text stringlengths 12 4.76M | timestamp stringlengths 26 26 | url stringlengths 32 32 |
|---|---|---|
OS X RAM Disk
================
[](https://travis-ci.org/zafarella/OSX-RAMDisk)
Need really fast Java IDE or browser? Then keep reading.
This app will create a [RAM disk](http://en.wikipedia.org/wiki/RAM_drive) in OS-X with specified size to
store the apps cache in RAM, which is known as SSD optimization - reducing disk IO or making browsing the web and
programming using IntelliJ more enjoyable.
Supported apps (you can add yours):
* [IntelliJ Idea 14/15](https://www.jetbrains.com/idea/download/)
* [Google Chrome](https://support.google.com/chrome/answer/95346?hl=en)
* [Google Canary](https://www.google.com/chrome/browser/canary.html)
* Safari
* iTunes
* [Android studio](http://developer.android.com/sdk/index.html)
* [WebShtorm](https://www.jetbrains.com/webstorm/)
* [Clion](https://www.jetbrains.com/clion/)
* [AppCode](https://www.jetbrains.com/objc/)
* [Xcode](https://developer.apple.com/xcode/downloads/)
* [PHP Storm](https://www.jetbrains.com/phpstorm/)
* [your_app_goes_here]
The IntelliJ Idea (or JetBrains IDEs) are really fast after this. Be aware that for the large code base you will
need to have larger RAM Disk. I don't have exact numbers, sorry, it can vary because of many factors. Mine
machine have 16GB - it works very good for small code bases.
If you observing performance degradation - revise how much memory you are using and may be adding more can help.
By default script will create RAM disk of 1/4 size of your RAM.
If you need to change the size - edit `startupRAMDiskandCacheMover.sh` header section. The RAM disk works with hibernate
option - you don't need to worry about this part.
Have something to discuss?
[](https://gitter.im/zafarella/OSX-RAMDisk?utm_source=badge&utm_medium=badge&utm_campaign=pr-badge&utm_content=badge)
[](https://bestpractices.coreinfrastructure.org/projects/458)
If you have any issues (compatibility etc) - I am glad to have them reported in the [issues](https://github.com/zafarella/OSX-RAMDisk/issues) tab.
Compatibility
============
Works on
* MAC OS X 10.10.2 Yosemite
* MAC OS X 10.11 EI Capitan
* MAC OS X 10.12 Sierra
> Note that you have to re-run the script in order to get the ram disk back after machine restart.
> Currently it does not place it on startup - I'm working on it.
Give it a try before installing
===============================
```bash
$ curl -o startupRAMDiskandCacheMover.sh https://raw.githubusercontent.com/zafarella/OSX-RAMDisk/master/Contents/MacOS/startupRAMDiskandCacheMover.sh &&
chmod +x startupRAMDiskandCacheMover.sh &&
./startupRAMDiskandCacheMover.sh
```
or
```
git clone git@github.com:zafarella/OSX-RAMDisk.git &&
OSX-RAMDisk/Contents/MacOS/startupRAMDiskandCacheMover.sh
```
Jetbrains IDE notes (IntelliJ)
===================
In order to speed up the compilation and responsiveness of the IDE you can
change "Project compiler output" and point it to ram disk:
```
echo /Volumes/ramdisk/${USER}/compileroutput
```
and in your project/module settings (Command+down) point to this directory.
You can also set this [setting by default](https://www.jetbrains.com/idea/help/accessing-default-settings.html)
for your projects at the main menu, choose `File | Other Settings | Default Settings`
In addition to above you can tune jvm with following [flags](https://gist.github.com/zafarella/43bc260c3c0cdc34f109)
`vim /Applications/IntelliJ\ IDEA\ 15.app/Contents/bin/idea.vmoptions`
Installation
============
Do not use it now - the startup script does not work yet - work in progress
```
git clone git@github.com:zafarella/OSX-RAMDisk.git
cd OSX-RAMDisk
make install
```
Manual Installation
------------------
```
cp OSXRamDisk.plist ~/Library/LaunchAgents
cp startupRAMDiskandCacheMover.sh /usr/local/bin
# note - it will close Chrome, safari idea
/usr/local/bin/startupRAMDiskandCacheMover.sh
```
Uninstall
============
Run `make uninstall`
or manually do following
Close the chrome, idea or any other application you configured to use ram disk.
```
rm /usr/local/bin/startupRAMDiskandCacheMover.sh
launchctl unload -w ~/Library/LaunchAgents/OSXRamDisk.plist
rm ~/Library/LaunchAgents/OSXRamDisk.plist
```
Alternatives
============
If you are Linux user use
* https://github.com/graysky2/profile-sync-daemon
-----------
Was made with ♥ in NYC
| 2024-01-15T01:26:18.401715 | https://example.com/article/8253 |
Q:
editable Text option in kinetic js
I want to add Textbox or editable element to give the user the option to edit the text.
This is my current code:
var text = new Kinetic.Text({
text: "Sample Text", ---> i want to edit this text
x: 50,
y: 10,
fill: "transparent",
fontSize: 10,
fontFamily: "Helvetica Neue",
textFill: "#000",
align: "center",
verticalAlign: "middle",
name:'TEXT'
});
A:
At the moment there does not seem to be any way to create editable text with Kinetic JS (see several threads about this at stackoverflow), some people suggest using an input field next to the canvas to edit the text, but my solution would be the following:
create a text with your code
on text click [text.on("click", function...], create an input field right at your mouse cursor
Well, that´s the plan. Maybe it´s easier to use a "save" button text to the input field, so you know exactly when to close it and when to store the input field data to the Kinetic text. you would also need a "close" function if you don´t want to edit it.
A very easy solution would also be a simple JavaScript prompt:
var xy = prompt("gimme your text");
So, something like this would be the best Solution imho:
myText.on('click', function(evt) {
this.setText(prompt('New Text:'));
layer.draw(); //redraw the layer containing the textfield
});
| 2024-01-14T01:26:18.401715 | https://example.com/article/3032 |
(BIVN) – On Tuesday, the Hawaii County Council dove into the budget for the upcoming fiscal year, but there are already deep concerns over how the eruption in the lower East Rift Zone of Kilauea, only two weeks old, will impact revenues.
Councilmembers got a preview of what might be in store during a Finance Committee meeting in Hilo on Monday.
Lisa Miura, Hawaii County’s real property tax administrator, told the council, “three weeks ago, we would never have anticipated losing a million dollars in revenue just from one area in Puna. Friday, I wouldn’t have estimated that that area would have grown so much just over the weekend.”
“We’re looking at, at least, $1 million dollars in loss of revenue so far and counting,” Miura said, “and it’s looking more like $1.2 million is where we’re at right now. This doesn’t even include the agricultural farms that are taking a huge impact. We started looking at this just from the Leilani Estates, Lanipuna Gardens, in that immediate area.”
“Clearly, knowing what we know today, it’s definitely not near enough,” Miura continued. “The area has lost value. If you’re asking what the total loss could be – not including the business impact, but just the real property values – it could go up to $6.2 million, if it’s for the whole area, beyond Pahoa the intersection. We’re obviously hoping it doesn’t get to that, but I think we’re just starting. And I’d be super hesitant to say that we’re even
close to coming to the end.” | 2024-05-03T01:26:18.401715 | https://example.com/article/3603 |
<!--
The MIT License
Copyright (c) 2004-2009, Sun Microsystems, Inc., Kohsuke Kawaguchi, Tom Huybrechts, id:cactusman
Permission is hereby granted, free of charge, to any person obtaining a copy
of this software and associated documentation files (the "Software"), to deal
in the Software without restriction, including without limitation the rights
to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
copies of the Software, and to permit persons to whom the Software is
furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in
all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
THE SOFTWARE.
-->
<!--
Various system information for diagnostics
-->
<?jelly escape-by-default='true'?>
<j:jelly xmlns:j="jelly:core" xmlns:st="jelly:stapler" xmlns:d="jelly:define" xmlns:l="/lib/layout" xmlns:t="/lib/hudson" xmlns:f="/lib/form">
<l:layout permissions="${app.MANAGE_AND_SYSTEM_READ}" title="${%System Information}">
<st:include page="sidepanel.jelly" />
<l:main-panel>
<l:hasPermission permission="${app.SYSTEM_READ}">
<h1>${%System Properties}</h1>
<t:propertyTable items="${h.systemProperties}" />
</l:hasPermission>
<l:hasPermission permission="${app.SYSTEM_READ}">
<h1>${%Environment Variables}</h1>
<t:propertyTable items="${h.envVars}" />
</l:hasPermission>
<h1>${%Plugins}</h1>
<table class="pane sortable bigtable">
<j:choose>
<j:when test="${empty(app.pluginManager.plugins) and empty(app.pluginManager.failedPlugins)}">
<tr><td>
${%No plugins installed.}
</td></tr>
</j:when>
<j:otherwise>
<tr>
<th class="pane-header" initialSortDir="down">${%Name}</th>
<th class="pane-header">${%Version}</th>
<th class="pane-header">${%Enabled}</th>
</tr>
<j:forEach var="p" items="${app.pluginManager.plugins}">
<j:set var="state" value="${p.enabled?'true':'false'}"/>
<tr>
<td class="pane"><st:out value="${p.shortName}"/></td>
<td class="pane"><st:out value="${p.version}"/></td>
<td class="pane"><st:out value="${state}"/></td>
</tr>
</j:forEach>
</j:otherwise>
</j:choose>
</table>
<h1>${%Memory Usage}</h1>
<j:set var="type" value="${request.getParameter('type')}" />
<j:choose>
<j:when test="${type == 'sec10'}" />
<j:when test="${type == 'min'}" />
<j:when test="${type == 'hour'}" />
<j:otherwise>
<j:set var="type" value="min" />
</j:otherwise>
</j:choose>
<div>
${%Timespan}:
<j:choose>
<j:when test="${type != 'sec10'}">
<a href="?type=sec10">${%Short}</a>
</j:when>
<j:otherwise>
${%Short}
</j:otherwise>
</j:choose>
<st:nbsp />
<j:choose>
<j:when test="${type != 'min'}">
<a href="?type=min">${%Medium}</a>
</j:when>
<j:otherwise>
${%Medium}
</j:otherwise>
</j:choose>
<st:nbsp />
<j:choose>
<j:when test="${type != 'hour'}">
<a href="?type=hour">${%Long}</a>
</j:when>
<j:otherwise>
${%Long}
</j:otherwise>
</j:choose>
</div>
<script type="text/javascript">
var w = document.getElementById('main-panel').offsetWidth - 30;
document.write('<img src="${rootURL}/extensionList/hudson.diagnosis.MemoryUsageMonitor/0/heap/graph?type=${type}&width=' + w + '&height=500" alt="[${%Memory usage graph}]" />');
</script>
<noscript>
<img src="${rootURL}/extensionList/hudson.diagnosis.MemoryUsageMonitor/0/heap/graph?type=${type}&width=500&height=300" alt="[${%Memory usage graph}]" />
</noscript>
<l:isAdmin>
<h1>${%Thread Dumps}</h1>
<p>${%threadDump_blurb('threadDump')}</p>
</l:isAdmin>
</l:main-panel>
</l:layout>
</j:jelly>
| 2024-07-08T01:26:18.401715 | https://example.com/article/8434 |
module Taskell.Events.State
-- App
( continue
, write
, setTime
, countCurrent
, setHeight
-- Taskell.UI.Main
, normalise
-- Main
, create
-- Taskell.Events.Actions.Normal
, quit
, startEdit
, startCreate
, createListStart
, editListStart
, deleteCurrentList
, clearItem
, clearDate
, above
, below
, bottom
, top
, previous
, duplicate
, next
, left
, right
, up
, down
, moveLeftTop
, moveRightTop
, moveLeftBottom
, moveRightBottom
, moveToLast
, delete
, selectList
, listLeft
, listRight
, undo
, redo
, store
, searchMode
, clearSearch
, appendSearch
-- Taskell.Events.Actions.Insert
, createList
, removeBlank
, newItem
, normalMode
, finishTask
, finishListTitle
-- Taskell.Events.Actions.Modal
, showHelp
, showMoveTo
, moveTo
, getCurrentList
, getCurrentTask
, setCurrentTask
) where
import ClassyPrelude hiding (delete)
import Control.Lens ((%~), (&), (.~), (?~), (^.))
import Data.Char (digitToInt, ord)
import Data.Text (strip)
import Data.Time.Zones (TZ)
import qualified Taskell.Data.List as L (List, deleteTask, duplicate, getTask, move, nearest, new,
newAt, nextTask, prevTask, title, update)
import qualified Taskell.Data.Lists as Lists
import Taskell.Data.Task (Task, isBlank, name)
import Taskell.Types
import qualified Taskell.Events.State.History as History (redo, store, undo)
import Taskell.Events.State.Types
import Taskell.Events.State.Types.Mode (InsertMode (..), InsertType (..), ModalType (..),
Mode (..))
import Taskell.UI.Draw.Field (Field, blankField, getText, textToField)
type InternalStateful = State -> State
create :: TZ -> UTCTime -> FilePath -> Lists.Lists -> State
create tz t p ls =
State
{ _mode = Normal
, _history = fresh ls
, _path = p
, _io = Nothing
, _height = 0
, _searchTerm = Nothing
, _time = t
, _timeZone = tz
}
-- app state
quit :: Stateful
quit = pure . (mode .~ Shutdown)
continue :: State -> State
continue = io .~ Nothing
store :: Stateful
store state = pure $ state & history %~ History.store
undo :: Stateful
undo state = pure $ state & history %~ History.undo
redo :: Stateful
redo state = pure $ state & history %~ History.redo
setTime :: UTCTime -> State -> State
setTime t = time .~ t
write :: Stateful
write state = pure $ state & (io ?~ (state ^. lists))
-- createList
createList :: Stateful
createList state =
pure $
case state ^. mode of
Insert IList ICreate f ->
updateListToLast . setLists state $ Lists.newList (getText f) $ state ^. lists
_ -> state
updateListToLast :: InternalStateful
updateListToLast state = setCurrentList state (length (state ^. lists) - 1)
createListStart :: Stateful
createListStart = pure . (mode .~ Insert IList ICreate blankField)
-- editList
editListStart :: Stateful
editListStart state = do
f <- textToField . (^. L.title) <$> getList state
pure $ state & mode .~ Insert IList IEdit f
deleteCurrentList :: Stateful
deleteCurrentList state =
pure . fixIndex . setLists state $ Lists.delete (getCurrentList state) (state ^. lists)
-- insert
getCurrentTask :: State -> Maybe Task
getCurrentTask state = getList state >>= L.getTask (getIndex state)
setCurrentTask :: Task -> Stateful
setCurrentTask task state = setList state . L.update (getIndex state) task <$> getList state
setCurrentTaskText :: Text -> Stateful
setCurrentTaskText text state =
flip setCurrentTask state =<< (name .~ strip text) <$> getCurrentTask state
startCreate :: Stateful
startCreate = pure . (mode .~ Insert ITask ICreate blankField)
startEdit :: Stateful
startEdit state = do
field <- textToField . (^. name) <$> getCurrentTask state
pure $ state & mode .~ Insert ITask IEdit field
finishTask :: Stateful
finishTask state =
case state ^. mode of
Insert ITask iMode f ->
setCurrentTaskText (getText f) $ state & (mode .~ Insert ITask iMode blankField)
_ -> pure state
finishListTitle :: Stateful
finishListTitle state =
case state ^. mode of
Insert IList iMode f ->
setCurrentListTitle (getText f) $ state & (mode .~ Insert IList iMode blankField)
_ -> pure state
normalMode :: Stateful
normalMode = pure . (mode .~ Normal)
addToListAt :: Int -> Stateful
addToListAt offset state = do
let idx = getIndex state + offset
fixIndex . setList (setIndex state idx) . L.newAt idx <$> getList state
above :: Stateful
above = addToListAt 0
below :: Stateful
below = addToListAt 1
newItem :: Stateful
newItem state = selectLast . setList state . L.new <$> getList state
duplicate :: Stateful
duplicate state = setList state <$> (L.duplicate (getIndex state) =<< getList state)
clearItem :: Stateful
clearItem = setCurrentTaskText ""
clearDate :: Stateful
clearDate state = pure $ state & lists .~ Lists.clearDue (state ^. current) (state ^. lists)
bottom :: Stateful
bottom = pure . selectLast
selectLast :: InternalStateful
selectLast state = setIndex state (countCurrent state - 1)
top :: Stateful
top = pure . selectFirst
selectFirst :: InternalStateful
selectFirst state = setIndex state (0)
removeBlank :: Stateful
removeBlank state = do
currentTask <- getCurrentTask state
(if isBlank currentTask
then delete
else pure)
state
-- moving
--
moveVertical :: Int -> Stateful
moveVertical dir state = do
(lst, idx) <- L.move (getIndex state) dir (getText <$> state ^. searchTerm) =<< getList state
pure $ setIndex (setList state lst) idx
up :: Stateful
up = moveVertical (-1)
down :: Stateful
down = moveVertical 1
moveHorizontal :: Int -> Lists.ListPosition -> State -> Maybe State
moveHorizontal idx pos state =
fixIndex . setLists state <$> Lists.changeList pos (state ^. current) (state ^. lists) idx
moveLeftBottom :: Stateful
moveLeftBottom = moveHorizontal (-1) Lists.Bottom
moveRightBottom :: Stateful
moveRightBottom = moveHorizontal 1 Lists.Bottom
moveLeftTop :: Stateful
moveLeftTop = moveHorizontal (-1) Lists.Top
moveRightTop :: Stateful
moveRightTop = moveHorizontal 1 Lists.Top
moveToLast :: Stateful
moveToLast state =
if idx == cur
then pure state
else moveHorizontal (idx - cur) Lists.Bottom state
where
idx = length (state ^. lists) - 1
cur = getCurrentList state
selectList :: Char -> Stateful
selectList idx state =
pure $
(if exists
then current .~ (ListIndex list, TaskIndex 0)
else id)
state
where
list = digitToInt idx - 1
exists = Lists.exists list (state ^. lists)
-- removing
delete :: Stateful
delete state = fixIndex . setList state . L.deleteTask (getIndex state) <$> getList state
-- list and index
countCurrent :: State -> Int
countCurrent state = Lists.count (getCurrentList state) (state ^. lists)
setIndex :: State -> Int -> State
setIndex state idx = state & current .~ (ListIndex (getCurrentList state), TaskIndex idx)
setCurrentList :: State -> Int -> State
setCurrentList state idx = state & current .~ (ListIndex idx, TaskIndex (getIndex state))
getIndex :: State -> Int
getIndex = showTaskIndex . snd . (^. current)
changeTask :: (Int -> Maybe Text -> L.List -> Int) -> Stateful
changeTask fn state = do
list <- getList state
let idx = getIndex state
let term = getText <$> state ^. searchTerm
pure $ setIndex state (fn idx term list)
next :: Stateful
next = changeTask L.nextTask
previous :: Stateful
previous = changeTask L.prevTask
left :: Stateful
left state =
pure . fixIndex . setCurrentList state $
if list > 0
then pred list
else 0
where
list = getCurrentList state
right :: Stateful
right state =
pure . fixIndex . setCurrentList state $
if list < (count - 1)
then succ list
else list
where
list = getCurrentList state
count = length (state ^. lists)
fixListIndex :: InternalStateful
fixListIndex state =
if listIdx
then state
else setCurrentList state (length lists' - 1)
where
lists' = state ^. lists
listIdx = Lists.exists (getCurrentList state) lists'
fixIndex :: InternalStateful
fixIndex state =
case getList state of
Just list -> setIndex state (L.nearest idx trm list)
Nothing -> fixListIndex state
where
trm = getText <$> state ^. searchTerm
idx = getIndex state
-- tasks
getCurrentList :: State -> Int
getCurrentList = showListIndex . fst . (^. current)
getList :: State -> Maybe L.List
getList state = Lists.get (state ^. lists) (getCurrentList state)
setList :: State -> L.List -> State
setList state list = setLists state (Lists.updateLists (getCurrentList state) list (state ^. lists))
setCurrentListTitle :: Text -> Stateful
setCurrentListTitle text state = setList state . (L.title .~ text) <$> getList state
setLists :: State -> Lists.Lists -> State
setLists state lists' = state & lists .~ lists'
moveTo' :: Int -> Stateful
moveTo' li state = do
let cur = getCurrentList state
if li == cur || li < 0 || li >= length (state ^. lists)
then Nothing
else do
s <- moveHorizontal (li - cur) Lists.Bottom state
pure . selectLast $ setCurrentList s li
moveTo :: Char -> Stateful
moveTo char = moveTo' (ord char - ord 'a')
-- move lists
listMove :: Int -> Stateful
listMove offset state = do
let currentList = getCurrentList state
let lists' = state ^. lists
if currentList + offset < 0 || currentList + offset >= length lists'
then Nothing
else do
let state' = fixIndex $ setCurrentList state (currentList + offset)
setLists state' <$> Lists.shiftBy currentList offset lists'
listLeft :: Stateful
listLeft = listMove (-1)
listRight :: Stateful
listRight = listMove 1
-- search
searchMode :: Stateful
searchMode state = pure . fixIndex $ (state & mode .~ Search) & searchTerm .~ sTerm
where
sTerm = pure (fromMaybe blankField (state ^. searchTerm))
clearSearch :: Stateful
clearSearch state = pure $ state & searchTerm .~ Nothing
appendSearch :: (Field -> Field) -> Stateful
appendSearch genField state = do
let field = fromMaybe blankField (state ^. searchTerm)
pure . fixIndex $ state & searchTerm .~ pure (genField field)
-- help
showHelp :: Stateful
showHelp = pure . (mode .~ Modal Help)
showMoveTo :: Stateful
showMoveTo state = const (state & mode .~ Modal MoveTo) <$> getCurrentTask state
-- view
setHeight :: Int -> State -> State
setHeight = (.~) height
-- more view - maybe shouldn't be in here...
newList :: State -> State
newList state =
case state ^. mode of
Insert IList ICreate f ->
let ls = state ^. lists
in fixIndex $ setCurrentList (setLists state (Lists.newList (getText f) ls)) (length ls)
_ -> state
normalise :: State -> State
normalise = newList
| 2024-05-13T01:26:18.401715 | https://example.com/article/8315 |
BARRIE, Ont. — A man wanted for stealing women's bathing suits surrendered to authorities after city police say he confessed to his mother on Friday about the crimes.
The suspect was arrested after a woman visited the Barrie police station and told officers her son was responsible for prowling through backyards of homes in the Speirs Road and Emms Drive area where bathing suits were reported stolen.
"He confessed to his mom that he did it and she convinced him to come in (to the police station)," Const. Jamie Westcott said.
"Basically, his mom came in and said, 'My son admitted to me that he was the one who has been stealing the bathing suits' and officers asked if he could come in'," Westcott added.
In one case, a resident noticed articles of clothing missing from the backyard on four occasions and started to watch his pool area more frequently.
During the late hours of July 27, the resident noticed a man lurking around his property and chased him away.
Police later received more reports of stolen clothing dating back to Father's Day of this year.
"There was a couple that were unreported (before) police were called to the area twice," Westcott said. "If he doesn't offer up an explanation (about) why he did it and there's nothing on the radar about him, then it's hard to specifically say what reason (he did it)."
Police say the suspect stole five bathing suits, but "he disposed of them" before surrendering to police.
A 21-year-old man was arrested, processed and released. He has been charged with theft under $5,000 and a prowl by night. He faces a future court date.
barrie.news@sunmedia.ca | 2023-10-03T01:26:18.401715 | https://example.com/article/8165 |
The impact of sociodemographic, environmental, and behavioral factors, and cerebrovascular risk factors as potential predictors of the mattis dementia rating scale.
Age and education have been found to affect the Mattis Dementia Rating Scale (MDRS) score of elderly normals, but there have been no studies assessing the influence of environmental and behavioral factors on this scale. Their role as potential predictors of the MDRS total score was investigated. The MDRS was administered to 1,927 normal elderly subjects in the setting of a stroke prevention study. Results were correlated with 16 sociodemographic, environmental, and behavioral factors, and cerebrovascular risk factors. Study statistics resulted from multiple logistic regression analysis. Results indicated that higher age and arterial hypertension were associated with poorer cognitive performance, while better education and moderate general life stress exerted a positive effect on the participants' test results. Thus, besides the well-established factors of age and educational level, moderate general life stress and hypertension were identified as relevant predictors in determining the MDRS test performance of elderly normals. | 2023-09-06T01:26:18.401715 | https://example.com/article/9617 |
Antibiotics in H1Z1
Antibiotics is an item in H1Z1
Description [ edit ]
An agent that either kills or inhibits the growth of a microorganism, primarily used as a treatment for infections. | 2023-10-19T01:26:18.401715 | https://example.com/article/1235 |
We couldn't find anything matching the term "a bunch of phones just got busted for inflating benchmarks" on Gizmodo
You can try expanding your search to all G/O Media sites | 2024-06-18T01:26:18.401715 | https://example.com/article/4513 |
READ THE CITIZENS' VOICE
Digital Only Subscription
Read the digital e-Edition of The Citizens' Voice on your PC or mobile device, and have 24/7 access to breaking news, local sports, contests, and more at citizensvoice.com or on our mobile apps.
Digital Services
Have news alerts sent to your mobile device or email, read the e-Edition, sign up for daily newsletters, enter contests, take quizzes, download our mobile apps and see the latest e-circulars.
Contact Us
See department contacts, frequently asked questions, request customer service support, submit a photo or place an ad.
Article Tools
Voters in Newport Township will have to choose two Democrats from three commissioner candidates this primary election.
Incumbents John Zyla, 61, and John Vishnefski, 62, are defending their seats against John Grabowski in an election that comes on the heels of an ambulance flap over insurance reimbursements between the service in the township and another in Nanticoke and the township receiving a $500,000 grant to begin work on a new municipal building.
The incumbents say that, although it lacks major businesses for income, the township has been able to maintain a balanced budget while maintaining services like 24-hour fire protection, full-time police and garbage collection.
"Our biggest problem, we're looking at it every day - trying to get people to commit to the township is our infrastructure, because we're land rich and no big business," said Zyla, who was first elected commissioner in 1978. "I'm proud as we're going along that we're not in the red because we have no big business in the township now. Keeping everything going and not raising people's taxes, that's probably the proudest thing as a board."
Vishnefski, who has been a commissioner for about 10 years, said being able to begin work on the municipal building because of the grant is a "stepping stone" for the community.
"It's kind of like finally we can put something back into the township," he said.
Commissioners are still waiting to hear back from the ambulance companies on a potential resolution to the dispute with Nanticoke, and Vishnefski, a lifelong township resident, said he will be able to devote adequate time to the job if he's re-elected.
"Now in retirement I will have more time to spend with the other commissioners on making the township a better place to live," Vishnefski said.
Grabowski, a 47-year-old supervisor at Tru-Form in Wilkes-Barre, said he thinks honesty is the most important issue of the election. He noted that under his leadership as president of the Newport Township Recreation Board, the long-closed Coal Street park reopened with new equipment, there are more summer programs for children and the township's baseball fields are operating on a successful schedule.
"Raising a family in the Glen Lyon section of Newport Township drives me to make the township the best it can be for everyone," Grabowski said. "With this in mind I will be dedicated and hardworking for all the good of Newport Township."
jhalpin@citizensvoice.com, 570-821-2058
John Grabowski
Age: 47
Residence: Newport Township
Education: Greater Nanticoke Area High School
Employment: Tru-Form, Wilkes-Barre.
Experience: A supervisor position at Tru-Form has given me the experience of dealing with problems in a timely and cost-effective manner.
Family: Wife, Brenda Grabowski, and 10-year-old son, Jake.
John Vishnefski
Age: 62
Residence: Newport Township
Education: Greater Nanticoke Area High School, Class of 1970
Employment: Retired after 26 years in customer service at Pennsylvania American Water.
Experience: About 10 years as a Newport Township commissioner
Family: Wife, Diane; sons, John and Daniel
John Zyla
Age: 61
Residence: Newport Township
Education: Greater Nanticoke Area High School, Class of 1970; and one year at Northeasten Pennsylvania Technical Center
Employment: Utility plant operator for the Department of Corrections at SCI-Retreat.
Experience: Newport Township commissioner from 1978 to 1985; Greater Nanticoke Area School Board from 1985 to 1987; Sheatown committeeman from 1986 to 1993; Newport Township commissioner from 1993 to present; 35-year member of the Newport Township Lions Club.
We welcome user discussion on our site, under the following guidelines:
To comment you must first create a profile and sign-in with a verified DISQUS account or social network ID. Sign up here.
Comments in violation of the rules will be denied, and repeat violators will be banned. Please help police the community by flagging offensive comments for our moderators to review. By posting a comment, you agree to our full terms and conditions. Click here to read terms and conditions. | 2024-02-26T01:26:18.401715 | https://example.com/article/2472 |
MIAMI — Down here in South Florida's tropical capital, where the gap is so stark between what the haves have and what the have-nots don't, the NFL today puts on its Super Bowl at the peak of its power as the undisputed king of all American sports. The people who run this league have gotten it to this heady point because they've done so well doing what this city and this country often have not. They've spread the wealth.
Over the last half a century, the system based on sharing revenues has made it possible for teams from smaller cities, far away from Wall Street, to have a fair and fighting chance.
It has catapulted the NFL from a popular sports league to a sought-after entertainment property to a full-fledged cultural phenomenon. More people watch the NFL than any other sport. More people watch the NFL than any other anything.
The NFL, heading into today's game between the Indianapolis Colts and the New Orleans Saints, is the most successful sports league in this country's history, at its most successful point.
This past season raked in record ratings and roughly $8 billion in revenue — all in spite of the biggest recession since the Great Depression.
Here is the NFL in 2010: millionaire players and billionaire owners who financially never have had it better watched by millions of people who statistically seldom have had it worse.
Tense, looming labor issues, though, could lead to a mess next fall, and potentially no football at all the fall after that.
Why?
People who are already rich want to be even richer.
The Super Bowl has been played here more than anywhere else. Fitting. Because it's here, in a sense, where the sharing started, almost exactly 50 years ago, when the league's owners picked Pete Rozelle as the new commissioner in the winter of 1960 in a hotel on Miami Beach.
Rozelle, acknowledged by now as a visionary and perhaps the most important commissioner in the history of sports, saw the coming importance of TV. He wanted a national contract for the league, and he wanted all of its teams, 12 at the time, to split the profits.
The richest owner, of course, had the most to lose in that deal, at least in the short term, and so he was the one who had to be convinced. Wellington Mara owned the New York Giants.
By 1961, he agreed.
"We should all share, I guess," he said at the annual league meeting that year.
This makes the NFL, Chuck Klosterman wrote in his most recent book of essays, "arguably the most successful form of socialism in U.S. history." The Chicago Tribune once called the NFL "socialism with cheerleaders." Added the league's chief marketing officer in a story last month on the BBC: "We have a sort of socialist capitalism."
Socialism, Michael MacCambridge wrote in his history of the NFL, America's Game, "was how the sport ensured it was closer to operating as a pure meritocracy than any other realm in American society."
It's not really socialism, but its revenue sharing is more extensive and more egalitarian than any of the country's other sports, and is loyal to the heart of the ideology.
It's a model where those with more share with those with less for the sake of a greater good, and where the rich don't keep getting richer and the poor don't keep getting poorer.
Sports talk uses buzzwords to describe the results — "parity," "competitive balance" — but what it is, really, is this:
Everybody has a chance.
Including even Saints from a city that not that long ago was underwater and half-abandoned, where people stood on the tops of their homes, waving signs that said HELP.
• • •
The sharing of revenue isn't the only reason for the league's immense appeal. The sport is great on TV. The breaks in play are perfect for ads. Games happen just once a week. People like violence. Still, though, on the contribution of the somewhat socialist setup there is consensus.
"Instrumental," said Andrew Zimbalist, a sports economist from Smith College in Massachusetts.
The harvest of that level playing field looks like this:
Overall TV ratings for the league this season were higher than they've been in 20 years.
This past fall, TV deals with CBS, Fox, NBC and ESPN paid each team almost $100 million. Fourteen of the 15 most-watched shows on network TV were NFL games. Fourteen of the 15 most-watched shows on cable TV were NFL games. Only nine shows on TV were watched by 25 million or more people. They were all NFL games. The game in October between the Minnesota Vikings and the Green Bay Packers was the most-watched show on cable TV ever.
Forbes magazine says 25 sports franchises on the planet are worth $1 billion or more — the New York Yankees, five European soccer clubs, and 19 NFL franchises.
Even the lowest-valued of the 32 NFL teams, the Oakland Raiders, worth approximately $800 million, is worth more than all but three Major League Baseball teams and all the teams in the National Basketball Association and the National Hockey League.
The values of franchises in the NFL over the last 15 years have gone up 500 percent.
Who loves the NFL? People with white skin, black skin, brown skin. People who buy jerseys. People who play fantasy. The young and old, the rich and poor, the gamers and gamblers.
"America's Choice," the league called itself in a pamphlet distributed in the drumbeat buildup to the Super Bowl.
The pamphlet even listed reasons for such success. One of them: "extensive revenue sharing."
And yet both sides of the labor negotiations over exactly how to share all that money — the league and the players union — seem to be preparing for a football-less 2011 as if it's inevitable.
In the last generation or so, as the NFL with its wealth spreading has done nothing but get richer and richer, the discrepancy in the incomes between the rich and poor has done nothing but get more and more wide. That was true before the recession. The recession only made it worse.
The NFL has flourished using one philosophy. The nation has atrophied using another.
"You'd think the NFL owners would take a look around and see what's happened to our economic system," said Brian Moore, the Socialist Party's 2008 presidential candidate, who lives in Hernando County.
"Ultimately capitalism fails," he said, "because ultimately a small group of people get too greedy."
• • •
The director of the players union was asked here on Thursday to gauge the seriousness of the possibility of no football come 2011.
"On a scale of 1 to 10," said DeMaurice Smith, "it's a 14."
The commissioner of the league was asked here on Friday to respond to that.
The crux of this struggle can get lost in testy words, Monopoly-money numbers and the complex specifics of labor negotiations involving a multibillion-dollar corporation.
The union says the league wants the players to take an 18 percent pay cut. The league says that too high a percentage of the soaring revenues goes to the players and that some of that money is necessary to do things like build new stadiums.
Basically, though, some of the richer owners have come to think that they're sharing too much with the slightly less rich owners, so all the owners have turned to the players to get back some of the money, and the players have looked at all the money the league is making and have told the owners: You're crazy.
If the two sides don't reach an agreement by next month, next season won't have a salary cap, which means the owners can spend as much on players, or as little, as they want.
And if the two sides don't reach an agreement by March 2011? No more football.
Worst-case scenario?
"Potential devastation brought about by a lockout," said David Carter, a sports business expert at the University of Southern California.
NationalFootballPost.com is doing a webinar this month on the league's labor issues. The title: "The end of the NFL as we know it."
"It's a complicated question," veteran Pro Football Weekly editor Hub Arkush wrote in last week's issue, "no different from whether the wealthy should pay a higher percentage of tax on their incomes than the poor, which is at the heart of concerns over the future of America."
• • •
On South Beach's Ocean Drive on Friday night, across from the $19 mojitos and the techno beat and the pastel glitz, an uncle and a nephew stood on the sidewalk by the start of the sand, wearing their black and gold Saints jerseys and their Mardi Gras beads, celebrating the party for now.
They'd paid $1,500 apiece for tickets that were $800 face value.
"I had a dream about this game," David Giveans said, looking toward the sky, "and the Saints are going to play magically."
"I'm going to be eating Ramen noodles," Randy Giveans said, "for the next four months."
Twitter chief executive Jack Dorsey last year made a definitive announcement about the company's famous 140-character count amid rumors that the firm would substantially relax the limit. "It's staying," Dorsey told the "Today" show's Matt Lauer. "It's a good constraint for us."
Florida continues to improve its plan for modernizing the interstate system in Tampa Bay. The Florida Department of Transportation has unveiled four new options for rebuilding I-275 near downtown Tampa, and some of them would ditch previous plans for toll lanes downtown while keeping express lanes for faster, … | 2023-11-01T01:26:18.401715 | https://example.com/article/7087 |
Sugar Futures Under Pressure
By
Leslie Josephs
May 5, 2013 7:18 p.m. ET
NEW YORK—Big commodity traders are taking their largest delivery of sugar from the futures market in at least 24 years, highlighting concerns about securing supplies of the sweetener despite a global glut.
The companies will accept 1.43 million metric tons of sugar, worth $558.3 million, according to delivery notices posted on the... | 2024-06-03T01:26:18.401715 | https://example.com/article/5930 |
Love Games bring the spirit of Colorado snowboarding back to the Rocky Mountain State in 2013
The idea of Love Games and what snowboarding needed in Colorado started as a conversation on the lift at Eldora between myself and Scotty Goodale. We both thought Colorado was thought of in the wrong way and only known for the X Games, Dew Tour and the premiere events that come through Colorado every year. And while those events are great for Colorado and snowboarding they are simply one side of snowboarding and with all the huge parks and the major ski corps’ acceptance of snowboarding over the last twenty years.
We both felt like something was missing. Kids were missing out on all the spots that we used to ride or hear about (some of these were the quarterpipe at Vail, the ironing board at Loveland Pass, the Stump of Manhood at Copper). These were the proving grounds back in the day and if you did something at one of those spots, people talked about it. To add to the challenge of this, you had to go out with your friends and build these spots up. In some cases these were full-day builds–just manpower, shovels, and creativity. This type of riding made some of those early pros better riders and well-rounded riders; there were no pipe jocks or rails kids. It was all just snowboarding at its purest and all just for the love of it.
That was the last time I rode the lift with Scotty Goodale and a few short weeks later it all came together: a session/funtest/shred get together/whatever you want to call it, on the top of Loveland Pass, where most of Colorado’s early progression had taken place, on spots like the Bush Gap, the quarterpipe, and Pocahontas. “Love Games,” said JG Mazzotta (co-owner of Satellite). “It’s perfect. That’s the name.” Now in its third year, the hype and excitement for the Love Games and the group of people involved, is in it for the love of snowboarding and Colorado. This is what Colorado was, is, and should be: fun, kickass, no rules snowboarding with your friends. | 2023-10-22T01:26:18.401715 | https://example.com/article/1680 |
---
abstract: 'We construct a central extension of the group of automorphisms of a 2-Tate vector space viewed as a discrete 2-group. This is done using an action of this 2-group on a 2-gerbe of gerbel theories. This central extension is used to define central extensions of double loop groups.'
author:
- Sergey Arkhipov and Kobi Kremnizer
title: '2-gerbes and 2-Tate spaces'
---
Introduction
============
In this paper we study the question of constructing central extensions of groups using group actions on categories.
Let $G$ be a group. The basic observation is that the category of $\mathbb{G}_m$ central extensions of $G$ is equivalent to the category of $\mathbb{G}_m$-gerbes over the classifing stack of $G$. This is in turn equivalent to the category of $\mathbb{G}_m$-gerbes over a point with an action of $G$. Thus by producing categories with a $G$ action we get central extensions.
We then take this observation one category theoretic level higher. We want to study central extensions of 2-groups. Here a 2-group is a monoidal groupoid such that its set of connected componants is a group with the induced product. We look at the case of a dicrete 2-group, that is we can think of any group $G$ as a 2-group with objects the elements of the group, morphisems the identities and monoidal structure the product.
We see that $\mathbb{G}_m$-central extensions of a discrete 2-group are the same as 2-gerbes over the classifing stack of the group. This also can be interpreted as a 2-gerbe with $G$ action. Thus to get extensions as a 2-group we should find 2-categories with $G$-action.
These observations are used to define central extensions of automorphism groups of 1-Tate spaces and discrete automorphism 2-groups of 2-Tate spaces.
The category of $n$-Tate spaces is defined inductively. $0$-Tate spaces are finite dimensional vector spaces. $(n+1)$-Tate spaces are certain indpro objects of the category of $n$-Tate spaces. To a $1$-Tate space we can associate a 1-gerbe of determinant theories. This 1-gerbe has a natural action of the automorphism group of the 1-tate space. This gives the central extension of the group.
Similarly, to a 2-tate space we can associate a 2-gerbe of gerbel theories with an action of the automorphism group of the 2-Tate space. This action gives the central extension of the discrete 2-group.
If $G$ is a finite dimensional reductive group and $V$ is a finite dimensional representation we get an embedding of the formal double loop group $G((s))((t))$ into the automorphism group of the 2-tate space $V((s))((t))$. Thus we can restrict the central extension to the double loop group. These central extensions of the double loop group as a 2-group will be used in the future to study the (2-)represntation theory of these groups and relating it to the 2-dimensional Langlands program.
The idea of constructing the higher central extension in categorical terms belongs essentially to Michael Kapranov. S.A would like to thank him for sharing the idea in 2004.
After writing this paper we found out that a similar result was obtained by Osipov in his unpublished Preprint. S.A. would like to thank Osipov for sharing the manuscript with him.
[^1] [^2]
Group actions on gerbes and central extensions.
================================================
$\mathbb{G}_m$-gerbes and central extensions
--------------------------------------------
Let‘s recall the notion of a group acting on a category.
\[groupact\] An action of a group $G$ on a category $C$ consists of a functor $F_g:C\to C$ for each $g\in G$ and a natural transformation $\tau_{g,h}:F_{gh}\to F_g F_h$ s.t. $$\label{action cocycle}
\begin{diagram}
F_{g_1 g_2 g_3} & &\rTo^{\tau_{g_1,g_2 g_3}} & F_{g_1}F_{g_2 g_3} \\
\dTo_{ \tau_{g_1 g_2, g_3}} & & & \dTo_ {F_{g_1}(\tau_{g_2 ,g_3})} \\
F_{g_1 g_2}F_{g_3} & &\rTo^{\tau_{g_1 ,g_2}F_{g_3}} & F_{g_1}F_{g_2}F_{g_3}\\
\end{diagram}$$ commutes for any $g_1,g_2,g_3\in G$.
We also require that $F_1=Id$ and that $\tau_{1,g}=Id$ and $\tau_{g,1}=Id$.
Suppose that $C$ is a $\mathbb{G}_m$ gerbe (over a point). By this we mean that:
- $C$ is a groupoid.
- $C$ is connected (there exists an arrow between any two objects)
- For any object $A$ of $C$, $Aut(A)\simeq \mathbb{G}_m$.
Note that this implies that all the $Hom$ spaces are $\mathbb{G}_m$-torsors.
*Remark* If $C$ and $D$ are 1-gerbes then their product $C\times D$ is also a 1-gerbe. This will be used below.
In this case we have the following theorem [@Bry]:
\[centext\] Let $G$ act on a $\mathbb{G}_m$-gerbe $C$. For each object $A$ of $C$ we get a $\mathbb{G}_m$-central extension $\widetilde{G}_A$. These central extensions depend functorially on $A$ (hence are all isomorphic). If there exists an equivariant object this extension splits.
*Proof:* Let $A\in ob C$. Define $$\widetilde{G}_A=\big\{(g,\phi):g\in G,\phi\in Hom(F_g(A),A)\}$$ with product given by $$(g_1,\phi_1)(g_2,\phi_2)=(g_1 g_2, \phi_1\circ F_{g_1}(\phi_2))$$ Associativity follows from \[action cocycle\].
Another way of interpreting this theorem is as follows: An action of $G$ on a gerbe $C$ over a point is the same (by descent) as a gerbe over $\mathbb{BG}$. By taking the cover $$\begin{diagram}
pt\\
\dTo\\
\mathbb{BG}\\
\end{diagram}$$ we get that such a gerbe gives (again by descent) a line bundle $L$ over $G$ with an isomorphism $$p_1^*(L)\otimes p_2^*(L) \to m^*(L)$$ that gives a product covering that of $G$ and a coherence relation which tells us that this product is associative. Hence we get
The category of $\mathbb{G}_m$-central extensions of $G$ is equivalent to the category of $\mathbb{G}_m$-gerbes over $\mathbb{BG}$.
Central extension of the automorphism group of a 1-tate space
-------------------------------------------------------------
Let $\mathcal{V}$ be a 1-Tate space. Recall (or see section \[tate\]) that this is an ind-pro object in the category of finite dimensional vector spaces, this equivalent to $\mathcal{V}$ having a locally linearly compact topology. Any such is isomorphic to $V((t))$ (formal loops into $V$) but non-canonnically. Recall also the notion of a lattice $\mathcal{L}\subseteq \mathcal{V}$ (pro-subspace or linearly compact subspace) and that if $\mathcal{L}_1\subseteq \mathcal{L}_2$ are two lattices then $\mathcal{L}_2 /\mathcal{L}_1$ is finite dimensional.
\[det theory\] A determinant theory is a rule that assigns to each lattice $\mathcal{L}$ a one-dimensional vector space $\Delta_\mathcal{L}$ and to each pair $\mathcal{L}_1\subset\mathcal{L}_2$ an isomorphism $$\Delta_{\mathcal{L}_1 \mathcal{L}_2}:\Delta_{\mathcal{L}_1}\otimes Det(\mathcal{L}_2/\mathcal{L}_1)\to \Delta_{\mathcal{L}_2}$$ such that foe each triple $\mathcal{L}_1\subset\mathcal{L}_2\subset\mathcal{L}_3$ the following diagram commutes $$\begin{diagram}
\Delta_{\mathcal{L}_1} \otimes Det(\mathcal{L}_2/ \mathcal{L}_1) \otimes Det(\mathcal{L}_3/\mathcal{L}_2) & & & &\rTo & \Delta_{\mathcal{L}_1} \otimes Det(\mathcal{L}_3/ \mathcal{L}_1)\\
\dTo & & & & & \dTo \\
\Delta_{\mathcal{L}_2}\otimes Det(\mathcal{L}_3/\mathcal{L}_2) & & & & \rTo & \Delta_{\mathcal{L}_3} \\
\end{diagram}$$
We have the obvious notion of a morphism between two determinant theories and it is easy to see that the category of determinant theories is in fact a $\mathbb{G}_m$-gerbe.
Let $GL(\mathcal{V})$ be the group of continuous automorphisms of $\mathcal{V}$. This group acts on the gerbe of determinant theories and hence we get using theorem \[centext\] a central extension $\widetilde{GL(\mathcal{V})_\mathcal{L}}$ for each choice of lattice $\mathcal{L}$. Unless $\mathcal{V}$ itself is a lattice, this central extension does not split.
Group actions on 2-gerbes and central extensions of 2-groups
============================================================
2-Groups
--------
\[2group\] A 2-group is a monoidal groupoid $C$ s.t. its set of connected components $\pi_0(C)$ with the induced multiplication is a group.
The basic example is is the discrete 2-group associated to any group $G$: the set of objects is $G$ itself and morphisms are only the identities. The monoidal structure comes from the group multiplication. We will denote this discrete 2-group by $\mathcal{G}$.
Note that 2-groups can be defined in any category with products (or better in any topos) so we have topological, differential and algebraic 2-groups.
One can define a general notion of extensions of 2-groups but we are only interested in the following case:
Let $G$ be a group (in a topos) and $A$ an abelian group (again in the topos). A central extension $\widetilde{\mathcal{G}}$ of the discrete 2-group associated to $G$ by $A$ is a 2-group s.t.:
- $\pi_0(\widetilde{\mathcal{G}})\simeq G$
- $\pi_1(\widetilde{\mathcal{G}},I)\simeq A$
Here $I$ is the identity object for the monoidal structure and $\pi_!$ means the automorphism group of the identity object.
Action of a group on a bicategory
---------------------------------
Lets recall first the notion of a bicategory (one of the versions of a lax 2-category) [@Be].
A bicategory $\mathcal{C}$ is given by:
- Objects $A,B,...$
- Categories $\mathcal{C}(A,B)$ (whose objects are called 1-arrows and morphisms are called 2-arrows)
- Composition functors $\mathcal{C}(A,B)\times\mathcal{C}(B,C)\longrightarrow\mathcal{C}(A,C)$
- Natural transformations (associativity constraints) $$\begin{diagram}
\mathcal{C}(A,B)\times\mathcal{C}(B,C)\times\mathcal{C}(C,D) & & & \rTo & \mathcal{C}(A,B)\times\mathcal{C}(B,D)\\
&&&&\\
\dTo & & \rdImplies & &\dTo\\
&&&&\\
\mathcal{C}(A,C)\times\mathcal{C}(C,D) & & & \rTo & \mathcal{C}(A,D)\\
\end{diagram}$$
This data should satisfy coherence axioms of the Maclane hexgagon form.
*Remark* As a bicategory with one object is the same as a monoidal category the coherence axioms should become clear (though long to write).
Let $\mathcal{C}$ and $\mathcal{D}$ be two bicategories. A functor $\mathcal{F}:\mathcal{C}\to\mathcal{D}$ consists of:
- For each object $A\in Ob(\mathcal{C})$ an object $\mathcal{F}(A)\in Ob(\mathcal{D})$
- A functor $\mathcal{F}_{AB}:\mathcal{C}(A,B)\to\mathcal{D}(\mathcal{F}(A),\mathcal{F}(B))$ for any two objects $A,B\in Ob\mathcal{C}$
- A natural transformation $$\begin{diagram}
\mathcal{C}(A,B)\times\mathcal{C}(B,C) & & & \rTo & \mathcal{C}(A,C)\\
&&&&\\
\dTo^{\mathcal{F}_{AB}\times\mathcal{F}_{BC}} & & \rdImplies & &\dTo_{\mathcal{F}_{AC}}\\
&&&&\\
\mathcal{D}(\mathcal{F}(A),\mathcal{F}(B))\times\mathcal{D}(\mathcal{F}(B),\mathcal{F}(C)) & & & \rTo & \mathcal{D}(\mathcal{F}(A),\mathcal{F}(C))\\
\end{diagram}$$
This natural transformation should be compatible with the associativity constraints.
Again the comparison with monoidal categories should make it clear what are the compatibilities.
Let $\mathcal{F}$ and $\mathcal{G}$ be two functors between $\mathcal{C}$ and $\mathcal{D}$. A natural transformation $(\Xi,\xi)$ is given by:
- A functor $\Xi_{AB}:\mathcal{D}(\mathcal{F}(A),\mathcal{F}(B))\to \mathcal{D}(\mathcal{G}(A),\mathcal{G}(B))$ for each pair of objects
- A natural transformation $$\begin{diagram}
\mathcal{C}(A,B) && & \rTo^{\mathcal{F}_{AB}} & \mathcal{D}(\mathcal{F}(A),\mathcal{F}(B))\\
&\rdline^{\mathcal{G}_{AB}} &&\ldImplies^{\xi_{AB}}& \dTo_{\Xi_{AB}}\\
&&\rdTo&&\\
& &&& \mathcal{D}(\mathcal{G}(A),\mathcal{G}(B)) \\
\end{diagram}$$
These should be compatible with the structures.
Given two natural transformations $(\Xi^1,\xi^1),(\Xi^2,\xi^2):\mathcal{F}\to\mathcal{G}$ a modification is a natural transformation $\phi_{AB}:\Xi^1_{AB}\to\Xi^2_{AB}$ such that $$\begin{diagram}
\Xi^1_{AB}\mathcal{F}_{AB}&\rImplies^{\xi_{AB}}&\mathcal{G}_{AB}\\
\dImplies^{\phi_{AB}\mathcal{F}_{AB}}& &\dImplies_{Id}\\
\Xi^2_{AB}\mathcal{F}_{AB}&\rImplies^{\xi_{AB}}&\mathcal{G}_{AB}\\
\end{diagram}$$ commutes for all $A$ and $B$ and is compatible with all the structures.
Now we can define an action of a group on a bicategory:
Let $G$ be a group and $\mathcal{C}$ a bicategory. An action of $G$ on $\mathcal{C}$ is given by a functor $\mathcal{F}_g:\mathcal{C}\to\mathcal{C}$ for each $g\in G$ and a natural transformation $(\Xi,\xi)_{g,h}:\mathcal{F}_{gh}\to \mathcal{F}_g\mathcal{F}_h$ such that there exists a modification $$\
\begin{diagram}
\mathcal{F}_{g_1 g_2 g_3} & &\rTo^{(\Xi,\xi)_{g_1,g_2 g_3}} &\mathcal{F}_{g_1}\mathcal{F}_{g_2 g_3} \\
\dTo^{ (\Xi,\xi)_{g_1 g_2, g_3}} & & \ldImplies^{\phi_{g_1,g_2,g_3}}& \dTo_ {\mathcal{F}_{g_1}((\Xi,\xi)_{g_2 ,g_3})} \\
&&&\\
\mathcal{F}_{g_1 g_2}\mathcal{F}_{g_3} & &\rTo^{(\Xi,\xi)_{g_1 ,g_2}\mathcal{F}_{g_3}} &\mathcal{F}_{g_1}\mathcal{F}_{g_2}\mathcal{F}_{g_3}\\
\end{diagram}$$ for any $g_1,g_2,g_3\in G$ satisfing a cocycle condition.
2-gerbes and central extensions of 2-groups
-------------------------------------------
Let $A$ be an abelian group.
A 2-gerbe (over a point) with band $A$ is a bicategory $\mathcal{C}$ such that
- It is a 2-groupoid: every 1-arrow is invertible up to a 2-arrow and all 2-arrows are invertible.
- It is connected: there exists a 1-arrow between any two objects and a 2-arrow between any 1-arrows.
- The automorphism group of any 1-arrow is isomorphic to $A$
In other words all the categories $\mathcal{C}(A,B)$ are 1-gerbes with band $A$ and the product maps are maps of 1-gerbes.
Suppose $G$ acts on a 2-gerbe $\mathcal{C}$ with band $A$. To this we can associate a central extension $\widetilde{\mathcal{G}}$ of the discrete 2-group associated to $G$ by $A$.
The construction is the same as in \[centext\] (with more diagrams to check). A better way of presenting the construction is using descent: a 2-gerbe with an action of $G$ is the same as a 2-gerbe over $\mathbb{BG}$ (we haven‘t defined 2-gerbes in general but the definition is clear [@Bre]). Using the same cover as before $pt\to \mathbb{BG}$ we get a gerbe over $G$ which is multiplicative. That means that we are given an isomorphism $$p_1^*(\mathcal{F})\otimes p_2^*(\mathcal{F})\to m^*(\mathcal{F})$$ satisfying a cocycle condition on the threefold product (here $m:G\times G\to G$ is the multiplication). This gerbe gives in turn an $A$-torsor over $G\times G$ giving the Hom-spaces of the 2-group and the multiplicative structure gives the monoidal structure.
This construction also works in the other direction. Suppose we have a central extension of the discrete 2-group $\mathcal{G}$ associated to the group $G$ by the abelian geoup $A$. Then the Hom spaces define an $A$-torsor $\mathcal{HOM}$ over $G\times G$ and the existance of composition means that over $G\times G\times G$ we are given an isomorphism: $$p_{12}^*(\mathcal{HOM})\otimes p_{23}^*(\mathcal{HOM})\to p_{13}^*(\mathcal{HOM})$$ satisfying a cocycle condition over the fourfold product (associativity). Here $p_{ij}$ are the projections. Thus we have a gerbe over $G$ with band $A$. Let‘s denote this gerbe by $\mathcal{F}$.
The existence of the monoidal structure implies that we are given an isomorphism over $G\times G$ $$p_1^*(\mathcal{F})\otimes p_2^*(\mathcal{F})\to m^*(\mathcal{F})$$ satisfying a cocycle condition on the threefold product. Hence the gerbe is multiplicative. In other words we got:
A central extension of the discrete 2-group associated to $G$ by $A$ is the the same as a 2-gerbe over $\mathbb{BG}$ with band $A$.
Actually also here we have an equivalence of categories.
Today‘s technology ([@Lu])enables one to define n-gerbes with nice descent theory. So we can generalize the whole discussion to:
\[n-extension\] The category of n-gerbes with band $A$ and with action of $G$ is equivalent to that of central extensions by $A$ of the discrete n-group associated to $G$.
This will be done in another paper.
2-Tate spaces and 2-groups {#tate}
==========================
In this section we introduce the notion of a locally compact object introduced by Beilinson and Kato [@B; @K].
Locally compact objects in a category
-------------------------------------
Let $C$ be a category. The category of locally compact objects of $C$ is the full subcategory of $Ind(Pro(C))$ consisiting of functors that are isomorphic to diagrams of the following sort: Let $I,J$ be linearly directed orders. Let $F:I^{op}\times J\to C$ be a diagram such that for all $i,i`\in I$ and $j,j`\in J$ $i\leq i`$ and $j\leq j`$ the diagram: $$\begin{diagram}
F(i`,j)& \rTo & F(i`,j`)\\
\dTo& & \dTo\\
F(i,j)&\rTo &F(i`,j)\\
\end{diagram}$$ is both cartesian and cocartesian and vertical arrows are surjections and horizontal arrows are injections. A compact object is a locally compact object isomorphic to one which is constant in the Ind direction.
The following statement follows easily from set-theory and the Yoneda lemma:
If $F$ is locally compact then the functors $\stackrel{lim}{\leftarrow}\stackrel{lim}{\rightarrow}F$ and $\stackrel{lim}{\rightarrow}\stackrel{lim}{\leftarrow}F$ are naturally isomorphic.
From now on we will assume that the indexing sets $I,J$ are countable.
Suppose $C$ is an exact category. Say a sequence of locally compact objects is exact if it can be represented by a map of diagrams $F_1\to F_2\to F_3 :I^{op}\times J\to C$ where all the arrows are exact in $C$. A routine check shows :
The category of locally compact objects of $C$ is exact.
Note that if $C$ is Abelian (and nontrivial) the category of locally compact objects is not abelian.
Using the standard reindexing trick (Appendix of [@AM]) we also get
Let $F_1\to F_2$ be an admissible injection (w.r.t. the exact structure) of compact objects then $coker(F_1\to F_2)$ is also a compact object.
Let $F_1$ and $F_2$ be two admissible compact subobjects of $F$ then $F_1\times_F F_2$ is also compact.
Now we can define inductively n-Tate spaces (we still assume that the indexing sets are countable):
A 0-Tate space is a finite dimensional vector space. Suppose we have defined the category of n-Tate spaces. A $n+1$-Tate space is a locally compact object of n-Tate spaces. A lattice of a $n+1$-Tate space is an admissible compact subobject.
Note that any 2-Tate space is of the form $\mathcal{V}((t))$ where $\mathcal{V}$ is a 1-Tate space. An example of a lattice in this case is $\mathcal{V}[[t]]$.
Some facts on 1-Tate spaces
---------------------------
We have from the previous section that:
The category of (1-)Tate spaces is an exact category with injections set-theoretic injections and surjections dense morphisms.
Recall also the notion of the determinant grebe associated to a Tate space $\mathcal{V}$. From now on we will denote it by $\mathcal{D}_\mathcal{V}$.
Let $$0\to \mathcal{V}'\to \mathcal{V} \to \mathcal{V}'' \to 0$$ be an admissible exact sequence of Tate spaces. Then we have an equivalence of $\mathbb{G}_m$-gerbes $$\mathcal{D}_{\mathcal{V}'}\otimes \mathcal{D}_{\mathcal{V}''}\to \mathcal{D}_\mathcal{V}$$ such that if $\mathcal{V}_1\subset\mathcal{V}_2\subset\mathcal{V}_3$ then we have a natural transformation $$\begin{diagram}
\mathcal{D}_{\mathcal{V}_1} \otimes \mathcal{D}_{\mathcal{V}_2/ \mathcal{V}_1} \otimes \mathcal{D}_{\mathcal{V}_3/\mathcal{V}_2} & & &\rTo & \mathcal{D}_{\mathcal{V}_1} \otimes \mathcal{D}_{\mathcal{V}_3/ \mathcal{V}_1}\\
\dTo & & & & \dTo \\
&&\ldImplies&&\\
&&&&\\
\mathcal{D}_{\mathcal{V}_2}\otimes \mathcal{D}_{\mathcal{V}_3/\mathcal{V}_2} & & & \rTo & \mathcal{D}_{\mathcal{V}_3} \\
\end{diagram}$$ and if we have $\mathcal{V}_1\subset\mathcal{V}_2\subset{V}_3\subset\mathcal{V}_4$ then a cubical diagram of natural transformations commutes.
2-Tate spaces and gerbel theories
---------------------------------
It follows from the previous discussion that:
Let $\mathbb{V}$ be a 2-Tate space.
1. If $\mathbb{L}'\subset \mathbb{L}$ are two lattices then $\mathbb{L}/\mathbb{L}'$ is a 1-Tate space.
2. For any two lattices $\mathbb{L}$ and $\mathbb{L}'$ there exists a third lattice $\mathbb{L}''\subset \mathbb{L}\cap\mathbb{L}'$
Now we can define a gerbel theory.
Let $\mathbb{V}$ be a 2-vector space. A gerbel theory $\mathbb{D}$ is
- For each lattice $\mathbb{L}\subset\mathbb{V}$ a $\mathbb{G}_m$-gerbe $\mathbb{D}_\mathbb{L}$
- If $\mathbb{L}'\subset\mathbb{L}$ are two lattices then we have an equivalence $$\begin{diagram}
\mathbb{D}_\mathbb{L} &\rTo^{\phi_{\mathbb{L}\mathbb{L}'}}& &\mathbb{D}_{\mathbb{L}'}\otimes \mathcal{D}_{\mathbb{L}/\mathbb{L}'}\\
\end{diagram}$$
- For $\mathcal{V}_1\subset\mathcal{V}_2\subset\mathcal{V}_3$ we have a natural transformation $$\begin{diagram}
\mathbb{D}_{\mathcal{V}_1} \otimes \mathcal{D}_{\mathcal{V}_2/ \mathcal{V}_1} \otimes \mathcal{D}_{\mathcal{V}_3/\mathcal{V}_2} & & &\rTo & \mathbb{D}_{\mathcal{V}_1} \otimes \mathcal{D}_{\mathcal{V}_3/ \mathcal{V}_1}\\
\dTo & & & & \dTo \\
&&\ldImplies&&\\
&&&&\\
\mathbb{D}_{\mathcal{V}_2}\otimes \mathcal{D}_{\mathcal{V}_3/\mathcal{V}_2} & & & \rTo & \mathbb{D}_{\mathcal{V}_3} \\
\end{diagram}$$
Given $\mathcal{V}_1\subset\mathcal{V}_2\subset\mathcal{V}_3$ these natural transformations should commute on a cubical diagram.
Now we have
Gerbel theories on a given 2-Tate space $\mathbb{V}$ form a $\mathbb{G}_m$ 2-gerbe $\mathbb{GERB}_\mathbb{V}$.
Let‘s denote $\mathbb{GL}(\mathbb{V})$ the group of continuos automorphisms of a 2-Tate space $\mathbb{V}$. This group acts naturally on the 2-gerbe $\mathbb{GERB}_\mathbb{V}$. *Remark* the action is actually a strict one. We get:
Let $\mathbb{V}$ be a 2-Tate space. Given a lattice $\mathbb{L}\subset\mathbb{V}$ we get a $\mathbb{G}_m$ central extension of the discrete 2-group associated to $\mathbb{GL}(\mathbb{V})$.
Using \[n-extension\] we can go on and define central extensions of discrete n-groups of automorphism of n-Tate spaces.
### Application: central extension of a double loop group
Let $G$ be a finite dimensional reductive group over a field. Let $V$ be a finite dimensinal representation of $G$. From this data we get a map $$G((s))((t))\to \mathbb{GL}(V((s))((t)))$$ where $G((s))((t))$ is the formal double loop group of $G$. From this embedding we get a central extension of the discrete 2-group $G((s))((t))$.
### A variant
There is another way to think about $\mathbb{G}_m$-gerbes.
Let $\mathit{Pic}$ be the symmetric monoidal groupoid of 1-dimensional vector spaces. A $\mathbb{G}_m$-gerbe is a module category over this monoidal category equivalent to $\mathit{Pic}$ as module categories (where $\mathit{Pic}$ acts on itself by the monoidal structure).
This definition is equivalent to the definition given before. Now, following Drinfeld [@Dr] we define a graded version of a $\mathbb{G}_m$-gerbe.
Let $\mathit{Pic}^\mathbb{Z}$ be the symmetric monidal groupoid of $\mathbb{Z}$-graded 1-dimensional vector spaces with the super-commutativity constraint ($a\otimes b \to (-1)^{deg(a)deg(b)} b\otimes a$). A $\mathbb{Z}$-graded $\mathbb{G}_m$-gerbe is a module category over $\mathit{Pic}^\mathbb{Z}$ equivalent to it as module categories.
We have a map from $\mathit{Pic}^\mathbb{Z}$ to the discrete 2-group $\mathbb{Z}$ which sends a 1-dimensional graded vector space to its degree. This map induces a functor between graded $\mathbb{G}_m$-gerbes and $\mathbb{Z}$-torsors. We can now repeat the entire story with $\mathbb{Z}$-graded gerebs. For instance, instead of a determinant theory we will get a graded determinant theory. The $\mathbb{Z}$-torsor coing to it will be the well known dimension torsor of dimension theories. A dimension theory for a 1-Tate space is a rule of associating an integer to each lattice satisfying similar conditions as a determinant theory.
In this way we will get for a 2-Tate space an action of $\mathbb{GL}(\mathbb{V})$ on the $\mathbb{G}_m$-gerbe of dimension torsors. This action will give us a central extension of the group $\mathbb{GL}(\mathbb{V})$ (not the 2-group!). And similarly we can get central extensions of groups of the form $G((s))((t))$. Thus we see that if we work with graded determinant theory we get a central extension of the dicrete 2-group $\mathbb{GL}(\mathbb{V})$ which induces the central extension of the group $\mathbb{GL}(\mathbb{V})$ (For this central extension see [@O]).
Another reason to work with graded theories is that they behave much better for the direct sum of 1-Tate spaces. It is true that the determinant gerbe of the direct sum of 1-Tate spaces is equivalent to the tensor product of the gerbes but this equivalence depends on the ordering. If one works with graded determinant theories this equivalence will be canonical.
M. Artin, B. Mazur, *Etale Homotopy*, Lecture Notes in Mathematics 100, Springer-Verlag 1969.
A. A. Beilinson, *How to glue perverse sheaves* in: *K-theory, Arithmatic and Geometry* Editor: Y. I. Manin, Lecture Notes in Mathematics 1289, 42-51, Springer-Verlag 1987.
Benabou, Jean *Introduction to bicategories.* 1967 Reports of the Midwest Category Seminar pp. 1–77 Springer, Berlin
Breen, Lawrence *On the classification of $2$-gerbes and $2$-stacks.* Astérisque No. 225 (1994)
Brylinski, Jean-Luc *Central extensions and reciprocity laws.* Cahiers Topologie Géom. Différentielle Catég. 38 (1997), no. 3, 193–215.
Drinfeld, Vladimir *Infinite-dimensional vector bundles in algebraic geometry: an introduction.* The unity of mathematics, 263–304, Progr. Math., 244, Birkhäuser Boston, Boston, MA, 2006.
Kato, Kazuya *Existence theorem for higher local fields.* Invitation to higher local fields (Münster, 1999), 165–195 (electronic), Geom. Topol. Monogr., 3, Geom. Topol. Publ., Coventry, 2000.
Lurie, Jacob *Higher Topos Theory.*, arXiv:math/0608040
Osipov, D. V. *Central extensions and reciprocity laws on algebraic surfaces.* (Russian) Mat. Sb. 196 (2005), no. 10, 111–136; translation in Sb. Math. 196 (2005), no. 9-10, 1503–1527
[^1]: K.K. was supported in part by NSF grant DMS-0602007.
[^2]: S.A. was supported in part by NSERC.
| 2024-04-06T01:26:18.401715 | https://example.com/article/2319 |
Ahead of Gameweek 21, with Harry Kane out of the picture, we have reviewed the two players who are possibly the standouts for the armband in a head to head piece: Eden Hazard and Mo Salah.
Our designer Marco has created this head 2 head infographic:
Eden Hazard
The Case For:
The Stoke defence is decimated : Zouma is ineligible, Martins Indi and captain Shawcross are injured. Even full back Pieters has a knock which leaves a one man #Wimmerwatch defending the line.
: Zouma is ineligible, Martins Indi and captain Shawcross are injured. Even full back Pieters has a knock which leaves a one man #Wimmerwatch defending the line. Hazard has been called out for his poor form recently in FPL, but the underlying stats still prove his capability. He is in form in terms of how he’s actually playing, it’s worth remembering: in those matches where he has blanked in FPL terms, he has been praised as man of the match and has had standing ovations when substituted off.
still prove his capability. He is in form in terms of how he’s actually playing, it’s worth remembering: in those matches where he has blanked in FPL terms, he has been praised as man of the match and has had standing ovations when substituted off. Perhaps crucially, Chelsea have a much longer rest between games, with them next playing on 3rd January – a whole 48 hours more time to recover between Gameweeks than Liverpool’s players, which may equal less rotation in this fixture.
between games, with them next playing on 3rd January – a whole 48 hours more time to recover between Gameweeks than Liverpool’s players, which may equal less rotation in this fixture. He’s also a good chaser captain, remaining a differential at just 12% owned – if he smashes it, you could really rise in your mini-leagues and overall.
The Case Against:
We all know that Hazard is a great player, but as an FPL asset questions are beginning to be asked . The Newcastle game where he scored a brace feels like a distant memory as after 5 gameweeks all he has managed is an assist in terms of attacking returns – and that was being tripped for an Alonso free kick.
. The Newcastle game where he scored a brace feels like a distant memory as after 5 gameweeks all he has managed is an assist in terms of attacking returns – and that was being tripped for an Alonso free kick. After a less than stellar recent history, can we really trust him as a captaincy option?
Mo Salah
The Case For:
He’s so consistent ! Anyone who has been playing FPL this season cannot be playing seriously if they do not already own this guy. He has only blanked 5 of the 20 Gameweeks this season and has failed to register attacking returns only once since Gameweek 9.
! Anyone who has been playing FPL this season cannot be playing seriously if they do not already own this guy. He has only blanked 5 of the 20 Gameweeks this season and has failed to register attacking returns only once since Gameweek 9. 15 goals and 7 assists is a phenomenal record in what has been a fantastic maiden season at Liverpool for the Egyptian and he has rightly deserved all the plaudits that have come his way
record in what has been a fantastic maiden season at Liverpool for the Egyptian and he has rightly deserved all the plaudits that have come his way With his high ownership, if you are looking for “safety in numbers” in terms of a consistent captain Salah is your man.
The Case Against:
There is always that danger with Klopp and Liverpool that there will be rotation , especially right now. Klopp has rotated more than any other Premier League manager this season and nobody seems safe – especially with just 48 hours between Liverpool fixtures.
, especially right now. Klopp has rotated more than any other Premier League manager this season and nobody seems safe – especially with just 48 hours between Liverpool fixtures. Leicester perhaps is not the easiest fixture, in our podcast we talked on our about targetting teams with your captaincy picks and Leicester wasn’t one of the teams we mentioned. Although they haven’t exactly been defensively solid in recent weeks, they also haven’t been experiencing the thrashings the likes of Southampton, Swansea and the aforementioned Stoke have.
Conclusion
In a battle of Salah vs Hazard, based on this season’s form there can only be one winner – that is Mo Salah. His attacking returns this season have been phenomenal and week in week out he has been showing consistency which is unparalleled by any other FPL player this season.
For Nick, he is getting the armband for his FPL team this Gameweek as he’s in a good position overall and in his mini leagues.
In contrast, Tom needs to land differential captains and is probably giving Hazard one last chance – the season’s form does favour Salah, but we have seem that Hazard is a good enough player to smash it in any circumstance… he’s hoping it’ll happen today.
Who will you pick?
Good luck from both of us this Gameweek.
WGTA. | 2024-06-09T01:26:18.401715 | https://example.com/article/1536 |
Weinstein Company & Vivendi ink home entertainment deal
MUMBAI: The Weinstein Company (TWC) and Vivendi Entertainment (VE) have entered into a home entertainment partnership that will make Vivendi Entertainment the exclusive distributor of The Weinstein Company library and grant VE the rights to distribute 20 new direct-to-DVD titles from TWC over the next year.
The Weinstein Company library includes a vast array of titles and brands, as well as feature films such as The Reader, 2009 Oscar nominee for Best Picture featuring Academy Award Best Actress winner Kate Winslet and Vicky Cristina Barcelona, featuring Academy Award Best Supporting Actress winner Penelope Cruz; the Dragon Dynasty series with films featuring Jackie Chan and Jet Li; Dimension Extreme titles including George Romero’s Diary of the Dead, Pulse 2 and 3, Dario Argento’s Mother Of Tears, Hell Ride, presented by Quentin Tarantino, Teeth and many others; classics like El Cid starring Charleton Heston and Sophia Loren, andFall of the Roman Empire; as well as animated classics including The Reef, Tortoise & The Hare, The Blue Elephant, Jerry Lewis’ animated remake of his legendary film The Nutty Professor, and more.
TWC co-chairman Bob Weinstein said, "Vivendi Entertainment is a great place to build our home entertainment library and, in keeping with our plan for the company, develop and increase our catalog business. We have a relationship with Doug Morris going back twenty years and we are thrilled to be putting our library into Vivendi’s hands."
VE president Tom O’Malley added, "It’s a great honor to be partnering with Bob and Harvey. They are both icons in the film industry and having them as partners takes Vivendi Entertainment to a new level. We’re thrilled to be representing their catalog to retailers and are excited about their upcoming slate of direct-to-DVD films." | 2023-10-16T01:26:18.401715 | https://example.com/article/3599 |
Revised. Amendments from Version 1
==================================
The reviewers were critical about oxidant-resistance of the B-YL peptide, use of surfactant therapy to treat ALI/ARDS, the modelling data set and requested additional information about the design and production of B-YL peptide, captive bubble surfactometry and animal experiments. As a response to the reviewer's comments, we removed our claims about oxidant-resistance of the B-YL peptide and surfactant usage in ALI/ARDS. We decided to remove the methodology and results sections (and figures 5-8) on homology models, molecular dynamic (MD) simulation and Membrane Protein Explorer (MPEx) from the manuscript as modeling was only a secondary focus and needs more work to answer the questions raised. After we complete running more simulations, we plan to publish a separate manuscript with a more extensive modeling data set. We answered the various questions about the design and production of B-YL peptide, captive bubble surfactometry and animal experiments. The manuscript now focuses on the high *in vitro* and *in vivo* surface activities of the sulfur-free surfactant protein B peptide mimic B-YL and we reflected this in the new title.
Introduction
============
Lung surfactant is a lipid-protein mixture that is synthesized by alveolar type II cells and secreted into the alveolus where it reduces surface tension at the air-liquid interface. Mammalian lung surfactant harvested by lavage consists of approximately 80% phospholipids, 10% neutral lipids and 10% protein [@ref-1]. Phospatidylcholine (PC), and particularly dipalmitoylphosphatidylcholine (DPPC), is the major phospholipid constituent of lung surfactant. DPPC enhances the formation of a rigid film at the air-liquid interface that reduces alveolar surface tension to low values during dynamic compression, whereas fluid phospholipids and neutral lipids are important because they significantly improve film spreading [@ref-2][@ref-3]. The highly hydrophobic surfactant protein B (SP-B) and, to a lesser extent, surfactant protein C (SP-C), facilitate the absorption of phospholipids into the air-liquid interface and thus play an important role in the reduction of alveolar surface tension. SP-B is pivotal for normal lung function, by hereditary SP-B deficiency being fatal in newborn infants [@ref-4] and also in SP-B knockout mice [@ref-5]. Human SP-B is a 79 amino-acid, lipid-associating monomer (MW 8.7 kDa) found in the lung as a covalently linked homodimer. Early theoretical studies based on homology comparisons indicated that the SP-B monomer consists of 4-5 α-helices [@ref-6][@ref-10] with three intramolecular disulfide bridges (i.e., Cys-8 to Cys-77, Cys-11 to Cys-71 and Cys-35 to Cys-46) [@ref-11], and belongs to the saposin protein superfamily [@ref-12]. The helical bundle for SP-B folds into two leaves, with one leaf having α-helices 1 (N-terminal helix), 5 (C-terminal helix) and 4 and the other composed of α-helices 2 and 3 [@ref-13][@ref-14].
Intratracheal administration of animal-derived lung surfactants, which contain only polar lipids and native SP-B and SP-C, has greatly improved morbidity and mortality of premature infants with neonatal respiratory distress syndrome (RDS) as a result of surfactant-deficiency due to lung immaturity [@ref-15]. Existing clinically available formulations are extracted from lung lavages or homogenates from pigs (Curosurf®) and cows (Infasurf®, Survanta®), and contain small amounts of SP-B and SP-C (\<\< 2% of total weight) in a lipid extract with DPPC as its main component. Based on the predicted 3D-saposin motif for SP-B, we have developed minimal SP-B constructs that have desirable structural properties and maintain high activities in animal models of surfactant deficiencies [@ref-9][@ref-10]. For example, Super Mini-B (SMB) is a 41-residue, 'short-cut' peptide ( [Figure 1A](#f1){ref-type="fig"}), based on the primary sequence, secondary structure and tertiary folding of the known sequence of native SP-B (79-residues), that mimics the high surfactant activity of its parent protein [@ref-10][@ref-14][@ref-16]. SMB incorporates the N-terminal α-helix ( residues 8-25) and C-terminal α-helix ( residues 63-78) of native SP-B as a single linear peptide ( [Figure 1A](#f1){ref-type="fig"}), joined together with a customized turn to form a α-helix hairpin (α-helix/turn/α-helix, αtα) [@ref-17]. SMB has two vicinal disulfide bonds (i.e., Cys-8 to Cys-77 and Cys-11 to Cys-71) that further covalently link the N- and C-terminal α-helices, and also a hydrophobic N-terminal insertion sequence (i.e., residues 1-7; FPIPLPY). Experimental procedures validated the above structural model for SMB, including conventional C-FTIR spectroscopy, mass spectroscopy, I-TASSER, ModWeb and SWISS MODEL homology modeling, and Molecular Dynamics (MD) simulations in lipid mimics and lipid bilayers [@ref-14][@ref-16][@ref-18]. When formulated with a lipid composition that mimics that of native lung surfactant, SMB has shown excellent surface activity with fresh and stored preparations, which was closely associated with the formation of an α-helix hairpin [@ref-10][@ref-14][@ref-18].
{#f1}
Because surfactant therapy is life-saving in preventing and treating RDS in preterm infants, on-going research is studying whether surfactant therapy may be efficaciously extended to pediatric and adult patients with clinical acute lung injury (ALI) or the acute respiratory distress syndrome (ARDS) [@ref-19]. ALI and ARDS may each be caused by direct exposure of lungs to pathogens, oxidative air pollutants, cigarette smoke and other irritants in the alveolar space, and by the presence of endogenous reactive oxygen species (ROS) in damaged lungs due to permeability edema or the inflammatory response. Subsequent oxidative alterations may produce dysfunctional and even inactive lung surfactant in these diseases [@ref-20][@ref-21]. SP-B is an important target for ROS-induced oxidative surfactant inactivation [@ref-22][@ref-23]. Specifically, oxidation of native SP-B involves alterations in the methionines (Met-29, Met-65) and tryptophan (Trp-9), which correlates well with the loss of *in vitro* surfactant activity [@ref-23]. Mimics based on the native SP-B sequence may be likewise sensitive to oxidation processes. Kim *et al.* [@ref-24] reported that ozone treatment of SP-B(1--25), an SP-B mimic whose sequence overlaps residues 1--25 of SMB ( [Figure 1A](#f1){ref-type="fig"}) and native SP-B, variably oxidized amino-acids known to react with ozone. In contrast to the nearly complete homogenous oxidation of the susceptible SP-B(1--25) residues (i.e., Cys-8, Cys-11, Trp-9, and Met-21) in the solvent phase, only a limited subset of residues (Trp-9 and Met-21) oxidized in the hydrophobic interfacial environment provided by the lipid surfactant layer [@ref-24]. In additional studies, Hemming *et al.* [@ref-25] showed that exposure of either SP-B ~1--25~ or SMB at the air-water interface to dilute ozone ( 2 ppm) produced a rapid loss of surface activity (i.e., increase in surface tension). Because decreases in tryptophan fluorescence occurred concurrently with increasing surface tension for these two SP-B mimics [@ref-25], it is likely that oxidative disruption of the indole ring of Trp-9 can play a role in the diminished surface activity in the full-length protein, possibly due to a fraying of the N-terminal α-helix [@ref-25][@ref-26].
Synthetic lung surfactant with SP-B and SP-C peptide mimics offers substantial advantages over current animal-derived surfactants for treating surfactant deficiency in neonatal RDS. Current research on synthetic lung surfactant has focused on designing peptide mimics of natural surfactant proteins that are highly effective, stable, and easy to manufacture [@ref-9][@ref-10]. Here, we conducted structural and functional experiments on 'B-YL' ( [Figure 1B](#f1){ref-type="fig"}), a 41-residue SMB variant that has its four Cys and two Met residues replaced by Tyr (Tyr-8, Tyr-11, Tyr-34 and Tyr-40) and Leu (Leu-21 and Leu-28), respectively, and tested whether these hydrophobic substitutions produce a surface-active, α-helix hairpin. Tyrosine was substituted for cysteine because of its aromatic ring interactions that emulate disulfide formation [@ref-27][@ref-29] and methionine, that is easily oxidized, was replaced by leucine based on its similar molecular structure and polarity [@ref-30].
Methods
=======
Materials
---------
HPLC grade chloroform, methanol, trifluoroethanol (TFE), and acetonitrile were purchased from Fisher Scientific (Pittsburgh, PA 15275), trifluoroacetic acid from Sigma Chemical Co (Saint Louis, MO 63103), NMR quality deuterated water was from Aldrich Chemical Co. (St. Louis, MO 63103), and Sephadex LH-20 chromatography gel from Pharmacia (Uppsala, Sweden). Phospholipids were supplied by Avanti Polar Lipids (Alabaster, AL 35007), and Sodium Dodecyl Sulfate (SDS) detergent was from Sigma Chemical Co (Saint Louis, MO 63103).
The Super Mini-B (SMB) peptide sequence ( [Figure 1A](#f1){ref-type="fig"}) was synthesized using a standard Fmoc protocol with a Symphony Multiple Peptide Synthesizer (Protein Technologies, Inc., Tucson, AZ 87514) or a CEM Liberty microwave synthesizer (CEM Corporation, Mathews, NC 28104), cleaved-deprotected and purified using reverse phase HPLC as described earlier [@ref-14][@ref-18]. This synthesis protocol included folding of the peptide in a structure-promoting TFE-buffer solvent system to promote oxygen-mediated disulfide linkages between Cys-8 and Cys-40 and between Cys-11 and Cys-34 [@ref-10][@ref-14]. This covalently stabilized connectivity gave the peptide a helix-hairpin conformation, comparable to the topological organization seen for the N- and C-terminal helical domains of the saposin family of proteins [@ref-9][@ref-10][@ref-12]. The synthesis of B-YL was identical to that of SMB, except for replacing cysteines with tyrosines (Tyr-8, Tyr-11, Tyr-34, and Tyr-40) and methionines with leucines (Leu-21 and Leu-28), and also omitting the oxidation step. The purified SMB and B-YL peptides were each freeze-dried directly, and the masses were confirmed by MALDI TOF mass spectrometry as described previously [@ref-17]. Peptide concentrations were routinely quantitated using UV absorbance based on the assay procedure developed by Anthis and Clore [@ref-31].
Preparation of proteins and lipids in surfactant dispersions
------------------------------------------------------------
Peptide and lipids were formulated as lipid-peptide dispersions to have a total of 3% by mole fraction of SMB or B-YL and 35 mg of total lipid \[i.e., DPPC: POPC: POPG 5:3:2 mole:mole:mole\] per mL of dispersion [@ref-18]. The peptide was dissolved in 10 mL of trifluoroethanol and co-solvated with the lipid in chloroform, followed by removal of the solvents with a stream of nitrogen gas and freeze drying of the resulting lipid-peptide film to remove residual solvent. The film was then dispersed with Phosphate Buffered Saline and the sample flask containing the hydrated film was rotated for 1 h at 60°C to produce a solution of multilamellar vesicles (MLVs) [@ref-14]. Lipid controls were similarly prepared but without peptide. These dispersions were then stored at 4°C prior to structural and functional measurements. To determine the molecular mass of peptides formulated with lipids, the peptide was separated from lipid using normal phase chromatography with Sephadex LH-20 [@ref-32]. Mass spectral analysis of the B-YL peptide indicated there was no change in the molecular weight due to oxidation of tyrosines or tryptophan for one year when formulated with surfactant lipids.
Circular dichroism (CD) spectroscopy of the secondary structure of the B-YL mimic
---------------------------------------------------------------------------------
CD spectra (190--260 nm) of the B-YL peptide in various structure-promoting environments, including surfactant dispersions, were measured with a JASCO 715 spectropolarimeter (Jasco Inc., Easton MD 21601). The instrument was routinely calibrated for wavelength and optical rotation using 10-camphorsulphonic acid [@ref-33]. The sample solutions were scanned using 0.01 cm pathlength cells at a rate of 20 nm per minute, a sample interval of 1 nm, and a temperature of 37°C. Sample concentration was determined by UV absorbance at 280 nm [@ref-31]. Peptide concentration was 100 μM in sample solutions with either TFE:Phosphate buffer (10 mM, pH 7.0) having a volume ratio of 4:6 (v/v), SDS micelles (100 mM) in phosphate buffer (10 mM, pH 7.0), or Single Unilamellar Vesicles (SUVs) of simulated surfactant lipids (DPPC: POPC: POPG; 5:3:2, mole:mole:mole). Surfactant lipid SUVs were prepared at a concentration of 2.6 μM lipids/mL of phosphate buffer solution (10 mM, pH 7.0) by bath sonication for 10 minutes ( <https://avantilipids.com/tech-support/liposome-preparation/>). Sample spectra were baseline corrected by subtracting spectra of protein-free solution from that of the protein-bound solution and expressed as the Mean Residue Ellipticity \[θ\] ~MRE~ as shown in [equation (1)](#e1){ref-type="other"}:
$${{\lbrack\text{θ]}}_{\text{MRE}} = (\lbrack\text{θ]} \times \text{100})/(1 \times \text{c} \times \text{N})}\mspace{144mu}\left( 1 \right)$$
The symbol θ is the measured ellipticity in millidegrees, l is the pathlength in cm, N is the number of residues in the peptide, and c is the concentration of the peptide in mM.
Quantitative estimates of the secondary structural contributions were also made with SELCON 3 [@ref-34] using the spectral basis set for membrane proteins, option 4 implemented from the [DichroWeb website](http://dichroweb.cryst.bbk.ac.uk/html/home.shtml) [@ref-35][@ref-36].
Attenuated-Total-Reflectance Fourier-transform infrared (ATR-FTIR) spectrometry of the B-YL and SMB peptides
------------------------------------------------------------------------------------------------------------
ATR-FTIR spectra were recorded at 37°C using a Bruker Vector 22 FTIR spectrometer (Pike Technologies, Fitchburg, WI 53719) with a deuterium triglyceride sulfate (DTGS) detector. The spectra were averaged over 256 scans at a gain of 4 and a resolution of 2 cm [@ref-14]. For spectra of B-YL and SMB in TFE solutions, self-films were first prepared by air-drying peptide originally in 100% HFIP onto a 50 × 20 × 2 mm, 45° attenuated total reflectance (ATR) crystal for the Bruker spectrometer. The dried peptide self-films were then overlaid with solutions containing 40% TFE/60% deuterated-10 mM sodium phosphate buffer (pH 7.4), at a peptide concentration of 470 μM. Control solvent samples were similarly prepared for FTIR analysis, but without peptide. Spectra of peptides in solvent were obtained by subtraction of the solvent spectrum from that of peptide solvent. For FTIR spectra of B-YL and SMB in either SDS micelles or surfactant lipids, each lipid-peptide solution was transferred onto a germanium ATR crystal. The aqueous solvent was then removed by flowing nitrogen gas over the sample to produce a thick lipid-peptide (lipid:peptide ratios of 10:1, mole:mole) [@ref-14]. The multilayer film was then hydrated to ≥35% with deuterated water vapor in nitrogen for 1 h before acquiring the spectra [@ref-37]. The spectra for either the B-YL or SMB peptides in the film were obtained by subtracting the spectrum of a peptide-free control sample from that of the peptide-bound sample. The relative amounts of α-helix, β-turn, β-sheet, or random (disordered) structures in lipid-peptide films were estimated using Fourier deconvolution (GRAMS AI 8, version 8.0, Thermo Fisher Scientific, Waltham, MA 02451). The respective areas of component peaks were calculated using curve-fitting software ( [Igor Pro](https://www.wavemetrics.com/products/igorpro/igorpro.htm), version 1.6, Wavemetrics, Lake Oswego, OR 97035) [@ref-38]. FTIR frequency limits were: α-helix (1662-1650 cm ), β-sheet (1637-1613 cm ), turn/bend (1682-1662 cm ), and disordered or random (1650-1637 cm ) [@ref-39].
Captive bubble surfactometry
----------------------------
Adsorption and surface tension lowering ability of surfactant preparations were measured with a captive bubble surfactometer at physiological cycling rate, area compression, temperature, and humidity [@ref-14]. The captive bubble surfactometer used here was a fully-computerized version of that described and built by Schürch and coworkers [@ref-40][@ref-41]. Quasi-static compression and expansion of the air bubble was performed in discrete steps at a rate of 5% of the bubble volume every 10 sec with continuous video recording of the bubble shape. Dynamic compression and expansion cycling was performed between 10 and 110% of the original bubble area at a cycling rate of 20 cycles/min. Both modalities show extreme flattening of the air bubble in active surfactant preparations. We used a B-YL surfactant mixture consisting of 3 mole% of B-YL peptide formulated in surfactant lipids (DPPC:POPC:POPG 5:3:2, mole:mole:mole) with a concentration of 35 mg/mL. Surfactant lipids alone were used as negative control and SMB surfactant (3 mole% of SMB in surfactant lipids) and the clinical surfactant Curosurf® (porcine lung extract containing both SP-B and SP-C and 80 mg/mL of lipids) as positive control. We routinely analyze surfactant preparations at an average surfactant lipid concentration of \~25 μg/mL in the bubble chamber, but as Curosurf® is more concentrated than synthetic surfactant, we applied 1 µL of synthetic surfactant at 35 mg/mL and 0.5 µL of Curosurf® at 80 mg/mL to the bubble chamber (\~1.5 mL volume), and performed all measurements in quadruplicate.
*In vivo* experiments
---------------------
Animal experiments were performed under established protocols reviewed and approved by the Institutional Animal Care and Use Committee of the Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center (LA BioMed protocol \# 020645). All procedures and anesthesia were in accordance with the American Veterinary Medical Association (AMVA) guidelines. Any suffering of the rabbits was ameliorated by providing optimal anesthesia and sedation as outlined below.
The lung lavage rabbit model represents a relatively pure state of surfactant deficiency over at least 6--8 h and allows for serial measures of arterial blood gases and lung compliance in ventilated, surfactant-deficient animals with a clinical picture of respiratory failure as seen in neonatal RDS and ALI/ARDS. Respiratory failure secondary to surfactant deficiency has a high mortality if not treated with a highly surface-active surfactant preparation. Thirty-three young adult, New Zealand white rabbits, weighing 1.0--1.4 kg, were purchased from IFPS Inc. (Norco, CA). The animals were housed as pairs for a minimum of 24 h in the C.W. Steers Biological Resources Center of LA BioMed, using large cages with non-traumatic and moisture absorbent bedding, and provided with rabbit toys and food and water *ad libitum*. Husbandry was provided by veterinary technicians under supervision of a veterinarian. The number of animals has been determined from a population correlation=0.6, α=0.05, tails=2, and power=0.8, which gives a sample size of 16 (2x8). Therefore, we generally use 8 animals to test clinical efficacy of an experimental surfactant preparation (here: 3 mole% B-YL in surfactant lipids, n=9) with groups of 8 animals as positive controls (here: Curosurf® and 3 mole% SMB in surfactant lipids, both n=8) and 8 animals for negative controls (here: surfactant lipids alone \[DPPC:POPC:POPG 5:3:2 mole:mole:mole\], n=8). These treatment group sizes allow significant differences to be found between rabbits receiving an optimal surfactant and positive and negative controls. Animals were assigned to a surfactant preparation using a randomized algorithm and experiments were performed in a special laboratory area set up for the provision of intensive care.
The rabbits received anesthesia with 50 mg/kg of ketamine and 5 mg/kg of acepromazine intramuscularly prior to placement of a venous line via a marginal ear vein. After intravenous administration of 2 mg/kg of propofol and 2 mg/kg of midazolam for anesthesia and sedation, a small incision in the skin of the anterior neck allowed for placement of an endotracheal tube and a carotid arterial line. After insertion of the endotracheal tube, mechanical ventilation was initiated and muscle paralysis induced with intravenous vecuronium (0.1 mg/kg) to prevent spontaneous breathing. During the ensuing duration of mechanical ventilation, anesthesia consisted of continuous intravenous administration of 30 mg/kg/h of propofol and, as needed, additional intravenous dosages of 2 mg/kg of midazolam for sedation, whereas muscle paralysis was maintained with hourly intravenous administration of 0.1 mg/kg of vecuronium. Maintenance fluid was provided with a continuous infusion of lactated Ringer's solution at a rate of 10 mL/kg/h. Heart rate, arterial blood pressures and rectal temperature were monitored continuously (Labchart® Pro, ADInstruments Inc., Colorado Springs, CO).
The rabbits were ventilated with a volume-controlled rodent ventilator (Harvard Apparatus, South Natick, MA) using a tidal volume 7.5 mL/kg, a positive end-expiratory pressure of 3 cm H ~2~O, an inspiratory/expiratory ratio of 1:2, 100% oxygen, and a respiratory rate sufficient to maintain the partial pressure of carbon dioxide (PaCO ~2~) at 40 mmHg. Airway flow and pressures and tidal volume were monitored with a pneumotachograph connected to the endotracheal tube (Hans Rudolph Inc., Kansas City, MO). When the partial pressure of oxygen in arterial blood (PaO ~2~) was \>500 mmHg at a peak inspiratory pressure \<15 cm H ~2~O in 100% oxygen, surfactant deficiency was induced with repeated intratracheal instillation and removal of 30 mL/kg of warmed normal saline. When the PaO ~2~ was stable at \<100 mmHg (average 4 lavages), B-YL surfactant or a surfactant control (SMB, Curosurf® or surfactant lipids alone) was then instilled intratracheally at a dose of 100 mg/kg body weight, similar to dosages given to premature infants with RDS. Curosurf® is more concentrated (80 mg/mL) than SMB and B-YL surfactant and lipids alone (35 mg/mL), so Curosurf® was given at 1.25 mL/kg and SMB and B-YL surfactant and lipids alone at 2.9 mL/kg. Oxygenation was followed by measuring arterial pH and blood gases and lung compliance at 15 min intervals over a 2 h period. Dynamic lung compliance was calculated by dividing tidal volume/kg body weight by changes in airway pressure (peak inspiratory pressure minus positive end-expiratory pressure) (mL/kg/cm H ~2~O).
Animals were sacrificed 2 h after surfactant administration with an overdose (200 mg/kg) of intravenous pentobarbital. End-points were oxygenation and dynamic lung compliance at 120 min after surfactant administration.
Statistical analysis
--------------------
All data are expressed as mean ± SEM. Statistical analyses (IBM Statistical Package for the Social Sciences (SPSS) 23.0) used Student\'s t-test for comparisons of discrete data points, and functional data were analyzed by one-way analysis of variance (ANOVA) with Scheffe\'s post hoc analysis to adjust for multiple comparisons. Differences were considered statistically significant if the P value was \<0.05.
Results
=======
Spectroscopic analysis of B-YL and SMB in lipid mimic and surfactant lipid environments
---------------------------------------------------------------------------------------
The secondary structures for B-YL in either lipid mimetics (i.e., 40% TFE/60% deuterated-sodium phosphate buffer, pH 7.4 and deuterated aqueous SDS micelles) or surfactant lipids \[i.e., deuterated aqueous DPPC: POPC: POPG 5:3:2 (mole:mole:mole) multilayers\] were studied with conventional C-FTIR spectroscopy. Representative FTIR spectra of the amide I band for B-YL in these environments were all similar ( [Figure 2](#f2){ref-type="fig"}), each showing a principal component centered at 1654--1655 cm with a small low-field shoulder at 1619--1626 cm . Because earlier FTIR investigations of proteins and peptides [@ref-39][@ref-42] have assigned bands in the range of 1650--1659 cm as α-helical, while those at 1613--1637 cm are characteristic of β-sheet, B-YL probably assumes α-helical and β-sheet structures and possibly other conformations in these environments. Self-deconvolutions of the [Figure 2](#f2){ref-type="fig"} spectra confirmed that B-YL is polymorphic, primarily adopting α-helix but with significant contributions from β-sheet, loop-turn and disordered components ( [Table 1](#T1){ref-type="table"}). Interestingly, the relative proportions of secondary conformations determined from FTIR spectra of B-YL (i.e., α-helix \> loop-turn disordered β-sheet) in both lipid-mimetics and surfactant lipids of varying polarity are all comparable, suggesting an overall stability of the B-YL structure that is remarkably conserved. It is also important to note that the proportions of these secondary conformations are all compatible with B-YL principally assuming an α-helix hairpin [@ref-10][@ref-14][@ref-18].
{#f2}
###### Spectroscopic proportions of secondary structure [^a^](#FN1){ref-type="other"} for B-YL and SMB in lipid-mimetics and surfactant lipid.
System \% Conformation [^a^](#FN1){ref-type="other"}
------------------------------------------------------- ----------------------------------------------- ------ ------ ------
*FTIR Analysis of B-YL* [^b^](#FN2){ref-type="other"}
40% TFE 44.9 20.1 14.0 21.0
SDS 43.5 21.5 15.4 19.6
Surfactant Lipid 44.3 18.9 15.1 21.7
*CD Analysis of B-YL* [^c^](#FN3){ref-type="other"}
40% TFE 46.9 11.8 15.1 26.2
SDS 52.0 13.9 9.9 24.2
Surfactant Lipid 44.6 16.3 13.3 25.8
*FTIR Analysis of SMB* [^d^](#FN4){ref-type="other"}
40% TFE 47.1 19.4 20.2 13.3
SDS 44.9 22.2 12.2 20.7
Surfactant Lipid 42.3 27.5 11.7 18.5
Tabulated results are means from four closely-reproduced separate determinations for each condition and spectral type.
See [Figure 2](#f2){ref-type="fig"}. ATR-FTIR spectra were estimated for proportions of the secondary structure for B-YL in 40% trifluoroethanol (TFE), sodium dodecyl sulfate SDS micelles and surfactant lipid-MLV films using self-deconvolution of the peptide amide I band (see **Methods** and **Results**).
See [Figure 3](#f3){ref-type="fig"}. Circular dichroism (CD) spectra were analyzed for proportions of the secondary structure for the B-YL mimic in 40% TFE, SDS micelles or surfactant lipid using spectral deconvolution (see **Methods** and **Results**).
See [Figure 4](#f4){ref-type="fig"}. ATR-FTIR spectra were estimated for proportions of the secondary structure for Super Mini-B (SMB) in SDS micelles and surfactant lipid-MLV films using self-deconvolution of the peptide amide I band (see **Methods** and **Results**).
The secondary conformations for B-YL in lipid mimics (i.e., 40% TFE, aqueous SDS) or synthetic surfactant lipids \[aqueous (DPPC:POPC:POPG 5:3:2 mole:mole:mole\] were also studied with Circular Dichroism (CD) spectroscopy, to validate the above FTIR results. CD spectra for B-YL in these environments ( [Figure 3](#f3){ref-type="fig"}) were all similar, each indicating a major α-helical component characterized by a double minimum at 208 and 222 nm [@ref-43][@ref-45]. Deconvolutions of the [Figure 3](#f3){ref-type="fig"} spectra showed that B-YL is polymorphic, principally adopting α-helix ( 45--52%), but with significant contributions (i.e., 10--26% each) from loop-turn, disordered/random and β-sheet components ( [Table 1](#T1){ref-type="table"}). Interestingly, the secondary conformation proportions determined from CD analysis for B-YL (i.e., α-helix \> random loop-turn β-sheet) in both surfactant lipids and lipid mimetics are all compatible with B-YL folding as an α-helix hairpin [@ref-18]. Moreover, the overall maintenance of these secondary conformations from CD spectra in [Table 1](#T1){ref-type="table"} additionally supports our FTIR findings that B-YL assumes a stable 3D-structure in environments of varying polarity.
![CD spectra of the B-YL mimic for SP-B in several lipid-mimetics and surfactant lipid.\
Circular Dichroism (CD) spectral plots show the mean residue ellipticities (\[θ\] ~MRE~ x 10 deg-cm dmol ) as a function of wavelength (nm). ( **A**) 40% TFE. ( **B**) SDS. ( **C**) Surfactant Lipid. The double minimum at 208 and 222 nm in each plot indicates that α-helix is the dominant secondary structure for B-YL in these environments. Peptide concentrations were 100 μM. The optical pathlength was 0.01 cm and the temperature was 37°C. Spectra represent the average of 8 scans.](gatesopenres-2-13916-g0002){#f3}
Comparative FTIR spectroscopic studies were next performed on Super Mini-B (SMB) in lipid mimics and surfactant lipids to assess whether the B-YL substitutions in [Figure 1](#f1){ref-type="fig"} perturb the structure of the parent SMB. The secondary structures for SMB in lipid mimetics (i.e., deuterated 40 % TFE, deuterated aqueous SDS) and surfactant lipids (deuterated aqueous DPPC:POPC:POPG 5:3:2 mole:mole:mole) were investigated with conventional C-FTIR spectroscopy. [Figure 4](#f4){ref-type="fig"} shows that representative FTIR spectra of the amide I band for SMB in these environments were similar, each indicating a dominant α-helical component centered at 1654--1655 cm with a small low-field shoulder due to β-sheet at 1618--1620 cm [@ref-40][@ref-43]. Self-deconvolution of the FTIR spectra in [Figure 4](#f4){ref-type="fig"} demonstrated that SMB in either TFE, SDS or surfactant lipids folds with secondary structures that are characteristic of the α-helix hairpin ( [Table 1](#T1){ref-type="table"}). Our finding that the respective secondary structure profiles for B-YL and SMB are similar in [Table 1](#T1){ref-type="table"} suggests that the amino-acid substitutions in B-YL (e.g., four Cys residues replaced by Tyr) do not disrupt the α-helix hairpin conformation.
{#f4}
Captive bubble surfactometry
----------------------------
Captive bubble surfactometry of B-YL and SMB surfactants (3 mole% peptide in DPPC:POPC:POPG 5:3:2 mole:mole:mole), Curosurf®, and surfactant lipids alone demonstrated excellent surface activity of B-YL ( [Figure 5](#f5){ref-type="fig"}). Surface activity of BYL and SMB surfactant and Curosurf® were consistently and equally low during quasi-static cycling with values ≤1 mN/m, indicating that the modifications in the B-YL peptide did not lead to a loss in *in vitro* surface activity compared to its parent peptide SMB. In contrast, minimum surface tension values of surfactant lipids alone far exceeded those of B-YL, SMB and Curosurf® surfactant and amounted to 18 mN/m (p\<0.001).
{#f5}
*In vivo* experiments
---------------------
Animal experiments directly examined the *in vivo* pulmonary activity of B-YL surfactant when instilled intratracheally in ventilated young adult rabbits with surfactant deficiency and impaired lung function induced by repeated saline lung lavages ( [Figure 6](#f6){ref-type="fig"}). Surfactant was administered by intratracheal instillation after the PaO ~2~ was reduced to stable levels \<100 mmHg when breathing 100% oxygen. For this timeframe of study, this model reflects a relatively pure state of surfactant deficiency in animals with mature lungs. Rabbits receiving B-YL, SMB and Curosurf® surfactant had significantly improved arterial oxygenation over the 2 h period of study post-instillation compared to control rabbits instilled with surfactant lipids alone ( [Figure 6](#f6){ref-type="fig"}, p\<0.001). Dynamic lung compliance also significantly improved over the same period of post-instillation study in rabbits treated with B-YL and SMB surfactants and Curosurf® compared to lipid-only controls ( [Figure 6](#f6){ref-type="fig"}). During the first 75 min after surfactant administration, mean PaO ~2~ values of the B-YL group were slightly lower than in the Curosurf® group (p\<0.03), but were not different from those in the SMB group. Thereafter, mean PaO ~2~ values were similar among the three active surfactant preparations. Dynamic lung compliance of B-YL and SMB surfactants and Curosurf® was not statistically significant different throughout the study period. These data indicate that the modifications in the SP-B peptide mimic B-YL did not lead to a loss in *in vivo* surface activity, despite a difference in initial kinetics compared to Curosurf®.
{#f6}
Discussion
==========
The basic premise tested here was whether the 'sulfur-free' B-YL peptide, a 41-residue Super Mini-B (SMB) variant that has its four cysteine residues replaced by tyrosine and its two methionine residues replaced by leucine, would fold with the same α-helix hairpin conformation earlier shown by SMB and Mini-B to correlate with high *in vitro* and *in vivo* surfactant activities [@ref-8][@ref-10][@ref-14][@ref-18].
In the present studies, circular dichroism (CD) and FTIR spectroscopy of 'B-YL' in surfactant lipids showed secondary structures compatible with the peptide folding as an α-helix hairpin, similar to that of SMB in lipids ( [Figure 2](#f2){ref-type="fig"}-- [Figure 4](#f4){ref-type="fig"}; [Table 1](#T1){ref-type="table"}). Moreover, captive bubble surfactometry indicated excellent surface activity for B-YL surfactant ( [Figure 5](#f5){ref-type="fig"}), while also showing good oxygenation and dynamic compliance in lavaged, surfactant-deficient adult rabbits, an animal model of surfactant deficiency ( [Figure 6](#f6){ref-type="fig"}). One possible explanation of this correlation between α-helix turn and surfactant activity in B-YL is that the disulfide bonds of the parent SMB have been replaced by a core of clustered Tyr that instead crosslinks the N- and C- helices through noncovalent interactions involving aromatic rings. In this context, it is worthwhile to compare these B-YL results with an earlier functional and NMR structural investigation of Tachyplesin I (TP-I) [@ref-46]. TP-I is a 17-residue peptide that exhibits high antimicrobial activity and forms a β-hairpin (i.e., antiparallel β-sheet) stabilized by two disulfide cross-links. Interestingly, replacement of the disulfides with four tyrosines produced a TP-I analog (TP-1Y) with a stable β-hairpin conformation in solution and high antimicrobial activity, while the corresponding TP-I analog with four alanines (TP-IA) was unstructured in solution and inactive. Because of the proximity of the tyrosine side chains, Laederach *et al.* [@ref-46] proposed that the β-hairpin conformation and high antimicrobial activity of TP-IY were stabilized by aromatic ring stacking interactions (i.e., "π-stacking" interactions) [@ref-27][@ref-29]. It is tempting to speculate that tyrosines may be playing a similar role in maintaining the α-helix hairpin structure and high surfactant activity of B-YL in lipid environments. To address remaining questions, we are planning long-time (≥ 1.0 µsec) production runs for all-atom MD simulations of B-YL to ensure that our final models are fully equilibrated in hydrated surfactant lipid bilayers.
Our 'sulfur-free' B-YL mimic may prove to be superior to its parent SMB for treating premature infants with RDS for several reasons. First, B-YL is less expensive and faster to synthesize than SMB because it omits an oxidation step and is self-folding. Second, the substitution of Cys and Met residues with Tyr and Leu, respectively, may render the B-YL mimic less susceptible to inactivation by reactive oxygen species.
Lung immaturity and surfactant deficiency are the main cause of RDS in very preterm infants. Mechanical ventilation and exposure to high oxygen concentrations may lead to an inflammatory lung process resulting in bronchopulmonary dysplasia (BPD), a chronic lung disease of preterm infants. Use of antenatal steroids, administration of exogenous surfactant, and advanced modes of ventilation have shown only limited benefits in preventing BPD. In a neonatal rat model of hyperoxia-induced lung injury, we found that nebulized PPARγ agonist pioglitazone (PGZ) with B-YL surfactant accelerates lung maturation and prevents neonatal hyperoxia-induced lung injury more than with either modality alone, thereby potentially preventing BPD more effectively [@ref-47]. These findings suggest a potential role for B-YL surfactant as a vehicle for intrapulmonary drug therapy.
Conclusion
==========
The 'sulfur-free' B-YL forms an amphipathic helix-hairpin in surfactant liposomes with high surface activity, and is functionally similar to its parent (SMB) and native SP-B. This self-folding peptide is easier to synthesize and may provide an extra edge over SMB in the treatment of respiratory failure in premature infants with RDS.
Data availability
=================
Raw data are available on OSF: <http://doi.org/10.17605/OSF.IO/6295P> [@ref-48]
Data are available under the terms of the [Creative Commons Zero \"No rights reserved\" data waiver](http://creativecommons.org/publicdomain/zero/1.0/) (CC0 1.0 Public domain dedication).
10.21956/gatesopenres.13916.r26555
Referee response for version 2
Pérez-Gil
Jesús
1
Referee
https://orcid.org/0000-0003-3587-7147
Department of Biochemistry, Faculty of Biology and Research Institute Hospital 12 de Octubre, Complutense University, Madrid, Spain
**Competing interests:**No competing interests were disclosed.
27
7
2018
All the questions raised have been properly addressed in my opinion.
I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.
10.21956/gatesopenres.13916.r26554
Referee response for version 2
Booth
Valerie
1
Referee
https://orcid.org/0000-0001-9342-9217
Department of Biochemistry , Memorial University of Newfoundland, St. John\'s, NL, Canada
**Competing interests:**No competing interests were disclosed.
16
7
2018
All concerns have been addressed.
I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.
10.21956/gatesopenres.13861.r26281
Referee response for version 1
Pérez-Gil
Jesús
1
Referee
https://orcid.org/0000-0003-3587-7147
Department of Biochemistry, Faculty of Biology and Research Institute Hospital 12 de Octubre, Complutense University, Madrid, Spain
**Competing interests:**No competing interests were disclosed.
28
3
2018
This study summarizes data on the design, synthesis, structure, lipid-protein interactions and surface activity -in vitro and in vivo- of a synthetic peptide analog that mimics certain functional segments of pulmonary surfactant protein SP-B. The team responsible has a large expertise in the design and optimization of this type of peptide mimics of surfactant proteins, and the current work is a natural and smart extension of previous work.
In the current study, an analog to a well-know synthetic surrogate of SP-B, the so-called "mini-B", has been produced and analyzed in detail. This 'B-YL' peptide is a mini-B version in which cysteines forming disulphide bonds, in both wild-type SP-B ad mini-B, have been substituted by tyrosines. The rational is that tyrosines could also contribute to stabilize peptide-peptide interactions via pi-stacking and so yielding the typical alpha-helical hairpin bridging N-terminal and C-terminal helical segments of SP-B together. The substitution of Cys by Tyr would on the other hand supposedly render a peptide surrogate with lower propensity to oxidation, according to the authors, thanks to the elimination of cysteine residues. The authors essentially conclude that the B-YL analog is entirely comparable, structurally and functionally, to the mini-B construct, and therefore that it would be equally useful to produce synthetic surfactants for therapeutic applications.
In general term, the experiments have been properly carried out, and they provide extensive proofs that the peptide behaves "in general terms" as it was expected. In this sense, it is interesting to see how the substitution of two disulphides by tyrosine clustering could also serve as a basis to build a membrane active peptide fold such as the one of miniB. This is certainly an advantage from the point of view of its synthesis and production. It would be for instance a large advantage to produce inexpensive large amounts of this type of peptides by overexpression in bacteria, where formation of disulphides would certainly be a limitation.
What I am not so sure is whether this peptide would actually be less susceptible to oxidation, and whether this peptide is actually a good mimic of SP-B, or at least as good as miniB.
As mentioned by the authors, one of the targets of oxidation-promoted inactivation of surfactant proteins are the aromatic residues. Actually, oxidation of the single tryptophan of SP-B (as shown by the group of Possmayer), located at its N-terminal helical segment, is associated with complete inactivation of the protein. It had been previously demonstrated (see for instance Ryan et al.(2005) [@rep-ref-26281-1] or Serrano et al.(2006) [@rep-ref-26281-2]) that this tryptophan is essential at the N-terminal end of SP-B, because it takes part of a highly hydrophobic-at-interface segment which defines very high affinity for insertion into amphipathic environments such as the air-liquid interface. Now this tryptophan has been substituted in the whole peptide by 4 tyrosines. Tyrosines may maintain a high affinity for the interface, but at the cost of being also highly susceptible to oxidation. The authors could have shown if it is true that exposure of B-YL to oxidant reactions preserve its activity better than in the case of mini-B.
Another major problem in my opinion of the substitution of disulphides by aromatic residues is that it may change dramatically the way the peptide perturb surfactant membranes and films, which is crucial for a good surface activity. Disulphides surely impose a very strong constraint to the way the two helical segments orientate into the membrane. As a matter of fact, the tilting of the amphipathic N-terminal and C-terminal helical segments of SP-B, which is crucial for perturbing lipid packing to the point of facilitating the transfer of surface active lipid molecules between different bilayers or between the bilayers and the interfacial film, may be subtly different in the case of miniB, and even more in the B-YL analog. I may agree that tyrosine clustering could roughly join the C-terminal and N-terminal segments together, but they would do that in a much more flexible, dynamic and fluctuating way than the disulphides, and that may reduce the efficiency for the protein to induce membrane perturbation. This could be the reason why the maximum surface tension during cycling of lipid-peptide films at the CBS is higher in the case of B-YL than in mini-B, and much more than in the case of Curosurf containing true SP-B, where the full protein structure may impose a much more defined geometry to the N-terminal/C-terminal helical cluster. The limited MD simulations in the presence of lipids also seem to show differences in tilting of the helical segments with respect to the lipid surface. The authors have neglected these differences, but it would be important to show if they do really exist and whether they are reproducible.
Other problem related with the final geometry of the lipid-protein complexes comes from the high hydrophobicity-at interface of the aromatic residues. The introduction of the 4 tyrosines may force a orientation of the mini-B construct which is much more anchored to the surface of the membrane, where aromatic residues tend to partitition, than it is the case for the tyrosine-free miniB analog.
The authors may argue that the MD simulations do not reflect substantial differences in this respect, but a 500 nsec simulation may or may not be enough to get the fully equilibrated state. Have the authors data to evaluate whether longer simulation times could reflect further differences?
There is an additional important issue that may arise from the substitution of disulphides by tyrosines that in my opinion has not been properly addressed. If tyrosine clustering is enough to sustain intramolecular peptide-peptide interactions stabilizing the miniB hairpin, it may also sustain intermolecular peptide-peptide interactions, which could end in peptide aggregation and clustering, potentially reducing lipid dispersion and surface activity. The simulations run do not contain multiple copies of the peptide, which could assess whether intramolecular interactions are or not preferred over intermolecular interactions, provided that long enough simulation times are applied. This problem does not exist, obviously, when the intramolecular interactions are maintained through covalent disulphide bonds.
Other questions that would require some discussion include:
The use of surfactant therapy on therapies to treat ALI and ARDS is under strong debate. It is doubtful that a simple synthetic surfactant such as those containing mini-B-like peptides as surrogates of SP-B would be ever useful to treat ARDS patients.
The way captive bubble experiments have been performed has been poorly explained and produce some confusion. In page 6, it is stated that CBS has been operated at "physiological cycling rate". However, in page 14, it is stated that "Surface activity of ... were consistently and equally low during quasi-static cycling..." What has been the compression-expansion cycling rate used? There is also some confusion with respect to the concentration at which the different surfactants have been tested in the CBS. In page 6, it is stated that "We routinely analyze surfactant preparations at an average surfactant lipid concentration of 25 microgram/mL". Later it is stated that "We used a B-YL surfactant mixture consisting on... with a concentration of 35 mg/mL". Could you, please, clarify what is the lipid concentration used to obtain each of the CBS isotherms? How this concentration is applied (in the bulk hypophase in which the bubble is formed, or directly at the air-water interface)?
The results of MD simulations have been taken as a proof that the cys-by-tyr substitutions can also sustain the intramolecular peptide-peptide interactions defining the formation of the miniB-like helical hairpin in surfactant lipids. The question is what were the initial points of at which those simulations were started? Where the aromatic sidechains already clustered or where the peptides initially embedded into the membranes in an extended conformation, to see whether the propensity for the hairpin to be formed could be entirely sustained by the affinity of tyrosines to pile? This second type of experiments could be crucial. Even better if the simulation cell could contain not one but several copies of the peptides.
The experiments in vivo seems to indicate that the B-YL analog is less active than miniB or Curosurf to produce good oxygenation indexes, at least at the shortest times. The authors state that there is no statistical difference between the activity in vivo of the two different analogs. Have they tested statistical significance of the means only at the end times or have they checked whether differences at shorter times could indicate that there may be a significant difference in kinetics (which can also functionally important)?
In summary, I think the study can be of interest for the scientists in the field, and may open alternatives in the design of other peptides or proteins potentially mimicking the structure-function determinants of surfactant proteins. However, instead of merely summarizing the main parallelisms found, the Discussion should be completed by addressing all the questions raised in this report, which could add substantially to the structural and functional features that may be important to test when designing future new peptide surfactant additives for therapeutic purposes.
I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.
Walther
Frans
LA BioMed at Harbor-UCLA Medical Center, USA
**Competing interests:**No competing interests were disclosed.
4
7
2018
**Response to Reviewer Dr. Pérez-Gil:**
1\. What I am not so sure is whether this peptide would actually be less susceptible to oxidation, and whether this peptide is actually a good mimic of SP-B, or at least as good as miniB.
As mentioned by the authors, one of the targets of oxidation-promoted inactivation of surfactant proteins are the aromatic residues. Actually, oxidation of the single tryptophan of SP-B (as shown by the group of Possmayer), located at its N-terminal helical segment, is associated with complete inactivation of the protein. It had been previously demonstrated (see for instance Ryan et al.(2005) <https://gatesopenresearch.org/articles/2-13/v1#rep-ref-26281-1> or Serrano et al.(2006) <https://gatesopenresearch.org/articles/2-13/v1#rep-ref-26281-2>) that this tryptophan is essential at the N-terminal end of SP-B, because it takes part of a highly hydrophobic-at-interface segment which defines very high affinity for insertion into amphipathic environments such as the air-liquid interface. Now this tryptophan has been substituted in the whole peptide by 4 tyrosines. Tyrosines may maintain a high affinity for the interface, but at the cost of being also highly susceptible to oxidation. The authors could have shown if it is true that exposure of B-YL to oxidant reactions preserve its activity better than in the case of mini-B.
Response: As suggested by the other reviewer, Dr. Valerie Booth, we decided to remove all claims of "oxidation-resistance" in the title, abstract, conclusion and other parts of the text. The B-YL peptide is somewhat less sensitive to oxidation by Leu substitution for Met and storage for one year showed no Tyrosine or Tryptophan oxidation by mass spec. B-YL is actually as good a mimic of SP-B as Super Mini-B at captive bubble surfactometry and in the lavaged, surfactant-deficient rabbits.
2. Another major problem in my opinion of the substitution of disulphides by aromatic residues is that it may change dramatically the way the peptide perturb surfactant membranes and films, which is crucial for a good surface activity. Disulphides surely impose a very strong constraint to the way the two helical segments orientate into the membrane. As a matter of fact, the tilting of the amphipathic N-terminal and C-terminal helical segments of SP-B, which is crucial for perturbing lipid packing to the point of facilitating the transfer of surface active lipid molecules between different bilayers or between the bilayers and the interfacial film, may be subtly different in the case of miniB, and even more in the B-YL analog. I may agree that tyrosine clustering could roughly join the C-terminal and N-terminal segments together, but they would do that in a much more flexible, dynamic and fluctuating way than the disulphides, and that may reduce the efficiency for the protein to induce membrane perturbation. This could be the reason why the maximum surface tension during cycling of lipid-peptide films at the CBS is higher in the case of B-YL than in mini-B, and much more than in the case of Curosurf® containing true SP-B, where the full protein structure may impose a much more defined geometry to the N-terminal/C-terminal helical cluster. The limited MD simulations in the presence of lipids also seem to show differences in tilting of the helical segments with respect to the lipid surface. The authors have neglected these differences, but it would be important to show if they do really exist and whether they are reproducible.
Other problem related with the final geometry of the lipid-protein complexes comes from the high hydrophobicity-at interface of the aromatic residues. The introduction of the 4 tyrosines may force a orientation of the mini-B construct which is much more anchored to the surface of the membrane, where aromatic residues tend to partitition, than it is the case for the tyrosine-free miniB analog.
Response: Simulations show no difference in surface orientation. However, we decided to remove the homology models, molecular dynamic (MD) simulation and Membrane Protein Explorer (MPEx) from the manuscript as modeling was only a secondary focus and we plan to publish a more extensive data set in a follow-up paper.
3\. The authors may argue that the MD simulations do not reflect substantial differences in this respect, but a 500 nsec simulation may or may not be enough to get the fully equilibrated state. Have the authors data to evaluate whether longer simulation times could reflect further differences?
Response: We extended simulations to one microsecond. However, we have decided to remove the homology models, molecular dynamic (MD) simulation and Membrane Protein Explorer (MPEx) from the manuscript as modeling was only a secondary focus and we plan to publish a more extensive data set in a follow-up paper.
4\. There is an additional important issue that may arise from the substitution of disulphides by tyrosines that in my opinion has not been properly addressed. If tyrosine clustering is enough to sustain intramolecular peptide-peptide interactions stabilizing the miniB hairpin, it may also sustain intermolecular peptide-peptide interactions, which could end in peptide aggregation and clustering, potentially reducing lipid dispersion and surface activity. The simulations run do not contain multiple copies of the peptide, which could assess whether intramolecular interactions are or not preferred over intermolecular interactions, provided that long enough simulation times are applied. This problem does not exist, obviously, when the intramolecular interactions are maintained through covalent disulphide bonds.
Response: Insertion sequence keeps this from happening. However, we decided to remove the homology models, molecular dynamic (MD) simulation and Membrane Protein Explorer (MPEx) paragraphs from the manuscript as modeling was only a secondary focus and plan to publish a more extensive data set in a follow-up paper.
5\. The use of surfactant therapy on therapies to treat ALI and ARDS is under strong debate. It is doubtful that a simple synthetic surfactant such as those containing mini-B-like peptides as surrogates of SP-B would be ever useful to treat ARDS patients.
Response: We agree with the reviewer and removed the statements about surfactant therapy for ALI/ARDS from the abstract, the last paragraph of page 3, discussion and conclusion.
6\. The way captive bubble experiments have been performed has been poorly explained and produce some confusion. In page 6, it is stated that CBS has been operated at "physiological cycling rate". However, in page 14, it is stated that "Surface activity of ... were consistently and equally low during quasi-static cycling..." What has been the compression-expansion cycling rate used? There is also some confusion with respect to the concentration at which the different surfactants have been tested in the CBS. In page 6, it is stated that "We routinely analyze surfactant preparations at an average surfactant lipid concentration of 25 microgram/mL". Later it is stated that "We used a B-YL surfactant mixture consisting on... with a concentration of 35 mg/mL". Could you, please, clarify what is the lipid concentration used to obtain each of the CBS isotherms? How this concentration is applied (in the bulk hypophase in which the bubble is formed, or directly at the air-water interface)?
Response: We actually do both quasi-static and dynamic cycling on the CBS. Quasi-static compression and expansion of the air bubble is performed in discrete steps at a rate of 5% of the bubble volume every 10 sec with continuous video recording of the bubble shape. Dynamic compression and expansion cycling is performed between 10 and 110% of the original bubble area at a cycling rate of 20 cycles/min. Both modalities show extreme flattening of the bubble in active surfactant preparations. In figure 9 we present the data from quasi-static cycling. We routinely analyze surfactant preparations at an average surfactant lipid concentration of 25 µg/mL in the bubble chamber, but as Curosurf® is more concentrated than synthetic surfactant, we applied 1 µL of synthetic surfactant at 35 mg/mL and 0.5 µL of Curosurf® at 80 mg/mL to the bubble chamber (1.5 mL volume). After introducing surfactant and the air bubble into the CBS chamber, both move upwards to the interface with the agarose plug. This information was added to the methods section.
7\. The results of MD simulations have been taken as a proof that the cys-by-tyr substitutions can also sustain the intramolecular peptide-peptide interactions defining the formation of the miniB-like helical hairpin in surfactant lipids. The question is what were the initial points of at which those simulations were started? Where the aromatic sidechains already clustered or where the peptides initially embedded into the membranes in an extended conformation, to see whether the propensity for the hairpin to be formed could be entirely sustained by the affinity of tyrosines to pile? This second type of experiments could be crucial. Even better if the simulation cell could contain not one but several copies of the peptides.
Response: See above, we decided to remove the homology models, molecular dynamic (MD) simulation and Membrane Protein Explorer (MPEx) from the manuscript as modeling was only a secondary focus and we plan to publish a more extensive data set in a follow-up paper.
8\. The experiments in vivo seems to indicate that the B-YL analog is less active than miniB or Curosurf to produce good oxygenation indexes, at least at the shortest times. The authors state that there is no statistical difference between the activity in vivo of the two different analogs. Have they tested statistical significance of the means only at the end times or have they checked whether differences at shorter times could indicate that there may be a significant difference in kinetics (which can also functionally important)?
Response: In response to the reviewer, we calculated the statistical significance of differences in means at every 15 min time-point after surfactant instillation and found no significant differences in dynamic compliance for the 3 surface-active surfactant preparations throughout the experiments. During the first 75 min after surfactant administration, mean oxygenation values of the B-YL surfactant group were slightly lower than in the Curosurf® group (p\<0.03), but not different from those in the Super Mini-B (SMB) group, suggesting initial differences in kinetics. Thereafter oxygenation was similar in B-YL, SMB and Curosurf® surfactants. This info was added to the results section.
10.21956/gatesopenres.13861.r26299
Referee response for version 1
Booth
Valerie
1
Referee
https://orcid.org/0000-0001-9342-9217
Department of Biochemistry , Memorial University of Newfoundland, St. John\'s, NL, Canada
**Competing interests:**No competing interests were disclosed.
20
3
2018
Walther, Gupta, Gordon and Waring present studies of a peptide called "B-YL" which they propose may be of utility as a component of exogenous lung surfactant replacement therapy for conditions such as ARDS and ALI. In these conditions, the lung environment is "hostile" to lung surfactant proteins and a variety of inactivating components including reactive oxygen species are present. The experimental work is comprehensive and complementary, as well as expertly done and clearly described (with a few exceptions as detailed below). I appreciate the effort to include the *in vitro* and *in vivo* functional work, as well as the structural studies. I also believe that the general thrust of the work -- creating peptide components that can act in place of full length lung surfactant proteins -- is very worthwhile.
However, I do have trouble with the premise for the paper -- that removing the cysteines and methionines will make the peptide "oxidation-resistant". The authors present no justification that cysteines are a target of ROS damage. In the lung surfactant literature, it's been shown that tryptophan 9 is the main target of oxidation, with methionine residues as a secondary target [@rep-ref-26299-1]. The peptide B-YL leaves this critical tryptophan unchanged and so may well be just as susceptible to damage as the parent peptide, super Mini-B. Furthermore, it's been proposed that one of the roles of methionines may be to protect the tryptophan by competing for ROS. So, removing the methionines may actually make the protein MORE susceptible to damage. Thus, I think the options are to either back up the assertion that the new peptide is "oxidation-resistant" with convincing experiments or references OR to remove all claims of "oxidation-resistant" from the title, abstract, conclusion and other parts of the text. I think the work stands up perfectly well without the oxidation-resistant angle, because as the authors point out, the removal of the cysteines makes it more feasible to scale up production to the scale needed for clinical work.
Here are the rest of my comments, roughly in the same order as the manuscript: Page 3 bottom left. Could you add a sentence to describe what an alpha-helix hairpin is. It's referred to several times later on so it would be good to start with a clear picture of what it is.Page 3, right hand column, 15 lines from the bottom reads "Trp-9 plays a role in the diminished surface activity possibly due to fraying of the N-terminal alpha-helix 24,25". Reference 25 actually suggests the activity may be changed because the oxidizing Trp to kynurenine causes the peptide to change its depth within the lipid layer.Page 3, right hand column, 1 sentence of the last paragraph. I'm not sure we can say that "ALI/ARDS... REQUIRES the use of exogenous surfactants" since I'm not sure that it's ever been convincingly shown that exogenous surfactant treatment substantially helps patients with ALI/ARDS -- can you re-phrase or back-up this statement.Page 3, last sentence. It would be good to explain why tyrosine (instead of some other amino acid) was chosen to replace the Cys and Met.Methods paragraph 2 and throughout. It is very (very!) confusing that Super Mini-B is referred to throughout as "oxidized" SMB. The "oxidation" is just the normal formation of disulfide bonds and since the paper is supposedly about making a "oxidation-resistant" version of SMB the two meanings are bound to be confounded by readers. I would just call it "SMB with disulfides" or something else along those lines.Page 5, last paragraph. Instead of referring to a "recent homology modeling program" and then naming the actual program 5 lines later, I would put the name of the program right into this first sentence.Page 5, last paragraph -- which pdb files went into the homology model? I think it's important to know this as there's not that much sequence homology between SP-B and known structures so whichever ones I-TASSER is choosing will have a big influence on how the structures look.Page 5 under the MD section... what was the initial position of the peptide within the bilayer and how did it change during the simulation? Note that Khatami et al. [@rep-ref-26299-2] found that the secondary structure of full length SP-B in MD simulations varied a lot with the position with respect to the bilayer. This is probably less important for the smaller peptide, but is still worth mentioning the initial position and the rationale for it.Page 6 under Captive bubble surfactometry. I'm guessing 3% of B-YL peptide is by mole? Can you add this info (here and later on) so we're clear?Page 7 top left. At some point (not necessarily here) it would be good to compare the dose of surfactant (in mg/kg body weight) to what is given to preemies. Also could you comment on why the dose is lower for Curosurf than for SMB?Page 7. First paragraph under results and Table 1. I'm not sure its appropriate to quote "Beta-sheet" content since I don't think you are proposing there is an actual sheet involved. Could you choose something more appropriate, like "beta-strand" or "beta-hairpin" or just "beta-structure".Figure 3. Since estimating secondary structure is so dependent on protein concentration, it would be good to know what method was used to determine the peptide concentration (desalted dry weight, UV, colorimeteric assay ?).Page 10, and later. The "core of hydrophobic residues" should be compared to that of Mini-B's experimental structure. How much of this core is preserved in your predictions for the SMB and B-YL structures?Page 10, bottom left and elsewhere. Can you replace all instances of "largely agrees with" with something more quantitative -- like backbone RMSD.Page 11, left hand column. In addition to the pi stacking interactions, I'm wondering what the hydroxyl on the tyrosines are doing -- are they finding anything to hydrogen bond to? What?Page 11, 2 sentence of the 2 paragraph: as for 14 above, please replace "generally in good agreement" with something more precise.Page 11 -- How do the starting and final structures and hydrophobic core compare to the experimental structure for Mini-B in SDS micelles?Page 14 -- right hand side, please replace "good overlap" and "remarkably analogous" with something more precise like RMSD.
I have read this submission. I believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.
Walther
Frans
LA BioMed at Harbor-UCLA Medical Center, USA
**Competing interests:**No competing interests were disclosed.
4
7
2018
**Response to Reviewer Dr. Valerie Booth:**
General response
Suggestion to remove all claims of "oxidation-resistance" from the title, abstract, conclusion, and other parts of the text.
Response: We removed all claims of "oxidation-resistance" from the title, abstract, conclusion, and text. As B-YL peptide is sulfur-free, the title was changed to: "A sulfur-free peptide mimic of surfactant protein B (B-YL) exhibits high in vitro and in vivo surface activities".
**Specific comments:**
1\. Page 3, bottom left. Could you add a sentence to describe what an alpha-helix hairpin is. It's referred to several times later on so it would be good to start with a clear picture of what it is.
Response: We have added to Page 3 bottom left a definition of an alpha helix hairpin structure as well as provided a literature reference for it: "SMB incorporates the N-terminal α-helix (\~residues 8-25) and C-terminal α-helix (\~residues 63-78) of native SP-B as a single linear peptide (Figure 1A), joined together with a customized turn to form a α-helix hairpin (a-helix/turn/a-helix, ata) \[Fezoui Y et al., 1994\]."
2\. Page 3, right hand column, 15 lines from the bottom reads "Trp-9 plays a role in diminished surface activity possibly due to fraying of the N-terminal alpha helix 24-25". Reference 25 actually suggest the activity may be changed because the oxidizing Trp to kynurenine causes the peptide to change its depth within the lipid layer.
Response: We have added here that this is in the full-length protein and in addition we have incorporated mass spec findings in the results section that indicate that the B-YL peptide does not undergo oxidation of its aromatic amino acids when stored in surfactant lipids for one year:
"Trp-9 can play a role in diminished surface activity in the full length native protein possibly due to fraying of the N-terminal alpha helix 24-25".
"Mass spectral analysis of the B-YL peptide indicated there was no change in the molecular weight due to oxidation of tyrosines or tryptophan for one year when formulated with surfactant lipids."
3\. Page 3, right hand column, 1 sentence of the last paragraph. I'm not sure we can say that "ALI/ARDS... REQUIRES the use of exogenous surfactants" since I'm not sure that it's ever been convincingly shown that exogenous surfactant treatment substantially helps patients with ALI/ARDS -- can you re-phrase or back-up this statement.
Response: We agree with the reviewer and removed this sentence and "surfactant dysfunction in ALI/ARDS" in the next sentence.
4\. Page 3, last sentence. It would be good to explain why tyrosine (instead of some other amino acid) was chosen to replace the Cys and Met.
Response: We have added an additional sentence (line 2, page 4) to explain our rational in the selection of tyrosine and leu for cysteine and methionine. We opted for leucine rather than the commonly used norleucine because we felt that the use of non-natural amino acids may cause longer term metabolic problems *in vivo*.
"Tyrosine was substituted for cysteine because of its aromatic ring interactions that emulate disulfide formation \[55, 56, 57\] and methionine, that is easily oxidized, was replaced by leucine based on its similar molecular structure and polarity \[44\]."
5\. Methods paragraph 2 and throughout. It is very (very!) confusing that Super Mini-B is referred to throughout as "oxidized" SMB. The "oxidation" is just the normal formation of disulfide bonds and since the paper is supposedly about making a "oxidation-resistant" version of SMB the two meanings are bound to be confounded by readers. I would just call it "SMB with disulfides" or something else along those lines.
Response: We have modified the text using "SMB" instead of "oxidized SMB" in accordance with the reviewer's comments, so that there is no confusion with oxidation of the peptide per se.
6\. Page 5, last paragraph. Instead of referring to a "recent homology modeling program" and then naming the actual program 5 lines later, I would put the name of the program right into this first sentence.
Response: We decided to remove the homology models, molecular dynamic (MD) simulation and Membrane Protein Explorer (MPEx) from the manuscript as modeling was only a secondary focus and we plan to publish a more extensive data set in a follow-up paper.
7\. Page 5, last paragraph -- which pdb files went into the homology model? I think it's important to know this as there's not that much sequence homology between SP-B and known structures so whichever ones I-TASSER is choosing will have a big influence on how the structures look.
Response: Please see our response to reviewer's comment \#6.
8\. Page 5 under the MD section... what was the initial position of the peptide within the bilayer and how did it change during the simulation? Note that Khatami et al. <https://gatesopenresearch.org/articles/2-13/v1#rep-ref-26299-2> found that the secondary structure of full length SP-B in MD simulations varied a lot with the position with respect to the bilayer. This is probably less important for the smaller peptide, but is still worth mentioning the initial position and the rationale for it.
Response: Please see our response to reviewer's comment \#6.
9\. Page 6 under Captive bubble surfactometry. I'm guessing 3% of B-YL peptide is by mole? Can you add this info (here and later on) so we're clear?
Response: We used 3 mole % of B-YL or SMB peptide. We have clarified the concentration by including a reference \[17\] detailing the formulation used for SMB and B-YL peptides.
10\. Page 7 top left. At some point (not necessarily here) it would be good to compare the dose of surfactant (in mg/kg body weight) to what is given to preemies. Also could you comment on why the dose is lower for Curosurf than for SMB?
Response: All animals received 100 mg lipids/kg bodyweight of one of the 4 surfactant preparations. The clinical surfactant Curosurf® is formulated by the manufacturer at 80 mg/mL and SMB and B-YL surfactant and lipids alone were formulated at 35 mg/mL, so Curosurf® was dosed at 1.25 mL/kg and the synthetic surfactants at 2.9 mL/kg. Clinical surfactant is routinely dosed at 100 mg/kg in premature infants with RDS, so the dosages used here were similar to those used clinically. This info was added to the methods on page 7.
11\. Page 7. First paragraph under results and Table 1. I'm not sure its appropriate to quote "Beta-sheet" content since I don't think you are proposing there is an actual sheet involved. Could you choose something more appropriate, like "beta-strand" or "beta-hairpin" or just "beta-structure".
Response: We have replaced "Beta-sheet" with "beta-structure".
12\. Figure 3. Since estimating secondary structure is so dependent on protein concentration, it would be good to know what method was used to determine the peptide concentration (desalted dry weight, UV, colorimeteric assay ?).
Response: We have added the following description and reference with regard to peptide quantitation: "Peptides were routinely quantitated using UV absorbance based on the assay procedure developed by Anthis and Clore (Protein Science, 2013)".
13\. Page 10, and later. The "core of hydrophobic residues" should be compared to that of Mini-B's experimental structure. How much of this core is preserved in your predictions for the SMB and B-YL structures?
Response: Please see our response to reviewer's comment \#6.
14\. Page 10, bottom left and elsewhere. Can you replace all instances of "largely agrees with" with something more quantitative -- like backbone RMSD.
Response: Please see our response to reviewer's comment \#6.
15\. Page 11, left hand column. In addition to the pi stacking interactions, I'm wondering what the hydroxyl on the tyrosines are doing -- are they finding anything to hydrogen bond to? What?
Response: Please see our response to reviewer's comment \#6.
16\. Page 11, 2 sentence of the 2 paragraph: as for 14 above, please replace "generally in good agreement" with something more precise.
Response: Please see our response to reviewer's comment \#6.
17\. Page 11 -- How do the starting and final structures and hydrophobic core compare to the experimental structure for Mini-B in SDS micelles?
Response: Please see our response to reviewer's comment \#6.
18\. Page 14 -- right hand side, please replace "good overlap" and "remarkably analogous" with something more precise like RMSD.
Response: Please see our response to reviewer's comment \#6.
[^1]: No competing interests were disclosed.
| 2024-05-21T01:26:18.401715 | https://example.com/article/3450 |
aaafencemaster.com – old wood fence 3 Why Have a Fence For years, fences have always been the best structures because they offer privacy and security. They protect properties against intruders making them special. There are various types of fences from metal, vinyl, pickets and wooden fences. Of all wooden ones are mostly overlooked resulting […] | 2024-02-02T01:26:18.401715 | https://example.com/article/8818 |
Cigar Preview: Camacho Super Limitado
Eiroa has accumulated about 24 different blends since 1996 and has decided to release these to select retailers. He is intending only to make about 6000 boxes for each of the blend releases. He is targeting the first release to the original 40 customers of the Camacho Corojo blend.
This won't be mass-marketed, but Eiroa truly is going to embrace the principle of Cigar Coop - "The Smoke, the craft, and the people". Eiroa will take a personal approach by touring and hand delivering these boxes to small groups of only about 20 to 25 people maximum.. He will talk more about the different blends as he is on his road show.
The packaging concept is very unique. This is not a cigar that will be sold individually, but by the box. The box will contain 18 cigars and will be virtually air tight - complete with tissue paper that will almost create what he terms a "natural box-press". The box is sealed with four screws and will require a screwdriver to open. The video in the link above showcases the boxes.
The first of the series will use what Eiroa calls the "Generoso" wrapper. This was named after Eiroa's grandfather. It was Eiroa's father that worked on this tobacco through an experimental seed. The experiment was not successful from a yield standpoint, but Eiroa feels this is a tobacco that developed great flavor. The first release will be in Camacho's trademark 11/18 perfecto size. Unfortunately the video above does not showcase the cigar.
Eiroa describes the cigar as "complex", but most important he boldly states in the interview, "this is the best cigar I ever made".
Cigar Enthusiasts will most likely be very willing to try to get their hands on this cigar as I am sure this will be one of the most sought after cigars for years to come. | 2024-04-09T01:26:18.401715 | https://example.com/article/8515 |
RBI Denies Creating Crypto, Blockchain and AI Research Unit
India’s central bank has reportedly denied setting up a unit to research cryptocurrency, blockchain and artificial intelligence as the media reported last month. This unit was supposed to research, draft rules, and supervise new emerging technologies.
Also read: 160 Crypto Exchanges Seek to Enter Japanese Market, Regulator Reveals
RBI Denies Setting Up Crypto Research Unit
There have been reports circulating in the media over the past month that the Reserve Bank of India (RBI) had set up a research unit for cryptocurrency, blockchain, and artificial intelligence. However, the central bank has now reportedly denied setting up a research unit for this purpose.
On Sept. 26, Coin Crunch India published an article stating that the central bank “denies setting up research unit on cryptocurrency, blockchain or AI.” The information comes from RBI’s response to a Right to Information (RTI) request filed by the author of the article, Naimish Sanghvi. An RTI allows any citizen of India to request information from a public authority. To the central bank, Sanghvi requested:
An Economic Times report…claims that RBI has setup a new unit to research AI and blockchain technology. Please let us know if this is true and who is heading this unit.
He explained, “I personally filed an RTI application asking the RBI to provide more information on the new unit.” The URL to the Economic Times article was also provided in the RTI. Sanghvi noted, “About a month later, on September 26, RBI disposed of the RTI with the below reply.”
There is no new unit created formally in RBI for the purpose mentioned in RTI query. Therefore there is no information to furnish in the matter.
The Unit Supposedly Created by RBI
Reports of the central bank’s new unit started spreading on Aug. 27 when the Economic Times published an article claiming that “The Reserve Bank of India (RBI) has formed a new unit within the central bank to beef up its own intellectual capital in the face of emerging technologies like cryptocurrency, blockchain and artificial intelligence.”
The news outlet described at the time that “The unit is just about a month old as of now and though a chief general manager is identified to lead it, a formal announcement internally has not been made yet,” elaborating:
This new unit will research and possibly draft rules and supervise new emerging technologies in the future, two people familiar with the central bank’s plans said.
While the existence of the aforementioned unit is in question, the RBI has emphasized the need to monitor crypto development. In its annual report published at the end of last month, the central bank confirmed that it is “keeping a close watch on cryptocurrency.” The RBI issued a circular on April 6 banning banks from providing services to crypto businesses, prompting a number of industry participants to file petitions against the ban. The Supreme Court of India was supposed to hear them on Sept. 11 but the case has repeatedly been postponed.
What do you think of the RBI denying setting up a crypto research unit? Let us know in the comments section below.
Images courtesy of Shutterstock.
Need to calculate your bitcoin holdings? Check our tools section. | 2024-03-24T01:26:18.401715 | https://example.com/article/9275 |
Epoprostenol therapy decreases elevated circulating levels of monocyte chemoattractant protein-1 in patients with primary pulmonary hypertension.
Primary pulmonary hypertension (PPH) is a rare disease characterized by progressively increased resistance of the pulmonary arteries associated with vascular remodeling. Infiltration of inflammatory cells in affected vessels is a common pathological finding. Monocyte chemoattractant protein-1 (MCP-1) is recognized as a potent chemotactic and activating factor for monocytes and leukocytes, but its significance in PPH is unclear. Serum MCP-1 concentrations were measured in 16 PPH patients and the results were compared with those in 16 normal controls. MCP-1 concentrations in PPH patients (265.6+/-29.5 pg/ml) were significantly elevated compared with those in normal controls (119.6+/-6.9 pg/ml, p<0.0001). In 9 patients (3 men, 6 women; mean age, 29+/-3 years), repeated MCP-1 and hemodynamic measurements were performed prior to and during intravenous epoprostenol therapy. During a mean follow-up period of 7+/-1 months, MCP-1 concentrations were significantly reduced (288.8+/-122.8 to 185.9+/-117.5 pg/ml, p<0.01). Circulating MCP-1 concentrations are increased in PPH patients, but can alleviated by chronic intravenous epoprostenol therapy. The increase in MCP-1 might be one of the important factors responsible for the disease development in patients with PPH. | 2024-05-13T01:26:18.401715 | https://example.com/article/7206 |
Q:
Add legend to scatter plot (PCA)
I am a newbie with python and found this excellent PCA biplot suggestion (Plot PCA loadings and loading in biplot in sklearn (like R's autoplot)). Now I tried to add a legend to the plot for the different targets. But the command plt.legend() doesn't work.
Is there an easy way to do it?
As an example, the iris data with the biplot code from the link above.
import numpy as np
import matplotlib.pyplot as plt
from sklearn import datasets
from sklearn.decomposition import PCA
import pandas as pd
from sklearn.preprocessing import StandardScaler
iris = datasets.load_iris()
X = iris.data
y = iris.target
#In general a good idea is to scale the data
scaler = StandardScaler()
scaler.fit(X)
X=scaler.transform(X)
pca = PCA()
x_new = pca.fit_transform(X)
def myplot(score,coeff,labels=None):
xs = score[:,0]
ys = score[:,1]
n = coeff.shape[0]
scalex = 1.0/(xs.max() - xs.min())
scaley = 1.0/(ys.max() - ys.min())
plt.scatter(xs * scalex,ys * scaley, c = y)
for i in range(n):
plt.arrow(0, 0, coeff[i,0], coeff[i,1],color = 'r',alpha = 0.5)
if labels is None:
plt.text(coeff[i,0]* 1.15, coeff[i,1] * 1.15, "Var"+str(i+1), color = 'g', ha = 'center', va = 'center')
else:
plt.text(coeff[i,0]* 1.15, coeff[i,1] * 1.15, labels[i], color = 'g', ha = 'center', va = 'center')
plt.xlim(-1,1)
plt.ylim(-1,1)
plt.xlabel("PC{}".format(1))
plt.ylabel("PC{}".format(2))
plt.grid()
#Call the function. Use only the 2 PCs.
myplot(x_new[:,0:2],np.transpose(pca.components_[0:2, :]))
plt.show()
Any suggestions for PCA biplots are welcome!
Also other codes, if the adding of the legend is easier in another way!
A:
I recently proposed an easy way to add a legend to a scatter, see GitHub PR. This is still being discussed.
In the meantime you need to manually create your legend from the unique labels in y. For each of them you'd create a Line2D object with the same marker as is used in the scatter plot and supply them as argument to plt.legend.
scatter = plt.scatter(xs * scalex,ys * scaley, c = y)
labels = np.unique(y)
handles = [plt.Line2D([],[],marker="o", ls="",
color=scatter.cmap(scatter.norm(yi))) for yi in labels]
plt.legend(handles, labels)
| 2024-01-15T01:26:18.401715 | https://example.com/article/5334 |
Kate McTiriss's Proposal
The Following Containment Procedure Was Unanimously Approved by Site Directors' Executive Committee of the Whole and the O5 Council
Item #: SCP-001
Object Class: Thaumiel (Subjective assessment)
Special Containment Procedures: It was the unanimous subjective opinion of the Site Directors' Executive Committee of the Whole on May 3, 20██ that the SCP-001 database entry slot should be locked to edits and only made available for modification with seven (7) private keys belonging to members of the O5 Council. It was the majority subjective opinion of SDECotW that the object believed to have been most recently designated SCP-001 should no longer be given an SCP designation, and should be stored in a standard high-value containment locker in Site-19.
It was the unanimous opinion of SDECotW that no objective claims or statements should be made in the main SCP-001 page of the Foundation Database under any circumstances, only verifiably true records of the opinions of Foundation governing bodies in the past.
It was the majority opinion of the O5 Council on May 3, 20██ that in the event that Entity Thaumiel, Dr. Mary Nakayama, or any entity claiming to be either makes contact with the SCP Foundation, they will be referred to the O5 Council for negotiation and cooperation. It was the majority opinion of the O5 Council that no efforts will be made at this time to neutralize Entity Thaumiel or the vulnerabilities of the SCP-001 database position.
Description: It was the unanimous opinion of SDECotW and the O5 Council on May 3, 20██ that any statement of fact made on this specific SCP Foundation Database page ⦿/Procedures/001/SCP-001.ftml becomes objectively true. The prior unanimous opinion of SDECotW and the O5 Council holds that modifications to this page have vast, and potentially infinite, Category–Aleph Room ("Greatest Concern") reality modification consequences; the prior unanimous opinion of SDECotW and the O5 Council held that no further testing on these effects is to occur due to the potential XK/CK/LK/VK/ZK/תK-Class Scenarios believed to be highly probable with said testing.
It was the unanimous opinion of SDECotW that other pages within the ⦿/Procedures/001/ portion of the Foundation Database have no anomalous effects, and that prior versions of the SCP-001 database leading to the believed discovery of SCP-001's effects and the possible creation of Entity Thaumiel are to be stored as subpages in this directory for reference.
It was the unanimous opinion of SDECotW that all blank spots on the Foundation database shall be checked for further Category–Aleph Room reality modification anomalies, and that only a series of 1,000 thoroughly checked database spots shall be available to Foundation personnel for the designation of new Special Containment Procedures at any given time.
▷ ⦿/Procedures/001/Past/Feb_18,_20██_1.ftml ▽ ⦿/Procedures/001/Past/Feb_18,_20██_1.ftml Foundation Database changelog:
Creating new SCP documentation. Trying it in the 2███ slot, but the object's effects might move it over to -001. Had the admins unlock the empty 001 slot (why was it empty? convenient, I guess) just in case.
- mnakayama, Feb 18 20██ 11:34 AM Item #: SCP-001 Object Class: Safe Special Containment Procedures: SCP-001 is to be kept in a standard low-value containment locker at Site-91a. Additional research into SCP-001's effects will be the responsibility of Site-91a Chief Numerologist Dr. Mary Nakayama. Description: SCP-001 is a vinyl record containing Esquivel's 1958 album Exploring New Sounds in Stereo (RCA). The album has an anomalous impact on digital numerical lists that contain it. The album, when listed in text saved digitally, will always be listed first, even if it was intended to be listed in another position. SCP-001 was sent to Billboard magazine as a review copy prior to its release in 1958. Its effects were not noticed until December 20██, when Billboard intern M. S██████, tasked with updating the manual files of review albums in magazine headquarters to a database format noted SCP-001's effects and reported it to superiors. Efforts to locate the RCA employee(s) responsible for sending SCP-001 to Billboard are ongoing. Primary Containment Theory currently holds that SCP-001 was a crude attemtp to manipulate Billboard's album rankings which failed due to the manual typesetting in use by the magazine at the time.
▷ ⦿/Procedures/001/Past/Feb_18,_20██_2.ftml ▽ ⦿/Procedures/001/Past/Feb_18,_20██_2.ftml Foundation Database changelog:
Yep, moved right over. Weird, funny. Going to look into this more (might be some potential here?). Also, fixed a typo, thanks to Dr Amoralles.
- mnakayama, Feb 18 20██ 11:41 AM Item #: SCP-001 Object Class: Safe Special Containment Procedures: SCP-001 is to be kept in a standard low-value containment locker at Site-91a. Additional research into SCP-001's effects will be the responsibility of Site-91a Chief Numerologist Dr. Mary Nakayama. Description: SCP-001 is a vinyl record containing Esquivel's 1958 album Exploring New Sounds in Stereo (RCA). The album has an anomalous impact on digital numerical lists that contain it. The album, when listed in text saved digitally, will always be listed first, even if it was intended to be listed in another position.2 SCP-001 was sent to Billboard magazine as a review copy prior to its release in 1958. Its effects were not noticed until December 20██, when Billboard intern M. S██████, tasked with updating the manual files of review albums in magazine headquarters to a database format noted SCP-001's effects and reported it to superiors.3 Efforts to locate the RCA employee(s) responsible for sending SCP-001 to Billboard are ongoing. Primary Containment Theory currently holds that SCP-001 was a crude attemtp attempt to manipulate Billboard's album rankings which failed due to the manual typesetting in use by the magazine at the time.
▷ ⦿/Procedures/001/Past/Apr_1,_20██_1.ftml ▽ ⦿/Procedures/001/Past/Apr_1,_20██_1.ftml Foundation Database changelog:
Important one-day revision to containment procedures ;)
- mnakayama, Apr 1 20██ 9:41 AM Item #: SCP-001 Object Class: Safe Special Containment Procedures: SCP-001 is to be kept in a standard low-value containment locker at Site-91a. Additional research into SCP-001's effects will be the responsibility of Site-91a Chief Numerologist Dr. Mary Nakayama. All Level 2 researchers in Site-91a shall give Dr. Nakayama $5, if possible, over her lunch break on April 1, 20██. Description: SCP-001 is a vinyl record containing Esquivel's 1958 album Exploring New Sounds in Stereo (RCA). The album has an anomalous impact on digital numerical lists that contain it. The album, when listed in text saved digitally, will always be listed first, even if it was intended to be listed in another position.2 SCP-001 was sent to Billboard magazine as a review copy prior to its release in 1958. Its effects were not noticed until December 20██, when Billboard intern M. S██████, tasked with updating the manual files of review albums in magazine headquarters to a database format noted SCP-001's effects and reported it to superiors.3 Efforts to locate the RCA employee(s) responsible for sending SCP-001 to Billboard are ongoing. Primary Containment Theory currently holds that SCP-001 was a crude attempt to manipulate Billboard's album rankings which failed due to the manual typesetting in use by the magazine at the time.
▷ ⦿/Procedures/001/Past/Apr_1,_20██_2.ftml ▽ ⦿/Procedures/001/Past/Apr_1,_20██_2.ftml Foundation Database changelog:
What the fuck what the fuck what. the. fuck.
- mnakayama, Apr 1 20██ 12:54 PM. Item #: SCP-001 Object Class: Safe Special Containment Procedures: SCP-001 is to be kept in a standard low-value containment locker at Site-91a. Additional research into SCP-001's effects will be the responsibility of Site-91a Chief Numerologist Dr. Mary Nakayama. All Level 2 researchers in Site-91a shall give Dr. Nakayama $5, if possible, over her lunch break on April 1, 20██. Description: SCP-001 is a vinyl record containing Esquivel's 1958 album Exploring New Sounds in Stereo (RCA). The album has an anomalous impact on digital numerical lists that contain it. The album, when listed in text saved digitally, will always be listed first, even if it was intended to be listed in another position.2 SCP-001 was sent to Billboard magazine as a review copy prior to its release in 1958. Its effects were not noticed until December 20██, when Billboard intern M. S██████, tasked with updating the manual files of review albums in magazine headquarters to a database format noted SCP-001's effects and reported it to superiors.3 Efforts to locate the RCA employee(s) responsible for sending SCP-001 to Billboard are ongoing. Primary Containment Theory currently holds that SCP-001 was a crude attempt to manipulate Billboard's album rankings which failed due to the manual typesetting in use by the magazine at the time.
▷ ⦿/Procedures/001/Past/Apr_1,_20██_3.ftml ▽ ⦿/Procedures/001/Past/Apr_1,_20██_3.ftml Foundation Database changelog:
Testing something.
- mnakayama, Apr 1 20██ 9:09 PM. Item #: SCP-001 Object Class: Safe Special Containment Procedures: SCP-001 is to be kept in a standard low-value containment locker at Site-91a. Additional research into SCP-001's effects will be the responsibility of Site-91a Chief Numerologist Dr. Mary Nakayama. Dr. Nakayama's desk nameplate is colored green for easy identification. Description: SCP-001 is a vinyl record containing Esquivel's 1958 album Exploring New Sounds in Stereo (RCA). The album has an anomalous impact on digital numerical lists that contain it. The album, when listed in text saved digitally, will always be listed first, even if it was intended to be listed in another position.2 SCP-001 was sent to Billboard magazine as a review copy prior to its release in 1958. Its effects were not noticed until December 20██, when Billboard intern M. S██████, tasked with updating the manual files of review albums in magazine headquarters to a database format noted SCP-001's effects and reported it to superiors.3 Efforts to locate the RCA employee(s) responsible for sending SCP-001 to Billboard are ongoing. Primary Containment Theory currently holds that SCP-001 was a crude attempt to manipulate Billboard's album rankings which failed due to the manual typesetting in use by the magazine at the time.
▷ ⦿/Procedures/001/Past/Apr_2,_20██_1.ftml ▽ ⦿/Procedures/001/Past/Apr_2,_20██_1.ftml Foundation Database changelog:
Making a note about my availability
- mnakayama, Apr 2 20██ 8:09 AM. Item #: SCP-001 Object Class: Safe Special Containment Procedures: SCP-001 is to be kept in a standard low-value containment locker at Site-91a. Additional research into SCP-001's effects will be the responsibility of Site-91a Chief Numerologist Dr. Mary Nakayama. Dr. Nakayama's desk nameplate is colored green for easy identification. Personnel are advised that Dr. Nakayama will be likely unavailable until Apr 9, 20██, as she has been granted paid vacation days by Site Director Green for this time span. Description: SCP-001 is a vinyl record containing Esquivel's 1958 album Exploring New Sounds in Stereo (RCA). The album has an anomalous impact on digital numerical lists that contain it. The album, when listed in text saved digitally, will always be listed first, even if it was intended to be listed in another position.2 SCP-001 was sent to Billboard magazine as a review copy prior to its release in 1958. Its effects were not noticed until December 20██, when Billboard intern M. S██████, tasked with updating the manual files of review albums in magazine headquarters to a database format noted SCP-001's effects and reported it to superiors.3 Efforts to locate the RCA employee(s) responsible for sending SCP-001 to Billboard are ongoing. Primary Containment Theory currently holds that SCP-001 was a crude attempt to manipulate Billboard's album rankings which failed due to the manual typesetting in use by the magazine at the time.
▷ ⦿/Procedures/001/Past/Apr_9,_20██_1.ftml ▽ ⦿/Procedures/001/Past/Apr_9,_20██_1.ftml Foundation Database changelog:
Noting upcoming title change..
- mnakayama, Apr 9 20██ 10:40 AM. Item #: SCP-001 Object Class: Safe Special Containment Procedures: SCP-001 is to be kept in a standard low-value containment locker at Site-91a. Additional research into SCP-001's effects will be the responsibility of Site-91a Chief Numerologist Dr. Mary Nakayama. Personnel are advised that Dr. Nakayama will be likely unavailable until Apr 9, 20██, as she has been granted paid vacation days by Site Director Green for this time span. Dr. Nakayama, Chief Numerologist at Site-91a until Apr 9, will be promoted to Site Co-Director alongside Dr. Green at noon on Apr 9. She will retain sole responsibility over SCP-001. Description: SCP-001 is a vinyl record containing Esquivel's 1958 album Exploring New Sounds in Stereo (RCA). The album has an anomalous impact on digital numerical lists that contain it. The album, when listed in text saved digitally, will always be listed first, even if it was intended to be listed in another position.2 SCP-001 was sent to Billboard magazine as a review copy prior to its release in 1958. Its effects were not noticed until December 20██, when Billboard intern M. S██████, tasked with updating the manual files of review albums in magazine headquarters to a database format noted SCP-001's effects and reported it to superiors.3 Efforts to locate the RCA employee(s) responsible for sending SCP-001 to Billboard are ongoing. Primary Containment Theory currently holds that SCP-001 was a crude attempt to manipulate Billboard's album rankings which failed due to the manual typesetting in use by the magazine at the time.
▷ ⦿/Procedures/001/Past/May_3,_20██_1.ftml ▽ ⦿/Procedures/001/Past/May_3,_20██_1.ftml Foundation Database changelog:
Well. This works like I think it does. I've thought this over for weeks: It's time. I've locked the page down to everyone but myself and O5s. I think I'm doing the right thing. I really do think I am. Pray for me.
- mnakayama, May 3 20██ 4:11 AM. Item #: SCP-001 Object Class: Safe Special Containment Procedures: SCP-001 is to be kept in a standard low-value containment locker at Site-91a. Additional research into SCP-001's effects will be the responsibility of Dr. Mary Nakayama. Dr. Nakayama, Chief Numerologist at Site-91a until Apr 9, will be promoted to Site Co-Director alongside Dr. Green at noon on Apr 9. She will retain sole responsibility over SCP-001. Description: SCP-001 is a vinyl record containing Esquivel's 1958 album Exploring New Sounds in Stereo (RCA). The album has an anomalous impact on digital numerical lists that contain it. The album, when listed in text saved digitally, will always be listed first, even if it was intended to be listed in another position.2 SCP-001 was sent to Billboard magazine as a review copy prior to its release in 1958. Its effects were not noticed until December 20██, when Billboard intern M. S██████, tasked with updating the manual files of review albums in magazine headquarters to a database format noted SCP-001's effects and reported it to superiors.3 Efforts to locate the RCA employee(s) responsible for sending SCP-001 to Billboard are ongoing. Primary Containment Theory currently holds that SCP-001 was a crude attempt to manipulate Billboard's album rankings which failed due to the manual typesetting in use by the magazine at the time. Mary Nakayama, immediately after the saving of this document, will attain omnipotence and omniscience, rising to and becoming Godhead. She will span all time and have complete dominion over this Universe and this Reality. Everything, everything under everything and everything over everything, will be at her command. She will gain all necessary mental faculties to process and utilize these abilities while maintaining uninterrupted consciousness. Members of the O5 council will receive a note indicating the nature of SCP-001. Her family will receive a note indicating her love for them. Mary Nakayama disappeared from her quarters at Site-91a before 6 AM on May 3. She has not been located since. | 2023-09-06T01:26:18.401715 | https://example.com/article/1330 |
Carpet Cleaning in NASHVILLE, Tennessee
When you need affordable and professional carpet cleaning services for your home or business, contact Steam-Pro in Nashville, Tennessee. We offer an array of carpet cleaning services to meet your specific needs, including:
Pet Packages
Do your carpets have pet stains? If so, be sure and ask about our pet packages that includes basic steam cleaning, a pet enzyme to treat pet stains and a disinfectant treatment to sanitize and treat pet odors.
If your carpets need that "extra" boost, choose our deluxe pet package. This includes everything in the regular pet cleaning package, plus the use of deep cleaning.
Steam-Pro pet packages include the necessary basic cleaning special and enzyme treatments for pet urine stains and odors. Many of these can be eliminated with just one treatment. Make your carpets look and smell like new again. | 2023-09-28T01:26:18.401715 | https://example.com/article/7000 |
Q:
why @media only screen and (min-width: 768px) also apply for screen width less than 768px
The css for min-width 768 is not working properly in mobile. But same css is working properly in inpect mode for width less than 768 in chrome desktop browser.
@media only screen and (min-width: 768px){
#main {
max-width: 75%;
float: left;
}
}
But when I switch to mobile mode in inspect tool it's again not working properly.
I am trying to edit the blogger classic theme.
link of the blog https://egadgetdeals.blogspot.com/2019/11/what-youll-build-in-part-1.html?m=1
A:
The meta tag viewport to avoid zoom is missing, add this into the head tag :
<meta name="viewport" content="width=device-width, initial-scale=1">
| 2024-02-11T01:26:18.401715 | https://example.com/article/6828 |
Introduction {#s1}
============
In conversation, the meaning of linguistic expressions such as "the red couch" is often ambiguous, such that interlocutors need to work together to make sure their interpretations are aligned ([@BHU116C51]). One influential proposal assumes that interlocutors align their interpretations by processing language against their "common ground," the set of mutual beliefs and expectations that are shared, and critically, "known to be shared" with their interlocutors ([@BHU116C37]; [@BHU116C11]; [@BHU116C63]). This collaborative model of conversation assumes that the memory representations forming the common ground are built up through a process of "grounding" ([@BHU116C10]). Processing language consistently with common ground involves accessing representations that are known to be shared, and suppressing information known privately to oneself.
The process of inferring another\'s mental states, or "mentalizing" (e.g., [@BHU116C18]) is likely to be involved not only in establishing common ground representations but also in selectively accessing and maintaining such representations in a context-sensitive manner. Language users cannot always count on others having the same perceptual states and experiences and so must on occasion modulate what information they use in speaking and understanding to be consistent with what they know about their interlocutor. Behavioral evidence suggests that during conversation, mentalizing is often called upon for resolving referential ambiguity, especially in cases in which there are clear differences in perspective ([@BHU116C35]; [@BHU116C36]).
Given the inherent ambiguity of language, mentalizing would seem to be an essential ingredient of successful communication ([@BHU116C43]; [@BHU116C36]). However, research over the past several decades indicates that mentalizing is effortful ([@BHU116C54]; [@BHU116C44]; [@BHU116C38]) and that language users have access to other strategies for resolving ambiguity that do not involve mentalizing ([@BHU116C17]; [@BHU116C51]; [@BHU116C60]; [@BHU116C4]).
One case that is relevant to the current investigation concerns how basic memory processes activate contextually relevant information during conversational language processing. During interaction, the perceptual experiences associated with hearing and seeing a particular interlocutor will tend to increase the accessibility of information in long-term memory that is associated with that interlocutor; in this way, basic memory mechanisms promote contextually appropriate speaking and understanding. However, the episodic representations that are forged through conversational interaction are not identical to common ground, as episodic representations can be shared without also being known to be shared ([@BHU116C60]). Furthermore, contextually appropriate representations may become activated in a contextually appropriate manner via the basic memory retrieval principle of encoding specificity rather than through mentalizing ([@BHU116C4]). Supporting this view, a recent study shows that when a speaker articulates an utterance designed by another speaker (e.g., reading someone else\'s email aloud), listeners activate information associated with the person delivering the message (the messenger/reader) rather than with the person who designed it, despite the relevant common ground being that which is shared with the utterance designer ([@BHU116C4]).
In short, because processes other than mentalizing can promote successful communication, in any given case in which language users adapt their language processing to context, it is an empirical question whether or not such adaptation involved mentalizing as an indicator of genuine partner-oriented processing. Our study therefore set out to investigate these questions using magnetoencephalography (MEG) to monitor listeners′ unfolding interpretations of referentially ambiguous expressions during live social interaction: We tested whether mentalizing would occupy a central, anticipatory role or a more "on demand" role within common ground processing, which has been of some debate recently (e.g., [@BHU116C43]; [@BHU116C36]). MEG is well suited to the study of spoken language processing in context, because it provides the necessary temporal and spectral resolution to examine moment-by-moment changes in activation and modulation of neural oscillations, as well as sufficient spatial resolution to enable localization of function and the identification of brain networks.
Previous neuroimaging studies have addressed issues of referential ambiguity, memory, and mentalizing, but usually these issues are addressed separately in different studies, often in non-conversational settings with socially isolated participants. While EEG studies have documented a remarkably early sensitivity to referential ambiguity (\"NRef\" effect; [@BHU116C66]; [@BHU116C67]), it remains unclear whether such effects can be modulated by conversational memory or by beliefs about common ground, as participants in these studies were presented with prepared text or speech in social isolation. An fMRI study of communicative perspective taking reported activations related to referential ambiguity in the superior dorsal medial prefrontal cortex, bilateral middle temporal gyri, and the left temporal pole, whereas activations in the left precuneus and bilateral temporo-parietal junctions (TPJs) particularly reflected the presence vs. absence of an avatar during referential instructions ([@BHU116C14]). However, this study used artificial avatars and did not involve interaction with live partners.
Other fMRI and lesion studies have identified regions of the brain that are likely to be responsible for building and/or maintaining representations of others′ beliefs and goals, including right-hemisphere structures in temporo-parietal areas such as the posterior temporal sulcus (pSTS) and the TPJ, in addition to certain medial ([@BHU116C58]; [@BHU116C57]; [@BHU116C68], for review) and especially ventromedial (e.g., [@BHU116C23]; [@BHU116C2]) prefrontal areas. A recent study showed that these same regions may be involved in generating and inferring communicative intentions during live nonlinguistic communication ([@BHU116C46]). This is consistent with other recent studies that used relatively realistic social interaction (for review, see [@BHU116C29]) and which have shown increased activation in social cognition and reward brain areas ([@BHU116C53]). In sum, although we have learned much about the various brain systems involved in processing referential ambiguity and in mentalizing, there is still little understanding of when, and how extensively, mentalizing networks might be activated when participating in realistic conversational interaction.
The absence of neuroimaging studies on conversational language processing reflects the existence of a number of technical and logistical challenges that have imposed a barrier to this kind of research. First, the required signal-to-noise ratio for neuroimaging data analysis typically necessitates a larger number of trials compared with behavioral studies, as well as a high level of control over the stimuli and stimuli presentation timings, in order to reduce any additional sources of variability. This need for large numbers of highly controlled trials is at odds with the characteristics of naturalistic interaction with live conversational partners, where it is difficult to predict what speakers will say and when they will say it. Furthermore, identifying the brain networks involved in the processing of conversational speech requires a neuroimaging technique that provides adequate spatial and temporal resolution. We surmounted these obstacles by using MEG with a novel communication-game paradigm "do-I-see-what-you-mean?" (see Fig. [1](#BHU116F1){ref-type="fig"}, Panel *A*) that enabled spontaneous, quasi-naturalistic conversation with trained confederates, but which still allowed us full control over stimulus characteristics and timing through interleaving prerecorded speech with live speech. Critically, we implemented this interleaving in a way that would lead participants to believe that they were experiencing a live interaction including only spontaneously produced speech by real participants. Figure 1.Panel *A*: Design and example displays and speech in the interactive (left) and test (right) phases. Stimuli were presented in color during the experiment. The speaker\'s view was implied by the speaker\'s behavior without being seen by the participant and is presented here for clarity. Physical stimuli in the test phase were identical for the 4 experimental conditions (same-/different-speaker precedent match/no precedent) over participants, but test trials were never repeated within a single participant. Panel *B*: Visualization of predictions from the anticipatory and "on-demand" view of mentalizing about which areas are expected to be more active in the same-speaker precedent mismatch than the other conditions during different parts of the test phase.
The experiment alternated between blocks of trials comprising a \"grounding\" phase, characterized by spontaneous interaction between the participant and 1 of 2 confederate speakers, followed by a testing phase in which participants heard speech from 1 of the 2 speakers that was (unbeknownst to them) prerecorded and not produced live. During interactive grounding phases (*n* = 42 of interactions in each phase), participants built up temporary referring precedents (e.g., agreements to call a particular object a "couch"; see [@BHU116C8]) through live interaction with 1 of the 2 confederate speakers (1 male and 1 female) regarding how images presented on separate screens were to be named (Fig. [1](#BHU116F1){ref-type="fig"}, Panel *A*, left and middle panel). On trials of the subsequent test phase (*n* = 26 of trials in each phase), both the participant and the confederate speaker allegedly saw 1 object on their respective screens (Fig. [1](#BHU116F1){ref-type="fig"}, Panel *A*, right panel). In critical \"precedent mismatch\" trials, the participant saw a target object from the interactive grounding phase and then heard either the same or the other (confederate) speaker name their own object (prerecorded speech), but using a different (mismatching) term from the one established for the target object during grounding (e.g., using the term "sofa" rather than the established term "couch" to refer to an object; Fig. [1](#BHU116F1){ref-type="fig"}, Panel *A*, right, top panel). Based on the description the speaker chose, the participant had to decide whether or not the speaker was looking at the same object.
In short, we manipulated 2 factors during the critical test-phase trials (in relation to the grounding phase): Firstly, we manipulated whether the same or different (confederate) speaker would name the test pictures (blocked per test phase), and secondly, we manipulated (1) whether the current naming did not match a previously established precedent or (2) whether no precedent had been established at all. That is, in some grounding trials, objects had been referred to by their location (e.g., "top left"), potentially generating interactive memory traces for that object, yet without a naming precedent (see Fig. [1](#BHU116F1){ref-type="fig"}, Panel *A*, right, middle panel). These "no precedent" trials served as baseline conditions for the same- and different-speaker conditions, respectively. Additionally, \"precedent match\" filler trials (and a number of other catch trials) were added as well to each test phase to ensure that participants would not learn to expect a precedent mismatch on a majority of trials (see Fig. [1](#BHU116F1){ref-type="fig"}, Panel *A*, right, bottom panel; see also Materials for detailed information).
Importantly, a speaker might use a new (mismatching) term for different reasons. The possibility that the speaker might be gazing at a different object provided a cooperative reason why the same speaker, who set up the precedent in the first phase, might use a new term; they might want to indicate that they now see a different picture than before. This could be inferred via mentalizing. In contrast, if a different speaker had established the precedent, the current speaker might simply have different preferences for naming things, so in that case, it is more probable that the speaker is looking at the same picture as the participant. The task made it important for listeners to keep track of who said what, because whether the name they hear is a match or a mismatch (by the same or a different speaker) provides relevant information for deciding whether the speaker sees the same or a different picture. It is important to note that listeners were informed before each phase of test trials whether or not they would hear the same speaker as in the preceding interactive phase or the other speaker. This allowed for consistent person-specific retrieval of previous interactions and possibly anticipation of the speaker\'s intentions.
Different predictions can be made for the different conditions about the activation time-course of functional neurocognitive networks. It is important to point out, however, that in order to separate the various functional networks and their activation dynamics, we had to rely on the substantial body of previous neuroimaging research about how brain areas relate to function. Thus, the functional separations of episodic memory, language, and mentalizing networks we propose here have to be understood as well-founded, yet hypothetical assertions. Before fleshing out the crucial hypotheses about the time-course of mentalizing, we spell out specific predictions about the time-course of activation of memory and language networks. These predictions are rather independent of the different views regarding the anticipatory vs. "on-demand" role of mentalizing but also relate to speaker-specific common ground vs. more generic speaker-independent processing.
First, the visual stimulus would elicit retrieval of any existing precedents (e.g., couch), if present, before hearing any speech, simply on the basis of the episodic memory of the previous interaction (e.g., [@BHU116C3]). Such situated multimodal episodic short- and long-term representations have been associated with medial temporal lobe function (e.g., [@BHU116C62]; [@BHU116C48]), allowing viewpoint-dependent retrieval of an object in its visuo-spatial context (e.g., [@BHU116C59]; [@BHU116C64]), including the "negotiated" name for the object (e.g., [@BHU116C13] for review), along with the identity of the speaker ([@BHU116C31]). Because listeners knew in advance of each test phase which speaker would be speaking, we expected stronger retrieval of the precedent in the same-speaker condition (i.e., speaker identity serving as a further retrieval cue). This could be reflected by differential activation in the middle temporal lobe (e.g., [@BHU116C31]; [@BHU116C47]) and the temporal poles ([@BHU116C31]), that is, stronger anticipatory episodic retrieval, in conjunction with executive function areas in lateral prefrontal cortex ([@BHU116C55]; [@BHU116C34]). Importantly, episodic retrieval may lead to anticipation of a specific linguistic expression in the right temporal lobe, which has been proposed in conjunction with right lateral prefrontal cortex ([@BHU116C65]) as a locus for linguistic predictions and integration based on pragmatic (e.g., [@BHU116C20]; [@BHU116C16]) and/or visual episodic context (e.g., [@BHU116C39]). Such activations related to memory retrieval would be elicited by viewing the picture, so they can occur from the moment that the picture is presented but will probably be on-going throughout the trial. Furthermore, such activations would indeed reflect speaker-specific rather than generic speaker-independent memory processing. However, this fulfills a necessary but not a sufficient condition for evidencing the engagement of common ground. As pointed out earlier, it could merely reflect context-specific encoding and retrieval of representations that are shared without being known to be shared. Mentalizing processes, in contrast, would be a more genuine indicator of common ground use.
With regards to hypotheses concerning the involvement of mentalizing, previous research supports a prediction of greater involvement in the condition where the same speaker fails to match an established precedent, as this is the situation in which common ground is apparently violated ([@BHU116C43]; [@BHU116C36]). In contrast, situations where no precedent had been established or where a different speaker fails to match a precedent would require corrective mentalizing to a much lesser degree (if at all). Thus, observing the strongest mentalizing brain network activation in the same-speaker, precedent mismatch condition would corroborate the general view that participants make use of common ground processing for resolving referential ambiguity in the current paradigm. To distinguish between an anticipatory vs. an "on-demand" view of mentalizing in common ground processing, we need to establish *when* mentalizing is engaged in relation to language processing (see Fig. [1](#BHU116F1){ref-type="fig"}, Panel *B*). Are perspective-taking processes spontaneously engaged prior to an anticipated communicative event, in the service of generating expectations about what a speaker might say and how she might say it? Alternatively, are they mostly engaged \"on demand\" after the listener suspects communication failure and makes a conscious effort to reestablish common ground? We therefore examined the timing of activation of mentalizing networks, typically associated with the TPJ, precuneus (PC), and the ventromedial prefrontal cortex (vmPFC, e.g., [@BHU116C23]; [@BHU116C68]; [@BHU116C2]) to understand the extent to which these mentalizing networks are activated prior to naming by the same speaker or, in contrast, only in response to a precedent mismatch produced by the same speaker.
The patterns of activation timing, co-activation, and oscillatory coupling between distinct brain modules provided us with unprecedented detail about processes of human communicative interaction and further allowed us to disentangle a more partner-orientated from a more egocentric conception of interactive communication. However, we would like to re-iterate that the current segregation between functional brain modules is hypothetical (reverse inference), as it relies on previous neuroimaging research for linking brain areas to function. Our results must therefore be regarded as provisional, requiring further testing and confirmation by subsequent research.
Materials and Methods {#s2}
=====================
Participants {#s2a}
------------
We obtained MEG data from 16 British participants (8 males), all of whom reported speaking English as their native language. They were recruited from the participant pool of the psychology department of Glasgow University, were paid £6 per hour for their participation, and gave their informed consent. Data from an additional female participant were excluded because she clicked on the wrong picture too often (22 times) in the interactive phase (see Procedure).
Materials {#s2b}
---------
We gathered 320 pictures (from the Internet) that were given 2 plausible names in an informal pilot as the experimental pictures (see Table [1](#BHU116TB1){ref-type="table"} for examples). The 2 names for the experimental pictures were selected to be as balanced as possible. The more dominant name was always used the first time the object was named (in the interaction phase, see below). This was done to preclude the explanation that the speaker had thought of a better way to name the picture. We selected 640 other pictures as filler items that were given a name that was clearly dominant in the informal pilot. These pictures were used for 5 different categories of fillers. First, to make sure that not all pictures that were seen in the interactive phase were named differently in the subsequent test phase, we used precedent match fillers (Table [1](#BHU116TB1){ref-type="table"}, third row). We used 80 pictures to appear twice in the interactive phase and once (with the same name) in the following test phase. Second, in order to demonstrate to participants that different pictures could be named in the same way in the 2 different phases, we added the \"category filler\" condition (20 pairs of pictures, Table [1](#BHU116TB1){ref-type="table"}, fourth row) with 2 different pictures from the same category (e.g., piano and violin), 1 appearing in the interactive phase and 1 in the subsequent test phase, which were both named by their superordinate term (e.g., musical instrument). Furthermore, 100 pictures only appeared in the test phase, 40 of which were named correctly (\"new correct fillers,\" Table [1](#BHU116TB1){ref-type="table"}, fifth row), and the other 60 were named incorrectly (\"new incorrect fillers,\" Table [1](#BHU116TB1){ref-type="table"}, sixth row). The names used in the incorrect filler condition were related to the real names for the pictures (e.g., jar---glass) so that participants needed to pay attention to spot subtle differences. Next to that, 420 pictures were used as \"pure fillers\" (Table [1](#BHU116TB1){ref-type="table"}, bottom row). These appeared once in the interactive phase but were never named. Table 1Overview and examples of the experimental and filler items usedItemsNumberInteractive phaseTest phaseExample pictureExperimental precedent mismatch160SofaCouchExperimental no precedent160Top right (e.g.)FlamePrecedent match fillers80PearPearCategory fillers (pairs)20Musical instrument*absent**absent*Musical instrumentNew correct fillers40*absent*PhoneNew incorrect fillers60*absent*GlassPure fillers420*not namedabsent*[^1]
The names for the test phase (see Procedure) were recorded, divided equally between the 2 confederates. Some of the filler (but no experimental) names were recorded with a hesitation, to make participants believe the pictures were named on the spot.
Procedure {#s2c}
---------
Participants were first prepared for the MEG. HPI coils were attached to the participant\'s head behind the right and left ears, above the nasion, and on the right- and the left-hand side of the forehead. The coil positions and head shape were digitized before the scan using the Polhemus program and stylus (Polhemus Isotrak, Kaiser Aerospace, Inc.). Digitization is standardly used and allows to determine the head position in the MEG at the start and end of each block (maximum movement tolerated was 0.5 cm) and enables co-registration with the structural MRI for later source localization. Those participants that did not have a structural MRI were scanned after the experiment using a 3T Siemens Trio MRI (Siemens Medical Solutions). Preparation took about 45 min on average, during which the experimenter collected the confederates (instructed fourth-year psychology students, 1 female and 1 male) and introduced them to the participant. Participants were told that these 2 speakers would interact with them via a microphone from separate rooms. After 2 practice blocks, in which participants experienced the role of both listener and speaker, they were presented with 5 20-min runs consisting of 4 blocks each. The order of blocks was randomized per participant. Each block consisted of an interactive phase followed by a test phase. The speaker for each phase was always announced before the start of the phase and remained the same throughout the phase.
In an interactive phase, the speaker/confederate (following a script) asked the participant to click on pictures on the screen using an optical track ball. Participants were told they could interact with the speaker and ask questions. Participants always saw 9 pictures on the screen (see Fig. [1](#BHU116F1){ref-type="fig"}, Panel *A*, middle), and speakers were allegedly seeing the same stimuli and had to name those pictures marked by a red frame (see Fig. [1](#BHU116F1){ref-type="fig"}, Panel *A*, left). The speaker/confederate indicated most pictures by their name, but some by their location (e.g., "bottom right"). In the latter case, pictures in the marked location allegedly were obscured from the speakers view (see, e.g., Fig. [1](#BHU116F1){ref-type="fig"}, Panel *A*, left panel, bottom right picture). In each interactive phase, the speaker/confederate named 13 pictures twice in exactly the same way (later serving as precedent mismatch trials or as precedent match fillers) and 8 pictures twice by their location (later serving as no precedent trials).
In the test phases, the speaker/confederate was the same as for the preceding interactive phase in half of the cases and different in the other half. The participant saw only 1 picture at a time on the screen (see Fig. [1](#BHU116F1){ref-type="fig"}, Panel *A*, right). The speaker/confederate allegedly also saw only a single picture and named that picture (e.g., "sofa"). Participants were asked to indicate whether the speaker\'s picture was the same as or different from their own, using their dominant hand on the trackball (thumb for same picture and ring finger for different picture). They were not allowed to talk to the speaker. In reality, all utterances of the speaker/confederate in the test phase were recorded beforehand. Each trial started with a fixation cross in the middle of the screen, followed by presentation of the picture at the same location. In experimental trials (precedent mismatch or no precedent), the picture was always presented for 800 ms before the recorded name was played and stayed on the screen until a response was given. For filler trials, the preview interval before presentation of the name was varied. Each test phase started with 2 filler trials, followed by a random presentation of 8 precedent mismatch trials (named differently than in the interactive phase), 8 no precedent trials (indicated by their location in the interactive phase), 4 precedent match fillers (named the same as in the interactive phase), and 4 other fillers (see Materials and Table [1](#BHU116TB1){ref-type="table"}). Note that the physical stimuli in the test phase were identical for the 4 experimental conditions over participants, but items were not repeated within a participant. The different conditions were created by changing the speaker and the particular reference to this picture in the preceding interactive phase. Each experimental condition (same-speaker precedent mismatch; same-speaker no precedent; different-speaker precedent mismatch; different-speaker no precedent) occurred 80 times throughout the experiment.
Apparatus {#s2d}
---------
MEG data were acquired using a 248-channel (or SQUIDs; superconducting quantum interference devices) whole head magnetometer (4D-Neuroimaging Magnes 3600 WH system) at the CCNi at the University of Glasgow, sampled at 508.63 Hz and band-pass filtered between 0.1 and 200 Hz. Trigger pulses via the parallel port were used to synchronize MEG data acquisition with experimental events. A Panasonic 3-chip DLP projector (PT-D7700E-K) was employed for visual stimulus presentation. Resolution was 1024 × 768 pixels covering a visual angle of 24° horizontal by 18° vertical. Each picture in the 3 × 3 matrices, employed during the interactive phases, covered a visual angle of 3.5° × 3.5°, whereas the single pictures presented during the testing phases covered 4.7° × 4.7°.
Ethical Statement {#s2e}
-----------------
All procedures (including consent and participant debriefing) were reviewed and approved by the College Ethics Committee of the University of Glasgow and were in full agreement with APA and BPS guidelines, as well as with the Declaration of Helsinki.
Data Analysis {#s2f}
-------------
Preprocessing and statistical analysis was conducted using the Fieldtrip Matlab^®^ toolbox ([@BHU116C49]) and was in agreement with recently published guidelines for MEG research ([@BHU116C25]). First, epochs were extracted from the MEG for all test phase trials from 500 ms before the picture was shown on the screen (i.e., 1300 ms before sound onset) until 500 ms after the response. Subsequently, linear trends were removed and all epochs were denoised to remove signals generated by the HPI coils. Trials with very large (movement and/or eye) artifacts were removed before PCA/ICA since this procedure can be unreliable if the data contain much noise. On average, only 1 or 2 trials were removed per experimental condition at this stage (maximally 5, no significant differences between conditions). Then, PCA was used to reduce data dimensionality for each participant to 40, 60, or 100 components, which were then subjected to ICA ([@BHU116C49]; [@BHU116C25]). A higher number of components were used if signal and noise could not be separated clearly using the lower number of components. These components were inspected visually and removed if they contained only noise and/or artifacts (e.g., caused by heart beats or eye movements). The average proportion of removed components was 0.20 (range: 0.05 to 0.37). The remainder of the components was used to recreate the MEG signal. After that, individual trials with remaining artifacts were removed manually once more. This resulted in an average of 76.1 remaining trials (range: 69--80 out of 80). The numbers of remaining trials did not differ between the 4 conditions within the same analysis (Fs \> 1). To identify the same-speaker \"deliberation trials\" (see ERF results below), we took all trials from the same-speaker, precedent mismatch condition in which participants gave a \"different picture\" response, plus the one-third \"same picture\" responses with the longest RTs per participant. This led to an average of 42.6 deliberation trials per participant (range: 32--66). Finally, 5 or 6 bad channels were interpolated for each participant based on the signal of neighboring channels. These preprocessed data entered the ERF and time-frequency (power) analyses. For coherence analysis, we used preprocessed data without removing components via the standard PCA/ICA approach, since it has been suggested that removing ICs, when preceded by a PCA, distorts the oscillatory phase of the signal (e.g., [@BHU116C9]). All reported coherence effects are relative between conditions and unlikely to be biased by artifacts (e.g., heart, muscles), assuming a random distribution of artifacts across trials and conditions.
For evoked responses (ERF), trials of the same condition were averaged per participant. These averages were adjusted in relation to a baseline interval of 200 ms immediately prior to picture onset and filtered with a band-pass filter between 0.5 and 35 Hz. For time-frequency representations, the power of each frequency between 2 and 30 Hz (with steps of 1 Hz) was calculated on individual trials over time using a Hanning taper ([@BHU116C22]) with a window of 4 cycles (changing in length per frequency). For both ERF and time-frequency averages, planar gradient representations were calculated prior to sensor-level analysis. Often it is helpful to interpret MEG fields measured by magnetometers (and axial gradiometers, e.g., [@BHU116C25]) after transforming the data to a planar gradient configuration, that is, by computing the gradient tangential to the scalp. One advantage of the planar gradient transformation is that the signal amplitude typically is largest directly above a source. This transformation is particularly helpful for sensor-level analysis as it also allows for more communality across participants with the same source locations yet with differing orientations (planar gradient represents the focus above the location of the source and not the more orientation-dependent fields around the source). However, for source level analysis, the original magnetometer representation and according lead fields were employed. To test for statistically significant differences between conditions and reduce the multiple-comparison problem, we used the cluster-based approach implemented in the Fieldtrip toolbox ([@BHU116C40]). This robust method reduces the multiple-comparisons problem and controls family-wise error across subjects in time and space. To examine differences between experimental conditions, paired *t*-tests are performed for each time-point, channel, and frequency (for time-frequency analyses) with a threshold of *P* \< 0.05. Significant clusters in time, space, and frequency are identified on the basis of proximity (neighbors) in all dimensions of the cluster. Cluster statistics are calculated by taking the sum of *t*-values in every cluster. To obtain a *P*-value for each cluster, a Monte Carlo method is used to evaluate how extreme the cluster statistics of the 2 conditions are compared with random partitions of the samples. The proportion of random partitions that results in larger cluster statistics than the observed one is the *P*-value. The threshold was fixed to *P* = 0.05.
We employed 2-step analyses for emulating the interaction between 2 factors in time and frequency analyses. We first calculated a *t*-statistic for the difference between 2 conditions, for example, precedent mismatch vs. no precedent trials for each participant separately and then included the outcomes (*t*-values) of this first step statistic into a group statistic that compared a second difference, for example, same vs. different speaker (note, the first level *t*-statistic was calculated separately for the same- and different-speaker condition at the individual level). The comparison at the group level followed the robust statistics approach described earlier. The described 2-step analysis approached the interaction between speaker (same/different) and precedent (precedent mismatch/no precedent).
To identify sources underlying the sensor-level effects, individual single-shell ([@BHU116C45]) head models were generated based on the individual MRI aligned with the MEG sensor array via the conducted head digitization. Voxel size was 6 mm, and all individual head models were normalized to a standard brain prior to analysis. ERF sources were identified using a Linearly Constrained Minimum Variance (LCMV) beam former ([@BHU116C69]), where we calculated a common LCMV filter for all 4 conditions (to increase SNR) per participant. This common filter was then used to transform ("beam") the individual conditions into source (voxel) space for comparisons between conditions. For identifying generators of theta oscillations, we employed Dynamic Imaging of Coherent Sources (DICS) beam formers ([@BHU116C26]). In this case, we were able to use condition-specific spatial filters that could potentially reveal qualitative differences between conditions. DICS was also employed for localizing (inter-trial) phase-coherent sources in theta (4--6 Hz) by means of cross-spectral density matrices in relation to particular reference signals (see [@BHU116C27]; [@BHU116C33]). For statistical testing of source-localizations underlying ERF and time-frequency effects and coherent sources, we used the same cluster-based approach, in this case only clustering over voxels. Time windows and frequency ranges (in case of time-frequency sources) were chosen based on significant sensor-level effects. Sources identified in theta-power analysis were employed as references for theta coherence analysis. For this type of analysis, we reduced the multiple-comparison problem by using a \"false discovery rate\" (FDR) approach, since it has been suggested to be more sensitive to spatially localized effects compared with a bias toward more widespread effects in cluster-randomization ([@BHU116C24]).
Results and Discussion {#s3}
======================
Confirming the results of previous studies ([@BHU116C43]; [@BHU116C36]; [@BHU116C42]), our behavioral results indicated that listeners experienced greater confusion for precedent mismatches produced by the same speaker as compared with those produced by a different speaker. Figure [2](#BHU116F2){ref-type="fig"} shows that both reaction times and choices revealed an interaction between speaker (same/different) and precedent (mismatch/no). ANOVAs confirmed the prediction of a larger precedent mismatch vs. no precedent effect in the same speaker than the different-speaker case for RT (longer RTs, *F*~1,15~ = 8.43, *P* = 0.011) and for response choices (more \"different\" responses; *F*~1,15~ = 21.15, *P* \< 0.001). These interaction effects allowed us to specifically search for the neural substrates involved in generating these effects. We primarily analyzed MEG signals in the frequency domain since this type of analysis (in contrast to averaging, i.e., ERFs) is sensitive to evoked as well as to induced brain signals (e.g., [@BHU116C50]). We found strong effects in the theta band (4--6 Hz) that reflected widespread differences in cortical activity across conditions. These will be reported in the next section, whereas the more confined effects in alpha (9--13 Hz) and gamma (66--78 Hz) are reported in [Supplementary Figure S1](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1). Figure 2.Behavioral responses; RT (left) and choice responses ("different" or "same" picture; right). \**P* \< 0.05; \*\**P* \< 0.001.
Theta Oscillatory Effects {#s3a}
-------------------------
### Theta Power (Sensor and Source Space) {#s3a1}
Analyses were time-aligned to the onset of the spoken expression, such that negative values of the time variable represent processes taking place during the picture preview (pre-naming), whereas positive values represent processes taking place after onset of the verbal expression (post-naming). Consistent with other studies reporting theta oscillations in the context of episodic working memory and language processing (e.g., [@BHU116C7]; [@BHU116C28]; [@BHU116C6]; [@BHU116C32]; [@BHU116C19]; [@BHU116C21]), we found significant modulations of frequencies between 4 and 6 Hz. A time-frequency analysis at the sensor level between −800 and 1000 ms in the range of 2--30 Hz revealed a significant cluster (*P* = 0.012) in the theta range (4--6 Hz) for the precedent mismatch vs. no precedent comparison within the same-speaker condition, in a time window around 350--650 ms after naming onset (Fig. [3](#BHU116F3){ref-type="fig"}, top row). The corresponding comparison for different speaker did not reveal a significant effect in theta (Fig. [3](#BHU116F3){ref-type="fig"}, bottom row) or any other frequency (see [Supplementary Fig. S1](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1)), corroborating the special status of the same-speaker, precedent mismatch trials observed in the behavioral data. Figure 3.Time-frequency representations. Effects were found in theta (4--6 Hz) between 350 and 650 ms, only for the precedent effect within the same-speaker condition (top row), but not within the different-speaker condition (bottom row). Colors in the topographical plots on the left indicate differences in power (precedent mismatch minus no precedent), relative to a baseline time window (−1000 to −800 ms, just before display of the picture). Channels participating in the significant cluster in a representative time window (450--500 ms) are indicated by black dots. White circles indicate the channel shown in the 4 time-frequency plots on the right, showing power, relative to the baseline time window for each of the 4 conditions. White squares indicate the location of the effect in time and frequencies. Results for alpha and gamma frequencies are reported in [Supplementary Figure S1](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1).
We localized the sources of the observed sensor-level theta effect (same speaker: precedent mismatch vs. no precedent; see Fig. [3](#BHU116F3){ref-type="fig"}, top row) using DICS (see Methods) collapsing over a post-naming time window between 200 and 800 ms (to include ∼3 theta cycles) and 3 to 7 Hz. We chose these parameters to cover the maximum of the sensor-level effects across time samples and frequencies. The findings for the same-speaker, precedent effect (1 spatially distributed cluster, *P* = 0.028) are shown in Figure [4](#BHU116F4){ref-type="fig"}, Panel *A* (and [Supplementary Table S1](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1), Panel *A*) and revealed sources in areas that previous research (see Introduction) has related to: (1) mentalizing (right TPJ, ventromedial prefrontal cortex vmPFC, right PC), (2) episodic working memory including executive function (right parahippocampal gyrus PHG, left lateral (lat)PFC), (3) language (left temporal cortex TC, including left temporal pole TP), (4) attention (right posterior parietal cortex, PPC), and (5) motor functions (left lateral premotor and motor cortex, PMC). This source pattern conformed very strongly to our expectations regarding functional processing networks interacting in the post-naming interval (see Introduction). Figure 4.Theta-power sources localized for the post-naming interval by means of DICS (see Methods). Sources in red show a power increase in 3--7 Hz for the same-speaker precedent mismatch as compared with the no precedent condition (Panel *A*) or as a result of an interaction between speaker and precedent (Panel *B*). The color-coded scale represents *t*-values. Labels are L for left and R for right hemisphere; SM1, primary sensori-motor cortex; PMC, premotor cortex; PPC, posterior parietal cortex; OCC, occipital cortex; latPFC, lateral prefrontal cortex; TP, temporal pole; TC, temporal cortex; TPJ, temporo-parietal junction; PHG, parahippocampal gyrus; PC, precuneus; vmPFC, ventromedial prefrontal cortex. Further explanations are given in the text and [Supplementary Table S1](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1).
In order to further strengthen our pattern of results, we conducted a two-step analysis (see Methods) with the frequency characteristics and within the time interval described earlier in order to analyze the speaker-by-precedent interaction in source space. This analysis revealed significant interactions between speaker and precedent that showed a strikingly similar pattern (1 spatially distributed cluster, *P* = 0.008; Fig. [4](#BHU116F4){ref-type="fig"}, Panel *B*; [Supplementary Table S1](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1), Panel *B*) to that of the simple contrast in the same-speaker condition described earlier. Additional effects in the two-level analysis extended to the right lateral PFC, typically associated with executive functions in working memory. Effects also seemed to be more pronounced and extensive in core areas around the right TPJ, PC, and vmPFC, previously linked to mentalizing (see Introduction). Episodic working memory in right PHG and the left latPFC also revealed more pronounced levels of significance in this two-step analysis. In the left language areas, the focus of significance was shifted toward TP but still comprised middle TC.
Overall, the pattern across the 2 types of analysis is reassuringly consistent and highlights the involvement of typical mentalizing, episodic working memory, and language areas (conforming to previous research, see Introduction); a pattern that is highly specific to the same-speaker, precedent mismatch condition and to the post-naming interval. Note that observing the same basic pattern of theta-power effects in the interaction as well as in the simple contrast rules out the possibility that a negative effect for the different-speaker conditions may have manifested as an overall positive effect compared with the same-speaker conditions, thus, potentially driving the interaction effect. This is further in line with the reported sensor-level effects (see Fig. [3](#BHU116F3){ref-type="fig"}), where the same-speaker, precedent mismatch condition revealed the strongest theta-power increases.
Finally, in order to substantiate whether the sources observed for theta power in the post-naming interval, particularly in mentalizing areas, were indeed significantly less active in the pre-naming interval, we compared the 2 time periods directly by means of another two-step analysis. For the pre-naming interval, we chose a time window between −800 and −200 ms, of the same length as the 200- to 800-ms post-naming interval. The first step comprised of comparing the precedent mismatch to the no precedent condition for same speaker (controlling for low-level sensory differences) both pre- and post-naming. The pre-naming contrast was compared with the post-naming contrast in the second step. This led to 1 positive cluster (*P* = 0.006), see Figure [5](#BHU116F5){ref-type="fig"} (and [Supplementary Table S2](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1)). The results further corroborate our interpretation that most theta sources observed in the previous analysis and particularly those in typical mentalizing (and related social) areas such as TPJ, PC, TP, and parts of the vmPFC showed significantly stronger activation for same-speaker, precedent mismatch vs. no precedent trials in the post-naming interval. The right PHG and bilateral visual areas (occipital OCC) also revealed significantly stronger theta power for this comparison in the post-naming interval. Based on the existing literature (see Introduction), this suggests stronger episodic retrieval in the right hemisphere along with stronger visual processing in response to the naming mismatch. Left TC activation could indicate that a mismatch with an anticipated precedent (as compared with just hearing a new name without any precedent) may have led to more prominent language area activation than building up anticipation for a certain term pre-naming. As a form of \"reality check,\" left motor areas (MC) also showed up in this analysis. This was expected because no difference in motor response should be present pre-naming, whereas after naming, response processing was stronger for precedent mismatch than for no precedent trials. Figure 5.Theta-power sources before and after naming, localized by means of DICS (see Methods). Sources in red show a power increase in 3--7 Hz for contrasting same-speaker, precedent mismatch vs. same-speaker, no precedent in the post-naming interval compared with the same contrast in the pre-naming interval. Within the same-speaker condition, we compared precedent mismatch vs. no precedent conditions separately for the post- and the pre-naming intervals and for each participant (first step) and then employed a group-level statistic (second step) for comparing the 2 intervals. The color-coded scale represents *t*-values. For source labels, see Figure [4](#BHU116F4){ref-type="fig"}. Further source details are reported in [Supplementary Table S2](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1).
### Theta Phase-Coherence (Source-Space) {#s3a2}
To obtain a picture of the functional connectivity between these various brain areas, we analyzed phase-coherence in the 4--6 Hz band between 200 and 800 ms post-naming (see Methods). We contrasted precedent mismatch and no precedent conditions for the same speaker to identify cortical areas that revealed coherence differences relative to a particular reference site. The overall pattern of coherence is shown in detail in Figure [6](#BHU116F6){ref-type="fig"} (and [Supplementary Table S3](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1)) and reveals functional connectivity effects (statistical maps of significant theta phase-coherence effects) in relation to "seed" areas (reference sites) taken from the previous theta-power source analyses. Red color denotes areas that are coupled significantly stronger with the respective seed area in the mismatch compared with the no-precedent condition (mismatch \> no precedent), whereas blue color denotes the reverse effect (mismatch \< no precedent). Figure 6.Theta phase-coherence (4--6 Hz) localized for the post-naming interval by means of DICS (see Methods). Differences in coherent sources between same-speaker, precedent mismatch minus same-speaker, no precedent (FDR-corrected significant *t*-values) in reference to theta-power sources in latPFC, left TP, left mTC, right PHG, and right TPJ as identified in the reported power analyses (see Fig. [4](#BHU116F4){ref-type="fig"}). The color-coded scale represents *t*-values. New source labels in this figure are ACC, anterior cingulate cortex; SMA, supplementary motor area. For all other source labels, see Figure [4](#BHU116F4){ref-type="fig"}. Red-yellow sources denote stronger coherence in the same-speaker, precedent mismatch compared with the same-speaker, no precedent condition, whereas blue sources denote the opposite effect. Further explanations in the text and [Supplementary Table S3](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1).
Left TP and left TC were coupled to left PHG and left/right latPFC, and to vmPFC, which we interpret based on the existing literature (see Introduction) as the functional coupling between subnetworks related to language, episodic working memory, and mentalizing. This functional interpretation is further corroborated by the statistically significant coupling between right PHG and areas in latPFC, mTC, and left TPJ. Caudal anterior cingulate cortex has been related to conflict monitoring, and the currently observed coupling with temporal cortex could reflect conflict resolution between current and retrieved naming.
Importantly, when using the right TPJ as a reference site, we found the left vmPFC cortex to be significantly more coherent (mismatch \> no precedent). This corroborates the notion that information exchange within the mentalizing network was engaged more strongly for precedent mismatch trials by the same speaker compared with when no precedent had been established during the interaction. In addition, and somewhat surprisingly, significantly less coherence (mismatch \< no precedent) was found in relation to right middle TC and to right PMC. Reduced theta phase-coherence in mismatch compared with the no precedent condition could suggest active decoupling between 2 areas and could reflect suppression (e.g., [@BHU116C27]). The present result could be interpreted as TPJ suppressing predictions that were generated by the right hemisphere (particularly TC) during the pre-naming interval (e.g., [@BHU116C20]; [@BHU116C39]; [@BHU116C16] for review; [@BHU116C65]). While this remains speculative because coherence is a correlative measure that does not allow inferring a direction of influence, the right middle TC also reveals a similar pattern of decoupling in relation to the left lateral PFC (Fig. [6](#BHU116F6){ref-type="fig"}), supporting the notion of top-down suppression of a "wrong" linguistic prediction after the same speaker used a term that mismatched with the expected precedent.
Analysis of "Same-Speaker Deliberation" Trials {#s3b}
----------------------------------------------
So far, the results reported for the oscillatory domain have revealed stronger theta activity in the post-naming interval for same-speaker, precedent mismatch trials as compared with no precedent trials, but no significant differences at all were observed in the pre-naming interval and a direct (theta power) comparison showed that the post-naming effects were significantly stronger compared with pre-naming. Importantly, the post-naming effects in theta-power and -coherence have included areas and their coupling, which previous research has identified as core mentalizing areas (see Introduction). The results so far, therefore, support the notion of "on-demand" involvement of perspective taking and mentalizing in language processing.
However, it might be difficult for slow theta effects to reach significance in the relatively short (800 ms) pre-naming interval. Furthermore, to the extent that mentalizing might be taking place equally across all conditions, specifically in the pre-naming interval, these networks might not show up in any cross-condition comparisons. Although this seems unlikely, given the robust mentalizing differences observed in the post-naming interval, we made a final attempt to identify anticipatory brain activity in general and activity that could be related to mentalizing in particular. To create the best opportunity for finding mentalizing effects, we specifically targeted those trials within the same-speaker, precedent mismatch condition in which the behavioral evidence suggested engagement of mentalizing processes, either through a "different picture" response or through a "same picture" response with a particularly slow response time (see Methods for details). As these are trials where some sort of deliberation has evidently occurred, we refer to these particular trials as \"same-speaker deliberation trials.\" We compared these trials again to the same-speaker, no precedent trials, yet by selecting this subset with the highest probability of deliberation, conform to our behavioral indicators, any activation of mentalizing networks in the pre-naming interval that may have occurred should now become apparent.
Note that pre-selecting these trials is especially favorable toward a central, anticipatory view of mentalizing and works against more "on-demand," egocentric accounts. If participants give a \"different picture\" response, they show evidence that they took the perspective of the speaker and noted that she probably sees a different picture if using a different name than before. Slow responses at least indicate that participants probably did not expect this name, possibly because they used mentalizing to anticipate a certain name. Hence, if even this subset of trials does not support anticipatory mentalizing activity in the pre-naming interval, this would provide a strong argument against the idea that listeners use mentalizing spontaneously to generate speaker-specific linguistic predictions. Deliberative trial selection was applied separately for time- and frequency-data, yet only evoked responses in the time-domain (ERF; cf. ERP) revealed significant anticipatory effects in the pre-naming interval (Fig. [7](#BHU116F7){ref-type="fig"}). Complete ERF results are reported in [Supplementary Figure S2](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1). Figure 7.Sensor-level ERF effects. Sensor-level ERF comparisons for same-speaker deliberation trials (dotted dark blue line) compared with the same-speaker, no precedent trials (light blue line). Black asterisks indicate channels participating in significant clusters for this contrast in a representative time window. Two different time windows are shown: left = pre-naming; right = post-naming. The solid dark blue line representing all same-speaker, precedent mismatch trials is added for comparison. See also [Supplementary Figure S2](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1) for all sensor-level ERF results.
### ERF Analysis of Same-Speaker Deliberation Trials (Sensor and Source Space) {#s3b1}
Focusing on same-speaker deliberation trials, as compared with the same-speaker, no-precedent trials, we found 3 significant clusters between −800 and 1000 ms. Suggesting anticipatory processing, 2 were in the pre-naming preview phase; 1 between −550 and −23 ms (*P* = 0.004), 1 between −306 and 0 ms (*P* = 0.004) and both with a predominantly right-hemisphere topography (Fig. [7](#BHU116F7){ref-type="fig"}, left; Fig. [8](#BHU116F8){ref-type="fig"}, Panel *A*). One cluster (*P* \< 0.00001) lasted between 67 and 680 ms after naming, with a maximum amount of significant channels around 400 ms and a predominantly left-hemisphere topography (Fig. [7](#BHU116F7){ref-type="fig"}, right; Fig. [8](#BHU116F8){ref-type="fig"}, Panel *B*). Source analysis was then employed for both the pre- and post-naming interval to examine whether the anticipatory clusters involved mentalizing in addition to episodic retrieval. Figure 8.Significant sources for deliberation trials vs. no precedent (same speaker) using LCMV beam formers (see Methods). Panel *A* shows sources for the pre-naming interval (together with the corresponding ERF topography from Fig. [7](#BHU116F7){ref-type="fig"}, left). Panel *B* shows the sources for the late interval (ERF topography from Fig. [7](#BHU116F7){ref-type="fig"}, right). The color-coded scale represents *t*-values. Source labels do not conform to Figures [4](#BHU116F4){ref-type="fig"} and [6](#BHU116F6){ref-type="fig"} apart from POC, parieto-occipital cortex; OTC, occipito-temporal cortex; vlPFC, ventro-lateral prefrontal cortex. Further explanations are in the text and in [Supplementary Table S4](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1).
In the early interval, a time window between −350 and −150 ms (before naming onset) was centered on the peak of the sensor-level effect, and 1 significant, spatially distributed cluster was found (*P* \< 0.00001). For LCMV beam former analysis of the post-naming interval, a time window between 300 and 500 ms was centered on the peak of the effect at sensor level and another significant, spatially distributed cluster was found (*P* \< 0.00001). Conforming to the topography shown in Figure [7](#BHU116F7){ref-type="fig"} (left), sources for the pre-naming interval were located predominantly in the right hemisphere (see Fig. [8](#BHU116F8){ref-type="fig"}, Panel *A*, and [Supplementary Table S4](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1), Panel *A*). Sources comprised areas typically associated (see Introduction) with episodic working memory (right dlPFC, ACC, left PHG), language (right mTC), and visual processing (left occipital temporal cortex OTC, left parieto-occipital cortex POC, right OCC). In contrast, no clear mentalizing activation could be identified according to the typical areas reported in the literature and reviewed in Introduction. This pattern of results is in agreement with egocentric processing, rather than partner-oriented anticipation (see Introduction). PHG involvement in particular suggests that participants retrieved the episodic context associated with the specific target object they were viewing. Differences in visual areas further support the notion that episodic retrieval of previously named objects was more visually detailed. PHG might therefore play an anticipatory role in conjunction with dlPFC for retrieving the episodic context of the interaction with the target object, including information about the speaker and the used name---prior to the current naming of the object (e.g., [@BHU116C31]; [@BHU116C15]; [@BHU116C48]; [@BHU116C52]). The latter is in agreement with the observed effects in typical language-related areas of the middle TC in the right hemisphere, possibly indicating anticipation of the name previously associated with the picture during interaction (e.g., [@BHU116C20]; [@BHU116C39]; [@BHU116C16]; [@BHU116C65]). Effects in ACC are compatible with the notion of anticipation of cognitive effort or conflict ([@BHU116C61]; [@BHU116C1]). Due to the substantial amount of precedent mismatch trials (see Table [1](#BHU116TB1){ref-type="table"}), participants may have learned to anticipate conflict with the linguistic predictions they generated based on their previous interaction.
While we found evidence that speaker-specific predictions were generated based on episodic retrieval, it is doubtful whether this activation reflects common ground processing or merely context-specific retrieval (see Introduction). Given the lack of evidence for a difference in activation of TPJ and other mentalizing areas reported in the current literature (see Introduction) between same-speaker deliberation and no precedent trials in this pre-naming period, we must conclude that the overall picture of results is consistent with the general idea that communicatively relevant, partner-specific information can be activated through basic memory processes without mediation by access to common ground in terms of active co-representation of the other\'s mental states ([@BHU116C30]; [@BHU116C4]).
Sources for the post-naming interval were predominantly left lateralized (Fig. [8](#BHU116F8){ref-type="fig"}, Panel *B*, and [Supplementary Table S4](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1), Panel *B*) in concordance with the sensor topography of the ERF effects (Fig. [7](#BHU116F7){ref-type="fig"}, right). Effects in typical motor/premotor areas (PMC) might reflect more intense or more conflicting motor preparation that would fit with ACC involvement, which has been linked to conflict monitoring as well as anticipation ([@BHU116C61]). PHG also seemed to be involved in both intervals (and across all types of analysis), possibly suggesting that episodic retrieval efforts may have been continuously engaged more strongly in deliberation trials. This is of particular interest in the context of mentalizing effects in left TPJ and vmPFC only "after" naming. [@BHU116C56] pointed out the particular relevance of the left TPJ for reasoning about others\' beliefs, which in the present context only seemed to be engaged "on-demand," when mentalizing was required to resolve a conflict.
### Relating ERF and Theta Results {#s3b2}
The pattern observed in the ERF analysis of same-speaker deliberation trials complements and corroborates our results based on theta power and phase-coherence. So far, a few of the sources had only been reported in theta phase-coherence analysis. These have now been confirmed in the ERF analysis of deliberation trials: left PHG, left TPJ, caudal ACC, right PMC, and right middle TC (see Figs [6](#BHU116F6){ref-type="fig"} and [8](#BHU116F8){ref-type="fig"}). Importantly, however, potential mentalizing in the left TPJ was only confirmed for the post-naming interval (see ERF and coherence analyses). Furthermore, an area in the right middle TC that was most likely associated with linguistic predictions in the pre-naming interval (ERF analysis) revealed de-coupling of theta phase during the post-naming interval in relation to left lateral PFC and right TPJ (Fig. [6](#BHU116F6){ref-type="fig"}). This corroborates the proposed notion (see Section on theta phase-coherence) that "wrong" linguistic predictions might be suppressed when common ground is reestablished, that is, when an apparent precedent violation is resolved via mentalizing.
Although our results consistently show activation of areas previously related to mentalizing processes in the post-naming, but not the pre-naming interval, 2 potential concerns could be raised. First, areas such as the TPJ, vmPFC, and precuneus have reliably been related to mentalizing activities but could possibly also reflect other functions as well, since many brain areas participate in more than one cognitive activity. Next to mentalizing, the TPJ, for example, has been related to reorienting of attention to an unexpected stimulus (e.g., [@BHU116C12]; [@BHU116C41]). In the context of the present paradigm, a mismatching name might be considered an unexpected stimulus, because participants anticipate the previously mentioned name based on memory retrieval of the picture and its context. Insofar as the expectation for a certain name is stronger in the same-speaker condition (because of a tighter contextual similarity), the unexpectedness of the mismatch might be most prominent in the same-speaker, mismatch condition and therefore lead to the strongest TPJ response in that condition. It is difficult to rule out such an alternative explanation directly. However, we found both right and left TPJ to be involved across different analyses. Also, our theta phase-coherence results revealed a coupling between the right TPJ and the left vmPFC, 2 areas that have been strongly associated with the mentalizing network and their direct functional coupling is harder to reconcile with a stimulus expectancy account than with a mentalizing account (see also [@BHU116C41]). Nevertheless, further converging research, using similar paradigms, will be necessary to completely rule out alternative explanations and support our interpretation that more extensive mentalizing is required in response to experimental conditions such as the current same-speaker, mismatch condition. For example, an fMRI study, because of its better spatial resolution, could pinpoint more specifically the part of the TPJ involved, allowing for more precise functional interpretations (see, e.g., [@BHU116C41]). Alas, such an approach would not be able to corroborate our findings in terms of "when" mentalizing is engaged.
A further caveat concerns the fact that no differences in mentalizing areas were found in the pre-naming interval. This is in some aspects a null result, which should be interpreted with care and needs to be replicated by future studies. However, our direct comparison of theta power between the pre- and post-naming interval revealed that most effects (including TPJ) reported for the post-naming interval were significantly stronger compared with pre-naming, which corroborates our current interpretation. Finally, in our ERF analysis of deliberation trials, an extensive network of areas (typically related to episodic memory and language in previous research) was found to be activated in the pre-naming period, showing that our analysis was sensitive and powerful enough to pick up on differences between the conditions in that interval. Still, no typical mentalizing area such as TPJ was involved in this pattern, further corroborating our conclusion that these areas do not appear to be involved in anticipatory processing.
General Discussion {#s3c}
------------------
Our results indicate that brain areas typically related to language, vision, episodic working memory, and mentalizing in previous research are dynamically and jointly involved in encountering and resolving conflict after encountering a reference that mismatches with a previously negotiated precedent by the same speaker. The reported effects on behavior, evoked responses, oscillations, and sources were most pronounced when the mismatch occurred with respect to a precedent established by the same speaker, compared with processing of trials without a precedent or when the precedent had been established by a different speaker. It is important to note that the paradigm employed here was special in making the speaker\'s identity known to the listener before each block of test trials, thus giving ample opportunity for listeners to mentalize and access common ground to enhance speaker-specific linguistic predictions.
The dynamics of theta oscillations, sources, phase couplings, and evoked responses are fundamentally novel findings in themselves and overall have consistently revealed that listeners do access common ground previously established with a specific speaker (but not another speaker) and that these processes seem to involve speaker-specific episodic retrieval as well as mentalizing. These findings are compatible with most behavioral experiments showing partner-specific processing of referential precedents. However, the results across several, very different analysis approaches in source space (theta-power, -coherence, ERF) also shed light on the mechanisms that are engaged in anticipation of an upcoming linguistic reference in contrast to those mechanisms that are engaged in reaction to an apparent pragmatic violation of previously established common ground. Overall, we found more robust mentalizing effects (evoked and oscillatory theta activity) in the post-naming interval, suggesting that on a majority of trials, participants engaged in enhanced episodic retrieval and, most importantly, mentalizing in response to a perceived violation.
Only when focusing on those trials where mentalizing was most likely to occur---that is, same-speaker deliberation trials---did we find anticipatory (pre-naming) evoked activity (ERF analysis), but this was only for brain areas typically linked to episodic retrieval, linguistic predictions, and conflict anticipation, and not for areas typically involved in mentalizing. Importantly, episodic recall of speaker-specific representations is not identical to common ground, as episodic representations can be shared without also being known to be shared ([@BHU116C60]). That is, representations may become activated via the basic memory retrieval principle of encoding specificity rather than through any process that genuinely reflects processing of the speaker\'s experience, such as produced by mentalizing ([@BHU116C4]).
It is important to emphasize that selecting this particular subset of same-speaker deliberation trials was most favorable for finding anticipatory mentalizing activity; if these trials do not show anticipation of the speaker\'s mental states in the TPJ that has been primarily associated with perspective taking, then no other trial type is more likely to do so. Thus, looking back at the 2 accounts we contrasted in Introduction, the results of our analyses support the conclusion that anticipating specific speakers\' referential behavior based on mentalizing in relation to previously established common ground may not be a spontaneous, default process. In contrast, the default process seems to be more egocentric with anticipation only relying on episodic retrieval of visual and linguistic associations without any inference of the speaker\'s current mental states. The latter appears to be mainly engaged \"on demand\" once a pragmatic violation has been established and a deliberate decision has been made to account for it. Moreover, this evidence suggesting on-demand engagement of mentalizing has been obtained in the ecologically valid context of a realistic communicative interaction with live interlocutors.
Although the pattern of results was reassuringly consistent across our varied analyses, it is important to point out once again that the segregation of functional brain modules and the links between brain areas and function are based on the current state of the literature and must therefore be regarded as hypothetical and exploratory at the current stage. Future studies are necessary to corroborate these findings, yet we believe that the current results and interpretations will provide valuable constraints and hypotheses for future research. It should also be noted that our results were obtained with a novel, socially interactive paradigm that is quite different from most neurocognitive paradigms employed to date, which means that there is no clear evidentiary basis on which we could have generated more confirmatory-style predictions. Therefore, future research is needed to confirm the results of the present study, using similar or even more realistic paradigms. Further research is also needed to establish the generality of these results beyond the communicative scenario that we have investigated. It could well be the case that in certain scenarios mentalizing is indeed engaged more spontaneously, for example, in conversation with children who are not expected to adhere to common ground or to be able to fully engage in mentalizing themselves. Finally, compared with natural conversation, the present study still used a somewhat repetitive task, which was necessary at the current stage of our research for maintaining sufficient experimental control and statistical power. Still, the interactive nature of the paradigm should have been sufficient to have motivated participants to remain focused throughout the experiment. Our study could be a stepping stone toward even more naturalism, along a path that might eventually allow neuroimaging to tackle the unrestrained nature of real conversation.
Conclusions {#s4}
===========
In the current MEG study, we employed an innovative experimental paradigm that combined an initial phase of live conversational interaction with a confederate speaker and a subsequent test phase of prerecorded speech from either the same or another speaker. Naturalistic negotiation of referential precedents in the interactive phase was sometimes followed by a referential mismatch in the test phase. The critical condition was when the same speaker produced a mismatch, requiring participants to engage in mentalizing in order to judge whether the speaker was still referring to the same object.
Based on a substantial body of previous research relating specific cognitive functions to certain brain areas, our results for theta oscillations, theta sources, theta phase couplings and evoked responses consistently indicate that brain areas typically involved in language, vision, episodic working memory and mentalizing were dynamically and jointly involved in resolving conflict after encountering a mismatching reference by the same speaker (but not another speaker). However, we found more robust mentalizing effects in the post-naming than in the pre-naming interval, suggesting that on a majority of trials, participants engaged in mentalizing only in response to a perceived violation. Only when focusing on those trials where mentalizing was most likely to occur did we find any anticipatory (pre-naming) activity, but this activity was confined to brain areas typically linked to episodic retrieval, linguistic predictions, and conflict anticipation, and did not include areas typically involved in mentalizing. Importantly, episodic recall of speaker-specific representations is not identical to common ground, as episodic representations can be shared without also being known to be shared ([@BHU116C60]).
In conclusion, default processing of utterances that violate common ground seems to be quite egocentric at first, with anticipation relying primarily on episodic retrieval of visual and linguistic associations without any inference about the speaker\'s current mental states. The latter appears to be mainly engaged \"on demand\" once a pragmatic violation has been established and a deliberate decision has been made to account for it.
Supplementary Material {#s5}
======================
[Supplementary material can be found at: http://www.cercor.oxfordjournals.org/](http://cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhu116/-/DC1).
Funding {#s6}
=======
This work was supported by the Netherlands Organisation for Scientific Research (Rubicon Fellowship, 446-10-020 to S.B.), the European Research Council (Advanced Grant INTERACT \#269484 to Stephen Levinson \[S.B.\]), and the Economic and Social Research Council/Medical Research Council (RES-060-25-0010 to S.G. and RES-000-22-4325 to K.K.). Funding to pay the Open Access publication charges for this article was provided by the Economic and Social Research Council (ESRC, UK) via the University of Glasgow.
Supplementary Material
======================
###### Supplementary Data
We thank our 2 confederates, Louis Renn and Hellen McNair, and Laura Steenhuis for help with stimulus preparation. *Conflict of Interest*: None declared.
[^1]: Note: See Materials for descriptions of the types of items. Example pictures (last row) are presented in black and white but were presented to participants in color. The third and fourth columns indicate how the picture was referred to in the respective phases (if the picture was absent or not named in one of the phases, this is indicated in italics). Experimental items are presented in the first 2 rows and the different filler categories in the last 5 rows.
| 2023-11-25T01:26:18.401715 | https://example.com/article/8876 |
104 U.S. 636 (____)
SMELTING COMPANY
v.
KEMP.
Supreme Court of United States.
*639 The case was argued by Mr. J.H. McGowan and Mr. Walter H. Smith for the plaintiff in error, and by Mr. Fletcher P. Cuppy and Mr. Thomas A. Green for the defendants in error.
MR. JUSTICE FIELD, after stating the case, delivered the opinion of the court, as follows:
As seen by the statement of the case, the plaintiff relies for a reversal of the judgment upon three grounds: 1st, Error in *640 admitting the record of the proceedings of the land-office to impeach the validity of the patent to Starr issued upon them; 2d, Error in instructing the jury that a patent for a placer claim, since the act of 1870, could not embrace in any case more than one hundred and sixty acres; and, 3d, Error in instructing the jury that the owner, by purchase of several claims, must take separate proceedings upon each one, in order to obtain a valid patent, and that it was not lawful for him to prosecute a single application upon a consolidation of several claims into one, or for the land-officers, to allow such application and to issue a patent thereon.
We are of opinion that these several grounds are well taken, and that in each particular mentioned the court below erred.
The patent of the United States is the conveyance by which the nation passes its title to portions of the public domain. For the transfer of that title the law has made numerous provisions, designating the persons who may acquire it and the terms of its acquisition. That the provisions may be properly carried out, a land department, as part of the administrative and executive branch of the government, has been created to supervise all the various proceedings taken to obtain the title, from their commencement to their close. In the course of their duty the officers of that department are constantly called upon to hear testimony as to matters presented for their consideration, and to pass upon its competency, credibility, and weight. In that respect they exercise a judicial function, and, therefore, it has been held in various instances by this court that their judgment as to matters of fact, properly determinable by them, is conclusive when brought to notice in a collateral proceeding. Their judgment in such cases is, like that of other special tribunals upon matters within their exclusive jurisdiction, unassailable except by a direct proceeding for its correction or annulment. The execution and record of the patent are the final acts of the officers of the government for the transfer of its title, and, as they can be lawfully performed only after certain steps have been taken, that instrument, duly signed, countersigned, and sealed, not merely operates to pass the title, but is in the nature of an official declaration by that branch of the government to which the alienation of the public *641 lands, under the law, is intrusted, that all the requirements preliminary to its issue have been complied with. The presumptions thus attending it are not open to rebuttal in an action at law. It is this unassailable character which gives to it its chief, indeed its only, value, as a means of quieting its possessor in the enjoyment of the lands it embraces. If intruders upon them could compel him, in every suit for possession, to establish the validity of the action of the Land Department and the correctness of its ruling upon matters submitted to it, the patent, instead of being a means of peace and security, would subject his rights to constant and ruinous litigation. He would recover one portion of his land if the jury were satisfied that the evidence produced justified the action of that department, and lose another portion, the title whereto rests upon the same facts, because another jury came to a different conclusion. So his rights in different suits upon the same patent would be determined, not by its efficacy as a conveyance of the government, but according to the fluctuating prejudices of different jurymen, or their varying capacities to weigh evidence. Moore v. Wilkinson, 13 Cal. 478; Beard v. Federy, 3 Wall. 478, 492.
Of course, when we speak of the conclusive presumptions attending a patent for lands, we assume that it was issued in a case where the department had jurisdiction to act and execute it; that is to say, in a case where the lands belonged to the United States, and provision had been made by law for their sale. If they never were public property, or had previously been disposed of, or if Congress had made no provision for their sale, or had reserved them, the department would have no jurisdiction to transfer them, and its attempted conveyance of them would be inoperative and void, no matter with what seeming regularity the forms of law may have been observed. The action of the department would in that event be like that of any other special tribunal not having jurisdiction of a case which it had assumed to decide. Matters of this kind, disclosing a want of jurisdiction, may be considered by a court of law. In such cases the objection to the patent reaches beyond the action of the special tribunal, and goes to the existence of a subject upon which it was competent to act.
*642 These views are not new in this court; they have been, either in express terms or in substance, affirmed in repeated instances. One of the earliest cases on the subject was that of Polk's Lessee v. Wendell, reported in 9th Cranch, where the doctrine we have stated was declared, and the exceptions to it mentioned. There the plaintiff brought an action upon a patent of North Carolina, issued in 1800, for five thousand acres. The defendants relied upon a prior patent of the State for twenty-five thousand acres, issued in 1795 to one Sevier, through whom they claimed. Each patent embraced the lands in controversy, and they were situated in that portion of Tennessee ceded to the United States by North Carolina. On the trial it was contended that the elder patent was void on its face because it covered more than five thousand acres, the limit prescribed for a single entry by the laws of that State. Proof was also offered that the lands had not been entered in the office of the entry-taker of the proper county before their cession to the United States, and it was contended that the patent was therefore invalid. We shall hereafter refer to what the court said as to the alleged excess of quantity in the patent. At present we shall only notice the general doctrine declared as to the unassailability of patents in a court of law, and its decision upon the admissibility of the proof offered. It seems that a statute of 1777 directed the appointment in each county of an officer called an entry-taker, who was required to receive entries of all vacant lands in his county, and, if the lands thus entered were not within three months claimed by some other party than the person entering them, to deliver to such person a copy of the entry, with its proper number, and an order to the county surveyor to survey the land. This order was called a warrant. Upon it and the survey which followed a patent was issued. If there were no entry, there could be no warrant, and of course no valid patent. The ninth section declared that every right claimed by any person to lands which were not acquired in this mode, or by purchase or inheritance from parties who did so acquire them, or which were obtained in fraud or evasion of the provisions of the act, should be declared void. In 1779 North Carolina ceded to the United States the territory in which the lands lie for which the patent to Sevier *643 was issued, reserving, however, to the State all existing rights, which were to be perfected according to its laws. The cession was accepted by Congress. The survey, upon which the patent to Sevier was issued, was made in 1795, and the plaintiff, to impeach the patent, offered, as already stated, to show that there had been no entry of the land in the office of the entry-taker of the county where it was situated, previous to the cession; that is, in substance, that the grantor had no authority to make the grant, the land having been previously conveyed to the United States. This offer was disallowed by the court below, and as judgment passed for the defendants, the case was brought to this court, where, as mentioned, the general doctrine as to the presumptions attending a patent, which we have stated, was declared, with the exceptions to it. Upon the general doctrine the court observed, speaking through Mr. Chief Justice Marshall, that the laws for the sale of the public lands provided many guards to secure the regularity of grants and to protect the incipient rights of individuals and of the State from imposition; that officers were appointed to superintend the business, and rules had been framed prescribing their duty; that these rules were in general directory, and when all the proceedings were completed by a patent issued by the authority of the State, a compliance with those rules was pre-supposed, and that "every prerequisite has been performed is an inference properly deducible, and which every man has a right to draw from the existence of the grant itself." "It would, therefore, be extremely unreasonable," said the court, "to avoid the grant in any court for irregularities in the conduct of those who are appointed by the government to supervise the progressive course of the title from its commencement to its consummation in a patent;" but there were some things so essential to the validity of a contract, that the great principles of justice and of law would be violated did there not exist some tribunal to which an injured party might appeal, and in which the means by which the elder title was acquired might be examined, and that a court of equity was a tribunal better adapted to this object than a court of law; and it added that "there are cases in which a grant is absolutely void; as where the State has no title to the thing granted, or where the *644 officer had no authority to issue the grant. In such cases the validity of the grant is necessarily examinable at law." So the court held that proof that no entry had been made in the office of the entry-taker in the county where the lands patented were situated, prior to the cession to the United States, was admissible under the ninth section; for without such entry they would not be within the reservation mentioned in the act of cession. In other words, proof was admissible to show that the State had not retained control over the property, but had conveyed it to the United States.
In Patterson v. Winn, reported in 11th Wheaton, this case is cited, and, after stating what it decided, the court said: "We may, therefore, assume as the settled doctrine of this court, that if a patent is absolutely void upon its face, or the issuing thereof was without authority, or was prohibited by statute, or the State had no title, it could be impeached collaterally in a court of law in an action of ejectment, but in general other objections and defects complained of must be put in issue in a regular course of pleading in a direct proceeding to avoid the patent."
The doctrine declared in these cases as to the presumptions attending a patent has been uniformly followed by this court. The exceptions mentioned have also been regarded as sound, although from the general lauguage used some of them may require explanation to understand fully their import. If the patent, according to the doctrine, be absolutely void on its face, it may be collaterally impeached in a court of law. It is seldom, however, that the recitals of a patent will nullify its granting clause, as, for instance, that the land which it purports to convey is reserved from sale. Of course, should such inconsistency appear, the grant would fail. Something more, however, than an apparent contradiction in its terms is meant when we speak of a patent being void on its face. It is meant that the patent is seen to be invalid, either when read in the light of existing law, or by reason of what the court must take judicial notice of; as, for instance, that the land is reserved by statute from sale, or otherwise appropriated, or that the patent is for an unauthorized amount, or is executed by officers who are not intrusted by law with the power to issue grants of portions of the public domain.
*645 So, also, according to the doctrine in the cases cited, if the patent be issued without authority, it may be collaterally impeached in a court of law. This exception is subject to the qualification, that when the authority depends upon the existence of particular facts, or upon the performance of certain antecedent acts, and it is the duty of the Land Department to ascertain whether the facts exist, or the acts have been performed, its determination is as conclusive of the existence of the authority against any collateral attack, as is its determination upon any other matter properly submitted to its decision.
With these explanations of the exceptions, the doctrine of the cases cited may be taken as expressing the law accepted by this court since they were decided. Hoofnagle v. Anderson, 7 Wheat. 212; Boardman v. Lessee of Reed, 6 Pet. 328; Bagnell v. Broderick, 13 id. 436; Johnson v. Towsley, 13 Wall. 72; Moore v. Robbins, 96 U.S. 530.
In Johnson v. Towsley the court had occasion to consider under what circumstances the action of the Land Department in issuing patents was final, and after observing that it had found no support for the proposition offered in that case by counsel upon certain provisions of a statute, said, speaking by Mr. Justice Miller, that the argument for the finality of such action was "much stronger when founded on the general doctrine that when the law has confided to a special tribunal the authority to hear and determine certain matters arising in the course of its duties, the decision of that tribunal, within the scope of its authority, is conclusive upon all others." "That the action of the land-office," the court added, "in issuing a patent for any of the public land, subject to sale by pre-emption or otherwise, is conclusive of the legal title, must be admitted on the principle above stated, and in all courts and in all forms of judicial proceedings where this title must control, either by reason of the limited powers of the court or the essential character of the proceeding, no inquiry can be permitted under the circumstances under which it was obtained;" and then observed, that there exists in the courts of equity the power to correct mistakes and relieve against frauds and impositions; and that in cases where it was clear that the officers of the Land Department had by a mistake of the law given to *646 one man the land which, on the undisputed facts, belonged to another, to give proper relief. The doctrine thus stated was approved in the subsequent case of Moore v. Robbins.
The general doctrine declared may be stated in a different form, thus: A patent, in a court of law, is conclusive as to all matters properly determinable by the Land Department, when its action is within the scope of its authority, that is, when it has jurisdiction under the law to convey the land. In that court the patent is unassailable for mere errors of judgment. Indeed, the doctrine as to the regularity and validity of its acts, where it has jurisdiction, goes so far that if in any circumstances under existing law a patent would be held valid, it will be presumed that such circumstances existed. Thus, in Minter v. Crommelin, reported in 18th Howard, where it appeared that an act of Congress of 1815 had provided that no land reserved to a Creek warrior should be offered for sale by an officer of the Land Department unless specifically directed by the Secretary of the Treasury, and declared that if the Indian abandoned the reserved land it should become forfeited to the United States, a patent was issued for the land, which did not show that the Secretary had ordered it to be sold, and the court said: "The rule being that the patent is evidence that all previous steps had been regularly taken to justify making of the patent; and one of the necessary steps here being an order from the Secretary to the register to offer the land for sale because the warrior had abandoned it, we are bound to presume that the order was given. That such is the effect, as evidence, of the patent produced by the plaintiffs was adjudged in the case of Bagnell v. Broderick (13 Pet. 436), and is not open to controversy anywhere, and the State court was mistaken in holding otherwise."
On the other hand, a patent may be collaterally impeached in any action, and its operation as a conveyance defeated, by showing that the department had no jurisdiction to dispose of the lands; that is, that the law did not provide for selling them, or that they had been reserved from sale or dedicated to special purposes, or had been previously transferred to others. In establishing any of these particulars the judgment of the department upon matters properly before it is not assailed, nor is *647 the regularity of its proceedings called into question; but its authority to act at all is denied, and shown never to have existed.
According to the doctrine thus expressed and the cases cited in its support, and there are none in conflict with it, there can be no doubt that the court below erred in admitting the record of the proceedings upon which the patent was issued, in order to impeach its validity. The judgment of the department upon their sufficiency was not, as already stated, open to contestation. If in issuing a patent its officers took mistaken views of the law, or drew erroneous conclusions from the evidence, or acted from imperfect views of their duty, or even from corrupt motives, a court of law can afford no remedy to a party alleging that he is thereby aggrieved. He must resort to a court of equity for relief, and even there his complaint cannot be heard unless he connect himself with the original source of title, so as to be able to aver that his rights are injuriously affected by the existence of the patent; and he must possess such equities as will control the legal title in the patentee's hands. Boggs v. Merced Mining Co., 14 Cal. 279, 363. It does not lie in the mouth of a stranger to the title to complain of the act of the government with respect to it. If the government is dissatisfied, it can, on its own account, authorize proceedings to vacate the patent or limit its operation.
This doctrine as to the conclusiveness of a patent is not inconsistent with the right of the patentee, often recognized by this court, to show the date of the original proceeding for the acquisition of the title, where it is not stated in the instrument, as the patent is deemed to take effect by relation as of that date, so far as it is necessary to cut off intervening adverse claims. Thus, in a contest between two patentees for the same land, it may be shown that a junior patent was founded upon an earlier entry than an older patent, and therefore passes the title. Such evidence in no way trenches upon the ruling of the department upon matters pending before it. Nor is the doctrine of the conclusiveness of the patent inconsistent with the right of a party resisting it to show, if an entry is not stated in the instrument, that no entry of the land was made as an initiatory proceeding, where a statute, as was the case in *648 North Carolina, mentioned in Polk's Lessee v. Wendell, declares that proceedings for the title, when such entry has not been made, shall be adjudged invalid. A statute may in any case require proof of a fact which otherwise would be presumed. Except with reference to such anterior matters and others of like character, no one in a court of law can go behind the patent and call in question the validity of the proceedings upon which it is founded.
The case at bar, then, is reduced to the question whether the patent to Starr is void on its face; that is, whether, read in the light of existing law, it is seen to be invalid. It does not come within any of the exceptions mentioned in the cases cited. The lands it purports to convey are mineral, and were a part of the public domain. The law of Congress had provided for their sale. The proper officers of the Land Department supervised the proceedings. It bears the signature of the President, or rather of the officer authorized by law to place the President's signature to it, which is the same thing; it is properly countersigned, and the seal of the General Land-Office is attached to it. It is regular on its face, unless some limitation in the law, as to the extent of a mining claim which can be patented, has been disregarded. The case of the defendants rests on the correctness of their assertion that a patent cannot issue for a mining claim which embraces over one hundred and sixty acres. Assuming that the words "more or less," accompanying the statement of the acres contained in the claim, are to be disregarded, and that the patent is construed as for one hundred and sixty-four acres and a fraction of an acre, there is nothing in the acts of Congress which prohibits the issue of a patent for that amount. They are silent as to the extent of a mining claim. They speak of locations and limit the extent of mining ground which an individual or an association of individuals may embrace in one of them. There is nothing in the reason of the thing, or in the language of the acts, which prevents an individual from acquiring by purchase the ground located by others and adding it to his own. The difficulty with the court below, as seen in its charge, evidently arose from confounding "location" and "mining claim," as though the two terms always represent the same thing, whereas they *649 often mean very different things. A mining claim is a parcel of land containing precious metal in its soil or rock. A location is the act of appropriating such parcel, according to certain established rules. It usually consists in placing on the ground, in a conspicuous position, a notice setting forth the name of the locator, the fact that it is thus taken or located, with the requisite description of the extent and boundaries of the parcel, according to the local customs, or, since the statute of 1872, according to the provisions of that act. Rev. Stat., sect. 2324. The location, which is the act of taking the parcel of mineral land, in time became among the miners synonymous with the mining claim originally appropriated. So, now, if the miner has only the ground covered by one location, "his mining claim" and "location" are identical, and the two designations may be indiscriminately used to denote the same thing. But if by purchase he acquires the adjoining location of his neighbor, that is, the ground which his neighbor has taken up, and adds it to his own, then his mining claim covers the ground embraced by both locations, and henceforth he will speak of it as his claim. Indeed, his claim may include as many adjoining locations as he can purchase, and the ground covered by all will constitute what he claims for mining purposes, or, in other words, will constitute his mining claim, and be so designated. Such is the general understanding of miners and the meaning they attach to the term.
Previously to the act of July 9, 1870, Congress imposed no limitation to the area which might be included in the location of a placer claim. This, as well as every other thing relating to the acquisition and continued possession of a mining claim, was determined by rules and regulations established by miners themselves. Soon after the discovery of gold in California, as is well known, there was an immense immigration of gold-seekers into that Territory. They spread over the mineral regions and probed the earth in all directions in pursuit of the precious metals. Wherever they went they framed rules prescribing the conditions upon which mining ground might be taken up, in other words, mining claims be located and their continued possession secured. Those rules were so framed as to give to all immigrants absolute equality of right and privilege. *650 The extent of ground which each might locate, that is, appropriate to himself, was limited so that all might, in the homely and expressive language of the day, have an equal chance in the struggle for the wealth there buried in the earth. But a few months' experience in the precarious and toilsome pursuit drove great numbers of the miners to seek other means of livelihood and fortune, and they therefore disposed of their claims. They never doubted that their rights could be transferred so that the purchaser would hold the claims by an equally good title. Their transferable character was always recognized by the local courts, and the title of the grantee enforced. Many individuals thus became the possessors of claims covering ground taken up by different locations, and the amount which each person or an association of persons might acquire and hold was only limited by his or their means of purchase.
The rules and regulations originally established in California have in their general features been adopted throughout all the mining regions of the United States. They were so wisely framed and were so just and fair in their operation that they have not to any great extent been interfered with by legislation, either state or national. In the first mining statute, passed July 9, 1866, they received the recognition and sanction of Congress, as they had previously the legislative and judicial approval of the States and Territories in which mines of gold and silver were found. That act declared, and the declaration was repeated in a subsequent statute, that the mineral lands of the public domain were free and open to occupation and exploration by all citizens of the United States, and by those who had declared their intention to become such, subject to such regulations as might be prescribed by law, and subject, also, "to the local customs or rules of miners of the several mining districts," so far as the same were not in conflict with the laws of the United States. It authorized the issue of patents for claims on veins or lodes of quartz or other "rock in place" bearing gold, silver, cinnabar, or copper. Placer claims first became the subject of regulation by the mining act of July 9, 1870, c. 235 (16 Stat. 217), which provided that patents for them might be issued under like circumstances *651 and conditions as for vein or lode claims, and that persons having contiguous claims of any size might make joint entry thereof. But it also provided that no location of a placer claim thereafter made should exceed one hundred and sixty acres for one person or an association of persons. The mining act of May 10, 1872, c. 152 (17 id. 91), declared that a location of a placer claim subsequently made should not include more than twenty acres for each individual claimant. These are all the provisions touching the extent of locations of placer claims, and they are re-enacted in the Revised Statutes. Sects. 2330, 2331. A limitation is not put upon the sale of the ground located, nor upon the number of locations which may be acquired by purchase, nor upon the number which may be included in a patent. Every interest in lands is the subject of sale and transfer, unless prohibited by statute, and no words allowing it are necessary. In the mining statutes numerous provisions assume and recognize the salable character of one's interest in a mining claim. Sect. 13 of the act of 1870 declares that where a person or association or their grantors have held and worked claims for a period equal to the time prescribed by the Statute of Limitations of the State or Territory where the same is situated, evidence of such possession and working shall be sufficient to establish the right to a patent. Sect. 5 of the act of 1872, rendering a mining claim subject to relocation where certain conditions of improvement or expenditure have not been made, has a proviso that the original locators, "their heirs, assigns, or legal representatives, have not resumed work upon the claim after such failure and before such location." These provisions are of themselves conclusive that the locator's interest in a mining grant is salable and transferable, even were there any doubt on the subject, in the absence of express statutory prohibition. Those of the act of 1870 are also conclusive of the right of the purchaser of claims to a patent, for it is with reference to it that the derivative right by purchase or assignment is mentioned. Rev. Stat., sects. 2332, 2334.
In addition to all this, it is difficult to perceive what object would be gained, what policy subserved, by a prohibition to embrace in one patent contiguous mining ground taken up by *652 different locations and subsequently purchased and held by one individual. He can hold as many locations as he can purchase, and rely upon his possessory title. He is protected thereunder as completely as if he held a patent for them subject to the condition of certain annual expenditures upon them in labor or improvements. If he wishes, however, to obtain a patent, he must, in addition to other things, pay the government a fee of five dollars an acre, a sum that would not be increased if a separate patent were issued for each location.
The decision of this court upon one point in the case of Polk's Lessees v. Wendell, already cited, is directly applicable here. The patent to the defendants in that case was for twenty-five thousand acres of land, and one of the objections taken was that it was void because the statute of North Carolina limited an entry of one person to five thousand acres. But the statute declared that where two or more persons had entered, or should afterwards enter, lands jointly, or where two or more persons agreed to have their entries surveyed jointly in one or more surveys, the surveyor should survey the same accordingly in one entire survey. It was contended that as the statute provided for entries made by two or more persons it could not be extended to the case of distinct entries belonging to the same person. To this the court replied as follows: "For this distinction it is impossible to conceive a reason. No motive can be imagined for allowing two or more persons to unite their entries in one survey which does not apply with at least as much force for allowing a single person to unite his entries, adjoining each other, in one survey. It appears to the court that the case comes completely within the spirit, and is not opposed by the letter, of the law. The case provided for is `where two or more persons agree to have their entries surveyed jointly,' &c. Now this does not prevent the subsequent assignment of the entries to one of the parties; and the assignment is itself the agreement of the assignor that the assignee may survey the entries jointly or severally, at his election. The court is of opinion that, under a sound construction of this law, entries, which might be joined in one survey, if remaining the property of two or more persons, may be joined, though they become the property of a single person." The objection *653 to the patent by reason of its embracing over five thousand acres was accordingly overruled.
By a provision of the mining act of 1870, still in force, two or more persons, or association of persons, having contiguous claims of any size, are allowed to make a joint entry thereof. Rev. Stat., sect. 2330. If one individual should acquire all such contiguous claims by purchase, no sound reason can be suggested why he should not be equally entitled to enter them all by one entry as when they were held by the original parties. To quote the language of the case cited, "No motive can be imagined for allowing two or more persons to unite their entries in one survey which does not apply with at least as much force for allowing a single person to unite his entries adjoining each other in one survey."
The last position of the court below, that the owner of contiguous locations who seeks a patent must present a separate application for each, and obtain a separate survey, and prove that upon each the required work has been performed, is as untenable as the rulings already considered. The object in allowing patents is to vest the fee in the miner, and thus encourage the construction of permanent works for the development of the mineral resources of the country. Requiring a separate application for each location, with a separate survey and notice, where several adjoining each other are held by the same individual, would confer no benefit beyond that accruing to the land-officers from an increase of their fees. The public would derive no advantage from it, and the owner would be subjected to onerous and often ruinous burdens. The services of an attorney are usually retained when a patent is sought, and the expenses attendant upon the proceeding are in many instances very great. To lessen these as much as possible the practice has been common for miners to consolidate, by conveyance to a single person or an association or company, many contiguous claims into one, for which only one application is made and of which only one survey is had. Long before patents were allowed indeed, from the earliest period in which mining for gold and silver was pursued as a business miners were in the habit of consolidating adjoining claims, whether they consisted of one or more original locations, *654 into one, for convenience and economy in working them. It was, therefore, very natural, when patents were allowed, that the practice of presenting a single application with one survey of the whole tract should prevail. It was at the outset, and has ever since been, approved by the department, and its propriety has never before been questioned. Patents, we are informed, for mining ground of the value of many millions of dollars, have been issued upon consolidated claims, nearly all of which would be invalidated if the positions assumed by the defendants could be sustained.
It was urged on the argument that a patent for each location was required to prevent a monopoly of mining ground, to prevent, to use the language of counsel, the public domain from being "monopolized by speculators." The law limiting the extent of mining lands which an individual may locate has provided, so far as it was deemed wise, against an accumulation of them in one person's hands. It could not have prohibited the sale of the location of an individual without imposing a restriction injurious to his interests, and in many instances destructive of the whole value of his claim. Every one, at all familiar with our mineral regions, knows that the great majority of claims, whether on lodes or on placers, can be worked advantageously only by a combination among the miners, or by a consolidation of their claims through incorporated companies. Water is essential for the working of mines, and in many instances can be obtained only from great distances, by means of canals, flumes, and aqueducts, requiring for their construction enormous expenditures of money, entirely beyond the means of a single individual. Often, too, for the development of claims, streams must be turned from their beds, dams built, shafts sunk at great depth, and flumes constructed to carry away the débris of the mine. Indeed, successful mining, whether on lode claims or placer claims, can seldom be prosecuted without an amount of capital beyond the means of the individual miner.
There is no force in the suggestion that a separate patent for each location is necessary to insure the required expenditure of labor upon it. The statute of 1872 provides that on each claim subsequently located, until a patent is issued for it, *655 there shall be annually expended in labor or improvements one hundred dollars; and on claims previously located an annual expenditure of ten dollars for each one hundred feet in length along the vein; but where such claims are held "in common," the expenditure may be upon any one claim. As these provisions relate to expenditures before a patent is issued, proof of them will be a matter for consideration when application for the patent is made. It is not perceived in what way this proof can be changed or the requirement affected, whether the application be for a patent for one claim or for several claims held in common. Labor and improvements, within the meaning of the statute, are deemed to have been had on a mining claim, whether it consists of one location or several, when the labor is performed or the improvements are made for its development, that is, to facilitate the extraction of the metals it may contain, though in fact such labor and improvements may be on ground which originally constituted only one of the locations, as in sinking a shaft, or be at a distance from the claim itself, as where the labor is performed for the turning of a stream, or the introduction of water, or where the improvement consists in the construction of a flume to carry off the débris or waste material. It would be absurd to require a shaft to be sunk on each location in a consolidated claim, when one shaft would suffice for all the locations; and yet that is seriously argued by counsel, and must be maintained to uphold the judgment below.
The statutes provide numerous guards against the evasion of their provisions by parties seeking a mining patent, and afford an opportunity to persons in the neighborhood of the claim to come forward and present any objections they may have to the granting of the patent desired. By sects. 6 and 7 of the act of 1872, which constitute sects. 2325 and 2326 of the Revised Statutes, the procedure which a party seeking a patent, whether an individual or an association or a corporation, must follow is prescribed:
1st, The party must file an application in the proper land-office under oath, showing a compliance with the law, together with a plat and the field-notes of the claim, or "claims in common," made by or under the direction of the Surveyor-General *656 of the United States, showing the boundaries of the claim or claims, which must be distinctly marked by monuments on the ground.
2d, Previously, however, to the filing of the application, the claimant must post a copy of the plat, with a notice of his intended application, in a conspicuous place on the land embraced in it, and file an affidavit of at least two persons that such notice has been duly posted with a copy of the notice in the land-office.
3d, When such application, plat, field-notes, notice, and affidavits have been filed, the register of the land-office is required to publish a notice of the application for the period of sixty days, in a newspaper, to be designated by him, nearest to the claim, and post such notice in his office for the same period.
4th, The claimant, at the time of filing his application, or at any time thereafter within sixty days, is required to file with the register a certificate of the United States Surveyor-General, that five hundred dollars' worth of labor has been expended, or improvements to that amount have been made upon the claim by himself or grantors; that the plat is correct, with such further description, by reference to natural objects or permanent monuments, as shall identify the claim, and furnish an accurate description to be incorporated in the patent.
5th, At the expiration of sixty days the claimant is required to file his affidavit showing that the plat and notice have been posted in a conspicuous place on the claim during the period of publication. If no adverse claim shall have been filed with the register and receiver of the proper land-office within the sixty days of publication, it is then to be assumed that the applicant is entitled to a patent upon the payment to the proper officer of five dollars per acre, and that no adverse claim exists.
6th, The statute then proceeds to declare that if an adverse claim is filed during the period of publication, it must be upon the oath of the party making it, and must show the nature, boundaries, and extent of such adverse claim; and all proceedings, except the publication of the notice and the making and filing of the affidavit, shall be thereupon stayed until the controversy shall have been settled by a decision of a court of competent jurisdiction, or the adverse claim waived. And it *657 is made the duty of the adverse claimant, within thirty days after filing his claim, to commence proceedings in a court of competent jurisdiction to determine the question of the right of possession, and to prosecute the same with reasonable diligence to final judgment; and a failure to do so is to be deemed a waiver of his adverse claim. After judgment has been rendered in such proceedings, the party entitled to the possession of the claim, or any portion of it, may file a certified copy of the judgment-roll with the register of the land-office, together with a certificate of the Surveyor-General that the requisite amount of labor has been expended or improvements made thereon, and the description required in other cases; and must pay to the receiver five dollars an acre for his claim, together with the proper fees; and then the whole proceedings and the judgment-roll are to be certified by the register to the Commissioner of the General Land-Office, and a patent thereupon issued for the claim, or such portion thereof as the applicant, by the decision of the court, shall appear to be entitled to.
It will thus be seen that if an adverse claim is made to the mining ground for which a patent is sought, its validity must be determined by a local court, unless it be waived, before a patent can be issued. There would seem, therefore, to be more cogent reasons, in cases where a patent for such ground is relied upon, to maintain the doctrine which we have declared, that it cannot be assailed in a collateral proceeding, than in the case of a patent for agricultural land.
But it is unnecessary to pursue the subject further. The judgment of the court below must be reversed and the cause remanded for a new trial; and it is
So ordered.
MR. JUSTICE MILLER and MR. JUSTICE HARLAN dissented.
NOTE. Smelting Company v. Ray, error to the Circuit Court of the United States for the District of Colorado, was argued at the same time as the preceding case, and by the same counsel for the plaintiff in error, and by Mr. Thomas M. Patterson for the defendants in error.
MR. JUSTICE FIELD remarked that, as it presented the same questions there determined, the judgment of the court below must be reversed and the cause remanded for a new trial.
MR. JUSTICE MILLER and MR. JUSTICE HARLAN dissented.
| 2024-04-29T01:26:18.401715 | https://example.com/article/5786 |
{"type":"Post","url":"http:\/\/bankruptcydivorceblawg.com\/is-an-award-of-lump-sum-spousal-support-to-compensate-wife-for-husbands-bankruptcy-an-abuse-of-the-trial-courts-discretion\/","title":"Is an award of lump sum spousal support to compensate wife for husband\u2019s bankruptcy an abuse of the trial court\u2019s discretion?","logged":"true"} | 2023-11-13T01:26:18.401715 | https://example.com/article/9522 |
Them right wing nutjobs, always preach small state, cops in the streets and high penalties. But what do you get when you send ppl to jail to work for free as slaves? You get big government, the exact opposite of what they wanted. Hahaha thats so stupid..
When the government send ppl to jail, they, instead of taxing a fraction of your income, they tax 100% of your income, and the government gives that money to the prison owners.
A huge prison capacity = big government
Logged
"Its futile to dig in, if you cant prevent the enemys artilery to get within range"
You see at the end the cops walks up and starts asking everyone for their names and addresses. With out those he has NO JURISDICTION but those people don't realize it and start contracting immediately when they open their mouths. Never give your name or address unless you want what they are giving you. Simply say I am not contracting/conducting business with you. You can't be forced to contract no matter what the cop says.
So the group of reporters (at least four cameramen, and three others) were asked to go across the street, and instead they decided to stand on a median. We don't see what took place until the reporters start filming, seemingly after whatever took place to get the officer pissed. He is not asking them to leave, but just go across the street and out of the middle of the damn road.
I agree 100% that this guy was out of line with some of his comments, but asking a large group of people to get out of the street is not unreasonable, and I have seen how quickly people are to start treating cops who are just doing their job like trash.
The only thing I can see for certain from that video is that a bunch of self important media jackoffs managed to provoke an officer into saying something stupid on camera, so they can play "Martyr of Free Speech" for a day and get some publicity from it.
There is a time and place to "take a stand". When a police officer asks you to get out of the damn road is neither.
The Hospital asked them to get off Hospital grounds, which makes sense, they could end up being in the way in an emergency. They no doubt got their panties in a wad that the hospital would dare give orders to the press.
So the move to the median. Not the smartest thing to do, but I can understand how they might come to the decision to try setting up there. So at this point we have a cluster of "reporters" standing around practically in the street, possibly already sour over having had to move once.
Along comes this Police officer, who was called down there when the reporters were blocking the hospital entrance. He assesses the situation, sees a cluster of people standing on the median between two roads, and tells them they need to move to the sidewalk on the other side. This makes perfect sense, and it would have been negligent for the officer NOT to remove them from the street. Instead, the reporters "take a stand"... against what? An officer showing concern for public safety? The fact that reporters are not treated as Kings everywhere they go? What was the point in their actions?
The reporters were NOT asked to stop filming, even when they were being intentionally obnoxious sticking cameras in the officer's face. (No doubt trying to provoke him to request just that) They were not asked to leave, even though they were going out of their way to be a nuisance. They were simply asked to move 5 feet to the other side of the road. If my $100 Kodak 5mp easyshare camera can take video from the distance of 4 houses away, I'm sure their corporate sponsored, $$$$monies, professional grade cameras could film from across the street without a problem.
The only thing the cop has going against him are the comments he made, which are not even untrue. He stated that you First Amendment right can be terminated based on location and whether or not you are being a jackass. We could no doubt sit here and debate this all day, (that IS the law, but also an unconstitutional law is invalid, ect.) and both sides of the argument would be correct... technically speaking. But even the SCOTUS upholds that the first can be subject to time and place. So while we may disagree with the officer's statement on philosophical or legal grounds, we cannot really fault him for believing it is true. Also worth noting, this has ZERO to do with the first amendment anyways, lol, since they are not being censored or asked not to film, just move out of the damn road!
I sure would like to see video of the confrontation from the beginning. I'd be willing to bet my last dollar the officer started out being nice and friendly before these jackoffs started acting like pissed off angsty teenagers.
There are plenty of examples of "bad cops being dicks" to be found on the internet. This is not one of them.
There is a time and place to "take a stand". When a police officer asks you to get out of the damn road is neither.
Well bozo the clown can ask them to move also but that doesn't mean he has the authority to enforce it. Cops have no more authority than any of us do (according to the law) but they think they do, and whats worse, the people think so too. I bet you think that cops have more rights than us peasants.
The only thing the cop has going against him are the comments he made, which are not even untrue. He stated that you First Amendment right can be terminated based on location and whether or not you are being a jackass. We could no doubt sit here and debate this all day, (that IS the law, but also an unconstitutional law is invalid, ect.) and both sides of the argument would be correct... technically speaking. But even the SCOTUS upholds that the first can be subject to time and place. So while we may disagree with the officer's statement on philosophical or legal grounds, we cannot really fault him for believing it is true. Also worth noting, this has ZERO to do with the first amendment anyways, lol, since they are not being censored or asked not to film, just move out of the damn road!
The press (and me and you) have just as much of a right to be there as the cop or anyone else for that matter as you are no doubt aware but I think they are right for standing up to the cop. Why not show him his place as a public servant?I think that is the important lesson to learn from all of this. Expect to see a lot more of this kind of stuff in the near future as people get more repressed. Our prison system is bigger than Stalin's gulag at the height of its power. Lets flip this bitch over! woo hoo!
Expect to see a lot more of this kind of stuff in the near future as people get more repressed. Our prison system is bigger than Stalin's gulag at the height of its power. Lets flip this bitch over! woo hoo!
Given Loop's point regarding Police as Civil Servants and the limits of authority, yada yada.. How is "you need to get out of the street, how about standing on that sidewalk over there, yeah go ahead and film, that's fine.. just move slightly please" repressive? Are they being victimized by having their right to upset emergency traffic being violated? What about the rights of those who may need quick, unobstructed access to that hospital?
Even IF that cop had no more authority to ask them to move then Jack Nobody (and that's a big IF) why would you pick a fight over it? How does a person's thought process go from a guy asking you not to stand in the street to "ZOMG! THIS IS EXACTLY LIKE STALIN'S OPPRESSIVE REIGN! LET'S SET SOMETHING ON FIRE!" *slight paraphrasing used.
Even if I was willing to say this cop is the worst type of oppressive jerk to ever fill a uniform (which I am not, by any means) this video STILL shows the "reporters" acting more like unreasonable jackoffs than it does the officer. The type of people that pick a fight with a cop, just because he's a cop, and then whine about how oppressed they are. Loop I know you to be a very well read, very intelligent individual. I'm surprised to see you siding with these guys. (not surprised at your input necessarily, and definitely not surprised by your stance on "authority", but surprised you support this kind of asshattery.)
Well why not? I am a big fan of chaos and I kind of like people standing up to assholes. I agree that the press is a weak pathetic reflection of what we should have and maybe that's why I want them standing up to this guy or anyone else. It gives me a flashback to the times when the press was fearless in the face of flying bullets or black boots. Sure its pointless and stupid but sometimes little sparks can start larger fires. I guess that is what I would like to see... especially since I am going for a job interview at a newspaper in a short while.
BTW, its much worse than Stalin's regime, not this story, but in general we have surpassed his gulag system. | 2024-05-03T01:26:18.401715 | https://example.com/article/7592 |
Characteristics of the epitope of leukotriene B4 recognized by a highly specific mouse monoclonal antibody.
Mouse monoclonal IgG2b antibodies to leukotriene B4 bind [3H]leukotriene B4 with an affinity one-thirtieth to one-third that of different rabbit antibodies to leukotriene B4. The concentrations of related ligands required to inhibit by 50% the binding of [3H]leukotriene B4 define cross-reactivities of approximately 100% for carboxyl-derivatives of leukotriene B4, 10% for 12(S)-leukotriene B4 and 8 cis-leukotriene B4, which were not distinguished from leukotriene B4 by polyclonal antibodies, 3-5% for the two isomers of 6 trans-leukotriene B4, 5% for 20-OH-leukotriene B4 and 20-COOH-leukotriene B4, and less than 1% for other leukotrienes, mono-hydroxy-eicosatetraenoic acids, and the two leukotriene B4-like isomers of 8, 15-di-hydroxy-eicosatetraenoic acid. Thus the monoclonal combining site is highly specific for the di-hydroxy-triene portion of leukotriene B4. | 2023-12-29T01:26:18.401715 | https://example.com/article/8394 |
<a id='highlight' href='http://www.merinews.com/topics/business/google'>Google</a> Buzz is Google's first effort in social networking field. It was integrated into gmail and allowed its users to share links, photos, comments and so on. But this service could not survive for much time and had a life span of 20 months only. | 2024-05-20T01:26:18.401715 | https://example.com/article/6808 |
Square Enix folks are preparing a nice little surprise for everyone as the Tomb Raider reboot from 2013 will be free at some point in March 2020. Meanwhile, one other game is already free and two are about to follow.
Update: All freebies are now live. Tomb Raider games will be free until 24 March 2020, Headsnatchers until 22nd.
Lara Croft's redesign from 2013 was praised almost universally, to which the Steam reviews testify as well. Sitting at 95 per cent positive reviews, this reboot is one of the most successful Tomb Raider titles ever. Therefore, if you haven't played it for some reason, now would be a great time to give it a shot as it's expected to become free to keep for an undisclosed period of time.
Considering that SteamDB picked the Tomb Raider hint on 19 March 2020, it is quite possible the giveaway is imminent so keep your eyes peeled. We will also update this article once it starts.
That is not all, however, as Lara Croft and the Temple of Osiris will get the same treatment . A sequel to the successful Lara Croft and the Guardian of Light, this game will offer up to four-player co-op. Some players were pondering whether the game was worth the full price but since it's going to free, it doesn't hurt to add it to your library.
The third game that is headed for the giveaway session is Headsnatchers . Just like the Tomb Raider titles, it was recently marked for a March 2020 giveaway.
While you are waiting for those three games to go free, you might as well pick up Drawful 2 , which was available for free at the time of writing. This giveaway will last until 11 April 2020, so don't fret if you are not able to pick it up immediately.
We said there was only one other game free initially but here's another one for good measure. Deiland , a vibrant RPG is also free to pick up until 24 March 2020.
Square Enix Shadow of the Tomb Raider is the latest in the series kicked off in 2013
Considering the timing of these giveaways, it is possible they have something to do with persuading people to stay home due to health concerns over going outside during Coronavirus worldwide outbreak. | 2024-02-29T01:26:18.401715 | https://example.com/article/6100 |
Colleges are strange places. Ethnic and skin-color diversity are celebrated, but academic departments, administrators, and others actively and explicitly discriminate against people with diverse or different ideas. (E.g., I was on hiring committee recently in which the committee head said, “I don’t want to hire any more libertarians.” When the top candidate publication-wise turned out to be a libertarian and a Christian, he pushed to have the job description changed so that we hired a psychologist rather than a philosopher!) Though colleges are perhaps the least explicitly or implicitly racist places in the US, many students and faculty have become hypersensitive to racism, constantly searching for and calling out anything that could be interpreted by anyone as racist, or insufficiently deferential and respectful.
Check out this fascinating essay by sociologists Bradley Campbell and Jason Manning. Citing Donald Black, they claim part of the reason colleges have adopted a victim culture is that they have little intellectual diversity. Excerpt (emphasis added):
Environments with little diversity, Black says, give rise to a morality concerned with cultural purity. To be moral is to share the beliefs of one’s ancestors, one’s family, one’s neighbors. Given enough homogeneity, deviations may hardly occur — people either self-censor any deviant thoughts, or they are so like those around them they never have them in the first place. This appears to be the case in the most homogeneous societies, tribal societies. In more complex but still homogeneous societies, new ideas have a better chance to emerge, but they quickly become the object of rejection, ridicule, or worse. Heresy becomes a serious offense, possibly resulting in torture and execution. In many settings throughout human history, being culturally different was a serious crime. Environments with a lot of diversity, on the other hand, give rise to a morality of tolerance. Free speech and freedom of religion become rights. Heresy is no longer a crime, much less a capital crime, and outside of smaller, more solitary groups, it is no offense at all. To be moral is to respect and even value others’ differences. Indeed, what is offensive is opposition to diverse cultural expressions and characteristics. Discrimination in the workplace based on religion or ethnicity is forbidden, and even in informal settings, ethnic slurs and the like result in shaming or shunning. In this respect the morality of diverse modern societies is exactly opposite that of most tribal and traditional societies. Condemning someone for being culturally different is itself widely condemned.
Read the whole thing, then check out their original paper. | 2024-01-10T01:26:18.401715 | https://example.com/article/5853 |
1. Technical Field
The present disclosure relates to electronic devices; and particularly to an electronic device having a latching mechanism.
2. Description of Related Art
A conventional electronic apparatus includes a main body and a cover. The cover is pivotally attached to the main body for folding over the main body. The cover includes a hook, and the main body includes a locking slot. When the cover covers the main body, the hook of the cover deforms in order to pass through the locking slot and hooks to the main body securing the cover to the main body. However, when the cover is unfolded, the hook extends out of the cover and may be inconvenient to users.
Therefore, there is room for improvement in the art. | 2024-07-21T01:26:18.401715 | https://example.com/article/8923 |
base/project/:
project / manage.py:
python manage.py runserver
python manage.py
project/project:
project/project /__init__.py:
project/project /settings.py:
project/project /urls.py:
project/project /uwsgi.py:
project/static:
project/templates:
project/media:
import os BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) MEDIA_ROOT = os.path.join(BASE_DIR + '/media/') MEDIA_URL = '/media/' STATIC_URL = '/static/' STATICFILES_DIRS = [os.path.join(BASE_DIR, "static"), ] TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': ["templates"], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', ], }, }, ]
project/ app1:
project/app1/templatetags:
project/app1/templatetags/__init__.py:
project/app1/templatetags/tags.py:
project/app1/apps.py:
project/app1/models.py:
project/app1/migrations:
project/app1/migrations/__init__.py:
project/app1/migrations/001_initial.py:
project/app1/__init__.py:
project/app1/admin.py:
project/app1/urls.py:
project/app1/views.py:
project/app1/tests.py:
Let's talk about "Django" project structure in depth. You can see the complete project layout in above image.It is a container for our project. we can give any name to this directory and we can modify it at any time.It is created for all django projects. It is a command-line utility, it is used to interact with the "django" project in many ways.We use below command to run development server"runserver" is a command which is used to run the server.To show all available commands run the below commandThis directory contains the project files.It is a empty file that tells python to consider the directory as a package. It contains all configuration settings like database settings, installed apps, root url conf etc.It is the root url file. It contains url patterns to map the request to the respective view to process it.An entry-point for WSGI-compatible web servers to serve our project.It contains the static assets like css, javascript, images, etc.It contains the html files that will be used to create http response to a request.It is a path to store the media contents like files that are uploaded by users.To get project structure that is shown in above image. we need to updatefile with below code.To know more about customizing settings visit: https://docs.djangoproject.com/en/1.10/ref/settings/ It is a python package, It contains application related files.It's a directory that contains template tags of our application. Template tags helps us at the time of rendering the template. It takes the context from the template and processes it and again return it to the template.It's empty python file, it tells python to recognize the directory as a python package.It's a python file, it contains the custom template tags that we will use it in templates.It contains the application's configuration.It contains the models(db tables) of application. we represent our database tables with the model in django. ORM(Object Relation Mapper) converts the models to db tables. We do not use raw SQL(Structured Query Language) to query the database, instead we use django queries. ORM convert these queries into SQL equivalent code and performs the db query and again converts the relational data to python objects to make things easier.It contains the database migrations of application, each migration contains the database schema related code.It's empty python file, it tells python to recognize the directory as a python package.It's a migration file of application. It contains the database schema related code, that is used to create database schema.It's a python file, it tells python to recognize the directory as a python package.Django provides the inbuilt admin panel.This file contains the admin related code.It contains url's that are related to the application.It contains the views(functions/classes) that are mapped from the url's to process the request.It contains the unit tests of the application. | 2024-03-09T01:26:18.401715 | https://example.com/article/2905 |
Implementation of the Project P.A.T.H.S. in Hong Kong: observations based on the Co-Walker Scheme.
The implementation quality of the Tier 1 Program (Secondary 1 Program) of the Project P.A.T.H.S. in the third year of the Full Implementation Phase was examined in this study, with classroom observations of 233 units in 157 schools. Results demonstrated that the overall level of program adherence was generally high with an average of 72.96%. A total of 13 aspects regarding program delivery were significantly correlated. Multiple regression analyses indicated that overall implementation quality was significantly predicted by student participation and involvement, classroom control, use of positive and supportive feedback, degree of achievement of the objectives, and time management. Student participation and involvement, classroom control, degree of achievement of the objectives, and time management were significant predictors of success of implementation. | 2023-10-30T01:26:18.401715 | https://example.com/article/5637 |
1. Introduction {#sec1}
===============
Calcium entering the cell through voltage-gated Ca^2+^ channels plays an important role in mediating a wide variety of cellular events and includes feedback processes that regulate activity of the channel itself. The Ca^2+^-dependent modulation of channel activity mediated by the Ca^2+^-binding protein calmodulin (CaM) is found in many ion channels including the Ca~v~1 family \[[@B1]\]. Ca^2+^-dependent inactivation (CDI) of Ca~v~1.2 is mediated by CaM, and its structural determinants have been assigned to the proximal region of the C-terminus of Ca~v~1.2 \[[@B1], [@B2]\]. Three domains have been identified within this region: a Ca^2+^ binding EF-hand motif, a CaM-tethering site, and a CaM-binding IQ motif. The EF-hand motif, located \~16 residues beyond the end of the last transmembrane segment (IVS6), is absolutely necessary for CDI. The CaM-tethering site, which consists of both preIQ~3~ and IQ motifs, resides 50 amino acids downstream from the EF-hand motif and binds Ca^2+^-free CaM (apo-CaM) at resting \[Ca^2+^\]~i~. The IQ motif resides downstream from the EF-hand motif and the pre-IQ~3~ domain, and it binds Ca^2+^-CaM. When the interaction of CaM with either of these domains is compromised, CDI is reduced or eliminated \[[@B1], [@B2]\].
Recently, it has been demonstrated that the skeletal muscle L-type Ca^2+^ channel (Ca~v~1.1) also displays CDI mediated by CaM and that CaM associates with Ca~v~1.1 *in vivo* \[[@B3]\]. The initial 200 amino acids of the C-terminus of the Ca~v~1.1 are highly conserved and contain the above-described domains including the IQ motif. CaM binding to the IQ motif of Ca~v~1.2 channel has been shown to be necessary for CDI, and the mutation of the isoleucine (I1624) and glutamine (Q1625) to alanines (AA) in the IQ motif of Ca~v~1.2 resulted in ablation of CDI and significant reduction of apoCaM binding to Ca~v~1.2 \[[@B1], [@B2], [@B4]\]. Whether the IQ motif in Ca~v~1.1 plays a similar role remains to be determined.
In the present work, myotubes cultured from normal and dysgenic (lacking endogenous Ca~v~1.1) mice were used to investigate the role of the IQ motif in the function of Ca~v~1.1. The results presented demonstrate that the IQ motif in the C-terminus of Ca~v~1.1 is critical for function of Ca~v~1.1 as a voltage sensor as well as Ca^2+^ channel. Furthermore, the results indicate that the IQ motif may be a previously unrecognized site of protein-protein interaction between Ca~v~1.1 and the skeletal muscle ryanodine receptor (RyR1) and may play a role in skeletal muscle excitation-contraction (EC) coupling.
2. Experimental Procedures {#sec2}
==========================
2.1. Molecular Biology {#sec2.1}
----------------------
The coding sequence of yellow fluorescent protein- (YFP-) tagged Ca~v~1.1 channel (YFP-Ca~v~1.1) was a gift from Dr. K. Beam and is described in detail elsewhere \[[@B5]\]. The residues isoleucine (I) and glutamine (Q) at codons 1529-1530 of rabbit Ca~v~1.1 \[[@B6]\] were substituted with alanine (A) using the QuikChange II mutagenesis kit (Stratagene, La Jolla, CA), using the YFP-Ca~v~1.1 as a template. The construct YFP-Ca~v~1.1~AA~ was verified by restriction digest analysis and sequencing.
2.2. Cell Cultures {#sec2.2}
------------------
Primary myotubes were cultured from normal or dysgenic newborn mouse skeletal muscle as previously described \[[@B3]\]. For confocal microscopy purposes, primary cultures of myotubes were plated onto 35 mm culture dishes with integral no. 0 glass coverslip bottoms (MatTek) instead of Primaria dishes. Approximately one week after plating, dysgenic myotubes were injected with expression plasmids (cDNAs) encoding either YFP-Ca~v~1.1 or YFP-Ca~v~1.1~AA~ at concentrations of 0.2 *μ*g/*μ*L, respectively. In experiments assessing the effects of CaM on Ca^2+^ transients, normal myotubes (\~one week in culture) were injected with expression plasmids encoding CaM~wt~ or CaM~1234~ (gift of Dr. Yue) and green fluorescent protein (pEGFP-C1, BD Biosciences Clontech, CA) at concentrations of 0.1 and 0.02 *μ*g/*μ*L, respectively. Successfully transfected myotubes were identified 36--48 hours after injection by their *yellow* or *green* fluorescence under UV illumination.
2.3. Electrophysiology {#sec2.3}
----------------------
Patch pipettes were constructed of borosilicate glass and had resistances of 1.8--2.5 MΩ when filled with the standard internal solution, which contained (in mM) 145 Cs-aspartate, 10 Cs~2~-EGTA, 5 MgCl~2~, and 10 HEPES (pH 7.4 with CsOH). The external solution contained (in mM) 145 tetraethylammonium chloride (TEA-Cl), 10 CaCl~2~, 0.003 tetrodotoxin, and 10 HEPES (pH 7.4 with TEA-OH). The holding potential was --80 mV, and test pulses were preceded by a 1-s prepulse to --30 mV to inactivate endogenous T-type Ca^2+^ currents. Recorded membrane currents were corrected off line for linear components of leakage and capacitance by digitally scaling and subtracting the average of 10 preceding control currents, elicited by hyperpolarizing voltage steps (30 mV amplitude) from --50 mV. Ca^2+^ currents were normalized by linear cell capacitance (expressed in pA/pF). Values for *G*~max~, the maximal Ca^2+^ conductance, were obtained by fitting the measured currents according to the following equation:
$$I_{\text{peak}}{\,\,} = {\,\,}\frac{G_{\max}{\,\,}\left( {V - {\,\,}V_{R}} \right)}{\left\{ {1{\,\,} + {\,\,}\exp{\,\,}\left\lbrack {- {\left( {V - V_{1/2}} \right)/k}} \right\rbrack} \right\}},$$ where *I*~peak~ is the peak current activated at the test potential *V*, *V*~*R*~ is the extrapolated reversal potential, *V*~1/2~ is the potential for half-maximal activation of the Ca^2+^ conductance, and *k* is a slope factor.
The fraction of current remaining at the end of an 800 ms test pulse (*r*~800~) was determined by dividing the current remaining at the end of test pulse by the peak current, and this ratio was used to quantify the level of inactivation
$$r_{800}{\,\,} = {\,\,}\frac{I_{\text{end}}}{I_{\text{peak}}}.$$
For measurements of charge movement, 0.5 mM Cd^2+^ and 0.1 mM La^3+^ were added to the external solution to block Ca^2+^ currents. Charge movements were elicited in response to a prepulse protocol that consisted of a 1-s prepulse to −30 mV and a subsequent 40 ms repolarization to a pedestal potential (−50 mV), followed by a 25 ms depolarization to +40 mV. The maximum amount of charge that can be moved (*Q*~max~) was obtained by integrating the charge movement current at test potential of +40 mV. Linear leak and capacity currents were subtracted on line using −P/4 delivered from the holding potential (−80 mV) before each pulse. Charge movements were normalized to total cell capacitance (nC/*μ*F).
To measure relative changes in voltage-gated Ca^2+^ release from the SR, the Ca^2+^ indicator K~5~-Fluo-3 (0.5 mM) (Molecular Probes) was included in the pipette solution. After rupture of the cell membrane and entry into the whole cell configuration, cells were allowed to dialyze for about 5 min before recording in order to achieve adequate loading with indicator dye. Fluorescent emission was measured by a photomultiplier system (Biomedical Instrumentation Group, University of Pennsylvania). The set of filters used to record the fluorescent signal from Fluo-3 was as follows: excitation band-pass filter of 470/20 nm; dichroic long-pass mirror (510 nm); emission long-pass filter of 520 nm. After rupture and dye loading into the cell, the baseline fluorescence (*F*~base~) was monitored. The increase in fluorescent signal during depolarization was expressed as Δ*F*/*F*, where Δ*F* represents the increase in fluorescence above baseline fluorescence (Δ*F* = *F*~transient~ − *F*~base~), and *F* is *F*~base~. Peak fluorescence during each test pulse was plotted as a function of test potential V and fitted according to the following equation:
$$\frac{\Delta F}{F} = \frac{\left( {\Delta F/F} \right)_{\max}}{\left\{ {1{\,\,} + {\,\,}\exp\left\lbrack {\left( {V_{F1/2} - {\,\,}V} \right)/k_{F}} \right\rbrack} \right\}},{\,\,}$$ where (Δ*F*/*F*)~max~ is the maximal fluorescent change, *V*~*F*1/2~ is the potential for half-maximal activation of the Ca^2+^ transient, and *k*~*F*~ is a slope factor.
All recordings were performed at room temperature (\~20°C), and data are reported as mean ± SEM; *n* indicates the number of myotubes tested. Data sets were statistically compared by an unpaired, two-sample Student\'s *t*-test, with a confidence interval of at least 95%.
2.4. Confocal Microscopy {#sec2.4}
------------------------
Cells were bathed in rodent ringer (in mM: 146 NaCl, 5 KCl, 2 CaCl~2~, 1 MgCl~2~, 11 glucose, 10 HEPES; pH 7.4 adjusted with NaOH) and examined with an LSM 510 META laser scanning microscope (Zeiss, Thornwood, New York) with 40X oil immersion objective. The laser line (514 nm) of the argon laser (30 mW maximum output, operated at 50% or 6.3 A) was used to excite YFP fluorophore. Emissions of YFP were recorded in single-track configuration with a long-pass filter of 530 nm (Chroma, Rockingham, Vermont). Fluorescence signals were analyzed by the 510 LSM Image Examiner software (Zeiss, Thornwood, New York).
2.5. Immunocytochemistry {#sec2.5}
------------------------
Primary cell cultures were plated onto 35 mm culture dishes with integral no. 0 glass coverslip bottoms (MatTek). Myotubes expressing constructs of Ca~v~1.1 were identified by fluorescence. The cultures will be fixed with 100% methanol at −20°C for a minimum of 20 min. Cells were then incubated for 1 hour in PBS (phosphate-buffered saline) containing 1% BSA (bovine serum albumin) and 10% goat serum to block unspecific labeling. After 3 washes with PBS/BSA (.2%), cell cultures were incubated with specific primary antibody against the RyR1 (34C, Developmental Studies Hybridoma Bank (DSHB), UI) (dilution 1 : 4000) overnight at 4°C. Cells were washed out 3 times with PBS/BSA (.2%), followed by 1 hour of incubation with secondary antibody conjugated with Alexa 568 (at final dilution 1 : 5,000, goat anti-rabbit IgG, Invitrogen). Cells were then washed 3 times with PBS/BSA (.2%) to remove unbind secondary antibody and assessed with a confocal microscope.
3. Results {#sec3}
==========
*Ca^2+^-binding ability of CaM does not affect skeletal muscle EC coupling.* First, I addressed the question whether the Ca^2+^-binding ability of CaM plays any role in skeletal muscle EC coupling. Overexpressed mutant CaM which does not bind Ca^2+^ (CaM~1234~) can displace approximately 70% of endogenous CaM, as reflected by abolishment of CDI of Ca~v~1.1 \[[@B3]\]. However, overexpression of either CaM~wt~ or CaM~1234~ in normal myotubes did not significantly affect either current-voltage (*I*/*V*) relationship ([Figure 1(a)](#fig1){ref-type="fig"}) or voltage-gated Ca^2+^ release from SR as indicated by similar peak fluorescence-voltage relationship (Δ*F*/*F*-*V*) in comparison with uninjected normal myotubes ([Figure 1(b)](#fig1){ref-type="fig"}). This result suggests that either the Ca^2+^-binding ability of CaM or CaM itself does not play a role in skeletal muscle EC coupling. However, CaM associates with Ca~v~1.1 *in vivo* \[[@B3]\] and that indicates the possibility that CaM may still serve as a structural subunit of Ca~v~1.1, that is, that interaction between CaM and Ca~v~1.1 can stabilize the DHPR complex. By doing so, it may also ensure proper structural and functional coupling between DHPR and RyR1.
Therefore, I examined whether CaM association with Ca~v~1.1 is necessary for its function as a voltage sensor for EC coupling. The IQ motif of Ca~v~1.1 has been shown to bind CaM similar to IQ motifs of Ca~v~1.3 and Ca~v~2 channels \[[@B7]\]. Introduction of the mutation IQ/AA in the IQ motif of the cardiac L-type Ca^2+^ channel (Ca~v~1.2) resulted in abolishment of CDI and significant reduction of apoCaM binding to Ca~v~1.2 \[[@B2], [@B4]\]. Thus, corresponding IQ motif mutation in the C-terminus of Ca~v~1.1 was obvious place to start.
The mutation (IQ/AA) in the CaM-binding site of Ca~v~1.1 disables function of Ca~v~1.1 as a Ca^2+^ channel and voltage sensor for EC coupling. I introduced the IQ/AA mutation in the C-terminus of Ca~v~1.1 and investigated how this mutation will alter Ca~v~1.1 function as Ca^2+^ channel and voltage sensor for EC coupling. Introduction of the mutation IQ/AA in the IQ motif of Ca~v~1.2 resulted in abolishment of CDI and significant reduction of apoCaM binding to Ca~v~1.2 \[[@B2], [@B4]\]. Whether IQ motif in the Ca~v~1.1 plays a similar role is unknown. Dysgenic myotubes expressing either YFP-Ca~v~1.1 or YFP-Ca~v~1.1~AA~ were used to examine the role of IQ motif in Ca^2+^-dependent inactivation (CDI) of Ca~v~1.1. Injections of plasmids encoding various constructs of Ca~v~1.1 into dysgenic myotubes at concentrations of 0.2--0.5 *μ*g/*μ*L have been previously demonstrated to produce a similar extent of maximal, immobilization-resistant charge movement and similar Ca^2+^ current densities as normal myotubes, which corresponds to similar protein expression levels \[[@B3], [@B6], [@B8]--[@B10]\].
[Figure 2(a)](#fig2){ref-type="fig"} shows Ca^2+^ currents mediated by YFP-Ca~v~1.1 expressed in dysgenic myotube. The fraction of current remaining at the end of the pulse (*r*~800~) displayed a U-shaped voltage dependence (data not shown), consistent with a current-dependent inactivation process. In such a process, the extent of inactivation varies in proportion with the amplitude of the inward calcium current, which in turn depends on the number of conducting channels and the electrochemical driving force on calcium. Inactivation was minimal at a test potential of +10 mV, as reflected by an *r*~800~ value of 0.9 ± 0.08 (*n* = 7), and maximal at a test potential of +40 mV, as reflected by a minimum *r*~800~ value of 0.74 ± 0.03 (*n* = 7). Correspondingly, the Ca^2+^ current attained its maximum conductance at +40 mV ([Figure 1(c)](#fig1){ref-type="fig"}). Thus, Ca^2+^ currents mediated by YFP-Ca~v~1.1 displayed a current-dependent inactivation process, current-voltage (*I*-*V*) relationship ([Figure 2(c)](#fig2){ref-type="fig"}), and maximal Ca^2+^ ion conductance (*G*~max~ = 166 ± 18 nS/nF; *n* = 7) similar to the endogenous Ca~v~1.1 of normal myotubes \[[@B3]\]. These results suggest that YFP fused to the N-terminus of Ca~v~1.1 does not interfere with channel function.
In contrast, dysgenic myotubes expressing YFP-Ca~v~1.1~AA~ (Figures [2(b)](#fig2){ref-type="fig"} and [2(c)](#fig2){ref-type="fig"}) displayed either very small (\<1pA/pF) or no measurable Ca^2+^ currents. This is a very dramatic and surprising result considering that the corresponding mutation (IQ/AA) in the IQ motif of Ca~v~1.2 resulted only in ablation of CDI but did not affect the *I*-*V* relationship of Ca^2+^ currents mediated by Ca~v~1.2 \[[@B2]\]. Further voltage-gated Ca^2+^ currents and SR Ca^2+^ release were measured simultaneously from dysgenic myotubes expressing YFP-Ca~v~1.1~AA~ and compared with recordings from uninjected normal myotubes and normal myotubes overexpressing CaM~wt~ or CaM~1234~. The voltage-gated Ca^2+^ release from SR was completely abolished in dysgenic myotubes expressing YFP-Ca~v~1.1~AA~ ([Figure 2(d)](#fig2){ref-type="fig"}).
The loss of Ca~v~1.1~AA~ function could be a result of several scenarios such as that mutation caused misfolding of protein and insufficient membrane targeting or that protein-protein interaction between RyR1 and Ca~v~1.1 was significantly disturbed.If the latter possibility is the case, this result suggests that either the IQ motif itself or association of CaM with Ca~v~1.1 is necessary for *orthograde* signaling from Ca~v~1.1 to RyR1, which underlies skeletal muscle EC coupling.
*The IQ/AA mutation does not prevent proper targeting of Ca~v~1.1 into sarcolemma.* The severe loss of function, abolished Ca^2+^ current and orthograde signaling mediated by the Ca~v~1.1~AA~, could be explained by compromised targeting of Ca~v~1.1 to the T-SR junction as a result of incomplete protein folding.
[Figure 3](#fig3){ref-type="fig"} shows confocal images of *yellow* fluorescence from a dysgenic myotube expressing either YFP-Ca~v~1.1 or YFP-Ca~v~1.1~AA~. Expression of YFP-Ca~v~1.1 (a) or YFP-Ca~v~1.1~AA~ (b) resulted in the appearance of small yellow fluorescence puncta located near the cell surface. The small puncta correspond to groups of Ca~v~1.1 localized to T-SR junctions; these puncta are similar in size and distribution to those of Ca~v~1.1 foci revealed by immunohistochemistry \[[@B11]\]. There is a similar staining of the membrane and distribution of puncta in both myotubes, suggesting that both constructs are likely targeted to T-SR junctions.
To confirm targeting of YFP-Ca~v~1.1~AA~ to the sarcolemma, the *Q*~max~ was measured at +40 mV ([Figure 4](#fig4){ref-type="fig"}). The *Q*~max~ in dysgenic myotubes expressing Ca~v~1.1~AA~ (5.9 ± 0.5 nC/*μ*F; *n* = 27) was similar to that of normal myotubes (5.5 ± 0.4 nC/*μ*F; *n* = 16), but significantly larger (*P* \< 0.001) than in dysgenic myotubes alone (2.5 ± 0.2 nC/*μ*F; *n* = 18). This finding suggests that IQ/AA mutation in Ca~v~1.1 did not prevent the protein from being properly targeted or undergoing voltage-dependent conformational changes, which strongly suggest proper folding as intramembrane segment S4 of Ca~v~1.1 is responsible for voltage-dependent movement.
To further confirm Ca~v~1.1~AA~ proper targeting into T-SR junctions and site of EC coupling, I investigated colocalization of Ca~v~1.1 and RyR1. Dysgenic myotubes expressing either YFP-Ca~v~1.1 or YFP-Ca~v~1.1~AA~ (*yellow* fluorescence: YFP was artificially assigned as *green*) were incubated with specific primary antibody against the RyR1 followed by incubation with secondary antibody conjugated with Alexa 568 (*red*fluorescence). Colocalization of *green* and *red* fluorescence results in *yellow* pattern suggests colocalization of YFP-Ca~v~1.1 and RyR1 in T-SR junctions *in vivo* (see Figures [5(g)](#fig5){ref-type="fig"} and [5(h)](#fig5){ref-type="fig"}). Colocalization patterns of YFP-Ca~v~1.1~AA~ with RyR1 were compared to YFP-Ca~v~1.1 and RyR1 patterns in 5 different experiments. Colocalization patterns of either YFP-Ca~v~1.1 or YFP-Ca~v~1.1~AA~ with RyR1 were similar and have been analyzed by MetaMorph 7 software (Molecular Devices). Colocalization in near surface slices of z-stacks of YFP-Ca~v~1.1 and RyR1 was 83 ± 4% (*n* = 7), and colocalization of YFP-Ca~v~1.1~AA~ and RyR1 was 85 ± 2% (*n* = 7). These results strongly suggest that YFP-Ca~v~1.1~AA~ is targeted into T-SR junctions.
Together these results suggest that the IQ/AA mutation is not likely to affect protein folding within membrane. Furthermore, much more drastic alternation or deletions in Ca~v~1.1 sequence did not have such dramatic effects \[[@B12], [@B13]\].
Taking altogether, the loss of both ionic Ca^2+^ current and skeletal muscle EC coupling in Ca~v~1.1~AA~ along with charge movement similar to normal myotubes suggests that the IQ motif of the Ca~v~1.1 may be unrecognized site of protein-protein interaction between Ca~v~1.1 and RyR1 and play a role in both *orthograde* and *retrograde* signaling.
4. Discussion {#sec4}
=============
The present study provides new information about the skeletal muscle L-type Ca^2+^ channel (Ca~v~1.1). Specifically, the data demonstrate *in vivo* that the IQ motif in the C-terminus of Ca~v~1.1 is critical for function of Ca~v~1.1 as a voltage sensor as well as a Ca^2+^ channel. Furthermore, the results indicate that the IQ motif, in addition to II-III loop, may be a previously unrecognized site of protein-protein interaction between Ca~v~1.1 and RyR1 and, thus, may play a role in skeletal muscle EC coupling.
Ca~v~1.1 is localized in regions of the T-tubular membrane that are closely apposed to the sarcoplasmic reticulum (i.e., the T-SR junction), and the primary role of Ca~v~1.1 is to serve as the voltage sensor for skeletal muscle EC coupling. The second protein that plays a major role in this process is the skeletal muscle ryanodine receptor (RyR1). RyR1 is localized in junctional SR membrane and functions as calcium release channel. The mechanism of signal transmission between Ca~v~1.1 and RyR1 is still incompletely understood, but the most accepted view is that they are mechanically coupled and interact with each other through protein-protein interaction (*orthograde* and *retrograde* signaling). *Orthograde* signaling is the signal from Ca~v~1.1 to RyR1, in which movement of the voltage sensors in Ca~v~1.1 trigger opening of RyR1 and release of Ca^2+^ from the SR (EC coupling). *Retrograde* signaling is communication from RyR1 to Ca~v~1.1, in which RyR1 somehow increases the amount of L-type Ca^2+^ current mediated by Ca~v~1.1 \[[@B8], [@B9]\].
The Ca^2+^ conductance of Ca~v~1.1 channel is not necessary for functional excitation-contraction coupling between RyR1 and Ca~v~1.1; however, a direct protein-protein interaction between these two proteins in multiple sites is. It has been shown that cytoplasmic loops of Ca~v~1.1 and several regions of RyR1 play important role for normal physiological EC coupling in skeletal muscle \[[@B10], [@B14]--[@B17]\]. It has been also shown that protein-protein interaction between RyR1 and Ca~v~1.1 is necessary for Ca~v~1.1 display of Ca^2+^ conductance (retrograde signaling) \[[@B8]\]. It is clear that there are multiple contact sites between RyR1 and Ca~v~1.1 and not all of them are recognized and understood, yet. The most investigated region of contact between RyR1 and Ca~v~1.1 in Ca~v~1.1 is II-III cytoplasmic loop, but other regions play a role \[[@B14], [@B15]\].
In the present experiments, normal myotubes and dysgenic myotubes expressing either YFP-Ca~v~1.1 or YFP-Ca~v~1.1~AA~ were used to examine the role of the IQ motif in both functions of Ca~v~1.1, as a voltage sensor in EC coupling and Ca^2+^ channel. The primary cultures of skeletal muscle myotubes provide a natural cellular environment for Ca~v~1.1. First, I examined whether a fusion of YFP to Ca~v~1.1 would interfere with its function. The Ca^2+^ currents mediated by YFP-Ca~v~1.1 displayed an *I*-*V* relationship similar to the endogenous Ca~v~1.1 \[[@B3]\], suggesting that YFP fused on the N-terminus of Ca~v~1.1 does not interfere with its channel function, as was also shown by others \[[@B5]\]. Endogenous Ca~v~1.1 also exhibits CaM-mediated Ca^2+^-dependent inactivation (CDI) \[[@B3]\]. The Ca^2+^ currents mediated by YFP-Ca~v~1.1 also displayed current-dependent inactivation similar to the CDI of endogenous Ca~v~1.1, further supporting observation that fusion of YFP with Ca~v~1.1 does not interfere with channel function.
Second, I examined how IQ/AA mutation in Ca~v~1.1 will affect its function. Surprisingly, the intriguing finding of the present study was that dysgenic myotubes expressing YFP-Ca~v~1.1~AA~ displayed either very small or no measurable Ca^2+^ currents. Significant decrease or abolishment of Ca^2+^ current through Ca~v~1.1 could have resulted from improper targeting or folding of the protein. If Ca~v~1.1~AA~ was retained inside of myotubes due to incorrect folding and targeting, neither Ca^2+^ currents nor *Q*~max~ would be obtained. The absence of Ca^2+^ currents in some of the dysgenic myotubes expressing YFP-Ca~v~1.1~AA~ would suggest both. However, even though the Ca^2+^ current was absent, *Q*~max~ comparable with normal myotubes was observed. The *Q*~max~ measured in dysgenic myotubes expressing Ca~v~1.1~AA~ was significantly larger (*P* \< 0.001) than in dysgenic myotubes alone, but similar to that of normal myotubes measured here and to the *Q*~max~ measured in dysgenic myotubes expressing various constructs of wt Ca~v~1.1 at the similar experimental conditions elsewhere \[[@B6], [@B7]\].
The amount of *Q*~max~ in dysgenic myotubes expressing YFP-Ca~v~1.1~AA~ suggests that IQ/AA mutation in Ca~v~1.1 did not prevent the protein from being properly targeted and that protein can undergo voltage-dependent conformational changes. The size of small measurable Ca^2+^ currents measured in some (6 out of 14) of the dysgenic myotubes expressing Ca~v~1.1~AA~ (\<1pA/pF) was similar to L-type Ca^2+^ currents measured in dyspedic (lacking a functional gene of RyR1) myotubes \[[@B7]\], suggesting a loss of *retrograde* signaling from RyR1. Endogenous Ca~v~1.1 channels are present in sarcolemma of the dyspedic myotubes in similar density as in normal myotubes, as was demonstrated by comparable *Q*~max~ (dyspedic: 4.0 ± 1.4 nC/*μ*F; normal: 6.4 ± 2.8 nC/*μ*F) \[[@B7]\]. Thus, the amount of *Q*~max~ measured in dysgenic myotubes expressing Ca~v~1.1~AA~ (5.9 ± 0.5 nC/*μ*F) is in good agreement with the previously published values, and indicates that the IQ/AA mutation may have also disrupted *retrograde* signaling between Ca~v~1.1 and RyR1. The similar expression patterns and comparable colocalization of YFP-Ca~v~1.1 and YFP-Ca~v~1.1~AA~ with RyR1 in dysgenic myotubes obtained by confocal microscopy and immunocytochemistry further support the argument that YFP-Ca~v~1.1~AA~ seems to be folded and targeted properly to the T-SR junctions. In addition, much more drastic alternation or deletions in Ca~v~1.1 sequence did not have such dramatic effects \[[@B12], [@B13]\].
Third, the IQ/AA mutation in C-terminus of Ca~v~1.1 had a dramatic effect on its function as a voltage sensor for EC coupling. Even though amount of *Q*~max~ in dysgenic myotubes expressing YFP-Ca~v~1.1~AA~ is sufficient to support EC coupling (see above), the voltage-gated Ca^2+^ release from SR was completely abolished in these cells. This finding suggests that either tethering of CaM to Ca~v~1.1 as a structural subunit or the IQ motif itself is necessary for orthograde signaling between Ca~v~1.1 and RyR1 (EC coupling). Overexpression of CaM~wt~ and CaM~1234~ in normal myotubes did not significantly affect the peak fluorescence-voltage relationship (Δ*F*/*F*-*V*) in comparison with uninjected normal myotubes, suggesting that the Ca^2+^-binding ability of CaM does not play a role in skeletal muscle EC coupling in single twitch contractions.
For the first time, the present study shows that the IQ motif plays a role in both *orthograde* (skeletal muscle EC coupling) and *retrograde* (Ca^2+^ current) signaling between Ca~v~1.1 and RyR1 *in vivo*. Several regions of RyR1 were shown to participate in protein-protein interactions between Ca~v~1.1 and RyR1. However, until recently only the II-III loop of the Ca~v~1.1 has been thought to be necessary to convey *orthograde* and *retrograde* signaling between Ca~v~1.1 and RyR1. The present findings suggest that the C-terminus in addition to the II-III loop participates in and is necessary for the correct transmission of signals between Ca~v~1.1 and RyR1. These results support previously published *in vivo* findings that in addition to the II-III loop of Ca~v~1.1 additional intracellular loops of Ca~v~1.1 are necessary to restore the full extent of *orthograde* and *retrograde* signaling between Ca~v~1.1 and RyR1 \[[@B15]\]. The present findings also support *in vitro* results from pull-down assays, where it was demonstrated that CaM-binding region of RyR1 (3614--3543) interacts with the proximal C-terminus of Ca~v~1.1 (1393--1527) in the absence of CaM \[[@B18], [@B19]\]. It was also shown that CaM binding to the RyR1 is not essential for skeletal EC coupling \[[@B20]\]. This would indicate together with binding studies \[[@B18]\] that CaM association to either Ca~v~1.1 or RyR1 is not crucial for skeletal muscle EC coupling, but CaM-binding domains of both Ca~v~1.1 and RyR1 are. For example, it has been shown that CaM-binding region of RyR1 binds to IQ peptide of Ca~v~1.2 and in pull-down assay binds to Ca~v~1.1 \[[@B18]\]. It still remains to be determined whether CaM itself needs to be tethered to Ca~v~1.1 to ensure signaling and more experiments are in progress.
In conclusion, the results from confocal microscopy, immunocytochemistry, charge movement, and Ca^2+^ transients obtained from dysgenic myotubes expressing YFP-Ca~v~1.1~AA~ indicate that the IQ motif in the C-terminus of Ca~v~1.1 plays a crucial role in both *orthograde* (EC coupling) and *retrograde* (Ca^2+^ current) signaling between Ca~v~1.1 and RyR1.
The authors thanks Dr. David Yue for kindly providing CaM~wt~ and CaM~1234~ constructs Dr. Kurt Beam for discussions, providing YFP-Ca~v~1.1 construct, and for his support of preliminary studies and Dr. Brett Adams for his helpful insights and constructive criticism of the paper. This work was supported by MDA Research Grant and PIRG06-GA-2009-256580, Marie Curie Actions FP7-PEOPLE-2009-RG, EU.
{ref-type="disp-formula"}) (see Methods) and the average values. (b) The average peak fluorescence (Δ*F*/*F*) is plotted as a function of membrane potential (*V*~test~). Data were obtained from the indicated number of myotubes for each group. The smooth lines through data represent Boltzmann fits to the average data using equation ([3](#EEq3){ref-type="disp-formula"}) (see Methods).](JBB2011-504649.001){#fig1}
{ref-type="disp-formula"}) (see Methods) and the average values. (d) The average peak fluorescence (Δ*F*/*F*) is plotted as a function of membrane potential (*V*~test~). Data were obtained from the indicated number of myotubes for each group. The smooth lines through data represent Boltzmann fits to the average data using equation ([3](#EEq3){ref-type="disp-formula"}) (see Methods).](JBB2011-504649.002){#fig2}
{#fig3}
{#fig4}
{#fig5}
[^1]: Academic Editor: Guy Benian
| 2024-04-16T01:26:18.401715 | https://example.com/article/1049 |
Joseph Walker: Flying the friendly skies
There's always plenty of work to be done, and plenty of quiet, boring plane rides in which to do it. But the chance to make a new friend doesn't come along every day.
It isn't that Sam is unsociable. It's just that he's … well … you know …an engineer.
Not the kind that drive trains. Those guys are social animals (who wouldn't want to party with a guy who has one of those awesome train whistles to blow?).
Sam is the kind of engineer who sits at a desk and uses mathematical theories and scientific principles to design things.
How sociable can you be when your brain is full of stuff like that?
And that's where Sam's brain was as he boarded the plane for Phoenix. He had a briefcase full of work, and he was planning on some nice, quiet air time to get a few things done before he touched down in the Valley of the Sun.
The row-mates chatted for a little while. No, that isn't quite right. Clayton chatted and Sam listened. In just a few minutes Sam learned that Clayton attended a year-round school that was "off-track" for a couple of weeks, that he had an older brother and two older step-sisters and that he was especially excited to have some new coloring books and "bright liquid color" crayons.
Clayton didn't even slow down when the flight attendant brought their snack. He just kept chatting away while he munched, discussing everything and anything until he finally had to leave to use the restroom.
"OK," Sam said to himself hopefully, "maybe he'll settle down now and I can get some work done."
He pulled out some reports and spread them on the fold-down table in front of him, trying to send a subtle message to Clayton. But Clayton is 9, and 9-year-old boys don't do subtle.
Or do they?
After settling back into his seat, Clayton looked Sam right in the eye.
"Sam," he said, "you're a pretty nice guy."
That caught Sam a little off-guard.
"What makes you think that?" he asked.
Clayton didn't hesitate. "You talk to me," he said. "The last airplane trip I went on, the guy sitting next to me told me to shut up because he had to read." He glanced at the pile of papers on the table in front of Sam. Then he looked back at Sam.
The fact is, Sam is a nice guy. Which is why he spent the rest of the flight talking — well, OK, mostly listening — to a talkative 9-year-old boy. And then when they landed in Phoenix, he stayed on the plane until the flight attendant was finished with her other duties and could take care of Clayton.
And you know what? All of that work that Sam wanted to do on the plane eventually got done anyway. Only it got done by a smiling engineer who had a new 9-year-old friend.
Of course, it's entirely possible that Clayton set Sam up and used his "niceness" against him. But even if he did, where's the harm? There's always plenty of work to be done, and plenty of quiet, boring plane rides in which to do it. But the chance to make a new friend doesn't come along every day.
Especially if you don't have one of those awesome train whistles to blow. | 2024-06-24T01:26:18.401715 | https://example.com/article/8315 |
{
"keyboard": "tkw/stoutgat/v1",
"keymap": "default",
"commit": "06d4c0a3968f3f0ae0fc5deb36cb4b8de44b1428",
"layout": "LAYOUT_encoder",
"layers": [
[
"KC_MPLY", "KC_ESC",
"KC_GESC", "KC_1", "KC_2", "KC_3", "KC_4", "KC_5", "KC_6", "KC_7", "KC_8", "KC_9", "KC_0", "KC_MINS", "KC_EQL", "KC_BSPC", "KC_GRV",
"KC_TAB", "KC_Q", "KC_W", "KC_E", "KC_R", "KC_T", "KC_Y", "KC_U", "KC_I", "KC_O", "KC_P", "KC_LBRC", "KC_RBRC", "KC_DEL",
"KC_CAPS", "KC_A", "KC_S", "KC_D", "KC_F", "KC_G", "KC_H", "KC_J", "KC_K", "KC_L", "KC_SCLN", "KC_QUOT", "KC_NUHS", "KC_ENT", "KC_PGUP",
"KC_LSFT", "KC_NUBS", "KC_Z", "KC_X", "KC_C", "KC_V", "KC_B", "KC_N", "KC_M", "KC_COMM", "KC_DOT", "KC_SLSH", "KC_RSFT", "KC_UP", "KC_PGDN",
"KC_LCTL", "KC_LGUI", "KC_LALT", "KC_SPC", "KC_RALT", "MO(1)", "KC_RCTL", "KC_LEFT", "KC_DOWN", "KC_RGHT"
],
[
"KC_MPLY", "KC_ESC",
"KC_GRV", "KC_F1", "KC_F2", "KC_F3", "KC_F4", "KC_F5", "KC_F6", "KC_F7", "KC_F8", "KC_F9", "KC_F10", "KC_F11", "KC_F12", "KC_DEL", "KC_PSCR",
"KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "RESET", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_INS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_PAUS", "KC_TRNS",
"KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_INS", "KC_TRNS", "KC_HOME",
"KC_LSFT", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_MUTE", "KC_TRNS", "KC_TRNS", "KC_TRNS", "KC_RSFT", "KC_VOLU", "KC_END",
"KC_LCTL", "KC_LGUI", "KC_LALT", "KC_TRNS", "KC_RALT", "KC_TRNS", "KC_RCTL", "KC_TRNS", "KC_VOLD", "KC_TRNS"
]
]
}
| 2024-05-31T01:26:18.401715 | https://example.com/article/4823 |
[Clinical experiences with carteolol in patients with essential hypertension].
Publications dealing with investigations made with 5-(3-tert-butylamino-2-hydroxy-propoxy)-3, 4-dihydro-2(1H)-quinolinone hydrochloride (carteolol hydrochloride, Endak, Endak mite) on patients with essential hypertension, are briefly reviewed. Four controlled studies are considered in greater depth. A comparative study with pindolol indicates that the beta-receptor blocker carteolol led to a significant reduction of the elevated blood pressure of patients with essential hypertension, as did pindolol. The antihypertensive effect of carteolol, however, was seen in a significantly higher number of patients than that of pindolol (p less than 0.05). A further controlled clinical study of carteolol, this time in comparison with diuretics, also demonstrated its satisfactory antihypertensive effect. It was found that carteolol displayed a significantly greater (p less than 0.05 and p less than 0.001) effectivity in reducing the blood pressure than did previously prescribed diuretics. In another test the antihypertensive effect was established by comparison with a placebo (p less than 0.001). Moreover, a study has been made of the effect of carteolol on the renin-aldosterone system. The results established that the hypotensive effect of carteolol is not associated with an inhibition of the renin-aldosterone system. | 2024-01-05T01:26:18.401715 | https://example.com/article/4796 |
1. Introduction {#sec0005}
===============
*Escherichia coli* is an important platform for protein expressing and various product biosynthesis \[[@bib0005]\], however, the limited permeability of its outer membrane hinders the performance of *E. coli* as whole-cell biocatalyst \[[@bib0010]\]. The expression of SARS coronavirus small envelope protein \[[@bib0010]\] and deletion of *lpp* encoding lipoprotein in *E. coli* \[[@bib0015]\] were effective for increasing the outer membrane permeability. We have constructed *E. coli* mutants that could synthesize different length of lipopolysaccharides (LPS), the major molecules in the outer membrane, and found that the structure of LPS is closely relevant to the outer membrane permeability \[[@bib0020]\].
Lycopene is a bright red carotenoid pigment with 11 conjugated double bonds, and is an efficient singlet oxygen quencher. Recent advance in metabolic engineering has provided a very promising route for the heterologous production of lycopene within various microorganisms*. E. coli* has been widely utilized as microbial cell factory for the synthesis of various carotenoids \[[@bib0025]\]. *E. coli* can naturally synthesize (2E, 6E)-farnesyl diphosphate (FPP) from 3-phospho-[d]{.smallcaps}-glycerate and pyruvate through a series of catalytic reactions; expressing heterologous *crtE*, *crtB* and *crtI* in *E. coli* can convert FPP into lycopene ([Fig. 1](#fig0005){ref-type="fig"} ). Different types of plasmids have been used to carry the genes *crtE*, *crtB* and *crtI* to synthesize lycopene in *E. coli* \[[@bib0030]\]. Isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP), are synthesized via MEP pathway in *E. coli* \[[@bib0035]\]. In the MEP pathway, isopentenyl diphosphate isomerase encoded by *idi*, 1-deoxyxylulose-5-phosphate synthase encoded by *dxs*, 4-diphosphocytidyl-2C-methyl-[d]{.smallcaps}-erythritol synthase encoded by *ispD*, and 2C-methyl-[d]{.smallcaps}-erythritol 2,4-cyclodiphosphate synthase encoded by *ispF* play important roles; therefore, over-expressing these genes has been used to elevate isoprenoid accumulation \[[@bib0025],[@bib0040],[@bib0045]\]. For example, overexpressing *idi* could significantly stimulate carotenoid synthesis \[[@bib0050], [@bib0055], [@bib0060], [@bib0065]\]. Enhancing the gene expression by chromosomal promoter replacement \[[@bib0070]\] or introduction of a heterologous mevalonate pathway to increase IPP and DMAPP supply \[[@bib0075]\] have also been used for carotenoid synthesis.Fig. 1The biosynthetic pathway of lycopene in the recombinant *E. coli*. The last three reactions do not exist in *E. coli* but was introduced into *E. coli* in this study. Dxs, 1-deoxy-[d]{.smallcaps}-xylulose-5-phosphate synthase; Dxr, 1-deoxy-[d]{.smallcaps}-xylulose 5-phosphate reductoisomerase; IspD, 4-diphosphocytidyl-2C-methyl-[d]{.smallcaps}-erythritol synthase; IspE, 4-(cytidine 5′-diphospho)-2-C-methyl-[d]{.smallcaps}-erythritol kinase ; IspG, 1-hydroxy-2-methyl-2-(*E*)-butenyl 4-diphosphate synthase; IspH, 1-hydroxy-2-methyl-2-(*E*)-butenyl 4-diphosphate reductase; IDI, isopentenyl-diphosphate Δ-isomerase; IspA, geranyl diphosphate farnesyl diphosphate synthase; CrtE, geranylgeranyl pyrophosphate synthase subunit; CrtB, phytoene synthase ; CrtI, phytoene dehydrogenase ; G3P, 3-phospho-[d]{.smallcaps}-glycerate; DXP, 1-deoxy-[d]{.smallcaps}-xylulose 5-phosphate; MEP, 2-C-methyl-[d]{.smallcaps}-erythritol 4-phosphate; CDP-ME, 4-(cytidine 5′-diphospho)-2-C-methyl-[d]{.smallcaps}-erythritol; MEC, 2-phospho-4-(cytidine 5′-diphospho)-2-C-methyl-[d]{.smallcaps}-erythritol; HMBPP, 4-hydroxy-3-methylbut-2-enyl diphosphate; DMAPP, dimethylallyl diphosphate; IPP, isopentenyl diphosphate; GPP, geranyl diphosphate; FPP, (2E,6E)-farnesyl diphosphate; GGPP, geranylgeranyl diphosphate.Fig. 1
In this study, a series of *E. coli* LPS mutants strains \[[@bib0020]\] were used to synthesize lycopene by overexpressing the genes *crtE, crtB, crtI, dxr*, *dxs* and *ispA*, and the effects of different structures of LPS on lycopene biosynthesis were investigated.
2. Material and methods {#sec0010}
=======================
2.1. Strains, media and growth conditions {#sec0015}
-----------------------------------------
All *E. coli* strains used in this study were listed in [Table 1](#tbl0005){ref-type="table"} . *E. coli* strains were grown in LB medium (10 g/L trypton, 5 g/L yeast extract, 10 g/L NaCl) at 37 °C or 30 °C at 200 rpm. LB medium or 2 × YT + G medium (16 g/L tryptone, 10 g/L yeast extract, 5 g/L NaCl, 1 g/L glycerol), was used for shaking flask. When necessary, the medium was supplemented with ampicillin (100 μg/mL), kanamycin (30 μg/mL) or chloramphenicol (30 μg/mL) for plasmid maintenance or strain selection. Isopropyl-β-dthiogalactoside (IPTG) or arabinose were used as the inducer.Table 1Bacterial strains and plasmids used in this study.Table 1Strains or PlasmidsDescriptionSourceStrainsW3110Wild type *E. coli*, F−, λ−NovagenATCC14067Wild type *Corynebacterium glutamicum*ATCCΔ*waaC*W3110 Δ*waaC*\[[@bib0020]\]Δ*waaF*W3110 Δ*waaF*\[[@bib0020]\]Δ*waaG*W3110 Δ*waaG*\[[@bib0020]\]Δ*waaO*W3110 Δ*waaO*\[[@bib0020]\]Δ*waaR*W3110 Δ*waaR*\[[@bib0020]\]Δ*waaU*W3110 Δ*waaU*\[[@bib0020]\]Δ*waaP*W3110 Δ*waaP*\[[@bib0020]\]Δ*waaQ*W3110 Δ*waaQ*\[[@bib0020]\]Δ*waaY*W3110 Δ*waaY*\[[@bib0020]\]Δ*waaB*W3110 Δ*waaB*\[[@bib0020]\]Δ*waaC*/pWSK29-*crtEBI*Δ*waaC* harboring pWSK29-*crtEBI*This workΔ*waaF*/pWSK29-*crtEBI*Δ*waaF* harboring pWSK29-*crtEBI*This workΔ*waaG*/pWSK29-*crtEBI*Δ*waaG* harboring WSK29-*crtEBI*This workΔ*waaO*/pWSK29-*crtEBI*Δ*waaO* harboring pWSK29-*crtEBI*This workΔ*waaR*/pWSK29-*crtEBI*Δ*waaR* harboring pWSK29-*crtEBI*This workΔ*waaU*/pWSK29-*crtEBI*Δ*waaU* harboring pWSK29-*crtEBI*This workΔ*waaP*/pWSK29-*crtEBI*Δ*waaP* harboring pWSK29-*crtEBI*This workΔ*waaQ*/pWSK29-*crtEBI*Δ*waaQ* harboring pWSK29-*crtEBI*This workΔ*waaY*/pWSK29-*crtEBI*Δ*waaY* harboring pWSK29-*crtEBI*This workΔ*waaB*/pWSK29-*crtEBI*Δ*waaB* harboring pWSK29-*crtEBI*This workΔ*waaC*/pWSK29-*crtEBI*-*ispA*Δ*waaC* harboring pWSK29-*crtEBI*-*ispA*This workΔ*waaF*/pWSK29-*crtEBI*-*ispA*Δ*waaF* harboring pWSK29-*crtEBI*-*ispA*This workΔ*waaC*/pWSK29-*crtEBI*-*dxs*Δ*waaC* harboring pWSK29-*crtEBI*-*dxs*This workΔ*waaF*/pWSK29-*crtEBI*-*dxs*Δ*waaF* harboring pWSK29-*crtEBI*-*dxs*This workΔ*waaC*/pWSK29-*crtEBI*-*dxr*Δ*waaC* harboring pWSK29-*crtEBI*-*dxr*This workΔ*waaF*/pWSK29-*crtEBI*-*dxr*Δ*waaF* harboring pWSK29-*crtEBI*-*dxr*This workΔ*waaC*/pWSK29-*crtEBI*-*SR*Δ*waaC* harboring pWSK29-*crtEBI*-*SR*This workΔ*waaF*/pWSK29-*crtEBI*-*SR*Δ*waaF* harboring pWSK29-*crtEBI*-*SR*This workΔ*waaC*/pWSK29-*crtEBI*-*SRA*Δ*waaC* harboring pWSK29-*crtEBI*- *SRA*This workΔ*waaF*/pWSK29-*crtEBI*- *SRA*Δ*waaF* harboring pWSK29-*crtEBI*- *SRA*This workΔ*waaC*/pWSK29-*crtEBI*/pACYC184-*SRA*Δ*waaC* harboring pWSK29-*crtEBI* and pACYC184-*SRA*This workΔ*waaF*/pWSK29-*crtEBI*/pACYC184-*SRA*Δ*waaF* harbor the pWSK29-*crtEBI* and pACYC184-*SRA*This workΔ*waaC*/pWSK29-*crtEBI*/pACYC184-*SRAI*Δ*waaC* harbor the pWSK29-*crtEBI* and pACYC184-*SRAI*This workΔ*waaF*/pWSK29-*crtEBI*/pACYC184-*SRAI*Δ*waaF* harbor the pWSK29-*crtEBI* and pACYC184-*SRAI*This workPlasmidspWSK29Expression vector\[[@bib0130]\]pACYC184Expression vector\[[@bib0135]\]pBlueScript II SK+Cloning vector, ColE1, *lacZ*, Amp^R^StratagenepWSK29-*crtEBI*pWSK29 harboring the *crtEBI* operon from *C. glutamicum* ATCC14067This workpWSK29-*crtEBI*-*ispA*pWSK29 harboring the *crtEBI* operon from *C. glutamicum* ATCC14067, and *ispA* from *E. coli* W3110This workpWSK29-*crtEBI*-*dxs*pWSK29 harboring the *crtEBI* operon from ATCC14067 and *dxs* from W3110This workpWSK29-*crtEBI*-*dxr*pWSK29 harboring the *crtEBI* operon from ATCC14067 and *dxr* from W3110This workpWSK29-*crtEBI*-*SR*pWSK29 harboring the *crtEBI* operon from ATCC14067, and *dxs* and *dxr* from W3110This workpWSK29-*crtEBI*-*SRA*pWSK29 harboring the *crtEBI* operon from ATCC14067, and *ispA*, *dxs* and *dxr* from W3110This workpACYC184-*SRA*pACYC184 harboring the genes *ispA*, *dxs* and *dxr* from W3110This workpACYC184-*SRAI*pACYC184 harboring the genes *ispA*, *dxs*, *dxr* and *idi* from W3110This work
2.2. Construction of expression plasmids and recombinant strains {#sec0020}
----------------------------------------------------------------
The maps of different plasmids carrying the genes *crtE*, *crtB*, *crtI*, *dxr*, *dxs* or *ispA* individually or in combination are shown in [Fig. 2](#fig0010){ref-type="fig"} . Restriction enzymes, shrimp alkaline phosphatase, T4 DNA ligase and DNA ladder were purchased from Sangon (Shanghai, China). Plasmid DNA was prepared by using the EZ-10 spin column plasmid mini-preps kit from Bio Basic Inc. (Markham, Canada). PCR reaction mixtures (50 μL) contained: 5 μL 10 × *Ex Taq* buffer, 4 μL dNTP mixture (2.5 mM each), 1 μL plasmid template (100 ng/μL), 1 μL forward primer (20 μM), 1 μL reverse primer (20 μM) and 0.5 μL TaKaRa *Ex Taq* DNA polymerase. The PCR reaction was first heated to 94 °C and maintained for 10 min, followed by 35 cycles of denaturation (94 °C for 30 s), annealing (30 s at 55 °C or 58 °C) and extension (72 °C for 3 min). At the end, an additional 10 min incubation at 72 °C was used. PCR products were purified by using the TIANgel midi purification kit from Tiangen (Beijing, China). Primer synthesis and DNA sequencing were performed by Sangon. The sequences of primers used in this study are listed in [Table 2](#tbl0010){ref-type="table"} .Fig. 2Maps of different plasmids used in this study. The genes *crtE*, *crtI*, and *crtB* were amplified from the genome of *Corynebacterium glutamicum* ATCC14067.Fig. 2Table 2Primers used in this study.Table 2PrimerSequences (5′→3′)Restriction site*crtEBI*-29-FATGGGAGCTCAGGAGGTATATACCATGGACAATGGCATGACAAT*SacIcrtEBI*-29-RGGAGCGGCCGCTTAATGATCGTATGAGGTC*NotIdxs-*29-FGAGGCGGCCGCAGGAGGTATATACCATGAGTTTTGATATTGCCAA*NotIdxs*-29-RAACGGATCCTTATGCCAGCCAGGCCTTGAT*BamHIdxr*-29-FAACGGATCCAGGAGGTATATACCATGAAGCAACTCACCATTCT*BamHIdxr*-29-RAAGCTGCAGTCAGCTTGCGAGACGCATCAC*PstIispA*-29-FAACCTGCAGAGGAGGATTATAGGATGGACTTTCCGCAGCAACT*PstIispA*-29-RGCCGGTACCTTATTTATTACGCTGGATGATG*KpnIidi*-29-FAACGGTACCAGGAGGATTATAGGATGCAAACGGAACACGTCATT*KpnIidi*-29-RGGACTCGAGTTATTTAAGCTGGGTAAATGC*XhoI*184-srA-FGGCTCTAGTAGGAGGTATATACCATGAGTTTTGATATTGCCAA*XbaI*184-srA-FGCGTCTAGT TTATTTATTACGCTGGATGATG*XbaI*184-srAi-FGGCTCTAGTAGGAGGTATATACCATGAGTTTTGATATTGCCAA*XbaI*184-srAi-RGCGTCTAGTTTATTTAAGCTGGGTAAATGC*XbaI*
Fragments *crtE, crtB* and *crtI* were amplified from the genomic DNA of *Corynebacterium glutamicum* ATCC14067. Fragments *ispA*, *dxs*, *dxr* and *idi* were amplified from the genomic DNA of *E. coli* W3110, using different primer pairs listed in [Table 2](#tbl0010){ref-type="table"}. PCR products were digested with the corresponding restriction enzymes and ligated with the vector pWSK29 or pACYC184 similarly digested, resulting in the plasmids pWSK29-*crtEBI*, pWSK29-*crtEBI*-*ispA*, pWSK29-*crtEBI*-*dxs*, pWSK29-*crtEBI*-*dxr*, pWSK29-*crtEBI*-*SR*, pWSK29-*crtEBI*-*SRA*, pACYC184-*SRA*, and pACYC184-*SRAI,* respectively.
The plasmid pWSK29-*crtEBI* was transformed into *E. coli* W3110 and its mutant strains Δ*waaC*, Δ*waaF*, Δ*waaG*, Δ*waaO*, Δ*waaR*, Δ*waaU*, Δ*waaP*, Δ*waaQ*, Δ*waaY*, and Δ*waaB*, resulting in the strains Δ*waaC*/pWSK29-*crtEBI*, Δ*waaF*/pWSK29-*crtEBI*, Δ*waaG*/pWSK29-*crtEBI*, Δ*waaO*/pWSK29-*crtEBI*, Δ*waaR*/pWSK29-*crtEBI*, Δ*waaU*/pWSK29-*crtEBI*, Δ*waaP*/pWSK29-*crtEBI*, Δ*waaQ*/pWSK29-*crtEBI*, Δ*waaY*/pWSK29-*crtEBI*, and Δ*waaB*/pWSK29-*crtEBI*. The plasmids pWSK29-*crtEBI*, pWSK29-*crtEBI*-*ispA*, pWSK29-*crtEBI*-*dxs,* pWSK29-*crtEBI*-*dxr*, pWSK29-*crtEBI*-*SR* and pWSK29-*crtEBI*-*SRA* was transformed into Δ*waaC* and Δ*waaF,* respectively, resulting in the strains Δ*waaC*/pWSK29-*crtEBI*, Δ*waaF*/pWSK29-*crtEBI*, Δ*waaC*/pWSK29-*crtEBI*-*ispA*, Δ*waaF*/pWSK29-*crtEBI*-*ispA*, Δ*waaC*/pWSK29-*crtEBI*-*dxs*, Δ*waaF*/pWSK29-*crtEBI*-*dxs*, Δ*waaC*/pWSK29-*crtEBI*-*dxr*, Δ*waaF*/pWSK29-*crtEBI*-*dxr*, Δ*waaC*/pWSK29-*crtEBI*-*SR*, Δ*waaF*/pWSK29-*crtEBI*-*SR,* Δ*waaC*/pWSK29-*crtEBI*-*SRA*, and Δ*waaF*/pWSK29-*crtEBI*-*SRA*. The plasmids pACYC184-*SRA*, pACYC184-*SRAI* was transformed into Δ*waaC*/pWSK29-*crtEBI*, Δ*waaF*/pWSK29-*crtEBI,* resulting in the strains Δ*waaC*/pWSK29-*crtEBI*/pACYC184-*SRA*, Δ*waaF*/pWSK29-*crtEBI*/pACYC184-*SRA*, Δ*waaC*/pWSK29-*crtEBI*/pACYC184-*SRAI*, and Δ*waaF*/pWSK29-*crtEBI*/pACYC184-*SRAI*. Transformation of *E. coli* was performed according to the published protocol \[[@bib0080]\].
2.3. Analytical methods {#sec0025}
-----------------------
Cell growth during the cultivations was monitored by measuring the optical density at 600 nm (OD~600~). For dry cell weight (DCW) determination, a known volume of fermentation broth was centrifuged for 10 min in pre-weighed test tubes at 4 °C and 4000 rpm, washed once with water, and dried for 24 h at 90 °C to a constant weight.
To extract lycopene, the *E. coli* cells were grown in a 500-ml shaking flask at 37 °C and 200 rpm, harvested by centrifugation at 4000 rpm and 4 °C for 10 min, and rinsed twice with deionized water. Then the cells were suspended in 1 ml of acetone and incubated at 55 °C for 15 min in the dark. The samples were centrifuged at 4000 rpm for 10 min, and the acetone supernatant containing lycopene was transferred to a clean tube. The lycopene content of the extracts was measured according to the previous reported method \[[@bib0040]\]. Lycopene (purchased from Sigma) dissolved in acetone was used as the standard. The results were the mean from three independent determinations, and the standard deviations were in the range of ± 10% of the means.
2.4. Outer membrane permeability assay {#sec0030}
--------------------------------------
To determined outer membrane permeability of *E. coli*, the fluorescent probe 1*-N-*phenyl-1-naphthylamine (NPN) assay was used \[[@bib0085]\]. *E. coli* strains were cultivated in LB broth at 37 °C, harvested by centrifugation at 4000 rpm for 10 min, washed and resuspended in phosphate buffer (10 mM, pH = 7.4), The value of OD~600~ was adjusted to 0.5 in the final cell suspension. Then 1.92 mL of cell suspension was mixed with 80 μL NPN (1 mM) into quartz cuvette, immediately. Fluorescence was measured using a Fluorescence Spectrophotometer (650-60, Hitachi, Japan), using a slit width of 5 nm, an excitation wavelength of 350 nm and an emission wavelength of 420 nm.
3. Results {#sec0035}
==========
3.1. Lycopene biosynthesis in *E. coli* W3110 overexpressing the genes *crtE, crtB, and crtI* from *C. glutamicum* is affected by LPS structure {#sec0040}
-----------------------------------------------------------------------------------------------------------------------------------------------
LPS mutants Δ*waaC*, Δ*waaF*, Δ*waaG*, Δ*waaO*, Δ*waaR*, Δ*waaU*, Δ*waaP*, Δ*waaQ*, Δ*waaY* and Δ*waaB* from *E. coli* W3110 synthesized different length of LPS and showed different outer membrane permeability \[[@bib0020]\]. In order to effect of LPS structure on lycopene biosynthesis, pWSK29-*crtEBI* and pWSK29 were transformed into these strains and their lycopene productions were investigated \[[@bib0095]\].
As shown in [Fig. 3](#fig0015){ref-type="fig"} A, the color of the bacterial cells can be used to determine the amount of lycopene. W3110/pWSK29-*crtEBI* cells were red, but not W3110 and W3110/pWSK29 cells, suggesting that lycopene was produced only when the genes *crtE, crtB, and crtI* from *C. glutamicum* were overexpressed. Δ*waaC*/pWSK29-*crtEBI*, Δ*waaF*/pWSK29-*crtEBI* and Δ*waaY*/pWSK29-*crtEBI* cells were also red, Δ*waaG*/pWSK29-*crtEBI* cells were light red, suggesting lycopene was synthesized in these cells. These results indicate that LPS structure affects lycopene synthesis in *E. coli*. These cells were broken and lycopene was extracted to quantify. As shown in [Fig. 3](#fig0015){ref-type="fig"}B, all the strains harboring pWSK29-*crtEBI* can synthesize lycopene, but more lycopene was produced in Δ*waaC*/pWSK29-*crtEBI* (4.19 mg/g), Δ*waaF*/pWSK29-*crtEBI* (4.20 mg/g), Δ*waaY*/pWSK29-*crtEBI* (3.81 mg/g). This quantification is consistent with the red shades of the cells ([Fig. 3](#fig0015){ref-type="fig"}A vs B). Based on their OD~600~ value, the cell growth was retarded when pWSK29-*crtEBI* was introduced in *E. coli*. By comparison, Δ*waaC*/pWSK29-*crtEBI* and Δ*waaF*/pWSK29-*crtEBI* grew better and produced more lycopene than other strains, therefore, they were used in further study.Fig. 3A. Color comparison of different *E. coli* cells. B. Comparison of cell growth and lycopene yield in different *E. coli* cells. Data represent the average of three experiments and the error bars represent the standard deviation.Fig. 3
The outer membrane permeability of the 10 *E. coli* LPS mutants Δ*waaC*, Δ*waaF*, Δ*waaG*, Δ*waaO*, Δ*waaR*, Δ*waaU*, Δ*waaP*, Δ*waaQ*, Δ*waaY* and Δ*waaB* with or without pWSK29-*crtEBI* were analyzed, using the wild type W3110 as the control ([Fig. 4](#fig0020){ref-type="fig"} ). Similar outer membrane permeabilities were observe for the same strain with or without pWSK29-*crtEBI*, suggesting that the lycopene produced in the strains Δ*waaC*/pWSK29-*crtEBI*, Δ*waaF*/pWSK29-*crtEBI*, Δ*waaG*/pWSK29-*crtEBI*, Δ*waaO*/pWSK29-*crtEBI*, Δ*waaR*/pWSK29-*crtEBI*, Δ*waaU*/pWSK29-*crtEBI*, Δ*waaP*/pWSK29-*crtEBI*, Δ*waaQ*/pWSK29-*crtEBI*, Δ*waaY*/pWSK29-*crtEBI* and Δ*waaB*/pWSK29-*crtEBI* does not affect the outer membrane permeability and might locate in the inner membranes. Δ*waaC*/pWSK29-*crtEBI* showed high outer membrane permeability and produced a large amount of lycopene, but the outer membrane permeability and the lycopene production were not proportionally increased for other strains such as Δ*waaY*/pWSK29-*crtEBI* and Δ*waaP*/pWSK29-*crtEBI*. The results suggested that outer membrane permeability is not the only factor affecting lycopene production in *E. coli*.Fig. 4Comparison of cell outer membrane permeability of different *E. coli* cells. Data represent the average of three experiments and the error bars represent the standard deviation.Fig. 4
3.2. More lycopene was produced in Δ*waaC*/pWSK29-*crtEBI* and Δ*waaF*/pWSK29-*crtEBI* after enhancing the MEP pathway {#sec0045}
----------------------------------------------------------------------------------------------------------------------
To further improve lycopene yield, the key genes *dxs*, *dxr, ispA* and *idi* in the MEP pathway were overexpressed, individually or in combination, in Δ*waaC*/pWSK29-*crtEBI* and Δ*waaF*/pWSK29-*crtEBI*; the cell growth and lycopene production in these recombinant strains were investigated ([Fig. 5](#fig0025){ref-type="fig"} ).Fig. 5Comparison of cell growth and lycopene yield in different *E. coli* cells. Data represent the average of three experiments and the error bars represent the standard deviation.Fig. 5
Δ*waaC*/pWSK29-*crtEBI*-*ispA*, Δ*waaC*/pWSK29-*crtEBI*-*dxs*, and Δ*waaC*/pWSK29-*crtEBI*-*dxr* produced 4.53, 4.81 and 4.61 mg/g lycopene, respectively; Δ*waaC*/pWSK29-*crtEBI*-*SR*, Δ*waaC*/pWSK29-*crtEBI*-*SRA*, Δ*waaC*/pWSK29-*crtEBI*/pACYC184-*SRA* and Δ*waaC*/pWSK29-*crtEBI*/pACYC184-*SRAI* produced 5.17, 5.39, 5.08 and 5.14 mg/g lycopene, respectively ([Fig. 5](#fig0025){ref-type="fig"}). Compared to Δ*waaC*/pWSK29-*crtEBI,* these strains grew better and produced more lycopene, suggesting that enhancing the MEP pathway facilitates lycopene synthesis in *E. coli*.
Δ*waaF*/pWSK29-*crtEBI*-*ispA*, Δ*waaF*/pWSK29-*crtEBI*-*dxs*, and Δ*waaF*/pWSK29-*crtEBI*-*dxr* produced 4.35, 4.29 and 4.22 mg/g lycopene, respectively; Δ*waaF*/pWSK29-*crtEBI*-*SR*, Δ*waaF*/pWSK29-*crtEBI*-*SRA*, Δ*waaF*/pWSK29-*crtEBI*/pACYC184-*SRA*, and Δ*waaF*/pWSK29-*crtEBI*/pACYC184-*SRAI* produced 4.95, 5.28, 4.87 and 5.08 mg/g lycopene, respectively. Compared to Δ*waaF*/pWSK29-*crtEBI,* these strains produced more lycopene, suggesting again that enhancing the MEP pathway facilitates lycopene synthesis in *E. coli*.
4. Discussion {#sec0050}
=============
Biocatalysis employing the whole cell had been increasingly developed as a green technology in the synthesis of various valuable products, while low permeability of cell membrane always lead to the low productivities \[[@bib0015]\]. The outer membrane of gram-negative bacteria provided the cell with an effective permeability barrier against external noxious agents \[[@bib0090]\], and at the same time to allow the influx of nutrient molecules \[[@bib0095]\]. In the previous publications, *lpp* deletion was developed as a general permeabilization method. The *lpp* mutant had higher permeability of outer membrane and higher ability to synthesize [l]{.smallcaps}-carnitine \[[@bib0015]\]. Besides, expression of SCVE viroporins in *E. coli* also improved the diffusivity of small molecules across outer membrane through introducing additional pores within the outer membrane. As expected, the biocatalysts efficiency of *E. coli* was enhanced \[[@bib0010]\].
LPS, as the major molecule in outer membrane, played important roles on membrane behavior. In *E. coli*, LPS typically consists of a hydrophobic domain known as lipid A, a nonrepeating core oligosaccharide, and a distal polysaccharide known as *O*-antigen repeats. The core oligosaccharide is assembled on lipid A via sequential glycosyl transfer from nucleotide sugar precursors. In *E. coli*, the chromosomal *waa* locus encodes enzymes required for biosynthesis of the core oligosaccharide \[[@bib0100]\]. Mutations in LPS could alter outer membrane stability, giving rise to pleiotropic phenotype \[[@bib0105],[@bib0110]\]. Among 10 W3110 Δ*waa* mutant strains, W3110 Δ*waaC* has the simplest LPS structure. In compared to W3110, W3110 Δ*waaC* had four-fold higher membrane permeability, and this likely benefited for lycopene accumulation. Comparative transcriptome showed that mRNA levels of *dxr* and *ispA* in Δ*waaC* and Δ*waaF* were up-regulated, compared to W3110 (data not shown). The over-expression of the *dxr* gene provided more IPP precursors in the MEP pathway in tobacco, which consequently stimulated synthesis efficiency of isoprenoid downstream \[[@bib0115]\]. IPP and DMAPP supply likely limited lycopene biosynthesis \[[@bib0045]\]. Besides, the accumulation of metabolites in the MEP pathway stimulated the transcription of *dxs* and *dxr* in *Arabidopsis* cell culture \[[@bib0120]\]. In the current study, therefore, the genes *dxs*, *dxr* and *idi* were overexpressed individually or in combination, to increase these precursors supply. As expected, the overexpression of genes in MEP pathway stimulated lycopene synthesis \[[@bib0125]\].
A recombinant *E. coli* strain overexpressing the genes *crtE*, *crtB*, and *crtI* from *Deinococcus radiodurans* R12 and optimizing the Shine Dalgarno regions and aligned spacing sequence could produce 88 mg/g lycopene after 40 h fermentation \[[@bib0140]\]. *E. coli* K12f could efficiently uptake fructose; overexpressing the *crtEBI* operon from *Pantoea ananatis*. in K12f could produce 192 mg/g lycopene when grown on LB medium containing 10 g/L fructose \[[@bib0145]\]. Therefore, overexpressing the *crtEBI* operon from other bacteria in Δ*waaC* or Δ*waaF* might increase lycopene production
This study was supported by the National First-class Discipline Program of Light Industry Technology and Engineering (LITE2018-10) and the Collaborative Innovation Center of Jiangsu Modern Industrial Fermentation.
| 2023-09-07T01:26:18.401715 | https://example.com/article/8615 |
Remove from Favorites
Madigan Men has been added to your favorites.
Email me when the show airs
Email me the latest stories of Madigan Men
Synopsis: The comedy examines three generations of Irish men making their ways through the dating world. Benjamin is a recently divorced architect who gets dating advice both from his teenage son and his elderly father, both of whom live with him. Gabriel Byrne and Roy Dotrice star. | 2024-03-15T01:26:18.401715 | https://example.com/article/9851 |
Detection of Proteus mirabilis urease gene in urinary calculi by polymerase chain reaction.
Urea-splitting microorganisms cannot always be detected by stone or urine culture in patients with infection stones. Detection of genetic elements within the calculi by the polymerase chain reaction (PCR) may be a useful alternative. In this study, we assessed the usefulness of the PCR method in detecting the urease gene specific to Proteus mirabilis in urinary calculi. Thirty-eight metabolic stones (calcium oxalate and/or calcium phosphate, uric acid, or cystine) and 49 struvite stones were examined. The PCR was applied with DNA extracted by boiling pulverized stone pieces. Of the 87 stones, PCR demonstrated the presence of the P. mirabilis urease elements ureC1 and ureC2 in 17, all of which were struvite. Stone culture and urine culture had been performed in 22 and 46 struvite stone cases, respectively, and the PCR was positive in all of the 10 culture-positive calculi and also in two calculi from which P. mirabilis was not isolated. PCR was reliable and convenient for detecting P. mirabilis in desiccated struvite calculi. Study to detect other species such as Ureaplasma or Corynebacterium would be useful in elucidating the role of bacterial infection in the formation of these stones. | 2023-11-11T01:26:18.401715 | https://example.com/article/1530 |
See New 'Robin Hood' Photos; Here's Everything We Know So Far
Lionsgate has released two new photos for their upcoming Robin Hood. The first features Taron Egerton, who stars in the title role. Admittedly, this is a different – and younger – Robin Hood than we’ve seen in the past. Bow? Check. Quiver? Check. And yet, not a speck of green to be found in the iconic outlaw’s attire! You can investigate it for yourself below:
The next photo gives us our first look at Ben Mendelsohn, an actor well acquainted with villainy, as the Sheriff of Nottingham. He looks like he just came from a GQ photoshoot. I’m curious how these divergent yet fashionable choices speak to the film’s overall aesthetic. Let’s recap everything we know about this project so far below.
Ben Mendelsohn as Sheriff of Nottingham in #RobinHoodMovie - Coming to theaters in September 2018.
It’s fitting that Robin Hood, the legendary rogue known for robbing from the rich and giving to the poor, is in the public domain. It means he is free for anybody to use. It also means Hollywood can frequent his woods whenever they deem fit. There are currently four Robin Hood films in the works, Lionsgate’s production being nearest to release.
Based on a script by Joby Harold (King Arthur: Legend of the Sword), this is reported by Deadline to be a "gritty, revisionist take on the legend." The original title was Robin Hood: Origins as it follows our hero after fighting in the Crusades. Robin Hood returns home to find the Sherwood Forest beset by corruption. He decides to do something about it and forms a certain group of men to help. Yes, this certainly sounds like the classic story, but the filmmakers seem to be injecting some newfound flair and attitude.
Who is starring?
Taron Egerton, the young Welsh actor best known for playing ‘Eggsy' in the Kingsman film series, dons the hood. Jamie Foxx (Django Unchained, Ray) also stars as Little John, Robin’s right hand man. Together they will face off against the Sheriff of Nottingham as played by Ben Mendelsohn (best known for Rogue One and Netflix’s Bloodline).
Who else is in the film?
Eve Hewson (The Knick) plays Maid Marian. Will Scarlet, husband to Marian and half-brother to Robin, is played by Jamie Dornan (Fifty Shades of Grey). Paul Anderson (Peaky Blinders) will be playing Guy of Gisborne with actor/comedian/musician Tim Minchin cast in the role of Friar Tuck.
Who is directing?
Otto Bathurst. The London native is best known for directing British television, including episodes of Black Mirror and Peaky Blinders. Robin Hood will be his theatrical debut.
Movies.com, the ultimate source for everything movies, is your destination for new movie trailers, reviews, photos, times, tickets + more! Stay in the know with the latest movie news and cast interviews at Movies.com. | 2023-09-10T01:26:18.401715 | https://example.com/article/3682 |
using System;
using Microsoft.Extensions.DependencyInjection;
using Microsoft.Extensions.Options;
using WebMarkupMin.AspNet.Common;
#if ASPNETCORE1
namespace WebMarkupMin.AspNetCore1
#elif ASPNETCORE2
namespace WebMarkupMin.AspNetCore2
#elif ASPNETCORE3
namespace WebMarkupMin.AspNetCore3
#else
#error No implementation for this target
#endif
{
public class WebMarkupMinServicesBuilder
{
/// <summary>
/// Collection of service descriptors
/// </summary>
private readonly IServiceCollection _services;
/// <summary>
/// Constructs a instance of WebMarkupMin builder
/// </summary>
/// <param name="services"></param>
public WebMarkupMinServicesBuilder(IServiceCollection services)
{
_services = services;
}
public WebMarkupMinServicesBuilder ConfigureWebMarkupMin(Action<WebMarkupMinOptions> configure)
{
_services.Configure(configure);
return this;
}
public WebMarkupMinServicesBuilder ConfigureHtmlMinification(Action<HtmlMinificationOptions> configure)
{
_services.Configure(configure);
return this;
}
public WebMarkupMinServicesBuilder ConfigureXhtmlMinification(Action<XhtmlMinificationOptions> configure)
{
_services.Configure(configure);
return this;
}
public WebMarkupMinServicesBuilder ConfigureXmlMinification(Action<XmlMinificationOptions> configure)
{
_services.Configure(configure);
return this;
}
public WebMarkupMinServicesBuilder ConfigureHttpCompression(Action<HttpCompressionOptions> configure)
{
_services.Configure(configure);
return this;
}
public WebMarkupMinServicesBuilder AddHtmlMinification()
{
return AddHtmlMinification(configure: null);
}
public WebMarkupMinServicesBuilder AddHtmlMinification(Action<HtmlMinificationOptions> configure)
{
_services.AddSingleton<IConfigureOptions<HtmlMinificationOptions>, HtmlMinificationOptionsSetup>();
if (configure != null)
{
_services.Configure(configure);
}
_services.AddSingleton<IHtmlMinificationManager, HtmlMinificationManager>();
return this;
}
public WebMarkupMinServicesBuilder AddXhtmlMinification()
{
return AddXhtmlMinification(configure: null);
}
public WebMarkupMinServicesBuilder AddXhtmlMinification(Action<XhtmlMinificationOptions> configure)
{
_services.AddSingleton<IConfigureOptions<XhtmlMinificationOptions>, XhtmlMinificationOptionsSetup>();
if (configure != null)
{
_services.Configure(configure);
}
_services.AddSingleton<IXhtmlMinificationManager, XhtmlMinificationManager>();
return this;
}
public WebMarkupMinServicesBuilder AddXmlMinification()
{
return AddXmlMinification(configure: null);
}
public WebMarkupMinServicesBuilder AddXmlMinification(Action<XmlMinificationOptions> configure)
{
if (configure != null)
{
_services.Configure(configure);
}
_services.AddSingleton<IXmlMinificationManager, XmlMinificationManager>();
return this;
}
public WebMarkupMinServicesBuilder AddHttpCompression()
{
return AddHttpCompression(configure: null);
}
public WebMarkupMinServicesBuilder AddHttpCompression(Action<HttpCompressionOptions> configure)
{
if (configure != null)
{
_services.Configure(configure);
}
_services.AddSingleton<IHttpCompressionManager, HttpCompressionManager>();
return this;
}
}
} | 2024-03-12T01:26:18.401715 | https://example.com/article/2462 |
class RenameLocationIdToLocationAndChangeType < ActiveRecord::Migration
def change
rename_column :events, :location_id, :location
change_column :events, :location, :string
end
end | 2024-05-24T01:26:18.401715 | https://example.com/article/5856 |
Application of a new nanocarbonaceous sorbent in electromembrane surrounded solid phase microextraction for analysis of amphetamine and methamphetamine in human urine and whole blood.
Application of a new carbon-based sorbent was studied for the first time for extraction and quantification of amphetamine and methamphetamine as model analytes by means of electromembrane surrounded solid phase microextraction (EM-SPME). Since the basis of this microextraction method is adsorption of target analytes on the sorbent surface (after transferring across a supported liquid membrane) in an electrical field, the sorbent, which also performs the electrical potential, should have a conductive nature. On the other hand, using a synthesized fiber is a suitable solution to eliminate the interfering compounds existing in the fiber. To extract the model analytes from acidic sample solution through a thin layer of organic phase and into the aqueous acceptor phase and their final adsorption, 150V electrical potential was applied for 15min. Regardless of the high sample cleanup ability of the proposed method, which makes the analysis of complicated biological fluids possible, admissible extraction recoveries (9.0-18.8%) and suitable detection limits (less than 2.0ngmL(-1)) were obtained. Repeatability and reproducibility of the method were studied and intra- and inter-assay precisions were in the ranges of 2.0-7.3% and 7.5-12.5%, respectively. Coefficients of determination larger than 0.9964 were achieved by scrutinizing of the linearity up to 500ngmL(-1) and calibration curves were utilized for quantification of analytes of interest in human urine and whole blood samples. | 2024-05-22T01:26:18.401715 | https://example.com/article/7517 |
Structural mimicry of CD4 by a cross-reactive HIV-1 neutralizing antibody with CDR-H2 and H3 containing unique motifs.
Human immunodeficiency virus (HIV) entry into cells is initiated by the binding of its envelope glycoprotein (Env) gp120 to receptor CD4. Antibodies that bind to epitopes overlapping the CD4-binding site (CD4bs) on gp120 can prevent HIV entry by competing with cell-associated CD4; their ability to outcompete CD4 is a major determinant of their neutralizing potency and is proportional to their avidity. The breadth of neutralization and the likelihood of the emergence of antibody-resistant virus are critically dependent on the structure of their epitopes. Because CD4bs is highly conserved, it is reasonable to hypothesize that antibodies closely mimicking CD4 could exhibit relatively broad cross-reactivity and a high probability of preventing the emergence of resistant viruses. Previously, in a search for antibodies that mimic CD4 or the co-receptor, we identified and characterized a broadly cross-reactive HIV-neutralizing CD4bs human monoclonal antibody (hmAb), m18. Here, we describe the crystal structure of Fab m18 at 2.03 A resolution, which reveals unique conformations of heavy chain complementarity-determining regions (CDRs) 2 and 3 (H2 and H3). H2 is highly bulged and lacks cross-linking interstrand hydrogen bonds observed in all four canonical structures. H3 is 17.5 A long and rigid, forming an extended beta-sheet decorated with an alpha-turn motif bearing a phenylalanine-isoleucine fork at the apex. It shows striking similarity to the Ig CDR2-like C'C'' region of the CD4 first domain D1 that dominates the binding of CD4 to gp120. Docking simulations suggest significant similarity between the m18 epitope and the CD4bs on gp120. Fab m18 does not enhance binding of CD4-induced (CD4i) antibodies, nor does it induce CD4-independent fusion mediated by the HIV Env. Thus, vaccine immunogens based on the m18 epitope structure are unlikely to elicit antibodies that could enhance infection. The structure can also serve as a basis for the design of novel, highly efficient inhibitors of HIV entry. | 2023-09-06T01:26:18.401715 | https://example.com/article/9913 |
package cmap
import (
"encoding/json"
"sync"
)
var SHARD_COUNT = 32
// A "thread" safe map of type string:Anything.
// To avoid lock bottlenecks this map is dived to several (SHARD_COUNT) map shards.
type ConcurrentMap []*ConcurrentMapShared
// A "thread" safe string to anything map.
type ConcurrentMapShared struct {
items map[string]interface{}
sync.RWMutex // Read Write mutex, guards access to internal map.
}
// Creates a new concurrent map.
func New() ConcurrentMap {
m := make(ConcurrentMap, SHARD_COUNT)
for i := 0; i < SHARD_COUNT; i++ {
m[i] = &ConcurrentMapShared{items: make(map[string]interface{})}
}
return m
}
// Returns shard under given key
func (m ConcurrentMap) GetShard(key string) *ConcurrentMapShared {
return m[uint(fnv32(key))%uint(SHARD_COUNT)]
}
func (m ConcurrentMap) MSet(data map[string]interface{}) {
for key, value := range data {
shard := m.GetShard(key)
shard.Lock()
shard.items[key] = value
shard.Unlock()
}
}
// Sets the given value under the specified key.
func (m ConcurrentMap) Set(key string, value interface{}) {
// Get map shard.
shard := m.GetShard(key)
shard.Lock()
shard.items[key] = value
shard.Unlock()
}
// Callback to return new element to be inserted into the map
// It is called while lock is held, therefore it MUST NOT
// try to access other keys in same map, as it can lead to deadlock since
// Go sync.RWLock is not reentrant
type UpsertCb func(exist bool, valueInMap interface{}, newValue interface{}) interface{}
// Insert or Update - updates existing element or inserts a new one using UpsertCb
func (m ConcurrentMap) Upsert(key string, value interface{}, cb UpsertCb) (res interface{}) {
shard := m.GetShard(key)
shard.Lock()
v, ok := shard.items[key]
res = cb(ok, v, value)
shard.items[key] = res
shard.Unlock()
return res
}
// Sets the given value under the specified key if no value was associated with it.
func (m ConcurrentMap) SetIfAbsent(key string, value interface{}) bool {
// Get map shard.
shard := m.GetShard(key)
shard.Lock()
_, ok := shard.items[key]
if !ok {
shard.items[key] = value
}
shard.Unlock()
return !ok
}
// Retrieves an element from map under given key.
func (m ConcurrentMap) Get(key string) (interface{}, bool) {
// Get shard
shard := m.GetShard(key)
shard.RLock()
// Get item from shard.
val, ok := shard.items[key]
shard.RUnlock()
return val, ok
}
// Returns the number of elements within the map.
func (m ConcurrentMap) Count() int {
count := 0
for i := 0; i < SHARD_COUNT; i++ {
shard := m[i]
shard.RLock()
count += len(shard.items)
shard.RUnlock()
}
return count
}
// Looks up an item under specified key
func (m ConcurrentMap) Has(key string) bool {
// Get shard
shard := m.GetShard(key)
shard.RLock()
// See if element is within shard.
_, ok := shard.items[key]
shard.RUnlock()
return ok
}
// Removes an element from the map.
func (m ConcurrentMap) Remove(key string) {
// Try to get shard.
shard := m.GetShard(key)
shard.Lock()
delete(shard.items, key)
shard.Unlock()
}
// RemoveCb is a callback executed in a map.RemoveCb() call, while Lock is held
// If returns true, the element will be removed from the map
type RemoveCb func(key string, v interface{}, exists bool) bool
// RemoveCb locks the shard containing the key, retrieves its current value and calls the callback with those params
// If callback returns true and element exists, it will remove it from the map
// Returns the value returned by the callback (even if element was not present in the map)
func (m ConcurrentMap) RemoveCb(key string, cb RemoveCb) bool {
// Try to get shard.
shard := m.GetShard(key)
shard.Lock()
v, ok := shard.items[key]
remove := cb(key, v, ok)
if remove && ok {
delete(shard.items, key)
}
shard.Unlock()
return remove
}
// Removes an element from the map and returns it
func (m ConcurrentMap) Pop(key string) (v interface{}, exists bool) {
// Try to get shard.
shard := m.GetShard(key)
shard.Lock()
v, exists = shard.items[key]
delete(shard.items, key)
shard.Unlock()
return v, exists
}
// Checks if map is empty.
func (m ConcurrentMap) IsEmpty() bool {
return m.Count() == 0
}
// Used by the Iter & IterBuffered functions to wrap two variables together over a channel,
type Tuple struct {
Key string
Val interface{}
}
// Returns an iterator which could be used in a for range loop.
//
// Deprecated: using IterBuffered() will get a better performence
func (m ConcurrentMap) Iter() <-chan Tuple {
chans := snapshot(m)
ch := make(chan Tuple)
go fanIn(chans, ch)
return ch
}
// Returns a buffered iterator which could be used in a for range loop.
func (m ConcurrentMap) IterBuffered() <-chan Tuple {
chans := snapshot(m)
total := 0
for _, c := range chans {
total += cap(c)
}
ch := make(chan Tuple, total)
go fanIn(chans, ch)
return ch
}
// Returns a array of channels that contains elements in each shard,
// which likely takes a snapshot of `m`.
// It returns once the size of each buffered channel is determined,
// before all the channels are populated using goroutines.
func snapshot(m ConcurrentMap) (chans []chan Tuple) {
chans = make([]chan Tuple, SHARD_COUNT)
wg := sync.WaitGroup{}
wg.Add(SHARD_COUNT)
// Foreach shard.
for index, shard := range m {
go func(index int, shard *ConcurrentMapShared) {
// Foreach key, value pair.
shard.RLock()
chans[index] = make(chan Tuple, len(shard.items))
wg.Done()
for key, val := range shard.items {
chans[index] <- Tuple{key, val}
}
shard.RUnlock()
close(chans[index])
}(index, shard)
}
wg.Wait()
return chans
}
// fanIn reads elements from channels `chans` into channel `out`
func fanIn(chans []chan Tuple, out chan Tuple) {
wg := sync.WaitGroup{}
wg.Add(len(chans))
for _, ch := range chans {
go func(ch chan Tuple) {
for t := range ch {
out <- t
}
wg.Done()
}(ch)
}
wg.Wait()
close(out)
}
// Returns all items as map[string]interface{}
func (m ConcurrentMap) Items() map[string]interface{} {
tmp := make(map[string]interface{})
// Insert items to temporary map.
for item := range m.IterBuffered() {
tmp[item.Key] = item.Val
}
return tmp
}
// Iterator callback,called for every key,value found in
// maps. RLock is held for all calls for a given shard
// therefore callback sess consistent view of a shard,
// but not across the shards
type IterCb func(key string, v interface{})
// Callback based iterator, cheapest way to read
// all elements in a map.
func (m ConcurrentMap) IterCb(fn IterCb) {
for idx := range m {
shard := (m)[idx]
shard.RLock()
for key, value := range shard.items {
fn(key, value)
}
shard.RUnlock()
}
}
// Return all keys as []string
func (m ConcurrentMap) Keys() []string {
count := m.Count()
ch := make(chan string, count)
go func() {
// Foreach shard.
wg := sync.WaitGroup{}
wg.Add(SHARD_COUNT)
for _, shard := range m {
go func(shard *ConcurrentMapShared) {
// Foreach key, value pair.
shard.RLock()
for key := range shard.items {
ch <- key
}
shard.RUnlock()
wg.Done()
}(shard)
}
wg.Wait()
close(ch)
}()
// Generate keys
keys := make([]string, 0, count)
for k := range ch {
keys = append(keys, k)
}
return keys
}
//Reviles ConcurrentMap "private" variables to json marshal.
func (m ConcurrentMap) MarshalJSON() ([]byte, error) {
// Create a temporary map, which will hold all item spread across shards.
tmp := make(map[string]interface{})
// Insert items to temporary map.
for item := range m.IterBuffered() {
tmp[item.Key] = item.Val
}
return json.Marshal(tmp)
}
func fnv32(key string) uint32 {
hash := uint32(2166136261)
const prime32 = uint32(16777619)
for i := 0; i < len(key); i++ {
hash *= prime32
hash ^= uint32(key[i])
}
return hash
}
// Concurrent map uses Interface{} as its value, therefor JSON Unmarshal
// will probably won't know which to type to unmarshal into, in such case
// we'll end up with a value of type map[string]interface{}, In most cases this isn't
// out value type, this is why we've decided to remove this functionality.
// func (m *ConcurrentMap) UnmarshalJSON(b []byte) (err error) {
// // Reverse process of Marshal.
// tmp := make(map[string]interface{})
// // Unmarshal into a single map.
// if err := json.Unmarshal(b, &tmp); err != nil {
// return nil
// }
// // foreach key,value pair in temporary map insert into our concurrent map.
// for key, val := range tmp {
// m.Set(key, val)
// }
// return nil
// }
| 2024-01-04T01:26:18.401715 | https://example.com/article/9521 |
Q:
Submitting a form with different values using javascript
I am new to forms, and Javascript, so please be forgiving.
I have a form that looks like this:
<form method="post" action="control" name="myform">
<input type="submit" name="Name" value="Do A"/>
<input type="submit" name="Name" value="Do B" />
<input type="submit" name="Name" value="Do C" />
<input type="submit" name="Name" value="Close" />
</form>
I need to change this so that there are two buttons, and the form is submitted using javascript dependent on some external conditions, so I want it to look something like this:
<form method="post" action="control" name="myform">
<script>
function submitForm(form){
if(someConditionA){
submit the form so that the script performs same action as if the button Do A had been clicked
} if (someConditionB){
submit the form so that the script performs same action as if the button Do B had been clicked
} if (someConditionC){
submit the form so that the script performs same action as if the button Do C had been clicked
}
}
function closeForm(form){
window.close();
}
</script>
<button name="doAction" onClick="SubmitForm(this.form)">Do Action<\button>
<button name="close" onClick="SubmitForm(this.form)">Close<\button>
</form>
How can I implement the function submitForm?
Thanks
A:
Add a hidden field with the same name as the original submit buttons:
<input type="HIDDEN" name="Name" value=""/>
Set the value of that field based on your conditions:
function submitForm(form){
if(someConditionA){
form.Name.value = "Do A";
} if (someConditionB){
form.Name.value = "Do B";
} if (someConditionC){
form.Name.value = "Do C";
}
form.submit();
}
Change the new Close button to this:
<button name="close" onClick="this.form.Name.value='Close';this.form.submit();">Close<\button>
I haven't tested this, so it may contain a mistake or two, but that's the general idea. (+1 for 'this.form', not many folks know about that, nice.)
| 2023-08-25T01:26:18.401715 | https://example.com/article/4446 |
Service use by elders with heart disease.
The study purpose was to determine the impact of demographic, social, environmental, and health indicators on utilization of health services among elders with heart disease. Existing data from a regional Area Agency on Aging were used and the sample (N = 1,167) included vulnerable groups, men, blacks, low income, and rural residents. Services most frequently used were case management, congregate meal, home delivered meal, outreach, and recreation. Multiple linear and logistic regression indicated that race, marital status, living arrangements, payment source, residence, transportation capability, health conditions, sensory impairment, and function were predictors of service use. | 2023-10-05T01:26:18.401715 | https://example.com/article/5332 |
FILE(GLOB CPPFILES *.cpp)
FOREACH(CPPFILE ${CPPFILES})
GET_FILENAME_COMPONENT(FILENAME ${CPPFILE} NAME_WE)
ADD_LIBRARY(${FILENAME} MODULE ${CPPFILE})
TARGET_LINK_LIBRARIES(${FILENAME} ${MPI_CXX_LIBRARIES})
INCLUDE_DIRECTORIES(${MPI_CXX_INCLUDE_PATH}
${CMAKE_SOURCE_DIR}/src/bamglib
${CMAKE_SOURCE_DIR}/src/Graphics
${CMAKE_SOURCE_DIR}/src/femlib
${CMAKE_SOURCE_DIR}/src/fflib)
SET_TARGET_PROPERTIES(${FILENAME} PROPERTIES PREFIX "")
ENDFOREACH(CPPFILE)
| 2024-03-24T01:26:18.401715 | https://example.com/article/6065 |
Pages
April 27, 2006
G20-21-22: Red Sox at Cleveland
0427, 6 PM - Was hoping to find a bar with the Sox game on ESPN, but it turns out we have to get up at about 4:45 tomorrow/Friday morning to take a four-hour train from Cuzco to Machu Picchu. So it´ll be an early night.
0426, 7 PM: We are in Cuzco tonight and Thursday. Maybe we´ll find a bar with ESPN for tomorrow nights game.
Nice to see Manny come through last night, after Schilling was left in for the seventh. I was following along for the 7th via Gameday and it seemed like a mistake even before the game-tying hits. 133 pitches -- WTF? ... Tonight: Go Timmy!
0425, 9:30 AM - We have landed safely in Peru. I thought the country was in the eastern time zone, but apparently it is one hour west/earlier. And you know what time that is, right?
One must never forget that Roger is, at his core, an ass-hole. Thus he is drawn to the Yankees like the swallows are drawn to Capistrano. He can't help it.
This is a guy who demanded that the Sox make him the highest paid pitcher in the game after pitching .500 ball for four years, who said he would only leave Boston to be closer to his family in Texas and then signed with Toronto; who "retired," accepted expensive gifts and standing ovations, and then unretired by the beginning of the next season. Class act all the way.
Terry surprised me: I was thinking that if I was managing I'd put Wily Mo in cneter to get the offense going, and he actually tried it: gutsy, given WMP's misadventures in Fenway. So now Loretta and Youk stop hitting. | 2024-05-18T01:26:18.401715 | https://example.com/article/8640 |
Q:
Systemic sensory confusion?
Sometimes when a person gets touched on one part of the body they feel it else where and may think it came from a different part of the body. What causes this? Other examples are similar to why you can trick your self into thinking your arms are heavier than they really are. another would be that you can close your eyes and move in circles up and down your arm slowly and then when you guess where u are touching your hand is higher or lower than expected. What causes these things?
A:
The situations you describe involve what is called proprioception or the feedback to the brain of where your arms and limbs are in space. As APengioun mentioned, this is a complicated undertaking and if information is restricted, for example eyes are closed then the sense of where your limbs are gets messed up. As for your title, it's not really neuronal confusion as it is confusion of the sensory system if you can call it that. This includes sensory neurons from your limbs as well as central neurons in the brain that further process your information.
| 2024-03-02T01:26:18.401715 | https://example.com/article/4447 |
I consider myself a feminist, which means (to me at least) I support the elimination of barriers to access for all people, regardless of their gender. But in spite of that, the equality that follows such efforts comes with its own consequences for the culture, and sometimes even for the woman herself.
My wife, Amy, pastors a prominent church in downtown Portland. She has office hours, late-night meetings and weekend commitments that keep her away from home quite a bit, sometimes more often than she’d prefer. I work most days from home as a writer, which means I have greater flexibility in my schedule to take the kids, pick them up, and sometimes make dinner or even put the little guys to bed. It’s not often that Amy gets home after both kids are asleep, but it happens. And when it does, I see the pain on her face.
ADVERTISEMENT Thanks for watching! Visit Website
Zoe, our four-year-old, had a dad’s night at her preschool this past week, at which they presented us with the requisite finger paintings and other artifacts of her classroom time. But my favorite thing was a letter that she dictated to her teacher for me. The very first sentence in the letter was as follows:
“My dad loves taking me to school every morning.”
She’s right; I do. And I know sometimes Amy gets jealous when she has to kiss the kids on the head and dash out the door for an early meeting. Again, this is not a day-in, day-out thing, but it seems that when it happens, she struggles with it more than when I used to do it. For the first ten years or so of our marriage, I was the office job guy, affording her the opportunity to go to graduate school, stay home with our newborns and eventually, start a new church in our home. But I do think that, because in our culture it’s still often “expected” than men will be the primary providers, there was less of a cultural bias for me to overcome in leaving the kids.
ADVERTISEMENT Thanks for watching! Visit Website
ADVERTISEMENT Thanks for watching! Visit Website
Amy has told me that, although she has found her place in the professional world, she experiences an implicit (and sometimes even explicit) expectation from those around her to be both a full-time professional and an ever-present mom. So in a way, hers has been a process of addition rather than adjustment or reallocation. And lest anyone thinks this is an isolated experience, I heard a woman in NPR being interviewed about this very thing some time back, so it must be true!
Overall, as women enter the full-time workplace in growing numbers, they’re experiencing more of the same side effects that men “enjoy” from overwork and
related stress, including increased hypertension, heart disease and other risk factors related to eating on the run and missing out on exercise. Yes, there are exceptions to every rule, but research is finding that, as women gain opportunities once enjoyed predominantly by men, they’re also suffering from the effects those opportunities can have too.
For a more stark example, the United States military lifted the restriction this week that barred women from holding combat positions. Though this is a win for gender parity, the implications of what this means for those women who put their lives at greater risk is sobering.
There’s plenty of friction among women discussing the issue as well. Theologian and author Phyllis Tickle talks publicly about turning points that have affected family dynamics and, secondarily, church community, such as access to birth control and workplace parity. Her point – or at least one of them – seems to be that when children don’t come home to a parent after school or take the time to gather intentionally around a table for a meal, the family identity suffers. Others, such as author and blogger Julie Clawson, push back on this notion, suggesting that unfair blame is being cast in women’s direction, and that such claims draw a false correlation.
Some suggest that such trends mean we’re headed down a dangerous path, and they use this as their basis for calling for what they call a return to “traditional family values.” Others place the blame on unrealistic expectations for working mothers to be superhuman, a social burden that is not equally shared by men in a similar position. Others point a finger at our economic system, blaming the need for families to depend on two full-time incomes in many cases to subsist in the American middle class. Still others argue that these trends are largely a confabulation, manufactured by a society wrestling with gender roles, norms and a sense of ground shifting beneath their feet.
I told Amy over dinner a few nights ago (we made it together) that I predicted we will see a shift back toward what some would call more traditional gender roles in our children’s adulthood. Without such barriers to access, there is likely to be more fluidity in more of a back-and-forth dynamic, as people search for the kind of balance of multiple roles they feel fit best for them and their loved ones. As for me, I can handle the “pastor’s wife” jokes and the “mister mom” pokes, especially when the payoff is a letter like the one I got from Zoe. There may come a day when the writing well runs dry and I find myself back in a corporate office. But for now, I consider myself to be a part of a sort of frontier of our own for male identity.
It turns out that the elimination of gender barriers goes both ways. So far, I feel pretty fortunate to benefit from less traditional family values.
undefined | 2023-08-05T01:26:18.401715 | https://example.com/article/1217 |
Q:
How can I soften old film before putting it on a developing reel?
Is there a good way to soften old tightly curled film before trying to put it on a developing reel? I just destroyed an exposed cassette of 110 film. It was so curled that it kept jumping out of the track on my reel and I tried so many times the film finally broken in several spots.
In particular this was Fuji Color C-41 200 ISO 110 film. (I have several more rolls I plan on shooting and I'd prefer to develop at home.)
A:
Most roll film is constructed using CTA (Cellulous Triacetate) which has little curl memory. Some films are constructed using PET (polyester). PET has strong curl memory however it is difficult to initiate a tear with PET. This makes it ideal for high speed machine developing and automated printing as these machine handle hundreds of films splice together under tension. High speed photofinishing was the idea behind 126, 110 and the Advanced Photo System (APS).
Your best bet is to send the films off for process by a lab that handles theses films with a continuous film process.
If this is not practical, try soaking the film in a distilled water bath. Dry the film by hanging with a weight. All this must be done in total darkness. That will not be easy. If this fails to take out the curl, add a few drops of glycerin to the water bath.
Best of luck!
| 2024-03-20T01:26:18.401715 | https://example.com/article/1694 |
This is an archived article and the information in the article may be outdated. Please look at the time stamp on the story to see when it was last updated.
Please enable Javascript to watch this video
BUFFALO, Iowa -- An eastern Iowa police chief faces a long recovery after being hit by a stolen garbage truck.
On Monday Buffalo Police Chief T.J. Behning was trying to lay down stop sticks to stop a suspect driving a stolen garbage truck when the man allegedly rammed into Behning's squad car. Behning was knocked down by the car which was then pushed over him, according to a fellow officer who viewed the video captured by Behning's body camera.
Behning's wife says he suffered serious injuries to both of his legs. He'll require multiple surgeries and skin grafts. Right now doctors tell her they are most worried about infection.
Counselors have been brought in to the local elementary school to talk to the kids about the crash. Behning was well known to the kids. School officials say some viewed him as a father figure in their life.
20-year-old Logan Shoemaker is charged with Attempted Murder, Serious Injury by Vehicle, Theft, Robbery and Eluding. | 2024-06-11T01:26:18.401715 | https://example.com/article/3548 |
Effect of protein starvation on protein turnover in liver, oviduct and whole body of laying hens.
1. Whole body protein turnover rates in White Leghorn laying hens were reduced by protein starvation for 7 days, followed by complete restoration by protein repletion for 7 days. 2. Protein starvation considerably reduced fractional and absolute rates of protein synthesis both in the liver and, to a greater extent, in the oviduct. 3. It was suggested that a considerable portion of the reduced whole body protein synthesis could be accounted for by the reduced protein synthesis in these organs when laying hens were subjected to protein starvation. | 2023-11-28T01:26:18.401715 | https://example.com/article/2929 |
Bovine glycomacropeptide has intestinal antiinflammatory effects in rats with dextran sulfate-induced colitis.
Milk κ-casein-derived bovine glycomacropeptide (GMP) has immunomodulatory and bacterial toxin-binding effects, and it has been shown to exert intestinal antiinflammatory activity in the trinitrobenzenesulfonic acid-induced model of colitis. However, its mechanism of action is not well characterized, and it is not known whether GMP is effective in other experimental models. The intestinal antiinflammatory activity of GMP was assessed in the dextran sulfate sodium (DSS)-induced model of rat colitis. DSS was applied at a starting concentration of 5% (wt:v) in drinking water and adjusted when the disease activity index (DAI) increased substantially for 10 d. There were 3 experimental groups: control (no inflammation), DSS, and GMP (GMP-treated rats with DSS-induced colitis). GMP pretreatment (500 mg · kg(-1) · d(-1), starting 2 d before DSS treatment) reduced the DAI by 60% and lowered the colonic damage score by 44% (P < 0.05). GMP fully normalized the colonic expression of interleukin (IL) 1β, IL17, IL23, IL6, transforming growth factor β, IL10, and Foxp3 as assessed by quantitative RT-PCR. The production of interferon-γ by mesenteric lymph node cells ex vivo was also normalized by GMP treatment. In contrast, GMP did not change colonic thickening, myeloperoxidase, cyclooxygenase 2, or alkaline phosphatase. Histology analysis showed better preservation of the epithelium and attenuated infiltration and submucosal thickening in rats treated with GMP. We conclude that GMP exerts intestinal antiinflammatory activity in this model, which may be primarily related to actions on Th1 and Th17 lymphocytes and perhaps macrophages. | 2023-09-22T01:26:18.401715 | https://example.com/article/2726 |
Q:
How to animate a webpage (HTML/JS) without losing scalability?
I'm trying to make my webpage more interactive by making a small town-like map, with different buildings that are clickable and lead to different pages on my site, but I'm having a lot of difficulty animating the webpage with just HTML/JS and also making it stay the same even after resizing the window.
This is my test site right now, for clarity: https://people.ucsc.edu/~anlin/test#
(I am currently just switching between a png of the map and a gif of the buildings moving when the mouse is hovering)
How can I accomplish this, and should I be using something other than plain html/js to do this?
Thanks!
A:
You can use an <svg> , which is a "scalable vector graphic"
Here is almost an exact example of what you described
https://codepen.io/dudleystorey/pen/ltpmv
| 2024-07-17T01:26:18.401715 | https://example.com/article/1335 |
Q:
How to click dynamically added div with jQuery?
I have empty div that appends another div with jQuery function:
<div id="files_wrapper"> //comes on start
<div id="delete">delete</div> //will be dynamically created
</div>
I want event on a click:
$(document).ready(function() {
$("#delete").click(function(){
console.log("delete");
});
}
But nothing happens on a click. How to make it work?
A:
I found the answer:
$(document).on('click', '#delete', function() {
console.log("delete");
});
| 2024-05-08T01:26:18.401715 | https://example.com/article/6148 |
MEET THE HOSTS
BUCK REISING
Cowboy boot-wearing Arab with an identity crisis. Often mistaken for that caveman Andrew Luck. Extremely judgmental of SEC fans, public displays of affection and people who put clothes on dogs. In an abusive relationship with Indiana Men’s Basketball. Julian Council is the bane of my existence.
JULIAN COUNCIL
Born and raised in Charlotte, North Carolina. “Suffering Charlotte sports fan” which doesn’t exist. Elon University alum which is also the site of Tech U from He Got Game. Big time UNC fan, parents went there. Don’t @ me on twitter. Fried pickle connoisseur. Love the blue ridge mountains. | 2024-02-15T01:26:18.401715 | https://example.com/article/3019 |
EA Sued Over Stolen Madden 06 Features
Share.
By Andrew Burnes
Reuters reports that EA is being sued by an independent developer over supposedly stolen features found in Madden NFL 06:
In his lawsuit filed November 28 with the California Superior Court in San Mateo County, Virtual Jam owner Pernell Harris said he met with EA in late 2003 to discuss "Heart of a Champion," a football game he was developing in which players guide an athlete from high school to professional football.
Among other things, players pick the athlete's parents and handle all kinds of daily experiences from sports practice to school homework.
Harris said features from that game appeared in "Madden NFL 2006" when it was released earlier this year. He accused EA of breaching an "implied in fact contract" when it used those features without compensating him and said EA had violated a confidentiality agreement.
Pernell Harris, you will be squashed like a bug by EA's army of lawyers, no matter how valid your claims. | 2023-08-10T01:26:18.401715 | https://example.com/article/5748 |
//
// UITextDragging.h
// UIKit
//
// Copyright © 2017 Apple Inc. All rights reserved.
//
#import <Foundation/Foundation.h>
#import <UIKit/UIDragInteraction.h>
#import <UIKit/UITextInput.h>
NS_ASSUME_NONNULL_BEGIN
typedef NS_OPTIONS(NSInteger, UITextDragOptions) {
UITextDragOptionsNone = 0,
/* By default, previews generated by the system will retain
* the foreground and background text colors.
* Activating this option causes those colors to be stripped away,
* resulting in a text preview with black text on a clear background.
* This affects only the preview, not the contents of the drag.
* Any embedded images in the preview will remain as they are.
*/
UITextDragOptionStripTextColorFromPreviews = (1 << 0)
} API_AVAILABLE(ios(11.0)) API_UNAVAILABLE(watchos, tvos);
@protocol UITextDragDelegate;
/* Defines a text draggable control.
*/
API_AVAILABLE(ios(11.0)) API_UNAVAILABLE(watchos, tvos)
@protocol UITextDraggable <UITextInput>
@property (nonatomic, weak, nullable) id<UITextDragDelegate> textDragDelegate;
/* The text drag interaction that UIKit installs on the text control.
* Use this to explicitly disable drag interactions on system text controls,
* if desired.
*/
@property (nonatomic, readonly, nullable) UIDragInteraction *textDragInteraction;
/* Returns whether this control currently has at least one active drag session.
*/
@property (nonatomic, readonly, getter=isTextDragActive) BOOL textDragActive;
@property (nonatomic) UITextDragOptions textDragOptions;
@end
@class UIDragItem, UITargetedDragPreview;
@protocol UIDragSession, UITextDragRequest;
API_AVAILABLE(ios(11.0)) API_UNAVAILABLE(watchos, tvos)
@protocol UITextDragDelegate <NSObject>
@optional
/* Implement this to provide custom drag items when dragging out of a text control.
* If you return an empty array here, no drag will occur.
* The drag request provides the text range from which the user is dragging, and
* a set of default drag items which would be used if this delegate method were
* not implemented. You can modify and/or augment these at will.
*
* Note: this method might be called more than once. For instance, if the control
* is asked to provide more items to add to an existing session.
* You can detect this by checking the `existingItems` in the drag request.
*/
- (NSArray<UIDragItem *> *)textDraggableView:(UIView<UITextDraggable> *)textDraggableView itemsForDrag:(id<UITextDragRequest>)dragRequest;
/* Provide a preview for lifting the item out of the text control.
* If you return nil, the drag interaction will provide a default preview.
*
* Note: This will not be called for items obtained from a UITextDragRequest’s suggestedItems
* (via textDraggableView:itemsForDrag:).
* The text control will use its own previews for those items.
*/
- (nullable UITargetedDragPreview *)textDraggableView:(UIView<UITextDraggable> *)textDraggableView dragPreviewForLiftingItem:(UIDragItem *)item session:(id<UIDragSession>)session;
/* Called when the lift animation is about to start.
* Use the animator to animate your own changes alongside the system animation,
* or to be called when the lift animation completes.
*/
- (void)textDraggableView:(UIView<UITextDraggable> *)textDraggableView willAnimateLiftWithAnimator:(id<UIDragAnimating>)animator session:(id<UIDragSession>)session;
/* Called when the user actually begins dragging.
* At that point, the text has lifted out of the text control.
* `textDraggableView:dragSessionDidEnd:withOperation:` will be called when the drag ends.
*/
- (void)textDraggableView:(UIView<UITextDraggable> *)textDraggableView dragSessionWillBegin:(id<UIDragSession>)session;
/* Called when a drag out of this text control has ended.
* The operation tells you what happened on the drop side.
*/
- (void)textDraggableView:(UIView<UITextDraggable> *)textDraggableView dragSessionDidEnd:(id<UIDragSession>)session withOperation:(UIDropOperation)operation;
@end
API_AVAILABLE(ios(11.0)) API_UNAVAILABLE(watchos, tvos)
@protocol UITextDragRequest <NSObject>
@required
/* The text range being dragged.
*/
@property (nonatomic, readonly) UITextRange *dragRange;
/* The suggested items that the text control would return,
* if the responsible delegate method were not implemented.
* This is populated lazily, so only use it when you need it.
*/
@property (nonatomic, readonly) NSArray<UIDragItem *> *suggestedItems;
/* The existing items in the session.
* Will be filled when we request new items.
*/
@property (nonatomic, readonly) NSArray<UIDragItem *> *existingItems;
/* Indicates whether the drag context contains a selection.
* Use this to disable dragging from an attachment or links
* without them being selected. (In those cases, `selected` will be false.)
* For regular dragged text, this will always be true.
*/
@property (nonatomic, readonly, getter=isSelected) BOOL selected;
/* The current drag session.
*/
@property (nonatomic, readonly) id<UIDragSession> dragSession;
@end
NS_ASSUME_NONNULL_END
| 2023-08-08T01:26:18.401715 | https://example.com/article/2910 |
The baby has a disease called harlequin ichthyosis, which causes widespread and persistent thick, dry, “fish-scale” skin
A BABY girl has been born prematurely with an extremely rare, incurable condition that causes her skin to grow seven times faster than usual.
A 28-year-old woman, who wishes to remain anonymous, gave birth to the youngster at a government-run hospital in Patna district of Bihar, in eastern India over the weekend.
Caters News Agency 2 A baby girl has been born with a condition called harlequin ichthyosis, which causes skin to grow seven times faster than usual
The baby has a disease called harlequin ichthyosis, which causes widespread and persistent thick, dry, “fish-scale” skin.
The parents, who are said to have been traumatised by the birth, reportedly called the child “a curse” and refused to accept her.
They took the child home, but the mother reportedly doesn’t want to hold or feed her.
“I have no idea how this happened. Me and family are completely devastated,” she said.
Caters News Agency 2 The parents of the little girl are reportedly refusing to hold or feed her
“I am in shock as I was really looking forward to becoming a mother of a healthy child, be it a girl or a boy.”
Within hours of the news of the girl’s birth broke, scores of locals flocked to the hospital to have a glimpse of her.
Doctors were forced to intervene to remove the number of people gathered outside the hospital to see the baby.
Local media have reported that girl was born at 32 weeks, instead of 36 weeks.
What is harlequin ichthyosis? Ichthyosis is a condition that causes widespread and persistent thick, dry, “fish-scale” skin.
There are at least 20 different types of ichthyosis. Some types are inherited at birth and other types are acquired during adulthood.
There’s no cure for ichthyosis, but a daily skincare routine usually keeps the symptoms mild and manageable.
Most people with ichthyosis have inherited a particular faulty gene from their parent. The signs and symptoms of inherited ichthyosis appear at birth or within the first year of life.
The faulty gene affects the rate at which the skin regenerates – either the shedding of old skin cells is too slow, or the skin cells reproduce at a much faster rate than they can shed old skin. Either way, this causes a build-up of rough, scaly skin
Ichthyosis vulgaris is the most common type of inherited ichthyosis, affecting 1 in 250-1,000 people.
Harlequin ichthyosis is extremely rare, but the scaling is severe and requires intensive care at birth.
There’s no cure for ichthyosis, but moisturising and exfoliating the skin daily can help prevent dryness, scaling and the build-up of skin cells.
People with severe ichthyosis may need to spend several hours a day caring for their skin.
People with mild ichthyosis have a normal lifespan. However, the most severe inherited types can be life threatening. Source: NHS Choices
The Times Of India also states that the child was delivered naturally at 6am on Saturday.
“There was no problem during the delivery of the baby. The baby, who weighed around 2.50kg, even cried after her birth,” Dr Chaudhary, who was involved with the labour, said.
“We sent a child specialist to her home on Sunday and he reported that she was drinking milk. However, we have referred her to Patna Medical College and Hospital.”
Doctors believe the girl won’t survive for long as none of her organs have developed properly.
The probability of survival of such cases is only one in ten million.
The rare genetic condition called harlequin ichthyosis causes thickening of the skin and facial deformities.
A doctor said this is probably just the second reported case of harlequin ichthyosis in India.
The first case in the country was reported in June last year when a woman gave birth to a child with harlequin ichthyosis at Lata Mangeshkar College and Hospital in Nagpur.
The baby survived for just 48 hours.
“Such infants are prone to various infections because skin is not there to protect them,” said Dr A A Hai of Patna, adding that survival has also been reported in certain cases. | 2023-10-25T01:26:18.401715 | https://example.com/article/3373 |
---
abstract: 'We present a Fokker-Planck description of supercooled colloidal systems exhibiting slow relaxation dynamics. By assuming the existence of a local quasi-equilibrium state during the relaxation of the system, we derive a non-Markovian Fokker-Planck equation for the non-stationary conditional probability. ****A generalized Stokes-Einstein relation ****containing ****the temperature of the system at local quasi-equilibrium instead of the temperature of the bath ****is obtained. ****Our results explain experiments showing that the diffusion coefficient is not proportional to the inverse of the effective viscosity at frequencies related to the diffusion time scale. ****'
author:
- 'J. M. Rubí, I. Santamaría-Holek and A. Pérez-Madrid'
title: 'SLOW DYNAMICS AND LOCAL QUASI-EQUILIBRIUM. RELAXATION IN SUPERCOOLED COLLOIDAL SYSTEMS'
---
Introduction
============
The dynamics of slow relaxation systems exhibits peculiar characteristics which make it essentially different from the dynamics of systems relaxing in much shorter time scales [@angell]-[@nowak]. The aging behaviour of the correlation functions [@struick6] and the violation of the fluctuation-dissipation theorem [@kurchan] and of the Stokes-Einstein relation [@bonn6] are among those significant features which have attracted the interest of many researchers in the last few years. Relaxation phenomena in glasses, polymers, colloids and granular matter provide innumerable situations demanding new theoretical ****developments whose implementation constitutes ****a challenge for nonequilibrium statistical mechanics theories. ****
The origin of that peculiar behaviour lies in the fact that during its evolution, the system rests permanently away from equilibrium. This feature would justify why results obtained when ****the system is close to equilibrium are not necessary valid when that condition is not fulfilled. ****A simple example illustrating this point is supplied from the slow dynamics of a two-level system. During the transition, the system does not thermally equilibrate with the bath and as a consequence equipartition law is not valid. It was shown in [@origin6] that coarsening the level of description of the path that the system follows in the configuration space going from diffusion to activation regimes leads to violation of the fluctuation-dissipation theorem. The fast decay of the diffusion modes makes the system always close to equilibrium whereas the activation process occurring at longer time scales does not guarantee validity of the theorem.
In this paper we will present an example illustrating the peculiar dynamics of slow relaxation systems. Using a Fokker-Planck description we derive a generalized Stokes-Einstein relation for supercooled colloidal liquids showing that diffusion coefficient and inverse of viscosity are not proportional to each other at low frequencies, when the system becomes activated. At higher frequencies, the particles undergo diffusion in the solvent and that relation holds.
The paper will be distributed as follows. In Section **II**, we will briefly review the generalization of the Onsager fluctuation theory to nonequilibrium *aging* states. Section **III** will be devoted to the formulation of a mean field theory describing the dynamics of high concentrated suspensions. This theory will be used in Section **IV** to interpret experimental results supporting the violation of the Stokes-Einstein relation in supercooled colloidal liquids. In the conclusions section we will summarize our main results.
Slow relaxation dynamics and local quasi-equilibrium
====================================================
When the relaxation of a system is slow enough, its evolution takes place through a sequence of states characterized by a set of thermodynamical quantities ****in which the intensive parameters are, in general, different from those of the bath. ****It is then said that the system is at quasi-equilibrium.
A statistical mechanics description of those systems involves the non-stationary conditional probability density $ P(\underline{\alpha }_{0},t_{0}|\underline{\alpha },t) $, with $ \underline{\alpha }=(\alpha _{1},...,\alpha _{n}) $ representing the state vector of the system, and $ \underline{\alpha }_{0} $ the initial state at time $ t_{0} $. The local quasi-equilibrium states are characterized by the probability density $ P_{qe}(\underline{\alpha },t) $ satisfying
$$\label{limit P}
\lim _{t\rightarrow \infty }P(\underline{\alpha }_{0},t_{0}|\underline{\alpha },t)=P_{qe}(\underline{\alpha },t).$$
When relaxation takes place in a short time scale, $ P_{qe}(\underline{\alpha },t) $ reduces to the local equilibrium probability density in which the intensive parameters are those of the bath.
The evolution of the conditional probability density is governed by a Fokker-Planck equation. To obtain it, we will first formulate the continuity equation $$\label{continuidad alfa}
\frac{\partial }{\partial t}P(\underline{\alpha }_{0},t_{0}|\underline{\alpha },t)=-\frac{\partial }{\partial \underline{\alpha }}\cdot \left[ P(\underline{\alpha }_{0},t_{0}|\underline{\alpha },t)\underline{v}_{\underline{\alpha }}(\underline{\alpha }_{0},\underline{\alpha };t_{0},t)\right] ,$$ in which $ P\underline{v}_{\underline{\alpha }} $ represents the phase space probability current with $ \underline{v}_{\underline{\alpha }} $ the stream velocity in $ \underline{\alpha } $-space. That velocity can be obtained from a mesoscopic version of the nonequilibrium thermodynamics for slow relaxation systems we have proposed [@Slow6].
The existence of a local quasi-equilibrium state in $ \underline{\alpha } $-space ****enables one to formulate the Gibbs equation $$\label{Gibbs ec}
T(t)\delta s_{qe}(t)=\delta e_{qe}(t)-\int \mu _{qe}(t)\delta P(t)d\underline{\alpha },$$ where $ s_{qe}(t) $ is the entropy and $ e_{qe}(t) $ the mean internal energy per unit mass ****at quasi-equilibrium ****. We will assume that the temperature $ T(t) $ ****of the system at local quasi-equilibrium is only a function of time whereas the chemical potential $ \mu _{qe}(t) $ can be a function of $ \underline{\alpha } $. ****
The entropy of the system can be expressed in terms of the probability density by means of the Gibbs entropy postulate [@kampenSuper] in the form
$$\label{p. gibbs}
s(t)=-\frac{k}{m}\int P(t_{0}|t)\ln \frac{P(t_{0}|t)}{P_{qe}(t)}d\underline{\alpha }+s_{qe}(t),$$
where $ k $ is the Boltzmann constant and $ m $ the molecular mass.
The form of the current $ P\underline{v}_{\underline{\alpha }} $ ****can be inferred ****from the entropy production by relating it, as done in nonequilibrium thermodynamics [@degroot6], with the corresponding thermodynamic force. The entropy production is obtained by combining the rate of change of $ s_{qe}(t) $ obtained from Eq. (\[Gibbs ec\]) with the time derivative of Eq. (\[p. gibbs\]). After using Eq. (\[continuidad alfa\]) and integrating by parts assuming that **$ P(t_{0}|t)\underline{v}_{\underline{\alpha }}(t_{0},t) $** vanishes at the boundary, one may identify the non-equilibrium chemical potential ****$ \mu (t_{0};t)=\mu _{qe}(t)+\frac{kT(t)}{m} \ln \frac{P(t_{0}|t)}{P_{qe}(t)} $ and the corresponding thermodynamic force $ \frac{\partial \mu (t)}{\partial \underline{\alpha }} $, which is conjugated to the probability current $ P\underline{v}_{\underline{\alpha }} $. Following the scheme of nonequilibrium thermodynamics one simply obtains
$$\label{stream vel}
\underline{v}_{\underline{\alpha }}(t_{0};t)=-\underline{\underline{B}}(t_{0};t)\cdot \left[ \underline{X}(\underline{\alpha },t)+\frac{kT(t)}{m}\frac{\partial }{\partial \underline{\alpha }}\ln P(t_{0}|t)\right] ,$$
where we have defined the generalized force [@degroot6]
$$\label{X force}
\underline{X}(\underline{\alpha },t)\equiv -\frac{\partial }{\partial \underline{\alpha }}\left[ \frac{kT(t)}{m}\ln P_{qe}(t)\right] .$$
The time dependent transport coefficients $ \underline{\underline{B}}(t_{0};t) $ (related to the Onsager coefficients) incorporate memory effects through its dependence on time [@Fp-nonmarkovian6], [@oliveiraEURO], and the local quasi-equilibrium probability density is given by
**$$\label{Pqe gral coll}
P_{qe}(t)=P_{e}e^{\frac{m}{k\, T(t)}[\mu _{qe}-e_{qe}]},$$** where $ P_{e} $ is the equilibrium distribution function. Eq. (\[Pqe gral coll\]) can be obtained by using the statistical definition of the entropy in the Gibbs equation (\[Gibbs ec\]), [@Slow6]. Now, by substituting Eq. (\[stream vel\]) into (\[continuidad alfa\]) the resulting Fokker-Planck equation is
$$\label{FP gral colloid}
\frac{\partial P(t_{0}|t)}{\partial t}=\frac{\partial }{\partial \underline{\alpha }}\cdot \underline{\underline{B}}(t_{0};t)\cdot \left[ \underline{X}(\underline{\alpha },t)P(t_{0}|t)+\frac{kT(t)}{m}\frac{\partial P(t_{0}|t)}{\partial \underline{\alpha }}\right] ,$$
Using the Fokker-Planck equation (\[FP gral colloid\]), we can calculate the evolution equation for the equal-time correlation function of $ \underline{\alpha } $-variables which for sufficiently long times leads to the following expression for the temperature of the system
$$\label{T(t)}
T(t)\equiv \frac{m}{k}\left\langle \underline{X}(t)\cdot \underline{\alpha }(t)\right\rangle _{qe},$$
with $ \left\langle ...\right\rangle _{qe} $ denoting ****average at local quasi-equilibrium. This result reduces to the one corresponding to fast relaxation processes [@degroot-pp88] in which the average is performed at local equilibrium.
In Ref. [@Slow6], we have shown that the temperatures of the system and of the bath $ T_{B}(t) $ are related by $ T(t)=AT_{B}(t) $, expressing lack of thermal equilibration. Equilibrium is reached when $ A=1 $ in which case, for linear thermodynamic forces, one recovers the expression for equipartition law. The presence of $ T(t) $ in the last term of Eq. (\[FP gral colloid\]), gives rise to a modified version of the fluctuation-dissipation theorem.
Fokker-Planck description of concentrated colloidal suspensions
===============================================================
In this section, we will study diffusion in concentrated colloidal suspensions by means of an effective medium approach elaborated on the grounds of the theory we have introduced in the previous section. We will analyze the motion of a test colloidal particle through the suspension by using the Fokker-Planck equation describing the evolution of the two-time probability density $ P(\underline{\alpha }_{0},t_{0}|\underline{\alpha },t) $. In this case, the phase space vector is simply $ \underline{\alpha }=(\vec{u},\vec{r}) $, where $ \vec{u} $ and $ \vec{r} $ represent the velocity and position of the **test** particle.
To derive the Fokker-Planck equation, we will first formulate the Gibbs equation
$$\label{Gibbs colloids}
T\rho \delta s=\rho \delta e-\rho ^{-1}p\delta \rho -m\int \mu \delta Pd\vec{u},$$
which incorporates the effects of interactions among particles through the term containing the excess of osmotic pressure $ p $. Here $ e $ is the internal energy, $ m $ the mass of the particle and $ \rho =m\int Pd\vec{u} $ the mass density. In this case, the quasi-equilibrium probability density is given by [@Slow6]
$$\label{funcion equilibrio local}
P_{qe}=e^{\frac{m}{2kT}\left[ \mu _{qe}-\frac{1}{2}u^{2}-\rho ^{-1}p\right] }.$$
Here, the interaction of the test particle with the other colloidal particles is represented by means of the term $ \rho ^{-1}p $ which can be expressed in terms of a virial expansion in $ \rho $, whereas ****$ \mu _{qe} $ constitutes the ideal chemical potential. Introducing the fugacity $ z=P\, a $, with the activity coefficient given by $ a\equiv e^{\frac{m}{kT}\rho ^{-1}p} $, Eq. (\[p. gibbs\]) can be expressed as
$$\label{post Gibbs fugacity}
s=-\frac{k_{B}}{\rho }\int P\, \ln \frac{z}{z_{qe}}d\vec{u}+s_{qe},$$
where $ z_{qe}=e^{\frac{m}{kT}[\mu _{qe}-\frac{1}{2}u^{2}]} $ is the fugacity at quasi-equilibrium. Notice that in the limit of infinite dilution $ \rho ^{-1}p\cong 0 $, thus implying $ a=1 $, which corresponds to the ideal case. ****
The existence of interactions among the test and the other colloidal particles, gives rise to a force term in the continuity equation for $ P $. In particular, according to Eq. (\[funcion equilibrio local\]), the force entering into this term is given by **$ -\nabla (\rho ^{-1}p) $** (see for example Ref. [@mayorgas]). Now, by taking into account the definition of the activity coefficient $ a $, the continuity equation for $ P $ becomes ****
$$\label{continuidadch6}
\frac{\partial P}{\partial t}+\nabla \cdot P\vec{u}-\nabla \left[ \frac{kT(t)}{m}\ln a\right] \cdot \frac{\partial P}{\partial \vec{u}}=-\frac{\partial }{\partial \vec{u}}\cdot P\vec{v}_{\vec{u}},$$
where $ P\vec{v}_{\vec{u}} $ is the probability current, with $ \vec{v}_{\vec{u}} $ the stream velocity in $ \vec{u} $-space.
In accordance with the general formalism of nonequilibrium thermodynamics, the expression of the probability current $ P\vec{v}_{\vec{u}} $ can be obtained from the entropy production which only contains dissipative terms and is simply given by
$$\label{sigma colloid}
\sigma =-\frac{m}{T}\int P\vec{v}_{\vec{u}}\cdot \frac{\partial \mu }{\partial \vec{u}}d\vec{u}.$$
Eq. (\[sigma colloid\]) has been obtained by taking the time derivative of Eq. (\[post Gibbs fugacity\]), using Eqs. (\[continuidadch6\]), (\[funcion equilibrio local\]) and (\[Gibbs colloids\]), and the balance equation for the energy $ e(t) $, neglecting viscous dissipation [@degroot6]. In order to obtain Eq. (\[sigma colloid\]), we have also identified the nonequilibrium chemical potential
$$\label{mu colloids 6}
\mu (t_{0};t)=\mu _{qe}(t)+\frac{kT(t)}{m} \ln \frac{z(t_{0};t)}{z_{qe}(t)}.$$
By taking into account the definition (\[X force\]), the resulting generalized Fokker-Planck equation for the two-time probability density is
$$\label{FP-compres}
\frac{\partial P}{\partial t}+\nabla \cdot \vec{u}P-\nabla \left[ \frac{kT(t)}{m}\ln a\right] \cdot \frac{\partial P}{\partial \vec{u}}=\frac{\partial }{\partial \vec{u}}\cdot \beta (t)\left[ \vec{u}P+\frac{kT}{m}\frac{\partial P}{\partial \vec{u}}\right] ,$$
where $ \beta $ characterizes the dissipation of the kinetic energy of the test particle. This coefficient is, in general, function of time, position and ****density; ****its dependence on time ****is a consequence of the non-Markovian nature of the stochastic process [@Fp-nonmarkovian6], ****[@oliveiraEURO], [@tokuyama]. ****
From Eq. (\[FP-compres\]), we will now derive the evolution equation for the velocity field by taking the time derivative of the momentum $ \rho \vec{v}=m\int \vec{u}Pd\vec{u} $ and using Eq. (\[FP-compres\]). After integrating by parts one obtains
$$\label{momentum supercool}
\rho \frac{d\vec{v}}{dt}=-\beta \rho \vec{v}-\frac{kT(t)}{m}\left[ 1+\frac{\partial \ln a}{\partial \ln \rho }\right] \nabla \rho ,$$
where we have used the fact that, in the absence of an externally imposed flow, the second moment $ \! \! \, \, \vec{\vec{\mathrm{P}}}\! \! \, \, =m\int (\vec{u}-\vec{v})(\vec{u}-\vec{v})Pd\vec{u} $ can be approximated by $ \! \! \, \, \vec{\vec{\mathrm{P}}}\! \! \, \, =\frac{kT}{m}\rho \vec{\vec{1}} $, [@nosotrosPRE6].
At times such that $ t\gg \beta ^{-1} $, the particle enters the diffusion regime in which one may neglect the time derivative in Eq. (\[momentum supercool\]), obtaining then the constitutive relation for the mass diffusion current $ \rho \vec{v} $ which substituted into the mass continuity equation $ \frac{\partial \rho }{\partial t}=-\nabla \cdot (\rho \vec{v}) $, yields the Smoluchowski equation
$$\label{Smoluchowski}
\frac{\partial \rho }{\partial t}=\nabla \cdot \left( D\cdot \nabla \rho \right) .$$
From Eq. (\[momentum supercool\]) we may identify the diffusion coefficient
$$\label{Diff coef}
D=\frac{kT(t)}{m\beta }\left[ 1+\frac{\partial \ln a}{\partial \ln \rho }\right] .$$
The form of Eq. (\[Diff coef\]) coincides with the expression given in Ref. [@degroot6]. Notice, however, that it contains the temperature of the system at quasi-equilibrium instead of the temperature of the bath.
The generalized Stokes-Einstein relation in supercooled colloidal systems
-------------------------------------------------------------------------
It has been shown in [@bonn6] that in supercooled colloidal liquids at short frequencies the Stokes-Einstein relation is not fulfilled. Measurements of the viscosity and the diffusion coefficients obtained in Refs. [@mortensen6], [@mason6], indicate the existence of a frequency domain in which those quantities are not proportional (see figure 1). It is our purpose to offer here an explanation for those experimental results.
In [@mortensen6] it was shown that the colloidal system can be ****assumed isotropic and homogeneous at the considered volume fractions, ranging from the freezing to the glass transition values **$ \phi _{g} $**. Consequently, the transport coefficients can be assumed to be independent of the wave vector $ \vec{k} $. We will first introduce ****the ****effective viscosity ****
$$\label{D(w) colloid}
\eta (\omega )=\frac{kT}{6\pi R}D^{-1},$$
****where $ R $ is the radius of the particle.
The dependence of the viscosity on the frequency can be inferred through the expression of the penetration length $ \lambda $ of the diffusive ****modes. ****In the dilute case, $ \lambda $ is given through $ \lambda ^{-1}=\frac{1}{R}\left( \tau \omega \right) ^{\frac{1}{2}} $, with $ \tau =\frac{R^{2}}{6D_{0}} $ the characteristic diffusion time [@boon-yip] and **$ D_{0}=\frac{kT_{B}}{6\pi R\eta _{0}} $** the diffusivity in the pure solvent, ****with $ \eta _{0} $ its viscosity. At higher concentrations, it can be assumed to be
$$\label{lambda concentrated}
\lambda ^{-1}\equiv \frac{1}{\Gamma R}\left( \tau \omega \right) ^{\gamma },$$
where the exponent $ \gamma $ and the scaling function $ \Gamma $ may, in general, depend on the volume fraction. The quantity $ \Gamma R $ can be interpreted as an effective radius. ****
The penetration length gives an estimation for the average size of a cage formed by the surrounding particles [@cohen6]. At high frequencies, the test particle performs a free Brownian motion inside the cage and the viscosity is that of the pure solvent. At short frequencies, collisions of the test particle with the other particles modify the viscosity. ****Thus, we will assume the following expression for the effective viscosity ****
$$\label{eta w lambda}
\eta (\omega )=\eta _{0}\left( 1+R\lambda ^{-1}\right) ,$$
valid up to first order in $ R\lambda ^{-1} $ reflecting the fact that cage diffusion is important when $ R\sim \lambda $, [@cohen-cage]. ****
By taking into account the general relation between system and bath temperatures obtained from our formalism, $ T=AT_{B} $, [@Slow6], ****Eq. (\[D(w) colloid\]) can be written as ****
$$\label{SE super}
D\eta =\frac{kT_{B}}{6\pi R}A,$$
which constitutes a generalization of the Stokes-Einstein relation to systems exhibiting slow relaxation dynamics.
From Eq. (\[T(t)\]) and from its definition, the quantity $ A $ is essentially proportional to the velocity moments of the particle. In particular, when $ \underline{X}(t) $ is a linear function, $ A $ is proportional to the velocity correlation function. It is then plausible to assume the following expansion [@ngai], [@tokuyamaslow] ****
$$\label{A(w)}
A\cong \left[ 1+b\left( \tau \omega \right) ^{\epsilon }\right] ,$$
where $ b $ and the exponent $ \epsilon $ may, in general, be functions of the volume fraction $ \phi $. Comparison of Eq. (\[A(w)\]) with the corresponding relation obtained in [@bonn6] by fitting the experimental data yields $ \ln b\cong \epsilon \left( 40\frac{\phi }{\phi _{g}}-37\right) +2.659 $, and $ \epsilon =-0.77 $.
To contrast the theoretical expression of the effective viscosity (\[eta w lambda\]) ****with the experimental results reported in [@bonn6], we will take the logarithm of Eq. (\[eta w lambda\]) and expand the result in terms of the variable $ \log \tau \omega $, around $ \tau \omega =1 $. Up to first order we obtain
$$\label{log eta short}
\log \eta \cong \log \left[ \eta _{0}\left( 1+\frac{1}{\Gamma }\right) \right] +\frac{\gamma }{1+\Gamma }\log \tau \omega .$$
A direct comparison of Eq. (\[log eta short\]) with the fitting of experimental data given by the expression $ \log \eta \cong c_{0}+s(\phi )\log \tau \omega $, with $ s(\phi )\approx 6.39-13\phi $ and $ c_{0} $ a constant, gives the dependence of $ \gamma $ and $ \Gamma $ on the volume fraction.
The expression of the diffusion coefficient at the frequencies we are considering can now be derived by using Eq. (\[SE super\]). In figure **2**, we represent the diffusion coefficient given through Eq. (\[SE super\]) as a function of the reduced frequency. At higher concentrations ($ \phi =0.56,\, 0.55 $), a closer agreement with the experimental values of $ D $ given in [@bonn6] has been obtained with $ \epsilon =-0.77 $ (solid lines). At lower concentrations ($ \phi =0.53,\, 0.52 $), a closer agreement with experiments has been obtained with $ \epsilon =-0.67 $ (dotted lines). This dependence of the fitting on the value of the exponent $ \epsilon $ suggests that it is also a function of the volume fraction.
Conclusions
===========
In this paper, we have proposed a general formalism to analyze the dynamics of systems which relax in long time scales of the order of the observation time or even longer. The fact that the system always evolves through transient states never reaching equilibration with the bath is the origin of a peculiar behaviour different from that of systems whose propagating modes relax rapidly ending up in a quiescent state. The dynamics is non-Markovian and the correlation functions exhibit aging effects.
We have formulated a generalization of Onsager’s theory to nonequilibrium aging states to derive a Fokker-Planck equation which captures the main characteristics of the dynamics such as non-stationarity through the two-time probability density, non-Markovianity through the time-dependence of the transport coefficients and lack of thermal equilibration between system and bath. ****This equation is the main result of our analysis from which the behaviour of the correlation functions follows.
We have applied the theory to study the relaxation in supercooled colloidal liquids for which violation of the Stokes-Einstein relation at low frequencies has recently been found experimentally. The relation between diffusion coefficient and viscosity we have obtained explains those experiments. The key ingredients in this interpretation are the existence of a quasi-equilibrium state with a temperature different from that of the bath which is proportional to the velocity moments and the fact that the viscosity depends on the penetration length of the diffusion modes resulting from the underlying activated process taking place at sufficiently long times.
The formalism proposed thus offers an interesting theoretical framework for the study of glassy behaviour in colloidal liquids.
Acknowledgments
===============
We want to acknowledge Dr. D. Reguera for valious comments. I.S.H. acknowledges UNAM-DGAPA for economic support. This work was partially supported by DGICYT of the Spanish Government under Grant No. PB2002-01267.
Acknowledgments
===============
[10]{} M. D. Ediger, C. A. Angell and S. R. Nagel, J. Phys. Chem. **100**, 13200 (1996). P. G. Debenedetti and F. H. Stillinger, Nature, **410**, 259 (2001). T. S. Grigera and N. E. Israeloff, Phys. Rev. Lett. **83**, 5038 (1999). F. Sciortino, Nature materials, **1**, 145 (2002). L. Bellon, S. Ciliberto and C. Laroche, Europhys. Lett. **53**, 511 (2001). E. R. Nowak, et al, Phys. Rev. E **57**, 1971 (1998). L.C.E. Struick, *Physical aging in amorphous polymers and other materials*, Elsevier (1978). L. Cugliandolo, J. Kurchan and L. Peliti, Phys. Rev. E **55**, 3898 (1997). D. Bonn and W. K. Kegel, J. Chem. Phys. **118**, 2005 (2003). A. Pérez-Madrid, D. Reguera and J. M. Rubí, Physica A, in press. cond-mat/0210089. I. Santamaría-Holek, A. Pérez-Madrid and J. M. Rubí, cond-mat/0305605. S. R. de Groot and P. Mazur, *Non-equilibrium thermodynamics* (Dover, New York, 1984). N. G. van Kampen, *Stochastic processes in physics and chemistry* (North-Holland, Amsterdam, 1981). I. Santamaría-Holek and J. M. Rubí, Physica A **326**, 384 (2003). I. V. L. Costa, R. Morgado, M. V. B. T. Lima and F. A. Oliveira, Europhys. Lett. **63**, 173 (2003). See Ref. [@degroot6], pp. 88. J. M. Rubí and P. Mazur, Physica A **250**, ****253 (1998)., M. Mayorga, L. Romero-Salazar and J. M. Rubí, Physica A **307,** 297 (2002). I . Santamaría-Holek, D. Reguera and J. M. Rubí, Phys. Rev. E **63,** 051106 (2001). K.G. Wang and M. Tokuyama, Physica A **265,** 341 (1999). W. van Megen, T. E. Mortensen, S. R. Williams and J. Muller, Phys. Rev. E **58**, 6073 (1998). T. G. Mason and D. A. Weitz, Phys. Rev. Lett. **75**, 2770 (1995). J. P. Boon and S. Yip, *Molecular hydrodynamics* (Dover, New York, 1991). R. Verberg, I. M. de Schepper and E. G. D. Cohen, Phys. Rev. E **55**, 3143 (1997). R. Verberg, I. M. de Schepper and E. G. D. Cohen, Phys. Rev. E **61**, 2967 (2000). C. A. Angell, et al, J. Appl. Phys. **88**, 3113 (2000). M. Tokuyama, Phys. Rev. E **62**, R5915 (2000).
| 2024-06-20T01:26:18.401715 | https://example.com/article/2176 |
Antibody response of patients against a 120 kDa surface protein of Campylobacter pylori.
Campylobacter pylori strains were isolated and serum samples were obtained from 63 patients. Immunoblots of 52 patients sera using their own isolates as antigen showed a 120 kDa band, which was missing in the other 11 isolates and the respective sera. This band was not detected in other Campylobacter species. Effects of trypsin treatment of bacteria and absorption of sera by live organisms suggest a C. pylori-specific surface protein. | 2023-12-15T01:26:18.401715 | https://example.com/article/5350 |
Pathology of the liver in familial hemophagocytic lymphohistiocytosis.
Familial hemophagocytic lymphohistiocytosis is a rare, rapidly progressive disorder characterized by an activation of the immune system resulting in a systemic proliferation of lymphocytes and histiocytes. The disease is genetically heterogeneous and maps to at least 4 loci including the gene encoding perforin, a protein critical for the cytotoxic and regulatory functions of T lymphocytes and natural killer (NK) cells. Hepatic dysfunction often occurs early in the clinical course, but the pathology of the liver is not well characterized. The clinical history, laboratory data, and pathologic material (25 hepatic specimens) from 19 children (11 boys, 7 girls, 1 unknown, 12 d to 11 mo of age, median 3 mo) with FHL were reviewed. Routine and immunohistochemical stains were carried out in all cases, and perforin gene sequencing in a subset. Common to all specimens was a portal and sinusoidal infiltrate of CD3, CD8, granzyme B+ lymphocytes admixed with CD68, CD1a- histiocytes that exhibited hemophagocytosis. There was endothelialitis of portal and central veins and lymphocyte-mediated bile duct injury. The degree of portal and sinusoidal lymphohistiocytic infiltrate and endothelialitis varied from mild to marked and correlated with clinical severity. In some specimens, histiocytic cells predominated and in others, there was extensive hepatocellular giant cell transformation. Accordingly, 4 histopathologic patterns were observed: (1) chronic hepatitis-like, (2) leukemia-like, (3) histiocytic storage disorder-like, and (4) neonatal giant cell hepatitis-like. Two siblings homozygous for a 50delT nucleotide deletion had no perforin immunoreactive cells, 1 compound heterozygote for a deletion and missense mutation had cells with markedly diminished perforin expression, and 1 infant hemizygous for a perforin missense mutation had intact expression. Recognizing the morphologic changes in the liver and the immunophenotypic features of the infiltrate are critical for a rapid diagnosis and a prompt institution of treatment. | 2023-12-13T01:26:18.401715 | https://example.com/article/4262 |
Advances in semi-conductor processing and logic design have permitted an increase in the amount of logic that may be present on integrated circuit devices. As a corollary, computer system configurations have evolved from a single or multiple integrated circuits in a system to multiple cores, multiple hardware threads, and multiple logical processors present on individual integrated circuits, as well as other interfaces integrated within such processors. A processor or integrated circuit typically comprises a single physical processor die, where the processor die may include any number of cores, hardware threads, logical processors, interfaces, memory, controller hubs, etc.
As a result of the greater ability to fit more processing power in smaller packages, smaller computing devices have increased in popularity. Smartphones, tablets, ultrathin notebooks, and other user equipment have grown exponentially. However, these smaller devices are reliant on servers both for data storage and complex processing that exceeds the form factor. Consequently, the demand in the high-performance computing market (i.e. server space) has also increased. For instance, in modern servers, there is typically not only a single processor with multiple cores, but also multiple physical processors (also referred to as multiple sockets) to increase the computing power. But as the processing power grows along with the number of devices in a computing system, the communication between sockets and other devices becomes more critical.
Like reference numbers and designations in the various drawings indicate like elements. | 2024-03-23T01:26:18.401715 | https://example.com/article/7309 |
Q:
Referencing [weak self] as self? inside animateWithDuration causes crash
If I declare [weak self] on a closure and reference self as self? inside UIView.animateWithDuration the app will crash:
someFunc() { [weak self] (success) -> Void in
UIView.animateWithDuration(0.25) {
self?.someView.alpha = 1;
}
}
with a message sent to deallocated instance
but if I optionally unwrap self ahead of time it doesn't
someFunc() { [weak self] (success) -> Void in
if let weakself = self {
UIView.animateWithDuration(0.25) {
weakself.someView.alpha = 1;
}
}
}
Why is that, I would think that it doesn't matter which way I reference the weak self since it should "just" optionally unwrap self? correctly. For context this is done in a UICellView which is deallocated when I leave the UICollectionViewController
EDIT: Filed a bug with apple: #23492648
A:
I think the problem here is that self is special. You've passed the reference to self weakly into the anonymous function to prevent a retain cycle, but there isn't really an Optional wrapping self in this story. Thus, the syntactic sugar self?.someView.alpha = 1 — and remember, it is merely syntactic sugar — doesn't work.
It may be that Apple will regard this as a bug; or maybe not. But either way, the solution is to do formulaically exactly what you are doing in the second example: do the weak-strong dance explicitly.
| 2024-02-10T01:26:18.401715 | https://example.com/article/6719 |
'Report of the Committee on Mediumistic Phenomena', by William James (1886): With an introduction by.
Mediumship was a topic of great interest to some nineteenth-century students of mental phenomena. Together with the phenomena of hypnosis and other manifestations, mediumship was seen by many as a dissociative phenomenon. The purpose of this Classic Text is to present an excerpt of an article about the topic that William James (1842-1910) published in 1886 in the Proceedings of the American Society for Psychical Research about American medium Leonora E. Piper (1857-1950). The article, an indication of late nineteenth-century interactions between dissociation studies and psychical research, was the first report of research with Mrs Piper, a widely investigated medium of great importance for the development of mediumship studies. In addition to studying the case as a dissociative experience, James explored the possibility that Piper's mentation contained verifiable information suggestive of 'supernormal' knowledge. Consequently, James provides an example of a topic neglected in historical studies, the ideas of those who combined conventional dissociation studies with psychical research. | 2024-04-08T01:26:18.401715 | https://example.com/article/8304 |
Is it time to rewrite the operating system in Rust? [slides] - masklinn
https://www.slideshare.net/bcantrill/is-it-time-to-rewrite-the-operating-system-in-rust
======
jillesvangurp
I think the question is wrong. People are already writing new operating
systems in Rust just because they can. The question is whether we will end up
using their efforts or whether we keep on going back to the same monolith
kernels we have been using for the last thirty years or so. Whether it is NT,
Linux, or any of the BSD kernels, they each have decades of history behind
them.
These will of course still be around for the foreseeable future (i.e.
decades). At the same time, we are seeing Rust pop up in a lot of places that
used to be the exclusive domain of C. People are already re-implementing
libraries, popular command line tools, etc. A lot of these implementations
have clear merit in the sense that they are faster, safer to use, easier to
scale, maintain, etc.
IMHO it is just a matter of time before vendors start providing e.g. drivers
written in Rust for their hardware. I could see linux evolve to a point where
integrating drivers like that is both possible and common. Once that happens,
it will be a hybrid kernel effectively. Rust is not the only thing moving that
direction; wasm is also going that direction. People are talking about running
that in the kernel. And of course Rust runs on top of that as well. So one
outcome would be a lot of Rust code running in a wasm sandbox on top of legacy
kernels.
~~~
twtw
> wasm is also going that direction
Genuine question: why would WASM in the kernel make any sense at all?
~~~
nicoburns
Security. WASM is sandboxed by design.
~~~
twtw
Many things are "sandboxed by design." Few things are true sandboxes.
I'm very skeptical of the idea of throwing out virtual memory and process
isolation to depend instead only on software sandboxes.
------
tom_mellior
Bit of a mixed bag.
Slide 12:
> Go etc. are garbage collected, making interacting with C either impossible
> or excruciatingly slow.
"Impossible" is, of course, a lie. "Excruciatingly slow" may be the case,
though it depends on the kind of interaction you are looking at. Without any
context, this statement is overly general.
Slide 14 can be taken out of context and misrepresented as showing that "Rust
can be faster than C", although the programs being compared use different data
structures, so it's inconclusive. (It's not clear to me whether the author
wanted to make a broad claim like this. The title suggests so, but again, the
difference in data structures suggests otherwise.)
Slide 16:
> every operating system retains some assembly for reasons of performance
Is this really the case? I would be interested in examples. My impression was
that assembly is needed for hardware interaction for which there are simply no
C constructs available (setting timers, interrupts, system registers, and
whatnot), and possibly highly space-constrained bootloader stuff, but
performance? C compilers are not stupid.
Slide 19:
> in-kernel C tends to be de facto safe
This is a bit of a stretch. I mean, yes, _most_ lines of the Linux kernel have
never been the cause of a CVE. But it's hard to tell which lines are the
critical ones. Properly encapsulating safe/unsafe regions does seem like an
improvement. (My understanding is that Rust's "unsafe" is not properly
encapsulated: You might mess something up that will cause a segfault later on,
in ostensibly "safe" code. Still, it's a step forward.)
~~~
arcticbull
> Slide 12:
IMO the big GC related issue is lack of determinism especially in the
management of external resources. If you need that in a managed language
you're forced into grafting reference counting on top which is particularly
error-prone and unpleasant. Interacting with other languages can be slow, and
bridging uncomfortable.
> Slide 14:
Rust can be faster than C in the general case because of the optimizations
permitted by, among other things, strict aliasing rules. [1] The Rust language
invariants are stronger and therefore the compiler can be more aggressive.
> Slide 16:
IMO you can do all that stuff in C with a combination of volatile pointer I/O
and if necessary compiler intrinsics. I've done a lot of AVR programming and
never dropped down to assembler because something wasn't available in C. I'd
imagine the answer is really neither, just that some people are set in their
ways and view ASM as 'faster' even though in reality LLVM would probably
generate faster code by better taking into account instruction issue and data
dependencies.
> Slide 19:
Unsafe Rust is unsafe because you can't express what you want in safe Rust. To
your point, you can absolutely break things. The implicit contract is when
writing unsafe sections that you are to maintain the invariants of the safe
language at entry and exit of the block.
What makes safe Rust safer than C, though, is all the flagship features. You
can detect data races across threads (and interrupts) statically. You can't
write to and read from data at the same time. You have fully deterministic
dynamic collection of resources. etc.
[1] [https://robert.ocallahan.org/2017/04/rust-optimizations-
that...](https://robert.ocallahan.org/2017/04/rust-optimizations-that-c-cant-
do_5.html)
~~~
jonathanstrange
Any dynamic memory allocation lacks determinism, which is why in high
integrity systems it often forbidden to dynamically allocate memory.
As for Rust can be faster than C, well, people said the same about Ada but it
rarely is the case so I wouldn't hold my breath for Rust either. After all,
those languages use the same backends - GCC in the case of C & Ada, LLVM in
the case of C & Rust. But it's enough to as fast as optimized C and have all
the safety features.
~~~
jcranmer
> After all, those languages use the same backends - GCC in the case of C &
> Ada, LLVM in the case of C & Rust.
The killer flaw of C for performance is the pointer aliasing problem. C only
has the very coarse-grained tools of strict aliasing (often disabled in large
applications because it breaks code!) and restrict (which relies heavily on
manual programmer annotation) to control these aliasing issues. Since Rust has
the rule that you can only have one mutable reference to an object at once
(and read-read aliasing issues don't matter), it can effectively automatically
add in these annotations without relying on programmer annotation.
~~~
arcticbull
I think it's fair to say that "average" Rust code will be faster than
"average" C code due to lack of pointer aliasing issues as the average
developer doesn't care about/understand this enough to make the annotations in
any codebase I've worked in. Can you make both equally fast? I don't see why
not, they're both LLVM.
~~~
setr
Given enough time, effort and smarts, you can probably make any lang as fast
as any other :-)
------
Animats
I'd really like to see an open-source QNX-type microkernel in Rust. Everybody
is re-implementing early Unix in Rust, but that's not a good model. The great
thing about the QNX model is that the tiny kernel barely changes from year to
year, because everything is outside it and not very trusted. So it approaches
being totally debugged.
L4 is too low-level - you have to run another OS on top of it, usually Linux.
QNX offers a POSIX interface.
~~~
telotortium
What is the state of documentation on QNX? Is there sufficient documentation
that it would be possible to write a QNX-compatible kernel from the
documentation (plus access to a QNX machine, which has to be available somehow
outside of industry, right?)?
~~~
Animats
Until Blackberry bought it, it was open source. There were free downloads. Now
it's proprietary. But there's a lot of info out there from the open source
era. The manuals are available.
Here's the original QNX paper.[1]
[1] [https://cseweb.ucsd.edu/~voelker/cse221/papers/qnx-
paper92.p...](https://cseweb.ucsd.edu/~voelker/cse221/papers/qnx-paper92.pdf)
~~~
dman
I am amazed that I cannot find a copy of the source code from the time it was
freely available now.
~~~
Animats
Here's the 2007 press release announcing QNX going open source.[1]
On April 9, 2010, the day the acquisition closed, Research and Motion took the
source code offline, with no notice. All user open source projects on QNX were
abandoned shortly thereafter.[2]
[1]
[http://www.qnx.com/news/pr_2471_1.html](http://www.qnx.com/news/pr_2471_1.html)
[2]
[https://community.qnx.com/sf/sfmain/do/listProjects](https://community.qnx.com/sf/sfmain/do/listProjects)
------
BruceM
It'll be interesting to see how much use Rust gets within Fuchsia atop the
Zircon microkernel.
~~~
steveklabnik
The current state is, a few hundred thousands of lines, and Google hiring more
Rust engineers quite aggressively.
I'm also excited to see how it turns out :)
~~~
agumonkey
Any other high profile company/project using Rust ? (beside mozilla of course)
~~~
steveklabnik
Facebook, Dropbox, cloudflare, fastly, tons of startups you’ve heard of...
------
exabrial
Presentation by the Joyent CTO btw, who hired a lot of the old Sun Solaris
team.
~~~
qaq
Among other things because he is also was part of the old Solaris team?
~~~
exabrial
Hilarious example of why English is a terrible language: I meant for the the
pronoun to refer to Joyent, not [necessarily] the CTO.
~~~
magduf
No, that's an example of someone not knowing the language very well. You
should have written something like, "which is the company that...".
I can't think offhand of any language that's really better here in a sense of
being more efficient, except probably Classical Latin which is horribly
complicated and of course a dead language.
~~~
TomMarius
Czech allows you to specify that with a change of one letter depending on who
you mean (the CTO - který, the company - která) - this depends on different
genders of the two words, but is commonly used.
~~~
magduf
Are they officially calling themselves "Czechia" these days? I saw that on
Google Maps recently, I think. It certainly is shorter and simpler than "Czech
Republic".
~~~
TomMarius
It's the oficial short name (the full name is still Czech Republic), local
people don't like it much but they're coming around. However I wasn't
referring to the country (Czechia/Czech Republic) but to the language (Czech).
------
orbifold
A bit surprising that he doesn't mention any other C++ based kernels such as
[https://github.com/l4ka/pistachio/](https://github.com/l4ka/pistachio/) and
most of the fuchsia code base except for the lk micro kernel. In my opinion
fuchsia points towards where things are going multi-language implementations
(mostly c++) with an interface description language for interfacing
components. From a point of view of postmodern c++, rust has little to no
advantages left. It has a much more mature ecosystem and set of libraries, is
just as fast and can be very safe if used correctly.
~~~
fredmorcos
> From a point of view of postmodern c++, rust has little to no advantages
> left.
My entire adult life I've been writing C, I resisted Rust for a while but took
the plunge when a C++ project came along that was in dire need of being
reworked. I liked it, the language and the compiler and tooling around it
helped me tremendously.
I assume you're aware of all the things that Rust statically guarantees for
you, and I'll also assume you know the difference between language complexity
and language implementation complexity (eg, the compiler or some other
tooling):
I've been skimming through the C++ section of cppreference.com, and oh boy,
there's heaps and heaps of... stuff... just stuff. The interplay between all
that stuff is complex and it's hard to keep everything in mind. Keeping things
in mind is important for correctness, or at least for having a reasonable
amount of confidence in what you're writing. Information locality is also
important for correctness, and C++ lacks both of those. I'll even go further
and say that C++ is a write-only language, like a garbage bin of features and
exceptions to each of those features. Rust has many many many clear advantages
(and some disadvantages) compared to postmodern C++.
~~~
orbifold
Maybe just to elaborate: In contrast to rust, C++ is a standard defined
language, with >3 mature and competitive implementations, two of which (clang
/ microsofts compiler) provide excellent tooling and support for refactoring
(clang in particular) beyond any other language in existence (maybe except
Java). Instead of looking at cppreference.com, maybe consider browsing
[https://github.com/isocpp/CppCoreGuidelines/blob/master/CppC...](https://github.com/isocpp/CppCoreGuidelines/blob/master/CppCoreGuidelines.md)
the Cpp Core Guidelines, this outlines a forward looking vision of how good
c++ code should look like.
A lot of the static guarantees that rust provides can be modelled in C++ as
well, see for example "[https://clang.llvm.org/extra/clang-
tidy/checks/cppcoreguidel...](https://clang.llvm.org/extra/clang-
tidy/checks/cppcoreguidelines-owning-memory.html"). Eventually someone will
write a rust-style borrow checker as a clang analysis pass. Already now it is
possible to express a lot of compile time properties cleanly in c++, with
features such as constexpr lambdas, static_assert etc. Additional features
such as Concepts / meta-classes / modules will improve C++ expressivity even
further.
In short, yes C++ has a lot of stuff and everyone knows that it is hard to get
a grip on all its features and misfeatures. But there has been a continuous
effort to rectify and improve on its short comings. See for example
[https://clang.llvm.org/extra/clang-
tidy/checks/list.html](https://clang.llvm.org/extra/clang-
tidy/checks/list.html) for a list of clang based code transformations that are
able to automatically improve your c++ code.
The way I see it, just because of legacy reasons (I can interface with the
majority of commercial software developed in the last 30 years (CAD, EDA
software, Houdini, Abelton, ...)), tooling reasons (the rust compiler is a
slow hot mess, compared to the state of the art c++ compilers) and momentum
(there is a large incentive to continuously improve c++, because it is the
foundation of a large fraction of commercial software out there) it is
unlikely that rust will outcompete c++ in a significant way in the long run.
To close of with an example the lean theorem prover
[https://github.com/leanprover/lean](https://github.com/leanprover/lean),
implemented in C++ handily beats the 20+ year old Coq prover. One of its key
features is multicore support. If you look into its implementation details,
the equivalent rust code would have to work around a lot of rust "safety"
features, essentially because in many cases it is hard to convince a hardcoded
heuristic like a borrow checker that whatever you are doing is safe. The
static guarantees that rust gives wouldn't help you at all in correctly
implementing some of the very involved algorithms a theorem prover kernel has
to implement, while standing in the way of the implementation being
straightforward. This leaves aside the obvious tooling (you can use Visual
Studio, good profilers and debuggers) and integration (SAT checkers like Z3,
LLVM backend) advantages.
~~~
red75prime
> the lean theorem prover
Which has its share of segmentation faults (around 50 closed issues) and
unknown number of corner cases with silent memory corruption/data races.
------
mepian
The slide about the operating systems of the 1980s ignores Lisp machines.
Genera was not a "research system" and it had good performance. There was also
Xerox Star's OS written in Mesa.
------
jorangreef
I think Zig would be better suited.
See: [https://github.com/ziglang/zig/wiki/Why-Zig-When-There-is-
Al...](https://github.com/ziglang/zig/wiki/Why-Zig-When-There-is-Already-
CPP%2C-D%2C-and-Rust%3F)
~~~
ansible
I took a brief look at Zig.
The top slogan for Rust is "fearless concurrency", which ties back into the
memory model, mutability and sharing references. This helps you prevent (at
compile-time) data races and other interesting bugs.
I didn't see any support for that in Zig at all.
~~~
jungler
Last I checked Zig is more concerned about overflow conditions than
Rust(numeric overflow, stack overflow, OOM etc.) and boasts features in that
vein - so it competes, but not in the same territory.
If you are writing a kernel it's highly likely that you'll end up in a lot of
scenarios where you have to use unsafe Rust, in which case Zig would be the
better language for the task. Admittedly, it would be nice to have some of
both, and they both have room to get better. But I see Rust as more of a
"libraries and applications" centric setup, where it's the right thing for a
web browser and the wrong thing for a device driver.
------
EatYourGreens
These slides are quite high-level, so I've got to ask: what's the expected
benefit of using Rust to implement a kernel? I somehow thought that nearly all
interesting concurrency there would not fit into the paradigm of exclusive
ownership. And if we are preaching for programming in unsafe Rust, then
doesn't the message become less compelling?
~~~
eximius
The purported benefit would be to wrap all of the unsafe bits in safe wrappers
and then have a less bug prone, more secure OS, I suppose.
This would be, to put it mildly, quite difficult. Even then, unsafe code is
sometimes not written correctly which brings the whole thing down.
I, personally, still think it's worth it. I think efforts like Redox OS can
teach us a lot about what we're doing and offer a chance to collapse some of
the layers of cruft existing OSes have accumulated.
~~~
OoooooooO
Having only a small part of the code with unsafe means you only have to check
only a small % of the code for UB/security holes and not the whole code base
like in C.
It just limits the places shit can happen and which need to be closely
reviewed which alone is a big help.
~~~
cyphar
It should be noted that you can have correctness bugs can occur in safe code
if a Rust guarantee was violated in an unsafe block. This might seem obvious,
but it does mean that when you hit one of these bugs you might start with
debugging safe code and thus it's not _as_ clean a separation as some Rust
evangelists might imply.
------
twoodfin
Is there a video of this presentation? bcantrill’s always a fun / interesting
watch.
~~~
justincormack
There will be it was recorded. From Qcon SF this week.
------
mitchtbaum
Another important and related question to ask is what role Lua should play in
writing drivers and applications on top of a new kernel. NetBSD started on
this direction, but exactly what an operating system looks like when it
leverages both systems-level and scripting-level programmability waits to be
seen.
[https://www.netbsd.org/~lneto/dls14.pdf](https://www.netbsd.org/~lneto/dls14.pdf)
[https://www.lua.org/wshop13/Cormack.pdf](https://www.lua.org/wshop13/Cormack.pdf)
~~~
z3t4
I played with the idea of setting up a runtime for a scripting language such
as JS, then I was thinking, what is a OS anyway ? If it can be written in Rust
or any other high level language, it can also be written in a scripting
language !...?
------
stefs
i think there is a case for a rewrite, apart from the memory safety
guarantees. two things come to my mind:
1\. elimination of backwards compatibility. this is true for all new operating
systems, independently of the language. clean slate and throw away all the
baggage that was reasonable 20 years ago, doesn't hold true today anymore but
still is baked into the old architecture. this might be less relevant for all-
purpose OSes, but might be a viable option for specialized systems (IoT,
Network Appliances, ...). you remember what linus says when a kernel patch
breaks buggy userland code? we now get a second chance to implement a new
system that avoids whole classes for buggy code (while the underlying problem
doesn't go away, it may get greatly reduced).
2\. reduction of complexity. this _is_ a rust thing, and the story to back
this up is [stylo]([https://blog.rust-lang.org/2017/11/14/Fearless-
Concurrency-I...](https://blog.rust-lang.org/2017/11/14/Fearless-Concurrency-
In-Firefox-Quantum.html)), the parallel css engine used in firefox. i remember
reading that google tried to implement concurrent styling in chrome but
failed, because it got too complex in c++. human intellect is pretty much
finite and doesn't scale well; we rely on better tools. so, rust might enable
us to do things that were considered impossible before.
the emergence of such an OS would be gradual of course, niche at first, then
slowly growing until one day it's the new de-facto standard.
lets say, game engines. you rarely write your own game engine, because that's
too complex and ties up all the resources you need to actually implement your
game. so you buy one and it's in C++, of course. because they all are, and
thus your developers are fluent in C++. there are no game engines in rust and
few developers who know the language. but over the years, more and more game
devs will try rust in their spare time and like it and write game engines in
rust for their side or indie projects, where it's still feasible. a few of
those will grow and get more features and tooling and at _some point_,
suddenly, rust will be a viable alternative. even though rusts strengths
aren't really that important in game engines. performance happens on the
graphic cards anyway. security is not as big of a deal. parallelism is quite
constrained anyway. etc, etc. but if all else is equal, rust might be more
productive.
so, is it time to rewrite the OS in rust? sure, why not. it's just that we
wont all switch to redox overnight.
------
Leace
I'm surprised there are no mentions to Microsoft Research's Singularity, that
used only software barriers, and the languages used there (Sing#, Spec#) had
ownership concepts ([Claims] attribute).
------
discoball
Nim is realtime garbage collected and compiles to optimized C and it can use
the C ecosystem of libraries and tooling. It also produces smaller binaries
than Rust and is faster for most tasks.
~~~
m0th87
Despite what the Nim documentation says, realtime and garbage collection are
mutually exclusive (unless you count non-deferred reference counting and give
up on collecting cycles.) Setting maximum pause times doesn't change the fact
that the garbage will be collected nondeterministically, which is a problem
for kernels.
~~~
lucozade
Those are 3 orthogonal(ish) things.
Realtime just means that actions triggered by event occur in an explicitly
bounded time. It doesn't usually mean that they occur in the same time. So a
GC with bounded pause _could_ be used in a realtime system assuming you could
guarantee the explicit bounds.
I can't comment on whether or not this is true of Nim and pause time probably
isn't sufficient (depends on how it's defined) but they're not mutually
exclusive.
And most kernels don't need to be realtime unless they are realtime kernels.
Having said that, of course, the vast majority of GC systems are most
definitely not realtime, or anywhere close. But that's just actually true, not
theoretically true.
~~~
m0th87
> So a GC with bounded pause could be used in a realtime system assuming you
> could guarantee the explicit bounds.
You _can 't_ guarantee explicit bounds on when a given resource will be
collected with GC. Bounded times can provide upper bounds on GC pass runtime,
but they do that by potentially deferring further collection. Those deferrals
make it nondeterministic.
> And most kernels don't need to be realtime unless they are realtime kernels.
That's not true. Most (all?) kernels have internal realtime needs, e.g.
responding to interrupts.
There is a way to write a kernel with a GC'd language, as Niklaus Wirth has
demonstrated, by circumventing the GC where needed. But the critique I was
bringing up was simply that there's no such thing as a realtime GC.
------
adamnemecek
Rust allows for new architectures. Eg beos style os would be a match made in
heaven as rust really shines when it comes to async code.
Also maybe you could have a less complicated memory manager as you can deal
with allocations statically.
~~~
qaq
"rust really shines" they need to land async/await
~~~
steveklabnik
We really do. It’s in nightly; likely to hit stable early next year. One of
its precursors is being stabilized as we speak.
------
Animats
_in-kernel C tends to be de facto safe_
Huh?
------
jbb67
no.
~~~
keir-rex
I was expecting to see this type of response. I don't program at low levels
but it seems like this would be the responding answer. Kernel programmers
would be using something else if that's what they wanted to use. Decades of
experience and hard learnt lessons down the drain.
~~~
keir-rex
Also, if you can abstract away at a sufficiently low level why not just do it
in C where there's already a generation of experience and familiarity?
~~~
RhodesianHunter
Sure, why not just continue writing C for the rest of time?
------
eeZah7Ux
NO, and I wish HN stopped upvoting this sort of propaganda. There are hundreds
of languages around and the slides did not even attempt to compare pros and
cons across languages that would be suitable for kernels.
------
otabdeveloper1
> Is it time to rewrite the operating system in Rust?
No. Next question, please.
~~~
albru123
How constructive of you...
------
bryanrasmussen
[http://www.erights.org/elang/intro/index.html](http://www.erights.org/elang/intro/index.html)
~~~
tux1968
Hadn't heard about this before, and it does look interesting. But not sure why
you're linking to it in this context without comment? Especially since it
seems to be a moribund project.
~~~
bryanrasmussen
E had a pretty interesting security model and there were in various E writings
expressions of pipe dreams that operating systems should be rewritten using
it. I should probably have linked to one of those to make the connection more
explicit, but really it was just a momentary bit of snarkiness that didn't
deserve more than what I gave it.
| 2024-02-03T01:26:18.401715 | https://example.com/article/8959 |
Q:
Presto: Last day of the month prior
I have a list of dates. I would like to return the last date of the month prior like the below example:
date lastdayofmonthprior
'2018-04-03' '2018-03-31'
I have tried date_trunc('month', date('2018-04-03'))-1, however, I get this error:
'-' cannot be applied to date, integer
I'm guessing I can't do arithmetic to a date in Presto.
A:
You can use DATE_ADD in Presto:
DATE_ADD('day', -1, date_trunc('month', date('2018-04-30')))
| 2023-12-04T01:26:18.401715 | https://example.com/article/1320 |
Q:
Intersection of attracting sets that is not an attracting set.
Let $\phi$ be a homeomorphism of a topological metric space to itself. Let $A_i$ be a nested sequence of attracting sets for $\phi$. I have found out that the intersections of such sequences are called as quasi-attractors, but i don't know a lot of examples of attractors and can't find a simple example of a quasi-attractor that is not an attractor.
Definition of an attractor I am currently using:
$\phi$-invariant compact set $K$ such that $\forall$ $U(K)$ - neighbourhood of K $\exists$ $U'(K)$ such that $\phi^n(U'(K)) \subseteq U(K)$
$K$ has neigbourhood $N(K)$ such that $\forall x \in N(K) \: \lim_{n\to \infty} dist(\phi^n(x), K) = 0$
If I'm not mistaken first condition is still true for the limit of nested sequences, so there should be a problem with second one. Will appreciate any hint.
A:
It seems that i had found an answer for my problem. I need a map that is contracting points to spheres that are going in limit to point. Then the sequence i need is a sequence of disks, bounded by these spheres. They are attractors, but their intersection(point) is not, because for every point $x$ in neighbourhood of it there is a sphere between centre and $x$ that is blocking the way.
| 2024-07-27T01:26:18.401715 | https://example.com/article/4767 |
RENTON, Wash. -- It's a late-August afternoon at the Seattle Seahawks' lakefront headquarters, and practice is not over yet for some.
While the rest of the team has made its way off the field and inside the Virginia Mason Athletic Center, a pair of pass-rushers -- rookie sixth-round pick Jacob Martin and free-agent addition Barkevious Mingo -- remain. Clint Hurtt, the defensive line coach, is putting them through some extra work. Pete Carroll is there, too, instructing as much as he's observing.
The scene illustrated much of what's different about the 2018 Seahawks: their newness and youth on defense, what that means for Carroll and why the NFL's oldest coach appears rejuvenated even after an offseason that had to rank among the most difficult in his nine with the Seahawks.
Consider what all went down.
Seattle Departures A look at the major departures from last year's Seahawks: Players: CB Richard Sherman (released)
SS Kam Chancellor (injury)
DL Michael Bennett (traded)
DE Cliff Avril (injury)
DT Sheldon Richardson (free agency)
TE Jimmy Graham (free agency)
WR Paul Richardson (free agency) Coaches: OC Darrell Bevell
DC Kris Richard
OL coach/asst. head coach Tom Cable
LB coach/asst. head coach Micheal Barrow
DL coach Dwaine Board
Asst. DB coach Ricky Manning Jr.
Senior defensive asst. Travis Jones
Asst. special teams coach Heath Farwell
Offensive asst. Lemuel Jeanpierre
First, Carroll -- perhaps not completely by choice -- fired his offensive and defensive coordinators, his O-line coach and a handful of other assistants in the most significant overhaul of his staff since he arrived in Seattle. Then came the purging of some of the most important players in franchise history, followed by the parting shots aimed in Carroll's direction from two of them, Richard Sherman and Michael Bennett, who had either said or implied that his message had grown stale with the team's older players.
Carroll's Seahawks, 0-1 heading into Monday night's game against the Chicago Bears, are no longer considered the NFC heavyweights they were for the past several seasons. Their offseason retooling has left them younger in several spots, which was evident in their season-opening defeat to the Broncos in Denver.
Carroll has had his coaching challenges throughout the years: Percy Harvin's volatility in 2013-14; managing the attention that followed Seattle's Super Bowl victory and then navigating his players through the aftermath of a devastating Super Bowl loss; and handling what became increasingly difficult relationships with Sherman and Marshawn Lynch, to name a few.
The challenge this season: trying to remain competitive with a roster no longer as loaded with established talent, one whose once star-studded defense is more reliant than in recent seasons on unproven youth. How quickly can Carroll and his staff turn inexperienced players into productive ones?
After that August postpractice instruction had finished, Carroll was asked about the new-look secondary that was once the face of Seattle's defense.
"We're in a creation mode with these guys more than we're in kind of a maintenance mode that you would be with guys that you've had before," he told ESPN. "Once guys have played with us, they establish habits and things, and then we need to adjust them and hone their skill. This is more like the creation part of it.
"You're doing the sculpting right now."
Richard Sherman is one of the former Seahawks players who criticized Pete Carroll's message. Wesley Hitt/Getty Images
'It was time for these guys to move on'
Carroll remembers the look on John Wooden's face and the feeling it instantly gave him. It was during one of Carroll's first few seasons at USC that he began visiting with the legendary UCLA basketball coach.
"Every year I was trying to think of a question to ask him when we would get together in the springtime," Carroll recalled. "And I said, 'Coach, how much do you change your philosophy from year to year?' And he looked at me and I felt like, 'Oh man, I feel like a dumbass. Why did I ask that question?'
"He said, 'Coach, you don't change your philosophy. Your philosophy is what it is, and the players change.' That's what makes it seem different sometimes. The philosophy always stays the same."
In the past, players have lauded Carroll's consistency, how he's the same person with the same attitude every day. But Sherman, who had spent seven seasons with Seattle, criticized part of that consistency when he said after his release that Carroll's ways are better suited for college, where rosters turn over every four years. Bennett, who was dealt to the Philadelphia Eagles, told Sports Illustrated that he started to read books in team meetings last season because he had heard all of Carroll's jokes and anecdotes, although he later clarified to The Seattle Times that it was only in rookie meetings that he wasn't required to attend.
"We had kind of heard all his stories, we had kind of heard every story, every funny anecdote that he had," Sherman said. "And honestly because he just recycles them. And they're cool stories, they're great for team chemistry and building, et cetera, et cetera. But we had literally heard them all. We could recite them before he even started to say them."
Winningest Seahawks Coaches Pete Carroll needs one more victory to tie Chuck Knox for second-most in Seahawks history. Coach Years Record Win % Playoffs Mike Holmgren 1999-2008 86-74 .538 4-6 Chuck Knox 1983-1991 80-63 .559 3-4 Pete Carroll 2010-present 79-49-1 .616 9-5* Jack Patera 1976-1982 35-59 .372 0-0 Dennis Erickson 1995-1998 31-33 .484 0-0 Tom Flores 1992-1994 14-34 .292 0-0 Jim L. Mora 2009 5-11 .313 0-0 Mike McCormack 1982 4-3 .571 0-0 Source: Pro Football Reference *Won only Super Bowl in franchise history
Carroll brushed off the comments, describing them as something of a coping method.
"I'm not sad. I'm not surprised, though," he told KIRO-AM 710 ESPN Seattle. "We've just been through so much, and I know where their head is at and they're looking at stuff and they can go from one moment to the next and see things a little bit differently; it can change for them, and they're battling. They're out there battling for their own sake. It would be nice if they saw it differently. I see it differently than they saw it."
Carroll added: "Regardless of what they say, I'm not gonna be that petty about it. ... Somewhere down the road everything will be fine. I'm not worried about it."
And in making the point that players have to remain engaged, he hinted loudly that the decisions to move on from Sherman and Bennett were influenced by their attitudes and not just the usual factors of age, production, injury and salary.
"They have a responsibility to stay fresh, as well," Carroll said. "They have a responsibility to see it new. They have a responsibility to keep making this a challenge for themselves. ... I'm a teacher, I gotta help these guys learn, I gotta do whatever it takes to get that done and get the communication right. So we're constantly tweaking, we're constantly evolving -- they need to do the same. The freshness can come from both directions, or see you later. If it isn't the right place, go. 'You have to go? You're out of here.' That's a point I don't mind making -- it was time for these guys to move on."
Only seven players -- Russell Wilson, Doug Baldwin, Earl Thomas, Bobby Wagner, K.J. Wright, Justin Britt and J.R. Sweezy -- remain from the 2014 team that reached its second consecutive Super Bowl. It's why Baldwin says it's now a "young-guy team," and why he thinks Carroll is "being more of himself" this year.
"He's showing more of himself to us, telling more stories, just talking more about himself," Baldwin said. "Because it's a young team and he really needs these young guys to see who he is, where he's come from, the history of why he does the things he does. It's kind of like starting over again in some aspects."
Pete Carroll says he's feeling better than ever thanks to a new diet. Dustin Bradford/Getty Images
67 years young
When it started to become apparent late last season that the Seahawks might be headed for a drastic reshuffling of their roster, it raised speculation about Carroll's future. Would Carroll, who turned 67 this past week, be willing to wait however long it might take for the Seahawks to become championship contenders again?
The thing is, Carroll is the youngest 60-something you'll ever meet and probably thinks he could win with just about any roster.
He shot down the retirement speculation before Seattle's regular-season finale -- naturally, in a tweet complete with a dancing emoji.
People talking about retirement... I ain't old enough to think about retiring! 🕺 — Pete Carroll (@PeteCarroll) December 31, 2017
When the subject came up again during his weekly radio show, Carroll revealed that he had adopted a plant-based diet he says has changed his life.
His son Nate, the team's wide-receivers coach, had convinced Carroll and his wife, Glena, to give it a try during a family vacation last summer.
"We have gotten rid of gluten, we have gotten rid of dairy products and just cleaned it up and found that all of the old arthritic problems have gone away," Carroll told ESPN. "Really, something in there in the diet has helped in terms of the inflammation. It's startlingly different. Over my lifetime I've taken Celebrex and Vioxx and more Advil than I'd like to admit and all that stuff. I don't take anything anymore, and I don't need anything anymore.
"The diet has really changed everything."
"I don't feel any different about this than any season I can ever remember," Carroll said, "but I feel more excited to have a chance to see this opportunity come to life." Joe Nicholson/USA TODAY Sports
Hands-on Carroll
Carroll was a safety during his playing days, then cut his teeth in college and the NFL as a defensive backs coach. As such, he always has been hands-on with the younger players in Seattle's secondary.
But there have been more young players to mold this year now that Sherman and Kam Chancellor are gone, (Thomas also missed all offseason while holding out.) One of them is rookie fifth-round pick Tre Flowers, a lanky college safety in whom Carroll has taken a special interest, dating all the way back to the pre-draft process.
Flowers is now starting at right cornerback after injuries to veterans Byron Maxwell and Dontae Johnson. It's not something many would have predicted in the spring, when Flowers was in the beginning stages of his position switch.
After a rookie minicamp practice in May, Carroll was asked what excites him most about working with young players. He mentioned a meeting he had earlier in the day with Flowers.
It brought Carroll way back.
"I'm coaching up a guy that's going to turn into a corner, and that meeting right there, you could have put me in that meeting 30 years ago," Carroll said. "Talking the same stuff and principles and concepts, trying to reach a young kid and help him understand what this is all about and what he's getting into and all of that. It was awesome. I felt like I was right back in the middle of all of it.
"There's this rejuvenation to every season that we have that's a remarkable part of our business that sometimes we don't talk about enough. The newness, the challenges, the unknown, the expectations and the uncertainty of all of it makes this very exciting. I don't feel any different about this than any season I can ever remember, but I feel more excited to have a chance to see this opportunity come to life. I'm very grateful and appreciative of it.
"I was right in the middle of it today, and I had to stop for a minute, 'Wow, here we go.' I'm trying to make this kid understand and it's something he's never heard before or seen before. It's pretty darn exciting. That's just the start of it, then we'll see it unfold in time. It's really fun. That's just one of those stories." | 2023-08-19T01:26:18.401715 | https://example.com/article/7775 |
Ben went off once again last night and had 20 rebounds 12 points, and 8 blocks. He was 6/7 shooting, and had a steal and an assist to top it off. This is a typical game for Ben Wallace, and to say he is not a top 5 center in this league is absurd. I think he is a lock for the Defensive Player of the Year award.
Thoughts.............
Big Boy Laroux
03-28-2002, 06:34 PM
who the hell is a ben wallace hater? (by the way, nice use of the z to make it plural... i/expressions/face-icon-small-disgusted.gif)
ben is a great player. he hustles, works hard, and is physical (o'neal is DAMN lucky wallace didn't punch him after o'neal got a cheap lick in).
the only reason i think some people may not consider him a top center is his inability to create shots for himself. he gets the majority of his shots off of offensive rebounds or passes close to the basket. but that does not mean he is a bad offensive player. he moves quite well without the ball. he may just not have confidence in his offensive game. also, detroit has enough guys who want to score. he seems to be the exact opposite of uncle cliffy.
also, one more thing. and this is another reason why he may not be considered one of the best centers. he plays in the east. he could not be a center in the west. HE'S 6'9"! but i do think he'd be a hell of a great PF.
David
03-28-2002, 08:09 PM
<< who the hell is a ben wallace hater? (by the way, nice use of the z to make it plural... i/expressions/face-icon-small-disgusted.gif)
ben is a great player. he hustles, works hard, and is physical (o'neal is DAMN lucky wallace didn't punch him after o'neal got a cheap lick in).
the only reason i think some people may not consider him a top center is his inability to create shots for himself. he gets the majority of his shots off of offensive rebounds or passes close to the basket. but that does not mean he is a bad offensive player. he moves quite well without the ball. he may just not have confidence in his offensive game. also, detroit has enough guys who want to score. he seems to be the exact opposite of uncle cliffy.
also, one more thing. and this is another reason why he may not be considered one of the best centers. he plays in the east. he could not be a center in the west. HE'S 6'9"! but i do think he'd be a hell of a great PF. >>
Yeah, what he said.
Kat
03-28-2002, 11:41 PM
RCF...again.
Murphy3
03-29-2002, 12:11 AM
no one is a wallace hater..people only said that he doesn't deserve to be mentioned for the MVP
OzMavs
03-29-2002, 06:16 AM
I think this is the first negative thread started about Ben Wallace... probably the last! | 2023-08-24T01:26:18.401715 | https://example.com/article/5066 |
1994 Williamstown state by-election
A by-election for the Victorian Legislative Assembly district of Williamstown was held on 13 August 1994. The by-election was triggered by the resignation of Joan Kirner, the former Premier of Victoria, on 27 May 1994.
Results
References
Category:1994 elections in Australia
Category:Victorian state by-elections
Category:1990s in Victoria (Australia) | 2023-10-29T01:26:18.401715 | https://example.com/article/8826 |
Where Can I Buy Breast Actives Launches New Site To Help Women Increase Breast Size Naturally
WhereCanIBuyBreastActives.com has launched to offer women actionable advice on purchasing supplements that will help increase breast size and uniformity through natural supplement pills.
Breast size is something that varies hugely across every individual woman. Nevertheless, a proportional ideal has been reached through decades of media proliferation, and those who fall short of this ideal feel inadequate and under pressure to change. Doing so can be hazardous, which is why Where Can I Buy Breast Actives has been launched to provide people with information on a natural solution.
The treatment process is analyzed both in terms of effectiveness and economy. Before and after pictures demonstrate the effectiveness of the treatment (http://wherecanibuybreastactives.com/before-and-after-pictures/) time and time again. While the treatment does cost around $3,000 dollars for a year of therapy, that is a fraction of the $10,000 artificial implants cost, which in turn are unnatural and do not use the body’s natural processes.
The site also offers a practical guide as to where to buy the products in the UK, New Zealand and America to enable all English speakers to effectively source the treatments as they are scaled out toward global distribution. A full list of active ingredients is available to help people ensure there is no potential for allergic reaction. The site also gives advice on the best enhancement creams available today (http://wherecanibuybreastactives.com/what-is-the-best-enhancement-cream/).
A spokesperson for Where Can I Buy Breast Actives explained, “Breast Actives is a natural solution that generates hormones from within the pituitary gland itself, ensuring they are completely natural and create natural reactions in the breasts. The combination of cream and pills works from without and within to ensure maximum penetration at every layer of the breast tissue. That is why we feel this is the best solution available and why we are taking pains to ensure women can source this high quality product from reliable suppliers. The site is regularly updated with information on the product and its suppliers, and users can check back regularly for the latest updates.”
About Where Can I Buy Breast Actives:
Where Can I Buy Breast Actives is an online resource center dedicated to providing reliable, independent information on Breast Actives. Breast Actives are a combination of cream and pill treatments using 100% natural ingredients. The site gives people information on how they work and where to purchase them for the best price. | 2023-08-26T01:26:18.401715 | https://example.com/article/7247 |
<?xml version="1.0" encoding="UTF-8"?>
<CONFIG>
<ProjectOptions>
<Version Value="12"/>
<General>
<Flags>
<LRSInOutputDirectory Value="False"/>
<CompatibilityMode Value="True"/>
</Flags>
<SessionStorage Value="InIDEConfig"/>
<UseAppBundle Value="False"/>
</General>
<VersionInfo>
<Language Value=""/>
<CharSet Value=""/>
</VersionInfo>
<BuildModes Count="1">
<Item1 Name="default" Default="True"/>
</BuildModes>
<PublishOptions>
<Version Value="2"/>
</PublishOptions>
<RunParams>
<local>
<CommandLineParams Value="-F D:/programming/Jcf2/Test/TestCases/TestUnicode_be_ucs2.pas -out -config=D:/programming/Jcf2/Test/TestCases/JCFTestSettings.cfg"/>
<LaunchingApplication PathPlusParams="/usr/X11R6/bin/xterm -T 'Lazarus Run Output' -e $(LazarusDir)/tools/runwait.sh $(TargetCmdLine)"/>
</local>
<FormatVersion Value="2"/>
<Modes Count="1">
<Mode0 Name="default">
<local>
<CommandLineParams Value="-F D:/programming/Jcf2/Test/TestCases/TestUnicode_be_ucs2.pas -out -config=D:/programming/Jcf2/Test/TestCases/JCFTestSettings.cfg"/>
<LaunchingApplication PathPlusParams="/usr/X11R6/bin/xterm -T 'Lazarus Run Output' -e $(LazarusDir)/tools/runwait.sh $(TargetCmdLine)"/>
</local>
</Mode0>
</Modes>
</RunParams>
<RequiredPackages Count="1">
<Item1>
<PackageName Value="jcfidelazarus"/>
</Item1>
</RequiredPackages>
<Units Count="125">
<Unit0>
<Filename Value="JCF.lpr"/>
<IsPartOfProject Value="True"/>
</Unit0>
<Unit1>
<Filename Value="../../Parse/Tokens.pas"/>
<IsPartOfProject Value="True"/>
</Unit1>
<Unit2>
<Filename Value="../../Utils/JcfMiscFunctions.pas"/>
<IsPartOfProject Value="True"/>
</Unit2>
<Unit3>
<Filename Value="../../Parse/BuildTokenList.pas"/>
<IsPartOfProject Value="True"/>
</Unit3>
<Unit4>
<Filename Value="../../Settings/JcfRegistrySettings.pas"/>
<IsPartOfProject Value="True"/>
</Unit4>
<Unit5>
<Filename Value="../../Settings/SettingsTypes.pas"/>
<IsPartOfProject Value="True"/>
</Unit5>
<Unit6>
<Filename Value="../../Parse/TokenUtils.pas"/>
<IsPartOfProject Value="True"/>
</Unit6>
<Unit7>
<Filename Value="../../Settings/Streams/SettingsStream.pas"/>
<IsPartOfProject Value="True"/>
</Unit7>
<Unit8>
<Filename Value="../../Settings/SetClarify.pas"/>
<IsPartOfProject Value="True"/>
</Unit8>
<Unit9>
<Filename Value="../../Settings/SetReplace.pas"/>
<IsPartOfProject Value="True"/>
</Unit9>
<Unit10>
<Filename Value="../../JcfVersionConsts.pas"/>
<IsPartOfProject Value="True"/>
</Unit10>
<Unit11>
<Filename Value="../../Settings/JcfSettings.pas"/>
<IsPartOfProject Value="True"/>
</Unit11>
<Unit12>
<Filename Value="../../Parse/AsmKeywords.pas"/>
<IsPartOfProject Value="True"/>
</Unit12>
<Unit13>
<Filename Value="../../Parse/BuildParseTree.pas"/>
<IsPartOfProject Value="True"/>
</Unit13>
<Unit14>
<Filename Value="../../Process/BaseVisitor.pas"/>
<IsPartOfProject Value="True"/>
</Unit14>
<Unit15>
<Filename Value="../../ReadWrite/Converter.pas"/>
<IsPartOfProject Value="True"/>
</Unit15>
<Unit16>
<Filename Value="../../Utils/JcfFontSetFunctions.pas"/>
<IsPartOfProject Value="True"/>
</Unit16>
<Unit17>
<Filename Value="../../Parse/UI/fShowParseTree.pas"/>
<IsPartOfProject Value="True"/>
<ComponentName Value="frmShowParseTree"/>
<HasResources Value="True"/>
<ResourceBaseClass Value="Form"/>
</Unit17>
<Unit18>
<Filename Value="../../Process/VisitSetXY.pas"/>
<IsPartOfProject Value="True"/>
</Unit18>
<Unit19>
<Filename Value="../../Process/FormatFlags.pas"/>
<IsPartOfProject Value="True"/>
</Unit19>
<Unit20>
<Filename Value="../../Process/Obfuscate/FixCase.pas"/>
<IsPartOfProject Value="True"/>
</Unit20>
<Unit21>
<Filename Value="../../Process/Obfuscate/RemoveComment.pas"/>
<IsPartOfProject Value="True"/>
</Unit21>
<Unit22>
<Filename Value="../../Process/Obfuscate/RemoveUnneededWhiteSpace.pas"/>
<IsPartOfProject Value="True"/>
</Unit22>
<Unit23>
<Filename Value="../../Process/Obfuscate/RemoveReturn.pas"/>
<IsPartOfProject Value="True"/>
</Unit23>
<Unit24>
<Filename Value="../../Process/Obfuscate/RebreakLines.pas"/>
<IsPartOfProject Value="True"/>
</Unit24>
<Unit25>
<Filename Value="../../Process/RemoveEmptyComment.pas"/>
<IsPartOfProject Value="True"/>
</Unit25>
<Unit26>
<Filename Value="../../Process/Capitalisation/IdentifierCaps.pas"/>
<IsPartOfProject Value="True"/>
</Unit26>
<Unit27>
<Filename Value="../../Process/Capitalisation/Capitalisation.pas"/>
<IsPartOfProject Value="True"/>
</Unit27>
<Unit28>
<Filename Value="../../Process/Returns/ReturnChars.pas"/>
<IsPartOfProject Value="True"/>
</Unit28>
<Unit29>
<Filename Value="../../Process/Returns/BlockStyles.pas"/>
<IsPartOfProject Value="True"/>
</Unit29>
<Unit30>
<Filename Value="../../Process/Spacing/TabToSpace.pas"/>
<IsPartOfProject Value="True"/>
</Unit30>
<Unit31>
<Filename Value="../../Process/Spacing/SpaceToTab.pas"/>
<IsPartOfProject Value="True"/>
</Unit31>
<Unit32>
<Filename Value="../../Process/Spacing/MaxSpaces.pas"/>
<IsPartOfProject Value="True"/>
</Unit32>
<Unit33>
<Filename Value="../../Process/Spacing/SingleSpaceBefore.pas"/>
<IsPartOfProject Value="True"/>
</Unit33>
<Unit34>
<Filename Value="../../Process/Spacing/SingleSpaceAfter.pas"/>
<IsPartOfProject Value="True"/>
</Unit34>
<Unit35>
<Filename Value="../../Process/Spacing/SpaceBeforeColon.pas"/>
<IsPartOfProject Value="True"/>
</Unit35>
<Unit36>
<Filename Value="../../Process/Indent/Indenter.pas"/>
<IsPartOfProject Value="True"/>
</Unit36>
<Unit37>
<Filename Value="../../Process/Returns/LongLineBreaker.pas"/>
<IsPartOfProject Value="True"/>
</Unit37>
<Unit38>
<Filename Value="../../Process/Info/BasicStats.pas"/>
<IsPartOfProject Value="True"/>
</Unit38>
<Unit39>
<Filename Value="../../Parse/PreProcessor/PreProcessorExpressionTokens.pas"/>
<IsPartOfProject Value="True"/>
</Unit39>
<Unit40>
<Filename Value="../../Parse/PreProcessor/PreProcessorExpressionTokenise.pas"/>
<IsPartOfProject Value="True"/>
</Unit40>
<Unit41>
<Filename Value="../../ReadWrite/FileConverter.pas"/>
<IsPartOfProject Value="True"/>
</Unit41>
<Unit42>
<Filename Value="../../Utils/JcfUnicodeFiles.pas"/>
<IsPartOfProject Value="True"/>
</Unit42>
<Unit43>
<Filename Value="../../Ui/fJcfErrorDisplay.pas"/>
<IsPartOfProject Value="True"/>
<ComponentName Value="ExceptionDialog"/>
<HasResources Value="True"/>
<ResourceBaseClass Value="Form"/>
</Unit43>
<Unit44>
<Filename Value="../CommandLineConstants.pas"/>
<IsPartOfProject Value="True"/>
</Unit44>
<Unit45>
<Filename Value="../StatusMessageReceiver.pas"/>
<IsPartOfProject Value="True"/>
</Unit45>
<Unit46>
<Filename Value="../CommandLineReturnCode.pas"/>
<IsPartOfProject Value="True"/>
</Unit46>
<Unit47>
<Filename Value="../../ReadWrite/ConvertTypes.pas"/>
<IsPartOfProject Value="True"/>
</Unit47>
<Unit48>
<Filename Value="../../Parse/ParseError.pas"/>
<IsPartOfProject Value="True"/>
</Unit48>
<Unit49>
<Filename Value="../../Parse/ParseTreeNode.pas"/>
<IsPartOfProject Value="True"/>
</Unit49>
<Unit50>
<Filename Value="../../Parse/ParseTreeNodeType.pas"/>
<IsPartOfProject Value="True"/>
</Unit50>
<Unit51>
<Filename Value="../../Parse/SourceToken.pas"/>
<IsPartOfProject Value="True"/>
</Unit51>
<Unit52>
<Filename Value="../../Parse/SourceTokenList.pas"/>
<IsPartOfProject Value="True"/>
</Unit52>
<Unit53>
<Filename Value="../../Utils/JcfLog.pas"/>
<IsPartOfProject Value="True"/>
<UnitName Value="JCFLog"/>
</Unit53>
<Unit54>
<Filename Value="../../Settings/SetUses.pas"/>
<IsPartOfProject Value="True"/>
</Unit54>
<Unit55>
<Filename Value="../../Settings/JcfSetBase.pas"/>
<IsPartOfProject Value="True"/>
</Unit55>
<Unit56>
<Filename Value="../../Settings/SetAlign.pas"/>
<IsPartOfProject Value="True"/>
</Unit56>
<Unit57>
<Filename Value="../../Settings/SetCaps.pas"/>
<IsPartOfProject Value="True"/>
</Unit57>
<Unit58>
<Filename Value="../../Settings/SetFile.pas"/>
<IsPartOfProject Value="True"/>
</Unit58>
<Unit59>
<Filename Value="../../Settings/SetIndent.pas"/>
<IsPartOfProject Value="True"/>
</Unit59>
<Unit60>
<Filename Value="../../Settings/SetObfuscate.pas"/>
<IsPartOfProject Value="True"/>
</Unit60>
<Unit61>
<Filename Value="../../Process/Warnings/WarnUnusedParam.pas"/>
<IsPartOfProject Value="True"/>
</Unit61>
<Unit62>
<Filename Value="../../Process/Warnings/WarnDestroy.pas"/>
<IsPartOfProject Value="True"/>
</Unit62>
<Unit63>
<Filename Value="../../Process/Warnings/WarnAssignToFunctionName.pas"/>
<IsPartOfProject Value="True"/>
</Unit63>
<Unit64>
<Filename Value="../../Process/Capitalisation/UnitNameCaps.pas"/>
<IsPartOfProject Value="True"/>
</Unit64>
<Unit65>
<Filename Value="../../Process/Transform/SortUsesData.pas"/>
<IsPartOfProject Value="True"/>
</Unit65>
<Unit66>
<Filename Value="../../Process/Capitalisation/SpecificWordCaps.pas"/>
<IsPartOfProject Value="True"/>
</Unit66>
<Unit67>
<Filename Value="../../Settings/SetWordList.pas"/>
<IsPartOfProject Value="True"/>
</Unit67>
<Unit68>
<Filename Value="../../Settings/SetPreProcessor.pas"/>
<IsPartOfProject Value="True"/>
<UnitName Value="SetPreprocessor"/>
</Unit68>
<Unit69>
<Filename Value="../../Utils/JcfHelp.pas"/>
<IsPartOfProject Value="True"/>
</Unit69>
<Unit70>
<Filename Value="../../Settings/SetReturns.pas"/>
<IsPartOfProject Value="True"/>
</Unit70>
<Unit71>
<Filename Value="../../Settings/SetSpaces.pas"/>
<IsPartOfProject Value="True"/>
</Unit71>
<Unit72>
<Filename Value="../../Settings/Streams/RegistrySettings.pas"/>
<IsPartOfProject Value="True"/>
</Unit72>
<Unit73>
<Filename Value="../../Process/Obfuscate/ReduceWhiteSpace.pas"/>
<IsPartOfProject Value="True"/>
</Unit73>
<Unit74>
<Filename Value="../../Process/Obfuscate/RemoveConsecutiveWhiteSpace.pas"/>
<IsPartOfProject Value="True"/>
</Unit74>
<Unit75>
<Filename Value="../../Process/Warnings/WarnRealType.pas"/>
<IsPartOfProject Value="True"/>
</Unit75>
<Unit76>
<Filename Value="../../Process/Warnings/WarnCaseNoElse.pas"/>
<IsPartOfProject Value="True"/>
</Unit76>
<Unit77>
<Filename Value="../../Process/Warnings/WarnEmptyBlock.pas"/>
<IsPartOfProject Value="True"/>
</Unit77>
<Unit78>
<Filename Value="../../Process/Warnings/Warning.pas"/>
<IsPartOfProject Value="True"/>
</Unit78>
<Unit79>
<Filename Value="../../Process/Spacing/NoSpaceBefore.pas"/>
<IsPartOfProject Value="True"/>
</Unit79>
<Unit80>
<Filename Value="../../Process/Spacing/NoSpaceAfter.pas"/>
<IsPartOfProject Value="True"/>
</Unit80>
<Unit81>
<Filename Value="../../Process/Returns/ReturnAfter.pas"/>
<IsPartOfProject Value="True"/>
</Unit81>
<Unit82>
<Filename Value="../../Process/Nesting.pas"/>
<IsPartOfProject Value="True"/>
</Unit82>
<Unit83>
<Filename Value="../../Process/VisitSetNesting.pas"/>
<IsPartOfProject Value="True"/>
</Unit83>
<Unit84>
<Filename Value="../../Process/Returns/ReturnBefore.pas"/>
<IsPartOfProject Value="True"/>
</Unit84>
<Unit85>
<Filename Value="../../Process/Returns/NoReturnAfter.pas"/>
<IsPartOfProject Value="True"/>
</Unit85>
<Unit86>
<Filename Value="../../Process/Returns/NoReturnBefore.pas"/>
<IsPartOfProject Value="True"/>
</Unit86>
<Unit87>
<Filename Value="../../Process/AllProcesses.pas"/>
<IsPartOfProject Value="True"/>
</Unit87>
<Unit88>
<Filename Value="../../Process/Obfuscate/RemoveBlankLine.pas"/>
<IsPartOfProject Value="True"/>
</Unit88>
<Unit89>
<Filename Value="../../Process/SwitchableVisitor.pas"/>
<IsPartOfProject Value="True"/>
</Unit89>
<Unit90>
<Filename Value="../../Process/Returns/PropertyOnOneLine.pas"/>
<IsPartOfProject Value="True"/>
</Unit90>
<Unit91>
<Filename Value="../../Process/VisitStripEmptySpace.pas"/>
<IsPartOfProject Value="True"/>
</Unit91>
<Unit92>
<Filename Value="../../Process/Returns/RemoveBlankLinesAfterProcHeader.pas"/>
<IsPartOfProject Value="True"/>
</Unit92>
<Unit93>
<Filename Value="../../Process/Returns/RemoveBlankLinesInVars.pas"/>
<IsPartOfProject Value="True"/>
</Unit93>
<Unit94>
<Filename Value="../../Process/Returns/RemoveReturnsBeforeEnd.pas"/>
<IsPartOfProject Value="True"/>
</Unit94>
<Unit95>
<Filename Value="../../Process/Returns/RemoveReturnsAfterBegin.pas"/>
<IsPartOfProject Value="True"/>
</Unit95>
<Unit96>
<Filename Value="../../Utils/IntList.pas"/>
<IsPartOfProject Value="True"/>
</Unit96>
<Unit97>
<Filename Value="../../Process/Align/AlignConst.pas"/>
<IsPartOfProject Value="True"/>
</Unit97>
<Unit98>
<Filename Value="../../Process/Align/AlignBase.pas"/>
<IsPartOfProject Value="True"/>
</Unit98>
<Unit99>
<Filename Value="../../Process/Align/AlignAssign.pas"/>
<IsPartOfProject Value="True"/>
</Unit99>
<Unit100>
<Filename Value="../../Process/Align/AlignVars.pas"/>
<IsPartOfProject Value="True"/>
</Unit100>
<Unit101>
<Filename Value="../../Process/Align/AlignTypedef.pas"/>
<IsPartOfProject Value="True"/>
</Unit101>
<Unit102>
<Filename Value="../../Process/Align/AlignComment.pas"/>
<IsPartOfProject Value="True"/>
</Unit102>
<Unit103>
<Filename Value="../../Parse/PreProcessor/PreProcessorExpressionParser.pas"/>
<IsPartOfProject Value="True"/>
</Unit103>
<Unit104>
<Filename Value="../../Process/Spacing/RemoveSpaceAtLineEnd.pas"/>
<IsPartOfProject Value="True"/>
</Unit104>
<Unit105>
<Filename Value="../../Process/Transform/FindReplace.pas"/>
<IsPartOfProject Value="True"/>
</Unit105>
<Unit106>
<Filename Value="../../Process/Returns/ReturnsAfterFinalEnd.pas"/>
<IsPartOfProject Value="True"/>
</Unit106>
<Unit107>
<Filename Value="../../Parse/PreProcessor/PreProcessorParseTree.pas"/>
<IsPartOfProject Value="True"/>
</Unit107>
<Unit108>
<Filename Value="../../Process/Returns/RemoveConsecutiveReturns.pas"/>
<IsPartOfProject Value="True"/>
</Unit108>
<Unit109>
<Filename Value="../../Process/Transform/UsesClauseFindReplace.pas"/>
<IsPartOfProject Value="True"/>
</Unit109>
<Unit110>
<Filename Value="../../Process/Transform/UsesClauseInsert.pas"/>
<IsPartOfProject Value="True"/>
</Unit110>
<Unit111>
<Filename Value="../../Process/Transform/UsesClauseRemove.pas"/>
<IsPartOfProject Value="True"/>
</Unit111>
<Unit112>
<Filename Value="../../Settings/SetComments.pas"/>
<IsPartOfProject Value="True"/>
</Unit112>
<Unit113>
<Filename Value="../../Process/TreeWalker.pas"/>
<IsPartOfProject Value="True"/>
</Unit113>
<Unit114>
<Filename Value="../../Process/Transform/AddBlockEndSemicolon.pas"/>
<IsPartOfProject Value="True"/>
</Unit114>
<Unit115>
<Filename Value="../../Process/Transform/AddBeginEnd.pas"/>
<IsPartOfProject Value="True"/>
</Unit115>
<Unit116>
<Filename Value="../../Settings/SetTransform.pas"/>
<IsPartOfProject Value="True"/>
</Unit116>
<Unit117>
<Filename Value="../../Process/Align/AlignField.pas"/>
<IsPartOfProject Value="True"/>
</Unit117>
<Unit118>
<Filename Value="../../Process/Transform/SortUses.pas"/>
<IsPartOfProject Value="True"/>
</Unit118>
<Unit119>
<Filename Value="../../Settings/SetAsm.pas"/>
<IsPartOfProject Value="True"/>
</Unit119>
<Unit120>
<Filename Value="../../Process/Returns/RemoveReturnsAfter.pas"/>
<IsPartOfProject Value="True"/>
</Unit120>
<Unit121>
<Filename Value="../../Process/Indent/IndentAsmParam.pas"/>
<IsPartOfProject Value="True"/>
</Unit121>
<Unit122>
<Filename Value="../../Utils/JcfStringUtils.pas"/>
<IsPartOfProject Value="True"/>
</Unit122>
<Unit123>
<Filename Value="../../Process/Spacing/MoveSpaceToBeforeColon.pas"/>
<IsPartOfProject Value="True"/>
</Unit123>
<Unit124>
<Filename Value="../../Utils/JcfSystemUtils.pas"/>
<IsPartOfProject Value="True"/>
</Unit124>
</Units>
</ProjectOptions>
<CompilerOptions>
<Version Value="11"/>
<SearchPaths>
<IncludeFiles Value="../../Include"/>
<OtherUnitFiles Value="../../Output/Lazarus"/>
<UnitOutputDirectory Value="../../Output/Lazarus"/>
<SrcPath Value="../../Include"/>
</SearchPaths>
<Parsing>
<SyntaxOptions>
<CStyleOperator Value="False"/>
<UseAnsiStrings Value="False"/>
</SyntaxOptions>
</Parsing>
</CompilerOptions>
</CONFIG>
| 2024-05-02T01:26:18.401715 | https://example.com/article/8522 |
Urinary dopamine sulfate: regulations and significance in neurological disorders.
Dopamine-3-O-sulfate (DA-3-O-S) and dopamine-4-O-sulfate (DA-4-O-S) are important end products of L-dopa metabolism. Therefore they may give indications of disturbances in the peripheral metabolism of catecholamines, when measured in urine samples of patients with Parkinson's disease (PD). In addition, information about the reliability of DA sulfatation after L-dopa therapy may be of significance for its role in the elimination of DA from the peripheral nervous system. Although DA-3-O-S appears to be the predominant sulfo-conjugate in urine, there are no changes in PD nor in depression syndrome compared to controls with or without other neurological disorders. By contrast, DA-4-O-S is significantly decreased in de novo PD subjects. However, a similar reduction is notable in patients with other neurological disorders. In depressed persons the loss of this compound was less pronounced as compared to de novo PD. Treatment with combined L-dopa therapy caused increased excretion of DA-3-O-S, while changes in DA-4-O-S were only marginal. It is concluded that urinary DA-3-O-S cannot be used as marker for PD, while DA-4-O-S is significantly reduced in a variety of neurological disorders and in particular in de novo PD. Further studies are necessary to elucidate its role as possible peripheral marker to distinguish preclinical PD and depression syndrome. | 2023-08-09T01:26:18.401715 | https://example.com/article/3243 |
WEBVTT NOT ONLY DANGEROUS... IT'S AGAINST THE LAW. BUT THE HEAD OF LOUISVILLE'S POLICE'S TRAFFIC UNIT... SAYS THERE'S A MUCH MORE DANGEROUS DISTRACTION THAT MOST OF US DO EVERY DAY. WLKY'S INVESTIGATIVE REPORTER DUANE POHLMAN IS HERE WITH A CLOSE LOOK AT THE OTHER FATAL DISTRACTION... DUANE... TO READ THE AVERAGE TEXT... IT'LL TAKE YOU MORE THAN 4 SECONDS... 4 SECONDS WITH YOUR EYES "OFF" THE ROAD. BUT - ACCORDING TO POLICE - YOU ARE DISTRACTED MUCH LONGER.... JUST TO MAKE A CALL. DON'T BELIEVE ME? WATCH THIS. IF POLICE CATCH YOU... 23:58:52 DOG B AND FIFTH STOP LOOKING DOWN. LOOKING UP. LOOKING DOWN. LOOKING UP. TEXTING... 23:49:35 THIRD STOP B AND FORTH STOP "SHE'S TEXTING AWAY AT HER CELLPHONE." WHILE DRIVING... 23:40:22 - THIRD STOP THIS GUY'S TEXTING ON HIS PHONE YOU "WILL" 23:15:40 - FIRST STOP POINTS TO PULL OVER GET A TICKET. 23:51:19DOG B AND FIFTH STOP RIPS TICKET 23:30:19SECOND STOP I'M GOING TO ISSUE YOU A CITATION. TARGETED "TEXTING" PATROLS - LIKE THIS ONE ARE ROAMING IN LOUISVILLE - INCLUDING A RECENT 3-MONTH CRACKDOWN. 23:02 LT SEELYE WE WROTE 349 CITATIONS AND OF THOSE 349, 156 OF THOSE WERE SPECIFICALLY TEXTING. THE REASON FOR THE CRACKDOWN IS CLEAR... TEXTING CAN BE A FATAL DISTRACTION. 30:34 LT SEELYE THE AVERAGE TEXT TAKES ABOUT 4 AND A HALF SECONDS TO READ. TRAVELING AT 55 MILES AN HOUR - YOU'D TRAVEL A LOT OF TURF WHILE TEXTING. 32:06 LT SEELYE BY THE TIME YOU'RE DONE READING THAT TEXT, YOU'VE TRAVELED THE LENGTH OF THAT FOOTBALL FIELD. 50:43 LT SEELYE THAT QUICK TO HIT THE BRAKE IN FRONT OF ME WITH YOU TEXTING BEHIND ME. YOU CAN'T SEE THAT. BUT - ACCORDING TO THE HEAD OF LMPD'S TRAFFIC UNIT - A MUCH MORE COMMON USE OF THAT SMART PHONE IS ACTUALLY TWICE AS DISTRACTING - AND TWICE AS DANGEROUS - AS TEXTING. 32:12 LT SEELYE THE AVERAGE PHONE CALL - IT APPEARS- THROUGH THE SMART PHONE, TAKES TWICE THAT. THAT'S RIGHT... LT. JOE SEELYE SAYS USING YOUR SMART PHONE - AS WELL... A PHONE --- TO DIAL - IS EVEN MORE DISTRACTING THAN THE NOW OUTLAWED TEXTING WHILE DRIVING. I WAS SKEPTICAL... ...SO, LT. SEELYE CHALLENGED ME. 1:00:34 LT SEELYE 2 READY. GO. TIMING ME TO CALL SOMEONE ON MY IPHONE... 1:00:38 LT SEELYE 2 I HAVE A PASSCODE. I NAVIGATED SCREEN LOCKS... AND CONTACT LISTS TO FIND THE PERSON I WANTED TO CALL... 1:01:10 "SCOTT'S NUMBER...." AND THAT SMART PHONE DEMANDED MY CONCENTRATION... AND LOTS OF TIME. 1:01:30 ALRIGHT. 18 SECONDS 4 TIMES LONGER THAN WHAT IT TAKES TO READ THE AVERAGE TEXT. IF I WAS DRIVING... THAT MEANS MY SIMPLE CALL TO A FRIEND DISTRACTED ME FROM THIS... FOR 18 FULL SECONDS. THIS TIME, AT 55 MILES PER HOUR... ... I WOULD HAVE TRAVELED 4 FOOTBALL FIELDS... THAT'S A LOT OF DISTANCE FOR A DISTRACTION... WHEN THINGS GO WRONG OUT HERE - IN A HURRY. 30:20 LT. SEELYE SNAP THAT QUICK LT. SEELYE SAYS HE AND HIS FAMILY HAVE A RULE ABOUT SMART PHONES IN THE CAR... 42:24 PUT 'EM UP. TURN 'EM OFF. IF YOU NEED TO USE IT TURN IT ON. PULL OVER ON THE SIDE OF THE ROADWAY. LT. SEELYE SAYS IT'S CLEAR - NOT JUST TEXTING - BUT DIALING AND TALKING ON A SMART PHONE CAN TURN IN TO A FATAL DISTRACTION IN A HURRY... 42:15 I WOULD DEFINITELY LIKE TO SEE IT HANDS FREE. SOME TYPE OF HANDS FREE LAW. I THINK IT WOULD HELP US OUT. SAVE LIVES. LT. SEELYE SAYS HE DOES NOT WANT TO LEGISLATE... HIS JOB IS TO ENFORCE THE LAWS. BUT HE SAYS IT'S IMPORTANT TO REMEMBER THERE'S MORE THAN JUST TEXTING... WHEN IT COMES TO "FATAL DISTRACTIONS." I'M DUANE POHLMAN. WLKY | 2024-05-13T01:26:18.401715 | https://example.com/article/3520 |
/*
* Copyright (C) 2013 Apple Inc. All rights reserved.
*
* Redistribution and use in source and binary forms, with or without
* modification, are permitted provided that the following conditions
* are met:
* 1. Redistributions of source code must retain the above copyright
* notice, this list of conditions and the following disclaimer.
* 2. Redistributions in binary form must reproduce the above copyright
* notice, this list of conditions and the following disclaimer in the
* documentation and/or other materials provided with the distribution.
*
* THIS SOFTWARE IS PROVIDED BY APPLE INC. AND ITS CONTRIBUTORS ``AS IS''
* AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO,
* THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
* PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE INC. OR ITS CONTRIBUTORS
* BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
* CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
* SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
* INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
* CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
* ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
* THE POSSIBILITY OF SUCH DAMAGE.
*/
.sidebar > .panel.details.css-style .rules .label {
font-size: 11px;
font-family: "Lucida Grande", sans-serif;
color: rgb(60%, 60%, 60%);
text-shadow: white 0 1px 0;
padding: 0 10px;
}
.sidebar > .panel.details.css-style .rules .label .go-to-link {
color: inherit !important;
}
.sidebar > .panel.details.css-style .rules .label + .style-declaration-section {
margin-top: 5px;
}
.sidebar > .panel.details.css-style .rules .new-rule {
font-size: 12px;
font-family: "Lucida Grande", sans-serif;
font-weight: bold;
color: black;
text-shadow: white 0 1px 0;
padding: 5px 10px;
margin-bottom: 8px;
margin-top: -5px;
opacity: 0.5;
}
.sidebar > .panel.details.css-style .rules .new-rule img {
content: url(Images/Plus.svg);
width: 13px;
height: 13px;
vertical-align: -2px;
margin-right: 6px;
}
.sidebar > .panel.details.css-style .rules .new-rule:hover {
opacity: 0.6;
}
.sidebar > .panel.details.css-style .rules .new-rule:active {
opacity: 0.7;
}
| 2023-12-14T01:26:18.401715 | https://example.com/article/5898 |
The evangelical Christian take on masturbation is usually pretty simple: Don’t do it. Don’t touch yourself. Don’t even think about touching yourself. There’s something wrong with you if you do it. Pastor Mark Driscoll even went so far as to say it basically amounted to homosexuality (*gasp*) because it was a sexual act that didn’t involve a woman and did involve you touching a penis.
But that’s all referring to male masturbation. They typically don’t even want to acknowledge that women may want to touch themselves, too.
So I was pleasantly surprised to see Jordan Monge‘s article in Christianity Today in which she discusses female masturbation. Finally, a sensible take on the matter, right?
Not even close.
While she deserves some credit for admitting that women have sexual desires just like men, Monge paints masturbation as simply a “struggle with lust” rather than as a natural, normal, useful thing to do.
We must treat lust like other sins — not a way we act out as a consequence of other problems in our lives — but as a sin requiring us to learn the discipline of self-control that we must master if we ever hope to be the women God made us to be.
Because every time a woman touches herself, Baby Jesus cries.
The worst part may be when she invokes the “wisdom” of Pastor John Piper to make her readers “more Christ-centered, self-controlled” people:
A — Avoid tempting situations as much as possible. N — Say no to lustful thoughts in five seconds. T — Turn the mind toward Christ as a superior satisfaction. H — Hold the promise and pleasure of Jesus in your mind to drive other thoughts out. E — Enjoy a superior satisfaction in Christ. M — Move into a useful activity away from idleness and other vulnerable situations.
Did you catch all that?
Avoid anything that’ll make you think about sex. Which, in our society, is everything.
Don’t allow yourself to have any thoughts about sex. Think of Jesus instead!
Jesus will make you feel better than an orgasm.
Think of Jesus so you stop thinking about other men.
Jesus will make you feel amazing.
Do something that’ll make you stop thinking about sex. Like worshiping Jesus.
Dammit! None of that works! (Really, though, if you want to kill your libido, thinking about John Piper might just do the trick…)
Anyway, I came up with an alternative, sex-positive mnemonic:
A — Allow yourself to fantasize freely.
N — Never let anyone tell you that your sexual thoughts are shameful.
T — Thought crimes are not crimes.
H — Have fun!
E — Experiment with your body and find out what makes you happy.
M — Monge’s advice should be tossed aside like a used Kleenex.
(I was going to shuffle up that order and make it say “Hemant” but, again, didn’t want to kill your libido.)
It’s just awful advice with the intention of shaming women for doing something that’s completely natural and doesn’t hurt anybody. It’s in part because of this kind of sex-negativity that young Christians are leaving the church — they know the sex advice that people like Monge and Piper offer is pure bullshit.
Here’s evangelical thinking about sex in a nutshell: You shouldn’t have pre-marital sex because it’s sinful. You shouldn’t masturbate because it’s sinful. You shouldn’t have sexual thoughts because it’s sinful. And while we’re at it, let’s just teach abstinence-only sex education, because educating Christians about what sex is and how it works and how to have it as safely as possible would only give them ideas… and we can’t have them thinking now, can we?
This is also the sort of thinking that makes evangelicals more homophobic than the rest of society. When they think of LGBT people, all they think about is sex. Not love, not family, not community, just sex. And sex is bad. Always bad. Unless you’re married, but gay people shouldn’t be allowed get married, because that might lead to gay sex, and, as stated earlier, that’s bad.
Look, there may be problems connected to masturbation, but none of them are mentioned in Monge’s piece.
Everything she’s worried about is so completely unrealistic and unhealthy and unreasonable. She paints sexual desire as part of the problem when she’d be far better off focusing on positive ways to channel that desire. And as far as those options are concerned, masturbation ought to be at the top of the list.
The only time Jesus even needs to be mentioned is near the very end of the act.
(Image via Shutterstock)
| 2023-12-27T01:26:18.401715 | https://example.com/article/5906 |
Q:
Disregarding the ConditionalExpression in the output of Solve
I am trying to write a program in Mathematica that will perform basic uncertainty analysis for me and "show the work," so to speak. One of the pieces of this program will involve taking in an expression and list of variables, say,
myexpr = w == 2 y Cos[x] + z^2
myvaris = {x, y, z, w}
and solving the expressions for the first variable in the list, e.g.
Solve[myexpr, myvaris[[1]]]
which outputs
{{x -> ConditionalExpression[-ArcCos[(w - z^2)/(2*y)] + 2*Pi*C[1],
Element[C[1], Integers]]},
{x -> ConditionalExpression[ArcCos[(w - z^2)/(2*y)] + 2*Pi*C[1],
Element[C[1], Integers]]}}
which is all good and correct. But what I would like to obtain is just something like
{x -> ArcCos[(w - z^2)/(2*y)]}
without all the conditional expression business, because its presence wrecks the form of the output I'd like. In particular, what I want in the end is something I can pass to TeXForm which will go into a StringForm to output a chunk of LaTeX. Is it possible to construct something like this (and if so how), or am I asking a question which cannot be solved in pure generality?
To be clear, I'm not asking how to eliminate the particular occurrences of ConditionalExpression in the output above, but to eliminate all instances of such a ConditionalExpression and arbitrary constants in general, without having to manipulate by hand any intermediate results. I'm not really concerned with the output being reliably correct or complete in the end; I just want the expression that a naive high school algebra student would write down.
A:
You can set all generated parameters to 0 with:
Solve[myexpr,myvaris[[1]],GeneratedParameters->(0&)]
{{x->-ArcCos[(w-z^2)/(2 y)]},{x->ArcCos[(w-z^2)/(2 y)]}}
| 2024-05-25T01:26:18.401715 | https://example.com/article/3155 |
Q:
Three20 Image Gallery - Shows Oversized Image, Then Focuses
I have used the Three20 Framework to setup an image gallery in my iPhone App. I am sending in the specific width and height for each image, but when I view the individual images, they load at a slightly oversized size, they are a bit pixelated, and then they focus down to the correct size/ratio.
Most of the images are 300 x 400 and I am sending in 300 x 400 and the width and height, so when I view in landscape mode, I would expect the images to appear smaller than the overall screen, or to size-up to fill the screen.
Any ideas why I am getting larger images that size-down after they are fully loaded?
A:
if you are in landscape and passing 300x400, then it loads the image at 300x400 then does the scale to landscape (which is 480x300 max possible) after it has loaded completely (and therefore the controller knows its size from the image itself).
| 2023-08-14T01:26:18.401715 | https://example.com/article/6880 |
The goal of the proposed research is to understand the effects of ethanol exposure on neural systems responsible for the control of goal-directed actions and habit formation. Ethanol addiction is associated with a wide range of behavioral and cognitive deficits. While much progress has been made on the pharmacological targets mediating ethanol action on the brain, little is known about the adaptations resulting from ethanol addiction at the level of neural systems. So far, the majority of research on the effects of ethanol on goal-directed behavior has focused on alcohol self-administration paradigms. Rather neglected is the question of how ethanol affects the neural systems underlying normal reward-guided behavior. To understand the neuroadapative mechanisms responsible for the addictive properties of ethanol, we must first understand how it affects the normal mechanisms underlying reward-guided behavior in general. More specifically, little research has been conducted on the effects of ethanol on the striatum, a key structure in the control of voluntary behavior that has been implicated in habit formation and addiction as a result of recent research. Consequently, not much is known about how ethanol can change striatum-dependent learning and behavior. In this proposal it is hypothesized that exposure to ethanol (using the ethanol vapor chamber procedure) can usurp normal learning processes in the striatum that are engaged in automatization of skills and habit formation to have significant impact on the subsequent control of reward- guided behavior. Accordingly, three specific aims are proposed: 1) To determine the effects of prior ethanol exposure on striatum-dependent learning and behavior. 2) To determine the effects of prior ethanol exposure on striatal neural activity in awake behaving mice during instrumental learning. 3) To determine the effects of prior ethanol exposure on striatal synaptic transmission ex vivo using whole-cell patch clamp recording. This proposal employs an innovative and integrative approach in studying ethanol actions on the brain, by combining in vivo and ex vivo electrophysiological methods with powerful assays from the study of instrumental learning. Results from the proposed experiments will help us understand the neuroadaptive mechanisms in the cortico-striatal circuits that mediate the acquisition and control of goal-directed actions and habit formation. Such mechanisms can provide novel targets for the treatment of alcohol addiction. [unreadable] [unreadable] PUBLIC HEALTH RELEVANCE: Recent work has suggested a critical role for the dorsal striatum in habit formation. As a consequence, the involvement of different striatal regions in addiction is now becoming a focus of research. However, it is not clear how alcohol affects the neural circuits underlying habit formation. Results from the proposed studies will significantly advance our understanding of how exposure to alcohol can usurp plasticity mechanisms normally engaged in habit formation to promote to alter the control of voluntary behavior. Such knowledge can potentially lead to better treatment options that are specifically targeted at the physiological processes responsible for the development of habitual and compulsive alcohol seeking behavior. [unreadable] [unreadable] [unreadable] | 2024-06-14T01:26:18.401715 | https://example.com/article/9490 |
Totally Geeky or Geek Chic? Space Invaders Necklace
Devoted geeksugar reader calamari seemed rather intrigued by these bright yellow and pink Space Invader necklaces, noting they are "gosh darn cute." I have to agree with him there. The Space Invaders video game was initially released in its native Japan in 1978, but still tops many lists as one of the most influential video games ever created. What better way to commemorate the game and our love for geek jewelry than with colorful, feminine Invaders of our own? The piece costs about $30. | 2024-04-26T01:26:18.401715 | https://example.com/article/7147 |
The Maillard reaction and its control during food processing. The potential of emerging technologies.
The Maillard reaction between reducing sugars and amino acids is a common reaction in foods which undergo thermal processing. Desired consequences like the formation of flavor and brown color of some cooked foods but also the destruction of essential amino acids and the production of anti-nutritive compounds require the consideration of the Maillard reaction and relevant mechanisms for its control. This paper aims to exemplify the recent advances in food processing with regard to the controllability of heat-induced changes in the food quality. Firstly, improved thermal technologies, such as ohmic heating, which allows direct heating of the product and overcoming the heat transfer limitations of conventional thermal processing are presented in terms of their applicability to reduce the thermal exposure during food preservation. Secondly, non-thermal technologies such as high hydrostatic pressure and pulsed electric fields and their ability to extend the shelf life of food products without the application of heat, thus also preserving the quality attributes of the food, will be discussed. Finally, an innovative method for the removal of Maillard reaction substrates in food raw materials by the application of pulsed electric field cell disintegration and extraction as well as enzymatic conversion is presented in order to demonstrate the potential of the combination of processes to control the occurrence of the Maillard reaction in food processing. | 2024-01-13T01:26:18.401715 | https://example.com/article/6932 |
Carpet Steam Cleaning, Winston-Salem, NC
Carpet Steam Cleaning, Winston-Salem, NC
Remember what your carpets used to look like with our carpet steam cleaning services at your home or business in Winston-Salem.
Do you want your carpets to look new again, but you aren’t ready to invest the money needed to replace them? Our carpet steam cleaning services can bring new life to the carpets at your home or business in Winston-Salem, North Carolina. Carpet steam cleaning is sometimes known as the hot water extraction method.
Here at Steam Source, we have specially designed a carpet cleaning process with 10 careful steps for the ultimate clean:
It all starts in our truck where hot water is mixed with our cleaning solution. We only use cleaning solutions that are safe for your family and others who use your building.
We will move your furniture free of charge, as long as it is furniture that can be moved by two men.
This solution is injected deep into your carpets, where it breaks apart all the dirt and grime that have built up in your carpet over time.
Once the solution has loosened the dirt, our powerful vacuum extractor pulls the water, the cleaning solution and all the dirt and grime away from your carpet and into a holding tank in our truck. This vacuum is powerful enough to remove 95% of the water, which decreases the time needed for your carpets to fully dry.
We will put your furniture back, placing foam blocks or plastic discs underneath it to protect it while your carpet dries.
Beyond carpet steam cleaning, we also offer rug cleaning, carpet stretching and repair, stain and odor removal and carpet protector application. Give us a call today, and we can schedule an inspection of your carpets and upholstery. | 2023-11-19T01:26:18.401715 | https://example.com/article/7708 |
An entertaining peek into Kondo's prescriptive techniques, the show features some striking transformations: Rooms that were once piled high with toys, books, and knickknacks are totally cleared; floors once buried underneath piles of clothes valiantly reemerge. If these before-and-afters have you itching to clean your own space in the name of joy, here are four things to avoid to help you stay on track:
1. Think of it as a chore.
Most of us tidy in quick, short spurts. We take a few minutes to sort through our fridge when it gets overrun with food or edit our bookcases when there's no room for any new titles. These contained bursts of decluttering aren't as effective, according to Kondo, since they tend to feel like chores. Instead, Kondo recommends doing what she calls "special event tidying," in which you dedicate all your energy to cleaning your home until the job is done. "It is crucial to tackle this job within a short space of time while your spirits are uplifted," Kondo writes in The Life-Changing Magic of Tidying Up.
Make it a more enjoyable experience by putting on your favorite playlist, lighting a candle, and visualizing how much better you'll feel in your new space.
2. Keep trash bags of stuff lying around your house.
Once you ask the million-dollar question—"Does it spark joy?"—of all of your items, chances are you're going to have piles and piles of stuff that you're ready to let go of. Instead of allowing it to sit around for a few days, Kondo recommends getting it out of the house right away.
That doesn't mean you need to throw everything in the trash, though! Before you get started decluttering, make a list of places near you that you know will accept secondhand items (here are some you might not have thought of) so you can just load up your stuff and go once the job is done.
Article continues below
3. Discard things without thanking them.
While it might seem weird to express gratitude for inanimate objects, there's a reason Kondo has all of her clients thank the items they're getting rid of: It fosters an appreciation that makes people less likely to think of their belongings as disposable. By really acknowledging the purpose and utility of everything, you'll be more likely to treat your belongings with respect and be more critical of the new stuff you are allowing into your home moving forward.
4. Put all the pressure on yourself.
If you share your home with loved ones or roommates, it should be everyone's responsibility to keep it clean. "You're living together, so it's important for everyone to maintain their space," Kondo says on her show. She tells one mom who is having trouble delegating decluttering duties to her husband and kids that giving everyone one room that they alone are responsible for tidying is the only way to keep everyone accountable.
And with that primer, you should be ready to start the process of getting your home in order, which, according to Kondo, is the first step in getting the rest of your life in order too. | 2023-10-21T01:26:18.401715 | https://example.com/article/5977 |
TARGET = init
SRC_CC = main.cc
LIBS = base
INC_DIR += $(PRG_DIR)
CONFIG_XSD = config.xsd
# statically link sandbox library to avoid dependency from sandbox.lib.so
SRC_CC += library.cc child.cc server.cc
INC_DIR += $(REP_DIR)/src/lib/sandbox
vpath %.cc $(REP_DIR)/src/lib/sandbox
| 2023-10-02T01:26:18.401715 | https://example.com/article/7479 |
Tattoo insurance for business
Having your own business is usually great but it can be stressful as well. Little is likely to be more stressful than being on the receiving end of a claim for damages and then finding that you don’t have the appropriate tattoo insurance for business in place.
What are the risks?
Sadly, there are quite a few of them.
Your business involves, quite literally, people contact. Whenever you deal with people directly there are risks involved. Just a sample of these may include:
customers that suffer injury or illness they attribute to your activities (professional liability insurance); customers or members of the public who suffer injury on your premises or as a result of it such as a falling roof slate or tripping on a raised carpet (public liability insurance) a customer who suffers injury as a result of one of your products (product liability insurance); an employee who suffers injury while working on your behalf (employers’ liability insurance); business premises and equipment destroyed by natural disaster such as a flood or fire (commercial buildings insurance and office insurance). The list could be continued but the message may be clear – your tattoo business may be at risk unless you have tattoo insurance in place and, if necessary, commercial buildings insurance.
Is business tattoo insurance worthwhile?
It’s an old truth that insurance is never worthwhile – until about 5 seconds after you’ve had a major problem. In the cases above that involve personal injury, court awards following even relatively moderate instances of injury can be staggeringly high and potentially ruinous without insurance protection – unless of course you have hundreds of thousands of pounds laying around spare!
It may also be worth keeping in mind that you may have liability for people working on your behalf even if they are not ‘employees’ as such. Temporary or contract workers or even a friend lending a hand may involve you in serious risk if they are hurt in the process.
If you are employing people you may find that employers’ liability insurance is a legal requirement. If in any doubt it may be worthwhile taking specialist advice – being legally liable for an injury and in contravention of the law may not be a lot of fun!
Does it cost a lot?
The various forms of insurance protection outlined above can typically be purchased for realistic sums. That is certainly the case when the cost is compared to the costs that may be awarded against you following a successful claim.
Finding out more about tattoo business insurance may be smart move.
TATTOO PARLOUR INSURANCE TIPS
Taking out tattoo parlour insurance may not be as simple as taking out a standard policy. If you run your own tattoo parlour then you already know that you are responsible for a specialised business providing specialist services. So, you may find that you need insurance that looks at your specialist needs as well as the standard levels of cover such as buildings and contents insurance.
Working out what you need from your insurance policy may seem complicated but it doesn’t have to be that difficult. As with any commercial insurance policy you will need certain types of standard cover to insure you against damage, loss or theft. In general terms your buildings and contents cover may give you enough protection to get going.
But, this may not be enough to protect all of your business. The following tattoo parlour insurance tips may be worth thinking about: | 2023-10-20T01:26:18.401715 | https://example.com/article/1994 |
"Previously on AMC's The Walking Dead..." "Yo, is someone in there?" "We're just looking for a friend." "Get out of here!" "We gotta go!" "Roamers are everywhere!" "I'm sorry!" "We can't leave him!" "We give him a canteen, take him out to the main road, send him on his way." " He knows where we are." " He's not a threat." "James thinks I'm his." "He thinks the baby is his." "He is dangerous." "I thought we were going further." "We are." "18 miles out." "So why are we stopping?" "I wanted to talk." "Been waiting a week till we were gonna do this." " I just wanna talk." " We don't need to." "We do." "No man, we don't." "We're doing this." "I get it." "He was passed out when y'all brought him back, doesn't know where the farm is." "That isn't what I need to talk to you about." "I heard what really happened at the school." "Was it to survive?" "Yeah." "One of us wasn't gonna make it out." "It had to be him." "One shot to the leg, Carl lives." "Reality is..." "He had no business being here" "There." "Whatever." "You don't think I would've done it?" "No, man, I know you wouldn't have." "You don't think I can keep Lori or Carl safe?" "I didn't say that." "Or my baby?" "Is it gonna have to be me too?" "Rick, you can't just be the good guy and expect to live." "Okay?" "Not anymore." "I'm not the good guy anymore." "To save Carl's life," "I would've done anything-- anything." "Now Lori says you're dangerous, but you're not gonna be dangerous." "Not to us, not to me, not anymore." "How about you look at me?" "You and Lori" "I get what happened." "When I figured it out-- and I figured it out pretty quickly" "I wanted to break your jaw, let you choke on your teeth." "But I didn't." "That wasn't weakness." "It took everything." "That is my wife." "That is my son." "That is my unborn child." "I will stay alive to keep them alive." "You don't love her." "You think you do, but you don't." "Now the only way you and me keep on..." "Is that you accept everything I just said right here, right now, and we move forward with that understanding." "When it started it was just" "It was a couple of weird stories on the news." "Then-- then it was so quick." "Everything-- It just happened." "Two weeks later, I'm in the hospital and there were soldiers shooting people in the halls." "They were shooting people, man, not walkers." "Then the walkers came through." "You know, I tried to get you out," "I tried, but we weren't gonna make it." "Man, there was no way and I knew it." "But I couldn't live with it." "I couldn't live, knowing" "But I had to." "I didn't keep Lori and Carl alive, man." "They kept me alive." "I want you to know that I didn't look at her before that." "Brother, if I could take it all back, I would." "I wanna check the ropes." "It's all good." "Rick say anything to you about Glenn when they got back from town?" "Just that it had gotten pretty bad." "He's not the same." "Says he froze." "Blames me." "Says I got inside his head." "He came back-- that's what matters." "Men have to do certain things-- You know that" "And they're either gonna blame the little woman as the reason they do 'em or the reason they don't." "I'll tell you something-- what happens out there happens out there." "And we-- we're just trying to keep it together till they get back." " Things were good." "Maybe I" " Glenn's a big boy." "He makes his own choices, and then you-- do you have anything to apologize for?" "Tell him to man up and pull himself together." "Just don't say "man up."" "It never goes well." "Let me just get this to Beth." "You go on-- I got it." "We've gotta start using our knives more." "If there's one walker, we use our knives." "We keep things quiet." "We save ammunition." "Yeah." "We need dry goods ahead of the winter" "Warm clothes... fuel." "Maybe we get a break." "You gotta think the cold affects them." "If it doesn't kill 'em, it's gotta slow 'em down." "The second week of January last year, we got all that snow and ice." "My cousin got stuck on 85 for 24 hours." "Sitting in his car with a birthday cake for his girlfriend at Georgia tech." "He just sat and ate birthday cake and listened to the "Lord Of The Rings" book on tape." "We get lucky, we get the same winter as last year." "By December, it's a different world." "Safer." "Maybe we find some snowmobiles to make runs." "That sounds good." "Knock knock." "How about this-- You, uh" "You eat up all your food, we'll get you up and out of here and go take a walk." "What do you say?" "It'll do good to be outside." "You're pregnant." "How could you do that?" "Uh, I don't really have a choice." "You think it'll make a difference?" "Of course it will." "You eat something." "It's more than 18." "Yeah, I'm looking for a place." "A place for what?" "Give him a fair shake." "A shot." "There." "This'll do." "We'll leave the boy here and scavenge some supplies." "Over there." "Wait." "Like I said." "Gun's quick, easy, but other ways to do this." "One more." "Your turn." "Hey, Rick." "I don't see any bites." "Gotta be scratches then" "This one's hand, other one's cheek." "They had walkers here-- burned bodies down the hill." "I guess it gotta be scratches then, huh?" "Couldn't eat a thing, huh?" "You're gonna" "Hey." "I know how hard it is." "I tried for days to reach my mom, and get her on the phone." "I can only assume-- It's just so pointless." "Oh." "You have Maggie, and your father, Patricia and Jimmy." "And you've gotta stay strong for them." "I wish I could promise you it would be all right in the end." "I can't, but we can make now all right..." "And we have to." "Thank you." "I'll be right back." "We'll go take that walk." "Beth?" "You give it to me, sweetheart." "You don't wanna do this." "Andrea, have you seen Maggie or Hershel?" "I haven't seen Hershel, but I saw Maggie and Glenn walk by" " maybe 20 minutes ago." " Could you find her for me?" "I've gotta get back to the house." "Of course." "Sorry." "Oh." "The hell is this?" "Oh, come on, don't be stupid." "I owe you guys." "I can help protect what you've got." "Why would you save my life just to kill me by leaving me here?" "One guy-- one guy can't make it alone." "That's why I was with those dudes" " I was alone." "Don't be stupid!" "I'm not like them!" "I'm just some guy!" "I used to watch football and screw around on the Internet." "I lived with my mom!" "I lost her like you lost people." "I went to school with Maggie for God's sake!" "I went to church." "I rode the bench on varsity baseball." "You went to school with Maggie?" "You go to school with Maggie?" "Answer the question!" "Did you go to school with Maggie?" "I-- it-- she didn't know me." "Didn't even know I existed." "I mean, I knew her." "I knew who her dad was." "There is no way I would ever do anything" " to hurt her or her family." " Jesus." "Or you-- or your people!" "I'm not like the guys I was with!" "He knows where the farm is, Rick." "Where we are-- he knows." "Say he finds his way back to his people..." "Shane, no!" "Not now-- just not now!" "Well, when, Rick?" "When?" "When I've had a chance to think about it." "Don't let him kill me." "Please don't." "Shut up!" "We're going back." "It's a man's life." "I need a night to think it through." "You're gonna bring this piece of garbage-- this piece of garbage who-- he shot at you, Rick." "He ran with men who tried to kill you." "You gonna bring him back to where Lori sleeps?" "To where Carl sleeps?" "He'll be locked up in the barn," " unless you bust it open." " Oh, don't start that shit." " I'm taking the night." " Man, you take that-- you think on it, Rick." "Keep struggling with it." "It ain't hard, man." "The right choice is the one that keeps us alive." "It's always the same with you." "It's like the first moment-- it's whenever you're put to the test." "Stop acting like you know the way ahead, like you know the rules." "There are no rules, man." "We're lost." "No-no-no, man." "I know exactly where I am." "You don't know shit anymore." "I don't think you can do it, Rick." "It's my call, man." "I don't think you can keep them safe." "Ah!" "Damn!" "God!" "No!" "Get off me, man." "You're not doing this!" "You don't get to make these calls anymore." "I won't let you." "Are you crazy?" "What if dad finds out?" "What's he gonna do?" "Kill me for committing suicide?" "Stop being such a brat." "He'd die." "So would I." "This isn't just about you." "We all lost mom." "We'll lose each other and I couldn't stand that." "So you give up?" "Come on, bitch." "Let's see what you got." "Where's Hershel?" "He doesn't want to find out yet." "It's a family affair." "We'll let them work it out." "That's working it out?" "When Beth stops fighting, that's when it's time to worry." "You are being so selfish!" "This could've been handled better." "How so?" "You shouldn't have taken the knife away." " Excuse me?" " You were wrong, like Dale taking my gun." "That wasn't your decision." "She has to choose to live on her own." "She has to find her own reasons." "Want me to tie a noose for her?" "If she's serious, she'll figure out a way." "Doesn't mean I can't stop her or let her know that I care." "That has nothing to do with it, Lori." "She only has so many choices in front of her, and she believes the best one is suicide." " That's not an option." " Of course it is." "She doesn't need to be yelled at or treated like a child." "She needs a loaded gun, right?" "You'll understand if I don't send you in there." "I came through it." "And became such a productive member of the group." "Let Maggie handle this her way." "I contribute." "I help keep this place safe." "The men can handle this on their own." "They don't need your help." "I'm sorry." "What would you have me do?" "Oh, there's plenty of work to go around." "Are you serious?" "Everything falls apart, you're in my face over skipping laundry?" "Puts a burden on the rest of us, on me and Carol, and Patricia and Maggie." "Cooking, cleaning and caring for Beth." "And you-- you don't care about anyone but yourself-- You sit up on that RV, working on your tan with a shotgun in your lap." "No, I am on watch against walkers." "That is what matters, not fresh mint leaves in the lemonade." "And we are providing stability." "We are trying to create a life worth living." "Are you kidding me?" "Look, I went after Rick." "I took down two walkers." " After crashing Maggie's car." " Don't act like you're the only one who can take care of herself." " Ever apologize for that?" "Crashing her" " You're insane." " No, you are." "And you're the one that's self-centered, the way you take it all for granted." "My husband is out there for the hundredth time." "My son was shot." "Don't you dare tell me I take this for granted." "You don't get it, do you?" "Your husband came back from the dead, your son too." "And now you've got a baby on the way." "The rest of us have piled up our losses" "Me, Carol, Beth-- but you just keep on keeping on." " We have all suffered." " Playing house, acting like the queen bee, laying down rules for everybody but yourself." "You know what?" "Go ahead." "Go in there and tell that little girl that everything's gonna be okay, just like it is for you." "She'll get a husband, a son, baby, boyfriend." "She just has to look on the bright side." "Mom would be ashamed to learn she raised such a coward." " What about dad, Beth?" " He's clueless." " He had us waiting for a cure." " He knows he was wrong." "When has dad ever admitted he was wrong?" "He's just telling Rick's group what they want to hear." "And Jimmy?" "We went out for three months and now I'm married to him?" "And me?" "You could do that to me?" "I can't take another funeral." "You can't avoid it." "What are we waiting for?" " We should both do it." " What?" "At the same time." "Help each other." " No." " It's hard to do it." " No one wants to but" " No, please don't." " We can do it so it's peaceful, easy." " Stop talking like that." "Our choice, and then it would be over." "Or we'll be forced to do it when the farm and this house is overrun." " No one can protect us." " That's not true." "Who, Glenn?" "I heard what happened." "Rick will save his family, the others too." "We're alone." "You, me, Patricia, with only dad and Jimmy against a whole world of those things." "I don't wanna be gutted." "I wanna go..." "In this bed, tonight..." "With you beside me." "Please." "Okay." "You want some of that?" "Oh shit." "Hey." "You can't sit on top of her." "I can't leave her by herself." "You're gonna have to." "You're exhausted." "Go get some air." "I'll sit with her." "Go ahead." "Wash up, get something to eat." " I got it." " Okay." "Okay." " Thanks." " Okay." "Aren't you gonna say something?" "Is this what you want?" "The pain doesn't go away." "You just make room for it." " Oh!" " Holy shit." "Where the hell do you think you're going?" "What did you expect me to do?" "Please, just let me go, man." "That's what you came here for." " I'm not gonna tell anyone anything." " Shut up." "You wanna stay here?" "Help the guy that just tried to bash your head in?" "There's 10 roamers there." "You think you can take them on?" "They don't see us." "We can get out of here." "Oh, come on." "Fine!" "But let me have a gun." "I'll help you." "I'll show you." " I can." "I know it." " Let's go." " What?" " He did this." " We're going." " Oh, thank you." "Thank you." "Rick... no, man." "Come back, man." "Beth?" "Beth?" "Beth?" "Maggie?" "She's in there." "I heard glass." "Beth, you all right?" "Don't do this, Beth." "Don't do this." "Open up, please." "God, I left her with Andrea." "Where's a key?" "I don't know." "Beth honey, please open the door." "I'm not mad." "I'm not mad, Beth." "Maggie." "Hang on." "I'm sorry." "T's okay." "Stay there." "Yeah, you like that?" "Shane!" "Run!" "Go for the back door!" "Come on!" "Come on, get in!" "Go, man, go!" "Come on!" "Whoo" " Yeah!" "Hell yeah!" "You see that?" "You see what we did?" "Just keep driving." " Where were you?" " I heard." "Is she all right?" "She would be if you had stayed with her." "Where were you?" " How bad is she?" " It wasn't deep." "She wants to live." "She made her decision." " She tried to kill herself." " No, she didn't." "My father is stitching her wrist right now." "She'll live." "Stay away from her." "From both of us." "Don't you dare step foot inside this house again." "I'm not gonna say she was right, but Beth has made her choice." "She wants to live and now she knows it..." "And sometimes you have to cross the line." "Mmm." "If you wanna kill me, you're gonna have to do better than a wrench." "Probably gonna have to kill that boy," "but I am gonna think about it a night." "It can't be that easy, killing someone, killing anyone." "You know that." "That is my wife." "That is my son." "That is my child." "If you're gonna be with us, you gotta follow my lead, you gotta trust me." "It's time for you to come back." "♪ I am nothing ♪" "♪ without pretend ♪" "♪ I know my thoughts ♪" "♪ can't live with them♪" "♪ I am nothing ♪" "♪ without a man ♪" "♪ I know my thoughts ♪" "♪ but I can't hide them ♪" "♪ I don't need another friend ♪" "♪ when most of them ♪" "♪ I can barely keep up with them ♪" "♪ perfectly able to hold my own hand... ♪" "♪ but I still... ♪" "On the next episode of AMC's The Walking Dead..." "I didn't do anything!" " You shot at my boys, tried to take this farm!" "And you're trying to tell me you're innocent?" "He has got a gun and I'm looking for my friend." " You're just gonna kill him?" " People are scared!" "They need to be safe!" "I owe them that." " Rick's the leader of this group." " We all chase that." "If we do this, the people we worded, the world that we knew is dead!" "Now three episodes left this season." "A special look at a scene from next week's The Walking Dead will be revealed during the first commercial break of Comic Book Men." | 2023-12-25T01:26:18.401715 | https://example.com/article/8601 |
package com.zxin.springboot.controller;
import com.zxin.springboot.bean.Employee;
import com.zxin.springboot.mapper.EmployeeMapper;
import org.springframework.beans.factory.annotation.Autowired;
import org.springframework.stereotype.Controller;
import org.springframework.web.bind.annotation.GetMapping;
import org.springframework.web.bind.annotation.PathVariable;
import org.springframework.web.bind.annotation.RestController;
@RestController
public class EmpController {
@Autowired
EmployeeMapper employeeMapper;
@GetMapping("/emp/{id}")
public Employee getEmp(@PathVariable("id") Integer id){
return employeeMapper.getEmpById(id);
}
}
| 2023-10-19T01:26:18.401715 | https://example.com/article/2083 |
Q:
Cardinality of closed discrete subspace of a Tychonoff space with Countable Chain condition
If $X$ is a Tychonoff space satisfying countable chain condition, then is it possible that $X$ has an uncountable closed and discrete subspace.
A:
Yes. The Sorgenfrey plane is an example: it is ccc since it is separable, and the antidiagonal $\{(x,-x):x\in\mathbb{R}\}$ is an uncountable closed discrete subspace.
| 2024-07-17T01:26:18.401715 | https://example.com/article/2445 |
Many types of flat glasses are being used in various fields such as a window glass, an automobile window screen, a mirror, and the like. A flat glass may be manufactured by various techniques, and among them, a typical technique is a production technique using a float method. For example, a thin glass plane or a glass film for a thin-film-transistor (TFT) display is manufactured primarily by a float method, and a glass manufactured by a float method is called a float glass.
A method for manufacturing a float glass includes a continuous circulation process, and is gaining attention as a typical method for manufacturing a flat glass in that the method is operable discontinuously and permanently, for example, for at least several years almost without interruption as possible.
FIG. 1 is a diagram schematically illustrating a partial construction of an apparatus for manufacturing a float glass according to a related art.
As shown in FIG. 1, a float glass is generally formed using a float bath 10 in which a metal melt M such as a tin melt or a tin alloy melt is stored and circulates. In this instance, a glass melt having a lower viscosity than the metal melt M and being lighter by approximately ⅔ than the metal melt M is continuously supplied into the float bath 10 through an inlet of the float bath 10 via a spout lip 11. Inside the float bath 10, the glass melt G moves to a downstream side of the float bath 10 while the glass melt G is floating and spreading on the metal melt M. In this process, the glass melt G reaches roughly an equilibrium thickness by the effects of its surface tension and the gravity, so a glass strip or ribbon solidified to some extent is formed.
Subsequently, the glass melt is pulled toward an annealing furnace by a lift out roller adjacent to an outlet of the float bath to pass through an annealing process. In this instance, a thickness of a resulting glass may change by adjusting and changing an amount of glass poured through the inlet, a pulling rate determined by a rotation rate of rollers, and a forming means such as top rollers installed in a float chamber.
FIG. 2 is a diagram illustrating a spreading shape of the glass melt poured through the inlet of the float bath according to the related art, when viewed from the top of the float bath. In FIG. 2, an arrow denotes a movement direction of the glass melt.
Referring to FIG. 2, the metal melt M is received by an inner wall 12 of the float bath, and the glass melt G is provided from the spout lip 11 onto the metal melt M. Also, the provided glass melt G gradually spreads in a widthwise direction while moving in a downstream direction of the float bath 10. That is, as seen in the drawing, the glass melt G gradually spreads in upper and lower directions (widthwise direction) of the drawing while moving in a left to right direction of the drawing. In this instance, ends of the glass melt G in the widthwise direction are indicated by ‘a’ in FIG. 2. Like this, the glass melt G moves in the downstream direction while spreading in the widthwise direction in a state that the glass melt G floats on the metal melt M, and in this instance, a spreading shape and a spreading speed of the glass melt G may be determined by a density of glass, an atmospheric gas, a metal melt, a viscosity of glass, an interfacial tension between glasses, and the like.
However, when the spreading speed of the glass melt poured onto the metal melt is low, to manufacture a wide float glass, the problem that the float bath 10 should have a sufficient length is posed. Accordingly, it is advantageous to use a glass melt spreading fast as possible.
Conventionally, to increase the spreading speed of the glass melt, a high temperature driving condition method has been widely used. The high temperature driving condition method is a method that increases an upstream temperature of the float bath 10 to increase temperature of a glass melt and consequently to spread the glass melt fast.
However, this method using high temperature requires high cooling performance of the float bath 10 as well as a high amount of power. Also, because the high temperature driving condition may shorten the life of refractories constituting the float bath 10, it is unfavorable in an aspect of management of an apparatus. Furthermore, when a glass melt supply condition or a driving condition changes at an upstream of the float bath 10 where the glass melt spreads, formation of a glass ribbon may become unstable, and high temperature driving method is problematic in that unstability may be worsened. | 2023-10-08T01:26:18.401715 | https://example.com/article/8186 |
Buildings of a residential compound are seen in the haze during a polluted day in Beijing, China, March 17, 2016. REUTERS/Stringer
SHANGHAI (Reuters) - Provincial governments across China are taking measures ranging from inspecting outdoor barbecues to halting production at industrial plants to reduce worsening air pollution, the official Xinhua news agency said on Saturday.
China has adopted various measures over the years to reduce the blankets of smog which shroud many of the country’s northern cities in the winter, causing hazardous traffic conditions and disrupting daily life.
The local government in Hebei province has halted seven major industries in the city including steel, cement and glass, said Xinhua.
The Shijiazhuang city government, also in Hebei province, said on Thursday that car owners with certain number plates can only drive on specific days until the end of the year, following days of acrid smog.
Authorities in Chengdu, a city in the southwestern province of Sichuan, have sent law enforcement officials to inspect construction sites and barbecues.
Meanwhile, in the northern municipality of Tianjin, the municipal government has asked 119 companies to halt production until January.
Kindergartens, primary and middle schools have been advised to reduce outdoor activities in Taiyuan, a city in the northern province of Shanxi. | 2024-02-08T01:26:18.401715 | https://example.com/article/7157 |
Publications
Nepal - Food Security Assessment, May 2007
Food insecurity in Nepal is pervasive and widespread. A recent joint FAO/WFP Crop and Food Assessment Mission conducted in April 2007 concluded that malnutrition rates are at crisis level and that Nepal’s food security situation is at a crossroads. | 2024-07-20T01:26:18.401715 | https://example.com/article/2739 |
Certain holidays in Lithuania are dedicated to specific groups of people. Mother's day on the first Sunday of May typically includes children giving presents to their mothers. Fathers are similarly honored in the Father's day one month later (first Sunday of June), but the traditions for celebrating this holiday are not as strong.
Day of science and knowledge (September 1st) is the universal start of schoolyear in Lithuania, also followed by most universities. Kids bring flowers to their teachers and there are no lessons but a short introduction. Alcohol sales are banned all over Lithuania that day to discourage teenagers from getting drunk in post-holiday meetings with classmates.
Labour day (May 1st) used to be a major affair marked by massive state-organized parades during the Soviet occupation, participation in which had been mandatory for many people. After independence, it was briefly not a public holiday at all. Reinstated as such by the Socialdemocrats it failed to generate public attention and you will not see labor rallies of the southern European scale in Lithuania. Many people regard the Labour day to be primarily a Soviet holiday.
Women day (March 8th) celebration traditions also date to the Soviet Union, but this holiday is more popular than the Labour day. During it, males typically congratulate their female co-workers and bring them flowers.
Soviet Victory day (May 9th) is still regarded as their own "national day" by many local Russians who celebrate it at Soviet soldier memorials. It is undoubtedly the most controversial one among the once-mandatory Soviet holidays. To Lithuanians, the Soviet victory (and Western non-intervention) was a tragedy as it meant 45 additional years of occupation as well as the Genocide and guerilla war.
In the 1990s, the Saint Valentine day (February 14th), a holiday for lovers, gained a popularity that sometimes exceeded that of the independence day two days later (February 16th). Not native to Lithuania, the Valentine day celebrations were completely imported from the West. They include spending a romantic evening and mutual gift-giving for couples and lots of heart symbols; however, only a part of couples follow it.
After independence, as a nod to the historically-important Jewish community, the major Lithuanian municipalities and institutions often have some official celebrations of Hanookah (8 days in December or late November), held locally to be the most important festival for Jews. However, as at the mass migration to Israel has recently reduced the Jewish community to its lowest in hundreds of years, there is a little actual celebration of the event beyond the official speeches of the local politicians and Jewish leaders.
Other "national days" of countries that have minorities or expatriates in Lithuania or are friendly towards Lithuania or may also be celebrated, albeit such celebrations are often limited to some single location where whoever is interested comes (e.g. a yard next to the embassy). This includes the independence days of Latvia, Estonia, Ukraine, the USA. | 2023-10-03T01:26:18.401715 | https://example.com/article/4870 |
module org.commoncrawl.service.stats {
class StatsRecord {
[key] long timestamp =1;
long recordPosition = 2;
buffer data = 3;
}
class WriteStatsRecordRequest {
ustring recordGroup = 1;
StatsRecord record = 2;
}
class WriteStatsRecordResponse {
long recordPositon = 1;
}
class ReadStatsRecordsRequest {
ustring recordGroup = 1;
int recordCount = 2;
long ifLastKeyNot = 3;
long stopIfKeyLessThan =4;
}
class ReadStatsRecordResponse {
vector<StatsRecord> recordsOut = 1;
}
Service StatsService {
method writeStatsRecord(in WriteStatsRecordRequest, out WriteStatsRecordResponse);
method readStatsRecord(in ReadStatsRecordsRequest, out ReadStatsRecordResponse);
}
}
| 2024-02-26T01:26:18.401715 | https://example.com/article/9317 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.