text stringlengths 12 4.76M | timestamp stringlengths 26 26 | url stringlengths 32 32 |
|---|---|---|
Make Every Day Earth Day with Some Quick Energy-Saving Tips
Blog Post | April 23, 2012 - 12:04 pm
By Patrick Kiker, Communications Manager
Yesterday was the 42nd anniversary of Earth Day, but as we are often reminded, every day is Earth Day. And it’s not too late to do your part to reduce pollution by saving energy, while at the same time saving money by cutting down your utility and gas bills. Spring is a great time to make some changes around your home; here are some simple things you can do today:
During your spring cleaning, don’t forget to change the filters in your air conditioners. There may be leaks you can’t see so consider a home energy audit—your utility company or state energy office can help.
Search your house for “vampire loads”—all those gadgets and electronics in our homes use a significant amount of energy, even when we're not using them. Cut down on these "vampire loads” by unplugging electronics when they're not in use. Sound like too much work, or worried you'll forget? You can put certain electronics (say, your TV or DVR) on power strips so you can shut down many at a time or on timers so that they're only drawing energy during the hours of the day you'd normally use them. "Smart" power strips are also available that sense when a “master” device like a TV is off and turn off associated devices like a game console.
Take the time to change the oil in your car. In addition to making your car or truck last longer, replacing the oil and oil filter regularly will also help fuel economy. Check your owner's manual for specific recommendations about how often to change. Ask the service station if it recycles used oil, or if you do it yourself, take your old oil to someplace that does recycle. Ask for recycled oil as a replacement.
Think about replacing your tires with low-rolling-resistance (LRR) tires. Switching to a typical set of replacement tires lowers a vehicle's fuel economy as much as 4 percent. LRR tires, on the other hand, are specially designed to improve a vehicle's fuel economy. Most major tire manufacturers now produce LRR models, so when it comes time to replace your tires, seek out a set of LRR tires.
If you are looking for some more extensive ways to make your home more energy efficient (while improving its value), talk to your utility company. Many utilities are now offering low-cost financing for home energy improvements. Some utilities even allow customers to repay financing for improvements such as insulation, sealing, heat pump replacement, and appliance installation with the energy saved, and place the charge on your monthly utility bill. Often, these on-bill financing (OBF) programs will offer a free energy audit. So, check with your utility to see if they have any energy audit or financing offers available. You may be surprised at how cost-effective it is to improve the comfort of your home and the health of the planet at the same time.
ACEEE Summer Study on Energy Efficiency
in Buildings - Papers
Overview / Mission
The American Council for an Energy-Efficient Economy (ACEEE), a nonprofit, 501(c)(3) organization, acts as a catalyst to advance energy efficiency policies, programs, technologies, investments, and behaviors. We believe that the United States can harness the full potential of energy efficiency to achieve greater economic prosperity, energy security, and environmental protection for all its people. | 2023-08-14T01:26:18.401715 | https://example.com/article/5880 |
Q:
Foundation 5 top-bar dropdown menu randomly doesn't work, but then works after refreshing the page
I have a dropdown menu in my rails app (rails 4, ruby 2) that uses Foundation 5. Most of the time the dropdown menu works fine, but sometimes it (seemingly randomly) doesn't drop-down. I have tried it using both "hover" and "clickable" and got the same random breakdowns. Any time it hasn't worked, simply refreshing the page has solved the problem, but this is still a problem for users that I would like to avoid. Any suggestions?
This code is in views/layouts/_header.html.erb and is rendered in application.html.erb:
<nav class="top-bar" data-topbar data-options="is_hover: false">
<ul class="title-area">
<li class="name">
<h1><%= link_to 'What Key Am I In?', root_path %></h1>
</li>
<li class="toggle-topbar">Menu</li>
</ul>
<section class="top-bar-section">
<!-- Right Nav Section -->
<ul class="right">
<li><a href="#">All Keys</a></li>
<li><%= link_to 'All Chords', chords_path %></li>
<li><%= link_to 'All Notes', notes_path %></li>
<li class="divider"></li>
<li class="has-dropdown">
<% if current_user.nil? %>
<li><%= link_to 'Sign up!', new_user_registration_path %></li>
<li><%= link_to 'Log in', new_user_session_path %></li>
<% else %>
<a href="#"><%= current_user.username %></a>
<ul class="dropdown">
<li><%= link_to 'View profile', current_user %></li>
<li><%= link_to 'Edit profile', edit_user_registration_path(current_user) %></li>
<li class="divider"></li>
<li><%= link_to 'Chords Pending Approval', chords_pending_approval_path %>
<li class="divider"></li>
<li><%= link_to "Logout", destroy_user_session_path, method: :delete %></li>
</ul>
<% end %>
</li>
</ul>
</section>
</nav>
A:
I turned off Turbolinks and it seems to be working so far. Looks like this may have been what was causing the issue, which isn't that surprising as I have run into issues with things not working as expected because of Turbolinks.
| 2023-08-21T01:26:18.401715 | https://example.com/article/9274 |
Article content
Those in industry thinking there would be a major announcement on the Canadian Surface Combatant Monday came away somewhat disappointed.
In late February, Public Services and Procurement Canada announced they were looking at buying an off-the-shelf design for the country’s main future warship.
We apologize, but this video has failed to load.
tap here to see other videos from our team. Try refreshing your browser, or How much money will be saved by the new warship procurement process? No one knows for sure Back to video
Lisa Campbell, assistant deputy minister for acquisitions at Public Services and Procurement Canada, explained the process at the time to Defence Watch: “That eliminates a lot of technical risk and will get us to building ships sooner.”
On Monday Public Services Minister Judy Foote announced her department would proceed with that plan and select from an existing warship design.
For industry that changes little. Companies had already been told this was the case and were proceeding accordingly.
The change is estimated to reduce the time to acquire the surface combatant by about two years, Foote said. “The new approach significantly reduces the design and technical integration time,” she said at the news conference. | 2024-06-01T01:26:18.401715 | https://example.com/article/7054 |
Washington’s Blog
June 10, 2010
Janine Wedel has written extensively on how the “shadow elite” rule the world and about the “flexians” – the movers and shakers of the shadow elite who glide across borders, and structure overlapping (and not fully revealed) roles in government, business, media, and think tanks to serve their own agendas.
Wedel says that flexians wear many hats both within and outside of government, and use their networks of contacts to influence policy – are warping our democracy and the rule of law.
Peter Sutherland is the quintessential flexian.
According to his September 2009 bio:
Peter Sutherland is chairman of BP plc (1997 – current). He is also chairman of Goldman Sachs International (1995 – current). He was appointed chairman of the London School of Economics in 2008…. Before these appointments, he was the founding director-general of the World Trade Organisation. He had previously served as director general of GATT since July 1993 ….
Sutherland resigned as BP’s chairman in 2009, but apparently still serves in various key capacities.
Sutherland is managing director – as well as chairman – of Goldman Sachs International (Goldman Sachs International is the very powerful subsidiary of the Goldman Sachs Group, of which Lloyd Blankfein is CEO). Sutherland is also an Advisory Director of the Goldman Sachs Group itself.
And he is European Chairman for the Trilateral Commission.
He has, at various times, attended meetings of the Bilderberg group.
As if that is not enough, Sutherland also serves in the following capacities (click on “Read Full Background”):
Mr. Sutherland served as an Attorney General of Ireland and also served as European Commissioner from 1985 to 1989 where he was responsible for competition policy…. He serves as the Chairman of British Petroleum, BP Amoco PLC and United Kingdom. From 1989 to 1993, he served as the Chairman of Allied Irish Bank. …. He serves as a Non-Executive Director of Telefonaktiebolaget LM Ericsson. He serves as a Director of Goldman Sachs International. He has been Member of Supervisory Board at Allianz SE since January 2010 and serves as its Member of International Advisory Board …. Mr. Sutherland served as a Non Executive Director of BP Plc since July 1995. He serves as a Member of Foundation Board of World Economic Forum. He served as an Independent Non Executive Director of National Westminster Bank PLC since January 2001. He served as an Independent Non Executive Director of The Royal Bank Of Scotland Plc from January 2001 to February 6, 2009…. In addition, he serves on the board of Allianz, Koc Holding A.S. and is a member of the advisory board of Eli Lilly…. He served as a Director of LM Ericsson Telephone Co since 1996, Ericsson SPA since 1996 and Investor AB since 1995. He served as a Non Executive Director of Royal Bank of Scotland Group plc from January 2001 to February 6, 2009.
Sutherland is – literally – like Lloyd Blankfein and Tony Hayward rolled into one. But unlike Blankfein and Hayward, he has also held numerous powerful governmental and quasi-governmental positions.
This article was posted: Thursday, June 10, 2010 at 4:48 am
Print this page.
Infowars.com Videos:
Comment on this article | 2024-05-14T01:26:18.401715 | https://example.com/article/3731 |
1. Technical Field
The present invention relates generally to communication networks and, in particular, to data networks having physical transmission media. Still more particularly, the present invention is directed to a removable and replaceable network hub that facilitates centralized testing and reconfiguration of a data network having physical transmission media.
2. Description of the Related Art
A data network requires ongoing maintenance to upgrade or replace aging or failed network devices and to insert additional network devices into the data communication network. Such maintenance is performed relatively easily when the network device(s) to be replaced, upgraded or inserted are installed within a special purpose facility, such as a computer room having raised-access flooring or a network closet. In such cases, the ease of maintenance is due to the ability to easily access both the network devices and the physical transmission media (e.g., cabling) utilized to connect the network devices to the data communication network.
In some network installations, however, network maintenance is problematical in that the devices and/or the network transmission media comprising the data network are not easily accessible. For example, the insertion or removal of a network device or other topological changes to a data network installed within an aircraft often requires gutting the cockpit and/or cabin of the aircraft in order to access the installation sites of one or more network devices and portions of the aircraft wiring affected by the network change.
FIG. 1 is a high level plan view of an aircraft having a conventional data network. As illustrated, aircraft 10, which comprises a fuselage 12, wings 14, engines 16 and tail section (empennage) 18, has a data network 20 installed therein. In the depicted embodiment, data network 20 is a fibre channel arbitrated loop including a number of network devices 22, which are coupled together by fiber optic cables 24 terminated on either end by connectors 26. Network devices 22 may include, for example, an avionics computer, avionics sensors, aircraft system controls, and communications equipment.
As will be appreciated, data network 20 is typically installed within fuselage 12 behind cockpit instrumentation panels and other fixtures within the cabin interior. Consequently, if data network 20 requires testing, maintenance, or modification, for example, by the addition or removal of a network device 22 or reordering of network devices 22 within the loop, many of the fixtures of the cabin interior may have to be removed to access network devices 22 and/or fiber optic cables 24. It is therefore time consuming, expensive and inconvenient to reconfigure or test data network 20 and its components.
In recognition of the foregoing and additional difficulties with testing and reconfiguring conventional data network installations, the present invention provides an improved data network and a network hub for structures such as aircraft in which access to network infrastructure is restricted.
In accordance with the present invention, the data network includes a plurality of network devices, a plurality of physical transmission lines each coupled to a respective one of said plurality of network devices, and a network hub coupled to each of said plurality of physical transmission lines. The network hub has a removable and replaceable termination element providing signal connectivity between selected ones of said plurality of transmission lines. In one embodiment, the data network is installed within an aircraft including a fuselage, an empennage connected to the fuselage, a lift-generating surface coupled to the fuselage, and at is least one engine for propelling the aircraft.
Additional objects, features, and advantages of the present invention will become apparent from the following detailed written description. | 2023-08-04T01:26:18.401715 | https://example.com/article/9145 |
68 F.2d 814 (1934)
McNAIR
v.
BURT et al.
No. 6998.
Circuit Court of Appeals, Fifth Circuit.
February 7, 1934.
*815 Kenneth I. McKay, of Tampa, Fla., for appellant.
D. C. Hull and Joseph A. Scarlett, both of De Land, Fla., and Fred B. Noble, John C. Cooper, Jr., and H. P. Adair, all of Jacksonville, Fla., for appellees.
Before BRYAN, SIBLEY, and WALKER, Circuit Judges.
BRYAN, Circuit Judge.
This is an appeal from an order dismissing on motion a bill of complaint brought by the receiver of a failed national bank against its former directors. The bill seeks an accounting and recovery for losses sustained by the bank because of dividends paid out of capital assets and improvident and excessive loans made or permitted by the majority of the board of directors with the acquiescence of the minority. There is no charge of conspiracy or concealment of any act complained of; on the contrary, it is repeatedly alleged that the directors disregarded frequent warnings given to them by national bank examiners and the Comptroller of the Currency concerning the loans, although it is also asserted that the stockholders and creditors of the bank were kept in ignorance of the management of its affairs until after the closing of the bank and the appointment of a receiver. During the period covered by the prayer for accounting new directors were from time to time elected on the board; at least one of them served from some time in 1926 until the bank closed in July, 1929. No charge was made against that director of active participation in or of personal benefit derived from any violation of duty. Of the dividends and loans in question, some were made within five years, others within four years, but none within three years, before January 7, 1932, the date of bringing suit. The motions to dismiss were sustained on the ground that the suit was barred by a Florida statute which prescribes a limitation of three years for an action upon an "obligation or liability not founded upon an instrument of writing." C. G. L. § 4663 (5).
As this is a case which could have been brought in an action at law, the jurisdiction at law and in equity is concurrent. In such a case of concurrent jurisdiction, the equity court does not enforce the doctrine of laches, but instead is bound by the statute of limitations which governs in actions at law. Metropolitan Nat. Bank v. St. Louis Dispatch Co., 149 U. S. 436, 448, 13 S. Ct. 944, 37 L. Ed. 799; Curtis v. Connly, 257 U. S. 260, 42 S. Ct. 100, 66 L. Ed. 222. There is no applicable federal statute of limitations, and therefore the appropriate state statute on that subject controls. McClaine v. Rankin, 197 U. S. 154, 25 S. Ct. 410, 49 L. Ed. 702, 3 Ann. Cas. 500; Curtis v. Connly, supra. Appellant argues that, whatever statute of limitations is applicable, it did not begin to run until the bank closed, because until then *816 the stockholders and creditors of the bank were without knowledge of its affairs or financial condition. This argument fails when it is recalled that there is no claim of conspiracy or concealment; that bank examiners and the Comptroller of the Currency knew about the condition of the bank, that the personnel of the board of directors did not always remain the same, since new directors were elected from time to time to represent the stockholders, and that the stockholders themselves always had the right to inspect the books and ascertain the manner in which the affairs of the bank were being administered. Corsicana National Bank v. Johnson, 251 U. S. 68, 40 S. Ct. 82, 64 L. Ed. 141; Curtis v. Connly, supra; Anderson v. Gailey (D. C.) 33 F.(2d) 589; Hughes v. Reed (C. C. A.) 46 F.(2d) 435. Appellant next contends that the state statute of limitations applicable here is the one of five years, which is provided for "an action upon any contract, obligation or liability founded upon an instrument of writing not under seal." C. G. L. § 4663 (3). To sustain this position he argues that the oath which each director of a national bank is required by 12 USCA § 73 to take, that he will diligently and honestly administer the affairs of the bank, and will not knowingly violate, or willfully permit to be violated, any of the provisions of the National Banking Act (see 12 USCA § 21 et seq.) is an instrument of writing, within the meaning of the just-quoted five-year statute of limitations, upon which the cause of action here asserted may be maintained. The suggestion is a novel one, and no authority is cited in support of it. The statutory oath required of national bank directors exacts a solemn pledge and also serves as documentary proof to show who the directors were at any given time, but it does not itself evidence or disclose any contract, obligation, or liability, which is made the foundation for a civil action. This suit must rest, not upon the oath, but upon the statutory and common-law right to recover for negligence and dereliction of duty in the management of the bank's affairs. Appellant finally relies upon a state statute which bars within four years "any action for relief not specifically provided for in this Chapter," C. G. L. § 4663 (4), and cites Corsicana National Bank v. Johnson, supra, and McClaine v. Rankin, supra, in each of which a similar general statute was held applicable. The first of these cases arose in Texas and the other in Washington. In neither state was there a provision similar to that of the Florida statute concerning obligations or liabilities "not founded upon an instrument of writing." Therefore, in our opinion, neither of the two cases last cited is authority upon the point now under consideration. The four-year statute of Florida is not applicable because of the three-year statute. The three-year statute is applicable for the reason that the obligation or liability sued on was not founded upon an instrument of writing. It follows that the District Court did not err in dismissing appellant's bill of complaint.
The decree is affirmed.
| 2023-09-21T01:26:18.401715 | https://example.com/article/4876 |
{
"name": "universal",
"version": "0.1.0",
"private": true,
"scripts": {
"start": "babel-node src/server"
},
"dependencies": {
"@babel/core": "^7.9.0",
"@babel/node": "^7.8.7",
"@babel/preset-env": "^7.9.0",
"@babel/preset-react": "^7.9.4",
"babel-loader": "^8.1.0",
"core-js": "^3.6.4",
"express": "^4.17.1",
"found": "^0.5.1",
"prop-types": "^15.7.2",
"react": "^16.13.1",
"react-dom": "^16.13.1",
"webpack": "^4.42.1",
"webpack-dev-middleware": "^3.7.2"
}
}
| 2024-03-29T01:26:18.401715 | https://example.com/article/8994 |
Second homes in East Devon are "hugely detrimental" to the district's economy according to the National Housing Federation. Read this and more.
SECOND HOME WARNING: There are 7,227 second homes in East Devon and, according to the National Housing Federation, they are “hugely detrimental” to the district’s economy and are damaging communities.
It says, with the second homes standing empty for much of the time, shops are being hit.
Long-term, second homes could affect the sustainability of village shops, schools and pubs.
Second homeowners make up 5.5 per cent of residents in East Devon.
The figures were published by the Office of National Statistics as the National Housing Federation, published a report, Home Truths 2012, which revealed that rents are set to rise.
Jenny Allen, the federation’s manager for the South West, said: “The high number of second homes has helped push house prices up, taking them out of reach for local people.
“If families and young people in the region are priced out of their local villages, it can have a hugely damaging impact on community life, with village shops, schools and pubs closing as a result.”
----
DANCE: Dance students from Exmouth Community College recently teamed up with professionals in a bid to boost their exam grades.
Dancers from Motionhouse Dance Company, plus trainee teachers from Exeter University, worked with the GCSE and A-level students, supporting their practical work in the lead-up to their performance exams. | 2024-01-09T01:26:18.401715 | https://example.com/article/1601 |
Q:
ActionBar Menu Items disappear in NestedFragments
Since android 4.2 now support NestedFragment , and added it to support v13.
I use this NestedFragment on a classic situation : Create fragmentA that can swipe left and right and consume a majority of the screen space, and insert fragmentB and fragmentC into each fragment page.
My Problem is the MenuItem I create in fragmentB and fragmentC can`t show on Activity`s actionbar.Which before I use NestedFragment , it works well.
A:
got at some point the same problem. If you're using the ActionBarSherlock library this is a small bug. What you basically have to do is to call from your parent fragment from the onCreateOptionsMenu() method the onCreateOptionsMenu() method of the children, something like:
public void onCreateOptionsMenu(Menu menu, MenuInflater inflater) {
super.onCreateOptionsMenu(menu, inflater);
getChildFragment().onCreateOptionsMenu(menu, inflater);
}
hope this works, let me know.
Cheers.
| 2024-07-08T01:26:18.401715 | https://example.com/article/5358 |
Bitcoin investors were pleased to find yesterday that BTC’s bulls have come out swinging and are now pushing the cryptocurrency’s price towards the psychologically critical price level of $10,000, which is just a hair above its current price.
Although in the short-term Bitcoin is certainly bullish, over the long run it is incredibly bullish, and one chart even points to the possibility that it will one day be trading at $500,000.
Bitcoin Climbs to $9,850, But Faces Some Resistance
At the time of writing Bitcoin is trading up over 5% at its current price of $9,850, up significantly from 24-hour lows of $9,300.
This massive upwards momentum marks a continuation of the buying pressure that BTC first incurred in early-April that led it to surge from lows of $4,000. It is now abundantly clear that the cryptocurrency is currently in the throes of a bull market, but in order for it to surge higher it is critical that it breaks above $10,000 in the near-future.
Late-yesterday, the crypto quickly surged to highs of $9,900 where it faced some levels of resistance that pushed it down slightly.
Big Cheds, a popular cryptocurrency analyst on Twitter, spoke about the resistance that lies between BTC’s current price and $10,000, noting that bulls will have to decisively push its price above $9,948.
“$BTC #Bitcoin Daily – Moving like a champ – In order to hit $10,000 this will have to break the May 5th 2018 high of $9948,” he explained.
Analyst: Don’t Be Surprised if BTC’s Price Surge Exceeds Expectations
Although $10,000 remains a short-term battle for BTC, long-term it may have significantly further gains in store, and one chart is signaling that a move to $500,000 is not only possible, but plausible.
HornHairs, another popular crypto analyst, shared an overwhelmingly bullish sentiment in a recent tweet, explaining that if the next bull movement mirrors that seen in 2017, then Bitcoin could soon be surging way past its previously established all-time-highs.
“The last time price pierced the bearish cloud on the weekly for the first time after the end of a bear market, price went on to increase >5000%. Should history repeat, that would put price at $500k at the end of next cycle. Sounds ridiculous, but so did $20k,” he explained while referencing the below chart.
The last time price pierced the bearish cloud on the weekly for the first time after the end of a bear market, price went on to increase >5000%.
Should history repeat, that would put price at $500k at the end of next cycle.
Although it is too early to get excited about the possibility of there one day being a $500k Bitcoin, in the near-term it does seem as though bulls are in full control, which likely means that the world will soon see BTC one again break into the five-figure price region. | 2024-07-14T01:26:18.401715 | https://example.com/article/2643 |
Introduction {#sec1}
============
The design of efficient water oxidation catalysts (WOCs) based on nonprecious materials remains an important challenge for achieving a clean and sustainable solar fuels-based energy economy.^[@ref1]−[@ref3]^ We have previously shown that active WOCs can be formed by anodic electrodeposition of metal-oxides from neutral and near-neutral buffered aqueous solutions of cobalt,^[@ref4],[@ref5]^ nickel,^[@ref6],[@ref7]^ and recently, manganese.^[@ref8],[@ref9]^ In particular, the cobalt oxygen-evolving catalyst (Co-OEC) has been studied in detail, resulting in an understanding of the electrochemical kinetic mechanisms of its formation,^[@ref10]^ catalysis,^[@ref11]^ and charge transport.^[@ref12]^ The structural and electronic properties of Co-OEC have been clarified using XAS,^[@ref13]^ X-ray PDF,^[@ref14],[@ref15]^ EPR,^[@ref16]^ and X-ray GID.^[@ref17]^ These studies have revealed that the electrodeposited catalyst films comprise molecular to nanoscale-sized metalate clusters composed of edge-sharing CoO~6~ octahedra with a mixed valence Co(III/IV) resting state.
The development of soluble molecular WOCs based on Co^[@ref18]−[@ref21]^ as well as other transition metals, such as Ir,^[@ref22]^ Ru,^[@ref23]^ Cu,^[@ref24]^ and Fe^[@ref25]^ have also been a subject of intense focus. Molecular WOCs are attractive research targets because they provide a tractable means to characterize catalytic mechanisms and to identify reactive intermediates, thus forming the basis for the continued development of new WOCs. However, the true identity of the active catalyst must be clarified prior to a detailed interrogation of the WOC mechanism. Indeed, some molecules that were thought to be WOCs have subsequently been shown to be precursors of heterogeneous or colloidal materials, which are the active catalysts.^[@ref26]−[@ref29]^ Proper catalyst identification is especially challenging for the study of molecular cobalt WOCs because extremely small amounts of Co-OEC may be produced from the decomposition of the molecular catalyst.^[@ref30],[@ref31]^ An exemplar of this challenge is the all-inorganic cobalt polyoxometalate \[Co~4~(H~2~O)~2~(PW~9~O~34~)~2~\]^10--^ (Co~4~POM), which was suggested as a WOC.^[@ref32]^ Re-examination of the molecule showed that electrochemically driven oxygen evolution arose from the formation of Co-OEC on glassy carbon (GC) electrodes at 1.1 V vs Ag/AgCl.^[@ref30]^ Because the Co~4~POM was unstable at higher potentials, water oxidation activity could not be conclusively attributed to the Co~4~POM, as opposed to its role as a molecular precursor to Co-OEC.^[@ref33]^ The Co~4~POM has now been suggested to exhibit water oxidation activity but under specific photochemical conditions where Ru(bpy)~3~^3+^ is the oxidant.^[@ref34],[@ref35]^
![(left) Molecular structure of Co~4~O~4~ cubane structure **1** and (right) thermal ellipsoid representation at the 50% probability level of the one-electron oxidized cubane, **1**\[**PF**~**6**~\]. Hydrogen atoms and an acetonitrile molecule have been omitted for clarity. Atoms are color-coded: gray (carbon), blue (nitrogen), red (oxygen), dark blue (cobalt), green (fluorine), and yellow (phosphorus).](ja-2014-110393_0005){#fig1}
Against this backdrop, cubane Co~4~O~4~ clusters, such as Co~4~O~4~(OAc)~4~(Py)~4~, (**1**, Figure [1](#fig1){ref-type="fig"}), have come under investigation as a class of molecular cobalt complexes that are potential WOCs.^[@ref36]−[@ref40]^ We had previously investigated **1**, first synthesized by Das and co-workers,^[@ref41]^ and a related Co~4~O~4~ cubane of Christou,^[@ref42]^ in order to gain valuable insights into the electronic characteristics and proton-coupled electron transfer (PCET) behavior of Co(III/IV) in a Co-OEC environment.^[@ref43],[@ref44]^ The structure of **1** has been previously reported ([Figure S1, Supporting Information](#notes-1){ref-type="notes"});^[@ref41]^ the crystal structure of the oxidized cubane **1**^**+**^ was known as a perchlorate salt^[@ref45]^ and is now obtained as a PF~6~^--^ salt, as shown in Figure [1](#fig1){ref-type="fig"}. In our studies, we did not find any evidence that these cubanes were active WOCs. Motivated by the recent reports to the contrary^[@ref36]−[@ref39]^ and subsequent computational work outlining a detailed mechanistic pathway for **1** as a WOC,^[@ref46]^ we renewed our investigation of these molecules.
{#fig2}
Herein, we report that a Co(II) impurity in as-synthesized cubane **1** is primarily responsible for the reported catalytic water oxidation activity. We present a series of experiments that are useful for determining whether a small amount of a Co(II) impurity may lead to formation of a heterogeneous WOC. We further emphasize the utility of differential electrochemical mass spectrometry (DEMS) for clarifying how anodic potentials affect the decomposition of glassy carbon electrodes, which are commonly used in the study of WOCs. The reported experiments are aimed at establishing a standardized approach to evaluate the presence of Co(II) impurities in molecular complexes under investigation as water oxidation catalysts.
Results {#sec2}
=======
Synthesis {#sec2.1}
---------
We synthesized and isolated **1** by precisely following the one-pot procedure developed by others.^[@ref36],[@ref39]^ Despite satisfactory elemental analyses for **1** ([Table S1](#notes-1){ref-type="notes"}), we determined that this as-synthesized material, which was isolated by concentrating a dichloromethane (DCM) extraction, was not pure. The presence of impurities was indicated by the observation of many small peaks in the ^1^H NMR spectrum (Figures [2](#fig2){ref-type="fig"} and [S2--S4](#notes-1){ref-type="notes"}) and by the presence of slowly moving bands that eluted behind the product band on a silica thin layer chromatography (TLC) plate ([Figure S5](#notes-1){ref-type="notes"}). On the basis of the TLC result, purification of the compound was performed by column chromatography on silica, eluting with a gradient of 2--10% MeOH in DCM. Along with the slowly moving green bands, a red coloration was consistently observed at the top of the column. A comparison of ^1^H NMR spectra for crude (i.e., as-synthesized) and purified **1** is shown in Figure [2](#fig2){ref-type="fig"}. Several peaks that are observed in the aromatic region in the NMR of the crude sample are absent in the NMR of the purified sample. Molecular impurities are also indicated by many peaks in the *m*/*z* range of 300--700 in the ESI-MS of crude **1**; these peaks are absent in the purified sample ([Figure S6](#notes-1){ref-type="notes"}). A structural variant, **1-COOMe**, was also synthesized according to Das' original procedure;^[@ref41]^ the final product was isolated by precipitation and filtration. No diamagnetic impurities were detected in the ^1^H NMR spectra of the precipitated **1-COOMe**. However, to remove possible paramagnetic impurities, the precipitated **1-COOMe** was subject to further purification by chromatography. Interestingly, the same ^1^H NMR spectrum was obtained for precipitated and chromatographed **1-COOMe** ([Figure S7](#notes-1){ref-type="notes"}), though the former was observed to have impurities that were not removed by precipitation.
{#fig3}
Electrochemistry {#sec2.2}
----------------
The reported water oxidation activity of **1**([@ref36],[@ref39]) could not be replicated using purified samples. Figure [3](#fig3){ref-type="fig"} compares the CVs of crude and purified **1** (0.852 mg/mL, 1 mM assuming 100% purity). The catalytic current, peaking at 1.3 V (all potentials are referenced to Ag/AgCl), in the crude sample is consistent with the WOC activity that has been previously reported of **1** in the presence of proton accepting electrolytes. However, a similar catalytic wave in the purified sample is completely absent; only a reversible Co(III)~3~Co(IV)/Co(III)~4~ couple centered at *E*~1/2~ = +1.05 V is observed. Interestingly, the catalytic current detected with the crude sample is only prominent in the first scan of the CV. A similar behavior is observed for **1-COOMe** where precipitated samples exhibit a large catalytic current in the CV and chromatographed samples show only the reversible Co(III)~3~Co(IV)/Co(III)~4~ couple, as shown in [Figure S8](#notes-1){ref-type="notes"}. The *E*~1/2~ of the reversible couple is at a more positive potential than for **1**, due to the electron withdrawing nature of the methyl ester substituents on the pyridine ligands.
The electrochemistry of **1** was also investigated in carbonate buffer at pH = 7. The crude sample also showed a catalytic current (*E*~p~ = ∼1.4 V, [Figure S9](#notes-1){ref-type="notes"}), which was absent in the purified sample. The only observed difference between the CVs in carbonate and phosphate electrolyte is that the catalytic peak current of the crude sample occurs at a more positive (∼80 mV) potential in carbonate electrolyte.
To confirm that the catalytic current in the crude sample was associated with the oxygen evolution reaction, electrochemical oxidation was performed in a DEMS experimental setup, which allows for the immediate and simultaneous detection of all gaseous products formed at the electrode surface.^[@ref47]^ The catalytic current from an unpurified sample shown in the red trace of the top of Figure [4](#fig4){ref-type="fig"}A is accompanied by the production of O~2~, as shown in the middle panel of Figure [4](#fig4){ref-type="fig"}A. Purified **1** and **1-COOMe** were also investigated using DEMS under the identical conditions employed for that of the crude sample. As shown in the top panels of Figure [4](#fig4){ref-type="fig"}B,C for purified **1** and **1-COOMe**, respectively, the Faradaic current density decreases by over an order of magnitude from that of the crude sample. The waveform of the CVs in Figure [4](#fig4){ref-type="fig"} are different than those of CVs taken on stationary GC electrodes (e.g., Figure [3](#fig3){ref-type="fig"}, red trace) owing to the flow conditions of the DEMS experiment; similar waveforms are observed, for instance, at rotating disk electrodes where there is forced solution flow across an electrode surface.^[@ref48]^ The signal from the mass channel of O~2~ for the purified samples (middle panels in Figure [4](#fig4){ref-type="fig"}B,C) shows no O~2~ production for applied potentials below 1.4 V; at potentials of 1.4 V or greater, an extremely small amount of O~2~ is observed (pA intensities as opposed to nA intensities of crude samples). We note that for all three samples, the mass channel of CO~2~ exhibits a sizable signal when the electrode potential surpasses ∼1.2 V. The high level of evolved CO~2~ is observed even in the background scans of blank GC electrodes (black lines in the bottom panels in Figure [4](#fig4){ref-type="fig"}A--C).
{#fig4}
We sought to place a limit on the level of O~2~ produced by the cubane cluster within the error of our measurements. The middle panel of Figure [4](#fig4){ref-type="fig"}B indicates that there is a small but non-negligible amount of O~2~ produced in purified samples of **1** at applied potentials \>1.4 V. We therefore wished to quantify the amount charge passed with the current associated with the slight downturn in the red CV trace at potentials above 1.4 V in Figure [3](#fig3){ref-type="fig"}. Three separate voltammograms (using three independently prepared GC electrodes) were collected with a sample of purified **1** (black traces in [Figure S10b--d](#notes-1){ref-type="notes"}). A simulated CV ([Figure S10a](#notes-1){ref-type="notes"}) was subtracted from the background corrected raw data to remove the current that is due to the reversible Co(III)~3~Co(IV)/Co(III)~4~ couple, thus leaving only the current that may be attributed to oxygen evolution (red traces in [Figure S10b--d](#notes-1){ref-type="notes"}). From these data, the average current density was 0.11 ± 0.04 mA/cm^2^ at 1.5 V. Assuming that all of this current leads to the production of O~2~, then a TOF of 0.06 mol O~2~/mol catalyst is calculated at an overpotential of 0.89 V (see [SI](#notes-1){ref-type="notes"} for details). This low current density and TOF is consistent with catalysis from ppb concentrations of Co(II) produced from decomposition of the cubane (see [Discussion](#sec3){ref-type="other"}).
![Solution \[O~2~\] measurements during illumination of crude samples of **1** (black), purified **1** (red), and without added **1** (green). Photochemical reactions were performed in the presence of 0.5 mM Ru(bpy)~3~^2+^, 35 mM Na~2~S~2~O~8~, and 100 mM KPi pH = 7 buffer. The concentration of crude and purified **1** was 0.33 mM, assuming 100% purity for the crude material.](ja-2014-110393_0009){#fig5}
![CVs of 2 mM (assuming 100% purity) crude **1** and \[EDTA\] = 0 (black), 0.10 (red), 0.25 (blue) and 0.50 (green) mM in 0.2 M KPi (pH = 7). Arrow and cross indicates the initial point and direction of scan.](ja-2014-110393_0001){#fig6}
To exclude the possibility of chemistry specific to a **1**:GC interaction, Pt, Au, and FTO were also employed as electrode materials. In all three cases, a similar behavior was obtained as for the GC experiments: the CVs of the crude **1** showed significant water oxidation current, which was absent in the CVs of the purified material ([Figure S11](#notes-1){ref-type="notes"}).
Photochemistry {#sec2.3}
--------------
In addition to electrochemical WOC activity, photochemical water oxidation has been reported for as-synthesized samples of **1** using the Ru(bpy)~3~^2+^/S~2~O~8~^2--^ sacrificial oxidant system. The photochemical assay was performed in triplicate according to the literature procedure,^[@ref36]^ with the exception that phosphate buffer was used instead of carbonate (see [SI](#notes-1){ref-type="notes"} for details). The concentration of O~2~ was measured for samples of crude **1**, purified **1**, and without added catalyst. A fluorescence-based O~2~ sensor was immersed into N~2~ purged solutions containing \[Ru(bpy)~3~^2+^\] = 0.5 mM, \[S~2~O~8~^2--^\] = 35 mM, and \[**1**\] = 0.33 mM, and the cuvettes were photolyzed with a Hg/Xe arc lamp (λ~exc~ \> 400 nm). The yield of O~2~ over 400 s of photolysis decreased from 167 ± 15 μM for the crude samples to 31 ± 6 μM for the purified samples (Figure [5](#fig5){ref-type="fig"}).
![(a) ^31^P NMR spectra of the phosphate signal of a 0.5 mM solution (0.426 mg/mL) of purified **1** in 0.2 M KPi (pH = 7) with added Co(II) at the indicated concentrations. (b) The measured full-width at half-maximum (fwhm) of the phosphate ^31^P NMR signal is linearly dependent on the concentration of added Co(II). The equation of the linear calibration curve is fwhm = {(936 ± 8) × \[Co(II)\]} + (7.2 ± 0.4). (c--e) ^31^P NMR spectra of the phosphate signal for three separate batches of 0.426 mg/mL of crude **1** in 0.2 M KPi at pH = 7. Using the calibration curve of (b), the amount of line broadening corresponds to a Co(II) concentration of 0.086 ± 0.004 mM, 0.091 ± 0.008 mM, and 0.065 ± 0.006 mM for samples (c), (d) and (e), respectively.](ja-2014-110393_0002){#fig7}
Identification and Quantification of Impurities {#sec2.4}
-----------------------------------------------
To identify and quantify the impurity found in the crude samples of **1**, a series of spectroscopic and electrochemical experiments were performed. The EPR spectrum of a solid sample of crude **1** reveals a broad paramagnetic signal over the range *g* = 10 to 2, which is absent in the purified sample ([Figure S12](#notes-1){ref-type="notes"}). This signal is consistent with a paramagnetic Co(II) species.^[@ref16]^ To confirm the presence of a Co(II) impurity, EDTA was titrated into a CV solution of the crude sample. Figure [6](#fig6){ref-type="fig"} shows the CVs for the addition of EDTA (0--0.5 mM) into a 2 mM solution (assuming 100% purity) of crude **1** in 0.2 M KP~i~ pH = 7. Nearly complete suppression of the catalytic current was observed at 0.5 mM EDTA addition. As a control, a 50 μM solution of purified **1** was treated with 10 mM EDTA in 0.2 M KP~i~ at pH = 7 for 1 h, and no changes in absorbance were observed ([Figure S13](#notes-1){ref-type="notes"}), confirming that **1** is kinetically stable in the presence of EDTA. The CV wave of the Co(III)/Co(IV) couple of purified **1** with addition of EDTA ([Figure S14](#notes-1){ref-type="notes"}) is fully reversible, indicating that **1**^**+**^ is also stable to EDTA on the time scale of the CV experiment.
The amount of Co(II) introduced by dissolving the crude preparation of **1** in aqueous media could be quantified by applying ^31^P NMR line broadening analysis, which we previously employed to quantify the self-healing properties of Co-OEC.^[@ref10]^ A calibration curve was constructed by adding increasing amounts of a 1:1 mixture of Co(OAc)~2~:pyridine to a 0.5 mM solution (0.426 mg/mL) of purified **1** in 0.2 M KP~i~ buffer (Figure [7](#fig7){ref-type="fig"}, see [SI](#notes-1){ref-type="notes"} for experimental details). This calibration curve was used to determine the amount of Co(II) in batches of crude **1**. Although CV experiments were performed with **1** at a concentration of 0.852 mg/mL, at this concentration of crude **1**, the broadening of the phosphate signal is too great to construct a calibration curve over a wide enough range. Thus, we performed ^31^P NMR line broadening experiments at half the concentration used for CV experiments. Figure [7](#fig7){ref-type="fig"} shows the ^31^P NMR signals of phosphate upon dissolving 0.426 mg/mL of crude **1** for three separately prepared batches. Per the calibration curve, we determine that the Co(II) ion concentration in solution is \[Co(II)\] = 0.086 ± 0.004 mM, 0.091 ± 0.008 mM and 0.065 ± 0.006 mM for samples (c), (d) and (e), respectively (\[Co(II)\]~avg~ = 0.08 ± 0.01 mM). Translating this result to the concentrations used for CV experiments, a sample of 0.852 mg/mL of crude **1** introduces an average concentration of \[Co(II)\] = 0.16 ± 0.02 mM into solution.
The results of the ^31^P NMR experiments were confirmed by an electrochemical titration, in which \[Co(II)\] was correlated with the catalytic current observed by CV ([Figure S15](#notes-1){ref-type="notes"}). With increasing \[Co(II)\], the peak current of the catalytic wave at 1.3 V increases linearly. A calibration curve was again constructed and used to assess \[Co(II)\] in the three batches of crude **1** at the concentration used for CV experiments. The results of this assay shows excellent agreement with the ^31^P NMR experiment, albeit with larger error bars, giving 0.153 ± 0.019 mM, 0.178 ± 0.020 mM, and 0.120 ± 0.016 mM for the three samples, with a \[Co(II)\]~avg~ = 0.15 ± 0.03 mM.
Because of the insolubility of Co~3~(PO~4~)~2~ in aqueous media, the measured Co(II) concentration could be diminished due to loss of cobalt in the form of a Co~3~(PO~4~)~2~ precipitate. However, at these low \[Co(II)\], precipitation of Co(II) by phosphate is negligible due to the slow kinetics of formation of the Co~3~(PO~4~)~2~ on the time scale of the electrochemical or photochemical experiments, which take minutes to complete. To experimentally verify that no Co~3~(PO~4~)~2~ formed under our experimental conditions, a 0.15 mM solution of a 1:1 mixture of Co(OAc)~2~:pyridine in the presence of 0.2 M KPi at pH = 7 was monitored by ^31^P NMR line broadening over a 4 h period ([Figure S16](#notes-1){ref-type="notes"}). The ^31^P NMR spectrum establishes that the concentration of Co(II) in solution does not significantly decrease over this time period.
The ^31^P NMR line broadening experiment is also a sensitive measure of compound stability. Solids of purified **1** can be stored on the benchtop for at least 25 days without decomposition. The ^31^P NMR line broadening analysis of 0.5 mM **1** in 0.2 M KP~i~ buffer solution shows that the presence of Co(II) ions after 25 days is negligible ([Figure S17](#notes-1){ref-type="notes"}). In addition, comparison of the ^1^H NMR spectra of **1**, hours after purification and after 25 days are identical ([Figure S18](#notes-1){ref-type="notes"}).
Characterization of Electrode Surface {#sec2.5}
-------------------------------------
Since crude **1** introduces Co(II) into the solution, we would expect that at anodic potentials, Co-OEC will be deposited. Indeed, bulk electrolysis of a 1 mM solution of crude **1** at 1.2 V for 5 min resulted in the deposition of Co-OEC material on the electrode surface, which was readily observed by scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS) ([Figures S19a and S20a](#notes-1){ref-type="notes"}, respectively). Bulk electrolysis of the crude sample at a higher potential of 1.4 V results in significantly less Co-OEC detected on the electrode surface ([Figures S19c and S20c](#notes-1){ref-type="notes"}), despite more charge being passed ([Figure S21](#notes-1){ref-type="notes"}). Per the DEMS experiment, current is redirected from water splitting (O~2~ production) to degradation of the GC electrode (CO~2~ production at higher potential).
Although bulk electrolysis performed over 300 s of a purified sample at 1.2 V resulted in an EDS spectrum that is indistinguishable from that of a blank sample ([Figure S20b,d](#notes-1){ref-type="notes"}), the SEM images of the pure and blank samples showed a subtle difference. The density of light contrast material was increased in the pure sample as compared to that of the blank sample. We therefore pursued further characterization of the electrode surface by XPS analysis, which is more selective to analysis of surface materials than EDS. A comparison of high-resolution Co 2p XPS spectra of crude, pure, and blank GC electrodes after 300 s of bulk electrolysis at 1.2 V is shown in [Figure S22](#notes-1){ref-type="notes"}. A trace signal at the Co 2p~3/2~ peak of the pure sample is barely distinguishable over background, whereas a large Co 2p~3/2~ signal is observed for electrodes removed from bulk-electrolyzed solutions of crude **1**.
Discussion {#sec3}
==========
As-synthesized samples of **1** contain significant amounts of impurities in two forms. The many aromatic peaks in the ^1^H NMR spectra of crude **1** (Figure [2](#fig2){ref-type="fig"}) and the slowly eluting bands on TLC plates are likely Co(III) clusters of smaller nuclearity, which are known to be stable compounds.^[@ref49]^ Of greater significance, as demonstrated by EPR spectroscopy ([Figure S12](#notes-1){ref-type="notes"}), electrochemical measurements in the presence of the ion scavenging EDTA (Figure [6](#fig6){ref-type="fig"}) and ^31^P NMR line broadening analysis (Figure [7](#fig7){ref-type="fig"}), a Co(II) impurity is present in crude samples of **1**. Electrochemical titration experiments and ^31^P NMR line broadening experiments quantify significant amounts of Co(II) in as-synthesized preparations of **1**. Repeated experiments on different batches of as-synthesized **1** show that the concentration of Co(II) is 16% of the expected concentration of the cubane molecule, **1**. Because the Co(II) impurity is soluble in DCM, the ligation of the Co(II) ion likely involves solubilizing organic groups, such as the acetate or pyridine reactants of **1**, as salts of Co(II) with outer-sphere anions, such as acetate or nitrate, are unlikely to have significant solubility in DCM. Ligation of the solubilizing groups appears to be sufficiently weak that Co-OEC is easily formed (vide infra). As a cautionary note, the absence of line broadening in the ^1^H NMR spectra of **1** does not provide sufficient evidence that Co(II) is not present in solution.^[@ref36]^ The lack of significant line broadening in the ^1^H NMR spectra upon titrating 1:1 Co(OAc)~2~:pyridine into a sample of purified **1** ([Figure S23](#notes-1){ref-type="notes"}) indicates that this is not a sensitive measure of paramagnetic impurities, presumably because **1** (a neutral, weakly basic molecule) does not interact significantly with the Co(II) ion. As Figure [7](#fig7){ref-type="fig"} demonstrates, the phosphate ^31^P NMR signal is a much more sensitive measure of the presence of Co(II) impurities. The Co(II) ion impurities do not elute on silica and thus are easily removed from **1**. The same behavior is observed for **1-COOMe**, where silica gel chromatography can be used to remove Co(II) impurities from as-synthesized or precipitated samples.
The Co(II) impurity acts as a source for the formation of the known water oxidation catalyst, Co-OEC. The formation of heterogeneous Co-OEC occurs from solutions of Co(II) with any proton accepting electrolyte, as long as the concentration of the electrolyte is sufficiently high to control pH.^[@ref10],[@ref17]^ Moreover, Co-OEC will be formed from Co(II) either electrochemically or (photo)chemically as long as the potential is sufficient to oxidize Co(II) to Co(III) in the presence of electrolytes such as phosphate or carbonate. Consistent with the formation of Co-OEC, the catalytic wave in Figure [3](#fig3){ref-type="fig"} has the same peak potential and onset current as found for a CV of Co(II) solutions from which Co-OEC electrodeposits ([Figure S24](#notes-1){ref-type="notes"}). However, unlike a well-behaved catalytic process, as is typical of Co-OEC on FTO, a peak response is observed in the cyclic voltammogram. A peak in the catalytic wave will result from either depletion of substrate or catalyst deactivation.^[@ref50]^ Since the solvent, H~2~O, is the substrate, pH is maintained by a high concentration of phosphate, and current densities are low, we can safely rule out substrate depletion as the cause for the peak in Figure [3](#fig3){ref-type="fig"}. However, a peak will result if the catalyst were to be removed from the electrode in a parasitic side reaction, or as in this case, if oxidative degradation of the electrode is significant (vide infra).
Once the impurities are removed by column chromatography, the large catalytic waves in CVs of solutions of unpurified **1** (Figure [3](#fig3){ref-type="fig"}) and **1-COOMe** ([Figure S8](#notes-1){ref-type="notes"}) disappear completely. This behavior is observed on other electrode materials (Pt, Au, and FTO, [Figure S11](#notes-1){ref-type="notes"}) as well. Crude **1** shows higher currents at anodic potentials than purified **1**, providing further evidence that an impurity is responsible for the WOC, as opposed to spurious activity arising from a specific deleterious interaction between the cobalt cubane molecule, **1**, and a GC electrode. SEM, EDS, and XPS support the formation of a heterogeneous Co catalyst, which we attribute to Co-OEC, which deposits on electrodes from bulk electrolyzed solutions of crude **1**. Even in purified samples of **1**, XPS indicates that indeed a small amount of cobalt can be detected on the electrode. The production of Co-OEC from purified **1** explains the small amount of O~2~ observed in the DEMS experiment (Figure [4](#fig4){ref-type="fig"}B, middle panel) and the minute amount of current beyond background (Figure [3](#fig3){ref-type="fig"}, red trace) at potentials above 1.4 V vs Ag/AgCl. If all the current at 1.5 V goes to the production of O~2~, the TOF at this potential would be 0.06 mol O~2~/mol of **1**. However, only an extremely small amount of cobalt in the form of Co-OEC is needed to support the current density associated with this TOF. Using the Tafel slope and the known dependence of the exchange current density on the thickness (i.e., Co content) of films of Co-OEC,^[@ref12]^ it was determined that only ∼70 ppb of **1**, with its 4 cobalt atoms, would need to decompose to furnish enough cobalt to form Co-OEC and produce this observed current density (see [SI](#notes-1){ref-type="notes"} for details of the calculation). However, we note that the amount of Co-OEC and O~2~ produced is negligible as compared to the Co-OEC formed from as-synthesized samples of **1**.
At potentials above 1.4 V, the DEMS results show that the observed current is predominantly due to the production of CO~2~ when a GC electrode is used as the anode. As EDS and XPS results show, the process is so efficient at 1.4 V, that the current is largely redirected from Co-OEC production from the Co(II) impurity to oxidative degradation of the electrode. Importantly, the direct evidence of CO~2~ formation (Figure [4](#fig4){ref-type="fig"}A, bottom) under conditions that thermodynamically favor the formation of Co-OEC argues against the possibility that the Co-OEC catalyst is unstable at these high potentials. If the potential is such that the rate of degradation of the GC surface is rapid, as Stracke et al.^[@ref33]^ have noted, one cannot interpret the *absence* of deposited heterogeneous material after electrolysis as evidence of actual molecular catalysis, since surface catalyst will be lost upon degradation of the underlying electrode. Consistent with this argument, SEM and EDS analysis show a decrease of observable Co-OEC on the electrode for bulk electrolysis experiments performed at 1.4 V vs 1.2 V ([Figures S19 and S20](#notes-1){ref-type="notes"}). Any carbon material (e.g., graphene, carbon nanotubes. etc.) may be compromised due to degradation at high anodic potentials and thus water oxidation experiments performed on carbon-based anodes should be subject to DEMS or other mass spectrometric analysis to ensure that the current is not due to electrode oxidation to CO~2~.
As in electrochemical experiments, removing the Co(II) impurity from photochemically driven WOC also leads to a dramatic reduction in the amount of O~2~ observed (Figure [5](#fig5){ref-type="fig"}). In the photolysis experiment, persulfate (S~2~O~8~^2--^) is used as a sacrificial oxidant to form Ru(bpy)~3~^3+^ upon irradiation. The reduction potential of Ru(bpy)~3~^3+^ is 1.06 V vs Ag/AgCl. At pH = 7, Co-OEC is formed from Co(II) at potentials in the range of 0.75--0.80 V vs Ag/AgCl.^[@ref10]^ Therefore, under the conditions of the photolysis experiment, Co(II) can be oxidized to Co-OEC by Ru(bpy)~3~^3+^. Furthermore, the onset of WOC by Co-OEC is 0.90--0.95 V vs Ag/AgCl, and so Ru(bpy)~3~^3+^ is thermodynamically capable of driving catalyst turnover. In addition, the quenching reaction of Ru(bpy)~3~^2+^ by persulfate to produce Ru(bpy)~3~^3+^, also produces SO~4~^•--^ as a potential oxidant, which has ample overpotential to drive water oxidation (*E*° ∼ 2.2 V vs Ag/AgCl).^[@ref51]^ Thus, the major pathway giving rise to water photooxidation activity with as-synthesized **1** is consistent with the formation of Co-OEC from the in situ oxidation of Co(II) ions.
Although all photochemical studies have used as-synthesized **1**,^[@ref36]−[@ref39]^ and thus water oxidation may be supported by Co-OEC, the present study shows the photochemical oxidation of purified **1** also results in the production of measurable quantities of O~2~ (31 ± 6 μM) over 400 s of photolysis, leading to a TOF = 2.3 × 10^--4^ s^--1^. At the potential of Ru(bpy)~3~^3+^, which is within the Co(III)~3~Co(IV)/Co(III)~4~ wave (Figure [3](#fig3){ref-type="fig"}), no O~2~ is produced as measured by DEMS (Figure [4](#fig4){ref-type="fig"}B). Therefore, Ru(bpy)~3~^3+^ is not a potent enough oxidant to turn over **1**;^[@ref37]^ a greater overpotential is required, if **1** is indeed a molecular catalyst under these specific photochemical conditions. As noted above, the protocol of the photochemical experiment produces the strongly oxidizing species SO~4~^•--^. This species is free not only to react directly with Ru(bpy)~3~^2+^ but also to react with **1** because the concentrations of \[Ru(bpy)~3~^2+^\] = 0.5 mM and \[**1**\] = 0.33 mM are similar. Therefore, the observed O~2~ emanating from the photolysis conditions used for purified **1** in Figure [5](#fig5){ref-type="fig"} is likely due to the interaction of **1** with SO~4~^•--^, which has a considerably more positive reduction potential than Ru(bpy)~3~^3+^.
We envision photochemical WOC activity to be promoted by SO~4~^•--^. This species is capable of breaking the O--H bond (BDFE = 123 kcal/mol)^[@ref52]^ of water directly to produce the radical, **·**OH.^[@ref53]^ We do not expect the C--H bonds of the ligands, and thus the molecule itself, to be thermodynamically stable with respect to hydrogen atom abstraction given the extreme potentials provided by the electron accepting SO~4~^•--^ and proton accepting phosphate buffer species. If the cubane were to decompose, Co-OEC is a likely product of the decomposition pathway. Alternatively, computational investigations into the mechanism of WOC by **1** suggest that two oxidations of **1** to the level of Co(III)~2~Co(IV)~2~ and an acetate ligand dissociation were required prior to water attack and subsequent O--O bond formation.^[@ref46]^ We cannot confirm if SO~4~^•--^ is capable of oxidizing **1**^**+**^ because the electrochemical window limits the range of potentials for investigating the behavior of **1** at potentials beyond 1.5 V. If a higher oxidized cubane is capable of water oxidation activity, it occurs at extremely high overpotentials.
Conclusion {#sec4}
==========
Without purification by silica chromatography, the Co(III) oxo cubanes can be contaminated with Co(II) impurities, which are responsible for the observed water oxidation activity reported for these molecules. We have shown that an EDTA titration can be used to test for the presence of Co(II) and a ^31^P NMR experiment can be used for the Co(II) quantification; these experiments are more definitive than ^1^H NMR spectroscopy for identifying paramagnetic Co(II) impurities. Beyond Co(II) as an impurity, the use of any Co(II) complex should be assessed as an authentic WOC versus precursors for heterogeneous catalysts such as Co-OEC owing to the proclivity of Co(II) complexes to undergo rapid ligand substitution.^[@ref54],[@ref55]^ We note that water oxidation activity of a catalyst should not depend on whether an anodic potential is supplied electrochemically or (photo)chemically for mechanisms involving outer sphere electron transfers. In instances where homogeneous and heterogeneous O~2~ evolution experiments do not concur, it is appropriate to consider whether other species are responsible for catalytic activity. Finally, when inspecting carbon-based electrode surfaces for the deposition of heterogeneous catalysts, care must be exercised in the choice of oxidizing potentials, as extreme values can give rise to spurious current that is associated with CO~2~ evolution and electrode degradation as established by DEMS.
Experimental methods, calculations, X-ray crystallographic data in CIF format, elemental analyses, ^1^H NMR spectra, ESI-MS data, EPR spectra, UV--vis absorption spectra, ^31^P NMR calibration curve data, SEM/EDX images, XPS spectra, and further CV data. This material is available free of charge via the Internet at <http://pubs.acs.org>.
Supplementary Material
======================
######
ja5110393_si_001.pdf
######
ja5110393_si_002.cif
The authors declare no competing financial interest.
This material is based upon work supported by the U.S. Department of Energy Office of Science, Office of Basic Energy Sciences under Award Number DE-SC0009565. EPR spectra were recorded on instruments supported by NIH Award Numbers P41 EB-002804 and EB-002026. SEM and XPS imaging was performed at Harvard University's Center for Nanoscale Systems, a member of the National Nanotechnology Infrastructure Network, which is supported by the NSF under ECS-0335765. The DEMS work at Cornell (HW and HDA) was supported as part of the Energy Materials Center at Cornell, an Energy Frontier Research Center funded by the DOE Office of Basic Energy Sciences under Award Number DE-SC0001086. We acknowledge Dr. Yu-Sheng Chen for assistance with X-ray crystallography at ChemMatCARS, APS. ChemMatCARS Sector 15 is principally supported by NSF/CHE-1346572. Use of APS was supported by the DOE under Contract No. DE-AC02-06CH11357. We thank Dr. Mark Symes for his initial support of this work and for subsequent insightful electronic communications.
| 2023-12-25T01:26:18.401715 | https://example.com/article/6232 |
Transfusion-associated graft-versus-host disease with transfusion practice in cardiac surgery.
Transfusion-associated graft-versus-host disease (TA-GVHD) in immunocompetent patients has still been underdiagnosed and underreported. Risk of TA-GVHD caused by transfusion practice in cardiac surgery should be appropriately recognized. The correlation of TA-GVHD with transfusion practice in cardiac surgery was analyzed from our 17-year clinical experience. We retrospectively reviewed 2,686 consecutive adult patients who underwent cardiac surgery between 1980 and 1996. Classified according to transfusion practice, 847 patients (32%) received nonirradiated fresh homologous whole blood (mean per patient, 5+/-2 units) with or without other blood components; 592 patients (22%) nonirradiated stored RBCs older than 7 days (4+/-2), and 551 patients (21%) received irradiated homologous blood including, fresh whole blood (2+/-1), RBCs (4+/-1), and PCs (8+/-3), respectively. The remaining 696 patients (25%), did not require homologous transfusion. Four of 847 patients who received nonirradiated fresh homologous whole blood (< or =48 hours after donation) developed TA-GVHD. TA-GVHD did not occur in other patients. Our local experience demonstrates the incidence of TA-GVHD in patients who received fresh homologous whole blood in cardiac surgery was much higher, compared with previous reports. This result suggests that the frequency of TA-GVHD is nearly similar to the value calculated from the proportion of HLA haplotypes in the population. | 2024-03-21T01:26:18.401715 | https://example.com/article/8645 |
Watch free online Documentary films in Cosmos Documentaries:
Why Are We Getting So Fat?
Why Are We Getting So Fat?
Production: BBC
Duration: 59:00 min
Language: English
Over 62 per cent of adults in the UK are currently overweight or obese and this figure is set to rise. A common attitude is that obese people should be ashamed - it is their fault, they have no will power and if they could just 'eat less and exercise more', the problem would soon be solved. Yet, despite millions of pounds being spent on this simple message, the UK is getting fatter every year.Cambridge geneticist Dr Giles Yeo believes that for many obese people, simply eating less is a lot harder than you might think - and he is taking a road trip around the UK and America to uncover why. He meets the real people behind some of the more shocking newspaper headlines and, through their stories, reveals surprising truths which dispel commonly held myths about obesity. He gains access to scientists and doctors trialling cutting-edge techniques to tackle the crisis - from a 'miracle' hormone injection to a transfusion of faecal matter, and even learns a thing or two about his own size and relationship with food. | 2023-12-16T01:26:18.401715 | https://example.com/article/2094 |
{% set name = "singlem" %}
{% set version = "0.13.2" %}
package:
name: {{ name|lower }}
version: {{ version }}
source:
url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz
sha256: 46daead5d6ab89b741700544c26027d07b0ca3652c06a91e0a8215634845ea3b
build:
number: 0
noarch: python
script: "{{ PYTHON }} -m pip install . -vv"
requirements:
host:
- pip
- python >=3.6
- nose >=1.0
run:
- python >=3.6
- graftm >=0.12.2
- extern >=0.0.4
- tempdir >=0.6
- biopython >=1.64
- dendropy >=0.4.0
- pandas
- biom-format >=2.1.6
- orator >=0.9.7
- squarify >=0.3.0
- matplotlib-base >=2.0.2
- smafa >=0.5.0
- vsearch
- diamond >=0.9
- hmmer >=3.1b1
- h5py
- krona >=2.4
- orfm >=0.2.0
- pplacer >=1.1.alpha17
- mfqe >=0.5.0
- expressbetadiversity
test:
imports:
- singlem
requires:
- nose >=1.0
commands:
- singlem -h
about:
home: https://github.com/wwood/singlem
license: GNU General Public v3 (GPLv3)
license_family: GPL3
license_file: LICENSE
summary: 'SingleM is a tool to find the abundances of discrete operational taxonomic units (OTUs) directly from shotgun metagenome data, without heavy reliance on reference sequence databases. It is able to differentiate closely related species even if those species are from lineages new to science.'
| 2024-04-02T01:26:18.401715 | https://example.com/article/8748 |
Q:
How to secure my connection string? powershell + xml
I store my connection-string in XML file. Then i use it in powershell script. Is there a way to secure it/to encrypt it somehow?
A:
There are two methods I've seen for encrypting in Powershell
Use *SecureString cmdlets. It should be noted only the Windows ID that encrypted the original string can decrypt it (since it uses the Windows login as key)
Use a pass phrase with the Library-StringCrypto functions
Because of the limitations of the first method, I use the second. I'll then store my encrypted connection string in a SQL table and lock down permissions. To make a connection I'll retrieve the connection string from the SQL table and decrypt using a pass phrase.
| 2024-02-11T01:26:18.401715 | https://example.com/article/5241 |
# This tests the offset off by 22 mystery bug
# Must run slave with --disconnect-slave-event-count=1 --master-connect-retry=1
source include/master-slave.inc;
create table t1 (n int not null auto_increment primary key);
insert into t1 values(NULL);
insert into t1 values(2);
sync_slave_with_master;
select n from t1;
connection master;
drop table t1;
sync_slave_with_master;
# End of 4.1 tests
--source include/rpl_end.inc
| 2024-01-13T01:26:18.401715 | https://example.com/article/5107 |
New research in mice suggests that exposure to a biodiverse soil may improve mental health by raising levels of a bacterium with anxiety-relieving effects.
Share on Pinterest Exposure to biodiversity may have anxiety-relieving effects by altering our gut bacteria, new research in rodents suggests.
Intuitively, we know that living in excessively polluted, built-up areas cannot be good for our health and that breathing in the fresh air of natural spaces must be healthful.
But the impact of green spaces on overall health in general and on mental health, specifically, has been the subject of much recent research.
Older studies have suggested that living near green spaces lowers death risk overall and the risk of dying from a cardiovascular condition in particular. A study that Medical News Today recently reported on found that spending 2 hours in nature yields benefits for a person’s general health and psychological well-being.
Another study published this year suggested that growing up in a green area may lower the risk of developing mental health issues by 55%.
But what explains these mental health benefits? New research points to an interesting microbial link between the health of a person’s ecosystem and their health that may explain the beneficial association between green spaces and human health.
Craig Liddicoat, from the School of Biological Sciences at the University of Adelaide in Australia, led the new research, which appears in the journal Science of the Total Environment. | 2024-03-24T01:26:18.401715 | https://example.com/article/2337 |
NEW BRUNSWICK — A Rutgers University student was injured after being struck by a police car Wednesday afternoon, according to a report on NewBrunswickToday.com.
The student was hit by a Rutgers University police car while trying to cross College Avenue near Scott Hall at 5:24 p.m. Wednesday, the website reported.
The student was taken to nearby Robert Wood Johnson University Hospital with leg injures.
The website said Rutgers hasn't responded to requests for comment about the incident, though NewBrunswickToday.com reported that the school's head of transportation said the incident was being investigated internally.
Neither the police officer driving the car nor the student have been identified.
Follow @starledger | 2024-03-19T01:26:18.401715 | https://example.com/article/5068 |
Blockade of the ERK pathway markedly sensitizes tumor cells to HDAC inhibitor-induced cell death.
Constitutive activation of the extracellular signal-regulated kinase (ERK) pathway is associated with the neoplastic phenotype of a large number of human tumor cells. Although specific blockade of the ERK pathway by treating such tumor cells with potent mitogen-activated protein kinase/ERK kinase (MEK) inhibitors completely suppresses their proliferation, it by itself shows only a modest effect on the induction of apoptotic cell death. However, these MEK inhibitors markedly enhance the efficacy of histone deacetylase (HDAC) inhibitors to induce apoptotic cell death: such an enhanced cell death is observed only in tumor cells in which the ERK pathway is constitutively activated. Co-administration of MEK inhibitor markedly sensitizes tumor cells to HDAC inhibitor-induced generation of reactive oxygen species, which appears to mediate the enhanced cell death induced by the combination of these agents. These results suggest that the combination of MEK inhibitors and HDAC inhibitors provides an efficient chemotherapeutic strategy for the treatment of tumor cells in which the ERK pathway is constitutively activated. | 2023-08-17T01:26:18.401715 | https://example.com/article/1038 |
Applicability of Sepsis-3 criteria and quick Sequential Organ Failure Assessment in patients with cirrhosis hospitalised for bacterial infections.
An algorithm including Sepsis-3 criteria and quick Sequential Organ Failure Assessment (qSOFA) was recently proposed to predict severity of infection in cirrhosis. However, its applicability among patients without a baseline SOFA available for Sepsis-3 definition is unknown. We sought to investigate the applicability and prognostic value of qSOFA and Sepsis-3 criteria in patients with cirrhosis hospitalised for bacterial infections, without pre-hospitalisation SOFA. In this cohort study, 164 patients were followed up to 30 days. Data collection, including the prognostic models, was performed at admission and at day-3. All patients fulfilled Sepsis-3 criteria (admission SOFA ≥ 2) and, therefore, admission Sepsis-3 was not included in further analysis. Admission qSOFA was an independent predictor of survival (HR = 2.271, P = 0.015). For patients initially classified as high risk by qSOFA, Chronic Liver Failure - Sequential Organ Failure Assessment (CLIF-SOFA) was the only prognostic predictor. Among patients initially classified as low risk by qSOFA, the following parameters evaluated at day-3 were independent predictors of survival: qSOFA, acute-on-chronic liver failure, and Child-Pugh classification. Although not independently related to survival, Sepsis-3 criteria at day-3 was associated with lower 30-day survival in Kaplan-Meier analysis (66% vs 85%, P = 0.008). However, prognosis was better predicted by day-3 qSOFA, with 30-day Kaplan-Meier survival probability of 88% when qSOFA < 2 and 24% among those with qSOFA ≥ 2. Sepsis-3 criteria evaluated at admission are very limited in infected patients with cirrhosis without baseline SOFA. qSOFA was independently related to survival and appears to be a valuable tool for determining severity of infection and to follow patients initially classified as low risk. | 2024-03-05T01:26:18.401715 | https://example.com/article/8318 |
Q:
Can the iOS app open TikTok user profile?
Is there a way to open a TikTok user profile in the TikTok app instead of directing to the browser from our app?
Let's use Twitter example as they allow it:
twitter://user?screen_name=(username)
A:
The solution was found. If the app is installed on the phone and you try to launch a TikTok profile from
https://www.tiktok.com/@(username)
it will redirect you to the chosen profile in the app.
| 2023-11-22T01:26:18.401715 | https://example.com/article/5286 |
Q:
I do not see the text in 'Chiller' font, I request while using google web fonts
I was trying to use google web fonts on my JSP page but it doesn't seem to work correctly. On my Fedora 16 OS I have got Chiller font installed. And when I run the code that displays the text in Chiller font using google font apis on Fedora, it displays the text in that font but when I try it on Ubuntu, that doesn't have the chiller font installed, browser displays the default font it might use in the fallback. What could be the reason for this ? The snippet :
<head>
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
<link rel="stylesheet" type="text/css" href="http://fonts.googleapis.com/css?family=Chiller">
<style>
#page_font {
font-family: 'Chiller';
font-size: 50px;
}
</style>
<title>New Year Countdown </title>
</head>
<body> <div id="page_font"> <br /> Countdown </div> </body>
Note: The web address of that JSP page, where I have used this snippet.
A:
When calling http://fonts.googleapis.com/css?family=Chiller the Google website responds with:
Error (400): Missing font family
They didn't have a font named "Chiller"!
| 2023-09-12T01:26:18.401715 | https://example.com/article/2439 |
Median nerve damage during two-portal endoscopic carpal tunnel release.
To evaluate the adverse effects of Chow's two-portal endoscopic carpal tunnel release (ECTR) performed by an experienced surgeon on median nerve function in patients with idiopathic carpal tunnel syndrome, as compared to open carpal tunnel release (OCTR). Eighty-seven hands subjected to ECTR and 65 hands subjected to OCTR were reviewed. Both groups of patients were similar with regard to age, gender, and severity of the disease. Both groups were compared for the number of hands showing worsening of motor distal latency, sensory conduction velocity, and sensory disturbance after surgery. Thirteen hands of 12 patients showed worsening of median nerve function after ECTR, while only one hand showed worsening after OCTR. This difference was statistically significant (p=0.0041). Median nerve damage, although transient or not serious, may occur even if the procedure is done correctly. | 2024-07-22T01:26:18.401715 | https://example.com/article/4377 |
Anzeige
Im Nachhinein wird man sagen, die Billion war das Menetekel. Nachdem Amazon an der Börse – sehr kurzfristig – diesen Marktwert erreichte, ist die Stimmung gekippt. Und zwar brutal. Seit jenem Tag im Frühherbst werden Technologieaktien, zuvor jahrelang absolute Favoriten der Börsianer, plötzlich abverkauft.
Und jetzt hat sich der Abverkauf am Aktienmarkt dramatisch beschleunigt. Am Dienstag verloren Technologie-Titel auf breiter Front. Besonders hart traf es jene Werte, die die Börsenrallye der letzten Jahre angeschoben hatten: die Hightech- und Internet Schwergewichte Facebook, Amazon, Apple, Netflix und Google.
Deren Einfluss war so groß, dass Analysten aus den Anfangsbuchstaben der Firmennamen sogar eine eigene Formel bauten – die Formel der vermeintlich großen Gewinner des 21. Jahrhunderts: FAANG. Seit dieser Woche sind die viel gelobten FAANG-Aktien im Bärenmarkt.
Quelle: Infografik WELT
Verluste summieren sich jetzt auf eine Billion Dollar
Anzeige
Von „bear market“ (deutsch: Bärenmarkt) reden Börsianer, wenn Aktien oder Indices mehr als 20 Prozent verloren haben. Nicht selten brechen nach dem Verlust des ersten Fünftels alle Dämme. Investoren ziehen dann die Glaubwürdigkeit und Werthaltigkeit der ganzen „story“ in Zweifel und drücken bei jeder schlechten Zahl und jedem leisen Zweifel den Verkaufsknopf.
Die Verluste der FAANG-Aktien summieren sich jetzt – und da ist die Schicksalsziffer wieder – auf eine Billion Dollar. Im Hoch waren alle Aktien von Facebook, Amazon, Apple, Netflix und Google an der Börse 3,8 Billionen Dollar wert. Heute zahlen Investoren für die gleichen Aktien nur noch 2,8 Billionen Dollar. Der Schwund an Marktkapitalisierung entspricht der jährlichen Wirtschaftsleistung Mexikos.
Lesen Sie auch Schwächelnder Gigant Das Ende von Google hat begonnen
„Der ganze Kursaufschwung der Technologieaktien basierte auf der Annahme quasi unbegrenzten Wachstums“, sagt Frank Wieser, Geschäftsführer von PMP Vermögensmanagement in Düsseldorf. „Um das Kursniveau von Amazon zu rechtfertigen, müsste der Internethändler jährlich im hohen zweistelligen Bereich wachsen. Das ist aber einfach dauerhaft nicht möglich.“
Anzeige
Anfang September erreichte Amazon ein Rekordhoch bei 2050 Dollar. Damit wurde die Aktie des Online-Versandhändlers mit einem Kurs/Gewinn-Verhältnis (KGV) von fast 100 bewertet. Das bedeutet, dass Anleger einen Dollar Gewinn und etwaige Gewinnansprüche an der Börse mit dem hundertfachen Preis bezahlten.
Und dieses KGV basierte bereits auf den Gewinnschätzungen für das laufende, noch gar nicht abgeschlossene Geschäftsjahr. Doch als Amazon mit den Zahlen zum dritten Quartal einen etwas weniger euphorischen Ausblick veröffentlichte, beschleunigte sich der Ausverkauf.
Auswirkungen über Technologiesektor hinaus
Dazu kam, dass sich die globalen Konjunkturerwartungen insgesamt eintrübten und die amerikanische Notenbank gleichzeitig die Zinsen immer weiter anhob. „Bei wachstumsorientierten Unternehmen, wie beispielsweise Amazon, kommen die hohen Bewertungsniveaus an der Börse vor allem durch die Gewinnperspektiven der Zukunft zustande”, sagt Thomas Wüst, Vermögensverwalter bei Valorvest in Stuttgart.
Anzeige
Werden diese geringeren Prognosen auch noch mit höheren Sätzen abgezinst, kommt es zu einer doppelten Kompression. „Preisrückgängige im Technologiesektor sind stets auch Reflexe auf eine sich abschwächende Konjunktur”, sagt Markus Merkel, Vermögensverwalter bei Steinbeis & Häcker in München.
Quelle: Infografik WELT
Die großen US-Technologiewerte haben einen Abstrahleffekt für die restlichen Aktienbörsen. Als es anderswo bereits düster aussah, strahlten die FAANG-Titel noch hell. Damit scheint es nun vorerst vorbei. Im Gegenteil: Die gefallenen Hightech-Hoffnungen reißen die globalen Börsen in ihrem Sturz mit nach unten, und das betrifft keineswegs nur den Technologiesektor.
Auch der Deutsche Aktienindex (Dax) nähert sich der Marke, wo er in einen Bärenmarkt eintritt, was weitere Kursverluste wahrscheinlich machen würde. Die entsprechende Marke liegt bei 10.877 Punkten. Am Dienstag war das Börsenbarometer schon nicht mehr allzu weit vom davon entfernt: Am späten Nachmittag markierte der Dax bei 11.009 Punkten ein Jahrestief. Das entspricht einem Minus von rund 14 Prozent.
„Wachstumsstory ins Wanken gebracht“
Schon seit einiger Zeit warnen Beobachter davor, dass die Technologiesphäre an die Grenzen ihres Wachstums stößt. Facebook zeigt das exemplarisch. Inzwischen hat das soziale Netzwerk 2,3 Milliarden Nutzer. Viel mehr können es angesichts der auf der Erde lebenden Menschen mit Internet-Zugang nicht werden. Zwar muss das Unternehmen versuchen, mehr Wachstum aus den bestehenden Kunden herauszuholen.
Allerdings ist das mit einem strengen Datenschutz kaum möglich. Auch neue Geschäftsfelder zu erschließen wird immer schwieriger, weil Facebook wegen seiner Macht schon heute unter verschärfter Aufsicht steht. „Die zuletzt mäßigen Zahlen von Facebook haben die ganze Wachstumsstory ins Wanken gebracht“, erinnert sich Wieser.
Quelle: Infografik WELT
Thomas Wüst spricht von einer Gemengelage, die die FAANG-Aktien insgesamt stark unter Druck bringen kann, auch wenn deren Geschäftsmodelle sich im Einzelnen deutlich unterscheiden. „Es gilt weiterhin der Grundsatz für die künftige Bewertung der Unternehmen der Plattformökonomie, dass die künftige Regulierung eine wichtige Einflussgröße auf die künftige Unternehmensbewertung darstellt“, sagt der Vermögensverwalter. Regulierung sei auf internationaler Ebene ohnehin schwer kalkulierbar.
„Die Korrektur im Technologiebereich war überfällig. Die normale Börsenkorrektur hatte Monate vorher eingesetzt, und letztendlich haben die Technologieaktien auch den generellen Blick auf die Märkte vernebelt“, sagt Wieser. Eine durchschnittliche Korrektur dauere zwischen zwölf und 15 Monaten.
Anzeige
„Da sind wir aktuell mittendrin. Die Technologieaktien haben gerade erst mit der Korrektur angefangen und dürften wohl noch einiges Abwärtspotenzial haben“, sagt Wieser. Das ist jedoch das optimistische Szenario. Andere sehen Parallelen zur Dotcom-Blase, die im Jahr 2000 platzte.
Lesen Sie auch Meinung Handelskrieg Google, Facebook und Amazon sollen in Europa mehr Steuern zahlen!
„Deren Helden waren einst ebenso dominant wie die FAANG-Aktie heute“, sagt Dario Perkins, Stratege beim Analysehaus TS Lombard. Im Jahr 2000 hätten die zehn führenden Tech-Titel Microsoft, Cisco, Intel, IBM, AOL, Oracle, Dell, Sun, Qualcomm und HP ebenfalls 13 Prozent des gesamten Börsenwerts ausgemacht, ähnlich wie heute FAANG. Selbst nach 18 Jahren hat keiner der damaligen Tech-Giganten den breiten Markt geschlagen, warnt Perkins.
„Selbst wenn die neuen Technologien die Welt heute nachhaltig verändern, kann niemand sagen, ob die Unternehmen die Wachstumshoffnungen wirklich erfüllen können.“ Enttäuschte Hoffnungen aber werden teuer bezahlt. Sollte sich die Geschichte der Dotcom-Blase wiederholen, müssen sich Anleger auf eine lange Durststrecke einstellen. | 2023-09-06T01:26:18.401715 | https://example.com/article/9078 |
1. Introduction {#sec1}
===============
Advances in drug therapy have resulted in efficacious treatments being available for many acute and chronic medical conditions; however, it is well recognized that "Drugs don\'t work in patients who don\'t take them" \[[@B1]\]. The WHO defines adherence, a term which is often used interchangeably with compliance, as the extent to which a person\'s behaviour-taking medication, following a diet, and/or executing lifestyle changes, corresponds with agreed recommendations from a health care provider \[[@B2]\]. Unfortunately, nonadherence with medication regimens is not uncommon with the potential negative consequences of failure to achieve the desired treatment goal. Many factors may play a role in whether patients comply with their therapy and pregnancy may present unique challenges as fetal well-being must also be considered in addition to maternal health. This paper will provide a brief overview of medication adherence in general and then will focus on some of the issues related to medication-taking behaviour during pregnancy.
2. Overview of Medication Adherence {#sec2}
===================================
Nonadherence with drug therapy may take many forms with delayed or omitted doses being the most common errors. Discontinuation of medication administration prior to completion of the course is also common. Adherence is generally measured over a specified period of time and often reported as the percentage of the prescribed doses of medication actually taken by the patient \[[@B3]\]. In a meta-analysis of 569 studies, reported adherence to medical treatment ranged from 4.6% to 100% with a median of 76% and an overall average of 75.2% \[[@B4]\]. Drug compliance may be of particular concern with chronic conditions as therapy is often long term and patients without symptoms may be required to take medication to prevent later complications without any immediate benefits noted. Contrary to what one might think seriousness of the underlying medical condition does not ensure compliance, as has been shown with both cancer and organ transplant therapy \[[@B5]--[@B9]\]. Not taking one\'s medication is not without clinical implications given the relationship between inadequate adherence and unfavourable disease outcome. In a meta-analysis of 21 studies, good adherence with drug therapy was associated with lower mortality compared with poor adherence (odds ratio 0.56, 95% CI 0.50--0.63) \[[@B10]\]. Other consequences of nonadherence may include inappropriate alteration in treatment regimens or dosage adjustments with subsequent toxicity, unnecessary investigations, and increased costs.
Nonadherence with medical therapy is a complex multifaceted problem involving patient and family factors, disease factors, physician factors, and regimen factors \[[@B11]\]. Unfortunately, none of these factors have been found to reliably predict which patients will or will not take their prescribed medication. Various methods are available to assess adherence; however, all have advantages and disadvantages and no universally accepted gold standard exists. The accuracy of self-reporting is often questioned, in particular when the suggestion is that compliance is good. Pill counts may also underestimate adherence as patients "dump" their pills prior to their clinic visit. Measurement of drug levels, available for a limited number of medications, only reflects recent ingestion. Electronic monitors that provide continuous "real-time" measurement can provide information on temporal dosing patterns and allow correlation with breakthrough clinical events.
It is important to have a high index of suspicion in order to identify early those noncompliant patients who have failed to attain their treatment goal and who may benefit from more targeted support and adherence-enhancing strategies that may include educational and behavioural approaches. Potential barriers to adherence should be identified. No single intervention has been shown to be effective across all patients, conditions, and settings \[[@B12]\]. In a review of interventions for enhancing medication adherence less than one-half of the interventions tested were associated with statistically significant increases in medication adherence and only 29 of 93 interventions reported statistically significant improvements in treatment outcomes. The common theme was more frequent interaction with patients with attention to adherence \[[@B13]\].
3. Medication Adherence in Pregnancy {#sec3}
====================================
Despite the ample evidence in the literature of the important role of adherence with drug therapy in influencing treatment outcome in the general medical population, there is a relative paucity of studies that have focused specifically on whether pregnant women do or do not take their medication. Much of the research addressing medication compliance during pregnancy has been undertaken in women with HIV infection although there are scattered reports in other medical conditions.
The information available suggests that nonadherence with prescribed drugs is also a problem in the pregnant population. 39% of women who received one or more prescriptions reported noncompliance during pregnancy when interviewed within two weeks after delivery. Reasons included doubts about the use of the drug during pregnancy, expected side effects, disappearance of the complaints for which the drugs were prescribed, or the complaint persisted notwithstanding drug therapy. Approximately 40% of women had had one or more questions about drugs during their pregnancy with safety being the issue that raised most questions \[[@B14]\].
Similarly, using data from the North Jutland Prescription Database and from the Danish National Birth Cohort survey, the overall compliance rate with prescription drugs in pregnant women was estimated to be 43% \[[@B15]\]. In the outpatient clinics of an Australian hospital, medication nonadherence was reported by 59.1% of pregnant participants with a chronic health condition. Nonadherence was mainly nonintentional, with forgetting to take medication being the most common reason. In this study, the majority of participants had some concerns about using any medication during pregnancy \[[@B16]\].
3.1. Adherence with HIV Medications {#sec3.1}
-----------------------------------
Poor adherence with HIV treatment regimens may be a determinant of virologic failure, emergence of drug resistant virus, and disease progression \[[@B17]\]. In addition to treating the mother\'s underlying disease, antiretroviral treatment in pregnant women also aims to prevent vertical perinatal HIV transmission to the child \[[@B18], [@B19]\]. Highly active antiretroviral therapy (HAART) has reduced mother-to-child transmission rates to around 1 to 2% in resource-rich countries \[[@B20]\]. Lack of medication adherence in pregnant women with HIV infection may interfere with these goals. Medication nonadherence was a significant factor associated with suboptimal viral suppression at the time of delivery (defined by HIV viral load ≥ 1000 copies) in addition to baseline viral load ≥10,000 copies per milliliter \[[@B21]\].
Studies have shown that HIV-infected pregnant women have greater adherence with antiretroviral drugs than nonpregnant women \[[@B22]--[@B24]\]. However, adherence rates during pregnancy are still not optimal and have been reported to be between 43.1% and 80% using various methods of compliance assessment \[[@B22]--[@B28]\]. Better compliance with prescribed medications during pregnancy may be related to concern for the baby\'s health \[[@B24], [@B29]\]. In the Women and Infant Transmission Study, 90% of women who reported improved adherence with their HIV medications during pregnancy stated that their baby\'s health was the primary reason \[[@B24]\]. Dosing regimen has also been shown to be important as less than 6 pills per day and up to two doses per day were associated with better adherence \[[@B22]\]. Similarly, pregnant women who were prescribed zidovudine only once or twice daily demonstrated significantly higher adherence than those prescribed this medication three to five times per day \[[@B23]\]. Social support, especially from family members, has a positive influence on medication-taking behaviour \[[@B25]\].
Barriers to good adherence with antiretroviral therapy include being preoccupied with other issues and hectic lifestyles \[[@B29]\] as well as illicit drug use \[[@B27], [@B28]\]. Untreated depression during pregnancy is also associated with nonadherence to HIV treatment regimens and treatment of depression may improve medication adherence \[[@B30]\]. As poor adherence with antiretroviral drugs during pregnancy may predict nonattendance at infant followup \[[@B31]\], identifying women who are having trouble taking their medication is important.
3.2. Adherence with Medications Prescribed for Other Conditions {#sec3.2}
---------------------------------------------------------------
As in the general population less than perfect adherence with medication taking has been demonstrated in patients with other medical conditions, examples of which will be discussed.
### 3.2.1. Epilepsy {#sec3.2.1}
Incomplete compliance with anticonvulsant medication was reported by 62.3% (157/252) of pregnant women with epilepsy \[[@B32]\]. Hair analysis was undertaken in 26 pregnant women taking carbamazepine or lamotrigine with four patients (15%) showing declines in drug concentration in the more proximal segments suggesting a change in drug-taking behaviour. Results were interpreted to suggest that these women had discontinued their medication during pregnancy \[[@B33]\].
### 3.2.2. Asthma {#sec3.2.2}
For three categories of asthma severity before pregnancy (intermittent, mild persistent, and moderate/severe), mothers whose medication use fell below the recommended guideline experienced more severe asthma during pregnancy than women using their recommended medication \[[@B34]\]. In an online survey, 39% of women who have been pregnant reported that they had discontinued or reduced their asthma medication during pregnancy, a third having done so without discussion with a physician. Of potential significance in managing these patients, 40% of women indicated that they would be more likely to continue taking their asthma medication during pregnancy if their obstetrician alone recommended it \[[@B35]\]. 40% of pregnant asthmatic subjects reported nonadherence to inhaled corticosteroid medication (ICS). However, after asthma education nonadherence to ICS decreased to 21% \[[@B36]\] which is important to note as lack of appropriate treatment with inhaled corticosteroids is associated with exacerbations of asthma during pregnancy \[[@B37]\].
### 3.2.3. Inflammatory Bowel Disease {#sec3.2.3}
Although studies have suggested that exacerbations of inflammatory bowel disease (IBD) during pregnancy may worsen pregnancy outcomes, 84% of female patients with IBD reported concerns that their IBD medications would harm their pregnancy while only 19% reported concerns about the effect of active IBD on pregnancy \[[@B38]\]. In Crohn\'s disease 67% (37/55) of women reported adherence to medical treatment during pregnancy \[[@B39]\] while in ulcerative colitis 60% (37/62) of women reported adherence \[[@B40]\]. With both conditions, reasons stated for nonadherence included quiescent disease and fear of negative effects on the fetus \[[@B39], [@B40]\].
### 3.2.4. Nicotine Replacement Therapy {#sec3.2.4}
Adherence to nicotine replacement therapy (NRT) is low among pregnant smokers. Fish et al. found that overall only 29% of 104 women used NRT for the recommended 6 weeks and 41% used NRT as directed in the first 48 hours after a quit attempt \[[@B41]\].
4. Factors Affecting Medication Adherence in Pregnancy: Perception of Risk {#sec4}
==========================================================================
In addition to the multiple factors that may affect medication adherence in the nonpregnant population, there are unique influences that may play a role in pregnant women. On the one hand, pregnant women may be motivated to take their medication for the well-being of their baby, mindful of the potential negative fetal consequences of untreated maternal disease. On the other hand, it has been demonstrated that women may not take their medication due to concerns regarding potential adverse fetal effects \[[@B14], [@B39], [@B40], [@B42]\]. In some cases this fear may be justified based on known teratogenic effects; however, in many cases medications have not been demonstrated to be harmful. It has been shown that pregnant women tend to overestimate the risks associated with drug use during pregnancy. Most women who completed an internet survey were able to correctly identify that the general risk of malformation is ≤5%; however, they overestimated the teratogenic risk associated with many drugs during pregnancy \[[@B43]\].
5. Improvement in Medication Adherence in Pregnancy {#sec5}
===================================================
If women with inadequately controlled disease due to inadequate adherence with drug therapy are identified, they may be targeted for evidence-based counselling to correct their misperceptions, allay their fears, and hopefully improve medication-taking behaviour \[[@B43]\]. In addition, it may be possible to avoid medication nonadherence before it happens by proactively addressing the pregnant woman\'s concerns about the safety of medications. Ideally, with chronic drug therapy this counselling may occur as part of prepregnancy planning. Survey studies have shown that pregnant women feel they need information about the use of drugs during pregnancy \[[@B14], [@B42]\]. Media and other sources may provide misleading information provoking anxiety amongst pregnant women \[[@B43]\]. Given the overestimation of risk, the discussion should include, if available, evidence-based information on the effects of the medication\'s use during pregnancy allowing the pregnant women to make an informed decision as to whether to continue their prescribed therapy. Education should focus on the important role of good medication adherence for the health of both the mother and fetus.
Counselling by teratogen information services may play a role in influencing medication-taking behaviour \[[@B43]\]. After counselling by Motherisk, a Canadian teratogen information service, 61.1% (22/36) of pregnant women who had discontinued their antidepressant or benzodiazepine medication restarted their medication within a few days \[[@B44]\]. Health care workers, such as obstetricians and family physicians, are uniquely positioned to not only monitor adherence but to encourage consultation with drug information services to dispel misconceptions about the risks of medications to the fetus.
A meta-analysis of studies of directly observed therapy of highly active antiretroviral therapy (DOT-HAART) found that DOT-HAART recipients were more likely to achieve undetectable viral load and HAART adherence of greater than or equal to 95% \[[@B45]\]. A similar approach has been suggested for pregnant women. The third trimester of pregnancy may present an opportunity for the use of directly observed HAART to achieve virologic suppression for prevention of mother-to-child transmission of HIV \[[@B46]\]. Using a simulation model, use of DOT in women receiving HAART in 3rd trimester was associated with a relative risk of mother-to-child HIV transmission of 0.39 relative to conventional HAART. It was projected to be highly cost-effective, averting the downstream medical costs associated with pediatric HIV infection \[[@B46]\]. All but one of 17 Latina pregnant and postpartum women positively evaluated a proposed hypothetical modified DOT program \[[@B29]\] suggesting that at least some women would be accepting of this approach.
6. Summary {#sec6}
==========
Surprisingly, although it is generally accepted that the maintenance of good health of the pregnant women through the treatment of underlying maternal medical conditions is of potential benefit to the unborn fetus, medication nonadherence is a commonly encountered problem in this population. As in the nonpregnant patient the problem is complex with many factors playing a role; however, additional issues such as the potential effects of the medication on the baby may affect the mother\'s decision-making process. Ideally, poor compliance with therapy can be avoided through appropriate education of the mother although it is unlikely that this approach will be effective in all cases and solve all problems. More research to provide the evidence-based information regarding the effects of drugs during pregnancy, in order to avoid misperceptions, as well as better knowledge translation is needed. Identification and evaluation of other effective strategies to improve medication adherence in pregnant women who are already not taking their medication will also be important.
[^1]: Academic Editor: Gideon Koren
| 2024-02-15T01:26:18.401715 | https://example.com/article/2924 |
Successful thrombectomy for coronary embolism likely due to floating aortic plaque in ascending aorta.
A 70-year-old man with chest pain underwent coronary intervention for acute myocardial infarction. We immediately performed coronary thrombectomy with aspiration catheter and collected solid material as a result. After aspiration, we achieved thrombolysis in myocardial infarction trial (TIMI)-flow grade 3 without stenosis. Transesophageal echocardiography showed no intracardiac thrombus but pronounced mobile aortic plaque in ascending aorta. Transthoracic echocardiography showed moderate aortic regurgitation. A histological examination of retrieved material revealed severe calcified atherosclerotic plaque without thrombotic components. Thereby, coronary embolism in this case may have been caused by embolism of flaked aortic plaque, which was possibly carried by aortic regurgitation flow. | 2024-04-09T01:26:18.401715 | https://example.com/article/5425 |
NEW YORK (CNN/Money) - Berkley von Feilitzsch and her husband, Harry, have always dreamed of building a house of their own. They wanted to create something beautiful that would last a lifetime, but on a budget they could afford.
So, in spring of 2001, they took matters into their own hands.
"We decided to build our house without hiring a general contractor to have more control over the quality of work and the pace of construction," she said, noting the cost savings in the end more than made up for the extra legwork required.
The von Feilitzschs already owned undeveloped property in Northern Virginia, about 60 miles southwest of Washington, D.C. When baby number three came along, they knew it was time to break ground for a larger home. They selected the blueprints for their new pad and immediately set to work hiring independent contractors, coordinating schedules and filing all the necessary paperwork.
The von Feilitzschs' new house. (Photo taken right before the Thanksgiving Holiday '01)
Initially, they said, friends and relatives questioned their ability to manage the project on their own.
"With my husband working full-time as a management consultant and a new baby on the way, a few people said they thought we were crazy to do it ourselves," Berkley said.
The von Feilitzschs are among the thousands of people each year who embark on home construction - a souped up version of the American dream. If you're planning to join them, be forewarned it requires organizational skills, energy and patience to spare.
Is it worth the risk?
First, building permits and periodic inspections are required throughout the process, notes Robert Metcalfe, author of Housing Contracting and Building. If you're acting as the general contractor to save some dough, you'll have to set those up yourself.
Deposits also are required for all utilities before construction can begin, and getting your building permits can be a frustrating experience, especially for those who are unfamiliar with the system, according to the Arcadian Home Builders Association (AHBA). Mistakes can be costly and time-consuming.
The agency also notes that homeowners may only legally build one home per year, and are required to occupy the home upon completion. Otherwise, they're considered to be professional builders.
Also, homeowner contractors may not be required to carry workman's compensation insurance under state regulations, but it would be wise to require all subcontractors to present certification of their own workman's compensation coverage, according to AHBA.
It also is required by law to know that all your subcontractors who employ workers carry workman's compensation insurance.
Metcalfe warned you should always double check that the house plan you've selected can be physically constructed on your property. Some blueprints, for example, cannot be altered to conform to hilly slopes. This step should be determined prior to purchasing the land.
A watchful eye
Metcalfe said organization and constant oversight are the key elements to being a good general contractor. "If you cannot be on the project each day to check on things, then you should not try and be your own contractor," he advised.
The von Feilitzschs' new house. (As of Dec. 11, 2001) They expect to move into the new home by the end of March.
The Feilitzschs, for example, have three boys, age 8, 4 and 4 months old. As Berkley recalled, she had to call in an inspection from the hospital the day her youngest son was born.
"Our youngest son, Matthias, was born on a Monday morning, and that afternoon I got word that our excavator needed his backfill inspection done as soon as possible, so he could continue without delay," she said. "So I called the building office from my hospital bed and was able to keep things on track."
Metcalfe said managing the construction of your own home, without the help of a general contractor, can save homeowners up to 20 percent on the price of construction. On a $200,000 home, that's a savings of $40,000. But it's by no means the easiest way to get the job done.
For the young von Feilitzsch couple, dollars and cents factored heavily in their decision to go it alone. Their house is nearly complete and so far they they've saved between 25 and 30 percent overall. The price of the land, of course, remains the same.
In addition to the savings, Berkley said the experience helped her and her husband pay closer attention to details, ensuring they end up with exactly what they wanted. They expect to occupy their new house at the end of March.
"I am a housewife, and building the house has taken a considerable amount of time," she said. "But the greatest benefit is that we get to take part in every decision regarding the building of our new home." | 2024-03-03T01:26:18.401715 | https://example.com/article/8981 |
using NHapi.Base.Parser;
using NHapi.Base;
using NHapi.Base.Log;
using System;
using System.Collections.Generic;
using NHapi.Model.V28.Segment;
using NHapi.Model.V28.Datatype;
using NHapi.Base.Model;
namespace NHapi.Model.V28.Group
{
///<summary>
///Represents the CCU_I20_GOAL Group. A Group is an ordered collection of message
/// segments that can repeat together or be optionally in/excluded together.
/// This Group contains the following elements:
///<ol>
///<li>0: GOL (Goal Detail) </li>
///<li>1: VAR (Variance) optional repeating</li>
///<li>2: CCU_I20_ROLE_GOAL (a Group object) optional repeating</li>
///<li>3: CCU_I20_GOAL_OBSERVATION (a Group object) optional repeating</li>
///</ol>
///</summary>
[Serializable]
public class CCU_I20_GOAL : AbstractGroup {
///<summary>
/// Creates a new CCU_I20_GOAL Group.
///</summary>
public CCU_I20_GOAL(IGroup parent, IModelClassFactory factory) : base(parent, factory){
try {
this.add(typeof(GOL), true, false);
this.add(typeof(VAR), false, true);
this.add(typeof(CCU_I20_ROLE_GOAL), false, true);
this.add(typeof(CCU_I20_GOAL_OBSERVATION), false, true);
} catch(HL7Exception e) {
HapiLogFactory.GetHapiLog(GetType()).Error("Unexpected error creating CCU_I20_GOAL - this is probably a bug in the source code generator.", e);
}
}
///<summary>
/// Returns GOL (Goal Detail) - creates it if necessary
///</summary>
public GOL GOL {
get{
GOL ret = null;
try {
ret = (GOL)this.GetStructure("GOL");
} catch(HL7Exception e) {
HapiLogFactory.GetHapiLog(GetType()).Error("Unexpected error accessing data - this is probably a bug in the source code generator.", e);
throw new System.Exception("An unexpected error ocurred",e);
}
return ret;
}
}
///<summary>
/// Returns first repetition of VAR (Variance) - creates it if necessary
///</summary>
public VAR GetVAR() {
VAR ret = null;
try {
ret = (VAR)this.GetStructure("VAR");
} catch(HL7Exception e) {
HapiLogFactory.GetHapiLog(GetType()).Error("Unexpected error accessing data - this is probably a bug in the source code generator.", e);
throw new System.Exception("An unexpected error ocurred",e);
}
return ret;
}
///<summary>
///Returns a specific repetition of VAR
/// * (Variance) - creates it if necessary
/// throws HL7Exception if the repetition requested is more than one
/// greater than the number of existing repetitions.
///</summary>
public VAR GetVAR(int rep) {
return (VAR)this.GetStructure("VAR", rep);
}
/**
* Returns the number of existing repetitions of VAR
*/
public int VARRepetitionsUsed {
get{
int reps = -1;
try {
reps = this.GetAll("VAR").Length;
} catch (HL7Exception e) {
string message = "Unexpected error accessing data - this is probably a bug in the source code generator.";
HapiLogFactory.GetHapiLog(GetType()).Error(message, e);
throw new System.Exception(message);
}
return reps;
}
}
/**
* Enumerate over the VAR results
*/
public IEnumerable<VAR> VARs
{
get
{
for (int rep = 0; rep < VARRepetitionsUsed; rep++)
{
yield return (VAR)this.GetStructure("VAR", rep);
}
}
}
///<summary>
///Adds a new VAR
///</summary>
public VAR AddVAR()
{
return this.AddStructure("VAR") as VAR;
}
///<summary>
///Removes the given VAR
///</summary>
public void RemoveVAR(VAR toRemove)
{
this.RemoveStructure("VAR", toRemove);
}
///<summary>
///Removes the VAR at the given index
///</summary>
public void RemoveVARAt(int index)
{
this.RemoveRepetition("VAR", index);
}
///<summary>
/// Returns first repetition of CCU_I20_ROLE_GOAL (a Group object) - creates it if necessary
///</summary>
public CCU_I20_ROLE_GOAL GetROLE_GOAL() {
CCU_I20_ROLE_GOAL ret = null;
try {
ret = (CCU_I20_ROLE_GOAL)this.GetStructure("ROLE_GOAL");
} catch(HL7Exception e) {
HapiLogFactory.GetHapiLog(GetType()).Error("Unexpected error accessing data - this is probably a bug in the source code generator.", e);
throw new System.Exception("An unexpected error ocurred",e);
}
return ret;
}
///<summary>
///Returns a specific repetition of CCU_I20_ROLE_GOAL
/// * (a Group object) - creates it if necessary
/// throws HL7Exception if the repetition requested is more than one
/// greater than the number of existing repetitions.
///</summary>
public CCU_I20_ROLE_GOAL GetROLE_GOAL(int rep) {
return (CCU_I20_ROLE_GOAL)this.GetStructure("ROLE_GOAL", rep);
}
/**
* Returns the number of existing repetitions of CCU_I20_ROLE_GOAL
*/
public int ROLE_GOALRepetitionsUsed {
get{
int reps = -1;
try {
reps = this.GetAll("ROLE_GOAL").Length;
} catch (HL7Exception e) {
string message = "Unexpected error accessing data - this is probably a bug in the source code generator.";
HapiLogFactory.GetHapiLog(GetType()).Error(message, e);
throw new System.Exception(message);
}
return reps;
}
}
/**
* Enumerate over the CCU_I20_ROLE_GOAL results
*/
public IEnumerable<CCU_I20_ROLE_GOAL> ROLE_GOALs
{
get
{
for (int rep = 0; rep < ROLE_GOALRepetitionsUsed; rep++)
{
yield return (CCU_I20_ROLE_GOAL)this.GetStructure("ROLE_GOAL", rep);
}
}
}
///<summary>
///Adds a new CCU_I20_ROLE_GOAL
///</summary>
public CCU_I20_ROLE_GOAL AddROLE_GOAL()
{
return this.AddStructure("ROLE_GOAL") as CCU_I20_ROLE_GOAL;
}
///<summary>
///Removes the given CCU_I20_ROLE_GOAL
///</summary>
public void RemoveROLE_GOAL(CCU_I20_ROLE_GOAL toRemove)
{
this.RemoveStructure("ROLE_GOAL", toRemove);
}
///<summary>
///Removes the CCU_I20_ROLE_GOAL at the given index
///</summary>
public void RemoveROLE_GOALAt(int index)
{
this.RemoveRepetition("ROLE_GOAL", index);
}
///<summary>
/// Returns first repetition of CCU_I20_GOAL_OBSERVATION (a Group object) - creates it if necessary
///</summary>
public CCU_I20_GOAL_OBSERVATION GetGOAL_OBSERVATION() {
CCU_I20_GOAL_OBSERVATION ret = null;
try {
ret = (CCU_I20_GOAL_OBSERVATION)this.GetStructure("GOAL_OBSERVATION");
} catch(HL7Exception e) {
HapiLogFactory.GetHapiLog(GetType()).Error("Unexpected error accessing data - this is probably a bug in the source code generator.", e);
throw new System.Exception("An unexpected error ocurred",e);
}
return ret;
}
///<summary>
///Returns a specific repetition of CCU_I20_GOAL_OBSERVATION
/// * (a Group object) - creates it if necessary
/// throws HL7Exception if the repetition requested is more than one
/// greater than the number of existing repetitions.
///</summary>
public CCU_I20_GOAL_OBSERVATION GetGOAL_OBSERVATION(int rep) {
return (CCU_I20_GOAL_OBSERVATION)this.GetStructure("GOAL_OBSERVATION", rep);
}
/**
* Returns the number of existing repetitions of CCU_I20_GOAL_OBSERVATION
*/
public int GOAL_OBSERVATIONRepetitionsUsed {
get{
int reps = -1;
try {
reps = this.GetAll("GOAL_OBSERVATION").Length;
} catch (HL7Exception e) {
string message = "Unexpected error accessing data - this is probably a bug in the source code generator.";
HapiLogFactory.GetHapiLog(GetType()).Error(message, e);
throw new System.Exception(message);
}
return reps;
}
}
/**
* Enumerate over the CCU_I20_GOAL_OBSERVATION results
*/
public IEnumerable<CCU_I20_GOAL_OBSERVATION> GOAL_OBSERVATIONs
{
get
{
for (int rep = 0; rep < GOAL_OBSERVATIONRepetitionsUsed; rep++)
{
yield return (CCU_I20_GOAL_OBSERVATION)this.GetStructure("GOAL_OBSERVATION", rep);
}
}
}
///<summary>
///Adds a new CCU_I20_GOAL_OBSERVATION
///</summary>
public CCU_I20_GOAL_OBSERVATION AddGOAL_OBSERVATION()
{
return this.AddStructure("GOAL_OBSERVATION") as CCU_I20_GOAL_OBSERVATION;
}
///<summary>
///Removes the given CCU_I20_GOAL_OBSERVATION
///</summary>
public void RemoveGOAL_OBSERVATION(CCU_I20_GOAL_OBSERVATION toRemove)
{
this.RemoveStructure("GOAL_OBSERVATION", toRemove);
}
///<summary>
///Removes the CCU_I20_GOAL_OBSERVATION at the given index
///</summary>
public void RemoveGOAL_OBSERVATIONAt(int index)
{
this.RemoveRepetition("GOAL_OBSERVATION", index);
}
}
}
| 2024-05-31T01:26:18.401715 | https://example.com/article/2811 |
Dunlop KIRK HAMMETT CRY BABY WAH KH95 Pedal
Sale
Regular price
$159.99
Quantity
Now you can command the same killer wah tone as Kirk with the new Kirk Hammett Cry Baby Wah. Developed in close collaboration with the metal guitar icon himself, it has been meticulously tuned and tweaked to deliver the wah sound that revolutionized metal solos. This is the legendary tone that Kirk dials in on tour using his Cry Baby Rack Wah. Dunlop's engineers took Kirk's EQ, volume and tone settings-reflecting decades of blazing Cry Baby riffology-and reproduced them with exacting precision. This pedal is exceptionally even in response as you move from heel to toe, with a thick top end and full dynamic range. Dare to step into the footprint of a giant. Own a piece of the legend: the Kirk Hammett Signature Wah from Dunlop. | 2024-07-29T01:26:18.401715 | https://example.com/article/4802 |
PETA
United Airlines, the world’s largest carrier, will no longer ship non-human primates to research labs. Clarifying a policy that has been ambiguous since it merged with Continental Airlines in 2010, the airline today issued this statement: “We do not book, accept or transport non-human primates to or from medical research facilities domestically or internationally. We do ship non-human primates between zoos and sanctuaries within the 50 United States and Puerto Rico.”
With the adoption of similar rules by Air Canada last month (see ‘Air Canada to stop transporting research primates’), there are no longer any North American carriers that will move the thousands of primates that are imported each year to the United States and Canada (see ‘Activists ground primate flights’). The number of major airlines that say they fly research primates has now dwindled to four: Air France, China Eastern Airlines, Philippine Airlines and Vietnam Airlines.
United has been under pressure from activists with People for the Ethical Treatment of Animals (PETA), which launched a campaign after the merger, demanding that the merged airline explicitly adopt a policy banning research primate transport. Before the merger, Continental transported research primates; United did not. PETA says that its supporters sent 130,000 protest e-mails to the carrier and demonstrated at its office in Sydney, Australia, and at its Chicago headquarters.
The announcement marks an about face from a fiercely pro-research stance that a United official published on the website of the Animal Transportation Association in September 2011. It challenges other airlines to review their policies forbidding research primate transport. It reads, in part:
Virtually every major medical advance of the last century has depended upon research with animals … I know that the greater good of mankind can be served by our assisting this industry in the transport of these animals.
Lisa Schoppa, the author of the statement and then the manager of United’s PetSafe programme, has since left the company. A United spokeswoman would not say when and why she left.
// | 2024-04-24T01:26:18.401715 | https://example.com/article/8141 |
"Do or Do not. There is no try."
“The Idealism-Vs-Pragmatism Debate”: The Differences Between Obama And Sanders Matter
Paul Krugman noted the other day that there’s a “mini-dispute among Democrats” over who has the best claim to President Obama’s mantle: Hillary Clinton or Bernie Sanders. The New York Times columnist made the persuasive case that the answer is obvious: “Mr. Sanders is the heir to candidate Obama, but Mrs. Clinton is the heir to President Obama.”
The framing is compelling for reasons that are probably obvious. As a candidate, Obama was the upstart outsider taking on a powerful rival – named Hillary Clinton – who was widely expected to prevail. As president, Obama has learned to temper some of his grander ambitions, confront the cold realities of governing in prose, and make incremental-but-historic gains through attrition and by navigating past bureaucratic choke points.
But the closer one looks at the Obama-Sanders parallels, the more they start to disappear.
Comparing the core messages, for example, reinforces the differences. In 2008, Obama’s pitch was rooted in hopeful optimism, while in 2016, Sanders’ message is based on a foundation of outrage. In 2008, red-state Democrats welcomed an Obama nomination – many in the party saw him as having far broader appeal in conservative areas than Clinton – while in 2016, red-state Democrats appear panicked by the very idea of a Sanders nomination.
At its root, however, is a idealism-vs-pragmatism debate, with Sanders claiming the former to Clinton’s latter. New York’s Jon Chait argues that this kind of framing misunderstands what Candidate Obama was offering eight years ago.
The young Barack Obama was already famous for his soaring rhetoric, but from today’s perspective, what is striking about his promises is less their idealism than their careful modulation.
What Obama did eight years ago, Chait added, was make his technocratic pragmatism “lyrical” – a feat Clinton won’t even try to pull off – promising incremental changes in inspirational ways.
That’s not Sanders’ pitch at all. In many respects, it’s the opposite. Whatever your opinion of the Vermonter, there’s nothing about his platform that’s incremental. The independent senator doesn’t talk about common ground and bipartisan cooperation; he envisions a political “revolution” that changes the very nature of the political process.
The president himself seems well aware of the differences between what Greg Sargent calls the competing “theories of change.” Obama had a fascinating conversation late last week with Politico’s Glenn Thrush, and while the two covered quite a bit of ground, this exchange is generating quite a bit of attention for good reason.
THRUSH: The events I was at in Iowa, the candidate who seems to be delivering that now is Bernie Sanders.
OBAMA: Yeah.
THRUSH: I mean, when you watch this, what do you – do you see any elements of what you were able to accomplish in what Sanders is doing?
OBAMA: Well, there’s no doubt that Bernie has tapped into a running thread in Democratic politics that says: Why are we still constrained by the terms of the debate that were set by Ronald Reagan 30 years ago? You know, why is it that we should be scared to challenge conventional wisdom and talk bluntly about inequality and, you know, be full-throated in our progressivism? And, you know, that has an appeal and I understand that.
I think that what Hillary presents is a recognition that translating values into governance and delivering the goods is ultimately the job of politics, making a real-life difference to people in their day-to-day lives. I don’t want to exaggerate those differences, though, because Hillary is really idealistic and progressive. You’d have to be to be in, you know, the position she’s in now, having fought all the battles she’s fought and, you know, taken so many, you know, slings and arrows from the other side. And Bernie, you know, is somebody who was a senator and served on the Veterans’ Committee and got bills done. And so the–
THRUSH: But it sounds like you’re not buying the – you’re not buying the sort of, the easy popular dichotomy people are talking about, where he’s an analog for you and she is herself?
OBAMA: No. No.
THRUSH: You don’t buy that, right?
OBAMA: No, I don’t think – I don’t think that’s true.
The electoral salience of comments like these remains to be seen, but the president is subtly taking an important shot at the rationale of Sanders’ candidacy. For any Democratic voters watching the presidential primary unfold, looking at Sanders as the rightful heir to the “change” mantle, here’s Obama effectively saying he and Sanders believe in very different kinds of governing, based on incompatible models of achieving meaningful results. | 2024-06-01T01:26:18.401715 | https://example.com/article/8865 |
Health & Fitness
There is more to making cellular tower lease negotiations than one can ever imagine; for instance, you need to have in-depth knowledge about the telecom industry along with your lawyer if you want to make the best negotiations. Will you really be sure about that the deal that you are making with the cellular tower lease is the best there is in terms of price in the current market? Truth be told, when it comes to making cell phone tower lease agreements, there are just not a lot of lawyers that are capable of letting you get a lot of profit from your cellular carriers.
When the lawyer that you hire is someone that knows nothing about the world of telecommunication, then there are increased chances that you will be suffering the following issues.
– The cell company might be forcing you make deals with certain terms that will clearly not be to your favor in the end.
– The attorney that you have hired may tell you the deal you are making is not right when it should be right for you.
Nowadays, drone has become popular for their many uses. A drone also referred as Unmanned Aerial Vehicle is a battery powered machine that is capable of flying when controlled using a remote controller Drones are capable of capturing pictures, generating aerial videos among many other uses. Drones were mainly used by military but recently there has been an emergence of drones for commercial and recreational purposes.
A variety of drones are available in the market in different sizes and shapes and with unique features and capabilities. It is quite challenging to decide the best drone to buy for your unique needs. You can use drone reviews available on the internet to determine which is the best choice suitable for your needs.
The prices for drones have significantly decreased since the launch of the first commercial drone. Drone flying hobby have become more affordable than it was in the past. Many people buy drones for recreation purposes and for capturing aerial photographs for personal purposes.
In businesses, drones have been used for security surveillance, filming, collecting intelligent data and other commercial uses. Before buying a particular drone, it is important to research about the …
Pipes fittings incorporate a wide combination of pipes equipment including funnels, spigots and the joints that associate these apparatuses. In the event that you need to have an appropriately working seepage framework and nonstop water supply, it is essential for you to introduce the best Visalia Plumbing.
The wrong idea that individuals have in the present time is that, they disregard the essential pipes fittings and pipelines that keep running close by and underneath their home while they give careful consideration to inner pipes installations. They don’t totally understand the significance of having a protected and solid pipes framework. In the event that the pipes fittings are not working legitimately, it can prompt spillages. Breaks in the solid because of water drainage and wet dividers are the reasons for undetermined spillages that is the reason you have to dependably check for conceivable spillages in your home. This sort of spillages can really make your dividers debilitate. In this manner, it is basic to keep up a well-working pipes framework.
You likewise need to realize that steady upkeep and checkup is expected to pipes works. The articles that associate at least two funnels are really called …
The lack of knowledge about the prices of various medicines nowadays have made many websites to be formed to help individuals get this information easily. Many drugs that serve the same purpose have different prices where some have higher prices, and some are sold at low prices.
Many people lack information about the costs of their prescriptions and to their help are the drug pricing websites that avail this vital information to them to assist them in buying these drugs at a lower cost that saves them some money. In achieving this, drug pricing websites provide vital information and other resources that help in finding good drugs at a lower price. There are many merits of using a drug pricing website, and they are detailed below.
To start with, one of the merits of a drug pricing website is that it allows various people to be able to look for different drugs and also compare their differing prices, and therefore you end up buying drugs at a pocket-friendly price that you can afford without struggling. It Also, helps people to save some money and this is when they post drugs of different companies …
Nothing sounds worse than a busy work morning when your boss immediately wants you to print some things out but suddenly the printer in your office has ceased to do its functions, making you worry about the boss shouting at you again for a task not completed. We all know how it goes, first, you suddenly get all weird messages popping up here and there, and so you open up the whole machine to see some hidden compartments while you try to look for a piece that was probably broken or whatnot, and then you get all confused. And when you are no longer knowledgeable about what you are looking at and have been greatly confused about what is going on, all you can do is make a phone call in the hopes of finding help from any technician who can help you solve this kind of problem.
Sometimes, we often get so confused as to whether or not we should have the printers in the office replaced once they are broken, because usually, the printer repairs have prices almost the same as the brand new printers in the store, so it’s almost as if either … | 2024-01-02T01:26:18.401715 | https://example.com/article/3140 |
Q:
move a image partially out of the screen in android
I have an ImageView in android. I want to move the image partially inside the screen such that only a part of the image is visible. If I set margin or padding in xml the image shrinks. I used a translate Animation in onCreate method. But I see image moving the first time the view is presented. I want the image to be partially visible without the shift being visible. Is there any way of doing this?
A:
in the parent view (like LinearView) set ClipChildrens=false, if what you are looking for
check this code, it works for me...
<?xml version="1.0" encoding="utf-8"?>
<FrameLayout xmlns:android="http://schemas.android.com/apk/res/android"
android:layout_width="match_parent"
android:layout_height="match_parent" >
<ImageView
android:id="@+id/imageView1"
android:layout_width="wrap_content"
android:layout_height="wrap_content"
android:layout_gravity="right"
android:layout_marginRight="-20dp"
android:src="@drawable/ic_launcher" />
</FrameLayout>
| 2024-02-23T01:26:18.401715 | https://example.com/article/7013 |
First Report of Tomato yellow leaf curl virus Associated with Tomato Yellow Leaf Curl Disease in California.
Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5'-GGATCCACTTCTAAATGAATTTCCTG-3' and TYBamHI2c: 5'-GGATCCCACATAGTGCAAGACAAAC-3'), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002. | 2024-04-01T01:26:18.401715 | https://example.com/article/9621 |
Harvard Law School says that beginning this fall it will no longer require students to submit the traditional Law School Admissions Test as part of their application, marking a major shift in the schools rigorous admissions process.
Instead, candidates will be allowed to submit either the Graduate Record Examination or LSAT when applying for entry into the 2018 three-year Juris Doctor program, the law school said Wednesday.
In the past, many students have taken both the GRE and the LSAT when applying to graduate programs, costing them hundreds of dollars in testing fees. By accepting the GRE, Harvard Law School officials hope to ease the financial burden and expand legal education access to applicants from a range of socioeconomic and academic backgrounds.
Brian Snyder / Reuters Students graduating from the School of Law cheer as they receive their degrees during the 364th Commencement Exercises at Harvard University in Cambridge, Massachusetts May 28, 2015.
“Harvard Law School is continually working to eliminate barriers as we search for the most talented candidates for law and leadership,” Harvard Law School Dean Martha L. Minow said in a press release. “For many students, preparing for and taking both the GRE and the LSAT is unaffordable. All students benefit when we can diversify our community in terms of academic background, country of origin, and financial circumstances.”
A recent Harvard Law School study found that the GRE and LSAT equally predict the success of first-year law students prompted the school to change its admissions requirements. The American Bar Association is currently reviewing its rules regarding exam requirements for law schools.
For decades, the LSAT was a requirement for nearly all J.D. programs. The University of Arizona’s college of law announced it would accept either the GRE or the LSAT in February 2016, becoming the first ABA-accredited law school to do so. Harvard is now the second. | 2024-05-27T01:26:18.401715 | https://example.com/article/8043 |
Biochemically well-defined platelet plasma and granule membranes will be isolated by the refinement of currently used techniques and introduction of innovation for fractionating platelets. The study will continue to test external labeling techniques and other approaches in order to discover reliable plasma and granule membrane markers. Isolated platelet membranes will be used to obtain specific information about membrane structure and function. Plasma and granule membranes will be analyzed for differences in phospholipid and glycolipid composition and structure. The study will also continue to study the structure and function of platelet plasma membrane glycolipids and phospholipids by using intact platelets. The structural arrangement and function of plasma membrane phosphatidylethanolamine and phosphatidylserine will be probed by the selective modification of these lipids by enzymes, e.g., phosphatidylserine decarboxylase. The role of glycolipids in platelet function will be investigated by analyzing glycolipid membrane structure in platelets from normal individuals and from patients with hereditary and acquired platelet disorders. | 2023-09-21T01:26:18.401715 | https://example.com/article/3050 |
Latest Posts
BrowserCMS 3.5.x released - Now Rails 3.2 Ready!
June 1, 2012
We are proud to announce the BrowserCMS 3.5.1/3.5.0 are now available. We released 3.5.0 last week, and then as is to be expected a new version of Rails came out. So today we released 3.5.1 which ensures compatitbility with that version (Rails 3.2.5). | 2023-11-25T01:26:18.401715 | https://example.com/article/9704 |
[Processes of body perception and their therapeutic use in pediatrics. From nonspecific relaxation therapy to training to recognize disease-specific symptoms].
Focussing on processes of body perception is a major pathway of relaxation therapies (progressive relaxation, autogenic training, guided imagery, hypnotherapy, biofeedback). Traditionally its application has been related to psychosomatic and psychotherapeutic indications. Beyond this classical approach, recent behavioral medicine has emphasized the relevance of interoception processes and adequate attribution patterns concerning bodily sensations as a major source of adequate coping and self-management with somatic illness. Clinical application may refer to an improved cognitive-behavioral pain management in disease and treatment related conditions. Especially children and adolescents suffering from chronic conditions that may exacerbate rapidly may benefit from an education approach that teaches them to perceive their disease-related complaints and symptoms accurately and to attribute them correctly. A precise, panic-free and immediate symptom recognition of sudden airway obstruction is an important precondition of adequate coping with acute asthma crisis and starting risk orientated antiasthmatic treatment. In a similar way, the child with diabetes mellitus may identify early signs of hypoglycemia by self-observation, recognition and discrimination of physical, vegetative and psychological indicators of blood glucose decline that enable the child to take appropriate countermeasures. Other childhood disorders that offer chances for symptomatic self-monitoring and self-control comprise atopic dermatitis or epileptic seizures. Training young patients in precise symptom recognition may not only empower them in handling acute crisis but also strengthen global development of autonomy, control beliefs, self-responsibility and self-esteem. | 2024-01-26T01:26:18.401715 | https://example.com/article/7960 |
Background
==========
The use of amphetamine-type stimulants (ATS) including methamphetamines (MA) is a growing global health problem. ATS are the second most widely used group of substances, among which MA is the most prominent. It is estimated globally that the annual prevalence for ATS ranged between 0.3% and 1.2% in 2010, or some 14 to 52 million people aged 15 years to 64 years who had used such substances at least once in 2010 \[[@B1]\].
Many studies have addressed the physical and psychological harms of chronic MA use \[[@B2],[@B3]\] and its association with high-risk sexual behaviours among men who have sex with men (MSM) \[[@B4],[@B5]\]. MA use among MSM has been associated with low rates of condom use, high rates of unprotected anal sex, prolonged sexual activity, multiple partners, and casual partners \[[@B6]-[@B8]\]. Some studies among female drug users have also shown MA use to be associated with elevated concomitant sexual risks, including a higher number of sexual partners, unprotected vaginal and/or anal sex, and exchanging sex for money or drugs \[[@B9]-[@B11]\]. Besides increasing high-risk sexual behaviours, MA use can enhance HIV-1 infections in human macrophages in vitro \[[@B12]\]. Many studies indicate high risk of HIV and other sexually transmitted disease (STDs) infections among different MA users \[[@B13]-[@B16]\].
China is one of two countries with the highest records of ATS abuse. By the end of 2011, 1.794 million drug users had been registered in the updated Drug Abusers Information Database of China. Users of "new-type drugs," including ATS and ketamine, accounted for 32.7% of the total number of registered drug users \[[@B17]\].
Injection drug use (IDU), which mainly includes heroin, used to be the major cause of HIV infections, and the association between IDU and risk of HIV infections has been well documented \[[@B18]\]. However, the transmission routes of HIV have largely changed in recent years. The proportion of cases resulting from sexual transmission increased from 33.1% in 2006 to 76.3% in 2011 \[[@B19]\]. Compared with non-MA users, non-injecting heterosexual MA users report significantly higher numbers of sex partners, more frequent engagements in anal sex, and less frequent use of condoms and are twice as likely to have sex with a commercial sex worker (CSW) or exchange sex for drugs \[[@B7]\].
To date, despite the increasing risk for widespread HIV infections, little attention has been given to non-injecting heterosexual MA users, and the characteristics of non-injecting heterosexual MA users and related risk behaviours among them have not been well studied in China. A pilot study in Shandong Province found an alarmingly high prevalence of MA use among female CSWs. MA users were more likely to be inconsistent in condom usage and have syphilis \[[@B20]\]. The aim of this study is to explore the characteristics of male and female non-injecting heterosexual MA users in China and evaluate their high-risk behaviours in order to find specific intervention measures to prevent STDs and HIV infection.
Methods
=======
Study site
----------
The study was conducted in Chengyang District, Qingdao, Shandong Province, China. Qingdao is a coastal city in Shandong that attracts many foreign and domestic investors and tourists because of its mild climate, convenient transportation, and favourable policies. However, accompanied by booms in economic development and the entertainment industry, drug trafficking and abuse have become increasingly common in the city over the last ten years. Famous for "Iceland" in China (Qingdao is on the eastern end of Shandong Peninsula, and MA looks like ice in appearance), aside from having many MA users, Qingdao is one of the distribution centres of MA from South Korea, Japan, and Russia to China. Chengyang is one of the suburban districts of Qingdao. It connects the urban and rural areas of northern Qingdao and has a total area of 553.2 square kilometres and a population of 0.76 million people, including a mobile population of 0.3 million. It is one of the major industrial areas in Qingdao and, for many years, has been among the top districts in Shandong Province for exports. In the district, there are many foreign-owned or joint enterprises, manufacturing, and entertainment venues. MA users can be found in nightclubs, KTVs (one kind of entertainment venues with many private rooms where customers can sing and dance by themselves), bars, bath centres, hotels, and so on.
Recruitment and screening of participants
-----------------------------------------
This study was conducted as part of the "AIDS Projects in the Cover" program funded by the Bill & Melinda Gates Foundation and the Chinese government. Most participants were recruited from nightclubs, KTVs, bars and bath centres, accounting for 22.3%, 30.5%, 30.3%, and 9.6%, respectively, of the sample. Community outreach workers visited these venues and made the acquaintance of potential study subjects. The following inclusion criteria were used: (1) self-identified heterosexual; (2) use of MA as a major addictive drug; (3) use of MA by any means aside from injection; (4) in the 1 month prior to screening, had used MA at least once. A person satisfying all of these criteria was asked for an interview and examination at an STD clinic in the community hospital the following day. The "Snow Ball" approach was also applied in enrolling participants. Around 5.1% of the participants were recruited directly by doctors at the STD clinic, and 2.3% were referred by bosses of entertainment venues, friends, and STD clinical attendees. All surveys and examinations were conducted at the STD clinic in the community hospital by an STD doctor and a nurse. Around 87.5% of the female participants were CSWs; the remaining female participants were girlfriends or casual sex partners of male participants.
Data collection
---------------
The research protocol was approved by the Ethical Committee of Shandong Provincial Hospital for Skin Diseases, and all participants completed verbal informed consent prior to participation. An interviewer-administered questionnaire was used in data collection (see Additional file [1](#S1){ref-type="supplementary-material"} for the questionnaire). The following characteristics of MA users were examined: demographics (gender, age, marital status, ethnicity, education, residency and employment); perception of MA; perception of STDs/HIV; MA use; and sexual behaviour related to MA use. Each topic area was covered by several variables, each in the form of a question. Those diagnosed with STDs were given free and appropriate treatments.
Statistical analysis
--------------------
The characteristics of MA users by gender were examined. Differences in demographic characteristics, perception of MA, perception of STDs/HIV, MA use, and sexual behaviour related to MA use between males and females were compared. Chi-square and t-tests were used for statistical analysis.
Results
=======
Demographic information
-----------------------
As shown in Table [1](#T1){ref-type="table"}, among the 398 participants, 288 were males and 110 were females. The average age of females was significantly lower than males (27.0 vs. 34.2 years old). Males were more likely to be married (70.5% vs. 40.9%), while females were more likely to be single (50.0% vs. 25.3%). Males were more likely to be permanent residents (86.5% vs. 48.2%), while females were more likely to be in the mobile population (51.8% vs. 13.5%). Males were more likely to be self-employed businessmen (73.3% vs. 11.8%), while females were more likely to be engaged in commercial service (56.6% vs. 4.9%) or unemployed (30.9% vs. 16.3%). All of the differences between male and female MA users were statistically significant (p\<0.05). No significant differences were observed in terms of ethnicity and education level by gender, with Han accounting for 88.7% and middle school education accounting for 69.3% of the sample, respectively.
######
Demographic differences among 398 participants by gender
**Variable** **Total (N=398)** **Male (N=288)** **Female (N=110)** **t** **X**^**2**^ **P value**
------------------------------- ------------------- ------------------- -------------------- ------- -------------- -------------
Age, M (SD), range 32.3 (9.6), 16-67 34.2 (1.0), 16-67 27.0 (6.3), 19-48 7.11 \<0.05
Marital status
Single, n (%) 128 (32.2) 73 (25.3) 55 (50.0) 38.302 \<0.05
Married, n (%) 256 (64.3) 203 (70.5) 53 (40.9)
Divorced, n (%) 14 (3.5) 12 (4.2) 2 (9.1)
Ethnicity
Han, n (%) 353 (88.7) 262 (91.0) 91 (82.7) 5.772 \>0.05
Korean, n (%) 26 (6.5) 14 (4.9) 12 (10.9)
Others, n (%) 19(4.8) 12 (4.2) 7 (6.4)
Education
Elementary school, n (%) 18 (4.5) 15 (5.2) 3 (2.7) 1.671 \>0.05
Middle school, n (%) 276 (69.3) 201 (69.8) 75 (68.2)
High/technical school, n (%) 92 (23.1) 64 (22.2) 28 (25.5)
College or above, n (%) 12 (3.0) 8 (2.8) 4 (3.6)
Residency
Permanent residents, n (%) 302 (75.9) 249 (86.5) 53 (48.2) 63.717 \<0.05
Mobile population, n (%) 96 (24.1) 39 (13.5) 57 (51.8)
Employment
Self-employed, n (%) 224 (56.3) 211 (73.3) 13 (11.8) 177.11 \<0.05
Commercial service, n (%) 76 (19.1) 14 (4.9) 62 (56.4)
Unemployed, n (%) 81 (20.4) 47 (16.3) 34 (30.9)
Others, n (%) 17 (4.3) 16 (5.6) 1 (0.9)
Perception of MA use
--------------------
As shown in Table [2](#T2){ref-type="table"}, 92.2% of the respondents considered MA use as common as smoking and this perception was more acceptable in males than in females (96.2% vs. 81.8%, p\<0.05). Most males and females believed that MA enhances sexuality (97.2% vs. 99.1%, p\>0.05) while more males than females believed that it helps promote anti-inebriation (63.9% vs. 37.3%, p\<0.05) and pain relief (44.1% vs. 33.6%, p\<0.05). No gender differences were found in terms of perception of addictiveness of MA (47.2% vs. 44.5%, p\>0.05) and proportion of self-reported addiction to MA (46.2% vs. 43.6%, p\>0.05). Among those who admitted MA addiction, 30.1% of the males responded that it had occurred to them to abstain from MA and wanted to try it. In comparison, 33.3% of the females responded that it had occurred to them to abstain from MA but only 8.3% of them wanted to try it (p\<0.05).
######
Perceptions of MA use among MA users
**Questions** **Total (%, N=398)** **Male (%, N=288)** **Female (%, N=110)** **X**^**2**^ **P value**
------------------------------------------------------ ---------------------- --------------------- ----------------------- -------------- -------------
Do you think MA use is as common as smoking? (Yes) 367 (92.2) 277 (96.2) 90 (81.8) 22.861 \<0.05
Can MA enhance sexuality? (Yes) 389 (97.7) 280 (97.2) 109 (99.1) \>0.05
Does MA have the function of anti-inebriation? (Yes) 225 (56.5) 184 (63.9) 41 (37.3) 34.120 \<0.05
Can MA relieve pain? (Yes) 164 (41.2) 127 (44.1) 37 (33.6) 13.287 \<0.05
Is MA addictive? (Yes) 185 (46.5) 136 (47.2) 49 (44.5) 0.229 \>0.05
Are you addicted to MA? (Yes) 181 (45.5) 133 (46.2) 48 (43.6) 0.208 \>0.05
Did it occur to you to abstain from MA? (Yes) 56/181(30.9) 40/133 (30.1) 16/48 (33.3) 0.157 \>0.05
Do you want to have a try to abstain from MA? (Yes) 44/181(24.3) 40/133 (30.1) 4/48 (8.3) 9.061 \<0.05
Perception of STDs/AIDS
-----------------------
As shown in Table [3](#T3){ref-type="table"}, 99.7% of the males and 100% of the females had heard of syphilis (p\>0.05). The proportion of those who claimed knowing the transmission routes of syphilis was higher in males than in females (93.1% vs. 77.3%, p\<0.05). Although as high as 99.3% of the males and 100% of the females reported knowing the transmission routes of HIV, 64.2% of the males and 84.5% of the females believed that HIV can be transmitted by eating together (p\>0.05). Approximately 97.2% of the males and 100% of the females knew the risk of multiple sex partners. However, 33.3% of the males and 29.1% of the females believed that an HIV-infected person could be identified by appearance, and only 52.4% of the males and 67.3% of the females believed that STDs/AIDS could be prevented by using condoms (p\<0.05).
######
Perceptions of STD/AIDS among MA users
**Questions** **Total (%, n=398)** **Male (%, n=288)** **Female (%, n=110)** **X**^**2**^ **P value**
-------------------------------------------------------- ---------------------- --------------------- ----------------------- -------------- -------------
Have you ever heard of syphilis? (Yes) 397 (99.7) 287 (99.7) 110 (100)
Do you know the transmission routes of syphilis? (Yes) 353 (88.7) 268 (93.1) 85 (77.3) 19.772 \<0.05
Do you know the transmission routes of HIV? (Yes) 396 (99.5) 286 (99.3) 110 (100)
Can HIV be transmitted by eating together? (Yes) 278 (69.8) 185 (64.2) 93 (84.5) 17.978 \<0.05
Do you know the risk of multiple sex partners? (Yes) 390 (98.0) 280 (97.2) 110 (100) \>0.05
Can HIV infection be identified by appearance? (Yes) 128 (32.2) 96 (33.3) 32 (29.1) 1.262 \>0.05
Can STD/AIDS be prevented by using condom? (Yes) 225 (56.5) 151 (52.4) 74 (67.3) 17.800 \<0.05
Behaviours of MA use
--------------------
As shown in Table [4](#T4){ref-type="table"}, most of the male and female respondents reported MA as the only drug they used (94.8% vs. 98.2%, p\>0.05). Both the average onset age and the average years of MA use among females were lower than those among males (24.3 vs. 31.3, p\<0.05; 2.6 vs. 2.9, p\<0.05), and more females started MA use at an early age (X^2^=62.170, p\<0.05) with a shorter period of use (X^2^=19.411, p\<0.05) than males. However the average times of MA use per week was higher among females than among males (3.6 vs. 2.4, p\<0.05), and the proportion of those who used MA an average of 5 times and above per week was much higher in females than in males (X^2^=89.468, p\<0.05). MA was usually used in groups, and the group size reported by males was larger than that reported by females (4.2 vs. 3.8 persons, p\<0.05). Females were more likely to use MA with heterosexual partners than males (100% vs. 78.1%, p\<0.05).
######
MA use behaviours among MA users
**Variable** **Total (N=398)** **Male (N=288)** **Female (N=110)** **t** **X**^**2**^ **P value**
--------------------------------------------------- ------------------- ------------------- -------------------- ------- -------------- -------------
Using MA only, n (%) 381 (95.7) 273 (94.8) 108 (98.2) \>0.05
Onset age of MA use, M (SD), range 29.4 (9.1), 16-62 31.3 (9.3), 16-67 24.3 (6.2), 17-44 7.367 \<0.05
\<20 years old 42 (10.6) 13 (4.5) 29 (26.4)
20\~29 years old 174 (43.5) 116 (40.3) 58 (52.7) 62.170 \<0.05
30\~39 years old 120 (29.9) 100 (34.7) 20 (18.2)
≥40 years old 62 (16.1) 59 (20.5) 3 (2.7)
Years of MA use, M (SD), range 2.8 (1.1), 1-8 2.9 (1.2), 1-8 2.6 (0.9), 1-5 2.650 \<0.05
1 year 42 (10.6) 34 (11.8) 8 (7.3)
2 years 127 (31.9) 75 (26.0) 52 (47.3)
3 years 128 (32.2) 96 (33.3) 32 (29.1) 19.411 \<0.05
4 years 71 (17.8) 56 (19.4) 15 (13.6)
≥5 years 30 (7.5) 27 (9.4) 3 (2.7)
Times of MA use per week, M (SD), range 2.8 (1.4), 1-7 2.4 (1.0), 1-6 3.6 (1.9), 1-7 8.270 \<0.05
1 time 44 (11.1) 33 (11.5) 11 (10.0)
2 times 183 (46.0) 150 (52.1) 33 (30.0)
3 times 74 (18.6) 62 (21.5) 12 (10.9) 89.468 \<0.05
4 times 53 (13.3) 37 (12.8) 16 (14.5)
≥5 times 44 (11.1) 6 (2.1) 38 (34.5)
Number of persons using MA together (SD), range 4.1 (1.6), 2-10 4.2 (1.4), 2-10 3.8 (1.9), 2-10 2.409 \<0.05
Always using MA with heterosexual partners, n (%) 335 (84.2) 225 (78.1) 110 (100) 28.588 \<0.05
High-risk sexual behaviours related to MA use
---------------------------------------------
As shown in Table [5](#T5){ref-type="table"}, the proportions in males who had had sex with multiple partners and exchanged sex partners during MA use was significantly higher than those in females (96.9% vs. 77.3%, X^2^=39.147, p\<0.05; 72.9% vs. 46.4%, X^2^=24.862, p\<0.05). Among 288 male respondents, 96.2% had had sex with CSWs during MA use, and the number of CSWs as sex partners per MA use was 1.9 persons. Among 277 males who had had sex with CSWs, 72.2% had never used condoms. Among 77 males who had had sex with multiple CSW partners and reported always or usually using condoms, 87.0% had never changed condoms when changing CSW partners. About 96.4% of the females reported having had sex with partners for MA or money.
######
High-risk sexual behaviours related to MA use among MA users
**Variable** **Total (n=398)** **Male (n=288)** **Female (n=110)** **t** **X**^**2**^ **P value**
---------------------------------------------------------- ------------------- ------------------ -------------------- ------- -------------- -------------
Had sex with multiple partners during MA use 364 (91.5) 279 (96.9) 85 (77.3) 39.147 p\<0.001
Exchanged sex partners during MA use 261 (65.6) 210 (72.9) 51 (46.4) 24.862 p\<0.001
Had sex with commercial sex workers(CSWs) during MA use 277 (96.2)
Number of CSWs as sex partners per MA use, M (SD), range 1.9 (0.7), 1-4
Condom use in sex with CSWs
Never 200 (72.2)
Usually 58 (20.9)
Always 19 (8.9)
Changing condoms when changing CSWs
Never 67 (87.0)
Usually 3 (3.9)
Always 7 (9.1)
Discussion
==========
Gender differences among MA users have been reported by some studies. Female MA users were more likely to be younger, have lower educational level, have never been married, and be an MA-using sex partner \[[@B21]-[@B23]\]. Our findings show significant differences between the demographic characteristics of male and female MA users, and some new findings in this study differed from those in other studies. Most male MA users in this study were married and local or self-employed businessmen; most female MA users were young, single, and mobile CSWs. These findings are interesting because they suggest that gender-specific intervention measures should be implemented in risk reduction programs for MA user populations.
The reasons for MA use were investigated in this survey. The major reason for MA use is its benefit in enhancing sexuality; most male and female respondents neglected its addictiveness. Furthermore, both males and females had several wrong perceptions of MA. MA was usually regarded as a daily life necessity, very much like cigarettes, especially by male respondents. This finding indicates that more information on the risks and harm of MA should be provided in intervention programs in the future. MA use is a complicated social problem in many countries. The reasons why more and more people fall into MA addiction require more studies from the physiological, psychological, and social perspectives. Individual, social, and environmental factors have been reported to be associated with initiating MA injection \[[@B24]\]. In this study, among those who recognised its addictiveness, fewer females than males wanted to try to abstain from MA. The reasons underlying this behaviour require further investigation.
Gender differences were observed in terms of MA use behaviours. Most female MA users initiated MA use at an early age, had shorter abuse durations, used MA more frequently, and were more likely use MA with heterosexual partners. MA enhances sexual performance, sensitivity, and pleasure, increasing the risk of trauma from prolonged intercourse and failure to use condoms \[[@B25],[@B26]\], and is associated with having multiple sex partners and unprotected sex \[[@B9]-[@B11]\]. Results from this paper support previous findings showing that MA use can greatly increase the risk of STD/HIV transmission. Although most respondents in this study had enough knowledge of STD/AIDS, some misunderstandings were observed. Most male and female respondents recognised the risk of multiple sex partners; however, many MA users did not know how to prevent STDs/AIDS using condoms. High-risk sexual behaviours related to MA use among these respondents were very common, including having sex with multiple partners and exchanging sex partners. More males had been engaged in group sex and sex partner exchanges than females because most male respondents had had sex with CSWs during MA use. It indicates the truth that many sex episodes involved one man and more than one woman including those women who are not MA users during MA use, suggesting that some form of intervention specific to these kinds of sex encounters should be conducted. Furthermore, many males had also been engaged in other high-risk sexual practices, such as never using condoms and never changing condoms when changing CSW partners, which may endanger their female partners as well.
Several limitations are present in this study, including the sample population and the data collection methods. First, the study utilised non-random sampling recruitment methods and had inclusion criteria confined to non-injected heterosexual MA users; thus, the generalisability of the study results could be limited. Second, behavioural data were collected through self-reporting and memory or recall of behaviours during sexual or MA use events may be problematic. Third, most female MA users recruited into the study report behaviors that would lead them to be classified as sex workers. Therefore, the sample tells us little about MA use and related knowledge, attitudes, and risk behaviors in the broader population of women who use MA without injection. Finally, although STD/HIV testing was conducted for each participant in this cross-sectional study, detailed information about actual STD/HIV infection rates in this article was not provided. A multi-factor analysis on STD/HIV prevalence among non-injecting heterosexual MA users will be conducted in another study.
The study was characterised by a number of strengths. First, this study provides the first report in China addressing the characteristics of and high-risk behaviours among non-injecting heterosexual MA users. Second, the findings enrich our knowledge of gender differences in demographic characteristics, perception of MA and STDs/HIV, and high-risk behaviours among non-injecting heterosexual MA users. Third, this study discussed the reasons for MA use, although further investigation is needed.
Conclusion
==========
In conclusion, gender differences in the characteristics of and high-risk behaviours among non-injecting heterosexual MA users were observed. The findings suggest that integrating specific risk reduction strategies for non-injecting heterosexual MA user populations into intervention programs will be beneficial to the success of such programs.
Abbreviations
=============
ATS: Amphetamine-type stimulants; MA: Methamphetamines; MSM: Men who have sex with men; STDs: Sexually transmitted diseases; IDU: Injection drug use; CSWs: Commercial sex workers.
Competing interests
===================
No competing interests declared.
Authors' contributions
======================
SC participated in conception, revision and finalization of the manuscript. DL carried out the studies, participated in design, data collection and writing of the draft. ZW carried out participants recruitment, data collection and data analysis. TC participated in data collection and revision. All authors read and approved the final manuscript.
Pre-publication history
=======================
The pre-publication history for this paper can be accessed here:
<http://www.biomedcentral.com/1471-2458/13/30/prepub>
Supplementary Material
======================
###### Additional file 1
Questionnaire given to MA users.
######
Click here for file
Acknowledgements
================
This study was supported by the "AIDS projects in the cover" program funded by Bill & MelindaGates Foundation and Chinese government. We thank all participants in this study who shared their time and experiences.
| 2023-11-09T01:26:18.401715 | https://example.com/article/4800 |
Q:
method declaration
I haven't been programming for long and this is my first time declaring a method within my program and using this method in the program. In its simplicity, the program has the user enter a 5 digit zipcode and the method I created checks that the zipcode is only 5 characters and is all digits. When I use the method in the program no matter what I enter for the zipcode, the while statement runs asking me to input my zipcode again. This should only happen if you enter a string thats not five characters or a string without only digits. However, right now it is happening even when an actual zipcode is entered, leaving me to assume something is wrong with the method. I tried to be as clear as possible in the question but if any further clarification is needed I can try to clear things up, any info you can give would be appreciated. Here is my code:
import java.util.Scanner;
public class BarCode {
public static void main(String[] args) {
String zipcode;
Scanner in = new Scanner(System.in);
System.out.println("Please enter a 5 digit zipcode: ");
zipcode = in.nextLine();
while (checkInput(zipcode) == false) {
System.out.println("You did not enter a 5 digit zipcode: ");
zipcode = in.nextLine();
} // end while
} // ends main
public static boolean checkInput(String zipcode) {
boolean zipcodeLength = true;
boolean zipcodeDigits = true;
if (zipcode.length() != 5) {
zipcodeLength = false;
} // end if statement
for (int i = 0; i <= zipcode.length(); i++) {
if (!Character.isDigit(i)) {
zipcodeDigits = false;
} // end if statement
} // end for statement
if (zipcodeLength == false || zipcodeDigits == false) {
return false;
} // end if statement
else {
return true;
} // end else statement
} // end checkInput
}
A:
This is your problem :
if(!Character.isDigit(i))
should be
if(!Character.isDigit(zipcode.charAt(i)))
| 2024-02-18T01:26:18.401715 | https://example.com/article/6666 |
Three days. Five cities. Lots of Iowans.
During this past week around Independence Day, Senator Kamala Harris visited Iowans and journeyed across half of the state, gathering crowds, endorsements and lots of support.
Harris connected with Iowans in Central and Western Iowa, drawing intrigued caucus-goers (and a few out-of-staters) to events in West Des Moines, Des Moines, Indianola, Council Bluffs and Sioux City.
Response To Harris’ Message
Many attendees at Harris’ events were impressed by her debate stage performance, and she had even more impact when she was the only person on the microphone.
When her second event with NARAL on July 3 was postponed due to weather and then moved from Water Works to Confluence Brewery, her audience adjusted and quickly packed into the cramped backup space to listen to Harris’ talk about the importance of women’s health.
Every time she mentioned fighting for reproductive rights, on the offense and the defense, the crowd roared in support.
At a backyard event in Indianola on July 4, Harris asked what we have in a commander-in-chief; a member of the audience yelled back, “A draft dodger!”
In Council Bluffs at a riverside park that evening, the call for a new commander-in-chief earned Harris a standing ovation. The Southwest Iowa audience was also more vocal in their support with mixed shouts of “yeah,” “that’s right,” and “amen” echoing in response to various statements.
Harris’ Sioux City audience responded in particular to her message about closing the teacher pay gap, and mutters of support sprang up around the room when she talked about how Iowa farmers have suffered because of Trump’s trade policies.
Some parts of her speech received consistent, loud response from every part of Iowa she visited.
Whenever she referred to the next president using female pronouns, her audience erupted in applause. And everyone groaned whenever Harris said she wanted to talk about “the current occupant of the White House.”
And when Harris talked about the current state of the country as a house with missing shingles, she got muttered agreement that shifted into wild applause when she finished the thought by saying, “But we’re still standing!”
Connecting With The Audience
Each event attracted a dedicated crowd. Whether it was nearly 100 degrees with high humidity as it was in Des Moines and Indianola, a long wait, as it was in Indianola, or a lack of room in the venue, as it was in Sioux City. audiences waited and accommodated.
In Council Bluffs, Vickie Heghes spun flags as music played before Harris’ event. She’d been doing it for about three hours.
And this is Vickie Heghes from Omaha. She came to the park at 3:30 to spin and then her husband told her @KamalaHarris was speaking and she said knew she had to stay. "I'm spinning in support of her today." pic.twitter.com/QgAg3IG74J — Nikoel Hytrek (@n_hytrek) July 5, 2019
In return, Harris stayed for meet-and-greets, or she addressed the overflow crowd before her main event. Several times, she responded directly to audience-members.
@KamalaHarris addressing the overflow before her event pic.twitter.com/QzivHIsh2u — Nikoel Hytrek (@n_hytrek) July 5, 2019
In Sioux City, for example, she blessed a man who sneezed and came down from the stage to answer questions.
Everywhere she went, she almost always responded to crowd outbursts with a laugh or smile. She also made frequent eye contact and often addressed the people who asked questions by name.
This personal touch wasn’t lost on audience members, either.
At the NARAL event in Des Moines, a woman told her story about having an abortion and her conflicted feelings about it before she asked for Harris’ proactive plan for securing abortion rights. During the same Q&A session, another woman asked for Harris’ advice for running for a school board seat.
“She’s very articulate with her responses. She has a good presence. She’s powerful,” said Armando Becerril, a voter from Omaha at Harris’ Council Bluffs event. “That’s what I feel some of the other Democrats are missing.”
He said she also caught his attention because she explicitly mentions DACA in her speeches. Becerril said he’s a DREAMer, so her stance on the issue is important to him, and the fact that she mentions it by name is notable.
Susan Simmons in Sioux City said Harris came off as “strong, intelligent, powerful and someone who doesn’t take shit.” Simmons has been to as many events as she’s been able to, and she said Harris’ was the one she didn’t want to miss.
“We need to find someone to get that a-hole out of office,” she said. And Harris is at the top of Simmons’ list to do it.
by Nikoel Hytrek
Posted 7/7/19 | 2023-11-07T01:26:18.401715 | https://example.com/article/1389 |
#pragma once
#include "platform/string_storage_base.hpp"
#include "base/macros.hpp"
#include <string>
namespace settings
{
/// Current location state mode. @See location::EMyPositionMode.
extern char const * kLocationStateMode;
/// Metric or Feet.
extern char const * kMeasurementUnits;
template <class T>
bool FromString(std::string const & str, T & outValue);
template <class T>
std::string ToString(T const & value);
class StringStorage : public platform::StringStorageBase
{
public:
static StringStorage & Instance();
private:
StringStorage();
};
/// Retrieve setting
/// @return false if setting is absent
template <class Value>
WARN_UNUSED_RESULT bool Get(std::string const & key, Value & outValue)
{
std::string strVal;
return StringStorage::Instance().GetValue(key, strVal) && FromString(strVal, outValue);
}
template <class Value>
void TryGet(std::string const & key, Value & outValue)
{
bool unused = Get(key, outValue);
UNUSED_VALUE(unused);
}
/// Automatically saves setting to external file
template <class Value>
void Set(std::string const & key, Value const & value)
{
StringStorage::Instance().SetValue(key, ToString(value));
}
inline void Delete(std::string const & key) { StringStorage::Instance().DeleteKeyAndValue(key); }
inline void Clear() { StringStorage::Instance().Clear(); }
/// Use this function for running some stuff once according to date.
/// @param[in] date Current date in format yymmdd.
bool IsFirstLaunchForDate(int date);
}
namespace marketing
{
class Settings : public platform::StringStorageBase
{
public:
template <class Value>
static void Set(std::string const & key, Value const & value)
{
Instance().SetValue(key, settings::ToString(value));
}
template <class Value>
WARN_UNUSED_RESULT static bool Get(std::string const & key, Value & outValue)
{
std::string strVal;
return Instance().GetValue(key, strVal) && settings::FromString(strVal, outValue);
}
private:
static Settings & Instance();
Settings();
};
} // namespace marketing
| 2023-08-21T01:26:18.401715 | https://example.com/article/4424 |
Recent news
22 results for Post Traumatic Stress Disorder
The 22 push-up challenge aims to raise awareness of veteran suicide, after shocking figures revealed that 22 US veterans are taking their own lives every day. The inspiring online challenge has made it overseas, with amputee British soldiers joining the initiative.
British servicemen and women have been asked to film themselves taking part in the challenge. They will film themselves performing 22 push-ups daily for 22 days, uploading the videos to Facebook under the hashtags #22KILL and #22pushupchallenge.
Each day, a new person is nominated to join the initiative and take the challenge.
Now, more than 10,000 British soldiers (both currently serving and ex-servicemen) have taken part in the challenge, completing a...
Police officers who suffer post-traumatic stress want more to be done.
In the days following the 7/7 London bombings in 2005, acting sergeant, Gary Hayes of the British Transport police (BTP) was assigned to the temporary mortuary where bodies were being identified.
“When we got bodies in, they’d been down in those tunnels for two or three days, the decomposition, I’ve never seen anything like it in my life,” he said.
But Hayes believes it was a less visceral sign that triggered the complex PTSD he later developed. A card written by a father to his son, who had been killed on the day was what Hayes believes cost him his job.
“…The most overwhelming feeling of guilt came over me, it has stayed with me ever since.”
Hayes and other police officers (many who were first responders on 7/7) are calling for more help for emergency workers who develop PTSD. They believe that while people are aware of the condition and how it affects military personnel, very little has been done to understand PTSD among police, ambulance and...
A drug for multiple sclerosis could be re-purposed to erase bad memories for those who have suffered trauma.
The drug in question, fingolimod, has been tested on mice and was found to help rid them of memories of physical pain. The experiment, published in Nature Neuroscience, involved feeding mice the drug before giving them a mild electric shock. Normally, when mice are anxious they stop moving and have a fear of the chamber where they were given the shock. This behaviour rapidly reduced when the mice were given the fingolimod.
Scientists are hoping that this drug can be used in the future to remove bad memories and feelings associated with traumatic events – something that can be re-learnt, without the painful memories. This process is known as ‘fear extinction’ and has the potential to help rid sufferers of phobias and post-traumatic stress.
Up until now, no drug has been found to suppress such feelings successfully. Previous drug trials looked at medication that suppresses an enzyme known as HDAC, but trials showed that while sometimes successful,...
A 'significant increase' has been seen in the number of UK veterans seeking treatment for mental health issues.
Mental health charity Combat Stress has reported a 57% increase in numbers of Afghanistan veteran referrals from 2012-2013. The charity believes this issue will become highlighted as UK forces prepare to leave the country.
Combat Stress says in the past veterans waited an average of 13 years after serving before they sought help, but now veterans are waiting an average of 18 months. BBC defence correspondent Caroline Wyatt believes this could be explained by reduced stigma surrounding mental health problems as well as a greater awareness of the help available.
“The charity says it is small but a significant number of veterans who are battling these hidden psychological wounds that, if they don’t seek help, can get far, far worse and be far harder to treat.”
Post-traumatic stress disorder (PTSD) is the most common concern from veterans, a condition that can affect anyone who has experienced some sort of traumatic event – such as military...
Experts in the U.S. are creating virtual humans, which could be used as a stopgap therapy for those suffering from trauma and depression.
Researchers from the Universities of Southern California’s Institute for Creative Technologies are leading the way in the creation of virtual humans – the results of which could help those in need.
Blinking naturally and shuffling slightly in her chair, Ellie the virtual human starts her dialogue by introducing herself and pointing out that she is not a therapist, but would like to learn more about real people.
The way she speaks and reacts to people is determined by the tone of voice, facial expressions and body language of the person talking. All of these details are picked up by a simple gaming sensor and webcam. Researcher Dr Louis-Philippe Morency describes this as ‘Wizard of Oz mode’.
Ellie is currently controlled by a team of two while data is gathered and analysed...
According to recent statistics, new diagnoses of post-traumatic stress disorder (PTSD) have increased within British service personnel.
The number of British troops suffering from PTSD has increased over recent years. A total of 94 members of the armed forces were newly diagnosed with the disorder between July and September of last year, this is nearly four times as many recorded in the same period in 2008.
There were 305 new cases of PTSD in the 12 months running up to September of last year, while only 153 were recorded in 2007 – 2008. These statistics have been released by the Defence Analytical Services and Advice.
Figures revealed that personnel who served in Iraq or Afghanistan showed a much higher chance of developing mental disorders. RAF personnel, soldiers and non-officer ranks were also highlighted as more likely to suffer from mental health problems like PTSD.
The city of Misrata, which took the brunt of the Libyan revolution last year, is now faced with an acute crisis of psychiatric care for people left traumatised by the bloodshed of war and the hopelessness of a future with no freedom.
The fighting in Mistrata claimed 2,000 lives and wounded 14,000, giving the city the title of ‘Libya’s Stalingrad’ – one of history’s bloodiest battles.
During the three month battle, soldiers fighting to protect Colonel Gaddafi committed a number of atrocities, including the rape of Misratan women and the castration of Misratan men.
The war may have ended when rebel fighters killed Gaddafi in October last year, but the psychological wounds remain open.
The concept of post traumatic stress disorder (PTSD) is new in Libya and mental illness is still a massive taboo in much of the Arab world.
Millions of us stood silent at 11am last Sunday to remember Britain’s fallen soldiers.
With the plight of brave men and women fresh in our minds, now is the time to think about those who will be returning from Iraq and Afghanistan between now and 2014, when the last battalions are due to return from war.
Thousands of soldiers who appear healthy are suffering from an invisible wound – post-traumatic stress disorder (PTSD). The condition manifests after the witnessing of horrific things.
These people will be haunted by traumatic memories for the rest of their lives, with many turning to drugs and alcohol, and many others losing their families, losing their homes and even losing their desire to continue living.
In some extreme cases, PTSD sufferers commit violent crimes – just a few months ago 24 year old Afghan veteran Aaron Wilkinson hit the news for shooting dead his 52-year-old landlady. He has since admitted...
A new study published in the Journal of Affective Disorders has revealed that individuals who possess a certain gene variant could be predisposed to post traumatic stress disorder (PTSD).
The American research team who carried out the research analysed the DNA of 200 members of 12 different families who has witnessed and survived the 1988 Armenian earthquake. All of those involved had either seen dead bodies during the incident, or had seen people who had been seriously injured.
What the researchers found was that study participants who carried two particular gene variants (TPH1 and TPH2) known to have an impact upon serotonin production (a hormone which affects mood), were more likely to develop symptoms of PTSD.
PTSD is said to affect approximately 3% of the general population at one point or another, and usually sets in after an individual has experienced trauma, for example after war, a natural disaster or sexual abuse. | 2024-03-28T01:26:18.401715 | https://example.com/article/1577 |
Ender rod fixation of femoral shaft fractures in children.
Ender rod fixation for femoral shaft fractures in children was evaluated in a prospective study at two Level 1 trauma centers. Fifty-seven fractures in 52 patients were evaluated. Criteria for inclusion in the study included age younger than 14 years, femoral shaft fractures occurring in the middle 3/5, canal size greater than 7 mm, and parental consent. Hip and knee motion, gait, leg length discrepancy, and rotational asymmetry were evaluated by clinical examination. Standard radiographs were used to measure any residual angulation. A subset of patients whose injuries occurred more than 12 months previously was evaluated using scanograms. Followup averaged 20 months. There were no delayed unions and all fractures healed within 12 weeks. Clinically significant leg length discrepancy, malunion, or loss of motion did not occur. Functional results were excellent and complications were minor. Ender rod fixation of femur fractures in children allows the advantages of surgical fixation with minimal risk of complications. | 2023-10-30T01:26:18.401715 | https://example.com/article/1039 |
German engineering produces an overcomplicated scarecrow
This electronic scarecrow keeps the birds away and makes your neighbors hate you at the same time. That’s because its way too loud, even if the next house is far away. The conrad.de folks that brought us the climbing bike storage device are at it again, putting together car audio and strings of lights as part of the bird-shoo-ing technology. In the video after the break you’ll see that they’re using a PIR motion sensor to switch power to an automotive amp and head unit. The speakers, strings of lights, and spinning doo-dads are all hidden under a black cape. When an unsuspecting bird tries to feast on the crops, the scarecrow unfolds its arm Dracula-style and raises a ruckus. We don’t expect to see this at a local farm, but maybe for next Halloween?
I kept seeing this “guy” staring at me every damn time I went to our back gate, after a couple of weeks I’d had enough and went to confront “him”.
Turned out to be a “scarecrow”!
At least with this thing I’d have known!
Funny thing is the orchard had at least 6 gas “gun” bird scarer’s! | 2023-08-28T01:26:18.401715 | https://example.com/article/4452 |
Excerpt:civil procedure code (act v of 1908), order vii, rule 11 - partition suit referred to arbitration--decree drawn up in accordance with award--plaintiff, failure of, to deposit stamp duty, effect of--dismissal of suit, legality of. - .....to deposit rs. 10. it may be pointed out here that this rs. 10 was not a court-fee. it was the stamp duty which was payable upon an 'instrument of partition', which includes a decree for partition. for some reason or other, not very clear, this order was not complied with. in the meanwhile another judge had taken the place of the judge who had made the order directing a decree to be drawn up in accordance with the award. this new judge, finding that the order had not been complied with, dismissed the plaintiff's suit. the applicant contends that there was no jurisdiction in the court to dismiss the suit after a decree had been ordered to be drawn up merely by reason of the non-deposit of the stamp duty. we think that this contention has force. possibly if there had been a non-payment.....
Judgment:
1. This application in revision arises under the following circumstances. The plaintiff, who is the applicant here, brought a suit for partition. The parties referred the matter to arbitration and an award was made. No objection having been taken to the award, the Court directed that a decree should be made in the terms of the award. A week after this, the Court directed the plaintiff or his Pleader to deposit Rs. 10. It may be pointed out here that this Rs. 10 was not a Court-fee. It was the stamp duty which was payable upon an 'instrument of partition', which includes a decree for partition. For some reason or other, not very clear, this order was not complied with. In the meanwhile another Judge had taken the place of the Judge who had made the order directing a decree to be drawn up in accordance with the award. This new Judge, finding that the order had not been complied with, dismissed the plaintiff's suit. The applicant contends that there was no jurisdiction in the Court to dismiss the suit after a decree had been ordered to be drawn up merely by reason of the non-deposit of the stamp duty. We think that this contention has force. Possibly if there had been a non-payment of necessary Court-fees, the Court would have had jurisdiction to dismiss the suit, but as already pointed out this was a stamp duty, not a Court-fee. It would be certainly unfortunate if the order of the Court below remains. The parties would be left with a legacy of useless litigation. We allow the application and set aside the order of the Court below dismissing the plaintiff's suit, but on this condition that the applicant here shall deposit the stamp duty of Rs. 10 in the Court below within two months from this date. If he fails to do so, this application in revision will stand dismissed with costs without any further order. If the Rs. 10 is duly deposited, then we direct the parties to pay their own costs of this application. The record may be returned to the Court below as soon as possible. | 2023-11-25T01:26:18.401715 | https://example.com/article/1039 |
package plotberry
import (
"encoding/json"
"fmt"
"github.com/abourget/slick"
"io/ioutil"
"log"
"math"
"net/http"
"time"
)
type PlotBerry struct {
bot *slick.Bot
totalUsers int
pingTime time.Duration
celebrated bool
}
type TotalUsers struct {
Plotberries int `json:"plotberries"`
}
func init() {
slick.RegisterPlugin(&PlotBerry{})
}
func (plotberry *PlotBerry) InitPlugin(bot *slick.Bot) {
plotberry.bot = bot
plotberry.celebrated = true
plotberry.pingTime = 10 * time.Second
plotberry.totalUsers = 100001
statchan := make(chan TotalUsers, 100)
go plotberry.launchWatcher(statchan)
go plotberry.launchCounter(statchan)
bot.Listen(&slick.Listener{
MessageHandlerFunc: plotberry.ChatHandler,
})
}
func (plotberry *PlotBerry) ChatHandler(listen *slick.Listener, msg *slick.Message) {
if msg.MentionsMe && msg.Contains("how many user") {
msg.Reply(fmt.Sprintf("We got %d users!", plotberry.totalUsers))
}
return
}
func getplotberry () (*TotalUsers, error) {
var data TotalUsers
resp, err := http.Get("https://plot.ly/v0/plotberries")
if err != nil {
return nil, err
}
defer resp.Body.Close()
body, err := ioutil.ReadAll(resp.Body)
if err != nil {
return nil, err
}
err = json.Unmarshal(body, &data)
if err != nil {
return nil, err
}
return &data, nil
}
func (plotberry *PlotBerry) launchWatcher(statchan chan TotalUsers) {
for {
time.Sleep(plotberry.pingTime)
data, err := getplotberry()
if err != nil {
log.Print(err)
continue
}
if data.Plotberries != plotberry.totalUsers {
statchan <- *data
}
plotberry.totalUsers = data.Plotberries
}
}
func (plotberry *PlotBerry) launchCounter(statchan chan TotalUsers) {
finalcountdown := 100000
for data := range statchan {
totalUsers := data.Plotberries
mod := math.Mod(float64(totalUsers), 50) == 0
rem := finalcountdown - totalUsers
if plotberry.celebrated {
continue
}
if mod || (rem <= 10) {
var msg string
if rem == 10 {
msg = fmt.Sprintf("@all %d users till the finalcountdown!", rem)
} else if rem == 9 {
msg = fmt.Sprintf("%d users!", rem)
} else if rem == 8 {
msg = fmt.Sprintf("and %d", rem)
} else if rem == 7 {
msg = fmt.Sprintf("we're at %d users. %d users till Mimosa time!\n", totalUsers, rem)
} else if rem == 6 {
msg = fmt.Sprintf("%d...", rem)
} else if rem == 5 {
msg = fmt.Sprintf("@all %d users\n I'm a freaky proud robot!", rem)
} else if rem == 4 {
msg = fmt.Sprintf("%d users till finalcountdown!", rem)
} else if rem == 3 {
msg = fmt.Sprintf("%d... \n", rem)
} else if rem == 2 {
msg = fmt.Sprintf("%d more! humpa humpa\n", rem)
} else if rem == 1 {
plotberry.bot.SendToChannel(plotberry.bot.Config.GeneralChannel, fmt.Sprintf("%d users until 100000.\nYOU'RE ALL MAGIC!", rem))
msg = "https://31.media.tumblr.com/3b74abfa367a3ed9a2cd753cd9018baa/tumblr_miul04oqog1qkp8xio1_400.gif"
} else if rem <= 0 {
msg = fmt.Sprintf("@all FINALCOUNTDOWN!!!\n We're at %d user signups!!!!! My human compatriots, taking an idea to a product with 100,000 users is an achievement few will experience in their life times. Reflect, humans, on your hard work and celebrate this success. You deserve it, and remember, Plot On!", totalUsers)
plotberry.celebrated = true
} else {
msg = fmt.Sprintf("We are at %d total user signups!", totalUsers)
}
plotberry.bot.SendToChannel(plotberry.bot.Config.GeneralChannel, msg)
}
}
}
| 2024-05-16T01:26:18.401715 | https://example.com/article/7253 |
Ion/ion chemistry of high-mass multiply charged ions.
Electrospray ionization has enabled the establishment of a new area of ion chemistry research based on the study of the reactions of high-mass multiply charged ions with ions of opposite polarity. The multiple-charging phenomenon associated with electrospray makes possible the generation of multiply charged reactant ions that yield charged products as a result of partial neutralization due to ion/ion chemistry. The charged products can be readily studied with mass spectrometric methods, providing useful insights into reaction mechanisms. This review presents the research done in this area, all of which has been performed within the past decade. Ion/ion chemistry has been studied at near-atmospheric pressure in a reaction region that leads to the atmospheric/vacuum interface of a mass spectrometer, and within a quadrupole ion trap operated with a bath gas at a pressure of 1 mtorr. Proton transfer has been the most common reaction type for high-mass ions, but other forms of "charge transfer," such as electron transfer and fluoride transfer, have also been observed. For some ion/ion reactions, attachment of the two reactants has been observed. Multiply charged ion/ion reactions are fast, due to the long-range Coulombic attraction, and they are universal in that any pair of oppositely charged ions is expected to react due to the high exothermicity associated with mutual neutralization. The kinetics of reaction for multiply charged ions, derived from the same molecule with a given singly charged reactant ion, follow a charge-squared dependence, at least under normal quadrupole ion trap conditions. This dependence suggests that reaction rates are determined by the long-range Coulomb attraction, and that the ions react with constant efficiency as a function of charge state. In the case of proton transfer reactions from polypeptides to even-electron perfluorocarbon anions, no fragmentation of the polypeptide product ions has, as yet, been observed. Electron transfer from small oligonucleotide anions to rare gas cations, on the other hand, results in extensive fragmentation of the nucleic acid product ions. The extent of fragmentation decreases as the size of the oligonucleotide anions increases, reflecting a decrease in fragmentation rates associated with an increase in the number of internal degrees of freedom of the oligonucleotide. When ion-cooling rates become competitive with dissociation rates, the initially formed product ions are stabilized and fragmentation is avoided. Collisional cooling, therefore, likely plays an important role in the relative lack of dissociation observed thus far as a result of ion/ion reactions for most high-mass ions. The observed dependence of ion/ion reaction rates on the square of the ion charge, the universal nature of mutual neutralization, and the relative lack of fragmentation that arises from ion/ion reactions, makes ion/ion chemistry a particularly useful means for manipulating charge states. This review emphasizes applications that take advantage of the unique characteristics of ion/ion proton transfer chemistry for manipulating charge states. These applications include mixture analysis by electrospray, precursor ion charge state manipulation for tandem mass spectrometry studies, and simplified interpretation of product ion spectra. | 2024-06-13T01:26:18.401715 | https://example.com/article/9800 |
Q:
passing textbox value from parent page to child window in cfm
I am passing text field value from parent cfm page to child window which I am opening after clicking button or link.
<form name="parentForm" action="">
<input type="text" id="parentValue" value="" />
<input type="button" value="Open Popup" onclick ="javascript:LaunchPopup('openP.cfm');"/>
</form>
<script type="text/javascript">
function LaunchPopup(page) {
OpenWin = window.open(page, "myWindow", "width=400,height=200");
}
</script>
<!--- Child page : openp.cfm --->
<script>
if (opener.document){
mother = opener.document;
document.form1.popupValue.value = mother.parentForm.parentValue.value;
}
</script>
<form id="form1">
Value from the calling page: <input type="text" id="popupValue" value="" />
</form>
But for some reason, i am not able to pass the value which i entered in parent page. after i click button, i want to see the value what i entered in parent page.
A:
Parent page
<input
type="button" value="Open Popup"
onclick ="javascript:LaunchPopup('openP.cfm?parent=' + document.parentForm.parentValue.value);"
/>
openp.cfm
<cfparam name="url.parent" default="">
<form id="form1">
Value from the calling page:
<input type="text" id="popupValue" value="<cfoutput>#url.parent#</cfoutput>" />
</form>
| 2023-12-06T01:26:18.401715 | https://example.com/article/6041 |
Evidence that the peptidylprolyl isomerase domain of the hsp90-binding immunophilin FKBP52 is involved in both dynein interaction and glucocorticoid receptor movement to the nucleus.
We have previously shown that immunoadsorption of the FKBP52 immunophilin component of steroid receptor.hsp90 heterocomplexes is accompanied by coadsorption of cytoplasmic dynein, a motor protein involved in retrograde transport of vesicles toward the nucleus. Coimmunoadsorption of dynein is competed by an expressed fragment of FKBP52 comprising its peptidylprolyl isomerase (PPIase) domain (Silverstein, A. M., Galigniana, M. D., Kanelakis, K. C., Radanyi, C., Renoir, J.-M., and Pratt, W. B. (1999) J. Biol. Chem. 52, 36980-36986). Here we show that cotransfection of 3T3 cells with the FKBP52 PPIase domain and a green fluorescent protein (GFP) glucocorticoid receptor (GR) chimera inhibits dexamethasone-dependent movement of the GFP-GR from the cytoplasm to the nucleus. Cotransfection with FKBP12 does not affect GFP-GR movement. Inhibition of movement by the FKBP52 PPIase domain is abrogated in cells treated with colcemid to eliminate microtubules prior to steroid addition. After withdrawal of colcemid, microtubules reform, and PPIase inhibition of GFP-GR movement is restored. These observations are consistent with the notion that FKBP52 targets retrograde movement of the GFP-GR along microtubules by linking the receptor to the dynein motor. Here, we also show that native GR.hsp90 heterocomplexes immunoadsorbed from L cell cytosol contain dynein and that GR.hsp90 heterocomplexes assembled in reticulocyte lysate contain cytoplasmic dynein in a manner that is competed by the PPIase domain of FKBP52. | 2024-05-30T01:26:18.401715 | https://example.com/article/2951 |
Q:
Figuring out if points are the same in FME
So I am working on a project using spatial point data in FME. Both files contain 500 points and the hope is they are all the same. To figure out if any are different I was thinking of using PointOnPointOverlayer tool instead of a spatial realtor.
What are your thoughts guys on this or is their a better way. Just for heads up both files contain same information but from different sources so id and other useful information would not be the same to use a simple feature merger and then take unmerged ones as the different ones.
The goal is to figure out what records are not in the other data set.
A:
I'd try the ChangeDetector with no attributes -- so you'd set it up to only compare geometries. Just have it compare no attributes.
Takes a wee bit of concentration to figure out what all the ports do, but if you check the documentation it should be clear enough.
You could accomplish the same result with a PointOnPointOverlayer but it would be more work to post-process the results to figure out who'd be added or deleted. You'd need to set attributes up prior to going in and then examine what comes out once the attributes of matching points are merged. So it could be done but it would be harder. Note -- if you wanted to handle non-exact matches, then you'd have to go this way as ChangeDetector demands exact location matching, whereas point on point has a tolerance.
PS: Feel free to post over on the new FME community as others there may have additional insight.
| 2024-07-28T01:26:18.401715 | https://example.com/article/9098 |
Abbreviations used: CLP, common lymphoid progenitor; EBF, early B cell factor; ETP, early thymic progenitor; LSK, lin^−^ sca^hi^ kit^hi^; TN, triple negative.
Despite the essential role of the V(D)J recombinase in catalyzing antigen receptor loci rearrangement, the molecular mechanisms that regulate recombinase activity in hematopoietic progenitors remain unknown. The *rag1*/*2* components of the V(D)J recombinase initiate recombination by cleaving the DNA at Ig or TCR loci. *rag* expression is first detectable in a rare subset of lin^−^ sca^hi^ kit^hi^ (LSK) progenitors ([@bib1]). Both *rag* transcription and V(D)J recombinase activity are then up-regulated in bone marrow common lymphoid progenitors (CLPs), cells that efficiently produce B lymphocytes, and in early thymic progenitors (ETPs), cells that efficiently produce T lymphocytes ([@bib2], [@bib3]).
Conflicting studies highlight a potentially important role for the E2A gene products E47 and E12 as regulators of V(D)J recombination during the earliest stages of lymphocyte development. First, whole bone marrow from E2A- or E47-null mice lacks detectable *rag* transcripts and D-J~H~ rearrangements, suggesting a requirement for E2A activity in IgH recombination during B cell development ([@bib4], [@bib5]). However, both E2A- and E47-null mice also have a complete block in early B cell production. Thus, it is unclear whether the lack of *rag* expression and D-J~H~ rearrangements is due to a specific block in recombination processes or to the absence of B lineage progenitors. Second, retroviral reconstitution of E47 in long-term cultured E2A-deficient hematopoietic progenitors restores both *rag1* and *rag2* expression in vitro ([@bib6]), and ectopic expression of E12 in the 70Z/3 cell line promotes expression of *rag1* ([@bib7]). However, in other cell lines, expression of E2A was not sufficient to initiate V(D)J recombination in the absence of *rag* cotransfection, rendering it unclear whether E2A is a major regulator of *rag* transcription ([@bib8]--[@bib10]). Third, E2A binds to E*rag*, an enhancer of *rag* expression whose activity is required for V(D)J recombinase activity at the CLP stage of development ([@bib2], [@bib11]). E2A is expressed at low levels in LSKs and is highly up-regulated during progression to the B lineage ([@bib1], [@bib12]), but it remains unknown whether E2A activity is required for recombination in CLPs.
E2A initiates a key transcriptional cascade involving early B cell factor (EBF) and *pax5* that leads to the expression of lineage-specific genes required for B cell development and survival, including CD19, IgL, mb-1, B29, λ5, VpreB, and IL7R ([@bib13]--[@bib15]). Long-term culture with IL-7 restores detectable D-J~H~ joints in hematopoietic precursors from E2A-null mice, indicating that these cells can undergo V(D)J recombination under specific culture conditions ([@bib6]). There are two possible explanations for this observation. First, supportive culture conditions may enable survival of D-J~H~ ^+^ progenitors that would have died in vivo due to a developmental block. Second, supportive culture conditions may permit recombination events that are unable to occur in vivo due to the absence of requisite V(D)J recombination machinery. It would be useful to identify which hematopoietic progenitor subsets are still intact in mice lacking E2A gene products to determine the role of this transcription factor in regulating recombination initiation in vivo. To directly address this issue, we characterized the presence of specific hematopoietic progenitor populations in E47-deficient mice and analyzed recombinase activity within these precursor subsets using an in vivo fluorescent reporter of V(D)J recombinase activity.
Results
=======
E47-null mice completely lack pro--B cells
------------------------------------------
Because the precise stage at which B lineage development is blocked in E47- and E2A-null mice remains undefined, it is unclear whether the lack of detectable V(D)J rearrangements in fetal liver and bone marrow ([@bib4], [@bib16]) is due to a block in recombination or to the absence of the relevant developmental subsets in which V(D)J recombination occurs. Therefore, we characterized the presence of the earliest B lineage progenitors in mice lacking E47. AA4.1^+^ B220^+^ B lineage progenitors in the bone marrow can be resolved into pre-pro--B (CD19^−^ CD24^lo^) and pro-/pre-B (CD19^+^ CD24^hi^) subsets ([Fig. 1](#fig1){ref-type="fig"} A, top and middle rows). For this analysis, we excluded DX5^+^ NK cells, CD4^+^ DC progenitors, and Ly6C^+^ myeloid and plasma cells ([@bib2], [@bib17], [@bib18]), populations that contribute significant contamination to the B lineage progenitor gates.
{#fig1}
We found that pro--/pre--B cells were virtually undetectable in E47-null mice. This population was reduced from 65--82% in E47-heterozygous animals to 0--0.2% in E47-deficient animals ([Fig. 1](#fig1){ref-type="fig"} A, middle row, and not depicted). In contrast to the complete absence of pro--B cells, pre-pro--B cells are detectable in E47-null mice. However, pre-pro--B cells are reduced three- to fourfold in absolute cell number from 19,655 ± 19,164 (*n* = 10) in E47-heterozygous mice to 5,086 ± 5,743 (*n* = 10) in E47-null mice ([Fig. 2](#fig2){ref-type="fig"}). The cytokine receptors flt3 and c-Kit, which are expressed on the surface of the earliest B lineage precursors and down-regulated thereafter ([@bib19], [@bib20]), were detectable at comparable levels on pre-pro--B cells from E47-null versus E47-heterozygous animals ([Fig. 1](#fig1){ref-type="fig"} B and not depicted).
{#fig2}
Because E47 might regulate expression of the AA4.1 epitope, we confirmed the developmental block between pre-pro-- and pro--B cells using an analysis scheme that does not rely on discrimination of the AA4.1 antigen. Within the B220^+^ CD43^+^ CD4^−^ DX5^−^ Ly6C^−^ IgM^−^ subset, we found that CD19^−^ CD24^lo^ pre-pro--B cells, but not CD19^+^ CD24^hi^ pro--B cells, were detectable in E47-null mice ([Fig. 1](#fig1){ref-type="fig"} C, middle row). Thus, using two different schemes, we found that E47-deficient animals completely lack the pro- and pre-B population.
We examined recombinase activity in pre-pro--B cells from E47-null mice by crossing these animals to the H2-SVEX recombination substrate reporter line. In these mice, VEX, a spectral variant of GFP, is a sensitive in vivo reporter of V(D)J recombinase activity ([@bib2], [@bib21]). We found that VEX expression was reduced 65--85% in E47-null pre-pro--B cells defined according to either phenotypic scheme. The percentage of VEX^+^ pre-pro--B cells in E47-heterozygous versus E47-null mice was 14 versus 1.5% in AA4.1^+^ B220^+^ CD19^−^ CD24^lo^ pre-pro--B cells ([Fig. 1](#fig1){ref-type="fig"} A, bottom row) and 9.8 versus 1.4% in B220^+^ CD43^+^ CD19^−^ CD24l^o^ pre-pro--B cells ([Fig. 1](#fig1){ref-type="fig"} C, bottom row). Thus, E47 is required for V(D)J recombinase activity at this stage of development.
Taken together, these data show that not only does the B lineage defect in E47-deficient mice occur earlier than was previously appreciated, but E47 has two distinct activities in vivo: (a) regulating pre-pro-- and pro--B cell development and (b) controlling V(D)J recombination.
E47 and Erag are not required for recombinase activity in T lineage progenitors
-------------------------------------------------------------------------------
We have previously shown that recombinase activity in B but not T cells depends on the E*rag* enhancer of *rag* expression, which is a target of E2A ([@bib2], [@bib11]). In these experiments, we had examined the effects of E*rag* deletion on VEX expression in splenic T cells, taking advantage of the fact that VEX is a permanent marker of V(D)J recombination that occurs in the thymus ([@bib2]). To directly assess the contribution of E47 and E*rag* to V(D)J recombination in thymocytes, we characterized VEX expression in ETPs from E47- or E*rag*-null mice.
As shown in [Fig. 3](#fig3){ref-type="fig"} (left), loss of E47 did not significantly alter VEX expression in early triple negative (TN; CD3^−^ CD4^−^ CD8^−^) thymic progenitors, total CD4^−^ CD8^−^ double negative progenitors, or downstream CD4^+^ CD8^+^ double positive progenitor subsets. The most noticeable difference occurred in the TN1 cells, in which VEX was slightly reduced from 71% in E47 wild-type mice versus 54% in E47-null mice. Consistent with the minimal effect that loss of E47 has on recombinase activity in early TN subsets, VEX expression was comparable in ETPs from E47-heterozygous versus E47-null mice (not depicted). Likewise, E*rag* deletion also had little consequence. VEX expression was virtually identical or even slightly elevated in TN1--TN4 subsets from E*rag* wild-type versus E*rag*-null mice ([Fig. 3](#fig3){ref-type="fig"}, right).
{#fig3}
The minimal effect of E47 on VEX expression in T lineage progenitors cannot be attributed to lack of sensitivity of the H2-SVEX recombination substrate because VEX expression completely depends on the presence of *rag1* (Fig. S1 A, available at <http://www.jem.org/cgi/content/full/jem.20051190/DC1>), and recombination efficiency is proportional to levels of *rag* expression ([@bib2]). Moreover, it is unlikely that the H2-SVEX transgene is subject to significant position-dependent effects because VEX is detectable at comparable levels in hematopoietic tissue from multiple independent founders ([@bib2]) and is similar for the earliest TN1--TN4 populations across two different founders (compare VEX expression in E47 wild-type H2-SVEX SB110 mice in [Fig. 3](#fig3){ref-type="fig"} to H2-SVEX SB88 mice in Fig. S1 B). These data are consistent with the observation that although E47-null thymic progenitors have altered usage of specific TCR V region genes, these mice do not have a block in TCR recombination ([@bib22]). Taken together, these data suggest that both E47 and E*rag* are required for recombinase expression in early B cells but not early T cells.
E47 is required for optimal recombinase activity in DCs and NK cells
--------------------------------------------------------------------
We and others have previously shown that the D-J rearrangements at the IgH locus are not B/T lineage--restricted events ([@bib2], [@bib23]), and we wondered if E47 is required for recombination in other lineages. DC and NK populations have not been characterized in E47-null mice, and we found that these populations are present in reduced numbers. DC precursors in the bone marrow (AA4.1^+^ CD24^lo^ CD4^+^ B220^+^; reference [@bib17]) are reduced approximately fivefold from 64,950 ± 31,239 cells (*n* = 10) in E47 heterozygotes to 11,818 ± 11,096 (*n* = 10) in E47-null animals ([Fig. 2](#fig2){ref-type="fig"}). Similarly, splenic NK cells (NK1.1^+^ CD122^+^ CD3^−^) are reduced threefold from 450,865 ± 217,460 (*n* = 5) in E47 heterozygotes to 150,434 ± 83,067 (*n* = 4) from E47-null mice ([Fig. 2](#fig2){ref-type="fig"}).
As with pre-pro--B cells, recombinase expression in DC precursors and NK cells is markedly reduced in the absence of E47. VEX expression is decreased from 15 to 4.7% in DC precursors ([Fig. 4](#fig4){ref-type="fig"} A, bottom row) and from 8.9 to 2.8% in NK cells ([Fig. 4](#fig4){ref-type="fig"} B, bottom row) from E47-heterozygous versus E47-null mice, respectively. The observation that recombinase activity is reduced but not ablated in the absence of E47 highlights the potential contribution of other transcription factors to regulate recombination at these stages of development.
{#fig4}
These data suggest that the requirements for V(D)J recombination are coordinately regulated in B cells, NK cells, and DCs, and are controlled by distinct mechanisms in the T lineage. This interpretation is consistent with the notion that B and NK cells as well as some DCs develop from bone marrow CLPs, whereas the T lineage appears to most efficiently develop from thymic ETPs ([@bib24]) in which recombination might be under distinct transcriptional control.
E47 is important for normal development of multipotent lymphoid progenitors
---------------------------------------------------------------------------
*rag* expression is first detectable in a rare subset of LSK bone marrow progenitors ([@bib1]), and recombinase activity is up-regulated in CLPs ([@bib2], [@bib24]). Specifically, although *rag* expression is detectable in ∼4% of LSKs ([@bib1]), 40--50% of CLPs have recombination events as measured with the H2-SVEX recombination substrate ([@bib2]). Therefore, this developmental transition represents a pivotal stage in dissecting the molecular requirements for V(D)J recombination initiation.
We quantified LSKs and CLPs in E47-null mice to determine how early in development the E47 defect extends. Bone marrow LSKs were detected at comparable frequency (15--22%) in E47 wild-type, E47-heterozygous, and E47-null mice ([Fig. 5](#fig5){ref-type="fig"} A), suggesting that E47 is not required for the generation of LSKs. In terms of absolute cell number, LSKs were somewhat elevated from 56,122 ± 29,989 (*n* = 3) and 39,530 ± 16,780 (*n* = 9) in E47 wild-type and E47-heterozygous mice, respectively, to 73,269 ± 81,328 (*n* = 5) in E47-null mice ([Fig. 2](#fig2){ref-type="fig"}). However, these differences were not significant (P \> 0.5). Comparable to *rag* expression ([@bib1]), recombinase activity is detectable in ∼1--1.5% of LSKs (not depicted), and thus, it is difficult to determine whether loss of E47 affects VEX expression at this stage.
{#fig5}
In contrast to LSKs, the CLP population was significantly reduced in the absence of E47. We identified bone marrow CLPs using two different phenotypic schemes, again exploiting one staining combination that is independent of the AA4.1 antigen. As shown in [Fig. 5](#fig5){ref-type="fig"} B (top row), for the first phenotypic strategy ([@bib17]), 17--19% of IL7R^+^ lin^−^ cells are readily detectable as AA4^+^ Sca^lo^ bone marrow CLPs in E47 heterozygotes, but this population is reduced to 0.9--9.9% in E47-null mice shown from three different representative experiments. This 50--95% decrease in the percentage of CLPs is consistent with a 10-fold reduction in absolute cell number in this population from 7,556 ± 3,813 (*n* = 6) in E47 wild-type mice and 7,842 ± 2,367 (*n* = 17) in E47-heterozygous mice, respectively, to 724 ± 417 in E47 knockout mice (*n* = 15; [Fig. 2](#fig2){ref-type="fig"}). This residual CLP population in E47-deficient animals also expresses normal levels of c-Kit and only modestly reduced levels of flt3 ([Fig. 5](#fig5){ref-type="fig"} C).
We confirmed the presence of CLPs in E47-null mice using the AA4.1-independent definition IL7R^+^ lin^−^ Sca^lo^ c-Kit^lo^ ([@bib25]). As shown in [Fig. 5](#fig5){ref-type="fig"} D (middle row), these CLPs are similarly reduced from 19 to 5.2% in E47-heterozygous versus E47-null mice. We then confirmed that AA4.1 is detectable on these CLPs. Interestingly, AA4.1 was expressed on a high percentage of CLPs from E47-null versus E47-heterozygous mice, but it was reduced fourfold in intensity (mean fluorescence intensity: 6,245 vs. 1,494 in E47-heterozygous vs. E47-null mice; [Fig. 5](#fig5){ref-type="fig"} D, bottom row). It is unclear whether this decrease in AA4.1 expression reflects a requirement for E47 for normal levels of expression, or whether AA4.1^hi^ CLPs represent a developmental stage that is absent in the E47-deficient animals.
Early lymphoid progenitors are exquisitely sensitive to apoptosis, and reductions in the CLP compartment could be due to increases in apoptosis or to a failure to proliferate. However, we found that \<5% of CLPs or pre-pro--B cells from E47-null animals are annexin V^+^ DAPI^−^ ([Fig. 6](#fig6){ref-type="fig"} A), consistent with observations that B lymphocyte development in E47-deficient animals cannot be rescued by a *bcl2* transgene ([@bib26]). Although frequencies of apoptotic cells were low, dead pre-pro--B cells (DAPI^+^) accumulated just over twofold more in E47-null animals ([Fig. 6](#fig6){ref-type="fig"} A and not depicted), possibly reflecting a defect in the ability to clear apoptotic cells. Despite diminished numbers, CLPs and pre-pro--B cells from E47-null mice exhibit twofold higher levels of proliferation compared with E47-heterozygous animals. The percentage of BrdU^+^ progenitors was increased from 20 to 46% in CLPs and from 37 to 92% in pre-pro--B cells obtained from E47-heterozygous versus E47-deficient animals ([Fig. 6](#fig6){ref-type="fig"} B). Thus, the reduction in CLPs in E47-null mice is not due to either increased levels of apoptosis or a block in proliferation.
{#fig6}
E47 is indispensable for IgH recombination in multipotent CLPs
--------------------------------------------------------------
We examined the role of E47 in regulating recombinase activity in AA4.1^+^ Sca^lo^ CLPs, an essential step during differentiation to the B lymphocyte lineage. As shown in [Fig. 5](#fig5){ref-type="fig"} B (bottom row), VEX expression is ablated from 36% in CLPs from E47-heterozygous mice to 0% in E47-null mice, suggesting that the activity of E47 is absolutely required for recombinase activity at this stage of development. The complete loss of recombinase activity is consistent across all three mice depicted ([Fig. 5](#fig5){ref-type="fig"} B, bottom row), even though these animals had slightly different percentages of cells detected within the CLP gate (top row).
Not only did CLPs from E47-deficient mice lack recombinase activity, but these progenitors were also deficient in D-J~H~ recombination events at the endogenous IgH locus ([Fig. 7](#fig7){ref-type="fig"} A). D-J~H~ rearrangements were readily detected in CLPs from E47-heterozygous animals but were absent or barely discernable in CLPs derived from E47-null animals using a highly sensitive nested PCR strategy. By quantitative single cell PCR analysis of CLPs, D-J~H~ rearrangements were detectable in 6 out of 26 cells (23%) from E47-heterozygous mice. By contrast, of the more than 50 cells examined in E47-null mice, only one had a D-J~H~ rearrangement (1.9%). Thus, not only are CLPs reduced 10-fold in terms of absolute number in E47-null mice, but the frequency of CLPs capable of undergoing V(D)J recombination is reduced an additional 10-fold.
{ref-type="fig"} D were examined for D-J~H~ rearrangement status at the endogenous IgH locus by PCR. Germline (GL) DNA and rearrangements of D to J~1~, J~2~, J~3~, or J~4~ is indicated by arrowheads. Data from two independent sorts is shown (E47 heterozygote no. 1 and E47 knockout no. 1, 100 CLPs each; E47 heterozygote no. 2 and E47 knockout no. 2, 150 CLPs each). Rearrangement status of whole bone marrow from wild-type B6 mice and from *rag2* knockout mice is provided for comparison. Inset depicts the frequency of CLPs that have detectable D-J~H~ rearrangements as determined by quantitative single cell PCR. (B) *rag1* expression was quantified by real-time RT-PCR using 350 cell equivalents of cDNA from CLPs. Expression of *rag1* and the reference gene *β-actin* are shown for equal numbers of CLPs from E47-heterozygous and E47 knockout animals. ΔRN, the fluorescence intensity. Identical results were obtained using cells from at least two independent sorts.](20051190f7){#fig7}
V(D)J recombination at IgH loci requires *rag* expression and Ig gene transcription, and E47 has been shown to regulate both processes in cell lines. In primary CLPs, we found that loss of E47 dramatically inhibits *rag* expression. Consistent with the 100-fold reduction in recombination-competent lymphoid progenitors, *rag1* was not detectable in CLPs from E47-deficient animals despite successful amplification of β-*actin* transcripts by quantitative RT-PCR ([Fig. 7](#fig7){ref-type="fig"} B). In contrast to the paucity of *rag* transcripts, μ0 germline transcripts were readily detectable in CLPs from both E47 wild-type and E47-null mice (the frequency of detecting μ0 transcripts in single CLPs was approximately twofold less in E47-null compared with *rag1*-deficient mice; not depicted).
Taken together, these data indicate that E47 is required for *rag1* expression and recombinase activity as early as the CLP stage of development. These results also highlight a previously unrecognized role for E47 in regulating the developmental progression of LSKs to multipotent CLPs.
Discussion
==========
The recent definition of a transcriptional hierarchy that controls B lineage development raises fundamental questions about how E47 promotes B lineage specification in multipotent CLPs. Here, we show that E47 controls B lymphocyte production through one effect on CLP development and through a second effect on V(D)J recombination within the CLPs that do develop. These data provide in vivo evidence of a role for E47 influencing lineage commitment in multipotent hematopoietic progenitors and describe the role of E47 as the first essential transcriptional regulator of V(D)J recombinase activity.
Several studies suggested that E2A genes may regulate *rag* activity or other critical steps in V(D)J recombination. E2A binds to the E*rag* enhancer ([@bib27]), and forced expression of E12 or E47 induces *rag* transcripts in vitro ([@bib6], [@bib7]). Moreover, whole bone marrow and fetal liver from E2A- or E47-null mice lack detectable *rag* transcripts and V(D)J recombination events ([@bib4], [@bib5]). E2A has also been suggested to play a role in regulating IgH chromatin structure ([@bib28]). However, it was difficult to understand whether E2A gene products control V(D)J recombination in vivo as E2A- and E47-null mice have a complete block in the earliest stages of B lymphopoiesis. Here, we clearly separate the effects of E47 on the development of CLPs and pre-pro--B cells versus the effects of E47 on V(D)J recombination within these subsets. A diminished CLP subset (defined according to two different schemes) is detectable in E47-null mice, and this population lacks rag1 expression, V(D)J recombinase activity, and D-J~H~ recombination events ([Figs. 5](#fig5){ref-type="fig"} and [7](#fig7){ref-type="fig"}). Similarly, a reduced pre-pro--B subset is detectable in E47-null mice, and this population also has significantly reduced levels of recombinase activity ([Fig. 1](#fig1){ref-type="fig"}).
Mounting evidence suggests that CLPs are dominantly early B lineage progenitors rather than T lineage progenitors ([@bib2], [@bib24]). Not only are CLPs much more efficient at giving rise to the B versus T lineage in vivo ([@bib29]), but our data indicate that V(D)J recombinase activity in CLPs is uniquely sensitive to loss of either E47 ([Fig. 5](#fig5){ref-type="fig"}) or the E*rag* enhancer ([@bib2]). By contrast, ETPs and other T lineage progenitors appear relatively refractory to E47 or E*rag* deficiency ([Fig. 3](#fig3){ref-type="fig"} and not depicted). Within the CLP population, the observation that E47-null mice have a more severe defect in V(D)J recombinase activity than E*rag*-null animals ([@bib2]) suggests that E47 may regulate *rag* transcription through E*rag*-independent targets. E*rag* only is one of several cis-acting elements that regulate *rag* ([@bib11], [@bib30]--[@bib32]). The D3 enhancer located 8.1 kb upstream of *rag2* is of particular interest because D3 controls *rag2* expression in B220^+^ bone marrow cells. D3 contains three potential E-box binding sites, but it remains unknown whether E47 can effectively transactivate this enhancer ([@bib31]).
The lineage-specific activities of E2A might be controlled by at least three distinct mechanisms. First, E2A activity is antagonized by direct interaction with Ids, proteins that lack a DNA binding domain and therefore act as negative regulators ([@bib33], [@bib34]). Although relatively little is known about the patterns of Id expression during the earliest stages of hematopoiesis, Id1 is detectable as early as the LSK subset ([@bib1]), and transgenic mice overexpressing Id1 have significant reductions in B cell development ([@bib34]). Second, E2A has distinct binding partners in the B versus T lineage that may confer lineage-specific activation potential ([@bib35]). Third, recent studies tie Notch activity to degradation of E2A protein ([@bib36]). This observation is interesting because Notch is a key player in the B versus T lineage fate decision, with lower levels of Notch signaling promoting B lymphopoiesis and higher levels of Notch signaling promoting T lymphopoiesis ([@bib37], [@bib38]). Thus, in a simplified model, low signaling through Notch during progression to the B lineage might be associated with up-regulation of E2A-dependent *rag* transcription. A wealth of evidence supports a role for both Notch- and Id-dependent regulatory mechanisms at relatively late stages of hematopoietic development, and it would be useful to know whether E47, which is detectable at roughly comparable mRNA levels in *rag1*-GFP^+^ LSKs versus *rag1*-GFP^−^ LSKs ([@bib1]), has differential functional activity at the protein levels in these subsets.
Our observation that E47 activity is required as early as the CLP stage of development ([Figs. 5](#fig5){ref-type="fig"} and [7](#fig7){ref-type="fig"}) suggests the existence of important, but as yet unidentified, B cell--specific gene targets. The EBF and *pax5* transcription factors are two key regulators of B cell development whose activity depends on E47. However, fetal liver progenitors from EBF-null mice retain normal percentages of IL7R^+^ c-Kit^lo^ hematopoietic progenitors, suggesting that EBF is not essential for the development of this multipotent population ([@bib13]). Likewise, hematopoietic progenitors from *pax5*-deficient mice successfully generate D-J~H~ ^+^ pro--B cells, indicating that the *pax5* gene product BSAP is also dispensable in CLPs ([@bib39]). It is also interesting to note that CLPs from E47-null mice have reduced levels of AA4.1 and decreased forward scatter, consistent with a partial block in CLP development. The precise function of AA4.1, a lectin-like type I transmembrane protein ([@bib40]), remains unknown, and it will be interesting to determine whether up-regulation of AA4.1 expression plays a functional role in lineage progression.
Regulation of IgH chromatin structure by E2A ([@bib28]) could contribute to lack of V(D)J recombination in E47-deficient mice. However, E47 may not be essential for establishing open chromatin at the IgH locus in CLPs as we detected only a twofold reduction in the frequency of CLPs with germline μ0 transcript. Besides E2A, the related basic helix-loop-helix family members HEB and E2-2 may also be important for progression to the B lymphocyte lineage. Mice that are doubly heterozygous for mutations in any two of these three genes have more profound defects in pro--B cell development than any single heterozygous mutation ([@bib41]). HEB and E2-2 are detectable in B lineage progenitors from E47-null mice, and low-level activity from these genes in concert with EBF is sufficient to promote reasonably efficient expression of most B lineage--specific genes ([@bib14]). The different E proteins, including E12, E47, HEB, and E2-2, appear to have different affinity for E-box consensus sites. Relatively little is known about the individual roles that each transcription factor plays during development, although significant redundancies appear to exist. For example, mice expressing a dominant negative allele of HEB that forms nonfunctional heterodimers with E2A show a more pronounced T cell defect than do mice carrying null mutations for either HEB or E2A alone ([@bib35]). Moreover, E2A complexes can be composed of E12 or E47. E2A is detectable as dominant E47--E12 heterodimers in IL-7--expanded pro--B cells, whereas mature splenic B cells contain largely E47 homodimers ([@bib42]). Whether E2A exists functionally as homodimers or heterodimers in LSKs and CLPs, and whether distinct E protein complexes are can be differentially regulated by Notch- or Id-dependent inhibitory mechanisms, remains to be determined.
Here, we have shown that the activity of E47, a master regulator of B lineage development, is required for expression of both *rag1* and V(D)J recombinase activity in multipotent hematopoietic progenitors and B lineage lymphocytes. Distinct factors appear to control recombinase activity in the T lineage. These data provide one molecular mechanism by which E47 promotes B lineage specification in vivo. That additional mechanisms remain to be elucidated is suggested by our finding that E47-deficient mice fail to generate normal numbers of CLPs and pre-pro--B cells.
MATERIALS AND METHODS
=====================
Mice.
-----
H2-SVEX recombination reporter substrate mice were developed in our laboratory. Two independent H2-SVEX founder lines, SB110 and SB88, have been extensively characterized elsewhere ([@bib2]) and are inbred C57BL/6 mice. E*rag*- ([@bib11]) and E47-null mice ([@bib43]) were crossed to the H2-SVEX background. All mice were treated humanely in accordance with federal and state government guidelines, the University of Massachusetts Medical School institutional animal committee, and the Institutional Animal Care and Use Committee of the University of Pittsburgh.
Flow cytometry.
---------------
Freshly isolated bone marrow cells or thymocytes were resuspended to 3 × 10^7^/ml in staining media containing biotin-, flavin-, and phenol red--deficient RPMI 1640 (Irvine Scientific), 10 mM Hepes, pH 7.2, 0.02% sodium azide, 1 mM EDTA, and 3% newborn calf serum, and treated with 2.4G2 Fc block for 10 min on ice. Cells were incubated with primary antibodies for 20 min and then washed three times, incubated with streptavidin reagents for 15 min, and then washed three more times. After the final wash, samples were resuspended in 1 μg/ml propidium iodide to exclude dead cells. VEX was detected using 407 nm excitation ([@bib2]). Primary antibodies included thymus AA4.1 biotin or APC; B220 APC or biotin or Cy5PE or FITC; CD3 biotin or Cy5PE; CD4 Cy5PE or PE; CD8α APC or biotin or Cy5PE; CD11b biotin; CD19 biotin or Cy5PE or FITC; CD24 (clone 30-F1) Alexa 594; Cascade Blue or FITC; CD25 Cy7-APC; CD43 PE; CD122 PE; c-Kit PE; DX5 biotin or FITC; CD44 FITC; γδ-TCR biotin; Gr-1 biotin (clone 8C5); IgM (clone 331) biotin or FITC; IL-7Rα APC (clone A7R34) or PE (clone SB/14); Ly6C biotin or FITC; NK1.1 biotin or FITC; TER-119 biotin; and Sca-1 FITC. Secondary reagents were SA-Cy5PE, SA-Alexa 594, and SA-Cy7PE or SA-APC. Antibodies were purchased from BD Biosciences, eBioscience, Southern Biotechnology Associates, Inc. or CALTAG. Annexin V staining was performed according to the manufacturer\'s instructions (BD Biosciences) using 2.5 μl annexin V FITC and 0.2 μg/ml DAPI per 1.5 × 10^5^ cells. Flow cytometry was performed on a 3 laser, 7 detector DIVA FACSVantage, a 3 laser, 9 detector LSRII, or a 3 laser, 10 detector FACS Aria (Becton Dickinson). Data were analyzed with FlowJo software (Tree Star).
BrdU incorporation and annexin staining.
----------------------------------------
For analysis of proliferation, mice were injected i.p. with 200 μg BrdU in PBS, or PBS alone as a control, at 12-h intervals as described previously ([@bib44]). 24 h after the first injection, bone marrow was isolated and cells were stained for surface markers as described above. BrdU detection was performed with the BrdU flow kit (BD Biosciences) according to the manufacturer\'s instructions. For analysis of apoptosis, bone marrow populations from unmanipulated mice were stained for surface markers and then incubated with annexin V according to the manufacturer\'s instructions, except that DAPI was used instead of propidium iodide (BD Biosciences).
DNA isolation and PCR.
----------------------
Genomic DNA was isolated with the QIAGEN DNeasy kit according to the manufacturer\'s instructions. PCR amplification was performed with 10 μl DNA in 25 μl total volume with 1.6 μM dNTP (dATP, dTTP, dCTP, and dGTP), 2.5 U Taq, 4 mM MgCl~2~, 1X Buffer A (Fisher Scientific), and 4 μM of each primer. Primers 2011 (5′) and 2165 (3′) were used to detect the presence of the H2-SVEX ([@bib2]), whereas E47bas forward (5′) and E47bas reverse (3′) were used to detect E47 ([@bib26]) under the conditions described in each publication. PCR products were visualized with ethidium bromide on a 1.5% agarose gel in TBE buffer.
Quantitative PCR.
-----------------
Total RNA was prepared from sorted cells using the RNEasy mini kit (QIAGEN). The cycle conditions for real-time PCR were 95°C for 12 min followed by 50 cycles at 95°C for 15 s and at 60°C for 1 min. Probes and primer sets for the *rag* and actin genes were purchased from Applied Biosystems. Real-time PCR was performed in duplicate or triplicate on an ABI Prism 7900HT.
PCR detection of IgH rearrangements.
------------------------------------
Equal numbers of CLPs from E47-heterozygous or E47-null mice were sorted directly into Eppendorf 96-well plates containing lysis buffer as described previously ([@bib21]). The PCR protocol involves two rounds of amplification with nested primers. In the first round of PCR, the following three primers were used: GL-5-1, CCCGGACAGAGCAGGCAGGTGG; D~H~-5-1, ACAAGCTTCAAAGCACAATGCCTGGCT; and D~H~3-1, AGGCTCTGAGATCCCTAGACAG. In the second round of PCR, two separate reactions were performed using the following primers: germline detection: GL-5-2, GAGTTGACTGAGAGGACAG and GL-3-2, CGAAGTACCAGTAGCAC; and D-J~H~ rearrangement detection: D~H~5-2, ACGTCGACTTTT(G or C)TCAAGGGATCTACTACTGT and D~H~3-2, GGGTCTAGACTCTCAGCCGGCTCCCTCAGGG. In the first round, PCR amplification was performed in a total volume of 50 μl containing 0.2 mM dNTP, 1 μl CLONTECH Advantage cDNA Polymerase Mix, 1X CLONTECH Advantage PCR Buffer, 0.5 mg/ml BSA, and 0.4 μM of each primer. In the second round, 1 μl of each first-round product was added to a 50-μl reaction volume using the same conditions described above, except that second round primers were used at 2-μM concentrations. The cycling conditions for both rounds were: 95°C for 1 min, 63°C for 1 min, and 72°C for 1.5 min for 30 cycles, with a 10-min end extension at 72°C. PCR productions were visualized on 1.5% agarose gels stained with ethidium bromide. For analysis of single cells, single CLPs were sorted into individual wells and PCR was performed as described above. Only samples producing either a germline product or a specific rearrangement product are included in the analysis.
Statistical analysis.
---------------------
A Wilcoxon rank-sum test was used for statistical comparison of two samples. Multiple comparisons were performed using the Kruskal-Wallis test with Bonferroni correction of p. Differences were regarded as significant at P \< 0.05. Analyses were performed using the JMP version 5.1 statistical software package (SAS Institute).
Online supplemental material.
-----------------------------
Fig. S1 shows that VEX expression in T lineage precursors depends on *rag1* and is identical across multiple independent founders (compare Fig. S1 and [Fig. 3](#fig3){ref-type="fig"}). Fig. S1 is available at <http://www.jem.org/cgi/content/full/jem.20051190/DC1>.
We gratefully acknowledge Dave Allman, Avinash Bhandoola, Michelle Kelliher, and Joe Labrie for thoughtful discussions. We thank Kees Murre for providing E47-null mice and Mark Schlissel for providing E*rag*-null mice. We also thank Randy Hardy and Ben Rowley for generously sharing protocols and Scott Shell for advice. Kristy Pilbeam, Kiley Maguire, and Heather Paquin provided invaluable assistance with experiments. In addition, we thank Dewayne Falkner at the University of Pittsburgh Department of Immunology FACS facility as well as the University of Massachusetts Medical School Flow Cytometry Facility for their excellent help.
This work is supported by the American Heart Association (to L. Borghesi), University of Pittsburgh Competitive Medical Research Funding (to L. Borghesi), and National Institutes of Health grant AI043534 (to R. Gerstein).
The authors have no conflicting financial interests.
[^1]: CORRESPONDENCE Lisa Borghesi: <borghesi@pitt.edu>
| 2024-01-02T01:26:18.401715 | https://example.com/article/8326 |
Q:
How to Return JSON values from an ASP.NET page
i am creating the simple crud system using asp.net ajax JSON, i created the function get all to retrieve the values from the all_data.aspx page as type as JSON. but I couldn't retrieve the data.what i tried so far i added below
Table Design
<table id="tbl-category" class="table table-responsive table-bordered" cellspacing="0" width="100%">
<thead>
<tr>
<th></th>
<th></th>
<th></th>
<th></th>
</tr>
</table>
ajex function
function get_all() {
$('#tbl-category').dataTable().fnDestroy();
$.ajax({
url: 'all_data.aspx',
type: "GET",
dataType: "JSON",
success: function (data) {
$('#tbl-category').dataTable({
"aaData": data,
"scrollX": true,
"aoColumns": [
{ "sTitle": "fname", "mData": "fname" },
{ "sTitle": "age", "mData": "age" },
{
"sTitle": "Edit",
"mData": "id",
"render": function (mData, type, row, meta) {
return '<button class="btn btn-xs btn-success" onclick="get_category_details(' + mData + ')">Edit</button>';
}
},
{
"sTitle": "Delete",
"mData": "id",
"render": function (mData, type, row, meta) {
return '<button class="btn btn-xs btn-primary" onclick="RemoveCategory(' + mData + ')">Delete</button>';
}
}
]
});
},
record table consists of first name, age columns only here how to set this column as JSON type I don't know do it please some help me to do this i attached below what I tired so far
**all_data.aspx*
string sql = "select * from records";
SqlCommand cmd = new SqlCommand(sql, con);
con.Open();
cmd.ExecuteNonQuery();
DataTable dt = new DataTable();
SqlDataAdapter da = new SqlDataAdapter();
da.Fill(dt);
string sql = "{\"fname\":\"fname\",\"age\":\"age\"}";
Response.Clear();
Response.ContentType = "application/json; charset=utf-8";
Response.Write(json);
Response.End();
A:
Install using Newtonsoft.Json;. How to install Newtonsoft.Json
Create one class:
public class Employee
{
public string fname {get; set;}
public int age {get; set;}
}
In method:
public string GetEmployees()
{
string sql = "select * from records";
SqlCommand cmd = new SqlCommand(sql, con);
con.Open();
cmd.ExecuteNonQuery();
DataTable dt = new DataTable();
SqlDataAdapter da = new SqlDataAdapter();
da.Fill(dt);
List<Employee> employees = new List<Employee>();
employees = dt.AsEnumerable()
.Select(x => new Employee()
{
fname = x.Field<string>("fname"),
age = x.Field<int>("age"),
}).ToList();
return JsonConvert.SerializeObject(employees);
}
If you are getting proper data from C# method then append data like:
$.ajax({
type: "GET",
url: "https://jsonplaceholder.typicode.com/todos/1",
success: function(res) {
$.each(res, function(i, data) {
$("table.table").append("<tr><td>" + res.userId + "</td><td>" + res.title + "</td></tr>");
})
},
error: function(xhr, status, errorThrown) {
alert("An error occered, " + errorThrown);
}
});
<script src="https://cdnjs.cloudflare.com/ajax/libs/jquery/3.3.1/jquery.min.js"></script>
<table id="tbl-category" class="table table-responsive table-bordered" cellspacing="0" width="100%">
<thead>
<tr>
<th>Id</th>
<th>Name</th>
</tr>
</table>
| 2024-01-08T01:26:18.401715 | https://example.com/article/8860 |
How to Potty Train a Bullmastiff Puppy
Are you curious to know about How to Potty Train a Bullmastiff puppy? If yes, then congratulations, you are at the right place. Here, we will let to know that How to Potty Train a Bullmastiff puppy easily. We will facilitate you in dealing with your beloved Bullmastiff puppy in an efficient way.
Let’s have a glance at the most common queries about this training. It generally includes What is the easiest way to potty train a puppy, How do you train a bullmastiff puppy to pee and poop outside, and How do you train a bullmastiff puppy to pee and poop on the pad.
What is the easiest way to potty train a puppy?
Training the puppy is quite easy at the earlier stage of life. However, as the age advance, it becomes tough to teach and train the dog. You can potty train your puppy by taking it to the particle spot where it can defecate soon in the morning. Likewise, take it to this spot between the meals. When the Bullmastiff puppy defecates outside the home, then ensure to provide it a good reward. It would encourage the Bullmastiff puppy to do so. You should also take your puppy to the spot when it stings badly.
How do you train a bullmastiff puppy to pee and poop outside?
If you are aware of the signs of dog which depict urgency then you can train the dog well about pee and poop outside. The usual and most common signs are straightening of the tail or sniffing. It can also be circling or squatting. When the Bullmastiff dog urge to defecate or urinate then consider taking it outside the home on an immediate basis in order to train it properly. Doing this for a few times would enable the dog to pee and poop outside of its own.
How do you train a bullmastiff puppy to pee and poop on the pad?
It would be a great ease when your Bullmastiff puppy would defecate on the pad. You can train the dog to do so by taking it to the pad and waiting for it till it defecates. Defecating or peeing on the pad would be encouraged by the reward system. While it the dog does not pee or defecate on the pad, then do not punish the Bullmastiff dog at all. Leave it alone. It is necessary to follow the schedule of urination and peeing. They usually do such stuff at the scheduled time. Hence, take it near to pad during such time.
Are you having a Bullmastiff dog in your home? If yes, then consider training it at an earlier stage of its life. Get to know about How to train a Bullmastiff puppy in order to relish your life with it!
Feature your beloved pet at this platform by contacting us with the details of your pet. Enjoy selling the pet rapidly by meeting the right customer. Happy selling! | 2024-04-19T01:26:18.401715 | https://example.com/article/5833 |
Make Alaska Your Reality...
For those who know Alaska, it is no surprise that nearly every other reality tv show takes place in the state. The natural beauty, authenticity of the people, the adventure and the peaceful life come together to make Alaska a place to realize dreams. The Kenai Peninsula boasts active communities, spectacular views, and a wealth of recreational activities making it the perfect marriage of all the things Alaska has to offer.
There are three types of Alaskans who are shopping for real property: The Year Round Resident, the Recreational Owner and the Retiree. Alaska's Kenai Peninsula real estate offers abound for each of these markets. If you fall into one, or more, of these categories, we look forward to helping make your realty dreams, REALITY!
Our Real Estate Professionals are here to make your Live Alaska dream a reality!
At Coastal Realty we can represent you even if we are not the listing office for a property.
This email address is being protected from spambots. You need JavaScript enabled to view it. and let us find exactly the property you are looking for. | 2023-11-21T01:26:18.401715 | https://example.com/article/5802 |
This subproject is one of many research subprojects utilizing the resources provided by a Center grant funded by NIH/NCRR. The subproject and investigator (PI) may have received primary funding from another NIH source, and thus could be represented in other CRISP entries. The institution listed is for the Center, which is not necessarily the institution for the investigator. Our research program integrates functional studies with extensive structural analysis of pattern recognition receptors (PRRs) in complex with their ligands as well as downstream adapters and effector molecules. Both membrane-bound (such as the Toll-like receptors) and cytoplasmic (such as the CATERPILLAR family members and RIG-I/MDA5 antiviral proteins) PRRs are targeted. A critical feature of these innate immune receptors is that they distinguish among various classes of pathogen-specific molecules while retaining responsiveness to a large number of related molecules within a given biochemical class. Understanding such [unreadable][unreadable]Sbroad[unreadable][unreadable]? reactivity at the atomic level is one of the primary goals of the program. Ligand binding by the PRRs not only initiates intracellular signaling cascades leading to innate immune responses against infections, but also allows the innate immune system to orchestrate and potentiate the activities of the adaptive immune system. Our research aims to decipher this signaling network by studying structures of macromolecular complexes using x-ray crystallography. | 2024-05-26T01:26:18.401715 | https://example.com/article/4306 |
Menu
The world is increasingly becoming 1 large country. Borders are shrinking and commerce is growing. However, despite the increasing trend of cross-border business, a significant factor remains that each country and its economy is unique.
Countries are blessed with certain resources that another country would have in shortage, leading to certain economic advantages or disadvantages. Businesses ideally set up their business in a particular State with the intention of capitalising on their economic, demographic or commercial benefits, to do business. These economic barometers play a crucial role in defining the tax systems and tax rates of a particular State. This is also the reason why tax rates are different from one country to another.
What is Treaty Shopping
“Treaty shopping” generally refers to a situation where a person, who is resident in one country (say the “home” country) and who earns income or capital gains from another country (say the “source” country), is able to benefit from a tax treaty between the source country and yet another country (say the “third” country). Once the third-country resident investor has found such a country, income from the Home State may be channelled through a corporation organized under the laws of that country. The withholding tax rate on passive income under a tax treaty is usually less than the statutory rate applicable to residents of non-treaty countries, in many cases exempting the income from taxation.
The residents who indulge in Treaty Shopping take the benefits of the different tax system in a particular State. This situation often arises often where a person is resident in the home country but the home country does not have a tax treaty with the source country. It also happens when incomes of a specific nature are treated different in different States. Therefore, the roots of the Treaty shopping are in the inconsistencies among international tax regimes. As long as there exist dissimilarities of tax systems, it can lead to distortion of incomes and investments.
The term “treaty shopping” is thought to have originated in the United States. The analogy was drawn with the term “forum shopping”, which described the situation in US civil procedure whereby a litigant tried to “shop” between jurisdictions in which he expected a more favourable decision to be rendered. David Rosenbloom, who served as International Tax Counsel in the US Treasury Department during 1977-198 1, described the phenomenon as “the practice of some investors of ‘borrowing’ a tax treaty by forming an entity (usually a corporation) in a country having a favourable tax treaty with the country of source -that is, the country where the investment is to be made and the income in question is to be earned”. In other words, a person “shops” into an otherwise unavailable treaty through complicated structures; hence the term “treaty shopping”.
The term ‘Treaty Shopping’ has never featured in OECD and UN Model Treaties and their commentaries, but there has been a significant emphasis in eliminating treaty shopping through other measures. For example, references to the “problem commonly referred to as treaty-shopping” are made for the first time in the OECD Commentary on Art. 1, when discussing Limitation-of-Benefits (LOB) provisions and how these provisions are meant “to address the issue in a comprehensive way”. A description of treaty shopping is given indirectly and in very general terms. It is stated that LOB provisions are there to address treaty shopping. Then it is stated that LOB provisions are “aimed at preventing persons who are not residents of either Contracting States from accessing the benefits of a Convention through the use of an entity that would otherwise qualify as a resident of one of these States”.
If one looks at the quasi-definitions of treaty shopping, what one notes is that the term “treaty shopping”, as used, may encompass a broad spectrum of structures, ranging from the purely abusive and artificial ones to others with more substance. However, are all these instances of improper use of tax treaties? The OECD Commentary seems to perpetuate this confusion. The descriptions given in Paras. 9 and 20 of the OECD Commentary to Art. 1 would seem to catch general forms of treaty shopping; i.e. treaty shopping without tax haven or conduit connotations. However, the examples given in Para. 11 of the Commentary would seem to catch treaty shopping of a more specific and abusive nature; i.e. treaty shopping through conduits and/or base companies.
Does Treaty Shopping Begin where Tax Avoidance ends?
Tax avoidance is defined as the arrangement of one’s financial affairs to minimize tax liability within the ambit of law. Tax evasion on the other hand is defined to as the illegal non-payment or under payment of tax. Now the question arises, can tax avoidance be distinguished from tax evasion?
There is no imaginary line that distinguishes one from another. As the difference cannot be codified, these matters are evaluated by a competent authority based on the facts and circumstances of each case. This brings us to a very important question. Is Treaty Shopping tax avoidance or is it tax evasion? And it is when we raise this question that the already undiscernible line becomes even more blurred. What is it about treaty shopping that makes it an instance of the former rather than the latter? Why is it assumed that all forms of treaty shopping, irrespective of their degree of artificiality, constitute tax avoidance?
The term “treaty shopping”, applied generically, may encompass a variety of entities and forms of business. It will encompass legitimate businesses conducted with economic substance in a secondary state, as much as an intermediary company established as a conduit to capitalise on tax haven benefits. However, this is only one end of the spectrum. There is also the other end, where the intermediary company is a company with some substance, conducting its own trading activities, not controlled by the parent company and liable to some tax in the country of residence. It should always be remembered that an arrangement may be imbued with some economic substance that is not immediately apparent to the tax authorities. Therefore, it is clear that not all treaty shopping structures can be classified as one that is artificial or devoid of any economic substance. This is a discussion that is represented in India through the highly publicized Vodafone case. In Vodafone India Services Pvt Ltd. vs Union of India, the Appellant(Vodafone) had decided to enter into the India market to expand its global footprint, by buying Hutchison Essar. The company purchased shares of Hutchison Essar Cayman Island (which is a tax haven), which held Essar India’s shares. Therefore, in effect there was no transfer of Hutch India’s shares. Therefore, the sale of shares did not attract any capital gains tax in India. The Supreme Court ultimately decided that the entire transaction was within the four corners of law and hence not tax evasion.
Therefore, we can draw a conclusion from the recent high profile Vodafone case that the Supreme Court has recognised that this is a case of Treaty Shopping but the same does not amount to tax evasion; it is merely tax planning. The same was upheld in the Andhra Pradesh High Court in the case of Sanofi Pasteur Holdings SA.
Which State Has the Right to Tax?
While States strongly feel that Treaty Shopping is illegal and is a form of tax evasion, treaty shopping is, arguably, an instrument of international tax planning. But, what is it about this kind of tax planning that makes it objectionable? A number of arguments have been advanced in the international tax community. It has been argued that treaty shopping is an instance of tax avoidance and as such improper and contrary to the purposes of tax treaties. Secondly, it has also been argued that treaty shopping breaches the reciprocity of a treaty and alters the balance of concessions attained therein between the two contracting states. When a third-country resident “shops” into a treaty, then the treaty concessions are extended to a resident, whose state has not participated in this arrangement and may not reciprocate with corresponding benefits (e.g. exchange of information). The usual quid pro quo of the treaty is therefore compromised and the process subverted.
The Economic Allegiance Theory was first proposed by Georg Van Schnaz. The Theory is largely considered the bedrock for International Tax Theory and Administration. Van Schnaz argued that the resident (company or individual) owes significant responsibility and allegiance to the geographical State he does business in. The home state of the business provides resources, infrastructure, protection and domicile; due to the above reasons, they Resident ought to compensate the State through his/her allegiance to the State.
Furthermore, it is often claimed that treaty shopping creates a disincentive for countries to negotiate tax treaties. The general life of a tax treaty is a decade or more, due to the significantly long process that it is, from negotiation to finalisation. If third countries can get the benefits of reduced taxation for their residents without conferring reciprocal benefits to non-resident investors, then there is no need to enter into a tax treaty, especially if there are concerns that the tax treaty might be imbalanced. This may put countries which comply with their duties of fiscal co-operation arising through tax treaties (e.g. exchange of information), at a competitive disadvantage internationally. Furthermore, lack of fiscal co-operation enhances opportunities for international tax evasion.
Double Taxation Avoidance:
The bedrock of taxation is the principle of Source and Residence. States normally follow residence taxation or source taxation or a mix of both. Disputes arise when residents of a State deal with one and another. While one State would follow Source Taxation, the other would follow Residence based taxation and this leads to double taxation. Double taxation exists in 2 forms:
Juridical Double Taxation: Where the same income is taxed twice in the hands of the same tax payer in two different States
Economic Double Taxation: The same source of income is taxed twice but in the hands of difference payers. Eg: Profits of the company are taxed and later the dividend income is taxed in the hands of the shareholder
The aim of International Taxation is to mitigate Juridical Double Taxation to the extent possible. However, economic taxation is normally considered to be acceptable.
As detailed above, the most common form of double taxation is juridical double taxation and this happens due to existence of two different tax systems in either State. The dispute in claim over taxation is normally settled through Double Tax Avoidance Treaties that are entered into by the States. The Treaty, usually based on the OECD or UN Models, consists of 32 Articles detailing the treatment of income and taxation of incomes of various types, collection and enforcement of taxes.
The Double Taxation Avoidance Agreements(DTAAs) play a significant role in mitigating double taxation. While this is so, DTAAs are bilateral in nature; which means they are entered into between 2 countries taking cognizance of the economic and tax conditions and systems prevailing in either state and the expectant impact of the same on the treaty. Hence, each Treaty is very specific to either State; but does not consider a 3rd State, unless it is multilateral in nature. The very bilateral nature of DTAAs lends itself in presenting opportunities to derive tax advantages by a resident of a 3rd State operating with another DTAA (with either State) or no DTAA at all.
How to Mitigate Tax Avoidance – Limitation of Benefits:
With the increasing trend of entities using the DTAAs to their benefit, to avoid taxes as detailed above, the nature and scope of DTAAs has been made wider. While originally envisaged for avoid double taxation, one of the critical roles played by DTAAs today is avoidance of double NON-Taxation.
The Limitation of Benefits Article was originally introduced by the US, in the US Model Treaty, and every DTAA negotiated by the US includes this article. The importance of the Limitation of Benefits, or LOB, lies in its expansive nature. The Article is an anti-abuse rule which empowers the Revenue Authorities of the USA to deny the treaty benefits to a resident that is merely a conduit to obtain benefits of the treaty.
This Article is however, not present in the OECD or UN Model Treaty. Hence, countries which adopted these Model Treaties would have to voluntarily include the same, which isn’t done commonly. This lack of LOB clauses presented legal challenges in bringing to tax transactions which are in the nature of avoidance of tax but are still within the 4 corners of the law. This trend has been increasingly over time which has led to BEPS Committee formulating an action plan to address Treaty Abuse.
Action Plan 6 of the BEPS does exactly that. The Action Plan to Prevent Treaty Abuse is targeted at the strategy of establishing companies in States with desirable tax treaties that are often qualified as “letterboxes” “shell companies” or “conduits” because these companies exist on paper but have no or hardly any substance in reality. The Action Plan, though not binding unless adopted, proposes that States should first include in their title and preamble of the DTAA, a clear statement that the States that enter into a tax treaty intend to avoid creating opportunities for non-taxation or reduced taxation through tax evasion or avoidance, including through treaty shopping. Second, countries will implement this common intention by including in their treaties: requires
A combination of a “limitation-on-benefits” rule (LOB, which is a specific anti-abuse rule) and of a “principal purpose test” rule (PPT, a general anti-abuse rule);
The inclusion of the PPT rule, or
The inclusion of the LOB rule supplemented by a mechanism that deals with conduit arrangements, such as a restricted PPT rule applicable to conduit financing arrangements in which an entity otherwise entitled to treaty benefits acts as a conduit for payments to third-country investors
Therefore, the Limitation of Benefits article acts as a tool that enables the revenue authorities to look beyond the façade of an entity and look into the substance and not merely the form of the entity. Much like Corporate Law, Limitation of Benefits provides the law-maker a device to lift the corporate veil of the entity and look into the purpose, objects and history of the entity in question. LOB will be the single most powerful rule that can be used by revenue authorities to reduce treaty abuse through conduits.
Should Treaty Shopping Be Allowed:
Treaty Shopping presumes that there is an overall economic and revenue loss to the affected States. It could be argued that when treaty shopping increases economic activity, the overall economic gain might exceed source-country tax losses. This begs the question. When does treaty shopping increase economic activity and when does it not? Does it depend on whether the source country is a developing country? For example, in Union of India v. Azadi Bachao Andolan, the Supreme Court refused to imply an anti-treaty-shopping clause in the India-Mauritius tax treaty.
In the judgment, the Supreme Court emphasized that in developing countries, treaty shopping was often regarded as a tax incentive to attract scarce foreign capital or technology. “Developing countries need foreign investments, and the treaty shopping opportunities can be an additional factor to attract them”. Countries had to take a holistic view. “The developing countries allow treaty shopping to encourage capital and technology inflows, which developed countries are keen to provide to them. The loss of tax revenues could be insignificant compared to the other non-tax benefits to their economy. Many of them do not appear to be too concerned unless the revenue losses are significant compared to the other tax and non-tax benefits from the treaty, or the treaty shopping leads to other tax abuses.” Treaty shopping may be a necessary evil, tolerated in a developing economy, in the interest of long-term development.
Another important element to consider in the elimination of treaty shopping, is the purpose of DTAAs itself. The ultimate objective of avoiding double taxation or double non-taxation itself is neutralising the differences in global tax rates. The goals of a universal tax rate can be considered a pipe dream. As explained earlier, the tax rates of any country are linked to its economic condition and prevailing market situation. Therefore, as resources of the world are unevenly distributed, it is almost impossible that one can expect the tax rates between 3 countries to be the same, let alone across all countries in the world. Absent a truly neutral tax system, it is difficult to assess any distortions caused by treaty shopping. In fact, it could be argued that the inherent non-neutralities of tax systems create an incentive to treaty shop. In other words, the very existence of treaties itself lends itself to Treaty Shopping. Treaty shopping is perhaps a self-help way of lessening or removing fiscal impediments to international business imposed by the inadequate relief of international double taxation and the incomplete nature of the treaty network.
Therefore, we can establish that inadequate definitions and theoretical objections which are detached from reality.
Conclusion:
The arguments for Treaty Shopping from an objective and legal point of view point to the direction that supports the revenue, that Treaty Shopping is abusive in nature and lends itself to cheating the revenue of its dues. However, as seen above, the rationale that double taxation weakens countries ability to tax income by encouraging shifting income from domestic to cross-border countries maybe right, however it fails to taken into consideration the economic benefits accruing to the Residence State. Therefore, Treaty Shopping while from the perspective of the Source State is abusive in nature, for a Residence State (most likely a developing country) has significant economic benefits.
Further, considering the ultimate goal of tax neutrality is a pipe dream and is impossible to achieve, the existence of globally different tax regimes will stay, as will Bilateral Treaties, Treaty Shopping looks like a phenomenon that is set to stay.
The Supreme Court of India has been the figure head and guardian of the Constitution of our country and history has proven that it has been the last bastion of democracy. However, the very same organ that is established to protect the fundamental rights of the members of the country, has violated them in a shocking judgement. The bench of Justices Dipak Mishra and Amitava Roy, today, mandated that the Indian National Anthem must be compulsorily played at every theatre across the country before a movie begins.
This judgement of the Supreme Court has been delivered at a time when there is a worrying increase in the usage of the word ‘Nationalism’. The word itself is fairly harmless. It denotes pride and patriotism for a citizen of particular country towards his or her country. However, Nationalism today has become the dagger of action and the shield from repercussions. Almost as if an escutcheon, incidents of crowd vigilantism, lynching and communalism has taken shelter in the public eye. The Nationalist agenda runs deeper and thicker than what it actually means and has traditionally manifested in vested interests using it as a tool to further power.
Nationalism and Dictators
History has shown us that the rise of nationalism has been followed with dictatorial reigns with vested interests. The rise of Nazism in Germany, Idi Amin in Uganda, Facism in Italy, Soviet Communism(Stalin) in USSR, Fransico Franco in Spain, Saddam Hussein of Iraq and Gaddafi of Libya. Nationalism is an ideology evokes enthusiasm—elicits an emotional response—to the extent that it articulates a fantasy that is shared by members of a population. And when such an enthusiasm can be captured by a powerful and admired leader of the society, it can elicit passion among the population. Passion is usually associated with an enemy and this can be dangerous as the enemy could be anybody or anything that the leader directs to be.
Something more disconcerting is the rise of nationalism in India, at a time when borders between countries are vanishing and the world is becoming a unified global country. If borders are to be taken into cognizance then one must first delve into the borders that exist in our very own country. With 29 States and even more cultures in a single country, India really is multiple countries within the single country. For instance, a Punjabi Sindhi would find more in common with a Pakistani than a Tamilian or a Keralite. The Tamilian or a Keralite will be more similar to a Sri Lankan than an India from Assam. However, the Punjabi, the Tamil, the Keralite and the Assamese are bound by the agenda of India and nationalism while Sri-Lanka or Pakistan become the neighbour or the enemy. It’s not to say that we must wage war upon our brethren in various parts of country, but a hilarious factual representation of why nationalism is a concept which is fictional and fairy-dust.
“Time has come when people must respect national anthem which is part of constitutional patriotism. People must feel that it is their country. It is because of the country that they are enjoying freedom and liberty” – Justice Dipak Mishra, Hon’ble Judge Supreme Court of India
“Your life is bound up with the life of your whole people(your country). The nation is not merely the root of your strength; it is the root of your very life” – Adolf Hitler, Dictator and murderer of 6 million people
The Solution – Not Nationalism but National Fraternity
There exist too many differences between the very members of our own great country. Unity is mere term and divisiveness exists in spirit and can be seen in day-to-day interactions with people in different states. However, to genuinely overcome this challenge, one must lift the veil of nationalism and look beyond it into jungles of culture and fraternity. While students in school are taught that India is a melting pot of cultures, they’re not taught enough about the ingredients that make up the wonderful stew in the pot. Acceptance to different cultures, religions, languages, food, personal choices and lifestyles is the first step in achieving this object of fraternity.
Tolerance allows free and rational thinking and bring people together. Indians will love India, not because they happened to be born in specific geographical zone in the world, but because they genuinely love the people of the country and hence, love the country as a whole.
The archaic children’s tale, Emperor’s New Clothes is really a story layered with clever subtext. Something widely accepted as true or professed as being praiseworthy due to an unwillingness of the general population to criticize it or be seen as going against popular opinion (due to ignorance or otherwise). Never has this subtext been more relevant than the extremely disconcerting violence in Kashmir, just another chapter in what has been a few year dominant with public unrest in various parts of the country due to polarising reasons.
For almost 2 months now the beautiful state of Jammu & Kashmir has been overwhelmed with violence across multiple districts. The killing of a Kashmiri Militant Youth Burhan Wani in early July has sparked protests across the state, with concerned citizens and youths turning hostile due the increased proliferation of security and the transgression of personal rights of Kashmiris. Things escalated quickly with Pakistan and Indian representatives engaging in a war of words and the most citizens of our country trained their guns on Pakistan for causing this issue. However, if ignorance could be quantified, then the weighing scale would be out of order at this point.
What really plagues Kashmir?
To try to get the proverbial handle on this let’s delve into the quagmire that is Kashmir. The place that is known as Heaven on Earth is no stranger to problems. Dogged by violent clashes and almost always the tipping point of tempers between Pakistan and India, it is considered the most unstable and dangerous places in India. The State borders the only two countries that India has gone to war against and neither China nor Pakistan have eased up on their border incursion stances leading to increased deployment of security personnel, both with the Indian Army and the State Controlled J&K Police.
This rapacious growth of security personnel overtime has created discomfort and displeasure among the Kashmiris, leading to disillusionment with a Government that has been accused of little dialogue with its people and their needs. The increasing national identity of Pro-Hindutva activists, and silence from position of power, across the country has also threatened the secularity of the entire country and has further unsettled the already unstable Kashmiri populace. The communal polarisation was complete with the PDP merging with the BJP after it’s figure head Mufti Mohammed Sayeed passed away.
With requests of independent statehood rebuffed on a constant basis, normalcy has never been restored to the Kashmir Valley. Many of the youth are now taking to arms and are creating Militant outfits to attack security personnel. Burhan Wani was one such youth who was abused by Indian security personnel at the age of 10.
Burhan took up militancy at the young age of 15 and had gone on to become a commander at 21. He released a 6 minute video where he urged Kashmiri’s to report Indian security movements to him and his team so that they could ‘take action’ against the ‘enemies of the state’. Following this video, Burhan was shot and killed by the Kashmir Police, sparking outrage and protests across the state. Over 50,000 Kashmiri’s are said to have attended the funeral of Burhan.
Repeated Human Rights Violations
With an increasing death toll coupled with multiplying injuries and threats, the Kashmir unrest continues the disturbing trend of repeated human right violations in the country. The Rohit Vermula unrest, the JNU unrest, the Patidhar stir, the Jat Stir, constant attacks and murders by ‘Gau Rakshaks’, the Kashmir unrest and the increasing no.of attacks on Dalits in recent months are worrying. There appears to be an undercurrent of malcontentment that is being swept under the rug with no affirmative actions or resolutions taken to address the root of the problems.
Deeply ingrained is the belief that the evil conceal their dangerous predilections for violence, polarization and domination that when they wear them like bangles for all to see, the gullible laugh and call it a pose, or find it strangely charming.
When the United Nations Chief Ban Ki Moon conveyed his concern over the current situation and wished to send a delegation to investigate the Human Rights Violation, the request was rejected by Cabinet stating that it is an internal matter and not an international one.
This is where the pillars of logical argument start crumbling into fine dust. If the matter happened to be as internal as made out, what is the need to constantly engage Pakistan in a war of words through this event. To put things into perspective, the USA, UK, China and EU have all also released statements deploring the acts of the security forces in Kashmir today, but only Pakistan has been targeted. Also, wouldn’t engaging Pakistan automatically indicate it is not merely an internal matter?
Putting all that aside, irrespective of whether it is an international matter or an internal matter, why was the UN HR delegation denied entry to India? It’s not as if they are run by the US or China or Pakistan. The UN happens to be a non-partisan group that report facts and not opinions. A report from the UN would have equipped policy makers with information that could have been used to effectively curb Human Right abuse, however a golden opportunity was missed. One cannot help but hope the motive is not sinister, especially when considering a British team wishing to examine to communal harmony in India was also denied entry earlier this year.
Potential Solution?
Is there a potential solution for the issue raging on in J&K? In my opinion there can. I strongly feel Kashmir is now an integral part of India, granting the state independent statehood would have a debilitating effect on both India and J&K itself, as it is unequipped to handle the rigours of its geographical position.
One of the biggest reasons Kashmir will never be seceded by India is the fact that it happens to be a strategic vantage point. The Kashmir mountains and valleys make it a natural barrier from invasions outside the country. This will also explain why Kargil was a big battle for India as the points seized by Pakistan were critical barrier points.
But in my opinion the entire issue with J&K is it is largely viewed as a military and strategic place of interest for the country. So much so that there has been limited infrastructure development and minimal economic growth in industrial segments of the State. This has not only created a paucity in jobs but also resentment as the rest of India sees significant investment in the above mentioned areas.
Pakistan is a punching bag for a lot of issues in the State. The thought that Pakistan are the enemy is something that is pulverised into minds right from early school. This significantly affects free thinking as a lot of the issues really do not involve Pakistan at all. Schooling of an erudite manner needs to be in place to make Indians feel that Pakistan is not just a country, it’s a congregation of people. There will be good people and there will be bad people, just like how they are in India. The more this thought is approbated, the less virulent will our opinions be about Pakistan.
This more cultured approach to tackling the root of the challenges faced by Kashmiris will yield positive results, and while it may be impossible to remove militancy or cross border incursions, addressing issues by providing Kashmiri’s alternatives and valuing their life will drastically reduce the insurgents and will create a more positive and conducive atmosphere across the State and the country as whole. We have citizens that have incredible potential and hopefully this potential is achieved in the right way, by being empowered with knowledge and information rather than propaganda. This will genuinely help India prosper as a country with both economic growth and valuing Human Rights.
It is an issue which is constantly rumbling in the pits of the stomach of the country. Multiple stirs and suicides, paired with the Ruling Party’s strategic silence on the matter has meant it’s slowly working its way to the forefront of challenges faced by our Overlords. Most recently, the Censor Board banned a movie about the Patidhar Stir in Gujarat stating that it is likely to cause unrest and it will be a threat to the sovereignty and security of the country. I’m inclined to agree with this move and personally feel that the country is not educated or aware enough to handle a subject of that level of seriousness. The likelihood of the populous being swayed by simple yet emotional or violent portrayals of reservations might evoke passion and cause unrest in certain parts the country. Unfortunately, none of these acts nor movies will delve deep enough into the Jungle, that is reservation, to find the solution and solace that the country really needs.
Reservation is not Unique to India, its prevalent across the world
Before, we journey into the treacherous issued posed by Reservation, I felt it appropriate to brief the uniqueness of this problem in India. While reservations is a concept that is fairly common across the world, to uplift certain parts of the society that require facilitation, caste is a concept that entirely unique to India and does not exist anywhere else in the world. ‘Casteism’ was reasonably prevalent in the 1700s and 1800s in India. It was something that originated from centuries old customs and writings that nobody questioned. If someone broke the designated duty of the caste, they were either shunned or moved away from that society of people. It was a problem but not one which was out of hand, not until the British realised it could be.
Divide and rule was a strategy used by the British to devastating effect and the trappings of which are still felt to this day. Caste was one of the victims of this Divide & Rule policy where the Monarchy constantly gave benefits to a particular part of the society and quite vocally neglected another. This exercise was done in frequent intervals, ignoring one community while favouring another community/caste, driving a wedge between the different castes and societies in India. This vitriol channelled itself into various outlets including theatre, music, news and, the most damning of them all, story-tales to children. Is there any surprise this dislike has continued not only shortly after 1947 but even till 2017, almost 70 years after the British Oligarchs left the promise-land?
“History shows that where ethics and economics come in conflict, victory is always with economics. Vested interests have never been known to have willingly divested themselves unless there was sufficient force to compel them. “
Reservations were meant to be for 15 years only. The Constituent Assembly was short-sighted
The most eminent, Nationalist, far-sighted group of individuals were tasked with the responsibility of developing the Constitution for the largest democracy in the world. They set-out to tackle some of the greatest challenges faced by the country at the time and set precedents for the future of India. As Casteism and offshoots of the same, such as untouchability, was rampant at the time of Independence, the Assembly felt it appropriate to genuinely adhere to equality guaranteed by the Fundamental Rights and give every person in the country an equal opportunity to lead a dignified life.
‘What are we having this liberty for? We are having this liberty in order to reform our social system, which is full of inequality, discrimination and other things, which conflict with our fundamental rights. ‘
They felt not providing reservation for the oppressed sections of the society would only perpetuate inequality and would therefore not be true to the Constitution of India. They introduced Reservation but stated it would exist for 15 years for the specified classes of people. This move, in my opinion, is 2 of the most short-sighted decisions taken by the assembly. While I am in total agreement with the concept of reservation and the idea behind it, the fact that it was meant to be only for a period of 15 years automatically invalidates the ideology of equality. Humans by nature discriminate and it would only be a matter of time before another society becomes oppressed while one becomes the oppressor. Further, the Assembly introduced rigid ‘classes’ that would be eligible for the benefits of reservation. Another shockingly short-sighted view as, yet again, it invalidates the point of reservation itself as it guarantees reservations for a certain set of people constantly, which means they are never really empowered.
Needless to say, 70 years on, we have seen this part of the Constitution to be the most contentious. Repeatedly Politicians have used it as a weapon for political vote-banks and have kept these sections of the society oppressed and uneducated to benefit their political ambitions. These ambitions saw the 15 year reservation period extended indefinitely and classes of people eligible for reservation, constantly increased with the % of reservation also constantly being pushed. Despite, Supreme Court directing a cap on the % of reservation, some State Governments have still found ways to increase the reservations to 60%.
Why is it always Reservation or No Reservation? There Exists a Middle Ground – My Solution
Reservation is essential to enable equality and growth to specific people. But Reservation as it stands is a failure and the very fact that it has existed for 70 years and continues to remain static goes to show that it has done nothing to fuel the growth of the people whom reservations has been made for. It has merely been a powerful tool for the Politicians to wield and use effectively for their vested interests.
Reservation needs to be dynamic. It needs to be something that can be reviewed on a regular basis and check the effectiveness. A system should be in place which ensures the right level of reservation and resources need to be directed to the identified groups of people. It needs to be measurable. But considering the diverse nature and amount of people that exist in India, is it practically possible? How are you going to identify these people?
I believe it’s easily possible. We have an existing very powerful and expensive exercise that is carried out by all governments, irrespective of who is in power. The Census! Every person in India is visited and demographic details are obtained from the people of India. All the Government will need to do is expand the scope of the census, add more questions understanding the income status, wealth status and education status of everyone in the household. Get a trained representative to ask more questions about the social challenges and difficulties faced and the impacts of the same. The Census process will probably take a year longer to complete, but it’ll be a process that will be entirely worth it. The Government will have quantifiable and quantitative information regarding every citizen in India. The information will enable the Govt. to take decisions which are directly at addressing any inequalities which have been measured by this census data. All resources and reservation can be directed effectively in addressing these issues. A firmer stand can be taken where qualitative issues have plagued the growth of a certain class of people. Further, the Govt every 10 years can evaluate the impact of the decisions and resources to the specific class of people. The Govt. will be dynamic and will evolve and ration the right amount of resources to be administered to oppressed groups of people, the ones that are improving and new groups of people that might feature in the census.
I believe, this approach will ensure that there is genuine eradication of inequality and it will uphold the soul of the Constitution to enable Right to Equality. It will make reservation more effective and transparent and it will transform the Country.
‘People are pretty much alike. It’s only that our differences are more susceptible to definition than our similarities‘ – Linda Ellerbee
The tirade of Tanmy Bhatt, of AIB fame, about the beloved public figures Sachin Tendulkar and Lata Mangeshkar has evoked some very strong reactions on twitter and in the upper echelons of the Government. Needless to say, this has brought to forefront the ever raging tempest, the Free Speech debate.
India has the longest constitution in the world and this is not without reason. A fairly young constitution, less than 70 years old, the Constitution has already seen 100 amendments made compared to just 27 made to the 228 year old Constitution of the United States of America. In an almost comical and ironic, but relevant comparison, the first amendment to the Indian Constitution put into place ‘reasonable restrictions’ on Freedom of Speech, while the first amendment of the US Constitution prohibited any sort of abridgement of free speech.
So what happened in the 1 year of Absolute Free Speech in India?
Earlier, in March 1950, in Delhi, the government’s attempts at pre-censoring the Rashtriya Swayamsevak Sangh’s mouthpiece, the Organiser, had been over-ruled. The East Punjab Public Safety Act, 1949, under which the curbs were being applied, was held to be unconstitutional by the Supreme Court. In another case in May 1950, involving a left-leaning journal called Crossroads, published by Romesh Thapar from Mumbai, met with the same fate. At the time, Madras state had banned the Communist Party and, as part of that policy, prohibited the entry and circulation of Crossroads in the state. Thapar contested this ban legally and won, with the Supreme Court declaring the Madras Maintenance of Public Safety Act, 1949 unconstitutional.
Within a week of the decision, Home Minister Vallabhbhai Patel wrote to Prime Minister Jawaharlal Nehru, complaining that this ruling weakened the power of the Center in regulation of Press and the Public. Patel feared not being empowered to gag a Leader who was campaigning to annul Bengal’s partition (at the time). Despite their dissensions on most matters, both Nehru and the Iron Man of India believed in a powerful centralised state and decided to put into place certain controls which they could use as a device to restrict free speech in specific places. It is believed that the Father of the Constitution, BR Ambedkar, did not agree with these views but was a minority. However, he still managed to place the caveat of ‘reasonable’ restrictions that would be decided by the Judiciary, opposed to the Patel camp which insisted on total restriction which was in power of the executive.
Ridiculous Reasonable Restrictions Restore Ringleader Rule
We’re today saddled with vaguely defined hate speech, sedition and blasphemy laws that are repeatedly used on a regular basis for political ends. When people found solace in the internet, the Government sought to control the same and passed the Information Technology Act, 2000 which even went so far as to penalise “offensive” electronic messages. While one might argue that curbs on free speech are required in a country as wide and culturally different as India is, one fails to appreciate the ground reality of the situation. As we have seen in Mumbai in 1993 or in Gujarat in 2002, the state does not really seek to clamp down on free speech for such altruistic purposes. Instead, free speech curbs are used for petty political ends, banning books, movies, paintings, college gatherings and even Facebook status updates.
Even the last bastion of happiness has not been left alone in India. Comedy has always been an art that is liberal-minded. Almost all comedians will fight against censorship and have a way of interspersing comedy with public messages on freedom which has for several decades been a medium to reflect the mood of the public to changing jurisprudence. Ofcourse, this is something which is pure evil and shouldn’t be allowed.
Hence, in India, we’ve seen crackdown on a comedy roast hosted by All India Bakchod which poked fun at actors, directors and producers with their consent. We’ve further seen crackdown on poetry or music which capture the mood of the nation or take jibes at the ruling party; and now we’re witnessing the ruthless onslaught of an entertainer who ridiculed, on a lighter note, two famous Indian people on his personal snapchat account. This has been blown out of proportion and now the incumbent government and many political parties are urging the police to arrest the comedian and put him behind bars.
I personally don’t find All India Bakchod or Tanmay Bhatt too funny. In fact, a lot of their humour borders on being obnoxious and heavy handed, however, this remains their fundamental right and their freedom of speech. Tanmay Bhatt has not incited violence, nor has he indulged in hate speech. Neither the roast, nor his snapchat tirade been an attack on the democracy or freedom of the people of India. It might have been idiotic, sure, but it’s definitely not a crime. If anything, instead of putting restrictions on freedom of speech, the government could make idiocy a crime. Then again, if that is done, most of our Parliament would be behind bars.
Freedom of speech needs to be appreciated and put on the pedestal it deserves. Even if absolute freedom is not given in India, the reasonable restriction should genuinely be reasonable and the archaic sedition and hate speech laws should be vanquished in place of genuine laws to protect the sovereignty and integrity of India.
‘The Framers of the Constitution knew that free speech is the friend of change and revolution. But they also knew that it is always the deadliest enemy of tyranny’ – Hugo Black
The Opposition Leader MK Stalin is seated with the general public at the CM Swearing in Ceremony
The move by MK Stalin to attend the swearing-in ceremony of Hon’ble Chief Minister Jayalalitha a few days earlier is not really a political move; atleast not in any sense understood by traditional Tamil Nadu politics. That’s not to say it isn’t political at all. It strikes one as a move that is scathingly political but it’s disruptive, different and ruthlessly transparent. It’s a spit in the face of the modern politician, the culture of the soulless ghouls who inhabit that world, and the vacuous public multitude that seeks to worship and emulate them.
The State of Madras (as Tamil Nadu used to be called) was dominated by Congress till the DMK ousted the grand old party from its comfortable seat. Led by the charismatic Anna and assisted by his trusted Lieutenant, the fiery and dynamic, MK Karunanidhi and the razzle-dazzle of the party mascot, MG Ramachandran. After Anna’s passing, Karunanidhi ascended to the throne of Chief Minister, still with the help of his good friend MG Ramachandran.
Things soon turned sour as both the film-star and the Kalaignar looked to eclipse each other on the stage, vying for the love of the general public. The Film-Star won the battle and went to become the Chief Minister of the State and continued to be the Chief Minister till his death, a feat never repeated till Jayalalitha won the Legislative Assembly this month. However, the politicians continued to remain friends despite their differences and allegiances to their parties.
“Both MGR and I attacked each other in debates. But I can never forget my 40 year friendship with MGR. When I came to know of MGR’s death I rushed back from the railway station to pay my last respects. Rationalist leader Periyar E V Ramasamy had serious differences with Rajaji, but when the latter passed away, Periyar cried inconsolably”, Karunanidhi recalled. ”These great leaders had set examples of the great political culture in the state. Now, we have the responsibility of preserving it”, he added.
Well, that’s rather touching from Kalaignar, but neither him or nor the current ruling Supremo, Hon’ble CM Jayalalitha took efforts to mend their fences, instead focussed on undoing what the previous leader had done. This has been the legacy of Tamil Nadu politics, the state is littered with examples of discontinued work of the previous government, as if it was a haunted relic stayed fearing completion will unleash an unspeakable torment on the people, yet dominant enough to not be destroyed.
However, there now appears to be a new leaf in the primordial book of Tamil Nadu politics from left field. The source is none other than the 63 year old MK Stalin, son of the former Chief Minister MK Karunanidhi. Though, the ‘Thalapathi’ was not projected as the CM candidate of the DMK, he has led the party from the front and despite defeat has said all the right things (or the things the public want to hear but have never heard in the past).
On defeat, Stalin tweeted “We respect the people’s verdict & will work as a responsible opposition party. I take this opportunity to congratulate Selvi J Jayalalithaa”. He also stated that he would attend the swearing in ceremony of the AIADMK Supremo. While this could all be done by his Public Relations team, one may be allowed to dream that positive thoughts have been communicated, even if it’s sham. To the credit of the DMK leader, he went on to attend the swearing in ceremony and despite being seated in the 16th row(considered by his father as an insult), went on to wish the Chief Minister, the best for her term.
The move from Stalin is simple but unprecedented, atleast in recent times, and has evoked many a positive sentiment from the general public and his political competition. Infact, the Hon’ble CM later went on to apologise for his seating debacle and said “I convey my good wishes to him and look forward to working with his party for the betterment of the state”.
While one could call these leaders charlatans and their actions simply those where they pull wool over our eyes, we must have faith in our democratic system and trust that change will happen and I’d like to think that the change is happening right now. Sometimes, a little change is a good thing.
In a new featurette of the blog, we look at the worst dictators in history of the world and their lasting impacts.
‘The Last King of Scotland’ Idi Amin is among the worst tyrants of all time
The Homogeneity of India and Africa is sometimes striking. Like two peas in a pod, both the Sub-Continent and the Continent of sweeping savannahs have been rapaciously plundered by various European powers, but while India was able to consolidate and integrate itself into one collective democratic unit, numerous countries in Africa fell into the hands of power-hungry, barbaric and greedy tyrants – effects of which still prevail several decades later. Perhaps the most infamous of the barbaric Tyrants to torment the continent in recent decades was Idi Amin, the former pawn of Imperial Britain who rose through the ranks to become military dictator of Uganda. Amin, who was initially paraded as a charming and witty man, later was noticed for what he really was. He became the killer clown of Africa, butchering hundreds of thousands of his people while proclaiming himself the “Conqueror of the British Empire” and sending notes to Queen Elizabeth II, inviting her to come to Uganda to experience “a real man”.
Idi Amin first rose to prominence in the ranks of the King’s African Rifles, a regiment of the British Empire’s Colonial Army, derived from various native African tribes. Back in the waning days of the British Empire – when the British nobility could still just about get away with the rape and plunder of the tropics while pretending to bring civilisation to the “savages” – there was plenty of opportunity for an ambitious black man, so long as he was sufficiently subservient and willing to do the Empire’s dirty work when told to.
In 1962, the Brits handed Amin the job of suppressing a cattle rustling operation, being carried out in northern Uganda by the neighbouring Turkana tribe of Kenya. Amin had succeeded in doing the same however it later came to knowledge that Amin had been waging a campaign of sustained terror against the Turkanan tribesmen. His men carried out gruesome torture, cut off the testicles of their victims, bludgeoned some of them to death with clubs and buried others alive. Well, they did say that they wanted the Turkanans to stop stealing cattle. By this time, the British Empire was rapidly fading and since they weren’t used to the swamps and mosquitoes of Uganda, they decided to get the hell out of there. While any soldier would have been court martialed for his actions, Amin got away because the British didn’t want a prolonged legal battle at a country that was no longer their colony.
The Rise To Power
Uganda was officially granted independence on 9 October, 1962. Sir Edward Mutesa, King of the Baganda tribe, became the nation’s new President. Milton Obote, a good buddy of Amin, became the Prime Minister. Obote liked Amin even better than his previous British bosses had, and awarded him with rapid promotion. Amin became the deputy commander of Uganda’s armed forces. Obote had rapidly begun smuggling operations where he had made a lot money at the cost of Ugandan economy. When King Mutesa objected to the same, Obote suspended the constitution and made himself the overall leader of Uganda. King Mutesa was deported out of the country and Obote ruled with his trusted side-kick Amin.
However, as it turned out Amin wasn’t really a trust worthy side-kick. Amin waited until Obote went on holiday to Singapore, and then ordered the army to take over the country. Israel sent their General Chief of Staff, Colonel Bar-Lev, to Uganda to assist Amin with his coup. Amin declared himself the new President of Uganda. But Amin assured the people that he was only the temporary President, and that elections would take place very soon. However, Amin was forgetful and the elections never came. Probably because Amin was busy killing off anyone who he didn’t like.
Consolidation of Power
Amin went on to execute two thirds of the Ugandan army (6,000 out of about 9,000 troops) and replaced them with his own loyalists. Then Amin decided that Uganda would be a country for black people only, and set about expelling the 80,000 odd Indians and Pakistanis who were living there at the time, claiming that they were sabotaging the economy. He stole all of their property and gave it to the most loyal officers in his army and ofcourse, took some for himself – thank you very much. But, the only problem was, the Indians and Pakistanis constituted the majority of the professional and business class in Uganda, and without them, the economy collapsed.
Members of rival tribes, diplomats, businessmen, academics, members of the clergy, journalists, bothersome foreigners and plain old ordinary Ugandan citizens all got the chop. Anywhere between 100,000 and 500,000 people (depending on who you ask) were murdered. Entire villages were wiped out, and the Nile became so clogged with dead bodies that they began blocking up the dam intake pipes.
Amin goes Bat-Shit Crazy
By 1975, Amin had consolidated his grip on impoverished Uganda by ruthlessly eliminating anybody who was in his way. Most of the nation’s scarce resources were diverted into the ever expanding military. Not much was spared for civilian development. The military chiefs loyal to Amin became Uganda’s new elite. In a demonstration of his authority, Amin decided to stage a publicity stunt for the benefit of the world media. In an elaborate ceremony, he forced a group of Kampala’s white residents to carry him around on a throne, then kneel before him and pledge loyalty.
In 1976, Amin caused an international outrage by allowing a hijacked Air France passenger aircraft, carrying 105 Israeli hostages, to land in Uganda. Amin tried to put up the pretence of “assisting” with the hostage negotiations, while in fact he was collaborating with the Palestinian hijackers all along. Israel had no patience with the charade and promptly dispatched a unit of commandoes to Entebbe to take care of business. During the 58 minute operation, two of the hostages were killed and one left behind. The remaining 102 hostages were rescued, while the 8 hijackers were liquidated, along with 45 Ugandan soldiers who happened to get in the way.
The whole affair was considered a major embarrassment for Amin, and he reacted with insane fury. He ordered a fresh purge to be carried out, involving the murder of anybody suspected of “opposing” him, on whatever pretext. He pretty much just got totally pissed off and wanted to see some heads roll for it. Amin also expelled all remaining foreigners from the country.
The Beginning of the End
Post the Air France event, global ties with Uganda began to weaken. The UK and US decided that they didn’t want to be associated with terrorism (genocide is perfectly okay. But terrorism, oh no that awful). All economic and diplomatic ties were severed. Amin’s grip on the country was beginning to weaken. He could no longer count on much in the way of international support, and Uganda’s already battered economy suffered. Civil unrest became a constant threat. Amin attempted to distract the public’s attention from internal strife by acting on long standing plans to invade neighbouring Tanzania.
However, during the invasion, the Tanzanian forces showed they were no pushovers and decimated the Ugandan army. They went on to stage a counter-invasion and took the Ugandan capital of Kampala, forcing Amin to flee to safety. His reign of terror was finally over. Idi Amin left a legacy of chronic national debt, an annual inflation rate of over 200%, crime rate through the roof, catastrophic divide between the rich and the poor, and hundreds of thousands of its citizens left dead.
In 1989, Amin attempted to return to Uganda in order to stage a coup, but he was intercepted by authorities in Zaire and sent back to Saudi Arabia. There he remained until 2003, when he died from massive internal organ failure. In an interview that Amin gave, shortly before his death, he stated that he had no regrets about his actions in Uganda and claimed he was happier at Saudi Arabia than he had ever been in Uganda.
My Experience of Uganda
‘Everything you read and heard about Idi Amin, in papers and movies regarding how bad it was when he was in power. Well, how it really was, was much much worse’ – Abdullah – a Ugandan rebel at the time of Idi Amin – now a driver for my client.
As much as I’d like to make it seem that I travelled to Uganda to write up this blog post, its completely not the case. I had gone to Uganda with very limited knowledge about Idi Amin but during my 3 week stay there, learnt a lot about him and his impact on Uganda. His legacy and reign of terror is still very strongly felt in Kampala. There exists an almost tangible feeling in the air that signifies the divide between Foreigners and the Locals. The way they treat each other and how conversations happen. There still exists a fear that whoever is in power can at any time just assume charge over the entire country (and seemingly the current President is trying to do the same).
I only felt glad that despite all the similarities between India and Uganda (and many other African countries), we were lucky enough not to have a dictator at the helm of affairs, and a constitution that is strong enough to protect our people and the country. | 2024-05-22T01:26:18.401715 | https://example.com/article/5048 |
The results of recent clinical trials revealed that the immune system can eradicate cancer. Despite unprecedented cures in multiple types of cancer, the efficacy of immunotherapy in patients with epithelial ovarian cancer turned out to be rather limited.^[1](#CIT0001)^ Many mechanisms seem to be responsible for this inefficiency. Some are based on the local production of immunosuppressive mediators or recruitment of regulatory cells that impair the activity of lymphocytes. Other, include increased production of molecular brakes, known as checkpoints, that interfere with the immune response. A recently emerging and one of the most prominent features of tumor microenvironment (TME) that impacts local immune response is amino-acid metabolism, especially that of ʟ-tryptophan and ʟ-arginine. ʟ-arginine is a substrate for four enzymes including arginases (ARG1 and 2), that convert it to ʟ-ornithine and urea. T-cell proliferation is impaired at low ʟ-arginine concentrations, thereby depletion of this amino-acid impairs the development of immune response to tumor-associated neoantigens. In the TME and in secondary lymphoid organs ARG production is mainly attributed to myeloid-derived suppressor cells (MDSCs) and immunosuppressive M2-type tumor-associated macrophages (TAMs), which is linked to inflammatory processes driving tumorigenesis.^[2](#CIT0002)^ High ARG expression has been documented in blood of patients with hematologic malignancies such as acute myeloid leukemia and in the microenvironment of solid tumors like neuroblastoma, squamous cell carcinoma, lung, and colorectal cancer.^[3](#CIT0003),[4](#CIT0004)^ Recently, it has been shown that, similar to MDSCs and TAMs, some tumor cells themselves harness ʟ-arginine depletion to mitigate immunosurveillance.^[5](#CIT0005)^ Upregulated ARG has been linked to poor patients' survival; therefore, modulation of TME properties by inhibiting ARG appears to be a promising immunotherapeutic approach that might improve antitumor immune response.^[4](#CIT0004),[5](#CIT0005)^
Extracellular vesicles (EVs) are spherical-shaped, nanoscale particles carrying specific set of lipids, proteins or nucleic acids and are involved in intercellular communication. Secreted EVs might directly interact with various immune cells including B, T or NK cells, MDSCs and dendritic cells (DCs), exerting activating or inhibitory effects.^[6](#CIT0006)^ EVs derived from the malignant lesions possess the molecular signature of the parental cells and are investigated as potential diagnostic biomarkers for early cancer detection.^[7](#CIT0007)^ Exosomes, which are a well-characterized subpopulation of EVs, have been linked to tumor progression and metastasis.^[8](#CIT0008)^ Ovarian carcinoma (OvCa) is an asymptomatic at early stages, deadly cancer characterized by ascites accumulation in the abdomen and is known to secrete a substantial amount of EVs loaded with immunomodulatory cargo.^[9](#CIT0009)^
We have recently shown that ARG1 in EVs participates in the formation of the local immunosuppressive microenvironment in OvCa and alters systemic immune response.^[10](#CIT0010)^ We have detected ARG1 expression in both established OvCa cell lines as well as in tumor cells isolated from the ascites from OvCa patients. Immunohistochemistry of tissue sections of primary ovarian tumors revealed cytoplasmic staining for ARG1 with moderate to high intensity in 66.7% cases of a 84 patients cohort. Transcriptomic data analysis indicated worse survival in a cohort of patients displaying high ARG1 expression pattern in OvCa primary tumor in comparison with those with low ARG1 expression. ARG activity in serum samples of untreated OvCa patients with stage II and III tumors were significantly higher than in healthy controls correlating with poor prognosis. Increased ARG1 levels and activities were measured in the plasma of OvCa patients correlating with impaired proliferation ability of peripheral T-cells and downregulation of CD3ζ (CD247). CD3ζ belongs to the CD3 complex that associates with the T-cell receptor to generate and transmit activation signals in T-cells. These findings raised further questions on the potential mechanisms of immunomodulatory effects of ARG1, especially that T-cells mostly proliferate in local lymphoid organs rather than in the TME. A series of experiments demonstrated that OvCa cells release EVs that contain enzymatically active ARG1. Also, EVs isolated from the ascites of OvCa patients contained enzymatically active ARG1. EVs isolated from the ascites of over 40% of OvCa patients very strongly inhibited the proliferation and decreased CD3ζ levels in both CD4^+^ and CD8^+^ T-cell subsets. In many cases, the specific inhibition of ARG1 with ARG inhibitor or addition of excess ʟ-arginine to the culture medium partially reversed the effects of patients'-derived EVs. Likewise, inoculation of ARG1-containing EVs isolated from tumor cells strongly inhibited antigen-specific OT-I T-cells proliferation in mice. Further experiments revealed that ARG1-containing EVs are internalized by DCs in the local lymph nodes, where they abrogate the development of effective immune response. In contrast, a tagged recombinant ARG1 inoculated into mice was rapidly degraded and failed to reach DCs in the lymph nodes. Overexpression of ARG1 in murine ID8 OvCa cells led to accelerated tumor progression that was inhibited by treatment with ARG inhibitor.
Altogether, our studies reveal a novel mechanism of tumor-induced systemic T-cell dysfunction based on the activity of tumor-derived EVs containing ARG1 ([Figure 1](#F0001)). These vesicles transfer functionally active ARG1 as metabolic checkpoint molecules over a long distance to antigen-presenting cells and mitigate antitumor immune response, leading to an enhanced tumor growth in vivo. These results may also apply to other ARG-expressing tumor types and may have significant clinical implications for T-cell immunotherapy of cancer.10.1080/2162402X.2019.1655370-F0001Figure 1.Suppression of T-cell mediated antitumor immune response by extracellular vesicles (EVs) containing arginase-1 (ARG1). Ovarian carcinoma (OvCa) cells produce ARG1 and release this enzyme in secreted EVs to the local tumor microenvironment (TME). EVs are being transported by lymphatic vessels to local lymph nodes. Tumor-derived ARG1-containing EVs are internalized by dendritic cells (DCs) that acquire inhibitory properties and suppress T-cell proliferation. Blocking of ARG activity restores the proliferative potential of T-cells. Activated T-cells can differentiate into effector cells exerting antitumor activity. Figure was created with images adapted from Servier Medical Art licensed under a Creative Commons Attribution 3.0 Unported License.
Disclosure of potential conflicts of interest {#S0002}
=============================================
J.G. is a shareholder and Scientific Advisory Board member in OncoArendi Therapeutics.
The remaining authors declare no potential conflicts of interests.
Abbreviations {#S0003}
=============
ARGarginaseDCsdendritic cellsEVsextracellular vesiclesMDSCsmyeloid-derived suppressor cellsOvCaovarian carcinomaTAMstumor-associated macrophagesTMEtumor microenvironment
| 2023-12-10T01:26:18.401715 | https://example.com/article/4607 |
I do. I know Bella is supposed to kind of be plain, but Kristin is ridiculously mediocre. And I hate her voice and how she talks. I think she would be better/more suited for modeling if she weren't so awkward with the way she moves...
I flipped past "panic room" the other day (old movie with Jodie Foster) and I was reminded of how when I watched it, me and the rest of my family couldn't figure out if Kristin was a boy or a girl. It took forever. Sorry for that anecdotal interruption.
So, to answer your question, No. If I think something will ruin this movie, surely it would be her. | 2024-03-30T01:26:18.401715 | https://example.com/article/3341 |
357 So.2d 561 (1978)
Frank VUCI and the Manchac Villa, Inc.
v.
Mrs. George NATHANS.
No. 11911.
Court of Appeal of Louisiana, First Circuit.
February 21, 1978.
David L. Dawson, Jr., Baton Rouge, for plaintiffs and appellees.
Victor L. Marcello, Donaldsonville, for defendant and appellant.
Before LOTTINGER, EDWARDS and PONDER, JJ.
EDWARDS, Judge.
This is a suspensive appeal by the defendant, Mrs. George Nathans, from a judgment ordering her to vacate property owned by plaintiffs, Frank Vuci and the Manchac Villa, Inc.[1] Defendant contends that she is occupying the property under an unexpired written lease.
On October 15, 1968, plaintiff, Manchac Villa, Inc., leased a building and property *562 known as the "Italian Villa" located on Airline Highway in Prairieville, Louisiana to defendant's husband George Nathans. The lease was for a primary term of one year, from October 1, 1968 until September 30, 1969 at $300 per month. The lease also provided two options to renew, as follows:
4.
"Lessor further agrees to grant unto Lessee a four year option at the expiration of this lease on September 30, 1969 provided that lessee give lessor at least sixty (60) days written notice before the expiration of this lease of his intention regarding the exercise of this option. Lessor and Lessee further agree that in the event lessee exercise this option that a new agreement will be entered into regarding the monthly rental during this said four (4) year option, that the rental during this (4) year period is to be $500.00 per month.
5.
"Lessor further agrees to grant unto Lessee at the end of the abovementioned (4) year option, an additional option to lease said property for (5) additional years, at the rental of $500.00 per month."
Although the first option to renew was never exercised, Mr. Nathans continued in possession of the property. Mr. Nathans did not pay rent from June, 1969, through January, 1970. Thereafter, he resumed rent payments, but at the rate of $300 per month. He continued to pay $300 per month as rent through August, 1971, and thereafter paid monthly rent of $400.
Mr. Nathans died on November 30, 1972; Mrs. Nathans continued to occupy the premises. She paid $400 per month rent for the remainder of 1972, and $500 per month thereafter to the time of the hearing in 1977. Defendant never notified plaintiffs that she wished to exercise the options to renew the lease.
On August 30, 1977, defendant was notified to vacate the premises by September 30, 1977. Defendant refused to vacate, contending that she was protected by the written lease and that the plaintiffs were estopped from evicting her.
The trial court found: the lease had not been renewed in accordance with its terms and had expired; the defendant was occupying the property on a month-to-month basis; and there had been no conduct on plaintiffs' part which would estop them from evicting the defendant.
Defendant contends that the trial court's findings are manifestly erroneous.
ON MOTION TO DISMISS APPEAL
Plaintiffs filed a motion to dismiss the suspensive appeal alleging that defendant did not comply with LSA-C.C.P. art. 4735, which provides in pertinent part:
"An appeal does not suspend execution of a judgment of eviction unless the defendant has answered the rule under oath, pleading an affirmative defense entitling him to retain possession of the premises. . ."
The record discloses that defendant filed an original answer pleading a general denial. Subsequently during the summary hearing, defendant filed an amended answer, verified by her under oath, which asserted the affirmative defenses of estoppel and accord and satisfaction.
There is ordinarily no requirement for an answer to a rule. LSA-C.C.P. art. 2593. In eviction proceedings, however, LSA-C. C.P. art. 4735 mandates a sworn answer asserting an affirmative defense as a prerequisite to a suspensive appeal. Article 4735 contains no provision concerning the time for filing the answer. Therefore, the rules applicable to ordinary proceedings govern. LSA-C.C.P. art. 2596. Under LSA-C.C.P. arts. 1151 and 1154, the filing of an amended answer is within the discretion of the trial court.
Accordingly, the amended answer filed with leave of court during trial and before judgment was timely and satisfied the requirement of LSA-C.C.P. 4735. See Stoltz v. McConnell, 202 So.2d 451 (La.App. 4th Cir. 1967), writ refused 251 La. 231, 203 So.2d 559 (1967).
*563 Plaintiffs cite Keller v. Chauvin, 281 So.2d 181 (La.App. 4th Cir. 1973) in support of their motion.
We find Keller inapposite. In Keller the verified answer was under oath of the defendant's attorney. Such is not the situation in the instant case. Plaintiffs' motion is therefore denied.
ON THE MERITS
Defendant contends that the trial court erred in finding that the lease was not renewed and that it had expired. Defendant cites Lingle v. Wainwright, 215 La. 117, 39 So.2d 843 (1949) and Lakeside Dairies, Inc. v. Gregersen, 217 La. 510, 46 So.2d 752 (1950) to support her contention.
In both Lingle and Lakeside, the tenant sent the appropriate written notice exercising the option to renew, but not within the specified time. The Supreme Court held in each case that the lessor, who received a tardy notice exercising the option and allowed the tenant to retain possession of the property and continued to accept rent payments from the tenant, had waived the requirement of a timely written exercise of the option.
In the instant case, there is no evidence that the option was ever exercised. In fact, there is some testimony that Mr. Nathans did not wish to extend the lease and that his continued occupancy was under a new verbal agreement. Under these facts, the logic of Lingle and Lakeside is not applicable.
Consequently, the lease expired at the end of the primary term since Mr. Nathans did not exercise the option to renew. Exchange Oil and Gas Corp. v. Guillot, 251 So.2d 479 (La.App. 1st Cir. 1971). Defendant's occupancy of the premises after the expiration of the lease was under a reconduction of the lease on a month-to-month basis. Governor Claiborne Apartments, Inc. v. Attaldo, 256 La. 218, 235 So.2d 574 (1970). There is no merit in defendant's first contention.
Defendant also contends that the trial court committed manifest error in failing to find that plaintiff's conduct estopped them from cancelling the lease.
The trial judge stated, inter alia, in his Reasons for Judgment:
"* * * The Court further finds that there has been no conduct on the part of the plaintiff which would estop them from the contentions herein asserted. Plaintiff's conduct has been consistent with his assertion that the original lease has expired, and that the defendant was permitted to occupy the premises on a month-to-month basis.
"The letters written to Mr. and Mrs. Nathans in the year 1972, together with plaintiff's testimony, indicates that plaintiff considered the original lease terminated."
There is ample evidence in the record to support this finding. Defendant failed to substantiate its defense of estoppel.
For the above reasons, the judgment appealed is affirmed at defendant's cost.
AFFIRMED.
NOTES
[1] The parties stipulated at trial that Frank Vuci is the present owner of the property.
| 2023-08-21T01:26:18.401715 | https://example.com/article/9981 |
The truth behind the United States’ incessant desire to force regime change in Syria is unknown to the vast majority of Americans. The players are not who they seem to be, the facts are highly different from what traditional Western media outlets report.
DOUMA, SYRIA (Opinion) — The reported “chemical attack” at Douma, Russia has claimed, was fake news. One U.S. news agency has now confirmed from the location of the reported attack that April 7, 2018 was an uneventful day in this Syrian city and not one single person in Douma corroborated the story of a chemical attack taking place.
It is the latest in a long series of false-flag reports generated about Syria by the United States and forces that oppose the government of President Bashar al Assad. This trickery dates back to at least 2006, when a WikiLeaks cable exposed U.S. political treachery at its very worst; calculated meddling designed to harm the government and population of Syria.
In this article we will review false revelations and calculated moves undertaken by politicians to undermine Syria’s government, which is designed to provide protection to religious minorities and freedom for people of all faiths, who lived securely in Syria until civil war broke out in 2011.
President Donald Trump’s recent decision to attack Syria has been lauded by many Americans, but also widely condemned throughout the world. The president did not follow standard channels (i.e., congressional approval) before waging the attack. But U.S. pilots were brazenly directed to fire more than 100 missiles at Syria, killing innocent civilians, including children. The preemptive attack, had it happened on U.S. soil, would be unimaginable, but this is demonized Syria, a place most Americans, because of their national media, know very little about.
Many journalists suggest that Trump’s decision to launch the attack was correct because the people of Syria are suffering — but why is Syria suffering? One major reason is the United States’ insistence on the ouster of Assad. To accomplish this, the Americans have stirred unrest, generated false reports about chemical attacks, ignored pleas for humanitarian assistance to Syria, and backed and funded some of the most radical terrorists on the face of this planet, including the Islamic State and al Nusra Front. Many are the same people who attacked and killed American forces during the Iraq war.
Chemical propaganda
The U.S. news agency, One America News, reported from the site of the recent alleged chemical attack in Douma, revealing that there had not been a chemical attack, and that the whole event was staged by the “White Helmets,” heavily promoted by U.S. funding and described as anti-Assad rescuers who save people. In the group’s own words: “When the bombs rain down, the White Helmets rush in. Unarmed and neutral, they’ve saved 114,431+ lives and counting. Support them now.” According to the website Syria Civil Defense, the group may not really need such “support,” as it receives funding “from the governments of the U.K., Holland, Denmark, Germany, Canada, New Zealand, and the U.S.A.”
The crew from One America News spoke to citizens; they went to the affected neighborhood; they even talked to doctors at the hospital where the “White Helmets” reportedly brought the patients whom they claimed had suffered a chemical attack. Doctors at the facility said it was a normal day when the White Helmets burst in with numerous video cameras and “patients” who got up and walked out when the video cameras stopped rolling. Hoax doesn’t even seem like a strong enough term.
The strangest thing about the disclosure is that One America News supports Donald Trump in its evening right-wing talk show programs, and yet they completely contradict his claims of a chemical attack that led to the deadly U.S. attack. Their reporters proved to the world that the chemical attack in Douma was a hoax, undermining Trump’s chemical weapons claim and keeping true to their “fair news” position. The agency maintains a strong boundary between its pro-Trump talk shows and actual news reporting.
If the United States politicians want to see their country as the great savior of Syria, there are a number of things they should consider, beginning with the simple question: What did Syria do to the United States? The answer is, absolutely nothing at all. Playing world policeman is a long-ranging pattern in the U.S.; yet rarely, if ever, has the U.S. military made a positive difference in the world since World War II. Instead, the U.S. consistently loses the wars it starts, while maintaining as allies some of the most dangerous countries in existence.
Syria’s secular policies
The truth behind the United States’ incessant desire to force regime change in Syria is unknown to the vast majority of Americans. The players are not who they seem to be, the facts are highly different from what traditional Western media outlets report, and the military and political agendas pushed by both Barack Obama and Donald Trump are measured in blood, death, and the loss of human rights and religious freedom. The goal of both Assad and his father, Hafez al-Assad, who ruled Syria prior to Bashar, has been religious freedom for the people of Syria. That doesn’t go over well with the radicals with whom the U.S. maintains relations.
People of all faiths flourished in Syria prior to the so-called “Arab Spring.” The large-scale protests in Syria that garnered so much attention from the Western press were largely a result of a terrible drought that lasted over four years in Syria, bringing farmers to an economic standstill. Few Americans know this, because Western politicians and media told them it was all a big protest against the Assad regime, which was not true.
The Assad family are Alawis, sometimes called Alawites, a sect of Shia Islam that some Muslims consider blasphemous. The Alawis reject Sharia law; women are not required to wear a hijab, or head covering; and alcohol is permitted in certain religious ceremonies. Because Alawis have been persecuted as a minority religion, they traditionally identify with Christians and Jews. The goals of both Assad administrations has been to keep religion free, open and a matter of personal choice.
But all efforts to maintain a nation free from sectarian violence have been thwarted by the U.S. government. It is a bitter pill for those who relish and support humanitarianism.
A burned image of Christ is placed next to a wall at a Greek Orthodox church in Maaloula, Syria, March 3, 2016, after being pillaged by Syrian rebels. (AP/Pavel Golovkin)
The idea of U.S. politicians plotting for years, tossing out endless roadblocks, and complicating a nation’s quest to offer freedom of faith to its citizens conflicts sharply with American claims of supporting religious freedom. In fact, the actions of the American politicians are far more in line with promoting ethnic cleansing and religious intolerance, and that is exactly what has happened.
The Americans did the same thing to Iraq after illegally attacking the country over alleged weapons of mass destruction that did not exist. The Western powers annihilated the Gaddafi administration in Libya and that country, now in the hands of extremists, has open human slavery markets in its larger cities in 2018. Many of the victims are Black Jews deported from Israel under its extreme policies against people of color.
The most tragic result for Syria has been the loss of peace and the deaths of hundreds of thousands of people from all religious backgrounds. Who benefits from the violence? Arch rival Saudi Arabia, the political home of the Sunni Salafist/Wahhabi regime — the nemesis of Shia Islam — and the Zionist government of Israel, which has been annexing and stealing land in the Middle East for 70 years. Both are U.S. allies. In fact the confiscation of one of the few remaining parcels of land considered to be Palestine — the Golan Heights — is the prime reason Israel supports regime change in Syria, a nation that Israel has attacked time and time again in recent history.
Set up for a fall
The fabricated Douma chemical attack is the latest in a series of hoaxes and manipulations that began with this WikiLeaks cable from 2006, which reveals the mentality of the U.S. government toward Assad. In the cable, the U.S. government stated that “Syria has enjoyed a considerable up-tick in foreign direct investments (FDI)” and U.S. operatives were encouraged to dissuade FDI, which was largely coming from Syrian expats who were encouraged by positive developments brought by the Assad government.
The cable also revealed that the U.S. should “encourage rumors and signals of external plotting,” stating:
The [Assad] regime is intensely sensitive to rumors about coup-plotting and restlessness in the security services and military. Regional allies like Egypt and Saudi Arabia should be encouraged to meet with figures like Khaddam and Rif, al Asad as a way of sending such signals, with appropriate leaking of the meetings afterwards. This again touches on this insular regime’s paranoia and increases the possibility of a self-defeating over-reaction.”
Abdul Halim Khaddam was vice president of Syria from 1984 to 2005. He was a longtime loyalist of former President Hafez Assad (sometimes spelled “Asad”), but broke relations with Bashar in 2005. Rif’at Ali al-Assad, the younger brother of Hafez Assad, led a coup d’état against his brother in the early 1980’s when Hafez was suffering from heart problems and was exiled; he currently lives in France.
No moderate rebels
There may have been moderates at the beginning of the civil war but that is far in the background. The people who seek to destabilize the Syrian government and remove Assad are associated with the most radial and deadly school of thought among Islamic followers. They are Wahhabi, an intensely fundamentalist and conservative element of Sunni Islam created in Saudi Arabia that dates back to the 19th century. They hate the secular aspects of Syria; they want hardcore Islamic law; and the nemesis of Saudi Arabia is Shia Iran, which backs Assad and Syria.
It is extremely important to understand who the Wahhabis are, along with the Salafis, a Sunni sect that seeks to have people living as though they are still in the Middle Ages. Salafism came first, so all Wahhabis are Salafist, but not the other way around. Their teachings are what members of the Islamic State of the Levant (ISIL) follow. They are intolerant of all who are different, unless money is involved. As a matter of note, Salafism is a puritanical interpretation of Islam.
A Jabhat al-Nusra fighter talks on a radio while carrying his weapon in the front line of Khan Sheikhoun, northern Idlib province, May, 2014. (Photo: Hamid Khatib/Reuters)
Wahhabism was founded by Mohammed Ibn Abd al-Wahhab, who lived from 1703 to 1792. As noted by the Telegraph:
In the 1970s, with the help of funding from petroleum exports and other factors, Saudi charities started funding Wahhabi schools (madrassas) and mosques across the globe and the movement underwent ‘explosive growth.’”
Regarding Wahhabism’s puritanical and iconoclastic philosophies, the U.S. Congressional Research Service (CSR) in the Library of Congress wrote:
In particular, Abd al Wahhab denounced many popular Islamic beliefs and practices as idolatrous. Ultimately, he encouraged a ‘return’ to the pure and orthodox practice of the ‘fundamentals’ of Islam, as embodied in the Quran and in the life of the Prophet Muhammad. Muhammad bin Saud, the ancestral founder of the modern-day Al Saud dynasty, partnered with Abd al Wahhab to begin the process of unifying disparate tribes in the Arabian Peninsula. Their partnership formed the basis for a close political relationship between their descendants that continues today.”
Today, Saudi Arabia is an intolerant nation, rich from oil reserves, that does not allow freedom of religion to exist within its borders. Saudi officials still perform public beheadings and even crucifixions in open public squares. The countries the Saudis oppose, Syria and Iran, heavily demonized and targeted, both protect their religious minorities, namely Christians and Jews. Iraq, under the leadership of the late Saddam Hussein, also allowed religious freedom — though the Americans did everything possible to destroy this. No Jews exist in Saudi Arabia, yet the Saudi’s increasingly view Israel as an ally.
The following excerpt from the WikiLeaks cable proves that the whole idea of driving terrorists into Syria and causing havoc for the Syrian Arab Republic Government (SARG) was designed in Washington:
Publicize presence of transiting (or externally focused) extremist groups in Syria, not limited to mention of Hamas and PIJ. Publicize Syrian efforts against extremist groups in a way that suggests weakness, signs of instability, and uncontrolled blowback. The SARG’s argument (usually used after terror attacks in Syria) that it too is a victim of terrorism should be used against it to give greater prominence to increasing signs of instability within Syria.”
Civil war triggered by hunger and despair
Syria’s population increased from 3 million in 1946 to almost 24 million by 2010, the year before the country’s civil war broke out. This must be considered against the fact that only a small percentage of Syria’s land can sustain agriculture, as the country is extremely hard-pressed to provide water for farming. In fact, in 2010, only 13,500 square kilometers of Syria could provide crops due to minimal irrigation. Only 185,000 square kilometers of land are considered arable under ordinary non-drought conditions, according to a 2013 article by William R. Polk, who began writing for The Atlantic in 1958. The Euphrates River is partly drained by Turkey and Iraq before reaching Syria, and a terrible drought-plagued Syria from 2006 to 2011. It is, according to many reports, very similar to the “Dust Bowl” in the U.S. in the 1930’s that sent people from Oklahoma and other affected areas fleeing west to California’s San Joaquin Valley.
At the time of the drought, Americans were told that the people of Syria were rising up against their “tyrannical” leader, when in fact they were hungry and battling forces of nature. According to Polk:
That drought was said to have been the worst ever recorded, but it was one in a long sequence: Just in the period from 2001 to 2010, Syria had 60 ‘significant’ dust storms.”
In some areas, all agriculture ceased. In others, crop failures reached 75 percent. And generally as much as 85 percent of livestock died of thirst or hunger. Hundreds of thousands of Syria’s farmers gave up, abandoned their farms, and fled to the cities and towns in search of almost non-existent jobs and severely short food supplies. Outside observers, including UN experts, estimated that between 2 and 3 million of Syria’s 10 million rural inhabitants were reduced to ‘extreme poverty.'”
As the defeated farmers moved into Damascus and other cities, they shared resources with a quarter of a million Palestinian refugees forced to flee by Israeli colonization, and 100,000 Iraqi people forced to flee their homes in fear of violence under the U.S. occupation. Polk explains that in 2008, the head of the UN Food and Agriculture Organization in Syria termed the situation “a perfect storm,” warning that Syria faced “social destruction.”
A WikiLeaks cable from 2008 explains that the UN Office for Coordination of Humanitarian Affairs (OCHA) “launched an appeal on September 29 requesting roughly $20.23 million to assist an estimated one million people impacted by what the UN describes as the country’s worst drought in four decades.”
Syria’s minister of agriculture publicly stated that the “economic and social fallout” from the drought was “beyond our capacity as a country to deal with.” USAID’s decision was to do absolutely nothing, and the U.S. agency chose to let the Syrian people suffer. In retrospect, it seems the decision simply supported the U.S. policy of regime change — no amount of hunger or strife moved or softened the heart the director of USAID.
Syrian diversity
Small groups of people have historically been able to survive and prosper in Syria and, while the country’s history is entwined with the Islamic faith, Polk wrote that enclaves of residents — “leftovers” — were comprised of those who had survived migrations and invasions:
During most of the last five centuries, when what is today Syria was part of the Ottoman Empire, groups of Orthodox, Catholic, and other Christians; Alawis, Ismailis, and other sorts of Shia Muslims; and Yazidis, Kurds, Jews, and Druze lived in enclaves and in neighborhoods in the various cities and towns alongside Sunni Muslim Arabs.”
Polk concluded:
Looming over Syrian politics and heightening the tensions among the contenders for dominance throughout the post-war period has been the modern, powerful, and American-supported state of Israel: regular wars between Syria and Israel began in 1948, almost before either state had achieved full independence, and were repeated in 1967 and 1973. Border clashes, informal fighting, and limited ceasefires were interspersed among these major confrontations.
And since 1967, Israel has occupied the 1,200 square kilometers (460 square miles) of Syrian territory known as the Golan Heights. In 1981, Israel proclaimed that it had annexed the territory, a move not recognized by the U.S. or other states, and moved nearly 20,000 settlers there. Meanwhile, intermittent peace talks have been secretly held from time to time without result. A ceasefire, negotiated in 1974, has held, but today the two states are still legally at war.”
The people of Syria will spend years recovering from the devastation of war. General Wesley Clark famously stated in an interview with Amy Goodman in 2007, “This is a memo that describes how we’re going to take out seven countries in five years, starting with Iraq, and then Syria, Lebanon, Libya, Somalia, Sudan and, finishing off, Iran.” The deception and hoaxes, fake news stories and air strikes, are a deliberate attempt by the U.S. government to reduce the quality of life among the Syrian people while aiding some of the most dangerous terrorists who have ever roamed the face of this earth.
The very notion of the U.S. targeting a country like Syria that protects religious freedom is a singeing attack on American values. News agencies need to adhere to the truth. They need to investigate stories and vet their sources, before sounding the alarm over events that may not have taken place at all. If the U.S.-backed “rebels” had defeated the Syrian government, the country would be in the hands of radicals who would immediately implement Sharia law. This is what the U.S. has been spending vast amounts of taxpayer money to accomplish, and it would effectively send Syria back to the stone age.
Top Photo | US and British special forces train Syrian opposition fighters from of the New Syrian Army (NSA) and Jaish Awsoud Al-Sharqiah at an undisclosed site in Jordan (Photo: Al-Masdar)
Tim King is a former U.S. Marine with an extensive background in covering human rights issues. Tim reported from the wars in Afghanistan in 2006 and 2007 and Iraq in 2008, he is the founder and former News Editor of Salem-News.com.
With neither its farmers nor fishermen safe from Saudi coalition attacks, famine has become a massive crisis in Yemen, further exacerbated by the coalition’s blockade of the country which largely prevents food from being imported into the troubled nation. | 2023-08-23T01:26:18.401715 | https://example.com/article/1763 |
Tamim still uncertain for second Test
Left-hand opener Tamim Iqbal is still uncertain in the second Test against visiting West Indies. The southpaw still could not start batting against pace bowling. On the other hand, Imrul Kayes is also uncertain with the shoulder injury. As a result, rookie Sadman Islam may open the innings with Soumya Sarkar in Dhaka test which will kick off on November 30.
Tamim falls into injury while playing Asia Cup and he had to return against the Windies. But he could not play in the Chattogram Test for a new muscle injury. Tamim, however, expressed hope that he can return in second Test. But he could not recover as expected. So, the left-hand opener is uncertain for Mirpur Test.
Chief selector Minhazul Abedin on Sunday said to media about Tamim, "We have not received full updates from physio yet. As far as I know that he is quickly overcome the injury. Hopefully, if he could not play the second Test, then he will able to play in the one-day series. "
BCB doctors, however, do not want to give their opinion right now. While there is uncertainty about Tamim's return to the Mirpur Test, there is no possibility of playing Imrul Kayes. The left-handed opener got his shoulder injury during the first Test in Chattogram. A reliable source of BCB said that Imrul will not play in the Mirpur Test starting on November 30. Sadman Islam can be opened in his place. | 2023-09-03T01:26:18.401715 | https://example.com/article/8205 |
Russian stocks are up 16 percent since Nov. 8, based on the performance of the RSX Van Eck Vectors Russia ETF, while the other emerging markets are down 6 percent collectively, as measured by the iShares MSCI Emerging Markets ETF EEM .
Oil's rise above $50 has helped Russia, which depends on its energy industry to remain solvent. President-elect Donald Trump is also expected to push for better relations with Moscow, which U.S. intelligence agencies say hacked into the Democratic National Committee's emails in an effort to throw the election toward Trump. Russian President Vladimir Putin denies it.
Brent crude is up 19 percent since Election Day and was trading at just under $55 per barrel Friday.
"They're obviously getting benefits both from the sense that the tensions with the West are going to go down and that they're going to have more access to markets, plus the fact that oil has gone up," said Bruce Kasman, chief global economist at JPMorgan.
"It's a double positive for them," he said, adding that an agreement to curtail oil output that OPEC reached this month with Russia and some other nonmember states should push crude prices higher. | 2024-07-13T01:26:18.401715 | https://example.com/article/3103 |
<Type Name="NSDataWritingOptions" FullName="MonoMac.Foundation.NSDataWritingOptions">
<TypeSignature Language="C#" Value="public enum NSDataWritingOptions" />
<TypeSignature Language="ILAsm" Value=".class public auto ansi sealed NSDataWritingOptions extends System.Enum" />
<AssemblyInfo>
<AssemblyName>MonoMac</AssemblyName>
<AssemblyVersion>0.0.0.0</AssemblyVersion>
</AssemblyInfo>
<Base>
<BaseTypeName>System.Enum</BaseTypeName>
</Base>
<Attributes>
<Attribute>
<AttributeName>System.Flags</AttributeName>
</Attribute>
</Attributes>
<Docs>
<summary>To be added.</summary>
<remarks>To be added.</remarks>
</Docs>
<Members>
<Member MemberName="Atomic">
<MemberSignature Language="C#" Value="Atomic" />
<MemberSignature Language="ILAsm" Value=".field public static literal valuetype MonoMac.Foundation.NSDataWritingOptions Atomic = unsigned int32(1)" />
<MemberType>Field</MemberType>
<AssemblyInfo>
<AssemblyVersion>0.0.0.0</AssemblyVersion>
</AssemblyInfo>
<ReturnValue>
<ReturnType>MonoMac.Foundation.NSDataWritingOptions</ReturnType>
</ReturnValue>
<Docs>
<summary>To be added.</summary>
</Docs>
</Member>
<Member MemberName="Coordinated">
<MemberSignature Language="C#" Value="Coordinated" />
<MemberSignature Language="ILAsm" Value=".field public static literal valuetype MonoMac.Foundation.NSDataWritingOptions Coordinated = unsigned int32(4)" />
<MemberType>Field</MemberType>
<AssemblyInfo>
<AssemblyVersion>0.0.0.0</AssemblyVersion>
</AssemblyInfo>
<Attributes>
<Attribute>
<AttributeName>System.Obsolete("no longer available")</AttributeName>
</Attribute>
</Attributes>
<ReturnValue>
<ReturnType>MonoMac.Foundation.NSDataWritingOptions</ReturnType>
</ReturnValue>
<Docs>
<summary>To be added.</summary>
</Docs>
</Member>
<Member MemberName="FileProtectionComplete">
<MemberSignature Language="C#" Value="FileProtectionComplete" />
<MemberSignature Language="ILAsm" Value=".field public static literal valuetype MonoMac.Foundation.NSDataWritingOptions FileProtectionComplete = unsigned int32(536870912)" />
<MemberType>Field</MemberType>
<AssemblyInfo>
<AssemblyVersion>0.0.0.0</AssemblyVersion>
</AssemblyInfo>
<Attributes>
<Attribute>
<AttributeName>MonoMac.ObjCRuntime.Since(4, 0)</AttributeName>
</Attribute>
</Attributes>
<ReturnValue>
<ReturnType>MonoMac.Foundation.NSDataWritingOptions</ReturnType>
</ReturnValue>
<Docs>
<summary>To be added.</summary>
</Docs>
</Member>
<Member MemberName="FileProtectionCompleteUnlessOpen">
<MemberSignature Language="C#" Value="FileProtectionCompleteUnlessOpen" />
<MemberSignature Language="ILAsm" Value=".field public static literal valuetype MonoMac.Foundation.NSDataWritingOptions FileProtectionCompleteUnlessOpen = unsigned int32(805306368)" />
<MemberType>Field</MemberType>
<AssemblyInfo>
<AssemblyVersion>0.0.0.0</AssemblyVersion>
</AssemblyInfo>
<Attributes>
<Attribute>
<AttributeName>MonoMac.ObjCRuntime.Since(5, 0)</AttributeName>
</Attribute>
</Attributes>
<ReturnValue>
<ReturnType>MonoMac.Foundation.NSDataWritingOptions</ReturnType>
</ReturnValue>
<Docs>
<summary>To be added.</summary>
</Docs>
</Member>
<Member MemberName="FileProtectionCompleteUntilFirstUserAuthentication">
<MemberSignature Language="C#" Value="FileProtectionCompleteUntilFirstUserAuthentication" />
<MemberSignature Language="ILAsm" Value=".field public static literal valuetype MonoMac.Foundation.NSDataWritingOptions FileProtectionCompleteUntilFirstUserAuthentication = unsigned int32(1073741824)" />
<MemberType>Field</MemberType>
<AssemblyInfo>
<AssemblyVersion>0.0.0.0</AssemblyVersion>
</AssemblyInfo>
<Attributes>
<Attribute>
<AttributeName>MonoMac.ObjCRuntime.Since(5, 0)</AttributeName>
</Attribute>
</Attributes>
<ReturnValue>
<ReturnType>MonoMac.Foundation.NSDataWritingOptions</ReturnType>
</ReturnValue>
<Docs>
<summary>To be added.</summary>
</Docs>
</Member>
<Member MemberName="FileProtectionMask">
<MemberSignature Language="C#" Value="FileProtectionMask" />
<MemberSignature Language="ILAsm" Value=".field public static literal valuetype MonoMac.Foundation.NSDataWritingOptions FileProtectionMask = unsigned int32(4026531840)" />
<MemberType>Field</MemberType>
<AssemblyInfo>
<AssemblyVersion>0.0.0.0</AssemblyVersion>
</AssemblyInfo>
<Attributes>
<Attribute>
<AttributeName>MonoMac.ObjCRuntime.Since(4, 0)</AttributeName>
</Attribute>
</Attributes>
<ReturnValue>
<ReturnType>MonoMac.Foundation.NSDataWritingOptions</ReturnType>
</ReturnValue>
<Docs>
<summary>To be added.</summary>
</Docs>
</Member>
<Member MemberName="FileProtectionNone">
<MemberSignature Language="C#" Value="FileProtectionNone" />
<MemberSignature Language="ILAsm" Value=".field public static literal valuetype MonoMac.Foundation.NSDataWritingOptions FileProtectionNone = unsigned int32(268435456)" />
<MemberType>Field</MemberType>
<AssemblyInfo>
<AssemblyVersion>0.0.0.0</AssemblyVersion>
</AssemblyInfo>
<Attributes>
<Attribute>
<AttributeName>MonoMac.ObjCRuntime.Since(4, 0)</AttributeName>
</Attribute>
</Attributes>
<ReturnValue>
<ReturnType>MonoMac.Foundation.NSDataWritingOptions</ReturnType>
</ReturnValue>
<Docs>
<summary>To be added.</summary>
</Docs>
</Member>
<Member MemberName="WithoutOverwriting">
<MemberSignature Language="C#" Value="WithoutOverwriting" />
<MemberSignature Language="ILAsm" Value=".field public static literal valuetype MonoMac.Foundation.NSDataWritingOptions WithoutOverwriting = unsigned int32(2)" />
<MemberType>Field</MemberType>
<AssemblyInfo>
<AssemblyVersion>0.0.0.0</AssemblyVersion>
</AssemblyInfo>
<ReturnValue>
<ReturnType>MonoMac.Foundation.NSDataWritingOptions</ReturnType>
</ReturnValue>
<Docs>
<summary>To be added.</summary>
</Docs>
</Member>
</Members>
</Type>
| 2024-05-14T01:26:18.401715 | https://example.com/article/8897 |
288 F.Supp.2d 730 (2003)
OTTO CANDIES, LLC
v.
UNITED STATES OF AMERICA
Nos. Civ.A. 99-3692, Civ.A. 99-3693, Civ.A. 01-450, Civ.A. 01-452.
United States District Court, E.D. Louisiana.
May 28, 2003.
As Amended June 12, 2003.
*731 *732 Jerome John Reso, Jr., John A. Rouchell, Leon Hirsch Rittenberg, III, Baldwin & Haspel, LLC, New Orleans, LA, Albert H. Turkus, Pamela F. Olson, Julia M. Kazaks, Troy L. Olsen, Skadden, Arps, Slate, Meagher & Flom, LLP, Washington, DC, for plaintiff.
John M. Bilheimer, Christopher M. Pietruszkiewicz, U. S. Department of Justice, Tax Division, Washington, DC, Hemant Sharma, Mark Stier, U. S. Department of Justice, Washington, DC, for defendant.
Richard Edgar Anderson, Harahan, LA, for movant.
FINDINGS OF FACT AND CONCLUSIONS OF LAW
AFRICK, District Judge.
In these consolidated cases,[1] plaintiffs, Otto Candies, L.L.C., successor to Otto Candies, Inc., jointly referred to as "OCI," and Candies Towing Company, L.L.C., successor to Candies Towing Company, Inc., and jointly referred to as "CTI," seek a refund of accumulated earnings taxes, as well as related penalties and interest, that were assessed against them by the Internal Revenue Service pursuant to 26 U.S.C. § 531. The assessments relate to fiscal years ending April 30, 1991, through April 30, 1996, with respect to OCI, and fiscal years ending April 30, 1991, through April 30, 1995, with respect to CTI.
On January 13, 2003, a non-jury trial commenced which concluded on January 17, 2003. Upon consideration of the evidence adduced at trial, including the testimony of the witnesses and the admitted exhibits, the briefs and arguments of counsel, and the law, the Court makes the following findings of fact and conclusions of law pursuant to Rule 52(a) of the Federal Rules of Civil Procedure.
I.
Plaintiffs, OCI and CTI, are in the marine transportation business, predominantly serving the offshore oil and gas industry in the Gulf of Mexico.[2] OCI owns and *733 operates powered vessels such as offshore supply vessels ("OSVs") and tugboats ("tugs"), while CTI owns and operates non-powered vessels such as barges.[3] OCI and CTI are limited liability companies organized and existing under the laws of the State of Louisiana.[4] The companies' principal place of business is in Des Allemands, Louisiana.[5]
The parties dispute whether plaintiffs are due a refund of accumulated earnings taxes, associated penalties and interest paid, plus further interest thereon in accordance with the law. As will be discussed in more detail below, the Internal Revenue Code imposes accumulated earnings taxes on corporations deemed to have accumulated earnings and profits for the purpose of avoiding taxes that might otherwise be imposed if the income was distributed to shareholders. 26 I.R.C. §§ 531, 532(a).[6]
Plaintiffs' position is that accumulated earnings taxes, as well as associated penalties and interest, should not have been assessed against plaintiffs. Plaintiffs argue that to the extent the companies retained funds, they did so for business purposes and not to avoid taxes. Plaintiffs contend that at the end of each year in question, each company had reasonable identified business needs that exceeded the companies' available assets for that year. According to the plaintiffs, their business needs included (1) replacing the companies' aging fleet; (2) investing in particular projects associated with the companies' core business, but not their day-to-day operations; (3) providing for the companies' working capital needs; and (4) being prepared, should such need arise, to redeem the stock of one of the companies' three major shareholders.[7]
Procedural History
For purposes of this lawsuit, the "years in question" are fiscal years 1991 through 1996 for OCI and fiscal years 1991 through 1995 for CTI.[8] During the years in question, OCI and CTI were both corporations organized and existing under the laws of the State of Louisiana and they were taxed pursuant to Subchapter C of the Internal Revenue Code.[9] During these years, the companies timely filed their federal income tax returns and paid all taxes reportedly due.[10]
On January 12, 1995, and then again on October 23, 1998, the Internal Revenue Service ("IRS") issued notices of deficiency, stating that the companies owed additional amounts, including accumulated earnings taxes and related penalties and *734 interest for each of the years in question.[11] OCI and CTI paid the total amount of the assessed taxes and penalties plus interest.[12] Thereafter, the companies submitted timely claims for refunds, seeking the return of the taxes as well as related penalties and interest paid.[13] Following negotiations with the IRS Office of Appeals, all issues raised in the claims for refunds were resolved except the accumulated earnings tax issue.[14] The remaining amounts in dispute are as follows:
OCI
Fiscal Year Tax Penalty Interest Total
1991 $1,407,768 $ 281,554 $ 541,458 $ 2,230,780
1992 1,164,870 232,974 287,303 1,685,147
1993 1,422,827 284,565 208,278 1,915,670
1994 1,359,988 271,998 779,892 2,411,878
1995 1,889,607 377,921 792,905 3,060,433
1996 676,912 135,383 192,073 1,004,368
TOTAL $7,921,972 $1,584,395 $2,801,909 $12,308,276
CTI
Fiscal Year Tax Penalty Interest Total
1991 $ 581,485 $ 116,297 $ 223,842 $ 921,624
1992 971,621 194,324 240,230 1,406,175
1993 871,738 174,347 127,640 1,173,725
1994 1,569,390 313,878 898,930 2,782,198
1995 1,054,632 210,926 442,528 1,708,086
TOTAL $5,048,866 $1,009,772 $1,933,170 $7,991,808[15]
History of the Companies
OCI and CTI are family-owned and family-operated businesses founded in 1942 by the late Captain Otto Candies when he agreed to transport Humble Oil personnel on a borrowed boat to and from a location on Bayou Des Allemands where Humble Oil intended to drill an oil rig. He was then hired by Humble Oil to keep the canal leading to that location free from vegetation. Having no money, Captain Candies borrowed $500 to buy a boat in order to provide those services. Thereafter, he was hired to provide additional services to Humble Oil (now ExxonMobil) in connection with the rig's operation. Over a period of time, the marine transportation services offered by Captain Candies expanded and his companies evolved to become one of the leading providers of marine transportation services in the Gulf of Mexico.[16] The companies' growth is attributed in large part to Captain Candies' conservative philosophy of investing earnings back into the companies so that he would have funds to expand the companies and the companies would not have to incur debt.[17]
*735 During the years in question, stock in OCI and CTI was held primarily by Captain Candies' three sons: Otto Candies, Jr., chairman and chief operating officer of OCI and CTI, Paul Candies, president of OCI and CTI, and Kevin Candies, executive vice president of OCI and CTI.[18] Otto Candies, III, the son of Otto Candies, Jr., was the companies' secretary and treasurer.[19] Otto Jr., Paul, Kevin, and Otto III (collectively, the "Candies family" or "management") work together in the same small office building and virtually see each other each day. As such, many management decisions are made informally at work, rather than during formal board meetings.[20] During and prior to the years in question, the companies paid no dividends to their shareholders.[21]
Because OCI and CTI provide transportation services to oil and gas companies, primarily in the Gulf of Mexico, the companies' economic vitality is largely dependent upon that industry. As the price of oil and gas rises and falls and exploration and production activities in the Gulf of Mexico correspondingly increase and decrease the demand for marine transportation services dramatically fluctuates.[22] In particular, the "day rate," which is the customary unit of pricing for vessel services, swings widely up and down depending upon market conditions.[23] These swings can occur over very short periods of time and they can be unpredictable.[24] In sum, the companies operate in a highly volatile business environment.
Nevertheless, OCI and CTI, despite the volatility of the oil and gas industry, have succeeded. Unlike many of their competitors, the companies funded their operations internally whenever possible, a strategy that, as previously stated, had its origin in the conservative business philosophy of the late Captain Otto Candies.[25] As a result, the companies, in part because they were debt free, have been able to successfully weather rough periods in the oil and gas industry.[26]
OCI and CTI have always had a good reputation in their industry. As Captain Robert J. Underhill,[27] defendant's expert in the Gulf of Mexico marine industry, himself acknowledged, "[T]hey were very frugal, a well-run company, closely held, *736 nothing but good.... They understood and knew the business ... in my estimation, better than anyone."[28] Likewise, Sid Mizell, senior vice president of sales and marketing for Halter Marine, Inc., a local shipyard, testified:
The Candies have always been an organization that has over the years in my opinion ran their business very I'm not sure if `frugal' is a proper term, but they pay attention to their business, they don't get flamboyant with their lifestyles. They obviously reinvest in their fleet renewal programs, and as their equipment gets older, they continue to replace the older equipment with new equipment. And in my opinion, they have been one of the more successful operators.[29]
The years in question followed the roughest downturn in the history of the oil and gas industry.[30] After an oil price peak in 1981, the oil and gas industry suffered a severe recession that lasted at least until 1988.[31] During that recession, many of OCI's and CTI's competitors went bankrupt and/or were forced out of business.[32] OCI and CTI also suffered steep declines in revenue during that time, but their conservative approach of reinvesting earnings into the companies and avoiding debt by self-funding most operations enabled them to survive.[33] As defendant's expert, Captain Underhill stated, "[m]any companies went out of business, lost their shirts, but not the Candies. They were in pretty good shape. They were always the old Candies, there was just he wasn't a guy to spend money foolishly. They just didn't do it."[34]
In 1991 and the years that followed, the companies' management was acutely aware of the recession of the 1980s, and management proceeded with an extra measure of caution despite some increase in oil prices from 1988 to 1991. As Kevin Candies testified, "we were very, very cautious, wanting to move forward, but cautiously.... We had just experienced the depression of the '80s like none of us had ever seen before and it was a very scary thing...."[35] Throughout the difficult years in question, the companies and their peers were hopeful that the industry would rebound at any moment.[36] As such, the Candies wanted to remain in a position of financial strength so that when the market did rebound, the companies had the resources to expand and become more competitive.[37] However, in the early 1990s, oil prices declined again, further emphasizing the need for prudence.[38]
Fleet Replacement
The companies' business centers around their respective fleets. During the years on question, the companies' fleet was growing old. After years of little capital *737 investment during the industry wide depression of the 1980s, many of the companies' vessels were beyond their optimum life expectancies.[39] In 1991, OCI's fleet included the following vessels:
16 OSVs: 1 vessel 23 years old
4 vessels 19 years old
1 vessel 17 years old
1 vessel 16 years old
1 vessel 13 years old
5 vessels 12 years old
3 vessels 8 years old
10 tugs: 6 vessels 10 years old
1 vessel 9 years old
1 vessel 6 years old
1 vessel 5 years old
1 vessel new[40]
During times of expansion, OCI's practice was to replace its OSVs and tugs approximately every 12 years.[41] Even when the market did not support a 12 year replacement cycle, OSVs and tugs were generally not expected to be used for more than 15 years or, at the very latest, 20 years.[42] In the early 1990s, the average age of OSVs and tugs retired from the marine transportation service industry was 15 years.[43] As the above chart demonstrates, as of 1991 almost all of OCI's OSVs were nearly due or past due for replacement and some of the tugs were approaching the same status.
With respect to CTI, its fleet in 1991 including the following vessels:
25 barges: 3 vessels 21 years old
6 vessels 18 years old
2 vessels 15 years old
1 vessel 14 years old
2 vessels 12 years old
2 vessels 11 years old
7 vessels 10 years old
2 vessels 9 years old[44]
The life expectancy of barges is approximately 20 years.[45] Therefore, approximately one third of CTI's barges were nearly due or past due for replacement in 1991.
In addition to the growing age of its fleet, management was keenly aware that changes in technology and customer demands dictated a need for new vessels. As oil exploration moved further offshore into the Gulf, new OSVs and tugs with deep water capability were required.[46] Regardless of their condition, the older vessels in OCI's fleet could not meet these requirements.[47]
Plaintiffs' fleet replacement need was undisputed at trial. In fact, even defendant's own expert in the marine industry, Captain Underhill, emphatically agreed that the Candies needed to modernize their fleet in order to stay in business.[48]
*738 Given the aged and outdated state of the existing fleet, it was management's intent to make substantial new vessel expenditures as soon as the market provided a reasonable return on its investment.[49] Each year, management expected and hoped that the following year would bring conditions ripe for fleet replacement. After the downturn of the 1980s, the companies' management was reluctant to make major vessel expenditures until it seemed clear that the prevailing day rates would justify the investment, particularly since new vessel technologies made boat building more expensive. Management's reluctance was shared by many of the companies' competitors. In fact, during the years in question, new vessel construction decreased significantly with respect to offshore operations conducting business in the Gulf of Mexico.[50]
According to the testimony of Candies family members, the companies' management discussed fleet replacement needs regularly during the years in question, both formally at board meetings reflected in several of the companies' minutes[51] and informally during day-to-day interactions with each other.[52] OCI intended to build 12 OSVs, ranging in size from 180 feet to 220 feet at a cost of between $3,500,000 and $5,000,000 each, and 6 tugs, approximately 9,000 horsepower each at a cost of approximately $3,000,000 each.[53] CTI intended to replace at least twelve of its barges at a cost of approximately $3,000,000 each.[54] The details concerning OCI's plans were recorded in interview notes written by IRS Agent Cyrus Fanguy in December, 1992, during the very beginning of his audit, when he met with Paul Candies and discussed OCI's fleet replacement plans.[55]
The companies also discussed their fleet replacement needs with management personnel at a number of shipyards during the years in question. In particular, Otto Candies, Jr. spoke regularly, as often as two or three times per month, with representatives of Bender Shipyards and Halter Marine.[56] During his conversations with shipyard representatives, Otto Candies, Jr. would discuss details of new vessel construction such as the type of equipment the vessels would require, pricing, horsepower, etc.[57] These conversations were not idle chatter. As Frank Terrell, vice president of sales for Bender Shipyard, testified:
Otto Candies told me that he would buy some boats, that I just needed to stick with them, that they were serious, and that when the time was right they would be a buyer. They had a fleet to replace and they were going to replace it. I took that to be a very serious statement, so that's what we did. We stuck there and kept talking, and eventually conditions *739 changed to where it made it worth their while to build new vessels.[58]
Similarly, Halter Marine, Inc.'s Sid Mizell testified:
The Candies, like I said, they have always said that they are in the business to stay and to keep their fleet so that they're competitive.... [A] lot of people ... go out and shop and kick the tires, but when they came to us with a project, I always took them seriously, that it at least if we didn't get the job, someone would.[59]
Plaintiff's expert witness, Dr. Colin Blaydon, provided his expert opinion as to the amount of financial resources he would have recommended that plaintiffs have available to meet fleet replacement needs during the years in question. Dr. Blaydon is Dean Emeritus of the Amos Tuck School of Business at Dartmouth College and a director of the economics and finance consulting firm of LECG.[60] His involvement with LECG primarily has been in the fields of quantitative analysis, financial economics, and corporate governance.[61] He has served on the board of directors of 26 corporations, including nine closely held companies and four family-owned companies.[62] He is recognized as an expert in finance, managerial economics and, in particular, the assessment of the strategic options available to a company, the impact of alternative strategies for retention of resources upon a company's long-term prospects for survival, and the analysis of the reasonable needs of a company for financial resources.[63]
Dr. Blaydon had numerous meetings with plaintiffs' management and investigated the details of their fleet replacement plans.[64] Analyzing such information, including data about the age of vessels in plaintiffs' fleet and anticipated costs of vessel replacement, Dr. Blaydon concluded that he would have advised OCI and CTI to retain the following amounts for fleet replacement at the end of each of the years in question:
1991 1992 1993 1994 1995 1996
OCI $39,800,000 42,900,000 48,400,000 49,000,000 57,400,000 37,200,000
CTI $11,900,000 12,200,000 12,600,000 15,100,000 16,500,000[65]
These figures represent amounts needed merely to maintain, not expand, the existing fleet capacity.[66] The year-by-year totals are less than the fleet replacement costs the companies' management actually planned ($60,000,000 to $78,000,000 for OCI and $36,000,000 for CTI).[67] These *740 totals are also considerably less than the $100,000,000 that defendant's expert, Captain Underhill, testified would have been required for plaintiffs to replace their aging fleet.[68] It is plaintiffs' position that the amounts quantified by Dr. Blaydon are the minimum amounts the companies should have retained during the years in question for fleet replacement.[69]
OCI ultimately did make major fleet replacement expenditures. From 1991 through 2001, OCI spent or committed to spend a total of $173,697,000 on new vessels, including 14 OSVs and 7 tugs. After subtracting approximately $84,559,000 from the sale of old vessels and approximately $40,000,000 in financing commitments, OCI has made or has committed to make a net outlay of approximately $50,000,000 of its own resources on fleet replacement.[70]
CTI has only just begun construction because its business remains depressed. In 2002, CTI committed to purchase a $15,000,000 barge. Management still intends for CTI to engage in major fleet replacement as soon as market conditions so warrant.[71]
Defendant offered no direct evidence disputing OCT's and CTI's fleet replacement plans or activity. To the contrary, as stated above, defendant's own expert, Captain Underhill, agreed that the companies needed to retain approximately $100,000,000 to replace their fleet.[72] His only contention was that the companies should have invested in fleet replacement earlier in the 1990s.[73] Notwithstanding that assertion, however, Captain Underhill readily admitted that reasonable business minds could differ as to the appropriate time for fleet replacement. Specifically, Captain Underhill testified:
THE COURT: Captain, in all your experience that you've had and notwithstanding the regard which you have, from your testimony, for some of the things that the Candies do and their reputation in the industry, is it reasonable for me to assume that knowledgeable persons in the field such as yourself, such as the Candies, could have different business judgments as far as when it was necessary to replace a fleet?
THE WITNESS: Why, certainly. Certainly.[74]
*741 Project Needs
The companies are frequently presented with opportunities to engage in various projects that are related to their business, but that are outside of their day-to-day operations of vessel chartering and brokering. These projects include opportunities to bid on large jobs and submit proposals to purchase, refit, or construct vessels for unique undertakings. The projects also include opportunities to finance the operations of the companies' customers and suppliers. Certain of the projects provide the companies with a means of diversifying their business outside the gas and oil industry in order to ensure economic survival.[75]
During the years in question, the companies were presented with numerous opportunities to engage in a variety of such projects.[76] The flow of projects was continuous. Some projects required extensive consideration and development before coming to conclusion, while others were addressed more quickly.[77] The projects took a variety of forms.[78]
At trial, plaintiffs identified a number of projects for which they anticipated business needs during the years in question. The projects relied upon by plaintiffs were all viable and outstanding as of the end of one or more of the years in question[79] and, according to plaintiffs, gave rise to a reasonably anticipated business need susceptible of quantification.[80]
Plaintiffs' counsel retained Michael C. Odom, a certified public accountant formerly employed by Arthur Andersen LLP, to provide his expert opinion regarding the various projects considered by OCI and CTI during the taxable years at issue. Mr. Odom has served as the "engagement partner" for numerous publicly and privately held oil and gas and oilfield services companies and he has over 30 years of experience in conducting audits and due diligence investigations for clients and lenders engaged in the oil and gas industry.[81] Mr. Odom was asked to testify regarding management's level of consideration of identified projects and to determine the amount of funds that would have been required to develop those projects, outstanding as of the end of any of the years in question, to which management gave serious and extensive consideration.[82] Mr. Odom reviewed extensive documentary files regarding the projects and met several times with the companies' management to discuss the projects.[83]
*742 In conducting his analysis, Mr. Odom reviewed approximately one hundred potential projects[84] and considered (1) the amount of time and resources committed by management for development of the project; (2) whether documents and other available information indicated that management gave the project serious consideration; (3) management's own indications of the consideration given to the pursuit and development of the project; (4) the degree to which project specifications and management's responsibilities with respect to the project were established; and (5) the commitment of the companies' funds for the development of the project.[85] Based on such criteria, Mr. Odom concluded that seventeen of the approximately one hundred identified projects were the subject of serious and extensive consideration by the companies' management and were under consideration as of the end of a taxable year.[86] Mr. Odom's opinion was corroborated by the testimony of the companies' management and third-party witnesses. It is only these projects, as set forth below, and their associated quantified needs, upon which plaintiffs rely in asserting the companies' reasonable business needs.[87]
Marine Spill Response Corporation
After the Exxon Valdez oil spill, Congress directed U.S. oil companies to adopt oil spill cleanup procedures to minimize the effects of future oil spills from oil tankers. The oil industry's response was to create the Marine Spill Response Corporation ("MSRC"), a private company funded by the oil industry.[88] In late 1990 and early 1991, the MRSC sought bids for the construction and charter of up to sixteen vessels to respond to marine spills. On April 29, 1991, OCI submitted a four-volume bid to MSRC. Pursuant to that bid, OCI proposed to supply nine newly constructed oil spill response vessels for charter to the MSRC. The vessels would be designed and constructed by Halter Marine at a cost of $11,600,000 to $12,100,000 each, for a total of approximately $105,000,000.[89] The bid provided that OCI and CTI would finance the vessels, build the vessels, and be repaid through charter hire.[90]
*743 In connection with this project, the companies solicited and received blueprints and other design drawings relating to vessel construction which would be submitted as part of their bid to the MSRC. The companies performed considerable research with respect to this project.[91] According to Admiral John D. Costello, president of the MRSC, the MRSC considered the companies' proposal to be a serious bid and he believed that the companies had the financial resources to support their proposal.[92]
OCI's bid remained outstanding at the end of the companies' 1991 fiscal year.[93] However, in the summer of 1991, MSRC rejected OCI's bid, opting instead to have the vessels built at its own cost.[94]
Freeport New Discovery Sulphur
The companies had a long-standing relationship with Freeport McMoRan ("Freeport"), a firm engaged in sulphur mining and other natural resources production. In March, 1991, Freeport contacted the Candies regarding the movement of sulphur from Port Sulphur, Louisiana, to Tampa, Florida.[95] By letter dated April 5, 1991, OCI presented Freeport three proposed options for moving sulphur from the designated locations: (1) converting the Louisiana Brimstone, a vessel owned by Freeport, at an estimated cost of $31,000,000; (2) building a large tug-barge unit at an estimated cost of $30,250,000; and (3) building two smaller tug-barge units at a cost of $41,000,000.[96] One of Freeport's objectives with respect to this project was to have the vessel operator, rather than Freeport, invest the capital necessary to convert the Louisiana Brimstone or build the new vessels required to move the sulphur.[97]
The testimony of the witnesses, together with the corporate minutes of OCI and CTI, indicate that management committed significant time and resources to work with Freeport in developing the vessel specifications and related cost estimates, in coordinating vessel design specifications with engineers, and in confirming vessel delivery dates with the vessel contractor.[98] As of the fiscal year ending April 30, 1991, management anticipated investing at least $30,250,000 in this project.[99] This amount represents the least expensive of the options set forth in the April 5, 1991, proposal to Freeport.[100]
*744 Given the large nature of this venture, the companies expected to co-venture this project, allocating to CTI the non-powered vessel costs which were not to exceed the amount of CTI's available assets. The remaining costs will be allocated to OCI.[101] As of April 30, 1991, CTI had approximately $15,400,000 of available assets and, therefore, it would not have had the necessary available assets to make the full $20,250,000 barge investment contemplated. OCI had approximately $41,100,000 of available assets as of the 1991 fiscal year end. Accordingly, the anticipated investment for this project allocated $15,400,000 to CTI and the remainder, i.e., $14,850,000, to OCI.[102]
Foster Duncan, senior vice-president for Freeport-McMoRan Business Enterprises, testified by deposition that Freeport viewed its discussions with the companies as serious and that he believed the companies were seriously interested in the project and had the funds necessary to invest in same.[103] Ultimately, however, Freeport awarded the project to one of the companies' competitors.[104]
Hall-Houston
During the years in question, Hall-Houston was an independent oil and gas exploration and development company that operated in the Gulf of Mexico.[105] In late 1990, OCI began soliciting Hall-Houston for marine transportation work. At or around that same time, Hall-Houston was experiencing cash flow difficulties and it proposed that OCI purchase Hall-Houston preferred stock in exchange for its business.[106] On or about January, 1991, Gary Hall, chairman and CEO of Hall-Houston, met with Paul Candies to discuss the purchase of the stock.[107] By April 30, 1991, OCI had made a commitment to make a $5,000,000 investment in Hall-Houston in return for Hall-Houston agreeing to make OCI its sole provider of marine transportation services.[108] Consistent with that agreement, on August 5, 1991, OCI purchased 50,000 shares of Hall-Houston preferred stock for $5,000,000.[109]
In early 1995, Hall-Houston contacted management regarding a proposed issuance of Hall-Houston subordinated notes.[110] By April 30, 1995, OCI had again committed to invest an additional $4,000,000 in Hall-Houston subordinated notes.[111] Consistent with that commitment, OCI subscribed on May 11, 1995 and on May 24, 1995, respectively, to make two separate purchases of two $2,000,000 Hall-Houston subordinated notes.[112]
*745 Finally, in April 1996, OCI committed to provide $4,950,000 in financing to Hall-Houston. As of April 30, 1996, OCI had advanced $1,093,703 of that amount.[113]
Paul Candies testified that OCI made these investments in Hall-Houston based upon management's judgment that it was important to make the investments to maintain OCI's business relationship with Hall-Houston.[114] Mr. Candies' testimony was corroborated by that of Gary Hall, chairman and CEO of Hall-Houston, who acknowledged that if OCI had not made the investments, OCI would have lost some of the Hall-Houston marine transportation business to a competitor who was prepared to make an investment in Hall-Houston.[115] Each of the 1991, 1995, and 1996 financings provided Hall-Houston with the funds needed to engage in new activity that ultimately generated more business for the companies.[116]
The companies' gross receipts from sales to Hall-Houston for the 1990 to 1997 fiscal years were as follows:
1990 $ 37,859
1991 0
1992 2,542,872
1993 4,490,543
1994 1,474,666
1995 2,081,793
1996 2,023,225
1997 2,084,981[117]
OCI and CTI continue to provide marine transportation services to Hall-Houston' successor, Energy Partners Ltd.[118]
Tug for Gardinier Sulphur Barge
Gardinier was a subsidiary of Cargill, Inc. In November, 1990, Gardinier/Cargill hired OCI to tow a sulphur barge from Tampa, Florida to Mexico.[119] Initially, OCI towed the sulphur barge with an existing tug which had to be modified to be compatible with the barge. In January, 1991, OCI's board of directors began discussing the possibility of building a new tug specifically dedicated to this charter. The board estimated that the new tug would cost between $4,500,000 to $5,500,000.[120] On February 6, 1991, OCI and Cargill amended their November 29, 1990, contract and agreed that OCI would build a new tug to tow the sulphur barge.[121] At a March 28, 1991, OCI board of directors meeting, Otto Candies, Jr. announced that OCI had contracted with Halter Marine, Inc. for the construction of a new tug. The board estimated that the tug would cost approximately $3,000,000 and that the new tug's linkage system, engines and deck machinery would cost an additional $1,000,000 to $2,000,000 over the contract price with Halter Marine, at a *746 total projected cost of approximately $5,000,000.[122]
In fiscal year 1993, Halter Marine delivered the new tug, the Kelly Candies. The capitalized cost of the vessel was $3,600,000. The difference between that amount and the originally projected $5,000,000 cost was due to the fact that used equipment, rather than new equipment, was utilized. However, according to the testimony of Otto Candies, Jr., as of April 30, 1991, neither management nor Halter Marine expected the use of used equipment.[123] Therefore, as of the end of fiscal year 1991, management reasonably estimated that the projected expense for the construction of the Kelly Candies tug body, engines, linkage system and deck machinery would be approximately $5,000,000.[124]
Offshore Pipelines, International Tugs
In April, 1991, OCI was considering purchasing two tugs from Offshore Pipelines, International ("OPI") which had been previously owned by OCI.[125] The minutes of the April 19, 1991, board of directors meeting indicate that OCI was willing to trade services and forgive accounts receivable in exchange for the tugs.[126] Paul Candies explained that by selling the two vessels, OPI "wanted to free up capital to do other things and have someone else do their marine transportation work."[127] OCI management concluded that purchasing the vessels would provide OCI with a valuable opportunity to work with OPI in West Africa.[128] Accordingly, as of the end of the 1991 fiscal year, management anticipated purchasing the vessels for up to $1,500,000 each.[129]
On October 5, 1991, OPI sent OCI a draft purchase agreement for the two tugs stating a total purchase price of $3,800,000.[130] OPI's offer was more than OCI was willing to pay for the tugs and, consequently, OCI decided against purchasing the vessels. Another buyer ultimately purchased them for $3,800,000.[131]
Freeport Sulphur Tankers
In April 1992, Sonny Launey of Freeport contacted Otto Candies, Jr. to inquire about the companies' interest in a ten-year contract to move sulphur from a new discovery site to Port Sulphur, Louisiana.[132] The companies' minutes from their April 20, 1992, board of directors meetings, as well as management's notes regarding the project, indicate that it was estimated that this venture would require a $10,000,000 investment.[133] In order to satisfy its obligations *747 under the contract, management planned to use existing tugs and build two new barges. The Candies met with representatives of Freeport on numerous occasions to discuss the details of the project.[134] According to the testimony of both the Candies and Foster Duncan, senior vice-president of Freeport, Freeport viewed its discussions with the companies as serious and told the companies that they were a strong candidate for the project.[135] As of April 30, 1992, management was committed to going forward with the project if the companies were awarded the project.[136] However, ultimately, Freeport decided not to pursue the project with OCI, opting instead to build two of its own barges for this project.[137]
Lykes Brothers Steamship Company Joint Venture
In early 1990, Lykes Brothers Steamship Company ("Lykes Brothers"), a company that owned and operated cargo ships, was considering converting some of its cargo ships into barges in order to render them more profitable. Beginning in early October, 1991, Lykes Brothers began discussions with OCI about a joint venture under which OCI would provide new or converted tugs to transport these barges.[138] The joint venture that was envisioned by OCI management, after considerable research on the available options, involved the construction of tugboats using integrated tug-barge systems with special linkage rather than conventional towing systems.[139] The cost of these vessels was estimated to be approximately $5,000,000 each.[140]
By the end of fiscal year 1992, OCI's management expected that at least two vessels would be constructed and that a minimum investment of $10,000,000 was anticipated.[141] Through its discussions with Lykes, management further believed, as of the end of fiscal year 1992, that OCI had a good chance of doing the project with Lykes.[142] Ultimately, however, Lykes did convert two of its vessels into barges but the joint venture between OCI and Lykes was not established.[143]
American Gulf Shipping
Beginning in the late 1980s, the companies began pursuing a business relationship with American Gulf Shipping, Inc. ("AGS"). AGS owned and operated several vessels that transported grain, commodities, and other bulk cargo.[144] The companies were interested in a relationship with AGS because they wanted to expand their *748 bulk cargo transportation business in order to mitigate their dependence on the oil and gas industry.[145] Management was aware that AGS was approximately $5,000,000 in debt to other creditors. Therefore, in an effort to build a lasting business relationship with AGS, OCI's management agreed that AGS would not pay for towing services performed by OCI and that AGS would accrue a significant accounts payable balance to OCI.[146] As Paul Candies explained, "This way, they could take the revenues they were generating from the work we were doing at that time and pay off [their] debt."[147]
As of April 30, 1992, management was committed to providing AGS with accounts receivable funding up to $5,000,000 for the next fiscal year, while AGS used its revenues to pay off other pre-existing debts.[148] In March 1993, OCI had accrued receivables from AGS of over $5,000,000. OCI transferred that balance to CTI. On March 26, 1993, AGS issued a promissory note to CTI for $5,698,292 which was secured by first mortgages on six AGS vessels.[149]
The relationship between the companies and AGS continued through the 1993 tax year and OCI's business with AGS increased. Because the companies and AGS were involved in a continuing and growing business and because management believed that the grain business had tremendous potential, OCI again committed as of April 30, 1993, to extend accounts receivable financing for an additional $5,000,000 during the 1994 tax year.[150] As of April 30, 1994, OCI's AGS receivable balance was $5,087,121.[151] CTI's note receivable balance was $4,736,246. Eventually, OCI, CTI and AGS entered into a series of transactions which resulted in OCI foreclosing on AGS's vessels in order to receive payment on the companies' outstanding accounts receivable balances.[152]
CSX
This was a joint project for CTI and OCI.[153] In the early 1990s, the rail transport company, CSX, in order to eliminate various inefficiencies associated with the land route alternatives, considered transporting rail cars via the Gulf of Mexico, from Mobile and/or New Orleans to a port in Vera Cruz, Mexico. The rail cars would be transferred using a combination of tugs and barges or self-contained vessels. Under either scenario, the barges or vessels would be specially designed to transport rail cars.[154] CSX, via its consultants, Leo Richardson, Sr., and his son, Leo Richardson, II, contacted the Candies about possible participation in this project.[155] CSX initially wanted OCI and CTI to provide towing or other operating services for the *749 barges or vessels, but OCI and CTI proposed participation in the project on an equity investment basis in that they would build, own, and operate all of the vessels involved. CSX became interested in the companies' proposal.[156]
The minutes from the OCI and CTI board of directors meetings, as well as the various correspondence exchanged between the parties, show that negotiations between management and CSX began around October, 1992, and lasted through February, 1995.[157] Proposals for the transportation of the rail cars ranged from the construction and chartering of one tug-barge vessel to the construction and chartering of as many as four or five tug-barge vessels.[158]
In connection with this project, the companies invested significant time and money in researching all aspects of the construction of the vessels, including obtaining specifications and design drawings, meeting with representatives of CSX both in the United States and Mexico, and contacting financial institutions to discuss the possibility of borrowing funds in excess of the companies available assets.[159] CSX took the companies' proposal to finance, build, and operate the vessels seriously and considered OCI and CTI to be good candidates for the project. As Andrew J. Westhoff, finance director of CSX assigned to the CSX project during the relevant time period, testified:
It truly was a very interesting project but throughout it all the Candies proposals were, in fact still some of the best proposals that we had available. The capacity, their speed seemed to be just what we were looking for.
* * * * * *
[M]y personal conclusion was that they were definitely a viable candidate, yes. They had the expertise we were looking for. They could stand behind these letters they were sending to us. They seemed to be a very reputable company.[160]
As of fiscal years ending April 30, 1993, and April 30, 1994, management expected the full project to involve five tug-barge units or other rail carrier units, each costing approximately $20,000,000.[161] Therefore, as of April 30, 1993, and April 30, 1994, management anticipated a total investment of $100,000,000 and it was fully committed to using as much of the companies' available assets as reasonably possible to make that investment.[162]
According to management, funding for the tug vessels would have been provided by OCI, while funding for the barges would have been provided by CTI. However, since such a project contemplated a very large capital investment, the companies would have exhausted the bulk of their jointly available resources and they would have then had to borrow funds. *750 The anticipated investments for this project were, therefore, allocated proportionately between OCI and CTI based upon the relative available assets of each company during the relevant years.[163] The companies anticipated that they would have to borrow over and above the companies' available assets.[164]
The CSX rail-barge project was never completed. CSX abandoned its consideration of the project in February, 1995, because of the devaluation of the Mexican peso.[165]
Seamar Join Venture
In late 1992, OCI considered a possible joint venture with Seamar, a competitor of OCI, for the possible acquisition of Seamar's fleet of vessels. The minutes of an OCI's board of directors meeting held on November 24, 1992, show that in order for the joint venture or acquisition to proceed, the board estimated that OCI would have to invest $9,800,000 to pay off Seamar's outstanding debt. The evidence presented at trial showed that the project was considered from at least November, 1992 through July, 1993.[166] During that time, OCI loaned Seamar a total of $2,250,000 secured by first mortgages on Seamar vessels. According to Paul Candies, these loans were unrelated to the $9,800,000 investment, but they were made in an effort to further OCI's joint venture/acquisition opportunity with Seamar.[167] As of April 30, 1992, OCI's management was still pursuing the $9,800,000 joint venture/acquisition opportunity and this continued for several months thereafter. Ultimately, the parties were unable to come to terms and Seamar was purchased by another company.[168]
Exxon Land Purchase
This project related to OCI's purchase of 19,000 acres of land located in Lafourche Parish, Louisiana, from Exxon, the companies' first customer. Exxon was still a major client and OCI's management believed that the purchase of the property would further its business relationship with Exxon.[169] As Paul Candies stated, although management did not believe that Exxon would cease doing business with the companies if OCI did not purchase the land, the transaction was nevertheless *751 viewed as an opportunity to "continue to negotiate with Exxon to further enhance our relationship.... [I]t just gave us a better opportunity to work with people that we were already good vendors with."[170]
The testimony of the witnesses, along with the minutes of OCI's board of directors meetings and correspondence between OCI and Exxon, evidence that negotiations between the companies spanned the course of two years beginning in November, 1992, when OCI commissioned an independent appraiser to appraise the land.[171] On January 15, 1993, OCI submitted a bid for $1,700,000.[172] OCI's board of directors was aware that Exxon had appraised the land for $2,400,000 and, at its April 12, 1993 meeting, the board authorized up to $2,400,000 for the purchase of the land.[173] In May, 1994, OCI made an offer to Exxon of $2,300,000.[174] The offer was ultimately accepted and the transaction was consummated in December, 1994.[175] Based on the evidence, the Court finds that as of April 30, 1993, and April 30, 1994, management was committed to spending as much as $2,400,000 to purchase the Exxon land.
KAP Resources Investment
KAP Resources, Ltd. ("KAP Resources") was a Canadian company developing a Chilean copper mine. On April 28, 1994, OCI entered into a private placement subscription agreement to purchase 1,100,261 common shares and 833,531 common shares purchase warrants of KAP Resources for $994,666.[176] It was management's hope and belief that the relationship arising from this investment could lead KAP Resources to charter OCI vessels to transport copper from Chile to the United States. As Paul Candies testified:
Mr. Plant came to us and said he understood that KAP Resources was going to open a Chilean copper mine, was looking for some investment to facilitate that mine, thought that we couldif we became one of the investors in KAP Resources or one of the bigger investors in KAP Resources, we could expand our ocean freight business to transport the copper from either Chile to Canada where they had a processing facility or Chile to the United States where the copper would be processed.[177]
On May 6, 1994, OCI purchased the KAP Resources shares and warrants as outlined in the April 28, 1994, subscription agreement.[178]
Candies-Mott International
On August 10, 1995, OCI and Allen Mott established Candies-Mott International, L.L.C. ("Candies Mott"), of which 60 percent was owned by Mott and 40 percent was owned by OCI. Candies-Mott was established to engage in the vessel brokerage *752 business in Paraguay and, potentially, in other countries.[179] The operating agreement dated October 10, 1995, required OCI to make monthly loans of $30,000 to Candies-Mott for the first twelve months of its operation. According to the terms of the operating agreement, Candies-Mott was to issue a promissory note for each advance and repay the notes with interest at the end of the calendar year. For each subsequent year of Candies-Mott's existence, OCI was to finance Candies-Mott based upon Candies-Mott's expenses for the preceding year.[180]
From August, 1995, to April, 1996, OCI loaned Candies-Mott a total of $270,000 pursuant to the August 10, 1995, operating agreement. Candies-Mott later repaid this amount to OCI.[181] As of April 30, 1996, OCI management expected to fund Candies-Mott for at least another year at the rate of $30,000 per month for a total of $360,000. Otto Candies, III, testified:
At that point in time they had several good projects working. We thought the company was going to continue on at least for another year minimum at that point in time, so we managed to fund itat least the $30,000 a monthfor another year at that point in time.[182]
In fact, after April 30, 1996, OCI funded Candies-Mott for eighteen more months at $30,000 per month. Candies-Mott, however, did not repay any of these additional amounts and, therefore, OCI made no further advances to Candies-Mott.[183]
Paraguay LPG Transportation
This was a joint project for OCI and CTI. In 1995, the companies pursued an opportunity, through Allen Mott of Candies-Mott, to construct, prepare, and operate a towboat and two barges to transport liquefied petroleum gas ("LPG") in Paraguay for Petropar, the government-owned oil company of Paraguay.[184] The project was intended to move LPG from the coast upriver to consumers as Paraguay had no pipeline distribution system.[185]
Project development and discussions between the companies began as early as early as March 10, 1995.[186] In April, 1995, representatives of OCI and CTI traveled to Paraguay and met with Paraguayan cabinet-level officials with whom they discussed this project. They also met with the President of Paraguay.[187] On April 21, 1995, Allen Mott sent a letter to a Paraguayan governmental official on behalf of Otto Candies, Jr. and Otto Candies, III, discussing the details of the project.[188] The April 27, 1995, minutes of the OCI board of directors indicate that the company was pursuing a project for "an LPG barge for Paraguay and additional towboats/barges *753 to work in the Paraguay and Parana river systems."[189]
On May 3, 1995, Allen Mott sent the companies a worksheet setting forth rate calculations and a $10,145,000 capital budget for this project, consisting of $4,000,000 for each of the two new barges, $1,500,000 for one towboat, and $645,000 in transportation costs.[190] According to management, the companies expected to coventure this project. The $10,145,000 capital budget referred to in the May 3, 1995, worksheet was to be allocated between OCI and CTI so that OCI paid for the towboat ($1,500,000) and half of the transportation expenses ($322,500) and CTI paid for the remainder.[191]
Otto Candies, Jr. testified that the figures in the May 3, 1995, worksheet were consistent with the figures that management estimated as of April 30, 1995, just three days earlier. As Otto Candies, Jr. stated:
Q. Mr. Candies, that stipulation of the parties indicates that on May 3, 1995, Mr. Allen Mott sent the companies a worksheet setting forth rate calculations and a $10,145,000 capital budget for this project. Is that consistent with your recollection?
A. It is.
Q. Specifically, the stipulation says the capital budget consists of $4 million for each of two barges, $1.5 million for one towboat, and $645,000 in transportation costs. Is that, sir, consistent with your recollection?
A. It is.
* * * * * *
Q. Can you tell the Court, to the best of your recollection whether those were the numbers the company had in mind as of April 30, some three days earlier?
A. Yes, it is.
Q. Is it consistent with your recollection that those are the numbers that you then had in mind for the Paraguay LPG Transportation Project?
Q. It is.[192]
Otto Candies, Jr.'s testimony was corroborated by that of his son, Otto Candies, III, who similarly testified that as of April 30, 1995, the companies planned to make the $10,145,000 equipment investments detailed on the May 3, 1995, worksheet.[193] To this end, the companies solicited and received blueprints and other design drawings relating to construction of the proposed vessels and the companies spent significant time and effort developing the details of the project.[194] Ultimately, the companies' bid was not accepted as the project was awarded to a South American competitor.[195]
*754 Morrison-Knudsen Tunnel Project
The minutes of a January 16, 1991, CTI board of directors meeting indicate that Morrison-Knudsen Co. ("Morrison-Knudsen") contacted CTI about possibly providing a barge for a tunnel construction project known as the Boston Harbor Tunnel Project.[196] Morrison-Knudsen was interested in hiring CTI for this project because it owned the only available U.S.-flagged submersible barge, the OC-350, and because it had experience in underwater tunnel construction.[197] However, given that there was no dry dock at Boston Harbor, it was necessary to modify the OC-350 in order to perform the work required by Morrison-Knudsen. Specifically, the OC-350's deck space needed to be increased to allow it to lower as many pre-connected tunnel sections as possible into the water at one time. There was also a possibility that stability columns would have to be added to the barge.[198]
The board minutes show that the board planned to offer Morrison-Knudsen the option of either modifying the OC-350 or building a new one for the project and that the board estimated that modifying the existing barge would cost $1,000,000, while building a new barge would cost between $8,000,000 to $10,000,000. CTI made such an offer to Morrison-Knudsen.[199] The project remained under consideration through April 30, 1991, and for several months thereafter.[200]
At a November 26, 1991, board of directors meeting, the board discussed the status of the Morrison-Knudsen project. The minutes indicate that Morrison-Knudsen requested a quote for adding a 50-foot mid-body section to the OC-350 and that management planned to obtain a quote from Trinity Marine in order to respond to Morrison-Knudsen's inquiry.[201] Negotiations continued for several months following and including April 30, 1992.[202]
As of April 30, 1992, CTI was considering various options for lengthening the OC-350 to gain more deck space. Depending upon the option ultimately selected, management still estimated that the modifications would cost as much as $1,000,000. The $1,000,000 option included adding an extra hull and deck section to lengthen the barge and adding stability columns.[203]
On June 1, 1992, CTI and Bethship-Sparrow Point Yard entered into a contract for the OC-350 to haul tunnel sections for the Morrison-Knudsen Boston tunnel project.[204] Immediately thereafter, CTI put the OC-350 in Bollinger shipyard.[205] On September 4, 1992, Bollinger Machine Shop sent OCI a $435,722 invoice for modifications to the OC-350.[206] According to management, the conversion of *755 the OC-350 that was ultimately completed at a cost of $435,722 included less deck space and it was, therefore, less costly than that which was originally contemplated as of April 30, 1991 and April 30, 1992.[207] In fact, it was not until the OC-350 had been sent to the Bollinger Shipyard in June, 1992, that it was decided that the barge would undergo less extensive modifications.[208] As Paul Candies testified:
Q. If the actual invoice from Bollinger Shipyard came in September of 1992, could you tell the Court how long before that a decision was made as to what modifications would be done and how much they would cost, sir?
A. We put the barge in June, so immediately upon decisions being made we put the barge in and put the barge on charter to Morrison-Knudsen and the modification was done there.
Q. As of April 30, 1991, had a decision already been made that only $435,000 in modifications would be done?
A. No.
Q. As of April 30, 1992, had such a decision been made?
A. No.
* * * * * *
Q. As of April 30, 1991 and April 30, 1992, what was the amount that was estimated by management of CTI that would have to be expended to complete the project?
A. $1 million for the barge.[209]
Freeport Phosphoric Acid Barge
In 1992, Freeport McMoRan ("Freeport") contracted with OCI to build and operate a new barge to transport phosphoric acid between Tampa, Florida, and Taft, Louisiana.[210] At an April 20, 1992, meeting, OCT's and CTI's board of directors approved a $7,500,000 budget, consisting of $5,100,000 to build a new barge and the remainder to modify existing equipment for Freeport's phosphoric acid transportation needs.[211] As of April 30, 1992, management anticipated making a total investment of $7,500,000 in the Freeport project.
On May 18, 1992, OCI and McDermott entered into a contract[212] for the construction of a new barge for the price of $5,131,043.[213] OCI began making barge construction progress payments on May 19, 1992, and by the end of October, 1992, *756 OCI had paid McDermott a total of approximately $1,800,000.[214]
After McDermott began building the barge, a dispute arose between McDermott and CTI concerning the progress of construction. Because of the dispute, McDermott stopped work on the barge, OCI stopped making progress payments, and the Freeport contract was cancelled.[215]
On January 14, 1993, McDermott filed a petition for declaratory judgment against OCI in the 16th Judicial District Court, Parish of St. Mary, Louisiana. McDermott sought $4,900,000 in damages.[216] As of April 30, 1993, OCI's financial statements reflect that management estimated that it might need to pay a $4,900,000 judgment in the McDermott litigation.[217] As of April 30, 1994, OCI's financial statements reflect that management estimated that it might need to pay a $5,454,000 judgment in the McDermott litigation.[218] On January 8, 1996, the lawsuit was finally settled with CTI paying McDermott $6,750,000.[219] From April 30, 1994, through the settlement of the lawsuit, management believed that it was necessary to retain assets to satisfy any judgment rendered against OCI.[220]
Cargill Ammonia Barge
In late 1992 or early 1993, Cargill contacted the companies to charter a barge to move ammonia from Tampa, Florida, to ports in New Orleans, Louisiana, Port of Spain, Trinidad, and Coatzacoalcas, Mexico.[221] The March 1, 1993, board of directors minutes of OCI and CTI mentioned Cargill's interest in chartering an ammonia barge and further discussed the possibility of converting or building such a barge.[222] In connection with this project, CTI engaged in numerous discussions with Design Associates, Inc., Trinity Marine Group, and Northstar Marine Services to develop a design and specifications for the ammonia barge.[223] It also solicited architectural drawings and operating cost estimates relating to the barge construction which estimates were submitted as part of its bid.[224] On March 18, 1993, Otto Candies, Jr. sent a fax to Cargill attaching assumptions relating to the barge characteristics and estimating that such a barge would cost $13,000,000.[225] According to the testimony of Otto Candies, Jr., CTI's bid of *757 March 18, 1993, was outstanding as of April 30, 1993, and discussions with Cargill continued for several months thereafter.[226] The project, however, was ultimately not awarded to CTI.
Project Summary
Based on his review of documents and information related to dozens of potential projects that were considered for investment by OCI and CTI, as well as his discussions with management of the companies regarding those projects, Mr. Odom determined that each of the above-described projects involved real business opportunities that the companies pursued with serious interest and attention and that all of them were viable and outstanding as of the end of one or more years in question.[227] Consideration of the projects generally required a significant time commitment by management and in some instances the investment of funds for vessel specifications and marine architectural drawings. The potential projects are summarized as follows, together with the amount of investment that would have been required to complete each such project:
*758
-----------------------------------------------------------------------------------------------------------------------------
| | 4/30/91 | 4/30/92 | 4/30/93 | 4/30/94 | 4/30/95 | 4/30/96 |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| OCI | | | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| American Gulf | $ | $5,000,000 | $5,000,000 | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Gardinier Sulfur Barge | $ 5,000,000 | | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Freeport Sulphur Tankers | | $10,000,000 | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| OPI | $ 3,000,000 | | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Lykes Brothers | | $10,000,000 | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Freeport New Discovery | $14,850,000 | | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Seamar | | | $9,800,000 | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| CSX | | | $71,000,000 | $68,000,000 | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Exxon Land | | | $ 2,400,000 | $ 2,400,000 | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Hall-Houston | $ 5,000,000 | | | | $4,000,000 | $3,900,000 |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| KAP Resources | | | | $ 994,666 | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Candies-Mott | | | | | | $ 360,000 |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Paraguay LPG | | | | | $1,822,500 | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| MSRC | $75,600,000 | | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Totals - OCI | $103,450,000 | $25,000,000 | $88,200,000 | $71,394,666 | $ 5,822,500 | $ 4,260,000 |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| | | | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| CTI | | | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Morrison-Knudson | $1,000,000 | $ 1,000,000 | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Freeport Phosphoric Acid | | $ 7,500,000 | $ 4,900,000 | $ 5,454,000 | $ 5,454,000 | |
| Barge | | | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| MSRC | $29,400,000 | | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| CSX | | | $29,000,000 | $32,000,000 | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Cargill | | | $13,000,000 | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Freeport New Discovery | $15,400,000 | | | | | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Paraguay LPG | | | | | $ 8,322,500 | |
|----------------------------|----------------|---------------|---------------|---------------|---------------|---------------|
| Totals - CTI | $45,800,000 | $ 8,500,000 | $46,900,000 | $37,454,000 | $13,776,500 | |
-----------------------------------------------------------------------------------------------------------------------------
Significantly, defendant offered no direct evidence at trial which would contradict evidence offered by plaintiffs that they had legitimate business reasons to invest in the projects previously identified. Furthermore, defendant did not contradict plaintiffs' evidence regarding their plans to use their accumulated funds to invest in those projects.
Working Capital
The companies also required working capital which would be used in day-to-day operations.[228] As Dr. Blaydon explained, working capital is used to cover the time lag between when a company's expenses must be paid and when the company receives payment from its customers for the goods or services provided.[229] According *759 to management, having sufficient working capital is important for the companies given that both OCI and CTI sometimes use their billing cycle as a competitive tool, offering customers the ability to defer payments.[230] During the years in question, management believed that the companies needed, on a combined basis, between $12,000,000 and $20,000,000 for both working capital and unanticipated special projects that might arise during the coming year.[231]
At the request of plaintiffs' counsel, Dr. Blaydon calculated the amount of working capital that he would have recommended each of the companies have available at the end of each year at issue. Dr. Blaydon used historical data to calculate the number of days needed to turn over both accounts receivable and accounts payable, subtracting the payables cycle from the receivables cycle, and multiplying the resulting total operating cycle by annual operating expenses.[232] By adding one standard deviation to the relevant expenses, this annual amount was adjusted to account for industry volatility.[233] This formula resulted in the following projected working capital needs:
1991 1992 1993 1994 1995 1996
OCI $4,000,000 $4,500,000 $5,200,000 $7,200,000 $7,000,000 $7,100,000
CTI $ 400,000 $ 800,000 $1,000,000 $1,300,000 $1,500,000[234]
Defendant did present direct evidence in opposition to plaintiffs' working capital claim. That evidence, however, demonstrates that in some fiscal years, the differences between the plaintiffs' and the defendant's amount of required working capital are relatively insignificant. Defendant concedes that the companies had a reasonable business need to retain the following amounts for working capital:
1991 1992 1993 1994 1995 1996
OCI $3,951,000 $4,218,000 $4,647,000 $6,285,000 $6,596,000 $5,824,000
CTI $ 285,000 $ 143,000 $ 153,000 $ 208,000 $ 259,000[235]
The above figures represent amounts identified by defendant's expert witness, Dr. Raymond Ball, who was asked to analyze plaintiffs' working capital needs. Dr. Ball is a professor of accounting at the University of Chicago's graduate school of *760 business who qualified as an expert in accounting as well as financial statements analysis, cash flow needs analysis, and working capital needs analysis.[236]
Dr. Ball conducted an analysis using composite data gathered from a group of companies that he deemed comparable to OCI and CTI. The companies Dr. Ball relied upon included companies in the stevedoring, marina, yacht basin, and log rafting businesses, as well as companies offering swamp buggy rides. Dr. Ball was unable to list characteristics which those companies shared with OCI and CTI, except to say that they were all involved in water transportation and had similar operating cycles.[237] Dr. Ball did not use OCI's and CTI's own data. He did not research the nature and purpose of the companies' activities before choosing comparable firms and he did not inquire whether his selected comparable companies experienced financial and economic conditions like those experienced by the companies.[238] Finally, instead of conducting a separate billing cycle analysis for each year, Dr. Ball applied a single average billing cycle, including aggregate data from 1991 through 1996, in order to estimate the working capital needs of OCI and CTI for each year.[239]
In considering the testimony of both experts, the Court finds that Dr. Blaydon's working capital analysis provides a basis for determining the reasonable working capital needs of OCI and CTI at it uses the companies' own data and it takes into consideration the unique aspects of the companies' operations. Dr. Ball's analysis provides a basis for determining the working capital needs of OCI and CTI based upon data from a group of companies having little in common with OCI and CTI. Dr. Ball's analysis, therefore, does not reliably determine the companies' working capital needs in each year and the Court will not rely on his analysis in arriving at its decision.
Shareholder Redemption
It has always been important to the Candies that the companies remain closely held entities. To that end, on November 1, 1990, the companies and their shareholders entered into stock redemption agreements that obligated the companies to redeem all shares tendered by a deceased shareholder's family.[240] Management, therefore, believed it was necessary for the companies to retain sufficient funds to redeem a shareholder, if such a situation arose, in any given year.[241]
Dr. Blaydon testified as to the amount of funds he would have advised OCI and CTI to maintain for this redemption prospect. Using valuations of the companies conducted in 1990 and 1993, Dr. Blaydon multiplied the most recently available valuation for a given tax year by the fraction of stock held by the largest shareholder (i.e., 33%).[242] Dr. Blaydon concluded that he would have recommended that the companies retain the following amounts for shareholder redemption:
*761
1991 1992 1993 1994 1995 1996
OCI $5,300,000 5,300,000 5,300,000 15,900,000 15,900,000 15,900,000
CTI $1,200,000 1,200,000 1,200,000 8,100,000 8,100,000[243]
Defendant presented no direct evidence at trial which contradicted the amounts recommended by Dr. Blaydon or the evidence presented by plaintiffs concerning their need to accumulate such funds for shareholder redemption.
Total Business Needs
In sum, plaintiffs conclude that OCI and CTI had reasonable business needs to accumulate the following amounts during the years in question:
1991 1992 1993 1994 1995 1996
OCI Fleet replacement $39,800,000 $42,900,000 $48,400,000 $49,000,000 $57,400,000 $37,200,000
Projects 103,450,000 25,000,000 88,200,000 71,394,666 5,822,500 4,260,000
Working capital 4,000,000 4,500,000 5,200,000 7,200,000 7,000,000 7,100,000
SH redemption 5,300,000 5,300,000 5,300,000 15,900,000 15,900,000 15,900,000
TOTAL $152,550,000 $77,700,000 $147,100,00 $143,494,666 $86,122,500 $64,460,000
CTI Fleet replacement 11,900,000 12,200,000 12,600,000 15,100,000 16,500,000
Projects 45,800,000 8,500,000 46,900,000 37,454,000 13,766,500
Working capital 400,000 800,000 1,000,000 1,300,000 1,500,000
SH redemption 1,200,000 1,200,000 1,200,000 8,100,000 8,100,000
TOTAL $59,300,000 $22,700,000 $61,700,000 $61,954,000 $39,866,500[244]
Companies' Available Assets
Plaintiffs also presented evidence regarding the assets that the companies had available during the years in question to meet their quantified business needs. Plaintiffs contend that not all of the assets on the companies' books as of the end of each year in question were available for distribution to shareholders or to meet the identified business needs. Assets already employed in the companies' business, such as real estate used in operations, vessels and related support equipment, and investments in affiliates, customers, suppliers, and joint venturers, were investments made to benefit the companies and were, therefore, unavailable to meet business needs or to be distributed.[245] Paul Candies testified as to the details of each investment which plaintiffs identified as unavailable and the defendant contradicted none of that testimony.[246]
Plaintiffs' counsel asked Dr. Blaydon to calculate the amount of assets available to meet the companies' needs in each year in question. Dr. Blaydon examined six categories of potentially available assets.[247] Assets which Dr. Blaydon classified as available were those assets that if liquidated, distributed, or used to meet reasonable business needs of the companies, would not significantly impair the core operations of the businesses.[248] Assets that were being used for purposes related to *762 maintaining or growing the core businesses were not considered available.[249] As Dr. Blaydon explained, the marine vessels and the companies' land used for office space, although corporate assets, were not available to meet the business needs of the companies.[250]
Dr. Blaydon analyzed six categories of potentially available corporate assets reflected on the companies' balance sheets.[251] Dr. Blaydon classified (1) cash and marketable securities as available; (2) business-related investments in public securities, such as stock of publicly traded companies, as available;[252] (3) other current assets net of liabilities as available; (4) capital financing and other less liquid investments unrelated to the companies' core marine transportation operations as available; (5) private investments related to the companies' core business, such as investments in privately held oil and gas companies like Hall-Houston, as not available; and (6) investments in subsidiaries and related entities as not available.[253]
This analysis led to the following net available assets totals:
1991 1992 1993 1994 1995 1996
OCI $41,100,000 40,400,000 42,900,000 41,500,000 33,500,000 35,800,000
CTI $15,100,000 19,600,000 16,900,000 20,200,000 21,000,000[254]
The classifications employed by Dr. Blaydon were confirmed by the testimony of Paul Candies.[255] Defendant offered no direct evidence contradicting the plaintiffs' evidence regarding their available assets. The only challenges by defendant to Dr. Blaydon's assessment of available assets relate to a few of OCI's business related private investments which Dr. Blaydon classified as unavailable. Specifically, defendant avers that OCI's investments in KAP Resources, Hall-Houston and Bollinger Quick Repair were unrelated to OCI's business and, therefore, should have been considered available to meet the reasonable business needs of the companies.[256] After hearing the testimony of Dr. Blaydon as corroborated by that of Paul Candies, the Court is satisfied that those investments were sufficiently related to the companies' core business in that they either secured or had the potential of securing a significant amount of work for the companies as in the case of the investments in Hall-Houston and KAP Resources.[257] As in the case of the investment *763 in Bollinger Quick Repair, Inc., the investments also provided the companies with services directly linked to their operations.[258]
Cyrus J. Fanguy, the IRS agent who audited plaintiffs' tax returns, testified regarding the findings and calculations which led to the imposition of accumulated earnings taxes on OCI and CTI for the years in question. Significantly, Mr. Fanguy testified that his sole reason for concluding that the companies had improperly accumulated earnings in excess of the reasonable needs of the business was a lack of sufficient information about the companies' business needs and available assets.[259] After hearing the testimony of Mr. Fanguy, the Court is of the opinion that Mr. Fanguy was simply not provided with all the testimony and evidence presented at trial and, therefore, he lacked the necessary information to make the appropriate calculations.
Shareholders' Motivation for Retaining Earnings
The Candies family members testified that to the extent that management retained earnings and profits and did not pay dividends to shareholders prior to or during the years in question, they did so to meet the reasonable business needs identified above.[260] As Otto Candies, Jr. stated:
We needed the money in the business because if ever business started again we needed our money to move quickly. We need to be a viable competitor. We had to keep our fleets modern. We had to keep our company together.[261]
Otto Candies, Jr.'s testimony was corroborated by that of Paul Candies who testified that the sole motivation for retaining funds in the companies was to preserve the assets of the business for future operations and expansion.[262] These practices were not motivated to avoid income tax. The Candies family members all testified that after having weathered the industry downturn of the 1980s and having witnessed the disappearance of competitors and other industry members from the market as their businesses failed, the companies' management was especially mindful during the years in question that the companies could only survive through prudent and conservative decision making.[263]
Mr. Odom evaluated what the financial and operating impact on the companies would have been had they distributed the assets that defendant alleges were improperly accumulated. His analysis showed, *764 for example, that OCI's net available assets to meet business needs at the end of the 1996 fiscal year would have dropped from $34,600,000 to $8,800,000 if OCI had distributed the earnings that defendant alleges were improperly accumulated from 1991 through 1996. CTI's net available assets to meet business needs would have similarly dropped from $21,000,000 to $4,900,000 from 1991 to 1995.[264] Mr. Odom concluded that such distributions would have significantly weakened the companies, impaired their reputation such that certain business opportunities might no longer be available to them, and "lessened [the companies'] prospects for survival."[265] Mr. Odom also concluded that the companies "would have had a problem replacing their vessel fleet because vessels are expensive and they would not have had the cash to do that."[266]
From time to time, OCI also made loans to one or more shareholders, never proportionate to their interest in the companies, which were collateralized and accrued interest. OCI had the ability to demand repayment at any time and some payments have been made.[267] The Candies family members testified that OCI made these loans, rather than paying dividends, because management wanted to be assured that it could get the money back whenever it might be needed for the business.[268] During the course of business, OCI management also used corporate funds to pay for business related expenses, including expenses to entertain business contacts.[269] From time to time, some of these expenses were personal expenditures which were charged to OCI.[270] However, management testified that OCI had an established procedure for ensuring that shareholders and other employees were charged back for personal expenses that were initially charged as a business expense.[271] Any personal items not properly charged back to the shareholders were inadvertent bookkeeping errors.[272] This testimony was uncontroverted by the defendant and the Court found the testimony of management to be credible in this regard.
II.
This Court has jurisdiction pursuant to 28 U.S.C. § 1346 and 26 U.S.C. § 7422 as this is a lawsuit seeking refund of federal taxes, penalties and interest assessed and collected by defendant, the United States of America. Venue is proper in the Eastern District of Louisiana pursuant to 28 U.S.C. § 1402(a)(2) inasmuch as OCI and CTI are corporations having their principal place of business within this district.
This case is governed by the provisions of 26 I.R.C. §§ 531 through 537 of the United States Code. 26 I.R.C. §§ 531 through 537 provide for the assessment of *765 accumulated earnings tax on a corporation "formed or availed of for the purpose of avoiding the income tax with respect to its shareholders by permitting earnings and profits to accumulate instead of being divided or distributed." 26 I.R.C. § 532(a). A corporation is not subject to an accumulated earnings tax "if its accumulations are required for the `reasonable needs of the business.'" 26 I.R.C. § 535(c)(1); J.H. Rutter Rex Mfg. Company, Inc. v. Commissioner of Internal Revenue, 853 F.2d 1275, 1278 n. 4 (5th Cir.1988)("26 I.R.C. §§ 531-537, impose an accumulated earnings tax on that portion of the earnings of a corporation that has been accumulated in excess of the corporation's `reasonable business needs' for the purpose of avoiding the taxation of those amounts as dividends in the hands of the corporation's shareholders"). Therefore, there are two elements to the assessment of the tax: (1) accumulation of earnings and profits beyond the reasonable needs of the corporation, and (2) an intent to avoid shareholder taxes. J.H. Rutter Rex Mfg. Company Inc., 853 F.2d at 1285. In an action for refund of accumulated earnings taxes, the taxpayer bears the burden of proving the reasonable needs for its accumulations and the absence of the proscribed purpose. EMI Corporation v. Commissioner, 50 T.C.M. (CCH) 569, 583 (1985); King v. United States, 641 F.2d 253, 259 (5th Cir. 1981). Further, the Court notes that insofar as "the accumulated earnings tax is a penalty tax paid in addition to the regular tax on corporate earnings, it is to be strictly construed." Rutter Rex, 853 F.2d at 1286.
In order to determine whether a corporation is subject to accumulated earnings tax, the Court must conduct a three part analysis. First, the reasonable needs of the business are determined. 26 I.R.C. § 537; EMI Corporation, 50 T.C.M. (CCH) at 582; Salley v. United States of America, 1976 WL 1157, *6-7 (W.D.La. Mar. 18, 1976). As will be discussed below, the reasonable needs of a corporation include "both its present day-to-day operating needs (which is referred to as `working capital' needs) and its reasonably anticipated future needs." Salley, 1976 WL 1157 at *6. After the reasonable needs of the business are determined, that amount "must then be compared with the funds that the corporation actually has available to meet these needs." Id. at *7. Available funds are those funds reflected in net liquid assets that are unrelated to the taxpayer's business.[273]Id. at *12; EMI Corporation, 50 T.C.M. (CCH) at 583. Therefore, assets which are liquid but business related are not considered assets that are available to meet the reasonable needs of the business. Hughes, Inc. v. Commissioner, 90 T.C. 1, 22-24, 1988 WL 65 (1988). Further, to the extent that previously accumulated earnings and profits in the form of liquid assets from prior years are sufficient to meet the corporation's reasonable needs for the year, current earnings are excess and are deemed to be distributable. Rutter Rex, 853 F.2d at 1285.
If, after making the above stated comparison, the corporation has more funds or accumulated earnings available than it has business needs, this excess is subject to the accumulated earnings tax. Salley, 1976 WL 1157 at *7. On the other hand, "if the corporation has less funds available than it has needs for, there is no accumulated earnings tax due." Id.
*766 Various treasury regulations have been promulgated pursuant to "26 I.R.C. § 537 to provide a framework for evaluating the reasonable needs of a business." Rutter Rex, 853 F.2d at 1286. Treas. Reg. § 1.537-(1)(a)[274] provides in pertinent part:
An accumulation of the earnings and profits (including the undistributed earnings and profits of prior years) is in excess of the reasonable needs of the business if it exceeds the amount that a prudent businessman would consider appropriate for the present business purposes and for the reasonably anticipated future needs of the business.
An accumulation to provide necessary working capital for the business constitutes a reasonable present business need. Treas. Reg. § 1.537-2(b)(4). Working capital "is the money a corporation needs to survive on a day-to-day basis and would include money to buy raw materials, to pay for labor costs, and to cover overhead costs." Rutter Rex, 853 F.2d at 1286 n. 14. "Reasonably anticipated future needs of a business are those beyond the day-to-day working capital needs of a business" and include, among others, the need (1) to provide for bona fide expansion of business or replacement of plant; (2) to acquire a business enterprise through purchasing stock or assets; and (3) to provide for investments or loans to suppliers or customers if necessary in order to maintain the business of the corporation.[275]Rutter Rex, 853 F.2d at 1286; Treas. Reg. § 1.537-2(b).
Treas. Reg. § 1.537-1(b)(1) further provides that in order to qualify as a reasonably anticipated business need, a corporation must have specific, definite, and feasible plans for the use of the accumulation. The accumulation, however, does not have to "be used immediately, nor must the plans for its use be consummated within a short period after the close of a taxable year." Treas. Reg. § 1.537-1(b)(1); Rutter Rex, 853 F.2d at 1292. Further, in a closely held corporation, it is not necessary that the plans be memorialized in formal corporate minutes. Salley, 1976 WL 1157 at *10; EMI Corporation, 50 T.C.M. (CCH) at 582. Rather, "[t]he test is whether the taxpayer['s] intent to undertake the plan is manifested by some `substantial active move toward implementation,' such as incurring expenditures to further the plan." Rutter Rex, 853 F.2d at 1292 (citing Motor Fuel Carriers, Inc. v. Commissioner, 559 F.2d 1348, 1352 (5th Cir.1977); see also, Hogg's Oyster Company, Inc. v. United States, 676 F.2d 1015, 1018 (4th Cir.1982))("[S]ome steps must have been taken toward [the plan's] realization"); Battelstein Investment Company v. United States, 302 F.Supp. 320, 327 *767 (S.D.Tx.1969), aff'd, 442 F.2d 87 (5th Cir. 1971)("[Plans] must be manifested by a contemporaneous course of conduct").
When determining the reasonably anticipated needs of the business, one must look to the facts as they existed at the close of the taxable year. Treas. Reg. § 1.537-1(b)(2). Hindsight cannot be used against the taxpayer. Id. In determining whether a reasonably anticipated need of the business existed at the close of any given taxable year, "subsequent events shall not be used for the purpose of showing that the retention of earnings or profits was unreasonable at the close of said taxable year." Id. Subsequent events, however, "may be considered to determine whether the taxpayer actually intended to consummate or has actually consummated the plans for which the earnings and profits were accumulated." Id.
Whether a corporation's "accumulation of earnings and profits is in excess of the reasonable needs of its business is a question of fact." Rutter Rex, 853 F.2d at 1285. In determining the reasonable needs of the business for purposes of the accumulated earnings tax, the courts must give great deference to the business judgment of corporate management. Id. at 1285-86; Knight Furniture Co., Inc. v. Commissioner, 81 T.C.M. (CCH) 1069, 1074 (2001)("[D]etermining the reasonable needs of a business is, in first instance, a question for the officers and directors of the corporation. Courts should be hesitant to substitute their judgment and attribute tax-avoidance motive unless the facts and circumstances clearly warrant the conclusion that the accumulation of earnings and profits was unreasonable"); Thompson Engineering Co. v. Commissioner, 751 F.2d 191, 197 (6th Cir.1985). As the Fifth Circuit in Rutter Rex held, the "[d]etermination of a corporation's reasonable business needs is properly left to the corporation's management since they are most familiar with the complexities and makeup of their corporation and its business." Rutter Rex, 853 F.2d at 1285
Furthermore, a Court should not question the business judgment of corporate management's business decision to finance its operations without incurring debt. As the Fifth Circuit in Rutter Rex stated:
The laws do not force [a corporation] to turn to available commercial financing. The decision not to rely on credit is up to the business judgment of corporate management. The IRS and the courts have no power to substitute their judgment for the valid business judgment of corporate management to operate without extensive borrowing. This is true even though the corporation may have the ability to obtain favorable outside credit.
853 F.2d at 1285 (citations omitted); see also Shaw-Walker Co. v. Commissioner, 390 F.2d 205, 213 (6th Cir.1968)("The fact that a taxpayer has financed its growth from retained earnings rather than from the sale of additional stock or commercial borrowing `should not place it in a position of being subjected to a penalty tax under Section 531'"); Knight Furniture, 81 T.C.M. (CCH) at 1076 ("Once an expenditure is deemed to be a reasonable need of the business, that a corporation chooses to finance the expenditure from earnings and profits rather than from debt should not place the corporation in a position of being subjected to the accumulated earnings tax").
In Rutter Rex, the Fifth Circuit concluded that Rutter Rex's "legally acceptable aversion to borrowing," coupled with the nature of its business, "demanded that [Rutter Rex] accumulate substantial capital in order to tide the company over during lean years." Rutter Rex, 853 F.2d at 1294. As a result, the Fifth Circuit determined that the accumulation of earnings *768 and profits to protect against certain potential future adverse business contingencies was a reasonably anticipated future need of the business within the meaning of 26 I.R.C. § 537. Id. at 1294.
As Treas. Reg. § 1.537-2(b) makes clear, the accumulation of earnings for "bona fide expansion of business or replacement of plant" is a reasonable business need. Therefore, capital accumulations are permissible for fleet replacement. See W.L. Mead, Inc. v. Commissioner, 34 T.C.M. (CCH) 924, 931 (1975)(long term accumulations justified pursuant to existence of periodic, but regular, plan of truck fleet replacement). Where a company has a history of growth and modernization, it need not always set aside a specific sum to achieve a specific goal. John P. Scripps Newspapers v. Commissioner, 44 T.C. 453, 457, 1965 WL 1175 (1965); Salley, 1976 WL 1157, at *11. Specific and definite plans may be evidenced by a history of expansion and a policy of continued growth. Salley, 1976 WL 1157 at *12 ("[T]he expansion history of the corporation should play an important role in determining whether it should be allowed to accumulate funds for expansion. A strong history of expansion is a positive indication that a corporation intends to continue expanding in the future); Bremerton Sun Publishing Co. v. Commissioner, 44 T.C. 566, 584, 1965 WL 1186 (1965).
The knowledge and experience of the taxpayer is given great deference by the Court, particularly with respect to the company's plans for expansion. In C.E. Estes, Inc. v. Commissioner, 41 T.C.M. (CCH) 354 (1980), the court relied on the taxpayer's statements as to its plans to expand its fleet of trucks in finding that the taxpayer was reasonable in accumulating earnings and profits:
In 1974 the cost of a custom trailer was $8,000. Through his experience in the trucking industry Estes knew in 1974 that at least 20 of the trailers purchased in 1968 and 1969 would have to be replaced within the next few years at a cost of at least $160,000. It was also his experience that at about the same time two tractors would need replacement at a cost of at least $50,000. Thus, during fiscal 1974, petitioner was aware that within two to three years a cash outlay of at least $210,000 would be required. By 1975 custom trailer costs had risen to $10,000 per unit and tractors had increased to a price of $34,000 each. As a result, in fiscal 1975 petitioner revised its estimated cost to replace these items up to $268,000. Petitioner's plans to acquire this equipment were not vague or uncertain. They were believed to be necessary if petitioner was to remain in the business of hauling Celanese products and for the expansion of leasing operations.
Estes' statements of petitioner's plans to purchase tractors and trailers are of particularly great weight since petitioner actually did expend $200,200 on new trailers in 1977, $96,000 on new tractors ordered in 1978, and $130,000 on more trailers in 1979.
* * * * * *
Based on the foregoing discussion, we hold that it was reasonable for petitioner to accumulate earnings for fiscal year 1974 in the amount of $210,000, and for 1975 in the amount of $268,000 for equipment needs.
Id. at 357-58, 1980 WL 4330.
As the Fifth Circuit has stated,
With regard to plans for expansion, modernization, diversification, replacement of equipment, and similar business needs, the relevant inquiry is whether the company's plans appear to have been a real consideration during the tax year in question rather than simply an afterthought to justify the challenged *769 accumulations ... In order for such plans to be specific and definite, however, the taxpayer corporation need not have formal blueprints for action.
The test is whether the taxpayer intent to undertake the plan is manifested by some substantial active move toward implementation, such as incurring expenditures to further the plan.
Rutter Rex, 853 F.2d at 1292 (citations and quotations omitted).
The various projects considered by OCI and CTI during the years in question, those being part of the companies' core operations and plans for economic expansion, are subject to the same legal standards discussed above for fleet replacement. See Rhoades Oil Company v. Commissioner, 50 T.C.M. (CCH) 294, 307, 311-12 (1985). To the extent that plans to invest in each of the claimed projects were specific, definite and feasible, they constitute a reasonably anticipated need of the companies for which funds may be accumulated. Treas. Reg. § 1.537-1(b)(1); see also, EMI Corporation, 50 T.C.M. at 587-88 ("A corporation may reasonably accumulate earnings to fund an expansion of its business").
"Redemption of stock of a minority shareholder is a valid business purpose, and funds retained for such a purpose are retained for the reasonable needs of a corporation's business." Oman Construction Co., Inc. v. Commissioner, 24 T.C.M. (CCH) 1799, 1810 (1965); EMI Corporation, 50 T.C.M. (CCH) at 588. Funds may be reserved to meet future redemption obligations long in advance of the actual circumstances triggering the redemption where a company is bound to make future redemptions pursuant to a stock purchase agreement. EMI Corporation, 50 T.C.M. at 588-89.
A corporation may also reasonably accumulate earnings as a reserve against some contingent liabilities which would include potential legal liabilities. Id. at 586-87, 1985 WL 15007.
Finally, even if the above determinations show an excess so that accumulated earnings tax is due, the taxpayer is not liable for the tax if it shows "by the preponderance of the evidence that tax avoidance was not `one' of the motives for retaining an `excess' accumulation." Salley, 1976 WL 1157 at *7; 26 I.R.C. § 533(a). "It is not necessary that tax avoidance be the dominant, or sole motive." Salley, 1976 WL 1157 at *7 (citing U.S. v. The Donruss Company, 393 U.S. 297, 308, 89 S.Ct. 501, 507, 21 L.Ed.2d 495 (1969)). "[T]he taxpayer must show a complete lack of the proscribed motive." EMI Corporation, 50 T.C.M. at 583. 26 I.R.C. § 533(a) creates a presumption of tax avoidance motive if the corporation's accumulations are unreasonable. Such presumption is determinative "unless the corporation by the preponderance of the evidence shall prove to the contrary." 26 I.R.C. § 533(a); Rutter Rex, 853 F.2d at 1285 n. 13.
Considering the above criteria, the Court now turns to an application of the law to the facts of this case. As stated above, in order for plaintiffs to recover, they must prove that (1) the companies did not unreasonably accumulate earnings or (2) that if they did, the companies did not do so to avoid taxes with respect to their shareholders.[276] 26 I.R.C. § 533.
*770 Applying the provisions of 26 I.R.C. §§ 531-537, as interpreted by the relevant Treasury Regulations, and case-law to the particular facts of this case, the Court finds that plaintiffs have met their burden of proving that they had reasonable business needs to accumulate the amounts identified by their experts for fleet replacement, project funding, working capital, potential legal liabilities, and shareholder redemption. Furthermore, the Court finds that the companies had specific, definite, and feasible plans for using the accumulations for those business needs. The Court heard the testimony of the Candies family members (i.e. the companies' management) and it finds that testimony to be credible. The Candies' testimony was corroborated in important respects by the testimony of disinterested third-party witnesses, by a considerable volume of documentary evidence, and even, in one important respect, by defendant's own expert, Captain Underhill, who acknowledged the companies' need to accumulate as much as $100,000,000 for fleet replacement.
The entire record is compelling in that it demonstrates the many valid business reasons which caused the companies to retain funds and the companies' specific, definite, and feasible plans to use the retained funds for those valid business needs. The actions of the companies, both during the years in question and thereafter, further illustrate the truthfulness of testimony regarding the intent of the companies' management. A thorough review of the evidence and testimony presented at trial clearly establishes that OCI and CTI were not "formed or availed of for the purpose of avoiding the income tax" with respect to their shareholders "by permitting earnings and profits to accumulate instead of being divided or distributed." 26 I.R.C. § 532(a). Rather, the companies' identified business needs provide more than ample justification for an accumulation of earnings and profits.
With respect to fleet replacement, the Court finds that the companies had reasonable business needs to accumulate, at a minimum, the amounts that Dr. Blaydon testified were required for fleet replacement in each of the years in question. Plaintiffs' needs for fleet replacement were certain as evidenced by Paul Candies' statements to IRS agent, Cyrus Fanguy, and as corroborated by the testimony of several witnesses, including that of shipyard representatives, Frank Terrell, Jr. and Sid Mizell. Management's plans to use the accumulations to meet those needs were specific, definite, and feasible. In fact, OCI's eventual net outlay of $50,000,000 and gross outlay of $173,000,000 for fleet replacement as well as CTI's recent $15,000,000 barge construction contract, confirms these plans, and indicate that Dr. Blaydon's estimates of the amounts required for fleet replacement were conservative.[277]
With respect to the projects, the overwhelming evidence presented by plaintiffs shows that the companies had a reasonable business need to accumulate funds for each of the projects identified in this opinion and that the companies' plans to use these funds for the projects were also specific, definite, and feasible. This conclusion is confirmed by plaintiffs' expert, Michael Odom, who independently determined (1) which projects were given serious and extensive consideration by the companies' management; and (2) the amounts that were required to complete those projects which were outstanding at the end of any of the fiscal years in question.
As for working capital, the Court finds that the companies reasonably intended to accumulate funds for this need. The *771 Court accepts Dr. Blaydon's expert assessment of the amounts required by the companies for working capital for each of years in question.
Management's explanation for retaining assets to satisfy any potential legal liability to McDermott was credible. As previously mentioned, the lawsuit was fully settled after CTI made a $6,750,000 payment to McDermott.
Finally, the Court concludes that each of the companies had a reasonable business need to retain the amounts identified by Dr. Blaydon for stock redemption in accordance with the companies' stock redemption agreements. As previously noted, shareholder redemption plans, especially those involving minority shareholders, have been routinely recognized by the courts as legitimate business needs. See Oman Construction Co., Inc., 24 T.C.M. (CCH) at 1810; EMI Corporation, 50 T.C.M. (CCH) at 588. Furthermore, having heard the testimony of the witnesses, the Court finds that management had specific, definite, and feasible plans to use the companies' accumulated funds for such shareholder redemption.[278]
In sum, the Court finds that plaintiffs' identified business needs were reasonable. In light of the strong caselaw mandating that courts defer to the business judgment of corporate management, the companies' conservative business approach, which has stood the test of time in a volatile industry, should not be second-guessed. As the Tax Court noted in Rhoades Oil Company v. Commissioner, 50 T.C.M.(CCH) 294, 306 (1985):
Reasonable business needs cannot be determined in a vacuum or out of context of the given business or industry. In evaluating petitioner's reasonable business needs, we must keep in mind the nature of petitioner's particular business and the business environment in which it operated.
In Rhoades Oil Company, the Tax Court noted that the volatility of the oil and gas industry led to "rapidly accelerating prices for equipment, supplies, and personnel needed in the business of gas *772 and oil exploration." Id. at 306, 1985 WL 14948. The Tax Court recognized that the specific environment in which the taxpayer operated had to be considered in evaluating Rhoades Oil Company's reasonable business needs with respect to a tar sand oil extraction project. Holding that the project constituted a reasonably anticipated business need for which the accumulation of funds was justified, the Court concluded by stating that, "[i]n an industry as volatile as the gas and oil business in those years, we would be loathe a decade later to second-guess corporate management as to its reasonable business needs for developing tar sands as an oil source." Id. at 311, 1985 WL 14948.
Given the extreme volatility of the companies' business both historically and during the years in question, the reasoning of the Tax Court in Rhoades Oil Company is particularly applicable here. This Court will not substitute its judgment for that of the companies' thoughtful and experienced management.
In summary, based upon the evidence presented at trial, the Court holds that plaintiffs' reasonable business needs for the years at issue were as follows:
1991 1992 1993 1994 1995 1996
OCI Fleet Replacement $39,800,000 $42,900,000 $48,400,000 $49,000,000 $57,400,000 $37,200,000
Projects 103,450,000 25,000,000 88,200,000 71,394,666 5,822,500 4,260,000
Working Capital 4,000,000 4,500,000 5,200,000 7,200,000 7,000,000 7,100,000
Stock Redemption 5,300,000 5,300,000 5,300,000 15,900,000 15,900,000 15,900,000
TOTAL $152,550,000 $77,700,000 $147,100,000 $143,494,666 $86,122,500 $64,460,000
CTI Fleet Replacement $11,900,000 $12,200,000 $12,600,000 $15,100,000 $16,500,000
Projects 45,800,000 8,500,000 46,900,000 37,454,000 13,766,500
Working Capital 400,000 800,000 1,000,000 1,300,000 1,500,000
Stock Redemption 1,200,000 1,200,000 1,200,000 8,100,000 8,100,000
TOTAL $59,300,000 $22,700,000 $61,700,000 $61,954,000 $39,866,500
Plaintiffs' reasonable business needs, including reasonably anticipated needs for the years at issue, compared to plaintiffs' accumulated earnings and profits as reflected in net liquid assets, produce the following results:
1991 1992 1993 1994 1995 1996
OCI Available Assets $41,100,000 $40,400,000 $42,900,000 $41,500,000 $32,300,000 $34,600,000
OCI Business Needs 152,550,000 83,000,000 147,100,000 143,494,666 86,122,500 64,460,000
Excess(Deficit) $(111,450,000) (42,600,000) (104,200,000) (101,994,666) (53,822,500) (29,860,000)
CTI Available Assets $15,100,000 $19,600,000 $16,900,000 $20,200,000 $21,000,000
CTI Business Needs 59,300,000 22,700,000 61,700,000 61,954,000 39,866,500
Excess/(Deficit) $(44,200,000) (3,100,000) (44,800,000) (41,754,000) (18,866,500)[279]
Considering the foregoing, the Court finds that plaintiffs did not retain or accumulate their earnings beyond their reasonable business needs. To the contrary, as the foregoing chart indicates, plaintiffs' business needs actually exceeded their net liquid assets for each of the years in question. Under such circumstances, the accumulated earnings tax cannot apply. Salley, 1976 WL 1157 at *13.
Inasmuch as the Court has determined that there was a deficit of accumulated earnings, it need not consider whether the companies were "availed of" by the shareholders for the purpose of avoiding income taxes to themselves. Id.; Rhoades Oil Company, 50 T.C.M. at 312-13, 1985 WL 14948. Nevertheless, the Court finds that a proscribed purpose was not present.
*773 Defendant devoted the majority of its time at trial and in its post-trial brief to its claims of improper motive. Specifically, defendant argues that loans to shareholders, investment in entities unrelated to the companies' core business, and the use of company funds for personal benefits are factors indicative of improper motive.[280] These arguments, however, are not only irrelevant,[281] but also contrary to the evidence adduced at trial.
With respect to the shareholder loans, the testimony of witnesses established that from time to time OCI made loans to Kevin Candies and Paul Candies or Paul Candies, Inc. (a corporation owned by Paul Candies).[282] However, these loans were documented, secured with collateral, accrued interest, and were subject to repayment on demand.[283] The borrowers have made repayments on all of the loans and some have been completely repaid.[284] At no time did either of the companies make loans to the shareholders that were proportionate to their ownership interests, as would clearly have been the case if there had been an attempt to disguise dividends.[285] In fact, as the Candies family members testified, OCI made loans to shareholders rather than pay dividends because the demand nature of the loans meant that the funds would always be available for OCI's business needs. Amounts distributed via dividends would have been unavailable to the companies.[286] Nothing about these loans suggests tax avoidance.
The travel and entertainment expenses underscored by the defendant throughout the trial are likewise immaterial and not determinative of the issue of an intent to avoid taxes. As the Candies family members testified, some of the expenses, a very small fraction of the total number of such items whose exact scope defendant could not identify,[287] were admittedly not properly documented as business or personal expenses.[288] Although OCI had a procedure for ensuring that shareholders or other employees were charged back for personal expenditures that were paid in the first instance by the company, the Court finds that a small number of such charges were inadvertently not so processed.[289] Defendant also claims that travel and entertainment expenses, including items admittedly properly documented and admittedly involving business matters such as client meetings, were extravagant and show that the Candies family members "took a lot of perks out of the business."[290] Defendant's *774 argument, however, is meritless. The evidence with respect to travel and entertainment expenses reveals the routine workings of a small business whose success is dependent in large part on its relationships with old and new customers and vendors. Accordingly, the Court does not attribute an improper motive with respect to these business expenditures.
Finally, the Court rejects defendant's arguments that the companies' investments in assets unrelated to the companies' business suggest an improper motive for retaining funds. According to the credible testimony of the Candies family members, to the extent that management made investments in unrelated business assets, they did so in order to increase their return on capital while diversifying risk. At all times, management intended to liquidate those investments when the funds reasonably could be used for business needs.[291]
Having considered the evidence of this case, the Court finds that the shareholders' honest intent was to expand the business of OCI and CTI and tax avoidance played no part in that decision. Accordingly, it is the determination of this Court that the accumulated earnings taxes assessed for the years in question against OCI in the total amount of $12,308,276[292] and against CTI in the total amount of $7,991,808[293] were wrongly assessed and collected and that these amounts, together with interest thereon at the applicable rate from the date of payment until refunded, should be paid the plaintiffs, Otto Candies, L.L.C. and Candies Towing Company, L.L.C. See Salley, 1976 WL 1157 at *13. Judgment shall be entered in accordance with these findings of fact and conclusions of law.
* * * * * *
NOTES
[1] Civil action Nos. 99-3692, 01-450, 99-3693, and 01-452 were consolidated on March 2, 2000. R. Doc. No. 6.
[2] R. Doc. No. 84, Testimony of Otto Candies, Jr., pp. 28-29.
Trial transcript, R. Doc. Nos. 84-87. All further references to the testimony of witnesses and to trial exhibits refer to R. Doc. Nos. 84-87.
[3] Testimony of Otto Candies, Jr., pp. 28-30.
[4] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 i.
[5] Id.
[6] Citations to the Internal Revenue Code of 1986 as amended (26 U.S.C.) are noted as "I.R.C. §."
[7] R. Doc. No. 88, Pretrial order, Summary of material facts, ¶ 6.
[8] The companies' fiscal years end on April 30 of each year. For example, "fiscal year 1991" means May 1, 1990, to April 30, 1991. Transcript, p. 29.
[9] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 i. OCI and CTI are presently limited liability companies and are taxed pursuant to Subchapter S of the Internal Revenue Code. However, during the years in question, they were both corporations organized and existing under the laws of the State of Louisiana and were taxed pursuant to Subchapter C of the Internal Revenue Code. Id. Sometime after 1996, OCI and CTI changed their corporate status from a Subchapter C to a Subchapter S company. Testimony of Otto Candies, Jr., pp. 136-37.
[10] Id. at ¶ 7 iii.
[11] Id. at ¶ 7.iv, .v. Originally, the total amount of the assessed taxes, penalties, and interest for OCI for fiscal years 1991-1996 was $13,634,249.71. With respect to CTI, the original total amount of the assessed taxes, penalties, and interest for fiscal years 1991-1995 was $8,009,701.85. Id. at ¶ 7.vii.
[12] Id. at ¶ 7.vi.
[13] Id. at ¶ 7.vii.
[14] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7.ix.
[15] Id.
[16] Testimony of Paul Candies, pp. 193-95.
[17] Testimony of Kevin Candies, pp. 386-87; Exhibit P-923, Depo. testimony of Sid Mizell, pp. 35-36.
[18] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7.x; Testimony of Otto Candies, Jr., p. 27; Testimony of Paul Candies, p. 191; Testimony of Kevin Candies, p. 384.
[19] Testimony of Otto Candies, III, pp. 398-99. The Candies brothers and Otto, III continue to hold these positions.
[20] Testimony of Otto Candies, Jr., pp. 39-40; Testimony of Paul Candies, p. 200; Testimony of Kevin Candies, p. 386; Testimony of Otto Candies, III, pp. 399-400.
[21] Testimony of Otto Candies, Jr., pp. 40, 135.
[22] Testimony of Otto Candies, Jr., pp. 29-30; Exhibit P-899, Blaydon report, pp. 13, 18-21, 27-30, 31-34; Testimony of Michael C. Odom, p. 571.
[23] Testimony of Otto Candies, Jr., pp. 34-38; Testimony of Paul Candies, p. 197; Testimony of Underhill, p. 644; Exhibit P-899, Blaydon report, pp. 11-14, 18-21, 29-30, 32-34; P-903 (day rate table); Exhibit P-898, Odom report, pp. 23-25, 28, 61-63.
[24] Id.
[25] Testimony of Otto Candies, Jr., pp. 38-39; Testimony of Paul Candies. pp. 199-200.
[26] Exhibit P-899, Blaydon report, pp. 24, 38-41.
[27] Captain Underhill is a marine surveyor and a consultant. He holds an unlimited master license and has sixty (60) years of experience in the maritime industry in the Gulf of Mexico. As a marine surveyor and consultant, he has worked closely with numerous oil and gas companies in the Gulf of Mexico and he has served as an expert witness in various court proceedings. Exhibit D-76; Testimony of Underhill, pp. 626-632.
[28] Testimony of Underhill, pp. 633, 638.
[29] Exhibit P-923, Depo. testimony of Mizell, pp. 35-36.
[30] Testimony of Otto Candies, Jr., p. 32; Testimony of Paul Candies, p. 197; Exhibit P-899, Blaydon report, pp. 18-19.
[31] Id.
[32] Testimony of Paul Candies, pp. 197-98; Exhibit P-923, Depo. testimony of Mizell, p. 38; Exhibit P-899, Blaydon report pp. 22-23.
[33] Exhibit P-899, Blaydon report, pp. 24, 38-39
[34] Testimony of Underhill, p. 634.
[35] Testimony of Kevin Candies, pp. 385-86, 394.
[36] Testimony of Otto Candies, Jr., p. 38; Testimony of Otto Candies, III, pp. 400-01;
[37] Id.
[38] Exhibit P-899, Blaydon report, p. 19; Exhibit P-898, Odom report, pp. 15, 17.
[39] Testimony of Otto Candies, Jr., p. 54; Exhibit P-899, Blaydon report, p. 48.
[40] Testimony of Otto Candies, Jr., p. 31; Exhibit P-899, Blaydon report, Appendix D. revised, p. D-10.
[41] Testimony of Blaydon, p. 679; Exhibit P-899, Blaydon report, pp. 54-55.
[42] Id.
[43] Id.; Exhibit P-86 (January/February 1990 Ocean Industry article).
[44] Testimony of Paul Candies, p. 196; Exhibit P-899, Blaydon report, Appendix D revised, p. D-15.
[45] Testimony of Blaydon, p. 679; Exhibit P-899, Blaydon report, p. 55.
[46] Testimony of Otto Candies, Jr., pp. 44-49; Testimony of Paul Candies, pp. 202-03; Exhibit P-923, Depo. testimony of Mizell, pp, 57-58; Testimony of Frank Terrell, Jr., pp. 486-87; Exhibit P-899, Blaydon report, pp. 43-44.
[47] Exhibit P-899, Blaydon report, pp. 48-49.
[48] Testimony of Underhill, pp. 643-44.
[49] Testimony of Otto Candies, Jr., pp. 44, 56-57; Testimony of Paul Candies, pp. 210-11; Testimony of Frank Terrell, Jr., pp. 484-85.
[50] Otto Candies, Jr., pp. 33-34; Exhibit P-923, Depo. testimony of Mizell, pp. 52-53, 61; Testimony of Terrell, pp. 484, 500-01; Testimony of Underhill, pp. 645-46.
[51] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶¶ 7.xxxvi, .xlvi, .xlix; R. Doc. No. 65, Stipulation, ¶ 153.
[52] Testimony of Otto Candies, Jr., pp. 42-43, Testimony of Paul Candies, pp. 201, 213.
[53] Testimony of Paul Candies, pp. 204-06; Testimony of Cyrus J. Fanguy, pp. 536-540.
[54] Testimony of Otto Candies, Jr., pp. 42-43, 53-55; Testimony of Paul Candies, pp. 202-03, 209-211.
[55] P-914 (Fanguy notes of interviews).
[56] Testimony of Otto Candies, Jr., pp. 42-43; Exhibit P-923, Depo. testimony of Mizell, p. 49; Testimony of Terrell, pp. 480-482.
[57] Testimony of Terrell, pp. 480-81.
[58] Testimony of Terrell, p. 485.
[59] Exhibit P-923, Depo. testimony of Mizell, p. 62.
[60] Exhibit P-899, Blaydon report, pp. 1-2.
[61] Id.
[62] Id.
[63] Testimony of Blaydon, p. 661.
[64] Exhibit P-899, Blaydon report, pp. 4, 9; Testimony of Blaydon, pp. 665-67.
[65] Testimony of Blaydon, pp. 678-88, Exhibit P-899, Blaydon report, pp. 48-57.
[66] Exhibit P-899, Blaydon report, p. 49. In his analysis, Dr. Blaydon used an assumed life of 16 years for OSVs and tugs which figure was midway between the 12 year life that was OCI's objective and a longer estimate of an assumed life of 20 years. Dr. Blaydon also assumed the barges expected life to be 20 years. Id. at pp. 54-55. Dr. Blaydon's figures take into consideration the proceeds from the sale of the old vessels, except barges, which were expected to have little or no salvage value at the time of replacement. Id. at 52, 54.
[67] As previously mentioned, according to the testimony of the Candies, management planned to build 12 OSVs at $3,500,000 to $5,000,000 each, 6 tugs at approximately $3,000,000 each, and 12 barges at approximately $3,000,000 each. These figures total between $60,000,000 and $78,000,000 for OCI and $36,000,000 for CTI.
[68] Testimony of Underhill, p. 643.
[69] R. Doc. No. 77, Post-trial memorandum, p. 5.
[70] Testimony of Otto Candies, Jr., pp. 49-52, 56; Testimony of Paul Candies 206-08; Testimony of Terrell, pp. 494-98; Exhibit J-176 (table of construction contracts); Exhibit J-177 (table of vessel sales).
[71] Testimony of Otto Candies, Jr., 50-51, 143-44; Testimony of Paul Candies, pp. 288-91; Testimony of Terrell, pp. 487-88.
[72] Testimony of Underhill, p. 643.
[73] Specifically, Captain Underhill testified:
BY MR. TURKUS:
Q. I want to make sure I understand you, Captain Underhill. Your view is they should have started replacing their fleets during the '91 to '96 years?
A. Yes.
Q. In the deposition you gave me an estimate of the amount that would have been required to rebuild their fleets in the 90's. Do you remember that, sir?
A. Vaguely.
Q. Is it correct that it's your opinion here today that the amount they would have required to replace their fleets would have been in the neighborhood of $100 million?
A. Yes.
Id. at p. 643.
[74] Testimony of Underhill, p. 640.
[75] Testimony of Otto Candies, Jr., pp. 58-59; Exhibit P-898, Odom report, pp. 86-96.
[76] Id.
[77] Testimony of Otto Candies, Jr., pp. 59-62; Exhibit P-898, Odom report, pp. 96-98.
[78] Id. As will be discussed more fully below, some projects were bids made in response to public requests for proposals to make major capital investments in marine transportation equipment that would be put to a particular specialized use. Others were job estimates made in response to more targeted requests, such as when someone familiar with the companies' reputation and capabilities would ask if the companies could provide certain-long term services. Still others were opportunities to invest in or co-venture with customers or potential customers with the objective of securing business from those firms. R. Doc. No. 77, Plaintiffs' Post-trial brief, pp. 6-7
[79] As will be explained below, the relevant law requires that a Court consider a company's reasonably anticipated needs "as they exist on the basis of the facts at the close of the taxable year." Treas. Reg. § 1.537-1(b)(2).
[80] R. Doc. No. 61, Plaintiffs' Pretrial memorandum, p. 11.
[81] Exhibit P-898, Odom report, pp. 4-5.
[82] Id. at pp. 2-4.
[83] Testimony of Odom, pp. 579-81; Exhibit P-898, Odom report, pp. 2-4.
[84] Testimony of Odom, p. 580.
[85] Testimony of Odom, pp. 580-81.
[86] Exhibit P-898, Odom report, Exhibit I.
[87] R. Doc. No. 77, Post-trial memorandum, p. 8.
[88] Testimony of Otto Candies, Jr., pp. 58-59; Testimony of Paul Candies, pp. 216-17; Exhibit P-923, Depo. testimony of John Costello, pp. 7-8, 10.
[89] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xc.f. Although plaintiffs' counsel projects the cost at $105,000,000, the Court calculates the cost at between $104,400,000 to $108,900,000. The outcome of this case is not affected by any difference in these figures.
[90] R. Doc. No. 65, Stipulation, ¶ 1; Testimony of Otto Candies, Jr., pp. 63-64, 67-68; Testimony of Paul Candies, pp. 217-19, 225-26; Exhibit P-923, Depo. testimony of Costello, pp. 36, 42; P-160 (bid cover letter); P-161 (bid excerpts).
Although it was generally management's practice to allocate the cost of a project between OCI and CTI, depending upon whether the project involved a powered or non-powered vessel, the large nature of this project required that the companies exhaust the bulk of their jointly available resources before they borrowed funds. The anticipated investment for this project was, therefore, allocated proportionately between OCI and CTI based upon their respective available assets in the relevant years. More specifically, it was anticipated that OCI would make an investment of $75,600,000 and CTI would invest the remaining $29,400,000. Testimony of Otto Candies, Jr., pp. 63-65; Testimony of Paul Candies, pp. 218-22, 338; Testimony of Odom, pp. 590-91; Exhibit P-898, Odom report, Exhibit I, pp. 37, 39-41.
[91] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7.g; Testimony of Paul Candies, pp. 217-18, 225-26.
[92] Exhibit P-923, Depo. testimony of Costello, pp. 21-22, 35, 42.
[93] Testimony of Otto Candies, Jr., pp. 68-69.
[94] Testimony of Otto Candies, Jr., pp. 68-69; Testimony of Paul Candies, pp. 219, 225; Exhibit P-923, Depo. testimony of Costello, pp. 43-44.
[95] Testimony of Otto Candies, Jr., pp. 69-71, 74-75.
[96] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7.xci.c.; Testimony of Otto Candies, Jr., pp. 70-72; Exhibit P-923, Depo. testimony of Foster Duncan, pp. 16-19; Exhibit P-898, Odom report, p. 90; Exhibit PFJ-188 (04/05/91 letter).
[97] R.Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7; Exhibit P-923, Depo. testimony of Duncan, pp. 20, 23, 25, 40-41.
[98] Exhibit P-898, Odom report, p. 91; R. Doc. No. 65, Stipulation, ¶¶ 16-17; Testimony of Otto Candies, Jr., pp. 69-75; Exhibit PFJ-188 (04/05/91 letter to Freeport) and Exhibit PFJ-189 (04/08/91 letter to Trinity Marine).
[99] The barge costs were estimated to be $20,250,000 and the tug costs were estimated to be $10,000,000. Exhibit P-898, Odom report, pp. 90-92 and attached Exhibit I, pp. 18-19.
[100] Testimony of Otto Candies, Jr., pp. 69-75; Exhibit P-923, Depo. testimony of Duncan, pp. 16-26; Exhibit P-898, Odom report, pp. 90-92.
[101] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7; Exhibit P-898, Odom report, pp. 90-91 and attached Exhibit I, p. 19.
[102] Testimony of Otto Candies, Jr., pp. 73-74; Exhibit P-898, Odom report, pp. 90-92 and Exhibit I, pp. 18-19.
[103] Exhibit P-923, Depo. testimony of Duncan, pp. 24, 32-33, 46-47.
[104] Testimony of Otto Candies, Jr., pp. 74-75; Exhibit P-923, Depo. testimony of Duncan, p. 25.
[105] Testimony of Paul Candies, p. 227.
[106] Testimony of Paul Candies, pp. 228-29; Testimony of Hall, pp. 460-61; R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7.xcii.a.
[107] Testimony of Hall, pp. 460-61.
[108] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7.xcii .f.; Testimony of Paul Candies, p. 229; Testimony of Hall, pp. 467-69; Exhibit P-898, Odom report, p. 88.
[109] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xcii.e.; R. Doc. No. 65, Stipulation, ¶ 21; Testimony of Hall, pp. 464-65.
[110] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xcii.h; R. Doc. No. 65, Stipulation, ¶ 22; Exhibit P-898, Odom report, p. 89.
[111] Testimony of Hall, p. 470.
[112] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7, .xcii.j; Testimony of Paul Candies, pp. 231-32; Testimony of Hall, pp. 467-70; Exhibit P-898, Odom report, p. 89; Exhibit P-186 (05/11/95 Subscription Agreement); Exhibit P-187 (05/24/95 Subscription Agreement).
[113] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xcii.l; Testimony of Paul Candies, pp. 233-34; Testimony of Hall, pp. 471-75; Exhibit P-898, Odom report, pp. 88-90; Exhibit P-191 (04/26/96 Purchase Agreement letter); Exhibit P-192 (05/16/96 Subscription Agreement); P-193 (05/21/96) (Letter from Hall-Houston).
[114] Testimony of Paul Candies, pp. 229, 233-35, 331.
[115] Testimony of Hall, pp. 470-71, 475-73.
[116] Id.
[117] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7.xcii.g.
[118] Testimony of Hall, pp. 465-67.
[119] Testimony of Otto Candies, Jr., pp. 75-76; Exhibit PFJ-201 (11/29/90 Agreement).
[120] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xciii.c; Exhibit DFJ-87 (01/16/91 OCI minutes).
[121] Testimony of Otto Candies, Jr. pp. 76-77; Exhibit PFJ-202 (02/06/91 Amendment to Agreement).
[122] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xciii.f; Testimony of Otto Candies, Jr., pp. 77-79.
[123] Testimony of Otto Candies, Jr., pp. 78-80.
[124] Id. at pp. 80-81.
[125] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xciv.a. Prior to this project, OCI had sold OPI two of its older vessels. OPI spent a considerable amount of money refurbishing them for use in the Gulf of Mexico. Testimony of Paul Candies, p. 236.
[126] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xciv.a; Exhibit DFJ-89 (04/19/91 OCI minutes); Testimony of Paul Candies, pp. 237-38.
[127] Testimony of Paul Candies, p. 237.
[128] Testimony of Paul Candies, p. 237.
[129] Testimony of Paul Candies, pp. 238-239.
[130] R. Doc. No. 65, Stipulation, ¶ 30.
[131] R. Doc. No. 65, Stipulation, ¶ 30; Testimony of Paul Candies, pp. 238-39.
[132] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xcv .a; Testimony of Otto Candies, Jr., pp. 81-82; Testimony of Otto Candies, III, p. 406; Exhibit P-923, Depo. testimony of Duncan, pp. 43-44 and Depo. Exhibits 6 OCP-0704 and 7 CTP-1246.
[133] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xcv.a; R. Doc. No. 65, Stipulation, ¶ 158; Testimony of Otto Candies, pp. 82-84; Testimony of Otto Candies, III, p. 406; Exhibit P-200 (project notes); Exhibit P-201 (project notes); P-202 (project notes).
One of Freeport's objectives was to have the vessel operator, rather than Freeport, invest the capital necessary to build the vessels required to move the sulphur. Testimony of Otto Candies, III, p. 407; Exhibit P-923, Depo. testimony of Duncan, pp. 40-42.
[134] Testimony of Otto Candies, III, pp. 407-08.
[135] Testimony of Otto Candies, Jr., p. 157; Testimony of Otto Candies, III, p. 407; Exhibit P-923, Depo. testimony of Duncan, pp. 41-42.
[136] Testimony of Otto Candies, Jr., p. 86.
[137] Testimony of Otto Candies, Jr., p. 85.
[138] R. Doc. No. 65, Stipulation, ¶¶ 33, 159; Exhibit DFJ-90 (10/29/91 OCI minutes).
[139] Testimony of Otto Candies, Jr., pp. 87-88.
[140] Testimony of Otto Candies, Jr., pp. 87-89, 154; Exhibit P-898, Odom report, Exhibit I, pp. 16-17.
[141] Id.
[142] Testimony of Paul Candies, pp. 242-43.
[143] Testimony of Otto Candies, Jr., pp. 87-88.
[144] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xcvii.a; Testimony of Paul Candies, pp. 243-44.
[145] Testimony of Paul Candies, p. 244.
[146] Id. at p. 245.
[147] Id.
[148] R. Doc. No. 65, Stipulation, ¶ 39; Testimony of Paul Candies, p. 245; Exhibit P-898, Odom report, Exhibit I, p. 8.
[149] Testimony of Paul Candies, p. 245; Exhibit J-221 (schedule of accounts receivable).
[150] Testimony of Paul Candies, pp, 246-47; Exhibit P-898, Odom report, Exhibit I, p. 8.
[151] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xcvii.r; Exhibit P-898, Odom report, Exhibit I, p. 7.
[152] Exhibit P-898, Odom report, Exhibit I, p. 8.
[153] Exhibit P-898, Odom report, Exhibit I, p. 21.
[154] Testimony of Otto Candies, Jr., pp. 58, 90-91; Testimony of Otto Candies, III, pp. 410-12; Exhibit P-923, Depo. testimony of Andrew J. Westhoff, former finance director of CSX Transportation, pp. 11-12, 19, 36.
[155] Testimony of Otto Candies, Jr., p. 91.
[156] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7, .xcviii.b and .xcviii.g; Testimony of Otto Candies, Jr., pp. 91-93; Exhibit P-923, Depo. testimony of Westhoff, pp. 85-87.
[157] Testimony of Otto Candies, Jr., pp. 93-101; R. Doc. No. 88, Pretrial order, Uncontested facts, ¶¶ 7.xcviii.a-.xcviii.z.
[158] Exhibit P-898, Odom report, Exhibit I, p. 21.
[159] Testimony of Otto Candies, Jr., pp. 91-103; Testimony of Otto Candies, III, pp. 410-16; Exhibit P-923, Depo. testimony of Westhoff, pp. 52-53, 90-91.
[160] Exhibit P-923, Depo. testimony of Westhoff, pp. 27-29, 53-54.
[161] Testimony of Otto Candies, Jr., pp. 90-103; Testimony of Otto Candies, III, pp. 410-16; Testimony of Odom, pp. 588-90; Exhibit P-898, Odom report, Exhibit I, p. 21.
[162] Testimony of Otto Candies, Jr., pp. 100-01.
[163] Testimony of Otto Candies, Jr., pp. 93, 97-98, 101, 103; Testimony of Otto Candies, III, pp. 412, 414-16; Testimony of Odom, pp. 586-90; Exhibit P-898, Odom report, Exhibit I, pp. 21-25.
For fiscal year 1993, plaintiffs' expert, Michael Odom, determined that OCI had 71% and CTI had 29% of the companies' combined assets and, therefore, they would have contributed $71,000,000 and $29,000,000, respectively, based upon management's expectations of $100,000,000 in costs. For fiscal year 1994, Mr. Odom calculated that OCI had approximately 68% and CTI had approximately 32% of the companies' combined assets and, therefore, the companies would have allocated $68,000,000 to OCI and $32,000,000 to CTI. Exhibit P-898, Odom report, Exhibit I, pp. 23, 25.
[164] Testimony of Odom, pp. 589-90; Exhibit P-898, Odom report, Exhibit I, pp. 23, 25; Testimony of Otto Candies, Jr., pp. 101-03; Testimony of Otto Candies, III, pp. 412-13.
[165] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7, .xcviii.z; Testimony of Otto Candies, Jr., p. 110; Testimony of Otto Candies, III, pp. 413-14; Exhibit P-923, Depo. testimony of Westhoff, pp. 47, 61; Exhibit P-349 (02/13/95 and 02/03/95 letters).
[166] Exhibit P-898, Odom report, Exhibit I, p. 19.
[167] Testimony of Paul Candies, p. 251; Exhibit P-898, Odom report, Exhibit I, pp. 19-20.
[168] Testimony of Paul Candies, pp. 251-52.
[169] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .c.a; Testimony of Paul Candies, pp. 252-53; Exhibit P-898, Odom report, p. 92.
[170] Testimony of Paul Candies, pp. 252-53.
[171] Exhibit P-898, Odom report, p. 92; Testimony of Paul Candies, p. 255; R. Doc. No. 65, Stipulation, ¶¶ 74-76.
[172] R. Doc. No. 65, Stipulation, ¶ 74.
[173] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7, .c.d; Testimony of Otto Candies, Jr., pp. 111-12.
[174] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7, .c.f; R. Doc. No. 65, Stipulation, ¶ 163; Testimony of Otto Candies, Jr., p. 112.
[175] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7, .c.g; Testimony of Otto Candies, Jr., p. 112.
[176] R. Doc. No. 88, Pretrial order, Uncontested Facts, ¶ 7 .ci.a.; R. Doc. No. 65, Stipulation, ¶ 77; Testimony of Paul Candies, p. 258.
[177] Testimony of Paul Candies, pp. 257-58.
[178] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶¶ 7 .ci.b-.ci.c; Testimony of Paul Candies, p. 258.
[179] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .cii .a; Testimony of Otto Candies, III, pp. 416-17.
[180] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .cii .b; Testimony of Otto Candies, III, pp. 417-18.
[181] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .cii .c; Testimony of Otto Candies, III, pp. 417-18.
[182] Testimony of Otto Candies, III, pp. 418-19.
[183] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .cii .c; Testimony of Otto Candies, III, pp. 419
[184] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .ciii.a; Testimony of Otto Candies, Jr., pp. 116-117; Testimony of Otto Candies, III, pp. 420.
[185] Id.
[186] Exhibit P-898, Odom report, Exhibit I, p. 32; Exhibit J-267 (04/10/95 fax attaching worksheets).
[187] Testimony of Otto Candies, III, pp. 421-22.
[188] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7, .ciii.b; Testimony of Otto Candies, III, p. 422; J-268.
[189] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7, .ciii.c.; R. Doc. No. 65, Stipulation, ¶ 164.
As Otto Candies, Jr. explained, "The project was to move LPG gas from Buenos Aires [Argentina] up the Parana River on to Asuncion, Paraguay." Testimony of Otto Candies, Jr., p. 116.
[190] R. Doc. No. 88, Pretrial order, ¶ 7 .ciii.d; Testimony of Otto Candies, Jr., p. 117; DFJ-269.
[191] R. Doc. No. 88, Pretrial order, ¶ 7 .ciii.h; Testimony of Otto Candies, Jr., p. 119; Testimony of Otto Candies, III, p. 424; Testimony of Odom p. 591; Exhibit P-898, Odom report, Exhibit I, pp. 32-33.
[192] Testimony of Otto Candies, Jr., pp. 117, 119.
[193] Testimony of Otto Candies, III, pp. 420-21.
[194] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶¶ 7 .ciii.e-g.
[195] Testimony of Otto Candies, Jr., p. 120.
[196] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .civ .c.
[197] Id.; Testimony of Paul Candies, p. 261.
[198] Testimony of Paul Candies, pp. 260-62.
[199] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .civ .a; Testimony of Paul Candies, pp. 261-63.
[200] Testimony of Paul Candies, p. 264.
[201] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .civ .b; Exhibit J-91 (11/26/91 OCI minutes).
[202] Exhibit P-898, Odom report, Exhibit I, p. 38.
[203] Testimony of Paul Candies, pp. 261-65.
[204] R. Doc. No. 65, Stipulation, ¶ 84; Testimony of Paul Candies, p. 263.
[205] Testimony of Paul Candies, p. 265.
[206] R. Doc. No. 65, Stipulation, ¶ 85.
[207] Testimony of Paul Candies, p. 265.
[208] Id. at pp. 264-66.
[209] Testimony of Paul Candies, pp. 265-66.
[210] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7, .cv .a; Testimony of Otto Candies, III, p. 425.
[211] R. Doc. No. 65, Stipulation, ¶ 158; Testimony of Otto Candies, III, pp. 425-26.
[212] Although CTI generally owned non-powered vessels, including barges, Paul Candies testified that in dealings with third parties, OCI, not CTI, was the contact point for both companies, even when CTI's barge business was involved. Paul Candies testified:
... Basically, Otto Candies [OCI] would be the contact point to where most of the customers would come in and Otto Candies would then decide whether it was a barge job or a boat job or a combination of both, but all administrative work would have been handled at Otto Candies.
Testimony of Paul Candies, p. 195. Although OCI initially entered into this contract with McDermott, this was in fact a CTI project. Testimony of Otto Candies, III, pp. 425-30.
[213] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .cv.c; Testimony of Otto Candies, III, p. 426.
[214] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .cv.d.
[215] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .cv.g.
[216] Id.; Testimony of Otto Candies, III, pp. 427-28.
[217] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .cv.i; Testimony of Otto Candies, III, 427-28; DFJ-41.
[218] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .cv.j; Testimony of Otto Candies, III, pp. 428-30; DFJ-42.
The report of plaintiff's expert, Michael Odom, notes that although the lawsuit filed against OCI originally demanded damages totaling $4,900,000, that damage claim was amended to $5,454,000. Exhibit P-898, Odom report, Exhibit I, p. 46.
[219] The parties do not dispute that CTI paid the settlement amount. It is further undisputed that as of April 30, 1996, CTI had spent approximately $2,000,000 in legal fees connected with the McDermott litigation. R. Doc. No. 88, Pretrial order, Uncontested facts, ¶¶ 7 .cv.k.-.cv.l; Testimony of Otto Candies, III, p. 429.
[220] Testimony of Otto Candies, III, p. 430.
[221] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .cvi .c.
[222] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ .cvi.a.
[223] Exhibit P-898, Odom report, p. 93.
[224] Id.
[225] Testimony of Otto Candies, Jr., pp. 122-23; Exhibit J-302 (03/18/93 letter).
[226] Testimony of Otto Candies, Jr., pp. 123-24; Exhibit P-898, Odom report, Exhibit I, p. 43.
[227] Testimony of Odom, pp. 581-83; 585-86; Exhibit P-898, Odom report, pp. 86-88.
[228] Testimony of Otto Candies, Jr., p. 135; Testimony of Paul Candies, pp. 268-70; Testimony of Otto Candies, III, p. 402; Testimony of Blaydon, pp. 688-91; Exhibit P-899, Blaydon report, p. 57.
[229] Testimony of Blaydon, pp. 688-91.
[230] Testimony of Paul Candies, pp. 270-71; Testimony of Blaydon, p. 710; Exhibit P-899, Blaydon report, p. 57.
[231] Testimony of Otto Candies, Jr., pp. 133-35.
[232] Exhibit P-899, Blaydon report, pp. 59-60.
[233] Testimony of Blaydon, p. 691; Exhibit P-899, Blaydon report, pp. 60.
As Dr. Blaydon explains:
Standard deviation is a measure of volatility around the average. Using statistical theory, and assuming certain characteristics of the underlying data, standard deviations around the mean can be used to approximate the probability that an event will occur. For example, the general rule of thumb is that there is a 68 percent probability an event will occur within one standard deviation around the mean. There is a 95 percent probability that an event will occur within two standard deviations around the mean.
Exhibit P-899, Blaydon report, p. 60 n. 124.
[234] Testimony of Blaydon, p. 692; Exhibit P-899, Blaydon report, p. 61.
[235] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶¶ 7.cviii, 7.cix; Testimony of Dr. Ball, pp. 777-80.
[236] Testimony of Ball, pp. 738-741.
[237] Testimony of Ball, pp. 812-13.
[238] Testimony of Ball, pp. 806-22; Exhibit D-74, Ball report, pp. 13-14, 16.
[239] Exhibit D-74, Ball report, pp. 7, 19.
[240] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .cxi; Testimony of Paul Candies, pp. 271-72.
[241] Testimony of Paul Candies, p. 271.
[242] Testimony of Blaydon, pp. 696-97; Exhibit P-899, Exhibit P-899, Blaydon report, pp. 62-63.
[243] Exhibit P-899, Exhibit P-899, Blaydon report, pp. 63-64
[244] R. Doc. No. 75, Plaintiffs' post-trial proposed findings of fact and conclusions of law, p. 70.
[245] Exhibit P-899, Blaydon report, pp. 69-73.
[246] Testimony of Paul Candies, pp. 275-84, 376-77.
[247] Exhibit P-899, Blaydon report, pp. 69-72.
[248] Testimony of Blaydon, pp. 698-99.
[249] Exhibit P-899, Blaydon report, p. 69.
[250] Id.
[251] Exhibit P-899, Blaydon report, p. 70.
[252] Dr. Blaydon testified that although these investments were related to the companies' business because they were made for the purpose of establishing a positive relationship with another company, he nevertheless considered them available since the investments were in publicly-traded securities and they could have been liquidated quickly for "something as important as a program of fleet replacement." Testimony of Blaydon, p. 698; Exhibit P-899, Blaydon report, pp. 70-71.
[253] Exhibit P-899, Blaydon report, pp. 70-72, and attached Appendix G; Testimony of Blaydon, pp. 698-99.
[254] Exhibit P-899, Blaydon report, pp. 72-73.
[255] Testimony of Paul Candies, pp. 257-59, 277-84.
[256] R. Doc. No. 82, Defendant's post-trial proposed findings of facts and conclusions of law,.pp. 89-90.
[257] As previously discussed, Paul Candies testified that the KAP Resources investment was made with the specific intention of securing marine transportation business from KAP's Chilean copper mines, and it was, therefore, related to the companies' business. Testimony of Paul Candies, pp. 257-59. Similarly, the investment in Hall-Houston secured a significant amount of marine transportation work for the companies which continues through the present. R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7 .xcii.g.
[258] Bollinger Quick Repair, formerly known as Avondale Quick Repair in Harvey, Louisiana, was a shipyard providing vessel repair services. In 1993, management was approached by Donald Bollinger who proposed that management assist him in purchasing the shipyard. OCI made an $8,000,000 investment in 1994. Paul Candies testified that management believed that making the investment would provide the companies with opportunities for more readily available vessel repair services at this and other shipyards owned by Donald Bollinger. The investment, according to Paul Candies, would enhance the companies' relationship with Mr. Bollinger and would preserve the shipyard as an active operating yard. Testimony of Paul Candies, pp. 278-81.
[259] Testimony of Fanguy, p. 542.
[260] Testimony of Otto Candies, Jr., pp. 135-37; Testimony of Paul Candies, p. 307.
[261] Testimony of Otto Candies, Jr., p. 137.
[262] Testimony of Paul Candies, p. 307.
[263] Testimony of Otto Candies, pp. 38-39, 135; Testimony of Paul Candies, pp. 199-201, Testimony of Kevin Candies, pp. 385-87, 393-94; Testimony of Otto Candies, III, p. 402.
[264] Testimony of Odom, pp. 573-77; Exhibit P-898, Odom report, pp. 71-77 and attached Exhibit G.
[265] Testimony of Odom, p. 576.
[266] Testimony of Odom, p. 576.
[267] Testimony of Otto Candies, Jr., p. 136; Testimony of Paul Candies, pp. 293-94; Testimony of Kevin Candies, pp. 388-91.
[268] Testimony of Otto Candies, Jr., pp. 136-37; Testimony of Paul Candies, pp. 306-07; Testimony of Kevin Candies, pp. 393-94.
[269] Testimony of Otto Candies, Jr., pp. 164-75; Testimony of Paul Candies, pp. 313, 369-71.
[270] Testimony of Otto Candies, Jr., p. 166.
[271] Testimony of Otto Candies, Jr., pp. 166-67, 182-83; Testimony of Paul Candies, p. 312.
[272] Id.
[273] In Ivan Allen Co. v. United States, 422 U.S. 617, 628, 95 S.Ct. 2501, 2507, 45 L.Ed.2d 435 (1975), the Supreme Court stated, "The question ... is not how much capital of all sorts, but how much in the way of quick or liquid assets, it is reasonable to keep on hand for the business."
[274] Citations to the relevant treasury regulations contained in the Code of Federal Regulations, 26 C.F.R. are noted as "Treas. Reg. § #).
[275] Treas. Reg. § 1.537-2(b) also lists the following non-exclusive uses of corporate funds which may indicate that a corporation's accumulations are not for the reasonable needs of the business. These include:
(1) Loans to shareholders, or the expenditure of funds of the corporation for the personal benefit of the shareholders;
(2) Loans having no reasonable relation to the conduct of the business made to relatives or friends of shareholders, or to other persons;
(3) Loans to another corporation, the business of which is not that of the taxpayer corporation, if the capital stock of such other corporation is owned, directly or indirectly, by the shareholder or shareholders of the taxpayer corporation and such shareholder or shareholders are in control of both corporations;
(4) Investments in properties, or securities which are unrelated to the activities of the business of the taxpayer corporation; or
(5) Retention of earnings and profits to provide against unrealistic hazards.
[276] 26 U.S.C. § 533 provides:
Evidence of purpose to avoid income tax (a) Unreasonable accumulation determinative of purpose. For purposes of section 532, the fact that the earnings and profits of a corporation are permitted to accumulate beyond the reasonable needs of the business shall be determinative of the purpose to avoid the income tax with respect to shareholders, unless the corporation by the preponderance of the evidence shall prove to the contrary.
[277] See Exhibit J-176 for table of construction contracts.
[278] Although defendant presented no direct evidence at trial contradicting plaintiffs' evidence of their need for shareholder redemption, defendant nevertheless claims in its post-trial memorandum that plaintiffs' accumulation of such funds is an indicator of an improper tax-avoidance motive because shareholder redemption plans only benefit the shareholders and not the corporation. In support of its contention, defendant relies upon Pelton Steel Casting Co. v. Commissioner, 251 F.2d 278 (7th Cir.1958) and Firstco, Inc. v. United States, 430 F.Supp. 1193, 1202 (S.D.Miss.1977). R. Doc. No. 82, p. 98-99. Those cases, however, are inapposite to the facts of this case. In both instances, each court found it significant that the redemption plans involved majority interests, rather than the minority interests involved in this case. In Pelton, the shareholding interests represented the controlling interest (80%) in the company. Pelton, 251 F.2d at 281. Similarly, in Firstco, the district court found the company to be a mere holding or investment company which carried with it the presumption of an intent to avoid income taxes. The taxpayer in that case was asserting a need to accumulate funds to redeem 100% of the company's stock. Firstco, 430 F.Supp. at 1199, 1202.
Firstco and Pelton are distinguishable in a material way from this case where the redemption need asserted by management is that of a minority, i.e., 33 percent, shareholder. See EMI Corporation, 50 T.C.M. at 588 (holding that although "a corporation may reasonably accumulate its earnings to fund a redemption of the shares of dissident or departing minority stockholders ... [w]hether the redemption of a majority stockholder's shares is a reasonable business need for the accumulation of the corporation's earnings and profits is a more difficult question"). The Court finds no evidence suggesting that the stock purchase agreements were designed to serve the personal interests of stockholders rather than the business interest of the corporation.
[279] Exhibits P-919, P-920, P-921, P-922.
[280] R. Doc. No. 76, Defendant's post-trial brief, pp. 2-3, 6, 21-24.
[281] As previously stated, this Court need not even reach the question of whether plaintiffs were "availed of" for the purpose of avoiding taxes because this Court finds that the companies' reasonable business needs exceeded their available assets. Rhoades Oil Company, 50 T.C.M. at 312; 26 I.R.C. § 532(a).
[282] R. Doc. No. 65, Stipulation, ¶¶ 168-89, 191-92; Testimony of Kevin Candies, pp. 389-93; Testimony of Paul Candies, pp. 294-95, 299-301, 304-06.
[283] Id.
[284] R. Doc. No. 88, Pretrial order, Uncontested facts, ¶¶ 7 .xv, .xvi, .xix.
[285] Testimony of Otto Candies, Jr., p. 136; Testimony of Paul Candies, pp. 293-94; Testimony of Kevin Candies, pp. 388-91.
[286] Testimony of Otto Candies, Jr., p. 136-37; Testimony of Paul Candies, pp. 306-07, 393-95; Testimony of Kevin Candies, pp. 393-94.
[287] R. Doc. No. 84, p. 171, 173.
[288] Testimony of Otto Candies, Jr., pp. 166-67, 182-83; Testimony of Paul Candies, p. 312.
[289] Id.
[290] R. Doc. No. 76, Defendant's post-trial brief, pp. 21-23; R. Doc. No. 86, p. 622.
[291] Testimony of Otto Candies, Jr., pp. 134-35; Testimony of Paul Candies, pp. 273-74; Testimony of Otto Candies, III, p. 431.
[292] According to the stipulation of the parties, this amount is comprised of the following particulars:
OCI
Fiscal Year Tax Penalty Interest Total
1991 $1,407,768 $281,554 $ 541,458 $ 2,230,780
1992 1,164,870 232,974 287,303 1,685,147
1993 1,422,827 284,565 208,278 1,915,670
1994 1,359,988 271,998 779,892 2,411,878
1995 1,889,607 377,921 792,905 3,060,433
1996 676,912 135,383 192,073 1,004,368
TOTAL $7,921,972 $1,584,395 $2,801,909 $12,308,276
R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7, ix.
[293] This amount is comprised of the following particulars:
CTI
Fiscal Year Tax Penalty Interest Total
1991 $581,485 $116,297 $223,842 $ 921,624
1992 971,621 194,324 240,230 1,406,175
1993 871,738 174,347 127,640 1,173,725
1994 1,569,390 313,878 898,930 2,782,198
1995 1,054,632 210,926 442,528 1,708,086
TOTAL $5,048,866 $1,009,772 $1,933,170 $7,991,808
R. Doc. No. 88, Pretrial order, Uncontested facts, ¶ 7, ix.
| 2023-10-13T01:26:18.401715 | https://example.com/article/9703 |
Q:
Polynomial rings: if $A \otimes_B A$ is free over $A$, is it a complete intersection?
Let $A = k[x_1,\ldots,x_n]$ be a polynomial ring over a field $k$ of characteristic zero and $\{y_j\}_{1 \leq j \leq \ell}$ a family of homogeneous polynomials. Write $B$ for the subring $k[y_1,\ldots,y_\ell]$.
Assume that
the quotient $A \otimes_B k$ is finite-dimensional and
the tensor product $A \otimes_B A$ is a free $A$-module
(the structure map is $A = A \otimes_k k \to A \otimes_B A$).
I want to conclude that either $A \otimes_B A$ or $A \otimes_B k$ is a complete intersection ring, meaning the ideal $(y_1,\ldots,y_\ell)$ in $A$ or the ideal $(1 \otimes y_j - y_j \otimes 1)_{1 \leq j \leq \ell}$ in $A \otimes_k A$ is generated by some regular subsequence.
Is either $A \otimes_B A$ or $A \otimes_B k$ a complete intersection ring?
A:
It will be enough to show that $B \to A$ makes $A$ a free $B$-module, by the answer to this question.
To do this pick a finite basis of $A \otimes_B A$ as a free $A$-module; it is possible to take representatives for the basis in the image of $k \otimes_B A$, say $(1 \otimes c_j)$. This choice defines a unique $A$-linear map doing what one would expect with the chosen basis (and in all but trivial cases destroying ring structure):
\begin{align*}\tilde{f}\colon A \otimes_k k \otimes_B A &\overset\sim\longrightarrow A \otimes_B A,\\1 \otimes 1 \otimes c_j &\longmapsto 1 \otimes c_j.\end{align*}
Consider the restriction of this $\tilde f$ to the $B \otimes_k k \otimes_B A$; we claim this gives us a $B$-basis for $B \otimes_B A \cong A$. Indeed, the restriction factors as
$$ B \otimes_k k \otimes_B A \overset f\longrightarrow B \otimes_B A \longrightarrow A \otimes_B A,$$
where the second map is the natural $(B \hookrightarrow A) \otimes_B A$ and $f$ is the unnatural $B$-linear map given by the same formula as $\tilde f$.
Now, $f$ is injective because the composition is (being the inclusion followed by the bijection $\tilde f$) and surjective by inspection. Since $B \otimes_B A \cong A$ as a $B$-algebra, the composition
$$B \otimes_k k \otimes_B A \underset f{\overset\sim\longrightarrow} B \otimes_B A \overset\sim\longrightarrow A$$
gives us our desired $B$-basis of $A$.
| 2024-02-04T01:26:18.401715 | https://example.com/article/8002 |
16--Award_Ceremony/16_Award_Ceremony_Awards_Ceremony_16_195.jpg
4
533.861 212.042 28.4521 37.2831 0.981712
455.145 186.312 27.8479 40.165 0.968743
232.433 24.2786 41.2361 58.8068 0.879042
597.455 239.345 24.9795 34.2779 0.835132
| 2024-06-14T01:26:18.401715 | https://example.com/article/9986 |
Q:
How to add a CheckBox in the office 2016 - Word?
How to add a CheckBox in the office 2016 - Word? When the user click on the box, the box should get checked. How do i add the check box in the word?
A:
Customize the ribbon and enable the Developer ribbon. The Developer ribbon has the controls that can be added to a page. After adding the control, you need to click Review ribbon > Restrict Editing and allow filling in forms. The screenshot shows how. Then click the button "Yes, start enforcing protection" and save the document.
| 2023-11-13T01:26:18.401715 | https://example.com/article/7996 |
Transcribed by David Price, email ccx074@coventry.ac.uk
THE SAINT'S TRAGEDY
PREFACE BY THE REV. F. D. MAURICE, M.A. (1848)
The writer of this play does not differ with his countrymen
generally, as to the nature and requirements of a Drama. He has
learnt from our Great Masters that it should exhibit human beings
engaged in some earnest struggle, certain outward aspects of which
may possibly be a spectacle for the amusement of idlers, but which
in itself is for the study and the sympathy of those who are
struggling themselves. A Drama, he feels, should not aim at the
inculcation of any definite maxim; the moral of it lies in the
action and the character. It must be drawn out of them by the heart
and experience of the reader, not forced upon him by the author.
The men and women whom he presents are not to be his spokesmen; they
are to utter themselves freely in such language, grave or mirthful,
as best expresses what they feel and what they are. The age to
which they belong is not to be contemplated as if it were apart from
us; neither is it to be measured by our rules; to be held up as a
model; to be condemned for its strangeness. The passions which
worked in it must be those which are working in ourselves. To the
same eternal laws and principles are we, and it, amenable. By
beholding these a poet is to raise himself, and may hope to raise
his readers, above antiquarian tastes and modern conventions. The
unity of the play cannot be conferred upon it by any artificial
arrangements; it must depend upon the relation of the different
persons and events to the central subject. No nice adjustments of
success and failure to right and wrong must constitute its poetical
justice; the conscience of the readers must be satisfied in some
deeper way than this, that there is an order in the universe, and
that the poet has perceived and asserted it.
Long before these principles were reduced into formal canons of
orthodoxy, even while they encountered the strong opposition of
critics, they were unconsciously recognised by Englishmen as sound
and national. Yet I question whether a clergyman writing in
conformity with them might not have incurred censure in former
times, and may not incur it now. The privilege of expressing his
own thoughts, sufferings, sympathies, in any form of verse is easily
conceded to him; if he liked to use a dialogue instead of a
monologue, for the purpose of enforcing a duty, or illustrating a
doctrine, no one would find fault with him; if he produced an actual
Drama for the purpose of defending or denouncing a particular
character, or period, or system of opinions, the compliments of one
party might console him for the abuse or contempt of another.
But it seems to be supposed that he is bound to keep in view one or
other of these ends: to divest himself of his own individuality
that he may enter into the working of other spirits; to lay aside
the authority which pronounces one opinion, or one habit of mind, to
be right and another wrong, that he may exhibit them in their actual
strife; to deal with questions, not in an abstract shape, but mixed
up with the affections, passions, relations of human creatures, is a
course which must lead him, it is thought, into a great
forgetfulness of his office, and of all that is involved in it.
No one can have less interest than I have in claiming poetical
privileges for the clergy; and no one, I believe, is more thoroughly
convinced that the standard which society prescribes for us, and to
which we ordinarily conform ourselves, instead of being too severe
and lofty, is far too secular and grovelling. But I apprehend the
limitations of this kind which are imposed upon us are themselves
exceedingly secular, betokening an entire misconception of the
nature of our work, proceeding from maxims and habits which tend to
make it utterly insignificant and abortive. If a man confines
himself to the utterance of his own experiences, those experiences
are likely to become every day more narrow and less real. If he
confines himself to the defence of certain propositions, he is sure
gradually to lose all sense of the connection between those
propositions and his own life, or the life of man. In either case
he becomes utterly ineffectual as a teacher. Those whose education
and character are different from his own, whose processes of mind
have therefore been different, are utterly unintelligible to him.
Even a cordial desire for sympathy is not able to break through the
prickly hedge of habits, notions, and technicalities which separates
them. Oftentimes the desire itself is extinguished in those who
ought to cherish it most, by the fear of meeting with something
portentous or dangerous. Nor can he defend a dogma better than he
communes with men; for he knows not that which attacks it. He
supposes it to be a set of book arguments, whereas it is something
lying very deep in the heart of the disputant, into which he has
never penetrated.
Hence there is a general complaint that we 'are ignorant of the
thoughts and feelings of our contemporaries'; most attribute this to
a fear of looking below the surface, lest we should find hollowness
within; many like to have it so, because they have thus an excuse
for despising us. But surely such an ignorance is more inexcusable
in us, than in the priests of any nation: we, less than any, are
kept from the sun and air; our discipline is less than any contrived
merely to make us acquainted with the commonplaces of divinity. We
are enabled, nay, obliged, from our youth upwards, to mix with
people of our own age, who are destined for all occupations and
modes of life; to share in their studies, their enjoyments, their
perplexities, their temptations. Experience, often so dearly
bought, is surely not meant to be thrown away: whether it has been
obtained without the sacrifice of that which is most precious, or
whether the lost blessing has been restored twofold, and good is
understood, not only as the opposite of evil, but as the deliverance
from it, we cannot be meant to forget all that we have been
learning. The teachers of other nations may reasonably mock us, as
having less of direct book-lore than themselves; they should not be
able to say, that we are without the compensation of knowing a
little more of living creatures.
A clergyman, it seems to me, should be better able than other men to
cast aside that which is merely accidental, either in his own
character, or in the character of the age to which he belongs, and
to apprehend that which is essential and eternal. His acceptance of
fixed creeds, which belong as much to one generation as another, and
which have survived amid all changes and convulsions, should raise
him especially above the temptation to exalt the fashion of his own
time, or of any past one; above the affectation of the obsolete,
above slavery to the present, and above that strange mixture of both
which some display, who weep because the beautiful visions of the
Past are departed, and admire themselves for being able to weep over
them--and dispense with them. His reverence for the Bible should
make him feel that we most realise our own personality when we most
connect it with that of our fellow-men; that acts are not to be
contemplated apart from the actor; that more of what is acceptable
to the God of Truth may come forth in men striving with infinite
confusion, and often uttering words like the east-wind, than in
those who can discourse calmly and eloquently about a righteousness
and mercy, which they know only by hearsay. The belief which a
minister of God has in the eternity of the distinction between right
and wrong should especially dispose him to recognise that
distinction apart from mere circumstance and opinion. The
confidence which he must have that the life of each man, and the
life of this world, is a drama, in which a perfectly Good and True
Being is unveiling His own purposes, and carrying on a conflict with
evil, which must issue in complete victory, should make him eager to
discover in every portion of history, in every biography, a divine
'Morality' and 'Mystery'--a morality, though it deals with no
abstract personages--a mystery, though the subject of it be the
doings of the most secular men.
The subject of this Play is certainly a dangerous one, it suggests
questions which are deeply interesting at the present time. It
involves the whole character and spirit of the Middle Ages. A
person who had not an enthusiastic admiration for the character of
Elizabeth would not be worthy to speak of her; it seems to me, that
he would be still less worthy, if he did not admire far more
fervently that ideal of the female character which God has
established, and not man--which she imperfectly realised--which
often exhibited itself in her in spite of her own more confused,
though apparently more lofty, ideal; which may be manifested more
simply, and therefore more perfectly, in the England of the
nineteenth century, than in the Germany of the thirteenth. To enter
into the meaning of self-sacrifice--to sympathise with any one who
aims at it--not to be misled by counterfeits of it--not to be unjust
to the truth which may be mixed with those counterfeits--is a
difficult task, but a necessary one for any one who takes this work
in hand. How far our author has attained these ends, others must
decide. I am sure that he will not have failed from forgetting
them. He has, I believe, faithfully studied all the documents of
the period within his reach, making little use of modern narratives;
he has meditated upon the past in its connection with the present;
has never allowed his reading to become dry by disconnecting it with
what he has seen and felt, or made his partial experiences a measure
for the acts which they help him to understand. He has entered upon
his work at least in a true and faithful spirit, not regarding it as
an amusement for leisure hours, but as something to be done
seriously, if done at all; as if he was as much 'under the Great
Taskmaster's eye' in this as in any other duty of his calling. In
certain passages and scenes he seemed to me to have been a little
too bold for the taste and temper of this age. But having written
them deliberately, from a conviction that morality is in peril from
fastidiousness, and that it is not safe to look at questions which
are really agitating people's hearts merely from the outside--he
has, and I believe rightly, retained what I should from cowardice
have wished him to exclude. I have no doubt, that any one who wins
a victory over the fear of opinion, and especially over the opinion
of the religious world, strengthens his own moral character, and
acquires a greater fitness for his high service.
Whether Poetry is again to revive among us, or whether the power is
to be wholly stifled by our accurate notions about the laws and
conditions under which it is to be exercised, is a question upon
which there is room for great differences of opinion. Judging from
the past, I should suppose that till Poetry becomes less self-
conscious, less self-concentrated, more _dramatical_ in spirit, if
not in form, it will not have the qualities which can powerfully
affect Englishmen. Not only were the Poets of our most national age
dramatists, but there seems an evident dramatical tendency in those
who wrote what we are wont to call narrative, or epic, poems. Take
away the dramatic faculty from Chaucer, and the Canterbury Tales
become indeed, what they have been most untruly called, mere
versions of French or Italian Fables. Milton may have been right in
changing the form of the Paradise Lost,--we are bound to believe
that he was right; for what appeal can there be against his genius?
But he could not destroy the essentially dramatic character of a
work which sets forth the battle between good and evil, and the Will
of Man at once the Theatre and the Prize of the conflict. Is it not
true, that there is in the very substance of the English mind, that
which naturally predisposes us to sympathy with the Drama, and this
though we are perhaps the most untheatrical of all people? The love
of action, the impatience of abstraction, the equity which leads us
to desire that every one may have a fair hearing, the reserve which
had rather detect personal experience than have it announced--
tendencies all easily perverted to evil, often leading to results
the most contradictory, yet capable of the noblest cultivation--seem
to explain the fact, that writers of this kind should have
flourished so greatly among us, and that scarcely any others should
permanently interest us.
These remarks do not concern poetical literature alone, or chiefly.
Those habits of mind, of which I have spoken, ought to make us the
best _historians_. If Germany has a right to claim the whole realm
of the abstract, if Frenchmen understand the framework of society
better than we do, there is in the national dramas of Shakespeare an
historical secret, which neither the philosophy of the one nor the
acute observation of the other can discover. Yet these dramas are
almost the only satisfactory expression of that historical faculty
which I believe is latent in us. The zeal of our factions, a result
of our national activity, has made earnest history dishonest: our
English justice has fled to indifferent and sceptical writers for
the impartiality which it sought in vain elsewhere. This resource
has failed,--the indifferentism of Hume could not secure him against
his Scotch prejudices, or against gross unfairness when anything
disagreeably positive and vehement came in his way. Moreover, a
practical people demand movement and life, not mere judging and
balancing. For a time there was a reaction in favour of party
history, but it could not last long; already we are glad to seek in
Ranke or Michelet that which seems denied us at home. Much, no
doubt, may be gained from such sources; but I am convinced that
_this_ is not the produce which we are meant generally to import;
for this we may trust to well-directed native industry. The time
is, I hope, at hand, when those who are most in earnest will feel
that therefore they are most bound to be just--when they will
confess the exceeding wickedness of the desire to distort or
suppress a fact, or misrepresent a character--when they will ask as
solemnly to be delivered from the temptation to this, as to any
crime which is punished by law.
The clergy ought especially to lead the way in this reformation.
They have erred grievously in perverting history to their own
purposes. What was a sin in others was in them a blasphemy, because
they professed to acknowledge God as the Ruler of the world, and
hereby they showed that they valued their own conclusions above the
facts which reveal His order. They owe, therefore, a great amende
to their country, and they should consider seriously how they can
make it most effectually. I look upon this Play as an effort in
this direction, which I trust may be followed by many more. On this
ground alone, even if its poetical worth was less than I believe it
is, I should, as a clergyman, be thankful for its publication.
F. D. M.
INTRODUCTION
The story which I have here put into a dramatic form is one familiar
to Romanists, and perfectly and circumstantially authenticated.
Abridged versions of it, carefully softened and sentimentalised, may
be read in any Romish collection of Lives of the Saints. An
enlarged edition has been published in France, I believe by Count
Montalembert, and translated, with illustrations, by an English
gentleman, which admits certain miraculous legends, of later date,
and, like other prodigies, worthless to the student of human
character. From consulting this work I have hitherto abstained, in
order that I might draw my facts and opinions, entire and unbiassed,
from the original Biography of Elizabeth, by Dietrich of Appold, her
contemporary, as given entire by Canisius.
Dietrich was born in Thuringia, near the scene of Elizabeth's
labours, a few years before her death; had conversed with those who
had seen her, and calls to witness 'God and the elect angels,' that
he had inserted nothing but what he had either understood from
religious and veracious persons, or read in approved writings, viz.
'The Book of the Sayings of Elizabeth's Four Ladies (Guta,
Isentrudis, and two others)'; 'The Letter which Conrad of Marpurg,
her Director, wrote to Pope Gregory the Ninth' (these two documents
still exist); 'The Sermon of Otto' (de Ordine Praedic), which begins
thus: 'Mulierem fortem.'
'Not satisfied with these,' he 'visited monasteries, castles, and
towns, interrogated the most aged and veracious persons, and wrote
letters, seeking for completeness and truth in all things;' and thus
composed his biography, from which that in Surius (Acta Sanctorum),
Jacobus de Voragine, Alban Butler, and all others which I have seen,
are copied with a very few additions and many prudent omissions.
Wishing to adhere strictly to historical truth, I have followed the
received account, not only in the incidents, but often in the
language which it attributes to its various characters; and have
given in the Notes all necessary references to the biography in
Canisius's collection. My part has therefore been merely to show
how the conduct of my heroine was not only possible, but to a
certain degree necessary, for a character of earnestness and piety
such as hers, working under the influences of the Middle Age.
In deducing fairly, from the phenomena of her life, the character of
Elizabeth, she necessarily became a type of two great mental
struggles of the Middle Age; first, of that between Scriptural or
unconscious, and Popish or conscious, purity: in a word, between
innocence and prudery; next, of the struggle between healthy human
affection, and the Manichean contempt with which a celibate clergy
would have all men regard the names of husband, wife, and parent.
To exhibit this latter falsehood in its miserable consequences, when
received into a heart of insight and determination sufficient to
follow out all belief to its ultimate practice, is the main object
of my Poem. That a most degrading and agonising contradiction on
these points must have existed in the mind of Elizabeth, and of all
who with similar characters shall have found themselves under
similar influences, is a necessity that must be evident to all who
know anything of the deeper affections of men. In the idea of a
married Romish saint, these miseries should follow logically from
the Romish view of human relations. In Elizabeth's case their
existence is proved equally logically from the acknowledged facts of
her conduct.
I may here observe, that if I have in no case made her allude to the
Virgin Mary, and exhibited the sense of infinite duty and loyalty to
Christ alone, as the mainspring of all her noblest deeds, it is
merely in accordance with Dietrich's biography. The omission of all
Mariolatry is remarkable. My business is to copy that omission, as
I should in the opposite case have copied the introduction of
Virgin-worship into the original tale. The business of those who
make Mary, to women especially, the complete substitute for the
Saviour--I had almost said, for all Three Persons of the Trinity--is
to explain, if they can, her non-appearance in this case.
Lewis, again, I have drawn as I found him, possessed of all virtues
but those of action; in knowledge, in moral courage, in spiritual
attainment, infinitely inferior to his wife, and depending on her to
be taught to pray; giving her higher faculties nothing to rest on in
himself, and leaving the noblest offices of a husband to be supplied
by a spiritual director. He thus becomes a type of the husbands of
the Middle Age, and of the woman-worship of chivalry. Woman-
worship, 'the honour due to the weaker vessel,' is indeed of God,
and woe to the nation and to the man in whom it dies. But in the
Middle Age, this feeling had no religious root, by which it could
connect itself rationally, either with actual wedlock or with the
noble yearnings of men's spirits, and it therefore could not but die
down into a semi-sensual dream of female-saint-worship, or fantastic
idolatry of mere physical beauty, leaving the women themselves an
easy prey to the intellectual allurements of the more educated and
subtle priesthood.
In Conrad's case, again, I have fancied that I discover in the
various notices of his life a noble nature warped and blinded by its
unnatural exclusions from those family ties through which we first
discern or describe God and our relations to Him, and forced to
concentrate his whole faculties in the service, not so much of a God
of Truth as of a Catholic system. In his character will be found, I
hope, some implicit apology for the failings of such truly great men
as Dunstan, Becket, and Dominic, and of many more whom, if we hate,
we shall never understand, while we shall be but too likely, in our
own way, to copy them.
Walter of Varila, a more fictitious character, represents the
'healthy animalism' of the Teutonic mind, with its mixture of deep
earnestness and hearty merriment. His dislike of priestly
sentimentalities is no anachronism. Even in his day, a noble lay-
religion, founded on faith in the divine and universal symbolism of
humanity and nature, was gradually arising, and venting itself, from
time to time, as I conceive, through many most unsuspected channels,
through chivalry, through the minne-singers, through the lay
inventors, or rather importers, of pointed architecture, through the
German school of painting, through the politics of the free towns,
till it attained complete freedom in Luther and his associate
reformers.
For my fantastic quotations of Scripture, if they shall be deemed
irreverent, I can only say, that they were the fashion of the time,
from prince to peasant--that there is scarcely one of them with
which I have not actually met in the writings of the period--that
those writings abound with misuse of Scripture, far more coarse,
arbitrary, and ridiculous, than any which I have dared to insert--
that I had no right to omit so radical a characteristic of the
Middle Age.
For the more coarse and homely passages with which the drama is
interspersed, I must make the same apology. I put them there
because they were there--because the Middle Age was, in the gross, a
coarse, barbarous, and profligate age--because it was necessary, in
order to bring out fairly the beauty of the central character, to
show 'the crooked and perverse generation' in which she was 'a child
of God without rebuke.' It was, in fact, the very ferocity and
foulness of the time which, by a natural revulsion, called forth at
the same time the Apostolic holiness and the Manichean asceticism of
the Mediaeval Saints. The world was so bad that, to be Saints at
all, they were compelled to go out of the world. It was necessary,
moreover, in depicting the poor man's patroness, to show the
material on which she worked; and those who know the poor, know also
that we can no more judge truly of their characters in the presence
of their benefactors, than we can tell by seeing clay in the
potter's hands what it was in its native pit. These scenes have,
therefore, been laid principally in Elizabeth's absence, in order to
preserve their only use and meaning.
So rough and common a life-picture of the Middle Age will, I am
afraid, whether faithful or not, be far from acceptable to those who
take their notions of that period principally from such exquisite
dreams as the fictions of Fouque, and of certain moderns whose
graceful minds, like some enchanted well,
In whose calm depths the pure and beautiful
Alone are mirrored,
are, on account of their very sweetness and simplicity, singularly
unfitted to convey any true likeness of the coarse and stormy Middle
Age. I have been already accused, by others than Romanists, of
profaning this whole subject--i.e. of telling the whole truth,
pleasant or not, about it. But really, time enough has been lost in
ignorant abuse of that period, and time enough also, lately, in
blind adoration of it. When shall we learn to see it as it was?--
the dawning manhood of Europe--rich with all the tenderness, the
simplicity, the enthusiasm of youth--but also darkened, alas! with
its full share of youth's precipitance and extravagance, fierce
passions and blind self-will--its virtues and its vices colossal,
and, for that very reason, always haunted by the twin-imp of the
colossal--the caricatured.
Lastly, the many miraculous stories which the biographer of
Elizabeth relates of her, I had no right, for the sake of truth, to
interweave in the plot, while it was necessary to indicate at least
their existence. I have, therefore, put such of them as seemed
least absurd into the mouth of Conrad, to whom, in fact, they owe
their original publication, and have done so, as I hope, not without
a just ethical purpose.
Such was my idea: of the inconsistencies and short-comings of this
its realisation, no one can ever be so painfully sensible as I am
already myself. If, however, this book shall cause one Englishman
honestly to ask himself, 'I, as a Protestant, have been accustomed
to assert the purity and dignity of the offices of husband, wife,
and parent. Have I ever examined the grounds of my own assertion?
Do I believe them to be as callings from God, spiritual,
sacramental, divine, eternal? Or am I at heart regarding and using
them, like the <DW7>, merely as heaven's indulgences to the
infirmities of fallen man?'--then will my book have done its work.
If, again, it shall deter one young man from the example of those
miserable dilettanti, who in books and sermons are whimpering meagre
second-hand praises of celibacy--depreciating as carnal and
degrading those family ties to which they owe their own existence,
and in the enjoyment of which they themselves all the while
unblushingly indulge--insulting thus their own wives and mothers--
nibbling ignorantly at the very root of that household purity which
constitutes the distinctive superiority of Protestant over Popish
nations--again my book will have done its work.
If, lastly, it shall awaken one pious Protestant to recognise, in
some, at least, of the Saints of the Middle Age, beings not only of
the same passions, but of the same Lord, the same faith, the same
baptism, as themselves, _Protestants_, not the less deep and true,
because utterly unconscious and practical--mighty witnesses against
the two antichrists of their age--the tyranny of feudal caste, and
the phantoms which Popery substitutes for the living Christ--then
also will my little book indeed have done its work. C. K.
1848.
CHARACTERS
Elizabeth, daughter of the King of Hungary,
Lewis, Landgrave of Thuringia, betrothed to her in childhood.
Henry, brother of Lewis.
Walter of Varila, }
Rudolf the Cupbearer, }
Leutolf of Erlstetten, }
Hartwig of Erba, } Vassals of Lewis.
Count Hugo, }
Count of Saym, etc. }
Conrad of Marpurg, a Monk, the Pope's Commissioner for the
suppression of heresy.
Gerard, his Chaplain.
Bishop of Bamberg, uncle of Elizabeth, etc. etc.
Sophia, Dowager Landgravine.
Agnes, her daughter, sister of Lewis.
Isentrudis, Elizabeth's nurse.
Guta, her favourite maiden.
Etc. etc. etc
The Scene lies principally in Eisenach, and the Wartburg; changing
afterwards to Bamberg, and finally to Marpurg.
PROEM
(EPIMETHEUS)
I
Wake again, Teutonic Father-ages,
Speak again, beloved primaeval creeds;
Flash ancestral spirit from your pages,
Wake the greedy age to noble deeds.
II
Tell us, how of old our saintly mothers
Schooled themselves by vigil, fast, and prayer,
Learnt to love as Jesus loved before them,
While they bore the cross which poor men bear.
III
Tell us how our stout crusading fathers
Fought and died for God, and not for gold;
Let their love, their faith, their boyish daring,
Distance-mellowed, gild the days of old.
IV
Tell us how the sexless workers, thronging,
Angel-tended, round the convent doors,
Wrought to Christian faith and holy order
Savage hearts alike and barren moors.
V
Ye who built the churches where we worship,
Ye who framed the laws by which we move,
Fathers, long belied, and long forsaken,
Oh! forgive the children of your love!
(PROMETHEUS)
I
Speak! but ask us not to be as ye were!
All but God is changing day by day.
He who breathes on man the plastic spirit
Bids us mould ourselves its robe of clay.
II
Old anarchic floods of revolution,
Drowning ill and good alike in night,
Sink, and bare the wrecks of ancient labour,
Fossil-teeming, to the searching light.
III
There will we find laws, which shall interpret,
Through the simpler past, existing life;
Delving up from mines and fairy caverns
Charmed blades, to cut the age's strife.
IV
What though fogs may stream from draining waters?
We will till the clays to mellow loam;
Wake the graveyard of our fathers' spirits;
Clothe its crumbling mounds with blade and bloom.
V.
Old decays but foster new creations;
Bones and ashes feed the golden corn;
Fresh elixirs wander every moment,
Down the veins through which the live past feeds its child, the
live unborn.
ACT I
SCENE I. A.D. 1220
The Doorway of a closed Chapel in the Wartburg. Elizabeth sitting
on the Steps.
Eliz. Baby Jesus, who dost lie
Far above that stormy sky,
In Thy mother's pure caress,
Stoop and save the motherless.
Happy birds! whom Jesus leaves
Underneath His sheltering eaves;
There they go to play and sleep,
May not I go in to weep?
All without is mean and small,
All within is vast and tall;
All without is harsh and shrill,
All within is hushed and still.
Jesus, let me enter in,
Wrap me safe from noise and sin.
Let me list the angels' songs,
See the picture of Thy wrongs;
Let me kiss Thy wounded feet,
Drink Thine incense, faint and sweet,
While the clear bells call Thee down
From Thine everlasting throne.
At thy door-step low I bend,
Who have neither kin nor friend;
Let me here a shelter find,
Shield the shorn lamb from the wind.
Jesu, Lord, my heart will break:
Save me for Thy great love's sake!
[Enter Isentrudis.]
Isen. Aha! I had missed my little bird from the nest,
And judged that she was here. What's this? fie, tears?
Eliz. Go! you despise me like the rest.
Isen. Despise you?
What's here? King Andrew's child? St. John's sworn maid?
Who dares despise you? Out upon these Saxons!
They sang another note when I was younger,
When from the rich East came my queenly pearl,
Lapt on this fluttering heart, while mighty heroes
Rode by her side, and far behind us stretched
The barbs and sumpter mules, a royal train,
Laden with silks and furs, and priceless gems,
Wedges of gold, and furniture of silver,
Fit for my princess.
Eliz. Hush now, I've heard all, nurse,
A thousand times.
Isen. Oh, how their hungry mouths
Did water at the booty! Such a prize,
Since the three Kings came wandering into Coln,
They ne'er saw, nor their fathers;--well they knew it!
Oh, how they fawned on us! 'Great Isentrudis!'
'Sweet babe!' The Landgravine did thank her saints
As if you, or your silks, had fallen from heaven;
And now she wears your furs, and calls us gipsies.
Come tell your nurse your griefs; we'll weep together,
Strangers in this strange land.
Eliz. I am most friendless.
The Landgravine and Agnes--you may see them
Begrudge the food I eat, and call me friend
Of knaves and serving-maids; the burly knights
Freeze me with cold blue eyes: no saucy page
But points and whispers, 'There goes our pet nun;
Would but her saintship leave her gold behind,
We'd give herself her furlough.' Save me! save me!
All here are ghastly dreams; dead masks of stone,
And you and I, and Guta, only live:
Your eyes alone have souls. I shall go mad!
Oh that they would but leave me all alone
To teach poor girls, and work within my chamber,
With mine own thoughts, and all the gentle angels
Which glance about my dreams at morning-tide!
Then I should be as happy as the birds
Which sing at my bower window. Once I longed
To be beloved,--now would they but forget me!
Most vile I must be, or they could not hate me!
Isen. They are of this world, thou art not, poor child,
Therefore they hate thee, as they did thy betters.
Eliz. But, Lewis, nurse?
Isen. He, child? he is thy knight;
Espoused from childhood: thou hast a claim upon him.
One that thou'lt need, alas!--though, I remember--
'Tis fifteen years agone--when in one cradle
We laid two fair babes for a marriage token;
And when your lips met, then you smiled, and twined
Your little limbs together.--Pray the Saints
That token stand!--He calls thee love and sister,
And brings thee gew-gaws from the wars: that's much!
At least he's thine if thou love him.
Eliz. If I love him?
What is this love? Why, is he not my brother
And I his sister? Till these weary wars,
The one of us without the other never
Did weep or laugh: what is't should change us now?
You shake your head and smile.
Isen. Go to; the chafe
Comes not by wearing chains, but feeling them.
Eliz. Alas! here comes a knight across the court;
Oh, hide me, nurse! What's here? this door is fast.
Isen. Nay, 'tis a friend: he brought my princess hither,
Walter of Varila; I feared him once--
He used to mock our state, and say, good wine
Should want no bush, and that the cage was gay,
But that the bird must sing before he praised it.
Yet he's a kind heart, while his bitter tongue
Awes these court popinjays at times to manners.
He will smile sadly too, when he meets my maiden;
And once he said, he was your liegeman sworn,
Since my lost mistress, weeping, to his charge
Trusted the babe she saw no more.--God help us!
Eliz. How did my mother die, nurse?
Isen. She died, my child.
Eliz. But how? Why turn away?
Too long I've guessed at some dread mystery
I may not hear: and in my restless dreams,
Night after night, sweeps by a frantic rout
Of grinning fiends, fierce horses, bodiless hands,
Which clutch at one to whom my spirit yearns
As to a mother. There's some fearful tie
Between me and that spirit-world, which God
Brands with his terrors on my troubled mind.
Speak! tell me, nurse! is she in heaven or hell?
Isen. God knows, my child: there are masses for her soul
Each day in every Zingar minster sung.
Eliz. But was she holy?--Died she in the Lord?
Isen [weeps]. O God! my child! And if I told thee all,
How couldst thou mend it?
Eliz. Mend it? O my Saviour!
I'd die a saint!
Win heaven for her by prayers, and build great minsters,
Chantries, and hospitals for her; wipe out
By mighty deeds our race's guilt and shame--
But thus, poor witless orphan! [Weeps.]
[Count Walter enters.]
Wal. Ah! my princess! accept your liegeman's knee;
Down, down, rheumatic flesh!
Eliz. Ah! Count Walter! you are too tall to kneel to little girls.
Wal. What? shall two hundredweight of hypocrisy bow down to his
four-inch wooden saint, and the same weight of honesty not worship
his four-foot live one? And I have a jest for you, shall make my
small queen merry and wise.
Isen. You shall jest long before she's merry.
Wal. Ah! dowers and dowagers again! The money--root of all evil.
What comes here? [A Page enters.]
A long-winged grasshopper, all gold, green, and gauze? How these
young pea-chicks must needs ape the grown peacock's frippery!
Prithee, now, how many such butterflies as you suck here together on
the thistle-head of royalty?
Page. Some twelve gentlemen of us, Sir--apostles of the blind
archer, Love--owning no divinity but almighty beauty--no faith, no
hope, no charity, but those which are kindled at her eyes.
Wal. Saints! what's all this?
Page. Ah, Sir! none but countrymen swear by the saints nowadays:
no oaths but allegorical ones, Sir, at the high table; as thus,--'By
the sleeve of beauty, Madam;' or again, 'By Love his martyrdoms, Sir
Count;' or to a potentate, 'As Jove's imperial mercy shall hear my
vows, High Mightiness.'
Wal. Where did the evil one set you on finding all this heathenry?
Page. Oh, we are all barristers of Love's court, Sir; we have
Ovid's gay science conned, Sir, ad unguentum, as they say, out of
the French book.
Wal. So? There are those come from Rome then will whip you and
Ovid out with the same rod which the dandies of Provence felt lately
to their sorrow. Oh, what blinkards are we gentlemen, to train any
dumb beasts more carefully than we do Christians! that a man shall
keep his dog-breakers, and his horse-breakers, and his hawk-
breakers, and never hire him a boy-breaker or two! that we should
live without a qualm at dangling such a flock of mimicking
parroquets at our heels a while, and then, when they are well
infected, well perfumed with the wind of our vices, dropping them
off, as tadpoles do their tails, joint by joint into the mud! to
strain at such gnats as an ill-mouthed colt or a riotous puppy, and
swallow that camel of camels, a page!
Page. Do you call me a camel, Sir?
Wal. What's your business?
Page. My errand is to the Princess here.
Eliz. To me?
Page. Yes; the Landgravine expects you at high mass; so go in, and
mind you clean yourself; for every one is not as fond as you of
beggars' brats, and what their clothes leave behind them.
Isen [strikes him]. Monkey! To whom are you speaking?
Eliz. Oh, peace, peace, peace! I'll go with him.
Page. Then be quick, my music-master's waiting. Corpo di Bacco! as
if our elders did not teach us to whom we ought to be rude! [Ex.
Eliz. and Page.]
Isen. See here, Sir Saxon, how this pearl of price
Is faring in your hands! The peerless image,
To whom this court is but the tawdry frame,--
The speck of light amid its murky baseness,--
The salt which keeps it all from rotting,--cast
To be the common fool,--the laughing stock
For every beardless knave to whet his wit on!
Tar-blooded Germans!--Here's another of them.
[A young Knight enters.]
Knight. Heigh! Count! What? learning to sing psalms? They are
waiting
For you in the manage-school, to give your judgment
On that new Norman mare.
Wal. Tell them I'm busy.
Knight. Busy? St. Martin! Knitting stockings, eh?
To clothe the poor withal? Is that your business?
I passed that canting baby on the stairs;
Would heaven that she had tripped, and broke her goose-neck,
And left us heirs de facto. So, farewell. [Exit.]
Wal. A very pretty quarrel! matter enough
To spoil a waggon-load of ash-staves on,
And break a dozen fools' backs across their cantlets.
What's Lewis doing?
Isen. Oh--befooled,--
Bewitched with dogs and horses, like an idiot
Clutching his bauble, while a priceless jewel
Sticks at his miry heels.
Wal. The boy's no fool,--
As good a heart as hers, but somewhat given
To hunt the nearest butterfly, and light
The fire of fancy without hanging o'er it
The porridge-pot of practice. He shall hear or--
Isen. And quickly, for there's treason in the wind.
They'll keep her dower, and send her home with shame
Before the year's out.
Wal. Humph! Some are rogues enough for't.
As it falls out, I ride with him to-day.
Isen. Upon what business?
Wal. Some shaveling has been telling him that there are heretics on
his land: Stadings, worshippers of black cats, baby-eaters, and
such like. He consulted me; I told him it would be time enough to
see to the heretics when all the good Christians had been well
looked after. I suppose the novelty of the thing smit him, for now
nothing will serve but I must ride with him round half a dozen
hamlets, where, with God's help, I will show him a mansty or two,
that shall astonish his delicate chivalry.
Isen. Oh, here's your time! Speak to him, noble Walter.
Stun his dull ears with praises of her grace;
Prick his dull heart with shame at his own coldness.
Oh right us, Count.
Wal. I will, I will: go in
And dry your eyes. [Exeunt separately.]
SCENE II
A Landscape in Thuringia. Lewis and Walter riding.
Lewis. So all these lands are mine; these yellow meads--
These village greens, and forest-fretted hills,
With dizzy castles crowned. Mine! Why that word
Is rich in promise, in the action bankrupt.
What faculty of mine, save dream-fed pride,
Can these things fatten? Mass! I had forgot:
I have a right to bark at trespassers.
Rare privilege! While every fowl and bush,
According to its destiny and nature
(Which were they truly mine, my power could alter),
Will live, and grow, and take no thought of me.
Those firs, before whose stealthy-marching ranks
The world-old oaks still dwindle and retreat,
If I could stay their poisoned frown, which cows
The pale shrunk underwood, and nestled seeds
Into an age of sleep, 'twere something: and those men
O'er whom that one word 'ownership' uprears me--
If I could make them lift a finger up
But of their own free will, I'd own my seizin.
But now--when if I sold them, life and limb,
There's not a sow would litter one pig less
Than when men called her mine.--Possession's naught;
A parchment ghost; a word I am ashamed
To claim even here, lest all the forest spirits,
And bees who drain unasked the free-born flowers,
Should mock, and cry, 'Vain man, not thine, but ours.'
Wal. Possession's naught? Possession's beef and ale--
Soft bed, fair wife, gay horse, good steel.--Are they naught?
Possession means to sit astride of the world,
Instead of having it astride of you;
Is that naught? 'Tis the easiest trade of all too;
For he that's fit for nothing else, is fit
To own good land, and on the slowest dolt
His state sits easiest, while his serfs thrive best.
Lewis. How now? What need then of long discipline,
Not to mere feats of arms, but feats of soul;
To courtesies and high self-sacrifice,
To order and obedience, and the grace
Which makes commands, requests, and service, favour?
To faith and prayer, and pure thoughts, ever turned
To that Valhalla, where the virgin saints
And stainless heroes tend the Queen of heaven?
Why these, if I but need, like stalled ox
To chew the grass cut for me?
Wal. Why? Because
I have trained thee for a knight, boy, not a ruler.
All callings want their proper 'prentice time
But this of ruling; it comes by mother-wit;
And if the wit be not exceeding great,
'Tis best the wit be most exceeding small;
And he that holds the reins should let the horse
Range on, feed where he will, live and let live.
Custom and selfishness will keep all steady
For half a life.--Six months before you die
You may begin to think of interfering.
Lewis. Alas! while each day blackens with fresh clouds,
Complaints of ague, fever, crumbling huts,
Of land thrown out to the forest, game and keepers,
Bailiffs and barons, plundering all alike;
Need, greed, stupidity: To clear such ruin
Would task the rich prime of some noble hero--
But can I nothing do?
Wal. Oh! plenty, Sir;
Which no man yet has done or e'er will do.
It rests with you, whether the priest be honoured;
It rests with you, whether the knight be knightly;
It rests with you, whether those fields grow corn;
It rests with you, whether those toiling peasants
Lift to their masters free and loyal eyes,
Or crawl, like jaded hacks, to welcome graves.
It rests with you--and will rest.
Lewis. I'll crowd my court and dais with men of God,
As doth my peerless namesake, King of France.
Wal. Priests, Sir? The Frenchman keeps two counsellors
Worth any drove of priests.
Lewis. And who are they?
Wal. God and his lady-love, [aside] He'll open at that--
Lewis. I could be that man's squire.
Wal [aside] Again run riot--
Now for another cast, [aloud] If you'd sleep sound, Sir,
You'll let priests pray for you, but school you never.
Lewis. Mass! who more fitted?
Wal. None, if you could trust them;
But they are the people's creatures; poor men give them
Their power at the church, and take it back at the ale-house:
Then what's the friar to the starving peasant?
Just what the abbot is to the greedy noble--
A scarecrow to lear wolves. Go ask the church plate,
Safe in knights' cellars, how these priests are feared.
Bruised reeds when you most need them.--No, my Lord;
Copy them, trust them never.
Lewis. Copy? wherein?
Wal. In letting every man
Do what he likes, and only seeing he does it
As you do your work--well. That's the Church secret
For breeding towns, as fast as you breed roe-deer;
Example, but not meddling. See that hollow--
I knew it once all heath, and deep peat-bog--
I drowned a black mare in that self-same spot
Hunting with your good father: Well, he gave
One jovial night, to six poor Erfurt monks--
Six picked-visaged, wan, bird-fingered wights--
All in their rough hair shirts, like hedgehogs starved--
I told them, six weeks' work would break their hearts:
They answered, Christ would help, and Christ's great mother,
And make them strong when weakest: So they settled:
And starved and froze.
Lewis. And dug and built, it seems.
Wal. Faith, that's true. See--as garden walls draw snails,
They have drawn a hamlet round; the <DW72>s are blue,
Knee-deep with flax, the orchard boughs are breaking
With strange outlandish fruits. See those young rogues
Marching to school; no poachers here, Lord Landgrave,--
Too much to be done at home; there's not a village
Of yours, now, thrives like this. By God's good help
These men have made their ownership worth something.
Here comes one of them.
Lewis. I would speak to him--
And learn his secret.--We'll await him here.
[Enter Conrad.]
Con. Peace to you, reverend and war-worn knight,
And you, fair youth, upon whose swarthy lip
Blooms the rich promise of a noble manhood.
Methinks, if simple monks may read your thoughts,
That with no envious or distasteful eyes
Ye watch the labours of God's poor elect.
Wal. Why--we were saying, how you cunning rooks
Pitch as by instinct on the fattest fallows.
Con. For He who feeds the ravens, promiseth
Our bread and water sure, and leads us on
By peaceful streams in pastures green to lie,
Beneath our Shepherd's eye.
Lewis. In such a nook, now,
To nestle from this noisy world--
Con. And drop
The burden of thyself upon the threshold.
Lewis. Think what rich dreams may haunt those lowly roofs!
Con. Rich dreams,--and more; their dreams will find fulfilment--
Their discipline breeds strength--'Tis we alone
Can join the patience of the labouring ox
Unto the eagle's foresight,--not a fancy
Of ours, but grows in time to mighty deeds;
Victories in heavenly warfare: but yours, yours, Sir,
Oh, choke them, choke the panting hopes of youth,
Ere they be born, and wither in slow pains,
Cast by for the next bauble!
Lewis. 'Tis too true!
I dread no toil; toil is the true knight's pastime--
Faith fails, the will intense and fixed, so easy
To thee, cut off from life and love, whose powers
In one close channel must condense their stream:
But I, to whom this life blooms rich and busy,
Whose heart goes out a-Maying all the year
In this new Eden--in my fitful thought
What skill is there, to turn my faith to sight--
To pierce blank Heaven, like some trained falconer
After his game, beyond all human ken?
Wal. And walk into the bog beneath your feet.
Con. And change it to firm land by magic step!
Build there cloud-cleaving spires, beneath whose shade
Great cities rise for vassals; to call forth
From plough and loom the rank unlettered hinds,
And make them saints and heroes--send them forth
To sway with heavenly craft the spirit of princes;
Change nations' destinies, and conquer worlds
With love, more mighty than the sword; what, Count?
Art thou ambitious? practical? we monks
Can teach you somewhat there too.
Lewis. Be it so;
But love you have forsworn; and what were life
Without that chivalry, which bends man's knees
Before God's image and his glory, best
Revealed in woman's beauty?
Con. Ah! poor worldlings!
Little you dream what maddening ecstasies,
What rich ideals haunt, by day and night,
Alone, and in the crowd, even to the death,
The servitors of that celestial court
Where peerless Mary, sun-enthroned, reigns,
In whom all Eden dreams of womanhood,
All grace of form, hue, sound, all beauty strewn
Like pearls unstrung, about this ruined world,
Have their fulfilment and their archetype.
Why hath the rose its scent, the lily grace?
To mirror forth her loveliness, from whom,
Primeval fount of grace, their livery came:
Pattern of Seraphs! only worthy ark
To bear her God athwart the floods of time!
Lewis. Who dare aspire to her? Alas, not I!
To me she is a doctrine, and a picture:--
I cannot live on dreams.
Con. She hath her train:--
There thou may'st choose thy love: If world-wide lore
Shall please thee, and the Cherub's glance of fire,
Let Catharine lift thy soul, and rapt with her
Question the mighty dead, until thou float
Tranced on the ethereal ocean of her spirit.
If pity father passion in thee, hang
Above Eulalia's tortured loveliness;
And for her sake, and in her strength, go forth
To do and suffer greatly. Dost thou long
For some rich heart, as deep in love as weakness,
Whose wild simplicity sweet heaven-born instincts
Alone keep sane?
Lewis. I do, I do. I'd live
And die for each and all the three.
Con. Then go--
Entangled in the Magdalen's tresses lie;
Dream hours before her picture, till thy lips
Dare to approach her feet, and thou shalt start
To find the canvas warm with life, and matter
A moment transubstantiate to heaven.
Wal. Ay, catch his fever, Sir, and learn to take
An indigestion for a troop of angels.
Come, tell him, monk, about your magic gardens,
Where not a stringy head of kale is cut
But breeds a vision or a revelation.
Lewis. Hush, hush, Count! Speak, strange monk, strange words, and
waken
Longings more strange than either.
Con. Then, if proved,
As I dare vouch thee, loyal in thy love,
Even to the Queen herself thy saintlier soul
At length may soar: perchance--Oh, bliss too great
For thought--yet possible!
Receive some token--smile--or hallowing touch
Of that white hand, beneath whose soft caress
The raging world is smoothed, and runs its course
To shadow forth her glory.
Lewis. Thou dost tempt me--
That were a knightly quest.
Con. Ay, here's true love.
Love's heaven, without its hell; the golden fruit
Without the foul husk, which at Adam's fall
Did crust it o'er with filth and selfishness.
I tempt thee heavenward--from yon azure walls
Unearthly beauties beckon--God's own mother
Waits longing for thy choice--
Lewis. Is this a dream?
Wal. Ay, by the Living Lord, who died for you!
Will you be cozened, Sir, by these air-blown fancies,
These male hysterics, by starvation bred
And huge conceit? Cast off God's gift of manhood,
And, like the dog in the adage, drop the true bone
With snapping at the sham one in the water?
What were you born a man for?
Lewis. Ay, I know it:--
I cannot live on dreams. Oh for one friend,
Myself, yet not myself; one not so high
But she could love me, not too pure to pardon
My sloth and meanness! Oh for flesh and blood,
Before whose feet I could adore, yet love!
How easy then were duty! From her lips
To learn my daily task;--in her pure eyes
To see the living type of those heaven-glories
I dare not look on;--let her work her will
Of love and wisdom on these straining hinds;--
To squire a saint around her labour field,
And she and it both mine:--That were possession!
Con. The flesh, fair youth--
Wal. Avaunt, bald snake, avaunt!
We are past your burrow now. Come, come, Lord Landgrave,
Look round, and find your saint.
Lewis. Alas! one such--
One such, I know, who upward from one cradle
Beside me like a sister--No, thank God! no sister!--
Has grown and grown, and with her mellow shade
Has blanched my thornless thoughts to her own hue,
And even now is budding into blossom,
Which never shall bear fruit, but inward still
Resorb its vital nectar, self-contained,
And leave no living copies of its beauty
To after ages. Ah! be less, sweet maid,
Less than thyself! Yet no--my wife thou might'st be,
If less than thus--but not the saint thou art.
What! shall my selfish longings drag thee down
From maid to wife? degrade the soul I worship?
That were a caitiff deed! Oh, misery!
Is wedlock treason to that purity,
Which is the jewel and the soul of wedlock?
Elizabeth! my saint! [Exit Conrad.]
Wal. What, Sir? the Princess?
Ye saints in heaven, I thank you!
Lewis. Oh, who else,
Who else the minutest lineament fulfils
Of this my cherished portrait?
Wal. So--'tis well.
Hear me, my Lord.--You think this dainty princess
Too perfect for you, eh? That's well again;
For that whose price after fruition falls
May well too high be rated ere enjoyed--
In plain words,--if she looks an angel now, you will be better mated
than you expected, when you find her--a woman. For flesh and blood
she is, and that young blood,--whom her childish misusage and your
brotherly love; her loneliness and your protection; her springing
fancy and (for I may speak to you as a son) your beauty and knightly
grace, have so bewitched, and as some say, degraded, that briefly,
she loves you, and briefly, better, her few friends fear, than you
love her.
Lewis. Loves me! My Count, that word is quickly spoken;
And yet, if it be true, it thrusts me forth
Upon a shoreless sea of untried passion,
From whence is no return.
Wal. By Siegfried's sword,
My words are true, and I came here to say them,
To thee, my son in all but blood.
Mass, I'm no gossip. Why? What ails the boy?
Lewis. Loves me! Henceforth let no man, peering down
Through the dim glittering mine of future years,
Say to himself 'Too much! this cannot be!'
To-day, and custom, wall up our horizon:
Before the hourly miracle of life
Blindfold we stand, and sigh, as though God were not.
I have wandered in the mountains, mist-bewildered,
And now a breeze comes, and the veil is lifted,
And priceless flowers, o'er which I trod unheeding,
Gleam ready for my grasp. She loves me then!
She who to me was as a nightingale
That sings in magic gardens, rock-beleaguered,
To passing angels melancholy music--
Whose dark eyes hung, like far-off evening stars,
Through rosy-cushioned windows coldly shining
Down from the cloud-world of her unknown fancy--
She, for whom holiest touch of holiest knight
Seemed all too gross--who might have been a saint
And companied with angels--thus to pluck
The spotless rose of her own maidenhood
To give it unto me!
Wal. You love her then?
Lewis. Look! if yon solid mountain were all gold,
And each particular tree a band of jewels,
And from its womb the Niebelungen hoard
With elfin wardens called me, 'Leave thy love
And be our Master'--I would turn away--
And know no wealth but her.
Wal. Shall I say this to her?
I am no carrier pigeon, Sir, by breed,
But now, between her friends and persecutors,
My life's a burden.
Lewis. Persecutors! Who?
Alas! I guess it--I had known my mother
Too light for that fair saint,--but who else dare wink
When she is by? My knights?
Wal. To a man, my Lord.
Lewis. Here's chivalry! Well, that's soon brought to bar.
The quarrel's mine; my lance shall clear that stain.
Wal. Quarrel with your knights? Cut your own chair-legs off!
They do but sail with the stream. Her passion, Sir,
Broke shell and ran out twittering before yours did,
And unrequited love is mortal sin
With this chaste world. My boy, my boy, I tell you,
The fault lies nearer home.
Lewis. I have played the coward--
And in the sloth of false humility,
Cast by the pearl I dared not to deserve.
How laggard I must seem to her, though she love me;
Playing with hawks and hounds, while she sits weeping!
'Tis not too late.
Wal. Too late, my royal eyas?
You shall strike this deer yourself at gaze ere long--
She has no mind to slip to cover.
Lewis. Come--
We'll back--we'll back; and you shall bear the message;
I am ashamed to speak. Tell her I love her--
That I should need to tell her! Say, my coyness
Was bred of worship, not of coldness.
Wal. Then the serfs
Must wait?
Lewis. Why not? This day to them, too, blessing brings,
Which clears from envious webs their guardian angel's wings.
[Exeunt.]
SCENE III
A Chamber in the Castle. Sophia, Elizabeth, Agnes, Isentrude, etc.,
re-entering.
Soph. What! you will not? You hear, Dame Isentrude,
She will not wear her coronet in the church,
Because, forsooth, the crucifix within
Is crowned with thorns. You hear her.
Eliz. Noble mother!
How could I flaunt this bauble in His face
Who hung there, naked, bleeding, all for me--
I felt it shamelessness to go so gay.
Soph. Felt? What then? Every foolish wench has feelings
In these religious days, and thinks it carnal
To wash her dishes, and obey her parents--
No wonder they ape you, if you ape them--
Go to! I hate this humble-minded pride,
Self-willed submission--to your own pert fancies;
This fog-bred mushroom-spawn of brain-sick wits,
Who make their oddities their test for grace,
And peer about to catch the general eye;
Ah! I have watched you throw your playmates down
To have the pleasure of kneeling for their pardon.
Here's sanctity--to shame your cousin and me--
Spurn rank and proper pride, and decency;--
If God has made you noble, use your rank,
If you but know how. You Landgravine? You mated
With gentle Lewis? Why, belike you'll cowl him,
As that stern prude, your aunt, cowled her poor spouse;
No--one Hedwiga at a time's enough,--
My son shall die no monk.
Isen. Beseech you, Madam,--
Weep not, my darling.
Soph. Tut--I'll speak my mind.
We'll have no saints. Thank heaven, my saintliness
Ne'er troubled my good man, by day or night.
We'll have no saints, I say; far better for you,
And no doubt pleasanter--You know your place--
At least you know your place,--to take to cloisters,
And there sit carding wool, and mumbling Latin,
With sour old maids, and maundering Magdalens,
Proud of your frost-kibed feet, and dirty serge.
There's nothing noble in you, but your blood;
And that one almost doubts. Who art thou, child?
Isen. The daughter, please your highness,
Of Andreas, King of Hungary, your better;
And your son's spouse.
Soph. I had forgotten, truly--
And you, Dame Isentrudis, are her servant,
And mine: come, Agnes, leave the gipsy ladies
To say their prayers, and set the Saints the fashion.
[Sophia and Agnes go out.]
Isen. Proud hussy! Thou shalt set thy foot on her neck yet,
darling,
When thou art Landgravine.
Eliz. And when will that be?
No, she speaks truth! I should have been a nun.
These are the wages of my cowardice,--
Too weak to face the world, too weak to leave it!
Guta. I'll take the veil with you.
Eliz. 'Twere but a moment's work,--
To slip into the convent there below,
And be at peace for ever. And you, my nurse?
Isen. I will go with thee, child, where'er thou goest.
But Lewis?
Eliz. Ah! my brother! No, I dare not--
I dare not turn for ever from this hope,
Though it be dwindled to a thread of mist.
Oh that we two could flee and leave this Babel!
Oh if he were but some poor chapel-priest,
In lonely mountain valleys far away;
And I his serving-maid, to work his vestments,
And dress his scrap of food, and see him stand
Before the altar like a rainbowed saint;
To take the blessed wafer from his hand,
Confess my heart to him, and all night long
Pray for him while he slept, or through the lattice
Watch while he read, and see the holy thoughts
Swell in his big deep eyes!--Alas! that dream
Is wilder than the one that's fading even now!
Who's here? [A Page enters.]
Page. The Count of Varila, Madam, begs permission to speak with
you.
Eliz. With me? What's this new terror?
Tell him I wait him.
Isen [aside]. Ah! my old heart sinks--
God send us rescue! Here the champion comes.
[Count Walter enters.]
Wal. Most learned, fair, and sanctimonious Princess--
Plague, what comes next? I had something orthodox ready;
'Tis dropped out by the way.--Mass! here's the pith on't.--
Madam, I come a-wooing; and for one
Who is as only worthy of your love,
As you of his; he bids me claim the spousals
Made long ago between you,--and yet leaves
Your fancy free, to grant or pass that claim:
And being that Mercury is not my planet,
He hath advised himself to set herein,
With pen and ink, what seemed good to him,
As passport to this jewelled mirror, pledge
Unworthy of his worship. [Gives a letter and jewel.]
Isen. Nunc Domine dimittis servam tuam!
[Elizabeth looks over the letter and casket, claps her hands and
bursts into childish laughter.]
Why here's my Christmas tree come after Lent--
Espousals? pledges? by our childish love?
Pretty words for folks to think of at the wars,--
And pretty presents come of them! Look, Guta!
A crystal clear, and carven on the reverse
The blessed rood. He told me once--one night,
When we did sit in the garden--What was I saying?
Wal. My fairest Princess, as ambassador,
What shall I answer?
Eliz. Tell him--tell him--God!
Have I grown mad, or a child, within the moment?
The earth has lost her gray sad hue, and blazes
With her old life-light; hark! yon wind's a song--
Those clouds are angels' robes.--That fiery west
Is paved with smiling faces.--I am a woman,
And all things bid me love! my dignity
Is thus to cast my virgin pride away;
And find my strength in weakness.--Busy brain!
Thou keep'st pace with my heart; old lore, old fancies,
Buried for years, leap from their tombs, and proffer
Their magic service to my new-born spirit.
I'll go--I am not mistress of myself--
Send for him--bring him to me--he is mine! [Exit.]
Isen. Ah! blessed Saints! how changed upon the moment!
She is grown taller, trust me, and her eye
Flames like a fresh-caught hind's. She that was christened
A brown mouse for her stillness! Good my Lord!
Now shall mine old bones see the grave in peace!
SCENE IV
The Bridal Feast. Elizabeth, Lewis, Sophia, and Company seated at
the Dais table. Court Minstrel and Court Fool sitting on the Dais
steps.
Min. How gaily smile the heavens,
The light winds whisper gay;
For royal birth and knightly worth
Are knit to one to-day.
Fool [drowning his voice].
So we'll flatter them up, and we'll cocker them up,
Till we turn young brains;
And pamper the brach till we make her a wolf,
And get bit by the legs for our pains.
Monks [chanting without].
A fastu et superbia
Domine libera nos.
Min. 'Neath sandal red and samite,
Are knights and ladies set;
The henchmen tall stride through the hall,
The board with wine is wet.
Fool. Oh! merrily growls the starving hind,
At my full skin;
And merrily howl wolf, wind, and owl,
While I lie warm within.
Monks. A luxu et avaritia
Domine libera nos.
Min. Hark! from the bridal bower,
Rings out the bridesmaid's song;
''Tis the mystic hour of an untried power,
The bride she tarries long.'
Fool. She's schooling herself and she's steeling herself,
Against the dreary day,
When she'll pine and sigh from her lattice high
For the knight that's far away.
Monks. A carnis illectamentis
Domine libera nos.
Min. Blest maid! fresh roses o'er thee
The careless years shall fling;
While days and nights shall new delights
To sense and fancy bring.
Fool. Satins and silks, and feathers and lace,
Will gild life's pill;
In jewels and gold folks cannot grow old,
Fine ladies will never fall ill.
Monks. A vanitatibus saeculi
Domine libera nos.
[Sophia descends from the Dais, leading Elizabeth. Ladies follow.]
Sophia [to the Fool]. Silence, you screech-owl.--
Come strew flowers, fair ladies,
And lead into her bower our fairest bride,
The cynosure of love and beauty here,
Who shrines heaven's graces in earth's richest casket.
Eliz. I come, [aside] Here, Guta, take those monks a fee--
Tell them I thank them--bid them pray for me.
I am half mazed with trembling joy within,
And noisy wassail round. 'Tis well, for else
The spectre of my duties and my dangers
Would whelm my heart with terror. Ah! poor self!
Thou took'st this for the term and bourne of troubles--
And now 'tis here, thou findest it the gate
Of new sin-cursed infinities of labour,
Where thou must do, or die!
[aloud] Lead on. I'll follow. [Exeunt.]
Fool. There, now. No fee for the fool; and yet my prescription was
as good as those old Jeremies'. But in law, physic, and divinity,
folks had sooner be poisoned in Latin, than saved in the mother-
tongue.
ACT II
SCENE I. A.D. 1221-27
Elizabeth's Bower. Night. Lewis sleeping in an Alcove.
Elizabeth lying on the Floor in the Foreground.
Eliz. No streak yet in the blank and eyeless east--
More weary hours to ache, and smart, and shiver
On these bare boards, within a step of bliss.
Why peevish? 'Tis mine own will keeps me here--
And yet I hate myself for that same will:
Fightings within and out! How easy 'twere, now,
Just to be like the rest, and let life run--
To use up to the rind what joys God sends us,
Not thus forestall His rod: What! and so lose
The strength which comes by suffering? Well, if grief
Be gain, mine's double--fleeing thus the snare
Of yon luxurious and unnerving down,
And widowed from mine Eden. And why widowed?
Because they tell me, love is of the flesh,
And that's our house-bred foe, the adder in our bosoms,
Which warmed to life, will sting us. They must know--
I do confess mine ignorance, O Lord!
Mine earnest will these painful limbs may prove.
. . . . .
And yet I swore to love him.--So I do
No more than I have sworn. Am I to blame
If God makes wedlock that, which if it be not,
It were a shame for modest lips to speak it,
And silly doves are better mates than we?
And yet our love is Jesus' due,--and all things
Which share with Him divided empery
Are snares and idols--'To love, to cherish, and to obey!'
. . . . .
O deadly riddle! Rent and twofold life!
O cruel troth! To keep thee or to break thee
Alike seems sin! O thou beloved tempter,
[Turning toward the bed.]
Who first didst teach me love, why on thyself
From God divert thy lesson? Wilt provoke Him?
What if mine heavenly Spouse in jealous ire
Should smite mine earthly spouse? Have I two husbands?
The words are horror--yet they are orthodox!
[Rises and goes to the window.]
How many many brows of happy lovers
The fragrant lips of night even now are kissing!
Some wandering hand in hand through arched lanes;
Some listening for loved voices at the lattice;
Some steeped in dainty dreams of untried bliss;
Some nestling soft and deep in well-known arms,
Whose touch makes sleep rich life. The very birds
Within their nests are wooing! So much love!
All seek their mates, or finding, rest in peace;
The earth seems one vast bride-bed. Doth God tempt us?
Is't all a veil to blind our eyes from him?
A fire-fly at the candle. 'Tis love leads him;
Love's light, and light is love: O Eden! Eden!
Eve was a virgin there, they say; God knows.
Must all this be as it had never been?
Is it all a fleeting type of higher love?
Why, if the lesson's pure, is not the teacher
Pure also? Is it my shame to feel no shame?
Am I more clean, the more I scent uncleanness?
Shall base emotions picture Christ's embrace?
Rest, rest, torn heart! Yet where? in earth or heaven?
Still, from out the bright abysses, gleams our Lady's silver
footstool,
Still the light-world sleeps beyond her, though the night-clouds
fleet below.
Oh that I were walking, far above, upon that dappled pavement,
Heaven's floor, which is the ceiling of the dungeon where we lie.
Ah, what blessed Saints might meet me, on that platform, sliding
silent,
Past us in its airy travels, angel-wafted, mystical!
They perhaps might tell me all things, opening up the secret
fountains
Which now struggle, dark and turbid, through their dreary prison
clay.
Love! art thou an earth-born streamlet, that thou seek'st the lowest
hollows?
Sure some vapours float up from thee, mingling with the highest
blue.
Spirit-love in spirit-bodies, melted into one existence--
Joining praises through the ages--Is it all a minstrel's dream?
Alas! he wakes. [Lewis rises.]
Lewis. Ah! faithless beauty,
Is this your promise, that whene'er you prayed
I should be still the partner of your vigils,
And learn from you to pray? Last night I lay dissembling
When she who woke you, took my feet for yours:
Now I shall seize my lawful prize perforce.
Alas! what's this? These shoulders' cushioned ice,
And thin soft flanks, with purple lashes all,
And weeping furrows traced! Ah! precious life-blood!
Who has done this?
Eliz. Forgive! 'twas I--my maidens--
Lewis. O ruthless hags!
Eliz. Not so, not so--They wept
When I did bid them, as I bid thee now
To think of nought but love.
Lewis. Elizabeth!
Speak! I will know the meaning of this madness!
Eliz. Beloved, thou hast heard how godly souls,
In every age, have tamed the rebel flesh
By such sharp lessons. I must tread their paths,
If I would climb the mountains where they rest.
Grief is the gate of bliss--why wedlock--knighthood--
A mother's joy--a hard-earned field of glory--
By tribulation come--so doth God's kingdom.
Lewis. But doleful nights, and self-inflicted tortures--
Are these the love of God? Is He well pleased
With this stern holocaust of health and joy?
Eliz. What! Am I not as gay a lady-love
As ever clipt in arms a noble knight?
Am I not blithe as bird the live-long day?
It pleases me to bear what you call pain,
Therefore to me 'tis pleasure: joy and grief
Are the will's creatures; martyrs kiss the stake--
The moorland colt enjoys the thorny furze--
The dullest boor will seek a fight, and count
His pleasure by his wounds; you must forget, love,
Eve's curse lays suffering, as their natural lot,
On womankind, till custom makes it light.
I know the use of pain: bar not the leech
Because his cure is bitter--'Tis such medicine
Which breeds that paltry strength, that weak devotion,
For which you say you love me.--Ay, which brings
Even when most sharp, a stern and awful joy
As its attendant angel--I'll say no more--
Not even to thee--command, and I'll obey thee.
Lewis. Thou casket of all graces! fourfold wonder
Of wit and beauty, love and wisdom! Canst thou
Beatify the ascetic's savagery
To heavenly prudence? Horror melts to pity,
And pity kindles to adoring shower
Of radiant tears! Thou tender cruelty!
Gay smiling martyrdom! Shall I forbid thee?
Limit thy depth by mine own shallowness?
Thy courage by my weakness? Where thou darest,
I'll shudder and submit. I kneel here spell-bound
Before my bleeding Saviour's living likeness
To worship, not to cavil: I had dreamt of such things,
Dim heard in legends, while my pitiful blood
Tingled through every vein, and wept, and swore
'Twas beautiful, 'twas Christ-like--had I thought
That thou wert such:--
Eliz. You would have loved me still?
Lewis. I have gone mad, I think, at every parting
At mine own terrors for thee. No; I'll learn to glory
In that which makes thee glorious! Noble stains!
I'll call them rose leaves out of paradise
Strewn on the wreathed snows, or rubies dropped
From martyrs' diadems, prints of Jesus' cross
Too truly borne, alas!
Eliz. I think, mine own,
I am forgiven at last?
Lewis. To-night, my sister--
Henceforth I'll clasp thee to my heart so fast
Thou shalt not 'scape unnoticed.
Eliz [laughing] We shall see--
Now I must stop those wise lips with a kiss,
And lead thee back to scenes of simpler bliss.
SCENE II
A Chamber in the Castle. Elizabeth--the Fool
Isentrudis--Guta singing.
High among the lonely hills,
While I lay beside my sheep,
Rest came down and filled my soul,
From the everlasting deep.
Changeless march the stars above,
Changeless morn succeeds to even;
Still the everlasting hills,
Changeless watch the changeless heaven.
See the rivers, how they run,
Changeless toward the changeless sea;
All around is forethought sure,
Fixed will and stern decree.
Can the sailor move the main?
Will the potter heed the clay?
Mortal! where the spirit drives,
Thither must the wheels obey.
Neither ask, nor fret, nor strive:
Where thy path is, thou shall go.
He who made the streams of time
Wafts thee down to weal or woe.
Eliz. That's a sweet song, and yet it does not chime
With my heart's inner voice. Where had you it, Guta?
Guta. From a nun who was a shepherdess in her youth--sadly plagued
she was by a cruel stepmother, till she fled to a convent and found
rest to her soul.
Fool. No doubt; nothing so pleasant as giving up one's will in
one's own way. But she might have learnt all that without taking
cold on the hill-tops.
Eliz. Where then, Fool?
Fool. At any market-cross where two or three rogues are together,
who have neither grace to mend, nor courage to say 'I did it.' Now
you shall see the shepherdess' baby dressed in my cap and bells.
[Sings.]
When I was a greenhorn and young,
And wanted to be and to do,
I puzzled my brains about choosing my line,
Till I found out the way that things go.
The same piece of clay makes a tile,
A pitcher, a taw, or a brick:
Dan Horace knew life; you may cut out a saint,
Or a bench, from the self-same stick.
The urchin who squalls in a gaol,
By circumstance turns out a rogue;
While the castle-bred brat is a senator born,
Or a saint, if religion's in vogue.
We fall on our legs in this world,
Blind kittens, tossed in neck and heels:
'Tis Dame Circumstance licks Nature's cubs into shape,
She's the mill-head, if we are the wheels.
Then why puzzle and fret, plot and dream?
He that's wise will just follow his nose;
Contentedly fish, while he swims with the stream;
'Tis no business of his where it goes.
Eliz. Far too well sung for such a saucy song.
So go.
Fool. Ay, I'll go. Whip the dog out of church, and then rate him
for being no Christian. [Exit Fool.]
Eliz. Guta, there is sense in that knave's ribaldry:
We must not thus baptize our idleness,
And call it resignation: Which is love?
To do God's will, or merely suffer it?
I do not love that contemplative life:
No! I must headlong into seas of toil,
Leap forth from self, and spend my soul on others.
Oh! contemplation palls upon the spirit,
Like the chill silence of an autumn sun:
While action, like the roaring south-west wind,
Sweeps laden with elixirs, with rich draughts
Quickening the wombed earth.
Guta. And yet what bliss,
When dying in the darkness of God's light,
The soul can pierce these blinding webs of nature,
And float up to The Nothing, which is all things--
The ground of being, where self-forgetful silence
Is emptiness,--emptiness fulness,--fulness God,--
Till we touch Him, and like a snow-flake, melt
Upon His light-sphere's keen circumference!
Eliz. Hast thou felt this?
Guta. In part.
Eliz. Oh, happy Guta!
Mine eyes are dim--and what if I mistook
For God's own self, the phantoms of my brain?
And who am I, that my own will's intent
Should put me face to face with the living God?
I, thus thrust down from the still lakes of thought
Upon a boiling crater-field of labour.
No! He must come to me, not I to Him;
If I see God, beloved, I must see Him
In mine own self:--
Guta. Thyself?
Eliz. Why start, my sister?
God is revealed in the crucified:
The crucified must be revealed in me:--
I must put on His righteousness; show forth
His sorrow's glory; hunger, weep with Him;
Writhe with His stripes, and let this aching flesh
Sink through His fiery baptism into death,
That I may rise with Him, and in His likeness
May ceaseless heal the sick, and soothe the sad,
And give away like Him this flesh and blood
To feed His lambs--ay--we must die with Him
To sense--and love--
Guta. To love? What then becomes
Of marriage vows?
Eliz. I know it--so speak not of them.
Oh! that's the flow, the chasm in all my longings,
Which I have spanned with cobweb arguments,
Yet yawns before me still, where'er I turn,
To bar me from perfection; had I given
My virgin all to Christ! I was not worthy!
I could not stand alone!
Guta. Here comes your husband.
Eliz. He comes! my sun! and every thrilling vein
Proclaims my weakness.
[Lewis enters.]
Lewis. Good news, my Princess; in the street below
Conrad, the man of God from Marpurg, stands
And from a bourne-stone to the simple folk
Does thunder doctrine, preaching faith, repentance,
And dread of all foul heresies; his eyes
On heaven still set, save when with searching frown
He lours upon the crowd, who round him cower
Like quails beneath the hawk, and gape, and tremble,
Now raised to heaven, now down again to hell.
I stood beside and heard; like any doe's
My heart did rise and fall.
Eliz. Oh, let us hear him!
We too need warning; shame, if we let pass,
Unentertained, God's angels on their way.
Send for him, brother.
Lewis. Let a knight go down
And say to the holy man, the Landgrave Lewis
With humble greetings prays his blessedness
To make these secular walls the spirit's temple
At least to-night.
Eliz. Now go, my ladies, both--
Prepare fit lodgings,--let your courtesies
Retain in our poor courts the man of God.
[Exeunt. Lewis and Elizabeth are left alone.]
Now hear me, best beloved:--I have marked this man:
And that which hath scared others, draws me towards him:
He has the graces which I want; his sternness
I envy for its strength; his fiery boldness
I call the earnestness which dares not trifle
With life's huge stake; his coldness but the calm
Of one who long hath found, and keeps unwavering,
Clear purpose still; he hath the gift which speaks
The deepest things most simply; in his eye
I dare be happy--weak I dare not be.
With such a guide,--to save this little heart--
The burden of self-rule--Oh--half my work
Were eased, and I could live for thee and thine,
And take no thought of self. Oh, be not jealous,
Mine own, mine idol! For thy sake I ask it--
I would but be a mate and help more meet
For all thy knightly virtues.
Lewis. 'Tis too true!
I have felt it long; we stand, two weakling children,
Under too huge a burden, while temptations
Like adders swarm up round: I must be led--
But thou alone shall lead me.
Eliz. I? beloved!
This load more? Strengthen, Lord, the feeble knees!
Lewis. Yes! thou, my queen, who making thyself once mine,
Hast made me sevenfold thine; I own thee guide
Of my devotions, mine ambition's lodestar,
The Saint whose shrine I serve with lance and lute;
If thou wilt have a ruler, let him be,
Through thee, the ruler of thy slave. [Kneels to her.]
Eliz. Oh, kneel not--
But grant my prayer--If we shall find this man,
As well I know him, worthy, let him be
Director of my conscience and my actions
With all but thee--Within love's inner shrine
We shall be still alone--But joy! here comes
Our embassy, successful.
[Enter Conrad, with Count Walter, Monks, Ladies, etc.]
Conrad. Peace to this house.
Eliz. Hail to your holiness.
Lewis. The odour of your sanctity and might,
With balmy steam and gales of Paradise,
Forestalls you hither.
Eliz. Bless us doubly, master,
With holy doctrine, and with holy prayers.
Con. Children, I am the servant of Christ's servants--
And needs must yield to those who may command
By right of creed; I do accept your bounty--
Not for myself, but for that priceless name,
Whose dread authority and due commission,
Attested by the seal of His vicegerent,
I bear unworthy here; through my vile lips
Christ and His vicar thank you; on myself--
And these, my brethren, Christ's adopted poor--
A menial's crust, and some waste nook, or dog-hutch,
Wherein the worthless flesh may nightly hide,
Are best bestowed.
Eliz. You shall be where you will--
Do what you will; unquestioned, unobserved,
Enjoy, refrain; silence and solitude,
The better part which such like spirits choose,
We will provide; only be you our master,
And we your servants, for a few short days:
Oh, blessed days!
Con. Ah, be not hasty, madam;
Think whom you welcome; one who has no skill
To wink and speak smooth things; whom fear of God
Constrains to daily wrath; who brings, alas!
A sword, not peace: within whose bones the word
Burns like a pent-up fire, and makes him bold
If aught in you or yours shall seem amiss,
To cry aloud and spare not; let me go--
To pray for you--as I have done long time,
Is sweeter than to chide you.
Eliz. Then your prayers
Shall drive home your rebukes; for both we need you--
Our snares are many, and our sins are more.
So say not nay--I'll speak with you apart.
[Elizabeth and Conrad retire.]
Lewis [aside]. Well, Walter mine, how like you the good legate?
Wal. Walter has seen nought of him but his eye;
And that don't please him.
Lewis. How so, sir! that face
Is pure and meek--a calm and thoughtful eye.
Wal. A shallow, stony, steadfast eye; that looks at neither man nor
beast in the face, but at something invisible a yard before him,
through you and past you, at a fascination, a ghost of fixed
purposes that haunts him, from which neither reason nor pity will
turn him. I have seen such an eye in men possessed--with devils, or
with self: sleek, passionless men, who are too refined to be manly,
and measure their grace by their effeminacy; crooked vermin, who
swarm up in pious times, being drowned out of their earthly haunts
by the spring-tide of religion; and so making a gain of godliness,
swim upon the first of the flood, till it cast them ashore on the
firm beach of wealth and station. I always mistrust those wall-eyed
saints.
Lewis. Beware, Sir Count; your keen and worldly wit
Is good for worldly uses, not to tilt
Withal at holy men and holy things.
He pleases well the spiritual sense
Of my most peerless lady, whose discernment
Is still the touchstone of my grosser fancy:
He is her friend, and mine: and you must love him
Even for our sakes alone, [to a bystander] A word with you, sir.
[In the meantime Elizabeth and Conrad are talking together.]
Eliz. I would be taught--
Con. It seems you claim some knowledge,
By choosing thus your teacher.
Eliz. I would know more--
Con. Go then to the schools--and be no wiser, madam;
And let God's charge here run to waste, to seek
The bitter fruit of knowledge--hunt the rainbow
O'er hill and dale, while wisdom rusts at home.
Eliz. I would be holy, master--
Con. Be so, then.
God's will stands fair: 'tis thine which fails, if any.
Eliz. I would know how to rule--
Con. Then must thou learn
The needs of subjects, and be ruled thyself.
Sink, if thou longest to rise; become most small--
The strength which comes by weakness makes thee great.
Eliz. I will.
Lewis. What, still at lessons? Come, my fairest sister,
Usher the holy man unto his lodgings. [Exeunt.]
Wal [alone]. So, so, the birds are limed:--Heaven grant that we do
not soon see them stowed in separate cages. Well, here my
prophesying ends. I shall go to my lands, and see how much the
gentlemen my neighbours have stolen off them the last week,--
Priests? Frogs in the king's bedchamber! What says the song?
I once had a hound, a right good hound,
A hound both fleet and strong:
He ate at my board, and he slept by my bed,
And ran with me all the day long.
But my wife took a priest, a shaveling priest,
And 'such friendships are carnal,' quoth he.
So my wife and her priest they drugged the poor beast,
And the rat's bane is waiting for me.
SCENE III
The Gateway of a Convent. Night.
Enter Conrad.
Con. This night she swears obedience to me! Wondrous Lord!
How hast Thou opened a path, where my young dreams
May find fulfilment: there are prophecies
Upon her, make me bold. Why comes she not?
She should be here by now. Strange, how I shrink--
I, who ne'er yet felt fear of man or fiend.
Obedience to my will! An awful charge!
But yet, to have the training of her sainthood;
To watch her rise above this wild world's waves
Like floating water-lily, towards heaven's light
Opening its virgin snows, with golden eye
Mirroring the golden sun; to be her champion,
And war with fiends for her; that were a 'quest';
That were true chivalry; to bring my Judge
This jewel for His crown; this noble soul,
Worth thousand prudish clods of barren clay,
Who mope for heaven because earth's grapes are sour--
Her, full of youth, flushed with the heart's rich first-fruits,
Tangled in earthly pomp--and earthly love.
Wife? Saint by her face she should be: with such looks
The queen of heaven, perchance, slow pacing came
Adown our sleeping wards, when Dominic
Sank fainting, drunk with beauty:--she is most fair!
Pooh! I know nought of fairness--this I know,
She calls herself my slave, with such an air
As speaks her queen, not slave; that shall be looked to--
She must be pinioned or she will range abroad
Upon too bold a wing; 't will cost her pain--
But what of that? there are worse things than pain--
What! not yet here? I'll in, and there await her
In prayer before the altar: I have need on't:
And shall have more before this harvest's ripe.
[As Conrad goes out, Elizabeth, Isentrudis, and Guta enter.]
Eliz. I saw him just before us: let us onward;
We must not seem to loiter.
Isen. Then you promise
Exact obedience to his sole direction
Henceforth in every scruple?
Eliz. In all I can,
And be a wife.
Guta. Is it not a double bondage?
A husband's will is clog enough. Be sure,
Though free, I crave more freedom.
Eliz. So do I--
This servitude shall free me--from myself.
Therefore I'll swear.
Isen. To what?
Eliz. I know not wholly:
But this I know, that I shall swear to-night
To yield my will unto a wiser will;
To see God's truth through eyes which, like the eagle's,
From higher Alps undazzled eye the sun.
Compelled to discipline from which my sloth
Would shrink, unbidden,--to deep devious paths
Which my dull sight would miss, I now can plunge,
And dare life's eddies fearless.
Isen. You will repent it.
Eliz. I do repent, even now. Therefore I'll swear.
And bind myself to that, which once being light,
Will not be less right, when I shrink from it.
No; if the end be gained--if I be raised
To freer, nobler use, I'll dare, I'll welcome
Him and his means, though they were racks and flames.
Come, ladies, let us in, and to the chapel. [Exeunt.]
SCENE IV
A Chamber. Guta, Isentrudis, and a Lady.
Lady. Doubtless she is most holy--but for wisdom--
Say if 'tis wise to spurn all rules, all censures,
And mountebank it in the public ways
Till she becomes a jest?
Isen. How's this?
Lady. For one thing--
Yestreen I passed her in the open street,
Following the vocal line of chanting priests,
Clad in rough serge, and with her soft bare feet
Wooing the ruthless flints; the gaping crowd
Unknowing whom they held, did thrust and jostle
Her tender limbs; she saw me as she passed--
And blushed and veiled her face, and smiled withal.
Isen. Oh, think, she's not seventeen yet.
Guta. Why expect
Wisdom with love in all? Each has his gift--
Our souls are organ pipes of diverse stop
And various pitch; each with its proper notes
Thrilling beneath the self-same breath of God.
Though poor alone, yet joined, they're harmony.
Besides these higher spirits must not bend
To common methods; in their inner world
They move by broader laws, at whose expression
We must adore, not cavil: here she comes--
The ministering Saint, fresh from the poor of Christ.
[Elizabeth enters without cloak or shoes, carrying an empty basket.]
Isen. What's here, my Princess? Guta, fetch her robes!
Rest, rest, my child!
Eliz [throwing herself on a seat] Oh! I have seen such things!
I shudder still; your gay looks dazzle me;
As those who long in hideous darkness pent
Blink at the daily light; this room's too bright!
We sit in a cloud, and sing, like pictured angels,
And say, the world runs smooth--while right below
Welters the black fermenting heap of life
On which our state is built: I saw this day
What we might be, and still be Christian women:
And mothers too--I saw one, laid in childbed
These three cold weeks upon the black damp straw;
No nurses, cordials, or that nice parade
With which we try to balk the curse of Eve--
And yet she laughed, and showed her buxom boy,
And said, Another week, so please the Saints,
She'd be at work a-field. Look here--and here--
[Pointing round the room.]
I saw no such things there; and yet they lived.
Our wanton accidents take root, and grow
To vaunt themselves God's laws, until our clothes,
Our gems, and gaudy books, and cushioned litters
Become ourselves, and we would fain forget
There live who need them not. [Guta offers to robe her.]
Let be, beloved--
I will taste somewhat this same poverty--
Try these temptations, grudges, gnawing shames,
For which 'tis blamed; how probe an unfelt evil?
Would'st be the poor man's friend? Must freeze with him--
Test sleepless hunger--let thy crippled back
Ache o'er the endless furrow; how was He,
The blessed One, made perfect? Why, by grief--
The fellowship of voluntary grief--
He read the tear-stained book of poor men's souls,
As I must learn to read it. Lady! lady!
Wear but one robe the less--forego one meal--
And thou shalt taste the core of many tales
Which now flit past thee, like a minstrel's songs,
The sweeter for their sadness.
Lady. Heavenly wisdom!
Forgive me!
Eliz. How? What wrong is mine, fair dame?
Lady. I thought you, to my shame--less wise than holy.
But you have conquered: I will test these sorrows
On mine own person; I have toyed too long
In painted pinnace down the stream of life,
Witched with the landscape, while the weary rowers
Faint at the groaning oar: I'll be thy pupil.
Farewell. Heaven bless thy labours and thy lesson.
[Exit.]
Isen. We are alone. Now tell me, dearest lady,
How came you in this plight?
Eliz. Oh! chide not, nurse--
My heart is full--and yet I went not far--
Even here, close by, where my own bower looks down
Upon that unknown sea of wavy roofs,
I turned into an alley 'neath the wall--
And stepped from earth to hell.--The light of heaven,
The common air, was narrow, gross, and dun;
The tiles did drop from the eaves; the unhinged doors
Tottered o'er inky pools, where reeked and curdled
The offal of a life; the gaunt-haunched swine
Growled at their christened playmates o'er the scraps.
Shrill mothers cursed; wan children wailed; sharp coughs
Rang through the crazy chambers; hungry eyes
Glared dumb reproach, and old perplexity,
Too stale for words; o'er still and webless looms
The listless craftsmen through their elf-locks scowled;
These were my people! all I had, I gave--
They snatched it thankless (was it not their own?
Wrung from their veins, returning all too late?);
Or in the new delight of rare possession,
Forgot the giver; one did sit apart,
And shivered on a stone; beneath her rags
Nestled two impish, fleshless, leering boys,
Grown old before their youth; they cried for bread--
She chid them down, and hid her face and wept;
I had given all--I took my cloak, my shoes
(What could I else? 'Twas but a moment's want
Which she had borne, and borne, day after day),
And clothed her bare gaunt arms and purpled feet,
Then slunk ashamed away to wealth and honour.
[Conrad enters.]
What! Conrad? unannounced! This is too bold!
Peace! I have lent myself--and I must take
The usury of that loan: your pleasure, master?
Con. Madam, but yesterday, I bade your presence,
To hear the preached word of God; I preached--
And yet you came not.--Where is now your oath?
Where is the right to bid, you gave to me?
Am I your ghostly guide? I asked it not.
Of your own will you tendered that, which, given,
Became not choice, but duty.--What is here?
Think not that alms, or lowly-seeming garments,
Self-willed humilities, pride's decent mummers,
Can raise above obedience; she from God
Her sanction draws, while these we forge ourselves,
Mere tools to clear her necessary path.
Go free--thou art no slave: God doth not own
Unwilling service, and His ministers
Must lure, not drag in leash; henceforth I leave thee:
Riot in thy self-willed fancies; pick thy steps
By thine own will-o'-the-wisp toward the pit;
Farewell, proud girl. [Exit Conrad.]
Eliz. O God! What have I done?
I have cast off the clue of this world's maze,
And, like an idiot, let my boat adrift
Above the waterfall!--I had no message--
How's this?
Isen. We passed it by, as matter of no moment
Upon the sudden coming of your guests.
Eliz. No moment! 'Tis enough to have driven him forth--
And that's enough to damn me: I'll not chide you--
I can see nothing but my loss; I'll to him--
I'll go in sackcloth, bathe his feet with tears--
And know nor sleep nor food till I am forgiven--
And you must with me, ladies. Come and find him.
[Exeunt.]
SCENE V
A Hall in the Castle. In the background a Group of diseased and
deformed Beggars; Conrad entering, Elizabeth comes forward to meet
him.
Con. What dost thou, daughter?
Eliz. Ah, my honoured master!
That name speaks pardon, sure.
Con. What dost thou, daughter?
Eliz. I have been washing these poor people's feet.
Con. A wise humiliation.
Eliz. So I meant it--
And use it as a penance for my pride;
And yet, alas, through my own vulgar likings
Or stubborn self-conceit, 'tis none to me.
I marvel how the Saints thus tamed their spirits:
Sure to be humbled by such toil, but proves,
Not cures, our lofty mind.
Con. Thou speakest well--
The knave who serves unto another's needs
Knows himself abler than the man who needs him;
And she who stoops, will not forget, that stooping
Implies a height to stoop from.
Eliz. Could I see
My Saviour in His poor!
Con. Thou shall hereafter:
But now to wash Christ's feet were dangerous honour
For weakling grace; would you be humble, daughter,
You must look up, not down, and see yourself
A paltry atom, sap-transmitting vein
Of Christ's vast vine; the pettiest joint and member
Of His great body; own no strength, no will,
Save that which from the ruling head's command
Through me, as nerve, derives; let thyself die--
And dying, rise again to fuller life.
To be a whole is to be small and weak--
To be a part is to be great and mighty
In the one spirit of the mighty whole--
The spirit of the martyrs and the saints--
The spirit of the queen, on whose towered neck
We hang, blest ringlets!
Eliz. Why! thine eyes flash fire!
Con. But hush! such words are not for courts and halls--
Alone with God and me, thou shalt hear more.
[Exit Conrad.]
Eliz. As when rich chanting ceases suddenly--
And the rapt sense collapses!--Oh that Lewis
Could feed my soul thus! But to work--to work--
What wilt thou, little maid? Ah, I forgot thee--
Thy mother lies in childbed--Say, in time
I'll bring the baby to the font myself.
It knits them unto me, and me to them,
That bond of sponsorship--How now, good dame--
Whence then so sad?
Woman. An't please your nobleness,
My neighbour Gretl is with her husband laid
In burning fever.
Eliz. I will come to them.
Woman. Alack, the place is foul for such as you;
And fear of plague has cleared the lane of lodgers;
If you could send--
Eliz. What? where I am afraid
To go myself, send others? That's strange doctrine.
I'll be with you anon. [Goes up into the Hall.]
[Isentrudis enters with a basket.]
Isen. Why, here's a weight--these cordials now, and simples,
Want a stout page to bear them: yet her fancy
Is still to go alone, to help herself.--
Where will 't all end? In madness, or the grave?
No limbs can stand these drudgeries: no spirit
The fretting harrow which this ruffian priest
Calls education--
Ah! here comes our Count.
[Count Walter enters as from a journey.]
Too late, sir, and too seldom--Where have you been
These four months past, while we are sold for bond-slaves
Unto a peevish friar?
Wal. Why, my fair rosebud--
A trifle overblown, but not less sweet--
I have been pining for you, till my hair
Is as gray as any badger's.
Isen. I'll not jest.
Wal. What? has my wall-eyed Saint shown you his temper?
Isen. The first of his peevish fancies was, that she should eat
nothing which was not honestly and peaceably come by.
Wal. Why, I heard that you too had joined that sect.
Isen. And more fool I. But ladies are bound to set an example--
while they are not bound to ask where everything comes from: with
her, poor child, scruples and starvation were her daily diet; meal
after meal she rose from table empty, unless the Landgrave nodded
and winked her to some lawful eatable; till she that used to take
her food like an angel, without knowing it, was thinking from
morning to night whether she might eat this, that, or the other.
Wal. Poor Eves! if the world leaves you innocent, the Church will
not. Between the devil and the director, you are sure to get your
share of the apples of knowledge.
Isen. True enough. She complained to Conrad of her scruples, and
he told her, that by the law was the knowledge of sin.
Wal. But what said Lewis?
Isen. As much bewitched as she, sir. He has told her, and more
than her, that were it not for the laughter and ill-will of his
barons, he would join her in the same abstinence. But all this is
child's play to the friar's last outbreak.
Wal. Ah! the sermon which you all forgot, when the Marchioness of
Misnia came suddenly? I heard that war had been proclaimed on that
score; but what terms of peace were concluded?
Isen. Terms of peace! Do you call it peace to be delivered over to
his nuns' tender mercies, myself and Guta, as well as our lady,--as
if we had been bond-slaves and blackamoors?
Wal. You need not have submitted.
Isen. What! could I bear to see my poor child wandering up and
down, wringing her hands like a mad woman--I who have lived for no
one else this sixteen years? Guta talked sentiment--called it a
glorious cross, and so forth.--I took it as it came.
Wal. And got no quarter, I'll warrant.
Isen. Don't talk of it--my poor back tingles at the thought.
Wal. The sweet Saints think every woman of the world no better than
she should be; and without meaning to be envious, owe you all a
grudge for past flirtations. As I am a knight, now it's over, I
like you all the better for it.
Isen. What?
Wal. When I see a woman who will stand by her word, and two who
will stand by their mistress. And the monk, too--there's mettle in
him. I took him for a canting carpet-haunter; but be sure, the man
who will bully his own patrons has an honest purpose in him, though
it bears strange fruit on this wicked hither-side of the grave.
Now, my fair nymph of the birchen-tree, use your interest to find me
supper and lodging; for your elegant squires of the trencher look
surly on me here: I am the prophet who has no honour in his own
country. [Exeunt.]
SCENE VI
Dawn. A rocky path leading to a mountain Chapel. A Peasant sitting
on a stone with dog and cross-bow.
Peasant [singing].
Over the wild moor, in reddest dawn of morning,
Gaily the huntsman down green droves must roam:
Over the wild moor, in grayest wane of evening,
Weary the huntsman comes wandering home;
Home, home,
If he has one. Who comes here?
[A Woodcutter enters with a laden ass.]
What art going about?
Woodcutter. To warm other folks' backs.
Peas. Thou art in the common lot--Jack earns and Gill spends--
therein lies the true division of labour. What's thy name?
Woodc. Be'est a keeper, man, or a charmer, that dost so catechise
me?
Peas. Both--I am a keeper, for I keep all I catch; and a charmer,
for I drive bad spirits out of honest men's turnips.
Woodc. Mary sain us, what be they like?
Peas. Four-legged kitchens of leather, cooking farmers' crops into
butcher's meat by night, without leave or licence.
Woodc. By token, thou'rt a deer-stealer?
Peas. Stealer, quoth he? I have dominion. I do what I like with
mine own.
Woodc. Thine own?
Peas. Yea, marry--for, saith the priest, man has dominion over the
beast of the field and the fowl of the air: so I, being as I am a
man, as men go, have dominion over the deer in my trade, as you have
in yours over sleep-mice and woodpeckers.
Woodc. Then every man has a right to be a poacher.
Peas. Every man has his gift, and the tools go to him that can use
them. Some are born workmen; some have souls above work. I'm one
of that metal. I was meant to own land, and do nothing; but the
angel that deals out babies' souls, mistook the cradles, and spoilt
a gallant gentleman! Well--I forgive him! there were many born the
same night--and work wears the wits.
Woodc. I had sooner draw in a yoke than hunt in a halter.
Hadst best repent and mend thy ways.
Peas. The way-warden may do that: I wear out no ways, I go across
country. Mend! saith he? Why I can but starve at worst, or groan
with the rheumatism, which you do already. And who would reek and
wallow o' nights in the same straw, like a stalled cow, when he may
have his choice of all the clean holly bushes in the forest? Who
would grub out his life in the same croft, when he has free-warren
of all fields between this and Rhine? Not I. I have dirtied my
share of spades myself; but I slipped my leash and went self-
hunting.
Woodc. But what if thou be caught and brought up before the Prince?
Peas. He don't care for game. He has put down his kennel, and
keeps a tame saint instead: and when I am driven in, I shall ask my
pardon of her in St. John's name. They say that for his sake she'll
give away the shoes off her feet.
Woodc. I would not stand in your shoes for all the top and lop in
the forest. Murder! Here comes a ghost! Run up the bank--shove
the jackass into the ditch.
[A white figure comes up the path with lights.]
Peas. A ghost or a watchman, and one's as bad as the other--so we
may take to cover for the time.
[Elizabeth enters, meanly clad, carrying her new-born infant;
Isentrudis following with a taper and gold pieces on a salver.
Elizabeth passes, singing.]
Deep in the warm vale the village is sleeping,
Sleeping the firs on the bleak rock above;
Nought wakes, save grateful hearts, silently creeping
Up to the Lord in the might of their love.
What Thou hast given to me, Lord, here I bring Thee,
Odour, and light, and the magic of gold;
Feet which must follow Thee, lips which must sing Thee,
Limbs which must ache for Thee ere they grow old.
What Thou hast given to me, Lord, here I tender,
Life of mine own life, the fruit of my love;
Take him, yet leave him me, till I shall render
Count of the precious charge, kneeling above.
[They pass up the path. The Peasants come out.]
Peas. No ghost, but a mighty pretty wench, with a mighty sweet
voice.
Woodc. Wench, indeed? Where be thy manners? 'Tis her Ladyship--
the Princess.
Peas. The Princess! Ay, I thought those little white feet were but
lately out of broadcloth--still, I say, a mighty sweet voice--I wish
she had not sung so sweetly--it makes things to arise in a body's
head, does that singing: a wonderful handsome lady! a royal lady!
Woodc. But a most unwise one. Did ye mind the gold? If I had such
a trencherful, it should sleep warm in a stocking, instead of being
made a brother to owls here, for every rogue to snatch at.
Peas. Why, then? who dare harm such as her, man?
Woodc. Nay, nay, none of us, we are poor folks, we fear God and the
king. But if she had met a gentleman now--heaven help her! Ah!
thou hast lost a chance--thou might'st have run out promiscuously,
and down on thy knees, and begged thy pardon for the newcomer's
sake. There was a chance, indeed.
Peas. Pooh, man, I have done nothing but lose chances all my days.
I fell into the fire the day I was christened, and ever since I am
like a fresh-trimmed fir-tree; every foul feather sticks to me.
Woodc. Go, shrive thyself, and the priest will scrub off thy
turpentine with a new haircloth; and now, good-day, the maids are a-
waiting for their firewood.
Peas. A word before you go--Take warning by me--avoid that same
serpent, wisdom--Pray to the Saints to make you a blockhead--Never
send your boys to school--For Heaven knows, a poor man that will
live honest, and die in his bed, ought to have no more scholarship
than a parson, and no more brains than your jackass.
SCENE VII
The Gateway of a Castle. Elizabeth and her suite standing at the
top of a flight of steps. Mob below.
Peas. Bread! Bread! Bread! give us bread; we perish.
1st Voice. Ay, give, give, give! God knows, we're long past
earning.
2d Voice. Our skeleton children lie along in the roads--
3d Voice. Our sheep drop dead about the frozen leas--
4th Voice. Our harness and our shoes are boiled for food--
Old Man's Voice. Starved, withered, autumn hay that thanks the
scythe!
Send out your swordsmen, mow the dry bents down,
And make this long death short--we'll never struggle.
All. Bread! Bread!
Eliz. Ay, bread--Where is it, knights and servants?
Why butler, seneschal, this food forthcomes not!
Butler. Alas, we've eaten all ourselves: heaven knows
The pages broke the buttery hatches down--
The boys were starved almost.
Voice below. Ay, she can find enough to feast her minions.
Woman's Voice. How can she know what 'tis, for months and months
To stoop and straddle in the clogging fallows,
Bearing about a living babe within you?
And then at night to fat yourself and it
On fir-bark, madam, and water.
Eliz. My good dame--
That which you bear, I bear: for food, God knows,
I have not tasted food this live-long day--
Nor will till you are served. I sent for wheat
From Koln and from the Rhine-land, days ago:
O God! why comes it not?
[Enter from below, Count Walter, with a Merchant.]
Wal. Stand back; you'll choke me, rascals:
Archers, bring up those mules. Here comes the corn--
Here comes your guardian angel, plenty-laden,
With no white wings, but good white wheat, my boys,
Quarters on quarters--if you'll pay for it.
Eliz. Oh! give him all he asks.
Wal. The scoundrel wants
Three times its value.
Merchant. Not a penny less--
I bought it on speculation--I must live--
I get my bread by buying corn that's cheap,
And selling where 'tis dearest. Mass, you need it,
And you must pay according to your need.
Mob. Hang him! hang all regraters--hang the forestalling dog!
Wal. Driver, lend here the halter off that mule.
Eliz. Nay, Count; the corn is his, and his the right
To fix conditions for his own.
Mer. Well spoken!
A wise and royal lady! She will see
The trade protected. Why, I kept the corn
Three months on venture. Now, so help me Saints,
I am a loser by it, quite a loser--
So help me Saints, I am.
Eliz. You will not sell it
Save at a price which, by the bill you tender,
Is far beyond our means. Heaven knows, I grudge not--
I have sold my plate, have pawned my robes and jewels.
Mortgaged broad lands and castles to buy food--
And now I have no more.--Abate, or trust
Our honour for the difference.
Mer. Not a penny--
I trust no nobles. I must make my profit--
I'll have my price, or take it back again.
Eliz. Most miserable, cold, short-sighted man,
Who for thy selfish gains dost welcome make
God's wrath, and battenest on thy fellows' woes,
What? wilt thou turn from heaven's gate, open to thee,
Through which thy charity may passport be,
And win thy long greed's pardon? Oh, for once
Dare to be great; show mercy to thyself!
See how that boiling sea of human heads
Waits open-mouthed to bless thee: speak the word,
And their triumphant quire of jubilation
Shall pierce God's cloudy floor with praise and prayers,
And drown the accuser's count in angels' ears.
[In the meantime Walter, etc., have been throwing down the wheat to
the mob.]
Mob. God bless the good Count!--Bless the holy Princess--
Hurrah for wheat--Hurrah for one full stomach.
Mer. Ah! that's my wheat! treason, my wheat, my money!
Eliz. Where is the wretch's wheat?
Wal. Below, my lady;
We counted on the charm of your sweet words,
And so did for him what, your sermon ended,
He would have done himself.
Knight. 'Twere rude to doubt it.
Mer. Ye rascal barons!
What! Are we burghers monkeys for your pastime?
We'll clear the odds. [Seizes Walter.]
Wal. Soft, friend--a worm will turn.
Voices below. Throw him down.
Wal. Dost hear that, friend?
Those pups are keen-toothed; they have eat of late
Worse bacon to their bread than thee. Come, come,
Put up thy knife; we'll give thee market-price--
And if thou must have more--why, take it out
In board and lodging in the castle dungeon.
[Walter leads him out; the Mob, etc., disperse.]
Eliz. Now then--there's many a one lies faint at home--
I'll go to them myself.
Isen. What now? start forth
In this most bitter frost, so thinly clad?
Eliz. Tut, tut, I wear my working dress to-day,
And those who work, robe lightly--
Isen. Nay, my child,
For once keep up your rank.
Eliz. Then I had best
Roll to their door in lacqueyed equipage,
And dole my halfpence from my satin purse--
I am their sister--I must look like one.
I am their queen--I'll prove myself the greatest
By being the minister of all. So come--
Now to my pastime, [aside] And in happy toil
Forget this whirl of doubt--We are weak, we are weak,
Only when still: put thou thine hand to the plough,
The spirit drives thee on.
Isen. You live too fast!
Eliz. Too fast? We live too slow--our gummy blood
Without fresh purging airs from heaven, would choke
Slower and slower, till it stopped and froze.
God! fight we not within a cursed world,
Whose very air teems thick with leagued fiends--
Each word we speak has infinite effects--
Each soul we pass must go to heaven or hell--
And this our one chance through eternity
To drop and die, like dead leaves in the brake,
Or like the meteor stone, though whelmed itself,
Kindle the dry moors into fruitful blaze--
And yet we live too fast!
Be earnest, earnest, earnest; mad, if thou wilt:
Do what thou dost as if the stake were heaven,
And that thy last deed ere the judgment-day.
When all's done, nothing's done. There's rest above--
Below let work be death, if work be love! [Exeunt.]
SCENE VIII
A Chamber in the Castle. Counts Walter, Hugo, etc., Abbot, and
Knights.
Count Hugo. I can't forget it, as I am a Christian man. To ask for
a stoup of beer at breakfast, and be told there was no beer allowed
in the house--her Ladyship had given all the malt to the poor.
Abbot. To give away the staff of life, eh?
C. Hugo. The life itself, Sir, the life itself. All that barley,
that would have warmed many an honest fellow's coppers, wasted in
filthy cakes.
Abbot. The parent of seraphic ale degraded into plebeian dough!
Indeed, Sir, we have no right to lessen wantonly the amount of human
enjoyment!
C. Wal. In heaven's name, what would you have her do, while the
people were eating grass?
C. Hugo. Nobody asked them to eat it; nobody asked them to be there
to eat it; if they will breed like rabbits, let them feed like
rabbits, say I--I never married till I could keep a wife.
Abbot. Ah, Count Walter! How sad to see a man of your sense so led
away by his feelings! Had but this dispensation been left to work
itself out, and evolve the blessing implicit in all heaven's
chastenings! Had but the stern benevolences of providence remained
undisturbed by her ladyship's carnal tenderness--what a boon had
this famine been!
C. Wal. How then, man?
Abbot. How many a poor soul would be lying--Ah, blessed thought!--
in Abraham's bosom; who must now toil on still in this vale of
tears!--Pardon this pathetic dew--I cannot but feel as a Churchman.
3d Count. Look at it in this way, Sir. There are too many of us--
too many--Where you have one job you have three workmen. Why, I
threw three hundred acres into pasture myself this year--it saves
money, and risk, and trouble, and tithes.
C. Wal. What would you say to the Princess, who talks of breaking
up all her parks to wheat next year?
3d Count. Ask her to take on the thirty families, who were just
going to tramp off those three hundred acres into the Rhine-land, if
she had not kept them in both senses this winter, and left them on
my hands--once beggars, always beggars.
C. Hugo. Well, I'm a practical man, and I say, the sharper the
famine, the higher are prices, and the higher I sell, the more I can
spend; so the money circulates, Sir, that's the word--like water--
sure to run downwards again; and so it's as broad as it's long; and
here's a health--if there was any beer--to the farmers' friends, 'A
bloody war and a wet harvest.'
Abbot. Strongly put, though correctly. For the self-interest of
each it is which produces in the aggregate the happy equilibrium of
all.
C. Wal. Well--the world is right well made, that's certain; and He
who made the Jews' sin our salvation may bring plenty out of famine,
and comfort out of covetousness. But look you, Sirs, private
selfishness may be public weal, and yet private selfishness be just
as surely damned, for all that.
3d Count. I hold, Sir, that every alms is a fresh badge of slavery.
C. Wal. I don't deny it.
3d Count. Then teach them independence.
C. Wal. How? By tempting them to turn thieves, when begging fails?
By keeping their stomachs just at desperation-point? By starving
them out here, to march off, starving all the way, to some town, in
search of employment, of which, if they find it, they know no more
than my horse? Likely! No, Sir, to make men of them, put them not
out of the reach, but out of the need, of charity.
3d Count. And how, prithee? By teaching them, like our fair
Landgravine, to open their mouth for all that drops? Thuringia is
become a kennel of beggars in her hands.
C. Wal. In hers? In ours, Sir!
Abbot. Idleness, Sir, deceit, and immorality, are the three
children of this same barbarous self-indulgence in almsgiving.
Leave the poor alone. Let want teach them the need of self-
exertion, and misery prove the foolishness of crime.
C. Wal. How? Teach them to become men by leaving them brutes?
Abbot. Oh, Sir, there we step in, with the consolations and
instructions of the faith.
C. Wal. Ay, but while the grass is growing the steed is starving;
and in the meantime, how will the callow chick Grace stand against
the tough old game-cock Hunger?
3d Count. Then how, in the name of patience, would you have us
alter things?
C. Wal. We cannot alter them, Sir--but they will be altered, never
fear.
Omnes. How? How?
C. Wal. Do you see this hour-glass?--Here's the state:
This air stands for the idlers;--this sand for the workers.
When all the sand has run to the bottom, God in heaven just turns
the hour-glass, and then--
C. Hugo. The world's upside down.
C. Wal. And the Lord have mercy upon us!
Omnes. On us? Do you call us the idlers?
C. Wal. Some dare to do so--But fear not--In the fulness of time,
all that's lightest is sure to come to the top again.
C. Hugo. But what rascal calls us idlers?
Omnes. Name, name.
C. Wal. Why, if you ask me--I heard a shrewd sermon the other day
on that same idleness and immorality text of the Abbot's.--'Twas
Conrad, the Princess's director, preached it. And a fashionable cap
it is, though it will fit more than will like to wear it. Shall I
give it you? Shall I preach?
C. Hugo. A tub for Varila! Stand on the table, now, toss back thy
hood like any Franciscan, and preach away.
C. Wal. Idleness, quoth he [Conrad, mind you],--idleness and
immorality? Where have they learnt them, but from your nobles?
There was a saucy monk for you. But there's worse coming.
Religion? said he, how can they respect it, when they see you,
'their betters,' fattening on church lands, neglecting sacraments,
defying excommunications, trading in benefices, hiring the clergy
for your puppets and flatterers, making the ministry, the episcopate
itself, a lumber-room wherein to stow away the idiots and
spendthrifts of your families, the confidants of your mistresses,
the cast-off pedagogues of your boys?
Omnes. The scoundrel!
C. Wal. Was he not?--But hear again--Immorality? roars he; and who
has corrupted them but you? Have you not made every castle a weed-
bed, from which the newest corruptions of the Court stick like
thistle-down, about the empty heads of stable-boys and serving
maids? Have you not kept the poor worse housed than your dogs and
your horses, worse fed than your pigs and your sheep? Is there an
ancient house among you, again, of which village gossips do not
whisper some dark story of lust and oppression, of decrepit
debauchery, of hereditary doom?
Omnes. We'll hang this monk.
C. Wal. Hear me out, and you'll burn him. His sermon was like a
hailstorm, the tail of the shower the sharpest. Idleness? he asked
next of us all: how will they work, when they see you landlords
sitting idle above them, in a fool's paradise of luxury and riot,
never looking down but to squeeze from them an extra drop of honey--
like sheep-boys stuffing themselves with blackberries while the
sheep are licking up flukes in every ditch? And now you wish to
leave the poor man in the slough, whither your neglect and your
example have betrayed him, and made his too apt scholarship the
excuse for your own remorseless greed! As a Christian, I am ashamed
of you all; as a Churchman, doubly ashamed of those prelates, hired
stalking-horses of the rich, who would fain gloss over their own
sloth and cowardice with the wisdom which cometh not from above, but
is earthly, sensual, devilish; aping the artless cant of an
aristocracy who made them--use them--and despise them. That was his
sermon.
Abbot. Paul and Barnabas! What an outpouring of the spirit!--Were
not his hoodship the Pope's legate, now--accidents might happen to
him, going home at night; eh, Sir Hugo?
C. Hugo. If he would but come my way!
For 'the mule it was slow, and the lane it was dark,
When out of the copse leapt a gallant young spark.
Says, 'Tis not for nought you've been begging all day:
So remember your toll, since you travel our way.'
Abbot. Hush! Here comes the Landgrave.
[Lewis enters.]
Lewis. Good morrow, gentles. Why so warm, Count Walter?
Your blessing, Father Abbot: what deep matters
Have called our worships to this conference?
C. Hugo [aside]. Up, Count; you are spokesman.
3d Count. Exalted Prince,
Whose peerless knighthood, like the remeant sun,
After too long a night, regilds our clay,
Late silvered by the reflex lunar beams
Of your celestial lady's matron graces--
Abbot [aside]. Ut vinum optimum amati mei
Dulciter descendens!
3 Count. Think not we mean to praise or disapprove--
The acts of saintly souls must only plead
In foro conscientiae: grosser minds,
Whose humbler aim is but the public weal,
Know of no mesh which holds them: yet, great Prince,
Some dare not see their sovereign's strength postponed
To private grace, and sigh, that generous hearts,
And ladies' tenderness, too oft forgetting
That wisdom is the highest charity,
Will interfere, in pardonable haste,
With heaven's stern providence.
Lewis. We see your drift.
Go, sirrah [to a Page]; pray the Princess to illumine
Our conclave with her beauties. 'Tis our manner
To hear no cause, of gentle or of simple,
Unless the accused and the accuser both
Meet face to face.
3d Count. Excuse, high-mightiness,--
We bring no accusation; facts, your Highness,
Wait for your sentence, not our praejudicium.
Lewis. Give us the facts, then, Sir; in the lady's presence,
Her nearness to ourselves--perchance her reasons--
May make them somewhat dazzling.
Abbot. Nay, my Lord;
I, as a Churchman, though with these your nobles
Both in commission and opinion one,
Am yet most loth, my Lord, to set my seal
To aught which this harsh world might call complaint
Against a princely saint--a chosen vessel--
An argosy celestial--in whom error
Is but the young luxuriance of her grace.
The Count of Varila, as bound to neither,
For both shall speak, and all which late has passed
Upon the matter of this famine open.
C. Wal. Why, if I must speak out--then I'll confess
To have stood by, and seen the Landgravine
Do most strange deeds; and in her generation
Show no more wit than other babes of light.
First, she has given away, to starving rascals,
The stores of grain she might have sold, good lack!
For any price she asked; has pawned your jewels,
And mortgaged sundry farms, and all for food.
Has sunk vast sums in fever-hospitals,
For rogues whom famine sickened--almshouses
For sluts whose husbands died--schools for their brats.
Most sad vagaries! but there's worse to come.
The dulness of the Court has ruined trade:
The jewellers and clothiers don't come near us;
The sempstresses, my lord, and pastrycooks
Have quite forgot their craft; she has turned all heads
And made the ladies starve, and wear old clothes,
And run about with her to nurse the sick,
Instead of putting gold in circulation
By balls, sham-fights, and dinners; 'tis most sad, sir,
But she has swept your treasury out as clean--
As was the widow's cruse, who fed Elijah.
Lewis. Ruined, no doubt! Lo! here the culprit comes.
[Elizabeth enters.]
Come hither, dearest. These, my knights and nobles,
Lament your late unthrift (your conscience speaks
The causes of their blame); and wish you warned,
As wisdom is the highest charity,
No more to interfere, from private feeling,
With heaven's stern laws, or maim the sovereign's wealth,
To save superfluous villains' worthless lives.
Eliz. Lewis!
Lewis. Not I, fair, but my counsellors,
In courtesy, need some reply.
Eliz. My Lords;
Doubtless, you speak as your duty bids you:
I know you love my husband: do you think
My love is less than yours? 'Twas for his honour
I dare not lose a single silly sheep
Of all the flock which God had trusted to him.
True, I had hoped by this--No matter what--
Since to your sense it bears a different hue.
I keep no logic. For my gifts, thank God,
They cannot be recalled; for those poor souls,
My pensioners--even for my husband's knightly name,
Oh! ask not back that slender loan of comfort
My folly has procured them: if, my Lords,
My public censure, or disgraceful penance
May expiate, and yet confirm my waste,
I offer this poor body to the buffets
Of sternest justice: when I dared not spare
My husband's lands, I dare not spare myself.
Lewis. No! no! My noble sister? What? my Lords!
If her love move you not, her wisdom may.
She knows a deeper statecraft, Sirs, than you:
She will not throw away the substance, Abbot,
To save the accident; waste living souls
To keep, or hope to keep, the means of life.
Our wisdom and our swords may fill our coffers,
But will they breed us men, my Lords, or mothers?
God blesses in the camp a noble rashness:
Then why not in the storehouse? He that lends
To Him, need never fear to lose his venture.
Spend on, my Queen. You will not sell my castles?
Nay, you must leave us Neuburg, love, and Wartburg.
Their worn old stones will hardly pay the carriage,
And foreign foes may pay untimely visits.
C. Wal. And home foes, too; if these philosophers
Put up the curb, my Lord, a half-link tighter,
The scythes will be among our horses' legs
Before next harvest.
Lewis. Fear not for our welfare:
We have a guardian here, well skilled to keep
Peace for our seneschal, while angels, stooping
To catch the tears she sheds for us in absence,
Will sain us from the roaming adversary
With scents of Paradise. Farewell, my Lords.
Eliz. Nay,--I must pray your knighthoods--You must honour
Our dais and bower as private guests to-day.
Thanks for your gentle warning; may my weakness
To such a sin be never tempted more!
[Exeunt Elizabeth and Lewis.]
C. Wal. Thus, as if virtue were not its own reward, is it paid over
and above with beef and ale? Weep not, tender-hearted Count!
Though 'generous hearts,' my Lord, 'and ladies' tenderness, too oft
forget'--Truly spoken! Lord Abbot, does not your spiritual eye
discern coals of fire on Count Hugo's head?
C. Hugo. Where, and a plague? Where?
C. Wal. Nay, I speak mystically,--there is nought there but what
beer will quench before nightfall. Here, peeping rabbit [to a Page
at the door], out of your burrow, and show these gentles to their
lodgings. We will meet at the gratias. [They go out.]
C. Wal [alone]. Well:--if Hugo is a brute, he at least makes no
secret of it. He is an old boar, and honest; he wears his tushes
outside, for a warning to all men. But for the rest!--Whited
sepulchres! and not one of them but has half persuaded himself of
his own benevolence. Of all cruelties, save me from your small
pedant,--your closet philosopher, who has just courage enough to
bestride his theory, without wit to see whither it will carry him.
In experience, a child: in obstinacy, a woman: in nothing a man,
but in logic-chopping: instead of God's grace, a few schoolboy saws
about benevolence, and industry, and independence--there is his
metal. If the world will be mended on his principles, well. If
not, poor world!--but principles must be carried out, though through
blood and famine: for truly, man was made for theories, not
theories for man. A doctrine is these men's God--touch but that
shrine, and lo! your simpering philanthropist becomes as ruthless as
a Dominican. [Exit.]
SCENE IX
Elizabeth's bower. Elizabeth and Lewis sitting together.
Song
Eliz. Oh that we two were Maying
Down the stream of the soft spring breeze;
Like children with violets playing
In the shade of the whispering trees!
Oh that we two sat dreaming
On the sward of some sheep-trimmed down
Watching the white mist steaming
Over river and mead and town!
Oh that we two lay sleeping
In our nest in the churchyard sod,
With our limbs at rest on the quiet earth's breast,
And our souls at home with God!
Lewis. Ah, turn away those swarthy diamonds' blaze!
Mine eyes are dizzy, and my faint sense reels
In the rich fragrance of those purple tresses.
Oh, to be thus, and thus, day after day!
To sleep, and wake, and find it yet no dream--
My atmosphere, my hourly food, such bliss
As to have dreamt of, five short years agone,
Had seemed a mad conceit.
Eliz. Five years agone?
Lewis. I know not; for upon our marriage-day
I slipped from time into eternity;
Where each day teems with centuries of life,
And centuries were but one wedding morn.
Eliz. Lewis, I am too happy! floating higher
Than e'er my will had dared to soar, though able;
But circumstance, which is the will of God,
Beguiled my cowardice to that, which, darling,
I found most natural, when I feared it most.
Love would have had no strangeness in mine eyes,
Save from the prejudice which others taught me--
They should know best. Yet now this wedlock seems
A second infancy's baptismal robe,
A heaven, my spirit's antenatal home,
Lost in blind pining girlhood--found now, found!
[Aside] What have I said? Do I blaspheme? Alas!
I neither made these thoughts, nor can unmake them.
Lewis. Ay, marriage is the life-long miracle,
The self-begetting wonder, daily fresh;
The Eden, where the spirit and the flesh
Are one again, and new-born souls walk free,
And name in mystic language all things new,
Naked, and not ashamed. [Eliz. hides her face.]
Eliz. O God! were that true!
[Clasps him round the neck.]
There, there, no more--
I love thee, and I love thee, and I love thee--
More than rich thoughts can dream, or mad lips speak;
But how, or why, whether with soul or body,
I will not know. Thou art mine.--Why question further?
[Aside] Ay if I fall by loving, I will love,
And be degraded!--how? by my own troth-plight?
No, but my thinking that I fall.--'Tis written
That whatsoe'er is not of faith is sin.--
O Jesu Lord! Hast Thou not made me thus?
Mercy! My brain will burst: I cannot leave him!
Lewis. Beloved, if I went away to war--
Eliz. O God! More wars? More partings?
Lewis. Nay, my sister--
My trust but longs to glory in its surety:
What would'st thou do?
Eliz. What I have done already.
Have I not followed thee, through drought and frost,
Through flooded swamps, rough glens, and wasted lands,
Even while I panted most with thy dear loan
Of double life?
Lewis. My saint! but what if I bid thee
To be my seneschal, and here with prayers,
With sober thrift, and noble bounty shine,
Alone and peerless? And suppose--nay, start not--
I only said suppose--the war was long,
Our camps far off, and that some winter, love,
Or two, pent back this Eden stream, where now
Joys upon joys like sunlit ripples pass,
Alike, yet ever new.--What would'st thou do, love?
Eliz. A year? A year! A cold, blank, widowed year!
Strange, that mere words should chill my heart with fear--
This is no hall of doom,
No impious Soldan's feast of old,
Where o'er the madness of the foaming gold,
A fleshless hand its woe on tainted walls enrolled.
Yet by thy wild words raised,
In Love's most careless revel,
Looms through the future's fog a shade of evil,
And all my heart is glazed.--
Alas! What would I do?
I would lie down and weep, and weep,
Till the salt current of my tears should sweep
My soul, like floating weed, adown a fitful sleep,
A lingering half-night through.
Then when the mocking bells did wake
My hollow eyes to twilight gray,
I would address my spiritless limbs to pray,
And nerve myself with stripes to meet the weary day,
And labour for thy sake.
Until by vigils, fasts, and tears,
The flesh was grown so spare and light,
That I could slip its mesh, and flit by night
O'er sleeping sea and land to thee--or Christ--till morning light.
Peace! Why these fears?
Life is too short for mean anxieties:
Soul! thou must work, though blindfold.
Come, beloved,
I must turn robber.--I have begged of late
So soft, I fear to ask.--Give me thy purse.
Lewis. No, not my purse:--stay--Where is all that gold
I gave you, when the Jews came here from Koln?
Eliz. Oh, those few coins? I spent them all next day
On a new chapel on the Eisenthal;
There were no choristers but nightingales--
No teachers there save bees: how long is this?
Have you turned niggard?
Lewis. Nay; go ask my steward--
Take what you will--this purse I want myself.
Eliz. Ah! now I guess. You have some trinket for me--
You promised late to buy no more such baubles--
And now you are ashamed.--Nay, I must see--
[Snatches his purse. Lewis hides his face.]
Ah, God! what's here? A new crusader's cross?
Whose? Nay, nay--turn not from me; I guess all--
You need not tell me; it is very well--
According to the meed of my deserts:
Yes--very well.
Lewis. Ah, love!--look not so calm--
Eliz. Fear not--I shall weep soon.
How long is it since you vowed?
Lewis. A week or more.
Eliz. Brave heart! And all that time your tenderness
Kept silence, knowing my weak foolish soul. [Weeps.]
O love! O life! Late found, and soon, soon lost!
A bleak sunrise,--a treacherous morning gleam,--
And now, ere mid-day, all my sky is black
With whirling drifts once more! The march is fixed
For this day month, is't not?
Lewis. Alas, too true!
Eliz. Oh break not, heart!
[Conrad enters.]
Ah! here my master comes.
No weeping before him.
Lewis. Speak to the holy man:
He can give strength and comfort, which poor I
Need even more than you. Here, saintly master,
I leave her to your holy eloquence. Farewell!
God help us both! [Exit Lewis.]
Eliz [rising]. You know, Sir, that my husband has taken the cross!
Con. I do; all praise to God!
Eliz. But none to you:
Hard-hearted! Am I not enough your slave?
Can I obey you more when he is gone
Than now I do? Wherein, pray, has he hindered
This holiness of mine, for which you make me
Old ere my womanhood? [Conrad offers to go.]
Stay, Sir, and tell me
Is this the outcome of your 'father's care'?
Was it not enough to poison all my joys
With foulest scruples?--show me nameless sins,
Where I, unconscious babe, blessed God for all things,
But you must thus intrigue away my knight
And plunge me down this gulf of widowhood!
And I not twenty yet--a girl--an orphan--
That cannot stand alone! Was I too happy?
O God! what lawful bliss do I not buy
And balance with the smart of some sharp penance?
Hast thou no pity? None? Thou drivest me
To fiendish doubts: Thou, Jesus' messenger?
Con. This to your master!
Eliz. This to any one
Who dares to part me from my love.
Con. 'Tis well--
In pity to your weakness I must deign
To do what ne'er I did--excuse myself.
I say, I knew not of your husband's purpose;
God's spirit, not I, moved him: perhaps I sinned
In that I did not urge it myself.
Eliz. Thou traitor!
So thou would'st part us?
Con. Aught that makes thee greater
I'll dare. This very outburst proves in thee
Passions unsanctified, and carnal leanings
Upon the creatures thou would'st fain transcend.
Thou badest me cure thy weakness. Lo, God brings thee
The tonic cup I feared to mix:--be brave--
Drink it to the lees, and thou shalt find within
A pearl of price.
Eliz. 'Tis bitter!
Con. Bitter, truly:
Even I, to whom the storm of earthly love
Is but a dim remembrance--Courage! Courage!
There's glory in't; fulfil thy sacrifice;
Give up thy noblest on the noblest service
God's sun has looked on, since the chosen twelve
Went conquering, and to conquer, forth. If he fall--
Eliz. Oh, spare mine ears!
Con. He falls a blessed martyr,
To bid thee welcome through the gates of pearl;
And next to his shall thine own guerdon be
If thou devote him willing to thy God.
Wilt thou?
Eliz. Have mercy!
Con. Wilt thou? Sit not thus
Watching the sightless air: no angel in it
But asks thee what I ask: the fiend alone
Delays thy coward flesh. Wilt thou devote him?
Eliz. I will devote him;--a crusader's wife!
I'll glory in it. Thou speakest words from God--
And God shall have him! Go now--good my master;
My poor brain swims. [Exit Conrad.]
Yes--a crusader's wife!
And a crusader's widow!
[Bursts into tears, and dashes herself on the floor.]
SCENE X
A street in the town of Schmalcald. Bodies of Crusading troops
defiling past. Lewis and Elizabeth with their suite in the
foreground.
Lewis. Alas! the time is near; I must be gone--
There are our liegemen; how you'll welcome us,
Returned in triumph, bowed with paynim spoils,
Beneath the victor cross, to part no more!
Eliz. Yes--we shall part no more, where next we meet.
Enough to have stood here once on such an errand!
Lewis. The bugle calls.--Farewell, my love, my lady,
Queen, sister, saint! One last long kiss--Farewell!
Eliz. One kiss--and then another--and another--
Till 'tis too late to go--and so return--
O God! forgive that craven thought! There, take him
Since Thou dost need him. I have kept him ever
Thine, when most mine; and shall I now deny Thee?
Oh! go--yes, go--Thou'lt not forget to pray,
[Lewis goes.]
With me, at our old hour? Alas! he's gone
And lost--thank God he hears me not--for ever.
Why look'st thou so, poor girl? I say, for ever.
The day I found the bitter blessed cross,
Something did strike my heart like keen cold steel,
Which quarries daily there with dead dull pains--
Whereby I know that we shall meet no more.
Come! Home, maids, home! Prepare me widow's weeds--
For he is dead to me, and I must soon
Die too to him, and many things; and mark me--
Breathe not his name, lest this love-pampered heart
Should sicken to vain yearnings--Lost! lost! lost!
Lady. Oh stay, and watch this pomp.
Eliz. Well said--we'll stay; so this bright enterprise
Shall blanch our private clouds, and steep our soul
Drunk with the spirit of great Christendom.
CRUSADER CHORUS.
[Men-at-Arms pass, singing.]
The tomb of God before us,
Our fatherland behind,
Our ships shall leap o'er billows steep,
Before a charmed wind.
Above our van great angels
Shall fight along the sky;
While martyrs pure and crowned saints
To God for rescue cry.
The red-cross knights and yeomen
Throughout the holy town,
In faith and might, on left and right,
Shall tread the paynim down.
Till on the Mount Moriah
The Pope of Rome shall stand;
The Kaiser and the King of France
Shall guard him on each hand.
There shall he rule all nations,
With crozier and with sword;
And pour on all the heathen
The wrath of Christ the Lord.
[Women--bystanders.]
Christ is a rock in the bare salt land,
To shelter our knights from the sun and sand:
Christ the Lord is a summer sun,
To ripen the grain while they are gone.
Then you who fight in the bare salt land,
And you who work at home,
Fight and work for Christ the Lord,
Until His kingdom come.
[Old Knights pass.]
Our stormy sun is sinking;
Our sands are running low;
In one fair fight, before the night,
Our hard-worn hearts shall glow.
We cannot pine in cloister;
We cannot fast and pray;
The sword which built our load of guilt
Must wipe that guilt away.
We know the doom before us;
The dangers of the road;
Have mercy, mercy, Jesu blest,
When we lie low in blood.
When we lie gashed and gory,
The holy walls within,
Sweet Jesu, think upon our end,
And wipe away our sin.
[Boy Crusaders pass.]
The Christ-child sits on high:
He looks through the merry blue sky;
He holds in His hand a bright lily-band,
For the boys who for Him die.
On holy Mary's arm,
Wrapt safe from terror and harm,
Lulled by the breeze in the paradise trees,
Their souls sleep soft and warm.
Knight David, young and true,
The giant Soldan slew,
And our arms so light, for the Christ-child's right,
Like noble deeds can do.
[Young Knights pass.]
The rich East blooms fragrant before us;
All Fairyland beckons us forth;
We must follow the crane in her flight o'er the main,
From the frosts and the moors of the North.
Our sires in the youth of the nations
Swept westward through plunder and blood,
But a holier quest calls us back to the East,
We fight for the kingdom of God.
Then shrink not, and sigh not, fair ladies,
The red cross which flames on each arm and each shield,
Through philtre and spell, and the black charms of hell,
Shall shelter our true love in camp and in field.
[Old Monk, looking after them.]
Jerusalem, Jerusalem!
The burying place of God!
Why gay and bold, in steel and gold,
O'er the paths where Christ hath trod?
[The Scene closes.]
ACT III
SCENE I
A chamber in the Wartburg. Elizabeth sitting in widow's weeds; Guta
and Isentrudis by her.
Isen. What? Always thus, my Princess? Is this wise,
By day with fasts and ceaseless coil of labour;
About the ungracious poor--hands, eyes, feet, brain
O'ertasked alike--'mid sin and filth, which make
Each sense a plague--by night with cruel stripes,
And weary watchings on the freezing stone,
To double all your griefs, and burn life's candle,
As village gossips say, at either end?
The good book bids the heavy-hearted drink,
And so forget their woe.
Eliz. 'Tis written too
In that same book, nurse, that the days shall come
When the bridegroom shall be taken away--and then--
Then shall they mourn and fast: I needed weaning
From sense and earthly joys; by this way only
May I win God to leave in mine own hands
My luxury's cure: oh! I may bring him back,
By working out to its full depth the chastening
The need of which his loss proves: I but barter
Less grief for greater--pain for widowhood.
Isen. And death for life--your cheeks are wan and sharp
As any three-days' moon--you are shifting always
Uneasily and stiff, now, on your seat,
As from some secret pain.
Eliz. Why watch me thus?
You cannot know--and yet you know too much--
I tell you, nurse, pain's comfort, when the flesh
Aches with the aching soul in harmony,
And even in woe, we are one: the heart must speak
Its passion's strangeness in strange symbols out,
Or boil, till it bursts inly.
Guta. Yet, methinks,
You might have made this widowed solitude
A holy rest--a spell of soft gray weather,
Beneath whose fragrant dews all tender thoughts
Might bud and burgeon.
Eliz. That's a gentle dream;
But nature shows nought like it: every winter,
When the great sun has turned his face away,
The earth goes down into the vale of grief,
And fasts, and weeps, and shrouds herself in sables,
Leaving her wedding-garlands to decay--
Then leaps in spring to his returning kisses--
As I may yet!--
Isen. There, now--my foolish child!
You faint: come--come to your chamber--
Eliz. Oh, forgive me!
But hope at times throngs in so rich and full,
It mads the brain like wine: come with me, nurse,
Sit by me, lull me calm with gentle tales
Of noble ladies wandering in the wild wood,
Fed on chance earth-nuts, and wild strawberries,
Or milk of silly sheep, and woodland doe.
Or how fair Magdalen 'mid desert sands
Wore out in prayer her lonely blissful years,
Watched by bright angels, till her modest tresses
Wove to her pearled feet their golden shroud.
Come, open all your lore.
[Sophia and Agnes enter.]
My mother-in-law!
[Aside] Shame on thee, heart! why sink, whene'er we meet?
Soph. Daughter, we know of old thy strength, of metal
Beyond us worldlings: shrink not, if the time
Be come which needs its use--
Eliz. What means this preface? Ah! your looks are big
With sudden woes--speak out.
Soph. Be calm, and hear
The will of God toward my son, thy husband.
Eliz. What? is he captive? Why then--what of that?
There are friends will rescue him--there's gold for ransom--
We'll sell our castles--live in bowers of rushes--
O God! that I were with him in the dungeon!
Soph. He is not taken.
Eliz. No! he would have fought to the death!
There's treachery! What paynim dog dare face
His lance, who naked braved yon lion's rage,
And eyed the cowering monster to his den?
Speak! Has he fled? or worse?
Soph. Child, he is dead.
Eliz [clasping her hands on her knees.]. The world is dead to me,
and all its smiles!
Isen. Oh, woe! my Prince! and doubly woe, my daughter.
[Elizabeth springs up and rushes out.]
Oh, stop her--stop my child! She will go mad--
Dash herself down--Fly--Fly--She is not made
Of hard, light stuff, like you.
Soph. I had expected some such passionate outbreak
At the first news: you see now, Lady Agnes,
These saints, who fain would 'wean themselves from earth,'
Still yield to the affections they despise
When the game's earnest--Now--ere they return--
Your brother, child, is dead--
Agnes. I know it too well.
So young--so brave--so blest!--And she--she loved him--
Oh! I repent of all the foolish scoffs
With which I crossed her.
Soph. Yes--the Landgrave's dead--
Attend to me--Alas! my son! my son!
He was my first-born! But he has a brother--
Agnes! we must not let this foreign gipsy,
Who, as you see, is scarce her own wits' mistress,
Flaunt sovereign over us, and our broad lands,
To my son's prejudice--There are barons, child,
Who will obey a knight, but not a saint:
I must at once to them.
Agnes. Oh, let me stay.
Soph. As you shall please--Your brother's landgravate
Is somewhat to you, surely--and your smiles
Are worth gold pieces in a court intrigue.
For her, on her own principles, a downfall
Is a chastening mercy--and a likely one.
Agnes. Oh! let me stay, and comfort her!
Soph. Romance!
You girls adore a scene--as lookers on.
[Exit Sophia.]
Agnes [alone]. Well spoke the old monks, peaceful watching life's
turmoil,
'Eyes which look heavenward, weeping still we see:
God's love with keen flame purges, like the lightning flash,
Gold which is purest, purer still must be.'
[Guta enters.]
Alas! Returned alone! Where has my sister been?
Guta. Thank heaven you hear alone, for such sad sight would haunt
Henceforth your young hopes--crush your shuddering fancy down
With dread of like fierce anguish.
You saw her bound forth: we towards her bower in haste
Ran trembling: spell-bound there, before her bridal-bed
She stood, while wan smiles flickered, like the northern dawn,
Across her worn cheeks' ice-field; keenest memories then
Rushed with strong shudderings through her--as the winged shaft
Springs from the tense nerve, so her passion hurled her forth
Sweeping, like fierce ghost, on through hall and corridor,
Tearless, with wide eyes staring, while a ghastly wind
Moaned on through roof and rafter, and the empty helms
Along the walls ran clattering, and above her waved
Dead heroes' banners; swift and yet more swift she drove
Still seeking aimless; sheer against the opposing wall
At last dashed reckless--there with frantic fingers clutched
Blindly the ribbed oak, till that frost of rage
Dissolved itself in tears, and like a babe,
With inarticulate moans, and folded hands,
She followed those who led her, as if the sun
On her life's dial had gone back seven years,
And she were once again the dumb sad child
We knew her ere she married.
Isen [entering]. As after wolf wolf presses, leaping through the
snow-glades,
So woe on woe throngs surging up.
Guta. What? treason?
Isen. Treason, and of the foulest. From her state she's rudely
thrust;
Her keys are seized; her weeping babies pent from her:
The wenches stop their sobs to sneer askance,
And greet their fallen censor's new mischance.
Agnes. Alas! Who dared to do this wrong?
Isen. Your mother and your mother's son--
Judge you, if it was knightly done.
Guta. See! see! she comes, with heaving breast,
With bursting eyes, and purpled brow:
Oh that the traitors saw her now!
They know not, sightless fools, the heart they break.
[Elizabeth enters slowly.]
Eliz. He is in purgatory now! Alas!
Angels! be pitiful! deal gently with him!
His sins were gentle! That's one cause left for living--
To pray, and pray for him: why all these months
I prayed,--and here's my answer: Dead of a fever!
Why thus? so soon! Only six years for love!
While any formal, heartless matrimony,
Patched up by Court intrigues, and threats of cloisters,
Drags on for six times six, and peasant slaves
Grow old on the same straw, and hand in hand
Slip from life's oozy bank, to float at ease.
[A knocking at the door.]
That's some petitioner.
Go to--I will not hear them: why should I work,
When he is dead? Alas! was that my sin?
Was he, not Christ, my lodestar? Why not warn me?
Too late! What's this foul dream? Dead at Otranto--
Parched by Italian suns--no woman by him--
He was too chaste! Nought but rude men to nurse!--
If I had been there, I should have watched by him--
Guessed every fancy--God! I might have saved him!
[A servant-man bursts in.]
Servant. Madam, the Landgrave gave me strict commands--
Isen. The Landgrave, dolt?
Eliz. I might have saved him!
Servant [to Isen.] Ay, saucy madam!--
The Landgrave Henry, lord and master,
Freer than the last, and yet no waster,
Who will not stint a poor knave's beer,
Or spin out Lent through half the year.
Why--I see double!
Eliz. Who spoke there of the Landgrave? What's this drunkard?
Give him his answer--'Tis no time for mumming--
Serv. The Landgrave Henry bade me see you out
Safe through his gates, and that at once, my Lady.
Come!
Eliz. Why--that's hasty--I must take my children
Ah! I forgot--they would not let me see them.
I must pack up my jewels--
Serv. You'll not need it--
His Lordship has the keys.
Eliz. He has indeed.
Why, man!--I am thy children's godmother--
I nursed thy wife myself in the black sickness--
Art thou a bird, that when the old tree falls,
Flits off, and sings in the sapling?
[The man seizes her arm.]
Keep thine hands off--
I'll not be shamed--Lead on. Farewell, my Ladies.
Follow not! There's want to spare on earth already;
And mine own woe is weight enough for me.
Go back, and say, Elizabeth has yet
Eternal homes, built deep in poor men's hearts;
And, in the alleys underneath the wall,
Has bought with sinful mammon heavenly treasure,
More sure than adamant, purer than white whales' bone,
Which now she claims. Lead on: a people's love shall right me.
[Exit with Servant.]
Guta. Where now, dame?
Isen. Where, but after her?
Guta. True heart!
I'll follow to the death. [Exeunt.]
SCENE II
A street. Elizabeth and Guta at the door of a Convent. Monks in
the porch.
Eliz. You are afraid to shelter me--afraid.
And so you thrust me forth, to starve and freeze.
Soon said. Why palter o'er these mean excuses,
Which tempt me to despise you?
Monks. Ah! my lady,
We know your kindness--but we poor religious
Are bound to obey God's ordinance, and submit
Unto the powers that be, who have forbidden
All men, alas! to give you food or shelter.
Eliz. Silence! I'll go. Better in God's hand than man's.
He shall kill us, if we die. This bitter blast
Warping the leafless willows, yon white snow-storms,
Whose wings, like vengeful angels, cope the vault,
They are God's,--We'll trust to them.
[Monks go in.]
Guta. Mean-spirited!
Fair frocks hide foul hearts. Why, their altar now
Is blazing with your gifts.
Eliz. How long their altar?
To God I gave--and God shall pay me back.
Fool! to have put my trust in living man,
And fancied that I bought God's love, by buying
The greedy thanks of these His earthly tools!
Well--here's one lesson learnt! I thank thee, Lord!
Henceforth I'll straight to Thee, and to Thy poor.
What? Isentrudis not returned? Alas!
Where are those children?
They will not have the heart to keep them from me--
Oh! have the traitors harmed them?
Guta. Do not think it.
The dowager has a woman's heart.
Eliz. Ay, ay--
But she's a mother--and mothers will dare all things--
Oh! Love can make us fiends, as well as angels.
My babies! Weeping? Oh, have mercy, Lord!
On me heap all thy wrath--I understand it:
What can blind senseless terror do for them?
Guta. Plead, plead your penances! Great God, consider
All she has done and suffered, and forbear
To smite her like a worldling!
Eliz. Silence, girl!
I'd plead my deeds, if mine own character,
My strength of will had fathered them: but no--
They are His, who worked them in me, in despite
Of mine own selfish and luxurious will--
Shall I bribe Him with His own? For pain, I tell thee
I need more pain than mine own will inflicts,
Pain which shall break that will.--Yet spare them, Lord!
Go to--I am a fool to wish them life--
And greater fool to miscall life, this headache--
This nightmare of our gross and crude digestion--
This fog which steams up from our freezing clay--
While waking heaven's beyond. No! slay them, traitors!
Cut through the channels of those innocent breaths
Whose music charmed my lone nights, ere they learn
To love the world, and hate the wretch who bore them!
[Weeps.]
Guta. This storm will blind us both: come here, and shield you
Behind this buttress.
Eliz. What's a wind to me?
I can see up the street here, if they come--
They do not come!--Oh! my poor weanling lambs--
Struck dead by carrion ravens!
What then, I have borne worse. But yesterday
I thought I had a husband--and now--now!
Guta! He called a holy man before he died?
Guta. The Bishop of Jerusalem, 'tis said,
With holy oil, and with the blessed body
Of Him for whom he died, did speed him duly
Upon his heavenward flight.
Eliz. O happy bishop!
Where are those children? If I had but seen him!
I could have borne all then. One word--one kiss!
Hark! What's that rushing? White doves--one--two--three--
Fleeing before the gale. My children's spirits!
Stay, babies--stay for me! What! Not a moment?
And I so nearly ready to be gone?
Guta. Still on your children?
Eliz. Oh! this grief is light
And floats a-top--well, well; it hides a while
That gulf too black for speech--My husband's dead!
I dare not think on't.
A small bird dead in the snow! Alas! poor minstrel!
A week ago, before this very window,
He warbled, may be, to the slanting sunlight;
And housewives blest him for a merry singer:
And now he freezes at their doors, like me.
Poor foolish brother! didst thou look for payment?
Guta. But thou hast light in darkness: he has none--
The bird's the sport of time, while our life's floor
Is laid upon eternity; no crack in it
But shows the underlying heaven.
Eliz. Art sure?
Does this look like it, girl? No--I'll trust yet--
Some have gone mad for less; but why should I?
Who live in time, and not eternity.
'Twill end, girl, end; no cloud across the sun
But passes at the last, and gives us back
The face of God once more.
Guta. See here they come,
Dame Isentrudis and your children, all
Safe down the cliff path, through the whirling snow-drifts.
Eliz. O Lord, my Lord! I thank thee!
Loving and merciful, and tender-hearted,
And even in fiercest wrath remembering mercy.
Lo! here's my ancient foe. What want you, Sir?
[Hugo enters.]
Hugo. Want? Faith, 'tis you who want, not I, my Lady--
I hear, you are gone a begging through the town;
So, for your husband's sake, I'll take you in;
For though I can't forget your scurvy usage,
He was a very honest sort of fellow,
Though mad as a March hare; so come you in.
Eliz. But know you, Sir, that all my husband's vassals
Are bidden bar their doors to me?
Hugo. I know it:
And therefore come you in; my house is mine:
No upstarts shall lay down the law to me;
Not they, mass: but mind you, no canting here--
No psalm-singing; all candles out at eight:
Beggars must not be choosers. Come along!
Eliz. I thank you, Sir; and for my children's sake
I do accept your bounty. [aside] Down, proud heart--
Bend lower--lower ever: thus God deals with thee.
Go, Guta, send the children after me. [Exeunt severally.]
[Two Peasants enter.]
1st Peas. Here's Father January taken a lease of March month, and
put in Jack Frost for bailiff. What be I to do for spring-feed if
the weather holds,--and my ryelands as bare as the back of my hand?
2d Peas. That's your luck. Freeze on, say I, and may Mary Mother
send us snow a yard deep. I have ten ton of hay yet to sell--ten
ton, man--there's my luck: every man for himself, and--Why here
comes that handsome canting girl, used to be about the Princess.
[Guta enters.]
Guta. Well met, fair sirs! I know you kind and loyal,
And bound by many a favour to my mistress:
Say, will you bear this letter for her sake
Unto her aunt, the rich and holy lady
Who rules the nuns of Kitzingen?
2d Peas. If I do, pickle me in a barrel among cabbage.
She told me once, God's curse would overtake me,
For grinding of the poor: her turn's come now.
Guta. Will you, then, help her? She will pay you richly.
1st Peas. Ay? How, dame? How? Where will the money come from?
Guta. God knows--
1st Peas. And you do not.
Guta. Why, but last winter,
When all your stacks were fired, she lent you gold.
1st Peas. Well--I'll be generous: as the times are hard,
Say, if I take your letter, will you promise
To marry me yourself?
Guta. Ay, marry you,
Or anything, if you'll but go to-day:
At once, mind. [Giving him the letter.]
1st Peas. Ay, I'll go. Now, you'll remember?
Guta. Straight to her ladyship at Kitzingen.
God and His saints deal with you, as you deal
With us this day. [Exit.]
2d Peas. What! art thou fallen in love promiscuously?
1st Peas. Why, see, now, man; she has her mistress' ear;
And if I marry her, no doubt they'll make me
Bailiff, or land-steward; and there's noble pickings
In that same line.
2d Peas. Thou hast bought a pig in a poke:
Her priest will shrive her off from such a bargain.
1st Peas. Dost think? Well--I'll not fret myself about it.
See, now, before I start, I must get home
Those pigs from off the forest; chop some furze;
And then to get my supper, and my horse's:
And then a man will need to sit a while,
And take his snack of brandy for digestion;
And then to fettle up my sword and buckler;
And then, bid 'em all good-bye: and by that time
'Twill be 'most nightfall--I'll just go to-morrow.
Off--here she comes again. [Exeunt.]
[Isentrudis and Guta enter, with the children.]
Guta. I warned you of it; I knew she would not stay
An hour, thus treated like a slave--an idiot.
Isen. Well, 'twas past bearing: so we are thrust forth
To starve again. Are all your jewels gone?
Guta. All pawned and eaten--and for her, you know,
She never bore the worth of one day's meal
About her dress. We can but die--No foe
Can ban us from that rest.
Isen. Ay, but these children!--Well--if it must be,
Here, Guta, pull off this old withered hand
My wedding-ring; the man who gave it me
Should be in heaven--and there he'll know my heart.
Take it, girl, take it. Where's the Princess now?
She stopped before a crucifix to pray;
But why so long?
Guta. Oh! prayer, to her rapt soul,
Is like the drunkenness of the autumn bee,
Who, scent-enchanted, on the latest flower,
Heedless of cold, will linger listless on,
And freeze in odorous dreams.
Isen. Ah! here she comes.
Guta. Dripping from head to foot with wet and mire!
How's this?
[Elizabeth entering.]
Eliz. How? Oh, my fortune rises to full flood:
I met a friend just now, who told me truths
Wholesome and stern, of my deceitful heart--
Would God I had known them earlier!--and enforced
Her lesson so, as I shall ne'er forget it
In body or in mind.
Isen. What means all this?
Eliz. You know the stepping-stones across the ford.
There as I passed, a certain aged crone,
Whom I had fed, and nursed, year after year,
Met me mid-stream--thrust past me stoutly on--
And rolled me headlong in the freezing mire.
There as I lay and weltered,--'Take that, Madam,
For all your selfish hypocritic pride
Which thought it such a vast humility
To wash us poor folk's feet, and use our bodies
For staves to build withal your Jacob's-ladder.
What! you would mount to heaven upon our backs?
The ass has thrown his rider.' She crept on--
I washed my garments in the brook hard by--
And came here, all the wiser.
Guta. Miscreant hag!
Isen. Alas, you'll freeze.
Guta. Who could have dreamt the witch
Could harbour such a spite?
Eliz. Nay, who could dream
She would have guessed my heart so well? Dull boors
See deeper than we think, and hide within
Those leathern hulls unfathomable truths,
Which we amid thought's glittering mazes lose.
They grind among the iron facts of life,
And have no time for self-deception.
Isen. Come--
Put on my cloak--stand here, behind the wall.
Oh! is it come to this? She'll die of cold.
Guta. Ungrateful fiend!
Eliz. Let be--we must not think on't.
The scoff was true--I thank her--I thank God--
This too I needed. I had built myself
A Babel-tower, whose top should reach to heaven,
Of poor men's praise and prayers, and subtle pride
At mine own alms. 'Tis crumbled into dust!
Oh! I have leant upon an arm of flesh--
And here's its strength! I'll walk by faith--by faith
And rest my weary heart on Christ alone--
On him, the all-sufficient!
Shame on me! dreaming thus about myself,
While you stand shivering here. [To her little Son.]
Art cold, young knight?
Knights must not cry--Go slide, and warm thyself.
Where shall we lodge to-night?
Isen. There's no place open,
But that foul tavern, where we lay last night.
Elizabeth's Son [clinging to her]. O mother, mother! go not to that
house--
Among those fierce lank men, who laughed, and scowled,
And showed their knives, and sang strange ugly songs
Of you and us. O mother! let us be!
Eliz. Hark! look! His father's voice!--his very eye--
Opening so slow and sad, then sinking down
In luscious rest again!
Isen. Bethink you, child--
Eliz. Oh yes--I'll think--we'll to our tavern friends;
If they be brutes, 'twas my sin left them so.
Guta. 'Tis but for a night or two: three days will bring
The Abbess hither.
Isen. And then to Bamberg straight
For knights and men-at-arms! Your uncle's wrath--
Guta [aside]. Hush! hush! you'll fret her, if you talk of
vengeance.
Isen. Come to our shelter.
Children. Oh stay here, stay here!
Behind these walls.
Eliz. Ay--stay a while in peace. The storms are still.
Beneath her eider robe the patient earth
Watches in silence for the sun: we'll sit
And gaze up with her at the changeless heaven,
Until this tyranny be overpast.
Come. [aside] Lost! Lost! Lost!
[They enter a neighbouring ruin.]
SCENE III
A Chamber in the Bishop's Palace at Bamberg. Elizabeth and Guta.
Guta. You have determined?
Eliz. Yes--to go with him.
I have kept my oath too long to break it now.
I will to Marpurg, and there waste away
In meditation and in pious deeds,
Till God shall set me free.
Guta. How if your uncle
Will have you marry? Day and night, they say,
He talks of nothing else.
Eliz. Never, girl, never!
Save me from that at least, O God!
Guta. He spoke
Of giving us, your maidens, to his knights
In carnal wedlock: but I fear him not:
For God's own word is pledged to keep me pure--
I am a maid.
Eliz. And I, alas! am none!
O Guta! dost thou mock my widowed love?
I was a wife--'tis true: I was not worthy--
But there was meaning in that first wild fancy;
'Twas but the innocent springing of the sap--
The witless yearning of an homeless heart--
Do I not know that God has pardoned me?
But now--to rouse and turn of mine own will,
In cool and full foreknowledge, this worn soul
Again to that, which, when God thrust it on me,
Bred but one shame of ever-gnawing doubt,
Were--No, my burning cheeks! We'll say no more.
Ah! loved and lost! Though God's chaste grace should fail me,
My weak idolatry of thee would give
Strength that should keep me true: with mine own hands
I'd mar this tear-worn face, till petulant man
Should loathe its scarred and shapeless ugliness.
Guta. But your poor children? What becomes of them?
Eliz. Oh! she who was not worthy of a husband
Does not deserve his children. What are they, darlings,
But snares to keep me from my heavenly spouse
By picturing the spouse I must forget?
Well--'tis blank horror. Yet if grief's good for me,
Let me down into grief's blackest pit,
And follow out God's cure by mine own deed.
Guta. What will your kinsfolk think?
Eliz. What will they think!
What pleases them. That argument's a staff
Which breaks whene'er you lean on't. Trust me, girl,
That fear of man sucks out love's soaring ether,
Baffles faith's heavenward eyes, and drops us down,
To float, like plumeless birds, on any stream.
Have I not proved it?
There was a time with me, when every eye
Did scorch like flame: if one looked cold on me,
I straight accused myself of mortal sins:
Each fopling was my master: I have lied
From very fear of mine own serving-maids.--
That's past, thank God's good grace!
Guta. And now you leap
To the other end of the line.
Eliz. In self-defence.
I am too weak to live by half my conscience;
I have no wit to weigh and choose the mean;
Life is too short for logic; what I do
I must do simply; God alone must judge--
For God alone shall guide, and God's elect--
I shrink from earth's chill frosts too much to crawl--
I have snapped opinion's chains, and now I'll soar
Up to the blazing sunlight, and be free.
[The bishop of Bamberg enters. Conrad following.]
Bishop. The Devil plagued St. Antony in the likeness of a lean
friar! Between mad monks and mad women, bedlam's broke loose, I
think.
Con. When the Spirit first descended on the elect, seculars then,
too, said mocking, 'These men are full of new wine.'
Bishop. Seculars, truly! If I had not in my secularity picked up a
spice of chivalry to the ladies, I should long ago have turned out
you and your regulars, to cant elsewhere. Plague on this gout--I
must sit.
Eliz. Let me settle your cushion, uncle.
Bishop. So! girl! I sent for you from Botenstain. I had a mind,
now, to have kept you there until your wits returned, and you would
say Yes to some young noble suitor. As if I had not had trouble
enough about your dower!--If I had had to fight for it, I should not
have minded:--but these palavers and conferences have fretted me
into the gout: and now you would throw all away again, tired with
your toy, I suppose. What shall I say to the Counts, Varila, and
the Cupbearer, and all the noble knights who will hazard their lands
and lives in trying to right you with that traitor? I am ashamed to
look them in the face! To give all up to the villain!--To pay him
for his treason!
Eliz. Uncle, I give but what to me is worthless. He loves these
baubles--let him keep them, then: I have my dower.
Bishop. To squander on nuns and beggars, at this rogue's bidding?
Why not marry some honest man? You may have your choice of kings
and princes; and if you have been happy with one gentleman, Mass!
say I, why can't you be happy with another? What saith the
Scripture? 'I will that the younger widows marry, bear children,'--
not run after monks, and what not--What's good for the filly, is
good for the mare, say I.
Eliz. Uncle, I soar now at a higher pitch--
To be henceforth the bride of Christ alone.
Bishop. Ahem!--a pious notion--in moderation. We must be moderate,
my child, moderate: I hate overdoing anything--especially religion.
Con. Madam, between your uncle and myself
This question in your absence were best mooted.
[Exit Elizabeth.]
Bishop. How, priest? do you order her about like a servant-maid?
Con. The saints forbid! Now--ere I lose a moment--
[Kneeling.]
[Aside] All things to all men be--and so save some--
[Aloud] Forgive, your grace, forgive me,
If mine unmannered speech in aught have clashed
With your more tempered and melodious judgment:
Your courage will forgive an honest warmth.
God knows, I serve no private interests.
Bishop. Your order's, hey? to wit?
Con. My lord, my lord,
There may be higher aims: but what I said,
I said but for our Church, and our cloth's honour.
Ladies' religion, like their love, we know,
Requires a gloss of verbal exaltation,
Lest the sweet souls should understand themselves;
And clergymen must talk up to the mark.
Bishop. We all know, Gospel preached in the mother-tongue
Sounds too like common sense.
Con. Or too unlike it:
You know the world, your grace; you know the sex--
Bishop. Ahem! As a spectator.
Con. Philosophice--
Just so--You know their rage for shaven crowns--
How they'll deny their God--but not their priest--
Flirts--scandal-mongers--in default of both come
Platonic love--worship of art and genius--
Idols which make them dream of heaven, as girls
Dream of their sweethearts, when they sleep on bridecake.
It saves from worse--we are not all Abelards.
Bishop [aside]. Some of us have his tongue, if not his face.
Con. There lies her fancy; do but balk her of it--
She'll bolt to cloisters, like a rabbit scared.
Head her from that--she'll wed some pink-faced boy--
The more low-bred and penniless, the likelier.
Send her to Marpurg, and her brain will cool.
Tug at the kite, 'twill only soar the higher:
Give it but line, my lord, 'twill drop like slate.
Use but that eagle's glance, whose daring foresight
In chapter, camp, and council, wins the wonder
Of timid trucklers--Scan results and outcomes--
The scale is heavy in your grace's favour.
Bishop. Bah! priest! What can this Marpurg-madness do for me?
Con. Leave you the tutelage of all her children.
Bishop. Thank you--to play the dry-nurse to three starving brats.
Con. The minor's guardian guards the minor's lands.
Bishop. Unless they are pitched away in building hospitals.
Con. Instead of fattening in your wisdom's keeping.
Bishop. Well, well,--but what gross scandal to the family!
Con. The family, my lord, would gain a saint.
Bishop. Ah! monk, that canonisation costs a frightful sum.
Con. These fees, just now, would gladly be remitted.
Bishop. These are the last days, faith, when Rome's too rich to
take!
Con. The Saints forbid, my lord, the fisher's see
Were so o'ercursed by Mammon! But you grieve,
I know, to see foul weeds of heresy
Of late o'errun your diocese.
Bishop. Ay, curse them!
I've hanged some dozens.
Con. Worthy of yourself!
But yet the faith needs here some mighty triumph--
Some bright example, whose resplendent blaze
May tempt that fluttering tribe within the pale
Of Holy Church again--
Bishop. To singe their wings?
Con. They'll not come near enough. Again--there are
Who dare arraign your prowess, and assert
A churchman's energies were better spent
In pulpits than the tented field. Now mark--
Mark, what a door is opened. Give but scope
To this her huge capacity for sainthood--
Set her, a burning and a shining light
To all your people--Such a sacrifice,
Such loan to God of your own flesh and blood,
Will silence envious tongues, and prove you wise
For the next world as for this; will clear your name
From calumnies which argue worldliness;
Buy of itself the joys of paradise;
And clench your lordship's interest with the pontiff.
Bishop. Well, well, we'll think on't.
Con. Sir, I doubt you not.
[Re-enter Elizabeth.]
Eliz. Uncle, I am determined.
Bishop. So am I.
You shall to Marpurg with this holy man.
Eliz. Ah, there you speak again like my own uncle.
I'll go--to rest [aside] and die. I only wait
To see the bones of my beloved laid
In some fit resting-place. A messenger
Proclaims them near. O God!
Bishop. We'll go, my child,
And meeting them with all due honour, show
In our own worship, honourable minds.
[Exit Elizabeth.]
A messenger! How far off are they, then?
Serv. Some two days' journey, sir.
Bishop. Two days' journey, and nought prepared?
Here, chaplain--Brother Hippodamas! Chaplain, I say! [Hippodamas
enters.] Call the apparitor--ride off with him, right and left--
Don't wait even to take your hawk--Tell my knights to be with me,
with all their men-at-arms, at noon on the second day. Let all be
of the best, say--the brightest of arms and the newest of garments.
Mass! we must show our smartest before these crusaders--they'll be
full of new fashions, I warrant 'em--the monkeys that have seen the
world. And here, boy [to a page], set me a stoup of wine in the
oriel-room, and another for this good monk.
Con. Pardon me, blessedness--but holy rule--
Bishop. Oh! I forgot.--A pail of water and a peck of beans for the
holy man!--Order up my equerry, and bid my armourer--vestryman, I
mean--look out my newest robes.--Plague on this gout.
[Exeunt, following the Bishop.]
SCENE IV
The Nave of Bamberg Cathedral. A procession entering the West Door,
headed by Elizabeth and the Bishop, Nobles, etc. Religious bearing
the coffin which encloses Lewis's bones.
1st Lady. See! the procession comes--the mob streams in
At every door. Hark! how the steeples thunder
Their solemn bass above the wailing choir.
2d Lady. They will stop at the screen.
Knight. And there, as I hear, open the coffin. Push forward,
ladies, to that pillar: thence you will see all.
1st Peas. Oh dear! oh dear! If any man had told me that I should
ride forty miles on this errand, to see him that went out flesh come
home grass, like the flower of the field!
2d Peas. We have changed him, but not mended him, say I, friend.
1st Peas. Never we. He knew where a yeoman's heart lay! One that
would clap a man on the back when his cow died, and behave like a
gentleman to him--that never met you after a hailstorm without
lightening himself of a few pocket-burners.
2d Peas. Ay, that's your poor-man's plaster: that's your right
grease for this world's creaking wheels.
1st Peas. Nay, that's your rich man's plaster too, and covers the
multitude of sins. That's your big pike's swimming-bladder, that
keeps him atop and feeding: that's his calling and election, his
oil of anointing, his salvum fac regem, his yeoman of the wardrobe,
who keeps the velvet-piled side of this world uppermost, lest his
delicate eyes should see the warp that holds it.
2d Peas. Who's the warp, then?
1st Peas. We, man, the friezes and fustians, that rub on till we
get frayed through with overwork, and then all's abroad, and the
nakedness of Babylon is discovered, and catch who catch can.
Old Woman. Pity they only brought his bones home! He would have
made a lovely corpse, surely. He was a proper man!
1st Lady. Oh the mincing step he had with him! and the delicate
hand on a horse, fingering the reins as St. Cicely does the organ-
keys!
2d Lady. And for hunting, another Siegfried.
Knight. If he was Siegfried the gay, she was Chriemhild the grim;
and as likely to prove a firebrand as the girl in the ballad.
1st Lady. Gay, indeed! His smiles were like plumcake, the sweeter
the deeper iced. I never saw him speak civil word to woman, but to
her.
2d Lady. O ye Saints! There was honey spilt on the ground! If I
had such a knight, I'd never freeze alone on the chamber-floor, like
some that never knew when they were well off. I'd never elbow him
off to crusades with my pruderies.
'Pluck your apples while they're ripe,
And pull your flowers in May, O!'
Eh! Mother?
Old Woman. 'Till when she grew wizened, and he grew cold,
The balance lay even 'twixt young and old.'
Monk. Thus Satan bears witness perforce against the vanities of
Venus! But what's this babbling? Carolationes in the holy place?
Tace, vetula! taceas, taceto also, and that forthwith.
Old Woman. Tace in your teeth, and taceas also, begging-box! Who
put the halter round his waist to keep it off his neck,--who? Get
behind your screen, sirrah! Am I not a burgher's wife? Am I not in
the nave? Am I not on my own ground? Have I brought up eleven
children, without nurse wet or dry, to be taced nowadays by friars
in the nave? Help! good folks! Where be these rooks a going?
Knight. The monk has vanished.
1st Peas. It's ill letting out waters, he finds. Who is that old
gentleman, sir, holds the Princess so tight by the hand?
Knight. Her uncle, knave, the Bishop.
1st Peas. Very right, he: for she's almost a born natural, poor
soul. It was a temptation to deal with her.
2d Peas. Thou didst cheat her shockingly, Frank, time o' the
famine, on those nine sacks of maslin meal.
Knight. Go tell her of it, rascal, and she'll thank you for it, and
give you a shilling for helping her to a 'cross.'
Old Woman. Taceing free women in the nave! This comes of your
princesses, that turn the world upside down, and demean themselves
to hob and nob with these black baldicoots!
Eliz. [in a low voice]. I saw all Israel scattered on the hills
As sheep that have no shepherd! O my people!
Who crowd with greedy eyes round this my jewel,
Poor ivory, token of his outward beauty--
Oh! had ye known his spirit!--Let his wisdom
Inform your light hearts with that Saviour's likeness
For whom he died! So had you kept him with you;
And from the coming evils gentle Heaven
Had not withdrawn the righteous: 'tis too late!
1st Lady. There, now, she smiles; do you think she ever loved him?
Knight. Never creature, but mealy-mouthed inquisitors, and shaven
singing birds. She looks now as glad to be rid of him as any colt
broke loose.
1st Lady. What will she do now, when this farce is over?
2d Lady. Found an abbey, that's the fashion, and elect herself
abbess--tyrannise over hysterical girls, who are forced to thank her
for making them miserable, and so die a saint.
Knight. Will you pray to her, my fair queen?
2d Lady. Not I, sir; the old Saints send me lovers enough, and to
spare--yourself for one.
1st Lady. There is the giant-killer slain. But see--they have
stopped: who is that raising the coffin lid?
2d Lady. Her familiar spirit, Conrad the heretic-catcher.
Knight. I do defy him! Thou art my only goddess;
My saint, my idol, my--ahem!
1st Lady. That well's run dry.
Look, how she trembles--Now she sinks, all shivering,
Upon the pavement--Why, you'll see nought there
Flirting behind the pillar--Now she rises--
And choking down that proud heart, turns to the altar--
Her hand upon the coffin.
Eliz. I thank thee, gracious Lord, who hast fulfilled
Thine handmaid's mighty longings with the sight
Of my beloved's bones, and dost vouchsafe
This consolation to the desolate.
I grudge not, Lord, the victim which we gave Thee,
Both he and I, of his most precious life,
To aid Thine holy city: though Thou knowest
His sweetest presence was to this world's joy
As sunlight to the taper--Oh! hadst Thou spared--
Had Thy great mercy let us, hand in hand,
Have toiled through houseless shame, on beggar's dole,
I had been blest: Thou hast him, Lord, Thou hast him--
Do with us what Thou wilt! If at the price
Of this one silly hair, in spite of Thee,
I could reclothe these wan bones with his manhood,
And clasp to my shrunk heart my hero's self--
I would not give it!
I will weep no more--
Lead on, most holy; on the sepulchre
Which stands beside the choir, lay down your burden.
[To the people.]
Now, gentle hosts, within the close hard by,
Will we our court, as queen of sorrows, hold--
The green graves underneath us, and above
The all-seeing vault, which is the eye of God,
Judge of the widow and the fatherless.
There will I plead my children's wrongs, and there,
If, as I think, there boil within your veins
The deep sure currents of your race's manhood,
Ye'll nail the orphans' badge upon your shields,
And own their cause for God's. We name our champions--
Rudolf, the Cupbearer, Leutolf of Erlstetten,
Hartwig of Erba, and our loved Count Walter,
Our knights and vassals, sojourners among you.
Follow us.
[Exit Elizabeth, etc.; the crowd following.]
ACT IV
SCENE I
Night. The church of a convent. Elizabeth, Conrad, Gerard, Monks,
an Abbess, Nuns, etc., in the distance.
Conrad. What's this new weakness? At your own request
We come to hear your self-imposed vows--
And now you shrink: where are the high-flown fancies
Which but last week, beside your husband's bier,
You vapoured forth? Will you become a jest?
You might have counted this tower's cost, before
You blazoned thus your plans abroad.
Eliz. Oh! spare me!
Con. Spare? Spare yourself; and spare big easy words,
Which prove your knowledge greater than your grace.
Eliz. Is there no middle path? No way to keep
My love for them, and God, at once unstained?
Con. If this were God's world, Madam, and not the devil's,
It might be done.
Eliz. God's world, man! Why, God made it--
The faith asserts it God's.
Con. Potentially--
As every christened rogue's a child of God,
Or those old hags, Christ's brides--Think of your horn-book--
The world, the flesh, and the devil--a goodly leash!
And yet God made all three. I know the fiend;
And you should know the world: be sure, be sure.
The flesh is not a stork among the cranes.
Our nature, even in Eden gross and vile,
And by miraculous grace alone upheld,
Is now itself, and foul, and damned, must die
Ere we can live; let halting worldlings, madam,
Maunder against earth's ties, yet clutch them still.
Eliz. And yet God gave them to me--
Con. In the world;
Your babes are yours according to the flesh;
How can you hate the flesh, and love its fruit?
Eliz. The Scripture bids me love them.
Con. Truly so,
While you are forced to keep them; when God's mercy
Doth from the flesh and world deliverance offer,
Letting you bestow them elsewhere, then your love
May cease with its own usefulness, and the spirit
Range in free battle lists; I'll not waste reasons--
We'll leave you, Madam, to the Spirit's voice.
[Conrad and Gerard withdraw.]
Eliz. [alone]. Give up his children! Why, I'd not give up
A lock of hair, a glove his hand had hallowed:
And they are his gift; his pledge; his flesh and blood
Tossed off for my ambition! Ah! my husband!
His ghost's sad eyes upbraid me! Spare me, spare me!
I'd love thee still, if I dared; but I fear God.
And shall I never more see loving eyes
Look into mine, until my dying day?
That's this world's bondage: Christ would have me free,
And 'twere a pious deed to cut myself
The last, last strand, and fly: but whither? whither?
What if I cast away the bird i' the hand
And found none in the bush? 'Tis possible--
What right have I to arrogate Christ's bride-bed?
Crushed, widowed, sold to traitors? I, o'er whom
His billows and His storms are sweeping? God's not angry:
No, not so much as we with buzzing fly;
Or in the moment of His wrath's awakening
We should be--nothing. No--there's worse than that--
What if He but sat still, and let be be?
And these deep sorrows, which my vain conceit
Calls chastenings--meant for me--my ailments' cure--
Were lessons for some angels far away,
And I the corpus vile for the experiment?
The grinding of the sharp and pitiless wheels
Of some high Providence, which had its mainspring
Ages ago, and ages hence its end?
That were too horrible!--
To have torn up all the roses from my garden,
And planted thorns instead; to have forged my griefs,
And hugged the griefs I dared not forge; made earth
A hell, for hope of heaven; and after all,
These homeless moors of life toiled through, to wake,
And find blank nothing! Is that angel-world
A gaudy window, which we paint ourselves
To hide the dead void night beyond? The present?
Why here's the present--like this arched gloom,
It hems our blind souls in, and roofs them over
With adamantine vault, whose only voice
Is our own wild prayers' echo: and our future?--
It rambles out in endless aisles of mist,
The farther still the darker--O my Saviour!
My God! where art Thou? That's but a tale about Thee,
That crucifix above--it does but show Thee
As Thou wast once, but not as Thou art now--
Thy grief, but not Thy glory: where's that gone?
I see it not without me, and within me
Hell reigns, not Thou!
[Dashes herself down on the altar steps.]
[Monks in the distance chanting.]
'Kings' daughters were among thine honourable women'--
Eliz. Kings' daughters! I am one!
Monks. 'Hearken, O daughter, and consider; incline thine ear:
Forget also thine own people, and thy father's house,
So shall the King have pleasure in thy beauty:
For He is thy Lord God, and worship thou Him.'
Eliz. [springing up]. I will forget them!
They stand between my soul and its allegiance.
Thou art my God: what matter if Thou love me?
I am Thy bond-slave, purchased with Thy life-blood;
I will remember nothing, save that debt.
Do with me what Thou wilt. Alas, my babies!
He loves them--they'll not need me.
[Conrad advancing.]
Con. How now, Madam!
Have these your prayers unto a nobler will
Won back that wandering heart?
Eliz. God's will is spoken!
The flesh is weak; the spirit's fixed, and dares,--
Stay! confess, sir,
Did not yourself set on your brothers here
To sing me to your purpose?
Con. As I live
I meant it not; yet had I bribed them to it,
Those words were no less God's.
Eliz. I know it, I know it;
And I'll obey them: come, the victim's ready.
[Lays her hand on the altar. Gerard, Abbess, and Monks descend and
advance.]
All worldly goods and wealth, which once I loved,
I do now count but dross: and my beloved,
The children of my womb, I now regard
As if they were another's. God is witness
My pride is to despise myself; my joy
All insults, sneers, and slanders of mankind;
No creature now I love, but God alone.
Oh, to be clear, clear, clear, of all but Him!
Lo, here I strip me of all earthly helps--
[Tearing off her clothes.]
Naked and barefoot through the world to follow
My naked Lord--And for my filthy pelf--
Con. Stop, Madam--
Eliz. Why so, sir?
Con. Upon thine oath!
Thy wealth is God's, not thine--How darest renounce
The trust He lays on thee? I do command thee,
Being, as Aaron, in God's stead, to keep it
Inviolate, for the Church and thine own needs.
Eliz. Be it so--I have no part nor lot in't--
There--I have spoken.
Abbess. O noble soul! which neither gold, nor love,
Nor scorn can bend!
Gerard. And think what pure devotions,
What holy prayers must they have been, whose guerdon
Is such a flood of grace!
Nuns. What love again!
What flame of charity, which thus prevails
In virtue's guest!
Eliz. Is self-contempt learnt thus?
I'll home.
Abbess. And yet how blest, in these cool shades
To rest with us, as in a land-locked pool,
Touched last and lightest by the ruffling breeze.
Eliz. No! no! no! no! I will not die in the dark:
I'll breathe the free fresh air until the last,
Were it but a month--I have such things to do--
Great schemes--brave schemes--and such a little time!
Though now I am harnessed light as any foot-page.
Come, come, my ladies. [Exeunt Elizabeth, etc.]
Ger. Alas, poor lady!
Con. Why alas, my son?
She longs to die a saint, and here's the way to it.
Ger. Yet why so harsh? why with remorseless knife
Home to the stem prune back each bough and bud?
I thought the task of education was
To strengthen, not to crush; to train and feed
Each subject toward fulfilment of its nature,
According to the mind of God, revealed
In laws, congenital with every kind
And character of man.
Con. A heathen dream!
Young souls but see the gay and warm outside,
And work but in the shallow upper soil.
Mine deeper, and the sour and barren rock
Will stop you soon enough. Who trains God's Saints,
He must transform, not pet--Nature's corrupt throughout--
A gaudy snake, which must be crushed, not tamed,
A cage of unclean birds, deceitful ever;
Born in the likeness of the fiend, which Adam
Did at the Fall, the Scripture saith, put on.
Canst thou draw out Leviathan with a hook,
To make him sport for thy maidens? Scripture saith
Who is the prince of this world--so forget not.
Ger. Forgive, if my more weak and carnal judgment
Be startled by your doctrines, and doubt trembling
The path whereon you force yourself and her.
Con. Startled? Belike--belike--let doctrines be;
Thou shalt be judged by thy works; so see to them,
And let divines split hairs: dare all thou canst;
Be all thou darest;--that will keep thy brains full.
Have thy tools ready, God will find thee work--
Then up, and play the man. Fix well thy purpose--
Let one idea, like an orbed sun,
Rise radiant in thine heaven; and then round it
All doctrines, forms, and disciplines will range
As dim parhelia, or as needful clouds,
Needful, but mist-begotten, to be dashed
Aside, when fresh shall serve thy purpose better.
Ger. How? dashed aside?
Con. Yea, dashed aside--why not?
The truths, my son, are safe in God's abysses--
While we patch up the doctrines to look like them.
The best are tarnished mirrors--clumsy bridges,
Whereon, as on firm soil, the mob may walk
Across the gulf of doubt, and know no danger.
We, who see heaven, may see the hell which girds it.
Blind trust for them. When I came here from Rome,
Among the Alps, all through one frost-bound dawn,
Waiting with sealed lips the noisy day,
I walked upon a marble mead of snow--
An angel's spotless plume, laid there for me:
Then from the hillside, in the melting noon,
Looked down the gorge, and lo! no bridge, no snow--
But seas of writhing glacier, gashed and scored
With splintered gulfs, and fathomless crevasses,
Blue lips of hell, which sucked down roaring rivers
The fiends who fled the sun. The path of Saints
Is such; so shall she look from heaven, and see
The road which led her thither. Now we'll go,
And find some lonely cottage for her lodging;
Her shelter now is but a crumbling ruin
Roofed in with pine boughs--discipline more healthy
For soul, than body: She's not ripe for death.
[Exeunt.]
SCENE II
Open space in a suburb of Marpurg, near Elizabeth's Hut. Count
Walter and Count Pama of Hungary entering.
C. Pama. I have prepared my nerves for a shock.
C. Wal. You are wise, for the world's upside down here. The last
gateway brought us out of Christendom into the New Jerusalem, the
fifth Monarchy, where the Saints possess the earth. Not a beggar
here but has his pockets full of fair ladies' tokens: not a
barefooted friar but rules a princess.
C. Pama. Creeping, I opine, into widows' houses, and for a pretence
making long prayers.
C. Wal. Don't quote Scripture here, sir, especially in that gross
literal way! The new lights here have taught us that Scripture's
saying one thing, is a certain proof that it means another. Except,
by the bye, in one text.
C. Pama. What's that?
C. Wal. 'Ask, and it shall be given you.'
C. Pama. Ah! So we are to take nothing literally, that they may
take literally everything themselves?
C. Wal. Humph! As for your text, see if they do not saddle it on
us before the day is out, as glibly as ever you laid it on them.
Here comes the lady's tyrant, of whom I told you.
[Conrad advances from the Hut.]
Con. And what may Count Walter's valour want here?
[Count Walter turns his back.]
C. Pama. I come, Sir Priest, from Andreas, king renowned
Of Hungary, ambassador unworthy
Unto the Landgravine, his saintly daughter;
And fain would be directed to her presence.
Con. That is as I shall choose. But I'll not stop you.
I do not build with straw. I'll trust my pupils
To worldlings' honeyed tongues, who make long prayers,
And enter widows' houses for pretence.
There dwells the lady, who has chosen too long
The better part, to have it taken from her.
Besides that with strange dreams and revelations
She has of late been edified.
C. Wal. Bah! but they will serve your turn--and hers.
Con. What do you mean?
C. Wal. When you have cut her off from child and friend, and even
Isentrudis and Guta, as I hear, are thrust out by you to starve, and
she sits there, shut up like a bear in a hole, to feed on her own
substance; if she has not some of these visions to look at, how is
she, or any other of your poor self-gorged prisoners, to help
fancying herself the only creature on earth?
Con. How now? Who more than she, in faith and practice, a living
member of the Communion of Saints? Did she not lately publicly
dispense in charity in a single day five hundred marks and more? Is
it not my continual labour to keep her from utter penury through her
extravagance in almsgiving? For whom does she take thought but for
the poor, on whom, day and night, she spends her strength? Does she
not tend them from the cradle, nurse them, kiss their sores, feed
them, bathe them, with her own hands, clothe them, living and dead,
with garments, the produce of her own labour? Did she not of late
take into her own house a paralytic boy, whose loathsomeness had
driven away every one else? And now that we have removed that
charge, has she not with her a leprous boy, to whose necessities she
ministers hourly, by day and night? What valley but blesses her for
some school, some chapel, some convent, built by her munificence?
Are not the hospices, which she has founded in divers towns, the
wonder of Germany?--wherein she daily feeds and houses a multitude
of the infirm poor of Christ? Is she not followed at every step by
the blessings of the poor? Are not her hourly intercessions for the
souls and bodies of all around incessant, world-famous, mighty to
save? While she lives only for the Church of Christ, will you
accuse her of selfish isolation?
C. Wal. I tell you, monk, if she were not healthier by God's making
than ever she will be by yours, her charity would be by this time
double-distilled selfishness; the mouths she fed, cupboards to store
good works in; the backs she warmed, clothes-horses to hang out her
wares before God; her alms not given, but fairly paid, a halfpenny
for every halfpenny-worth of eternal life; earth her chess-board,
and the men and women on it merely pawns for her to play a winning
game--puppets and horn-books to teach her unit holiness--a private
workshop in which to work out her own salvation. Out upon such
charity!
Con. God hath appointed that our virtuous deeds
Each merit their rewards.
C. Wal. Go to--go to. I have watched you and your crew, how you
preach up selfish ambition for divine charity and call prurient
longings celestial love, while you blaspheme that very marriage from
whose mysteries you borrow all your cant. The day will come when
every husband and father will hunt you down like vermin; and may I
live to see it.
Con. Out on thee, heretic!
C. Wal. [drawing]. Liar! At last?
C. Pama. In God's name, sir, what if the Princess find us?
C. Wal. Ay--for her sake. But put that name on me again, as you do
on every good Catholic who will not be your slave and puppet, and if
thou goest home with ears and nose, there is no hot blood in
Germany.
[They move towards the cottage.]
Con. [alone]. Were I as once I was, I could revenge:
But now all private grudges wane like mist
In the keen sunlight of my full intent;
And this man counts but for some sullen bull
Who paws and mutters at unheeding pilgrims
His empty wrath: yet let him bar my path,
Or stay me but one hour in my life-purpose,
And I will fell him as a savage beast,
God's foe, not mine. Beware thyself, Sir Count!
[Exit. The Counts return from the Cottage.]
C. Pama. Shortly she will return; here to expect her
Is duty both, and honour. Pardon me--
Her humours are well known here? Passers by
Will guess who 'tis we visit?
C. Wal. Very likely.
C. Pama. Well, travellers see strange things--and do them too.
Hem! this turf-smoke affects my breath: we might
Draw back a space.
C. Wal. Certie, we were in luck,
Or both our noses would have been snapped off
By those two she-dragons; how their sainthoods squealed
To see a brace of beards peep in! Poor child!
Two sweet companions for her loneliness!
C. Pama. But ah! what lodging! 'Tis at that my heart bleeds!
That hut, whose rough and smoke-embrowned spars
Dip to the cold clay floor on either side!
Her seats bare deal!--her only furniture
Some earthen crock or two! Why, sir, a dungeon
Were scarce more frightful: such a choice must argue
Aberrant senses, or degenerate blood!
C. Wal. What? Were things foul?
C. Pama. I marked not, sir.
C. Wal. I did.
You might have eat your dinner off the floor.
C. Pama. Off any spot, sir, which a princess' foot
Had hallowed by its touch.
C. Wal. Most courtierly.
Keep, keep those sweet saws for the lady's self.
[Aside] Unless that shock of the nerves shall send them flying.
C. Pama. Yet whence this depth of poverty? I thought
You and her champions had recovered for her
Her lands and titles.
C. Wal. Ay; that coward Henry
Gave them all back as lightly as he took them:
Certie, we were four gentle applicants--
And Rudolph told him some unwelcome truths--
Would God that all of us might hear our sins,
As Henry heard that day!
C. Pama. Then she refused them?
C. Wal. 'It ill befits,' quoth she, 'my royal blood,
To take extorted gifts; I tender back
By you to him, for this his mortal life,
That which he thinks by treason cheaply bought;
To which my son shall, in his father's right,
By God's good will, succeed. For that dread height
May Christ by many woes prepare his youth!'
C. Pama. Humph!
C. Wal. Why here--no, 't cannot be--
C. Pama. What hither comes
Forth from the hospital, where, as they told us,
The Princess labours in her holy duties?
A parti- ghost that stalks for penance?
Ah! a good head of hair, if she had kept it
A thought less lank; a handsome face too, trust me,
But worn to fiddle-strings; well, we'll be knightly--
[As Elizabeth meets him.]
Stop, my fair queen of rags and patches, turn
Those solemn eyes a moment from your distaff,
And say, what tidings your magnificence
Can bring us of the Princess?
Eliz. I am she.
[Count Pama crosses himself and falls on his knees.]
C. Pama. O blessed saints and martyrs! Open, earth!
And hide my recreant knighthood in thy gulf!
Yet, mercy, Madam! for till this strange day
Who e'er saw spinning wool, like village-maid,
A royal scion?
C. Wal. [kneeling]. My beloved mistress!
Eliz. Ah! faithful friend! Rise, gentles, rise, for shame;
Nay, blush not, gallant sir. You have seen, ere now,
Kings' daughters do worse things than spinning wool,
Yet never reddened. Speak your errand out.
C. Pama. I from your father, Madam--
Eliz. Oh! I divine;
And grieve that you so far have journeyed, sir,
Upon a bootless quest.
C. Pama. But hear me, Madam--
If you return with me (o'erwhelming honour!
For such mean bodyguard too precious treasure)
Your father offers to you half his wealth;
And countless hosts, whose swift and loyal blades
From traitorous grasp shall vindicate your crown.
Eliz. Wealth? I have proved it, and have tossed it from me:
I will not stoop again to load with clay.
War? I have proved that too: should I turn loose
On these poor sheep the wolf whose fangs have gored me,
God's bolt would smite me dead.
C. Pama. Madam, by his gray hairs he doth entreat you.
Eliz. Alas! small comfort would they find in me!
I am a stricken and most luckless deer,
Whose bleeding track but draws the hounds of wrath
Where'er I pause a moment. He has children
Bred at his side, to nurse him in his age--
While I am but an alien and a changeling,
Whom, ere my plastic sense could impress take
Either of his feature or his voice, he lost.
C. Pama. Is it so? Then pardon, Madam, but your father
Must by a father's right command--
Eliz. Command! Ay, that's the phrase of the world: well--tell
him,
But tell him gently too--that child and father
Are names, whose earthly sense I have forsworn,
And know no more: I have a heavenly spouse,
Whose service doth all other claims annul.
C. Wal. Ah, lady, dearest lady, be but ruled!
Your Saviour will be there as near as here.
Eliz. What? Thou too, friend? Dost thou not know me better?
Wouldst have me leave undone what I begin?
[To Count Pama] My father took the cross, sir: so did I:
As he would die at his post, so will I die:
He is a warrior: ask him, should I leave
This my safe fort, and well-proved vantage-ground,
To roam on this world's flat and fenceless steppes?
C. Pama. Pardon me, Madam, if my grosser wit
Fail to conceive your sense.
Eliz. It is not needed.
Be but the mouthpiece to my father, sir;
And tell him--for I would not anger him--
Tell him, I am content--say, happy--tell him
I prove my kin by prayers for him, and masses
For her who bore me. We shall meet on high.
And say, his daughter is a mighty tree,
From whose wide roots a thousand sapling suckers,
Drink half their life; she dare not snap the threads,
And let her offshoots wither. So farewell.
Within the convent there, as mine own guests,
You shall be fitly lodged. Come here no more.
C. Wal. C. Pama. Farewell, sweet Saint! [Exeunt.]
Eliz. May God go with you both.
No! I will win for him a nobler name,
Than captive crescents, piles of turbaned heads,
Or towns retaken from the Tartar, give.
In me he shall be greatest; my report
Shall through the ages win the quires of heaven
To love and honour him; and hinds, who bless
The poor man's patron saint, shall not forget
How she was fathered with a worthy sire. [Exit.]
SCENE III
Night. Interior of Elizabeth's hut. A leprous boy sleeping on a
Mattress. Elizabeth watching by him.]
Eliz. My shrunk limbs, stiff from many a blow,
Are crazed with pain.
A long dim formless fog-bank, creeping low,
Dulls all my brain.
I remember two young lovers,
In a golden gleam.
Across the brooding darkness shrieking hovers
That fair, foul dream.
My little children call to me,
'Mother! so soon forgot?'
From out dark nooks their yearning faces startle me,
Go, babes! I know you not!
Pray! pray! or thou'lt go mad.
. . . . .
The past's our own:
No fiend can take that from us! Ah, poor boy!
Had I, like thee, been bred from my black birth-hour
In filth and shame, counting the soulless months
Only by some fresh ulcer! I'll be patient--
Here's something yet more wretched than myself.
Sleep thou on still, poor charge--though I'll not grudge
One moment of my sickening toil about thee,
Best counsellor--dumb preacher, who dost warn me
How much I have enjoyed, how much have left,
Which thou hast never known. How am I wretched?
The happiness thou hast from me, is mine,
And makes me happy. Ay, there lies the secret--
Could we but crush that ever-craving lust
For bliss, which kills all bliss, and lose our life,
Our barren unit life, to find again
A thousand lives in those for whom we die.
So were we men and women, and should hold
Our rightful rank in God's great universe,
Wherein, in heaven and earth, by will or nature,
Nought lives for self--All, all--from crown to footstool--
The Lamb, before the world's foundations slain--
The angels, ministers to God's elect--
The sun, who only shines to light a world--
The clouds, whose glory is to die in showers--
The fleeting streams, who in their ocean-graves
Flee the decay of stagnant self-content--
The oak, ennobled by the shipwright's axe--
The soil, which yields its marrow to the flower--
The flower, which feeds a thousand velvet worms,
Born only to be prey for every bird--
All spend themselves for others: and shall man,
Earth's rosy blossom--image of his God--
Whose twofold being is the mystic knot
Which couples earth and heaven--doubly bound
As being both worm and angel, to that service
By which both worms and angels hold their life--
Shall he, whose every breath is debt on debt,
Refuse, without some hope of further wage
Which he calls Heaven, to be what God has made him?
No! let him show himself the creature's lord
By freewill gift of that self-sacrifice
Which they perforce by nature's law must suffer.
This too I had to learn (I thank thee, Lord!),
To lie crushed down in darkness and the pit--
To lose all heart and hope--and yet to work.
What lesson could I draw from all my own woes--
Ingratitude, oppression, widowhood--
While I could hug myself in vain conceits
Of self-contented sainthood--inward raptures--
Celestial palms--and let ambition's gorge
Taint heaven, as well as earth? Is selfishness
For time, a sin--spun out to eternity
Celestial prudence? Shame! Oh, thrust me forth,
Forth, Lord, from self, until I toil and die
No more for Heaven and bliss, but duty, Lord,
Duty to Thee, although my meed should be
The hell which I deserve!
[Sleeps.]
[Two women enter.]
1st Woman. What! snoring still? 'Tis nearly time to wake her
To do her penance.
2d Woman. Wait a while, for love:
Indeed, I am almost ashamed to punish
A bag of skin and bones.
1st Woman. 'Tis for her good:
She has had her share of pleasure in this life
With her gay husband; she must have her pain.
We bear it as a thing of course; we know
What mortifications are, although I say it
That should not.
2d Woman. Why, since my old tyrant died,
Fasting I've sought the Lord, like any Anna,
And never tasted fish, nor flesh, nor fowl,
And little stronger than water.
1st Woman. Plague on this watching!
What work, to make a saint of a fine lady!
See now, if she had been some labourer's daughter,
She might have saved herself, for aught he cared;
But now--
2d Woman. Hush! here the master comes:
I hear him.--
[Conrad enters.]
Con. My peace, most holy, wise, and watchful wardens!
She sleeps? Well, what complaints have you to bring
Since last we met? How? blowing up the fire?
Cold is the true saint's element--he thrives
Like Alpine gentians, where the frost is keenest--
For there Heaven's nearest--and the ether purest--
[Aside] And he most bitter.
2d Woman. Ah! sweet master,
We are not yet as perfect as yourself.
Con. But how has she behaved?
1st Woman. Just like herself--
Now ruffling up like any tourney queen;
Now weeping in dark corners; then next minute
Begging for penance on her knees.
2d Woman. One trick's cured;
That lust of giving; Isentrude and Guta,
The hussies, came here begging but yestreen,
Vowed they were starving.
Con. Did she give to them?
2d Woman. She told them that she dared not.
Con. Good. For them,
I will take measures that they shall not want:
But see you tell her not: she must be perfect.
1st Woman. Indeed, there's not much chance of that a while.
There's others, might be saints, if they were young,
And handsome, and had titles to their names,
If they were helped toward heaven, now--
Con. Silence, horse-skull!
Thank God, that you are allowed to use a finger
Towards building up His chosen tabernacle.
2d Woman. I consider that she blasphemes the means of grace.
Con. Eh? that's a point, indeed.
2d Woman. Why, yesterday,
Within the church, before a mighty crowd,
She mocked at all the lovely images,
And said 'the money had been better spent
On food and clothes, instead of paint and gilding:
They were but pictures, whose reality
We ought to bear within us.'
Con. Awful doctrine!
1st Woman. Look at her carelessness, again--the distaff
Or woolcomb in her hands, even on her bed.
Then, when the work is done, she lets those nuns
Cheat her of half the price.
2d Woman. The Aldenburgers.
Con. Well, well, what more misdoings?
[aside] Pah! I am sick on't.
[Aloud] Go sit, and pray by her until she wakes.
]The women retire. Conrad sits down by the fire.]
I am dwindling to a peddling chamber-chaplain,
Who hunts for crabs and ballads in maids' sleeves,
I, who have shuffled kingdoms. Oh! 'tis easy
To beget great deeds; but in the rearing of them--
The threading in cold blood each mean detail,
And furzebrake of half-pertinent circumstance--
There lies the self-denial.
Women [in a low voice]. Master! sir! look here!
Eliz. [rising]. Have mercy, mercy, Lord!
Con. What is it, my daughter? No--she answers not--
Her eyeballs through their sealed lids are bursting,
And yet she sleeps: her body does but mimic
The absent soul's enfranchised wanderings
In the spirit-world.
Eliz. Oh! she was but a worldling!
And think, good Lord, if that this world is hell,
What wonder if poor souls whose lot is fixed here,
Meshed down by custom, wealth, rank, pleasure, ignorance,
Do hellish things in it? Have mercy, Lord;
Even for my sake, and all my woes, have mercy!
Con. There! she is laid again--Some bedlam dream.
So--here I sit; am I a guardian angel
Watching by God's elect? or nightly tiger,
Who waits upon a dainty point of honour
To clutch his prey, till it shall wake and move?
We'll waive that question: there's eternity
To answer that in.
How like a marble-carven nun she lies
Who prays with folded palms upon her tomb,
Until the resurrection! Fair and holy!
O happy Lewis! Had I been a knight--
A man at all--What's this? I must be brutal,
Or I shall love her: and yet that's no safeguard;
I have marked it oft: ay--with that devilish triumph
Which eyes its victim's writhings, still will mingle
A sympathetic thrill of lust--say, pity.
Eliz. [awaking]. I am heard! She is saved!
Where am I? What! have I overslept myself?
Oh, do not beat me! I will tell you all--
I have had awful dreams of the other world.
1st Woman. Ay! ay! a fine excuse for lazy women,
Who cry nightmare with lying on their backs.
Eliz. I will be heard! I am a prophetess!
God hears me, why not ye?
Con. Quench not the Spirit:
If He have spoken, daughter, we must listen.
Eliz. Methought from out the red and heaving earth
My mother rose, whose broad and queenly limbs
A fiery arrow did impale, and round
Pursuing tongues oozed up of nether fire,
And fastened on her: like a winter-blast
Among the steeples, then she shrieked aloud,
'Pray for me, daughter; save me from this torment,
For thou canst save!' And then she told a tale;
It was not true--my mother was not such--
O God! The pander to a brother's sin!
1st Woman. There now? The truth is out! I told you, sister,
About that mother--
Con. Silence, hags! what then?
Eliz. She stretched her arms, and sank. Was it a sin
To love that sinful mother? There I lay--
And in the spirit far away I prayed;
What words I spoke, I know not, nor how long;
Until a small still voice sighed, 'Child, thou art heard:'
Then on the pitchy dark a small bright cloud
Shone out, and swelled, and neared, and grew to form,
Till from it blazed my pardoned mother's face
With nameless glory! Nearer still she pressed,
And bent her lips to mine--a mighty spasm
Ran crackling through my limbs, and thousand bells
Rang in my dizzy ears--And so I woke.
Con. 'Twas but a dream.
Eliz. 'Twas more! 'twas more! I've tests:
From youth I have lived in two alternate worlds,
And night is live like day. This was no goblin!
'Twas a true vision, and my mother's soul
Is freed by my poor prayers from penal files,
And waits for me in bliss.
Con. Well--be it so then.
Thou seest herein what prize obedience merits.
Now to press forwards: I require your presence
Within the square, at noon, to witness there
The fiery doom--most just and righteous doom--
Of two convicted and malignant heretics,
Who at the stake shall expiate their crime,
And pacify God's wrath against this land.
Eliz. No! no! I will not go!
Con. What's here? Thou wilt not?
I'll drive thee there with blows.
Eliz. Then I will bear them,
Even as I bore the last, with thankful thoughts
Upon those stripes my Lord endured for me.
Oh, spare them, sir! poor blindfold sons of men!
No saint but daily errs,--and must they burn,
Ah, God! for an opinion?
Con. Fool! opinions?
Who cares for their opinions? 'Tis rebellion
Against the system which upholds the world
For which they die: so, lest the infection spread,
We must cut off the members, whose disease
We'd pardon, could they keep it to themselves.
[Elizabeth weeps.]
Well, I'll not urge it,--Thou hast other work--
But for thy petulant words do thou this penance:
I do forbid thee here, to give henceforth
Food, coin, or clothes, to any living soul.
Thy thriftless waste doth scandalise the elect,
And maim thine usefulness: thou dost elude
My wise restrictions still: 'Tis great, to live
Poor, among riches; when thy wealth is spent,
Want is not merit, but necessity.
Eliz. Oh, let me give!
That only pleasure have I left on earth!
Con. And for that very cause thou must forego it,
And so be perfect. She who lives in pleasure
Is dead, while yet she lives; grace brings no merit
When 'tis the express of our own self-will.
To shrink from what we practise; do God's work
In spite of loathings; that's the path of saints.
I have said. [Exit with the women.]
Eliz. Well! I am freezing fast--I have grown of late
Too weak to nurse my sick; and now this outlet,
This one last thawing spring of fellow-feeling,
Is choked with ice--Come, Lord, and set me free.
Think me not hasty! measure not mine age,
O Lord, by these my four-and-twenty winters.
I have lived three lives--three lives.
For fourteen years I was an idiot girl:
Then I was born again; and for five years,
I lived! I lived! and then I died once more;--
One day when many knights came marching by,
And stole away--we'll talk no more of that.
And so these four years since, I have been dead,
And all my life is hid with Christ in God.
Nunc igitur dimittas, Domine, servam tuam.
SCENE IV
The same. Elizabeth lying on straw in a corner. A crowd of women
round her. Conrad entering.
Con. As I expected--
A sermon-mongering herd about her death-bed,
Stifling her with fusty sighs, as flocks of rooks
Despatch, with pious pecks, a wounded brother.
Cant, howl, and whimper! Not an old fool in the town
Who thinks herself religious, but must see
The last of the show and mob the deer to death.
[Advancing] Hail! holy ones! How fares your charge to-day?
Abbess. After the blessed sacrament received,
As surfeited with those celestial viands,
And with the blood of life intoxicate,
She lay entranced: and only stirred at times
To eructate sweet edifying doctrine
Culled from your darling sermons.
Woman. Heavenly grace
Imbues her so throughout, that even when pricked
She feels no pain.
Con. A miracle, no doubt.
Heaven's work is ripe, and like some more I know,
Having begun in the spirit, in the flesh
She's now made perfect: she hath had warnings, too,
Of her decease; and prophesied to me,
Three weeks ago, when I lay like to die,
That I should see her in her coffin yet.
Abbess. 'Tis said, she heard in dreams her Saviour call her
To mansions built for her from everlasting.
Con. Ay, so she said.
Abbess. But tell me, in her confession
Was there no holy shame--no self-abhorrence
For the vile pleasures of her carnal wedlock?
Con. She said no word thereon: as for her shrift,
No Chrisom child could show a chart of thoughts
More spotless than were hers.
Nun. Strange, she said nought;
I had hoped she had grown more pure.
Con. When, next, I asked her,
How she would be interred; 'In the vilest weeds,'
Quoth she, 'my poor hut holds; I will not pamper
When dead, that flesh, which living I despised.
And for my wealth, see it to the last doit
Bestowed upon the poor of Christ.'
2d Woman. O grace!
3d Woman. O soul to this world poor, but rich toward God!
Eliz. [awaking]. Hark! how they cry for bread!
Poor souls! be patient!
I have spent all--
I'll sell myself for a slave--feed them with the price.
Come, Guta! Nurse! We must be up and doing!
Alas! they are gone, and begging!
Go! go! They'll beat me, if I give you aught:
I'll pray for you, and so you'll go to Heaven.
I am a saint--God grants me all I ask.
But I must love no creature. Why, Christ loved--
Mary he loved, and Martha, and their brother--
Three friends! and I have none!
When Lazarus lay dead, He groaned in spirit,
And wept--like any widow--Jesus wept!
I'll weep, weep, weep! pray for that 'gift of tears.'
They took my friends away, but not my eyes,
Oh, husband, babes, friends, nurse! To die alone!
Crack, frozen brain! Melt, icicle within!
Women. Alas! sweet saint! By bitter pangs she wins
Her crown of endless glory!
Con. But she wins it!
Stop that vile sobbing! she's unmanned enough
Without your maudlin sympathy.
Eliz. What? weeping?
Daughters of Jerusalem, weep not for me--
Weep for yourselves.
Women. We do, alas! we do!
What are we without you? [A pause.]
Woman. Oh, listen, listen!
What sweet sounds from her fast-closed lips are welling,
As from the caverned shaft, deep miners' songs?
Eliz. [in a low voice]. Through the stifling room
Floats strange perfume;
Through the crumbling thatch
The angels watch,
Over the rotting roof-tree.
They warble, and flutter, and hover, and glide,
Wafting old sounds to my dreary bedside,
Snatches of songs which I used to know
When I slept by my nurse, and the swallows
Called me at day-dawn from under the eaves.
Hark to them! Hark to them now--
Fluting like woodlarks, tender and low--
Cool rustling leaves--tinkling waters--
Sheepbells over the lea--
In their silver plumes Eden-gales whisper--
In their hands Eden-lilies--not for me--not for me--
No crown for the poor fond bride!
The song told me so,
Long, long ago,
How the maid chose the white lily;
But the bride she chose
The red red rose,
And by its thorn died she.
Well--in my Father's house are many mansions--
I have trodden the waste howling ocean-foam,
Till I stand upon Canaan's shore,
Where Crusaders from Zion's towers call me home,
To the saints who are gone before.
Con. Still on Crusaders? [Aside.]
Abbess. What was that sweet song, which just now, my Princess,
You murmured to yourself?
Eliz. Did you not hear
A little bird between me and the wall,
That sang and sang?
Abbess. We heard him not, fair Saint.
Eliz. I heard him, and his merry carol revelled
Through all my brain, and woke my parched throat
To join his song: then angel melodies
Burst through the dull dark, and the mad air quivered
Unutterable music. Nay, you heard him.
Abbess. Nought save yourself.
Eliz. Slow hours! Was that the cock-crow?
Woman. St. Peter's bird did call.
Eliz. Then I must up--
To matins, and to work--No, my work's over.
And what is it, what?
One drop of oil on the salt seething ocean!
Thank God, that one was born at this same hour,
Who did our work for us: we'll talk of Him:
We shall go mad with thinking of ourselves--
We'll talk of Him, and of that new-made star,
Which, as he stooped into the Virgin's side,
From off His finger, like a signet-gem,
He dropped in the empyrean for a sign.
But the first tear He shed at this His birth-hour,
When He crept weeping forth to see our woe,
Fled up to Heaven in mist, and hid for ever
Our sins, our works, and that same new-made star.
Woman. Poor soul! she wanders!
Con. Wanders, fool? her madness
Is worth a million of your paters, mumbled
At every station between--
Eliz. Oh! thank God
Our eyes are dim! What should we do, if he,
The sneering fiend, who laughs at all our toil,
Should meet us face to face?
Con. We'd call him fool.
Eliz. There! There! Fly, Satan, fly! 'Tis gone!
Con. The victory's gained at last!
The fiend is baffled, and her saintship sure!
O people blest of Heaven!
Eliz. O master, master,
You will not let the mob, when I lie dead,
Make me a show--paw over all my limbs--
Pull out my hair--pluck off my finger-nails--
Wear scraps of me for charms and amulets,
As if I were a mummy, or a drug?
As they have done to others--I have seen it--
Nor set me up in ugly naked pictures
In every church, that cold world-hardened wits
May gossip o'er my secret tortures? Promise--
Swear to me! I demand it!
Con. No man lights
A candle, to be hid beneath a bushel:
Thy virtues are the Church's dower: endure
All which the edification of the faithful
Makes needful to be published.
Eliz. O my God!
I had stripped myself of all, but modesty!
Dost Thou claim yet that victim? Be it so.
Now take me home! I have no more to give Thee!
So weak--and yet no pain--why, now naught ails me!
How dim the lights burn! Here--
Where are you, children?
Alas! I had forgotten.
Now I must sleep--for ere the sun shall rise,
I must begone upon a long, long journey
To him I love.
Con. She means her heavenly Bridegroom--
The Spouse of souls.
Eliz. I said, to him I love.
Let me sleep, sleep.
You will not need to wake me--so--good-night.
[Folds herself into an attitude of repose. The scene closes.]
ACT V
SCENE I. A.D. 1235.
A Convent at Marpurg. Cloisters of the infirmary. Two aged monks
sitting.
1st Monk. So they will publish to-day the Landgravine's
canonisation, and translate her to the new church prepared for her.
Alack, now, that all the world should be out sight-seeing and saint-
making, and we laid up here, like two lame jackdaws in a belfry!
2d Monk. Let be, man--let be. We have seen sights and saints in
our time. And, truly, this insolatio suits my old bones better than
processioning.
1st Monk. 'Tis pleasant enough in the sun, were it not for the
flies. Look--there's a lizard. Come you here, little run-about;
here's game for you.
2d Monk. A tame fool, and a gay one--Munditiae mundanis.
1st Monk. Catch him a fat fly--my hand shaketh.
2d Monk. If one of your new-lights were here, now, he'd pluck him
for a fiend, as Dominic did the live sparrow in chapel.
1st Monk. There will be precious offerings made to-day, of which
our house will get its share.
2d Monk. Not we; she always favoured the Franciscans most.
1st Monk. 'Twas but fair--they were her kith and kin.
She lately put on the habit of their third minors.
2d Monk. So have half the fine gentlemen and ladies in Europe.
There's one of your new inventions, now, for letting grand folks
serve God and mammon at once, and emptying honest monasteries, where
men give up all for the Gospel's sake. And now these Pharisees of
Franciscans will go off with full pockets--
1st Monk. While we poor publicans--
2d Monk. Shall not come home all of us justified, I think.
1st Monk. How? Is there scandal among us?
2d Monk. Ask not--ask not. Even a fool, when he holds his peace,
is counted wise. Of all sins, avoid that same gossiping.
1st Monk. Nay, tell me now. Are we not like David and Jonathan?
Have we not worked together, prayed together, journeyed together,
and been soundly flogged together, more by token, any time this
forty years? And now is news so plenty, that thou darest to defraud
me of a morsel?
2d Monk. I'll tell thee--but be secret. I knew a man hard by the
convent [names are dangerous, and a bird of the air shall carry the
matter], one that hath a mighty eye for a heretic, if thou knowest
him.
1st Monk. Who carries his poll screwed on over-tight, and sits with
his eyes shut in chapel?
2d Monk. The same. Such a one to be in evil savour--to have the
splendour of the pontifical countenance turned from him, as though
he had taken Christians for Amalekites, and slain the people of the
Lord.
1st Monk. How now?
2d Monk. I only speak as I hear: for my sister's son is chaplain,
for the time being, to a certain Archisacerdos, a foreigner, now
lodging where thou knowest. The young mail being hid, after some
knavery, behind the arras, in come our quidam and that prelate. The
quidam, surly and Saxon--the guest, smooth and Italian; his words
softer than butter, yet very swords: that this quidam had 'exceeded
the bounds of his commission--launched out into wanton and lawless
cruelty--burnt noble ladies unheard, of whose innocence the Holy See
had proof--defiled the Catholic faith in the eyes of the weaker
sort--and alienated the minds of many nobles and gentlemen'--and
finally, that he who thinketh he standeth, were wise to take heed
lest he fall.
1st Monk. And what said Conrad?
2d Monk. Out upon a man that cannot keep his lips! Who spake of
Conrad? That quidam, however, answered nought, but--how 'to his own
master he stood or fell'--how 'he laboured not for the Pope but for
the Papacy'; and so forth.
1st Monk. Here is awful doctrine! Behold the fruit of your
reformers! This comes of their realised ideas, and centralisations,
and organisations, till a monk cannot wink in chapel without being
blinded with the lantern, or fall sick on Fridays, for fear of the
rod. Have I not testified? Have I not foretold?
2d Monk. Thou hast indeed. Thou knowest that the old paths are
best, and livest in most pious abhorrence of all amendment.
1st Monk. Do you hear that shout? There is the procession
returning from the tomb.
2d Monk. Hark to the tramp of the horse-hoofs! A gallant show,
I'll warrant!
1st Monk. Time was, now, when we were young bloods together in the
world, such a roll as that would have set our hearts beating against
their cages!
2d Monk. Ay, ay. We have seen sport in our day; we have paraded
and curvetted, eh? and heard scabbards jingle? We know the sly
touch of the heel, that set him on his hind legs before the right
window. Vanitas vanitatum--omnia vanitas! Here comes Gerard,
Conrad's chaplain, with our dinner.
[Gerard enters across the court.]
1st Monk. A kindly youth and a godly, but--reformation-bitten, like
the rest.
2d Monk. Never care. Boys must take the reigning madness in
religion, as they do the measles--once for all.
1st Monk. Once too often for him. His face is too, too like Abel's
in the chapel-window. Ut sis vitalis metuo, puer!
Ger. Hail, fathers. I have asked permission of the prior to
minister your refection, and bring you thereby the first news of the
pageant.
1st Monk. Blessings on thee for a good boy. Give us the trenchers,
and open thy mouth while we open ours.
2d Monk. Most splendid all, no doubt?
Ger. A garden, sir,
Wherein all rainbowed flowers were heaped together;
A sea of silk and gold, of blazoned banners,
And chargers housed; such glorious press, be sure,
Thuringen-land ne'er saw.
2d Monk. Just hear the boy!
Who rode beside the bier?
Ger. Frederic the Kaiser,
Henry the Landgrave, brother of her husband;
The Princesses, too, Agnes, and her mother;
And every noble name, sir, at whose war-cry
The Saxon heart leaps up; with them the prelates
Of Treves, of Coln, and Maintz--why name them all?
When all were there, whom this our fatherland
Counts worthy of its love.
1st Monk. 'Twas but her right.
Who spoke the oration?
Ger. Who but Conrad?
2d Monk. Well--
That's honour to our house.
1st Monk. Come, tell us all.
2d Monk. In order, boy: thou hast a ready tongue.
Ger. He raised from off her face the pall, and 'Lo!'
He cried, 'that saintly flesh which ye of late
With sacrilegious hands, ere yet entombed,
Had in your superstitious selfishness
Almost torn piecemeal. Fools! Gross-hearted fools!
These limbs are God's, not yours: in life for you
They spent themselves; now till the judgment-day
By virtue of the Spirit embalmed they lie--
Touch them who dare. No! Would you find your Saint,
Look up, not down, where even now she prays
Beyond that blazing orb for you and me.
Why hither bring her corpse? Why hide her clay
In jewelled ark beneath God's mercy-seat--
A speck of dust among these boundless aisles,
Uprushing pillars, star-bespangled roofs,
Whose colours mimic Heaven's unmeasured blue,
Save to remind you, how she is not here,
But risen with Him that rose, and by His blaze
Absorbed, lives in the God for whom she died?
Know her no more according to the flesh;
Or only so, to brand upon your thoughts
How she was once a woman--flesh and blood,
Like you--yet how unlike! Hark while I tell ye.'
2d Monk. How liked the mob all this? They hate him sore.
Ger. Half awed, half sullen, till his golden lips
Entranced all ears with tales so sad and strange,
They seemed one life-long miracle: bliss and woe,
Honour and shame--her daring--Heaven's stern guidance,
Did each the other so outblaze.
1st Monk. Great signs
Did wait on her from youth.
2d Monk. There went a tale
Of one, a Zingar wizard, who, on her birthnight,
He here in Eisenach, she in Presburg lying,
Declared her natal moment, and the glory
Which should befall her by the grace of God.
Ger. He spoke of that, and many a wonder more,
Melting all hearts to worship--how a robe
Which from her shoulders, at a royal feast,
To some importunate as alms she sent,
By miracle within her bower was hung again:
And how on her own couch the Incarnate Son
In likeness of a leprous serf, she laid:
And many a wondrous tale till now unheard;
Which, from her handmaid's oath and attestation,
Siegfried of Maintz to far Perugia sent,
And sainted Umbria's labyrinthine hills,
Even to the holy Council, where the Patriarchs
Of Antioch and Jerusalem, and with them
A host of prelates, magnates, knights, and nobles,
Decreed and canonised her sainthood's palm.
1st Monk. Mass, they could do no less.
Ger. So thought my master--
For 'Thus,' quoth he, 'the primates of the Faith
Have, in the bull which late was read to you,
Most wisely ratified the will of God
Revealed in her life's splendour; for the next count--
These miracles wherewith since death she shines--
Since ye must have your signs, ere ye believe,
And since without such tests the Roman Father
Allows no saints to take their seats in heaven,
Why, there ye have them; not a friar, I find,
Or old wife in the streets, but counts some dozens
Of blind, deaf, halt, dumb, palsied, and hysterical,
Made whole at this her tomb. A corpse or two
Was raised, they say, last week: Will that content you?
Will that content her? Earthworms! Would ye please the dead,
Bring sinful souls, not limping carcases
To test her power on; which of you hath done that?
Has any glutton learnt from her to fast?
Or oily burgher dealt away his pelf?
Has any painted Jezebel in sackcloth
Repented of her vanities? Your patron?
Think ye, that spell and flame of intercession,
Melting God's iron will, which for your sakes
She purchased by long agonies, was but meant
To save your doctors' bills? If any soul
Hath been by her made holier, let it speak!'
2d Monk. Well spoken, Legate! Easier asked than answered.
Ger. Not so, for on the moment, from the crowd
Sprang out a gay and gallant gentleman
Well known in fight and tourney, and aloud
With sobs and blushes told, how he long time
Had wallowed deep in mire of fleshly sin,
And loathed, and fell again, and loathed in vain;
Until the story of her saintly grace
Drew him unto her tomb; there long prostrate
With bitter cries he sought her, till at length
The image of her perfect loveliness
Transfigured all his soul, and from his knees
He rose new-born, and, since that blessed day,
In chastest chivalry, a spotless knight,
Maintains the widow's and the orphan's cause.
1st Monk. Well done! and what said Conrad?
Ger. Oh, he smiled,
As who should say, ''Twas but the news I looked for.'
Then, pointing to the banners borne on high,
Where the sad story of her nightly penance
Was all too truly painted--'Look!' he cried,
''Twas thus she schooled her soft and shuddering flesh
To dare and suffer for you!' Gay ladies sighed,
And stern knights wept, and growled, and wept again.
And then he told her alms, her mighty labours,
Among God's poor, the schools wherein she taught;
The babes she brought to the font, the hospitals
Founded from her own penury, where she tended
The leper and the fever-stricken serf
With meanest office; how a dying slave
Who craved in vain for milk she stooped to feed
From her own bosom. At that crowning tale
Of utter love, the dullest hearts caught fire
Contagious from his lips--the Spirit's breath
Low to the earth, like dewy-laden corn,
Bowed the ripe harvest of that mighty host;
Knees bent, all heads were bare; rich dames aloud
Bewailed their cushioned sloth; old foes held out
Long parted hands; low murmured vows and prayers
Gained courage, till a shout proclaimed her saint,
And jubilant thunders shook the ringing air,
Till birds dropped stunned, and passing clouds bewept
With crystal drops, like sympathising angels,
Those wasted limbs, whose sainted ivory round
Shed Eden-odours: from his royal head
The Kaiser took his crown, and on the bier
Laid the rich offering; dames tore off their jewels--
Proud nobles heaped with gold and gems her corse
Whom living they despised: I saw no more--
Mine eyes were blinded with a radiant mist--
And I ran here to tell you.
1st Monk. Oh, fair olive,
Rich with the Spirit's unction, how thy boughs
Rain balsams on us!
2d Monk. Thou didst sell thine all--
And bought'st the priceless pearl!
1st Monk. Thou holocaust of Abel,
By Cain in vain despised!
2d Monk. Thou angels' playmate
Of yore, but now their judge!
Ger. Thou alabaster,
Broken at last, to fill the house of God
With rich celestial fragrance!
[Etc. etc., ad libitum.]
SCENE II
A room in a convent at Mayence. Conrad alone.
Con. The work is done! Diva Elizabeth!
And I have trained one saint before I die!
Yet now 'tis done, is't well done? On my lips
Is triumph: but what echo in my heart?
Alas! the inner voice is sad and dull,
Even at the crown and shout of victory.
Oh! I had hugged this purpose to my heart,
Cast by for it all ruth, all pride, all scruples;
Yet now its face, that seemed as pure as crystal,
Shows fleshly, foul, and stained with tears and gore!
We make, and moil, like children in their gardens,
And spoil with dabbled hands, our flowers i' the planting.
And yet a saint is made! Alas, those children!
Was there no gentler way? I know not any:
I plucked the gay moth from the spider's web;
What if my hasty hand have smirched its feathers?
Sure, if the whole be good, each several part
May for its private blots forgiveness gain,
As in man's tabernacle, vile elements
Unite to one fair stature. Who'll gainsay it?
The whole is good; another saint in heaven;
Another bride within the Bridegroom's arms;
And she will pray for me!--And yet what matter?
Better that I, this paltry sinful unit,
Fall fighting, crushed into the nether pit,
If my dead corpse may bridge the path to Heaven,
And damn itself, to save the souls of others.
A noble ruin: yet small comfort in it;
In it, or in aught else----
A blank dim cloud before mine inward sense
Dulls all the past: she spoke of such a cloud--
I struck her for't, and said it was a fiend--
She's happy now, before the throne of God--
I should be merry; yet my heart's floor sinks
As on a fast day; sure some evil bodes.
Would it were here, that I might see its eyes!
The future only is unbearable!
We quail before the rising thunderstorm
Which thrills and whispers in the stifled air,
Yet blench not, when it falls. Would it were here!
[Pause.]
I fain would sleep, yet dare not: all the air
Throngs thick upon me with the pregnant terror
Of life unseen, yet near. I dare not meet them,
As if I sleep I shall do--I again?
What matter what I feel, or like, or fear?
Come what God sends. Within there--Brother Gerard!
[Gerard enters.]
Watch here an hour, and pray.--The fiends are busy.
So--hold my hand. [Crosses himself.] Come on, I fear you not.
[Sleeps.]
[Gerard sings.]
Qui fugiens rnundi gravia
Contempsit carnis bravia,
Cupidinisque somnia,
Lucratur, perdens, omnia.
Hunc gestant ulnis angeli,
Ne lapis officiat pedi;
Ne luce timor occupet,
Aut nocte pestis incubet.
Huic coeli lilia germinant;
Arrisus sponsi permanent;
Ac nomen in fidelibus
Quam filiorum medius. [Sleeps.]
. . . . .
Conrad [awaking]. Stay! Spirits, stay! Art thou a hell-born
phantasm,
Or word too true, sent by the mother of God?
Oh, tell me, queen of Heaven!
O God! if she, the city of the Lord,
Who is the heart, the brain, the ruling soul
Of half the earth; wherein all kingdoms, laws,
Authority, and faith do culminate,
And draw from her their sanction and their use;
The lighthouse founded on the rock of ages,
Whereto the Gentiles look, and still are healed;
The tree whose rootlets drink of every river,
Whose boughs drop Eden fruits on seaward isles;
Christ's seamless coat, rainbowed with gems and hues
Of all degrees and uses, rend, and tarnish,
And crumble into dust!
Vanitas vanitatum, omnia vanitas!
Oh! to have prayed, and toiled--and lied--for this!
For this to have crushed out the heart of youth,
And sat by calm, while living bodies burned!
How! Gerard; sleeping!
Couldst thou not watch with me one hour, my son?
Ger. [awaking]. How! have I slept? Shame on my vaporous brain!
And yet there crept along my hand from thine
A leaden languor, and the drowsy air
Teemed thick with humming wings--I slept perforce.
Forgive me (while for breach of holy rule
Due penance shall seem honour) my neglect.
Con. I should have beat thee for't, an hour agone--
Now I judge no man. What are rules and methods?
I have seen things which make my brain-sphere reel:
My magic teraph-bust, full-packed, and labelled,
With saws, ideas, dogmas, ends, and theories,
Lies shivered into dust. Pah! we do squint
Each through his loophole, and then dream, broad heaven
Is but the patch we see. But let none know;
Be silent, Gerard, wary.
Ger. Nay--I know nought
Of that which moves thee: though I fain would ask--
Con. I saw our mighty Mother, Holy Church,
Sit like a painted harlot: round her limbs
An oily snake had coiled, who smiled, and smiled,
And lisped the name of Jesus--I'll not tell thee:
I have seen more than man can see, and live:
God, when He grants the tree of knowledge, bans
The luckless seer from off the tree of life,
Lest he become as gods, and burst with pride;
Or sick at sight of his own nothingness,
Lie down, and be a fiend: my time is near:
Well--I have neither child, nor kin, nor friend,
Save thee, my son; I shall go lightly forth.
Thou knowest we start for Marpurg on the morrow?
Thou wilt go with me?
Ger. Ay, to death, my master;
Yet boorish heretics, with grounded throats,
Mutter like sullen bulls; the Count of Saym,
And many gentlemen, they say, have sworn
A fearful oath: there's danger in the wind.
Con. They have their quarrel; I was keen and hasty:
Gladio qui utitur, peribit gladio.
When Heaven is strong, then Hell is strong: Thou fear'st not?
Ger. No! though their name were legion! 'Tis for thee
Alone I quake, lest by some pious boldness
Thou quench the light of Israel.
Con. Light? my son!
There shall no light be quenched, when I lie dark.
Our path trends outward: we will forth to-morrow.
Now let's to chapel; matin bells are ringing. [Exeunt.]
SCENE III
A road between Eisenach and Marpurg. Peasants waiting by the
roadside. Walter of Varila, the Count of Saym, and other gentlemen
entering on horseback.
Gent. Talk not of honour--Hell's aflame within me:
Foul water quenches fire as well as fair;
If I do meet him he shall die the death,
Come fair, come foul: I tell you, there are wrongs
The fumbling piecemeal law can never touch,
Which bring of themselves to the injured, right divine,
Straight from the fount of right, above all parchments,
To be their own avengers: dainty lawyers,
If one shall slay the adulterer in the act,
Dare not condemn him: girls have stabbed their tyrants,
And common sense has crowned them saints; yet what--
What were their wrongs to mine? All gone! All gone!
My noble boys, whom I had trained, poor fools,
To win their spurs, and ride afield with me!
I could have spared them--but my wife! my lady!
Those dainty limbs, which no eyes but mine--
Before that ruffian mob--Too much for man!
Too much, stern Heaven!--Those eyes, those hands,
Those tender feet, where I have lain and worshipped--
Food for fierce flames! And on the self-same day--
The day that they were seized--unheard--unargued--
No witness, but one vile convicted thief--
The dog is dead and buried: Well done, henchmen!
They are not buried! Pah! their ashes flit
About the common air; we pass them--breathe them!
The self-same day! If I had had one look!
One word--one single tiny spark of word,
Such as two swallows change upon the wing!
She was no heretic: she knelt for ever
Before the blessed rood, and prayed for me.
Art sure he comes this road?
C. Saym. My messenger
Saw him start forth, and watched him past the crossways.
An hour will bring him here.
C. Wal. How! ambuscading?
I'll not sit by, while helpless priests are butchered.
Shame, gentles!
C. Saym. On my word, I knew not on't
Until this hour; my quarrel's not so sharp,
But I may let him pass: my name is righted
Before the Emperor, from all his slanders;
And what's revenge to me?
Gent. Ay, ay--forgive and forget--
The vermin's trapped--and we'll be gentle-handed,
And lift him out, and bid his master speed him,
Him and his firebrands. He shall never pass me.
C. Wal. I will not see it; I'm old, and sick of blood.
She loved him, while she lived; and charged me once,
As her sworn liegeman, not to harm the knave.
I'll home: yet, knights, if aught untoward happen,
And you should need a shelter, come to me:
My walls are strong. Home, knaves! we'll seek our wives,
And beat our swords to ploughshares--when folks let us.
[Exeunt Count Walter and suite.]
C. Saym. He's gone, brave heart!--But--sir, you will not dare?
The Pope's own Legate--think--there's danger in't.
Gent. Look, how athwart yon sullen sleeping flats
That frowning thunder-cloud sails pregnant hither;--
And black against its sheeted gray, one bird
Flags fearful onward--'Tis his cursed soul!
Now thou shalt quake, raven!--The self-same day!--
He cannot 'scape! The storm is close upon him!
There! There! the wreathing spouts have swallowed him!
He's gone! and see, the keen blue spark leaps out
From crag to crag, and every vaporous pillar
Shouts forth his death-doom! 'Tis a sign, a sign!
[A heretic preacher mounts a stone. Peasants gather round him.]
These are the starved unlettered hinds, forsooth,
He hunted down like vermin--for a doctrine.
They have their rights, their wrongs; their lawless laws,
Their witless arguings, which unconscious reason
Informs to just conclusions. We will hear them.
Preacher. My brethren, I have a message to you: therefore hearken
with all your ears--for now is the day of salvation. It is written,
that the children of this world are in their generation wiser than
the children of light--and truly: for the children of this world,
when they are troubled with vermin, catch them--and hear no more of
them. But you, the children of light, the elect saints, the poor of
this world rich in faith, let the vermin eat your lives out, and
then fall down and worship them afterwards. You are all besotted--
hag-ridden--drunkards sitting in the stocks, and bowing down to the
said stocks, and making a god thereof. Of part, said the prophet,
ye make a god, and part serveth to roast--to roast the flesh of your
sons and of your daughters; and then ye cry, 'Aha, I am warm, I have
seen the fire;' and a special fire ye have seen! The ashes of your
wives and of your brothers cleave to your clothes,--Cast them up to
Heaven, cry aloud, and quit yourselves like men!
Gent. He speaks God's truth! We are Heaven's justicers! Our woes
anoint us kings! Peace--Hark again!--
Preacher. Therefore, as said before--in the next place--It is
written, that there shall be a two-edged sword in the hand of the
saints. But the saints have but two swords--Was there a sword or
shield found among ten thousand in Israel? Then let Israel use his
fists, say I, the preacher! For this man hath shed blood, and by
man shall his blood be shed. Now behold an argument,--This man hath
shed blood, even Conrad; ergo, as he saith himself, ye, if ye are
men, shall shed his blood. Doth he not himself say ergo? Hath he
not said ergo to the poor saints, to your sons and your daughters,
whom he hath burned in the fire to Moloch? 'Ergo, thou art a
heretic'--'Ergo, thou shalt burn.' Is he not therefore convicted
out of his own mouth? Arise, therefore, be valiant--for this day he
is delivered into your hand!
[Chanting heard in the distance.]
Peasant. Hush! here the psalm-singers come!
[Conrad enters on a mule, chanting the Psalter, Gerard following.]
Con. My peace with you, my children!
1st Voice. Psalm us no psalms; bless us no devil's blessings:
Your balms will break our heads. [A murmur rises.]
2d Voice. You are welcome, sir; we are a-waiting for you.
3d Voice. Has he been shriven to-day?
4th Voice. Where is your ergo, Master Conrad? Faugh!
How both the fellows smell of smoke!
5th Voice. A strange leech he, to suck, and suck, and suck,
And look no fatter for't!
Old Woman. Give me back my sons!
Old Man. Give me back the light of mine eyes,
Mine only daughter!
My only one! He hurled her over the cliffs!
Avenge me, lads; you are young!
4th Voice. We will, we will: why smit'st him not, thou with the
pole-axe?
3d Voice. Nay, now, the first blow costs most, and heals last;
Besides, the dog's a priest at worst.
C. Saym. Mass! How the shaveling rascal stands at bay!
There's not a rogue of them dare face his eye!
True Domini canes! 'Ware the bloodhound's teeth, curs!
Preacher. What! Are ye afraid? The huntsman's here at last
Without his whip! Down with him, craven hounds!
I'll help ye to't. [Springs from the stone.]
Gent. Ay, down with him! Mass, have these yelping boors
More heart than I? [Spurs his horse forward.]
Mob. A knight! a champion!
Voice. He's not mortal man!
See how his eyes shine! 'Tis the archangel!
St. Michael come to the rescue! Ho! St. Michael!
[He lunges at Conrad. Gerard turns the lance aside, and throws his
arms round Conrad.]
Ger. My master! my master! The chariot of Israel and the horses
thereof!
Oh call down fire from Heaven!
[A peasant strikes down Gerard. Conrad, over the body.]
Alas! my son! This blood shall cry for vengeance
Before the throne of God!
Gent. And cry in vain!
Follow thy minion! Join Folquet in hell!
[Bears Conrad down on his lance-point.]
Con. I am the vicar of the Vicar of Christ:
Who touches me doth touch the Son of God.
[The mob close over him.]
O God! A martyr's crown! Elizabeth! [Dies.]
NOTES TO ACT 1
The references, unless it be otherwise specified, are to the Eight
Books concerning Saint Elizabeth, by Dietrich the Thuringian; in
Basnage's Canisius, Vol. IV. p. 113 (Antwerp; 1725).
Page 21. Cf. Lib. I. section 3. Dietrich is eloquent about her
youthful inclination for holy places, and church doors, even when
shut, and gives many real proofs of her 'sanctae indolis,' from the
very cradle.
P. 22. 'St. John's sworn maid.' Cf. Lib. I. section 4. 'She chose
by lot for her patron, St. John the protector of virginity.'
Ibid. 'Fit for my princess.' Cf. Lib. I. section 2. 'He sent with
his daughter vessels of gold, silver baths, jewels, _pillows all of
silk_. No such things, so precious or so many, were ever seen in
Thuringen-land.'
P. 23. 'Most friendless.' Cf. Lib. I. sections 5, 6. 'The
courtiers used bitterly to insult her, etc. Her mother and sister-
in-law, given to worldly pomp, differed from her exceedingly;' and
much more concerning 'the persecutions which she endured patiently
in youth.'
Ibid. 'In one cradle.' Cf. Lib. I. section 2. 'The princess was
laid in the cradle of her boy-spouse,' and, says another, 'the
infants embraced with smiles, from whence the bystanders drew a
joyful omen of their future happiness.'
Ibid. 'If thou love him.' Cf. Lib. I. section 6. 'The Lord by His
hidden inspiration so inclined towards her the heart of the prince,
that in the solitude of secret and mutual love he used to speak
sweetly to her heart, with kindness and consolation, and was always
wont, on returning home, to honour her with presents, and soothe her
with embraces.' It was their custom, says Dietrich, to the last to
call each other in common conversation 'Brother' and 'Sister.'
P. 24. 'To his charge.' Cf. Lib. I. section 7. 'Walter of Varila,
a good man, who, having been sent by the prince's father into
Hungary, had brought the blessed Elizabeth into Thuringen-land.'
P. 25. 'The blind archer, Love.' For information about the pagan
orientalism of the Troubadours, the blasphemous bombast by which
they provoked their persecution in Provence, and their influence on
the Courts of Europe, see Sismondi, Lit. Southern Europe, Cap. III.-
VI.
P. 27. 'Stadings.' The Stadings, according to Fleury, in A.D.
1233, were certain unruly fenmen, who refused to pay tithes,
committed great cruelties on religious of both sexes, worshipped, or
were said to worship, a black cat, etc., considered the devil as a
very ill-used personage, and the rightful lord of themselves and the
world, and were of the most profligate morals. An impartial and
philosophic investigation of this and other early continental
heresies is much wanted.
P. 37. 'All gold.' Cf. Lib. I. section 7, for Walter's
interference and Lewis's answer, which I have paraphrased.
P. 38. 'Is crowned with thorns.' Cf. Lib. I. section 5, for this
anecdote and her defence, which I have in like manner paraphrased.
P. 39. 'Their pardon.' Cf. Lib. I section 3, for this quaint
method of self-humiliation.
Ibid. 'You know your place.' Cf. Lib. I. section 6. 'The vassals
and relations of her betrothed persecuted her openly, and plotted to
send her back to her father divorced. . . . Sophia also did all she
could to place her in a convent. . . . She delighted in the company
of maids and servants, so that Sophia used to say sneeringly to her,
"You should have been counted among the slaves who drudge, and not
among the princes who rule."'
P. 41. 'Childish laughter.' Cf. Lib. I. section 7. 'The holy
maiden, receiving the mirror, showed her joy by delighted laughter;'
and again, II. section 8, "They loved each other in the charity of
the Lord, to a degree beyond all belief.'
Ibid. 'A crystal clear.' Cf. Lib. I. section 7.
P. 43. 'Our fairest bride.' Cf. Lib. I. section 8. 'No one
henceforth dared oppose the marriage by word or plot, . . . and all
mouths were stopped.'
NOTES TO ACT II
Pp. 45-49. Cf. Lib. II. sections 1, 5, 11, et passim.
Hitherto my notes have been a careful selection of the few grains of
characteristic fact which I could find among Dietrich's lengthy
professional reflections; but the chapter on which this scene is
founded is remarkable enough to be given whole, and as I have a
long-standing friendship for the good old monk, who is full of
honest naivete and deep-hearted sympathy, and have no wish to
disgust _all_ my readers with him, I shall give it for the most part
untranslated. In the meantime those who may be shocked at certain
expressions in this poem, borrowed from the Romish devotional
school, may verify my language at the Romish booksellers, who find
just now a rapidly increasing sale for such ware. And is it not
after all a hopeful sign for the age that even the most questionable
literary tastes must nowadays ally themselves with religion--that
the hotbed imaginations which used to batten on Rousseau and Byron
have now risen at least as high as the Vies des Saints and St.
Francois de Sales' Philothea? The truth is, that in such a time as
this, in the dawn of an age of faith, whose future magnificence we
may surely prognosticate from the slowness and complexity of its
self-developing process, spiritual 'Werterism,' among other strange
prolusions, must have its place. The emotions and the imaginations
will assert their just right to be fed--by foul means if not by
fair; and even self-torture will have charms after the utter dryness
and life-in-death of mere ecclesiastical pedantry. It is good,
mournful though it be, that a few, even by gorging themselves with
poison, should indicate the rise of a spiritual hunger--if we do but
take their fate as a warning to provide wholesome food before the
new craving has extended itself to the many. It is good that
religion should have its Werterism, in order that hereafter
Werterism may have its religion. But to my quotations--wherein the
reader will judge how difficult it has been for me to satisfy at
once the delicacy of the English mind and that historic truth which
the highest art demands.
'Erat inter eos honorabile connubium, et thorus immaculatus, non in
ardore libidmis, sed in conjugalis sanctimoniae castitate. For the
holy maiden, as soon as she was married, began to macerate her flesh
with many watchings, rising every night to pray; her husband
sometimes sleeping, sometimes conniving at her, often begging her,
in compassion to her delicacy, not to afflict herself indiscreetly,
often supporting her with his hand when she prayed.' ('And,' says
another of her biographers, 'being taught by her to pray with her.')
'Great truly, was the devotion of this young girl, who, rising from
the bed of her carnal husband, sought Christ, whom she loved as the
_true husband of her soul_.
'Nor certainly was there less faith in the husband who did not
oppose such and so great a wife, but rather favoured her, and
tempered her fervour with over-kind prudence. Affected, therefore,
by the sweetness of this modest love, and mutual society, they could
not bear to be separated for any length of time or distance. The
lady, therefore, frequently followed her husband through rough
roads, and no small distances, and severe wind and weather, led
rather by emotions of sincerity than of carnality: _for the chaste
presence of a modest husband offered no obstacle to that devout
spouse in the way of praying, watching, or otherwise doing good_.'
Then follows the story of her nurse waking Lewis instead of her, and
Lewis's easy good-nature about this, as about every other event of
life. 'And so, after these unwearied watchings, it often happened
that, praying for an excessive length of time, she fell asleep on a
mat beside her husband's bed, and being reproved for it by her
maidens, answered: "Though I cannot always pray, yet I can do
violence to my own flesh by tearing myself in the meantime from my
couch."'
'Fugiebat oblectamenta carnalia, et ideo stratum molliorem, et viri
contubernium secretissimum, quantum licuit, declinavit. Quem
quamvis praecordialis amoris affectu deligeret, querulabatur tamen
dolens, quod virginalis decorem floris non meruit conservare.
Castigabat etiam plagis multis, et lacerabat diris verberibus carnem
puella innocens et pudica.
'In principio quidem diebus quadragesimae, sextisque feriis aliis
occultas solebat accipere disciplinas, laetam coram hominibus se
ostentrans. Post vero convalescens et proficiens in gratia, deserto
dilecti thoro surgens, fecit se in secreto cubiculo per ancillarum
manus graviter saepissime verberari, ad lectumque mariti reversa
hilarem se exhibuit et jocundam.
'Vere felices conjuges, in quorum consortio tanta munditia, in
colloquio pudicitia reperta est. In quibus amor Christi
concupiscentiam extinxit, devotio refrenavit petulantiam, fervor
spiritus excussit somnolentiam, oratio tutavit conscientiam,
charitas benefaciendi facultatem tribuit et laetitiam!'
P. 58. 'In every scruple.' Cf. Lib. III. section 9, how Lewis
'consented that Elizabeth his wife should make a vow of obedience
and continence at the will of the said Conrad, salva jure
matrimonii.'
P. 59. 'The open street.' Cf. Lib. II. section 11. 'On the
Rogation days, when certain persons doing contrary to the decrees of
the saints are decorated with precious and luxurious garments, the
Princess, dressed in serge and barefooted, used to follow most
devoutly the Procession of the Cross and the relics of the Saints,
and place herself always at sermon among the poorest women; knowing
(says Dietrich) that seeds cast into the valleys spring up into the
richest crop of corn.'
P. 60. 'The poor of Christ.' Cf. Lib. II. sections 6, 11, et
passim. Elizabeth's labours among the poor are too well known
throughout one half at least of Christendom, where she is, par
excellence, the patron of the poor, to need quotations.
P. 61. 'I'll be thy pupil.' Cf. Lib. II section 4. 'She used
also, by words and examples, to oblige the worldly ladies who came
to her to give up the vanity of the world, at least in some one
particular.'
P. 62. 'Conrad enters.' Cf. Lib. III. section 9, where this story
of the disobeyed message and the punishment inflicted by Conrad for
it is told word for word.
P. 66. 'Peaceably come by.' Cf. Lib. II. section 6.
P. 67. 'Bond-slaves.' Cf. Note 11.
P. 69. 'Elizabeth passes.' Cf. Lib. II. section 5. 'This most
Christian mother, impletis purgationis suae diebus, used to dress
herself in serge, and, taking in her arms her new-born child, used
to go forth secretly, barefooted, by the difficult descent from the
castle, by a rough and rocky road to a remote church, carrying her
infant in her own arms, after the example of the Virgin Mother, and
offering him upon the altar to the Lord with a taper' (and with
gold, says another biographer).
P. 71. 'Give us bread.' Cf. Lib. III. section 6. 'A.D. 1225,
while the Landgrave was gone to Italy to the Emperor, a severe
famine arose throughout all Almaine; and lasting for nearly two
years, destroyed many with hunger. Then Elizabeth, moved with
compassion for the miserable, collected all the corn from her
granaries, and distributed it as alms for the poor. She also built
a hospital at the foot of the Wartburg, wherein she placed all those
who could not wait for the general distribution. . . . She sold her
own ornaments to feed the members of Christ. . . . Cuidam misero
lac desideranti, ad mulgendum se praebuit!'--See p. 153.
P 80. 'Ladies' tenderness.' Cf. Lib. III. section 8. 'When the
courtiers and stewards complained on his return of the Lady
Elizabeth's too great extravagance in almsgiving, "Let her alone,"
quoth he, "to do good, and to give whatever she will for God's sake,
only keep Wartburg and Neuenberg in my hands."'
P. 87. 'A crusader's cross.' Cf. Lib. IV. section 1. 'In the year
1227 there was a general "Passagium" to the Holy Land, in which
Frederick the Emperor also crossed the seas' (or rather did _not_
cross the seas, says Heinrich Stero, in his annals, but having got
as far as Sicily, came back again--miserably disappointing and
breaking up the expedition, whereof the greater part died at the
various ports--and was excommunicated for so doing); 'and Lewis,
landgrave of the Thuringians, took the cross likewise in the name of
Jesus Christ, and . . . did not immediately fix the badge which he
had received to his garment, as the matter is, lest his wife, who
loved him with the most tender affection, seeing this, should be
anxious and disturbed, . . . but she found it while turning over his
purse, and fainted, struck down with a wonderful consternation.'
P. 90. 'I must be gone.' Cf. Lib. IV. section 2. A chapter in
which Dietrich rises into a truly noble and pathetic strain.
'Coming to Schmalcald,' he says, 'Lewis found his dearest friends,
whom he had ordered to meet him there, not wishing to depart without
taking leave of them.'
Then follows Dietrich's only poetic attempt, which Basnage calls a
'carmen ineptum, foolish ballad,' and most unfairly, as all readers
should say, if I had any hope of doing justice in a translation to
this genial fragment of an old dramatic ballad, and its simple
objectivity, as of a writer so impressed (like all true Teutonic
poets in those earnest days) with the pathos and greatness of his
subject that he never tries to 'improve' it by reflections and
preaching at his readers, but thinks it enough just to tell his
story, sure that it will speak for itself to all hearts:--
Quibus valefaciens cum moerore
Commisit suis fratribus natos cum uxore:
Matremque deosculatos filiali more,
Vix eam alloquitur cordis prae dolore,
Illis mota viscera, corda tremuerunt,
Dum alter in alterius colla irruerunt,
Expetentes oscula, quae vix receperunt
Propter multitudines, quae eos compresserunt.
Mater tenens filiuin, uxorque maritum,
In diversa pertrahunt, et tenent invitum,
Fratres cum militibus velut compeditum
Stringunt, nec discedere sinunt expeditum.
Erat in exercitu maximus tumultus,
Cum carorum cernerent alternari vultus.
Flebant omnes pariter, senex et adultus,
Turbae cum militibus, cultus et incultus.
Eja! Quis non plangeret, cum videret flentes
Tot honestos nobiles, tam diversas gentes,
Cum Thuringis Saxones illuc venientes,
Ut viderent socios suos abscedentes.
Amico luctamine cuncti certavere,
Quis eum diutius posset retinere;
uidam collo brachiis, quidam inhaesere
Vestibus, nec poterat cuiguam respondere,
Tandem se de manibus eximens suorum
Magnatorum socius et peregrinorum,
Admixtus tandem, caetui cruce signatorum
Non visurus amplius terram. Thuringorum!
Surely there is a heart of flesh in the old monk which, when warmed
by a really healthy subject, can toss aside Scripture parodies and
professional Stoic sentiment, and describe with such life and
pathos, like any eye-witness, a scene which occurred, in fact, two
years before his birth.
'And thus this Prince of Peace, 'he continues, 'mounting his horse
with many knights, etc. . . . about the end of the month of June,
set forth in the name of the Lord, praising him in heart and voice,
and weeping and singing were heard side by side. And close by
followed, with saddest heart, that most faithful lady after her
sweetest prince, her most loving spouse, never, alas! to behold him
more. And when she was going to return, the force of love and the
agony of separation forced her on with him one day's journey: and
yet that did not suffice. She went on, still unable to bear the
parting, another full day's journey. . . . At last they part, at the
exhortations of Rudolph the Cupbearer. What groans, think you, what
sobs, what struggles, and yearnings of the heart must there have
been? Yet they part, and go on their way. . . . The lord went
forth exulting, as a giant to run his course; the lady returned
lamenting, as a widow, and tears were on her cheeks. Then putting
off the garments of joy, she took the dress of widowhood. The
mistress of nations, sitting alone, she turned herself utterly to
God--to her former good works, adding better ones.'
Their children were 'Hermann, who became Landgraf; a daughter who
married the Duke of Brabant; another, who, remaining in virginity,
became a nun of Aldenburg, of which place she is Lady Abbess until
this day.'
NOTES TO ACT III.
P. 94. 'On the freezing stone.' Cf. Lib. II. section 5. 'In the
absence of her husband she used to lay aside her gay garments,
conducted herself devoutly as a widow, and waited for the return of
her beloved, passing her nights in watchings, genuflexions, prayers,
and disciplines.' And again, Lib. IV. section 3, just quoted.
P. 96. 'The will of God.' Cf. Lib. IV. section 6. 'The mother-in-
law said to her daughter-in-law, "Be brave, my beloved daughter; nor
be disturbed at that which hath happened by divine ordinance to thy
husband, my son." Whereto she answered boldly, "If my brother is
captive, he can be freed by the help of God and our friends." "He
is dead," quoth the other. Then she, clasping her hands upon her
knees, "The world is dead to me, and all that is pleasant in the
world." Having said this, suddenly springing up with tears, she
rushed swiftly through the whole length of the palace, and being
entirely beside herself, would have run on to the world's end, usque
quaque, if a wall had not stopped her; and others coming up, led her
away from the wall to which she had clung.
Ibid. 'Yon lion's rage.' Cf. Lib. III. section 2. 'There was a
certain lion in the court of the Prince; and it came to pass on a
time that rising from his bed in the morning, and crossing the court
dressed only in his gown and slippers, he met this lion loose and
raging against him. He thereon threatened the beast with his raised
fist, and rated it manfully, till laying aside its fierceness, it
lay down at the knight's feet, and fawned on him, wagging its tail.'
So Dietrich.
Pp. 99-100, 103-108. Cf. Lib. IV. section 7.
'Now shortly after the news of Lewis's death, certain vassals of her
late husband (with Henry, her brother-in-law) cast her out of the
castle and of all her possessions. . . . She took refuge that night
in a certain tavern, . . . and went at midnight to the matins of the
"Minor Brothers." . . . And when no one dare give her lodging, took
refuge in the church. . . . And when her little ones were brought
to her from the castle, amid most bitter frost, she knew not where
to lay their heads. . . . She entered a priest's house, and fed her
family miserably enough, by pawning what she had. There was in that
town an enemy of hers, having a roomy house. . . . Whither she
entered at his bidding, and was forced to dwell with her whole
family in a very narrow space, . . . her host and hostess heaped her
with annoyances and spite. She therefore bade them farewell,
saying, "I would willingly thank mankind if they would give me any
reason for so doing." So she returned to her former filthy cell.'
P. 100. 'White whales' bone' (i.e. the tooth of the narwhal); a
common simile in the older poets.
P. 104. 'The nuns of Kitzingen.' Cf. Lib. V. section 1. 'After
this, the noble Lady the Abbess of Kitzingen, Elizabeth's aunt
according to the flesh, brought her away honourably to Eckembert,
Lord Bishop of Bamberg.'
P. 106. 'Aged crone.' Cf. Lib. IV. section 8, where this whole
story is related word for word.
P. 109. 'I'd mar this face.' Cf. Lib. V. section 1. 'If I could
not,' said she, 'escape by any other means, I would with my own
hands cut off my nose, that so every man might loathe me when so
foully disfigured.'
P. 110. 'Botenstain.' Cf. ibid. 'The bishop commanded that she
should be taken to Botenstain with her maids, until he should give
her away in marriage.'
P. 111. 'Bear children.' Ibid. 'The venerable man, knowing that
the Apostle says, "I will that the younger widows marry and bear
children," thought of giving her in marriage to some one--an
intention which she perceived, and protested on the strength of her
"votum continentiae."'
P. 113. 'The tented field.' All records of the worthy Bishop on
which I have fallen, describe him as 'virum militia strenuissimum,'
a mighty man of war. We read of him, in Stero of Altaich's
Chronicle, A.D. 1232, making war on the Duke of Carinthia destroying
many of his castles and laying waste a great part of his land; and
next year, being seized by some bailiff of the Duke's, and keeping
that Lent in durance vile. In a A.D. 1237 he was left by the
Emperor as 'vir magnaminus et bellicosus,' in charge of Austria,
during the troubles with Duke Frederick; and died in 1240.
P 115. 'Lewis's bones.' Cf. Lib. V. section 3.
P 118. 'I thank thee.' Cf. Lib. V. section 4. 'What agony and
love there was then in her heart, He alone can tell who knows the
hearts of all the sons of men. I believe that her grief was
renewed, and all her bones trembled, when she saw the bones of her
beloved separated one from another (the corpse had been dug up at
Otranto, and _boiled_.) But though absorbed in so great a woe, at
last she remembered God, and recovering her spirit said--(Her words
I have paraphrased as closely as possible.)
Ibid. 'The close hard by.' Cf. Lib. V section 4.
NOTES TO ACT IV
P 120. 'Your self imposed vows.' Cf. Lib. IV. section I. 'On Good
Friday, when the altars were exhibited bare in remembrance of the
Saviour who hung bare on the cross for us, she went into a certain
chapel, and in the presence of Master Conrad, and certain Franciscan
brothers, laying her holy hands on the bare altar, renounced her own
will, her parents, children, relations, "et omnibus hujus modi
pompis," all pomps of this kind (a misprint, one hopes, for mundi)
in imitation of Christ, and "omnmo se exuit et nudavit," stripped
herself utterly naked, to follow Him naked, in the steps of
poverty.'
P 123. 'All worldly goods.' A paraphrase of her own words.
P 124. 'Thine own needs.' But when she was going to renounce her
possessions also, the prudent Conrad stopped her. The reflections
which follow are Dietrich's own.
P 125. 'The likeness of the fiend' etc. I have put this daring
expression into Conrad's mouth, as the ideal outcome of the teaching
of Conrad's age on this point--and of much teaching also which
miscalls itself Protestant, in our own age. The doctrine is not, of
course, to be found totidem verbis in the formularies of any sect--
yet almost all sects preach it, and quote Scripture for it as boldly
as Conrad--the Romish Saint alone carries it honestly out into
practice.
P 126. 'With pine boughs.' Cf. Lib. VI. section 2. 'Entering a
certain desolate court she betook herself, "sub gradu cujusdam
caminatae," to the projection of a certain furnace, where she roofed
herself in with boughs. In the meantime in the town of Marpurg, was
built for her a humble cottage of clay and timber.'
Ibid. 'Count Pama.' Cf. Lib. VI. section 6.
P 127. 'Isentrudis and Guta.' Cf. Lib. VII. section 4. 'Now
Conrad as a prudent man, perceiving that this disciple of Christ
wished to arrive at the highest pitch of perfection, studied to
remove all which he thought would <DW44> her, and therefore drove
from her all those of her former household in whom she used to
solace or delight herself. Thus the holy priest deprived this
servant of God of all society, that so the constancy of her
obedience might become known, and occasion might be given to her for
clinging to God alone.'
P 128. 'A leprous boy.' Cf. Lib. VI. section 8.
She had several of these proteges, successively, whose diseases are
too disgusting to be specified, on whom she lavished the most menial
cares. All the other stories of her benevolence which occur in
these two pages are related by Dietrich.
Ibid. 'Mighty to save.' Cf. Lib. VII. section 7. When we read
amongst other matters, how the objects of her prayers used to become
while she was speaking so intensely _hot_, that they not only
smoked, and nearly melted, but burnt the fingers of those who
touched them: from whence Dietrich bids us 'learn with what an
ardour of charity she used to burn, who would dry up with her heat
the flow of worldly desire, and inflame to the love of eternity.'
P 130. 'Lands and titles'. Cf. Lib. V. section 7,8.
P 131. 'Spinning wool.' Cf. Lib. VI. section 6. 'And crossing
himself for wonder, the Count Pama cried out and said, "Was it ever
seen to this day that a king's daughter should spin wool?" All his
messages from her father (says Dietrich) were of no avail.
P 135. 'To do her penance.' Cf. Lib. VII. section 4. 'Now he had
placed with her certain austere women, from whom she endured much
oppression patiently for Christ's sake who, watching her rigidly,
frequently reported her to her master for having transgressed her
obedience in giving some thing to the poor, or begging others to
give. And when thus accused she often received many blows from her
master, insomuch that he used to strike her in the face, which she
earnestly desired to endure patiently in memory of the stripes of
the Lord.'
P 136. 'That she dared not.' Cf. Lib. VII. section 4. 'When her
most intimate friends, Isentrudis and Guta (whom another account
describes as in great poverty), 'came to see her, she dared not give
them anything even for food, nor, without special licence, salute
them.'
P 137. 'To bear within us.' 'Seeing in the church of certain monks
who "professed poverty" images sumptuously gilt, she said to about
twenty four of them, "You had better to have spent this money on
your own food and clothes, for we ought to have the reality of these
images written in our hearts." And if any one mentioned a beautiful
image before her she used to say, 'I have no need of such an image.
I carry the thing itself in my bosom."'
Ibid. 'Even on her bed.' Cf. Lib. VI sections 5, 6.
P 139. 'My mother rose.' Cf. Lib. VI section 8. 'Her mother, who
had been long ago' (when Elizabeth was nine years old) 'miserably
slain by the Hungarians, appeared to her in her dreams upon her
knees, and said, "My beloved child! pray for the agonies which I
suffer; for thou canst." Elizabeth waking, prayed earnestly, and
falling asleep again, her mother appeared to her and told her that
she was freed, and that Elizabeth's prayers would hereafter benefit
all who invoked her.' Of the causes of her mother's murder the less
that is said the better, but the prudent letter which the Bishop of
Gran sent back when asked to join in the conspiracy against her is
worthy notice. 'Reginam occidere nolite timere bonum est. Si omnes
consentiunt ego non contradico.' To be read as a full consent, or
as a flat refusal, according to the success of the plot.
P. 140. 'Any living soul.' Dietrich has much on this point,
headed, 'How Master Conrad exercised Saint Elizabeth in the breaking
of her own will. . . . And at last forbad her entirely to give
alms; whereon she employed herself in washing lepers and other
infirm folk. In the meantime she was languishing, and inwardly
tortured with emotions of compassion.'
I may here say that in representing Elizabeth's early death as
accelerated by a 'broken heart' I have, I believe, told the truth,
though I find no hint of anything of the kind in Dietrich. The
religious public of a petty town in the thirteenth century round the
deathbed of a royal saint would of course treasure up most carefully
all incidents connected with her latter days; but they would hardly
record sentiments or expressions which might seem to their notions
to derogate in anyway from her saintship. Dietrich, too, looking at
the subject as a monk and not as a man, would consider it just as
much his duty to make her death-scene rapturous as to make both her
life and her tomb miraculous. I have composed these last scenes in
the belief that Elizabeth and all her compeers will be recognised as
real saints, in proportion as they are felt to have been real men
and women.
P. 142. 'Eructate sweet doctrine.' The expressions are Dietrich's
own.
Ibid. 'In her coffin yet.' Cf. Lib. VIII. section I.
Ibid. 'So she said.' Cf. Ibid.
Ibid. 'The poor of Christ.' 'She begged her master to distribute
all to the poor, except a worthless tunic in which she wished to be
buried. She made no will: she would have no heir beside Christ'
(i.e. the poor).
P. 143. 'Martha, and their brother,' etc.
I have compressed the events of several days into one in this scene.
I give Dietrich's own account, omitting his reflections. 'When she
had been ill twelve days and more one of her maids sitting by her
bed heard in her throat a very sweet sound, . . . and saying, "Oh,
my mistress, how sweetly thou didst sing!" she answered, "I tell
thee, I heard a little bird between me and the wall sing merrily;
who with his sweet song so stirred me up that I could not but sing
myself."'
Again, section 3. 'The last day she remained till evening most
devout, having been made partaker of the celestial table, and
inebriated with that most pure blood of life, which is Christ. The
word of truth was continually on her lips, and opening her mouth of
wisdom, she spake of the best things, which she had heard in
sermons; eructating from her heart good words, and the law of
clemency was heard on her tongue. She told from the abundance of
her heart how the Lord Jesus condescended to console Mary and Martha
at the raising again of their brother Lazarus, and then, speaking of
His weeping with them over the dead, she eructated the memory of the
abundance of the Lord's sweetness, affectu et effectu (in feeling
and expression?). Certain religious person who were present,
hearing these words, fired with devotion by the grace which filled
her lips, melted into tears. To whom the saint of God, now dying,
recalled the sweet words of her Lord as He went to death, saying,
"Daughters of Jerusalem," etc. Having said this she was silent. A
wonderful thing. Then most sweet voices were heard in her throat,
without any motion of her lips; and she asked of those round, "Did
ye not hear some singing with me?" "Whereon none of the faithful
are allowed to doubt," says Dietrich, "when she herself heard the
harmony of the heavenly hosts," etc. etc. . . . From that time till
twilight she lay, as if exultant and jubilant, showing signs of
remarkable devotion, till the crowing of the cock. Then, as if
secure in the Lord, she said to the bystanders, "What should we do
if the fiend showed himself to us?" And shortly afterwards, with a
loud and clear voice, "Fly! fly!" as if repelling the daemon.'
'At the cock-crow she said, "Here is the hour in which the Virgin
brought forth her child Jesus and laid him in a manger. . . . Let
us talk of Him, and of that new star which he created by his
omnipotence, which never before was seen." "For these" (says
Montanus in her name) "are the venerable mysteries of our faith, our
richest blessings, our fairest ornaments: in these all the reason
of our hope flourishes, faith grows, charity burns."'
The novelty of the style and matter will, I hope, excuse its
prolixity with most readers. If not, I have still my reasons for
inserting the greater part of this chapter.
P. 145. ' I demand it.' How far I am justified in putting such
fears into her mouth the reader may judge. Cf. Lib. VIII. section
5. 'The devotion of the people demanding it, her body was left
unburied till the fourth day in the midst of a multitude.' . . .
'The flesh,' says Dietrich, 'had the tenderness of a living body,
and was easily moved hither and thither at the will of those who
handled it . . . . And many, sublime in the valour of their faith,
tore off the hair of her head and the nails of her fingers ("even
the tips of her ears, et mamillarum papillas," says untranslatably
Montanus of Spire), and kept them as relics.' The reference
relating to the pictures of her disciplines and the effect which
they produced on the crowd I have unfortunately lost.
P. 146. 'And yet no pain.' Cf. Lib. VIII section 4. 'She said,
"Though I am weak I feel no disease or pain," and so through that
whole day and night, as hath been said, having been elevated with
most holy affections of mind towards God, and inflamed in spirit
with most divine utterances and conversations, at length she rested
from jubilating, and inclining her head as if falling into a sweet
sleep, expired.'
P. 147. 'Canonisation.' Cf. Lib. VIII. section 10. If I have in
the last scene been guilty of a small anachronism, I have in this
been guilty of a great one. Conrad was of course a prime means of
Elizabeth's canonisation, and, as Dietrich and his own 'Letter to
Pope Gregory the Ninth' show, collected, and pressed on the notice
of the Archbishop of Maintz, the miraculous statements necessary for
that honour. But he died two years before the actual publication of
her canonisation. It appeared to me that by following the exact
facts I must either lose sight of the final triumph, which connects
my heroine for ever with Germany and all Romish Christendom, and is
the very culmination of the whole story, or relinquish my only
opportunity of doing Conrad justice, by exhibiting the remaining
side of his character.
I am afraid that I have erred, and that the most strict historic
truth would have coincided, as usual, with the highest artistic
effect, while it would only have corroborated the moral of my poem,
supposing that there is one. But I was fettered by the poverty of
my own imagination, and 'do manus lectoribus.'
Ibid. 'Third Minors.' The order of the Third Minors of St. Francis
of Assisi was in invention of the comprehensive mind of that truly
great man, by which 'worldlings' were enabled to participate in the
spiritual advantages of the Franciscan rule and discipline without
neglect or suspension of their civic and family duties. But it was
an institution too enlightened for its age; and family and civic
ties were destined for a far nobler consecration. The order was
persecuted and all but exterminated by the jealousy of the Regular
Monks, not, it seems, without papal connivance. Within a few years
after its foundation it numbered amongst its members the noblest
knights and ladies of Christendom, St. Louis of France among the
number.
P. 149. 'Lest he fall.' Cf. Fleury, Eccl. Annals, in Anno 1233.
'Doctor Conrad of Marpurg, the King Henry, son of the Emperor
Frederick, etc., called an Assembly at Mayence to examine persons
accused as heretics. Among whom the Count of Saym demanded a delay
to justify himself. As for the others who did not appear, Conrad
gave the cross to those who would take up arms against them. At
which these supposed heretics were so irritated, that on his return
they lay in wait for him near Marpurg, and killed him, with brother
Gerard, of the order of Minors, a holy man. Conrad was accused of
precipitation in his judgments, and of having burned trop legerement
under pretext of heresy, many noble and not noble, monks, nuns,
burghers, and peasants. For he had them executed the same day that
they were accused, without allowing any appeal.'
P. 150. 'The Kaiser.' Cf. Lib. VIII. section 12, for a list of the
worthies present.
P. 151. 'A Zingar wizard.' Cf. Lib. I. section 1. The Magician's
name was Klingsohr. He has been introduced by Novalis into his
novel of Heinrich Von Ofterdingen, as present at the famous contest
of the Minnesingers on the Wartburg. Here is Dietrich's account:--
'There was in those days in the Landgrave's court six knights,
nobles, etc. etc., "cantilenarum confectores summi," song-wrights of
the highest excellence' (either one of them or Klingsohr himself was
the author of the Nibelungen-lied and the Heldenbuch).
'Now there dwelt then in the parts of Hungary, in the land which is
called the "Seven Castles," a certain rich nobleman, worth 3000
marks a year, a philosopher, practised from his youth in secular
literature, but nevertheless learned in the sciences of Necromancy
and Astronomy. This master Klingsohr was sent for by the Prince to
judge between the songs of these knights aforesaid. Who, before he
was introduced to the Landgrave, sitting one night in Eisenach, in
the court of his lodging, looked very earnestly upon the stars, and
being asked if he had perceived any secrets, "Know that this night
is born a daughter to the King of Hungary, who shall be called
Elizabeth, and shall be a saint, and shall be given to wife to the
son of this prince, in the fame of whose sanctity all the earth
shall exult and be exalted."
'See!--He who by Balaam the wizard foretold the mystery of his own
incarnation, himself foretold by this wizard the name and birth of
his fore-chosen handmaid Elizabeth.' (A comparison, of which
Basnage says, that he cannot deny it to be intolerable.) I am not
bound to explain all strange stories, but considering who and whence
Klingsohr was, and the fact that the treaty of espousals took place
two months afterwards, 'adhuc sugens ubera desponsata est,' it is
not impossible that King Andrew and his sage vassal may have had
some previous conversation on the destination of the unborn
princess.
P. 151. 'A robe.' Cf. Lib. II. section 9, for this story, on which
Dietrich observes, 'Thus did her Heavenly Father clothe his lily
Elizabeth, as Solomon in all his glory could not do.'
P. 152. 'The Incarnate Son.' This story is told, I think, by
Surias, and has been introduced with an illustration by a German
artist of the highest note, into a modern prose biography of this
saint. (I have omitted much more of the same kind.)
Ibid. 'Sainthood's palm.' Cf. Lib. VIII. sections 7, 8, 9. 'While
to declare the merits of his handmaid Elizabeth, in the place where
her body rested, Almighty God was thus multiplying the badges of her
virtues (i.e. miracles), two altars were built in her praise in that
chapel, which while Siegfried, Archbishop of Mayence, was
consecrating, as he had evidently been commanded in a vision, at the
prayers of that devout man master Conrad, preacher of the word of
God; the said preacher commanded all who had received any grace of
healing from the merits of Elizabeth, to appear next day before the
Archbishop and faithfully prove their assertions by witnesses. . . .
Then the Most Holy Father, Pope Gregory the Ninth, having made
diligent examination of the miracles transmitted to him, trusting at
the same time to mature and prudent counsels, and the Holy Spirit's
providence, above all, so ordaining, his clemency disposing, and his
grace admonishing, decreed that the Blessed Elizabeth was to be
written among the catalogue of the saints on earth, since in heaven
she rejoices as written in the Book of Life.' . . .
Then follow four chapters, headed severally--
Section 9. 'Of the solemn canonisation of the Blessed Elizabeth.'
Secion 10. 'Of the translation of the Blessed Elizabeth (and how
the corpse when exposed diffused round a miraculous fragrance).'
Section 11. 'Of the desire of the people to see, embrace, and kiss
(says Dietrich) those sacred bones, the organs of the Holy Spirit,
from which flowed so many graces of sanctities.'
Section 12. 'Of the sublime persons who were present, and their
oblations.'
Section 13. 'A consideration of the divine mercy about this
matter.'
'Behold! she who despised the glory of the world, and refused the
company of magnates, is magnificently honoured by the dignity of the
Pontifical office, and the reverent care of Imperial Majesty. And
she who, seeking the lowest place in this life, sat on the ground,
slept in the dust, is now raised on high, by the hands of Kings and
Princes. . . . It transcends all heights of temporal glory, to have
been made like the saints in glory. For all the rich among the
people "vultum ejus desprecantur" (pray for the light of her
countenance), and kings and princes offer gifts, magnates adore her,
and all nations serve her. Nor without reason, for "she sold all
and gave to the poor," and counting all her substance for nothing,
bought for herself this priceless pearl of eternity.' One would be
sorry to believe that such utterly mean considerations of selfish
vanity, expressing as they do an extreme respect for the very pomps
and vanities which they praise the saints for despising, really went
to the making of any saint, Romish or other.
Section 14. 'Of the sacred oil which flowed from the bones of
Elizabeth.' I subjoin the 'Epilogus.'
'Moreover even as the elect handmaid of God, the most blessed
Elizabeth, had shone during her life with wonderful signs of her
virtues, so since the day of her blessed departure up to the present
time, she is resplendent through the various quarters of the world
with illustrious prodigies of miracles, the Divine power glorifying
her. For to the blind, dumb, deaf, and lame, dropsical, possessed,
and leprous, shipwrecked, and captives, "ipsius mertis," as a reward
for her holy deeds, remedies are conferred. Also, to all diseases,
necessities, and dangers, assistance is given. And, moreover, by
the many corpses, "puta sedecim" say sixteen, wonderfully raised to
life by herself, becomes known to the faithful the magnificence of
the virtues of the Most High glorifying His saint. To that Most
High be glory and honour for ever. Amen.'
So ends Dietrich's story. The reader has by this time, I hope, read
enough to justify, in every sense, Conrad's 'A corpse or two was
raised, they say, last week,' and much more of the funeral oration
which I have put into his mouth.
P. 153. 'Gallant gentleman.' Cf. Lib. VIII. section 6.
P. 154. 'Took his crown.' Cf. Lib. VIII. section 12.
Ibid. The 'olive' and the 'pearl' are Dietrich's own figures. The
others follow the method of scriptural interpretation, usual in the
writers of that age.
P. 162. 'Domini canes,' 'The Lord's hounds,' a punning sobriquet of
the Dominican inquisitors, in allusion to their profession.
P 163. 'Folquet,' Bishop of Toulouse, who had been in early life a
Troubadour, distinguished himself by his ferocity and perfidy in the
crusade against the Albigenses and Troubadours, especially at the
surrender of Toulouse, in company with his chief abettor, the
infamous Simon de Montford. He died A.D. 1231.--See Sismondi, Lit.
of Southern Europe, Cap. VI.
*** | 2024-05-18T01:26:18.401715 | https://example.com/article/3984 |
Consider the $20 bill. It has no more value, as a simple slip of paper, than Monopoly money. Yet even children recognize that tearing one into small pieces is an act of inconceivable stupidity. What makes a $20 bill actually worth twenty dollars? In the third volume of his best-selling Naked series, Charles Wheelan uses this seemingly simple question to open the door to the surprisingly colorful world of money and banking.
Yoram Bauman is the world’s first and only stand-up economist. He is co-author of the “Cartoon Introduction to Climate Change” and the two volume “Cartoon Introduction to Economics,” and the 1998 book “Tax Shift,” which helped inspire the revenue-neutral carbon tax in British Columbia. He is campaign co-chair for the new Clean the Darn Air initiative, which supporters are working to get on the ballot in Utah in 2020.
Jonathan Williams, vice president and chief economist at American Legislative Exchange Council, explained that by looking at the economic outlook of each state and ranking them in 15 different factors -- including tax regulations, labor policies and economic growth -- ALEC is able to see which state ranks the richest and the poorest.
Last week, recipients of Utah State University’s Extension Awards were announced, honoring notable contributions from extension researchers and educators across the state.
While most individuals are unaware of how food gets from farm to table, Dr. Kynda Curtis, a professor and extension specialist in applied economics at Utah State University, is all too familiar with the process.
Employers in the agriculture industry have struggled to keep U.S. and foreign workers according to one Utah State University expert. A new update to the H-2A worker visa program might help workers keep their jobs in states like Utah.
UnDisciplined Episode 16: The transportation economist and the insect ecologist
This week on UnDisciplined, we're talking about the way people and animals move from place to place. Rick Geddes studies economic solutions for reducing traffic. Lori Spears is an entomologist who helps develop ways to keep non-native insects out of North America.
In today’s economic news, agriculture is taking over the headlines. Trade disputes have farmers and ranchers uncertain about the future of their businesses, but one small group of people specializing in complex agriculture economics are working to keep up with the fast-paced markets.
Without a stable home, positive role models and tools for success, many young Americans fall behind their peers and experience a rocky transition to adulthood, according to a new study. These issues not only affect young people later in life, but they also prove harmful to society as a whole.
Utah is getting the attention of large businesses and tech companies as a good place to build a foundation. Data from a recent study found the business environment is also attracting small independent retailers.
Utah has been one of the most popular areas in the United States for filmmakers since westerns hit the big screens almost 100 years ago according to experts in the film industry. Is it possible to reap the economic benefits of movies and commercials while preserving Utah’s iconic landscapes used on camera?
Starting a business is never easy, according officials at the U.S. Bureau of Labor Statistics. Close to a fifth of all startups don’t survive more than one year of operation, and nearly half never make it to their fifth anniversary. But Utah’s economic climate is better than most states in the U.S.
Small business owners in the United States and Utah are looking forward to the next 12 months, according to a recent study. But Utah has dropped in the rankings from number three in the nation to eighth this year for small business optimism.
The nonprofit organization Prosperity Now recently released its yearly economic “scorecard”—a report detailing the economic wellbeing of populations across the U.S. The report said there is a racial divide when it comes to economic security and in areas like Utah, minority groups tend to fare worse than white populations.
On Monday’s Access Utah, beloved folk singer Dar Williams joins us to talk about her latest book, described as “an impassioned account of the fall and rise of the small American towns she cherishes.”
Dubbed by the New Yorker as "one of America's very best singer-songwriters," Dar Williams has made her career not in stadiums, but touring America's small towns. She has played their venues, composed in their coffee shops, and drunk in their bars. She has seen these communities struggle, but also seen them thrive in the face of postindustrial identity crises.
Immigration reform groups are working to keep the 13,600 Utahns currently eligible for DACA in the United States. Representatives from the groups said children who immigrated to the U.S. with their parents have a positive impact on Utah’s economy.
Governor Herbert has created an exploratory committee to research the feasibility of an inland port for the state of Utah. Inland ports are designated sites with strong transportation infrastructure and distribution operations.
Interior Secretary Ryan Zinke has completed the review of national monuments mandated by President Trump. He has not released his recommendations. The New York Times is reporting that those recommendations include reducing the size of 4 national monuments, including Bears Ears and Grand Staircase-Escalante in Utah. Reports are that Secretary Zinke may recommend a drastic reduction in size for Bears Ears.
The “Reforming American Immigration for a Strong Economy Act” also known as the “RAISE Act,” seeks to reduce the amount of legal immigration to the United States by 50%. One immigration attorney in Salt Lake City is pushing for further discussion about how the act could prevent skilled workers from entering the United States. | 2023-12-14T01:26:18.401715 | https://example.com/article/1502 |
When I try to call doNothing from a Orbforms Designer App, I get the following fatal alert.
OrbFormsRT(3.0.4) called sysFatalAlert with the message "vm.cpp, Line:1304, op1->type == vtSavedFP"
Before I try to dig deeper, has anybody built a native add-in for Orbforms Designer using eclipse(Garnet OS devlopment suite) or prc-tools. For pocketC, seems like the add-in is built as a shared library. I tried to build it as a shared library which failed as well.
Further prc-tools documentations says that "m68k-palmos-obj-res" has been deprecated and recommends not to use it. So how does one build a standalone code resource? | 2023-10-27T01:26:18.401715 | https://example.com/article/7051 |
Squeem “Perfect Waist” Waist Cincher Review
Squeem Waist Cincher
Millions and millions of women out there just aren’t feeling quite as sexy or as confident as they probably should, and a lot of it has to do with body image issues completely and totally out of their control.
At the same time, different attempts to try and melt fat, lose weight, and look plus fuel better at the same time usually don’t work out quite as successfully as most of these women had hoped – and it ends up crippling their self-image even more.
That’s because there are a lot of modern-day snake oil products out there on the market, promising high in the sky results with absolutely no proof to back them up.
If you’re sick and tired of dealing with that misleading advertising and marketing, and instead want to get your hands on something you’ll be able to trust – something that will actually be able to give you the results you’re after – you’re going to want to check out the Squeem Perfect Waist Firm Compression Trainer (View on Amazon.com).
A revolutionary new solution in the weight loss and body toning world, this is one of the most impressive trainers we’ve ever come across – and one that we think you’re going to fall in love with!
What is the Squeem Perfect Waist Cincher?
An absolutely amazing breakthrough product produced by a Brazilian company that’s been in the business for more than 40 years, the Squeem waste compression trainer has been designed and developed from the ground up to give women every advantage at shaping and molding their body in record time while at the same time helping to stimulate fat loss.
This is so much more than a waist cincher, but instead a training product that is going to give you a gym like workout without any extra effort on your behalf whatsoever.
What’s so special about the Squeem Perfect Waist Trainer?
You see, from the moment that you strap the Squeem are, you’re going to look thinner, toned, and attractive, all thanks to the “smoothing out” that takes care of when you’re wearing it.
But better than that, it also starts to straighten out the muscles in your back to alleviate pain, pulls your abdominals in to give them a bit of a workout, and helps to accelerate your metabolism – turning you into a fat burning furnace so that you literally melt body fat right out of your body.
Are there any drawbacks to using the Squeem Perfect Waist Trainer?
We really tried to search high and low for drawbacks to moving forward with the Squeem, and came up empty-handed.
Its ability to reduce 1 to 4 inches(their claim) across your midsection with absolutely less effort whatsoever combined with its ability to give you work out like results without having to break a sweat really makes it a game changer.
Final verdict on the Squeem Perfect Waist Trainer
At the end of the day, you’d honestly have to be at least a little bit crazy not to get your hands on this game changing product from Squeem.
Hopefully you find one of these Squeem reviews useful! | 2023-11-09T01:26:18.401715 | https://example.com/article/9832 |
Wednesday, October 13, 2010
Today I helped serve hamburgers to our plant employees. I was "bun girl." My job was to split open the hamburger buns on the plastic plate so that "burger girl" could put the hamburger patties on the buns. Next "cheese girl" put the cheese on the burgers. Unfortunately, we had two minor glitches. One, the provider of the buns did not pre-cut the buns. You had to rip them open with your fingers and hopefully not totally mutilate the bun. Second, the plastic gloves we wore were X-Large size. I could literally bend the excess "fingers" down to the base of the palm of my hand.... and they were bright purple. Okay, the latter is not so much a glitch as it just highlighted, in brilliant purple, my struggles to open the uncut buns in over sized gloves. And no, much to the delight of everyone, "burger girl" and "cheese girl" were not willing to switch positions.
It was a fast paced assembly line with plant workers on their half hour lunch lined up ... With a laugh, smile and my eyes locked dead center in theirs I asked each one how they were doing followed by "white or wheat?" Odd, most just pointed. They were too busy laughing to even care. One kind soul found a plastic knife and brought it to me. A plant worker, patiently waiting for his bun stole it and said 'she don't need it.'
This morning the battery in my wireless mouse died. Tonight I went to change the battery and my hands, which have a tremor at times and arthritis could not open the little flap for the battery. I struggled and struggled and could not get a grip or enough pressure to open the flap. Suddenly I remembered my cat's fascination with my little mouse. I recalled them swatting it to the floor and...yes, you are correct, the flap would open and the battery would inevitably fall out. I pondered this. And with a stern warning to the cats that this was NOT to be taken as permission for them to attack my mouse, I dropped it on the floor. The cats sat there and looked at me as if to say, "boy are you going to be in trouble!" Me? I slipped the new battery in and am a happy little camper with my wireless mouse.
I've often said my hands are me. Sometimes, I just don't feel like I "fit." Sometimes, I mourn the things I cannot do or can no longer do. I think today was a gentle reminder of the simple joy of looking someone dead in the eye, acknowledging their presence and making them laugh. A gentle reminder that even nature can take "should not's" and turn them into little victories.
In the end, it is not so much about what they can and cannot do as it is what they hold on to and what they release ... just like my heart.
About Me
I have begun a path, though I know not where, to a journey’s end that is calling. Along the way I pause to absorb the metaphors and images of this life, which are so precious. Here you shall find me brave, you shall find me pondering, you shall find me searching, and you shall find me collecting the images and metaphors like shells upon the beach. I am very much like the little monkey wearing a dapper hat, playing the cymbals and drum and dancing a jig. I do not have it all figured out, I may be learning to write, but one thing I do know and that is how to collect the shells on the beach of my beloved Gulf Shores. I offer these shells to you. | 2024-04-06T01:26:18.401715 | https://example.com/article/7640 |
Q:
boost NuGet пакет
Добавил NuGet пакет boost 1.65.1 в Visual Studio 2015 (C++) и получил ошибку во время компиляции:
1>LINK : fatal error LNK1104: cannot open file 'libboost_system-vc140-mt-1_65_1.lib'
Переустановка пакета не помогла. Ошибка наблюдается даже если создать чистый проект и подключить boost
A:
Решение:
на сайте boost.org скачиваем библиотеку, компилируем и подключаем ее в Visual Studio инструкции я брал тут
http://kaktusenok.blogspot.com/2013/08/boost-visual-studio.html
все понятно и просто собралось решение в Releas конфигурации
| 2024-07-21T01:26:18.401715 | https://example.com/article/7870 |
Q:
Using Matrix. Rotate in OpenGL ES 2.0
Edit - Added more code
Having a lot of problems attempting to correctly rotate my quad using OpenGL ES 2.0.
It always seems to rotate around the centre of the screen co-ordinates. I'm trying to get it to rotate around it's own centre (for 2d, so z axis only).
I've been experimenting with Matrix.translate as show below. However, changing the x or y pos here simply draws the quad at a different place on the screen, but when it rotates, again it rotates around the centre of the screen. Please could someone explain how to get it to spin around it's own z axis (like a wheel)?
Thanks, here are the relevant lines of code - if more is needed, please ask and I will post. (Please note, I've looked at a lot of similar questions on SO and the wider internet but I've not managed to find an answer thus far).
Thanks.
//Set rotation
Matrix.setRotateM(mRotationMatrix, 0, -angle, 0, 0, 1.0f);
//Testing translation
Matrix.translateM(mRotationMatrix, 0, -.5f, .5f, 0f);
// Combine the rotation matrix with the projection and camera view
Matrix.multiplyMM(mvpMatrix, 0, mRotationMatrix, 0, mvpMatrix, 0);
My Shaders (declared at class level)
private final String vertexShaderCode =
"uniform mat4 uMVPMatrix;" +
"attribute vec4 vPosition;" +
"void main() {" +
" gl_Position = uMVPMatrix * vPosition;" +
"}";
private final String fragmentShaderCode =
"precision mediump float;" +
"uniform vec4 vColor;" +
"void main() {" +
" gl_FragColor = vColor;" +
"}";
From onSurfaceChanged
float ratio = (float) width / height;
Matrix.frustumM(mProjMatrix, 0, -ratio, ratio, -1, 1, 3, 7);
In My onDrawFrame method
// Set the camera position (View matrix)
Matrix.setLookAtM(mVMatrix, 0, 0, 0, 3, 0f, 0f, 0f, 0f, 1.0f, 0.0f);
//Calculate the projection and view transformation
Matrix.multiplyMM(mMVPMatrix, 0, mProjMatrix, 0, mVMatrix, 0);
A:
I´ve encountered the same problems (seen weird distortions and everything else), my solution based on the Android Training > Displaying Graphics with OpenGL ES > Adding Motion below.
(Head over to my detailed post for at if needed:
OpenGL ES Android Matrix Transformations.)
Set a mModelMatrix to identity Matrix
Matrix.setIdentityM(mModelMatrix, 0); // initialize to identity matrix
Apply translation to the mModelMatrix
Matrix.translateM(mModelMatrix, 0, -0.5f, 0, 0); // translation to the left
Apply rotation to a mRotationMatrix (angles in degrees)
Matrix.setRotateM(mRotationMatrix, 0, mAngle, 0, 0, -1.0f);
Combine rotation and translation via Matrix.multiplyMM
mTempMatrix = mModelMatrix.clone();
Matrix.multiplyMM(mModelMatrix, 0, mTempMatrix, 0, mRotationMatrix, 0);
Combine the model matrix with the projection and camera view
mTempMatrix = mMVPMatrix.clone();
Matrix.multiplyMM(mMVPMatrix, 0, mTempMatrix, 0, mModelMatrix, 0);
A:
Here is a walkthrough. Let's say you were to draw a teapot... the modelMatrix would be an identity to start with. The shape is centered on the origin like this:
Verify this is what you have before you continue...
Once you have you should apply the rotation to the model matrix, compile+run - you get a rotated copy...
Once you have this you can translate:
So for you, all you need to do appears to verify when rotation matrix is identity e.g.
Matrix.setIdentityM( mRotationMatrix,0);
that the shape is in the center. If it is not move it to the center.
Once it is in the center apply the rotation e.g.
Matrix.setIdentityM( mRotationMatrix,0);
<as needed movement to center>
Matrix.rotate(mRotationMatrix, 0, -angle, 0, 0, 1.0f);
<any other translation you want>
Do it in steps to make your life easy so you see what is going on.
| 2023-12-05T01:26:18.401715 | https://example.com/article/2372 |
[Evaluation of the efficacy of using regional cooling of the spinal cord in complicated spinal injury].
In 48 patients with complications after the spinal column trauma the local spinal cord cooling has been performed postoperatively. The positive results were: increased pulse blood flow to the spinal cord, reduction of the alpha-motor units excitability, and pain relief. Simplicity and safety of the local cooling allow it to be performed routinely in the spinal care units. | 2024-04-20T01:26:18.401715 | https://example.com/article/6482 |
Lycée Français Liberté de Bamako
Lycée Français Liberté de Bamako or the Etablissement Liberté is a French international school in Bamako, Mali. The school has primary, collège (junior high school) and lycée (senior high school) levels.
References
External links
Lycée Français Liberté de Bamako
Category:French international schools in Africa
Category:International schools in Mali
Category:Bamako | 2024-05-31T01:26:18.401715 | https://example.com/article/2221 |
Hand-assisted laparoscopic vs. laparoscopic colorectal surgery: a multicenter, prospective, randomized trial.
This study was designed to compare short-term outcomes after hand-assisted laparoscopic vs. straight laparoscopic colorectal surgery. Eleven surgeons at five centers participated in a prospective, randomized trial of patients undergoing elective laparoscopic sigmoid/left colectomy and total colectomy. The study was powered to detect a 30-minute reduction in operative time between hand-assisted laparoscopic and straight laparoscopic groups. There were 47 hand-assisted patients (33 sigmoid/left colectomy, 14 total colectomy) and 48 straight laparoscopic patients (33 sigmoid/left colectomy, 15 total colectomy). There were no differences in the patient age, sex, body mass index, previous surgery, diagnosis, and procedures performed between the hand-assisted and straight laparoscopic groups. Resident participation in the procedures was similar for all groups. The mean operative time (in minutes) was significantly less in the hand-assisted laparoscopic group for both the sigmoid colectomy (175 +/- 58 vs. 208 +/- 55; P = 0.021) and total colectomy groups (time to colectomy completion, 127 +/- 31 vs. 184 +/- 72; P = 0.015). There were no apparent differences in the time to return of bowel function, tolerance of diet, length of stay, postoperative pain scores, or narcotic usage between the hand-assisted laparoscopic and straight laparoscopic groups. There was one (2 percent) conversion in the hand-assisted laparoscopic group and six (12.5 percent) in the straight laparoscopic group (P = 0.11). Complications were similar in both groups (hand-assisted, 21 percent vs. straight laparoscopic, 19 percent; P = 0.68). In this prospective, randomized study, hand-assisted laparoscopic colorectal surgery resulted in significantly shorter operative times while maintaining similar clinical outcomes as straight laparoscopic techniques for patients undergoing left-sided colectomy and total abdominal colectomy. | 2023-11-11T01:26:18.401715 | https://example.com/article/8026 |
We were 85 feet (26 meters) underwater and more than five miles (eight kilometers) off the Florida coast when the lights went out. It was night, and conservationist Craig Taylor and I had been diving for two hours by the dim beams of the Aquarius research station—our underwater home and, at that depth, our only safe haven. About the size of a railroad freight car, Aquarius looked like a spaceship on the seafloor, an interior glow filling her view ports, exterior spotlights illuminating her sides and legs. When she lost power, she simply disappeared into the inky blackness, and I felt as cut off from the world as an astronaut stranded in space.
I fought the impulse to head for the surface, which is what scuba divers are trained to do when they get into trouble, because this was no ordinary dive. For the past four days we'd been living in Aquarius as aquanauts, and by now our bodies were saturated with nitrogen. If I surfaced quickly, without decompression, dissolved nitrogen in my body would expand from the sharp decrease in pressure, forming bubbles that could painfully squeeze nerves, block blood flow, or cause brain damage. Decompression sickness probably would kill me.
Suddenly Aquarius's emergency siren started wailing—a signal for all aquanauts to return immediately. The piercing sound, however, seemed to come from all directions. Breathing heavily on my scuba tanks as I swam through the darkness, I used my emergency lights to search for the web of excursion lines that had been mapped out for us during our one-week training session. These guidelines were a safety measure to help us navigate around the reef. Grasping a black braided rope in one gloved hand, Craig and I followed the line back to the station, where we felt our way across the coral-and-algae-covered metal to the rectangular opening in the bottom known as the moon pool.
The station functions like an inverted glass pushed down into a bucket of water: An air pocket remains at the top of the glass while the glass remains upright. The crew maintains the air pressure inside Aquarius at the same high pressure as the surrounding ocean, keeping the water from rushing in. We lived in that air pocket, which I was eager to get back to. Emerging from the ocean water, I stood waist-deep in the moon pool, removed my regulator, and breathed in the hot, humid air from Aquarius.
"Generator's down," said Christian Petersen, a U.S. Navy diving medical officer, as he stood above me in the dim emergency lighting. Without power from either of the two electric generators in the life-support buoy tethered above us on the surface, we had only dim emergency lights and no air-conditioning. In these warm tropical waters, with a half dozen people inside, our small laboratory would rapidly become stifling. I climbed up the stainless steel steps, peeled off my dive gear, and began to sweat.
to January 1945 when photographer Lilo Hess lured a striped burrfish to a microphone to hear what it had to say.
In More to Explore the National Geographic magazine team shares some of its best sources and other information. Special thanks to the Research Division.
A graphic way to visualize what can happen in a diver's body if the pressure of the surroundings is reduced too suddenly is to recall what happens in a bottle of soda when the top is removed quickly. The pressure that held the gas—carbon dioxide in soft drinks—in solution suddenly drops and the gas comes out of the solution in a burst of bubbles, flowing out over the top of the bottle.
Such a sudden release of pressure isn't only a hazard for divers, but also can be a danger in unpressurized civilian aircraft and high-flying military planes. Our bodies are saturated with nitrogen all the time, no matter the altitude at which we live. If an unpressurized airplane (usually a small, privately owned plane) rises quickly to altitudes of more than about 18,000 feet (5,500 meters) above sea level, that dissolved nitrogen can form bubbles, and the pilot and passengers suddenly find themselves dealing with the bends, even though they may be breathing oxygen to compensate for the thinner atmosphere. The solution is, of course, to come down to a lower altitude. Altitude-induced decompression sickness can also threaten military personnel who sometimes must work in depressurized sections of aircraft for a while, such as when a cargo door is opened for parachutists or an airdrop. In these instances, personnel who will be working in the unpressurized area breathe pure oxygen for a carefully regulated time period before the plane rises above a dangerous altitude, just as the aquanauts in Aquarius spent three 20-minute periods breathing oxygen at the beginning of their decompression. In each case, whether the person is high above the Earth or beneath the ocean's surface, the oxygen forces some of the dissolved nitrogen out of the body and reduces the chance of getting decompression sickness.
—Patricia Kellogg
Aquariuswww.uncw.edu/aquariusAt the Aquarius website you'll find technical details about the habitat and past missions, and when a mission is under way take a virtual visit through a live webcam. The site includes lesson plans, links, and lots of photographs.
National Marine Sanctuary Programwww.sanctuaries.nos.noaa.govHere you will find background on the national program and links to the websites of the 13 marine sanctuaries. Good resources for teachers, students, and anyone interested in oceanography.
New England Aquariumwww.neaq.orgTake a tour of Boston's New England Aquarium, investigate the research and conservation programs it's involved in, and find dozens of links.
Office of Naval Research Science and Technology Focuswww.onr.navy.mil/focusThis is a great place to begin an investigation into almost any aspect of oceanography. It also offers links, lessons, and a place to submit questions to ONR's scientists. | 2024-01-02T01:26:18.401715 | https://example.com/article/3402 |
My HYBRID is my everything bike. I'm not an avid rider like so many on BF but I will ride mine to work starting next month. I also use it to run light errands once in a while and for exercise/fun rides with the husband.
I use my hybrid for basic transportation. It's 4-6 miles to the nearest bus stop or train station, so unless I can cadge a ride from a family member in his car, I ride. I don't ride every day, as the Family Driver is pretty good about acting as chauffeur, but I like to be on my own schedule if I can, and the bike is a lifesaver when The Driver is out of town. I have biked to and from temp jobs, sometimes all the way. Other times I rode the bike to catch the bus or train.
I'm what you'd call Involuntarily Car Light. I used to live in a city, where the bus stopped on the corner near my apartment, and while I have owned cars I junked my last one years ago, rather than let it be a money pit. Eventually I let my driver's license expire, which I now regret. I used to walk or take the bus to work, occasionally rent a car, and ride my bike some. I'd happily do that now, but I've been out of work, and now live in a very car-centric area.
Once I obtain regular employment, I suppose I'll move to an apartment that's much better served by mass transit, if I can. Then I'll be able to switch back and forth between bus, train and bike, as needed.
I may need to budget for a better bike, too. I hit a bad hole in the road on my Univega Trail today and bent the rigid front fork. I got some free roadside assistance from a fellow rider, so it rolls, but I should replace it as soon as I can.
Even if my income spiked, and I could easily afford a dependable car, insurance and fuel, I'd still ride for the exercise and enjoyment. Since I started riding again I've been mentally kicking myself for the years I let my old 12-speed sit, neglected, in the basement storage locker of my old flat. The money I could have saved that I spent on bus fare, the extra pounds that wouldn't have been added to my beer gut....
Fast conveyance down the uneven, and often unpaved, roads and pathways here in northern Vermont. Either for pleasure, or to do some work or photography. I love the feeling of knowing that if it's not a crazed, boulder-strewn mountain-trail - I can take my bike down whatever paths I desire. And maintain a good speed in so doing.
My original intent was not to commute with my bike and when I bought it I had never even considered it. I bought it for pure pleasure. I have been into fitness pretty heavy for the last 15 years. Last year when gas went off the chart is when it 1st crossed my mind. My hours at work and the distance from my farm where the hurtles to overcome. It took some time but I figured it out. I am fortunate and run my division at work and manipulated my employees to control my hours. Then I found a place to drive part way and ride the rest. 10 miles each way currently. So now I save gas, reduce my carbon footprint, and get my aerobic workout in in 1 shot. There is always a way
The primary use of my Marin Mill Valley is as a back up to my Kona Nunu MTB which is used primarily as a short haul light freight delivery vehicle.
The Marin with a large load.
My Cannondale H300 CAAD1 was being used to take up space and collect dust until reading this forum made me want to take it out for a ride.
"Inspiration, move me brightly..."
I'm hoping to put it back into service, perhaps as the primary or maybe back-up hauler. The Marin then could be used for faster longer rides on the weekend. I'll probably swap the rear racks, the nice big Jandd will match the front rack on the H300, which makes a better utility bike. Smaller, lighter rack on the Marin, my sportier ride.
Four primary uses! That kinda sums up what hybrids are all about. Too bad yours is a touring bike and not a hybrid. You believe it's a hybrid and maybe that's what a hybrid really is. A bike that can do it all if the rider believes it can. Your bike is defined by what you do with it. | 2024-03-23T01:26:18.401715 | https://example.com/article/8158 |
List of Indiana state historical markers in Perry County
__NOTOC__
This is a list of the Indiana state historical markers in Perry County.
This is intended to be a complete list of the official state historical markers placed in Perry County, Indiana, United States by the Indiana Historical Bureau. The locations of the historical markers and their latitude and longitude coordinates are included below when available, along with their names, years of placement, and topics as recorded by the Historical Bureau. There are 4 historical markers located in Perry County.
Historical markers
See also
List of Indiana state historical markers
National Register of Historic Places listings in Perry County, Indiana
References
External links
Indiana Historical Marker Program
Indiana Historical Bureau
Perry County
Historical markers | 2024-05-24T01:26:18.401715 | https://example.com/article/2572 |
[package]
name = "polkadot-node-core-backing"
version = "0.1.0"
authors = ["Parity Technologies <admin@parity.io>"]
edition = "2018"
[dependencies]
futures = "0.3.5"
sp-api = { git = "https://github.com/paritytech/substrate", branch = "master" }
sc-client-api = { git = "https://github.com/paritytech/substrate", branch = "master" }
sp-blockchain = { git = "https://github.com/paritytech/substrate", branch = "master" }
keystore = { package = "sc-keystore", git = "https://github.com/paritytech/substrate", branch = "master" }
polkadot-primitives = { path = "../../../primitives" }
polkadot-node-primitives = { path = "../../primitives" }
polkadot-subsystem = { package = "polkadot-node-subsystem", path = "../../subsystem" }
polkadot-node-subsystem-util = { path = "../../subsystem-util" }
erasure-coding = { package = "polkadot-erasure-coding", path = "../../../erasure-coding" }
statement-table = { package = "polkadot-statement-table", path = "../../../statement-table" }
derive_more = "0.99.9"
bitvec = { version = "0.17.4", default-features = false, features = ["alloc"] }
log = "0.4.8"
[dev-dependencies]
sp-core = { git = "https://github.com/paritytech/substrate", branch = "master" }
sp-keyring = { git = "https://github.com/paritytech/substrate", branch = "master" }
futures = { version = "0.3.5", features = ["thread-pool"] }
assert_matches = "1.3.0"
polkadot-node-subsystem-test-helpers = { path = "../../subsystem-test-helpers" }
| 2023-09-22T01:26:18.401715 | https://example.com/article/3287 |
Q:
Android, is it possible to change UID of my application programmatically
I'm trying to build an application to lock-down specific applications and services.
Ive got a list of the packages installed on the android device and I know how to disable them but when I try I get a permission denied error about the uid is different.
Is there a way to make android think I'm the user that is trying to disable the the package or to change the uid of the application I'm running as to that of the package.
I know I can get the uid of the package I'm trying to disable using the ApplicationInfo.
The way I'm disabling the packages is:
pm.setApplicationEnabledSetting(packageName,
PackageManager.COMPONENT_ENABLED_STATE_DISABLED_USER,
PackageManager.DONT_KILL_APP);
A:
Is there a way to make android think I'm the user that is trying to disable the the package or to change the uid of the application I'm running as to that of the package.
Fortunately, no, for obvious security reasons.
Is there anyway i can disable other downloaded and system applications using the packageinfo or applicationinfo?
Fortunately, no, for obvious security reasons.
You may have additional options on rooted devices, and certainly with custom firmware.
| 2023-08-05T01:26:18.401715 | https://example.com/article/7032 |
Q:
Putting JVM arguments in a file to be picked up at runtime
I'm building a jar of my current application, which required several JVM arguments to be set.
Is there a way of setting these JVM arguments in a file rather than on the command line?
I've done some hunting and it looks like I might be able to do something witha java.properties file, possibly by setting a java-args, but I can't find any reference to the format for doing this.
Am I barking up the wrong tree?
Is this possible and if so how?
If not is there some other way to specify the JVM arguments?
A:
You could of course write a batch script to execute the JVM. The batch script could look into the file and call with the appropriate parameters. This would be OS dependent though.
| 2023-09-03T01:26:18.401715 | https://example.com/article/3232 |
WELCOME TO WATER EDGE RESORT ARUGAM BAY
Water Edge Resort is located in the small fishing village of Arugam Bay, south of Pottuvil in the Ampara
District. Set right on the beachfront, we’re only a few minutes walk away from the Arugam Bay Point, which is
among the top 10 surf points in the world.
But, this is not all. At Water Edge Resort, we ensure you don’t miss out on the fun.
Make sure you get up early to catch the sunrise over the sea. The sky is ablaze with shades of bright orange,
yellow and red, making the area ever more picturesque.
Stroll along the beach, or take a dip in the waters when the sun goes down. Or, if you dare, get on your
surfboard and pick the right wave.
Better still, the area is rich in wildlife. Drive into the wilderness of Kumana to see for yourself. If you
are looking for more adventure, get on your jeep, fasten your seatbelt and make your way towards the sand
dunes of Panama.
Alternatively, if you are looking for some peace and quiet, unwind at our beachside cabanas or sway in the
breeze on the outdoor hammocks. Enjoy some music while you sip a cool drink in the afternoon sun.
It’s all part of the experience. | 2024-02-27T01:26:18.401715 | https://example.com/article/8663 |
The invention described herein may be manufactured and used by or for the US Government for governmental purposes without the payment of any royalty thereon.
1. Background-Field of the Invention
The present invention relates to improving the detection performance of multi-channel receivers, and, in particular, to improving the detection of signals masked by the presence of partially correlated Gaussian or non-Gaussian noise plus additive Gaussian thermal white noise. The apparatus and method of the present invention is directed to the signal processing architecture and computational procedures of multi-channel receivers. The present invention has radar, sonar, geophysical, and biomedical applications.
2. Background-Description of the Prior Art
The use of multi-channel signal processing methods to detect the presence of a desired signal is well established. Basing such methods on parametric models offers the prospect of improved performance over the prior art.
In airborne array radar applications, for example, with J antenna elements (spatial channels) and N pulses per coherent processing interval (xe2x80x9cCPIxe2x80x9d), optimal signal detection methods using both angle- and Doppler-processing require joint space-time matched filtering in the JNxc3x97JN complex vector space. Such techniques are generally computationally prohibitive, and they require large amounts of secondary data (i.e., data from the radar surveillance region assumed to be free of the target signal of interest) to estimate the noise disturbance correlation. In addition, for conditions of non-homogeneous clutter, the secondary data may lack statistical equivalence to that in the range cell under test. Also, for the conventional Gaussian receiver, distinct thresholds must be established for individual range-azimuth cells over the entire radar surveillance volume. This requirement follows from the observation that the data sequence of N pulses is Gaussian for each individual range cell but non-Gaussian from cell to cell.
The performance of Gaussian receivers is improved to a degree by the systems described in the following U.S. patents:
U.S. Pat. No. 5,640,429 issued to Michels and Rangaswamy
U.S. Pat. No. 5,272,698 issued to Champion
U.S. Pat. No. 5,168,215 issued to Puzzo
U.S. Pat. No. 4,855,932 issued to Cangiani
U.S. Pat. No. 6,226,321 issued to Michels, et. al.
Cangiani et al. discloses a three dimensional electro-optical tracker with a Kalman filter in which the target is modeled in space as the superposition of two Gaussian ellipsoids projected onto an image plane. Puzzo offers a similar disclosure. Champion discloses a digital communication system.
Michels et al., U.S. Pat. No. 6,226,321, hereby incorporated by reference, discloses implementations, for a signal that has unknown amplitude. For the signal of unknown amplitude, Michels et al. teaches how to incorporate the estimated signal amplitude directly into the parametric detection procedure. Furthermore, Michels teaches two separate methods, namely, (1) how to detect the signal in the presence of partially correlated non-Gaussian clutter disturbance and (2) how to detect the signal in the presence of partially correlated Gaussian clutter disturbance. Furthermore, the method to detect the signal in the presence of partially correlated non-Gaussian clutter involves processing the received radar data and requires the use of functional forms that depend upon the probability density function (pdf) of the disturbance. Thus, the latter method requires knowledge of the pdf statistics of the non-Gaussian disturbance. The method does not teach how to process the data in such a manner that would not require knowledge of the disturbance process. Furthermore, it does not teach how to process the data with one method that would detect the signal in either Gaussian or non-Gaussian disturbance. Thus there exists a need for apparatus and method of processing the data with a detection method that does not require knowledge of the clutter statistics. Furthermore, there exists a need for a method that detects the signal in either Gaussian or non-Gaussian disturbance.
The performance improvements of the presently disclosed invention relative to prior art are detailed in J. H. Michels, M. Rangaswamy, and B. Himed, xe2x80x9cEvaluation of the Normalized Parametric Adaptive Matched Filter STAP Test in Airborne Radar Clutter,xe2x80x9d IEEE International Radar 2000 Conference, May 7-11, 2000, Washington, D.C. and J. H. Michels, M. Rangaswamy, and B. Himed, xe2x80x9cPerformance of STAP Tests in Compound-Gaussian Clutter,xe2x80x9d First IEEE Sensor Array and Multichannel Signal Processing Workshop (SAM 2000), Mar. 16-17, 2000, Cambridge, Mass. Both of these documents, designated references A and B, respectively, are incorporated herein by reference thereto.
Therefore one object of the present invention is to provide apparatus and method of detecting desired signals in additive Gaussian or non-Gaussian disturbance processes using single-channel or multiple-channel sensors.
Another of the present invention is to provide apparatus and method of detecting desired signals in additive Gaussian or non-Gaussian disturbance processes that use efficiently the available data from secondary data cells; i.e., require only a small number of secondary data cells.
Still another object of the present invention is to provide apparatus and method of detecting desired signals in additive Gaussian or non-Gaussian disturbance processes that uses linear prediction error filters.
Briefly stated, the present invention provides an apparatus and method for improving the detection of signals obscured by either correlated Gaussian or non-Gaussian noise plus additive jamming interference and thermal white Gaussian noise. Estimates from multi-channel data of model parameters that describe the noise disturbance correlation are obtained from data that contain signal-free data vectors, referred to as xe2x80x9csecondaryxe2x80x9d or xe2x80x9creferencexe2x80x9d cell data. These parameters form the coefficients of a multi-channel whitening filter. A data vector, referred to as the xe2x80x9ctest cellxe2x80x9d or xe2x80x9cprimaryxe2x80x9d data vector, to be tested for the presence of a signal passes through the multi-channel whitening filter. The filter""s output is then processed to form a test statistic. The test statistic is compared to a threshold value to decide whether a signal is xe2x80x9cpresentxe2x80x9d or xe2x80x9cabsentxe2x80x9d. Embodiments of the apparatus and method include estimating the signal amplitude both implicitly and explicitly and calculating test statistics for signal detection in both Gaussian and non-Gaussian noise.
According to an embodiment of the invention, in a system for processing signals, a method for identifying presence or absence of at least one potential target comprises the steps of: receiving from multiple channels signals corrupted by Gaussian or non-Gaussian disturbance; partitioning the signals into secondary data having a low probability of containing the potential target and primary data to be assessed for the presence of the target; estimating at least one linear filter parameter from the secondary data; filtering at least one steering vector and the primary data with at least one whitening filter based on the at least one linear filter parameter to produce at least one steering vector residual and at least one primary data residual; calculating a first test statistic as a function of the at least one linear filter parameter, the at least one steering vector residual, and the at least one primary data residual; and comparing the first test statistic to a threshold value to provide a xe2x80x9ctarget presentxe2x80x9d or a xe2x80x9ctarget absentxe2x80x9d response when the signals are corrupted by Gaussian disturbance.
According to a feature of the invention, in a system for processing signals, a method for identifying presence or absence of at least one potential target comprises the steps of: receiving from multiple channels signals corrupted by Gaussian or non-Gaussian disturbance; partitioning the signals into secondary data having a low probability of containing the potential target and primary data to be assessed for the presence of the target; estimating at least one linear filter parameter from the secondary data; filtering at least one steering vector and the primary data with at least one whitening filter based on the at least one linear filter parameter to produce at least one steering vector residual and at least one primary data residual; estimating signal amplitude as a function of the at least one linear filter parameter, the at least one steering vector residual, and the at least one primary data residual, thereby obtaining an estimated signal amplitude; multiplying the at least one steering vector residual by the estimated signal amplitude to obtain a scaled steering vector residual; subtracting the scaled steering vector residual from the at least one primary data residual to create an intermediate result; calculating a first quadratic term as a function of the at least one primary data residual and the at least one linear filter parameter; calculating a second quadratic term as a function of the intermediate result and the at least one linear filter parameter; subtracting the second quadratic term from the first quadratic term to form a first test statistic; and comparing the first test statistic to a threshold value to provide a xe2x80x9ctarget presentxe2x80x9d or a xe2x80x9ctarget absentxe2x80x9d response when the signals are corrupted by Gaussian disturbance.
According to another feature of the invention, apparatus for processing signals from which to identify presence or absence of at least one potential target, comprises: means for receiving multi-channel signals containing the at least one potential target obscured by Gaussian or non-Gaussian disturbance; means for partitioning the signals into secondary data having a low probability of containing the potential target and primary data to be assessed for the presence of the potential target; means for estimating at least one linear filter parameter from the secondary data; means for filtering at least one steering vector and the primary data with at least one whitening filter based on the at least one linear filter parameter to produce at least one steering vector residual and one primary data residual; first calculating means for calculating a first test statistic as a function of the at least one linear filter parameter, the steering vector residual, and the primary data residual; and means for comparing effective for comparing the first test statistic to a threshold value to provide a xe2x80x9ctarget presentxe2x80x9d or a xe2x80x9ctarget absentxe2x80x9d response when the signals are corrupted by Gaussian disturbance.
According to still another feature of the invention, apparatus for processing signals from which to identify presence or absence of at least one potential target, comprises: means for receiving multi-channel signals containing the potential target obscured by Gaussian or non-Gaussian disturbance; means for partitioning the signals into secondary data having a low probability of containing the potential target and primary data to be assessed for the presence of the potential target; means for estimating at least one linear filter parameter from the secondary data; means for filtering at least one steering vector and the primary data with at least one whitening filter based on the at least one linear filter parameter to produce at least one steering vector residual and one primary data residual; first calculating means for calculating an estimate of signal amplitude as a function of the at least one linear filter parameter, the steering vector residual, and the primary data residual; means for multiplying the filtered steering vector residual by the estimate of signal amplitude to create a scaled steering vector residual; first subtracting means for subtracting the scaled steering vector residual from the primary data residual to create an intermediate result; second calculating means for calculating a first quadratic term as a function of the primary data residual and the at least one linear filter parameter; third calculating means for calculating a second quadratic term as a function of the intermediate result and the at least one linear filter parameter; second subtracting means for subtracting the second quadratic term from the first quadratic term to form a first test statistic; and means for comparing the first test statistic to a threshold value to provide a xe2x80x9ctarget presentxe2x80x9d or a xe2x80x9ctarget absentxe2x80x9d response when the signals are corrupted by Gaussian disturbance.
The apparatus and method of the present invention provide a multi-channel receiver that improves the detection of target signals in the presence of either Gaussian or non-Gaussian correlated clutter together with additive jamming interference and thermal white noise. Further, the present invention provides such improved target detection without requiring knowledge of the clutter statistics. The present invention improves detection for radar, sonar, biomedical diagnostics, geophysical data processing, etc., where the input data contain either Gaussian or non-Gaussian disturbance. This improvement is achieved through the signal processing architecture and computational procedure described below.
Several important features of the present invention are: (1) it can process both single and multiple channel data; (2) the implementation described below applies to the detection of a signal with unknown amplitude embedded in disturbances of unknown correlation; (3) the detection architecture is canonical for non-Gaussian clutter described by spherically invariant random processes (xe2x80x9cSIRPsxe2x80x9d) (Rangaswamy, M., et. al., xe2x80x9cComputer generation of correlated non-Gaussian radar clutter,xe2x80x9d IEEE Trans. on Aerospace and Electronic Systems, vol. AES-31, pp. 106-116, 1995), i.e., the circuitry does not change when the statistics of the input data processes change; (4) the minimum mean squared error (MMSE) parameter estimators in the present invention are linear for the large class of non-Gaussian SIRPs that comprise the disturbance; (5) the implementation described below for the K (.alpha.=0.5)-receiver offers robust performance for a wide range of non-Gaussian as well as Gaussian noise, where .alpha. is the shape parameter of the clutter probability density function (xe2x80x9cpdfxe2x80x9d).
In the present invention, the unknown disturbance correlation is estimated from secondary data by means of parametric adaptive estimation algorithms. However, the estimate of signal amplitude is now embedded directly into the detection test statistic. Thus a large covariance matrix requiring approximately 2 JN range cells is no longer required, with the result that high detection performance can be achieved with a very low number of range cells.
In a preferred embodiment of the present invention for the detection of moving objects from an airborne radar, the processing system uses baseband sensor data from the A/D converters of an airborne phased array radar. This sensor data is organized as a J.times.1 vector sequence, where each element of the vector corresponds to a particular array element (or column), and each index in the sequence corresponds to a time sample that relates to a specific transmitted pulse of the N pulse coherent processing interval (xe2x80x9cCPIxe2x80x9d). A third dimension of the data is obtained from the K range rings measured from the radar. These range rings are swept by each pulse, thus providing K with Jxc3x971 observation data vectors in fast time for each of the N pulses in slow time. Thus, the data can be stacked in a data cube of dimension Jxc3x97Nxc3x97K.
To determine the presence or absence of a target, data are chosen from a specific range cell, the xe2x80x9ctest cellxe2x80x9d. Data from range cells immediately surrounding the test cell are xe2x80x9cguard bandxe2x80x9d cell data. Several procedures can determine the disturbance""s (e.g., ground clutter, jamming interference, thermal white noise) correlation properties. In one procedure, both the test cell and guard band data are removed from the data cube, leaving the xe2x80x9csecondaryxe2x80x9d or xe2x80x9creferencexe2x80x9d cell vectors, which are assumed to be signal free. In an alternative procedure, no vectors are removed from the data cube.
Linear parametric models (xe2x80x9cLPMsxe2x80x9d) describe the noise disturbance correlation. There are two general classes of such models for vector random processes: time series and state space. Either kind of LPMs falls within the intended scope of the present invention. Any of several multi-channel algorithms can estimate the parameters of the respective model types. The multichannel least squares (MLS) algorithm (S. L. Marple, Digital Spectral Analysis, Prentice Hall, 1987), Nuttall-Strand (Nuttall, A. H., xe2x80x9cMultivariate linear predictive spectral analysis employing weighted forward and backward averaging: A generalization of Burg""s algorithm,xe2x80x9d Naval Underwater Systems Center TR-5501, New London, Conn. October 1976; Strand, O. N., xe2x80x9cMulti-channel complex maximum entropy (auto-regressive) spectral analysis,xe2x80x9d IEEE Trans. Antom. Control, vol, AC-22, pg 634-640, August 1977) and Vierra-Morf (Morf, M., Vierra, A., Lee, D., Kailath, T., xe2x80x9cRecursive Multi-channel maximum entropy spectral estimation,xe2x80x9d IEEE Trans. on Geoscience Electronic, vol GE-16, no 2, April 1978) are algorithms that apply to time series models. A number of recently-developed multi-channel state space algorithms (Roman, J., Davis, D., xe2x80x9cMulti-channel Parametric Models for Airborne Radar Array Clutter,xe2x80x9d 1997 IEEE National Radar Conference, Syracuse, N.Y., May 13-15, 1997) apply to state space models. The model parameters estimated from any candidate algorithm form the coefficients in a multi-channel whitening filter. Both the data vector from the test cell and the known steering vector written in time sequential form are passed through this filter. The output vectors from the multi-channel whitening filter are then processed to form a scalar xe2x80x9ctest statistic.xe2x80x9d The xe2x80x9ctest statisticxe2x80x9d is then compared to a threshold value to decide whether a signal is present or absent.
The following definitions serve to clarify the present invention:
A/D Converter: a device that converts analog signals to digital signals.
Adaptive Matched Filter: a matched filter detector in which the disturbance covariance matrix is replaced with its estimate.
Clutter Shape Parameter (a): is the parameter that changes the K-distribution for clutter from Gaussian (xcex1="igr"xcexdxcfx86) to a high tailed probability density function (xcex1=0.1). Coefficients of Linear Prediction: the coefficients that weight a linear combination of time series of past data from a given process to estimate the process at some point in time.
Coherent Processing Interval (CPI): the number of pulses generated by a radar in an interval of time over which the radar maintains phase coherence.
Constant False Alarm Rate (CFAR): attribute of a receiver that maintains the false alarm rate fixed in the presence of changing interference levels.
Data Cube: the organization of data consisting of various channels, range cells, and pulses into a three-dimensional configuration for storage.
Diagonal Matrix: a matrix with whose elements are non-zero only along the diagonal.
Diagonal Matrix Coefficient (D): obtained from the LDL decomposition of either the model residual covariance matrix or the sample residual covariance matrix estimates.
Disturbance: all unwanted noise that interferes with the desired signal.
False Alarm: the decision that a signal is present when in fact it is not.
Fast Time: the round-trip time delay, as measured between range cells, of a single radar pulse (which travels at the speed of light).
Guard Band: the data, collected from range rings adjacent to the test cell, which are eliminated from the secondary data cells before estimating the disturbance statistics.
Host System: the system supported by the present invention.
Input Signal-to-Interference plus Noise Ratio: the ratio of the filter input signal power to the input power of the interference and white noise.
Linear Filter Parameters: the estimated coefficients of linear prediction used in the whitening filter of the parametric adaptive matched filter.
Matched Filter: in the context of this application, a linear filter that maximizes the output signal-to-interference-plus-noise ratio.
Model Residual Covariance: the estimated error covariance matrix obtained from a parameter estimation algorithm such as Nuttall-Strand.
Output Signal-to-Interference plus Noise Ratio: the ratio of the filter output signal power to the output power of the interference and white noise.
Prediction Error Filter: a filter that provides the difference operation between the input signal and its estimate formed by the weighted sum of past data values.
Range Rings: the concentric lines of constant range measured from the radar location, each with a width related to the radar bandwidth.
Reference Cell Data: data collected from range rings assumed to be free of the desired signal (also called secondary data).
Sample Covariance Matrix: the estimator of the covariance of a data vector process obtained from the mean of the outer products of the multiple realizations of the data vector.
Sample Residual Covariance: the estimated error covariance matrix obtained by applying the sample covariance matrix estimator to the prediction error filter output data.
Secondary Data: data collected from range rings assumed to be free of the desired signal.
Signal to Interference plus Noise Ratio (SINR): is the ratio of target signal power (or amplitude) to the sum of interference and noise power (or amplitude).
Slow Time: the interval between successive pulses from the radar.
Spherically Invariant Random Process: results from the modulation of a Gaussian process by a statistically independent random variable.
Signal Steering Vector: contains the bearing and Doppler information associated with a radar signal.
Test Cell Data: contained in the radar range cell under test for the presence or absence of a radar signal.
Test Statistic: a scalar quantity, computed from received radar data and compared to a pre-determined threshold value to determine the presence or absence of a radar signal.
Threshold: a scalar quantity compared to a test statistic to determine the presence or absence of a desired signal and chosen to maintain a specific criterion, such as the cost associated with correct and incorrect decisions or the specification of the probability of a false alarm.
Time Sequential Form: in the context of the present invention, the formatting of a signal or data vector as a time series.
Whitening Filter: transforms the correlated input data to uncorrelated white noise.
Zero Memory Non-linear Transform: method of transforming blocks of data to maintain dependence between the individual blocks.
The above and many other objects and advantages of the present invention will be readily apparent to one skilled in the pertinent art from the following detailed description of preferred embodiments of the invention and the related drawings, in which like reference numerals designate the same elements. | 2024-02-11T01:26:18.401715 | https://example.com/article/3308 |
/*
* Copyright (c) 2004-present, Facebook, Inc.
*
* This source code is licensed under the MIT license found in the LICENSE
* file in the root directory of this source tree.
*
*/
#pragma once
#include <jni.h>
#include "Common.h"
#include "References.h"
namespace facebook {
namespace jni {
namespace detail {
// In order to avoid potentially filling the jni locals table,
// temporary objects (right now, this is just jstrings) need to be
// released. This is done by returning a holder which autoconverts to
// jstring.
template <typename T>
inline T callToJni(T&& t) {
return t;
}
template <typename T>
inline JniType<T> callToJni(local_ref<T>&& sref) {
return sref.get();
}
// Normally, pass through types unmolested.
template <typename T, typename Enabled = void>
struct Convert {
typedef T jniType;
static jniType fromJni(jniType t) {
return t;
}
static jniType toJniRet(jniType t) {
return t;
}
static jniType toCall(jniType t) {
return t;
}
};
// This is needed for return conversion
template <>
struct Convert<void> {
typedef void jniType;
};
// jboolean is an unsigned char, not a bool. Allow it to work either way.
template<>
struct Convert<bool> {
typedef jboolean jniType;
static bool fromJni(jniType t) {
return t;
}
static jniType toJniRet(bool t) {
return t;
}
static jniType toCall(bool t) {
return t;
}
};
// convert to alias_ref<T> from T
template <typename T>
struct Convert<alias_ref<T>> {
typedef JniType<T> jniType;
static alias_ref<jniType> fromJni(jniType t) {
return wrap_alias(t);
}
static jniType toJniRet(alias_ref<jniType> t) {
return t.get();
}
static jniType toCall(alias_ref<jniType> t) {
return t.get();
}
};
// convert return from local_ref<T>
template <typename T>
struct Convert<local_ref<T>> {
typedef JniType<T> jniType;
// No automatic synthesis of local_ref
static jniType toJniRet(local_ref<jniType> t) {
return t.release();
}
static jniType toCall(local_ref<jniType> t) {
return t.get();
}
};
// convert return from global_ref<T>
template <typename T>
struct Convert<global_ref<T>> {
typedef JniType<T> jniType;
// No automatic synthesis of global_ref
static jniType toJniRet(global_ref<jniType>&& t) {
// If this gets called, ownership the global_ref was passed in here. (It's
// probably a copy of a persistent global_ref made when a function was
// declared to return a global_ref, but it could moved out or otherwise not
// referenced elsewhere. Doesn't matter.) Either way, the only safe way
// to return it is to make a local_ref, release it, and return the
// underlying local jobject.
auto ret = make_local(t);
return ret.release();
}
static jniType toJniRet(const global_ref<jniType>& t) {
// If this gets called, the function was declared to return const&. We
// have a ref to a global_ref whose lifetime will exceed this call, so we
// can just get the underlying jobject and return it to java without
// needing to make a local_ref.
return t.get();
}
static jniType toCall(global_ref<jniType> t) {
return t.get();
}
};
template <typename T> struct jni_sig_from_cxx_t;
template <typename R, typename... Args>
struct jni_sig_from_cxx_t<R(Args...)> {
using JniRet = typename Convert<typename std::decay<R>::type>::jniType;
using JniSig = JniRet(typename Convert<typename std::decay<Args>::type>::jniType...);
};
template <typename T>
using jni_sig_from_cxx = typename jni_sig_from_cxx_t<T>::JniSig;
} // namespace detail
template <typename R, typename... Args>
struct jmethod_traits_from_cxx<R(Args...)> : jmethod_traits<detail::jni_sig_from_cxx<R(Args...)>> {
};
}}
| 2024-04-07T01:26:18.401715 | https://example.com/article/9286 |
---
author:
- 'Sergeyev Ya.D.'
- 'Sergeyev Ya.D.'
- 'Sergeyev Ya.D.'
- 'Sergeyev Ya.D.'
- 'Sergeyev Ya.D.'
- 'Nelson E.'
- 'Hrbaček K.'
- 'Kawai T.'
- 'Kanovei V. and Reeken M.'
- 'Gordon E.I., Kusraev A.G., and Kutateladze S.S.'
- 'Gutman A.E. and Kutateladze S.S.'
---
A.E.Gutman[^1]\
S.S.Kutateladze
A trivial formalization is given for the informal reasonings presented in a series of papers by Ya.D.Sergeyev on a positional numeral system with an infinitely large base, grossone; the system which is groundlessly opposed by its originator to the classical nonstandard analysis.
[**Mathematics Subject Classification (2000):** ]{} 26E35.
[**Keywords:** ]{} nonstandard analysis, infinitesimal analysis, positional numeral system.
In recent years Ya.D.Sergeyev has published a series of papers [@S1; @S2; @S3; @S4; @S5] in which a positional numeral system is advanced related to the notion of grossone[^2]. Ya.D.Sergeyev opposes his system to nonstandard analysis and regards the former as resting on different mathematical, philosophical, etc. doctrines. The aim of the present note is to properly position the papers by Ya.D.Sergeyev on developing numeral systems. It turns out that a model of Ya.D.Sergeyev’s system is provided by the initial segment $\{1,2,\dots,\nu!\}$ of the nonstandard natural scale up to the factorial $\nu!$ of an arbitrary actual infinitely large natural $\nu$. Such a factorial serves as a model of Ya.D.Sergeyev’s grossone, thus demonstrating the place occupying by the numeral system he proposed.
As the main source we have chosen [@S4], the latest available paper by Ya.D.Sergeyev, which contains a detailed description of his basic ideas.
In the present note we are about to show that, contrary to what is expected by the author of [@S4], his indistinct definitions of grossone and the concomitant notions admit an extremely accurate and trivial formalization within the classical nonstandard analysis.
Use the formalism of the internal set theory IST by E.Nelson [@N] or any of the classical external set theories, for instance, EXT by K.Hrbaček [@H] or NST by T.Kawai [@K] (see also the monographs [@KR; @GKK]). As usual, ${}^\circ\!X$ denotes the standard core of a set $X$, i.e., the totality of all standard elements of $X$. In particular, ${}^\circ{\Bbb N}$ is the totality of all finite (standard) naturals. Fix an arbitrary infinitely large natural $\nu$ and denote its factorial by ${\GrossOne}$: $${\GrossOne}=\nu!\,,\quad\text{where }\,\nu\in{\Bbb N},\ \nu\approx\infty.$$ Show that ${\GrossOne}$ possesses all properties of “grossone” (postulated as well as implicitly presumed in [@S4]).
A possible approach to an adequate formalization (in the sense of [@S4]) of the notion of size or “the number of elements” of an arbitrary set $A$ of standard naturals (i.e., of an external subset $A\subset{}^\circ{\Bbb N}$) consists in assigning the natural $\|A\| = |{}^*\!A\cap\{1,2,\dots,{\GrossOne}\}|$ to each $A$, where ${}^*\!A$ is the standardization of $A$ and $|X|$ is the size (in the usual sense) of a finite internal set $X$. In this case it is clear that $\|{}^\circ{\Bbb N}\|={\GrossOne}$, which agrees with the fore-quoted “definition” of grossone. Note also that, due to the external induction, the function $A\mapsto\|A\|$ possesses the additivity property (presumed in [@S4]): $\bigl\|\bigcup_{k=1}^n A_k\bigr\| = \sum_{k=1}^n\|A_k\|$ for every family of pairwise disjoint sets $A_1,\dots,A_n\subset{}^\circ{\Bbb N}$, $n\in{}^\circ{\Bbb N}$.
Another approach (which is more trivial and considerably closer to that of [@S4]) to defining the number of elements consists in “replacing” the set ${}^\circ{\Bbb N}$ with the initial segment $${\Cal N}=\{1,2,\dots,{\GrossOne}\}$$ of the natural scale and considering the usual size $|A|\in{\Bbb N}$ of each internal set $A\subset{\Cal N}$. In this case, again, $|{\Cal N}|={\GrossOne}$; and the additivity of the counting measure $A\mapsto|A|$ needs no argument.
While crediting the author of [@S4] for the audacious extrapolation of the properties of the number $3$, we nevertheless cannot accept the fore-quoted agreement if for no other reason than the fact that the set ${\Bbb N}$ of naturals (in the popular sense of this fundamental notion) has no greatest element (with respect to the classical order). In order to keep the traditional sense for the symbol ${\Bbb N}$ (and being governed by “Postulate 3. [*The part is less than the whole*]{}” of [@S4]), instead of reusing this symbol for the proper subset $\{1,2,\dots,{\GrossOne}\}\subset {\Bbb N}$ we decided to give the latter a less radical notation, ${\Cal N}$.
Since ${\GrossOne}=\nu!$ is an infinitely large number, it satisfies [*Infinity*]{}. Every natural meets [*Identity*]{}, and so does ${\GrossOne}$. Presenting the factorial of an infinitely large number, ${\GrossOne}$ is divisible by every standard natural. Moreover, if $n\in{}^\circ{\Bbb N}$, $1\leqslant k\leqslant n$, and $$\begin{aligned}
{}^\circ{\Bbb N}_{k,n}&=\{k+(m-1)n\,:\,m\in{}^\circ{\Bbb N}\},\\
{\Cal N}_{k,n}&={\Cal N}\cap\{k+(m-1)n\,:\,m\in{\Bbb N}\};\end{aligned}$$ then $\|{}^\circ{\Bbb N}_{k,n}\|=|{\Cal N}_{k,n}|=\frac {\grossOne} n$. Hence, ${\GrossOne}$ meets [*Divisibility*]{}.
If a number is declared natural, it naturally cannot occur unnatural. To remove all doubts, we suggest a rigorous and detailed justification for satisfiability of the above postulate: for every $n\in{}^\circ{\Bbb N}$ we have $n<\nu$ and thus $$\text{the number }\ \frac{\GrossOne} n=\frac{\nu!}n=
\frac{1\mathbin{\boldsymbol\cdot} 2\mathbin{\boldsymbol\cdot}\ldots
\mathbin{\boldsymbol\cdot} n\mathbin{\boldsymbol\cdot}\ldots\mathbin{\boldsymbol\cdot}\nu}n\ \text{ is integer}.$$
Indeed, ${\GrossOne}\in\{1,2,\dots,{\GrossOne}\}={\Cal N}$, but ${\GrossOne}+1\notin\{1,2,\dots,{\GrossOne}\}={\Cal N}$. (However, taking it into account that ${\Cal N}$ is not the set of all naturals, the above trivial observation is unlikely “interesting.”)
In fact, ${}^\circ{\Bbb N}$ and ${\Cal N}$ are both proper subsets of the set ${\Bbb N}$ of [*all*]{} naturals. (As is known, the radical formalism of IST saves us from considering “extended numbers.”)
We permit ourselves to pass over other numerous descriptions of the properties of grossone and the accompanying notions in [@S4], since the corresponding analysis is quite analogous to that above (and equally trivial). However, we cannot help commenting the declared elimination of Hilbert’s paradox of the Grand Hotel:
The following unpretentious “paradox of the Gross Hotel” is brought to the audience’s attention: Even though all the grossrooms $1,2,\dots,{\GrossOne}$ are occupied, it is easy to accommodate one more client in the Gross Hotel. To this end it suffices to move the guest occupying room $n$ to room $n+\nobreak1$ for each [*finite*]{} $n$. Since $n+1<{\GrossOne}$ for all finite $n$, all the former guests get their rooms in the Gross Hotel, while room 1 becomes free for a newcomer.
Besides a babbling theorization around grossone, [@S4] includes an “applied” part dedicated to a new positional numeral system with base ${\GrossOne}$. (The system is meant for becoming a foundation for “Infinity Computer” [@S5] which is able to operate infinitely large and infinitesimal numbers.) Unfortunately, the corresponding exposition remains highly informal, and even crucial definitions are substituted with allusions and illustrating examples.
In the fore-quoted definitions, combinations of the terms “finite,” “infinite,” and “number” seem to be used quite vaguely. For instance, it is unclear from the text whether a numeral is assumed infinite (and in what sense) if it is not finite (in some sense). Following the definitions of [@S4] literally, a grosspower can be finite, infinite, and (or?) infinitesimal, while “finite” means $c{\mskip1mu}{\GrossOne}^0$ (a grossdigit $c$, a rational numeral), “infinite” is expressed by a numeral having al least one strictly positive grosspower, and “infinitesimal” is a numeral whose grosspowers are all strictly negative. Seemingly, this implies that a grosspower cannot be equal to, say, ${\GrossOne}^0+{\GrossOne}^{-1}$, but the subsequent examples of [@S4] show that this is not so, and arbitrary numerals can serve as grosspowers. In addition, the reason is completely unclear for choosing the terms “infinite” and “infinitesimal” exactly for the classes of numerals mentioned in the quote. For instance, the numeral $a={\GrossOne}^{{\grossOne}{\raise-6pt\hbox{$^{^{-1}}$}}}$ (with grosspower ${\GrossOne}^{-1}>0$) is “infinite” by definition, while, obviously, $1<a<2$. On the other hand, the numeral $b={\GrossOne}^{{\grossOne}{\raise-6pt\hbox{$^{^{-1}}$}}}{\mskip-8mu}-1$ is also considered “infinite” and not “infinitesimal,” while, as is easily seen, $b$ is infinitely close to zero in the sense that $-c<b<c$ for every finite $c>0$.
Regardless of terminological discipline, the fore-quoted definition of numerals $C$ cannot be considered formal if for no other reason than the participating notion of (“infinite” and “infinitesimal”) grosspowers depends on the initial notion of numeral, thus leading to a vicious circle. In addition, from the illustrations of [@S4] it is clear that the positional system proposed admit syntactically different numerals with coincident values: for instance, $0{\mskip1mu}{\GrossOne}^0\equiv0{\mskip1mu}{\GrossOne}^1$, $1{\GrossOne}^0\equiv1{\GrossOne}^{\hbox{\footnotesize0}\mskip2mu{\raise4.3pt\hbox{\grossOneN}}^{\mskip1mu0}}$. (The notion of the value of a term and the equivalence relation $\equiv$ are clarified in [@GK].) At the same time, [@S4] misses not only the corresponding stipulations (easy to guess though) but also any attempts of justifying the unambiguity of the positional system, even under implicit stipulations. Observe also that the description of [@S4] for the algorithms of calculating the sum and product of numerals (i.e., of finding the corresponding equivalent numeral) is very superficial, since it does not touch upon the problem of recognizing equivalent numerals (which is necessary for collecting similar terms) and that of comparing them (which is necessary for collating the summands in order of their “grosspowers”). It is thus not surprising that the patent application [@S5] reports on the development of “Infinity Calculator” which is able to handle numerals admitting “finite exponents” only.
To provide some justification, we briefly described in [@GK] one of the possible approaches to formalization of the notion of numeral as well as the corresponding algorithmic procedures.
[10]{}
, Edizioni Orizzonti Meridionali, Cosenza (2003).
Scheria, [**26-27**]{}, 63–72 (2005).
Periodico di Matematiche, [**6(2)**]{}, 11–26 (2006).
Chaos, Solitons & Fractals, [**33(1)**]{}, 50–75 (2007).
International patent application, submitted 08.03.04.
Bull. Amer. Math. Soc., [**83**]{}, No.6, 1165–1198 (1977).
Fund. Math., [**98**]{}, No.1, 1–24 (1978).
in: , Springer-Verlag, Berlin etc., 57–65 (1981).
, Springer-Verlag (Springer Monogr. in Math.), Berlin (2004).
, Nauka, Moscow (2008).
Siberian Math. J., [**49**]{}, No.5 (2008), to appear.
[*Alexander E. Gutman*]{}
[*Semën S. Kutateladze*]{}
[^1]: The work of the first author is supported by the Russian Science Support Foundation.
[^2]: The term “grossone” belongs to Ya.D.Sergeyev, has no relevance to the usual meaning of the noun “gross” in English, and stems most likely from “groß” in German or “grosso” in Italian.
| 2023-11-01T01:26:18.401715 | https://example.com/article/7536 |
Bandai is going to release the Figure-riseLABO Hoshino Fumina ( ホシノ・フミナ ) [The Second Scene] non-scale Plastic Model Kit from the anime “Gundam Build Fighters” series ( ガンダムビルドファイターズ ). Will be released in June 2019, 5,500 yen.
Official Gundam Build Fighters Battlogue homepage
http://gundam-bf.net/battlogue/
http://gundam-bf.net/battlogue/ via Bandai Hobby Site | 2024-02-20T01:26:18.401715 | https://example.com/article/4749 |
[Forming of the Pavlov pouch changes functional condition of the adherent mucosal layer in upper regions of the digestive tract].
In result of forming the Pavlov small gaster, secretion of pepsine in isolated part and, probable, in other parts of the gaster, was increased. This entailed a decrease in the pepsin sorption level on the luminal surface of adherent mucous layer of the gaster parts and intestine under study. This led to a drop of the level of structure glycoproteins and to increase in the per cent contents of polymeric glycoproteins in the whole pool of the mucous layer glycoproteins. The data obtained suggest that forming of the Pavlov small gaster indices significant changes of the adherent mucous layer structure-functional condition both in the gaster and in lower parts of the intestine. | 2024-05-03T01:26:18.401715 | https://example.com/article/6691 |
186 Cal.App.3d 1420 (1986)
231 Cal. Rptr. 414
THE PEOPLE, Plaintiff and Respondent,
v.
ELIGHA HARPER, Defendant and Appellant.
Docket No. F005293.
Court of Appeals of California, Fifth District.
November 7, 1986.
*1421 COUNSEL
Frank O. Bell, Jr., State Public Defender, under appointment by the Court of Appeal, and Joan Cavanagh, Deputy State Public Defender, for Defendant and Appellant.
John K. Van de Kamp, Attorney General, Eddie T. Keller, Eileen Ceranowski and Raymond L. Brosterhous II, Deputy Attorneys General, for Plaintiff and Respondent.
[Opinion certified for partial publication.[*]]
*1422 OPINION
AZEVEDO, J.[*]
Defendant Eligha Harper appeals from his conviction by jury of second degree murder (Pen. Code, § 187);[1] the jury found true an allegation that defendant personally used a firearm in the commission of the offense (§ 12022.5). Following denial of his motions for a new trial based on juror misconduct or, alternatively, for reduction of the verdict to voluntary manslaughter, defendant was sentenced to 15 years to life in prison with a 2-year enhancement imposed for the firearm use, for a total term of 17 years to life.
On appeal defendant contends his conviction must be reversed because (1) the trial court erred in denying his motion for a new trial based on alleged juror misconduct, and (2) the prosecutor committed Doyle error (Doyle v. Ohio (1976) 426 U.S. 610 [49 L.Ed.2d 91, 96 S.Ct. 2240]). Defendant also argues that the sentence imposed violates the constitutional proscription against cruel and unusual punishment. We disagree and affirm the judgment.
FACTS
In June 1984 defendant, then 70 years old, moved into the apartment of 51-year-old Leroy Wilson at Wilson's request. Wilson was in poor health, and his doctor had advised against Wilson living alone. Defendant slept on the couch and paid Wilson $90 per month. In July 1984 Elena Garcia, who had lived with Wilson for about a month and a half earlier in the year, moved back to the apartment. Since defendant was already renting the couch, Garcia slept with Wilson in the single bedroom.
In the early morning hours of July 17, Garcia invited her friend Teresa Ortiz back to the apartment. Wilson and the defendant were both at home, and Wilson gave Garcia permission for Ortiz to stay. Garcia then introduced Ortiz to defendant. The four sat around talking, and Wilson and defendant drank Thunderbird wine. Garcia had brought some groceries and a second bottle of Thunderbird for Wilson. Garcia and Ortiz injected heroin in the bathroom of the apartment and stayed up talking to Wilson and defendant for about an hour before both women went to bed in the bedroom.
Garcia was awakened about 9 a.m. the next morning by a loud argument between Wilson and defendant. Defendant accused Wilson of having had sex with both women all night long and told Wilson that he, defendant, *1423 now wanted to have sex with either of them. Wilson came into the bedroom and told Garcia defendant was very drunk and acting crazy. Garcia heard defendant making threats to kill Wilson, herself, and Ortiz. Garcia and Ortiz left the bedroom and went into the bathroom, where both women again injected heroin. Although Wilson did not appear to be drunk, defendant appeared very drunk. After about 10 minutes the women came out of the bathroom, and Garcia went into the kitchen to make breakfast.
From the kitchen Garcia could see part of the living room where the argument between Wilson and defendant was continuing. She saw defendant reach toward the sofa where he slept. Ortiz ran into the kitchen from the living room, telling Garcia that defendant had a gun. Garcia and Ortiz then ran out of the apartment, and on their way out both heard two shots. The last time Garcia saw Wilson, he was seated in his reclining chair. Neither Garcia nor Ortiz saw Wilson with a gun; Garcia had not heard Wilson make any threats. The two women ran to a neighboring apartment to borrow some clothing for Ortiz, who was wearing only her bra and panties, and to call the police. Garcia heard more shots, five or six in all, and the shots came one right after another.
Garcia testified she was not sure that defendant had actually shot Wilson as opposed to firing the gun into a wall or floor to emphasize a bluff. Therefore, both women returned to the apartment. Garcia opened the door a crack, and she saw defendant sitting at the kitchen table with a gun and a bottle of Thunderbird in front of him. Ortiz, who peeked in the window, testified that defendant was reading at the kitchen table. Garcia called softly for Wilson but got no response. She then spoke to defendant, asking him to come over to the door and talk to her. Garcia wanted to get defendant away from the gun on the table so she could get into the bathroom and retrieve her purse which still contained about one-half gram of heroin, for which Garcia had paid $150. Defendant told her he had killed Wilson and instructed Garcia to call the police. Garcia was successful in getting to the bathroom, and she glanced into the living room where she saw Wilson "kind of slooped back" and not moving. Some time later Garcia did call the Mendota Police Department, where she spoke with Chief Pena and with Officer Betty Barker.
Officer Barker was dispatched to the Mendota Garden Apartments about noon on July 17 in response to reports of gunshots. She received further information through a dispatch, relaying a telephone call from Garcia, that a man had been shot in apartment No. 139. Barker telephoned apartment 139, and when she asked to speak with Wilson, the male who answered (later identified as defendant) said, "No." Barker asked, "`Poppy, is this you?'"; defendant said, "`Yes'" and told Barker he had just shot his best *1424 friend. Barker tried to talk him into coming out of the apartment, but defendant broke off the conversation without giving any explanation for the shooting. Barker called a second time. Defendant told Barker that Wilson did not need any medical attention because he was dead. He again stated he did not want to come out but wanted Barker to come into the apartment and said he would not hurt her. Barker advised she could not comply. Defendant finally agreed to come out of the apartment and did so about 1 p.m. when he was taken into custody.
While Barker was transporting defendant to the police station, he stated numerous times that he had killed his best friend, that he had shot him. At the police station Barker Mirandized defendant and defendant responded, "I don't need an attorney. I killed my best friend. I shot him." Defendant said nothing else about what had happened; he provided no details of the shooting.
Dr. Jerry Nelson, the pathologist who performed the autopsy on Wilson, testified Wilson had been shot five times. Nelson found no evidence of powder burns or powder tattooing and concluded that the muzzle of the gun was at least two feet away from Wilson when he was shot. None of the wounds would have caused instant death, and death ultimately resulted from one bullet wound which penetrated the brain. Nelson also testified that a blood sample taken from defendant about 4 p.m. on July 17 revealed a blood alcohol level of .20. Wilson's blood alcohol level measured .17.
Lieutenant Vernon Banta of the Mendota Police Department also responded to the Mendota Garden Apartments and, upon entering apartment 139 after defendant's arrest, Banta observed Wilson's body in the living room in a rocking chair. Banta located two guns in the apartment, one a .32 caliber which appeared to be empty and was located under the sofa pillows and the second a fully loaded .38 caliber found on the kitchen table. The .32 caliber had been recently fired, but the .38 caliber did not appear to have been fired. Banta also observed some rounds of ammunition sitting atop a television and two .357 bullets lying next to the victim. Banta recovered three expended bullets from the apartment, two of which were under the victim, and recovered three more bullets at the autopsy. All of the bullets Banta seized had been fired from the .32 caliber gun.
Defense Case
Defendant testified in his own behalf. He had known Wilson since 1963. Although defendant had other housing arrangements in mind when he returned to Mendota, he accepted Wilson's invitation to stay with him. Defendant testified that Wilson owned three guns, a .57 (sic) Magnum, a .38 *1425 caliber snub-nosed revolver, and a .22 caliber German revolver. Because defendant cleaned the house, he knew where the guns were located. The .357 Magnum was kept in a broom closet, the .38 was kept under Wilson's bed pillow, and the .22 was kept in Wilson's reclining chair.
Early on July 16, Garcia offered to have sex with defendant for $20 so she could buy drugs. Although defendant protested because Garcia was Wilson's "woman," Wilson told defendant it was all right, and defendant "went through the motions." He then gave Garcia $20. Garcia left the apartment but returned for more money. When defendant refused to lend her the money, Wilson borrowed another $20 from defendant and left the apartment with Garcia. Wilson later returned alone with a six-pack of beer and a fifth of wine. Sometime after dark, Garcia returned with Ortiz. Although they were shaking and sick, defendant refused to lend either woman any more money until Wilson agreed to "stand" for $20 apiece; defendant told Wilson he would deduct it from the rent. The two women returned some time later and Wilson let them in. Garcia and Ortiz danced around the apartment in various stages of undress, injected heroin, and ultimately went to bed. Defendant went to bed about 4 or 5 a.m.
When defendant woke up, he decided to go and buy some beer, but he discovered that his wallet was missing from his pants. Defendant knocked on the bedroom door, and when Wilson answered, defendant told Wilson that one of the women had taken his wallet. Wilson went back into the bedroom, and defendant heard mumbling; then Wilson returned to the door of the bedroom and tossed defendant his billfold. Defendant had had eleven $20 bills in his wallet, of which only one remained. When defendant demanded the rest of his money, Wilson told defendant to get out of the house. Defendant persisted, and Wilson followed defendant into the living room. When Wilson sat down in his recliner and leaned over, defendant believed Wilson was going for the gun he kept in the chair. Defendant retrieved his own gun from under the sofa pillow and shot Wilson. Defendant believed Wilson would shoot him because defendant knew of Wilson's reputation for meanness and hatefulness and knew Wilson had shot at another man. The victim of this other shooting, 63-year-old Samuel Bridges, testified for the defense that Wilson had shot him in the face in an argument over a woman.
Defendant testified he had never told Officer Barker that he had shot Wilson because he thought Wilson was going to shoot him. When asked directly why he had shot Wilson, defendant responded, "[b]ecause I thought he was going to shoot me." Defendant further testified on cross-examination that although he told police repeatedly he had killed his best friend, he never mentioned anything about Wilson going for a gun. Defendant knew he fired his gun more than once but could not remember how many times.
*1426 DISCUSSION
I. Did the trial court err in denying defendant's motion for a new trial based on allegations of juror misconduct?
Defendant first contends the trial court committed reversible error in denying his motion for a new trial based on his allegations of juror misconduct. On the second day of jury deliberations, one juror, William McCaskill, attempted unsuccessfully to take a dictionary with him into the jury room but, nevertheless, recited to his fellow jurors the dictionary definition of murder which he had researched.
Initially, the Attorney General has conceded that these actions of Juror McCaskill did constitute misconduct as described by decisional law. (1a) "It is well settled that evidence obtained by jurors from sources other than in court is misconduct and constitutes grounds for a new trial if the defendant has been prejudiced thereby. [Citations omitted.] The misconduct creates a presumption of prejudice [citation omitted] which may be rebutted by a showing that no prejudice actually occurred [citations omitted]." (People v. Martinez (1978) 82 Cal. App.3d 1, 21 [147 Cal. Rptr. 208]; see also People v. Pierce (1979) 24 Cal.3d 199, 207-209 [155 Cal. Rptr. 657, 595 P.2d 91]; People v. Honeycutt (1977) 20 Cal.3d 150, 156 [141 Cal. Rptr. 698, 570 P.2d 1050].) Juror misconduct has also been found in "`statements made, or conduct, ... or events occurring, either within or without the jury room, of such character as is likely to have influenced the verdict improperly.' [Citations omitted.]" (People v. Neely (1979) 95 Cal. App.3d 1011, 1020 [157 Cal. Rptr. 531].) In light of respondent's concession, the question for this court, therefore, is whether the presumption of prejudice arising from juror misconduct has been rebutted in the instant case.
The standard for appellate review of a claim of juror misconduct was recently articulated in People v. Diaz (1984) 152 Cal. App.3d 926 [200 Cal. Rptr. 77]. There the court stated in pertinent part: "`[S]ince jury misconduct challenges the fundamental rights to an unprejudiced jury and the fairness of the trial proceedings, this issue is an independent appellate issue to be adjudicated by this court based upon the whole record.' [Citations omitted.] ...
".... .... .... .... .... .... .
(2) "Finally, a presumption of prejudice arises from any jury misconduct [citations omitted], which `may be rebutted by an affirmative evidentiary showing that prejudice does not exist or by a reviewing court's examination of the entire record to determine whether there is a reasonable probability *1427 of actual harm to the complaining party resulting from the misconduct.' [Citations omitted.] `Some of the factors to be considered when determining whether the presumption is rebutted are the strength of the evidence that misconduct occurred, the nature and seriousness of the misconduct, and the probability that actual prejudice may have ensued.' [Citation omitted.] In determining whether the presumption of prejudice has been rebutted, `it is clear that the usual "harmless error" tests for determining the prejudicial effect of an error (Chapman v. California (1967) 386 U.S. 18, 23-24 ...; People v. Watson [(1956)] 46 Cal.2d 818, 836 ...) are inapplicable. Convincing evidence of guilt does not deprive a defendant of the right to a fair trial [citation] since a fair trial includes among other things the right to an unbiased jury....' [Citations omitted.]" (People v. Diaz, supra, at pp. 933-935; see also People v. Neely, supra, 95 Cal. App.3d at pp. 1020-1021; People v. Martinez, supra, 82 Cal. App.3d at pp. 21-22.)
Cases dealing with juror misconduct consisting of receiving evidence outside of court are really not applicable to this case because no "evidence" was received outside of court; rather, the misconduct complained of consisted of one juror's out-of-court research into the definition of murder.
(3) In this regard, it is crucial, if not determinative, to keep in mind that the misconduct in this case was brought to the attention of the trial court before the jury had returned a verdict. Obviously, if such misconduct had been discovered after the verdict was rendered, the seriousness of the misconduct and its prejudicial impact on the jury would be difficult, if not impossible, to assess; thus the prosecution's burden to show such prejudice was rebutted would be almost insurmountable. However, when as in the instant case juror misconduct surfaces during deliberations and the trial court takes the opportunity to do all in its power to correct the error and obviate the prejudice, these efforts by the trial court become part of the record reviewable on appeal.
Defendant filed two juror declarations in support of his motion for a new trial, the first a declaration by John Durazo and the second by Sheri L. Johnson. The prosecutor, in turn, filed declarations in opposition to defendant's motion from all five male jurors on the panel, apparently because Durazo's initial allegations of racial bias were based on statements made by male jurors in the case.[2]
All the declarations state that on the second of two days of jury deliberation, one of the jurors recited a dictionary definition of murder which none of the declarants could recall, nor is the specific dictionary relied on *1428 identified. Moreover, the declarations are consistent that the juror who offered the extrajudicial definition "which did not jibe with the instructions given by the court as to the definition of murder" was immediately cautioned by other members of the jury that his definition could not be considered. Sheri Johnson declared the jurors then requested a reread of part of the district attorney's closing argument. Although the initial declaration of John Durazo filed in support of defendant's motion for a new trial states that "[t]he juror who recited the dictionary definition of murder was not a juror who initially supported a verdict of first degree murder," this is contradicted by the declaration of Jury Foreman Russell Pulliam. Pulliam declares that McCaskill himself caused the delay in reaching a unanimous verdict by holding out for first degree murder when all other jurors had agreed the verdict should be second degree murder.
Given the nature of the misconduct, the jurors' declarations that the offending member was immediately cautioned about his improper conduct might not be enough to rebut the presumption of prejudice after the verdict. However, in the instant case the impropriety was called to the attention of the trial court during deliberations. On the second day, the jury resumed deliberations at 9:07 a.m. At 11:17 the jury sent out a note. The note stated: "`Judge Creede, we have reached a stalemate. Although you have read the instructions on first and second degree murder so many times, there is among us those who cannot understand it or are trying to interpret the law under their own definitions. Someone actually looked murder up in a dictionary. We cannot seem to change or clarify this thinking, even after hours of argument. What can we do? ...'"[3]
Although defense counsel suggested to the court that this reading of an extrajudicial definition had tainted the jury, the court noted that "there are some types of misconduct that can be cured if they come to our attention in a timely manner.... This is the type that is, has the potential for being cured." When the jury was returned to the courtroom, the court gave them the following eloquent, cogent and off-the-cuff admonishment: "THE COURT: All right. Now, first of all, with regard to jurors bringing a dictionary or looking or anyone looking up murder in a dictionary, anyone on the jury who has looked up murder in a dictionary should put aside the dictionary definition and not consider it.
"As a judge, I do not get my definitions of crimes upon which you or any jury would receive instructions from a dictionary. I receive it from the *1429 statutes enacted by the legislature and by the decisions of the appellate courts, and not from a dictionary. Because we are dealing with sections of the Penal Code that define crimes, and those definitions of the crime are not contained in the dictionary. They are contained in the Penal Code as interpreted by court decisions.
"And therefore, anyone who would go to a dictionary definition is really violating your duties to decide the case on the law as given to you by the Court. So put aside anything you may have read any juror has read in a dictionary or put aside anything that a juror has told you about a dictionary definition or what the dictionary says, because that is using a standard that is not one that has been adopted by the legislature. And is not one that is a definition that has either that has been announced by the courts.
"And some of the definitions of crimes have, as stated in these instructions, they have been carefully reviewed by the legislature and the appellate courts on a frequent basis. Some are historical, some are not. But they have been reviewed to make certain that they are current. And in giving instructions to you, we have reviewed them to make certain that we are giving you the law as it existed on July 17th of 1984.
"All right. Now, well, with regard to Mr. you may not consider any dictionary definition. You should put aside any discussion or consideration of it."
Defendant argues that the vote of 11 to 1 could have occurred after the introduction of the dictionary definition, thus suggesting those jurors who had earlier been inclined to a conviction for voluntary manslaughter may have been prejudicially swayed by the improper definition. However, the Johnson declaration indicates that the three-way jury split occurred at the end of the first day of deliberations, and no juror was subsequently heard to announce he or she was taking a compromise position in voting for second degree murder. In light of the trial court's strong and unequivocal admonition that the dictionary definition was not to be considered, the more reasonable inference is that the definition did not affect the jurors' deliberation to defendant's prejudice. In fact, the Pulliam declaration suggests that McCaskill, who introduced the dictionary definition, was the lone holdout for first degree murder. If McCaskill was improperly swayed by the dictionary definition, it was an error to defendant's benefit, not his prejudice. Absent evidence to the contrary, a jury is presumed to follow the instructions of the trial court. Having been given a specific admonishment in light of misconduct by one of their members, it seems probable the jurors would more closely adhere to the instructions of the trial court and thus reduce *1430 the chance for prejudice. (Cf. People v. Underwood (1986) 181 Cal. App.3d 1223, 1238-1240 [226 Cal. Rptr. 840]; see also People v. Knights (1985) 166 Cal. App.3d 46, 51-52 [212 Cal. Rptr. 307].)
At the conclusion of the hearing on defendant's motion for a new trial, the court reviewed the admonitions given to the jury and noted that it was unnecessary to rely on a presumption the jurors had followed the admonition when the declarations made clear there was no further discussion of the dictionary definition. The court then stated: "And therefore, we find by a standard of beyond a reasonable doubt that the presumption of prejudice which arises from the dictionary being brought by one of the jurors and, apparently, some initial discussion of a brief nature on the subject was rebutted by the fact that we were able to bring the jury in, admonish them, that that was not the way to do it.
"And we also take note of the additional instructions that the Court gave the jury on the definition of the degrees of murder, and all the additional instructions that they requested on the subject.
"So on that issue, the Court determines by a standard of beyond a reasonable doubt, as shown by the declarations and also our admonition, and the further instructions we gave the jurors, that the presumption of prejudice has been rebutted."
(1b) We agree. The prosecution did successfully rebut the presumption of prejudice which arose when Juror McGaskill recited to his fellow jurors a dictionary definition of murder.
II., III.[*]
.... .... .... .... .... .... .
The judgment is affirmed.
Hanson (P.D.), Acting P.J., and Martin, J., concurred.
NOTES
[*] Pursuant to California Rules of Court, rules 976(b) and 976.1, this opinion is certified for publication with the exception of parts II and III.
[*] Assigned by the Chairperson of the Judicial Council.
[1] All further statutory references are to the Penal Code unless otherwise indicated.
[2] Juror misconduct based on racial bias was abandoned as a ground for this appeal.
[3] The prosecutor called to the trial court's attention the fact that the note from the jury initially referred to "`there is a juror,'" which was crossed out and changed to "`there is among us those.'"
[*] See footnote on page 1420, ante.
| 2023-08-07T01:26:18.401715 | https://example.com/article/9368 |
{
"_args": [
[
{
"name": "grunt",
"raw": "grunt@~0.4.5",
"rawSpec": "~0.4.5",
"scope": null,
"spec": ">=0.4.5 <0.5.0",
"type": "range"
},
"/home/tsayen/projects/dom-to-image"
]
],
"_from": "grunt@>=0.4.5 <0.5.0",
"_id": "grunt@0.4.5",
"_inCache": true,
"_installable": true,
"_location": "/grunt",
"_npmUser": {
"email": "cowboy@rj3.net",
"name": "cowboy"
},
"_npmVersion": "1.4.4",
"_phantomChildren": {},
"_requested": {
"name": "grunt",
"raw": "grunt@~0.4.5",
"rawSpec": "~0.4.5",
"scope": null,
"spec": ">=0.4.5 <0.5.0",
"type": "range"
},
"_requiredBy": [
"#DEV:/"
],
"_resolved": "https://registry.npmjs.org/grunt/-/grunt-0.4.5.tgz",
"_shasum": "56937cd5194324adff6d207631832a9d6ba4e7f0",
"_shrinkwrap": null,
"_spec": "grunt@~0.4.5",
"_where": "/home/tsayen/projects/dom-to-image",
"author": {
"name": "\"Cowboy\" Ben Alman",
"url": "http://benalman.com/"
},
"bugs": {
"url": "http://github.com/gruntjs/grunt/issues"
},
"dependencies": {
"async": "~0.1.22",
"coffee-script": "~1.3.3",
"colors": "~0.6.2",
"dateformat": "1.0.2-1.2.3",
"eventemitter2": "~0.4.13",
"exit": "~0.1.1",
"findup-sync": "~0.1.2",
"getobject": "~0.1.0",
"glob": "~3.1.21",
"grunt-legacy-log": "~0.1.0",
"grunt-legacy-util": "~0.2.0",
"hooker": "~0.2.3",
"iconv-lite": "~0.2.11",
"js-yaml": "~2.0.5",
"lodash": "~0.9.2",
"minimatch": "~0.2.12",
"nopt": "~1.0.10",
"rimraf": "~2.2.8",
"underscore.string": "~2.2.1",
"which": "~1.0.5"
},
"description": "The JavaScript Task Runner",
"devDependencies": {
"difflet": "~0.2.3",
"grunt-contrib-jshint": "~0.6.4",
"grunt-contrib-nodeunit": "~0.2.0",
"grunt-contrib-watch": "~0.5.3",
"semver": "2.1.0",
"shelljs": "~0.2.5",
"temporary": "~0.0.4"
},
"directories": {},
"dist": {
"shasum": "56937cd5194324adff6d207631832a9d6ba4e7f0",
"tarball": "https://registry.npmjs.org/grunt/-/grunt-0.4.5.tgz"
},
"engines": {
"node": ">= 0.8.0"
},
"homepage": "http://gruntjs.com/",
"keywords": [
"task",
"async",
"cli",
"minify",
"uglify",
"build",
"lodash",
"unit",
"test",
"qunit",
"nodeunit",
"server",
"init",
"scaffold",
"make",
"jake",
"tool"
],
"licenses": [
{
"type": "MIT",
"url": "http://github.com/gruntjs/grunt/blob/master/LICENSE-MIT"
}
],
"main": "lib/grunt",
"maintainers": [
{
"email": "cowboy@rj3.net",
"name": "cowboy"
},
{
"email": "tyler@sleekcode.net",
"name": "tkellen"
}
],
"name": "grunt",
"optionalDependencies": {},
"readme": "ERROR: No README data found!",
"repository": {
"type": "git",
"url": "git://github.com/gruntjs/grunt.git"
},
"scripts": {
"test": "grunt test"
},
"version": "0.4.5"
}
| 2023-08-12T01:26:18.401715 | https://example.com/article/7708 |
Lesbians in love, such a misunderstood topic in modern culture. It's not just about the color pink, or magical kisses in the rain. It's about two people in love who happen to be women. If you're a writer of femslash or simply a reader, stop in.
I want to make my story a one shot, though that's getting harder and harder when she won't stop talking to me. My major problem is whether to make this an origins story, or jump right into her established world like a true one shot would. There are just way too many details now. :(
Here. I thought I'd give you all a little taste of what I'm working on:
“Stop, evildoer, in the name of justice!”
The black figure did not look up. Two sleek, gloved hands continued shoving the priceless nanotechnology into a convenient hip-pouch. The sound of the pouch being zipped was unnaturally loud in the still night air.
“Wow, kitten, don’t get your panties in a bunch,” said a low female voice. “I’m just... borrowing these little bug thingies for someone.” A blue-tinted face peered at me out of the darkness, and though the eyes were partially hidden behind square, black-rimmed glasses, I thought I saw her wink. “Mmm, you are a cute one, aren’t you? I like the cat-suit. Do yourself a favor and go home, sweetie.”
Kitten? Kitten? I thought. Doesn’t this idiot know who I am? My face (or, well, my face behind a mask) had been plastered on the front page of every major newspaper for the past three weeks, ever since I had stopped that jewel heist at the National Bank.
“I don’t think you realize the gravity of your situation. I am Darkclaw, defender of all that is right–”
“Blah blah blah.” The black-gloved fingers tapped together like a talking mouth. My face burned. The blue skinned woman shoved her glasses up the bridge of her nose, adjusted her corset (how could she move in a corset, let alone commit crimes in one?), and rested her weight on one foot, her curvy hips swinging to the side. “You need to work on your delivery, Kit-Kat. You’re new to this, so I’ll give you a warning. Go home. You’re playing with the big girls now, and I’m the biggest.”
Maybe your ego is the biggest, I thought to myself, but I wasn’t sure if superheroes were allowed to be sarcastic, or just witty. “I’m afraid I can’t let you do that, Miss…?”
“You don’t have to let me do anything.” And without a parting comeback, the lean figure in the buckled corset and glasses was gone, pieces of hair falling out of her tight blue bun as she literally flew up into the air, blasting the ceiling apart as she went.
Well, sorry I haven't been around for awhile, regardless this topic caught my eye. I am interested in partaking and already have a story taking rough shape, and will be following roughly behind the 'hero' theme. I won't be able to really work on it for about two weeks, but after that I'm pretty much free and I should be able to get something out for this compilation.
I'm sorry for not updating in so long, I've been trapped in the middle of so many things the past two weeks. As a result my story isn't near finished. :( I'm really disappointed in myself, but that can be a good thing as we still have to decide on a few things.
I'd like to hear suggestions on an official date for the stories to be submitted so I can make a C2 for the compilation. It'll likely be small with probably 4-5 stories since that's about how many people are participating. I really think this can help spur interesting in femslash, and help out readers looking for some good fiction involving girls who like girls as the focus rather than a gimmick sub plot to lure you in.
Please post your questions and comments, and of course remember to check the rules at the top of this post first, it may answer your question.
IS IT TOO LATE TO JOIN??? I have a really good story idea, its called My Hero, and its not really superhero, its more like Batman: a person with loads of cool gadgets. PLease, please please can I join!!!!!
Due to a barrage of annoying classes, and the fact I bought The Sims 3 on Friday, I'm extending the deadline for submission to to the end of July.
I'm scrapping my story and starting fresh since it wasn't coming together at all. So everyone who has finished their story, thank you for your dedication and patience. You can use the free time to revise, or just talk about your story for the time being.
Lady Macbeth, you're more than welcome to join, I'll add your name to the list.
Sorry again everyone, I know this should have been finished a long time ago, but life keeps getting in the way and I want to post a quality story along with everyone else's.
Don't let go! The thing I do to keep my stories going is tell my sister that I am writing a short story, who then makes sure I finsh it on the pain of death :P. I told her too many unfinished stories when we were small, and now that she's bigger than me, she's making me pay for it. :D Anyway, I find that listening to music always helps if you don't have a turterous younger sister.....
Haha, I see. Yeah, I do listen to music whenever I write, and it tends to have an effect on how the story pans out. I have a friend who keeps pushing me to finish it, but it's just grinding to a halt at the moment. D: I'm trying to get it moving again by drawing the characters.
My story has devolved from a hero story into something completely different. The actual super hero story just isn't happening right now. That thing needs to be reworked from the ground up, and it exceeds to scope of this compilation. In place of that mirage of a story, I've decided to create another compilation story to my forever in development Aphrodite Academy novel.
I'm honestly not trying to come off as lazy, I've just been involved in many other stories at once (a horrible habit) and I've been inching this along to get it into the compilation. I just finished it last night, and have to go over it to fix any plot or other issues. So once again, my contribution is finished, for the most part. I hope people are still on board for this compilation. I know I've been terrible at keeping updates and motivating everyone to stick with it. Sorry :(
While I still have an idea for this, I've been procrastinating horribly. Life has been throwing curve balls at me and the words arn't coming as easily as they once did. Hopefully I'll be able to get my story done before this is all wrapped up.
Seeing as how this whole compilation failed horribly. I think we should try again with a fresh concept. The only issue for me is Nanowrimo 2009, though that's not until November. So I guess to anyone else who has completed their story, let me know what you want to do. I'm going to post mine since I'd rather not sit on it forever. | 2024-06-07T01:26:18.401715 | https://example.com/article/8635 |
Introduction {#Sec1}
============
Glioblastoma multiforme (GBM) is the most prevalent and biologically aggressive type of primary brain tumour in adults^[@CR1]^. Standard treatment is maximal surgical resection of a tumour followed by radiotherapy and temozolomide as an adjuvant chemotherapy^[@CR2]^. Despite these advanced treatments, the survival rate of GBM patients is still less than 5% over five years, with a median overall survival of merely 15--23 months^[@CR3]^. The factors that contribute to the high mortality are multifactorial. First and foremost, the diffuse invasion of GBM into brain parenchyma precludes complete surgical resection which leads to high recurrence^[@CR4]^. Recurring GBM are usually multi-drug resistant, rendering chemotherapy ineffective^[@CR5]^. On rare occasions, the high invasion and migration potential even leads to extracranial metastases^[@CR6]^.
The mechanisms of GBM invasion and migration are complex and encompasses the regulation of tumour microenvironment and of the molecular arrangement within the migrating GBM cells^[@CR7]^. To enable migration across the small perivascular space, GBM cells have been shown to reduce their volume by releasing cytoplasmic fluid^[@CR8]^. The reduction in cell size is particularly instrumental to GBM invasion into healthy brain tissue, since they migrate along pre-existing structures with high mechanical rigidity like blood vessels and myelinated nerve fibres^[@CR9]^. Besides the dramatic change in cell volume, GBM cells also rearrange the turnover of focal adhesions (FA) to facilitate migration. FA are temporal self-assembling complexes, which help the cells to form anchors with the extracellular matrix (ECM). Dynamics of several FA proteins, including integrin, vinculin, talin, and α-actinin, were shown to correlate to GBM cell traction force generation, which is associated with their adhesion to ECM and migration^[@CR10]^.
Deriving therapeutic counter measures against aforementioned infiltrative migration mechanisms employed by a cancer cell (such as the use of small molecules^[@CR11]^, peptides^[@CR12]^, RNA interference^[@CR13]^) has been an obvious approach to intervene cancer progression^[@CR14]^. Despite those discoveries, the pharmacokinetic challenges such as rapid degradation, clearance of those small molecules, and off-target adverse effects are still problematic in clinical translation. Their applications in GBM is particularly difficult, since the penetration of those agents across the blood--brain barrier (BBB) and targeted delivery into GBM are still the major bottlenecks^[@CR15]^.
Nanomedicines offer unprecedented advantages in targeted drug delivery into tumours, such as enhanced cellular uptake, controlled release of drugs, and protection of the agents from premature degradation^[@CR16]^. A range of nanoparticles (NP) have been developed to deliver small molecular drugs to inhibit cancer cell migration^[@CR17]--[@CR19]^. Interestingly, a few studies reported that NP treatments alone are inhibitory to cancer cell invasion of liver^[@CR20]^, cervical^[@CR21]^, and breast^[@CR22]^ origins. However, studies on the potential of NP treatments in attenuating GBM invasion and migration are absent, despite the hallmark of GBM being their infiltrative phenotype.
We sought to systematically investigate the effect of NP treatment on the migration potential of GBM cells. Porous silicon nanoparticle (pSiNP) were chosen as a model. pSiNP is a non-polymeric NP which possesses high surface area and biocompatibility. pSiNP also exhibits good biodegradability, the rate of which can be tuned over a wide time window (minutes to months) via surface modification to suit the desired biomedical applications^[@CR23]^. The dissolution product is silicic acid the non-toxic bioavailable form of silicon in the body^[@CR24],[@CR25]^. The versatile surface chemistry of pSiNP allows a wide range of conjugation chemistries^[@CR24]^. We conjugated pSiNP with human transferrin (Tf) to target GBM cells. Tf receptor (TfR) is one of the most commonly exploited cell surface targets for GBM, and the over-expression of TfR is conserved across the GBM biopsies^[@CR26]^. TfR expression is also reported at the vessel side of microvascular endothelial cells at the BBB, and the use of Tf as a targeting molecule has been reported to enhance shuffling therapeutics across BBB^[@CR27]^.
Most of the *in vitro* studies on cancer cell migration quantify migration by means of the scrape migration assay, whereby the speed of cell patches closure is positively correlated to their motility^[@CR28]^. However this assay has several limitations, such as the absence of chemotaxis-related directional migration^[@CR29]^, and the absence of a tightly confined microenvironment, that mimics the characteristic perivascular space that GBM cells infiltrate^[@CR30]^. Transwell models, which gauge cell migration through a perforated membrane with micron-sized pores, provide a better option, but the setup is largely incompatible to high-content imaging modalities and time-resolved studies that are essential to gaining mechanistic insights^[@CR31]^. Microfluidic chips constructed from transparent polymers and coverslips are becoming a popular option for oncology studies as they allow the implementation of chemotaxis-driven migration and high-content imaging^[@CR32]^.
In this work, we systematically studied the influence of Tf-modified pSiNP (Tf\@pSiNP) on GBM migration in a microfluidic-based cell migration chip. The chip comprised of microchannels that resemble the micron-scale perivascular space in brain parenchyma. We showed that Tf\@pSiNP enhanced internalisation into GBM U87 cells. Although Tf\@pSiNP were highly biocompatible and did not significantly affect ATP production in cells, Tf\@pSiNP treatment significantly discouraged U87 migration across the microchannels. We also observed that the extent of pSiNP uptake was negatively correlated to the success of cell migration across the microchannels. The potential mechanisms of the inhibition on GBM migration by pSiNP were further studied. Focal adhesions (FA) at the leading fronts of migrating U87 cells which had internalised the pSiNP appeared to be destabilised. This phenomenon may represent a lack of the traction needed for cell migration. In addition, we demonstrated that Tf\@pSiNP-internalised U87 cells with internalised Tf\@pSiNP were more resistive to hypertonic pressure-induced reduction of cell volume. Since GBM migration across microchannels required a dramatic reduction of cell volume, we posit that the presence of Tf\@pSiNP may inhibit U87 migration by attenuating the regulation of cell volume. Such inhibition has not been observed in a conventional scrape migration model which did not require the regulation of cell volume. In conclusion, our study proposes that Tf\@pSiNP treatment could potentially inhibit GBM cells from migrating. Together with the promise of pSiNP in targeted drug delivery, we believe that Tf\@pSiNP treatment could potentially applied to reduce GBM recurrence. We also envisage that the migration chip developed here also enables further study in the fundamental biology of GBM cell migration.
Results {#Sec2}
=======
Characterisation of Tf\@pSiNP {#Sec3}
-----------------------------
The conjugation of Tf onto pSiNP was performed as described in Fig. [1A](#Fig1){ref-type="fig"}, and the hydrodynamic particle size distribution and zeta potential were characterised by dynamic light scattering (DLS) with zeta-potential analyser. The shape of pSiNP was studied using cryogenic transmission electron microscopy (cryo-TEM) and Tf conjugation efficacy using inductively coupled plasma mass spectrometry (ICP-MS) respectively. DLS results, measured an average size of Tf\@pSiNP of 182 ± 0.8 nm, and the particle size distribution was narrow as indicated by a polydispersity index of 0.1 (Fig. [1B](#Fig1){ref-type="fig"}). The dimensions of Tf\@pSiNP revealed using cryo-TEM, corroborate the DLS results. The Tf\@pSiNP were mostly plate shaped (Fig. [1C](#Fig1){ref-type="fig"}). ICP-MS results showed that 1 mg of Tf\@pSiNP contains 0.61 ± 0.05 µg of Fe^2+^ ions. As the amount of Fe^2+^ per unit weight of Tf is known^[@CR33]^, this translated to 0.38 ± 0.03 mg of Tf per 1 mg of pSiNP. The zeta potential of carboxylated pSiNP before reaction was −14.4 $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\pm $$\end{document}$ 1.5 mV, while Tf\@pSiNP after reaction was −9.0 $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\pm $$\end{document}$ 0.6 mV. The unreacted carboxylate acid groups are believed to be the origin of the negative zeta potential.Figure 1Characterisation of transferrin (Tf) modified porous silicon nanoparticles (Tf\@pSiNP). (**A**) Schematic of Tf\@pSiNP. Sizes of pSiNP and Tf are not in scale. (**B**) Hydrodynamic particle size distribution of Tf\@pSiNP in PBS as measured by means of dynamic light scattering (DLS) using zeta-sizer. The zeta potential measured was −9.02 $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\pm $$\end{document}$ 0.64 mV. (**C**) Cryo-transmission electron microscopy image of Tf\@pSiNP in PBS. (**D**) Cellular uptake of Tf\@pSiNP and BSA\@pSiNP in U87 cells imaged by laser scanning confocal microscopy. (**E**) Internalisation of Tf\@pSiNP in U87 cells by cryo-TEM. The arrow heads show examples of Tf\@pSiNP within the vesicles.
To demonstrate the effect of Tf in enhancing pSiNP internalisation into GBM cells, bovine serum albumin-modified pSiNP (BSA\@pSiNP) were prepared as a control to delineating the role of Tf functionalisation in biological activities. Under cryo-TEM, BSA\@pSiNP appeared plate shaped (Supplementary Figure [1A](#MOESM1){ref-type="media"}) similar to Tf\@pSiNP. Hydrodynamic particle size and zeta potential of BSA\@pSiNP were 172 ± 4 nm and −9.9 ± 4.4, respectively (Supplementary Figure [1B](#MOESM1){ref-type="media"}), not significantly different from Tf\@pSiNP (p = 0.10, and p \> 0.99, respectively).
Tf modification on pSiNP enhanced cellular uptake by GBM cells {#Sec4}
--------------------------------------------------------------
Since Tf readily binds to TfR that is overexpressed in GBM cells, we aimed to evaluated whether the functionalisation of Tf would enhance Tf\@pSiNP cellular uptake by GBM cells (U87). By imaging Cy5-labeled BSA\@pSiNP and Tf\@pSiNP in exposed cells using confocal microscopy, higher fluorescence intensity of Cy5-Tf\@pSiNP (3 fold) was identified in the cytoplasm of GBM cells as compared to those exposed to Cy5-BSA\@pSiNP (Fig. [1D](#Fig1){ref-type="fig"}). This result indicates that Tf modification enhanced the uptake of pSiNP into U87 cells. It should be noted that BSA\@pSiNP was still taken up by U87 cells, although to a lesser degree. Unlike Tf, BSA is an inert protein abundantly present in serum and it is reported that BSA modification did not enhance NP uptake via clathrin-mediated receptor-mediated endocytosis^[@CR34]^. This explains that the uptake was apparently slower as detailed in our previous work^[@CR35]^. Additionally, the internalisation of Tf\@pSiNP in U87 cells was confirmed by means of cryo-TEM imaging (Fig. [1E](#Fig1){ref-type="fig"}).
Prior to investigating the biological roles of Tf\@pSiNP in GMB cells, biocompatibilities of Tf\@pSiNP and BSA\@pSiNP with U87 cells were examined via an ATP bioluminescence assay. Tf at a concentration of 38 µg/ml which was equivalent to the concentration of Tf for the Tf\@pSiNP samples was used as controls. It was shown that the ATP contents in both BSA\@pSiNP and Tf\@pSiNP treated U87 cells did not exhibit significant difference from untreated cells (Fig. [2A](#Fig2){ref-type="fig"}). Interestingly, cells exposed to Tf had a higher level of ATP, which may due to the increased metabolic activity enhanced by Fe^2+^ uptake^[@CR36]^. This result suggests that BSA\@pSiNP, Tf\@pSiNP and Tf did not negatively impact on the viability nor ATP level in U87 cells.Figure 2The effect of Tf\@pSiNP treatment on GBM cells viability and migration (conventional scrape migration assay). (**A**) Normalised cell viability of U87 cells exposed to Tf-pSiNP for 8 h revealed via an ATP viability assay (n = 3). (**B**) Montage of U87 closing the scraped area in a conventional scrape migration model over the period of 14 h. Red indicates cytoplasmic mCherry representing U87 cell bodies. (**C**) Quantification of the cell coverage over the scraped area after 7 and 14 h. Experiments were triplicated (n = 3, error bar = ±1 SD. \* Indicates p \< 0.05. Untreated (ctrl), BSA-conjugated pSiNP treated (BSA\@pSiNP), and free transferrin (Tf) treated cells were put as controls.
Towards a microfluidic GBM cell migration chip {#Sec5}
----------------------------------------------
Having confirmed that Tf-modification enhanced pSiNP cellular uptake, and was nontoxic to cells, we examined their effect on GBM cells migration using a conventional scrape-migration assay, which is one of the most common *in vitro* models in the studies of anti and pro migration parameters of cancer cells^[@CR37]^. Time-lapse imaging of U87 cell migration showed that the cells treated with Tf\@pSiNP, BSA\@pSiNP and Tf alone closed the scraped area at a similar rate and covered the empty spaces after 14 h (Fig. [2B](#Fig2){ref-type="fig"}). Cell coverage at the end of the study was quantified to indicate of the GBM cells motility. The data suggest that there was no significant difference between their rates in closing the scraped area, indicating the limited impact of Tf\@pSiNP on GBM cells motility (Fig. [2C](#Fig2){ref-type="fig"}). Interestingly, despite Tf exposure elevated ATP content in U87 cells, their migration was not significantly different to control and pSiNP exposed cells. However, it is important to note that the scrape-migration assay is highly simplistic compared to brain cancer cells migration in the brain microenvironment. For instance, chemotaxis and the cell shape modulations during migration in confined brain parenchyma were not considered here.
To better mimic the GBM migration characteristics, a "migration chip" model was used. The migration chip is composed of two main channels (500 µm wide) interconnected with 80 µm long microchannels with a cross-section of 3 µm (wide) × 3 m (height). Through quantitating the cell migration across the microchannels, the chip objectively reported how GBM cells migrate across tight spaces.
The uniformity of the microchannels were first affirmed by imaging the fluorescence of Cy5-labelled collagen I, that was coated onto the walls of microchannels (Supplementary Figure [1C](#MOESM1){ref-type="media"}). Blue and red food dyes were then injected into two main channels, respectively, to confirm the structural integrity of the chip (Fig. [3A](#Fig3){ref-type="fig"}). The two-coloured food dyes were not mixed instantly in the chip, indicating that the small size of microchannels efficiently lowered the rate of passive diffusion. The rate of mixing between the two main channels was further estimated by measuring the diffusion of fluorescence-labelled dextran from one of the main channels to another. A serum concentration gradient is commonly used to drive chemotaxis-mediated unidirectional migration of U87 cells across the microchannels. Our results show that a concentration gradient could be maintained up to 7--8 h (Supplementary Fig. [2A](#MOESM1){ref-type="media"}). This allowed us to mimic tight brain parenchyma and chemotaxis of GBM cells (Fig. [3B](#Fig3){ref-type="fig"}).Figure 3Schematic diagram and validation of migration chip for studying GBM cells migration. (**A**) Outlook of the migration chip. Red and blue dyes were injected to visualise two main channels with dimensions of 100 µm (H) × 500 m (W). The two channels were interconnected by microchannels (black arrow) with a cross-section of 3 µm (H) × 3 m (W). and length 80 µm. (**B**) Schematic illustration of the migration chip. Red box indicates U87 cells in the initial channel, where migrations was unrestricted. Motility was quantified and reported as free migration distance (FMD). "\*" and "^\#^" indicate cells that initiated migration, and completed migration across the microchannels, respectively. Cell migration was quantified and reported as cell migration index (CMI). The predicted FBS concentration gradient between the two main channels is illustrated in the plot to the left. (**C**) U87 cell migration across the microchannels was enhanced by a concentration gradient of serum across the microchannels. Cell protrusions and filopodia were more pronounced under this concentration gradient. (**D**) Successful migration of U87 cells was defined as a translocation of the nucleus across the microchannels. White arrows indicate migrated U87 cells. Blue is nucleus. Red is cytoplasmic mCherry. (**E**) Migration across microchannels, which is indicated by CMI. (**F**) Extent of U87 cells unrestricted motility, indicated by FMD (n = 3, error bar = ±1 SD. indicates p \< 0.05).
To validate the use of this chip in studying GBM cells, we first investigated U87 migration in the presence of a serum concentration gradient. As shown in Fig. [3C](#Fig3){ref-type="fig"}, under the influence of the serum concentration gradient, U87 cells had more lamellipodia and filopodia extended toward the empty microchannels in comparison to cells in the absence of serum concentration gradient. However, we observed that some cell migration attempts were unsuccessful even though their filopodia protruded across the microchannels. Therefore, the number of translocated nuclei was then used as a definite quantification of successful migration. As shown in Fig. [3D](#Fig3){ref-type="fig"}, the number of nuclei translocated through microchannels was observably greater when a serum concentration gradient was applied to the system. Quantitatively, the cell migration index (CMI) under the influence of the serum concentration gradient was 2.9-fold higher than those without serum (Fig. [3E](#Fig3){ref-type="fig"}). These results indicate the serum concentration gradient induced the directional migration across microchannels, consistent with the findings demonstrated in other studies^[@CR38],[@CR39]^. Supplementary Movie [1](#MOESM2){ref-type="media"} shows glioma cells migration under low-magnification objective in time lapse.
While CMI quantified the U87 cell migration across confined microchannels, we also studied unconfined cell migration in the main channel (Fig. [3B](#Fig3){ref-type="fig"}, red box), which is reported as the "free-migration distance" (FMD) value. In contrast to CMI, there was no significant differences between the FMD values of GBM cells in the chips with and without serum concentration gradient (Fig. [3F](#Fig3){ref-type="fig"}). This indicates that the serum concentration gradient did not affect the motility of the cells that were not in close proximity to the microchannels. These results suggest that the microchannels in the migration chip are a good representation of GBM cell infiltration across a confined space similar to that in brain parenchyma and can serve as a physiological representative model for cell migration.
Tf\@pSiNP uptake prevent GBM to migrate through the microchannels {#Sec6}
-----------------------------------------------------------------
The migration chip was then applied to gauge the effect of Tf\@pSiNP uptake on GBM cell migration. After seeding and incubation of GBM cells in the chip overnight, similar to the scrape-migration experiment, U87 cells were exposed to Tf\@pSiNP, BSA\@pSiNP, and Tf alone.
No significant differences were noted in FMD values of Tf\@pSiNP-, BSA\@pSiNP-, and Tf-exposed cells compared to untreated control group (Fig. [4A](#Fig4){ref-type="fig"}). These observations are in accordance with the scrape-migration assay result that cell migration was not affected by pSiNP exposures in the unconfined space.Figure 4The effect of Tf\@pSiNP, BSA\@pSiNP and Tf treatments on GBM cells migration in the migration chip. (**A**) U87 cell motility (restriction free) in the initial cell side reported as FMD. FMD was averaged from measurements taken from 3 chip units (n = 3). (**B**) Montage of U87 cell migration across the microchannels after treatments over the period of 8 h. Red is cytoplasmic mCherry. (**C**) Cell migration across the microchannels reported as CMI (n = 3, error bar = ±1 SD. \* indicates p \< 0.05).
The dynamic process of GBM cell migration through microchannels was captured via confocal time-lapse images (Fig. [4B](#Fig4){ref-type="fig"}). It was observed that a migrating U87 cell first extended a protrusion, the leading front of a cell, into the initial empty microchannels, while the retracting 'tail' was positioned on the initial cell side. We observed that this process, where a cell body was bridging across the microchannel, was an intermediate stage for cell migration. The intermediate stage was observed in all groups when GBM cells were migrating through the microchannels (Fig. [4B](#Fig4){ref-type="fig"}, white arrows). However, it was observed that the time required for a cell to protrude and retract its filopodia varied largely from cell to cell. Therefore, successful migrations were defined only by the translocation of nucleus from initial cell side to initial empty channel. Collectively, the rate of successful migration varied depending on the treatment. In contrast to the FMD value, we observed that Tf\@pSiNP treatments altered the CMI value significantly (Fig. [4C](#Fig4){ref-type="fig"}). CMI value of Tf\@pSiNP exposed cells lowered by 40% as compared to the control, indicating that Tf\@pSiNP inhibited GBM cells migration. In contrast, there was no significant difference between the CMI of Tf and control, suggesting that Tf alone did not significantly inhibit migration through microchannels. These results suggest that the inhibition was due to the Tf\@pSiNP internalisation, rather than the targeting molecule Tf. This is corroborated by the observation that the CMI of Tf\@pSiNP exposed cells being significantly lower than those exposed to BSA\@pSiNP, as well as the positive correlation with the level of internalisation (Fig. [1D](#Fig1){ref-type="fig"}).
We further investigated the effect of NP treatment exposure time on cell migration. We compared Tf\@pSiNP exposure at 1 h and 8 h and found that there was no significant difference in CMI of GBM cells (Supplementary Figure [2A](#MOESM1){ref-type="media"}). This may suggest that a reasonably short Tf\@pSiNP incubation time is sufficient to modulate GBM cell migration ability across microchannels.
Despite the observed inhibition of migration, 60% of cells treated with Tf\@pSiNP which initiated migration through microchannels, succeeded. It was possible that the extent of cellular uptake of NP varied among the cells. There appears to be a correlation between cell migration and NP uptake. Tf\@pSiNP, BSA\@pSiNP, and Tf were labelled with Cy5 fluorescent reporter in order to visualise the relative quantity of cell association. To reveal the correlation between NP uptake and its impact on the ability to migrate through microchannels, we quantified and compared the associations between Tf\@pSiNP, BSA\@pSiNP, and Tf in migrated U87 cells (Fig. [5A](#Fig5){ref-type="fig"}). The successfully migrated cell population in Tf\@pSiNP and BSA\@pSiNP treated groups had distinctively lower Cy5 association than that of Tf treated group. This indicates that the cells, which successfully migrated across the microchannels, took up fewer particles as compared to the cells which did not migrate. In contrast, Tf treated cells showed less difference in uptake between migrated and non-migrated cells, again consolidating that Tf alone did not modulate cell migration across microchannels. This highlights that the extent of migration inhibition correlated to the level of pSiNP association.Figure 5Visualisation of FA in U87 cells migrating across microchannels. (**A**) The amount of Tf\@pSiNP, BSA\@pSiNP, and Tf associated with U87 cells which migrated across microchannels as indicated by Cy5 intensity normalised to their respective non-migrated cells. Higher value indicates higher cell-pSiNP or cell-Tf associations in migrated cells. (**B**) Immunofluorescence staining of vinculin as a representation of FA. Filament actin, red. Nucleus, blue. Vinculin, green and white is Cy5-labelled Tf\@pSiNP, BSA\@pSiNP, and Tf. (**C**) Aspect ratio of identifiable FA in U87 cells. (n = 5, error bar = ±1 SD. \* indicates p \< 0.05).
Focal adhesions are de-stabilised in migrating GBM cells treated with Tf\@pSiNP {#Sec7}
-------------------------------------------------------------------------------
The unexpected migration-inhibitory effect of pSiNP on GBM cells prompted us to further investigate the mechanisms involved. As the coordination of focal adhesion (FA) formation is necessary for cell spreading and migration^[@CR40]^, we stained for vinculin, an adaptor protein in FA, by immunofluorescence (IF) to reveal the impact of Tf\@pSiNP on the maturation of FA.
Across all treatment groups, the first observation made was that vinculin staining was generally more pronounced in the filopodia extending across microchannels towards the empty channel side as compared to the cell bodies remaining on the initial channel side (Fig. [5B](#Fig5){ref-type="fig"}). This may reflect the polarisation of GBM cells during migration. Comparing all treatments, the vinculin staining intensity was higher in the filopodia of Tf\@pSiNP- and BSA\@pSiNP-treated cells. This indicates that more vinculin was expressed, and the subcellular location of vinculin was more polarised in those cells. Conversely, the vinculin recruited at the filopodia of control cells displayed defined rod shape structures. This is an indication of vinculin colocalising to talin that unfolds via mechanical force between cytoskeleton and integrins^[@CR41]^. Notably, although cells treated with Tf\@pSiNP and BSA\@pSiNP expressed more vinculin at the filopodia, vinculin appeared as diffuse shape patterns rather than defined rod shape structures. This may suggest that vinculin was not recruited to reinforce the FA of those cells.
Furthermore, we analysed the aspect ratios of the FA (Fig. [5C](#Fig5){ref-type="fig"}). The data demonstrates that the FA of control cells had higher aspect ratio than those receiving pSiNP and Tf, indicating that the structure of FA in the control cell filopodia were more elongated. While the FA of cells receiving Tf\@pSiNP and BSA\@pSiNP were more circular in shape and were less defined. This might suggest that the FA in those cells were less established. And since FA is a critical apparatus for cells to gain traction during migration, our finding might explain at least in part the reduction in migration observed in Tf\@pSiNP and BSA\@pSiNP treated cells.
Since immunofluorescence (IF) only afforded a snapshot of the morphology of FA and did not resolve the effect of pSiNP exposure on the dynamics of FA formation, we transiently transfected talin-GFP into the cells. Talin is an adaptor protein that binds to vinculin during FA maturation and provides cytoskeleton-ECM traction^[@CR41]^. We identified that U87 cells first migrated to the entrance of microchannels (see Fig. [6A](#Fig6){ref-type="fig"}, cell (a). Prior to formation of a protrusion of filopodia into microchannels, the talin expression was not prominent. Cell (b) represented the next stage of migration where the leading front protruded into the microchannel, while a tail was retracting (arrows). Cell (c) represented cells at the intermediate stage where the cell body spanned across entire microchannel before it had completed the migration across the channel. We frequently observed that a cell oscillated back and forth during this intermediate stage before completing translocation. Supplementary Movie [2](#MOESM3){ref-type="media"} shows the dynamics described in Fig. [6A](#Fig6){ref-type="fig"} in time lapse.Figure 6Time-lapse imaging of FA dynamics in U87 cells migrating across microchannels. (**A**) Stages of untreated cell migration across the microchannels. Cell (**a**) migrated to the entrance of microchannels; Leading front of cell (**b**) was protruding across the microchannels, while a tail was retracting (arrows); Cell (**c**) was at the intermediate stage where cell body spanned across entire microchannel. Cytoplasmic mCherry, red. Talin-GFP, green. (**B**) Talin-GFP expressing U87 cells treated by Tf\@pSiNP, BSA\@pSiNP, or left untreated, at their intermediate stages of migration across the microchannels. White arrows indicate observable FA at the leading fronts of the cells.
Figure [6B](#Fig6){ref-type="fig"} shows time-lapse images of talin-GFP expressing cells treated with Tf\@pSiNP, BSA\@pSiNP, and the untreated control. All cells shown here were at the beginning of the intermediate stage of migration across the microchannels, where the leading front and the retracting tail of the cells could be identified. At the time of 0 min defines as the start of the intermediate stage, where the leading front had reached the empty channel and displayed mature FA. For all cells, a greater number of defined FA was present in the leading fronts (FA indicted by white arrows) in comparison to the retracting tail. There were more clearly defined FA in the leading front of the control cells and BSA\@pSiNP exposed cells compared to Tf\@pSiNP treated cells at the 30 min lapse time. The differences widened as the migration progressed, and the originally well-defined FA in both of the pSiNP treatment groups became diffuse. This observation was consistent with our IF results and confirmed the difference existing at the leading front of the cells, which may partially explain the observed reduction in migration.
Inability of GBM cells to shrink plays a role in the Tf\@pSiNP-mediated migration inhibition {#Sec8}
--------------------------------------------------------------------------------------------
The impact of Tf\@pSiNP uptake on FA dynamics at the leading front of migrating U87 cells gave us a possible explanation for the reduced migration propensity. Interestingly, comparing Tf-treated and Tf\@pSiNP-treated cells, both displayed less-established FA, while only Tf\@pSiNP caused significant reduction in CMI (Fig. [4C](#Fig4){ref-type="fig"}). This indicated that Tf\@pSiNP treatment modulated GBM migration as well as through other mechanisms. In addition to FA dynamics, it is well-known that reduction in cell volume is also a critical step for brain cancer cells to navigate narrow brain parenchyma^[@CR9]^. This led to study the effect of Tf\@pSiNP uptake on the ability of U87 cells to undergo volumetric changes.
After exposure to Tf\@pSiNP for 8 h, cells decreased their cell volume under osmotic pressure induced by the hypertonic medium (1 osmol/L sucrose in DMEM). Fluorescence microscopy images of cells treated with Cy5-labelled Tf\@pSiNP indicate that the cells had taken up Tf\@pSiNP (Fig. [7A](#Fig7){ref-type="fig"}). Under confocal z-stack imaging, these cells had a larger cytoplasmic mCherry volume compared to control group cells, indicating that cells treated with Tf\@pSiNP were seemingly larger in size than that of the control cells under hypertonic osmotic pressure. We quantified the extent of the reduction in cell volume by normalising it to that before hypertonic medium treatment, and the 'cell volume change' was reported. Our results show that Tf\@pSiNP-exposed cells reduced cell volume by 51% while untreated cells reduced cell volume by 72% (Fig. [7B](#Fig7){ref-type="fig"}). This confirms that Tf\@pSiNP treatment decreased the ability of GBM cells to response to osmotic pressure and subsequent cell volume reduction. In addition, Tf exposed cells (without pSiNP) under hypertonic medium also reduced cell volume by 68%, indicating that Tf treatment alone was unlikely to mediate the resistance of cells responding to osmotic pressure. Since we observed that cytoplasmic water was released from control cells almost instantly (1 min) after inducing the hypertonic medium, the process was possibly facilitated by aquaporin water channels^[@CR42]^.Figure 7Characterising the effect of Tf\@pSiNP on GBM cell volume regulation and cell migration. (**A**) Morphology of U87 cells exposed to hypertonic medium imaged by means of scanning confocal microscopy. Cytoplasmic mCherry, Red. Cy5-labelled Tf\@pSiNP, white. Blue corresponds to nuclei. (**B**) Normalised U87 cell volume exposed to hypertonic medium. Cell volume measured is normalised to the cell volume measured before hypertonic treatment. A smaller normalised cell volume indicates larger cell volume reduction under hypertonic treatment. (n = 3, error bar = ±1 SD. \* indicates p \< 0.05). (**C**) Quantification of cell migration index of U87 cells treated with Cl^−^ channel blocker (niflumic acid) and Tf\@pSiNP.
The fact that Tf\@pSiNP treatment resists GBM cell volume reduction prompted us to study how cellular volume reduction affects migration through the microchannels of our migration chip. Ion channel blockers, such as niflumic acid, are well-known to inhibit GBM cell volume reduction, and are being studied as anti-metastatic agents^[@CR43]^. Therefore, we first studied the capability of niflumic acid-treated U87 cells in migrating across microchannels. We observed that the CMI of Cl^-^ channel blocker niflumic acid-treated U87 cells significantly dropped by 43% as compared to that in untreated cells (Fig. [7C](#Fig7){ref-type="fig"}). This indicates that the migration across microchannels in the chip required a reduction of the cell volume. Interestingly, we also observed that CMI of cells treated by Tf\@pSiNP was not significantly different to those cells treated by niflumic acid (Fig. [7C](#Fig7){ref-type="fig"}). To validate these observations, a more clinically relevant primary glioma cell (WK1) had been treated with Tf\@pSiNP and niflumic acid, and their migration were evaluated using a conventional Transwell model with the same pore size of 3 µm (Supplementary Fig. [2C](#MOESM1){ref-type="media"}). The results indicate that Tf\@pSiNP and Cl^-^ channel blocker exposures were also able to inhibit the migration of primary glioma cells, confirming our observations using U87 cells and our migration chip. The data collectively suggests that Tf\@pSiNP was likely inhibiting the migration of GBM cells by impacting the ability to reduce cell volume.
Discussion {#Sec9}
==========
It is known that 90% of cancer mortality is a result of metastasis^[@CR44]^. Inhibiting or eliminating cancer metastases is an obvious approach to improve survivability. Although cancer nanomedicine is more commonly driven to realise drug delivery and diagnosis, there has been sporadic evidence that some nanoparticle carriers (NP) alone can influence the migration of cancer cells. For example, Wang *et al*. demonstrated that ursolic acid NP inhibited cervical cancer migration through inducing apoptosis^[@CR21]^. BSA-based GRP78 receptor-targeting NP have been shown to inhibit hepatocellular carcinoma (HCC) cell invasion via receptor-mediated binding^[@CR20]^. While local metastasis is the hallmark and the root cause of the high brain cancer mortality, there has not been any attempt so far as published in public domain to study the effect of NP uptake on invasion.
To address this research gap, we used pSiNP as a model NP due to its excellent biocompatibility and drug encapsulating capacity. Since TfR is overexpressed on GBM cells and on the luminal side of blood-brain barrier (BBB)^[@CR27],[@CR45]^, it has become a popular target in a plethora of drug delivery studies. For example, Tf has been widely explored as a targeting ligand for improving BBB penetration of nanocarriers such as micelles^[@CR46]^, liposomes^[@CR47]^, and polymersomes^[@CR48]^. Coating of Tf on pSiNP through hydrophobic interactions was first described by Reuter *et al*.^[@CR49]^ They observed that Tf modification enhanced the internalisation into breast cancer cells. In this work, we studied whether Tf conjugation on pSiNP surface could enhance the internalisation into GBM cancer cells. Although pSiNP was mostly plate shaped, unlike spherical shaped liposomes and gold NP, we can demonstrate that Tf-decoration could result in a 3 fold increase pSiNP uptake into GBM cells compared to non-targeting BSA-coated pSiNPs (Fig. [1D](#Fig1){ref-type="fig"}). This enhancement is similar to those reported for gold NP decorated with Tf^[@CR50]^.
As predicted, Tf\@pSiNP were non-toxic and did not reduce ATP amount in GBM cells, in agreement to other pSiNP studies *in vitro* and *in vivo*^[@CR23],[@CR51]^. In a separate study, we also showed that Tf\@pSiNP is also highly tolerable in human cerebral microvascular cells, and non-CNS keratinocytes over a wide range of concentration^[@CR35]^, highlighting the biocompatibility of those nanoparticles. Since the cells exposed to Tf alone were also highly viable, the amount of Fe^2+^ released from Tf did not cause detrimental effects such as ferroptosis^[@CR52]^. Therefore, we believe that Tf\@pSiNP was a suitable model NP for us to study how Tf\@pSiNP treatment would impact on the ability of GBM cells to migrate.
Our "scrape-migration" assay result showed Tf\@pSiNPs had no migration inhibition in GBM cells. However, it should be noted that this conventional assay studies cells migration on a flat culture surface without any topographical restrictions, which is highly different to the brain parenchyma. Indeed, GBM cells diffusively infiltrate to the healthy brain tissue along narrow extracellular routes, such as stiff neuronal tracts, which require substantial cytoplasmic volume changes and highly regulated FA dynamics^[@CR43],[@CR53]^. These restrictions are commonly mimicked in a Transwell model, in which cancer cells migrate through narrow pores of a polymeric membrane. And the model has been used to gauge changes in cell migration. However, opaque Transwell membranes are not compatible with high-content imaging of morphological changes and FA dynamics during migration, which is crucial to study the impact of Tf\@pSiNP on cancer cell migration.
To overcome these limitations, we applied a microfluidic chip with tight topographical restrictions, in the form of an array of 3 μm × 3 μm microchannels connecting two parallel channels to study GBM cell migration. Such side-by-side placement of optically clear microchannels allowed simultaneous time-lapse visualisation of cells and direct measurement of the dynamics of the migration processes, which is a significant advantage as compared to the Transwell model^[@CR54]^. Indeed, similarly designed microchannels have been used to study the effect of different drugs or chemoattractant on migration rate of various cancer cells^[@CR55]^. Microchannel system was also applied to isolate brain tumour stem cells (BTSC)^[@CR56]^, and to study the mechanical properties of migrating GBM cells under confinement^[@CR57]^. However, to the best of our knowledge of published literature in the public domain it has never been applied to study the effect of NP treatment on GBM migration ability.
Although 8 μm diameter pores in the Transwell being widely used for cell migration studies^[@CR58],[@CR59]^, GBM cells were shown capable to migrate through even smaller restrictions. For example, a study by Harada *et al*. demonstrated that GBM cells migrated through pores of 3 μm diameter 35-fold faster than other cancer cells^[@CR60]^. In the current study, we also found that human GBM cells U87 were able to migrate through the 3 μm microchannels of our migration chip under serum concentration gradient as a chemoattractant.
Specifically, we visualised the migration of GBM cells in a time-resolved manner. It was observed that the GBM migration through a microchannel was initiated by sending leading front cell protrusion across the microchannel. An intermediate stage followed suit, where the cell body spanned across the entire microchannel with the leading front protrusion on the new channel side, while the retracting tail and the nucleus still remained in the original channel. Successful migration of GBM cells depended on whether the nucleus could be translocated and the tail could be retracted through the microchannels. This result in principle agrees with a study by Monzo *et al*.^[@CR61]^, in which the two phases of GBM cell migration down a track of 4 μm width were described, including cell elongation and tail retraction. The authors also reported that migrating GBM cells were polarised, where FA at the leading front were mostly defined and stationary, while the retracting tail FA were less established. Consistent with this report, our vinculin staining for FA also showed polarised morphologies. However, the migration speed of cell bodies reported by Monzo *et al*. was around 50 μm/h, while in our study most U87 cells took 8 h to complete the translocation across the microchannels (10 μm/h). Another study by Prahl *et al*. reported that U251 migrated in an enclosed linear channel (12 μm width, 5 μm height) at a speed of 30 μm/h^[@CR57]^. Since the microchannels that we used had a smaller cross-section (3 μm width, 3 μm height, Fig. [3](#Fig3){ref-type="fig"}), we believe that the differences may due to the level of confinement.
Migration and invasiveness of GBM cells are emerging as areas of therapeutic focus. In fact, small molecular ion channel inhibitors, such as chlorotoxin derivative TM601, blocker of Kv10.1 antihistamine and astemizole, were sought as ways to target GBM invasion^[@CR62]^. We studied the effect of Tf\@pSiNP treatment on GBM cell migration across microchannels and discovered that treatment with Tf\@pSiNP reduced GBM cell migration with the extent of reduction correlating positively to the extent of pSiNP-cell association, while this effect was absent for cells treated with Tf (Fig. [4](#Fig4){ref-type="fig"}). There were existing studies describing the inhibition of invasion by using NP loaded with radioisotopes and chemotherapeutics on hepatocellular carcinoma and gastric cancer^[@CR20],[@CR63]^, in which the cell invasions were inhibited by the cytotoxicity of the payload. In this study, pSiNP was not carrying any therapeutics, and the treatment did not hamper viability nor intracellular ATP content (Fig. [2](#Fig2){ref-type="fig"}). Therefore, the result obtained here was encouraging and intriguing.
Understanding this effect is important to translate such observation into clinical applications. We found that the FA at the leading front of migrating U87 cells, which were treated by Tf\@pSiNP, were morphologically less mature as compared to untreated cells (Fig. [5B](#Fig5){ref-type="fig"}). In addition, the observed elongated morphology is an indication of better cell migration ability^[@CR64]^. Increased vinculin localisation at elongated FA is a result of force-triggered talin unfolding and talin-vinculin binding, a traction force that is needed during cell migration^[@CR65],[@CR66]^. Therefore, we believe that the internalisation of pSiNP may attenuate the maturation of FA, which in turn hampers migration in U87 cells. However, since the FA of U87 cells exposure to Tf alone also displayed less elongated morphology as compared to control, we speculated that the attenuation of FA may only be one phase of the overall mechanisms.
The fact that pSiNP did not impede cell migration in a non-confined migration setting (scrape-migration assay), but in a microchannel migration setting, prompted us to investigate and discover that Tf\@pSiNP internalisation diminished the ability of GBM cells to reduce cell volume (Fig. [7A,B](#Fig7){ref-type="fig"}). Our data also suggests that successful cell migration through the tight microchannels in our migration chip required cell volume reduction (Fig. [7C](#Fig7){ref-type="fig"}). This agrees with long-standing observation that GBM cells dramatically reduce cell volume through extrusion of cytoplasmic water upon migrating along confined and mechanically rigid barriers, such as the vasculature's abluminal surface or white matter tracts^[@CR67]^. Together they suggest that the disabling of GBM cells to 'shrink' could explain the reduced cell migration across confined microchannels. Importantly, we observed that untreated GBM cells responded within 1 min to hypertonic pressure by shrinking while pSiNP-treated ones did not, indicating a possible involvement of aquaporins that facilitate rapid water efflux at a much higher rate than passive diffusion across the plasma membrane^[@CR42]^. Another possible explanation that we cannot exclude at this point is the physical 'crowding' of the cytoplasm with incompressible NP. In fact, Ali *et al*. made the similar observation that nuclear membrane-targeting gold NP inhibited ovarian cancer cell migration by physically increasing the stiffness of the nucleus^[@CR17]^.
Our data supports the hypothesis that pSiNP attenuated cell migration by resisting cell volume reduction in response to osmotic pressure, and the destabilisation of FA may have also contributed to the effect (Fig. [8](#Fig8){ref-type="fig"}). Since this proposed mechanism is fundamentally different from some well-established metastasis inhibitors, which disable Cl^-^ ion channels to drive osmotic pressure difference^[@CR9]^, the combined application of both may further hamper the cell migratory ability. Future studies should, thereby, explore the clinical potential of such combined treatment. Although the mechanism of how pSiNP attenuated GBM cell volume reduction and focal adhesion maturation remains to be further clarified, this work reported pSiNP as a new tool that is potent in reducing GBM cell migration and might enable new treatments option for GBM patients.Figure 8Mechanism of cell volume reduction in GBM cell migration across a confined space, and the proposed effect of pSiNP treatment on cell volume reduction.
In this study, we developed a GBM cell-targeting nanoparticle, Tf\@pSiNP, and studied its migration inhibitory effect on a microfluidic-based migration chip. This platform better mimicked the tight extracellular migration tracts in brain parenchyma, and allowed high-content time-resolved imaging of GBM cell migration. We have shown that Tf\@pSiNP were hydrodynamically stable, biocompatible, and their cellular uptake into GBM cells was enhanced by Tf surface functionalisation. GBM cells exposed to Tf\@pSiNP were shown less capable to migrate through tight microchannels. The level of inhibition was dependent on the uptake of the pSiNP core, but not the targeting molecule Tf. The pSiNP-induced destabilisation of FA at the leading front may partially explain the migration inhibition. Additional corroborating evidence suggests that pSiNP uptake reduced the plasticity of GBM cells facilitating cell volume reduction, which is essential for the migration through tight confined tracts. We believe that the inhibitory effect of Tf\@pSiNP on cell migration, together with the drug-delivery capability of pSiNP could potentially lead to the realisation of a disruptive strategy to treat GBM.
Materials and Method {#Sec10}
====================
Cell culture and maintenance {#Sec11}
----------------------------
Human U87 cells that stably express both intracellular mCherry and firefly luciferase, donated by Bakhos A. Tannous, MGH, Massachusetts, were cultured at 37 °C in 5% CO~2~ atmosphere in a humidified incubator. We chose U87-mCherry cells as a model for this study as the cytoplasmic mCherry expression allows the tracking of cell body under time-lapse cell imaging. The mCherry reporter expression and firefly luciferase activity in the U87 cells were clearly observable under microscopy and under *in vivo* bioluminescence imaging (data not shown), respectively, in agreement with the existing documentations characterising the cell line^[@CR68],[@CR69]^. This cell line was tested negative for mycoplasma contamination by us using PlasmoTest^TM^ Mycoplasma Detection Kit (InvivoGen, cat rep-pt1). For experiments that did not require live-cell tracking cell body, such as endpoint immunofluorescence experiments and talin-GFP experiment, wildtype U87 was used. For both cell types, Dulbecoo's Modified Eagle's Medium (DMEM) high glucose (Gibco, 11995073) supplemented with 10% heat inactivated fetal bovine serum (FBS, Invitrogen), 1% antibiotic-antimycotic (Anti-Anti, Invitrogen) was used to culture the cells. Culture media were refreshed every three days and the confluency was maintained below 80%.
A validation experiment was conducted on patient-derived glioblastoma WK1 cells, which were provided by Bryan Day, QIMR, Brisbane, Australia. The phenotype and heterogeneity of the cells were previously characterised^[@CR70],[@CR71]^. Cells were cultured in knockout Dulbecco's modified Eagle's medium (DMEM, Gibco, 12660-012), supplemented with 0.1 mg/mL recombinant human Epidermal Growth Factor (Gibco, PHG0314), 0.05 mg/mL recombinant human Fibroblast Growth Factor basic (Gibco, PHG0024), and StemPro Neural Supplement (Gibco, A10508-01). The culture media also contained GlutaMAX (Gibco, 35050-061) and penicillin/streptomycin (Gibco, 15140-122). Cells were only used between passages 16 and 25. Cells were passaged at approximately 90% confluency by incubating in Accutase solution (Sigma-Aldrich, A694), followed by inactivation with trypsin inhibitor. This primary cell was also tested negative for mycoplasma contamination.
Porous silicon nanoparticle (pSiNP) preparation {#Sec12}
-----------------------------------------------
pSiNP was fabricated according to a previously reported procedure^[@CR23],[@CR35]^. p+ type (0.01--0.02 Ω cm) silicon wafers (Siegert Consulting Co., Aachen, Germany) etched periodically at 50 (2.2 s period) and 200 (0.35 s period) mA/cm^2^ in a solution of 1:1 HF (38%):ethanol (EtOH) for 20 min. Afterwards, current density was increased to detach the porous silicon (pSi) films from the substrate to electropolishing conditions (250 mA/cm^2^, 3 s period). Then, pSi multilayer films were thermally hydrocarbonised under N~2~/acetylene (1:1, v/v) flow at 500 °C for 15 min and cooled down to room temperature in a N~2~ gas flow. The films were then immersed into neat undecylenic acid at 120 °C for 16 h. After this, the COOH-functionalised films were milled down into NP by ball milling in a 10 vol-% undecylenic acid-decane mixture. The obtained particles were washed with ethanol to remove the milling media. The size selection of the NP was done by centrifugation in ethanol and the final UA-functionalised particles (UnpSiNPs) were stored in ethanol at 4 °C for further use.
Preparation of covalently bound Tf /BSA\@pSiNP {#Sec13}
----------------------------------------------
Human holo-transferrin (Sigma T4132) was covalently bound to the UnpSiNP via EDC/NHS reaction, and the end product was termed Tf\@pSiNP. Briefly, UnpSiNP were washed three times with (2-N-morpholino) ethanesulfonic acid buffer (MES, pH 6.0) to remove the EtOH, and resuspended into 0.5 mL MES buffer after final wash (final concentration 10 mg/mL). 0.5 mg of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) hydrocholoride (Sigma 03459, final concentration 2.6 mM) and 1.1 mg of N-hydroxysulfosuccinimide (sulfo-NHS, Sigma 56485, final concentration 5 mM) were added to the reaction. The reaction components were mixed well and allowed to react for 15 min at room temperature. After the NHS ester activation, MES buffer was replaced by 300 µL PBS (pH 7.4). Then the suspension was added dropwise to 200 µL of transferrin solution in PBS (final concentration 10 mg/mL). The solution was mixed well and allowed to proceed for 2 h at room temperature with agitation. Then the reaction was quenched by 50 mM Tris for 15 min. Free transferrin was washed away by washing nanoparticles with PBS three times after the second step of amine reaction. The Tf\@pSiNP were stored in PBS for further studies. BSA-functionalised nanoparticles were prepared in the same way as Tf\@pSiNP.
Dynamic light scattering and zeta potential measurement {#Sec14}
-------------------------------------------------------
To study the hydrodynamic size and zeta-potential of nanoparticles, the particles were washed and resuspended in PBS. After 2 min sonication, the particles were then analysed using a Malvern Zeta-sizer (Malvern, Worcestershire, UK). Scattering angle θ = 173° was chosen, and the analysis was carried out at 25 °C. The data shown herein are an average of at least triplicated measurements.
Cryo-TEM imaging of nanoparticles {#Sec15}
---------------------------------
The Cryo-TEM was conducted following our previously described protocol^[@CR35]^. Briefly, a 3 µL sample of NP in PBS was dispensed onto a glow discharged copper grid (300 mesh) with lacey carbon film coating (ProSciTech, QLD, Australia). The grid was blotted against filter paper (Whatman 541) and plunged into liquid ethane using an in-house plunge freezing device in 80% humidity. The samples were presented to the transmission electron microscope TEM (FEI, Eindhoven, The Netherlands) operated at 120 kV using a Gatan 626 cryo-holder (Gatan, Pleasanton, CA, USA). A low electron dose of 8--10 electrons/Å^2^ was employed. Images were captured using a FEI Eagle 4kx4k CCD camera (FEI) and AnalySIS software v3.2 (Olympus.).
TEM visualisation of pSiNP internalisation {#Sec16}
------------------------------------------
U87 cells were cultured in a 6-well culture plate at 37 °C and 5% CO~2~ humidified atmosphere, with a starting density of 25,000 cells per cm^2^. Cultures were maintained for 24 h prior to incubation with nanoparticles at a concentration of 0.1 mg/mL. Controls (untreated cells) were generated in the same condition by incubating U87 cells in medium but without nanoparticles. After 24 h, the cells were washed to remove the non-internalised nanoparticles. The preparation of TEM samples was conducted according to the protocol described by Luo *et al*.^[@CR35]^. Briefly, the cells were first harvested by trypsinisation, and pelleted at 200 rcf. The cell pellets were fixed by glutaraldehyde treatment (3% in Sorenson's phosphate buffer, pH 7.4, ionic strength 0.154 M) (ProSciTech, Thuringowa, QLD) at room temperature for 2 h, buffer washed, and post-fixed in 1% osmium tetroxide for 1 h. After washing, pellets were then gradually dehydrated in increasing ethanol concentration and transferred to propylene oxide. They were then infiltrated and embedded in Epon Araldite(RroSciTech, Thuringowa, QLD) polymerised at 55 °C for 48 h. 200-mesh copper grids were used to collect ultrathin sections, which were then stained with 8% methanolic uranyl acetate, followed by Reynold's lead citrate, each for 5 min using conventional methodology. Samples were viewed by using a Tecnai T12 TEM (FEI, Eindhoven, the Netherlands) at an accelerating voltage of 120 kV.
Fabrication of migration chip with microchannels {#Sec17}
------------------------------------------------
The chip was fabricated via photolithographic and soft lithographic techniques. A silicon wafer was used to fabricate the master mould via deposition of photosensitive polymer (SU8). Dual layer fabrication of SU8 was performed to resolve the first thin layer (3 μm) array of parallel microchannels connecting the second thicker layer (100 μm) of two main channels. The master mould was then replicated onto Sylgard 184 polydimethylsiloxane (PDMS) prepared by mixing at a 10:1 ratio (monomer to catalyst). It was poured onto the wafer to the height of 100 µm in a 150 mm Petri dish and degassed for 15--30 min. Then, the polymer was cured inside an oven at 80 °C for a minimum of 1 h. The cured PDMS mould was then detached from the developed master. The inlet and reservoir holes were punched using 1.5 mm and 2.0 mm Haris Uni-Core biopsy punches (Ted Pella), respectively. Glass slide (MENZEL-GLASER) was washed in water and ethanol once each. The bonding surfaces -glass slide and PDMS - were then cleaned and activated by oxygen plasma for 30 s (Harrick Scientific, Ithaca, NY). After assembly, the chips were further incubated at 80 °C for 15 min. Before using the chip, it was sterilised under UV (wavelength: 254 nm) irradiation for 30 min. To enhance the U87 attachment to the chip, the channels were treated with poly-L-lysin solution (Thermo Fisher Scientific) for 1 h at room temperature, then washed with PBS and DMEM, respectively.
Characterisation of microchannels in migration chip {#Sec18}
---------------------------------------------------
In order to visualise the main channels and microchannels in the chip, cyanine-5 (Cy5) dye labeled collagen was injected and probed the internal surface of the channels. Collagen type I from rat tail (1 mg/mL, Sigma-Aldrich 11179179001) was diluted in PBS and labeled with Cy5-NHS ester (Lumiprobe, 43020) by following manufacturer's procedure. The resulting product Cy5-labeled collagen (100 μg/mL) in PBS was then injected into both main channels of the chip and incubated for 1 h at room temperature. The remaining Cy5-labeled collagen solution was aspirated and the channels were washed with PBS. The collagen-coated chip was then imaged under a confocal laser scanning microscope (Leica SP8).
Cell seeding into migration chip with microchannels {#Sec19}
---------------------------------------------------
To assess the potential of GBM cells in migrating through microchannels to mimick brain parenchyma, U87-mCherry or U87WT were first seeded and allowed to attach and acclimatise for at least 8 h prior to experimentation. Before the experiment (24 h), cells were labeled with live-cell nucleus tracker DRAQ5^TM^ (Invitrogen 62252) for 5 min such that the nucleus could be traced. Hoechst (33342) was used instead for experiments that required the visualisation of Cy5 conjugated pSiNP or Tf. Cells were then injected at a concentration of 10 $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$${\rm{\times }}$$\end{document}$ 10^6^ cells/mL. Each channel held approximately 8 µL of medium and thus the cell seeding was consistently at 8 $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$${\rm{\times }}$$\end{document}$ 10^4^ cells per channel. During the acclimatisation stage, no FBS gradient was applied across the microchannels (that is DMEM with 10% serum was used in both the cell channel and empty channel). According to our observations, the pre-experiment migration without serum gradient was minimal (Fig. [3F](#Fig3){ref-type="fig"}). The pre-experiment migration was subtracted from calculations of cell migration index to reveal the migrations only within the period of experiment.
Immunostaining and transfection {#Sec20}
-------------------------------
Immunofluorescence conducted was based on the protocol recently described by Tang *et al*.^[@CR72]^. The cells were cultured in the migration chips for 24 h, followed by treatment and migration for 8 h then fixed in freshly prepared 4% paraformaldehyde (PFA) at room temperature for 15 min. The cells were washed with PBS twice (5 min each time) and permeabilised in 0.1% Triton X-100 in PBS for 2 min. After washing with PBS twice (5 min each time), the cells were blocked with 1% bovine serum albumin (BSA) in PBS for 30 min. Primary antibody incubation was conducted overnight, the cells were then washed three times with PBS (5 min each time). Fluorochrome-conjugated secondary antibody incubation was conducted for 60 min. The primary antibody used was mouse anti-vinculin (1:200, Thermofisher, MA5-11690) and the secondary antibody used was Alexa 488 goat anti mouse (1:200, Invitrogen, A11001). After antibody incubations, the cells were washed twice with PBS (5 min). The nucleus and cytoskeleton were counter stained with Hoechst 33342 (Sigma Aldrich, B2261) and rhodamine-phalloidin (Invitrogen, R415), respectively. The stained samples were imaged with a confocal laser scanning microscope (Leica SP8).
To visualise the focal adhesion dynamics, plasmid encoding talin-GFP was transiently transfected into U87WT cells. Briefly, 300,000 cells per well were seeded into a 24-well plate. After 3 hours, CellLight® Talin-GFP, BacMam 2.0 transfection reagent (Thermofisher, C10611) were added to the culture reaching a ratio of 40 particles per cell (PPC). Then, transfected cells were incubated at 37 °C humidified incubator for 16 h before seeding in the migration chip.
Time-lapse live-cell confocal microscopy {#Sec21}
----------------------------------------
The migration of GBM cells after NP exposure were imaged over a time course of 8 h by using time-lapse confocal microscope. Briefly before the experiment, the initial cell channel in the migration chip (Fig. [3B](#Fig3){ref-type="fig"}), which was seeded with U87-mCherry cells, were gently perfused and replaced with CO~2~ independent medium (Thermo Fisher Scientific, 18045-088) with 0% serum containing pSiNP, Tf, or no treatments. The other channel was replenished with fresh CO~2~ independent medium with 10% serum. The migration chip was then immediately transferred to laser scanning confocal microscope (Nikon Ti-E and A1R) equipped with humidified culture chamber maintained at 37 °C environment. Images were captured every 20 min. To image focal adhesion (FA) dynamics, migration chip with U87WT transiently transfected with talin-GFP was treated similarly as described above, while the talin dynamics were imaged every 7 min.
An independent experiment was conducted to evaluate how the duration of exposure affects GBM cells migration. The imaging procedure remained unchanged while the unbounded treatments were washed off by perfusing fresh CO~2~ independent medium with 0% serum before imaging. Over all experiments, the extent of migration was analysed by counting the number of cell nuclei clearing the microchannels and reaching the initially empty channel. Details of image analysis are described in the image analysis section.
Quantitative image analysis {#Sec22}
---------------------------
U87 cell migration time-lapses (.nd2 format) of each experiments were imported to image analysis software Imaris ×64 (ver. 9.1.1 Jan 29 2018) to conduct analysis objectively. Using this software, we compare the cell motility and infiltration potential of U87 cells under different treatments based on two measurements, namely free migration distance (FMD), and cell migration index (CMI), respectively. For the analyses of Cy5 fluorophore intensity, and measurement of FA dimensions, Fiji ImageJ (ver 2.0.0) was used.
FMD (with the unit µm) is defined as the average distance travelled by individual cells over the period of the experiment. The higher the FMD indicates the population of cells has a higher motility. To measure FMD, we first drew regions of interest on the initial cell channel, away from the microchannels (as illustrated by red box, Fig. [3B](#Fig3){ref-type="fig"}). Each cell was registered into Imaris based on their mCherry signal, and the distance travelled by each of them were calculated. Therefore, FMD is fundamentally different from CMI, since FMD did not reflect the capability of cells squeezing through microchannels. FMDs were measured based on the migration distance of at least 100 cells in one chip unit, and the average of three chip units is reported.
CMI is defined here as the ratio between the number of nuclei (representing the cell) clearing the microchannels (exemplified by cells in hashtags, Fig. [3B](#Fig3){ref-type="fig"}), divided by the total number of nuclei located at the microchannels (exemplified by cells in asterisks, Fig. [3B](#Fig3){ref-type="fig"}). Higher CMI indicates those U87 cells which had a higher capability in infiltrating through tight spaces. The CMI of each group is calculated by averaging the counting made on at least three biological replicates.
To reveal the correlation between pSiNP uptake and cell migration, Cy5 fluorescence intensity in the cells, corresponding to the level of uptake, was measured as integrated density (IntDen). Cy5 intensity ratio, which equals to Cy5 intensity in cells cleared microchannels divided by Cy5 intensity in cells which did not, was reported. A low intensity ratio indicates that the migrated cells were less associated with pSiNP. Each intensity measurement is based on at least 50 randomly selected cells, and an average ratio over 3 chip units is reported for each group. In addition, the aspect ratio of FA, which reflects their stability^[@CR64],[@CR66]^, was measured and reported. Images of vinculin immunofluorescence showed the morphology of FA were used. Using Fiji ImageJ, the length and the width of the FAs were measured. Aspect ratio (length divided by width) of the FA was reported. Measurement of aspect ratio for each group is based on at least 100 identifiable FA, an average aspect ratio is reported. A higher aspect ratio indicates the FA are more elongated. The aspect ratio is close to 1 when the FA are circular in shape.
Cell ATP assay {#Sec23}
--------------
Glo-luminescence cell viability assay kit (Promega, G7570) was used to measure the ATP content in cells treated by Tf\@pSiNP, BSA\@pSiNP, and Tf. Briefly, a starting density of 5,000 cells per well were first seeded onto 96-well white plates. The cells were maintained in medium for 1 or 2 d until confluence before treating the cells with the aforementioned groups. Control cells were those without any treatment, and each group was triplicated. After 8 h incubation, the cell viability was then determined using the assay kit following manufacturer provided protocol. The luminescence intensity of each group was then read using a microplate reader. The data were expressed as mean and standard deviation of 3 replicates.
Scrape-migration assay {#Sec24}
----------------------
U87-mCherry cells in the logarithmic growth phase were collected and seeded into a 6-well plate at 37 °C in a humidified atmosphere of 5% CO~2~ for 24 h. When the cells reached above 80% confluence, a vertical scratch was introduced with a 10--200 μL micropipette tip. To keep the length and width of the scratch similar, the scratching angle was kept below 30°. To remove the detached cells, the plate was washed three time with PBS and then, immediately exposed to the previously prepared CO~2~ independent medium, with 10% serum medium containing the aforementioned groups or no treatment. The time-lapse images were captured every 30 min by laser scanning confocal microscope (Nikon Ti-E and A1R) for 14 h. The rate of cell migration was then calculated by measuring the percentage of scraped area covered over the period of the experiment. The rate was defined as (%) = (1 − scraped width/initial scratch width) × 100%
Cell volume regulation measurement {#Sec25}
----------------------------------
U87-mCherry cells with the density of 10,000 cell/mL were seeded in glass-bottomed well plate and cultured for 8 h at 37 °C in 5% CO~2~ in a humidified incubator. Afterwards, the medium was replaced with DMEM containing Tf\@pSiNP or no treatment and incubated for further 8 h. The well plate was placed on a laser scanning confocal microscope platform (SP8, Leica) equipped with a humidified incubator maintained at 37 °C and 5% CO~2~. A z-stack image was taken at the exact same point before and after adding hypertonic DMEM containing sucrose at a final concentration of 1 M sucrose.
The cytoplasmic volume of the cells, which was indicated by intracellular mCherry, was measured by Imaris software. Each measurement was based on at least 50 cells each chip, and an average over 3 chip units was generated for each group. Cell shrinkage ratio, which is defined by dividing the cell volume before and after hypertonic treatment, was reported. Larger cell shrinkage ratio indicates the cell volume reduced more under hypertonic treatment.
Statistics {#Sec26}
----------
All experiments were triplicated, unless otherwise stated. Statistical analysis was conducted by using the Prism software. All data were presented as mean ± standard deviation (SD). The statistical difference between groups was determined by non-parametric Mann-Whitney test. The hypothesis was accepted at a 95% significant level (p \< 0.05).
Supplementary information
=========================
{#Sec27}
Supplementary information. Supplementary information2. Supplementary information3.
**Publisher's note** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors contributed equally: Sana Sheykhzadeh and Meihua Luo.
Supplementary information
=========================
is available for this paper at 10.1038/s41598-020-59146-5.
This work was performed in part at the Melbourne Centre for Nanofabrication in the Victorian Node of the Australian National Fabrication Facility (ANFF). This work was supported by the Foundation for Children (EOI. 2016-081), Blood-brain-barrier penetrating nanocarriers for treatment of childhood glioblastoma, John Stocker Fellowship (PF16-072), Developing theranostic porous silicon nanoparticles for brain cancer treatment. We also acknowledge funding from the Commonwealth Scientific and Industrial Research Organisation (CSIRO) Probing Biosystem Future Science Platform.
Sana Sheykhzadeh, Meihua Luo and Wing Yin Tong, Nicolas H., Voelcker conceived the project. Sana Sheykhzadeh and Meihua Luo performed the experiments, analysed the data and wrote the majority of the manuscript. Bo Peng assisted with the fabrication of migration chip. Jacinta White performed the cryo-TEM imaging and analysis. Tweety Tang developed and performed the immunostaining and transfection. Ermei Mäkilä provided the porous silicon nanoparticles. Youssef Abdalla performed experiments on patient-derived primary cells. All authors contributed to the final version of the manuscript. Nicolas H. Voelcker and Wing Yin Tong supervised the project.
The authors declare no competing interests.
| 2024-04-26T01:26:18.401715 | https://example.com/article/9104 |
Endoscopic application of Gianturco-Rösch biliary Z-stent.
Ginaturco-Rösch Z-stent is a new self-expanding stainless steel stent for drainage of the obstructed biliary system. It has been used only with a percutaneous transhepatic technique. We describe a new method for endoscopic retrograde placement of a Gianturco-Rösch biliary Z-stent. This report describes our experience for endoscopic application of a Gianturco-Rösch biliary Z-stent in a patient with a benign stricture and multiple common bile duct stones. | 2024-02-25T01:26:18.401715 | https://example.com/article/7472 |
Q:
How to remove white space, line breaks etc from a string in python
Have a below output and wanted to remove the white space and line breaks.
\n', ' var [3:0] apple [1:0];\n', ' int mango;\n', ' float banana [5:0];\n', ' int lichi;\n', '
I tried both the below code but its not working. Any comments/corrections ?
print str(str(re.sub('[^A-Za-z0-9[:]]+[\r\n]+', ' ', str(match_group_t[i]))))
print re.sub(r"(?<=[a-z])\r?\n"," ", match_group_t[i])
Drop in your comments for any correction !
Expected Output is : Only
var [3:0] apple [1:0], int mango, float banana [5:0], int lichi. So that I can store type and name separately in an array and use it later. Like
variable data in an array: [apple, var, lelem, [3:0], rleme, [1:0]]
A:
You can use the expression in re.sub:
(?:[;\n']|\s{2,})
(?: Non capturing group
[;\n'] Characters ; , \n and '.
| Or
\s{2,} Whitespace, two or more.
) Close non capturing group.
Python code:
import re
mystr = "\n', ' var [3:0] apple [1:0];\n', ' int mango;\n', ' float banana [5:0];\n', ' int lichi;\n', ' "
print(re.sub(r"(?:[;\n']|\s{2,})",r'',mystr)[2:])
Prints the desired output:
var [3:0] apple [1:0], int mango, float banana [5:0], int lichi,
| 2023-08-11T01:26:18.401715 | https://example.com/article/6805 |
Q:
Programy chatbot executes Django command
I am studying the way to integrate programy to my Django application. First thing I would like to see is chatbot be able to execute Django-command. For example
I: How many orders are created today?
bot: They are {{ Order.objects.filter(...).count() }} orders
When I look at the document. It mentions only AIML, but does not mention anything about execute further command.
Possible workaround:
It seems to be impossible since <set>, <get> tags are static and programy has to compile and loaded into the memory before bot start conversation.
Drawback:
Doing the pre-queries and set the variable. Bot will present the outdated value.
Question:
How do I let bot execute Django by itself?
A:
According to the documenation for Program-Y it does have support for an External REST Service.
If you had a Django application which presented a REST API then Program-Y should hook straight into it.
| 2024-06-21T01:26:18.401715 | https://example.com/article/3549 |
How Adapting These 6 Lessons By Aristotle Can Lead You To A Happier Life
The thinker who coached Alexander the Great, wrote more on happiness than any other ancient philosopher.
When we think of ancient Greek philosophers, we picture older men in white robes debating about political and social issues. However, philosophers actually dominated many subjects including poetry, zoology, and even theater. For example, Aristotle, who is considered one of the most important figures in western philosophy, left behind transcripts on his studies on subjects like ethics and he expanded on an a topic that is of interest to all of us: the pursuit of happiness. So, would Aristotle’s lessons help us improve our way of life? Of course, he studied human behavior and pondered on what made us happy. He stated that a sensation of joy was not a state of the mind but an activity. In addition, he saw happiness as achievable goal and ourselves as capable of developing behaviors to contrast negative obstacles. In other words, “happiness depends on ourselves” and not on destiny or luck. The following lessons can be implemented in your everyday life as they once served as advice for Alexander the Great.
“We cannot learn without pain.”
Aristotle believed there were physical and mental conditions required for us to reach happiness. By telling us that pain is an element of learning, he is saying that experiences where we have been hurt, make us more resistant for future scenarios. For example, remember being hurt by someone else’s decisions? Probably when it came to love matters. You were probably a little naive back then and the pain that this experience taught you now serves as a lesson to protect yourself from future disappointments.
“The antidote for fifty enemies is one friend.”
As independent as we think we are, nothings replaces the support that comes with a friend, especially during times when everybody seems to be against us. Aristotle recognized the importance of allies, after he lost his most prominent student, Alexander the Great, when he was chased after his enemies. We all need a friend to rely on and let our friends know they can rely on us too.
“Patience is bitter, but its fruit is sweet.”
Being desperate over something will not solve an issue faster. Aristotle knew this and his advices helped forged a legendary king of Macedonia who was able to conquer the Persian empire: Alexander the Great.
“The gods too are fond of a joke.”
As mentioned before, Aristotle believed that happiness was not a state but an activity. Thus, it is important to contribute to the reach of our own happiness and enjoy things like laughter. Sometimes we are easily offended by pranks and jokes because we feel embarrassed. The best solution to this is to laugh at yourself and let your guard down for a moment.
“He who has overcome his fears will truly be free.”
Aristotle believed in our ability to construct behaviors to overcome obstacles. He said happiness depends in the cultivation of virtue. In other words, taking the steps towards confronting your own fears is a big step directed to accomplishing happiness.
“The worst form of inequality is to try to make unequal things equal.”
Standing from a position with more restrictions than others, can cause frustration and rage at matters associated with luck. For example, coming from a low-income institution while others have the privilege to study at private ones and even abroad, sounds unfair. Bur Aristotle said that even though luck affects happiness, it all came down to how we confronted a situation that made the difference. Inequality can take place in many forms, but thinking about what others have that you don’t, doesn’t solve the problem. Working hard, persistence, and lots of efforts will help you climb to the top.
***
Aristotle put more thought into the topic of happiness than any other philosopher prior to our era. He focused on finding ways to live life at its fullest and finding meaningful details on the way. When reading his teaching think of how they apply to your daily life and decisions. His teachings might sound simple, but they make a difference in the pursuit of happiness when taken seriously. | 2023-09-09T01:26:18.401715 | https://example.com/article/7515 |
Butler, Vogt homer in A's 14-2 win over Cubs
Tools
Oakland Athletics' Barry Zito works against the Chicago Cubs in the fourth inning of a spring training exhibition baseball game Tuesday, March 24, 2015, in Mesa, Ariz.
MESA — Edwin Jackson might be thinking he wishes he never found his way to work.
The Cubs right-hander was scratched from his start Tuesday when he went to the wrong ballpark, then gave up eight runs when he finally found the mound in Chicago's 14-2 loss to the Oakland Athletics.
Jackson said he entered 'Oakland Athletics spring training complex' into his Google Maps app on his phone and it directed him to Phoenix Muni, which is across the street from the Phoenix Zoo. The A's are now training at HoHoKam, the Cubs former spring training home. The Cubs current home is less than five miles away.
"It was my fault for not looking to see where it was," said Jackson, who arrived in time to see Cubs prospect hit his ninth homer of the spring in the third inning. "I've had positive outing throughout the spring, except this one."
Jackson said getting to the park late had no effect on his pitching.
"I was already dressed and got here in time to get ready but they didn't want me to rush things," he said. "I came to the stadium with the mindset of being ready. It was a crazy way to start the day."
Blake Parker made the emergency start and gave up a two-run homer to Billy Butler.
Jackson entered for the second inning and allowed nine hits — six for extra bases — eight runs in 1 2-3 innings.
Stephen Vogt also had a two-run shot for Oakland.
"They hit the ball whether it was a good pitch or not," Jackson said. "They did a lot of damage with two outs. They found all the gaps."
Barry Zito, returning to baseball following a year's absence, extended his scoreless innings streak to 11, allowing one hit in four innings. He walked three and struck out two, lowering his ERA to 2.30.
"I can only control how I throw the ball," Zito said. "I got up to 65 pitches today. I hit the mark."
ZEROES FOR ZITO
Zito keeps things simple. Make pitches, keep walks to a minimum and continue to compete.
"When I make my pitches, things have gone OK," he said after his third straight scoreless outing. "I felt pretty but I don't want to be walking guys like that. I threw an errant pitch here and there but that sequence was pretty good."
A's manager Bob Melvin continues to marvel at Zito's return.
"It's a blowout game, he's pitching to guys with large numbers on their back and he still makes every pitch. He continues to get outs. It's impressive to see."
COOK SENT TO MINORS
Former all-star closer Ryan Cook was optioned to Triple-A Nashville after the game. He had appeared in five games, allowing 13 runs over 5 1-3 innings.
"The timing of it is to get him down there and get things worked out," Melvin said. "We expect him to be back. He's too good, too talented not to pitch here."
STARTING TIME
Athletics: Starter Drew Pomeranz allowed two runs on three hits over 2 2-3 innings. He walked four and struck out four. Pomeranz said his right hip tightened up on him during warmups and he was never able to get it right. He said it's happened in the past, and only in spring training. "It shouldn't be something that's sore past today," he said. "I check it every day. I'm used to dealing with it. It's just a pain. I want to have good results. I don't want to leave any doubt."
TRAINER'S ROOM
Cubs: INF Starlin Castro (tight right groin) had the day off but was expected to return to action on Wednesday. ... RHP Kyle Hendricks threw five scoreless innings in a 'B' game against the Arizona Diamondbacks Tuesday. He allowed one hit. ... LHP Jon Lester (tired arm) will make a minor league start in Thursday.
Athletics: OF Coco Crisp was scratched from the starting lineup with soreness in his left elbow and received a cortisone shot. He's expected to miss two to three days. "The goal is to get him healthy by the start of the season," Melvin said. ... OF Josh Reddick (right oblique strain) is moving closer to returning to action and could be in the lineup sometime this weekend.
UP NEXT
Cubs: LHP Travis Wood will pitch when Chicago travels to Peoria to take on the Seattle Mariners. | 2023-08-22T01:26:18.401715 | https://example.com/article/7368 |
This is a story from ESPN The Magazine's Body Issue 2017, on newsstands on July 7. Subscribe today!
GREG ODEN HAS a recurring dream. He's playing defense for the Trail Blazers. He blocks a shot and passes to the outlet and sprints downcourt, light and fast and strong. He's three years removed from his last NBA appearance now, trying to build a new life out of the lows of his last one, but in the dream he can still play. He can still run. He glides to the paint, catches a return pass and dunks. Coast-to-coast. The crowd explodes. He feels a sweet rush of adrenaline. Fans love him, and he loves himself -- all joy and no shame.
ODEN IS IN the lobby of the academic support center on the Ohio State campus on a late-May morning, registering for classes to finish the degree he started a decade ago. He lived in a dorm a block away at the time. He remembers returning to Columbus after a Final Four run ended in a national championship loss to Florida in 2007. Most assumed he would leave for the NBA, but he came back to go to class. "I never planned on leaving," he says. Students waited for him outside his dorm. Cars stopped on the street to stare. It took him 45 minutes to walk one block. Oden called his coach, Thad Matta, and said, "I can't get to class." A few weeks later, Oden announced that he would leave for the draft, one of many decisions in his life that wasn't really his to make. Now, 10 years, three major knee surgeries and a failed career later, Oden arrives at the academic support center unnoticed and unbothered, his burden no longer walking to this building but rather walking up it.
THREE FLIGHTS OF stairs. That's what he's looking at to reach his adviser's office. At 29, Oden can't jump like he used to -- he can't leap at all off his right leg -- but he swallows half a flight of stairs in his first step. He gently grunts. His body is hurting and scarred, but he actually looks young. It used to be the opposite. In high school, the deep creases near his eyes led some to suspect he was older than his verified age. Even then, with a seemingly limitless future, he struggled under the pressure placed upon him by his body, by what it seemed capable of, by the way it dictated to him. He was going to play basketball. He was going to be a superstar. He was going to take care of his family. He was going to be a Hall of Famer.
The pressures grew when his body failed him. Over the course of a decade, he developed a dependence on painkillers and alcohol to sleep, and he was arrested on domestic violence charges. Oden is now a student again, with a fiancée and 9-month-old daughter, still processing being at the center of a mania and disappointment to which few American athletes can relate. He reaches the top of the first flight of stairs at the academic support center, breathing too hard for the distance, and says, "Dead lifts are catching up to me!"
At Lawrence North in Indianapolis, Oden won three consecutive championships and was a two-time Parade All-American. Brian Bahr/Getty Images
THE DAY BEFORE registering for classes, Oden is in the weight room at the Jerome Schottenstein Center on campus, where he once played and now helps the basketball team as a student assistant coach. He places just two 45-pound weights on a bar -- "I've got nothing to prove," he jokes with a shrug -- and deadlifts it, bending and straightening his fragile knees. In between sets, he describes himself as the "biggest bust in NBA history," as if saying it out loud will give him some kind of dominion over the pain of it. Before the NBA, Oden never had a serious knee injury. Not at Sarah Scott Middle School in Terre Haute, Indiana, where he first worked hard at basketball. Not at Lawrence North in Indianapolis, where he won three consecutive championships and was a two-time Parade All-American. And not during his single season at Ohio State, where he was a first-team All-American.
Two lifts into another set, something is off.
"Coach!" Oden hollers, dropping the bar and easing himself to the ground until he lies flat on his back. Dave Richardson, Ohio State basketball's longtime strength coach, runs out of his gym office. He crouches down and lifts Oden's right leg, gently shaking his foot, then pulling hard as if he were tugging a rope, his face reddening, Oden wincing for almost a minute before they both feel a pop of relief.
Still sweating, Oden explains that when he was in sixth grade, he grew so volcanically -- 6 inches in less than a year -- that his right hip detached from its socket. After surgery to place two pins in the joint, Oden enjoyed swinging his gangly legs on crutches down the hallways at school. But though the procedure worked, it left his right leg 8 millimeters shorter than his left. He walked with a bit of a dip, leaving people to assume that he was strutting, acting hard. Over time, his body adjusted, but the hip required the occasional heavy tug when it jammed.
After Oden was drafted first overall by the Trail Blazers in 2007, one pick ahead of Kevin Durant, the team outfitted him with a special orthotic insert to even his legs. "Three weeks later, I'm in surgery," he says. Oden can't prove that the orthotic is the sole reason his body collapsed in the NBA. The wheels were in motion for his body to fall apart the moment he hit his first growth spurt on the way to 7 feet. Everything in his life since has been governed by it.
"And now I'm back here," he says at the gym, "trying to figure it all out."
The Heat signed Oden in 2013, but he played sparingly that season, and the team let him walk. Andrew D. Bernstein/NBAE/Getty Images
HALFWAY UP THE stairs, Oden slows for a moment before he hits the final stretch. He's slightly hunched over and for a moment doesn't seem that tall -- then he straightens himself and you wonder how anyone ever got a shot off. He's wearing his own shoe: Nike size 19 in the Trail Blazers colors of white, red and black, a logo of his last name etched into the heel. Once an embodiment of a bright basketball future, it's now a relic. Oden's friends worried when he was drafted by Portland, not just because he had to move to the Pacific Northwest after spending most of his adolescence in the Midwest. His personality always seemed miscast for his body. He was an introvert -- a self-described loner who "goes with the flow" -- who had pictured himself as one day being a dentist or a movie critic. There was a lingering sadness you felt in his company a decade ago, a fragility as he told you he felt "expected and obliged to be the best."
Oden always had tried to reckon with what his body was and could be, its power and potential. When he was a 17-year-old junior, he drew up a plus-minus list about whether to enter the NBA draft or go to college. NBA: "Set for life. Play against the best. Could be all-time leading scorer." College: "Fun. Win national title? Love Ohio State." He lunched with Kevin Garnett and bowled with Peyton Manning and rode in a limo with Baron Davis. But he also "wanted to hide and wanted to be a kid," says Reginald Shelt, an assistant coach at Lawrence North in those years. Oden couldn't disappear off the court, so he sometimes would try to do so on it, content to rebound and block shots. Jack Keefer, Lawrence North's head coach, instated a 15-touches-a-game rule for him. "He never wanted to be a basketball player," Shelt says. "That wasn't his thing. Yes, he played basketball. But basketball didn't define him in his mind."
Former Ohio State assistant Alan Major remembers a jump shot Oden made against Georgetown in the Final Four because it was the Buckeyes' 38th game and Oden had taken just a handful of jumpers all year. GMs nitpicked that Oden didn't dominate the way a 7-footer should, but a perceived red flag was actually a teenager's coping mechanism. "He really needed to be 5-11 and a bookworm," Major says.
When Oden got to Portland, his isolation wasn't just that of the introverted. It was the isolation of the injured. His knee injury after wearing the orthotics wiped out his first season. At the beginning of his second year, the team gave him an insert so thick that it pushed his right ankle past the rim of his high-tops. Thirteen minutes into his regular-season debut, he sprained his right foot and missed two weeks. Three and a half months later, he chipped his left kneecap and missed three more weeks.
As Oden's body broke, so did his mind. Afraid of being photographed in public doing anything but rehabbing, he wouldn't leave home, which soon turned into not leaving his bedroom. "I tried to get in my own little cocoon," he says. He would lie in bed all day, living with the dull panic that he was the Sam Bowie to Durant's Michael Jordan. "You're a bust and you can't do nothing about it," he says now. "I'm sitting there watching all these guys get better." Oden went to a dark place. Before he had turned 21, he'd grown used to drinking alone -- there are no fake IDs for famous 7-footers -- and now all of the vices that had been creeping into his life for years took over. His nighttime routine became beer, light liquor, dark liquor, champagne, wine -- "whatever I could get," he says -- coupled with two Percocets, at least two Vicodin and at least three sleeping pills, anything to help him feel less. "It got to the point where I was taking so many pills and drinking just to sleep at night that even if I didn't want to drink, I wouldn't be able to sleep," he says.
Guilty and ashamed, Oden apologized to Trail Blazers management before his 2007 and 2009 surgeries. He was easy to text but hard to get on the phone. "I don't know that he had a trusted male figure in his life that could give him good advice," Shelt says. Oden wanted out. He would look at pills and ask, Does it make you drowsy? All right, I'm taking it. "I was like, 'If I don't wake up, whatever,'" he says.
In 2009, Oden started seeing a therapist. Each session began with 10 minutes of silent meditation. He cut back on the heavy drinking and hired a personal chef. Through the first 20 games of that season, he played well and enjoyed himself, showing flashes of his original promise. But in December, he jumped to challenge a shot by Aaron Brooks of the Rockets. Their knees bumped midair. Oden felt a hollow pop. The Blazers' trainer held Oden's head to the floor so that he couldn't look down at his kneecap, mangled and split. Teammate Brandon Roy hustled to his side and said, "Oh my god," and backed away.
When Oden went down with a knee injury in December 2009, teammate Brandon Roy could only respond: "Oh my god." Cameron Browne/NBAE/Getty Images
The only thing Oden remembers from the night in 2012 when the Trail Blazers cut him -- after three more years and three more knee operations -- is that he drank enough to not remember anything. The Heat signed him in 2013, but he played sparingly that season, and the team let him walk. Soon after, on Aug. 7, 2014, Oden was supposed to be with the Ohio State basketball team in the Bahamas, volunteering on a summer tour, but he bailed at the last minute. He went to a club with his on-and-off girlfriend at the time, Christina Green, and he coupled beers with shots. They returned to the house of Oden's mother, Zoe, and started arguing. Zoe and a friend of Green's tried to calm him down, but Oden swatted them out of the way, pushed Green onto a couch and hit her three times, according to the police report. The last blow split open her forehead, drawing blood. Oden's mother pulled him off, and Green's friend called 911. Oden also called 911, ordered an ambulance and turned himself in. "I was wrong," he told police, "and I know what has to happen."
Oden pleaded guilty to a felony charge of battery with moderate bodily injury, for which he received probation, a fine and an order to attend counseling and Alcoholics Anonymous classes. Almost three years later, he thinks often about that night, though he can't discuss it in much detail because of the terms of a civil suit. "I just want to be a good example for my fiancée and daughter," he says. He thinks about what will happen when Londyn one day Googles her daddy's name and discovers something much worse than being the biggest bust in NBA history. And he thinks about what he did next, trying to begin a new life.
He moved back to Columbus.
HE REACHES THE top of the stairs, masking pain. He always hurts somewhere -- his knees, his legs, his hip, his back. He talks about goals the way many former NFL players do, in terms of just wanting to be able to walk and to be able to pick up his daughter and to be able to make peace with not feeling right -- not feeling good -- ever again. People sometimes ask if he still plays ball or, worse, look at him with pity in their eyes because they know why he doesn't. He looks like he could play -- until he tries to run. He's on a roster for a five-on-five summer tournament, but whether he'll play is an open question. He loves his identity as a father and husband-to-be, but he needs a professional distinction outside of his current one.
So in fall 2014, Oden started showing up at the Schottenstein Center basketball court. He had a support system -- Matta would let him come to practices and games and be around the guys -- but it was no small feat. A body that once announced his arrival now announced his failures. "I tried to find happiness again," he says. One day, Jake Diebler, an OSU video coordinator at the time, introduced himself. "I'm a big fan of yours," Diebler said. They became friends, and Oden became Diebler's project. He was out of shape, in constant pain, bereft of confidence and still feeling the pressure to somehow right a wrong, both with his career and his criminal actions. He would often cancel their morning workouts, claiming his knees hurt. "Rather than a full workout, let's do half," Diebler would say, and Oden would relent. "He was lost," says Diebler, now an assistant at Vanderbilt. "It hurt my heart to see him go through what he did. But it was also cool to see him go through it."
Oden could no longer rely on his physical dominance, so he practiced hooks and jumpers. By the summer of 2015, he landed tryouts with the Mavericks and Hornets but received no offers. The only chance came from the Jiangsu Dragons of the Chinese Basketball Association. He took it. In the preseason, he injured his thumb, missing three weeks. But he didn't fall apart; he returned to play 25 games. That he had even gotten himself in shape to play felt like enough of a win. "I was actually ready to play basketball," he says. It was more than a chance to walk off the court with a new semblance of peace. It was an invisible victory upon which the rest of his life would be built.
"He really needed to be 5-11 and a bookworm," former Buckeyes assistant Alan Major said. Jim Prisching/Chicago Tribune/Getty Images
HE ENTERS THE office of John Macko, his academic counselor. Oden sits opposite Macko, knees touching the bottom of the desk. Oden still has a lot of the $24 million he made in his career, but he knows how quickly the life he thought he'd have can disappear. He might coach. Might broadcast. Might go into business. "Who knows?" he says.
Energetic and excited to see Oden, Macko plays a video made years ago in which famous OSU athletes tout the school's academics.
"You seen it?" Macko says.
"I haven't seen it," Oden says.
Oden is the first athlete to appear.
"Oh man," he says, shaking his head. "So skinny."
His old life will always follow him, haunting him, even as he tries to define his new one. He didn't throw away his future; his body broke before he could experience it. He is often asked to give motivational speeches, but he doesn't know what to say. "I don't think I have an ending yet," he says. On the first day of school last fall, Oden stood in line for his student ID card, surrounded by freshmen. Last semester he took a class about NCAA rules and regulations -- a class he lived -- but he still did his required reading. He grinds as if something larger than a degree is at stake.
Macko switches screens, to Oden's student profile.
Oden seems antsy, staring at his accumulated credits. He registers for advanced math and history of sports. Now the number of credits left for his degree appears on the screen. He leans in.
"That's all you've got left," Macko says.
"Oh really?"
He's closer than he realized. He leans back, feeling a little lighter. "I'm chopping away at it." He'll likely receive his degree in two years. He smiles and says, "I need to eat."
He will go next door to a greasy spoon called Hang Over Easy, one of his favorite spots from his first run as a student. People will stare at him as he enters, as he ducks below low ceilings. He'll find a quiet table and relax, ordering both breakfast and lunch. A waiter will welcome him back and give him a card for free food. Someone else will shake his hand and will walk away saying, "That's my man!" Then he will go home and play with Londyn. A good morning will become a good day. But first, Oden walks down the stairs of the academic support center, back to the first floor. His steps are slow and studied, but they are steady, so much easier than the way up. | 2023-11-18T01:26:18.401715 | https://example.com/article/9238 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.