 IL-10^−/−^ and BALB/c mice were bred in-house or purchased from Harlan and maintained under barrier conditions at LSHTM. IL-10-GFP reporter mice [@ppat.1000004-Kamanaka1] were maintained under barrier conditions at the National Institutes of Health. Cryopreserved *Plasmodium yoelii* 17X (non lethal; PyNL) and *P. yoelii* 17XL (lethal; PyL) parasites were passaged once through mice before being used in experimental animals.
Unless stated otherwise, male or female mice, 7--9 weeks of age, were infected intraveneously with 1 × 10^3^ or 1 × 10^4^ parasitised red blood cells (pRBC). Parasitaemia was determined daily by examination of Giemsa-stained thin smears of tail blood for the first seven days of infection and every second day thereafter. On every second day, mice were weighed and RBCs were counted using an automated haemoanalyser (Beckman Coulter). Plasma was stored (at −20°C) for cytokine quantification. On selected days post-infection, mice were sacrificed and spleens were removed. Single spleen cell suspensions were prepared by homogenisation through a 70 µm cell strainer (BD Biosciences) and live cells enumerated by trypan blue exclusion.
Cell sorting {#s4b}
------------
CD4^+^ T cells were positively selected using anti-mouse CD4-conjugated midiMACS beads (Miltenyi Biotec) according to the manufacturer\'s instructions and the purity of eluted cells was checked by flow cytometry. In some experiments, the CD4+ cells were labelled with anti-mouse CD4 (GK1.5: Rat IgG2b: E-bioscience) and anti-mouse CD25 (PC61: Rat IgG1: E-bioscience) fluorochrome-labelled antibodies and sorted, using a BD FACSVantage SE, into CD4^+^CD25^+^ and CD4^+^CD25^−^ populations. In separate experiments CD4^+^ T cells, isolated from IL-10-GFP reporter mice [@ppat.1000004-Kamanaka1] on day 7 of infection, were labelled with anti-mouse CD4 (GK1.5: Rat IgG2b: E-bioscience) and IL-10 producing (GFP^+^) and non-IL-10 producing (GFP^−^) CD4^+^ T cells were purified by flow cytometric cell sorting.
Real time PCR {#s4c}
-------------
IL-10, Foxp3, IFN-γ, IL-4, IL-13 and IL-17A mRNA were quantified by Taqman (ABI, Warrington, UK). RNA was extracted (RNAeasy) and DNAse1 treated prior to cDNA synthesis. cDNA expression for each sample was standardised using the housekeeping gene GAPDH. Cycling conditions were: initialisation 2 min at 50°C and 10 min at 95°C followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C.
Primer sequences:
IL-10 Forward ATGCTGCCTGCTCTTACTGACTG
Reverse CCCAAGTAACCCTTAAAGTCCTGC,
Foxp3 Forward CACCTATGCCACCCTTATCC,
Reverse CGAACATGCGAGTAAACCAA
IFN-γ Forward AGA GCC AGA TTA TCT CTT TCT ACC TCA G
Reverse CCT TTT TCG CCT TGC TGT TG
IL-4 Forward ACG AGG TCA CAG GAG AAG GGA
Reverse AGC CCT ACA GAC GAG CTC ACT C
IL-13 Forward CCTCTGACCCTTAAGGAGCTTAT
Reverse CGTTGCACAGGGGAGTCT
IL-17A Forward TGTGAAGGTCAACCTCAAAGTC
Reverse AGGGATATCTATCAGGGTCTTCATT
Cytokine ELISA {#s4d}
--------------
Rat anti-mouse IL-10 (JES5-2A5; Rat IgG~1~; Mabtech, Sweden) or rat anti-mouse interferon (IFN)-γ (AN-18; Rat IgG1; eBioscience) antibodies were used as capture antibodies, diluted in 0.5 M Tris-HCl, pH 8.9 buffer. Biotinylated rat anti-mouse IL-10 MAb (JES5-16E3; Rat IgG~2b~; Mabtech) or rat anti-mouse IFN-γ MAb (R4-6A2; Rat IgG1; Mabtech) were used as detecting antibodies and were visualised using streptavidin-alkaline phosphatase (eBioscience) and *p*-nitrophenyl phosphate (Sigma Aldrich, UK). Absorbance was read at 405 nm using a MRX TC II microplate reader (Dynex Technologies Ltd,. UK)
Flow cytometry {#s4e}
--------------
For flow cytometric analysis, cells were surface stained with anti-mouse CD4 (RM4-5; Rat IgG~2a~; BD Biosciences), anti-mouse CD25 (PC61; Rat IgG~1~; eBioscience), anti-mouse CD69 (H1.2F3; Armenian Hamster IgG; eBioscience), anti-mouse CD62L (MEL-14; Rat IgG2a; eBioscience) or anti-mouse CD127 (A7R34; Rat IgG2a; eBioscience). Intracellular Foxp3 staining using anti-mouse Foxp3 (FJK-16s; Rat IgG~2a~; eBioscience) was performed by permeabilising cells with 0.1% Saponin/PBS. Cells were concurrently incubated with anti-mouse CD16/32 (Fc block) when staining with all conjugated antibodies. Flow cytometric acquisition was performed using a FACSCalibur (BD Immunocytometry Systems, USA) and all analysis was performed using Flowjo software (Treestar Inc., OR, USA)
Histopathology {#s4f}
--------------
Liver and lung tissues were fixed in 10% Formalin-saline. Fixed tissues were paraffin embedded and stained with haematoxylin and eosin. Slides were microscopically examined at 20X magnification.
Statistical analysis {#s4g}
--------------------
Statistical significance was determined using Student\'s T test, unless otherwise stated, with P\<0.05 taken as indicating a significant difference.
Supporting Information {#s5}
======================
###### Anti-CD25 antibody administration does not affect the outcome of low dose PyL infection.
C57BL/6 mice were treated with either a single dose of 0.75 mg 7D4, or with 0.25 mg 7D4 combined with 0.75 mg PC61, 3 days prior to infection with 10^3^ PyL parasites. The course of PyL in anti-CD25 antibody-treated mice and control mice was then followed by monitoring (A) parasitaemia, (B) anaemia and (C) mortality. \# indicates significant differences (P\<0.05) between 7D4 and 7D4 + PC61 treated mice. No significant differences were observed between the other groups of mice. Groups consisted of 4 mice and the results are representative of 2 independent experiments.
(0.02 MB TIF)
######
Click here for additional data file.
###### Anti-CD25 antibody administration does not affect the outcome of PyNL infection.
C57BL/6 mice were treated with either a single dose of 1 mg PC61 7 days prior to infection with PyNL (Expt 1) or with a single dose of 0.75 mg 7D4 or 0.25 mg 7D4 combined with 0.75 mg PC61 on the day of PyNL infection (Expt 2). The course of PyNL in anti-CD25 antibody-treated mice and control mice was then followed by monitoring (A, D) parasitaemia, (B, E) anaemia and (C, F) weight loss. No mortality occurred in any of the groups during either experiment. \* indicates significant differences (P\<0.05) between PC61 treated and control mice. No significant differences were observed between 7D4, 7D4 + PC61 treated mice and control mice. Groups consisted of 3--5 mice per group.
(0.02 MB TIF)
######
Click here for additional data file.
###### Anti-CD25 antibody administration does not affect the outcome of PyL infection in BALB/c mice.
BALB/c mice were treated with either a single dose of 0.75 mg 7D4, or with 0.25 mg 7D4 combined with 0.75 mg PC61, 3 days prior to infection with 104 PyL pRBC or with 3 repeated injections of 0.5 mg 7D4 on days −3, −1 and +5 relative to PyL infection. The efficiency of depletion of CD25+ and Foxp3+ CD4+ T cells was determined in peripheral venous blood by measuring the expression of CD25^+^ and Foxp3^+^ CD4^+^ T cells was determined in peripheral venous blood by measuring the expression of (A) CD25 and (B) Foxp3 on CD4^+^ T cells. The course of PyL in anti-CD25 antibody-treated mice and control mice was then followed by monitoring (C) parasitaemia, (D) anaemia and (E) mortality. Symbols represent significant differences (p\<0.05) between groups: ∼ 7D4 vs PBS, Φ 7D4/PC61 vs PBS, + 7D4/PC61 vs 7D4 x3, \# 7D4 vs 7D4/PC61. Groups consisted of 5 mice.
(0.15 MB TIF)
######
Click here for additional data file.
The authors have declared that no competing interests exist.
This study was funded by the Wellcome Trust (grant reference number 074538). J.C.H. is supported by a fellowship from the Royal Society.
[^1]: **¤:** Current address: School of Pharmacy, University of Nottingham, University Park, Nottingham, United Kingdom
[^2]: Conceived and designed the experiments: KC JdS ER. Performed the experiments: KC DB MW JH. Analyzed the data: KC DB MW. Contributed reagents/materials/analysis tools: YB MK RF. Wrote the paper: KC ER.
| 2023-09-17T01:26:59.872264 | https://example.com/article/8385 |
Q:
Does the MD5 change from encryption?
I have something I've been researching into and I can't find an answer or maybe just understand. When encrypting a file WITHOUT changing the contents does that change the MD5 Sum/Hash of a file? Like a Word file with the same unchanged string of characters being encrypted, does the encrypted file hold the same MD5 Sum as the encrypted Word file?
A:
Yes, encrypting a file should substantially change any hash of a file.
Cryptographic hash codes are constructed such that hashing any two different strings should produce wildly different results, even if there's a close connection between the original strings. For example, the MD5 hash of "hello" is
5d41402abc4b2a76b9719d911017c592
while the MD5 hash of "hello?" is
3809718a10a0f59bcf6d4939c10fd28d
Encrypting a file should, with good encryption, make the resulting file look statistically random. Consequently, if you were to hash an encrypted file, it should give a hash that's statistically indistinguishable from the hash of a random string. That means that the probability that you should get the same hash output would, roughly speaking, be about 1 / N, where N is the number of possible hash outputs. For even a decently good hash function, this should be astronomically small.
| 2023-11-21T01:26:59.872264 | https://example.com/article/9664 |
Q:
Add simple keybinding in Atom
How can I add a keybinding in Atom to run rustfmt on the current file? Do I have to create or install a package? Can I attach it to the "Editor: Auto Indent" command? How do I find out which package Auto Indent comes from?
A:
There is a package called atom-beautify which seems to have preliminary support for rustfmt.
| 2024-05-25T01:26:59.872264 | https://example.com/article/6677 |
how safe of a blind buy is Allure EB?
my bottle of Allure Sport is empty and I was going to get a replacement. but from what i've read, edition blanche sounds more appealing to me so at this point i might opt for that instead. the only problem is that there aren't any Chanel boutiques in my area so I'd need to buy it from the Chanel website
i try to avoid blind buying because it's burned me a couple times in the past. so if i like Sport how likely is it that i'll like EB
If your name really is Don Cheadle, Edition Blanche is a very safe buy since you're a multi-millionaire many times over.
For me, Edition Blanche wouldn't have been a safe blind buy at all. I thought I'd love it, but I'm smart enough to know blind buying is never entirely safe, so I sampled it first. And I was surprised by how much I hated it. It smelled like cleaning products to me. Then again, I'm not big on lemon. YMMV.
my bottle of Allure Sport is empty and I was going to get a replacement. but from what i've read, edition blanche sounds more appealing to me so at this point i might opt for that instead. the only problem is that there aren't any Chanel boutiques in my area so I'd need to buy it from the Chanel website
i try to avoid blind buying because it's burned me a couple times in the past. so if i like Sport how likely is it that i'll like EB
If your name really is Don Cheadle, Edition Blanche is a very safe buy since you're a multi-millionaire many times over.
For me, Edition Blanche wouldn't have been a safe blind buy at all. I thought I'd love it, but I'm smart enough to know blind buying is never entirely safe, so I sampled it first. And I was surprised by how much I hated it. It smelled like cleaning products to me. Then again, I'm not big on lemon. YMMV. | 2023-10-04T01:26:59.872264 | https://example.com/article/6566 |
Polycystin-2 is a non-selective calcium channel that regulates tubulogenesis and maintains homeostasis in several organ systems, including the liver, heart, and kidneys. Mutations in polycystin-2 account for 15% of the cases of people with autosomal dominant polycystic kidney disease (ADPKD), a genetically inherited disorder causing renal failure. Most polycystin-2 in epithelial cells localizes to the endoplasmic reticulum (ER) where it combines with the IPS receptor to control calcium homeostasis. Yet little is known about the mechanisms that localize this polytopic membrane channel to the ER. Our laboratory identified PACS-2 as a novel sorting protein and recently discovered that it binds to the cytosolic domain of polycystin-2 and is required to localize the channel to the ER. PACS-2 connects polycystin-2 to COPI, a vesicular coat protein that controls Golgi-to-ER retrieval. PACS-2/COPI may control the ER localization of polycystin-2 by directing an efficient Golgi-to-ER trafficking step. To test this hypothesis, experiments in Aim 1 will determine whether ER localization of polycystin-2 requires COPI and whether PKD2 is localized to the ER through a retentionor retrieval-based mechanism. To test the role of COPI in controlling the ER localization of full-length polycystin-2, we will use siRNA depletion of the beta-COP subunit and develop two polycystin-2 reporter constructs will be developed to determine quantitatively whether polycystin-2 is localized to the ER by a Golgi-to-ER retrieval step and the role of PACS-2 and COPI in directing this pathway. Specific aim 2 will determine which of the seven COPI subunits and residues in the polycystin-2 cytosolic domain-in addition to phosphorylated Ser812-are important for binding to PACS-2 and directing ER localization of polycystin-2. Yeast two-hybrid genetic screens and protein binding assays will identify COPI subunits and amino acid residues within the polycystin-2 cytosolic domain essential for complex formation. Polycystin-2 reporter molecules containing mutations of identified amino acids will be expressed to rigorously determine their role in the ER localization of polycystin-2 and their potential role in the targeting of polycystin-2 to the TGN, cell surface and primary cilia. Together, these studies will identify the fundamental mechanisms that control the subcellular localization of polycystin-2 and may provide a foundation to understand how intracellular signaling pathways are disrupted in polycystic kidney disease. The proposed studies are relevant to public health because insight into how polycystin-2 action is regulated is crucial for understanding kidney function and for developing therapies that can protect ADPKD patients from the devastating effect of this disease. [unreadable] [unreadable] [unreadable] [unreadable] | 2024-04-08T01:26:59.872264 | https://example.com/article/4567 |
[Study on endothlin and its gene expression in splanchnic vessels in cirrhotic rats].
To investigate the role of endothelin(ET) in the pathogenesis of portal hypertension, ET-1 level and its gene expression in splanchnic vessels from cirrhotic rats were observed. ET levels of both plasma and vascular tissues were determined by radioimmunoassay. ET mRNA in vascular tissues was probed with RT-PCR technique expressed as optical density(OD) value from image analysis. ET peptide and mRNA in PV and SMA vessels were all significantly higher in cirrhotic rats than those in normal rats, while in cirrhotic rats, ET and its gene expression of PV was dramatically higher than that of SMA(P < 0.05). In addition, the positive correlation was observed in difference between PV and SMA in ET concentration with portal pressure(r = 0.737, P < 0.01). ET may be involved in the mechanisms of the formation of portal hypertension mainly due to constructing portal vein, increasing portal flow resistance. | 2023-10-07T01:26:59.872264 | https://example.com/article/4709 |
Tony and Al dig into Queensland, a game from Cheapass.com.
[PLEASE DISREGARD THE THE TITLE CARD IN THE VIDEO THAT SAYS “CHEAPASSGAMES.COM.” ALBERT IS A DUMB.] | 2024-05-27T01:26:59.872264 | https://example.com/article/4615 |
The African experience: a proposal to address the lack of access to neurosurgery in rural sub-Saharan Africa.
Restricted access to neurosurgical care in rural sub-Saharan Africa remains an unaddressed and formidable challenge. Despite the implementation of a rigorous 5-year curriculum to train and certify indigenous neurosurgeons "in continent" as Fellows of the College of Surgeons in Neurosurgery for East, Central, and Southern Africa (FCS-ecsa-NS), provincial and rural hospitals are likely to see no change in this woeful status quo for the foreseeable future. Modifying that curriculum with a two-tiered training experience that includes fast-track certification of general surgeons to perform basic neurosurgical procedures in their own hospitals is a viable alternative to redress this problem in a timely fashion. Founded on a competence-based as opposed to a time-served assessment of clinical/surgical skills along the lines of a 2002 landmark study in the United Kingdom, such an approach (in tandem with retaining separate FCS certification for prospective faculty in the NSTP-ECSA program) deserves urgent reconsideration. | 2024-07-20T01:26:59.872264 | https://example.com/article/8632 |
Q:
MSBuild Call PS Script - Does Nothing
The issue is that I get no error, but I get a loading screen showing what appears to be PowerShell successfully called, but everything is suspended (no failures, it just lingers with Windows PowerShell [copyright info]. In digging around, I decided to just see if I could get it to write out a warning and it appears that it is setting the execution policy to unrestricted (which is how my system is currently set as well).
I did think that maybe the execution policy wasn't set to unrestricted, so I tried passing in the -Force parameter, but got an error about it being invalid.
The PS script:
Write-Warning "Called successfully.
The XML code to call it:
<Target Name="DoSomething">
<PropertyGroup>
<ponyone>FullOne</ponyone>
<ponytwo>HalfOne</ponytwo>
<ponytree>LatterExcen</ponytree>
</PropertyGroup>
<Exec Command="powershell.exe -NonInteractive -executionpolicy Unrestricted" />
<Exec Command="powershell.exe .\Do-Something.ps1 FullOne HalfOne LatterExcen" />
</Target>
Confirmed that this is because of the executionpolicy; when I only run the second script, it errors due to scripts being disabled, even though PowerShell shows the execution policy is unrestricted.
A:
Using the following msbuild project:
<Project xmlns="http://schemas.microsoft.com/developer/msbuild/2003" ToolsVersion="14.0">
<Target Name="RunPSScript">
<Exec Command="powershell.exe -NonInteractive -executionpolicy Unrestricted -command ".\Do-Something.ps1""/>
</Target>
</Project>
The PS script is executed as expected, given the following output:
Microsoft (R) Build Engine version 14.0.25123.0
Copyright (C) Microsoft Corporation. All rights reserved.
Build started 5/25/2016 1:43:41 PM.
Project "D:\lab\my.proj" on node 1 (default targets).
RunPSScript:
powershell.exe -NonInteractive -executionpolicy Unrestricted -command ".\Do-Something.ps1"
EXEC : warning : Called successfully. [D:\lab\my.proj]
Done Building Project "D:\lab\my.proj" (default targets).
Build succeeded.
"D:\lab\my.proj" (default target) (1) ->
(RunPSScript target) ->
EXEC : warning : Called successfully. [D:\lab\my.proj]
1 Warning(s)
0 Error(s)
Time Elapsed 00:00:00.36
More details here.
| 2024-07-15T01:26:59.872264 | https://example.com/article/5824 |
Influenza A (H1N1 09): public health lessons and questions.
Influenza A (H1N1 09) has been in Australia for 2 months and, in a world that had been preparing for a potentially dramatic outbreak due to H5 avian influenza, it has challenged global and national planning assumptions, definitions of pandemic influenza and our public health interventions. It has also highlighted how much we have yet to learn about both pandemic and seasonal influenza. | 2023-09-02T01:26:59.872264 | https://example.com/article/5060 |
Introduction {#s1}
============
Viral hemorrhagic fevers (VHFs) generally describe a severe, variety of viral often fatal diseases characterized by fever and bleeding in humans [@pone.0095635-Bray1], [@pone.0095635-Geisbert1], which are caused by several distinct families of enveloped, single-stranded RNA viruses including *Bunyaviridae*, *Flaviviridae*, *Filoviridae* and *Arenaviridae*, and a novel rhabdovirus associated with acute hemorrhagic fever found in Central Africa in 2012 [@pone.0095635-LeGuenno1]--[@pone.0095635-Grard1]. After transmission from their reservoir hosts or vectors to humans, or even spread from person to person, many of hemorrhagic fevers viruses (HFVs) cause severe, life-threatening diseases [@pone.0095635-Khan1], [@pone.0095635-Centers1]. The clinical symptoms in the early phase of VHFs are very similar irrespective of the causative viruses and resemble a flu-like illness or common enteritis, often including marked fever, fatigue, dizziness, muscle aches, loss of strength, and exhaustion [@pone.0095635-Drosten1], . Therefore, it is too difficult to distinguish the various etiologic agents based on clinical signs and symptoms, which makes the accurate and timely laboratory detection of viruses important in early diagnosis of VHFs.
In view of its identifying the selected target gene of RNA viruses rapidly and specifically, probe-based real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) assay is widely used for virus detection [@pone.0095635-Mackay1], [@pone.0095635-Espy1]. Quite a lot of such methods for detection of hemorrhagic fever viruses have been published, which provides useful references for people working on VHFs [@pone.0095635-Drosten2]--[@pone.0095635-Trombley1]. However, most of these qRT-PCR assays may cover limited virus strains or apply under different cycling conditions. Therefore, a panel of reliable comprehensive one-step real-time qRT-PCR assays covering all important pathogens, suitable for multiplex screening or specific quantitative identification with fast turn-around time and identical cycling parameters is still urgently needed, so that the unknown samples can be tested simultaneously and effectively.
Here, we established a series of one-step real-time qRT-PCR assays for multiplex detection of 28 viruses, which covered nearly all the important viral pathogens that cause VHFs, including Hantaan virus (HTNV), Seoul virus (SEOV), Puumala virus (PUUV), Dobrava virus (DOBV), Tula virus (TULV), Black creek canal virus (BCCV), Andes virus (ANDV), Sin nombre virus (SINV), Crimean-congo hemorrhagic fever virus (CCHFV), Rift valley fever virus (RVFV), Severe fever with thrombocytopenia syndrome virus (SFTSV), Heartland virus (HLV), Omsk hemorrhagic fever virus (OHFV), Kyasanur forest disease virus (KFDV), Dengue virus (DENV), Yellow fever virus (YFV), Marburg virus (MARV), Ebola Zaire virus (ZEBOV), Ebola Sudan virus (SEBOV), Ebola Cote d'Ivoire virus (CEBOV), Junin virus (JUNV), Machupo virus (MACV), Guanarito virus (GTOV), Sabia virus (SABV), Chapare virus (CHAV), Lassa virus (LASV), Lujo virus (LUJV) and Bas-Congo virus (BASV). All assays were optimized at a universal thermal cycling condition, and evaluated under monoplex or multiplex condition for detection and absolute quantification of viral RNAs, which were proved to be reliable molecular tools of early diagnosis and consequently addressing the threat of viral hemorrhagic fevers.
Results {#s2}
=======
Selection of Primers and Probes {#s2a}
-------------------------------
Genomic sequences of all representative strains of each viral species were downloaded from the GenBank database (Supplementary [Table S1](#pone.0095635.s002){ref-type="supplementary-material"}). Alignments were performed with Clustal W using complete sequences of listed HFVs. After visual inspection of the sequence alignments, targeted genomic regions with high conservation were chosen, which located at encoding gene of nucleocapsid protein (NP) of viruses from *Bunyaviridae*, *Filoviridae* and BASV, non-structural protein 5 (NS5) of viruses from *Flaviviridae*, and glycoprotein (GP) of viruses from *Arenaviridae*. In total, 27 primer-probe pairs were designed and appraised, and all primers/probes were grouped into seven groups based on the related diseases or virus families. Of them, ANDV and SINV were designed to share the same primers/probe set in Group B ([Table 1](#pone-0095635-t001){ref-type="table"}). BLAST analysis was also performed among chose viral target sequences in NCBI database to confirm the specificities of the primer-probe sets.
10.1371/journal.pone.0095635.t001
###### Primers, probes, and amplicon sizes of the one-step real-time qRT-PCR assays.
{#pone-0095635-t001-1}
Group Viruses GenBankAccession No. ForwardPrimers ReversePrimers Probes Ampliconsize (bp)
------- -------------------- ---------------------- --------------------------------------------- ------------------------------------------- ---------------------------------------------------------------- -------------------
**A** **~HTNV~** ~NC_005218~ ~F(771--793):\ GCTTCTTCCAGATACAGCAGCAG~ ~R(862--884):\ GCCTTTGACTCCTTTGTCTCCAT~ ~P(811--839):\ FAM-CCTGCAACAAACAGGGAYTACTTACGGCA-BHQ1~ ~114~
**SEOV** NC_005236 F(217--237): GATGAACTGAAGCGCCAACTT R(272--291): CCCTGTAGGATCCCGGTCTT P(239--263): HEX-CCGACAGGATTGCAGCAGGGAAGAA-BHQ1 76
**PUUV** NC_005224 F(181--201): AGGCAACAAACAGTGTCAGCA R(334--359): GCATTTACATCAAGGACATTTCCATA P(278--304): Texas Red-CTGACCCGACTGGGATTGAACCTGATG-BHQ2 179
**DOBV** NC_005233 F(755--772): TGACCTCCCRTGCAARCT R(801--818): GGTGGATGGGCCTTTGGT P(777--803): Cy5-TCTGAGCCATCWCCAACRTCTTTGACC-BHQ2 65
**B** **TULV** NC_005227 F(181--199): AGACGGGCAGCTGTGTCAG R(286--303): ATCCGGCTCAAGCCCAGT P(215--239): Texas Red -GGCAGACTTCAAGAGGCAGCTTGC-BHQ2 126
**BCCV** L39949 F(818--842): CGACAAATGGTGCTTACTTTATGAA R(884--909): TGATTCAGCAGTGTCAATTAGGTCTA P(847--875): Cy5-CAGACACAGGTTGAAGAGTCAAAGGTGCA-BHQ2 92
**ANDV/** **SINV** NC_003466 F(81--102): ACACGAACAACAGCTCGTGACT R(278--299): GGTTCAATCCCTGTTGGATCAA P(197--224): FAM-CTRCATTGGAGACCAAACTCGGRGAACT-BHQ1 219
**C** **CCHFV** NC_005302 F(726--747): GCCGTTCAGGAATAGCACTTGT R(869--889): TGTTATCATGCTGTCGGCRCT P(750--777): HEX-CAACAGGCCTTGCYAAGCTYGCAGAGAC-BHQ1 164
**RVFV** NC_014395 F(1254--1275): CATGGTWGTCCCAGTGACAGGA R(1330--1355): GATGAGTTGACTCTATCACGAGTTGC P(1276--1303): Cy5-AGCCACTCACTCAAGACGACCARAGCCT-BHQ2 102
**SFTSV** HM745932 F(1104--1125): GGGTCCCTGAAGGAGTTGTAAA R(1155--1178): TGCCTTCACCAAGACTATCAATGT P(1127--1146): Texas Red -TTCTGTCTTGCTGGCTCCGCGC-BHQ2 75
**HLV** JX005842 F(1457--1484): GCATTCTCCTTCAGCTCATAGACTCTAG R(1525--1549): GAACAAGATAGTGAAAGCATGTGGC P(1495--1525): FAM-CATCCTCTCAGCGCCTTTCTTAGACATCTTG-BHQ1 93
**D** **OHFV** NC_005062 F(9557--9579): TCGAGGCTACAGACTCACACAAC R(9614--9633): AAGGCGTTCTTCTCCGTGGT P(9588--9611): FAM-CGCAGCCACCTCTCCACTCGTAGC-BHQ1 77
**KFDV** NC_004355 F(9416--9434): GAGGCTGCGTCATGGACAT R(9487--9508): CCTTGATGTTCGTGAGGGTGTT P(9451--9473): HEX-CAACGTGGTTCAGGCCAGGTGGT-BHQ1 93
**DENV** NC_001474 F(8977--9002): GGAAGTAGAGCAATATGGTACATGTG R(9157--9179): CCGGCTGTGTCATCAGCATAYAT P(9082--9109): Texas Red -TGTGCAGTCCTTCTCCTTCCACTCCACT-BHQ2 203
**YFV** NC_002031 F(9858--9878): GAGGAAGGGTGTCTCCAGGAA R(9911--9932): ACATGTTGGCATAGGCTTTGCT P(9883--9910): CY5-CTGGATGATCAAGGAAACAGCTTGCCTC-BHQ2 75
**E** **MARV** NC_001608 F(1179--1203): AACAATTCCACCTTCAGAAAACTGA R(1310--1331): GTGACACCCGATTCTGTGATTG P(1209--1236): Cy5-CACACAGTCAGACAYTNGCCGTCCTCAG-BHQ2 153
**ZEBOV** NC_002549 F(501--521): CGCCGAGTCTCACTGAATCTG R(609--633): AGTTGGCAAATTTCTTCAAGATTGT P(578--608): FAM-CGGCAAAGAGTCATCCCAGTGTATCAAGTAA-BHQ1 133
**SEBOV** NC_006432 F(1832--1855): GTTGACCCGTATGATGATGAGAGT R(1915--1934): CATCGTCGTCGTCCAAATTG P(1870--1894): HEX-CTACGAGGATTCGGCTGAAGGCACC-BHQ1 103
**CEBOV** NC_014372 F(2030--2051): CGAAACCCGACTAATATGCCAA R(2095--2117): TGTTATCCCTGGCGTATTCTTGA P(2055--2085):Texas Red -AAGACTCCACACAAAACAATGACAATCCTGC-BHQ2 88
**F** **JUNV** NC_005081 F(1135--1158): TGATGAGTGTCCCYTACTGCAATT R(1251--1276):AATATCCAGTCATTACGGAAGTCAGA P(1192--1220): FAM-CAGGACAACACTCATTRCCAAGGTGCTGG-BHQ1 142
**MACV** NC_005078 F(1388--1411): GTTGAYATTTGTTTCTGGAGCACA R(1478--1497): TGAGGCAAAGGACAGGCTTC P(1456--1479): HEX-CACCCATCGACACCTCAAAGGCGA-BHQ1 110
**GTOV** NC_005077 F(847--867): TGACATGCCAGGTGGTTACTG R(919--941): TCAAATTACACTTGGCRACAGCT P(865--893): Texas Red -CAGCAACCAACATCCACCTYTCAAGACAG-BHQ2 95
**SABV** NC_006317 F(882--905): TTGAAAGATGGATGCTAGTGACGT R(961--983): TCAACATGTCACAGAATTCCGAA P(928--959): Cy5-CACAGCACTAGCAAAATGTAACCTTGACCACG-BHQ2 102
**G** **CHAV** NC_010562 F(1109--1133): GACACTCCCTACTGCAACTACACAA R(1176--1196): TAACCATCCAACAGCGTGGAA P(1144--1171): HEX-TGTCAACCACACCATCACAGGAGAGCAT-BHQ1 88
**LASV** NC_004296 F(2380--2402): ATGGCTTGTTTGTTGAAGTCRAA R(2488--2509): TGACCAGGTGGATGCTAATTGA P(2412--2442): Texas Red -CATGTCACAAAATTCTTCATCGTGCTTCTCA-BHQ2 130
**LUJV** NC_012776 F(571--591): GGCCCATGATGACAAGAACTG R(637--661): CCTCACTTTGTAGTGGGTTTCTGAA P(599--628): Cy5-CTACACCCATTGAACTACCTGAGGCTCCTG-BHQ2 91
**BASV** JX297815 F(763--785): GGACTGGGATTGGTCACTAGGTC R(842--865): TGGATCTGTCTGAATGAAGGACTG P(794--819): FAM-CTGCATCGGCCTGTTCCAACCTGTAC-BHQ1 103
Preparation of Viral RNA Standards {#s2b}
----------------------------------
To evaluate the designed primers/probe and optimize the real-time PCR assay, viral RNA standards were needed. Firstly double-stranded DNA fragments of the complete open reading fragments (ORFs) of NP coding gene of the viruses from *Bunyaviridae* and *Filoviridae*, partial ORF of NP coding gene of BASV, complete ORFs of GP coding gene of the viruses from *Arenaviridae,* and partial ORFs of NS5 coding gene of the viruses from *Flaviviridae* were obtained through chemical synthesis or RT-PCR amplification from viral isolates (HTNV, SEOV, SFTSV, DENV and YFV). After the introduction of T7 promoter sequence to the 5′ or 3′ terminus of these DNA fragments using PCR amplification, the PCR products were used as DNA templates for *in vitro* transcription of positive- or negative-sense viral RNA standards corresponding to related viruses. The resulted 28 RNA transcripts were purified and measured by NanoDrop Spectrophotometer. The 260 nm/280 nm ratios were all between 2.0 and 2.1, indicating that the RNA products were highly pure. The concentration of RNA transcripts were quantified with ranging from 200 to 1185 ng/µL, and the copy numbers were calculated respectively according to the concentration and size of each single-stranded RNA fragment (Supplementary [Table S2](#pone.0095635.s003){ref-type="supplementary-material"}). Then, a serial dilution (10^1^ to 10^8^ copies/µL) of purified viral RNA transcripts was used to create RNA standard templates for development of one-step real-time qRT-PCR.
Development of One-step Real-time qRT-PCR Assays {#s2c}
------------------------------------------------
The goal was to obtain one universal system able to detect effectively all 28 common hemorrhagic fever viruses listed above. Thus we performed numerous assays to optimize the concentrations of primers/probe and experimental condition, which consequently resulted a developed one-step real-time RT-PCR assay.
The optimized reaction system of 25 µL total volume consisted of 12.5 µL of 2× RT-PCR buffer, 400 nM of each primer, 120 nM of each probe, 1 µL of Enzyme Mix and 5 µL of viral RNA transcripts or RNA extracts. The optimal reaction conditions of a one-step assay were used as follows: 50°C for 30 min, 95°C for 10 min, then 40 cycles of 15 s at 95°C and 45 s at 60°C. The CT value for a positive sample was set at 35 cycles according to a liner range of a typical standard curve for each virus detection assay, which was also a strict standard for positive determination.
Using the developed reaction system, we tested each primers-probe set in the monoplex assays, and then combined them into 4-plex reactions for multiplex one-step real-time qRT-PCR assays according to [Table 1](#pone-0095635-t001){ref-type="table"}.
Specificities and Qualitative Ability of Assays {#s2d}
-----------------------------------------------
To assess the specificity of the multiplex one-step real-time qRT-PCR, the cross-reactivity of the monoplex primers/probe was examined first using all the *in vitro* transcribed viral RNA standards with the concentration of 10^6^ copies/µL, RNA extracts from viral isolates and human serum (140 µL of each sample producing 40 µL RNA extract) as templates. According to the criteria of qualitative determination in this study, the detection results of all the samples were determined. For testing of synthetic RNA standards, no cross-amplification reaction for any other virus was observed. All of the specific reactions had high positive fluorescence signals, and mean CTs were in the range of 15.22--20.13 ([Table 2](#pone-0095635-t002){ref-type="table"}). In addition, there was also no significant non-specific amplification plots obtained in the testing of viral RNA extracts and healthy human sera ([Table 3](#pone-0095635-t003){ref-type="table"}). The specificities of these 28 qRT-PCR assays were suggested to be 100% at a cut-off C~t~ value ≤35. It was indicated that the specificity of the developed one-step real-time qRT-PCR assay is considered satisfactory, and the primers/probe sets will be applicable for the multiplex assays.
10.1371/journal.pone.0095635.t002
###### Specificity analysis using in vitro transcribed viral RNAs.
{#pone-0095635-t002-2}
Assay In vitro transcribed target viral RNA (5×10^6^ copies/PCR)
--------------- ------------------------------------------------------------ ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------
**HTNV** **20.13** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**SEOV** -- **17.69** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**PUUV** -- -- **18.25** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**DOBV** -- -- -- **17.53** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**TULV** -- -- -- -- **19.51** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**BCCV** -- -- -- -- -- **17.67** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**ANDV/SINV** -- -- -- -- -- -- **18.87** **18.92** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**CCHFV** -- -- -- -- -- -- -- -- **18.31** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**RVFV** -- -- -- -- -- -- -- -- -- **19.01** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**SFTSV** -- -- -- -- -- -- -- -- -- -- **18.46** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**HLV** -- -- -- -- -- -- -- -- -- -- -- **17.58** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**OHFV** -- -- -- -- -- -- -- -- -- -- -- -- **18.11** -- -- -- -- -- -- -- -- -- -- -- -- -- -- --
**KFDV** -- -- -- -- -- -- -- -- -- -- -- -- -- **18.62** -- -- -- -- -- -- -- -- -- -- -- -- -- --
**DENV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- **18.55** -- -- -- -- -- -- -- -- -- -- -- -- --
**YFV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **17.65** -- -- -- -- -- -- -- -- -- -- -- --
**MARV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **17.39** -- -- -- -- -- -- -- -- -- -- --
**ZEBOV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **18.93** -- -- -- -- -- -- -- -- -- --
**SEBOV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **17.52** -- -- -- -- -- -- -- -- --
**CEBOV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **17.69** -- -- -- -- -- -- -- --
**JUNV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **18.82** -- -- -- -- -- -- --
**MACV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **17.25** -- -- -- -- -- --
**GTOV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **17.92** -- -- -- -- --
**SABV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **17.83** -- -- -- --
**CHAV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **18.32** -- -- --
**LASV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **18.13** -- --
**LUJV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **17.92** --
**BASV** -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- **18.9**
The number indicates Ct value determined from three replicates;
The minus represents a negative detection;
10.1371/journal.pone.0095635.t003
###### Specificity analysis using viral isolates and healthy human sera.
{#pone-0095635-t003-3}
Assay Viral isolates Healthy human serum (positive/tested)
--------------- ---------------- --------------------------------------- ----------- -------------------------------- ----------- ---- -------
**HTNV** **19.07** -- -- -- -- -- 0/200
**SEOV** -- **17.33** -- -- -- -- 0/200
**PUUV** -- -- -- -- -- -- 0/200
**DOBV** -- -- -- -- -- -- 0/200
**TULV** -- -- -- -- -- -- 0/200
**BCCV** -- -- -- -- -- -- 0/200
**ANDV/SINV** -- -- -- -- -- -- 0/200
**CCHFV** -- -- -- -- -- -- 0/200
**RVFV** -- -- -- -- -- -- 0/200
**SFTSV** -- -- **16.28** -- -- -- 0/200
**HLV** -- -- -- -- -- -- 0/200
**OHFV** -- -- -- -- -- -- 0/200
**KFDV** -- -- -- -- -- -- 0/200
**DENV** -- -- -- **16.47, 18.12, 19.07, 15.13** -- -- 0/200
**YFV** -- -- -- -- **15.22** -- 0/200
**MARV** -- -- -- -- -- -- 0/200
**ZEBOV** -- -- -- -- -- -- 0/200
**SEBOV** -- -- -- -- -- -- 0/200
**CEBOV** -- -- -- -- -- -- 0/200
**JUNV** -- -- -- -- -- -- 0/200
**MACV** -- -- -- -- -- -- 0/200
**GTOV** -- -- -- -- -- -- 0/200
**SABV** -- -- -- -- -- -- 0/200
**CHAV** -- -- -- -- -- -- 0/200
**LASV** -- -- -- -- -- -- 0/200
**LUJV** -- -- -- -- -- -- 0/200
**BASV** -- -- -- -- -- -- 0/200
The number indicates Ct value determined from three replicates;
The minus represents a negative detection;
\*DENV1-4, 4 types of dengue virus, viral strains of Hawaii, New Guinea, H87 and H241 were used.
Sensitivities and Detection Limits of Assays {#s2e}
--------------------------------------------
To evaluate sensitivity, 10-fold serial dilutions of RNA standards (from 10^1^ to 10^8^ copies/µL) were used to estimate the detection limits of viral RNA copy load for the developed one-step real-time qRT-PCR assay. The amplification efficiencies of the monoplex assays for the 28 HFVs were all above 90%. The standard curves showed a high correlation coefficient, R^2^\>0.99, for all the viruses detections (Supplementary [Figure S1](#pone.0095635.s001){ref-type="supplementary-material"}). The potential limits of detection (LODs) of these assays were determined to be at a range from 30 to 160 RNA copies/PCR ([Table 4](#pone-0095635-t004){ref-type="table"}).
{#pone-0095635-g001}
10.1371/journal.pone.0095635.t004
###### Detection limits of multiplex one-step real time qRT-PCR assays.
{#pone-0095635-t004-4}
Group Detected Viruses Limits of detection (SEM) (Copies/PCR)
------- ------------------ ---------------------------------------- -------- ------- --------
**A** **HTNV** 100.1 (19.1) 174.3 (22.3)
**SEOV** 48.2 (8.1) 56.7 (11.5)
**PUUV** 85.7 (14.9) 94.1 (10.6)
**DOBV** 52.9 (6.1) 55.7 (4.7)
**B** **TULV** 143.9 (14.3) 143.5 (17.6)
**BCCV** 64.9 (12.7) 65.5 (10.5)
**ANDV** 103.7 (18.3) 148.5 (14.6)
**SINV** 86.3 (22.8) 124.3 (14.9)
**C** **CCHFV** 133.5 (10.2) 114.4 (12.5)
**RVFV** 155.7 (24.9) 215.6 (3.8)
**SFTSV** 94.3 (18.5) 134.8 (2.5)
**HLV** 103.5 (9.3) 146.0 (23.3)
**D** **OHFV** 78.1 (14.8) 107.1 (23.2)
**KFDV** 53.0 (16.8) 73.6 (1.2)
**DENV** 114.2 (15.4) 124.8 (13.6)
**YFV** 31.2 (24.9) 66.4 (25.2)
**E** **MARV** 56.5 (3.1) 70.8 (19.6)
**ZEBOV** 116.9 (9.4) 110.4 (14.5)
**SEBOV** 46.1 (5.2) 46.5 (2.6)
**CEBOV** 58.4 (7.4) 64.8 (14.1)
**F** **JUNV** 105.6 (13.5) 116.5 (18.4)
**MACV** 45.9 (9.6) 63.5 (14.0)
**GTOV** 69.1 (16.4) 86.3 (11.8)
**SABV** 68.0 (10.9) 82.3 (15.9)
**G** **CHAV** 84.2 (5.8) 115.6 (18.9)
**LASV** 53.2 (6.3) 50.0 (5.0)
**LUJV** 62.2 (20.9) 75.8 (15.0)
**BASV** 137.8 (23.2) 149.7 (7.4)
The synthesized RNA standards were then used for the multiplex assay testing, and standard curves of detections for each virus RNA transcripts were also constructed and showed high correlation coefficient, R^2^\>0.99 ([Figure 1](#pone-0095635-g001){ref-type="fig"}). The results showed that the multiplex one-step real-time qRT-PCR assays could detect all the listed HFVs confirmed positive samples and no cross-reaction with the other examined RNA viruses was observed. In most multiplex assays (26 out of 28 virus detections), the LODs were at a range from 45 to 150 RNA copies/PCR, which was similar to that in the monoplex assays ([Table 4](#pone-0095635-t004){ref-type="table"}). Besides, HTNV and RVFV detection assays showed a little lower sensitivity with the LODs of 174.3 and 215.6 copies/PCR, respectively. The analysis of the LOD indicated that the strategy of multiplex detection ensures the sensitivity of the assay system.
Reproducibility of Multiplex One-step Real-time qRT-PCR Assay {#s2f}
-------------------------------------------------------------
To assess the reproducibility of the multiplex one-step real-time qRT-PCR assay, mean C~T~ values were calculated at a serial dilution of viral RNA transcript standards (from 10^1^ to 10^8^ copies/µL), and the variations within and between runs in the linear range of the assays were statistically analyzed (Supplementary [Table S3](#pone.0095635.s004){ref-type="supplementary-material"}). The coefficients of variation (CVs) of C~T~ values were all less than 5% with 0.03--4.84% for intra-assays and 0.07--4.98% for inter-assays ([Figure 2](#pone-0095635-g002){ref-type="fig"}), suggesting that the developed multiplex one-step real-time qRT-PCR assay is reproducible.
{#pone-0095635-g002}
Evaluation using Clinical Specimens {#s2g}
-----------------------------------
To evaluate sensitivity and specificity of the multiplex one-step real-time qRT-PCR assays on clinical specimens, healthy human sera and sera from the respective patients infected with individual viruses were collected, in which HFRS patients, SFTS patients and Dengue fever patients were included. Three related groups of multiplex qRT-PCR assays, including Group A, Group C and Group D. were performed for test the diagnostic specificity and sensitivity in comparison with monoplex qRT-PCR assays. For the tested sera from 11 HFRS patients infected with HTNV and 48 SFTS patients infected with SFTSV, the assay sensitivity was 100% with all tested samples detected HTNV positive (11/11) in Group A or SFTSV positive (48/48) in Group C respectively, and the rest viruses in Group A (0/11) or C (0/48) were detected negative for above collected clinical samples ([Table 5](#pone-0095635-t005){ref-type="table"}). The test of 53 sera collected from Dengue fever patients showed 96.2% sensitivity (51 out of 53 detected DENV positive) with only two negative samples ([Table 5](#pone-0095635-t005){ref-type="table"}). There were no false positive results observed in the unrelated patients sera and healthy human sera, suggesting 100% specificity in all the three tested groups of multiplex assays ([Table 5](#pone-0095635-t005){ref-type="table"}).
10.1371/journal.pone.0095635.t005
###### Evaluation of the multiplex real-time qRT-PCR assays using clinical specimens.
{#pone-0095635-t005-5}
Group Detected Viruses Patients sera[\*](#nt106){ref-type="table-fn"} (positive/tested) Healthy human sera (positive/tested)
------- ------------------ ------------------------------------------------------------------ -------------------------------------- ----------- -------
**A** **HTNV** **11/11** 0/48 0/53 0/100
**SEOV** 0/11 0/48 0/53 0/100
**PUUV** 0/11 0/48 0/53 0/100
**DOBV** 0/11 0/48 0/53 0/100
**C** **CCHFV** 0/11 0/48 0/53 0/100
**RVFV** 0/11 0/48 0/53 0/100
**SFTSV** 0/11 **48/48** 0/53 0/100
**HLV** 0/11 0/48 0/53 0/100
**D** **OHFV** 0/11 0/48 0/53 0/100
**KFDV** 0/11 0/48 0/53 0/100
**DENV** 0/11 0/48 **51/53** 0/100
**YFV** 0/11 0/48 0/53 0/100
\*Patient types were confirmed by sera detection using the corresponding monoplex assays.
Discussion {#s3}
==========
VHFs are often fatal in spite of modern intensive care, especially some HFVs can be transmitted from human to human and consequently threat to cause epidemics with high mortality rates [@pone.0095635-Bossi1], [@pone.0095635-Whitehouse1]. Due to the unspecific clinical characters at the early phase of VHFs, a rapid and reliable laboratory testing appeared to be of utmost importance in diagnosis. Molecular assays based on RT-PCR have been successfully applied in the diagnosis of many types of VHFs [@pone.0095635-Drosten2]--[@pone.0095635-Trombley1]. However, most of these published methods only covered part of vial pathogens that caused VHFs. In this study, a multiplex quantitative real-time RT-PCR assay for detection of 28 HFVs which could be carried out in the same 96 wells plate was developed and evaluated. The assay sensitivity and specificity for diagnosis of HTNV, SFTSV and Dengue fever virus infection in patient sera were reliable and desirable. The assay system permits to use a universal reactive condition simultaneously to detect nearly all the hemorrhagic fever viral pathogens. Primers and probes were designed based on alignments of all possible representative viral genomic sequences in recent updated GenBank database, and optimized to react effectively under the same thermal cycling condition, which makes it possible to group these assays as required for broad-range multiplex screening of viral pathogens. It was difficult to obtain specific primers and probes to distinguish ANDV and SINV, thus these two viruses had to share the same primers/probes set to ensure that ANDV and SINV could be detected successfully and rapidly in the established universal system, and other detection methods could be used for further identification. For this point, the system we established in this study still remains to get improvement.
All the assays showed standard curves with high amplification efficiencies and strong linear correlations. The specificity and the reproducibility of the assays were demonstrated and the sensitivity of the systems was acceptable. No significant non-specific amplification was observed among the testing of 28 *in vitro* transcribed viral RNAs ([Table 2](#pone-0095635-t002){ref-type="table"}), RNA extracts of Viruses isolates and 200 healthy human sera ([Table 3](#pone-0095635-t003){ref-type="table"}), which suggested the high specificity of the primers/probe sets. In the multiplex assays testing, there was also no cross-amplification found in RNA transcripts of other viruses, indicating that the developed multiplex one-step real-time qRT-PCR assays were reliable in specificity. The CV of Ct values were all less than 5% in each dilution of synthesized viral RNAs for both intra-assays and inter-assays, suggesting that the multiplex assays were of good reproducibility ([Figure 2](#pone-0095635-g002){ref-type="fig"}). The LODs of these assays were determined in terms of viral RNA copy numbers, ranged from 30 to 160 RNA copies/PCR in the monoplex assays. In the followed multiplex assays, the main range of LODs was from 45 to 150 RNA copies/PCR, which covered more than 90% detected HFVs ([Table 4](#pone-0095635-t004){ref-type="table"}). For HTNV detection assay, the LOD were influenced slightly by viral family based grouping of primers and probes into 4-plex reactions. It resulted in a lower sensitivity of HTNV detection in the multiplex testing with the LOD of 174.3 copies/PCR ([Table 4](#pone-0095635-t004){ref-type="table"}). Another LOD beyond the main range was observed in the RVFV detection (215.6 copies/PCR). It may be, to some extent, due to the relative higher LOD of RVFV detection (155.7 copies/PCR) in the corresponding monoplex assay ([Table 4](#pone-0095635-t004){ref-type="table"}). However, the overall of the sensitivities of multiplex assays was satisfactory, which made it possible to screen VHFs pathogens in one or two steps without requiring of large amount of clinical samples.
So far, most HFVs occurred in limited areas in the world, thus it is difficult to collect clinical samples of all of these 28 viral infections for assays evaluation and validation. The assays developed here were evaluated mostly based on chemically synthesized viral RNA standards, isolated viral RNAs from HFV strains (HTNV, SEOV, SFTSV, DENV 1--4 types, YFV and CHIKV) and healthy donor sera as negative control. It still remains the limitations of the assays to evaluate the specificities and sensitivities of the clinical diagnostic for those viruses included in this study because of the lack of clinical specimens. However, It is noteworthy that the LOD was determined by the linearity with statistically proved, resulting in representing the minimal number of copies that will be detected in 100% of the assays. The LODs and standard curves may be extended for quantitative analysis of clinical samples that are from infections caused by hemorrhagic fever viruses. Furthermore, evaluation with clinical samples of patients from three of hemorrhagic fever diseases, including HFRS caused by HTNV, SFTS caused by SFTSV and Dengue fever caused by DENV ([Table 5](#pone-0095635-t005){ref-type="table"}) showed the reliable specificities and sensitivities for laboratory detection of the infections with these viruses and provided potential use for clinical diagnosis.
In conclusion, the comprehensive multiplex one-step real-time TaqMan qRT-PCR assays for rapid detection of 28 HFVs was established and evaluated in this study, which nearly covered all the hemorrhagic fever viruses. The developed multiplex one-step real-time qRT-PCR assay was tested using different simulate samples and showed excellent parameters in the followed statistical analysis. Therefore, this assay proved to be specific, sensitive and, apparently, convenient for rapid and simultaneous identification in laboratory, and could be certainly extended to routine diagnosis and epidemiological detection of VHF infections.
Materials and Methods {#s4}
=====================
Primers and Probes Design {#s4a}
-------------------------
Genomic sequences used in the study were all retrieved from the GenBank database of NCBI (<http://www.ncbi.nlm.nih.gov/nuccore/>), including the nucleotide sequences of the full genome of the HFVs in the families of *Flaviviridae* and *Filoviridae*, the S segments of the viruses in the families of *Bunyaviridae* and *Arenaviridae*, and the only one genomic sequence of BASV. The multiple alignments of genomic sequences were carried out respectively using Clustal W within the sequence editor package BioEdit (version 7.0.9) to identify conserved regions by visual inspection of the sequence alignments [@pone.0095635-Hall1]. Primers and probe for each virus were designed using a Primer Express software (version 3.0, Applied Biosystems), and optimized using DNASTAR software by analysis of potentials for dimerization, cross-linking and secondary structures. The specificity of primer and probe sequences was further confirmed using primer--BLAST (NCBI). The probes were differently labeled with the fluorescent dyes, FAM, HEX, TEXAS RED or CY5. All oligonucleotides were synthesized by Shanghai Sangon Biotech Co., Ltd.
Viruses and Samples {#s4b}
-------------------
Viral isolates propagated in C6/36 or Vero cells, including HTNV (84Fli strain), SEOV (L99 strain), SFTSV (HB29 strain), DENV 1--4 types (Hawaii, New Guinea, H87 and H241 strains), YFV (17D strain) and Chikungunya fever virus (CHIKV, SD08Pan strain), were prepared. Human serum samples from healthy adult donors (n = 200) were assembled from samples library of Chinese National Institute for Viral Diseases Control and Prevention. Among them, CHIKV isolates and healthy human sera were used as negative control in all the tests, whereas the other viral isolates were implied as positive or negative control in the detection assays for different viruses. The human sera from HFRS patients (N = 11), SFTS patients (N = 48) and Dengue fever patients (N = 53) in the acute phase were from our laboratory collections, which were all confirmed by monoplex real-time qRT-PCR assays, and other specific detection methods (virus isolation or IgG detection).
RNA Extraction {#s4c}
--------------
RNAs from sera and the culture supernatant of virus-infected cells were extracted from 140 µL of each sample using QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer's instructions, then eluted in 40 µL sterilized RNase free water and stored at −80°C before use.
Preparation of Viral RNA Standards {#s4d}
----------------------------------
Preparation of viral RNA standards was initiated with viral genomic DNA fragments obtained through chemical synthesis or RT-PCR amplification from viral isolates (HTNV, SEOV, SFTSV, DENV and YFV). The T7 promoter sequence was then introduced into the 5′ terminus (for positive-strand viruses) or 3′ terminus (for negative-strand viruses) of these DNA fragments via PCR amplification. The PCR products were purified using the Gel Extraction Kit (Qiagen) and used for *in vitro* transcription with a RiboMAX™ Large Scale RNA Production Systems-T7 (Promega). The synthetic RNA transcripts were purified by RNeasy Mini Kit (Qiagen), followed by concentration calculation using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies) and analysis by 2% agarose gel electrophoresis, and then stored at −80°C. Dilutions of viral RNA standards ranging from 10^1^ to 10^8^ copies/µL were prepared by 10-fold serial dilution of RNA transcripts in sterilized RNase free water according to the concentration and length of each transcript.
One-step Real-time qRT-PCR Assays {#s4e}
---------------------------------
One-step real-time qRT-PCR reactions were performed using AgPath-ID™ one-step RT-PCR Kit (Applied Biosystems), and contained 12.5 µL of 2× RT-PCR buffer, 400 nM of each primer, 120 nM of each probe, 1 µL of Enzyme Mix and 5 µL of viral RNA transcripts or RNA extracts in a final volume of 25 µL. Total RNA extracted from Hela cells was used as negative control. Real-time qRT-PCR cycling was performed on Bio-Rad CFX96 system as follows: 50°C for 30 min, 95°C for 10 min, then 40 cycles of 15 s at 95°C and 45 s at 60°C. The fluorogenic signal emitted was collected at the end of annealing-extension step. A threshold was automatically set and the threshold cycle value (C~t~) was consequently determined. Three replicates of the assay within or between runs were performed. Multiplex assays were assembled by grouping the primers and probes according to the hosts/vectors or viral families (Supplementary [Table S3](#pone.0095635.s004){ref-type="supplementary-material"}), reaction conditions were as same as described above.
Specificity, Sensitivity and Reproducibility {#s4f}
--------------------------------------------
To assess the specificities of the developed one-step real-time qRT-PCR assays, each pair of primers and probe was tested in triplicate against all the other *in vitro* synthetic viral RNA transcripts with the concentration of 10^6^ copies/µL, RNA extracts of HTNV, SEOV, SFTSV, DENV, YFV and CHIKV, as well as serum RNA from a panel of 200 sera from human without VHFs.
To evaluate sensitivity of monoplex and multiplex one-step real-time qRT-PCR assays, each group of 10-fold serial dilutions of 28 *in vitro* synthetic target viral RNA transcripts, ranging from 10^1^ to 10^8^ copies/µL, were used as standard preparations to assess the detection limits of viral RNA copy load. Three replicates of the assay within or between runs were performed to assess the reproducibility, and the intra-assay and inter-assay variations over the linear range of the assays were statistically calculated.
Statistical Analysis {#s4g}
--------------------
Regression, reproducibility and the coefficient of variation (CV) of the mean C~t~ value for each standard concentration within and between individual PCR runs were statically calculated by using GraphPad Prism version 5.01 (GraphPad Software, San Diego, CA; <http://www.graphpad.com/prism/Prism.htm>) to evaluate linearity and determine the quantitative performance of each assay.
Ethical Consideration {#s4h}
---------------------
According to the medical research regulation of National Health and Family Planning Commission, China, all studies involved in human samples were reviewed and approved by the ethics committee of China Center for Disease Control and Prevention, which uses international guidelines to ensure confidentiality, anonymity, and informed consent. The written informed consent was agreed by the donors.
Supporting Information {#s5}
======================
######
**Amplification plots and standard curves of monoplex one-step real-time TaqMan qRT-PCR assays.** The monoplex one-step real-time TaqMan RT-PCR assays were performed with synthesized in vitro target viral RNA transcripts ranging from 10^1^ to 10^8^ copies/µL to evaluate the specificity and the sensitivity of each primers/probe set. A PCR baseline subtractive curve fit view of the data is shown with relative fluorescence units (RFUs) plotted against cycle numbers. Standard curves generated from the Ct values obtained against known concentrations, the coefficient of determination (R^2^) and slope of the regression curve for each assay are indicated.
(PDF)
######
Click here for additional data file.
######
**GenBank accession numbers of hemorrhagic fever viruses aligned in this study.**
(PDF)
######
Click here for additional data file.
######
**Viral RNA standards prepared via in vitro transcription.**
(PDF)
######
Click here for additional data file.
######
**Reproducibility analysis of multiplex one-step real-time RT-PCR assays.**
(PDF)
######
Click here for additional data file.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
[^2]: Conceived and designed the experiments: DXL MFL JDL. Performed the experiments: ZP AQL JQ CCH. Analyzed the data: ZP AQL. Contributed reagents/materials/analysis tools: ZP AQL JQ CCH SZ CL QFZ. Wrote the paper: ZP AQL MFL DXL.
| 2024-06-29T01:26:59.872264 | https://example.com/article/9093 |
Harry left the Dursleys long ago. Devoid of a family, he found himself his own: The Maruaders. Now he is fifteen. He is not the gullible and naive Harry Potter Dumbledore expected to attend Hogwarts Harry/Ginny | 2023-12-24T01:26:59.872264 | https://example.com/article/2003 |
Q:
How to list available video modes using C#?
I've found nice examples using C++ (http://www.codeproject.com/KB/tips/resswitch.aspx), but not in C#.
Can someone help, please?
Edit:
The exact function that list the video modes is:
BOOL CVideoModes::GetAvailableVideoModes(CAvailableVideoModes& modes)
{
modes.SetSize(0, 5);
int i=0;
DEVMODE dm;
while (EnumDisplaySettings(NULL, i, &dm))
{
CVideoMode thismode(dm.dmBitsPerPel, dm.dmPelsWidth,
dm.dmPelsHeight, dm.dmDisplayFrequency);
modes.SetAtGrow(i, thismode);
++i;
}
modes.FreeExtra();
return (i>0);
}
But sincerelly I cannot understand that C++ code. Where I can find that "thismode" function?
A:
If you mean video modes are available resolutions, try to invoke EnumDisplaySettingsEx
details can be found here:
http://msdn.microsoft.com/en-us/library/dd162612(VS.85).aspx
small program that lists available resolutions:
using System;
using System.Linq;
using System.Runtime.InteropServices;
using System.Windows.Forms;
namespace ListResolutions
{
class Program
{
[DllImport("user32.dll")]
public static extern bool EnumDisplaySettings(
string deviceName, int modeNum, ref DEVMODE devMode);
const int ENUM_CURRENT_SETTINGS = -1;
const int ENUM_REGISTRY_SETTINGS = -2;
[StructLayout(LayoutKind.Sequential)]
public struct DEVMODE
{
private const int CCHDEVICENAME = 0x20;
private const int CCHFORMNAME = 0x20;
[MarshalAs(UnmanagedType.ByValTStr, SizeConst = 0x20)]
public string dmDeviceName;
public short dmSpecVersion;
public short dmDriverVersion;
public short dmSize;
public short dmDriverExtra;
public int dmFields;
public int dmPositionX;
public int dmPositionY;
public ScreenOrientation dmDisplayOrientation;
public int dmDisplayFixedOutput;
public short dmColor;
public short dmDuplex;
public short dmYResolution;
public short dmTTOption;
public short dmCollate;
[MarshalAs(UnmanagedType.ByValTStr, SizeConst = 0x20)]
public string dmFormName;
public short dmLogPixels;
public int dmBitsPerPel;
public int dmPelsWidth;
public int dmPelsHeight;
public int dmDisplayFlags;
public int dmDisplayFrequency;
public int dmICMMethod;
public int dmICMIntent;
public int dmMediaType;
public int dmDitherType;
public int dmReserved1;
public int dmReserved2;
public int dmPanningWidth;
public int dmPanningHeight;
}
static void Main(string[] args)
{
DEVMODE vDevMode = new DEVMODE();
int i = 0;
while (EnumDisplaySettings(null, i, ref vDevMode))
{
Console.WriteLine("Width:{0} Height:{1} Color:{2} Frequency:{3}",
vDevMode.dmPelsWidth,
vDevMode.dmPelsHeight,
1 << vDevMode.dmBitsPerPel, vDevMode.dmDisplayFrequency
);
i++;
}
}
}
}
| 2024-02-18T01:26:59.872264 | https://example.com/article/9666 |
The Como Hotel, Melbourne
A long established destination in South Yarra, The Como Melbourne undergoes a carefully considered renovation. Alice Blackwood reports.
Home to a dress circle of retail outlets, cafes, designer hotels and purveyors of high-end goods, South Yarra is a popular destination for Melbourne locals and visitors alike. The suburb’s fashionable Chapel Street–Toorak Road junction could be described as the pulse of the precinct encompassing, among other things, The Como Melbourne, a boutique hotel that sits within the Signature series of Accor’s MGallery Collection.
Boasting a 23-year tenure, The Como Melbourne is popular among patrons for its spacious rooms, extra deep bathtubs, secret Japanese gardens and notably, its recent interior refurbishment.
Embarking on the refurbishment of the hotel was a slow and painstaking process, with the hotel booked out more often than not, and management opting to keep the hotel open while simultaneously renovating floor-by-floor.
Melbourne design studio Elsie + Betty are well versed in the design of contemporary hospitality fit-outs and undertook a considered briefing and design development period on The Como.
Its original Japanese cultural themes and interior aesthetic provided a strong frame of reference for Elsie + Betty’s Valentina Kopilas who says: “We were inspired by the strong Japanese theme and Japanese gardens which lead off the rooms.” Here she highlights design details such as the recurring maple leaf motif found within many of the rooms.
The hotel building, shaped in a semi-circle, houses myriad room configurations across multiple levels. Taking this into account, The Como commenced its renovations with the utmost tact, transforming its many spaces floor-by-floor, over a 7-month period.
While rooms sport new interior structures and furnishings (many of which are sourced from notable Australian designer-retailers such as Jardan), the designers chose to retain some of the more iconic features, such as the extra deep Japanese style bathtubs – “all original, but resurfaced,” notes Kopilas.
Themost exciting of The Como’s accommodation is its exclusive penthouses, of which there are three, each fit-out to a theme of Pearl, Gem and Gold.
Here high-end European pieces from Space Furniture are complemented by custom-patterned rugs from Brintons.
The penthouses are spread across two levels; the upper levels of Pearl and Gem housing luxury bathing and showering areas, with a sauna room to top it off. By far the most opulent of all three is Gold, an entertainer’s playground complete with baby grand piano.
While the bedrooms are very much the highlight of the hotel, Kopilas highlights the corridors as her favourite design element.
“They have such a great mood when you walk in, with their beautiful halo lights and Brintons custom-patterned carpet.”
Don’t miss out on any print issue of Habitus!
Habitus Magazine is the Asia Pacific authority of choice for Design Hunters® looking for the special in design and architecture and products, providing an exclusive view into the regions most beautiful homes. | 2024-02-02T01:26:59.872264 | https://example.com/article/5812 |
"use strict";
exports.__esModule = true;
exports.merge = merge;
exports.validate = validate;
exports.normalizeReplacements = normalizeReplacements;
function _objectWithoutProperties(source, excluded) { if (source == null) return {}; var target = {}; var sourceKeys = Object.keys(source); var key, i; for (i = 0; i < sourceKeys.length; i++) { key = sourceKeys[i]; if (excluded.indexOf(key) >= 0) continue; target[key] = source[key]; } if (Object.getOwnPropertySymbols) { var sourceSymbolKeys = Object.getOwnPropertySymbols(source); for (i = 0; i < sourceSymbolKeys.length; i++) { key = sourceSymbolKeys[i]; if (excluded.indexOf(key) >= 0) continue; if (!Object.prototype.propertyIsEnumerable.call(source, key)) continue; target[key] = source[key]; } } return target; }
function merge(a, b) {
var _b$placeholderWhiteli = b.placeholderWhitelist,
placeholderWhitelist = _b$placeholderWhiteli === void 0 ? a.placeholderWhitelist : _b$placeholderWhiteli,
_b$placeholderPattern = b.placeholderPattern,
placeholderPattern = _b$placeholderPattern === void 0 ? a.placeholderPattern : _b$placeholderPattern,
_b$preserveComments = b.preserveComments,
preserveComments = _b$preserveComments === void 0 ? a.preserveComments : _b$preserveComments;
return {
parser: Object.assign({}, a.parser, b.parser),
placeholderWhitelist: placeholderWhitelist,
placeholderPattern: placeholderPattern,
preserveComments: preserveComments
};
}
function validate(opts) {
if (opts != null && typeof opts !== "object") {
throw new Error("Unknown template options.");
}
var _ref = opts || {},
placeholderWhitelist = _ref.placeholderWhitelist,
placeholderPattern = _ref.placeholderPattern,
preserveComments = _ref.preserveComments,
parser = _objectWithoutProperties(_ref, ["placeholderWhitelist", "placeholderPattern", "preserveComments"]);
if (placeholderWhitelist != null && !(placeholderWhitelist instanceof Set)) {
throw new Error("'.placeholderWhitelist' must be a Set, null, or undefined");
}
if (placeholderPattern != null && !(placeholderPattern instanceof RegExp) && placeholderPattern !== false) {
throw new Error("'.placeholderPattern' must be a RegExp, false, null, or undefined");
}
if (preserveComments != null && typeof preserveComments !== "boolean") {
throw new Error("'.preserveComments' must be a boolean, null, or undefined");
}
return {
parser: parser,
placeholderWhitelist: placeholderWhitelist || undefined,
placeholderPattern: placeholderPattern == null ? undefined : placeholderPattern,
preserveComments: preserveComments == null ? false : preserveComments
};
}
function normalizeReplacements(replacements) {
if (Array.isArray(replacements)) {
return replacements.reduce(function (acc, replacement, i) {
acc["$" + i] = replacement;
return acc;
}, {});
} else if (typeof replacements === "object" || replacements == null) {
return replacements || undefined;
}
throw new Error("Template replacements must be an array, object, null, or undefined");
} | 2024-01-28T01:26:59.872264 | https://example.com/article/5079 |
A gas station didn't heed the attendant's request to put out his cigarette, so the attendant doused him and his car with a powder-based extinguisher.
Sorry for the potato camera quality of the video. For a clearer look at the smoking customer, here's a portrait of him by Robert Crumb. | 2024-06-20T01:26:59.872264 | https://example.com/article/2275 |
# Copyright 2014 Square Inc.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
# Creates a {Blob} if necessary and then calls {Blob#import_strings} on it.
class BlobImporter
include Sidekiq::Worker
sidekiq_options queue: :high
# Executes this worker.
#
# @param [String] importer The ident of an importer.
# @param [Fixnum] blob_id The ID of the blob being imported.
# @param [Fixnum] commit_id The ID of the Commit with this blob.
def perform(importer, blob_id, commit_id)
commit = Commit.find(commit_id)
blob = Blob.find(blob_id)
importer = Importer::Base.find_by_ident(importer)
blob.import_strings importer, commit
rescue Git::CommitNotFoundError, Git::BlobNotFoundError => err
commit.add_import_error(err, "failed in BlobImporter for commit_id #{commit_id} and blob_id #{blob_id}")
end
include SidekiqLocking
end
| 2024-01-12T01:26:59.872264 | https://example.com/article/2335 |
Q:
Frequency of Oscillations about Circular Orbit
I'm trying to figure out the frequency of small oscillations about the basic circular path of a mass at the end of a spring, being spun around a table. I understand that the spring will stretch out a bit, and then it will have a stable circular orbit. Moreover, introducing a little bit of extra stretching will cause it to oscillate about this orbit, but I have no idea what approach to take. I've seen things like binomial expansions and the like to calculate small changes to orbits, but I can't even seems to get a good, functional equation to describe the set up. Can someone give me a little guidance?
A:
The potential energy is $U\left(r\right) = k \left(r - r_0\right)^2 / 2$, where $r_0$ is the equilibrium position of the spring. Since this is a central potential (depends only on $r$), angular momentum $L$ is conserved, and we can use the concept of an effective potential energy (see equation 335 here)
$$
\begin{eqnarray}
U_{eff}\left(r\right) &=& \frac{L^2}{2 m r^2} + U\left(r\right) \\
&=& \frac{L^2}{2 m r^2} + \frac{1}{2} k \left(r - r_0\right)^2
\end{eqnarray}
$$
The equilibrium position $r_*$ is then given by
$$
0 = \frac{d U_{eff}}{dr} \Bigg|_{r=r_*} = -\frac{L^2}{mr_*^3} + k\left(r_* - r_0\right) \ \ \ \Rightarrow \ \ \ u^4 - u^3 = C,
$$
where $u = r_*/r_0$ and $C = L^2 / \left(m k r_0^4\right)$.
The angular frequency of small oscillations about $r=r_*$ is then
$$
\omega = \left(\frac{1}{m} \frac{d^2 U_{eff}}{dr^2} \Bigg|_{r=r_*} \right)^{1/2} = \left(\frac{k}{m} + \frac{3 L^2}{m^2 r_*^4}\right)^{1/2}
$$
Now it remains to solve for $u$ in $u^4 - u^3 = C$.
| 2024-06-30T01:26:59.872264 | https://example.com/article/3050 |
The goal of this training grant program is to prepare outstanding M.D, M.D-Ph.D. and Ph.D. trainees for careers as scientific leaders in HIV/AIDS research. Despite enormous progress over nearly 4 decades towards reducing the morbidity and mortality from HIV/AIDS, substantial challenges remain. These include developing a safe and effective vaccine; development of a cure for HIV infection; improving the treatment and management of opportunistic infections such as tuberculosis that burden HIV-infected patients in resource-limited settings; managing the threat of antiretroviral drug resistance; developing safe and effective interventions to reduce HIV- associated immune activation that leads to end-organ disease; and developing long-acting antiretroviral drugs to facilitate life-long adherence to antiretroviral therapy. Progress on these fronts requires basic and translational research to further our understanding of the molecular biology, pathogenesis, immunology, prevention and therapeutics of HIV/AIDS. Over the past 30 years this program has trained 128 post-doctoral fellows, the majority of whom have gone on to leadership positions in academia, industry and government. This program will provide in-depth laboratory experience in a specific research area of HIV-related virology, immunology, epidemiology, molecular genetics, molecular therapeutics, genomics and/or systems biology. Criteria for selecting trainees will include prior training record, aptitude for research and demonstrated commitment to a research career. All applicants will be selected by a Training Advisory Committee (TAC); 5 trainees will be selected annually. Particular emphasis will be given to the recruitment of minorities and others underrepresented in AIDS research, including women, individuals with disabilities and those from disadvantaged backgrounds. Basic elements of the program include: 1) in-depth research training through laboratory investigation of a specific scientific question in a particular area of AIDS research under mentorship of a senior investigator; 2) a didactic program consisting of appropriately chosen courses specific to the trainee?s career goals; 3) frequent exposure to seminars, workshops and colloquia related to AIDS; regular review of progress by individual Research Advisory Committees and the TAC. The training facilities consist of state-of-the-art research laboratories at Harvard Medical School, Harvard-TH Chan School of Public Health, Beth Israel-Deaconess Hospital, Brigham and Women?s Hospital, Dana Farber Cancer Institute, Massachusetts General Hospital and the Ragon Institute of MGH, Harvard and MIT. Independently funded senior and junior faculty at each of these institutions constitute the faculty of this training program, representing diverse AIDS-related disciplines. The faculty collaborate extensively with one another on AIDS research and will collaborate in directing this training program. The Harvard Center for AIDS Research and the Harvard Medical School Clinical and Translational Science Center (Harvard Catalyst) provide additional institutional resources that enrich the scientific experience and career development of our trainees. | 2023-10-07T01:26:59.872264 | https://example.com/article/6384 |
export PYTEST_MARKER="-m pymysql"
export DOCKER_DEPS="mysql"
export MYSQL_HOST="mysql"
export MYSQL_USER="eapm"
export MYSQL_PASSWORD="Very(!)Secure"
export WAIT_FOR_HOST="mysql"
export WAIT_FOR_PORT=3306
| 2024-05-12T01:26:59.872264 | https://example.com/article/7848 |
Breast conservation and prolonged chemotherapy for locally advanced breast cancer: the University of Michigan experience.
To determine whether breast conservation and prolonged neoadjuvant chemotherapy have efficacy in locally advanced breast cancer (LABC), as measured by survival and rate of breast conservation. Eighty-nine patients with stage III disease were enrolled at the University of Michigan (UM) onto a prospective nonrandomized trial. Patients received nine 21-day cycles of neoadjuvant chemohormonal therapy that consisted of doxorubicin 30 mg/m2 and cyclophosphamide 750 mg/m2 intravenously on day 1, conjugated estrogens 0.625 mg orally twice daily on days 6 to 8, methotrexate 40 mg/m2 and fluorouracil 500 mg/m2 intravenously on day 8, and tamoxifen 10 mg orally twice daily on days 9 to 14. Patients with a negative biopsy received radiation only, while those with residual disease underwent mastectomy and postoperative radiotherapy. Eight more cycles of chemohormonal therapy were administered after local-regional therapy. The clinical response rate to neoadjuvant therapy was 97%, 28% of patients had a complete pathologic response evaluated at biopsy. Five-year overall and disease-free survival probabilities were 54% and 44%, respectively. The median disease-free survival time was 2.4 years. The 5-year actuarial rates of local-regional control with local failure as only first failure were 82% and 78% following radiotherapy, and mastectomy and radiotherapy, respectively (P = .99). Prolonged neoadjuvant chemohormonal therapy and biopsy-driven local therapy have efficacy in LABC, with 28% of patients being candidates for breast conservation and a 5-year overall survival rate of 54%. | 2023-09-11T01:26:59.872264 | https://example.com/article/5876 |
Helen Haskell on Tracking Medical Errors: How We Err When Counting the Casualties of Medical Care
Helen Haskell on Tracking Medical Errors: How We Err When Counting the Casualties of Medical Care
It has been 12 years since Helen Haskell lost her 15-year-old son, Lewis Blackman, because of a series of medical errors, and she has worked hard in that time to prevent similar errors. She founded Mothers Against Medical Error (MAME). She helped with a campaign to get a hospital infection public disclosure bill passed into law in South Carolina. And she lobbied the South Carolina legislature to have the Lewis Blackman Hospital Safety Act passed in 2005 in honor of her son.
When Haskell’s son was suffering from the effects of a surgery gone wrong, Haskell tried to get the attention of physicians. She was punted to a medical resident, and only found out later that the resident had very little experience. The Blackman Act requires that staff wear tags indicating whether they are physicians, residents, or medical students. It also requires nurses to contact attending physicians when a patient needs them.
Haskell contacted me when I was writing about Sorry Works! with some thoughts on the number of people harmed by medical professionals, and I asked her to write some guest posts about the subject. The first is below.
We will not be able to effectively prevent medical harm until we have a better handle on just how much harm there is.
The source that is most often cited for the frequency of medical harm in the United States – the 1999 Institute of Medicine (IOM) report To Err is Human – relied on data from the 1980s and 1990s for its broad estimate of 44,000 to 98,000 annual deaths from medical error. These numbers came from two studies – one in New York and one in Utah and Colorado – that were initially undertaken to measure the feasibility of malpractice insurance reform. They looked at a wide range of adverse medical events, both fatal and non-fatal, and they also found big differences between populations. The death rate in the New York study, for example, was more than twice that of Utah and Colorado.
Overall, the New York study found that adverse medical events caused harm to 3.7% of all hospital patients. In the Utah-Colorado study, the rate was 2.9%. Only a fraction of these adverse events were considered to be due to error.
The IOM arrived at its totals by applying the medical error death rates in each study to the total number of hospital admissions in the United States in 1997. The errors counted in the IOM report included only those that both met the strict standard of legal liability and also led to death. This amounted to about one death in every 350 to 750 hospital admissions.
As shocking as these numbers were, many people have felt that they did not capture the extent of medical harm in the United States.
For one, the investigations were restricted to hospitals, which provide only a portion of the medical care in the US. What about the millions of patients who undergo procedures in surgery centers and outpatient clinics? What about residential care and medical treatment in facilities like nursing homes and dialysis clinics? What about the decisions made in doctors’ offices that lead to patient harm or death?
In addition, by focusing just on medical errors for which a health care provider might be legally liable, the IOM left the impression that millions of other medical injuries might be somehow inevitable. But how do we know what an error is? And who decides? Then there is the issue of the accuracy of medical records, which a 2008 Harvard study suggested might be missing as many as half the adverse events that harm patients.
The biggest problem with the IOM numbers, however, is simply their age.
Medical research moves slowly. Even by the time of its publication, the IOM report’s numbers were far from current. The New York numbers were 15 years old. And the Utah-Colorado numbers were seven years old. Today, those numbers are 28 years and 20 years old.
Health writers would not write about cancer statistics from 1984 as if they were current or diabetes rates from 1992 as if were just released. So why do these dusty IOM numbers – with all their limitations – continue to hold sway with journalists?
In part it’s because the IOM numbers caused such a stir in 1999 that they became widely cited in the medical literature, reinforcing the old estimate even in very recent publications. Also, by rounding up the 98,000 estimate, writers have created an ominous and easy-to-remember total: 100,000 deaths every year. It sounds scary.
More recent estimates, though, tell us that the true number of patients harmed every year by the medical system is probably even scarier. I’ll write about those studies – and some of the issues raised by the studies – in the next post.
Comments
I found the "Harvard" study of 2008 somewhat confusing and never could get clear answers from the first author on my questions. That said, according to the abstract, the medical records showed 11 serious, preventable adverse events, and patients could recall an additional 21 serious, preventable events. This means the medical record under-reported such errors by MORE than a factor of 2...it's more like a factor of 3: (11+21)/3 = 11
The recent deFeijter article (PLoS ONE 7(2)) reported internal reporting systems (IRS) do not accurately capture all adverse events or incidents. Using information from multiple sources: patient complaints, retrospective chart review and from healthcare workers is preferable. Patient complaints revealed more incidents in relation to diagnosis (surprising!!), general care and procedure/treatment than the information entered by healthcare workers into the IRS.
Announcements
Join us at 8:30 a.m. March 22 on Facebook for a life streaming of our daylong briefing on the U.S. Census. You'll learn about the challenges facing counters, efforts to delegitimize the U.S. Census, how the climate of fear in immigrant communities might impede a good count, and discuss reporting and census data analysis strategies.
If you're a journalist with big ideas who wants your work to matter, the Center for Health Journalism invites you to apply for the all-expenses-paid National Fellowship -- five days of stimulating discussions in Los Angeles about social and health safety net issues, plus reporting and engagement grants of $2,000-$12,000 and six months of expert mentoring. | 2024-01-16T01:26:59.872264 | https://example.com/article/4929 |
Biographical Sketch: Eva GERSON
Institution: International Foundation for Science (IFS)
Country: Other (non-African institution)
Ms Gerson is a former New Yorker now living in Sweden. She received her B.Sc. in Accounting from Fairleigh Dickinson University and an MBA from New York University. Prior to moving to Sweden, Ms Gerson was Director of Finance at the New York Association for New Americans (NYANA) and Budget Director at the UJA-Federation of Jewish Philanthropies of New York City. Ms Gerson has been the Head of Finance and Administration at IFS for twelve years. Ms Gerson is representing Dr Michael Stahl, Director of IFS who was unable to attend due to a conflict in his schedule. | 2023-08-21T01:26:59.872264 | https://example.com/article/8492 |
SAN FRANCISCO – During the maiden voyage of the San Francisco Bay Area’s first plug-in hybrid electric ferry today, Governor Edmund G. Brown Jr. signed a comprehensive package of bills aimed at dramatically reducing carbon emissions by boosting the number of zero-emission vehicles and charging stations in California and getting dirty cars and trucks off the road.
“Whether we travel by car, bus, or boat the need to move to zero-emission transportation is urgent. These bills will help get more clean cars on the road and reduce harmful emissions,” said Governor Brown.
The signing – which took place aboard the Enhydra, a new hybrid electric ferry from the Red and White Fleet based in the San Francisco Bay, included 8 bills that aim to reduce carbon emissions from the transportation sector, which currently accounts for approximately 50 percent of the state’s greenhouse gas emissions and about 80 percent of smog-forming pollutants.
The bills signed by the Governor today include:
AB 193 (Cervantes) creates the Zero-Emission Assurance Project, which will provide a rebate for the purchase of a replacement battery or fuel cell component for a used zero-emission vehicle (ZEV) for qualified consumers. This will build consumer confidence in the purchase of a used zero emission vehicle by providing additional assurance that replacement of a battery or fuel cell component will not impose a cost burden on low-income consumers.
AB 2006 (Eggman) makes permanent an existing agricultural worker vanpool program, which will result in zero-emission and hybrid vans taking passenger vehicles off the road in communities most impacted by California’s poor air quality.
AB 2127 (Ting) supports the state’s goal of achieving 5 million ZEVs on the road by 2030 by affirming the California Energy Commission’s authority to assess the need for charging infrastructure to support adoption of zero-emission vehicles, including freight and off‑road vehicles.
AB 2885 (Rodriguez) continues the legislative priority of ensuring that California’s incentive programs serve all communities, by extending the requirement that the California Air Resources Board (CARB) conduct outreach to low-income households and communities as part of the Clean Vehicle Rebate Project. The bill also requires CARB to continue to prioritize rebates to low-income applicants until Jan 1, 2022.
SB 957 (Lara) facilitates further growth of the used zero-emission vehicle market by opening carpool lanes to low-income drivers of used clean air vehicles.
SB 1000 (Lara) requires the state to assess whether vehicle-charging infrastructure is sufficient to encourage the purchase of electric vehicles, and ensures that both plug-in electric vehicles and zero-emission vehicles have equal access to charging infrastructure. By increasing accessibility to electric vehicle charging infrastructure and managing the costs of electricity, SB 1000 will support the transportation electrification needed to meet California’s greenhouse gas and clean air goals.
SB 1014 (Skinner) directs the state to develop emissions reduction targets for ride-hailing services, which represent a growing element of California’s transportation sector. This bill will help ensure that work the Governor has set into motion to increase adoption of zero-emission vehicles in public and private fleets throughout the state continues.
SB 1403 (Lara) ensures that the state’s incentive dollars are invested strategically and are incentivizing the adoption of zero and near-zero emission heavy duty vehicles and equipment, including school buses. The bill requires CARB to develop three-year investment plans for these vehicles starting in 2019. It is critical that investments are prioritized – demand for the state’s incentive programs that support zero and near-zero emission heavy-duty vehicles and equipment vastly outstrips the resources available.
Today’s action builds on the state’s past efforts to boost zero-emission vehicles in California, including Governor Brown’s executive order earlier this year to get 5 million zero-emission vehicles onto California’s roads by 2030 and the state’s Zero-Emission Vehicle Action Plan.
AB 2195 (Chau) will help the public access information regarding the greenhouse gas emissions from gas leakage and flaring resulting from natural gas imported into and consumed in California.
AB 2564 (Rodriguez) will help protect communities from the increased pollution associated with glider kits. With pending federal threats regarding leniencies related to glider kits, this bill sets a high, non-negotiable penalty amount for operating non-compliant glider kits in the state. Diesel particulate matter emissions from glider kits can be up to 450 times higher than emissions from trucks that are complying with the state’s regulations. This bill sends a strong message that dirty glider kits are not welcome in California.
AB 3232 (Friedman) directs state agencies to work together to assess what actions should be taken to reduce emissions from the state’s residential and commercial buildings, recognizing the important work needed to reduce our greenhouse gas emissions from the building sector.
SB 720 (Allen) builds upon California’s commitment to environmental literacy by updating CalRecycle’s environmental principles and concepts to formally include climate change and ensures that the Instructional Quality Commission integrates these environmental principles into future curriculum.
SB 1013 (Lara) in the face of federal reversals, this bill provides a critical backstop to ensure California does not backslide on emissions of hydrofluorocarbons and achieves its short-lived climate pollutant reduction goals. The bill also creates the Fluorinated Gases Emission Reduction Incentive Program to promote the adoption of low‑global warming potential refrigerants.
SB 1016 (Allen) prohibits homeowner associations from unreasonably restricting an owner’s ability to install or use an electric vehicle time-of-use meter and modifies current liability policies.
SB 1072 (Leyva) establishes a regional climate collaborative program to assist under‑resourced communities with accessing statewide public and other grant money for climate change mitigation and adaptation‑related projects. The bill also requires the Strategic Growth Council to develop technical assistance best practices that state agencies may use and identify state grants that could benefit from technical assistance best practices.
SB 1477 (Stern) The quantity of greenhouse gas emissions associated with buildings is second only to greenhouse gas emissions from the transportation sector. This bill establishes two incentive programs aimed at reducing emissions from buildings – one to provide financial incentives for the deployment of near-zero emission building technologies and a second to incentivize the installment of low‑emission space and water heating equipment for new and existing buildings.
On the first full day of the Global Climate Action Summit, Governor Brown also joined a ministerial dialogue hosted by the U.S. Climate Alliance to facilitate bilateral engagement between an international array of heads of state, senior officials from U.S. Climate Alliance states and other climate leaders.
In addition, Governor Brown met with Minister McKenna, Deputy Minister Lendo, Governor Inslee and Governor David Ige of Hawaii to finalize areas for cooperation first outlined in Bonn last year with the launch the North American Climate Leadership Dialogue. The leaders today discussed near-term priorities for ambitious climate action across the region and will develop a framework for implementation in the coming months. California has partnered extensively with its neighbors to combat climate change, including the addition of Mexico and Canada to the Under2 Coalition last year, the linkage of the California and Quebec cap-and-trade programs in 2014 and partnerships between California and other Pacific Coast states on a range of issues, including to oppose expanded offshore drilling.
Earlier in the day, Governor Brown and fellow Summit co-chair and America’s Pledge co-founder Michael Bloomberg released a new report quantifying non-federal action in the U.S. to drive down greenhouse gas emissions, and Governor Brown joined fellow U.S. Climate Alliance governors to announce ambitious new commitments by the coalition. Governor Brown and Commissioner Cañete also reiterated their commitment to greater alignment of California and EU carbon markets and to engage other jurisdictions with emerging programs, building on last year’s meeting between the leaders in Brussels.
Yesterday, Governor Brown welcomed China’s delegation to the Summit, signing an agreement to enhance climate and clean energy cooperation, meeting with the Vice Governor of Jiangsu Province and joining leaders, including former Vice President Al Gore, for a U.S.-China subnational climate dialogue. Governor Brown also addressed the Under2 Coalition General Assembly and joined a signing ceremony for 16 new members; participated in an event to support the Talanoa Dialogue, led by the Prime Minister of Fiji Frank Bainimarama; and met with C40 Steering Committee members at San Francisco City Hall.
On Tuesday, Governor Brown highlighted the importance of California’s landmark cap-and-trade program at an event co-hosted by the by the European Commission, Canada and California, during which he blasted the Trump Administration’s proposal to roll back methane regulation; met with Minister Xie to discuss the China delegation’s leading role at the Summit; held discussions with Governors’ Climate and Forests Task Force members and indigenous community leaders; and delivered remarks at the National Governors Association’s Water Policy Institute conference. Earlier this week, Governor Brown signed legislation setting a 100 percent clean electricity goal for the state, and issued an executive order establishing a new target to achieve carbon neutrality – both by 2045. Late last week, Governor Brown also signed legislation to block new federal offshore oil drilling along California’s coast and announced the state’s opposition to the federal government’s plan to expand oil drilling on public lands in California.
California’s Leadership on Climate Change
California continues to lead the world in adopting innovative policies to fight climate change. Last week, the Governor issued an executive order to safeguard California’s unique plants, animals and ecosystems that are threatened by climate change and last month, the state released its Fourth Climate Change Assessment, which details new research on the impacts of climate change and provides planning tools to support the state’s response.
Earlier this year Governor Brown issued executive orders to improve the health of the state’s forests and help mitigate the threat and impacts of wildfire, and get 5 million zero-emission vehicles onto California’s roads by 2030. Last year, the Governor signed landmark legislation to extend and strengthen the state’s cap-and-trade program and create a groundbreaking program to measure and combat air pollution at the neighborhood level.
Under Governor Brown, California has established the most ambitious greenhouse gas emission reduction targets in North America; set the nation’s toughest restrictions on destructive super pollutants; and will reduce fossil fuel consumption up to 50 percent and double the rate of energy efficiency savings in buildings by 2030. The state has met its 2020 target four years early, reducing emissions 13 percent while growing the economy 26 percent. From 2015 to 2016 alone, emissions reductions were roughly equal to taking 2.4 million cars off the road, saving 1.5 billion gallons of gasoline and diesel fuel.
In addition, Governor Brown has helped establish and expand coalitions of partners across the nation and globe committed to curbing carbon pollution, including the Under2 Coalition, which this week grew to include 222 total jurisdictions on 6 continents, representing more than 1.3 billion people and $34 trillion in GDP – equivalent to 17 percent of the global population and 43 percent of the global economy. Members of the coalition make a number of key commitments, including reducing greenhouse gas emissions equivalent to 80 to 95 percent below 1990 levels or to less than 2 annual metric tons per capita by 2050.
California and 17 other states collectively representing more than 40 percent of the U.S. car market sued the U.S. Environmental Protection Agency earlier this year to preserve the nation’s uniform vehicle emission standards that save drivers money at the pump, cut oil consumption, reduce air pollution and curb greenhouse gases. | 2024-05-16T01:26:59.872264 | https://example.com/article/6101 |
G23
G23 may refer to:
HMS Dagger (G23), a British Royal Navy Weapon class destroyer vessel scrapped prior to completion
Junkers G-23, a 1930 German three-engine, low-wing monoplane nine-passenger aircraft
PRR G23, an American PRR 4-6-0 steam locomotive
and also :
a Compact fluorescent lamp Bipin socket designation
‘ a slightly different fluorescent lamp Bipin socket from German company Paulmann
the Glock 23 handgun
Other degenerative diseases of basal ganglia ICD-10 code | 2024-03-03T01:26:59.872264 | https://example.com/article/8485 |
Q:
Spread operator not type safe
I have a function that is supposed to return some type but using the spread operator caused it to assign a misspelled key.
interface State {
fieldA: number,
fieldB: string
}
const reducer: (state: State, action: {payload: string}) => State = (state, action) => {
// please note that those variables are not desired
const tmp = { ...state, feildB: action.payload }; // No compile time error, as I would expect
// This is too verbose... but works as expected
const tmp2 = Object.assign<State, Partial<State>>(state, {feildB: action.payload}) // ERROR - this is what I need
return tmp
}
const t = reducer({fieldA: 1, fieldB: 'OK'}, {payload: 'Misspelled'}) // Misspelled
console.log("feildB", (t as any).feildB) // Misspelled
console.log("fieldB", (t as any).fieldB) // OK
Is there a way to make it typesafe, while keeping the boilerplate to the minimum?
Playground code HERE
A:
TypeScript is doing what it is supposed to do. In your case, you are creating a new object tmp with a new type that has 3 fields, namely:
interface State {
fieldA: number,
fieldB: string
}
interface Tmp {
fieldA: string;
fieldB: string;
feildB: string;
}
In other words, the spread operator performs the following operation:
interface Obj {
[key: string]: any;
}
const spread = (...objects: Obj[]) => {
const merged: Obj = {};
objects.forEach(obj => {
Object.keys(obj).forEach(k => merged[k] = obj[k]);
});
return merged;
}
The spread operator is creating a new type of object for you; if you want to infer the type, then you should do:
// this now throws an error
const tmp: State = { ...state, feildB: action.payload };
| 2024-01-10T01:26:59.872264 | https://example.com/article/9598 |
Story highlights John Podesta was Hillary Clinton's 2016 presidential campaign chairman
House investigators sent out invites last week to six witnesses
(CNN) Hillary Clinton's 2016 presidential campaign chairman, John Podesta, traveled to Capitol Hill on Tuesday to meet with House investigators digging into Russia's efforts to alter the 2016 elections.
The Russian hack of Podesta's emails played a pivotal role in the election, as WikiLeaks released tens of thousands of his emails one day at a time during last year's presidential campaign.
Podesta told reporters after the meeting he was "happy to cooperate" with the committee's investigation.
Asked if President Barack Obama was aggressive enough in combating Russia's interference, as some have argued he wasn't, Podesta said the administration was "dealing with an unprecedented incidence of the weaponization of the fruits of Russian cyber activity, and I think they were trying to make the best judgments they could on behalf of the American people."
The emails revealed the inner workings of the Clinton campaign, including the micro-machinations and positioning as they decided how to fight the House Benghazi probe, primary challenger Bernie Sanders and a host of other issues.
Read More | 2023-08-06T01:26:59.872264 | https://example.com/article/8442 |
---
abstract: 'A six-quark state with the benzene-like color structure based on a color string model is proposed and studied. Calculation with quadratic confinement with multi-string junctions shows that such a state has a ground state energy similar to that of other hidden color six-quark states proposed so far. Its possible effect on $NN$ scattering is discussed.'
author:
- 'Jialun Ping$^{a,b}$, Chengrong Deng$^a$, Fan Wang$^c$, T. Goldman$^d$'
title: 'Quantum chromodynamic quark benzene [^1]'
---
In the QED world, there are almost countless structures of matter. Among organic molecules, there are very interesting varieties such as methane, benzene, fullerene, etc. In the QCD world, up to now, only very limited structures of matter have been discovered: quark-antiquark mesons, three-quark baryons, nuclei and neutron stars. However, the QCD interaction is richer and more varied than QED so one would expect there to be even more varieties of QCD matter. In pentaquark studies, various color structures have been proposed: color singlet hadron molecules \[K($q\bar{q}$)N($q^3$)\], color anti-triplet diquarks \[$(qq)(qq)\bar{q}$\], quark methane \[$q^4\bar{q}$\], etc. Although the high statistics experimental data of JLab and COSY [@Jlab] did not reveal a pentaquark signal, the theoretical view point of multi-quark structures has been broadened in the course of pentaquark studies.
Lattice QCD calculation does not rule out the existence of glueballs, quark-gluon hybrids, multi-quark states, etc. An interesting question is whether there is a peculiar property of low energy non-perturbative QCD that is responsible for hiding or even excluding these otherwise possible structures of matter. Lattice QCD calculations for mesons, baryons, tetraquarks and pentaquarks reveal a flux-tube or string like structure [@lattice; @latt1]. The naive flux-tube or string model [@isg; @ww], after adjusting the model parameters, gives qualitatively similar estimates of ground state energies of hadrons compared to other quark models. We therefore use this model to study the possible structures of multi-quark systems. Other models, such as the bag model [@bag], quark compound model [@simonov], potential model [@potential], Skyrmion model [@kop], chiral soliton model [@dia] and others [@others] have all been used in the study of multi-quark systems. In general they give similar results and mutually support the existence of multi-quark systems.
In this letter, we propose and study a new color string structure, a benzene-like structure, for the six-quark system. We estimate the ground state energy of this system, which we call QCD benzene, using a non-relativistic color string model [@ww] with harmonic confinement.
Strings are actually dynamical variables to which kinetic and potential energies can be attributed [@isg]. The potential energy is proportional to the total length of strings. String tensions can be estimated from the bag model or deduced from lattice QCD calculations. They can also be determined empirically by fitting hadron masses. We take the last, [*i.e.*]{} a purely phenomenological approach. Since we are only interested in qualitative properties of QCD benzene, we assume a quadratic confinement potential for the color string rather than linear as this simplifies the calculation significantly.
A comparative study showed the inaccuracy of this choice is quite small [@ww]. There are two reasons to expect this: One is that the spatial variations in separation of the quarks (lengths of the string) do not differ significantly, so the difference between the two functional forms is small and can be absorbed in the adjustable parameter, the stiffness. The second is that we are using a non-relativistic description of the dynamics and, as was shown long ago [@shimon], an interaction energy that varies linearly with separation between fermions in a relativistic, first order differential dynamics has a wide region in which a harmonic approximation is valid for the second order (Feynman-Gell-Mann) reduction of the equations of motion. A numerical check (see Table 1 below) confirmed this expectation.
For the six-quark system, there are four possible string structures as shown in Fig.1. The first three were discussed in many papers in the past but we have not found any previous discussion for the last one. In these figures, $\mathbf{r}_i$ represents the position coordinate of the quark $q_i$ which is denoted by a black dot, $\mathbf{y}_i$ represents a junction where three flux tubes meet. A thin line connecting a quark and a junction represents a fundamental, [*i.e.*]{} color triplet, representation and a thick line connecting two junctions is for a color sextet, octet or others, namely a compound string. The different types of string may have differing stiffness [@mit; @bali]. An inverted line represents a conjugate $SU(3)$ color representation. Both the overall color singlet nature of a quark system and the $SU(3)$ color coupling rule at each junction must be satisfied. Then various types of color coupling are allowed in QCD, including that shown in figure 1d of a benzene-like form.
=1.8in
a\. Two color-singlet baryons state
=2.3in
b\. Two color-octet baryons state
=2.0in
c\. Three di-quarks state
=2.2in
d\. Benzene-like state
Fig. 1. Four possible string structures of six-quark states.
In the string model with quadratic confinement, the potential energy of the benzene-like string configuration for a six-quark state has the following form, $$U=\frac{1}{2}k\left( \sum_{i=1}^6(\mathbf{r}_{i}-\mathbf{y}_{i})^2
+ \kappa {\sum_{i<j}}^{\prime} (\mathbf{y}_i-\mathbf{y}_j)^2 \right),$$ where the $\sum^{\prime}$ means the summation is over the adjacent pairs. The string stiffness constant of an elementary or color triplet string is $k$, while $k\kappa$ is the compound string stiffness. In fig.1d, each quark is connected by a different compound string and each string with a different dimension of the color SU(3) group representation will have a different stiffness [@mit; @bali]. However, due to quarks being fermions, the Hamiltonian for a multi-quark system must be properly antisymmetrized under quark exchange. In QED benzene, each carbon is connected to the neighboring carbons with a single and a double bond, but it has been proven that QED benzene has $D_{6h}$ symmetry. Therefore, it is natural to use a common stiffness, $k\kappa$, for the compound string for each color configuration, after taking into account the symmetry requirement.
For given quark positions $\mathbf{r}_i,~i=1,\cdots,6$, in the center-of-mass (CM) system, we can fix the position coordinates of those junctions $\mathbf{y}_i,~i=1,\cdots,6$ by minimizing the energy of the system. The result is, $$\mathbf{y}_1=\frac{(\kappa+4\kappa^2)(\mathbf{r}_2+\mathbf{r}_6)\\
+\kappa^2(\mathbf{r}_3+\mathbf{r}_5)+(1+3\kappa)^2
\mathbf{r}_1}{(1+\kappa)(1+3\kappa)(1+4\kappa)},$$ and other configurations have a similar form. Thus we can define a set of canonical coordinates, $$\begin{aligned}
\mathbf{R}_{1} & = & \frac{1}{2}(\mathbf{r}_6
+\mathbf{r}_3-\mathbf{r}_1-\mathbf{r}_4), \nonumber \\
\mathbf{R}_{2} & = & \frac{1}{2}(\mathbf{r}_6-\mathbf{r}_3
+\mathbf{r}_1-\mathbf{r}_4), \nonumber \\
\mathbf{R}_{3} & = & \sqrt{\frac{1}{12}}(2\mathbf{r}_2
-\mathbf{r}_6-\mathbf{r}_1+2\mathbf{r}_5-\mathbf{r}_3-\mathbf{r}_4),
\\
\mathbf{R}_{4} & = & \sqrt{\frac{1}{12}}(2\mathbf{r}_2-\mathbf{r}_6
+\mathbf{r}_1-2\mathbf{r}_5+\mathbf{r}_3-\mathbf{r}_4), \nonumber
\\
\mathbf{R}_{5}
& = & \sqrt{\frac{1}{6}}(\mathbf{r}_2+\mathbf{r}_4+\mathbf{r}_6
-\mathbf{r}_1-\mathbf{r}_3-\mathbf{r}_5), \nonumber \\
\mathbf{R}_{6} & = & \sqrt{\frac{1}{6}}(\mathbf{r}_1+\mathbf{r}_2
+\mathbf{r}_3+\mathbf{r}_4+\mathbf{r}_5+\mathbf{r}_6). \nonumber\end{aligned}$$ Finally, the potential energy $U$ can be written as, $$\begin{aligned}
U & = & \frac{k}{2}\left(\frac{3\kappa}{1+3\kappa}\mathbf{R}_{1}^2
+\frac{\kappa}{1+\kappa}\mathbf{R}_{2}^2
+\frac{3\kappa}{1+3\kappa}\mathbf{R}_{3}^2 \right. \nonumber \\
&\ \ & \left. +\frac{\kappa}{1+\kappa}\mathbf{R}_{4}^2
+\frac{4\kappa}{1+4\kappa}\mathbf{R}_{5}^2\right)\end{aligned}$$ Using this string potential in a non-relativistic Hamiltonian with effective quark mass $m$ [@ww], we find the ground-state energy of QCD benzene to be $$M_6=6m+\frac{3}{2}\omega\left(2\sqrt{\frac{\kappa}{1+\kappa}}
+2\sqrt{\frac{3\kappa}{1+3\kappa}}+\sqrt{\frac{4\kappa}{1+4\kappa}}
\right),$$ where $\omega$ is equal to $\sqrt{k/m}$.
Furthermore, by calculating the distance between two adjacent quarks and the distances between quarks and the CM, the spatial structure of QCD benzene can be obtained. The distances between any two adjacent quarks can be shown to be equal and so are the distances between any quark and the CM. These are $$\begin{aligned}
\langle (\mathbf{r}_i-\mathbf{r}_j)^2
\rangle&=&\frac{1}{2m\omega\sqrt{\kappa(1+4\kappa)}}\left(\sqrt{(1+\kappa)
(1+4\kappa)}\right.\nonumber \\
&\ \ & \left. +1+4\kappa+\sqrt{3(1+3\kappa)(1+4\kappa)} \right),\end{aligned}$$ where $j = i+1$ (mod 6), and $$\begin{aligned}
\langle {\mathbf{r}_i}^2
\rangle&=&\frac{1}{24m\omega\sqrt{\kappa(1+4\kappa)}}\left(12\sqrt{(1+\kappa)
(1+4\kappa)}\right.\nonumber \\
&\ \ & \left. +3+12\kappa+4\sqrt{3(1+3\kappa)(1+4\kappa)} \right).\end{aligned}$$ Clearly these two distances generally are not equal, so the QCD benzene cannot be planar. However, we can show that the two equilateral triangles, namely $\bigtriangleup_{135}$ and $\bigtriangleup_{246}$, lie on two parallel planes. The length of the side of the equilateral triangle is $$\langle \mathbf{L}^2
\rangle=\frac{3}{2m\omega}\left(\sqrt{\frac{1+3\kappa}{3\kappa}}
+\sqrt{\frac{1+\kappa}{\kappa}}\right)$$ and the distance between the two parallel planes is $$\langle (\mathbf{R}_{135}-\mathbf{R}_{246})^2
\rangle=\frac{1}{2m\omega}\sqrt{\frac{1+4\kappa}{\kappa}}$$ $\mathbf{R}_{135}$ and $\mathbf{R}_{246}$ represent the centers-of-mass of $q_1q_3q_5$ and $q_2q_4q_6$, respectively. The spatial structure of QCD benzene is shown in Fig.2. Projecting the $\Delta_{135}$ plane onto the $\Delta_{246}$ plane, we obtain a planar benzene.
=1.9in
Fig. 2. The spatial structure of the benzene-like state.
To check this result, the same model has been applied to the tetraquark and pentaquark systems. Three-dimensional configurations are also favored as shown in Figs.3 and 4, where a solid-dot and a hollow-dot represent a quark and antiquark, respectively, while $\mathbf{R}_{12}=\frac{\mathbf{r_1}+\mathbf{r_2}}{2}$ and $\mathbf{R}_{34}=\frac{\mathbf{r_3}+\mathbf{r_4}}{2}$ represent the midpoints of $\mathbf{r}_{1}$, $\mathbf{r}_{2}$ and $\mathbf{r}_{3}$, $\mathbf{r}_{4}$, respectively. Please note Figs.3 and 4 only express the coordinates of the quarks; the string configurations are not shown.
=1.9in
Fig.3. The spatial structure of the tetraquark state.
In Figs.3 and 4, $\mathbf{r}_{12}=\mathbf{r}_1-\mathbf{r}_2$ is perpendicular to $\mathbf{r}_{34}=\mathbf{r}_3-\mathbf{r}_4$, and $\mathbf{r}_{12,34}=\mathbf{R}_{12}-\mathbf{R_{34}}$ is perpendicular to $\mathbf{r}_{12}$ and $\mathbf{r}_{34}$. The lengths of $\mathbf{r}_{12}$ and $\mathbf{r}_{34}$ can be shown to be equal, $$\begin{aligned}
\langle (\mathbf{r}_{12})^2 \rangle=\langle (\mathbf{r}_{34})^2
\rangle=\frac{1}{m\omega}\end{aligned}$$ For the tetraquark and pentaquark states, the distances between $\mathbf{R}_{12}$ and $\mathbf{R}_{34}$ are respectively:
=1.9in
Fig.4. The spatial structure of the pentaquark state.
$$\begin{aligned}
\langle (\mathbf{R}_{12}-\mathbf{R}_{34})^2
\rangle=\frac{1}{m\omega}\sqrt{\frac{1+\kappa}{\kappa}}\end{aligned}$$
$$\begin{aligned}
\langle (\mathbf{R}_{12}-\mathbf{R}_{34})^2
\rangle=\frac{1}{m\omega}\sqrt{\frac{2+\kappa}{\kappa}}\end{aligned}$$
In the pentaquark state, the distance between the antiquark and the CM of the 4-quark subset is $$\begin{aligned}
\langle (\mathbf{r}_{5,1234})^2
\rangle=\frac{1}{m\omega}\sqrt{\frac{2+5\kappa}{5\kappa}}\end{aligned}$$ Consequently, multiquark states in our quark model must form three-dimensional configurations which is due to the dynamics of the systems: The string shrinks the distance between any two connected quarks to as short a distance as possible to minimize the potential energy, while the kinetic motion expands the distance between any two quarks to as long a distance as possible to minimize the kinetic energy: The stereo structures meet this requirement better than a planar one does.
For pentaquark systems, lattice QCD obtains almost degenerate energies for both planar and 3-dimensional configurations. However, the entropy of a 5$q$ system is found to be larger in a three-dimensional configuration [@latt1]. For tetraquark systems, a three-dimensional tetrahedral structure is rather stable against the transition into two mesons [@latt2].
The non-zero value of $(\mathbf{r}_{5,1234})^2$ is due to the fact that the anti-quark oscillates around the CM of the four quarks and the value of $(\mathbf{r}_{5,1234})^2$ is calculated with a harmonic oscillator wave function.
For comparison, we also present results for two other color structures of the six quark system [@ww], $$\begin{aligned}
M_{33}&=&6m+\frac{3}{2}\omega\left(2+\sqrt{\frac{3\kappa}{2+3\kappa}}
+\sqrt{\frac{\kappa(2\kappa+0.6277)}{2\kappa^2+7\kappa+2}} \right.
\nonumber \\
&\ \ & \left.
+\sqrt{\frac{2\kappa(\kappa+3.186)}{2\kappa^2+7\kappa+2}} \right)\end{aligned}$$ $$M_{222}=6m+\frac{3}{2}\omega\left(3+2\sqrt{\frac{\kappa}{2+\kappa}}\right)$$ Here, $M_{33}$ and $M_{222}$ are ground-state energies of the two color-octet, hidden color state (Fig.1b) and the three di-quark state (Fig.1c) respectively.
In our calculation, there are three free parameters: The non-strange quark mass $m$ and the harmonic oscillator stiffnesses, $k$ and $\kappa k$. The first two can be fixed from the masses of the non-strange hadrons. We take $\overline{M}_{3}$ as the average mass of $N+\Delta$ and take $\overline{M}_{2}$ as the average mass of light, non-strange mesons $$\begin{aligned}
\overline{M}_{3} & = & \frac{1}{2}(N+\Delta) = 3m+3\omega, \\
\overline{M}_{2} & = & \frac{1}{4}\left(\frac{3}{4}\pi+
\frac{1}{4}\eta\right)+ \frac{3}{4}\left(\frac{3}{4}\rho+\frac{1}{4}\omega
\right) \nonumber \\
& = & 2m+\frac{3}{2}\omega.\end{aligned}$$ From this, we obtain the effective quark mass $$m = 2\overline{M}_{2}-\overline{M}_{3} = 0.19 GeV.$$ The constant $k$ of an elementary string can be eliminated in favor of the experimental baryon mass $\overline{M}_{3}$. The inter-junction string parameter $\kappa$ depends on the color dimension, $d$, of the string. In the MIT bag model [@mit], for example, one finds effectively $$\kappa_{d}=\sqrt{\frac{C_d}{C_3}},$$ where $C_d$ is the eigenvalue of the Casimir operator associated with the $SU(3)$ color representation $d$ on either end of the string. However lattice QCD calculations find that the stiffness, $\kappa_d$, of higher dimensional color charge is scaled by $C_d$ instead of $\sqrt{C_d}$ [@bali]. The compound strings of six-quark systems have five possible color structures: $\textbf{3}$, $\textbf{3*}$, $\textbf{6}$, $\textbf{6*}$ and $\textbf{8}$, so each geometric configuration may have different states when the color dimension dependence of the string stiffness is included. This means that the minimum string energy also varies in general from one state to another. We shall not include all these (small) variations, but use instead an average compound string constant $\kappa k$.
Numerical results for these three hidden color structures are shown in the Table 1. To check the approximation introduced by quadratic confinement the linear confinement results with the same multi-quark wave functions obtained from quadratic confinement model are listed in Table 1 as a comparison.
Table 1. The masses of the six-quark systems (GeV)
confinement $\kappa$ Three-di-quark Color-octet Benzene-like
------------- ---------- ---------------- ------------- --------------
quadratic 1.0 2.22 2.21 2.19
1.5 2.26 2.26 2.25
linear 1.0 2.31 2.31 2.38
1.5 2.31 2.31 2.37
From the Table, it can be seen that while the different color structures have similar masses (around 2.2 to 2.4 GeV), the benzene-like structure has the lowest mass whereas the three di-quark structure has the highest mass for quadratic confinement. On the other hand for linear confinement, the benzene-like structure has the highest mass, whereas the other two have smaller masses. After taking into account the model uncertainties, we can only conclude that the three hidden color states have similar masses. With an increase of $\kappa$, the differences between the masses decreases. In the limit $\kappa\rightarrow\infty$, they have the same mass due to having the same flux-tube structure in which the compound flux-tube shrinks to zero, leaving a hub and spokes configuration with one junction.
The color magnetic interaction (CMI), which is important for hadron spectroscopy, has not yet been included in our model calculation. The main reason for this is that we have not found a method to calculate the matrix element of CMI for benzene-like structure. In our previous pentaquark calculation, we found that the tetrahedron has a lower mass than the Jaffe-Wilczek di-quark structure even after taking into account of CMI [@ping]. To give a estimate of the effect of CMI, we calculated CMI for hidden color states consisted of two color-octet baryons. the results are in the range of 20-120 MeV for two color-octet nucleons or $\Delta$’s systems. We expect the benzene-like structure should have energy around 2.21-2.50 GeV, at 0.33-0.62 GeV above the two-nucleon mass.
The true six quark state will, of course, involve a mixture of these differing string structures. In general, channel coupling will reduce the ground state energy of the system. Therefore, for channel coupling calculations in QCD models, these color channels should be included. Unfortunately, at present we do not have any reliable information about the transition interaction between different color structures, especially from a color singlet hadron state to genuine hidden color multi-quark states. The transition interaction is very much needed for the study of multi-quark states.
In nucleon-nucleon ($NN$) scattering, QCD benzene should be one of the possible intermediate states as well as the other color structures shown in Fig.1. In order to simplify our argument, we neglect the 6 and 6\* strings temporarily. Then, if we cut the two color 8 strings, the QCD benzene will shrink into two color singlet baryons (which we take to be two nucleons for convenience in this discussion). Except for exchanges in quark labels, these two nucleons are the initial ones, as shown in Fig.1a, in the $NN$ scattering process. It should be possible for two nucleons to transform into QCD benzene and other genuine hidden color six quark states due to flux tube fluctuations when they are close enough to be within the range of confinement ($\sim 1 fm$). For example, the creation of two gluons can simultaneously excite the two color singlet nucleons into two color octet baryons which are coupled together to be overall color singlet – this is nothing else but a QCD benzene. If the scattering energy is near that of these hidden color states (2.2 to 2.5 GeV), then the intermediate six quark state should be dominantly in a hidden color state because the number of hidden color states is much larger than color singlet one so the entropy of hidden color state is much higher than the color singlet one and it cannot decay into two colorful nucleons directly due to color confinement. It must transform back into two color singlet nucleons before decaying. Such a process is similar to compound nucleus formation and therefore should induce a resonance around the energies of these hidden color states in $NN$ scattering. We call this state a “color confined, multi-quark resonance" and it is different from all of the microscopic resonances discussed by S. Weinberg [@weinberg]. Our present understanding of QCD does not obviate such a back and forth transition between color singlet hadron and genuine hidden color multi-quark states. An open question remains as to whether or not experiments have observed such a color confined, multi-quark resonance. In fact there is a structure in the $pp$ scattering cross section around 2.2 to 2.4 GeV which has been explained in terms of $\Delta$ production [@mach]. However in Our quark model calculations, we found that there are several $N-\Delta$, $\Delta-\Delta$ broad resonances in this energy range, in addition to the benzene-like structure. Can it also be described by broad overlapping resonances due to these structures? This possibility seems not to have been ruled out and it is under study in our group.
The possible existence of benzene-like structure is based on the description of quarks interaction via flux tubes. Although the lattice QCD calculation gave some supports to the idea, its validity is not beyond doubt. Other studies are needed to check if the QCD benzene structure obtained from color flux tube model is really a QCD result.
This work is supported by the National Science Foundation of China under grants 10375030 and 90503011 and by the U.S. Department of Energy under contract W-7405-ENG-36.
CLAS collaboration, Phys. Rev. Lett. **96**, 032001 (2006); **96**, 042001 (2006); Phys. Rev. **D 74** 032001 (2006); hep-ex/0605001.\
COSY-TOF collaboration, hep-ex/0612048. C. Alexandrou, P. De Forcrand, and A. Tsapalis, Phys. Rev. **D 65**, 054503 (2002);\
T. T. Takahashi, H. Suganuma, Y. Nemoto, and H. Matsufuru, Phys. Rev. **D 65**, 114509 (2002). F. Okiharu, H. Suganuma, T. T. Takahashi, Phys. Rev. Lett. **94**, 192001 (2005). N. Isgur and J. Paton, Phys. Rev. **D 31**, 2910(1985);\
E. S. Swanson, hep-ph/0311328. Fan Wang and C.W. Wong, Nuovo Cimento, **86 A**, 283 (1985). J. J. de Swart, P. J. Mulders and L. J. Somers, in Baryon 1980, N. Isgur (ed.), Toronto univ. 1980;\
P. LaFrance and E. L. Lomon, Phys. Rev. **D 34**, 1341 (1986);\
W.R. Greenberg and E. L. Lomon, Phys. Rev. **D 47**, 2703 (1997). Yu. A. Simonov, Nucl. Phys. **A 463**, 231c (1987). A. Valcarce et al., Rep. Prog. Phys. **68**, 965 (2005) and references there in. V. B. Kopeliovich, Nucl. Phys. **A 639**, 75c (1998). D. Diakonov, V. Petrov and M. Polyakov, Z. Phys. **A 359**, 305 (1997);\
D. Diakonov, hep-ph/0406043. M.W. Paris and V.R. Pandharipande, Phys. Rev. [**C62**]{}, 015201 (2000). T. Goldman and S. Yankielowicz, Physical Review **D 12**, 2910 (1975). K. Johnson and C.B. Thorn, Phys. Rev. [**D13**]{}, 1934 (1976); C. Semay, Eur. Phys. J. [**A22**]{}, 353 (2004). G.S. Bali, Phys. Rev. [**D62**]{}, 114503 (2000). F. Okiharu, H. Suganuma, T. T. Takahashi, Phys. Rev. **D 72**, 014505 (2005). J. L. Ping, D. Qing, F. Wang and T. Goldman, Phys. Lett. **B 602**, 197 (2004).\
T. Goldman, F. Wang, J. L. Ping and D. Qing, AIP Conf. Proc. **814**, 325 (2006).\
F. Wang and J.L. Ping, Proceedings of the 3rd Asia-Pacific Conference on Few Body Problems in Physics, 156 (2007), (world Scientific, Singapore). S. Weinberg, [*The Quantum Theory of Fields*]{}, (Combridge University Press, 1995), V.I, p.159. K.O. Eyser, R. Machleidt, W. Scobel and the EDDA collaboration, Eur. Phys. J. **A 222**, 105 (2004); nucl-th/0311002.
[^1]: Email address: jlping@njnu.edu.cn (J. Ping)
| 2023-12-25T01:26:59.872264 | https://example.com/article/8865 |
EXPERIENCING SYNDEMIC: DISENTANGLING THE BIOSOCIAL COMPLEXITY OF TUBERCULOSIS THROUGH QUALITATIVE RESEARCH.
Tuberculosis (TB) remains a major global public health problem that has become a crisis fuelled by HIV and the increasing occurrence of antimicrobial resistance. What has been termed the biosocial nature of TB challenges effective control of the disease. Yet, biosocial interactions involved in the persistence of TB in diverse settings are difficult to systematically account for. The recently developed framework of syndemics provides a way to capture how complex health problems result from the interactions between diseases such as HIV and TB, and harmful social conditions such as unemployment, malnutrition and substance abuse. This article advances the syndemics scholarship by examining health conditions that cluster together with TB in the Russian Federation, by eliciting a set of social processes that precipitate this clustering and exacerbate health outcomes, and by analysing interactions between these health conditions and social processes. To provide an account of this complexity, the article takes a qualitative approach and draws on the perspectives and experiences of people with TB. The results demonstrate emergence of a syndemic of stress, substance abuse, TB and HIV that is sustained by poverty, occupational insecurity, marginalization and isolation. Frictions between the narrow focus of the health care system on TB and the wider syndemic processes in which the lives of many persons with TB are embedded, contribute to poorer health outcomes and increase the risks of developing drug resistance. Finally, the article argues that the large-scale and impersonal forces become embodied as individual pathology through the crucial interface of the ways in which persons experience and make sense of these forces and pathologies. Qualitative research is needed for the adequate analysis of this biosocial complexity in order to provide a solid basis for responses to TB-centred syndemics in various settings. | 2023-08-09T01:26:59.872264 | https://example.com/article/2970 |
As a teacher in Los Angeles, I spend my days working with students who have benefited from Deferred Action for Childhood Arrivals — the landmark policy, also known as DACA, that grants immigrants who entered our nation as minors deferred action from deportation and eligibility for a work permit.
ADVERTISEMENT
Over the past year and a half, I have watched as President-elect Donald Trump Donald John TrumpBarr criticizes DOJ in speech declaring all agency power 'is invested in the attorney general' Military leaders asked about using heat ray on protesters outside White House: report Powell warns failure to reach COVID-19 deal could 'scar and damage' economy MORE has repeatedly pledged to immediately rescind this policy upon taking office. I have listened as he has rationalized his decision, characterizing young immigrants as “criminals” who make our country less “safe” and should be “deported.”
I have taught many DACA students over the years and know this characterization is false.
Take a junior in my class this year, I’ll call her Elizabeth. She has lived in the United States for nearly 10 years and hardly remembers life in El Salvador, the country in which she was born. For years, her mother worked tirelessly and saved to not only ensure that Elizabeth and her older sister could come to America and live a better life, but also to able to afford the application fees necessary to enroll them both in DACA.
Elizabeth is aware of her mother’s sacrifices and is determined to make sure that her mother’s hard work is not in vain. She applies herself in class and cleans houses with her mother part-time to help support her family.
Since the tender age of 11, she has dreamed of nothing else but of going to college and becoming an engineer — and DACA would allow her to do exactly that, so that she could one day become an active and contributing member of our society.
But now, with DACA under threat as Trump assumes office next week, Elizabeth dreams are turning into a nightmare. She has suffered from panic attacks since the election, anxious that her opportunities, the plans she has made for herself and worked so hard to carry out, may all being taken away.
“Going back to a country with many problems including gangs and drugs scares me,” Elizabeth recently wrote of potentially having to return to El Salvador. “My family over there lives in fear of being assaulted.”
As an educator, I cannot stand idle while students like Elizabeth live with such fear and hopelessness — it goes against the core of what it means to be a teacher. It is our responsibility to protect our most vulnerable students and open doors of opportunity to them.
That’s why, right here in Los Angeles, we will not stay silent as our students’ futures are placed in jeopardy.
The Los Angeles Unified School District has pledged to take a stand on behalf of its immigrant families, declaring every public school in the city as a “safe zone” for undocumented students.
Earlier this year, the district directed schools to prohibit U.S. Immigration and Customs Enforcement (ICE) officials looking to deport students from entering schools without a thorough review process.
And just last month, the district promised that, should President-elect Donald Trump attempt to turn its storage of student information against their families, it will resist that attempt “to the fullest extent provided by the law.” It’s an action that I urge school districts across our country to join us in taking.
While our district offers legal support, at Franklin High School — where I teach — we are also committed to doing what we can to empower our students with information. In collaboration with the American Civil Liberties Union, my school will host a forum to explain to our immigrant students and their parents their legal rights and what to do in the event that they are detained by ICE.
Through education, we hope to ease the minds of the many students who live in fear of being detained and deported because they or a member of their family is undocumented.
President-elect Trump, this is what DACA really is: a light that has guided Elizabeth and countless other gifted, hard-working young people out of the shadows. It is the core of the American dream, that each generation should be able to build a better life for the next generation.
It opens the doors to opportunity for the millions of immigrant children who proudly claim the United States as their home — and, in many cases, the only home that they have ever known.
Until this new administration can see the value in continuing this vital program, I hope that my fellow teachers — in Los Angeles and in cities nationwide — will join me in vowing to stand up for our students, for DACA, and for what we know is right.
Miguel Covarrubias teaches Social Studies at Franklin High School and is a member of Educators for Excellence-Los Angeles. He has developed curriculum for the Stanford Education Group, LAUSD and the ACLU, and he was the recipient of the United Way Inspirational Teacher Award in 2014. | 2024-04-08T01:26:59.872264 | https://example.com/article/2966 |
About This Project
We've identified that ketone bodies, i.e. fuels in the bloodstream that result from a very low carbohydrate diet, metabolically inhibit growth of 7 cancer cell lines in cell culture, but not 3 normal cell types. Future cancer treatments using diet could become more effective and less toxic. We recently posted this project on Experiment requesting funds for supplies. We need salary for our superb technologist, as the NIH has not funded us, as they are committed to drug therapies. | 2024-05-31T01:26:59.872264 | https://example.com/article/5920 |
1. Field of the Invention
The present invention relates to a circuit with less power consumption, and more particularly, to a Schmitt-trigger circuit that consumes less electrical power by reducing the amount of the required DC current.
2. Description of the Prior Art
In the present days, many kinds of electrical products are manufactured each day. Except high operation speed, these new products are usually designed to consume less power. This is a very important topic because the employed chips of the electrical products usually have higher package densities than before. Otherwise, the chips may be destroyed when they keep active for a time interval over than a threshold. Accordingly, it is thought to decrease the DC (Direct Current) current that is used to drive the chips for work.
Those chips, such as flip-flops and shift registers, start their operations when the voltage levels at the input terminals rise or fall. Sometimes, the waveform at the input terminal will be distorted, so that the rising or falling time must be also prolonged to prevent operation from error. Typically, the variation at the voltage level of the input signal will change the logic states of the sequent transistors. However, the voltage potential at the input terminal may remain near Vcc/2 whatever the input signal rise or fall. Therefore, the chip will generate unstable outputs even there is only little variation at the voltage level of the input signal. A requirement is thus arisen to design a circuit, such as Schmitt-trigger circuit that enlarges the signal margins for the input signal. Accordingly, the chips can work steadily even there are still fluctuations at the input signal.
Referring to FIG. 1, which represents a diagram illustrative of the Schmitt-trigger circuit used conventionally (please refer to U.S. Pat. No. 3,984,703). Obviously, the transistors 101, 102, 103, and 104 are connected in series, with their gates coupled together for receiving the input signal (V.sub.in). The drains of the transistors 102 and 103, the gates of the transistors 105 and 106 are also tied together to derive the output signal (V.sub.out) for pipeline operations. As noted, the transistors 102 and 103 are connected as a comparator, and these two transistors are coupled in series across a source potential V.sub.cc to ground. Transistors 101, 104, 105, and 106 are employed to be potential dividers, and each the above-mentioned potential divider is series connected across the source potential V.sub.cc to ground.
Although the Schmitt-trigger circuit of the FIG. 1 provides relatively high input impedance (about 10.sup.12 ohms), however, some disadvantages still offer from the conventional Schmitt-trigger circuit. For example, when V.sub.in changes (i.e., rises or falls) very slowly, all the transistors in the Schmitt-trigger circuit will be turned on simultaneously. In addition, because V.sub.in may be derived from a reference circuit, which indicates that the V.sub.in can not be always kept at the reference voltage levels (such as V.sub.cc or ground), all the transistors of the Schmitt-trigger circuit will be also simultaneously conducted. Therefore, there will be a DC current path from V.sub.cc, through transistors 101, 102, 103, 104, to ground, and the DC current will be thought to consume additional and undesired electrical power. On the other hand, the size-ratio of the PMOS and NMOS transistors will be unbalanced if an extreme trigger point, such as higher or lower trigger point is required. Usually, it indicates that larger sizes of the PMOS and NMOS transistors will be needed to adjust the extreme trigger points, and more areas are occupied by the additional sizes of the transistors. A need has been arisen to disclose a Schmitt-trigger circuit for reducing the power consumption, and furthermore, to overcome the disadvantages of the conventional skills. | 2024-01-11T01:26:59.872264 | https://example.com/article/9239 |
Share with Friends
Periodization for Athletes
Periodization Athlete Development for Athletics PowerPoint Presentations
Originally Published 25 October 2016.
1. Summary Presentation on Athlete Development for Athletes Dinas Zamboanga Del Sur from Pinoyathletics.info Periodization 2. Training by Age 3. Sprints Phases 4. Teaching Drills 2. Periodization is the systematic planning of athletic or physical training. The aim is to reach the best possible performance in the most important competition of the year. It involves gradual improvements during various parts of a training program for each period. Conditioning programs can use periodization to break up the training program into the following 3. Division of Periodization 4. Division of Periodization Offseason (General) preseason (specific) In season (competition) Postseason (recovery) Periodization divides the year-round condition program into phases of training that focus on different goals. 5. Training Organization Training should be organized and planned in advance of a competition or performance. It should consider the athlete’s potential, his/her performance in tests or competition, and the calendar of competition. It has to be simple, suggestive, and above all flexible as its content can be modified to meet the athlete’s rate of progress. 6. Training by Age – Long Term Development and Progression of Strength Training Source: Bompa T. and Buzzichelli C., Periodization Training for Sports – 3rd Edition, Human Kinetics, 2015 7. Speed Development – Phases 8. 5 phases and the “percent contribution” to the total race. 1. Reaction Time (1%) 2. Block Clearance (5%) 3. Speed of Efficient Acceleration (64%) 4. Maintenance of Maximum Velocity (18%) 5. Lessened Degree of Deceleration (12%) 9. Looking at this chart, it’s no wonder why sprint coaches elect to focus on speed and acceleration work. But this doesn’t show the whole picture as one component can severely affect the next component. For example, proper block clearance sets up for proper speed of efficient acceleration 10. Reaction Time Reaction time is measured by the time taken from the firing of the gun to the first muscular reaction performed by the sprinter. Bad reaction time will produce a very different 100-meter race pattern with the sprinter rushing through the next phases! 11. Block Clearance 2 things come to mind. 1) You need proper biomechanics in the starting position in order to generate the greatest power to overcome inertia. 2) The greater the force applied in driving from the starting blocks by the sprinter, the greater the initial velocity produced. The block clearance phase sets you up for the next phase. 12. Speed of Efficient Acceleration In the 40-yard dash, the athlete accelerates to maximum velocity in as short a time as possible. This also applies for the 100 meters. However, the longer it takes the sprinter to reach maximum velocity, the greater the potential for the sprinter to reach higher maximum velocities (which is the goal for the 100 meters, right?). Today we are seeing athletes such as Usain Bolt and Tyson Gay reaching top speeds well beyond the “traditional” 60 meters. The word “optimal” comes to mind, where an effective acceleration phase can produce the highest maximum velocity. 13. Maintenance of Maximum Velocity Optimizing is a popular word here. An optimal combination of stride rate, stride length, and ground contact time will produce the highest top end speed. This topic has been discussed at lengths on this Blog. As far as posture goes, the sprinter will be in a full upright position during this phase. 14. Lessened Degree of Deceleration The sprinters’ ground contact time increases with fatigue. We’ve seen that on the article Ground Contact Time, Stride Length and Fatigue in the 400m. Staying relaxed, and “staying tall” with a high vertical displacement are common terms. But a lot of coaches neglect the importance (and biomechanics) of the arms and hands. Arm action is just as important as the legs. 15. Example Workout Warmup Sequence Foam Roll (if available) Hamstrings Quads Adductors Abductors Glutes Lower back Upper back Jogging Jogging 50m run 50m walk For more advanced athletes 4×100 at 90% or 8×100 at 80% Sprinters 100, 200, 100 Hurdles, Throwers 1-2 laps 400, 800, 400H 2-3 laps 1500 and up 3-5 laps Wall Swings (10 on each side) Front and Back Side to side Rotation Hurdle Fire Drill with fence behind Drills 16. (3 of each in training, 2 of each in competition) Skipping Toe walk March A March B March C Skip A Skip B Skip C Straight Leg bound Karioke Butt Kick High Knees Bounds Height Bounds Distance Shuffle (each leg) Fast Feet Pawing Bottle Drills (5 – 10 times each), (spacing 2 shoes, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6) Mini Hurdles (if available) Wind Sprints 30-50m (2-3 progressive speed) Warm Down Sequence Stairs 5-10 times Extra Activity pushups, sit-ups, dips etc. Static and Partner assisted stretching (about 10-15 mins) Foam Rolling Jog a lap
Periodization Athlete Development for AthleticsDinas One Day Sports Science Seminar
Coaching Clinic in Dinas, Zamboanga Del Sur. Facilitators Zamboanga Sports Academy Coaches Ian Moncada, Bap Bap, Eliezer Salinas and Andrew Pirie.
“They ask me why I teach, and I reply, ‘Where could I find such splendid company?’ There sits a statesman, strong, unbiased, wise; another Daniel Webster, silver-tongued. A doctor sits beside him, whose quick, steady hand may mend a bone, or stem the life-blood’s flow. And there a builder; upward rise the arch of a church he builds, wherein that minister may speak the word of God, and lead a stumbling soul to touch the Christ. And all about, a gathering of teachers, farmers, merchants, laborers —those who work and vote and build and plan and pray into a great tomorrow. And I may say, I may not see the church, or hear the word, or eat the food their hands may grow, but yet again I may; And later I may say, I knew him once, and he was weak, or strong, or bold or proud or gay. I knew him once, but then he was a boy. They ask me why I teach and I reply, ‘Where could I find such splendid company?'” – by John Wooden
I nterview Tudor Bompa Development of Periodization
June 27, 2013
Tudor Bompa is known to many as the man who single-highhandedly revolutionized Western training methods. Name your favorite strength coach and very likely he’s been strongly influenced by the work of Tudor Bompa. Learn his secrets!
By: Mike Mahler
Feb 21, 2003
After more than forty years of work in the arena of international sports. Tudor Bompa is widely considered one of the world’s leading specialists when it comes to periodization, planning, peaking, and strength and powerlifting. Name your favorite strength coach and very likely he’s been strongly influenced by the work of Tudor Bompa.
Like many top coaches. Tudor Bompa began as an athlete himself and competed as a rower in the 1956 Olympic Games. As a coach (if one can even use that limiting term to describe him), Tudor Bompa has worked with athletes in eleven Olympic Games and World Championships and has helped create four gold medals and 22 national champions. He’s presented his training theories is over 30 countries.
In other words, this guy knows his stuff! Currently, Tudor Bompa is a full-time professor at York University in Toronto Ontario. Luckily, he took the time to sit down to an interview with Mike Mahler.
____________________________________________________
Testosterone: How did you first get interested in strength training?
Tudor Bompa: My athletic background is in track and field, and later on I got into rowing and cross country skiing. I was amongst the first athletes to incorporate a great deal of strength training into training for skiing. That was back in the early 1960s! My improvements were so visible that many other competitors were aghast. Because of my gains in upper and lower-body strength, I was able to use the skating technique for many parts of the race. Equally important was the use of my superior force in the arms.
T: How did you first begin coaching the things you learned as an athlete?
TB: The most critical innovations in the approach to strength training came in 1963. When I was asked to train a nationally ranked javelin thrower. Her coach had moved to another city and I was the only person who could train her. I have to mention that at that time. As is the case today in many sports, athletes were training year-round only for power, using some free weights but also a great deal of medicine ball training.
Before I started to train this athlete in early 1963, I’d logically concluded that power is a function of maximum strength [he highest force one can display in one attempt or 1RM], as well as speed and quickness of action. While speed has more genetic limitations than strength, I had decided to look for improved power by increasing maximum strength to the highest possible levels.
As I continued to train this thrower. I also continuously monitored and tested both speed and quickness and maximum strength. After a year and a half of training her. I found out that gains in power come 95% from gains in maximum strength, and only 5% of speed. That year represented the year when I created periodization of strength. Using this strength training strategy. My javelin thrower improved by 15 meters within a year and a half. She became the Olympic champion in 1964 and set a new world record as well.
T: You’ve written a great deal about periodization and its application in strength training. In your terms, what exactly is periodization?
TB: In the case of training, periodization has two elements. First, periodization of the annual plan, or how this type of plan is divided into specific phases of training. Therefore we have the preparatory, competitive, and transition phase. These phases are further subdivided into macrocycles and microcycles.
Second, of motor abilities — strength, speed, and endurance. In order to maximize the development of these abilities, another kind of “periodization” exists, with specific training phases and training objectives. In case of periodization of strength, the sequence of these phases are: Anatomical Adaptation (AA phase), Maximum Strength Phase, and conversion (transformation) of such gains into power.
Periodization represents a clear structure to follow and is thus the most effective way to improve athletic performance.
T: What are some of the most common mistakes that athletes make with regard to training?
TB: This question is really big! I’ll try to provide a brief answer. The first problem is the influence of bodybuilding on strength training for sports. Many people believe that strength is proportional to size.
T: Not true?
TB: Completely incorrect!. Hypertrophy is necessary only in very few sports, such as linebackers in football, shot putters in track and field, the super heavy-weight category in wrestling, or if an individual is far too slim. In such a case, the periodization of strength has to include three to six, or even nine weeks of training for hypertrophy. For any other athletes, bodybuilding methods are completely useless!
Sports do not require mass!. Sports require power, quickness, and fast application of force. Bodybuilding methods do not result in increasing power. On the contrary, bodybuilding methods make the athletes much slower. And this is a no-no in most of the sports that require quickness and acceleration in force application.
T: Okay, what’s another major mistake you see?
TB: The fallacy of Olympic weightlifting exercises! There are several strength coaches with Olympic lifting backgrounds. Unfortunately for them, they can’t adjust their knowledge to the needs of strength training for sports. Strength training programs for sports must recognize that almost every sport involves different and specific muscle groups. These muscles are called “prime movers” or the muscles performing the actual technical moves. Therefore, strength training exercises have to target prime movers. The Olympic lifting exercises are rigidly targeting only certain muscle groups, often not very important for many sports.
T: Give us an example of what you mean.
TB: Take judo for instance. Once I listened to a presentation regarding strength training for judo. The speaker was your typical Olympic lifting coach. He went over snatches and the clean and jerk! When the organizers asked my opinion, I simply said that the whole idea is wrong because judo involves primarily the flexor muscles of the hips, abdominals, and trunk, not the ex-tensors normally targeted by Olympic lifting moves. The lifting coach became very upset when he heard me say this and left the room!
The exact same thing happened with swimming. An Olympic lifting coach once again suggested (what else?) the clean and jerk and the snatch. I pointed out that he was really missing the actual prime movers used in swimming, the arms flexors. The coach’s exercises were targeting exactly the opposite group of muscles, the ex-tensors. How difficult is it to understand such a basic concept in sports training? Personally, I’d use power cleans only for few sports such as linebackers in football and Greco-roman wrestling. I’d use clean and jerks for basketball players, performed with a medicine ball or a power ball.
This leads to another problem. The Olympic lifting coaches are using their own periodization, specific to Olympic lifting. Well, how much common sense does one need to have in order to understand that the Olympic lifting coaches have to adapt their training methodology to the periodization of that particular sport and not the other way around?
T: Good point. Any other mistakes you see that drive you nuts?
TB: Many athletes and coaches use the same type of strength training, irrespective of the physiological requirements their respective sports require. Each sport has its specific physiological profile. The sports where the alactic energy system is dominant are basically sports where speed and power are necessary to achieve high results [jumping and throwing events in track and field, linebackers, baseball, sprinting, etc.]
For sports where the alactic-acid system has a high percentage of ergo-genesis, or breakdown in the percentage of the three energy systems, it’s required that power-endurance and muscle-endurance [30-50 reps per set] be trained. Finally, for endurance-dominant sports, one needs to develop muscle-endurance [tens and even hundreds of reps]. If this isn’t achieved, a good adaptation to such training won’t occur.
What we see here is a very important training principle — strength training has to play a physiological role; it has to tap the same energy system to add to the specific adaptation to the physiological requirements of a given sport. If one doesn’t follow the above principle, he or she is entirely missing the point in strength training. I can strongly state that in athletics there is no strength for strength’s sake, but rather just strength training with a specific purpose: maximum adaptation for performance improvement.
T: Are there any strength-training exercises that all athletes should be doing?
TB: Certainly, especially as they target the ankle, knee, and hip muscles. Most sports performed on the ground [all team sports, track, martial arts, etc.] use knee extensors and flexors, and gastrocnemius and soleus for the ankle actions. Therefore squats, leg curls, and toe raises are very popular with most sports.
Although many coaches do use squats and leg curls, toe raises aren’t utilized as much as the other two exercises. Somehow they miss the fact that ankles play a very important role in any type of sprinting, quick changes of direction, and any agility actions. In many cases, the and soleus are stronger than the quadriceps! This is why improvements in quickness and agility will come faster after these two muscles get stronger.
T: How about abs?
TB: Yes, this is equally true with regard to abdominal muscles. Abdominal curls with all variations and rotations are very necessary for all sports. A strong back is also crucial in many sports. Therefore, back extensions should be considered.
As for the arms and shoulders, there are more sports-specific variations than for the lower body. Look at the technical moves to figure out the prime movers in that sport. In sports training, it’s more important to think about training movements and not muscles since exercises that mimic a technical move are better for targeting the prime movers.
I also believe that training has to be simplified. Especially nowadays, when there are so many gimmicks being introduced on the market and some individuals come up with all kinds of “novelties”! If you were to listen to each individual promoting a novelty [i.e. Overspeed training, balance-training, etc.], you’ll never have the time to actually train the athlete to reach the optimal adaptation level. Remember that high levels of specific adaptation results in athletic improvements!
T: What are some of the techniques you’ve used to blast through training plateaus?
TB: An athlete doesn’t reach a plateau very quickly. It takes time — several years of training at a high level — before something like that can even be considered. In my career of many years, I’ve rarely seen athletes reaching a plateau in strength training. This situation is mostly discussed in bodybuilding and at times in football. Nevertheless, let’s try to discuss some possibilities for breaking through training plateaus. Here are five:
Use a maximum strength phase to stimulate a higher percentage of fast-twitch muscles into action. In many sports, strength training is poorly designed — lifting weights for strength’s sake. There’s no plan, no periodization. Athletes and bodybuilders that use periodization very rarely reach a plateau, in my experience. •Design a good periodization program with phases of maximum strength and phases of power training, where the objective is to increase the firing rate of fast-twitch muscles. In my strength training book, Periodization of Training for Sports, I discuss that in detail. If one has a longer preparatory (pre-season) phase, several phases of maximum strength and power could be alternated. This alternation of maximum strength with power would certainly have the probability of breaking the plateau. Under normal conditions, I wouldn’t suggest a maximum-strength phase for longer than six weeks. It’s quite stressful to cope with. However, if an athlete has reached a plateau, I’d use a nine-week long maximum strength phase. Under these conditions, the muscles are stimulated at much higher levels than before. Use more eccentric (negative) contraction techniques. Eccentric contractions require a much higher tension in the fast-twitch muscles. Eccentric training shouldn’t be used before the athletes have a better background. Unfortunately, many coaches can hardly wait to use everything they know; in this way, they themselves are contributing to reaching a plateau.
T: So training and performance plateaus are often the coach’s fault?
TB: Often a plateau is reached because of a coach’s ignorance. Poor selection of training methods and their logical sequence also contribute. Similarly, the lack of patience in applying the right method at the right time also contributes to a psychological plateau, meaning that the coach thinks “I have used everything I know!” What’s next then? Don’t rush to throw everything you know at your athlete!
Organize a longer-term sequence of training methods. Plan everything you do well. Be more methodical in what you use in training. Allow the necessary time for the athlete to grow, to get ready for the next method, load increment, or alternation of types of strength. Remember that you can help a great deal, but you may also do quite a bit of damage. The coach has to wisely use maximum stimulation, high recruitment of fast-twitch muscles, and alternate with power training, where the firing rate of the same muscles are trained.
T: What about altering tempo? For example, taking more time in the concentric and eccentric ranges?
TB: Altering tempo is mostly a bodybuilding concept, though some people promote it as a sort of strength-training novelty, good for everything and everybody. The scope of altering the tempo of a lift is to create the highest tension in a muscle for the longest period of time, using both concentric and eccentric contractions.
Here’s the main difference between bodybuilding and strength training for sports. For bodybuilding, the scope of increased tension is designed to induce hypertrophy. In strength training for sports, using heavy loads [> 85-90% of 1 RM] the scope is not to increase the duration of tension, but rather to apply the force against resistance as quickly and dynamically as possible so that the highest number of fast-twitch muscle fibers are recruited in the action.
Therefore, a major reason we use heavy loads in training athletes in different sports is to stimulate the recruitment of fast-twitch muscle fibers, and as a result, to use them during the performance of athletic action. The more fast-twitch muscle fibers are used during the performance of technical skills, the higher the application of force and the benefit for increased performance.
The use of eccentric contraction in strength training for sports isn’t as popular as the concentric contraction. However, in some sports like throwing events in track and field and linebackers in football, it’s used both to increase maximum strength and hypertrophy.
T: What role does nutrition play in recovery and do you provide nutrition and supplementation advice for athletes?
TB: The efficiency of an athlete’s performance depends on his or her quality of training and nutrition. The energy used by the body strictly depends on the nutrition, diet, and training supplements one uses. But nutrition has to also be periodized according to the periodization of strength and endurance training. One can’t just talk about nutrition in disregard of training.
For instance, the diet has to be different for an individual working to improve hypertrophy, doing maximum speed training, or working on long-distance aerobic endurance. All these examples refer to completely different types of training which require a very specific type of nutrition.
Unfortunately, most nutritionists haven’t grasped this very important concept yet. They’ve never heard about periodization of training and the specific needs of nutrition as per a training program planned for given days. They’re still talking about nutrition in general.
Two years ago, I specified such a concept to a small group of nutritionists. Most of them wanted more information about it. I suggested they look into my book, Periodization Training for Sports-3rd Edition , where integrated periodization is discussed.
T: Fair enough. I’ve read that in Bulgaria, Olympic athletes train five times a day, seven times a week and that Russian power-lifters bench press up to 21 times a week. What do you think of this training frequency and would these types of programs be beneficial to a natural trainer?
TB: I just wish that people wouldn’t compare apples to oranges. In order to discuss this, we have to better qualify what Bulgarians and Russian Olympic weightlifters were doing in the time of the communist system. Yes, the Bulgarian Olympic lifters were training from 9:00 AM to 5:00 or 6:00 PM, 45 minutes on and 30 minutes off, except for the lunch break of some two hours. The Russians weren’t power-lifters. They were Olympic lifters and what they were doing is something they’ve adapted to progressively over several years. Most of these athletes had a background of eight to ten years before they were doing that kind of training.
Also, remember that their training regimen was done in national training camps, where training, sleeping, and food ingestion were the only things they were doing. In addition, they weren’t working on anything else, just lifting the bloody barbells! I’m not as impressed — exaggerations and myths aside — as many seem to be, simply because I have a similar background, where my athletes were training two to four times per day with a total of five to eight hours of training!
Now let’s examine what pro-athletes are doing in the US. They train technically, tactically, speed, agility and strength/power several times per week, some up to three times per day. Is anybody suggesting that these athletes have to bench press 21 times per week? Team sports, however, aren’t the best examples of training. Many amateur athletes train much more than pro-players. Also, the quality of coaching in many team sports, especially with regard to strength and conditioning, is quite pathetic. Similarly, some of the professional coaches — in fact, the majority — have a very poor understanding of training theory.
What do I think about the programs you mentioned? Who cares? Would I like to duplicate in this continent what my athletes have done in training camps in Romania? Not at all! Different societies, different times and mentality! Yet several of the athletes trained or consulted by myself in this continent have won against the East Europeans several times with just half of the amount of training time!
One of the key elements in training is to have high training knowledge and excellent methodology in applying it. Being equipped with such knowledge can do miracles. Forget about the “locker room gossip” regarding Russians and Bulgarians.
T: What books do you recommend on strength training — besides yours, of course? Who are the best strength training coaches out there?
TB: This is a very difficult question to answer, the reason being that I don’t feel comfortable discussing the books written by other authors. However, I’ll try to be as frank as I can. To be honest, I’m really dissatisfied with the level of strength training books available on the market. It seems to me that there’s a great mess regarding this important area.
One of the greatest frustrations I have is that to some authors, there’s no clear distinction between the objectives of strength training for sports, bodybuilding, and Olympic weightlifting. Authors with a football background expect everyone to do what a linebacker is doing. The same thing is valid for those who have a bodybuilding background. They discuss split routines, super-sets, etc. This is totally inadequate for strength training for sports.
To me, a strength training book must serve the needs of a given audience. Use the best sports science information possible and most importantly, be practical. Just going through the process of reviewing the literature (as many do) isn’t serving anybody’s purpose.
T: Do you feel that some or most strength coaches have a tendency to make their programs too general at times and too complicated at other times?
TB: Yes, you’re perfectly right. Let me try to explain what happens. There are several situations that are necessary to examine. Hopefully, from this analysis, some strength and conditioning coaches may start reflecting on their own situation.
First, both the technical coach (head coach) and the strength and conditioning coach are attempting to do their best to improve their athlete’s performance. Each of these two coaches is trying to prove to themselves what they know and what they can do. Unfortunately, these two individuals don’t cooperate well together to create programs specific to the needs of their athletes.
The head coach, not knowing much about strength and conditioning, doesn’t take a leadership role regarding how much training to do, in which areas, what to stress in order to make the athletes better, etc. The result of this lack of cooperation is a high level of fatigue. When the athletes are reporting to the coach, each coach considers them rested, which is hardly the case. Fatigue is a cumulative outcome of training. If improperly monitored, fatigue will affect an athletes potential, their focusing potential, their accuracy of passing and shooting, and their performance.
Another problem is the “cocktail” strength and conditioning coach. Often, training programs are very general, a sort of “cocktail,” doing all sorts of things for every athlete in the group.
There isn’t specificity regarding the needs of the sport, position played, or to relate the program to the dominant energy system in that particular sport. Knowing the proportions of energy systems in that sport dictates the type of training one must do.
T: Give us an example of that, please.
TB: In sports where the anaerobic alactic system is clearly dominant — baseball, linebackers in football, jumping and throwing events in track and field — training should be focused on maximum strength, power, and maximum speed. In other words, they’re focused on training elements that are tapping this energy system.
What business does a linebacker have running three miles? During the game he performs like a bulldozer, demolishing the opposition, but only for a two to four-second duration. To have such an athlete run three miles is a blasphemy! I wouldn’t call this “general training,” but a high degree of ignorance!
T: A “cocktail” strength and conditioning coach, huh? Interesting term. Any other categories of coaches you notice?
TB: Yes, the “busy-bee” type of strength and conditioning coach who wants to do too much in a very short period of time. Let’s face it, a strength and conditioning coach has two to three hours per week to work with team sports athletes. Depending on the phase of the annual plan, a strength and conditioning coach has to do specific work according to the periodization of a given motor ability. The closer to the competitive phase, the more specific and simplified training should be.
And yet many coaches are doing everything under the sun: lifting weights, power training, using medicine balls, working to improve maximum speed, etc. The uninitiated “greenhorn” coach, the one with a shallow level of knowledge in sports science, will easily bite into the gimmicks of the day, such as over-speed, balance training, rotation training, and functional training.
In addition to the fact that some of these training ideas don’t work at all, attempting to use them in training creates a crisis! A time crisis! If one has two to three hours to work with the athletes, when do they have the time to use all these novelties? Simplify your training! To be effective, training must be simplified.
To create an efficient program, one has to be very selective in what he does in training. Never forget that your training must result in a very specific adaptation. When superior adaptation occurs, performance will be superior. If one is using too many training elements, it’s almost impossible to have a good adaptation. Just think about that! If you do, you’ll see that you don’t have time and room for totally unproven gimmicks.
This is my case for position-specific training programs. In team sports, almost each position requires different qualities and taps specific proportions of the three energy systems. Take for instance a mid-fielder in soccer vs. a sweeper, or a linebacker versus a wide receiver in football. These positions are so different from each other than a “cocktail” training program impedes the improvement of these athletes. Therefore a strength and conditioning training program has to be specific, to train the necessary qualities for that position.
T: That makes total sense. By the way, do you have any new projects in the works?
TB: The newest book that will be launched is the second edition of Serious Strength Training. I’ll have a new co-author, Dr. Mauro DiPasquale. This new edition will be published by Human Kinetics in August 2002.
Another project I hope to start very soon will refer to endurance sports. I do believe, together with that we’ll bring several training novelties for endurance sports. Then, in the fall, I’d like to start to update my strength training for the sportsbook, Periodization Training for Sports-3rd Edition , where the title has to be corrected to incorporate the term “strength.” My intent is to make this book the most popular training book [it already is real, since it sold more copies than any other books.] The book will have many additions regarding sports science and practical application.
I’ll also refer to several fallacies used in training, from balance training to others. In my opinion, sports scientists have to take a strong and critical stance regarding the newest gimmicks invading and polluting the market.
T: Thanks for taking the time to chat with us, Tudor.
TB: My pleasure.For more information on Tudor Bompa, go to TudorBompa.com.
PLEASE SHARE THIS ARTICLE AND POST COMMENTS
| 2024-05-22T01:26:59.872264 | https://example.com/article/3920 |
Q:
Multiple comparison operators
What is the standard way in C# to check if a number is within a range of numbers?
Typically, I would do some variation of this with int i:
return (i >= start && i <= end);
Is there no syntax for something like this:
// does not work
return (start <= i <= end);
A:
The most close to what you expect is
return start <= i && i <= end;
| 2023-08-03T01:26:59.872264 | https://example.com/article/5329 |
[Serum globulin levels and intensity of hepatic fibrosis in patients with mansonic schistosomiasis].
A correlation between the levels of serum globulins and the hepatic fibrosis degree in chronic hepatitis was described, but reports in schistosomiasis mansoni have not been found. To evaluate the serum globulins and IgG levels, and periportal fibrosis intensity measured by ultrasound in patients with schistosomiasis mansoni. Between November, 2006 and February 2007, 41 patients which were eligible, filled them a questionnaire and had their levels of serum IgG measured by immunoturbidimetry and globulins indirectly measured by the Biuret method. The ultrasound was carried out by a single researcher, according to the Cairo and Niamey protocols. The average age was 41 years old and 25 female patients (61%). Ten patients (24%) from 41 showed serum globulins levels raised and 21 (51%) presented elevated IgG levels. According to the Cairo classification, 21 patients showed grade I of fibrosis, 18 grade II and 2 grade III; and by the Niamey classification 8 showed standard C, 20 D, and 13 E. Those with grade II or III of fibrosis had higher IgG levels than the ones with grade I (P = 0.047), as well as those who showed standards D and E as compared to C (P = 0.011). There was no association between the globulins levels and the intensity of fibrosis. In patients with schistosomiasis mansoni, an increase of the IgG serum levels was observed according to the progression from periportal fibrosis intensity, but the same was not founded with globulins levels. | 2023-09-03T01:26:59.872264 | https://example.com/article/7983 |
Spacious four bedrooms four bathrooms townhouse for sale in Benahavis Village, all of the Bedrooms are en-suite.
On the main floor you will find a fully fitted kitchen, guest toilet, spacious living room leading to a great terrace with panoramic views of the surrounding mountains and the Angosturas gorge. In the basement you can find a bedroom, bathroom, laundry room and storage. The property also comes a spacious private garage.
El Casar development offers you the natural evolution of the Andalusian architectural style, inspired by Andalusian tradition such as white facades, terra cotta tiling and forged ironwork, with a totally contemporary focus. All houses have a fireplace, hot-cold A/C and underfloor heating in the master bedroom. El Casar de Benahavis is just 600 meters from the town center.
The community has meticulously maintained gardens, three outdoor pools and a fitness center with gym, indoor heated pool and sauna. | 2023-09-29T01:26:59.872264 | https://example.com/article/6132 |
/**
* Roundcube webmail styles for the Address Book section
*
* Copyright (c) 2012, The Roundcube Dev Team
* Screendesign by FLINT / Büro für Gestaltung, bueroflint.com
*
* The contents are subject to the Creative Commons Attribution-ShareAlike
* License. It is allowed to copy, distribute, transmit and to adapt the work
* by keeping credits to the original autors in the README file.
* See http://creativecommons.org/licenses/by-sa/3.0/ for details.
*/
#addressview-left {
position: absolute;
top: 0;
left: 0;
width: 220px;
bottom: 0;
z-index: 2;
}
#addressview-right {
position: absolute;
top: 0;
left: 232px;
right: 0;
bottom: 0;
z-index: 3;
}
#addressbooktoolbar {
position: absolute;
top: -6px;
left: 0;
height: 40px;
white-space: nowrap;
z-index: 10;
}
#directorylistbox {
position: absolute;
top: 42px;
left: 0;
width: 100%;
bottom: 0;
}
#addresslist {
position: absolute;
top: 42px;
left: 0;
width: 280px;
bottom: 0;
}
#contacts-box {
position: absolute;
top: 42px;
left: 292px;
right: 0;
bottom: 0;
}
#addressview-left #quicksearchbar input {
width: 156px;
}
#directorylist li a,
#contacts-table .contact td.name {
background-image: url(images/listicons.png?v=017c.29530);
background-position: -100px 0;
background-repeat: no-repeat;
overflow: hidden;
padding-left: 36px;
text-overflow: ellipsis;
}
#directorylist li.addressbook a {
background-position: 6px -766px;
}
#directorylist li.addressbook.selected > a {
background-position: 6px -791px;
}
#directorylist li.addressbook ul li:last-child {
border-bottom: 0;
}
#directorylist li.addressbook ul.groups {
margin: 0;
padding: 0;
}
#directorylist li.addressbook ul.groups li {
width: 100%;
}
#directorylist li.contactgroup a {
padding-left: 62px;
background-position: 32px -1555px;
}
#directorylist li.contactgroup.selected a {
background-position: 32px -1579px;
}
#directorylist li.contactgroup input {
margin-left: 36px;
}
#directorylist li.contactsearch a {
background-position: 6px -1651px;
}
#directorylist li.contactsearch.selected a {
background-position: 6px -1675px;
}
#directorylist li.contactsearch input {
margin-left: 8px;
}
#directorylist li.addressbook div.collapsed,
#directorylist li.addressbook div.expanded {
top: 15px;
left: 20px;
}
#contacts-table .contact.readonly td {
font-style: italic;
}
#contacts-table td.name {
width: 95%;
}
#contacts-table td.action {
width: 24px;
padding: 4px;
}
#contacts-table td.action a {
display: block;
width: 16px;
height: 14px;
text-indent: -5000px;
overflow: hidden;
background: url(images/listicons.png?v=017c.29530) -2px -1180px no-repeat;
}
/* This padding-left should be equal to the focused border-left + the focused padding-left */
#contacts-table thead tr td:first-child,
#contacts-table tbody tr td:first-child {
border-left: 0;
padding-left: 36px;
}
/* because of border-collapse, we make the left border twice what we want it to be - half will be hidden to the left */
#contacts-table tbody tr.focused > td:first-child {
border-left: 2px solid #b0ccd7;
padding-left: 34px;
}
#contacts-table tbody tr.selected.focused > td:first-child {
border-left-color: #9ec2d0;
}
#contacts-table .contact td.name {
background-position: 6px -1603px;
}
#contacts-table .contact.focused td.name {
background-position: 4px -1603px;
}
#contacts-table .contact.selected td.name,
#contacts-table .contact.unfocused td.name {
background-position: 6px -1627px;
font-weight: bold;
}
#contacts-table .contact.selected.focused td.name {
background-position: 4px -1627px;
}
#contacts-table .group td.name {
background-position: 6px -1555px;
}
#contacts-table .group.focused td.name {
background-position: 4px -1555px;
}
#contacts-table .group.selected td.name,
#contacts-table .group.unfocused td.name {
background-position: 6px -1579px;
font-weight: bold;
}
#contacts-table .group.selected.focused td.name {
background-position: 4px -1579px;
}
#addresslist .boxtitle {
padding-right: 95px;
overflow: hidden;
text-overflow: ellipsis;
}
#addresslist .boxtitle a.poplink {
color: #004458;
font-size: 14px;
line-height: 12px;
text-decoration: none;
}
#contact-frame {
position: absolute;
top: 0;
left: 0;
right: 0;
bottom: 0px;
border: 0;
border-radius: 4px;
}
#headerbuttons {
position: absolute;
top: 48px;
right: 10px;
width: auto;
z-index: 10;
}
#sourcename {
color: #999;
font-size: 10px;
margin: -5px 0 8px 2px;
}
#contactphoto {
float: left;
margin: 0 18px 20px 0;
width: 112px;
}
#contactpic {
width: 112px;
min-height: 112px;
background: white;
}
#contactpic img {
max-width: 112px;
visibility: inherit;
}
#contactpic.droptarget {
background-image: url(images/filedrop.png?v=deab.605);
background-position: center;
background-repeat: no-repeat;
}
#contactpic.droptarget.hover {
background-color: #d9ecf4;
box-shadow: 0 0 5px 2px rgba(71,135,177, 0.9);
-moz-box-shadow: 0 0 5px 2px rgba(71,135,177, 0.9);
-webkit-box-shadow: 0 0 5px 2px rgba(71,135,177, 0.9);
-o-box-shadow: 0 0 5px 2px rgba(71,135,177, 0.9);
}
#contactpic.droptarget.active img {
opacity: 0.15;
}
#contactpic.droptarget.hover img {
opacity: 0.05;
}
#contacthead {
border: 0;
margin: 0 16em 1em 0;
padding: 0;
line-height: 1.5em;
font-size: 12px;
}
form #contacthead {
margin-right: 0;
}
#contacthead .names span.namefield,
#contacthead .names input {
font-size: 140%;
font-weight: bold;
}
#contacthead .displayname span.namefield {
font-size: 120%;
font-weight: bold;
}
#contacthead span.nickname:before,
#contacthead span.nickname:after {
content: '"';
}
#contacthead input {
margin-right: 6px;
margin-bottom: 0.2em;
}
#contacthead .names input,
#contacthead .addnames input {
width: 180px;
}
#contacthead input.ff_prefix,
#contacthead input.ff_suffix {
width: 90px;
}
.contactfieldgroup {
border: 0;
border-radius: 5px;
background: #f7f7f7;
background: -moz-linear-gradient(top, #f7f7f7 0%, #eee 100%);
background: -webkit-gradient(linear, left top, left bottom, color-stop(0%,#f7f7f7), color-stop(100%,#eee));
background: -o-linear-gradient(top, #f7f7f7 0%, #eee 100%);
background: -ms-linear-gradient(top, #f7f7f7 0%, #eee 100%);
background: linear-gradient(top, #f7f7f7 0%, #eee 100%);
margin: 0 0 12px 0;
padding: 8px;
}
.contactfieldgroup legend {
display: block;
margin: 0 -8px;
width: 100%;
font-weight: bold;
text-shadow: 0px 1px 1px #fff;
padding: 6px 8px 3px 8px;
background: #f0f0f0;
background: -moz-linear-gradient(top, #f0f0f0 0%, #d6d6d6 100%);
background: -webkit-gradient(linear, left top, left bottom, color-stop(0%,#f0f0f0), color-stop(100%,#d6d6d6));
background: -o-linear-gradient(top, #f0f0f0 0%, #d6d6d6 100%);
background: -ms-linear-gradient(top, #f0f0f0 0%, #d6d6d6 100%);
background: linear-gradient(top, #f0f0f0 0%, #d6d6d6 100%);
border-bottom: 1px solid #cfcfcf;
border-radius: 5px 5px 0 0;
}
.contactfieldgroup .row {
position: relative;
margin: 0.2em 0;
}
.contactfieldgroup .contactfieldlabel {
position: absolute;
top: 0;
left: 2px;
width: 110px;
white-space: nowrap;
overflow: hidden;
text-overflow: ellipsis;
color: #666;
}
.contactfieldgroup .contactfieldlabel select {
width: 100%;
color: #666;
}
.contactfieldgroup .contactfieldcontent {
padding-left: 120px;
min-height: 1em;
line-height: 1.3em;
}
.contactfieldgroup .contactfield {
line-height: 1.3em;
}
.contactcontrolleraddress .contactfieldcontent input {
margin-bottom: 0.1em;
}
.contactfieldcontent.composite {
padding-bottom: 8px;
}
.contactfieldcontent .contactfieldbutton {
vertical-align: middle;
margin-left: 0.5em;
}
.contactfield .ff_notes {
width: 99%;
}
a.deletebutton {
position: relative;
left: 5px;
top: -3px;
display: inline-block;
width: 16px;
height: 18px;
text-decoration: none;
text-indent: -5000px;
overflow: hidden;
background: url(images/buttons.png?v=3e15.39327) -7px -377px no-repeat;
}
#import-box {
position: absolute;
bottom: 0px;
top: 34px;
left: 0;
right: 0;
overflow: auto;
padding: 10px;
}
#import-box p,
#import-box .propform {
max-width: 50em;
}
| 2024-02-11T01:26:59.872264 | https://example.com/article/2994 |
Q:
postgresql db structure script
How to get my db structure without the data, (schema, tables, ...) as a script by command line.
A:
http://www.postgresql.org/docs/current/interactive/app-pgdump.html
pg_dump -s -U username database > backup.sql
Haven't tested it though, so not sure if it works.
edit: had the german link up there ;)
| 2024-06-02T01:26:59.872264 | https://example.com/article/1699 |
Focal choroidal excavaction associated with idiopathic choroidal neovascularization.
The case is presented of a 45 year-old man with a focal choroidal excavation associated with choroidal neovascularisation not included in the area of excavation. Clinical features were analysed using retinography, fluorescein angiography, optical coherence tomography, and optical coherence tomography angiography. The patient was treated with 3 intravitreal injections of bevacizumab, with a good response. Focal choroidal excavation can be associated with choroidal neovascularization not included in the area of excavation. Multimodal imaging provides a complete description of clinical features, before and after treatment. | 2024-06-25T01:26:59.872264 | https://example.com/article/6406 |
Nspire Network
My Son’s Music
Meta
Team Law
Category: J. Anthony Morris PhD – Former FDA
FLU SHOTS. FLU SHOTS. 18% EFFECTIVE and linked to Guillain-Barre and alzheimer’s, among other things.
——–The founder of the CDC, Dr. Alexander Langmuir, later Emeritus Professor at Harvard, was adamant when he stated:
“I would not take the flu vaccine, my wife doesn’t take the flu vaccine, no one should take the flu vaccine. And in fact, when I was head of the CDC, I wanted to make that as a public statement, and I refused to say that you should take the flu vaccine.” One reason being the flu vaccine is especially problematic in being recommended or required annually, and some brands still contain Thimerosal. That’s why I’m now a professor at Harvard.”
—————-
“There is no evidence that any influenza vaccine thus far developed is effective in preventing or mitigating any attack of influenza. The producers of these vaccines know that they are worthless, but they go on selling them, anyway.”
— J. Anthony Morris, PhD, former chief vaccine control officer and research virologist at the US Food and Drug AdministrationContinue reading Why doctors say ‘No’ to flu shots…..? | 2024-04-03T01:26:59.872264 | https://example.com/article/1859 |
Arizona's top utility regulator: State should double renewable energy requirements
Posted by Fletcher Wilkinson5sc on September 01, 2016
Arizona Corporation Commission Chairman Doug Little announced a proposal to double the state's Renewable Energy Standard to 30% by 2030, a significant increase from the existing 15% by 2025 requirement.
The ACC Chairman's proposal also seeks to remove some of the Renewable Energy Standard requirements in order to allow utilities to meet their goals in the most cost-effective manner. For example, the proposal includes removing the requirement that utilities purchase 30% of their renewable energy from distributed sources like rooftop solar - a move that will certainly cause controversy. | 2023-12-03T01:26:59.872264 | https://example.com/article/6413 |
/*
* Generic ISA Super I/O
*
* Copyright (c) 2018 Philippe Mathieu-Daudé
*
* This code is licensed under the GNU GPLv2 and later.
* See the COPYING file in the top-level directory.
* SPDX-License-Identifier: GPL-2.0-or-later
*/
#ifndef HW_ISA_SUPERIO_H
#define HW_ISA_SUPERIO_H
#include "qemu-common.h"
#include "sysemu/sysemu.h"
#include "hw/isa/isa.h"
#define TYPE_ISA_SUPERIO "isa-superio"
#define ISA_SUPERIO(obj) \
OBJECT_CHECK(ISASuperIODevice, (obj), TYPE_ISA_SUPERIO)
#define ISA_SUPERIO_GET_CLASS(obj) \
OBJECT_GET_CLASS(ISASuperIOClass, (obj), TYPE_ISA_SUPERIO)
#define ISA_SUPERIO_CLASS(klass) \
OBJECT_CLASS_CHECK(ISASuperIOClass, (klass), TYPE_ISA_SUPERIO)
#define SUPERIO_MAX_SERIAL_PORTS 4
typedef struct ISASuperIODevice {
/*< private >*/
ISADevice parent_obj;
/*< public >*/
ISADevice *parallel[MAX_PARALLEL_PORTS];
ISADevice *serial[SUPERIO_MAX_SERIAL_PORTS];
ISADevice *floppy;
ISADevice *kbc;
ISADevice *ide;
} ISASuperIODevice;
typedef struct ISASuperIOFuncs {
size_t count;
bool (*is_enabled)(ISASuperIODevice *sio, uint8_t index);
uint16_t (*get_iobase)(ISASuperIODevice *sio, uint8_t index);
unsigned int (*get_irq)(ISASuperIODevice *sio, uint8_t index);
unsigned int (*get_dma)(ISASuperIODevice *sio, uint8_t index);
} ISASuperIOFuncs;
typedef struct ISASuperIOClass {
/*< private >*/
ISADeviceClass parent_class;
/*< public >*/
DeviceRealize parent_realize;
ISASuperIOFuncs parallel;
ISASuperIOFuncs serial;
ISASuperIOFuncs floppy;
ISASuperIOFuncs ide;
} ISASuperIOClass;
#define TYPE_FDC37M81X_SUPERIO "fdc37m81x-superio"
#define TYPE_SMC37C669_SUPERIO "smc37c669-superio"
#endif /* HW_ISA_SUPERIO_H */
| 2024-06-14T01:26:59.872264 | https://example.com/article/4808 |
#!/usr/bin/env ruby
#
# na2aa.rb - translate any NA input into AA FASTA format
#
# Copyright:: Copyright (C) 2019 BioRuby Project
# License:: The Ruby License
#
require 'bio'
ARGV.each do |fn|
Bio::FlatFile.open(fn) do |ff|
ff.each do |entry|
next if /\A\s*\z/ =~ ff.entry_raw.to_s
na = entry.naseq
aa = na.translate
print aa.to_fasta(entry.definition, 70)
end
end
end
| 2023-12-10T01:26:59.872264 | https://example.com/article/6783 |
Q:
What's the time derivative of the Annihilation operator?
I've been dealing with annihilation operator recently where you can see related information
Time derivative of the state vector as expressed in abstract Hilbert space vs. as a wavefunction
How to get the time derivative of an expectation value in quantum mechanics?
and
"Creation and annihilation operators", Wikipedia
for definition.
Correction made by Valter Moretti and J.G.'s answer, there is no contradiction.
$$
\begin{align}
i \hbar \frac{\mathrm{d}}{\mathrm{d}t} \left(a \left| \psi(n,t) \right\rangle \right)
& ~=~ i \hbar \frac{\mathrm{d}}{\mathrm{d}t} \left(\sqrt{n} \left| \psi(n-1,t) \right\rangle \right) \\[5px]
& ~=~ H \sqrt{n} \left| \psi(n-1,t) \right\rangle \\[5px]
& ~=~ E_{n-1}\sqrt{n} \left| \psi(n-1,t) \right\rangle
\end{align}
\,.$$
and
\begin{align}
i\hbar\frac{d}{dt}(a|\psi(n,t)\rangle)
& =i\hbar\frac{d}{dt}(a)|\psi(n,t)\rangle+a(i\hbar\frac{d}{dt}|\psi(n,t)\rangle) \\[5px]
& =i\hbar \cdot iwa|\psi(n,t)\rangle+a(H|\psi(n,t)\rangle) \\[5px]
& =-\hbar w a|\psi(n,t)\rangle+a(E_n|\psi(n,t)\rangle) \\[5px]
& =(E_n-\hbar w)a|\psi(n,t)\rangle\\[5px]
& =E_{n-1} a|\psi(n,t)\rangle\\[5px]
& =E_{n-1} \sqrt{n}|\psi(n-1,t)\rangle
\end{align}
Notice $\frac{d}{dt}(a)\neq 0$ despite the fact that $a$ in matrix represtation is a constant matrix.
A:
The problem with your first answer is the identity (I prefer to modify notations)
$$a \psi_n(t) = \sqrt{n} \psi_{n-1}(t)\:.\quad (false \:\:if \:\:t\neq 0)\tag{1}$$
This is false if $t\neq 0$ (it is trivially true for $n=0$, but I assume $n\neq 0$ henceforth).
Since $\psi(t) := e^{-itH/\hbar} \psi$, the identity above can be expanded as
$$a e^{-itH/\hbar} \psi_n = \sqrt{n} e^{-itH/\hbar} \psi_{n-1} \quad(false \:\:if \:\:t\neq 0)\:.$$
In fact, both sides can be separately computed,
$$a e^{-itH/\hbar} \psi_n = a e^{-itE_n/\hbar} \psi_n= e^{-itE_n/\hbar} a\psi_n= e^{-itE_n/\hbar} \sqrt{n}\psi_{n-1} = \sqrt{n}e^{-itE_n/\hbar} \psi_{n-1} $$
whereas
$$\sqrt{n} e^{-itH/\hbar} \psi_{n-1} = \sqrt{n} e^{-itE_{n-1}/\hbar} \psi_{n-1}\:,$$
and
$$\sqrt{n}e^{-itE_n/\hbar} \psi_{n-1} \neq \sqrt{n} e^{-itE_{n-1}/\hbar} \psi_{n-1}$$
because
$$E_n\neq E_{n-1}\:.$$
The fundamental reason of the failure of (1) is that $a$ and $e^{-itH/\hbar}$ do not commute. It it were
$$a e^{-itH/\hbar} = e^{-itH/\hbar} a\:,$$
then we would have
$$\langle \psi_n |a e^{-itH/\hbar}\psi_m \rangle = \langle \psi_n | e^{-itH/\hbar} a \psi_m\rangle$$
i.e.
$$\langle a^*\psi_n | e^{-itH/\hbar}\psi_m \rangle = \langle e^{itH/\hbar}\psi_n | a \psi_m\rangle\:.$$
taking the time derivative for $t=0$,
$$\langle a^*\psi_n | H\psi_m \rangle = \langle H\psi_n | a \psi_m\rangle\:,$$
so that
$$\langle \psi_n | aH\psi_m \rangle = \langle \psi_n | Ha \psi_m\rangle\:,$$
so that
$$\langle \psi_n | (aH-Ha)\psi_m \rangle = 0$$
namely, since the Hermite functions $\psi_n$ span a dense space,
$$aH\psi_m= Ha\psi_m\:.$$
By linearity, we would have
$$aH= Ha\:.$$
at least restricting the domains to the span of Hermite functions $\psi_n$. The identity above is false in view of the commutation relations of $a$ and $a^*$ and $H = \hbar \omega (a^*a + I/2)$ over the said space.
Coming back to your question, the correct result is the second one.
| 2024-03-14T01:26:59.872264 | https://example.com/article/8293 |
Tesla CEO Elon Musk has announced today that the automaker is pushing its planned unveiling of its electric truck, Tesla Semi, from October 26 to November 16 as it focuses on Model 3 production and helping out power outage-ridden Puerto Rico.
As Tesla focuses on fixing those bottlenecks and increasing Model 3 production volumes, Musk decided to get rid of the potential distraction that is the unveiling of an entirely new business unit for Tesla; trucking.
The unveiling of Tesla Semi, which was spotted in the wild earlier this week – picture above, has been pushed by just over 2 weeks.
The timing is certainly interesting and we would be curious to know what was said during that conversation.
Musk was talking about a scalable energy storage and solar power solution with the governor on Twitter. In the meantime, Tesla is shipping Powerwalls, but as we reported, installations have been difficult due to the damaged infrastructure and the fact that some installers have engaged in price gouging.
We should have more information coming out of Puerto Rico on those projects in the coming weeks.
As for Model 3 production, Musk reiterated that Tesla is still in “production hell”. We are going to have a more in-depth report on what that means so far and how it can possibly affect delivery timelines with some exclusive information. Stay tuned.
Update 2: Tesla has offered to cover any non-refundable travel costs incurred by those who had already booked travel to the cancelled October 26th event. Here is the email they just sent out to invitees:
“The first Tesla Truck prototype is completed, but we’re going to push the unveiling event to Nov. 16 so we can devote resources to fixing Model 3 bottlenecks and increasing battery production for Puerto Rico and other affected areas.
If this delay causes any non-refundable or non-changeable travel expenses, please send invoices for travel booked prior to this communication to ReferralSupport@tesla.com and we’ll take care of those for you. | 2023-12-13T01:26:59.872264 | https://example.com/article/6485 |
Q:
Scaffold Create and Edit Views with Dropdownlist in MVC
I have a MVC3 application that populates a dropdownlist from a Model. When I select an item from the list , i would like to Update the url ('/Edit/4') on a single 'edit' link which will allow me display the edit view, i.e rather than use a template which creates edit links for all records in the model, I would like to use one edit link and then update it as items are selected in the dropdownlist. I have been able to achieve some of this using jquery , I would like to do it in C# code using MVC.
Any thoughts??
A:
I created a Sample code. I have an area. Highlighted part is your concerned code.
Controller
public class DropdownController : Controller
{
[HttpGet]
public ActionResult DropDownListFor()
{
Practise.Areas.MyPractise.Models.Dropdown d = new Models.Dropdown();
return View(d);
}
public ActionResult Edit(string Val)
{
return View();
}
}
Model
public class Dropdown
{
[Required(ErrorMessage = "Please select state")]
public string StateId { get; set; }
public int MyProperty { get; set; }
public List<SelectListItem> States
{
get
{
return new List<SelectListItem>()
{
new SelectListItem
{
Text = "Punjab",
Value = "Pb",
Selected = false
},
new SelectListItem
{
Selected = false,
Value = "HM",
Text = "Himachal"
}
};
}
}
}
DropDownListFor View
@model Practise.Areas.MyPractise.Models.Dropdown
<!DOCTYPE html>
<html>
<head>
<title>DropDownListFor</title>
<script src="/Scripts/jquery-1.7.1.min.js" type="text/javascript"></script>
<script type="text/javascript">
$(document).ready(function () {
$('#StateId').change(function () {
if($('#StateId option:selected').val() == "")
$('.edit').attr('href', "#");
else
$('.edit').attr('href',
"@Url.Action("Edit", "Dropdown",
new RouteValueDictionary(new { area = "MyPractise" }))"
+ "/" + $('#StateId option:selected').text());
});
});
</script>
</head>
<body>
@using (Html.BeginForm("DropDownListFor", "DropDown", FormMethod.Post,
new { id = "DropDownList" }))
{
@Html.DropDownListFor(m => m.StateId, Model.States, "select");
@Html.ValidationMessageFor(m => m.StateId);
<a class="edit" href="#">Edit</a>
<input type="submit" name="Submit" value="Submit" />
}
</body>
</html>
Area registration under MyPractiseAreaRegistration class under highlighted area
public class MyPractiseAreaRegistration : AreaRegistration
{
public override string AreaName
{
get
{
return "MyPractise";
}
}
public override void RegisterArea(AreaRegistrationContext context)
{
context.MapRoute(
"MyPractise_default1",
"MyPractise/{controller}/{action}/{Val}",
new { action = "Index", Val = UrlParameter.Optional }
);
context.MapRoute(
"MyPractise_default",
"MyPractise/{controller}/{action}/{id}",
new { action = "Index", id = UrlParameter.Optional }
);
}
}
| 2024-01-27T01:26:59.872264 | https://example.com/article/9361 |
DHAKA, Bangladesh (AP) — A ferry packed with about 200 people capsized in a river in southern Bangladesh early Tuesday and authorities said dozens of people were missing.
Local police chief Mohammad Shahabuddin Khan said about 35 people were rescued after the ferry sank on the Meghna River after colliding with a cargo boat. He said no bodies have been found yet.
The accident site is in Munshiganj district, about 20 miles (32 kilometers) south of the capital, Dhaka.
Khan said rescue workers were trying to locate the sunken ferry, the MV Shariatpur-1. The ferry was traveling to Dhaka from neighboring Shariatpur district to the southwest.
Estimates as to how many people were on board the ferry varied.
Khan put the number at close to 200, while Dulal Dewan, a survivor, told reporters that about 300 people were on board when the ferry sank.
It is difficult to get a reliable estimate as ferry operators rarely keep a list of passengers. Most passengers buy tickets once on board.
Ferry accidents, often blamed on overcrowding, faulty vessels and lax rules, are common in Bangladesh, a low lying delta nation of 160 million people. | 2023-08-06T01:26:59.872264 | https://example.com/article/3740 |
<?xml version="1.0" encoding="utf-8"?>
<!-- (c) 2006 Microsoft Corporation -->
<policyDefinitionResources xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" revision="1.0" schemaVersion="1.0" xmlns="http://schemas.microsoft.com/GroupPolicy/2006/07/PolicyDefinitions">
<displayName>Online Assistance</displayName>
<description>Online Assistance</description>
<resources>
<stringTable>
<string id="Assistance">Online Assistance</string>
<string id="windowscomponents">Windows Components</string>
<string id="ActiveHelpPolicy_Explain">This policy setting specifies whether active content links in trusted assistance content are rendered. By default, the Help viewer renders trusted assistance content with active elements such as ShellExecute links and Guided Help links.
If you enable this policy setting, active content links are not rendered. The text is displayed, but there are no clickable links for these elements.
If you disable or do not configure this policy setting, the default behavior applies (Help viewer renders trusted assistance content with active elements).</string>
<string id="ActiveHelp">Turn off Active Help</string>
<string id="HPExplicitFeedback">Turn off Help Ratings</string>
<string id="HPExplicitFeedbackPolicy_Explain">This policy setting specifies whether users can provide ratings for Help content.
If you enable this policy setting, ratings controls are not added to Help content.
If you disable or do not configure this policy setting, ratings controls are added to Help topics.
Users can use the control to provide feedback on the quality and usefulness of the Help and Support content.</string>
<string id="HPImplicitFeedback">Turn off Help Experience Improvement Program</string>
<string id="HPImplicitFeedbackPolicy_Explain">This policy setting specifies whether users can participate in the Help Experience Improvement program. The Help Experience Improvement program collects information about how customers use Windows Help so that Microsoft can improve it.
If you enable this policy setting, users cannot participate in the Help Experience Improvement program.
If you disable or do not configure this policy setting, users can turn on the Help Experience Improvement program feature from the Help and Support settings page.</string>
<string id="HPOnlineAssistance">Turn off Windows Online</string>
<string id="HPOnlineAssistancePolicy_Explain">This policy setting specifies whether users can search and view content from Windows Online in Help and Support. Windows Online provides the most up-to-date Help content for Windows.
If you enable this policy setting, users are prevented from accessing online assistance content from Windows Online.
If you disable or do not configure this policy setting, users can access online assistance if they have a connection to the Internet and have not disabled Windows Online from the Help and Support Options page.</string>
</stringTable>
</resources>
</policyDefinitionResources>
| 2023-12-03T01:26:59.872264 | https://example.com/article/3949 |
Edge Cover
An edge cover of a graph \(G\) is a set of edges \(E_c\) where every vertex in \(G\) is incident (touching) with at least one of the edges in \(E_c\). This means that each node in the graph is touching at least one of the edges in the edge covering. Edge cover is a topic in graph theory that has applications in matching problems and optimization problems . An edge cover might be a good way to solve a problem if the answer needs to include all nodes of a graph.
Contents
Edge Cover
An edge cover of a graph \(G\) is a set of edges \(E_c\) where every vertex in \(G\) is incident with at least one of the edges in \(E_c\). This means that each node in the graph is touching at least one of the edges in the edge covering.
In the image below, the red edges represent the edges in the edge cover of the graph.
Say you are going on a road trip, and there are five cities you want to visit. The cities are connected via roads. If this situation were modeled as a graph, what would the edges and nodes be?
The nodes would be the cities and the edges would be the roads.
How does edge cover apply to finding a route that will take you to each city?
Since edge cover involves finding a set of edges that will touch each node, and we want to go to each node (city), using edge cover, we can determine the roads to take (edges) that will bring us to each city.
How many additional edges need to be colored red in order for red edges to make an edge cover of this graph?
Minimum Edge Cover
A minimum edge covering is an edge covering using the smallest possible number of edges. In the graphs below, the minimum edge covering is indicated by red edges. The edge covering number is is the size of the smallest edge cover of \(G\) and is denoted by \(\rho(G)\). If any of the red edges were deleted from the edge covering, there would be vertices not connected to the edge covering, making the edge coloring invalid.
Edge cover is a type of optimization problem that can be solved in polynomial time.
Say you are having a party, but your guests are very picky eaters. You have the following list detailing which foods each guest will and will not eat.
Name
Food
William
Pizza, Rice, Apples
Emma
Potatoes, Rice, Peas
Ray
Cheese, Apples, Steak
Robert
Pizza
Katherine
Peas, Cheese
Vivian
Cheese, Potatoes
Divya
Apples
You want to minimize the number of groceries you buy while still making sure that each guest will have at least one food item that he or she will eat. You think that this problem can be solved using a edge cover (possibly slightly modified). What does the graph look like? Which foods should you buy?
Here, we really only care that each person has a food they will eat. We don't care if we don't have every food item that each person likes. The only requirement is that each person have at least one food item. While we can use a bipartite graph to help show each person's food preferences, the only nodes we will be using in our covering are the nodes indicating the people. That is, our edge cover need only connect each person node with some food item node — there must be at least one edge per person.
Here is one way to model this as a graph.
Of course a trivial solution to this problem would be to add all of the edges into the edge cover — buy all of the food so everyone is sure to be happy. But this is not optimal for minimizing the number of items you must buy. Here is one configuration that minimizes the number of items you have to buy (there are a few optimal solutions).
A perfect matching is also a minimum edge cover. This means that the size of a maximum matching cannot be larger than the size of a minimum edge cover.
Matching
Matching is a particular, is a type of altered edge cover. A matching in a graph is a set of edges that do not have a set of common vertices. In other words, a matching is a graph where each node has only one edge coming from it. This means that a matching doesn't necessarily have to include all nodes or edges.
Here is an example of a matching graph (the matching is indicated by red edges) that is not an edge covering.
What single edge can you color red to make this matching into an edge cover?
The added edge is colored blue.
Together, the red and blue edges form an edge cover because every vertex in the graph is connected to one of those edges.
A maximum matching is a matching that contains the largest possible number of edges (and therefore, as many vertices are matched as possible). In other words, a maximum matching is the maximal matching with the maximum number of edges. Every maximum matching is maximal, but not every maximal matching is a maximum matching.
A maximum matching is different from edge cover, but the two concepts are closely related. In the graph below, the red edges indicate a maximum matching and blue edges are added to show the edges that need to be added to the maximum matching in order to complete the edge cover set of edges.
The graph on the right is both a maximum matching and an edge cover since all of the lines in the matching (indicated by the red edges) touch all of the vertices in the graph. The graph on the left, however, needs some additional edges (the blue ones) to be added to its maximum matching in order to become an edge cover.
Finding An Edge Covering
An edge covering can be found in polynomial time by finding a maximum matching and extending it using a greedy algorithm until all vertices are covered by the edges in the edge cover set.
Applications
The topics listed below have more constraints than just edge covering, but do use ideas present in edge covering in their problem approaches.
Minimum Spanning Trees
A spanning tree is a subgraph in a graph that has several properties.I think what would make your statement clearer is: First, if T is a spanning tree of graph G , then T must contain every vertex in G and T must be said to connect each vertex with a continuous path of edges. This has elements of edge cover because every vertex in G must be in T , and because the edges of T touch every vertex at least once they would then represent an edge cover.
Minimum spanning trees are a variant of the spanning tree. A minimum spanning tree for an unweighted graph, G, is a spanning tree that minimizes the number of edges or edge weights. A minimum spanning tree for a weighted graph, G, is a spanning tree that minimizes the weights of the edges in the tree.
Minimum spanning trees are very helpful in many applications and algorithms. They are often used in water networks, electrical grids, and computer networks. They are also used in graph problems like the traveling salesperson problem, and they are used in important algorithms such as the min cut max flow algorithm.
Here is a minimum spanning tree, indicated by the thicker black line, in the overall graph.
This path connects all the vertices together using the shortest length. The sum of the lengths of each edge for this spanning tree is smaller than the sum of any other other possible spanning trees.
Graph Coloring
A coloring on a graph can involve it's edges or it's vertices . Many day-to-day problems, like minimizing conflicts in scheduling, are also equivalent to graph colorings.
A proper edge coloring with 4 colors
The most common type of edge coloring is analogous to graph (vertex) colorings. Each edge of a graph has a color assigned to it in such a way that no two adjacent edges are the same color (this is an augmenting path). Such a coloring is a proper edge coloring. With cycle graphs, the analogy becomes an equivalence, as there is an edge-vertex duality. In general, however, the chromatic number is not related to the minimal \(k\) such that a proper edge \(k\)-coloring exists.
Another type of edge coloring is used in Ramsey Theory and similar problems. In such cases, edges of the graph are colored one of \(k\) colors and mathematicians investigate the resulting colored graph substructures to determine what sizes of complete subgraphs exist.
A final type of edge coloring is used in the study of spanning trees. Edges are colored in such a way that there does not exist a cycle of the same color, and the minimal number of colors required for such an edge coloring of a given graph is known as its arboricity. | 2024-04-16T01:26:59.872264 | https://example.com/article/7671 |
Pro-life signs outside the Supreme Court in June 2014. (Jim Bourg/Reuters)
On NRO yesterday, Kyle Blanchette and Robert VerBruggen both made strong arguments that abortion restrictions can reduce abortion rates. I have noted on NRO in the past that pro-life gains in the court of public opinion have forced our ideological opponents to change their strategy. Instead of arguing that pro-lifers are philosophically wrong, supporters of legal abortion often argue that our policies are ineffective. They frequently cite studies claiming to show that pro-life laws are ineffective and suggest that pro-lifers should support more-generous spending on welfare, health care, or contraception as a strategy to reduce abortion rates.
In reality, there is a substantial body of academic research demonstrating that the incidence of abortion is sensitive to its legal status. The best study on this subject was published in the Journal of Law and Economics in 2004, specifically analyzing Eastern-European countries after the fall of Communism. Some countries, such as Romania, liberalized their abortion laws while others, such as Poland, instituted legal protections for the unborn. The study held constant a range of economic and demographic variables and found that modest abortion restrictions reduced abortion rates by 25 percent. Stronger limits had an even larger effect.
That said, the new National Bureau of Economic Research (NBER) study, which purports to show that pro-life parental-involvement laws are having a diminished impact in recent years, is interesting. I have a few thoughts about the findings. First, the overall abortion rate has fallen by 50 percent since 1980, but the abortion rate among minors (ages 15-17) has fallen by more than 80 percent over the same time period. It is reasonable to think that parental-involvement laws might have less of an effect as the incidence of abortion among minors goes down.
There are other factors as well. A preliminary reading of the study finds that the authors may have not considered the impact of other types of state-level pro-life laws. Additionally, greater availability of the morning-after pill might be reducing the effect of parental-involvement laws. Also, the only three states where parental-involvement laws took effect after 2010 are Illinois, Alaska, and New Hampshire. These states are not socially conservative, and it is possible that judges in these states might be more willing to approve judicial-bypass requests from minors seeking abortions. Finally, these three most recent laws are parental-notice laws, not parental-consent laws. Even though the NBER study did not find that parental-consent laws had a larger impact than parental-notice laws, this is still a topic worthy of further analysis.
This new study opens up some interesting avenues for future research, but it should not detract from the substantial body of peer-reviewed research indicating that pro-life laws reduce abortion rates. In fact, the NBER study cites 16 studies analyzing data from a range of states and years, showing that parental-involvement laws reduce the incidence of abortion among minors. There is a consensus that the federal Hyde Amendment saves thousands of lives each year, and a 2009 Guttmacher literature review noted that the vast majority of studies analyzing state-level public-funding limits found that these laws also lower abortion rates. The evidence is clear that protective laws will continue to save unborn children.
Advertisement | 2023-09-11T01:26:59.872264 | https://example.com/article/3829 |
Tuesday, November 20, 2012
I Have A Hench About Them: Ten Worst Bond Henchmen
Well, while we've had some great Bond Henchmen, some of whom are remembered more than the Bond Villains, we've also had some simply awful sidekicks. The Bond Henchman is not an easy job: you are expected to be colorful, dangerous, and eternally loyal to your Villain even if it flies against logic and your own interest.
Sometimes, however, a peculiar quark or unique characteristic does not automatically insure greatness. In fact, if exagerrated too much, those qualities make a Henchman look silly. Some Bond Henchmen are more memorable than their employers. Sometimes Bond Henchmen are so ineffective one wonders why they were hired in the first place. And sometimes they are memorable, but for all the wrong reasons.
With that, I offer the Ten Worst Bond Henchmen.
10.) Gobinda (Octopussy)
I'm taking a guess that Gobinda, loyal aide to Prince Kamal Khan, is Sikh based on his turban and beard. Maybe it's the Westerner in me, but I don't consider being a Sikh a unique quirk in any manner, let alone for a henchmen. I like Octopussy, but what makes Gobinda a poor Bond Henchman is that he echoes a little routine that Oddjob pulled off better in Goldfinger (if you watch both you'll know what I am referring to) and he violates an Unwritten Rule of Bond Henchmen: He Questions Orders.
At the climax of Octopussy, Bond is on top of Kamal's plane and causing havoc. Kamal Khan, frustrated that he can't make a clean getaway, orders Gobinda to get Bond (which means going out of an airplane in flight). Gobinda then asks, "Out THERE?" Kamal gives him a look of almost genuine shock (as if asking, 'you're questioning me?') and signals that he means yes. Gobinda then meekly says, "Yes, Sire," and goes out. And you call yourself a responsible Henchman...
09.) Zao (Die Another Day) *
Zao is a disastrous idea for a Bond Henchman. It's the idea that if you give the muscle/killer a distinct or weird trademark you've got a good character. In the case of Zao, it's a bad idea because having a face full of diamonds doesn't mean you'll actually do anything particularly special or interesting. The Bond Henchmen who had oddities or quirks actually used them (Jaws' teeth, Tee Hee's claw), but having a face scarred with diamonds? Boring.
Not only that, but for a Henchman he proved pretty inept, even wimpy. He was going through bizarre plastic surgery that would have turned our North Korean into a Caucasian. There is nothing that recommends Zao to be worth our time, or a threat to Bond at all.
08.) Nick Nack (The Man With the Golden Gun)
It's not necessarily Nick Nack's height that puts him at the Bottom of Bond Henchmen (although, to be frank, being disposed of by being put in a suitcase doesn't exactly bolster a case for him being ranked among the Greats). Nick Nack's problem is that HE is getting more fun out of the situations than anyone else. You simply CANNOT have your Henchman wear a bowler hat and not expect better things.
Nick Nack's main role in The Man With the Golden Gun is to put the titled character through the paces as he dispatches people in his lair. When he is actually called to take action (as when Nick Nack tries to kill Bond himself) it all comes off as farce, more for laughs than anything else. Besides, Nick Nack just seems like a bad idea: a gimmick to say, 'Look, we've got a unique Henchman. He may not be a good killer, he may not be a supergenius...he's just short and manages to scare incredibly stupid women'.
07.) Whisper (Live and Let Die) **
What IS the only thing recommending Whisper as a Henchman? It isn't his smarts, because he fails to kill Bond with a snake. It isn't his loyalty (or smarts) because Kananga doesn't shrink from both threatening him and making him an object of ridicule by shooting at an inflatable chair Whisper's sitting on, causing him to be thrown off.
No, the only thing Whisper has is the fact that he is barely audible, and that isn't a great trait or something that will cause menace or danger. Whisper, intentionally or not (I suspect it's the former) is a joke that no one, not even his employer, takes seriously. What can you say in favor of a Henchman who is so soft-voiced that when he calls "Look out!" no one would possibly be able to hear his alarm?
06.) Mr. Kidd and Mr. Wint (Diamonds Are Forever) ***
I imagine that in the past, people could get away with far more than they can now in terms of stereotypes. Mr. Kidd and Mr. Wint (or Mr. Wint and Mr. Kidd if you like) were so silly no one could take them seriously (even if they were quite effective as actual killers). It seems like Mr. Kidd and Mr. Wint (or vice-versa) were more on the comical side of things, with the fact that they were excessively courtly and polite towards each other. They also would address each other as "Mr. Kidd" and "Mr. Wint" in what was suppose to be dry humor but which came off as idiotic.
The fact that you couldn't take them seriously with their exagerratedly formal manner of addressing each other (let alone others) was bad enough. What really killed them off was the fact that it is strongly suggested that Mr. Kidd and Mr. Wint are homosexual lovers. One, I imagine, would have found homophobia rather hilarious in the 1970s, but it doesn't make any sense and just looks vulgar now. We see them walk away from killing people holding hands, and one expresses irritation when the other suggests a woman is attractive. However, if they were having sex, why would they bother addressing each other by their surnames? Their demise smacks of farce, bringing down two of the worst characters in the franchise, let alone Bond Henchmen.
05.) Renard (The World is Not Enough) ****
You know what's bad about Renard? Everything. Simply everything. We're told he has one of those distinctly Bondian Henchman quirks: he is impervious to pain due to a bullet being lodged in his brain. This said bullet will also eventually kill him. However, neither his inability to feel harm (though not necessarily his inability to BE harmed, two different things I'd argue) nor the fact that he's living on borrowed time is important in the great scheme of the movie.
Robert Carlyle is a great actor and has proven it again and again, from the comedy The Full Monty to the drama Priest to the series Once Upon a Time, but The World is Not Enough was clearly a Bartha role fo him. What to make of a performance where you look at the Henchman and think...is this guy serious? Who cares if he doesn't feel pain...it's irrelevant to the story. Who cares if he's going to die...ditto. Who cares what his issues are...ditto squared.
04.) Stamper (Tomorrow Never Dies)
Oh, I'm so scared of this goofy German. This big Teutonic baddie that never does anything apart from killing unarmed sailors and who manages to make his employer look even more stupid. What makes Stamper simply dreadful is that he is totally irrelevant to the film.
Think about it: when a major assassin is close to killing Bond, it isn't Stamper; it's Vincent Schiavelli's Dr. Kaufman. Even worse, said bad doctor is a joke from beginning to end, as if Tomorrow Never Dies suddenly stopped in the middle of mourning a Secondary Bond Girl to slip into a spoof of bad henchmen. Now, if it had been Stamper, he might have gone up a bit. However, given how he just seemed to be there because every Bond Villain needs a Henchman, and a Germanic one seemed to be menacing enough for our little trifle, Stamper is a waste from first appearance to last.
03.) Chang (Moonraker)
How bad of a Henchman do you have if people fail to realize that not only are you suppose to be a Henchman, but are actually IN the film? Pretty bad, and that's the case with Chang. Just as Nick Nack was a poor imitation of Oddjob, so Chang proved to be an even poorer imitation. Being a silent Asian does not make you menacing in and of itself.
Chang's biggest problem is that he really didn't do anything: he could have been a master swordsman, he could have been a silent killer, but instead, his only accomplishment was that he appeared to be the only one who take Drax seriously. When he finally comes face to face in a confrontation with Bond, Chang RUNS AWAY! No wonder that after he was killed off, Drax looked in the Help Wanted ads to find another Henchman...one with real teeth.
Chang had dominated the Number One spot for the longest of time, but wouldn't you know it, I found two even worse.
02.) Bull (The World Is Not Enough) ****
Who the hell IS this guy? Where did he come from? Mr. Bullion (or Bull) was suppose to be working for Bond's quasi-ally Zukovsky, but just as soon as we see him, he suddenly shifts sides to work for...well, we're not exactly sure for whom he works for, but then again, I imagine Bull himself doesn't know.
Just as quickly as he appears, he's killed off, and we certainly won't miss him. There is no point to The Bull (or Bull, or whatever you want to call him), and the name is just too tempting to not serve as a description of both the character and the film...
So now, the Worst Bond Henchman of All Time Is...
01.) Elvis (Quantum of Solace)
Here's a question: does anybody remember the VILLAIN in Quantum of Solace, let alone the Henchman? Here's another question: does it look like Elvis just left the monastery rather than the building? Like other bad Henchmen, he serves no purpose (even in something as abysmal as QOS).
Elvis (already the name sinks him) is suppose to be helping the Villain with his dastardly plan, which from what I understood was to steal Bolivia's water. However, what exactly did Elvis do? Did he kill anyone? I don't think so. Did he take on Bond personally? Not to my memory. Did he have a particular quirk or skill (apart from really silly hair bordering on DaVinci Code's Tom Hanks)? No. He was just there, doing nothing, adding nothing, and looking silly in the process.
Well, now with that out of the way, let's move on to our Henchmen's employers. Our next series will look at the Ten Best and Ten Worst Bond Villains.
James Bond (Lists) Will Return...
* Due to the confused nature of Die Another Day, I found it difficult to distinguish whether Zao or Miranda Frost was the actual Bond Henchman. However, given that Zao was the one more often than not at Graves' side and the one who appeared to do most of his Master's bidding, I opted for Zao being the more dominant Bond Henchman here, though Frost did make my list.
** Whisper was one of three Henchmen in Live and Let Die. The other two were Tee Hee and Baron Samedi. I've always felt that Baron Samedi was more for atmosphere, and Tee Hee actually did pose a threat to Bond. Whisper's only selling point was that he was barely audible, and his shocking ineptness didn't appear to affect his employment, which is another reason to discount him.
*** It's a point of debate whether the two female assassins/Willard Whyte bodyguards Bambi and Thumper were actual Bond Henchmen. I would argue that they don't count because they were only in ONE scene and they didn't have much screen-time (I put it at five to eight minutes at the most), disappearing before their scene was even over. Given that, and the fact that Mr. Kidd and Mr. Wint were the primary assassins in Diamonds Are Forever, they get the 'honor' of being this film's henchmen.
**** The World is Not Enough is even more confused than Die Another Day (and that's saying quite a lot). It is never established whether Renard worked for Elektra King or vice-versa. Therefore, the listing of Renard as the Bond Henchman is a point of legitimate debate. However, since he does try to kill Bond at the end, he gets the title of Henchman. Bull, who appears out of nowhere, appears to work for BOTH of them, so that puts him as a Bond Henchman as well.
1 comment:
I'd never considered Bull a henchman; he's more of a flunky. He's just a guy with a specific task, once it's done, so is he. As with Bambi and Thumper, he doesn't have enough screen time to qualify for hencher duties, and he certainly lacks the menace, devotion, etc. that a henchman needs to demonstrate. | 2023-12-11T01:26:59.872264 | https://example.com/article/5190 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.