text
stringlengths
12
4.76M
timestamp
stringlengths
26
26
url
stringlengths
32
32
DART-MS as a preliminary screening method for "herbal incense": chemical analysis of synthetic cannabinoids. Direct analysis in real time mass spectrometry (DART-MS) served as a method for rapid high-throughput screening of six commercially available "Spice" products, detecting various combinations of five synthetic cannabinoids. Direct analysis in real time is an ambient ionization process that, along with high mass accuracy time-of-flight (TOF)-MS to 0.0001 Da, was employed to establish the presence of cannabinoids. Mass spectra were acquired by simply suspending a small portion of sample between the ion source and the mass spectrometer inlet. The ability to test minute amounts of sample is a major advantage when very limited amounts of evidentiary material are available. In addition, reports are widespread regarding the testing backlogs that now exist because of the large influx of designer drugs. This method circumvents time-consuming sample extraction, derivatization, chromatographic, and other sample preparative steps required for analysis by more conventional mass spectrometric methods. Accordingly, the synthetic cannabinoids AM-2201, JWH-122, JWH-203, JWH-210, and RCS-4 were identified in commercially available herbal Spice products, singly and in tandem, at concentrations within the range of 4-141 mg/g of material. Direct analysis in real time mass spectrometry decreases the time necessary to triage analytical evidence, and therefore, it has the potential to contribute to backlog reduction and more timely criminal prosecution.
2024-06-16T01:26:58.646260
https://example.com/article/4156
Update: Police name suspect. Warning: The video embedded below contains explicit language. A Giant employee said she is in quarantine after a shopper spit on her face earlier this week. Carmella Jones of Harrisburg said she appears in a video circulating on Facebook defending herself against an unidentified female customer at the chain’s Kline Village store in Harrisburg. “I’ve never reached that level of anger in my life,” Jones said. “The girl was coming over to beat the crap out of me because I wouldn’t let her in the store,” she added. Since April 13, Giant has been limiting the number of shoppers inside stores as a social distancing measure in light of the coronavirus pandemic. Customers are asked to stand six feet apart as they wait to enter stores. READ MORE: Grocery store etiquette: How not to be a jerk during the coronavirus pandemic Jones said she is part-time and usually fills pickup grocery orders, but on on the day of the incident on April 14 she was asked to monitor the store’s front door. According to Jones, the customer tried to bypass other shoppers and got upset when she wasn’t permitted inside the store. Jones said the customer swore for several minutes and threatened to slap her. That’s when Jones said she picked up a yellow cone. “Then she stopped and coughed, and I said, ‘Don’t you dare spit on me.’ And she spit on me,” Jones said, adding the majority of the spit sprayed on her face and chest. In the video, Jones, who is wearing a red shirt, appears to hit the other woman with the cone before ramming her with a cart. “I swung and shoved to keep her away from me because she continued to come at me,” Jones said. At that point, what appears to be two other Giant employees try to separate the women as they begin to trade punches. Someone can be heard shouting, “You spit on me.” Jones said her granddaughter is one of the employees. According to Giant, the fight is an isolated event and they contacted the Harrisburg Police Department. Police Sgt. Kyle Gautsch said the incident is still under investigation and charges are pending. “During these difficult and anxious times, it’s important that we all come together as a community to support each other,” wrote Giant spokesman Ashley Flower in an email. Due to the nature of the investigation, Flower said Giant will not be commenting further on the incident. “The Giant Company is committed to providing a safe environment for all who enter our stores and take matters such as these very seriously,” she said. Jones, who said she is still employed at Giant, noted the incident shows the difficult circumstances grocery workers are under at this time. She added her doctor ordered her to quarantine at home for two weeks. “This needs to get out - how hard we work and how we risk our life,” she said, adding “only to be disrespected.” Thanks for visiting PennLive. Quality local journalism has never been more important. We need your support. Not a subscriber yet? Please consider supporting our work.
2024-01-21T01:26:58.646260
https://example.com/article/7656
PROJECT SUMMARY Background: According to the Bureau of Labor Statistics, the American workforce is aging. As a result, health problems associated with the aging process, like coronary heart disease (CHD) present new health and safety challenges. Over 3.5 million workers have CHD with significant work limitations and increased disability. Yet, little is known about how aging workers with CHD practice self-care, (i.e., adherence to medication and treatment, symptom monitoring and symptom management) on a daily basis within the context of employment or the consequences of poor self-care behaviors on aging worker health and safety. Furthermore, the effect of organization of work, defined as the work process (e.g., the way jobs are designed and performed) and organizational practices (management and production methods and human resource policies) on the health behavior of self-care and worker productivity in this population has not been explored. The proposed study is the first step in a program of research that addresses the National Occupational Research Agenda (NORA) priority to investigate how organization of work affects the health of the growing aging workforce, to identify risk factors that may disproportionately affect aging workers and to develop recommendations for interventions to improve the health and safety of older workers. The training plan is also aligned with the NORA research priority to prepare experts in organization of work. Purpose: The primary goal of the proposed study is to investigate the self-care practices of aging workers with CHD and the relationship of organization of work, resultant job-level risk factors, self-care, and health and productivity outcomes (health status, quality of life, absenteeism and presenteeism). This proposal has three specific aims: 1) to describe the self-care practices of aging workers with CHD, 2) to identify self-care types of aging workers with CHD and identify the characteristics and work-related determinants of self-care types in this population and 3) to explore the relationship of work organization and job-level characteristics to self-care, health status, quality of life and work-related (absenteeism, presenteeism) outcomes. Methods: To achieve these aims, a longitudinal study using mixed methodology and robust statistical methods is proposed. A sample of 125 adults (over age 50) with CHD who are employed full-time will be recruited from the New York City region. Findings from this study will identify organization- and job-level factors that predict self-care behavior types among aging workers with CHD. The significance of this study lies in its potential to serve as a basis for the development of targeted interventions, aimed at both work organization and job-level factors, to improve self-care among aging workers with CHD. Implications of study results may potentially lead to recommendations for workplace policies and generate novel job accommodations that facilitate self-care within the context of work. Career Development Training Plan: The long term goal of the training plan is to prepare the candidate for an occupational health research career as a successful independent investigator with expertise in organization of work research and a focus on optimizing self-care among aging workers with chronic illness. The immediate goals of this training plan are to provide the candidate with the opportunity to 1) engage in extensive training focused on organization of work theory and research and advanced quantitative methods, and 2) conduct an independent research project examining the self-care practices of aging workers with CHD and the relationship of organization of work, self-care and health and productivity outcomes through guided mentorship by an interdisciplinary team of experts and the extensive resources of New York University and the NIOSH Region II Universities NY/NJ ERC.
2023-12-02T01:26:58.646260
https://example.com/article/1616
State of the art in intravaginal ring technology for topical prophylaxis of HIV infection. There is renewed interest in the development of long-term, controlled-release dosage forms for the intravaginal delivery of antiretrovirals for HIV prophylaxis. This interest has catalyzed a renaissance in vaginal drug delivery, increasing the fundamental understanding of determinants of controlled drug delivery in the vagina as well as development of new materials, delivery platforms, and animal models. Our goal in writing this review from the perspective of engineers and pharmaceutical scientists interested in prevention of sexually transmitted infections is to highlight the current state of the art, progress in preclinical programs, new drug-delivery device designs, and to discuss some of the important unknowns in this area of HIV prevention for the general audience involved in HIV research. As far as antiretrovirals are concerned, this review is limited to programs working with antiretrovirals that are supported with an investigational new drug filing. We draw primarily from published papers in the PubMed and CAS databases, however, many of the most recent advances have yet to appear in the peer-reviewed literature and for this class of publications we draw from a recent formulation workshop held by CONRAD as well as from the Microbicides, Controlled Release Society, and CROI meetings.
2024-01-02T01:26:58.646260
https://example.com/article/3927
Report: BGE struggled to gather storm crews after derecho Baltimore Gas and Electric Co. struggled to muster the out-of-state crews from partner utilities needed to restore hundreds of thousands of power outages in the days after a deadly derecho struck June 29, the company said in a report to state energy regulators. Utility officials said they had little time to gather the necessary manpower because the storm struck with little warning. They also expressed concern about customers' high expectations for rapid restoration. The report, filed late Monday, kicks off the Maryland Public Service Commission's review of whether BGE's storm response was adequate. Power outages peaked at 430,000 at 1 a.m. June 29, two hours after the storm battered Maryland with sustained 70 mph winds, according to the report, More than 762,000 BGE customers lost power at some point in the nine days after the storm. The average outage lasted 38 hours. Irate customers and their advocates have criticized BGE for the length of storm cleanup and want to find a solution to prevent and shorten future outages. "People expect a higher level of reliability than they expected 50 years ago because they need a higher level of reliability for our modern economy," said Sen. Jim Rosapepe, who has advocated burying of power lines and fining of utilities for poor reliability. The report follows on the heels of BGE's unrelated request Friday to increase natural gas and electricity distribution charges, adding $11.80 per month to the bill of a median customer who receives both gas and electric service from the utility. On June 29, BGE said in the report, weather forecasts it received from contractors WeatherBug and Climate Impact Co. gave little indication that thunderstorms coming from the Midwest would hold together and reach Maryland. As late as 9:30 p.m., an hour and a half before the intense storm reached Baltimore, there was a threat of "general thunderstorms," but even those appeared likely to break up. Had there been more warning of the storm, as in the case of a hurricane, BGE officials would have worked to mobilize 1,000 workers in advance, the report said. BGE is a member of two shared-crew networks, one in the Mid-Atlantic and another in the Southeast. Instead, the utility was several hundred workers short of what it needed to operate repair crews in four out of the first five days after the storm. The storm downed about 9,200 wires. Each day multiple calls for more crews often went unheeded by its partners. BGE also called on a New York-based network, independent private contractors and other contractors that had worked with BGE but were not tied to another utility. The utility was unable to muster 1,000 workers until July 2 because crews were busy in other areas hit by the storm. A day later, the scope of the remaining work meant manpower requirements were raised to 1,500 workers, a level that wasn't reached until July 5, the report said. BGE's difficulty gathering crews was not unique. Under the crew-sharing system for major storms, no utility gets its full request of assistance if there aren't enough available workers to go around, said Stephen J. Woerner, BGE's chief operating officer. In the Washington area, Pepco also requested a force of more than 1,000 workers. Regardless of the challenges, BGE officials said in the report, with 1,000 fewer workers than used after Hurricane Irene last year, the utility restored a comparable number of outages in about the same amount of time. BGE restored 47 percent of outages within 36 hours and 84 percent within 4 days, according to the report. Utility officials also expressed a desire for customers to temper their anger over outages. Customers' anger was intense. BGE received 1.3 million calls, 6,100 e-mails and 11,000 mentions on social media from customers without power, according to the report. "During the June Derecho restoration, it was once again apparent that there is a disconnect between customer expectations of what is a reasonable [restoration time] in the aftermath of a severe impact storm and the realities associated with restoring power under such conditions," utility officials wrote in the report. "BGE will continue to work to provide its customers with the best information possible about when service will be restored, recognizing that unforeseen operating challenges can extend or elongate individual [restoration times]." Consumers' growing dependence on the Internet and other modern conveniences such as air conditioning has put utilities like BGE in a difficult position, said Mike Hyland, senior vice president for engineering services for the American Public Power Association. The association represents publicly owned utilities; BGE is not a member. "The expectations of restoration are a lot different than they used to be," Hyland said. "The idea of being without power more than about 48 hours drives the average customer crazy, let alone a week." One consumer advocate recognized the challenge of the massive storm cleanup job but defended customers' expectations. "It's hard not to feel sympathy for them; they have a big job to do," Maryland PIRG State Advocate Jenny Levin said. "But I don't think consumers expectations are too high. … Even when they have had advance notice they have had a lackluster response." Rosapepe, a Democrat who represents Prince George's and Anne Arundel counties, questioned why utilities weren't prepared for the storm, given that global climate change may be causing more extreme weather — a belief that Gov. Martin O'Malley and Public Service Commission Chairman Douglas Nazarian also recently expressed. BGE doesn't have an official stance on climate change, Woerner said. However, the utility is eager to have a public discussion about severe weather, massive outages and the costs and benefits of potential solutions such as hiring more permanent line crews or burying some or all power lines, he said. O'Malley set up a work group July 25 that will explore ways to improve electricity reliability in Maryland, and BGE officials welcomed the effort in the report. "It's best in that public policy arena where it's done sort of as an open book, where we can get all the facts on the table," Woerner said. Maryland Natural Resources Secretary John R. Griffin will also brief a U.S. Senate panel chaired by Sen. Ben Cardin on Wednesday, discussing what needs to be done to prepare for more severe weather brought on by climate change. Maryland People's Counsel Paula Carmody, who advocates for utility customers before the PSC, said her office will form positions on utilities' storm responses and ways to improve them after an engineering consultant reviews storm reports from BGE and other utilities. BGE customers will have the opportunity to air their concerns in public hearings across the Baltimore area Aug. 13-16 or in writing to the commission. Utility leaders will appear before the commission for hearings in September.
2024-04-14T01:26:58.646260
https://example.com/article/7843
--- abstract: | Identifying a set of homogeneous clusters in a heterogeneous dataset is one of the most important classes of problems in statistical modeling. In the realm of unsupervised partitional clustering, k-means is a very important algorithm for this. In this technical report, we develop a new k-means variant called Augmented k-means, which is a hybrid of k-means and logistic regression. During each iteration, logistic regression is used to predict the current cluster labels, and the cluster belonging probabilities are used to control the subsequent re-estimation of cluster means. Observations which can’t be firmly identified into clusters are excluded from the re-estimation step. This can be valuable when the data exhibit many characteristics of real datasets such as heterogeneity, non-sphericity, substantial overlap, and high scatter. Augmented k-means frequently outperforms k-means by more accurately classifying observations into known clusters and / or converging in fewer iterations. We demonstrate this on both simulated and real datasets. Our algorithm is implemented in Python and will be available with this report. Keywords: Unsupervised Learning, Clustering, k-means author: - | J. Andrew Howe, ahowe42@gmail.com\ Independent Researcher, Riyadh, Saudi Arabia bibliography: - 'AugClust.bib' title: 'Improved Clustering with Augmented k-means' --- \[sec\_intro\]Introduction ========================== Clustering $n$ datapoints in $p$ dimensions into $K$ distinct clusters is a very old problem in statistical modeling. The k-means algorithm, introduced by MacQueen [@MacQueen1967], is an important method[^1] to do this. Fundamentally, the k-means algorithm iterates through a set of steps in an attempt to minimize the sum of squared distances within all $K$ clusters. Its popularity is probably due to this inherent simplicity, as opposed to its perfection. Indeed, as mentioned in Krishna and Murty [@KrishnaMurty1999], the k-means algorithm exhibits a strong tendency to converge to suboptimal local minima, and is not robust to the initial state, leading to different ways to cluster the same dataset. Many researchers have proposed differing degrees of variations around the underlying theme of iteratively minimizing the total sum of squared distances. Wong [@Wong1982] developed a hybrid clustering algorithm using both k-means and single-linkage hierarchical clustering, with the specific goal of identifying high-density modal regions. With a similar goal of finding tight, stable clusters, Tseng and Wong [@TsengWong2005] used a re-sampling method with a merged k-means and truncated hierarchical clustering algorithm. To combat the same issue of scattered observations which truly don’t belong in any cluster, Maitra and Ramler [@MaitraRamler2009] proposed a new algorithm which iteratively builds each homogenous spherical cluster around a core, so that scattered observations are explicitly excluded. Several authors have used trimming in clustering with k-means, in which certain observations are remove (or trimmed). The goal of trimming is to identify clusters robustly w.r.t. outliers, originally proposed by Gordaliza [@Gordaliza1991]. Cuesta-Albertos *et al.* used a data-based trimming method optimized by simulated annealing [@Cuesta-Albertosetal1997]. García-Escudero *et al.* [@Garcia-Escuderoetal2008] introduced a trimmed clustering algorithm, constrained by the ratio of maximum to minimum eigenvalues from the within-cluster scatter matrices. García-Escuder *et al.* [@Garcia-Escuderoetal2009] further extended robust clustering with trimmed k-means by modeling linear patterns in the data around which clusters formed. Bozdogan [@Bozdogan1983] proposed an initialization method that initializes the clusters so that they are evenly spaced throughout the data. Arthur & Vassilvitskii [@ArthurVassilvitskii2007] proposed a modified algorithm called *k-means++*, wherein cluster centers are spaced around each other following an iterative distance-weighting scheme. Krishna and Murty [@KrishnaMurty1999] created a hybrid algorithm called *Genetic k-means* based on the Genetic Algorithm of Holland [@Holland1975; @Holland1992]. Along similar lines, Song *et al.* created their *GARM* algorithm, which computes the cluster distances using a regularized Mahalanobis distance. Use of the Genetic Algorithm in both cases allows the clustering algorithm to better avoid local optima and robustifies it against initialization. Perhaps most conceptually relevant to this article is the work by Tibshirani and Walther [@TibshiraniWalther2005]. Like [@TsengWong2005; @Wong1982], they focused on identifying stable clusters. Their approach used iterated k-fold cross-validation to create a hybrid unsupervised and supervised clustering prediction technique. In this work, we propose a new variant called *Augmented k-means* in which each iteration is augmented by performing logistic regression. Hence, our algorithm joins unsupervised and supervised clustering. The cluster-belonging probabilities output by the regression are used to exclude some observations from being used to re-estimate the cluster means. While this certainly adds computation time, the augmented algorithm tends to more accurately classify the observations into known clusters, and often converges in fewer iterations. For data with homogeneous, non-overlapping clusters and little scatter, Augmented k-means should require more time and iterations than k-means to converge to a solution, assuming the clusters are seeded well (as in [@ArthurVassilvitskii2007; @Bozdogan1983]). However, in our experience, real datasets for which clustering is needed are often generated by diffuse, heterogenous, non-spherical, and highly overlapped populations. Hence, Augmented k-means is a practical addition to the current set of clustering methodologies. In the interest of reproducible and open research, the Augmented k-means algorithm is implemented in Python using the scientific computing package numpy and the machine learning library scikit-learn [@scikit-learn]. Along with the code for running the Monte Carlo experiments, it will be available with this report. Our new algorithm is detailed in Section \[sec\_algorithm\], followed by numerical results on both simulated and real datasets in Section \[sec\_results\]. We finish with some concluding remarks in Section \[sec\_conclude\]. \[sec\_algorithm\]Augmented k-means =================================== The k-means algorithm typically starts with $K$ initial cluster means[^2]. From here, it iterates assigning observations into their closest cluster, and recomputing the cluster means. The notation we use is: - $\mathbf{x_i}$: the $i$th observation vector, $i=1,\ldots n$ - $y_i$: the cluster assignment of the $i$th observation, $y_i\in\left\{1,\ldots,K\right\}$, $i=1,\ldots n$ - $I\left(i,k\right)$: returns $1$ if $y_i=k$, and returns $0$ otherwise - $\mathbf{C_k}$: the mean vector of the $k$th cluster, $k=1,\ldots,K$ - $\epsilon$: convergence criteria for sequential difference in total sum of squared distances After generating $K$ initial cluster means - we use the initialization from k-means++ [@ArthurVassilvitskii2007] - the k-means algorithm is: 1. For each observation $\mathbf{x_i}$ and cluster $k$, compute the squared Euclidean distance to the mean $\mathbf{C_k}$: $$d_{ik} = \parallel\mathbf{x_i}-\mathbf{C_k}\parallel^2_2.$$ 2. Assign each observation to its closest cluster: $$y_i = \underset{k=1,\ldots,K}{\operatorname*{\arg\!\min}}d_{ik}.$$ 3. Recompute the cluster means: $$\mathbf{C_k} = \frac{1}{n_k}\sum_{i=1}^n I\left(i,k\right)\mathbf{x_i},\ n_k = \sum_{i=1}^n I\left(i,k\right)$$ 4. Compute the total sum of squared distances: $$S_t = \sum_{k=1}^K\sum_{i=1}^n I\left(i,k\right)d_{ik}.$$ 5. Measure the change in the total sum of squared distances from the previous iteration[^3], and compare against $\epsilon$. If $\left\vert S_{t-1} - S_{t} \right\vert<\epsilon$, exit. Otherwise, return to step (i). After step (ii), we have $n$ cluster assignments $y_i$. If we take the stance that they are known class labels, we can use this data to formulate a supervised learning problem. Accordingly, Augmented k-means inserts one step after (ii) and modifies (iii). This new step begins by solving the set of multinomial[^4] logistic regression equations shown below. $$\begin{aligned} \Pr(y_i=K)=&{\frac {1}{1+\sum _{k=1}^{K-1}e^{{\boldsymbol {\beta }}_{k}\cdot \mathbf x_i}}}\\ \Pr(y_i=1)=&{\frac {e^{{\boldsymbol {\beta }}_{1}\cdot \mathbf x_i}}{1+\sum _{k=1}^{K-1}e^{{\boldsymbol {\beta }}_{k}\cdot \mathbf x_i}}}\\ \Pr(y_i=2)=&{\frac {e^{{\boldsymbol {\beta }}_{2}\cdot \mathbf x_i}}{1+\sum _{k=1}^{K-1}e^{{\boldsymbol {\beta }}_{k}\cdot \mathbf x_i}}}\\ &\cdots\\ \Pr(y_i=K-1)=&{\frac {e^{{\boldsymbol {\beta }}_{K-1}\cdot \mathbf x_i}}{1+\sum _{k=1}^{K-1}e^{{\boldsymbol {\beta }}_{k}\cdot \mathbf x_i}}} \end{aligned}$$ Next, for each observation, it uses the estimated logistic relations to predict the probability of cluster membership in all clusters, and the probabilities are then ordered in descending order; the vector of ordered probabilities can be indicated as $P_i = \left\{p_k^1,p_k^2,\ldots,p_k^K\right\}$. Consider a situation where $P_i = \left\{p_3^1=0.5,p_1^2=0.49,p_2^3=0.01\right\}$ (for $K=3$); while the highest probability is associated with $k=3$, it’s not clear whether or not observation $i$ truly belongs in cluster $k=3$ or $k=1$. Since observation $i$ is clearly almost equidistant between both cluster means, it may not make sense to use it to recompute the mean of its assigned cluster $k=3$. Our algorithm computes the ratio of the two largest of these probabilities: $$R_i = \frac{p_k^1}{p_k^2}.$$ The $i$th observation is only used to recompute the mean of cluster $y_i$ if $R_i > 1.5$. We can annotate this condition as $I\left(R_i\right)$, which returns $1$ if the inequality is met, and $0$ otherwise. We use $1.5$ because it allows the algorithm to consider any observations with greater than a 60:40 split between the two most likely clusters as being firmly placed in its cluster. Any belonging probability spread out among the remaining clusters (for $K>2$) only makes the algorithm more lenient. After augmentation in this manner, the The full Augmented k-means algorithm is: 1. For each observation $\mathbf{x_i}$ and cluster $k$, compute the squared Euclidean distance to the mean $\mathbf{C_k}$: $$d_{ik} = \parallel\mathbf{x_i}-\mathbf{C_k}\parallel^2_2.$$ 2. Assign each observation to its closest cluster: $$y_i = \underset{k=1,\ldots,K}{\operatorname*{\arg\!\min}}d_{ik}.$$ 3. Perform logistic regression, with $\mathbf{x_i}$ as the independent data, and $y_i$ as the known class labels, then compute the cluster belonging probabilities, order them in descending order, and compute the ratio of the two largest probabilities $R_i=p_k^1/p_k^2$. 4. Recompute the cluster means: $$\mathbf{C_k} = \frac{1}{n_k}\sum_{i=1}^n I\left(i,k\right) I\left(R_i\right)\mathbf{x_i},\ n_k = \sum_{i=1}^n I\left(i,k\right) I\left(R_i\right)$$ 5. Compute the total sum of squared distances: $$S_t = \sum_{k=1}^K\sum_{i=1}^n I\left(i,k\right)d_{ik}.$$ 6. Measure the change in the total sum of squared distances from the previous iteration, and compare against $\epsilon$. If $\left\vert S_{t-1} - S_{t} \right\vert<\epsilon$, exit. Otherwise, return to step (i). Note that there’s no $I\left(R_i\right)$ in the step (v); the sequence of total sum of squared distances does not take into account the additional information generated by the logistic regression. This computation is left unmolested so as to retain the algorithms property of monotonic convergence. When Augmented k-means converges to a solution, every observation is classed into a cluster. However, the knowledge that certain observations had $I\left(R_i\right)=0$ is retained. Hence, in answer to the concerns addressed in [@MaitraRamler2009; @TsengWong2005; @Wong1982], we could instead mark these observations as scatter. The two panes of Figure \[figdemo\] - generated from simulated data with overlapping clusters - help explain why Augmenting k-means is an improvement. The solid blue circles in each pane shows how the mean of cluster 0 changed as the algorithm iterated, and the solid green triangles shows the same for cluster 2. The initial estimated cluster means from k-means++ are indicated with the “Init 0” / “Init 2” text, and the true cluster means are annotated with “True 0” / “True 2”. In both panes, the datapoints are the small points, and those circled in red are the observations excluded by the augmentation from updating the cluster means. In Figure \[figdemo\_K\], we see that the cluster means kept moving further away from the true centers. In Figure \[figdemo\_A\], however, we see that they stopped moving away after only a handful of iterations. The predominance of excluded observations in the upper right corner of the plots shows the reason. With k-means, these observations pulled the mean for cluster 0 in that direction. While not shown to make the plot more legible, there is an observation in the lower left corner which acted to pull the mean for cluster 2 in that direction. In each pane of Figure \[figdemo\], the distance between the final and true cluster means are written near the true means. For both clusters, the final means computed by Augmented k-means are closer. It should be clear that the benefit obtained by the augmentation is very dependent on the homogeneity and scatter in the data, as well as the number of clusters and their spacing. \[sec\_results\]Numerical Results ================================= Here we show comparative results for several datasets with known clustering structures. In both real data examples, we executed 1,000 replications of the algorithms, using k-means++ initialization. In each replication, both k-means and Augmented k-means began with the same initial state. \[sec\_simres\]Simulated Data ----------------------------- We begin with demonstrating the performance on a simulated bivariate dataset with $n=300$ observations from $K=4$ overlapping clusters. As can be seen in Figure \[figsim\], there are a lot of observations that we can expect to not be firmly placed in a specific cluster. Instead of 1,000 replications, we ran 5,000, since the data was simulated. Each time, the same data with the same initial means was used for both algorithms. As shown in Table \[tab\_simd\], Augmented K-means correctly classified more observations than k-means $82\%$ of the time, and it only under-performed in $13\%$ of the replications. When it did outperform k-means, the classification gain was slightly more than $5\%$. Augmented k-means converged in fewer iterations in approximately half the replications; when it converged faster, it required $4.86$ fewer iterations on average. Averaged over all 5,000 replications, Augmented k-means only needed to run $0.55$s longer. \[sec\_irisres\]Iris Data ------------------------- We continue with Fisher’s iris data. This dataset consists of $p=4$ flower characteristics: *petal length*, *petal width*, *sepal length*, and *sepal width*. There are $K=3$ groups: $50$ observations each from the varieties *Iris Setosa*, *Iris Versicolor*, and *Iris Virginica*. The comparative results for the Iris data are shown in Table \[tab\_iris\]. In $95\%$ of the simulations, Augmented k-means correctly classified more observations, with an average improvement of $3.2\%$. For this dataset, the augmentation algorithm tended to require more iterations; in the $30\%$ of simulations in which it converged faster, Augmented k-means required on average 4.6 fewer iterations. For the rare simulations in which the classification performance was worse, the average shortfall relative to k-means was only $0.7\%$ - a single observation. \[sec\_wineres\]Wine Composition Data ------------------------------------- Our final example is the wine recognition dataset of M. Fiorina, *et al.*, used in [@AeberhardCoomansEtal1992]. These data are the results of a chemical analysis of $n=178$ wines grown in the same region in Italy but derived from $K=3$ different cultivars ($n_1=59$, $n_2=71$, $n_3=48$). The analysis determined the values of $p=13$ characteristics of each wine. The variables are shown in Table \[tab\_winedata\]. For the wine data, Augmented k-means outperformed k-means in $78\%$ of the simulations, regarding classification, and $59\%$ regarding iteration count, as can be seen in Table \[tab\_wine\]. While the improvement in classification performance was slight, the average additional computation time required by Augmented k-means was only $0.11$s. When it needed more iterations than k-means, the excess was less than 2 iterations on average. \[sec\_conclude\]Concluding Remarks =================================== In this technical report, we’ve developed a new clustering algorithm, called Augmented k-means, that combines unsupervised clustering with k-means and supervised clustering with logistic regression. In each iteration, we use the group membership probabilities from logistic regression to exclude observations used to recompute the cluster means in k-means. This allows each cluster to form without being influenced by observations which don’t firmly belong. We have demonstrated the advantages of Augmented k-means on both simulated and real datasets. The augmentation frequently leads to better classification performance and / or faster convergence. It is true that our results demonstrate minimal incremental performance improvement over k-means++, which could be seen as a reason to forego publication. However, we feel that our hybrid unsupervised + supervised clustering approach is sufficiently innovative to justify publication. Additional work around this innovation will only be accelerated by sharing the idea openly in the research community. Further research with Augmented k-means could go in a few directions. The most obvious would be to attempt to augment k-means with a different supervised learning procedure, such as discriminant analysis (linear, quadratic, or kernel) or artificial neural networks. Of course, with both these procedures, the researcher has several subjective parameterization decisions to make. Also, neither produces the cluster belonging probabilities, so some other model output would need to be used in their place. It could be worthwhile to include a feature selection procedure in the logistic regression step in our algorithm. While this would require more CPU time, modeling the predictive power in an optimal subset should cause more greedy exclusion of observations, which may further improve performance. [^1]: As of a 2002 survey [@Berkhin2002]. [^2]: Alternatively, it can start by classifying each observation into $K$ clusters, but this is a trivial difference [^3]: Only starting from the second iteration, obviously. [^4]: Obviously, if $K=2$, regular binary logistic regression is used.
2024-05-19T01:26:58.646260
https://example.com/article/9951
Gov. David Ige will allow the half-percent excise tax surcharge for rail to be extended for five years to cover the cash-strapped Hono­lulu rail project's estimated $910 million shortfall, and will also allow the first medical marijuana dispensaries to be established in Hawaii. Star-Advertiser. Hawaii County now has an opportunity to add a half-cent local surcharge to the 4 percent state general excise tax, thanks to Gov. David Ige’s notice Monday that he will not veto a bill that includes the other counties along with Honolulu’s GET extension for its controversial rail project. West Hawaii Today. The Kauai County Council will soon have to decide whether it wants to raise taxes. Gov. David Ige announced on Monday he will not veto legislation that gives the Neighbor Islands the option of levying a tax surcharge on the state’s General Excise Tax (G.E.T.) in order to raise money for transportation. Garden Island. Hawaii Gov. David Ige announced Monday that he currently plans to veto eight of the 252 bills the Legislature approved this past session. Bills to combat sex trafficking, allow University of Hawaii graduate students to unionize and clarify the order of succession for lieutenant governor were among those he’ll potentially veto. Civil Beat. Governor David Ige released his intent to veto list today. He also talked about the bills he will sign or allow to become law. Hawaii Public Radio. Gov. David Ige on Monday announced his intent to veto two pieces of legislation that involve the University of Hawaii. Pacific Business News. Hawaii Gov. David Ige said Monday that he plans to veto a sex trafficking bill that many in law enforcement have said will make it more difficult to lock up pimps and madams. Civil Beat. Gov. David Ige said he plans to veto a bill that would ban sex trafficking, making the state the only one in the nation without a comprehensive law on the subject. Associated Press. Hawaii Gov. David Ige said that he intends to veto a bill passed by the State Legislature that would repeal the ethanol facility tax credit and establish a renewable fuels production tax credit. Pacific Business News. Hawaii is changing a law so that those who practice traditional Hawaiian clean burials won't be accused of abusing a corpse. The idea is being pushed by people who say there's not enough space in cemeteries to accommodate an aging population. Associated Press. Governor David Ige has informed the Hawai‘i State Legislature of his intent to veto a list of eight bills. Maui Now. Hawaii will hold its first three-day Cannabis Business Expo on July 17 at the Hawaii Convention Center hosted by the medical marijuana magazine Kaulana Na Pua. Civil Beat. Any new Hawaii businesses that have not yet signed up for Affordable Care Act qualified health insurance plans may be blocked from receiving federal subsidies until an eligibility determination system is put in place by the state. Pacific Business News. Oahu State Rep. Tom Brower, videotaping a homeless encampment in Kaka­ako, was reportedly assaulted by several people Monday afternoon and taken to the Queen's Medical Center, sources told the Honolulu Star-Advertiser. A lawmaker involved in an altercation in Kaka'ako ended up in Queen’s Medical Center after videotaping several homeless people in the area on Monday. KITV4. Jonah Iose, 14, and Isaiah Totoa, 17, said they got mad when state Rep. Tom Brower, also known as the sledgehammer lawmaker, refused to put away his camera after they asked nicely. Hawaii News Now. A 37-year volunteer reserve officer of the Honolulu Police Department said he saw active-duty officer Vincent Morre assault a patron of an illegal gambling house in September but did nothing about it. Star-Advertiser. A former probation officer pleaded guilty Monday to felony theft and forgery. Freeman Sasao, 56, a former Oahu circuit court probation officer, was charged with theft and felony offenses in May. Star-Advertiser. Hawaii The Hawaii National Guard is not among the options being discussed to reopen the road up Mauna Kea so construction crews can reach the site of the planned $1.4 billion Thirty Meter Telescope, Gov. David Ige said Monday. Civil Beat. Last week, the Governor stated that “we are a patient people in Hawaii”, but today David Ige’s patience appeared to be wearing thin. Big Island Video News. The Chinese are coming. So say tourism officials, who are advising island businesses to prepare themselves to handle an influx of tourists who are expected to become one of the most important markets for Hawaii businesses for the foreseeable future. Tribune-Herald. Maui Opinion: Watching the battle over the construction of the Thirty Meter Telescope (TMT) on Mauna Kea and now the Daniel K. Inouye Solar Telescope (DKIST) on Haleakala has reached nearly comical proportions. MauiTime. Kauai An arbitrator did not exceed his authority when he awarded promotions to three Kauai Police Department officers in 2009, according to a state Supreme Court ruling issued Monday. Garden Island. After years of delays on major Hawaii transportation projects, Federal Highway Administration officials are warning the state they may yank funding for new highway projects unless the state streamlines its plodding, bureaucratic system and moves roadwork into construction more quickly. Star-Advertiser. Fallout from the state's backlog of federally funded highway projects will affect Hawaii motorists for years as the state Department of Transportation halts work on some complex, large-scale projects that would increase road capacity and ease traffic flow. Star-Advertiser. As Gov. David Ige continues working on which bills he will approve or veto from the 2015 session, a key lawmaker says the Legislature is unlikely to override any vetoes once the list is published. Star-Advertiser. Hawaii lawmakers sent more than 200 bills to Gov. David Ige last spring but he still has to decide what he’s going to do with nearly half of them. Legislation to establish medical marijuana dispensaries, authorize the counties to levy a surcharge on the General Excise Tax and make it easier for someone to change their birth certificate so it aligns with their gender identity are among the 114 bills pending action by the governor. Civil Beat. Land board members heard from Native Hawaiians who say even though they worry about how their cultural gathering rights will be affected, they support this temporary ban on the taking of sea cucumbers. KITV4. Mufi Hannemann has been appointed president and CEO of the Hawaii Lodging & Tourism Association, a position he previously held after serving as Honolulu's mayor. Star-Advertiser. Oahu On an island that many people think of as paradise, the struggle for residents to get to school or to work in crushing traffic gridlock is a daily part of life. Associated Press. What will Chinatown look like in the next few years? That was the question posed at Saturday’s Chinatown Action Summit. KHON2. Hawaii While the 1-year-old June 27 lava flow hasn’t threatened populated areas since March, geologists at the Hawaiian Volcano Observatory continue to study samples that might help fine-tune projections if it sends another 2,000-degree river of molten rock toward homes in lower Puna. Tribune-Herald. Motorists driving the Queen Kaahumanu Highway near Waikoloa on Sunday morning saw hundred of runners streaming along the makai shoulder of the roadway and along Waikoloa Beach Drive. But for the first time in years, West Hawaii drivers weren’t having to adjust their course and travel times for the Kona Marathon. West Hawaii Today. Maui Repeated floods have eroded Iao Stream's channel bed and levees over the past three decades to the point where the U.S. Army Corps of Engineers is proposing new structures and stream diversions to protect surrounding homes and businesses. Maui News. Kauai A charter school employee in Kauai files a civil rights complaint over what he says is the practice of forced prayer on campus, illustrating the complex relationship between culture and spirituality at many of the state’s Hawaiian-focused schools. Civil Beat. The Kauai County Council unanimously approved a Kauai Police Department request to purchase a package deal that includes more than 100 body cameras and 100 Tasers worth just under $180,000, using money from the KPD asset forfeiture fund. Garden Island. When the Pacific Missile Range Facility at Barking Sands begins consolidating its electric grid with $30 million in federal funding earmarked for the project, it’s Capt. Bruce Hay’s hope that alternative energy will be part of the solution. Garden Island. Hawaii’s governor never planned to get involved in politics. In 1985, David Ige was 28 and working as an electrical engineer in the private sector, with no thought of ever running for elected office. Garden Island. Molokai A proposed 6-mile fencing and management project in the Waikolu Valley and Pu'u Ali'i Natural Area Reserve will be discussed at an informational meeting from 5 to 7 p.m. Monday at Kalanianaole Hall on Molokai. Maui News. Construction of the Thirty Meter Telescope remained on hold for a second straight day Thursday after two rock altars were discovered on the access road leading to the Mauna Kea summit. Star-Advertiser. Police named the 12 individuals arrested and charged Wednesday with obstructing Mauna Kea Access Road while protesting the construction of the Thirty Meter Telescope.Tribune-Herald. The boulders and rock walls were cleared Thursday, but the road to the top of Hawaii’s tallest mountain remained inaccessible to the public following a dramatic protest against the Thirty Meter Telescope the day before. Tribune-Herald. Despite a handful of arrests, officers and protesters treat each other well. But this week’s attempt to resume construction of the Thirty Meter Telescope gets off to a rocky start with boulders strewn across the mountain road, forcing its closure. Civil Beat. The Office of Mauna Kea Management is working on a set of rules that will for the first time give the office legal tools to govern public and commercial access on the mountain. Associated Press. What happened on the mountain top Thursday took some state officials by surprise, but according to the state's top lawyer, the decision about access sits squarely at the University of Hawaii. KITV4. Hawaii has ranked as the worst state to do business for the second time in three years, according to CNBC’s annual America’s Top States for Business ranking. Pacific Business News. Hawaii: Sun, Surf and Suicides. The islands seem to be part of a phenomenon one expert dubbed “suicide tourism,” in which some people seek out final-destination spots in well-known places. Civil Beat. U.S. Census Bureau released the 2014 state and county population information Thursday, including estimates broken down by age, sex, the five major race groups and Hispanic origin between April 1, 2010 to July 1, 2014. Civil Beat. Oahu The Honolulu Authority for Rapid Transportation estimated that the city would have to raise the median property tax bill by 5.6 percent to cover the existing project’s massive shortfall. How to finance that $900 million shortfall and whether to extend the half-percent surcharge were major issues at the Legislature this year, and Gov. David Ige is now considering whether to sign a bill to extend the excise tax surcharge for Oahu residents for five years to cover the rail project’s cost overruns. Star-Advertiser. The state has a constitutional obligation to protect productive farmland, Hawaii Supreme Court justices were told Thursday during oral arguments in a lawsuit challenging a land reclassification for D.R. Horton’s 11,750-home Hoopili development. Civil Beat. The Hawai’i Supreme Court heard oral arguments today in the case challenging the 12-thousand home Ho’opili development project in Ewa. Hawaii Public Radio. The Howard Hughes Corp. has changed its plans for a Kakaako residential project back to a mostly affordable for-sale condominium tower after requesting a Hawaii agency approve the project as a rental development. Pacific Business News. The Bikeshare Hawaii program got a big boost when the state and city pledged $1 million each to help put an estimated 1,700 bicycles on Oahu roads next year. Star-Advertiser. A 14-year police veteran and a former reserve officer are facing federal charges in connection with assaults in September on two gambling house patrons at the hands of another officer. Star-Advertiser. Hawaii The Hawaii Supreme Court on Thursday snuffed out proponents’ hopes of enforcing a voter-approved ballot initiative making adult personal use of marijuana on private property the lowest law enforcement priority of Hawaii County. West Hawaii Today. Maui It was a packed house Thursday night at the Kihei Community Center as residents concerned about cane burning met with the Department of Health and Hawaiian Commercial and Sugar Company. KHON2. A long-awaited high school stadium on Maui finally has the green-light. It certainly seems to have been on the fast track since there’s resolution. KHON2. Bus drivers at Maui Economic Opportunity voted to form a union Tuesday night, an official with Hawaii Teamsters Local 996 said Wednesday. Maui News. Kauai A public meeting to discuss Kauai’s housing shortage started with a bit of irony: so many people showed up that several were turned away due to lack of space. Garden Island. Next month, a public hearing is set for a measure that would require hikers in need of rescue — who disregard warnings — to pay the county for recovery missions. Garden Island. The construction relaunch of the Thirty Meter Telescope got off to a rocky start Wednesday, thanks to some antics by protesters — 12 of whom got arrested — and now the $1.4 billion project is on hold again. Star-Advertiser. Mauna Kea Access Road remained closed Wednesday evening after opponents of the Thirty Meter Telescope again halted construction of the $1.4 billion observatory following a highly coordinated protest. About 300 protesters used their bodies and large rocks to prevent construction crews from traveling more than a mile past the Mauna Kea Visitor Information Station, and about a dozen continued to block access above Hale Pohaku after the group claimed victory for the day. Tribune-Herald. State law enforcement officers arrested 11 people Wednesday who were blocking a road up Mauna Kea in protest of the Thirty Meter Telescope project. Hundreds were gathered on the mountain early in the morning to stop construction crews from resuming work on the $1.4 billion project. Civil Beat. Hundreds of protesters on a Hawaii mountain road erupted in cheers Wednesday after construction crews turned around and retreated from the site for what would be one of the world's largest telescopes. Associated Press. On Wednesday, hundreds of protesters forced construction crews for the Thirty Meter Telescope to come to a halt, but it didn’t come without sacrifice. KITV4. Construction of the Thirty Meter Telescope on Mauna Kea is on hold once again. Hawaii News Now. After a seven-hour demonstration, Hawaii DLNR (Department of Land and Natural Resources) agents just informed the hundreds of protesters on Mauna Kea that officers and TMT workers will turn around and no longer ask anyone to leave. No further arrests will be made today, they say. Hawaii News Now. The road to the summit of Mauna Kea is closed and Gov. David Ige’s chief of staff says construction on the Thirty Meter Telescope is on hold until further notice. KHON2. 10 citizens of Hawaii were arrested on Mauna Kea today for physically impeding construction crews for the controversial Thirty-Meter Telescope (TMT) project, which has resumed with the blessing of the state. Hawaii Independent. Scientists hoping to build a telescope that will allow them to see 13 billion light years away, offering a look into the early years of the universe, are facing opposition from Native Hawaiian groups who say the construction site is on sacred land. Associated Press. A Kauai man was at the Big Island’s Mauna Kea when protesters stopped construction from continuing on a giant telescope. Garden Island. At a time when the Department of Land and Natural Resources Aquatics Division was struggling for funding, its former top administrator spent more than $40,000, mostly for first-class travel. A review of former Aquatics division head Frazer McGilvray's government credit card, or pCard, expenditures shows that he took more than 30 first-class flights to the Mainland and the Neighbor Islands. Hawaii News Now. The Department of Health has asked physicians statewide to be on alert for Middle East Respiratory Syndrome after a deadly outbreak of the infectious disease hit South Korea. Star-Advertiser. Opinion: Bridging the Space Between Islands Could Lower Costs. An interisland ferry system and kamaaina discounts on air travel could stimulate economic activity, create jobs and lower prices — especially on the neighbor islands. Civil Beat. Oahu The Honolulu Ethics Commission voted Wednesday to adopt a media policy that severely restricts what any of its seven members, longtime Executive Director Chuck Totto and staff can tell news reporters. Star-Advertiser. The Honolulu Ethics Commission approved a new media policy Wednesday that effectively muzzles Executive Director Chuck Totto, who has long been an outspoken voice for good government. Civil Beat. A group of farmers has sued the owner and developer of a controversial Kunia agriculture tract, claiming the farmers were misled into believing they were buying fee-simple land in the project instead of shares in the nonprofit organization that actually owns the property. Star-Advertiser. The oceanfront parcel of land in Honolulu that had been reserved for the development of President Barack Obama’s presidential library has a new proposed use as a sports complex and for parking, the head of the Hawaii agency regulating development in the area confirmed to Pacific Business News. Protesters lined Kamehameha Highway near Kualoa Regional Park several times in the past week to block sheriff’s deputies from enforcing a court-ordered eviction and removing members of an extended Hawaiian family from a disputed parcel of land on Johnson Road. Civil Beat. The population of Kaka’ako is expected to double to about 30-thousand in the next 15 years or so. That’s one of the reasons the state is currently looking at ways to retain park space in the area. Hawaii Public Radio. The Howard Hughes Corp. will have to wait another month to learn whether Hawaii regulators will allow the Texas-based developer to change a previously approved Kakaako residential project from for-sale condominium units to rental apartments. Pacific Business News. It has been almost a year since the city took action to resolve staffing issues within EMS, but now we are learning the department may go back to its old schedule. KHON2. A landowner on a historic Punchbowl property has until mid-July to get a permit from the city to cut down about 50 trees that he’s already chopped down. Star-Advertiser. Hawaii We’re growing faster, younger and more diverse. The Big Island continues to lead Hawaii in the rate of population growth, according to the U.S. Census Bureau, which late Wednesday released county-level estimates of population, sex, race and age for 2014. West Hawaii Today. As rumors swirl about who will and won’t be on the ticket in 2016, two Big Island figures have confirmed they are considering a run for mayor. Former Kohala Councilman Pete Hoffmann and Puna Sen. Russell Ruderman both say it could be months before they make a final decision. Candidate filings open Feb. 1, 2016. West Hawaii Today. Maui While much of the attention has been on the Thirty Meter Telescope being built atop Mauna Kea on the Big Island, resistance by native Hawaiians to the Daniel K. Inouye Solar Telescope on Haleakala continues. KITV4. A rally and aloha ‘āina night vigil will be held at the Central Maui Baseyard tonight in support of those who are protecting Mauna Kea from construction on the Big Island of Hawaiʻi, and ongoing issues surrounding development at the summit of Haleakalā on Maui. Maui Now. County Council Member Bob Carroll has sent two bills and a resolution to the council that would encourage the creation and maintenance of affordable housing with a centerpiece of allowing ohana affordable units on properties as small as 5,000 square feet. Maui News. Kauai The Kauai County Council is considering a proposal to repeal the barking dog ordinance.Garden Island. The Office of Mauna Kea Management is rolling out a set of rules that will for the first time give the office the legal tools to govern public and commercial access on the mountain. West Hawaii Today. An ‘ahu or altar has gone up on the summit of Mauna Kea as protesters who say they're standing in protection of Native Hawaiian sacred space prepare for construction of the Thirty Meter Telescope to resume Wednesday morning. Hawaii News Now. Thirty Meter Telescope construction crews will not only confront protesters in the road to the summit of Mauna Kea on Wednesday, but apparently also at least one rock altar constructed near the work site. Star-Advertiser. A day before construction of the Thirty Meter Telescope was expected to resume, opponents made their way to the summit of Hawaii’s tallest mountain Tuesday to build a second ahu, or stone altar, within the project boundary. Tribune-Herald. After being put on hold for more than two months, work to build the Thirty Meter Telescope on Mauna Kea is set to restart. The project has already felt the resistance, and now, it'll have to face it again. KITV4. Multiple modifications have been made to the University of Hawaii's and the state of Hawaii’s approach to Mauna Kea on the Big Island, the Thirty Meter Telescope International Observatory Board said. Pacific Business News. In the hours before the Thirty Meter Telescope project will attempt to restart construction on Mauna Kea after months of delay, the office of Governor David Ige issued the following statement. Big Island Video News. Dozens of people are sleeping on Mauna Kea Tuesday night. Many are calling themselves the protectors of the mountain, and dozens more are expected by Wednesday morning. KHON2. The U.S. Department of Education on Tuesday renewed Hawaii's waiver from mandates of the federal No Child Left Behind law, allowing the state to continue evaluating public schools on a state-developed accountability system known as Strive HI. Star-Advertiser. The Obama administration is giving seven more states and the District of Columbia more flexibility from the requirements of the Bush-era No Child Left Behind education law. In addition to Washington, Education Secretary Arne Duncan on Tuesday renewed waivers for Georgia, Hawaii, Kansas, Missouri, Nevada, New York, and West Virginia. Associated Press. What Is Really Being Sustained by 100 Percent Renewable Energy? Two UH economists raise concerns that subsidizing local alternative energy production might be a fiscal drain that is about paying off special interests. Civil Beat. The leader of a white supremacist group said to have influenced the Charleston, S.C., church shooting suspect contributed $2,000 to the campaign of Charles Djou, the former Hawaii congressman. Civil Beat. OahuWith construction of 3 miles of the rail guideway from East Kapolei completed, crews will now move into areas populated by businesses and residents to begin constructing the guideway in Waipahu. Star-Advertiser. Retired bank executive Don Horner has been reappointed to the Honolulu Authority for Rapid Transportation’s board of directors by Mayor Kirk Caldwell. Star-Advertiser. PVT Land Co., which owns the only construction and demolition debris management facility on Oahu, plans to expand its West Oahu facility as it focuses more on recycling and generation of feedstock for renewable energy, according to public documents. Pacific Business News. Honolulu’s Mayor has been engaged in an ongoing verbal battle with the Chair of the nine-member City Council. Their latest exchange was over the City’s 2-billion dollar budget which passed without the Mayor’s signature. As Hawaii Public Radio’s Wayne Yoshioka reports, this could be only the beginning of a long political rivalry. Protesters lined Kamehameha Highway near Kualoa Regional Park several times in the past week to block sheriff’s deputies from enforcing a court-ordered eviction and removing members of an extended Hawaiian family from a disputed parcel of land on Johnson Road. Civil Beat. The U.S. Environmental Protection Agency and the state Department of Health are giving the public more time to comment on a proposal to better prevent and detect leaks from 20 giant fuel storage tanks near Pearl Harbor. Star-Advertiser. Those with plans to buy Fourth of July firecrackers could be out of luck. Permits to use firecrackers on the holiday are on sale through Wednesday, but having a permit doesn't mean you'll be able to find fireworks in a store. Star-Advertiser. After investing nearly $1.4 million to open a dune buggy rental shop on Oahu's North Shore, Matt Brown was blindsided earlier this year when he found out Hawaii law won't allow him to rent his gas-powered vehicles. Star-Advertiser. Hawaii The county Water Board, meeting Tuesday in Hilo, unanimously approved a five-year water rate plan that hikes rates 3 percent on July 1, followed by 4 percent next year and then 5 percent annually for the next three years. West Hawaii Today. Nearly two miles and more than $110,000 worth of ungulate-proof fencing on the Big Island was cut and destroyed by vandals recently. West Hawaii Today. Kamehameha Schools plans to begin demolition of the shuttered Keauhou Beach Hotel in early 2016 as the trust moves forward with plans for its educational complex known as Kahaluu Ma Kai. West Hawaii Today. MauiWith the clock ticking down, the Maui County Council on Monday voted to override Mayor Alan Arakawa's line-item veto of a provision in the budget that takes effect July 1 that limits spending in county departments to specific accounts. Maui News. The United States Citizenship and Immigration Services and the County of Maui’s Immigrant Services Division will be hosting three “Information Sessions” later this week for immigrants. The workshops will cover “employment eligibility, green cards, naturalization, petition for relatives and other issues,” according to a June 22 news release from the county. MauiTime. The Friends of Joe Blackburn will be selling kalua pig for $8 a pound, as he plans another run for the Maui County Council's Wailuku-Waihee-Waikapu residency seat. Maui News. Honolulu media outlets are looking to Maui as the implementation date of their plastic bag ban nears the July 1, 2015 start date. Maui Now. Kauai Idled trucks and tractors are spread out in a field behind DuPont Pioneer’s parent seed facility in Kekaha, a small town on the west side of Kauai. The noise of a generator is the only hint of activity at the site where researchers have worked for years growing genetically modified seeds used to create hybrid crops. Civil Beat. The Kauai County Council will form a subcommittee to study the possibility of switching to a county manager system of government. Garden Island. Mayor Bernhard Carvalho, Jr. signed the B&B bill on Friday, making it more difficult for Kauai residents to earn income by renting out rooms in their home on a short-term basis. Garden Island. A $3.5 million project aimed at removing 2,500 albizia trees along Kuhio Highway between Kalihiwai and Kahiliholo roads was pushed back to next year. The project, originally scheduled for April, was suspended as tree removal coincided with the birthing season of the Hawaiian hoary bat and the breeding season of the Hawaiian shearwater. Garden Island. Nearly 20 picketers outside the entrance to the Kauai Humane Society Tuesday protested the firing of two employees and called for the removal of KHS Executive Director Penny Cistaro. Garden Island. Federal officials have collected more than 3,000 written testimonies about proposed changes to the humpback whale sanctuary. Anne Walton, the sanctuary’s program analyst, said staff members for the National Oceanic and Atmospheric Administration will spend the coming months sorting the testimonies and replying with general responses based on the subject matter addressed in the comments. Garden Island. Gov. David Ige took his first international trip to Japan last week, and spent his time during the three-and-a-half day visit meeting with tour companies and airlines, as well as the prime minister of Hawaii’s largest but struggling international market for visitors. Pacific Business News. Gov. David Ige says Japan is Hawaii's most important source of foreign tourists, and his recent trip there was intended to solidify that relationship. Associated Press. Unlike most states, where charter schools are registered as private companies or nonprofit corporations, charters in Hawaii are state agencies. That means the state may be responsible for debts if the school closes. Civil Beat. OahuMayor Kirk Caldwell allowed the city's $2 billion operating budget and related bills to become law without his signature Monday and then criticized the Hono­lulu City Council and Chairman Ernie Martin of funding pet projects, apparent bureaucracy building, and overstepping their authority. Star-Advertiser. Honolulu Mayor Kirk Caldwell refused to sign off on several budget bills Monday, saying he had too many problems with City Council meddling. Caldwell also didn’t sign the Honolulu Authority for Rapid Transportation’s operating and capital budgets for similar reasons. Civil Beat. The City and County of Honolulu’s major budget bills are being returned to the City Council without the Mayor’s signature. The city’s chief executive has not signed previous budgets. Hawaii Public Radio. Rail officials are calling it a milestone. They are planning to announce a new phase of construction Tuesday, which could greatly impact those who live and work in Waipahu. KHON2. A new partnership between the University of Hawaii-West Oahu and a nonprofit that offers science, technology, engineering and mathematics curriculum programs will open the door for more students to gain valuable skills in fields where jobs are expected to grow over the next several years, officials say. Star-Advertiser. A Kahaluu woman said an off-duty police officer arrested for trespassing outside her home got special treatment because he was charged with misdemeanor offenses. Hawaii News Now. DLNR is using Facebook and Twitter as well as YouTube and vimeo.com to post an informational video called “Sacred Falls — Don’t Risk Your Life, A Fine, or Jail.” Civil Beat. Hawaii Struggling with a waiting list of more than 7,000 applicants, Hawaii County has given notice that, beginning July 10, it will stop taking applications for the federally subsidized rental assistance program commonly known as Section 8. West Hawaii Today. Earlier this year, Mayor Billy Kenoi told a group of business leaders he was working on a plan to improve Hilo’s dilapidated Banyan Drive area. As for what it is, he and his staff have chosen to remain silent. Tribune-Herald. Supporters of a West Hawaii shooting range haven’t given up on their longtime dream, even as the project seems at a standstill more than three decades after first being envisioned. West Hawaii Today. Construction of the Pahoa roundabout will begin by the end of the year and possibly by the end of summer, according to a state Department of Transportation spokesman. Tribune-Herald. A pernicious fungus is wiping out native ohia trees on Hawaii island, prompting scientists to work on ways to prevent its spread to other islands. Star-Advertiser. Work on a new restroom facility at the Hawaii County-managed Mauna Kea Recreation Area has been completed. Big Island Video News. Maui Opinion: I love it when a news story explaining a meaningless press release that hasn’t even been sent out yet. On June 20, The Maui News reported that Maui Police officials said during the June 17 Police Commission meeting that the department’s body camera study–in which 10 volunteer officers wore cameras donated by Taser–is effectively over. In fact, it apparently ended about six weeks ago. MauiTime. Kauai ILEAD Charter School co-organizer Deena Fontana Moraes and supporters made their case before the Hawaii State Charter School Commission on Friday. Garden Island. Tougher regulations could force some bed and breakfasts on Kauai out of business for good. KITV4. Hawaii Emergency Management Agency, formerly known as State Civil Defense, together with Kauai County Civil Defense Agency will conduct siren testing on Wednesday. Garden Island. With construction of the Thirty Meter Telescope scheduled to resume Wednesday and the Mauna Kea "protectors" refusing to back down, the possibility looms of a replay of the drama that saw the arrest of 31 protesters in April. Star-Advertiser. Construction is set to resume Wednesday on a controversial telescope on Hawaii’s Mauna Kea. Civil Beat. Ho‘omakaukau, the Hawaiian word for prepare or make ready. That was the message sent out by opponents of the controversial Thirty Meter Telescope following an announcement that the observatory plans to resume construction Wednesday morning of the $1.4 billion project near Mauna Kea’s summit. Tribune-Herald. Both sides are gearing up for the next skirmish in the Thirty Meter Telescope conflict. On Saturday, TMT partners agreed to restart construction of the $1.4 billion observatory planned for the summit area of Mauna Kea. Big Island Video News. Construction is about to resume on Mauna Kea. TMT partners announced they plan to resume building the controversial Thirty Meter Telescope starting Wednesday. Hawaii Public Radio. Construction on the controversial Thirty Meter Telescope project will resume on Wednesday, according to a statement released by the TMT International Observatory Board on Saturday. Hawaii News Now. Construction is now set to restart on the Thirty Meter Telescope atop Mauna Kea amidst continued protest. KITV4. The non-profit company that oversees the Thirty Meter Telescope (TMT) project gave the go-ahead to restart construction atop Mauna Kea on Wednesday, June 24. KHON2. A bill to extend a program that awards high school diplomas to veterans whose educations were interrupted because they were drafted during World War II, the Korean War or the Vietnam War was signed into law by Gov. David Ige on Friday. Star-Advertiser. As the Hawaii Health Connector winds down operations to move to the federal government's online platform, four of nine voting members of its board are leaving and a vendor has suspended its operations and continues to await payment. Pacific Business News. OahuHonolulu is about to become the last county in Hawaii to ban the plastic checkout bag. Starting July 1, businesses will be prohibited from giving out plastic bags and nonrecyclable paper bags to their customers at the point of sale for carrying groceries or other merchandise. Star-Advertiser. The Death of Aaron Torres: ‘What’s the Big Secret?’ Three Honolulu police officers were exonerated by their supervisors but then the city paid $1.4 million to settle the family’s lawsuit. So what really happened? Heavily redacted police reports obtained by Civil Beat are raising suspicions in a city that still lacks an independent oversight board. Civil Beat. A bill awaiting Hawaii Gov. David Ige’s signature would exempt thousands of homeowners from a controversial law that subjects homes built more than 50 years ago to a historic preservation review whenever a homeowner applies for a building permit. Pacific Business News. As the sun rises over Honolulu, commercial fishermen have already unloaded their catches and docked their boats for the day. The fish are lined up on pallets, packed in ice and displayed for buyers to inspect. Associated Press. Hawaii Did voters know what they were doing when they passed a charter amendment requiring the chief of the Department of Environmental Management to have an engineering degree or a degree in a related field? That question is at the heart of a motion filed by the attorney for former South Kona/Ka‘u Councilwoman Brenda Ford, who is asking 3rd Circuit Court Judge Ronald Ibarra to reconsider his May 26 ruling that Mayor Billy Kenoi and the County Council had discretion to put Bobby Jean Leithead Todd in that position without the engineering or similar degree seemingly required by the county charter. West Hawaii Today. For years now, people who wanted to delve into the history of Kona likely paid a visit to a small archive housed in the basement of the H.N. Greenwell Store Museum in Kealakekua. All of that could change with a new plan by the society to build a museum that will offer better access and provide an area where rotations of current works of art can mix with historical displays. West Hawaii Today. Maui Maui police hope to do more testing and investigation into body-worn cameras before any move to implement a program to have officers wear the devices in the field, Police Chief Tivoli Faaumu said. Maui News. Kauai The Kauai Police Department has received approval by the County Council to purchase 105 body cameras for police officers. Star-Advertiser. Hawaii’s first space launch — aimed at testing a low-cost launch system for small satellites — will blast off from Kauai’s military base on Oct. 29. Garden Island. An erosion control project geared at preventing landfill waste from dropping into the ocean behind Lihue Airport is nearing completion following a 17-month stall due to the discovery of a shearwater bird nesting colony on the worksite. Garden Island. After several days of testing, it has been determined that the pump and motor at the Kapaa swimming pool have to be replaced. Garden Island. Molokai Hale Maunaloa, a state-of-the-art residence on Molokai for individuals with developmental disabilities, is accepting applications for three available bedrooms. Maui News. Gov. David Ige has signed a bill to make his state the first to raise the legal smoking age to 21. The measure aims to prevent adolescents from smoking, buying or possessing both traditional and electronic cigarettes. Gov. David Ige signed it Friday. Associated Press. Hawaii Gov. David Ige signed a bill Friday that will make Hawaii the first state in the nation to ban smoking for anyone under the age of 21 once it goes into effect Jan. 1, 2016. Civil Beat. The number of homeless in Hawaii increased to its highest level in five years, boosted by a dramatic jump in the number of unsheltered homeless individuals, who now outnumber the sheltered, according to data released Thursday by the state. Star-Advertiser. The latest count of Hawaii’s homeless population shows it increased by more than 10 percent — despite the high-profile efforts of Honolulu city and state officials to combat the issue. Civil Beat. Neighbor island data confirms houselessness on the rise The state released the neighbor island data from its 2015 Point in Time count today and, in all counties but Kauai, the number of houseless citizens has increased. Hawaii Independent. The state Department of Land and Natural Resources is proposing an emergency ban on harvesting sea cucumbers in Hawaii’s nearshore waters after officials were alerted to recent incidents of over-harvesting off Oahu and Maui. Star-Advertiser. The state Department of Land and Natural Resources says the recent mass harvesting of sea cucumbers from near shore waters on Oʻahu and Maui has prompted them to request emergency actions to prevent the depletion of this marine resource from Hawaiʻi’s oceans. Maui Now. Reports of mass commercial harvesting of sea cucumbers off Oahu and Maui that may be in the tons have prompted the state Department of Land and Natural Resources to seek a four-month emergency ban on the taking of the sea creatures. Maui News. A study that could have implications for Hawaii’s timber and wind-turbine industries has found evidence of two distinct lineages of the endangered Hawaiian hoary bat, which flew 2,500 miles across open ocean in two migratory waves. Star-Advertiser. Hawaii residents have until 6 p.m. Friday to submit comments on a controversial proposal to expand areas under federal protection and strengthen rules aimed at protecting humpback whales and other marine life. Civil Beat. Nearly halfway through their sail around the world, a group of researchers arrived in Hawaii to look at plastic pollution on our shores as part of a global study of the issue. Star-Advertiser. Republican reps ask Souki to stand down on ethics commission complaint. State reps. Ward and McDermott say the speaker has overstepped his authority, praise commission's executive director, Les Kondo, for his firm enforcement of the state ethics code. Hawaii Independent. Oahu The Hawaii Supreme Court on Thursday heard arguments about whether the names of Honolulu Police Department officers suspended for serious offenses should be made public — and whether the decision to release or withhold the names ultimately rests with the courts or Legislature. Star-Advertiser. The Hawaii Supreme Court heard arguments Thursday in a case that could have far-reaching implications for police accountability in the Aloha State. At issue is whether cops who are suspended for serious misconduct, such as assault, drunken driving or lying to investigators, should have their names and disciplinary records released under Hawaii’s public records law. Civil Beat. Hundreds of people packed the Moanalua Middle School cafeteria Thursday night to hear a draft plan to improve the Navy's fuel tank facility at Red Hill. About 27,000 gallons of jet fuel oil leaked from one of the tanks last year, prompting concerns about whether nearby drinking water supplies were affected. Hawaii News Now. About 200 concerned citizens turned out for a public hearing held by the Environmental Protection Agency to hear public comment on a measure that is supposed to address the damage caused by a 27,000-gallon fuel spill at the Navy’s Red Hill Bulk Fuel Storage Facility in 2014 and to prevent any future spills by the Navy. Star-Advertiser. The Honolulu City Council’s Zoning and Planning Committee resurrected a controversial issue in Kailua and O’ahu’s North Shore. That of vacation rentals in residential neighborhoods. Hawaii Public Radio. After three hours of testimony both in favor and against making more residential vacation rentals legal, the City Council Zoning and Planning Committee voted Thursday to defer the issue yet again. Star-Advertiser. Hawaii Hawaii County’s homeless population has exploded in the past year, adding more new individuals than the rest of the state combined. In a count conducted statewide on Jan. 25, the state Department of Human Services logged 1,021 homeless individuals without shelter on the Big Island, and an additional 220 that were being housed either through emergency shelters or transitional housing programs. Tribune-Herald. With protesters waving signs outside their gate, developers of the Hokulia luxury subdivision say they are committed to moving quickly to create plans for burial sites, and will sit down with area descendants to craft plans for how graves should be protected and cared for. West Hawaii Today. For a pretty penny, you can own what is considered the largest privately owned tract of old-growth koa forest on the planet. Honolulu-based Finance Factors is selling a 13,129-acre property known as the “Hilo Koa Forest.” Tribune-Herald. Maui Maui County's unemployment rate edged below 4 percent in May to 3.9 percent, 0.6 percentage point lower than the same month last year, the Department of Labor and Industrial Relations reported Thursday. Maui News. Kauai The drought that is gripping Kauai is expected to improve in some areas — and become more severe in others. Garden Island. “Squeezed Out: Understanding Kauai’s Housing Shortage” is the topic of the Kauai Planning and Action Alliance (KPAA) annual membership meeting Thursday from 2 to 4 p.m. at Kauai Community College, OCET Building, Room 105. The public is welcome to attend. Garden Island. Maunawili residents are bracing for another busy summer, anticipating an onslaught of visitors by the busload along with local hikers passing through the otherwise quiet neighborhood to get to the Maunawili Falls Trail. Star-Advertiser. A $740,000 grant from the U.S. Centers for Disease Control and Prevention could give state Department of Health officials a better understanding on the reasons why suicides and other violent deaths happen. Civil Beat. Hawaii’s High Technology Development Corp. has released a request for proposals in search of mentors to coach technology companies on the Neighbor Islands. HTDC is based in the Manoa Innovation Center and has had difficulty expanding its program outside of Oahu. Pacific Business News. For all he knows, Colin Kippen will be out of his job in two weeks. Since June 2012, Kippen has been serving as the governor’s coordinator on homelessness, a job overseeing Hawaii’s homelessness response system. Civil Beat. Oahu Na Pua Makani Power Partners LLC countered recent community opposition to a second wind farm in Kahuku Wednesday by saying the new turbines will lower electricity bills. Star-Advertiser. To help ease traffic congestion caused by rail and other construction projects in Central and West Oahu, City Councilman Brandon Elefante has introduced a resolution urging public and private employers to provide some help to employees, including those commuting into downtown from Waipahu and Pearl City. Star-Advertiser. The city will relocate its bustling Kapalama satellite city hall and driver licensing offices at City Square this fall to the former Sprint building several blocks away on Dillingham Boulevard, city administration officials confirmed Wednesday. Star-Advertiser. Honolulu Board of Water Supply officials told members of a City Council committee Wednesday that they worry a draft plan to make improvements at the Red Hill Bulk Fuel Storage Facility does too little over too long a period of time. Star-Advertiser. Security guards at Honolulu International Airport voted overwhelmingly to join a Hawaii-based union Wednesday, joining neighbor island colleagues who have already done the same. The union's president said he hopes to negotiate a master agreement to raise the guards' pay and improve what he called “meager” benefits. Hawaii News Now. Hawaii Mayor Billy Kenoi and his campaign manager, who was hired in April to head the Office of Aging, are the subjects of an ethics complaint alleging political favoritism in county hiring. West Hawaii Today. The nonprofit Hawaii Island Electric Cooperative has retained an investment banker with years of experience with mergers and acquisitions as it continues to explore the idea of public ownership of the Big Island’s electric utility. Tribune-Herald. Finance Factors is selling its 13,130-acre Koa Forest on the Big Island of Hawaii, which is one of the single-largest privately-owned tracts of old growth native koa trees in existence, for $14 million. Pacific Business News. Maui Police Chief Tivoli Faaumu said two police officers "followed what they were trained to do" when they were confronted by a fugitive who shot at the officers before shooting himself following a traffic stop Saturday afternoon in Wailuku. Maui News. Maui County Corporation Counsel Patrick Wong regularly visits Las Vegas each year, according to the Financial Disclosure Statements he’s filed with the Maui County Board of Ethics. And over the past four or five years, these statements show, his trips to Vegas have clearly been worth far more than the nearly six hours it takes to fly there. In fact, they show that since 2011, Wong has earned somewhere between $500,000 and $1.2 million gambling in Vegas. MauiTime. Health officials say they couldn’t investigate an increase in mosquitoes on Maui because of a lack of resources. The state Department of Health’s vector control unit suffered severe cuts years ago and we’ve been following the issue since. Vector control handles animals that have the potential to carry disease, from rodents to insects. KHON2. Kauai Kauai Bus riders have until the end of June to buy monthly and annual passes before rates go up. Monthly fare prices will increase by $5 starting July 1. Garden Island. The Kauai County Council on Wednesday gave its stamp of approval to new collective bargaining agreements that will raise public employee wages and other benefits by more than $1.3 million in the coming fiscal year, forcing the county to again dip into its reserve savings. Garden Island. The future is uncertain for tours of one of Kauai’s most famous resorts, as partial demolition of the hotel is pending state and county approval. Bob Jasper, owner of Coco Palms Tour, said he’s unsure how demolition work at Coco Palms Resort will affect his business. Garden Island. Molokai A devastating pest known as the coconut mite was recently found on Molokai and now threatens to destroy the island's historic Kapuaiwa Coconut Grove. Maui News. Kahoolawe In one month, the cash-strapped Kaho'olawe Island Reserve Commission raised about $38,000 to assist with operations through the summer, but the group still is short of its $100,000 goal and may have to reduce volunteer trips to the one-time practice range for the military. Maui News. Two Hawaii organizations are receiving National Park Service grants to help them share the history of sites where the federal government confined Japanese-Americans during World War II. Star-Advertiser. Starting next year, public schools in Hawaii will be required to offer sex education to students — a big shift from the current policy that allows individual schools to decide whether to teach the subject. Civil Beat. Sexual health education will now be mandatory for Hawaii public school students, under a revised sex education policy approved Tuesday by the Board of Education that expands a long-standing abstinence-based policy to include lessons on contraception, disease prevention and skills to help students make "healthy decisions" about sexuality and relationships. Star-Advertiser. The state Department of Education's senior management team will receive 4 percent raises at the start of next month under a request approved Tuesday by the Board of Education. Star-Advertiser. House Speaker Joe Souki this week denied reports that he more than doubled his investment in Hawaiian Electric Industries in late 2013, as top NextEra executives were readying their preliminary bid for the island utility. Civil Beat. A former state attorney general, a federal prosecutor and a private attorney are being recommended for a federal judgeship in Hawaii. U.S. Sens. Mazie K. Hirono and Brian Schatz recommended Tuesday that President Barack Obama consider former Attorney General David Louie, Assistant U.S. Attorney Jill Otake and private attorney Clare Connors to replace Chief Judge Susan Oki Mollway when she becomes a senior judge Nov. 6. Star-Advertiser. Hawaii Sens. Mazie Hirono and Brian Schatz have submitted to the White House the names of three nominees, including a former state attorney general, for the position of U.S. District Court judge for the District of Hawaii. Pacific Business News. State lawmakers spent most of last session crafting rules for a medical marijuana dispensary system in Hawai‘i. And as Hawaii Public Radio's Molly Solomon reports, it has the potential to provide a growing market for entrepreneurs eager to set up shop. Oahu Honolulu's rail project officials saw lower-than-expected prices for the latest batch of stations to go out to bid, indicating that transit officials' attempts to curb at least some of the painful cost increases are paying off. Star-Advertiser. Honolulu’s $6 billion rail project received a slight dose of positive news Tuesday when officials opened bids for construction of three stations on the west side of Oahu. Civil Beat. A measure allowing sparklers and fireworks fountains to become legal on New Year's Eve and the Fourth of July secured a vote of support from a key City Council committee Tuesday. Star-Advertiser. Oahu's fireworks ban sparked a heap of heated debate. Tuesday afternoon, the Honolulu City Council may have reignited the discussion by hearing a bill that would add more sparkle to celebrations. KITV4. How Military Policies Drive Up Rents on Oahu. Service members who live off the base enjoy housing allowances that surpass fair market rental prices. That, real estate analysts say, helps push up rents. Civil Beat. Hawaii News Now has uncovered troubling allegations that there's a cover-up underway by supervisors and managers at the Women's Community Correctional Center of an alleged assault by a guard on a woman prison inmate. Hawaii The Hawaii County Council, with very little comment, made quick work Tuesday unanimously passing a $99.75 million bond issue requested by Mayor Billy Kenoi. West Hawaii Today. A nonbinding resolution in English and Hawaiian will soon be on its way to the Hawaii Legislature, asking the state to declare July 31 “La Hoihoi Ea,” or Restoration Day, in recognition of the day in 1843 that independence was restored to the Kingdom of Hawaii. West Hawaii Today. Objecting to a restriction that would limit spending in county departments to specific accounts, Mayor Alan Arakawa has issued a line-item veto of the measure in the Maui County Council's fiscal 2016 budget. Maui News. A University of Hawaii research organization is forecasting a slight decrease in visitor stay times and an increase in visitor arrivals for Kauai through 2017. Garden Island. Friday is the deadline to submit a completed bed-and-breakfast (homestay) permit application if it includes a guesthouse. The Kauai County Council recently approved changes to the rules governing the B&B permit process; among the changes, permits will no longer be granted to B&B operators who use a separate guesthouse to provide accommodations. Mayor Bernhard Carvalho, Jr. has said he intends to sign the bill. Garden Island. About Me Nancy Cook Lauer has more than 25 years experience as a journalist, winning national and state awards for newspapers in Florida and Hawaii. She publishes a daily state government news aggregate and commentary blog, All Hawaii News. Vice President of the Hawaii SPJ chapter as well as former president of the Big Island Press Club, Lauer has a Master of Science degree in Library and Information Studies from Florida State University and a Bachelor of Science Degree in Psychology, summa cum laude, from Old Dominion University. She earned her reporting chops covering the 2000 Bush v. Gore presidential election at Florida's ground zero and was recently honored with a Torch of Light award and a Hawaii state Senate commendation for uncovering questionable spending practices in local government. I disclose This policy is valid from 30 January 2009 This blog is a personal blog written and edited by me. For questions about this blog, please contact nclauer@gmail.com. This blog accepts forms of cash advertising, sponsorship, paid insertions or other forms of compensation. The compensation received will never influence the content, topics or posts made in this blog. All advertising is in the form of advertisements generated by a third party ad network. Those advertisements will be identified as paid advertisements. The owner(s) of this blog is not compensated to provide opinion on products, services, websites and various other topics. The views and opinions expressed on this blog are purely the blog owners. If we claim or appear to be experts on a certain topic or product or service area, we will only endorse products or services that we believe, based on our expertise, are worthy of such endorsement. Any product claim, statistic, quote or other representation about a product or service should be verified with the manufacturer or provider. This blog does not contain any content which might present a conflict of interest. To get your own policy, go to http://www.disclosurepolicy.org
2023-11-08T01:26:58.646260
https://example.com/article/9593
AT_INIT m4_ifdef([AT_COLOR_TESTS], [AT_COLOR_TESTS]) m4_include([tests/ovs-macros.at]) m4_include([tests/ovsdb-macros.at]) m4_include([tests/ofproto-macros.at]) m4_include([tests/ovsdb-execution.at]) m4_include([tests/ovsdb-cluster.at])
2024-01-15T01:26:58.646260
https://example.com/article/6971
This site requries that you enable JavaScript in your browser. Most features of this site simply will not work without a modern JavaScript-enabled web browser. Try visiting our site in one of the following browsers with JavaScript enabled:Firefox, Safari, or Opera Summary: A weekly 30 minute review of international news and opinion, recorded from a shortwave radio and the internet. With times, frequencies, and websites for listening at home. 3 files- Highest quality broadcast, regular broadcast, and slow-modem streaming. NHK World Radio Japan, the Voice of Russia, Radio Deutsche-Welle, and Radio Havana Cuba. Credits: Notes: Dear Radio Friend, The latest Shortwave Report (May 23) is up at the website http://www.outfarpress.com/shortwave.shtml in 3 forms- (new) HIGHEST QUALITY (128kb)(27MB), broadcast quality (16MB), and quickdownload or streaming form (6MB) (28:59) Links at page bottom (If you have access to Audioport there is a highest quality version posted up there {35MB} http://www.audioport.org/index.php?op=producer-info&uid=904&nav=&) This week's show features stories from NHK World Radio Japan, the Voice of Russia, Radio Deutsche-Welle, and Radio Havana Cuba. From JAPAN- The UN warned that methamphetamine trafficking has tripled over a 5 year period in Asia and North America. The Chinese death toll in factory attacks in Vietnam rose to 5. Vietnam and the Philippines agreed to join naval forces to fight against Chinese oil drilling in disputed areas of the South China Sea. Workers at the destroyed Fukushima nuclear power plants have begun officially releasing ground water into the Pacific Ocean. The US has sent military personnel to central Africa to aid in the search for schoolgirls kidnapped in Nigeria. From RUSSIA- The Pentagon is spending $350 million upgrading a base in England for surveillance of Africa. A researcher describes how little has been done to cut back on the espionage and drone warfare overseas, as revealed by Edward Snowden. From GERMANY- Mali held a new election amidst confusion, while Tuareg separatists maintained their stronghold town against the Mali army. Record rainfall and accompanying floods left vast areas of the Balkans underwater and with a loss of electricity and drinking water- as well, the estimated one million land mines remaining in the region may have been exposed and swept away by the floods. Former Egyptian president Mubarak was sentenced to 3 years in prison for corruption- meanwhile another 163 supporters of former President Morsi have been jailed for up to 15 years. The US charged 5 Chinese military officers with hacking into US businesses to steal trade secrets. China and Russia signed a huge 30 year deal on natural gas. In Thailand martial law was declared by the military to interrupt violent demonstrations- news sources and social media have been censored- on Wednesday the military hosted talks between political rivals, though as I produce this show, no breakthroughs have been achieved. From CUBA- Russian Foreign Minister Lavrov denies rumors that his country is seeking to establish military bases in South America but is looking for naval ports- he stated that Russia is seeking to build a new canal across Nicaragua to rival the Panama Canal. Venezuela will file a complaint at the UN claiming that the US is sabotaging the government and financing the opposition. The UN may investigate the killing of two unarmed Palestinian teenagers last week. Noam Chomsky along with Angela Davis and many others will take part in the "Five Days For The Five" event in Washington DC. There is an article about the Shortwave Report by Cassandra Roos on line - http://www.campusprogress.org/soundvision/780/big-stories-shortwaves I was interviewed for an informative weekly radio show Mediageek, available at http://radio.mediageek.net All that plus times and frequencies for listening at home. It's free to rebroadcast, please notify me if you're airing it and haven't notified me in the last month, please mention the website if you only air a portion. If you just want to listen and have a slow connection, try the streaming version- lower sound quality but good enough and way easier if you don't have a high-speed internet connection. If streaming is a problem because of your slow connection, download the smaller file- it takes 20 minutes or less, and will play swell in any mp3 player application (RealPlayer, Winamp, Quicktime, iTunes, etc) you have on your computer. TIME SLOT on KZYX! This program will be aired on Sunday afternoon at 4pm (PST) on KZYX/Z Philo CA, you might be able to stream via < http://www.kzyx.org > I hope you'll listen and air this if you're connected with a radio station. I am still wondering how to get financially compensated for the 25 hours I put into this program weekly- any ideas are appreciated. Any stations rebroadcasting this (or listeners) are welcome to donate for production costs. You can do so through the website. Many thanks to those that have donated! No Guilt! (maybe a little) links for this week's edition- < http://www.outfarpress.com/swr140523.mp3 > (27 MB) HIGHEST QUALITY < http://www.outfarpress.com/swr_05_23_14.mp3 > (16MB) Broadcast Quality < http://www.outfarpress.com/swr_05_23_14_24.mp3 > (6MB) Slow Modem streaming Website Page- < http://www.outfarpress.com/shortwave.shtml > ¡FurthuR! Dan Roberts "I like the dreams of the future better than the history of the past." -- Thomas Jefferson
2024-01-12T01:26:58.646260
https://example.com/article/5609
<?php /* * This file is part of the Symfony package. * * (c) Fabien Potencier <fabien@symfony.com> * * For the full copyright and license information, please view the LICENSE * file that was distributed with this source code. */ namespace Symfony\Bundle\FrameworkBundle\Controller; use Symfony\Component\DependencyInjection\ContainerAwareInterface; use Symfony\Component\DependencyInjection\ContainerInterface; use Symfony\Component\HttpFoundation\RedirectResponse; use Symfony\Component\HttpFoundation\Request; use Symfony\Component\HttpFoundation\Response; use Symfony\Component\HttpKernel\Exception\HttpException; use Symfony\Component\Routing\Generator\UrlGeneratorInterface; /** * Redirects a request to another URL. * * @author Fabien Potencier <fabien@symfony.com> * * @final since version 3.4 */ class RedirectController implements ContainerAwareInterface { /** * @deprecated since version 3.4, to be removed in 4.0 */ protected $container; private $router; private $httpPort; private $httpsPort; public function __construct(UrlGeneratorInterface $router = null, $httpPort = null, $httpsPort = null) { $this->router = $router; $this->httpPort = $httpPort; $this->httpsPort = $httpsPort; } /** * @deprecated since version 3.4, to be removed in 4.0 alongside with the ContainerAwareInterface type. */ public function setContainer(ContainerInterface $container = null) { @trigger_error(sprintf('The "%s()" method is deprecated since Symfony 3.4 and will be removed in 4.0. Inject an UrlGeneratorInterface using the constructor instead.', __METHOD__), E_USER_DEPRECATED); $this->container = $container; $this->router = $container->get('router'); } /** * Redirects to another route with the given name. * * The response status code is 302 if the permanent parameter is false (default), * and 301 if the redirection is permanent. * * In case the route name is empty, the status code will be 404 when permanent is false * and 410 otherwise. * * @param Request $request The request instance * @param string $route The route name to redirect to * @param bool $permanent Whether the redirection is permanent * @param bool|array $ignoreAttributes Whether to ignore attributes or an array of attributes to ignore * * @return Response A Response instance * * @throws HttpException In case the route name is empty */ public function redirectAction(Request $request, $route, $permanent = false, $ignoreAttributes = false) { if ('' == $route) { throw new HttpException($permanent ? 410 : 404); } $attributes = []; if (false === $ignoreAttributes || \is_array($ignoreAttributes)) { $attributes = $request->attributes->get('_route_params'); unset($attributes['route'], $attributes['permanent'], $attributes['ignoreAttributes']); if ($ignoreAttributes) { $attributes = array_diff_key($attributes, array_flip($ignoreAttributes)); } } return new RedirectResponse($this->router->generate($route, $attributes, UrlGeneratorInterface::ABSOLUTE_URL), $permanent ? 301 : 302); } /** * Redirects to a URL. * * The response status code is 302 if the permanent parameter is false (default), * and 301 if the redirection is permanent. * * In case the path is empty, the status code will be 404 when permanent is false * and 410 otherwise. * * @param Request $request The request instance * @param string $path The absolute path or URL to redirect to * @param bool $permanent Whether the redirect is permanent or not * @param string|null $scheme The URL scheme (null to keep the current one) * @param int|null $httpPort The HTTP port (null to keep the current one for the same scheme or the configured port in the container) * @param int|null $httpsPort The HTTPS port (null to keep the current one for the same scheme or the configured port in the container) * * @return Response A Response instance * * @throws HttpException In case the path is empty */ public function urlRedirectAction(Request $request, $path, $permanent = false, $scheme = null, $httpPort = null, $httpsPort = null) { if ('' == $path) { throw new HttpException($permanent ? 410 : 404); } $statusCode = $permanent ? 301 : 302; // redirect if the path is a full URL if (parse_url($path, PHP_URL_SCHEME)) { return new RedirectResponse($path, $statusCode); } if (null === $scheme) { $scheme = $request->getScheme(); } $qs = $request->getQueryString(); if ($qs) { if (false === strpos($path, '?')) { $qs = '?'.$qs; } else { $qs = '&'.$qs; } } $port = ''; if ('http' === $scheme) { if (null === $httpPort) { if ('http' === $request->getScheme()) { $httpPort = $request->getPort(); } elseif ($this->container && $this->container->hasParameter('request_listener.http_port')) { @trigger_error(sprintf('Passing the http port as a container parameter is deprecated since Symfony 3.4 and won\'t be possible in 4.0. Pass it to the constructor of the "%s" class instead.', __CLASS__), E_USER_DEPRECATED); $httpPort = $this->container->getParameter('request_listener.http_port'); } else { $httpPort = $this->httpPort; } } if (null !== $httpPort && 80 != $httpPort) { $port = ":$httpPort"; } } elseif ('https' === $scheme) { if (null === $httpsPort) { if ('https' === $request->getScheme()) { $httpsPort = $request->getPort(); } elseif ($this->container && $this->container->hasParameter('request_listener.https_port')) { @trigger_error(sprintf('Passing the https port as a container parameter is deprecated since Symfony 3.4 and won\'t be possible in 4.0. Pass it to the constructor of the "%s" class instead.', __CLASS__), E_USER_DEPRECATED); $httpsPort = $this->container->getParameter('request_listener.https_port'); } else { $httpsPort = $this->httpsPort; } } if (null !== $httpsPort && 443 != $httpsPort) { $port = ":$httpsPort"; } } $url = $scheme.'://'.$request->getHost().$port.$request->getBaseUrl().$path.$qs; return new RedirectResponse($url, $statusCode); } }
2023-09-07T01:26:58.646260
https://example.com/article/8314
//! Configure the window of your application in native platforms. mod mode; mod settings; pub mod icon; pub use icon::Icon; pub use mode::Mode; pub use settings::Settings;
2023-08-19T01:26:58.646260
https://example.com/article/2397
<?xml version="1.0" encoding="utf-8"?> <packages> <package id="Microsoft.Owin" version="3.0.0" targetFramework="net45" /> <package id="Microsoft.Owin.Host.SystemWeb" version="3.0.0" targetFramework="net45" /> <package id="Owin" version="1.0" targetFramework="net40" /> </packages>
2024-01-24T01:26:58.646260
https://example.com/article/1948
## Pet Food Nation The SMART, EASY, and HEALTHY Way to Feed Your Pet Now ## Joan Weiskopf Ruth and Donny, Elaine, Lenora, Sue Five angels who believe "The greatness of a nation and its moral progress can be judged by the way its animals are treated." —Mahatma Gandhi ## Contents Epigraph Note to the Reader Introduction Part One: Why You Need This Book Now The Pet Food Scandal A Canned History of the Pet Food Industry Who's Minding the Store Part Two: What Your Pet Wants You to Know Sound Nutrition for Your Pet The Pet Food Pie The Balanced Diet Should I Use Commercial Pet Food? Reading the Label Table Scraps: Do's and Don'ts Homemade Pet Food: Pros and Cons Why Raw Food Diets Failed Mixing Commercial with Table Scraps and Homemade Cookin' Part Three: Home Cooking Recipes Know Your Breed For Dogs For Cats Basic Recipes for Dogs Basic Recipes for Cats Joan's Vitamin Chart Know Your Minerals Doing It Right Good Product Sources Searchable Terms Acknowledgments About the Author Copyright About the Publisher ## Note to the Reader: A Call to Action Early in 2007, in response to customer complaints that their pets were getting sick from bad food, a Canadian pet food manufacturer, Menu Foods, ran a controlled test. Twenty-five cats and fifteen dogs were given the Menu product; in short order, nine cats and one dog died. This prompted a call to the U.S. Food and Drug Administration in mid-March and the immediate recall of sixty million cans and pouches of dog and cat food that had originated at the Toronto plant. Suspicion centered on wheat gluten, a protein source and binder found in many pet foods. Menu had only recently changed suppliers for the gluten, and it was believed that the new supplier, based in China, had provided gluten contaminated with melamine, a chemical used in making plastic cutlery and also used in fertilizer. It was not only the poor animals involved in the controlled test that were affected. * * * Q: In light of the pet food recall, should I stop feeding my dog commercial pet food? A: There are a few good commercial pet foods out there—look for ones that have not been recalled and that have human-quality meat and whole grains. They are okay, but home-cooked is ideal. * * * Soon, there were reports that as many as 3,200 pets had died from tainted food, mostly due to kidney failure; another 6,000 were said to have become ill. The recall involved pet foods from more than one hundred separate brands, as Menu was the provider of pet food components to several centralized processing plants, including two in the United States. In fact, Menu Foods makes private-label pet food for seventeen of the top 20 North American retailers, including Kroger, Safeway, and Wal-Mart. But the recall was by no means confined to cheaper, mass-market brands: also pulled off the shelves were top-of-the-line brands like Iams and Eukanuba. Pet owners were understandably worried, and remain so. Since the original recall, melamine has been found in rice gluten and corn gluten, and the recall has broadened. Pet lovers around the country are very, very worried, not to mention angry: * What have I been feeding my pet? * What can I feed her now? * What's gone so wrong? My mission with this book is to help guide you through these uncertain times. I offer you my experience, my education and my lifelong passion for pets. Together, let's change the way we think about how we feed our beloved pets, and how we prepare for the future. Joan Weiskopf May 2007 ## Introduction Family lore has it that when I was about a year old—before I had even taken my first step—I stood up out of my stroller and walked directly over to a big white fluffy dog and gave a toddler's hello. Apparently, the big white fluffy dog (which I now know was a Great Pyrenees) greeted my wobbly approach with benign amusement. Good doggie! Thus began my life-long fascination with animals. Fifty years later I am still in thrall to our four-legged friends; in fact, I remain particularly enamored of big white fluffy dogs, as professionally I breed, train, and show Bedlington terriers, who are fluffy and white, although nowhere near the size of my first Great Pyrenees friend. My early years were spent in the busy New York City borough of Queens. Our family moved when I was three to New Rochelle, a quiet bedroom community with large houses, wide, tree-lined streets, and plenty of backyards. I got a new little brother I loved but no dog, and one of my earliest memories is that I set about to change that. I tried to adopt about every neighborhood mutt I could sweet-talk into my company. One day—I couldn't have been more than four or five—a cocker spaniel named Georgia and I ran away from home. Every policeman in the area was on alert to pick me up and take me back to my parents. And they did. More than once. I don't remember where I wanted to go. I wasn't unhappy. I just knew I was happiest when wandering around in the company of my sweet canine neighbor, Georgia. When I was about twelve we finally got our own dog, a miniature poodle named Jiffi. We named her Jiffi because I was Joan, Mom was Janet, Dad was Jesse, and my brother was Jay. It had to be a J. * * * Q: Should I stop feeding my cat commercial pet food immediately? A: No pet diet should be changed suddenly. All change should be gradual—7 to 10 days for a complete change. * * * For all intents and purposes, Jiffi was mine. I had been relentless in wanting to get a pet, and it was a reward for something commendable I did but that is now lost to memory. Perhaps I cleaned my room. (Unlikely.) In any event, "the dog" was my responsibility. "The dog's your responsibility, Joanie," my mother would say. But she didn't have to remind me often. Unlike many other teenagers, I fulfilled my responsibilities to Jiffi loyally, faithfully, happily. I loved that dog. * * * Myth The older the pet, the less protein it needs. The Truth: Older dogs and cats actually need more protein, as the body becomes less efficient throughout the aging process. What is needed is higher quality protein with easier digestibility and better bioavailability of nutrients. * * * Much of what I learned about dealing with pets I learned early: Listen to them. Watch them. Learn about them. Feed them well. Feeding back then (the late 1950s) was much different from today. Most people treated their pets as an additional household member, as they do now, and they fed them accordingly. There wasn't much specialty food—pet food—available. The grocery store aisles were not lined up with dog and cat food. We fed them from our kitchens. I remember my mother going to the butcher shop once a month to stock the family freezer with meat. After ordering everything we needed—chops and roasts and fryers and sausages and steaks—she'd ask for some "dog meat." The kindly butcher would then produce a log of ground, frozen trimmings from his walk-in freezer. How much, Ma'am? the butcher would ask, poised with his saw in the air. My mother would order several 1-pound chunks sawed from the log, and that would be the main food source for Jiffy for a good month, complemented by table scraps and whatever else she could talk people into giving her. In 1968 I went to college at the University of Illinois to study pre-veterinary medicine. I loved the work and the science and the prospect of working with dogs and cats (I also loved cats), but unfortunately, the administrators at the vet school did not look kindly on women entering the program. It may come as a surprise to many, but back then, most vet programs were for guys, and they centered on what I call "chain food medicine," that is, large-animal veterinary practice. Small-animal disciplines were mostly an aside. Needless to say, I switched majors, to fine arts, mostly metalworking and jewelry design. I felt these made for more practical career choices, given the hippie 1960s and the reality then of the vet school landscape, as it had related to me in no uncertain terms. I graduated from Illinois with dual degrees in fine arts and medical illustration in 1972 and went on to Rochester Institute of Technology, where I earned a master's degree in teaching. I worked in the jewelry industry for many, many years. In 1977, I got the first dog of my own as an adult: Percy, a Bedlington terrier, the breed commonly referred to as lamblike. I got him from a breeder I knew in New Jersey. The curves and line and the sculpture-like qualities of that particular terrier attracted me and has held my heart ever since. From that point on I was hooked. My journey since then has led me to write this very book. * * * Myth Dry food is better for my pet than wet food. The Truth: In commercial pet food, wet food is generally healthier than dry because wet food ingredients are usually not rendered or processed, but simply canned under sterile conditions (one hopes). Wet foods usually contain much more protein. They also have more moisture, which is better for cats. Dry food has no inherent dental value for pets. * * * Unfortunately, Percy was a sickly dog. I discovered that Bedlington terriers have a serious genetic flaw that makes them prone to liver toxicosis (in humans this is called Wilson's disease). Medically, Percy was missing the enzyme required to metabolize copper. Copper, though needed only in trace quantities, is present in drinking water (thanks to copper pipes), but if your system doesn't have the key to breaking it down, it builds up in your liver and will reach poisonous levels. Thankfully, a medicine called penicillamine came along, which chelates (binds) the copper and flushes it from the system. I was amazed to see the application of good science and intelligent intervention up close. My interest and fascination with veterinary medicine returned full force. At the age of thirty-five I resolved to finish what I had started back in Illinois, or at least try. Of the twenty-seven vet schools in the country, the only one that had a significant interest in animal nutrition was Tufts in Boston. There I came to understand that my true calling lay in prevention of health problems in animals, rather than in tending to the sick or injured. After leaving Tufts, I did all I could to learn about alternative methods of care, including feeding. I developed a network of vets and pet owners who were able to give me some very good information on nutritional care for dogs. * * * Q: What's better: canned or dry pet food? A: Because the canning process itself is a preserving process, there are fewer chemical preservatives in canned food, unless your dry food manufacturer is diligent about using natural preservatives. Read the label! * * * Today, I live in Pennsylvania with my six adult dogs, all Bedlingtons. My "kennel" is a black leather sofa in the living room. I cook for my dogs every day. But that's just me. I don't expect every pet owner to be at the stove for their doggies and kitties every day, or to give over their household furniture to their pets. Our lives can be hectic, our schedules cramped, and there are so many options for feeding your pet. But as a breeder, dog show person, and lover of animals who knows just a little about how dogs work, I do want to share with you how my experience is reflected in my feeding regimen, if only to show you how much loving care can be put—and easily put—into tending your beloved furry friends. The Way I Feed My Dogs Every morning, I let the dogs out, let them in, and feed them breakfast. Sometimes I have prepared some meals in advance and frozen them; sometimes I cook them up fresh. It all depends on my schedule. Regardless, this is the regimen I follow. Five days a week, they will get either chicken livers or chicken hearts or chicken gizzards, which I buy in bulk every two months—fifty pounds' worth, organic and free range (of course, I freeze a good deal of it), which brings the cost to a little over one hundred dollars. That's breakfast for six for six to eight weeks. The chicken parts I sauté very lightly in organic coconut oil. I sauté the chicken giblets only enough to take off the chill; the middle is completely raw. I add string beans (fresh or frozen, not canned—too much sodium) to the skillet and zucchini, which you can get fresh all year round. In the winter months, I put some grain in the breakfast—cooked oatmeal or barley, pasta, couscous, kasha, or brown rice. I scoop it into their bowls, almost always adding a fish oil capsule and a heaping teaspoon of organic full-fat yogurt. I refresh their water. The other two mornings, I fix them eggs—scrambled eggs: four eggs for my six terriers. At around 11:30, my dogs start looking at the refrigerator, as if it might magically open under their steady, loyal gaze. It does get opened, by me, and I give them each a raw chicken neck—dipped first in boiling water to kill any surface bacteria but without cooking the nutrients out of the bones within. For dinner, they get the boiled chicken (or rabbit, duck, bison, venison, lamb, hamburger, pork, or fish twice a week; all pets, dogs and cats, need their protein sources varied). I give them whatever vegetables are in season (broccoli, cabbage, kale, romaine, carrots occasionally, sweet potatoes occasionally, asparagus, green peppers), all lightly sautéed in the chicken juices. I may toss a little rice or some kind of cooked grain in as well. * * * Q: My dog has eaten some chocolate. How do I know if he has eaten too much? A: Symptoms of chocolate toxicity are vomiting, diarrhea, panting, restlessness, increased urination, and muscle tremors. * * * Domesticated cats and dogs should not be grazing, so I pick the bowls up off the floor after a half hour (if there is ever any food left). These animals have made their kills, now it's time for them to rest. No snacks till bedtime, when—I shouldn't say this—I might indulge them with a potato chip or, more healthfully, some air-popped popcorn. They are likely to receive gifts of fruit daily, like bananas, pineapple, apples, or melon (but never grapes). Dried fruits are fine: dates, figs, apricots (but never raisins). * * * Myth Too much fat is bad for dogs and cats. The Truth: Dogs and cats metabolize fats differently than humans do. Fats provide thermo-regulation and energy. Unless there is some other underlying disease process, fats are good for our pets, especially Omega 3 from fish. * * * In Pet Food Nation, I hope to show you just how easy and inexpensive it is to ensure that your dog or cat is eating nutritiously—whether you are cooking for one or six, for a malamute or a beagle, for a Persian or a Maine Coon cat; whether you are relying to some extent on commercial pet food or table scraps, or a mixture. The most important thing to understand is your own pet. Once you realize what he or she needs—specific to breed, geography, age, and temperament—you'll never need to worry that you aren't doing the best for your pet. But if it's commercial pet food you're using, to whatever extent, you'll have to learn to read the label! You have brought your pets into your world. They deserve the best you can give them. And they need it now more than ever. Special note: Transitioning to a Healthy Diet If this book or events in general inspire you to make a change in your pet's diet, please do so gradually, over seven to ten days, introducing a little bit more of the new diet each day. A change for the better often fails if done too quickly. The pet can experience a variety of problems, including diarrhea, excessive urination, and possible kidney failure. Be careful, be slow, be patient. Good health is not far away. Here's why your pet may very well need such a change. ## part one ## Why You Need This Book Now ## The Pet Food Scandal Although it is true that the spring 2007 recall was the largest in the history of the pet food industry, it is by no means the first time tainted pet food has caused a problem. In late 2005, the presence of aflatoxin forced a manufacturer to recall its product; in the past year, traces of aminopterin, used in rat poison, were found in dog food that turned deadly. Back in 1995, Nature's Recipe pulled $20 million worth of its product due to the presence of vomitoxin; the source of that recall has not been conclusively identified. Melamine, although not meant to be in food, is not known to be toxic. Some suspect that melamine found in the 2007 products is a "marker" for something else that is proving deadly, as yet unidentified. If that is the case, perhaps the melamine is not even necessary to the fatal tainting of pet food. No wonder pet owners are nervous; no wonder the pet food industry is nervous, too. I hope to be able to give some relief by explaining what's at stake and what the issues are. * * * Q: Is milk/dairy really good for cats, even as a special treat? A: Cats lose the ability to digest lactose, but a small amount as a treat is fine if they tolerate it. Best to use a fermented milk product, such as yogurt, kefir (fermented cow's milk), or buttermilk, which have great health benefits from the good bacteria it puts into the system. * * * There are an estimated 144 million pet cats and dogs in the United States; their owners bought more than $15 billion worth of pet food last year. That's a lot of kibble. But with the threat of deadly illness hanging in the air, pet owners cannot wait for the industry or its regulators at the FDA to step in and tell them what's wrong and how it is to be fixed. There's no time, and there's too much at stake. There is one thing, however, that pet owners can do that will not only ensure the nutritional health of their companion animals right now, but in all likelihood will radically transform (and reform) the pet food industry itself: make their own pet food. For those of you who want to try, read on. For those of you who fear that it might be impractical to make your own pet food, also please read on: you will learn how to read a commercial pet food label and know just what you are giving your pet. ## A Canned History of the Pet Food Industry Before you make up your mind about how you intend to feed your pet today, tomorrow, or into the future, let me first give you a brief overview of the pet food business. It's good to be informed—and you may well conclude that the recent scandal was less an aberration than an inevitability. Although the 2007 pet food scandal has grabbed the attention of the mass media and has understandably come as a shock to many pet owners, concerned animal nutrition advocates have been warning for years that mass-produced pet food was potentially harmful to pets, and certainly not healthy for them. Much of the problem stems from the fact that dogs and cats are carnivores; they need significant amounts of protein in their diets. Protein is not easily come by and is subject to bacterial decay; hence, ensuring uncontaminated food as well as long shelf life is a challenge. * * * Myth A pet eating grass is a sign of sickness. The Truth: Ingesting grasses and dirt is more likely to mean that your pet is in need of some varied nutrients. Good soil, for example, contains micronutrients; weeds and grasses, especially dandelion, can be very good liver cleansers. Of course, any chemically treated plant or grass is not good. Grass eating, unless excessive or followed by vomiting, is a good thing. * * * It is well known that pet food companies, in their search for protein, have resorted to slaughterhouse waste, restaurant grease, and garbage, not to mention the four Ds: dead, diseased, dying, and disabled animals. To ensure that there is no bacteria in these components, they are rendered—that is, cooked in a vat (hair, hoof, collars, plastic bags, and all) at about 250 degrees for up to an hour, then centrifuged at high speeds till the tallow floats to the top. The tallow is used as a source of fat in pet foods and sprayed on chunks to make them tastier to the animals; some of the rest may be processed into kibble. This cooking indeed kills bacteria, but it also eliminates all the healthy enzymes found in meat products. And the high heat and centrifuging does not remove heavy chemicals, like the sodium pentobarbital that is used to euthanize animals. Likewise, the grain elements used in pet foods (unless labeled "whole grains") come from more or less the bottom silage, the sweepings from farm silos, where disinfectants and metals mix with the grain dust and husks, and the grain itself is subject to contamination by a variety of mycotoxins. The low-rent sources for much of what constitutes commercial pet food is alarming enough, but with the rendering of protein compromising nutritional value and the high toxin exposure of the grain sources, a pet owner might be excused for, well, gagging. * * * Q: What is rendering? A: Rendering is when raw materials are dumped into a large vat and boiled for several hours to separate fat, remove water, and kill bacteria, viruses, and parasites. The high temperatures used (270°F/130°C) can destroy natural enzymes and proteins found in the raw ingredients. Then there are myriad chemicals sprayed on the food to prevent toxic mold buildup. Instead of toxic mold, the pet food contains toxic chemicals! * * * It was not always thus. Cats and dogs have been domesticated as both working animals and pets for thousands of years (dogs much longer than cats, however). Until less than a hundred years ago, cats and dogs for the most part relied on a diet of prey, table scraps, and food from the butcher or the fisherman. They ate the ends of bread, oatmeal, and barley from the scrapings of the family pot, and bits of fruit; they chewed on bones left over from family meals. They drank clean water and milk and buttermilk slurry. In fact, there wasn't even a pet food industry until the late 19th century, and it was hardly an industry. A man named James Spratt, an American entrepreneur trying to sell lightning rods, ventured to London in search of customers. He brought his dog along with him; on the transatlantic passage the dog was given some old ship biscuits, the bane of many a sailor's diet and, Spratt decided, not worthy of his dog. But it give Spratt an idea: to develop a dog cake that was nutritious and edible. Spratt's Patent was founded. Spratt's biscuit consisted of ground wheat, vegetables, beetroot, and dried meat, including buffalo imported from America. He started his company in England, where there was a considerable demand from English country gentlemen with hunting dogs and mastiffs. He began a U.S. operation in the 1890s, setting up shop in Newark, New Jersey. Spratt and a few other British companies dominated the small market in the early decades of the twentieth century, until F. H. Bennett of New York City introduced the "milk bone biscuit," a calcium-fortified staple. Bennett eventually made dozens of varieties of biscuits and crackers, but his great innovation was to make the biscuit in the shape of a bone. Dogs ate it up. Many innovators followed: P. M. Chappel began canning dog food in the 1920s under the Ken-L-Ration brand; what they canned was horse meat, which met with a rocky reception at first, but, when dogs proved to love it, was eventually accepted. Clarence Gaines introduced a dry formula and also engineered a national distribution network. It was only a matter of time before a national-brand food purveyor of human food got into the act. In 1931 the National Biscuit Company (Nabisco) bought Milk Bone, which resulted in a sales force 3,000 strong calling on the nation's storeowners to stock what they heretofore had not: food for animals. * * * Q: I pay top dollar to buy high-quality dry cat food with no animal by-products for my pet. Am I correct in assuming that this is safe food and good for her, especially since the brand is not on the recall list? A: Almost all commercially prepared kibble (dry food) is grain-based. It would be better to feed the cat a home-prepared diet of seventy-five percent animal-based protein. * * * Today, pet food companies are huge, and the past few years have seen large companies bought up by even larger ones. Nestlé's bought Purina to form Nestlé Purina; it produces the well-known Fancy Feast, Alpo, Friskies, Mighty Dog, Puppy Chow, and Tender Vittles. Del Monte bought the pet food division of Heinz, now home to Gravy Train, 9Lives, MeowMix, and Nature's Recipe. Mars Inc. acquired the Royal Canin line, which includes Pedigree, Waltham's, and Sensible Choice, and just lately gobbled up Nutro. Procter and Gamble (P&G) bought the well-respected Iams company, maker of Iams and Eukanuba, nearly eight years ago, and Colgate-Palmolive got into the business by acquiring the venerable Hill's Science Diet. Then, of course, there are many boutique and private-label pet food companies. One of the things made patently clear in the latest recall is that labels large and small get ingredients from one of three gigantic co-packagers—and then affix their own labels. When the list of recalled lines runs one hundred deep, nearly everyone is implicated. Not all, of course, but consumers must beware. But why beware when you can simply prepare? In most homes, the foods are present that can nutritiously feed the family cat or dog. Although for many years vets advised against feeding pets "human food," you seldom hear that now. Instead, you will hear the proviso "But you must supplement with vitamins and enzymes and be careful not to feed them too much of one thing or not enough of another." Of course. As with humans, achieving a healthy balanced diet is not a no-brainer. You have to think a little. But once you have understood the needs of your particular pet and committed to a regimen of food and supplements, it will become second nature. It won't be as mindless as opening a can or picking up the fifty-pound bag at the supermarket and filling the water bowl twice a day; rather, it will become an extension of your love for your pet. If you can do it, you should. If you can't, if you must rely on commercial pet food, do it right. ## Who's Minding the Store? The effects of a half-century of burgeoning pet ownership has spawned a big business in pet food. And with big business comes salesmanship. It is the salesmanship that has exacted a price. In the competition for business from pet owners, pet food manufacturers have done their best to sell you their products, making claims for the delectability and nutritional value of their food. In that effort, they have searched for larger markets and greater margins, as most any business would. Unfortunately, and unlike the food industry in general, the oversight for the food we feed our pets has been weak, as the tainted pet food scare has shown. Who is the watchdog when it comes to pet food? Well, let's be honest: it's not the kind of watchdog you'd want guarding anything precious to you. But you should know who they are. Three organizations oversee the industry. The federal Food and Drug Administration (FDA), the Center for Veterinary Medicine (CVM), and the Association of American Feed Control Officials (AAFCO). What's missing here? Think about who inspects the beef you eat and the chicken you buy for your family. That's the Department of Agriculture, and the Department of Agriculture is involved only in the pet food that we export outside of the country. Inside our borders, we have only the FDA. Now the FDA hardly has pet food at the center of its radar screen; it is a federal agency that regulates, among other things, drugs, medical instruments, vaccines, blood products, and a lot of personal devices and appliances that emit radiation, such as cell phones and microwaves. The FDA farms out its pet food oversight responsibilities to the Center for Veterinary Medicine, a division of the FDA. The CVM regulates the manufacture and distribution of food additives and drugs for pets. It has no role in monitoring where the food comes from—neither the proteins nor the fats nor the grains nor the water in pet food. The CVM is charged with upholding a requirement that the pet food be "pure and wholesome" and be truthfully labeled. Unfortunately, the CVM does little, if any, testing. It busies itself with, on occasion, attempting to verify exception claims made by a pet food manufacturer—"prevents worms," for example. * * * Fun Fact What do the numbers 310807, 083107, and 8/31/07 have in common? They are accepted notations of "best before" dates on pet food; the first is in the International Date Code style. * * * The regulation of pet food labeling falls to the AAFCO, which works in partnership with the FDA and CVM. Many could persuasively argue that this is a case of the fox minding the chicken coop, as the AAFCO is little more than a trade organization, whose membership includes representatives from the large pet food manufacturers. That is not to say that the AAFCO does not have pet health clearly in mind; after all, the pet food industry needs our pets (more than our pets need them!). The AAFCO issues, no doubt in good faith, a vast and complicated array of labeling requirements, beginning with what requirements must be met to allow a manufacturer to say "All Chicken" or "Fish Platter" or "With Beef" on the bag or can. But it has no teeth. Its requirements are really more in the way of standards. Manufacturers are supposed to meet those standards, but, as with the CVM, there is little or no testing going on. Thus, today we have to trust ourselves and common sense. There is a world of information about what you might be feeding your pet. It's up to you to find it. My hope is that this book makes that job easier. ## part two ## What Your Pet Wants You to Know ## Sound Nutrition for Your Pet When it comes to understanding our pet cats and dogs, it's crucial to understand where they came from. Their origins and history as a species, combined with the more recent histories of their breeding and the customs of their care, are what determine what they need today. Both cats and dogs began as predators in the wild; both are classified as carnivores—that is, their metabolism depends on meat protein and they are built and wired to acquire it and process it. It is how they grow. A 2002 study published in the journal Science examined the mitochondrial DNA of dogs found at archaeological sites around the world and concluded that dogs descended from wolves in East Asia, where they were first domesticated. This theory has superseded previous beliefs that the dog originated in the Middle East. In any event, it is likely that wild wolves in search of food were attracted to human encampments, attracted by the smells of food being prepared. The wilder, flightier dogs may have shied away, while the more passive members of a wild pack may have lingered around the settlements, eventually finding that their presence was welcome, with food coming a little easier. Of course, with their speed, strength, and sharp teeth, early dogs were excellent hunters. It was only a matter of time before those dogs who found human company hospitable were eventually trained to help in the hunting. These animals accompanied humans on long travels across Asia and across the Bering Strait, bringing the species to the Americas some 12,000 to 15,000 years ago. Although hunter-gatherers were responsible for spreading dogs across the world, it was the development of permanently sited farming cultures that led to the true domestication of the animals, with selective breeding. Since dogs were found to be instrumental in a variety of important community functions—hunting, birding, waterfowl retrieval, herding, vermin control, not to mention serving as guards and companions—the variety of combinations of breeding to isolate one or more of these virtues led to the enormous variety within the species that we have today. The origins of today's cat are less in dispute. They are descended from the African wildcat (Felis sylvestris lybica). A small, fast animal that roamed in the African savannas, the African wildcat descended from early miacids, as are lions and tigers. The domestication of cats (into Felis sylvestris catus) is thought to have begun only 4,000 years ago, in Egypt, where their mysterious ways were a source of fascination and their ability to hunt down rodents most welcome. The fact that the cat has been domesticated for far less time than the dog explains a lot—about the independence and strong will we attribute to the felines, as opposed to the dog's widely cherished sociability. The cat's diet is also closer to what it was in the wild than is the dog's. Cats are considered not only carnivores but "obligate" carnivores, meaning they must have animal protein (whereas a dog can survive longer on a low-protein diet). The cat's methodical and deadly stalking and pouncing are well known. Even today, cats who have never been off the living room carpet, if left to their own devices on the street or in a meadow would not go hungry. The same cannot be said for the dog, though the social charm of most canines will go a long way toward getting them what they need, at least for a while. * * * Q: Since dogs and cats descend from prey animals and are accustomed to feasting on their kill and then resting till hungry again, should I also occasionally make my pet fast? A: No. Unless your pet is on a raw food diet (which I don't recommend), fasting is not a good idea. In fact, cats, who get most of their water from food, should never go long without eating—never an entire day. * * * What does this tell us, in general, about our pets? First of all, it tells us that our pets are descended from species that ate raw food: animal meat, organs, bone, blood, even hair, fur, and feathers. Both cats and dogs were locked into finding protein, so that eggs, reptiles, and rodents were on the menu. More so than cats, dogs are believed to have eaten carrion; they would eat from carcasses they found in the woods. Dogs were also more likely to feast on the digestive tracks of killed or found prey, thereby often ingesting grain and vegetable matter from non-carnivorous prey, such as deer. Being hunters, cats and dogs are also, in their origins, feast-and-famine animals. That is, they gorge on kill, then rest to digest and only move again when hungry. Since hunters are eating raw food, this cycle allows them to complete the process of digestion and evacuation of waste before having another fill, an important factor in avoiding bacterial infection. Finally, we should note that the African wildcat, being a grassland animal, was not accustomed to an abundance of available water; cats today, it is plain to see, are hardly built for lapping up water like a dog is. As a result, cats absorb virtually all the moisture they need from their prey—or their pet food. * * * Q: Some of my fancy friends are now giving their dogs and cats bottled water to drink. Is this ridiculous or recommended? A: Tap water is just as harmful for your pet as it is for you. Bottled, filtered, or reverse-osmosis water is a great investment. * * * So what should we do? Simple: We should feed our pets with their ancestral feeding habits in mind. If you give your cat a mouse, give your dog a rabbit. ## The Pet Food Pie Of course, it's a little impractical in these times to have your animals feed on live prey, but it has not always been so. A hundred years ago, cats and dogs, though welcome in homes, basically foraged for themselves. Water and table scraps might be left for them on the back porch, but as often as not, looking for Puss or King was futile as they were out on hunting expeditions. It's a different world today. Still, the nutrients your dog or cat was ingesting in its self-caught meal is what we must discover in order to provide a healthy diet. What were our African wildcat and East Asian dog getting on their forays into woods or fields? Six things, which make up the pet food pie: The correct proportions of these elements is the source of not only some dispute, but of confusing ways of measurement: by weight, by volume, by calorie? The standard way of listing ingredients is by weight, but that doesn't break out the value of some of the nutrients, such as protein and fat, that might reside in more than one type of ingredient (meat has protein and so do grains, for example). My rule of thumb is that cats should have seventy-five percent protein and the rest in grains, vegetables, and fruit, while the dog ratio should be sixty-five percent protein, with the balance in grains, vegetables, and fruit. For both, an occasional multivitamin supplement is a good idea. * * * Q: When the pet food label says "meat," what animal is it from? A: "Meat" refers only to skeletal muscle tissue taken from cows, swine, sheep, and goats. Since sheep and goats are rare compared to the 37 million cows and 100 million hogs slaughtered for food every year, nearly all meat by-products come from cattle and pigs. * * * Essential Components of the Pet Animal Diet 1) Protein: Protein is found in both animal and plant material, specifically grains. Meat, poultry, dairy, and eggs are high-quality sources of protein; rice barley, wheat, rye, and corn are good sources of vegetable protein, but the vegetable and grain proteins are of lesser quality than animal protein. Cats need more protein, perhaps twice as much as dogs. 2) Carbohydrates: Our pets and we differ greatly in the need for carbohydrates and in how we digest them. Our pets' need for carbs can be completely satisfied by their diet and synthesis in their bodies, provided that the diet has adequate protein and fat. Starches and grains are virtually useless to our pets unless they are well cooked. Just remember that commercial pet foods may contain thirty to sixty percent dry-weight carbs in dry food, and five to thirty percent in wet canned food. 3) Fats: Animal fat is a great source of energy for cats and dogs and carries essential fatty acids. Fats also help transport fat-soluble vitamins (which the body stores more easily than water-soluble vitamins) throughout the body. They also make food taste better and stimulate appetite. Fats are also found in some vegetables (lots in avocados) and some fruits (dates) and are in good supply in nuts and seeds. 4) Vitamins: There are two categories of vitamins: water-soluble and fat-soluble. Water-soluble vitamins include the B vitamins, niacin, pantothenic acid, folic acid, biotin, choline, and Vitamin C. Fat-soluble vitamins are Vitamins A, D, E, and K. 5) Minerals: Minerals are essential for bone formation, muscle metabolism, fluid balance, and nervous system function. Major essential minerals are potassium, calcium, phosphorus, magnesium, and sodium chloride. Trace elements are iron, copper, manganese, zinc, iodine, selenium, and cobalt. Although mineral dietary requirements are minimal, they are essential to general good health. 6) Water: Clean, fresh water is essential to nearly every process of your pet's body. Neither cat nor dog can last more than a few days without water. Cats ancestrally are accustomed to absorbing their water from their prey. In today's world, it's best to keep a bowl filled for them. Same for doggie. * * * Myth A regular diet repeated day after day is best for my pet's digestion. The Truth: Variety is the spice of life. Dogs and cats have historically relied on capturing and eating prey and were accustomed to the variety this introduced. Also, the same diet with an unvarying protein source can lead to allergies and deficiencies in micro-trace minerals. * * * Whatever you feed your pet, and from wherever it comes, it should aspire to represent all six parts of the pet food pie. Otherwise, you're doing your pet wrong. ## The Balanced Diet Most books that break down the proper diet for dogs and cats are going to be misleading. They will likely say that a dog diet should consist of one-third protein, one-third grains and carbohydrates, and one-third fruits and vegetables. For cats, they will recommend two-thirds protein and the rest in grains, carbs, and fruit. This can be misleading because it assumes you are feeding your pets commercial pet food, where the animal protein is generally of low quality and much of the protein is therefore provided through grains. Dogs on a diet of homemade pet food could do well with having three-fourths of their diet be animal source by weight. That would give them not only all the protein they need, but all the fats and carbs and most of the vitamins and minerals as well, and in a highly bioavailable form—meaning they can easily absorb it. If making your own pet food is not your first choice, then just make sure as best you can that the animal protein is of the highest quality you can get in a commercially available pet food. Food Groups and Sources It is important to know the nutritional yield of various food groups. Below is an ideal yield from organic product. The numbers will be somewhat compromised by many commercial pet food processes. Meat: All meats yield similar amounts of protein (6 to 8 grams per ounce). Lamb, pork, and beef are highest in fat; poultry is lowest. Lamb yields the most calcium, poultry the least. Beef kidney and poultry are the lowest in calories. Dairy: Per cup, cottage cheese trumps all other dairy in protein (26 grams); plain yogurt yields 12 grams and has half the fat. Note that fat is not bad for your pet unless your vet has determined that it has a weight problem. Cottage cheese, however, is loaded with salt, even low-sodium brands. * * * Myth Milk products, though good for cats, are bad for dogs. The Truth: Soured milk products, including yogurt, kefir, and buttermilk, are excellent sources of bioavailable calcium for both cats and dogs. * * * Grains: Couscous and pasta have the most protein, about 9 grams per cooked cup. Oats, brown rice, and rye are high in calcium. Oats and whole wheat are high in potassium. Corn, barley, and rye are highest in fiber. Vegetables: Black beans, lentils, and lima beans are the kings of vegetable protein—though legumes (watch out for soybeans) can cause digestive problems. I recommend against using any soy product: tofu, sprouts, beans. Vegetables are great sources of potassium, except for a few, such as artichokes and green peppers. As for vitamins, broccoli, parsley, and spinach are very high in A and C. Fruits: The main dietary value of fruits is in providing vitamins, minerals, fiber, and enzymes. Dates and figs are surprisingly good sources of protein and fat, as well as calcium. But raisins and grapes—No! Nuts and seeds: Sunflower seeds are high in calories and fat and provide some calcium. Pecans also have a good amount of fat and are loaded with calcium. Nuts and seeds should be ground or chopped for any pet, or little of the nutritional benefit will be absorbed. Almonds are the best—they should always be raw, unsalted, and preferably organic. ## Should I Use Commercial Pet Food? Now that you have a basic outline of what your pet, whether dog or cat, needs, it's time to ask the question: Do I feed my boon companion a commercial variety of pet food? The safest—and, at the moment, sanest—answer to the question is No! The recent pet food recall has shaken not only pet owners; it has shaken a multibillion-dollar industry to its core. You better believe that the commercial pet food business is gravely concerned, not only about the quality of its product, but about maintaining (the loyalty of) its customers. With the number of cats and dogs in America approaching 150 million, this is serious business indeed. Those pets are going to be fed. The question is, what will they be fed and who will make it? As we know, the methods of producing commercial pet food are not regulated in the way that the production and packaging of human food is. As we also know, the regulations that are in place—most of them subject only to voluntary compliance—cannot easily or effectively be extended to some of the basic components that come from overseas. Store-bought pet foods come in a variety of styles, at a variety of prices, and of varying quality. But the centralized distribution system exposed in the Menu Foods recall of 2007, where melamine-laced wheat gluten from China became a component in more than one hundred different brands, has called into question every consumer assumption about what we are paying for. Is the relatively high-quality Iams really healthier than some of the lower-priced foods? Or are only some of the components of better grade? One thing melamine (a by-product of coal used in fertilizer, but whose nitrogen levels can be misread as levels of protein) did was render every brand of pet food no stronger than its weakest (or most toxic) link. Let's Be Real for a Minute I don't give my pets commercial pet food. But when it comes to assessing the situation for other, understandably concerned pet owners, I am a realist. I realize that arguing for strict avoidance of anything of a commercial origin is impractical advice for many of us. Not every person is going to want to feed his or her pet food from the table; not every person is going to have the time or inclination to prepare food. After all, many Americans, for a variety of reasons, don't even feed themselves very well, much less their four-legged companions. In addition, there are situations where even the most diligent of pet owners, those committed to the healthiest foods, find themselves, say, on a road trip with a hungry dog on board, at which point, lacking homemade provisions iced in a cooler, the passing supermarket might provide a couple of cans of acceptable food that'll suit Bowser in the backseat just fine. * * * Q: I have a busy young family and we travel a lot. We love to bring our Labrador with us. In a pinch, can you recommend any fast-food or drive-thru food that would be safe for our pet, since we often rely on that for ourselves? A: No problem giving the dog a filet of fish (if possible, remove some of the coating). It's okay to feed a plain burger, leaving off the bun and the fixings. Chicken is fine in strips or pieces, again removing the coating if possible. * * * ## Reading the Label Commercial pet food does have labeling requirements, all of which are contained in the annually revised official publication of the AAFCO. Although the AAFCO cannot be said to regulate the pet food industry, it does provide standards that pet food makers are expected to follow. If you are currently feeding your pet from a bag or a can, I strongly recommend that you read the label, regardless of whether you plan to stick with commercial pet food or to transition to another feeding regimen. But before you get to the label, just look at the container itself. A lot is evident right there. The name of the food: This provides the first indication of the food's content. If it says "All Beef" or "100% Chicken," the product cannot contain more than that one ingredient (aside from water and trace amounts of preservatives and condiments such as salt or onion powder). Style of food: Products labeled Dinner or Recipe or Entrée or Platter are bound by the AAFCO's "25% Rule," which applies when an ingredient constitutes at least 25 percent of the weight of a wet product or at least 10 percent of the dry matter. A combination of ingredients (beef and lamb) included in the product name is permissible when each ingredient constitutes at least 3 percent of the product weight, excluding water weight. If any product makes a point of saying With Chicken or With Lamb, the "with" ingredient must amount to at least 3 percent of the food by weight. Flavors: If a pet food is labeled as having a certain "flavor"—say, Chicken Flavor—the product itself need contain only a very small extract of chicken, or may even contain an artificial chicken flavor. It need not contain chicken itself. Life stages: Choosing the proper food got even more challenging when manufacturers started labeling their foods as being suited for certain life stages, such as puppy or kitten, large adult or senior. According to the AAFCO, the body that governs the standards for pet-food labeling, there are only two true designations: puppy and kitten. These formulas generally have more calories and protein. Products labeled for older cats and dogs generally are no different from regular adult formulas. "Lite" formulas can be misleading. Many labels don't display calorie breakdowns. If you want to know the calorie count, contact the manufacturer. A pet food can claim to be "light" or "lean" only if it meets the AAFCO's standard definitions for these terms. These definitions differ for dog and cat food and also depend on the moisture content of the food. The words "light," "lite," and "low-calorie" all have the same meaning. The words "lean" and "low-fat" also mean the same. But "fewer calories" and "reduced calories" mean only that the product has fewer calories than another product, and "less fat" and "reduced fat" mean the product is less fatty than another one. * * * Myth Vegetables will give my dog or cat diarrhea. The Truth: It is a good idea to slowly introduce some vegetables into your pet's diet; veggies provide needed roughage and many excellent vitamins. Tip: Slightly steaming raw vegetables in gingerroot will not only make the veggies more palatable, but can help release some vitamins, such as the lutein in tomatoes and the Vitamin A in carrots. However, some vegetables (onions) are verboten. * * * Ingredient Labeling The ingredient list itself holds the key to what's actually in that pet food from a bag or can. Ingredients are listed in descending order of weight. As we know, pets need protein, carbohydrates (grains, vegetables), fat, minerals, and vitamins. But what they need most (cats somewhat more than dogs) is protein. The protein used in pet food comes from a variety of sources. When cattle, swine, chickens, lambs, or other animals are slaughtered, lean muscle tissue is trimmed away from the carcass for human consumption, along with the few organs that people like to eat, such as tongues and tripe. About fifty percent of every food animal does not get used in human foods. Whatever remains—head, feet, bones, blood, intestines, lungs, spleen, liver, ligaments, fat trimmings, and other parts not generally consumed by humans—is used in pet food, animal feed, fertilizer, industrial lubricants, soap, rubber, and other products. These "other parts" are known as "by-products." Meat: When a label says "meat," it is referring to muscle, whether of mammal, poultry, or fish. Although it may be accompanied by fat, sinew, skin, and nerve, it comes directly from the slaughterhouse and has been somehow processed, though not rendered. * * * Q: Should dogs be allowed to chew bones? A: Bones are fine if they are fresh and raw, with the exception of chicken and fish bones, but never give cooked bones of any kind. The marrow from a fresh, raw bone is good for the dog or cat, but too much can cause diarrhea. Scoop some of it out for another day. * * * Meat by-product: The thing to look out for in commercial pet food is "meat by-product." According to the AAFCO, "Meat by-product is the nonrendered, clean parts of slaughtered mammals other than meat." Basically, it is animal parts that are not meat; it can be lungs, kidneys, brains, spleens, intestines, blood, and livers, all of which are likely repositories for a variety of diseased tissues and contaminants. In poultry, by-product can include heads and feet. You seldom see fish by-product, but see below for fish meal. Some people argue that, because a carnivorous prey animal, cat or dog, would be accustomed to eating plenty of "meat by-product" (hair, feather, hooves, intestines, waste matter), there is no cause for alarm. True, if you could trust that all commercial meat by-products were healthy. But the origin of much of this meat by-product in commercial pet foods—zoo animals, euthanized pets and horses, often old and diseased animals—makes meat by-product a less than welcome ingredient. Meat meal: Meal, like by-product, is an iffy proposition in your pet food. It consists of product from mammalian tissue, such as blood, hoof, hide, hair, and even manure. The term "meal" means that these materials are not used fresh, but have been rendered. Other protein sources: Some of the other sources of protein you don't want to know about, but you must if you take seriously the notion of buying commercial pet food. According to the AAFCO, these might very well be part of the protein component in your pet food: hair, spray-dried animal blood, dehydrated food waste (food garbage picked up from restaurants, etc.), dried paunch products (stomach contents of slaughtered cows), and dried swine waste. Vegetable protein: Most dry foods contain a large amount of cereal grain or starchy vegetables to provide texture. These high-carbohydrate plant products also provide a cheap source of "energy"—the rest of us call it "calories." Gluten meals are high-protein extracts from which most of the carbohydrate has been removed. They are often used to boost protein percentages without expensive animal-source ingredients. Corn gluten meal is the most commonly used for this purpose. Wheat gluten is also used to create shapes like cuts, bites, chunks, shreds, flakes, and slices, and as a thickener for gravy. In most cases, foods containing vegetable proteins are among the poorer quality foods. * * * Q: I am a strict vegetarian (vegan) who owns two dogs (rescues). I feed them primarily vegetarian organic dry food and soy-based fake meats, which they love. Is this safe? They seem happy and healthy. A: It is not a good idea to impose your vegan ways on any carnivore; soy products are not well digested by dogs and can cause bloating. * * * Animal and poultry fat: The unique, pungent odor you smell when you open a new bag of dry pet food—that's the smell of rendered animal fat, or vegetable fats and oils often deemed inedible by humans. These fats are sprayed directly onto extruded kibble and pellets to make them more palatable. The fat also acts as a binding agent to which manufacturers add other flavor enhancers, such as "animal digests" made from processed by-products. Preservatives: Dog food companies are making moves to get away from using artificial preservatives. Chemicals used as preservatives, such as BHA, BHT, and ethoxyquin, have been under scrutiny, and many companies are switching to natural preservatives like Vitamin C (ascorbate), Vitamin E (tocopherols), and oils of rosemary, clove, or other spices to preserve the fats in their products. Potential contaminants: Given the types of things manufacturers put in pet food, it is not surprising that bad things sometimes happen. Ingredients used in pet food are often highly contaminated with a wide variety of toxic substances. Some of these are destroyed by processing, but others are not. Bacteria: Slaughtered animals, as well as those that have died because of disease, injury, or natural causes, are sources of meat, by-products, and rendered meals. An animal that died on the farm might not reach a rendering plant until days after its death. Therefore, the carcass is often contaminated with bacteria such as salmonella and E. coli. Pet food manufacturers do not test their products for bacterial endotoxins. * * * Myth Raw eggs are bad for pets. The Truth: Although egg white contains the glycoprotein avidin, which blocks uptake of biotin, a nutrient essential for healthy hair and skin, the yolk supplies more than enough biotin to compensate, so eating whole, raw eggs is okay. Raw eggs are a wonderful source of protein, vitamins, and minerals. A meal a week with eggs is a must. * * * Chemicals: Because sick or dead animals can be processed as pet foods, the drugs that were used to treat or euthanize them may still be present in the end product. Penicillin and pentobarbital are just two examples of drugs that can pass through processing unchanged. Antibiotics used in livestock production are also thought to contribute to antibiotic resistance in humans. Mycotoxins: Toxins from mold or fungi are called mycotoxins. Modern farming practices, adverse weather conditions, and improper drying and storage of crops can contribute to mold growth. Pet food ingredients that are most likely to be contaminated with mycotoxins are grains such as wheat and corn and fish meal. How Is Pet Food Made? The vast majority of dry food is made with a machine called an extruder. First, materials are blended in accordance with a recipe created with the help of computer programs that provide the nutrient content of each proposed ingredient. For instance, corn gluten meal has more protein than wheat flour. Because the extruder needs a consistent amount of starch and low moisture to work properly, dry ingredients—such as rendered meat and bone meal, poultry by-product meal, grains, and flours—predominate. The dough is fed into the screws of an extruder. It is subjected to steam and high pressure as it is pushed through dies that determine the shape of the final product, much like the nozzles used in cake decorating. As the hot, pressurized dough exits the extruder, it is cut by a set of rapidly whirling knives into tiny pieces. As the dough reaches normal air pressure, it expands or "puffs" into its final shape. The food is allowed to dry, and then is usually sprayed with fat, digests, or other compounds to make it more palatable. When it is cooled, it can be bagged. Semi-moist foods and many pet treats are also made with an extruder. To be appealing to consumers and to keep their texture, they contain many additives, colorings, and preservatives; they are not a good choice for a pet's primary diet. Wet Food or Dry? Wet or canned food begins with ground ingredients mixed with additives. If chunks are required, an extruder forms them. Then the mixture is cooked and canned. The sealed cans are then put into containers resembling pressure cookers, and commercial sterilization takes place. Some manufacturers cook the food right in the can. Wet foods are quite different in content from dry or semi-moist foods. Although many canned foods contain by-products of various sorts, they are "fresh" and heavily processed (and they are often frozen for transport and storage). Wet foods usually contain much more protein, and it's often of a little higher quality, than dry foods. They also have more moisture, which is better for cats. They are packaged in cans or pouches. Some Rules of Thumb for Commercial Pet Food Users If you are going to buy commercial pet food, here are a few rules to follow: 1) Look for certification by the AAFCO. According to the FDA's Center for Veterinary Medicine, "An AAFCO nutritional adequacy statement is one of the most important aspects of a dog or cat food label." As I said, the AAFCO's independence as a consumer protector is not pristine, but this is the minimum you should require of your commercial pet food. 2) Look for meats that are human grade. The designation "USDA" means the product is approved for human consumption. Better yet, look for meat labeled "organic" otherwise, the product is likely to contain hormones, growth stimulants, and antibiotics and/or may come from diseased and decayed animal flesh that just might even be cat or dog. 3) For cat and dog food, "meat" should be the first item listed. And skip anything that says "by-product." Remember: Preservatives: Look for natural preservatives—Vitamins C and E have strong preservative qualities. Stay away from BHA, BHT, and ethoxyquin. Fish: Don't buy any pet food with fish in it that has a shelf life longer than six months. And watch your expiration dates! Grains: Look for whole grains (barley, rice, oats); no "hulls." Fats: Avoid anything that lists "animal fat." The fat source should be specific: beef, chicken, etc. Carbohydrates: Skip "beet pulp" this is an artificial stool hardener and too high in sugar. * * * Q: I have a very friendly dog and everyone in the neighborhood seems to give him treats and biscuits, which he is happy to eat. Is this dangerous, especially in light of the pet food recall? A: I would be careful allowing the neighbors to feed your pets. Many treats have also been recalled. * * * Finally, if you must use commercial pet food over any length of time, change brands periodically (but slowly). Many experts say that this will ensure that any nutrient deficiencies in a particular food won't have long-term effects. Also, alternate between dry food and canned. Canned food is generally better nutritionally than dry food because it contains fewer grain ingredients and fewer preservatives, and canning itself is a preservative process. Dry food can offer some minimal dental benefits for some animals for whom wet food causes problems. Find three or four foods your pet likes and alternate among them. ## Table Scraps: The Do's and Dont's How about table scraps—human food—as a supplement to a commercial diet? In a household that primarily feeds its pets run-of-the-mill commercial pet food, table scraps may well be the healthiest fare the pet eats, whether a slice of ham or a few green beans from the dinner table or a handful of popcorn in the family room. Unfortunately, feeding our pets human food has fallen into disfavor, not so much for dietary reasons as for behavioral ones: a begging dog or a cat sauntering up to the gravy boat is not our idea of animal etiquette. That is not to say that feeding your pet table scraps is sufficient as a method of providing balanced nutrition. But when you consider that much of what constitutes good nutrition for the mammalian pet is also good nutrition for the mammalian pet owner, you will realize that there are great opportunities right in your own kitchen that will help both parties: the pet will eat better, and the pet owner gets to economize. As for aiding and abetting a begging attitude, never feed your pet at the table (or under it). Table scraps should supplement regular food at regular feeding times in the good old bowl, but should never account for more than ten percent of what the pet eats. And don't give your pets the idea that the dining room table is their own feeding platform. * * * Q: Do dogs and cats have food allergies? If so, how do we know, and what do we do about it? A: Allergic reactions can present themselves in many ways: vomiting, diarrhea, skin eruptions, swelling of the paws or ears, watery eyes, scratching, or biting. Try to isolate the culprit by withholding certain ingredients one by one and monitoring the condition. * * * What Scraps Can I Feed My Pet? Your dog or cat can eat most of the things a human would normally eat, but not all things. Here's a list: Meat: Yes, but limit giving the skin of poultry. Make it a special and infrequent treat. Chocolate: No. Chocolate contains theobromine, natural in the coca plant, harmless to humans but neurotoxic to dogs and cats in sufficient quantities. One Hershey's Kiss won't be a threat to most pets; a square of Baker's chocolate could be serious. Onions: No. In significant quantities, onions can cause hemolytic anemia. Look for watery eyes in cat or dog as a sign that someone got into the onion sack. Garlic: No. Although it is not particularly harmful to the pet, it is in the onion family, so excessive use is not a good idea. Grapes and raisins: No. Animals have died from eating grapes and raisins, though no one knows why. Bones (cooked): No. Bones are good only if raw. Cooking not only takes out many of the nutrients from the bone, but makes it dangerously splintery. A raw bone has enough moisture in it to keep it from being reduced to sharp shards that could be injurious. * * * Q: What human foods are bad for dogs? A: Chocolate, onions, raisins, grapes, soy products, citrus. * * * Dairy products: Many milk products can cause gastric distress in dogs and cats. Fermented-type milk products, including yogurt, kefir, buttermilk, and cottage cheese, are okay, and can be an excellent source of calcium and protein. As for cheese—it's not as bad as milk, but you should avoid the processed cheeses. A little parmesan sprinkled on the pet food is a great idea; it has lots of protein per ounce (ten grams) and is very delectable to cats and dogs alike. * * * Myth Introduction of healthy food will give my pet diarrhea. The Truth: Although a looser stool may result as you introduce healthier food to your pet, this is for two very good reasons: (1) your pet is ridding itself if old toxins during the changeover, expelling all the chemicals and preservatives that have built up; (2) healthy food does not contain the artificial stool hardeners, like beetroot and tomato pomace, that commercial foods employ to make pet owners believe their products are healthy. They are not. * * * Legumes and nuts: Yes. Both are good for cats and dogs in small quantities. Nuts should be ground and legumes well cooked, not raw. Soy products: No. Pets can't utilize the amino acid complex from soy. You will find a lot of soy in commercial pet food because it is a cheap and plentiful protein source; it just happens to be useless to a dog or cat. It is not terribly harmful, but it may cause gas in some pets. A little tofu or some soy sprouts won't hurt your pet, but it won't do them much good either. Potatoes: Yes and No. White potatoes have little or no nutritive value for a dog or a cat, but they're not harmful. Sweet potatoes are another story: they have more fiber, and the Vitamin A that makes the tubers orange is excellent. Potatoes should be well-cooked. Do not give dogs raw potato skin peelings. Bacon: No. It's full of nitrates. Pan drippings: No, not in quantity. Chicken and turkey pan drippings can lead to pancreatitis. (Drizzling a little over your pet's bowl—just a little—will do no harm. Just don't set down the pan in front of her.) Cereal: Yes and No. No to sweetened cereals. Whole grain cold cereals are excellent, as are oats, which must be cooked. Uncooked grains can soak up too much moisture once eaten. Fruit: Yes and No. No citrus: it's too acidic (though a little orange might be tolerated). Apples, pears, bananas, melons, peaches, and dried fruits are very good. Bread: Yes and No. As with humans, white and refined flour breads are close to zero nutritionally, but they aren't harmful. Whole grain or seeded breads are better; they're full of excellent fiber. Cookies: No. Sugar is not good for pets; artificial sweeteners are worse. Stay away from candies and cookies that contain sugar or artificial sweetener. Raw vegetables: Yes, but be sure they are fresh and chopped. Some people recommend juicing; if you don't mind, go ahead. But will your pet eat it? Not all do. * * * Helpful Hint Spicing or flavoring: Flavoring with a little meat broth or an herb such as ginger, may be the trigger to get your pet to enjoy vegetables. * * * ## Homemade Pet Food: Pros and Cons The major arguments against homemade pet food are economic, dietetic, and pragmatic. That is, it's too costly, it's not healthy enough, and it's impractical. None of these arguments can withstand scrutiny, except perhaps the last. Who am I to say what is possible or practical for any given pet owner? There are many reasons why cooking for an animal just won't work for some people: their own health, their schedule, their orientation toward cooking of any sort. * * * Q: What human foods are bad for cats? A: Chocolate, onions, raisins, grapes, soy products, citrus. * * * But I can say from experience (which jibes, I believe, with common sense) that offering your dog or cat a homemade menu is not more expensive than going the commercial route if—and this is a crucial if—you are interested in feeding your pet well. Low-rent commercial dog food indifferently fed, with little concern for the dog's well-being, is no doubt easier on the pocketbook than more expensive food of any sort, whether commercial or home-prepared. But let me see your vet bills. You pay one way or the other. Or your pet does. * * * Q: I cook for my dog. What vitamins and minerals should I add to his diet of human-grade food? A: I suggest a top-quality fish oil capsule, a probiotic, and a multivitamin/mineral formulated for your pet from Standard Process (Wisconsin). * * * Let me stress this: The ingredients for preparing pet food at home can be purchased cheaply. Yes, you should get organic meat; yes, it should be free-range. Yes, you should get vegetables in season (though frozen are okay), and fresh fruit, and whole grains, and high-quality vegetable oils, and supplements from good companies. But you needn't always go top end. And aren't chicken necks and wings and thighs fairly cheap? Isn't oatmeal cheap? Aren't apples and celery cheap? Yogurt won't break the bank. I feed six adult pedigreed dogs for six weeks on about $300. That's $50 a week, dinner and breakfast and snacks—for six. For one dog, that's less than $10 a week. Think about what you spend (you commercial pet food buyers) on canned and bagged food per week. Can it be much less than this? As for the dietetic argument, that's the one that commercial pet food companies like to hear. But in truth, it is an argument also made by the American Veterinary Medical Association. In fact, the AVMA is against all kinds of human food: "Table scraps should definitely not be a part of your pet's diet," says AVMA President Roger Mahr. "Gravies, meat fats and poultry skin can readily cause stomach and intestinal upsets, and even lead to a life-threatening condition called pancreatitis in dogs. Bones will splinter when chewed and cannot be digested by the animal's system. Chocolate can be poisonous to them, but it tastes good so pets will eat it if they have the opportunity. Dark chocolate used in baking is particularly dangerous to pets, and xylitol—a common sweetener in baked goods—has been linked with liver failure and death in dogs." To which I say to my readers, as I did above: Be intelligent. Don't feed them chicken skin and fat drippings and chocolate and cooked bones. * * * Q: My dog is a fussy eater and is on prescription dry food for his sensitive stomach. I often mix a little bit of peanut butter or plain yogurt into his food to make it more appealing to him. Is this safe? A: Peanut butter is hard to digest, and unless it's organic with no salt or sugar added, I would avoid it completely. A full-fat plain yogurt is a great addition. * * * The AVMA also contends that pet nutrition is so vastly complicated and implies that the commercial pet food industry is so on top of these complicated issues that an intelligent person cooking at home can't possibly match what's in the can, pouch, or bag from the supermarket. To which I say: Get thee to a rendering plant. The AVMA's advice—no table scraps, no homemade food—makes sense only if a pet owner cares to know nothing about what his or her pet needs. A diet of indiscriminately offered human food is no good, and could be worse than commercial pet food. But the point of this book is to educate the pet owner so his or her efforts in the home kitchen are more than a match for the heavily processed commercial food, which is prepared with shelf life and profit margins in mind. Tips on Feeding the Homemade Diet Cook the meat. I am against raw food in general, because of some complications that I will get to in a subsequent section. The risk of bacterial infection is too high, and the consequences too dire, not to cook meat. However, small bony portions of chicken, for example, can be quickly submerged in boiling water to kill any possible skin bacteria but without cooking the bones excessively. Grains should be cooked. Uncooked grains can swell in the pet's stomach, and can also be passed without yielding nutritional benefit. Vegetables should be steamed or served raw. Always chop or slice vegetables or run them through a food processor. Oils should be refrigerated. This is especially true of safflower, sunflower, olive, and the more expensive flaxseed and sesame oils. A teaspoon of oil atop the pet food serving will help maintain a lustrous coat and clear skin. Fruit should be chopped. Apples, pears, watermelon, and berries are all good for your pet and rich in vitamins. ## Why Raw Food Diets Failed Let's look at why raw food diets for pets caught on for a while. First, cats and dogs were once avid predators. Several thousand years ago, they ate all their meals raw, and certainly as recently as a hundred years ago they ate raw prey to a considerable extent. So raw food is not anathema to a dog's or a cat's instincts, taste buds, or digestive system. Second, a study by Frances Pottenger, in which cats were fed a diet of raw meat and bone, cod liver oil, and raw milk, had no significant health problems through three successive generations, compared to three variant control diets involving cooked meat, pasteurized milk, and even sweetened condensed milk. The control group, on the other hand, experienced a host of health and reproductive problems. The study lasted 10 years and involved 900 cats. Pottenger (1909–1967) was a California M.D. whose principal research involved tuberculosis; his original observations about pet diet stemmed from TB experiments he was running on cats. "Pottenger's cats" are cited often in the raw food community as a scientific basis for the wisdom of feeding only raw food. Third, raw food is good for pets, relatively speaking. Compared to much of the commercial pet food available, it offers something processed food delivers poorly: bioavailable nutrients and crucial enzymes that are killed by rendering and drying. Now, let's look at why raw food diets failed. In the main, I attribute the decline in the popularity of the raw food diet to the strictness of its regimen, the zealotry of its promotion, and the ick factor. For example, raw food diet enthusiasts insist that the intricacies of its execution must be exactingly followed. Consider these instructions, from a typical pro-raw website, on determining serving size: Multiply your dog's weight by 16 to get the number of ounces he weighs. Multiply that by .02, which gives you 2% of his body weight. Multiply that by .6 to give you the weight of RMB you should feed. That is, chicken necks, wings, backs etc. Go back to the 2% of his body weight again and multiply that number by .4 to get the weight in ounces of vegetable patty mix you should feed. The raw food diet also discourages feeding any grains, discourages "contamination" by snack or kibble; and requires extra digestive enzymes to help the pet process the raw food. As for zeal, the raw food folks are a bit much. So keen are they on the concept "raw" that they will even accept a total vegetarian diet (puréed raw veggies), which shows, in my view, a reckless disregard for what cats and dogs need: animal protein and animal-source vitamins and minerals. The ick factor comes in when you find yourself handling pounds and pounds of raw chicken and beef and grinding the offal—organ meat, such as liver, kidney, heart—into "veggie patties." There is also the unfortunate period of adjustment that any pet would have to make to raw food, filled with gastric distress requiring uncomfortable spells of enforced fasting. And let's not get into the fecal lowlights of said transition. The nickname for the raw food diet is BARF: bones and raw food. The name tells you a lot. As I have already indicated, and will reiterate, I do not recommend anything close to a raw food diet. Yes to raw bones, a must; yes to occasional bits of raw meat and very lightly cooked chicken. But cooked grain is an essential component, as are vegetables, raw and lightly cooked (carrots are healthier when cooked). In addition (without being an alarmist, which I am not), a steady diet of raw meat and bone seems to improve the slim chances of salmonella or trichinosis invading your pet's system. Why flirt with that? ## Mixing Commercial Food with Table Scraps and Homemade Cookin' If you find it more convenient to have commercial pet food as part of your pet's diet, by all means do so. If you can't bring yourself to deny your pet some food from the table, don't feel guilty—just give him the good stuff and not the bad. But I strongly recommend that you prepare the bulk of your pet's diet yourself. It is safe, nutritious, and inexpensive. And it can be fun. Acceptable Commercial Foods In my experience, there are two pet food companies whose products for cats and dogs I recommend as a component of a mixed-source diet: Flint River Ranch, out of Roswell, Georgia, and Nature's Logic, of Lincoln, Nebraska. Neither of these companies, I might add, were cited in the extensive recall of this spring. Flint River double-bakes its pet food, which, unlike the high-heat steam process used by most other commercial pet food operators, keeps in many of the basic nutrients while making other nutrients—especially in the grains—more bioavailable. Flint also uses human-grade meats. They make food canned and dry, for both cats and dogs. Nature's Logic also stacks up well and offers such complex and varied animal sources as rabbit, duck, and salmon, in addition to beef and chicken. Each of these companies avoids chemical preservatives, and Nature's Logic also avoids using any chemically synthesized vitamins or minerals. Although both are more expensive than most other commercial pet foods, for my dollar this is the way to go if you must have some ready-made food to supplement your home-cooked diet and to take with you on the road with your pets. The Table Scraps When you are cleaning up after your own dinner, think like your cat or dog for a moment. Take a look at what's left over and consider if a portion of that might not only be a delectable treat for the furry one, but something that will add to his nutritional roster of things he needs. Uneaten cubes of squash, a bit of the roast, a heel of the whole wheat baguette, the slab of uneaten fried egg—these things, your pet would like you to know, would look great in that very special bowl on the floor. The mother lode of the diet, of course, is what you make yourself. In Part Three of this book I hope to help you with that by providing easy recipes and dollops of encouragement. ## part three ## Home Cooking Recipes ## Know Your Breed Before I get to the home-prep recipes I recommend, it is important for you to take a moment to consider just what kind of dog or cat you have. This will help you hone your instincts as to what makes sense for your pet. The breed of your dog or cat can tell you a lot about its needs. It can tell you what diet, climate, and kinds of activities it is accustomed to. It may tell you what behavioral attributes you can expect to be foregrounded in its manner; it can tell you how long you might expect it to live, what kinds of diseases or maladies it might be prone to; it might tell you what you should do and should not do, feed and not feed. ## For Dogs The American Kennel Club divides breeds into seven groups: Herding Working Sporting Non-sporting Terriers Toys Hounds Although generalizing is, by definition, an inexact science, these AKC groupings are based on a lot of wisdom. These groups are not organized by incidental dog attributes, say, size or shape or color or length of hair. Their organization is based on the dogs' origins and breeding histories, which are very much tied up in what kinds of life these animals are not only used to, but built for. It is good to familiarize yourself with these divisions, though, as you will see, when it comes to drawing inferences relevant to feeding, there is a second, somewhat more useful way to organize the canine world. * * * Fun Facts Cats have 244 bones. Dogs have 319 bones. Humans have 206 bones. Now you know why pets need calcium. * * * The AKC Way The Herding Group These wonderful doggies, until about twenty years ago, were part of the AKC Working group. They are basically the collies, sheepdogs, and shepherding animals. They are very intelligent and responsive to training. For the most part, these breeds originated in northern Europe, mostly the British Isles. They were raised on farms that had livestock. Their diets, like any dog's, requires a lot of animal protein. But because of their long hair (think collie) or thick fur (think German shepherd), they also require, and benefit from, plenty of high-quality fats. The Working Group These are the very strong and physical dogs, bred to perform such jobs as guarding property and pulling sleds. Akitas, malamutes, Great Danes, Bernese mountain dogs, boxers, bullmastiffs, Doberman pinschers, and rottweilers are some of the dogs in this group (as is that first dog I saw so long ago, my Great Pyrenees!). You can bet that these dogs were well fed, since, as working animals, their energy and strength was essential to their function. Sources of high protein like kidney and liver and sources of iron and calcium like raw bone and green vegetables would be central to their diet. The Sporting Group This companionable set of dogs, if working at all, was probably involved in either a human leisure activity or a less taxing job assignment. The group includes retrievers, spaniels, setters, pointers, and the Weimaraner. These dogs would be less accustomed to diets high in animal protein and would have a lower calorie requirement. Grains would be an essential part of their diet—or should be—though, to the extent that they are not being pushed extremely hard physically, one should be careful not to overload with carbohydrates, else the animals get fat. The Non-sporting Group Think puffy, cute, pretty, small, alert, active, fierce, muscular. Sound confusing? The Non-sporting group is very diverse—and this is where you begin to see how the AKC grouping falters in its applicability to our concerns about what to feed. Everything from the American Eskimo dog to the Lhasa apso is in this category, which also includes some spaniels (Tibetan), some terriers (also Tibetan), the poodle, the dalmatian, bulldogs, and spitzes. The variations in coat, size, personality, and origins make this group difficult to project dietetically. The Terrier Group This is a much more distinctive and unique group, with wiry coats, smallish in size (except the Airedale), self-possessed in spirit. The group includes many familiar breeds: Norwich, Kerry blue, Norfolk, Scottish, and cairn. And, of course, that dearest to me: the Bedlington. The terriers' intelligence makes them quite engaged with humans. Ancestrally, almost all terriers were what I call "ratters"—they hunted vermin. You will see the dietary implications below. The Toy Group The toys, as the name suggests, are small and fun. According to the American Kennel Club, the function of this group is "to embody sheer delight." You may wonder about that if a Chihuahua gets irked, but toys have been bred for nothing other than their conveniently-sized packages of companionability—whether Pekinese, Pomeranian, pug, poodle (again, across groups), shih tzu, or the Italian greyhound. These are delicate dogs, far removed from work or hunting. Their hyperactivity keeps them quite calorie hungry, but because of their size, their dietary needs are about the same as a cat's. The Hound Group These dogs hunt by sight or sound. They can make a lot of noise; they generally have good stamina, sleek coats, and a lot of strength. They range from the well-known beagle, dachshund (its own group, by the way, in Europe), and bloodhound, to the more exotic Afghan hounds, Scottish deerhounds, and salukis. These dogs are used to a lot of activity outdoors, and they thrill to the sights and smells of certain prey. These are meat eaters and bone eaters. Not that you'd forget. The Pet Food Nation Way As helpful as the AKC designations are in separating dogs by type, you may note that certain breeds might appear in different groups; the poodle, for example, is in both the Toy and the Non-sporting group; spaniels can be found in the Sporting as well as the Toy group. A more helpful organization is the following. This is how I see the landscape of dog breeds: Hunting dogs Northern working dogs Toys Sight hounds Mountain dogs Herding dogs Working dogs Dachshunds Other hounds * * * Fun Facts A Dog's Life A dog's heart rate ranges from 70 to 110 beats per minute. Breaths per minute: 10 to 30 (panting). Average body temperature: 101.5 (same as a cat's). * * * Hunting dogs include Labradors, retrievers, and standard poodles (yes, they were originally hunters), along with some working water dogs, such as Newfoundlands, water spaniels, and the Portuguese water dog. They traditionally ate chicken, trout, salmon, duck and other water fowl, and geese. Occasionally they had oats or barley and predominantly ate potatoes and green beans as their vegetables. Apples would be their most likely fruit. Northern working dogs are huskies, malamutes, and Samoyeds. They ate mostly fish, salmon, and sardines and occasionally elk, venison, and buffalo. They would likely have eaten potatoes but probably no grains. Toys or other small companion dogs and Tibetan breeds ate fish and chicken, some lamb, plus local vegetables and brown rice, possibly millet. Sight hounds—greyhounds, Afghans, wolfhounds, salukis, and deerhounds—all ate rabbit, venison, and poultry as well as local vegetables, including potatoes. Apples were a likely fruit; brown rice, whole barley, oats, and bulgur wheat would have been the grain sources. Mountain dogs—rottweilers and northern district terriers (West Highland, Scottish)—ate lamb, chicken, and rabbit with wild parsley, carrots, and potatoes, as well as oats and barley. Herding breeds like collies, shelties, corgies, and lowland (or Lake District) terriers ate cod, salmon, halibut, some lamb, and chicken. Peas and carrots were the common vegetable, along with potatoes. Oats and barley would have been their mainstay grains. Working dogs such as German shepherds, Dobermans, schnauzers, Great Danes, Old English sheepdogs, and borzoi hounds ate beef and lamb, cabbage, and greens with oats and barley. Dachshunds' diet was similar to the lowland terriers'. This group includes Airedales, Staffordshires, Yorkshires, and Norfolks. Other hounds—beagles, foxhounds, and bassets—ate lamb, chicken, and rabbit with parsley, carrots, and potatoes as well as oats and barley. As for mixed breeds, your guess is as good as mine—probably better than mine, if you own one. If you do have a mutt of mixed breed, try to determine what the predominant breed is. You can count on one thing: it probably has the best traits of all its mixed ancestors and is probably more adaptable, dietwise, then its purebred brethren. ## For Cats A member of our good old Felis sylvestris catus species, today's domesticated cat is born with a predisposition to develop bonds with humans. But as cat lovers (and haters) know, the cat is an independent force—temperamentally, of course, but its independence runs even more deeply. A domesticated cat can return to a feral, semi-wild state and not only survive there, but even reproduce. The cat's dietary system works in high gear all of the time; it has stringent dietary requirements. Unlike dogs and humans, cats cannot turn off enzymes. They are in a constant state of glucogenesis. Felines cannot survive on a vegetarian diet, and they get almost all their water from food. It is hard to get a cat to drink. Cats function at a high metabolic rate, so their need for protein is great. A grain-based diet, as our commercial pet foods generally are, presents a real challenge to the cat. Cats need taurine (available only from meat protein), arachidonic acid (found only in animal tissue), and preformed Vitamin A. * * * Fun Facts What's that purring sound? A cat's normal body temperature in 101.5. Heart rate is 110 to 180 beats per minute. Respiratory rate is 30 to 50 breaths a minute, nearly 4 times the rate of humans. * * * Although cats were long ago kept for utilitarian purposes as vermin control, they have since overwhelmingly been bred for their companionability and appearance—that is, their color and markings. Cats today break down into four classes, which are hard to classify as to actual geographic origin. This is because, as principal rat catchers, cats were often aboard ships that stopped at many ports around the world. Short-haired breeds Long-haired breeds Rex Spotted Short-Haired Breeds This group includes the Abyssinians, the Siamese and Oriental shorthairs, the tailless Manx cats, and the British, European, and American shorthairs, which are basically your common cat. A "domestic short-haired cat" has no pedigree. Long-Haired Breeds The long-haired cats include the Maine Coon cat, Persian cats, and the Angora, among many others. The Persian is probably the oldest of these, and is the most popular pedigreed cat in the United States. It is docile, gentle, and relatively inactive. It should be fed carefully, and fats and carbohydrates should be kept to a minimum. The Maine Coon cat is the second most popular longhair in the United States. It is a large cat, with long legs and a soft, profuse coat and is very hardy, athletic, playful, and amiable. Rex These are the cats that some believe came from somewhere else—like outer space. Actually, they come from two places in England, Cornwall and Devon. They have a distinct, pixie-like head, and their coats are mostly downlike. Spotted Cats These cats are most often the result of elaborate breeding. Consider the ocicat, a spotted cat that resulted from the interbreeding of Abyssinian, Siamese, and American shorthair. It is the only spotted domestic breed selectively bred to emulate the look of the cats of the wild: a big, active animal with an athletic appearance. It is well-muscled, and its satiny fur shows off both its muscles and its ocelot-like spots to great effect. Spotted cats can be the ultimate in finicky, which means: give them what they want—they're beautiful. The domestication of the cat has been so short (4,000 years) compared to the dog (perhaps 15,000 years), that cats, regardless of type—whether longhair, shorthair, rex, or spotted—pretty much eat the same thing. Come back to me in 11,000 years and there may be more variation, but right now, you feed a Manx much like you'd feed a Maine Coon. And the same for everything in between. ## Basic Recipes for Dogs These are my basic recipes for a typical dog, a twenty-pound dog. If feeding a forty-pound dog, double the ingredients for their daily ration. If feeding twice daily, split the ration in half. These generic recipes will provide your dog with twenty-five to forty percent fat and meat protein. A couple of notes: I like to do my light sautéing of the animal protein—whether chicken, turkey, or hamburger—as well as some of the veggies on occasion, in organic coconut oil. It has no trans fats, even when used for frying. I also recommend that you have a good probiotic on hand as a supplement. There are several good ones on the market. The probiotic helps balance the healthy bacteria in the gut of both dogs and cats. Remember to provide plenty of clean drinking water—as much as your dog needs. I recommend digestive enzymes ("green food"), and a multivitamin mineral specifically for your pets several times weekly. Happy cooking! Cooking Ahead: A Bulk Recipe for Dogs 2 Tbsp. oil (organic oils: olive, coconut, safflower, fish oil or codliver oil) 3/4 cup water or low-sodium broth 1½ cup puréed chopped or lightly steamed vegetables 1 cup well-cooked grains (oatmeal, barley, rice, millet, quinoa, or buckwheat) 1 lb. raw meat, poultry, or cooked fish (salmon, mackerel, whiting, cod, sardines) Mix thoroughly and freeze in daily portions (2 to 3 cups for 20-pound dog). Thaw and warm before serving (do not microwave). Feel free to top with sprinkling of high-quality kibble or 1 Tbsp. of full-fat yogurt. Cooked organ meat (¼ cup) can be added several times a week. Dog Breakfast: Monday-Friday 1/8 to ¼ cup mixture of organic chicken hearts, gizzards, livers ¾ cup string beans, either fresh or frozen ¼ cup grated zucchini small handful chopped romaine lettuce heaping tsp. organic full-fat yogurt 1/8 tsp. probiotic liquid 1 fish oil capsule Very briefly sauté meat in 1 Tbsp. organic coconut oil just to warm, not to cook. Then add all vegetables and lightly sauté till their color brightens. Place in dog bowl, top with fish oil capsule, probiotic, and yogurt. Dog's Weekend Breakfast Use a duck egg or other organic chicken egg instead of meat twice a week. ¼ cup grain (brown rice or sweet potato or pasta, oatmeal, or quinoa) ½ cup string beans Dog's Every Night Dinner ½ cup boiled chicken,* which can include the chicken fat 1 cup lightly steamed vegetables: cauliflower, broccoli, cabbage, bok choy. You can add tomatoes or pumpkin as well. Dog Snack/Lunch A dog should be fed only twice a day. But I do indulge my dogs in a healthy dog biscuit at night, and if they are particularly active (and insistent), I have raw organic chicken neck handy for lunch. Dip the chicken neck in boiling water for just a few seconds. Rice and Beans ½ cup cooked brown rice ½ cup lightly cooked hamburger ½ cup well-cooked kidney beans fish oil capsule ½ tsp. calcium powder (eggshell powder; see sidebar for preparation) multivitamin/mineral for dogs Makes 2 servings (20-pound dog) You can substitute turkey or chicken for the hamburger; instead of brown rice, you can substitute cooked barley, bulgur, millet, or oats. Fish and Oats 3 cups cooked oatmeal 1 cup fish (mackerel, salmon, whiting, sardine—canned salmon or sardines are okay) 1 cup of green beans ½ tsp. eggshell powder Makes 2 servings (20-pound dog) Mainly Vegetable 1½ cups cooked bulgur or whole wheat couscous 2/3 cup chicken, fish, hamburger, or turkey ½ tsp. eggshell powder or ½ cup lightly steamed green leafy vegetable 1 cup grated zucchini (raw) or cooked cauliflower or broccoli Makes 2 servings (20-pound dog) Lite Dinner: Beef and Lentils 1 cup boiled lentils 1 cup cooked rice 2 tsp. oil 1/2 cup lightly cooked hamburger pinch of sea salt ½ tsp. eggshell powder multivitamin/mineral supplement Makes 2 servings (20-pound dog) * * * Eggshell Powder: Great Calcium Supplement This is ideal for a calcium boost. Wash and dry a dozen empty eggshells and bake at 300 degrees for 10 minutes. Grind into a power in mortar or coffee grinder. Mix ¼ tsp. into your dog's or cat's food several times a week. (If using organic eggs, no need to bake.) * * * Doggie's Sunday Fare 1½ cups cooked pasta 1/3 cup cooked millet 1 cup roasted chicken (including skin as special treat) 1 cup pureed peas and carrots ¼ cup lightly steamed carrots multivitamin/mineral supplement ½ tsp. eggshell powder Makes 2 servings (20-pound dog) Dogs with Kidney Disease Always, without exception, use the best quality protein sources for a pet with kidney trouble. I offer two recipes. Note: daily ration (2 servings) for 20-pound dog Meat and Potatoes ¼ cup lean hamburger or chicken (cooked) 3 cups cooked potato with skin 1 Tbsp. chicken fat oil pinch of sea salt 500 mg Vitamin C (Ester-C is best) 1 Tbsp. minced parsley 1/2 tsp. eggshell powder multivitamin/mineral supplement Note: if kidney stones are suspected, cut the Vitamin C dosage in half. Eggs and Potatoes 1 egg (scrambled, or hard-boiled and chopped) 3 cups boiled potato with skin 1 Tbsp. chicken fat or fish oil capsule ½ tsp. eggshell powder pinch of sea salt 500 mg Vitamin C (Ester-C is best) 1 Tbsp. minced parsley multivitamin/mineral supplement Note: if kidney stones are suspected, cut the Vitamin C dosage in half. Canine Heart Diet ¾ cup lean beef, chicken, or fish (well-cooked) 3 cups boiled potatoes with skins 2 tsp. chicken fat 1 fish oil capsul ½ tsp. eggshell powder multivitamin/mineral supplement * * * So, What's with the Chicken Fat? Cats and dogs, unless they have a severe thyroid problem, aren't prone to high cholesterol. It is perfectly fine to set aside the fat from your family's chicken and refrigerate it or cook it up lightly. Add 1 to 2 teaspoons to your pet's food. * * * Dogs with Cancer Canine Cancer Care Tumor cells rely heavily upon carbohydrates for their energy, but those cells cannot utilize fats for energy, while the rest of the body can. As such, diets with increased fat content may slow tumor growth. 1 cup lightly cooked meat with fat 1½ cup mixed vegetables 2 Tbsp. salmon oil ½ tsp. eggshell powder a pinch of sea salt multivitamin/mineral supplement Makes 2 servings (20-pound dog) ## Basic Recipes for Cats As we know, cats need protein. I recommend that 75 percent (by weight) of their diet come from animal-protein source. The recipes below are for a 10-pound cat. Notice that, for cats, I go lighter on the grains (you may leave them out completely). Cooking Ahead: A Bulk Recipe for Cats This recipe is for cooking a batch of high-nutrition food, which you can divide into single servings and freeze. When preparing to serve, do not microwave; rather, slowly warm ever so slightly on the stove. 2 Tbsp. oil (organic oils: olive, coconut, safflower, or fish oil) ¾ cup water or low-sodium broth ¼ cup well-cooked grains (oatmeal, barley, rice, millet, quinoa, or buckwheat) ¼ cup puréed raw or lightly steamed puréed vegetable (raw: zucchini, squash, broccoli, green beans; cooked: carrots, winter squash, pumpkin, yams/sweet potatoes) 1 lb. raw meat (ground turkey, chicken, lamb, buffalo, ostrich, venison) or 1 lb. cooked fish (mackerel, salmon, whiting, cod, tuna or sardines) Mix thoroughly and freeze in daily portions (½ cup for 10-pound cat). Thaw and warm before serving (do not microwave). Cooked organ meat (¼ cup) can be added several times a week. Hint: Keep a dish of fresh wheat grass handy for snacks. Add 1/8 tsp. eggshell powder daily and a feline vitamin/mineral supplement several times a week. A probiotic and enzyme powder are recommended. Cat's Breakfast for a 10-Pound Cat ¼ cup yogurt, kefir, buttermilk, or cottage cheese 1/4 cup chicken heart, liver, kidney (cooked) 1 fish oil capsule 1 Tbsp. puréed pumpkin (canned whole pumpkin is okay) 1 tsp. parsley, romaine, or spinach, chopped For the pumpkin you may substitute puréed carrots, wheat grass, chopped string beans, cucumbers, zucchini, squash, or corn. Note: Don't serve liver more than twice a week. Cat's Dinner for a 10-Pound Cat ¼ cup very lightly sautéed or boiled chicken or fish 1 tsp. greens (wheat grass, collards, spinach, parsley, etc.) 1 Tbsp. cooked potatoes, turnip, parsnip Note: Add ¼ tsp. of eggshell powder several times a week for calcium boost. Cat's Special Breakfast for 10-Pound Cat 1/8 cup cottage cheese 1 egg, lightly scrambled 1/8 cup well-cooked oatmeal 1/8 cup puréed string bean pinch of sea salt * * * Helpful Hint Nuts for Cats and Dogs: Ground nuts are an excellent source of fatty acids. Pets love the taste. Use organic unroasted, unsalted nuts—walnuts and almonds are best, but peanuts are also fine. Be sure to grind them or reduce to a paste. But no peanut butter unless no salt or sugar added. * * * Holiday Dinner for Cats ¼ cup cooked polenta or cornmeal 1 tsp. vegetable oil or salmon oil ½ cup ground turkey or chicken (cooked) 1 tsp. fresh vegetable purée multivitamin/mineral supplement 1/8 tsp. eggshell powder Makes 2 servings (10-pound cat) Cat's Mixed Grill and Pasta 1/3 cup cooked chicken 1/8 cup cooked whole wheat pasta 2 sardines 1/8 cup lightly steamed vegetable multivitamin/mineral supplement Makes 2 servings (10-pound cat) * * * Some Rules of Thumb for Cats and Dogs * Lean meats: turkey, liver, mackerel, chicken, tuna, heart * Fatty meats: roaster chicken, lamb, hamburger * High-protein grains: buckwheat, barley, bulgur, millet * Lower protein grains: brown rice, corn meal, rolled oats * High-protein legumes: red kidney beans, lentils, split peas, white or black beans (soak and cook well) * Careful: Spinach, chard, and rhubarb are high in oxalic acid, which interferes with calcium absorption. * Fruits and berries: all good, except grapes and raisins * * * * * * Helpful Hint Natural Digestive Enzymes: Herbs and grasses (parsley, romaine, wheat grass, etc.) contain enzymes to aid in the digestion. A must. * * * Cat's Hardy Meal 4 oz. canned tuna fish, salmon, tuna, mackerel 1 hard-boiled egg (chopped) 1 fish oil capsule 1/8 cup puréed vegetable multivitamin/mineral supplement Makes 2 servings (10-pound cat) For Cats with Kidney Disease A relatively low-protein diet may help reduce clinical signs of uremic toxins in the presence of renal dysfunction. Vitamin C helps flush the kidneys. If kidney stones are suspected, cut the Vitamin C dosage in half. For Kidney Care I ¼ cup cooked chicken or other lean meat ½ oz. canned clams ½ cup cooked white rice 1 Tbsp. chicken fat pinch of sea salt ¼ tsp. eggshell powder 500 mg Vitamin C (Ester-C is best) ¼ tsp. parsley For Kidney Care II 3 egg whites, hard-boiled (chopped) 1 oz. canned sardines ½ cup cooked rice 1 Tbsp. chicken fat pinch of sea salt 1/3 tsp. eggshell powder 1/8 tsp. parsley 500 mg Vitamin C (Ester-C is best) multivitamin/mineral supplement * * * Helpful Hints A test for a good fish oil: puncture a capsule, drain into a glass, and put it in the freezer. Check in 24 hours: it should be just firm enough to leave a thumbprint. If it is crystallized, it is low-quality fish oil. * * * For Feline Heart Care ¾ cup cooked chicken or ½ cup tuna, mackerel, or salmon (cooked) 1 oz. canned chopped clams 2 tsp. chicken fat or salmon oil ¼ tsp. calcium powder multivitamin/mineral supplement For Feline Cancer Care ¾ cup lightly cooked meat with fat 1 Tbsp. puréed mixed vegetables 2 tsp. salmon oil ¼ tsp. eggshell powder multivitamin/mineral supplement * * * Special Diets for Sick Pets * Arthritis: Avoid all nightshade vegetables (peppers, eggplant, potato, tomato). * Kidney or bladder stones: Avoid spinach, asparagus, dairy products, organ meats, legumes, parsley, carrots, kale, potatoes, cucumbers. No grains. * Diabetes: Serve three meals daily. Avoid fatty meats. Introduce some raw foods, as it stimulates the pancreas. Add dandelion, garlic, parsley. Feed grains. * Diarrhea: Limit water; liquid should come from broth of meat bones, well-cooked rice, canned pumpkin. * * * ## Joan's Vitamin Chart Nature makes vitamins in complete food forms. We use them as a whole, not as isolated pieces. Whole food nutrients are by and large the most usable (bioavailable) and bioactive in the body. These nutrients work together synergistically to achieve maximum biological effect. This chart shows you the essential vitamins your dog and cat need, along with their sources, their function, the signs of a deficiency in that vitamin, and the signs of an excess. This is for your general information. You should purchase a general multivitamin to give your dog or cat. This chart will help you understand the why and the wherefore of the vitamins you are providing. It will also let you know, via the natural food sources for each, which vitamins you are providing in your pet food. Nutrient & Source BIOTIN liver, kidney, egg yolk, yeast, milk, legumes Function metabolize fat, protein, and vitamin C Deficiency skin lesions, anemia, hair loss, muscle weakness, heart disease Excess nontoxic Nutrient & Source FOLIC ACID liver, kidney, yeast, leafy green vegetables Function formation of red blood cells, builds antibodies, cell division Deficiency anemia, birth defects, poor appetite Excess nontoxic Nutrient & Source CHOLINE organ meats, fish, egg yolk, yeast, wheat germ, dairy, legumes, whole grains Function fat emulsifier, nerve function and structure Deficiency fatty liver, neurological disorders, heart disease, thymus degeneration Excess diarrhea Nutrient & Source VITAMIN A fish oil, liver, eggs, dairy, dark green and yellow vegetables Function skeletal growth, epithelial tissue, immune system, reproduction, vision, nerve function Deficiency skeletal deformities, cleft palate, skin lesions, night-hyperactivity, liver damage, blindness, infection, deafness Excess liver problems Nutrient & Source VITAMIN B1 (thiamine) whole grains, meat, legumes, nuts, yeast Function digestion of carbs and protein Deficiency stool eating, anorexia, muscle weakness, CNS disturbances Excess nontoxic Nutrient & Source VITAMIN B2 (riboflavin) mill products, organ meat, eggs, green vegetables Function digestion of carbs and fats, cell growth Deficiency skin lesions, neurological disorders, shedding/oily coat Excess nontoxic Nutrient & Source VITAMIN B3 (niacin) liver, meat, eggs, dairy, whole grain, legumes Function stimulates circulation, processes amino acids, carbs, and glucose, utilization of fatty acids, aids HCL production Deficiency dermatitis, diarrhea, dementia Excess nontoxic Nutrient & Source VITAMIN B5 (pantothenic acid) liver, kidney, dairy, yeast, legumes, wheat germ, peanuts Function fatty acid synthesis, steroid production, reduces stress Deficiency premature graying, low blood sugar, Addison's disease, anorexia, reduced immunity Excess none observed Nutrient & Source VITAMIN B6 (pyridoxine) liver, meat, yeast, dairy, whole grains, egg yolk, fish Function metabolism of protein & amino acids, electrolyte balance, red-blood cell production (note: destroyed by heat) Deficiency neurological disorders, anemia, heart disease, tooth decay, dermatitis, swollen tongue, pregnancy disorder, lowered immunity Excess none observed Nutrient & Source VITAMIN B12 liver, kidney, meat, fish, poultry, eggs Function formation of red blood cells, aids assimilation of fats, carbs, proteins Deficiency anemia, impaired neurological function, fatigue Excess nontoxic Nutrient & Source VITAMIN C (ascorbic acid) citrus, green vegetables, berries, tomatoes Function formation of collagen, capillary integrity Deficiency weak bones, dental problems Excess nontoxic Nutrient & Source VITAMIN D (fat-soluble) fish liver oils, yeast, egg yolk, sunlight Function calcium & phosphorus absorption, bone growth, regulation of calcium Deficiency defective bone growth (rickets) Excess hyper-calcemia Nutrient & Source VITAMIN E (tocopherol, fat-soluble) nuts, brown rice, wheat germ, green leafy vegetables, safflower oil, whole grains, soybean, sunflower oil Function antioxidant, enhances immune system, aids healing, prevents scars, retards aging, increases sperm production Deficiency reproductive failure, muscle deformation, weakened immunity, heart disease, parasitis in cats Excess nontoxic Nutrient & Source VITAMIN K (fat-soluble) liver, green leafy vegetables Function essential to blood clotting, protein production Deficiency internal bleeding Excess anemia Nutrient & Source VITAMIN F vegetable oils: safflower, sunflower, wheat germ oil, linseed Function healthy skin and hair Deficiency skin conditions, poor coat Excess none observed ## Know Your Minerals Minerals are essential for bone formation, muscle metabolism, fluid balance, and nervous system function. Our pets ingest minerals from water and food: meat, grain, vegetables, fruit, legumes. Minerals depend on each other as well as on the presence of other nutrients in order to function; conversely, the presence of some vitamins can inhibit the absorption or metabolizing of some minerals. All minerals are absorbed in the gastrointestinal tract and eliminated through the kidneys as urine or processed and broken down by the liver or by digestive secretions. Minerals that remain—that are stored in the body—will be in bone or muscle. The macro-minerals include calcium, phosphorous, magnesium, and sulfur, plus the electrolytes sodium, potassium, and chloride. Micro—or trace minerals needed in minute amounts are iron, boron, chromium, copper, fluoride, iodine, molybdenum, silicon, manganese, selenium, and zinc. Beware: Trying to supplement individual trace elements is risky, as a pinch goes a long way. Too much becomes quickly toxic. Major (Macro) Minerals Calcium and phosphorus are necessary in a specific ratio for teeth and bone formation, storage and transfer of energy, and nerve and muscle function. An imbalance in the ratio will cause skeletal problems. Sources: Green leafy vegetables, sardines, blackstrap molasses, salmon, nuts (calcium). Fish, meat (muscle and organ), beans, poultry (phosphorus). Potassium and sodium work in tandem, maintaining fluid balance in cells for proper muscle and nerve function. Sodium deficiency is unlikely in our pets, but potassium deficiency causes muscle weakness and heart and kidney lesions. Also hypertension. Sources: Meats, poultry, fish, bananas, whole grains, sweet potato, squash, beans, dried apricots. Sodium chloride is found everywhere in the diet as "salt." Salt-induced hypertension in the dog or cat is not usually seen. * * * Fun Facts Frontloaded: On average, dogs carry 75 percent of their weight from the shoulders forward. Cats carry 75 percent of their weight from their hips backward. * * * Magnesium is found in soft tissue and bone; it interacts with calcium to provide proper muscle and nerve function and aids in the body's use of potassium and sodium. Deficiency leads to muscle weakness and sometimes convulsions. Excessive amounts in a cat lead to lower urinary tract blockages. Sources: Whole grains, green leafy vegetables, meat, beans, bananas, apricots. Sulfur is found everywhere in the body and is most highly concentrated in skin, nails, and hair. It is used for wound healing and synthesis of chondroitin-sulfate. It is easily destroyed by antibiotics killing bacteria in the intestines. Sulfur supplemented as MSM (methyl sulfonyl methane) will help with skin conditions and arthritis. Sources: Meat, fish, dairy products, eggs. Trace (Micro) Minerals Trace elements are iron, copper, zinc, manganese, iodine, selenium, cobalt, boron, chromium, iodine, molybdenum, and silicon. Although dietary requirements are minimal, they are essential to general good health. * * * Herbs and Their Uses * Aloe vera: arthritis, digestion. * Chamomile: indigestion, calmative. * Dandelion: arthritis, liver function (hepatitis). * Ginger: circulation, digestion. * Kelp/seaweed: tonic for stomach, improves pigmentation. * Milk thistle: liver tonic. * Mint: digestion. * Mullein: nerve tonic. * Nettle tea infusion: relieves itchy dander. * Slippery elm bark: relieves diarrhea. * Valerian root: calmative. * Yucca: arthritis. * * * Iron is critical for healthy red blood cells and an essential component of enzymes involved in cellular respiration. Iron from animal sources appears to be more readily absorbed than that from vegetable sources. There is some evidence that feeds high in soy products could interfere with iron absorption, leading to a recommendation that soy-based foods be supplemented with an iron supplement at a dosage higher than normally required. Sources: Beef, liver, beans. Copper is necessary in the production of melanin, the pigment that colors coat and skin, and is linked to iron metabolism. Deficiencies can cause impaired bone growth and anemia, even if iron intake is normal. Sources: Whole wheat, beef liver, nuts, seeds, shellfish. Zinc is heavily involved in skin and coat health, enzyme function, and protein digestion. Deficiencies lead to poor growth, reproductive failure, and skin lesions. Sources: Lamb, pork, liver, eggs, wheat germ, beans. Manganese is necessary for collagen formation and lipid metabolism, as well as normal reproduction. Deficiencies include reproductive failure and impaired growth. Sources: Whole grains, nuts, peas, beets, green leafy vegetables, eggs. Iodine is a component of thyroid hormones, which regulate metabolic rate. Sources: Seaweed, saltwater fish, sea salt. Selenium works with Vitamin E and is a cell membrane antioxidant. Sources: Broccoli, eggs, organ meat. Cobalt is a part of Vitamin B12. Sources: Meat and shellfish. Boron works with calcium and magnesium to build strong bones. Sources: Apples, nuts, pears, carrots. Chromium (sometimes called Glucose Tolerance Factor) is needed to metabolize glucose. Sources: Brown rice, turkey, catnip. Molybdenum is necessary for nitrogen metabolism. Sources: Liver, cereal grains, beans. Silicon is necessary for collagen formation and maintenance of flexible arteries. It counteracts the toxic effects of aluminum. It helps heal wounds and wards off skin disorders. Sources: Beets, brown rice, bell peppers. ## Doing It Right Let's not forget one thing: we, as a species, long ago decided to domesticate these wild animals, these wolves and wild cats. We have taken them in because they worked, because they were useful, because they were a delight to have around. The deal now is, they can't feed like they used to. Our laws prohibit dogs from running down deer; in many places, laws prohibit pets from being outdoors without a leash. And in many municipalities, you don't want your cat stalking the neighborhood rats. Not any more. So we have to feed them. They can't feed themselves. We owe it to these wonderful creatures to do the very best job we can—to give them food that will encourage happy, healthy lives. Sometimes it can be hard to keep a pet, harder still to feed them well. But think of your pet: hungry for nutrients, wanting to be full, wanting to feel secure in its feeding. Think of yourself, enjoying your pet's long and happy life with you. You've read this book; you've learned about what your pet needs and what you can do. You do have a lot of options, but in my view, feeding your pet indifferently, and in uninformed fashion, is not one of them. Clearly, recent events surrounding the massive recall of pet food have given us all pause. Now it is time to act. I am not recommending that we abandon our huge commercial pet food industry, but I am saying that we can be part of an overall reform in how we feed our animals—a return, if you will, to the spirit of how animals used to be fed by their keepers. This will help pet food makers realize that indeed we do care enough about our pets to make the effort to feed them well. If we show the way, the industry will have to follow. It is up to us. ## Good Product Sources Commercial Pet Food Flint River Ranch www.frrco/7478 Makes high-quality dog and cat food and other products. Nature's Logic www.natureslogic.com Also a good choice. Neither of these brands, as of this writing, were involved in the pet food recall of 2007. Supplements Dynamite Marketing www.dynamitemarketing.com Vitamin supplements for pets, horses, birds. ## Searchable Terms Note: Entries in this index, carried over verbatim from the print edition of this title, are unlikely to correspond to the pagination of any given e-book reader. However, entries in this index, and other terms, may be easily located by using the search feature of your e-book reader. additives and manufacturing of pet food, 66 See also specific additive aflatoxin, 17 age, pet, and proteins, 4 allergies, 46, 73 aloe vera, 143 Alpo, 27 alternative care, Weiskopf's interest in, 8 aluminum, 145 American Kennel Club, groupings by, 99–100,101–4 American Veterinary Medical Association (AVMA), 82, 83–84 aminopterin, 17 anemia, 74, 136, 137, 144 "animal digests," 63 animals fat of, 62–63, 68 and labels on pet food, 62–63 as protein source, 59, 89, 102 and raw food diets, 89 as vitamin and mineral sources, 89 See also type of animal antibiotics, 64, 67 antioxidants, 145 arachidonic acid, 110 arthritis, 134, 143 artificial sweeteners, 77 Association of American Feed Control Officials (AAFCO), 30, 31–32, 55,56,57,60,61,67 avidin, 64 bacon, 76 bacteria, 63–64, 84 bad foods, 11, 58, 73–74, 80, 82 balanced diets, 47—50 BARF (bones and raw food), 90 beans in cat recipes, 126, 127, 128, 130 and dog groupings, 106 in dog recipes, 117, 118, 119 and food groups, 49 in homemade pet food, 10 and minerals, 140, 141, 142, 144, 145 as table scraps, 71 and vitamins, 138 Bedlington terriers, 1–2, 6, 7, 103 Beef and Lentils (dog recipe), 120 beet pulp, 68 beetroot, 75 Bennett, F. H., 25 BHA, 63, 68 BHT, 63, 68 biotin, 45, 64, 136 biscuits, dog, 25, 69, 118 bladder stones, 134 body temperature, 105, 110 bone meal, 65 bones AVMA recommendation about, 82 as bad food, 74, 82, 84 as by-product, 59 calcium in, 102 in cats, 100 cooked, 60, 74, 82, 84 and dog groupings, 102, 104 in dog recipes, 11 in dogs, 100 fun facts about, 100 and history of pet food industry, 25 and homemade pet food, 84 and minerals, 145 raw, 60, 74, 80, 90, 102 and raw food diet, 87–88, 90 as table scraps, 74 and vitamins, 138 boron, 140, 142, 145 brands acceptable, 92 changing, 69 See also specific brand bread, 77 breakfast recipes for cat, 127, 128 recipes for dog, 10, 117–18 breaths per minute, 105 breeds/breeding, 36, 97, 107. See also groupings broth in cat recipes, 126, 134 in dog recipes, 116 Bulk Recipe for Cats, 125–26 Bulk Recipe for Dogs, 116–17 butcher shops, "dog meat" from, 5 by-products, 59, 60–61, 63, 65, 66, 67 calcium and balanced diets, 49, 50 in cat recipes, 127, 130, 132, 133 and dog groupings, 102 in dog recipes, 119 fun facts about, 100 function of, 140,141, 145 as major (macro) mineral, 45, 140, 141 and other minerals, 141, 145 sources of, 49, 50,75, 102, 121, 140 calories, 57, 61,102, 104 cancer, 124, 133–34 Canine Cancer Care (recipe), 124 Canine Heart Diet (recipe), 123 canned pet food acceptable, 92 alternating between dry and, 69 dry versus, 9 grains in, 69 manufacturing of, 66 nutrition of, 69 and pet food pie, 44 preservatives in, 9, 69 See also wet food carbohydrates and cancer, 124 in cat diets, 47 and cat groupings, 112 in dog diets, 47, 48, 124 and dog groupings, 102 in dry foods, 61 in homemade pet food, 48 and labels on pet food, 58, 68 in pet food pie, 42, 44 and vitamins, 136, 137 cats breakfast for, 127, 128 commercial pet food for, 3 dinner for, 127, 129 domestication of, 37, 109, 113, 147 fun facts about, 100, 105, 110 groupings of, 109–13 human foods that are bad for, 80 magnesium in, 141 origins and history of, 35, 37, 38, 41–42, 87 Pottenger's experiments with, 87–88 recipes for, 125–34 weight of, 141 See also specific topic Cat's Hardy Meal (recipe), 130 Cat's Mixed Grill and Pasta (recipe), 129 Cat's Special Breakfast for 10-Pound Cat (recipe), 128 Center for Veterinary Medicine (CVM), 30–31, 67 cereal, 76 "chain food medicine," 5 chamomile, 143 Chappel, P.M., 25–26 cheese, 75 chemicals, 64, 75 chicken in acceptable commercial brands, 92 in cat recipes, 126, 127, 129, 130, 131, 132, 133 in dog diets, 54 and dog groupings, 106, 107 in dog recipes, 10, 11, 115, 117, 118, 119, 120, 121, 122, 123 drippings, 76, 82 fat of, 68, 118, 122, 123, 131, 132, 133 in homemade pet food, 81, 82, 84 and labels, 32, 56, 59, 68 and raw food diet, 89, 90 and regulation of pet food industry, 30,31 See also poultry chloride, 140 chocolate, 11,73–74,80,82 cholesterol, 123 choline, 45, 136 chromium, 140, 142, 145 citrus, 74, 77, 80 clove oil, 63 coats and cat groupings, 112 and dog groupings, 103, 104 and minerals, 144 and oils, 85 and vitamins, 136, 138 cobalt, 45, 142, 145 coconut oil, 115, 116, 117, 126 codliver oil, 87, 116 Colgate-Palmolive, 27 colorings, 66 commercial pet food acceptable, 92 artificial stool hardeners in, 75 AVMA recommendations about, 83 and balanced diets, 47, 48 by-products in, 61 carbohydrates in, 44 for cats, 3 cost of, 92 for dogs, 80 and dry versus wet food, 7 food groups in, 48 good product sources for, 149 and groupings for cats, 110 as healthy, 75 history of, 21–28 and homemade pet food, 83–84, 91–93 labels on, 13, 19, 55–65 manufacturing of, 92 mixing table scraps and homemade pet food with, 91–93 need for changes in, 148 pros and cons of, 51–54, 80 protein in, 47 quality of, 52 raw food diet versus, 88 rules of thumb for, 67–69 soy in, 76 table scraps as supplement to, 71–77, 91–93 Weiskopf's recommendations about, 148 condiments, and labels on pet food, 56 contaminants, potential, 63–65 cookies, 77 copper, 7–8, 45, 140, 142, 144 corn meal, 62, 65, 130 cost of commercial pet foods, 92 of homemade pet food, 81–82 of pet food, 18–19 cottage cheese, 48 dachshunds, 105, 107 dairy products and balanced diets, 48 as calcium source, 75 in cat recipes, 128, 134 for cats, 18 as food group, 48 myth about, 49 as protein source, 75 and raw food diet, 87–88 sources of, 48 as table scraps, 74–75 dandelion, 22, 143 dates, on pet food labels, 31, 68 Del Monte, 27 dental benefits, 7, 69 diabetes, 134 diarrhea, 11, 14, 58, 60, 73, 75, 134 diets balanced, 28, 47–50 changes in, 3, 13–14, 69, 75 and history of pet food, 24–25 myths about, 46 need for reform of pet, 19, 148 and origins and history of pets, 35–40 and pets as household members, 4–5 variety in, 46 See also type of diet dinner for dogs, 11, 118 and labels on pet food, 56 recipes for cat, 127, 129 recipes for dog, 118 "dog meat," 5 Doggie's Sunday Fare (recipe), 121 dogs breakfast for, 10, 117–18 dinner for, 11, 118 domestication of, 36, 113, 147 fun facts about, 100, 105 groupings of, 99–100, 101–7 lunch for, 11, 118 origins and history of, 35–36, 38, 41–42, 87, 100, 147 recipes for, 10, 115–24, 129–30 snacks for, 12 variety of, 36 weight of, 141 Weiskopf's feeding of her, 10–12 See also specific topic domestication of cats, 37, 109, 113, 147 of dogs, 36, 113, 147 dry food acceptable, 92 alternating between canned and, 69 benefits of, 69 canned/wet versus, 7, 9 carbohydrates in, 44 for cats, 7, 26 and history of pet food industry, 26 labels on, 56, 61 manufacturing of, 65, 66 myth about, 7 prescription, 83 preservatives in, 9 quality of, 26 vegetarian organic, 62 Dynamite Marketing, 150 eggs in cat recipes, 128, 130, 132 in dog recipes, 118, 122 importance of, 64 raw, 64 as source of vitamins and minerals, 64 as table scraps, 93 Eggs and Potatoes (dog recipe), 122–23 eggshell powder as calcium source, 121 in cat recipes, 125, 126, 127, 129, 132, 134 in dog recipes, 119, 120, 121, 122, 123, 124 how to make, 121 entrée labels, 56 enzymes, 28, 88, 89, 109, 116, 126, 131 ethoxyquin, 63, 68 Eukanuba, 27 extruders, 65–66 Fancy Feast, 27 fast food, 54 fasting, 38, 89 fat(s) animal, 62–63, 68 AVMA recommendation about, 82 and balanced diets, 48, 50 benefits of, 12 and cancer, 124 and cat groupings, 112 chicken, 68, 118, 122, 123, 131, 132, 133 in dog diets, 48 and dog groupings, 101 in dog recipes, 115, 118 and history of pet food industry, 23 in homemade pet food, 48 importance of, 12 and labels on pet food, 57, 59, 62–63, 68 and manufacturing of pet food, 65 myths about, 12 in pet food pie, 42, 44 poultry, 62–63, 123 preservation of, 63 sources of, 48, 50, 68 too much, 12 trans, 115 and vitamins, 137 fatty acids, 128,137 feast-and-famine animals, 39 fiber, 49, 50, 77 fish in cat recipes, 126, 127, 129, 130, 131, 132, 133 and dog groupings, 106 in dog recipes, 116, 119, 120 and labels on pet food, 68 fish meal, 60, 65 Fish and Oats (dog recipe), 119 fish oil in cat recipes, 126, 127, 130, 133 in dog recipes, 10, 116, 117, 119, 122, 123 helpful hints about, 133 and homemade pet food, 81 importance of, 12 flavorings, 77 flavors, on labels, 56 flaxseed oil, 85 Flint River Ranch, 92, 149 flours, and manufacturing of pet food, 65 fluoride, 140 folic acid, 45, 136 Food and Drug Administration (FDA), 19, 30, 31, 67 food groups, 48–50 For Feline Heart Care (recipe), 133 For Kidney Care I (cat recipe), 131–32 For Kidney Care II (cat recipe), 132 4 Ds (dead, diseased, dying and disabled animals), 23 Friskies, 27 fruit and balanced diets, 50 in cat diets, 43, 47 in cat recipes, 130 in dog diets, 43, 47 and dog groupings, 106 in homemade pet food, 81, 85 and pet food pie, 44 as snacks, 12 as table scraps, 77 See also specific recipe fun facts about cats, 100, 105, 110 about dogs, 100, 105 fungi, 64 Gaines, Clarence, 26 garlic, 74 Georgia (cocker spaniel), 2 ginger, 77, 143 gingerroot, 58 glucogenesis, 109 Glucose Tolerance Factor (chromium), 145 gluten meals, 61 grains and balanced diets, 49 in canned pet food, 69 in cat diets, 43, 47 and cat groupings, 110 in cat recipes, 125, 126, 128, 129, 130, 134 in cereals, 76 in commercial pet food, 92 cooked, 90 in dog diets, 43, 47 and dog groupings, 102, 106, 107 in dog recipes, 116, 118, 119, 121 in dry food, 26, 61 and history of pet food industry, 23 in homemade pet food, 81, 84 and labels on pet food, 68 and manufacturing of pet food, 65 and pet food pie, 43–44 potential contaminants of, 65 protein in, 43—44 and raw food diets, 89, 90 sources of, 49 uncooked, 76, 84 See also specific recipe grapes, 12, 50, 74, 80 grass, myth about, 22 Gravy Train, 27 grazing, 12 groupings AKC, 101–4 for cats, 109–13 for dogs, 99–100, 101–7 Nation Way, 104–7 growth stimulants, 67 heart care recipes for cat, 133 recipes for dog, 123 and vitamins, 136, 137, 138 heart rate, 105, 110 Heinz, 27 herbs, 77, 131, 143 herding dogs, 99, 101, 105, 106–7 Hill's Science Diet, 27 Holiday Dinner for Cats (recipe), 129 homemade pet food AVMA recommendations about, 82, 83–84 and balanced diets, 47–48 cost of, 81–82 for dogs, 10–12, 47–48 ingredients in, 81 mixing table scraps and commercial pet food with, 91–93 and need for change in pet food industry, 19 pros and cons of, 79–85 tips about, 84–85 and Weiskopf's feeding of her dogs, 10–12 hormones, 67 horse meat, 26 hounds, 99, 104, 105, 106, 107 "hulls," 68 "human food," for pets, 27–28 hunting dogs, 105–6 hypertension, 141 Iams, 27, 52 ick factor, 88, 89–90 ingredient labeling, 58–65 iodine, 45, 140, 142, 144 iron, 45, 102, 140, 142, 143–44 Jiffi (poodle), 2–3, 5 kelp/seaweed, 143 Ken-L-Ration, 26 kibble, 63, 89, 117. See also dry food kidney disease and changing diets, 14 and minerals, 141 recipes for cats with, 131—32, 134 recipes for dogs with, 122–23 labels AFFCO certification on, 67 on commercial pet food, 13, 19, 55–65, 67 and history of pet food industry, 27 "meat" on, 43 and regulation of pet food industry, 30–31, 32 USDA, 67 legumes, 76 life stages, and labels on pet food, 57 "lite" formulas, 57 liver, 117, 127 liver toxicosis, 7–8 long-haired cats, 111—12 lunch for dogs, 11, 118 recipes for, 118 lutein, 58 magnesium, 45, 140, 141–42, 145 Mahr, Roger, 82 manganese, 45, 140, 142, 144 manufacturing of pet food, 65–66 Mars Inc., 27 meal. See type of meal meat and balanced diets, 48 in broths, 77 by-products of, 60–61 and cat groupings, 110 in cat recipes, 126, 129, 130, 133, 134 in commercial pet food, 92 and dog groupings, 104, 107 in dog recipes, 115, 116, 117, 118, 119, 120, 122, 124 grade of, 67 in homemade pet food, 84 and labels on pet food, 59, 67 organic, 67, 81 protein in, 110 raw, 90 and raw food diet, 87–88 sources of, 48 as table scrap, 73 meat meal, 61 Meat and Potatoes (dog recipe), 122 melamine, 17–18, 52 melanin, 144 Menu Foods, 52 Meow Mix, 27 Mighty Dog, 27 Milk Bone, 25, 26 milk. See dairy products milk thistle, 143 minerals, 139–45 and acceptable commercial foods, 92 in cat recipes, 126, 129, 130, 133, 134 in dog diets, 48 in dog recipes, 119, 120, 121, 122, 123, 124 and homemade pet food, 48, 81 importance of, 45, 139, 142 and labels on pet food, 59 major/macro-, 45, 140–42 micro/trace-, 140, 142–45 and pet food pie, 42, 45 sources of, 50, 64, 89, 139, 140, 141, 142, 143–45 vitamins as inhibiting, 139 warning about, 140 See also specific mineral mint, 143 mixed breeds, 107 mold, 64–65 molybdenum, 140, 142, 145 mountain dogs, 105, 106 MSM (methyl sulfonyl methane), 142 mullein, 143 multivitamins in cat diets, 43 in cat recipes, 126, 129, 130, 132, 133,134 in dog diets, 43 in dog recipes, 119, 120, 121, 122, 123,124 and homemade pet food, 81 and vitamin chart, 135 mycotoxins, 64–65 Nation Way groupings, 104–7 National Biscuit Company (Nabisco), 26 Nature's Logic, 92, 149 Nature's Recipe, 17, 27 neighbors, feeding of pets by, 69 Nestlé's, 27 nettle tea infusion, 143 niacin, 45 9Lives, 27 non-sporting dogs, 99, 102–3 northern working dogs, 105, 106 Nutro, 27 nuts/seeds, 44, 50, 76, 128 ocicat, 112 oils benefits of, 85 in cat recipes, 126, 129 in dog recipes, 116, 120 in homemade pet food, 84–85 See also type of oil olive oil, 85, 116, 126 onion powder, 56 onions, 58, 74, 80 organic foods, 62, 67, 81, 83 oxalic acid, 130 packaging, 66 pan drippings, 76, 82 pancreatitis, 76, 82 pantothenic acid, 45 peanut butter, 83, 128 Pedigree, 27 pedigrees, for cats, 111 penicillin, 64 pentobarbital, 64 Percy (Bedlington terrier), 6, 7 pet food amount of money spent on, 18–19 changing brands of, 69 recalled/tainted, 17–19, 21, 29, 51, 52, 69, 148, 149 See also canned pet food; commercial pet food; dry food; homemade pet food; pet food industry; wet food pet food industry competition in, 29 concerns of, 51 history of, 21–28 need for reform in, 19, 148 regulation of, 19, 29–32, 52, 55 standards in, 55 pet food pie, 41–46 pets as household members, 4–5 number of U.S., 18–19, 51–52 origins, 60–61 See also cats; dogs phosphorus, 45, 140 platter labels, 56 poodles, 2–3, 5, 102, 103, 104, 105 popcorn, 12 potassium, 45, 49, 140–41 potato chips, 12 potatoes, 76, 106, 107, 122–23, 127, 134 Pottenger, Frances, 87–88 poultry AVMA recommendation about, 82 by-products of, 60, 65 in cat recipes, 126, 129 and dog groupings, 106, 107 in dog recipes, 116, 119, 120 fat of, 62–63 and labels on pet food, 62–63 and manufacturing of pet food, 65 in recipes, 115 skin of, 73, 82, 84 as table scrap, 73 See also chicken prescription dry food, 83 preservatives and acceptable commercial foods, 92 in canned pet food, 9, 69 and change in diets, 75 in dry food, 9 and labels on pet food, 56, 63, 68 and manufacturing of pet food, 66 preventive medicine, 8 probiotics, 81, 115–16, 117, 126 Procter and Gamble (P&G), 27 protein and age of pet, 4 animal, 59, 89, 102 and balanced diets, 48, 49, 50 in cat diets, 26, 42–43, 44, 47 and cat groupings, 110 in cat recipes, 125, 131 in commercial pet food, 47 in dog diets, 11, 43, 44, 47 and dog groupings, 101–2 in dog recipes, 115, 122–23 and dry versus wet food, 7 and food groups, 48 and history of pet food industry, 22–23 in homemade pet food, 47–48 and kidney disease recipes, 122–23, 131 and labels on pet food, 57, 58, 59, 61–62 and life stages, 57 and manufacturing of pet food, 65, 66 and minerals, 144 myth about, 4 and origins and history of dogs, 37 in pet food pie, 42–44 quality of, 47, 48, 66 and raw food diets, 89 and rendering, 23, 24 sautéing of, 115 sources of, 11, 22–23, 43–44, 48, 49, 50, 59, 61–62, 64, 75, 76, 89, 101–2, 110 and variety in diets, 46 and vitamins, 136, 137 in wet food, 66 See also specific type of protein or recipe Puppy Chow, 27 Purina, 27 quality and labels, 62 of meats, 67 of pet food, 51, 52, 62 of protein, 47, 48, 66 of wet food, 66 raisins, 12, 50, 74, 80 "ratters," terriers as, 103, 111 raw food in cat recipes, 134 for cats, 87–88 in homemade pet food, 84 See also type of food raw food diets commercial pet food versus, 88 decline in popularity of, 88 as failure, 87–90 and origins and history of pets, 38, 39 serving size in, 88–89 recipe labels, 56 recipes basic cat, 125–34 basic dog, 115–24 breakfast cat, 127, 128 breakfast dog, 10, 117–18 for cancer, 124, 133–34 dinner cat, 127, 129 dinner dog, 118 for heart care, 123, 133 for kidney disease, 122–23, 131–32 lunch dog, 118 rules of thumb for, 129–30 snack dog, 118 See also specific recipe regulation of pet food industry, 19, 29–32, 52, 55 See also standards rendering, 23, 24, 59, 60, 61, 62, 63, 65, 83, 88 respiratory rate, 110 rex cats, 111, 112 rice, 106, 118, 119, 120, 130, 131, 132, 134 Rice and Beans (dog recipe), 119 Rochester Institute of Technology, 6 rosemary oil, 63 Royal Canine, 27 safflower oil, 116, 126 saffron oil, 84–85 salmon oil, 124, 129, 134 salmonella, 90 salt, 48, 56, 83 scandal, pet food, 17–19, 21, 51, 52 selenium, 45, 140, 142, 145 semi-moist food, manufacturing of, 66 Sensible Choice, 27 short-haired cats, 111 sick pets special diets for, 134 See also specific illness sight hounds, 105 silicon, 140, 142, 145 slippery elm bark, 143 snacks for dogs, 12, 118 and raw food diets, 89 sodium, 140–41 sodium chloride, 45 soy products, 49, 62, 74, 76, 80, 144 special diets, for sick pets, 134 spices, 77 sporting dogs, 99, 102 spotted cats, 111, 112–13 Spratt, James, 25 Standard Process, 81 standards, for pet-food labels, 55,57 stool hardeners, 68, 75 sugar, 77, 83 sulfur, 140, 142 sunflower oil, 85 supplements good product sources for, 150 in homemade pet food, 81 See also minerals; multivitamins; vitamins; specific vitamin or mineral sweet potatoes, 76, 118 table scraps acceptable, 93 AVMA recommendations about, 82, 83 for dogs, 82 do's and dont's of, 71–77 mixing commercial and homemade pet food with, 91–93 taurine, 110 Tender Vittles, 27 terriers, 10, 99, 102, 103, 106, 107. See also Bedlington terriers testing, of pet food, 31,32 thyroid problems, 123 tomato pomace, 75 toxic chemicals, 23, 24. See also specific chemical toy dogs, 99,103–4, 105, 106 treats, pet, 66, 69 trichinosis, 90 Tufts University, 8 25% rule, 56 University of Illinois, Weiskopf at, 5–6 U.S. Department of Agriculture, 30, 67 valerian root, 143 vegetables bad, 58 and balanced diets, 49 benefits of, 58 calcium in, 102 in cat diets, 43 in cat recipes, 126, 127, 128, 129, 130, 133, 134 cooked, 90 and diarrhea, 58 in dog diets, 43, 47 and dog groupings, 102, 106–7 in dog recipes, 115, 116, 117, 118, 119, 121, 124 fats and oils of, 62, 81, 129 flavorings on, 77 as food group, 49 in gingerroot, 58 in homemade pet food, 81, 84 and labels on pet food, 62 myths about, 58 and pet food pie, 44 protein in, 43–44, 61–62 raw, 77, 84 and raw food diets, 90 recipe for mainly, 120 sautéing of, 115 sources of, 49 as table scraps, 77 See also specific vegetable, recipe, vitamin or mineral vegetarian diets, 62, 89, 109–10 veterinary medicine, 5–6, 8 vitamin A, 45, 49, 58, 76, 110, 136 vitamin B, 45 vitamin B1, 136 vitamin B2, 136 vitamin B3, 137 vitamin B5, 137 vitamin B6, 137 vitamin B12, 137, 145 vitamin C, 45, 49, 63, 68, 122, 123, 131, 132, 136, 138 vitamin D, 45, 138 vitamin E, 45, 63, 68, 138, 145 vitamin F, 138 vitamin K, 45, 138 vitamins, 135–38 and acceptable commercial foods, 92 in cat recipes, 126 in dog diets, 48 fat-soluble, 44, 45 in homemade pet food, 48, 81, 85 importance of, 28, 135–38 as inhibiting minerals, 139 and labels on pet food, 59 and pet food pie, 42, 44–45 sources of, 50, 58, 64, 89, 135–38 water-soluble, 44–45 See also specific vitamin Walham's, 27 water bottled, 40 in cat diets, 7, 38,39,45,66, 110 in cat recipes, 134 importance of, 45, 116 and labels on pet food, 56 and origins and history of cats, 39 and pet food pie, 42, 45 weight and basic dog recipes, 115 of cats, 48, 125, 141 of dogs, 48, 88–89, 115, 141 and labels on pet food, 56 and raw food diets, 88–89 Weiskopf, Joan, personal and professional background of, 1–14 wet food carbohydrates in, 44 for cats, 7, 66 dry versus, 7, 9 labels on, 56 manufacturing of, 66 moisture in, 66 myth about, 7 protein in, 66 quality of, 66 See also canned food wheat and balanced diets, 49 in cat recipes, 126,127,129,130, 131 and dog groupings, 106 in dog recipes, 116, 120 and history of pet food industry, 23 and manufacturing of pet food, 65 as mineral source, 144 and pet food pie, 43 and table scraps, 93 as vitamin source, 136, 137, 138 wheat gluten, 52, 62 "with ingredient," on labels, 56 working dogs, 99, 101–2, 105, 106, 107. See also northern working dogs working water dogs, 106 xylitol, 82 yogurt, 10, 18, 48, 49, 75, 81, 83, 117, 127 yucca, 143 zinc, 45, 140, 142, 144 ## Acknowledgments The kind man feeds his beast before sitting down to dinner.—Hebrew Proverb Nature does not call for long recipes.—Paracelsus This has been quite a journey, with the genuine spirit of HarperCollins illuminating the way. Maureen O'Brien, Lisa Sharkey, and Stephanie Fraser, you are the best. Marcia and Julia, thanks for getting me started. Michael Coffey, my writing angel, has proved that a great listener can tell a great story. ## About the Author Joan Weiskopf is a nationally recognized veterinary clinical nutritionist, dog breeder, and show handler. She attended Tufts University School of Veterinary Medicine and is featured as an expert on Animal Planet. Visit www.AuthorTracker.com for exclusive information on your favorite HarperCollins author. ## Copyright This book is written as a source of information only. The information contained in this book should by no means be considered a substitute for the advice of a qualified veterinary professional, who should always be consulted before beginning any new food regime for your pet. All efforts have been made to ensure the accuracy of the information contained in this book as of the date published. The author and the publisher expressly disclaim responsibility for any adverse effects arising from the use or application of the information contained herein. PET FOOD NATION. Copyright © 2007 by Joan Weiskopf. All rights reserved under International and Pan-American Copyright Conventions. By payment of the required fees, you have been granted the non-exclusive, non-transferable right to access and read the text of this e-book on-screen. No part of this text may be reproduced, transmitted, down-loaded, decompiled, reverse engineered, or stored in or introduced into any information storage and retrieval system, in any form or by any means, whether electronic or mechanical, now known or hereinafter invented, without the express written permission of HarperCollins e-books. Adobe Digital Edition September 2009 ISBN 978-0-06-198612-3 10 9 8 7 6 5 4 3 2 1 ## About the Publisher Australia HarperCollins Publishers (Australia) Pty. Ltd. 25 Ryde Road (PO Box 321) Pymble, NSW 2073, Australia http://www.harpercollinsebooks.com.au Canada HarperCollins Publishers Ltd. 55 Avenue Road, Suite 2900 Toronto, ON, M5R, 3L2, Canada http://www.harpercollinsebooks.ca New Zealand HarperCollinsPublishers (New Zealand) Limited P.O. Box 1 Auckland, New Zealand http://www.harpercollins.co.nz United Kingdom HarperCollins Publishers Ltd. 77-85 Fulham Palace Road London, W6 8JB, UK http://www.harpercollinsebooks.co.uk United States HarperCollins Publishers Inc. 10 East 53rd Street New York, NY 10022 http://www.harpercollinsebooks.com * Feel free to substitute cooked ostrich, buffalo, or lamb.
2023-10-05T01:26:58.646260
https://example.com/article/3766
This fall will be a great season for Universal Monsters fans. Not only will Universal release eight classic Universal Monsters movies on Blu-ray for the first time, Diamond Select Toys will also be paying tribute to the origins of the most famous monsters on Earth. True, you've already seen DST's upcoming assortments of 7-inch action figures (see HERE) and 2-inch Minimates (HERE), as well as their new line of 8-inch vinyl bust banks (HERE), but they aren't done yet! There are still two more DST products to announce for the Universal Monsters in 2012, and they're both a blast from the past. Last year, DST honored the cinematic origins of the Mummy, the Wolfman and the Creature from the Black Lagoon by releasing them as a boxed set of black-and-white figures (read our review HERE) - the way they were originally seen in theaters - dubbed the Legacy Series. Well, this year, DST is adding to the legacy with a boxed set of Dracula, Frankenstein and the Bride of Frankenstein, all in stunning black-and-white (picture above). With sculpting by Gabriel Marquez, Rudy Garcia and Jean St. Jean, these 7-inch figures will come packaged in a beautiful display box, but each will also come with a base for out-of-package display. The final Universal Monsters products to hit in 2012 will be from the past, as well - this time the distant 1970s! DST's 8-inch Retro Cloth Series 3 will bring us the Bride of Frankenstein and the Creature from the Black Lagoon in the style of vintage 1970s toy lines like Remco's Universal Monsters or Mego's World's Greatest Monsters. With real fabric clothing designed by retro experts EMCE Toys, these figures will bring out the kid in you... or at least show you how your parents lived way back when.
2024-07-30T01:26:58.646260
https://example.com/article/1271
Q: .htaccess: Redirect pages if not accessed within subdomain Scenario: Main domain domain.com points to */home/domain/www* Addon domain addon.com points to */home/domain/www/addon/www* Question: How do I do the following: http://addon.domain.com instead of http://domain.com/addon http://addon.domain.com/page.html instead of http://domain.com/addon/page.html A: try adding these rules to the htaccess file in the /home/domain/www directory: RewriteEngine On RewriteCond %{HTTP_HOST} ^(www\.)?domain\.com$ [NC] RewriteRule ^addon/?(.*)$ http://addon.domain.com/$1 [L,R=301]
2023-12-15T01:26:58.646260
https://example.com/article/4046
Fleur Alpha Cream makes natural beauty for you Fleur Alpha CreamAs we develop old and our age builds, our body experiences a few changes. A few changes may make you look fat, some may make you look lousy, and the greater part of the progressions can be seen all over. With developing age, your face begins looking dull and your facial muscles contract. Particularly on account of ladies, this issue is very apparent. They here and there don't comprehend the repercussions of developing age and consequently experience a few medical procedures, fill botox in their cheeks and numerous different things. Additionally, infiltrating the blade in the skin in some cases prompts a few destructive impacts. There are a few other common strategies also. For making one look more youthful there are numerous beautifying agents in the market that occasionally breakdown our skin. Be that as it may, stress not! We have an all-new item, titled Fleur Alpha Cream. Arranged with regular fixings, this item is useful for those ladies who are experiencing the issues that join developing age. For making things simpler for you, we have curated a rundown of various highlights, preferences, confinements and significantly more that are related with Fleur Alpha Cream. As we develop old and our age expands, our body experiences a few changes. A few changes may make you look fat, some may make you look lousy, and a large portion of the progressions can be seen all over. With developing age, your face begins looking dull and your facial muscles contract. Particularly on account of ladies, this issue is very clear. They once in a while don't comprehend the repercussions of developing age and in this manner experience a few medical procedures, fill botox in their cheeks and numerous different things. Additionally, entering the blade in the skin once in a while prompts a few destructive impacts. There are a few other characteristic techniques too. For making one look more youthful there are numerous beautifying agents in the market that occasionally breakdown our skin. Yet, stress not! We have an all-new item, titled Fleur Alpha Cream. Arranged with common fixings, this item is gainful for those ladies who are experiencing the issues that join developing age. For making things simpler for you, we have curated a rundown of various highlights, preferences, restrictions and substantially more that are related with Fleur Alpha Cream. Fleur Alpha Cream No uncertainty that we will all become more established some time or another and this will carry with it a pack of skin harms that we as a whole will undoubtedly experience the ill effects of. Regardless of whether we need or not we as a whole will without a doubt need to watch the happening and occurring of any sort of wrinkles and furthermore recolors on our delightful skin one day. Fleur Alpha Cream is that one for the most part required skincare cream of great importance which has today become the main of all skin assurance creams on account of the extreme measure of prerequisite it has among the open who had been experiencing and suffering numerous sorts of skin decay. What is Fleur Alpha Cream? Going about as an enemy of maturing equation for your skin, Fleur Alpha Cream can end up being an otherworldly item for the ladies who need to dispose of those spots and wrinkles. Everyone needs to have that ideal and faultless looking skin. Be that as it may, because of the expanding contamination and worry in one's life, it's not possible for anyone to deal with their skin. In this manner, Fleur Alpha Cream is one such healthy skin cream that will help in making you somewhat more youthful than your age. Along these lines, don't stand by a lot and request the item on the web and bring back your childhood! Fleur Alpha Cream will help in disappearing all the defects that have happened all over because of the developing age. Additionally, it is important to utilize it normally with the goal that it can play out its undertakings successfully. For making your skin look energetic, the item requires to be bought multiple times, when a holder gets wrapped up. Fleur Alpha Cream helps in expanding the measure of collagen in the skin, which is one of the basic hormones that is required by an individual. Fleur Alpha Cream is that most needed enemy of maturing, skincare and skin insurance cream that is currently at last here to appropriately and in the entirety of the ways hinder the harms that are caused to the skin which may some of the time incorporate wrinkles or at different occasions scarce differences or even some other skin harm that you have been experiencing relying upon the specific sort of skin that you have. Fleur Alpha Cream has the nearness in it of countless multivitamins that make its equation absolutely worth of utilizing for your sensitive facial skin. It has the containing in it of different nutrients and minerals in it and nutrient E and nutrient C being the most noteworthy just as its principle sort of fixings. It accompanies the intend to give you a firmer and a breathtaking sort of skin very soon. The washing of your face is need before the use of this cream to ensure that no sort of soil is available on the skin and there can be full and complete assimilation of the cream when it is applied. At that point apply it while rubbing the cream on the skin for around 15 to 20 minutes with the goal that the pores are open and there is finished adequacy of the cream. After that leave it medium-term for around 5 hours so the cream can play out its working. Where to purchase Fleur Alpha Cream? There are a few corrective items in the market, that are there to take into account all the requirements of skincare. Be that as it may, these items don't greatly affect our skin and will in general switch for some other option. One such skincare is Fleur Alpha Cream. On the off chance that you are somebody who needs to purchase this item, at that point click on any of the pictures given right now. It will take you to the fundamental website page of the item and from that point you can without much of a stretch request the skincare cream at your doorstep. To get it you need to go to the online store in some time or, more than likely you may need to confront its wrapping up. It is most likely going to be disappointing for you and furthermore offers are constrained and they are likewise very nearly elimination. So get it with a great deal of urgencies in the event that you truly need your skin to sparkle and shine with its common kind the brilliance which must be given to you in a brief timeframe by this skincare cream. Presently arrive at your ideal magnificence and look delightful as ever before simply like a VIP that too in a characteristic manner by making this cream yours and making it a piece of your day by day excellence schedule.
2024-07-31T01:26:58.646260
https://example.com/article/2739
Q: Vertical alignment to center a text box inside a Command bar Content I am having a problem trying to center (vertically) a text box inside a Command Bar Content. Actually I have this (look at the last third line): <CommandBar Grid.Row="0" FlowDirection="LeftToRight"> <AppBarButton x:Name="Back" Icon="Back" Label="Back" Click="Back_Click"/> <AppBarButton x:Name="Forward" Icon="Forward" Label="Forward" Click="Forward_Click"/> <AppBarButton x:Name="Refresh" Icon="Refresh" Label="Refresh" Click="Refresh_Click"/> <AppBarButton x:Name="Cancel" Icon="Cancel" Label="Cancel" Click="Refresh_Click"/> <AppBarButton x:Name="Home" Icon="Home" Label="Home" Click="Home_Click"/> <CommandBar.Content> <TextBox x:Name="Value" VerticalAlignment="Center" KeyDown="Value_KeyDown" HorizontalAlignment="Center" Margin="0,0,0,0" Width="880"/> </CommandBar.Content> </CommandBar> The problem is that I have seen some guides where people write exactly that an it worked for them... but for me not. I am no sure what to do, I have tried with grid, relative panels, stack panels, etc using the design view of the Visual Studio 2017 as I could but I haven't found a solution. P.S: Both @Xavier Xie - MSFT and @Jeff R. found a way to aling it only when the labels of the app buttons are showed, when they aren't the textbox seems unaligned. I'm looking for a way to aling it when they aren't showed and when they are showed. (So the alignment must change by some way automatly when the label are showed or not). If that isn't possible I'm looking for at least aling it when the labels aren't showed (not like they anwsers). A: You could try to set VerticalContentAlignment="Center" for CommandBar like the following: <Page.BottomAppBar> <CommandBar Grid.Row="0" FlowDirection="LeftToRight" VerticalContentAlignment="Center"> <AppBarButton x:Name="Back" Icon="Back" Label="Back" VerticalAlignment="Center" VerticalContentAlignment="Center"/> <AppBarButton x:Name="Forward" Icon="Forward" Label="Forward" VerticalAlignment="Bottom" VerticalContentAlignment="Center"/> <AppBarButton x:Name="Refresh" Icon="Refresh" Label="Refresh" VerticalContentAlignment="Center"/> <AppBarButton x:Name="Cancel" Icon="Cancel" Label="Cancel" VerticalContentAlignment="Center"/> <AppBarButton x:Name="Home" Icon="Home" Label="Home" VerticalContentAlignment="Center"/> <CommandBar.Content> <TextBox x:Name="Value" Width="880"/> </CommandBar.Content> </CommandBar> </Page.BottomAppBar> [Updated on 2018/6/8] [Updated on 2018/6/14] After a lot of tests and consult with my colleagues, we found a way to achieve your target. I am looking for a way to aling it both with label and without label. I'll update my question to explain that explicitly. To achieve your target, let's first check CommandBar styles and templates. Please locate to CompactOpenUp VisualState. You could see that it applies an animation to ContentTransform and change its Y axis position. That's reason why the textbox will be vertical aligned when the CommandBar is opened. <VisualState x:Name="CompactOpenUp"> <Storyboard> <DoubleAnimationUsingKeyFrames Storyboard.TargetName="ContentTransform" Storyboard.TargetProperty="Y"> <DiscreteDoubleKeyFrame KeyTime="0:0:0" Value="{Binding TemplateSettings.CompactVerticalDelta, RelativeSource={RelativeSource Mode=TemplatedParent}}"/> </DoubleAnimationUsingKeyFrames> ...... Inspired by this, we also could dynamically change the textbox's Y axis position to make it vertical aligned when the CommandBar is closed. Then, let's locate to ContentControl in the style. This control actually is used to host your TextBox. So, we can define a TranslateTransform for it like the following: <ContentControl x:Name="ContentControl" ContentTemplate="{TemplateBinding ContentTemplate}" Content="{TemplateBinding Content}" ContentTransitions="{TemplateBinding ContentTransitions}" Foreground="{TemplateBinding Foreground}" HorizontalAlignment="{TemplateBinding HorizontalContentAlignment}" HorizontalContentAlignment="{TemplateBinding HorizontalContentAlignment}" IsTabStop="False" VerticalAlignment="{TemplateBinding VerticalContentAlignment}" VerticalContentAlignment="{TemplateBinding VerticalContentAlignment}"> <ContentControl.RenderTransform> <TranslateTransform x:Name="ContentControlTransform"></TranslateTransform> </ContentControl.RenderTransform> </ContentControl> After that, I believe you've known that we need to define an animation in CompactClosed visual state. But you need to think about if the value of Y axis is appropriate. How to calculate this value? Let's check the CompactOpenUp visual state. It binds TemplateSettings.CompactVerticalDelta as its Y axis position. The CompactVerticalDelta will be changed dynamically in different visual state. So, we need define a converter for calculating the value. The converter class like the following: public class CompactVerticalDeltaConverter:IValueConverter { public object Convert(object value, Type targetType, object parameter, string language) { return (double)value/2; } public object ConvertBack(object value, Type targetType, object parameter, string language) { throw new NotImplementedException(); } } Then, the CompactClosed visual state finally should like the following: <VisualState x:Name="CompactClosed"> <Storyboard> <DoubleAnimationUsingKeyFrames Storyboard.TargetName="ContentControlTransform" Storyboard.TargetProperty="Y"> <DiscreteDoubleKeyFrame KeyTime="0:0:0" Value="{Binding TemplateSettings.CompactVerticalDelta, RelativeSource={RelativeSource Mode=TemplatedParent},Converter={StaticResource CompactVerticalDeltaConverter}}"/> </DoubleAnimationUsingKeyFrames> </Storyboard> </VisualState> For now, we have achieved your target. Please try it.
2023-12-07T01:26:58.646260
https://example.com/article/4606
Q: CString from NSData I'm trying to write a simple html parser in Swift. I imported libxml via a bridge header. But now I have the problem by getting the xml file into a CString. The method htmlReadMemory needs a CString as first parameter. I loaded the xml file into NSData. Passing data.bytes doesn't work. I'm getting the error Could not find an overload for '__conversion' that accepts the supplied arguments. In an obj-c code example, this way works. Why not in Swift? Any ideas, how I can bring the NSData to an CString? A: You'll need to convert it to NSString first, then you can use the cString() function: let xmlData = NSData() let cocoaString = NSString(data: xmlData, encoding: NSUTF8StringEncoding) let cString = cocoaString.cString()
2024-02-03T01:26:58.646260
https://example.com/article/1840
Resheto The resheto () is a Ukrainian percussive folk instrument. The resheto consists of a wooden ring with a diameter of up to 50cm (20in). Initially the ring was strung with a sieve rather than a skin tightened over one side. The resheto is struck with the hand or a stick. Related instruments Tambourine Bubon Taraban See also Ukrainian folk music Sources Humeniuk, A. Ukrainski narodni muzychni instrumenty, Kiev: Naukova dumka, 1967 Mizynec, V. Ukrainian Folk Instruments, Melbourne: Bayda books, 1984 Cherkasky, L. Ukrainski narodni muzychni instrumenty, Tekhnika, Kiev, Ukraine, 2003. 262 pages. Category:Ukrainian musical instruments Category:Percussion instruments
2024-04-09T01:26:58.646260
https://example.com/article/8273
Circulating CXCL11 and CXCL10 are increased in hepatitis C-associated cryoglobulinemia in the presence of autoimmune thyroiditis. No data are available about circulating levels of the CXCL11 chemokine in hepatitis C virus (HCV)-associated mixed cryoglobulinemia (MC) patients with or without autoimmune thyroiditis (AT). The aim of the present study, therefore, was to evaluate serum CXCL11 levels in these patients. Serum CXCL11 (and for comparison, CXCL10) was measured in 45 patients with MC, 45 patients with MC and AT (MC + AT), 45 sex- and age-matched controls without AT (control 1), 45 sex- and age-matched patients with AT without cryoglobulinemia (control 2), and in 45 sex- and age-matched patients with hepatitis C chronic infection without MC (HCV+). Serum CXCL11 and CXCL10 levels were significantly higher in control 2 than in control 1 (p < 0.01). MC patients had CXCL11 and CXCL10 significantly higher than control 1 (p < 0.01). MC + AT patients had CXCL11 and CXCL10 higher than control 2 (p < 0.01) and MC patients (p = 0.02). Serum CXCL11 levels were not associated with any of the clinical features of cryoglobulinemia in patients with MC and MC + AT, which was the same for CXCL10. CXCL10 and CXCL11 in HCV+ patients were significantly higher than in controls 1 and 2, but lower than in MC or MC+AT patients. Our study first demonstrates higher serum levels of CXCL11 chemokine in patients with MC than in HCV+ patients, and in particular in the presence of AT.
2024-06-06T01:26:58.646260
https://example.com/article/3833
--- blog: 'https://intandemly.com/blog' logohandle: intandemly sort: intandemly title: Intandemly website: 'https://www.intandemly.com/' ---
2024-04-03T01:26:58.646260
https://example.com/article/6169
If this is your first visit, be sure to check out the FAQ by clicking the link above. You may have to register before you can post: click the register link above to proceed. To start viewing messages, select the forum that you want to visit from the selection below. Welcome to CycloneFanatic.com. I notice you haven't taken the time to register yet, now is as good of time as any:) Worst Team in the NFL Who do you believe is the worst team in the nfl. I put the teams for the poll I believe are in a class of their own. Not just all the 0-3. Im torn between the rams and the chiefs. But the Lions are there as well Re: Worst Team in the NFL I'm always amazed that with a salary cap there is still such a large disparity between NFL teams. The NBA makes sense where one player can make a huge difference, but with the shear number of players on an NFL team you'd think it would be more balanced.The talent shouldn't be THAT much different from team to team. So what exactly makes these teams so bad? Coaching? Quaterback play? I think it is amazing to have a team to undefeated, or defeated for that matter. Re: Worst Team in the NFL Originally Posted by keepngoal KC wins next week. -keep. Against the Broncos? Have you watched them play this season? If I honestly had to W/L the season I would say the Miami game is the only game they will be favored in the rest of the season. I understand they are rebuilding but it's a disaster down there right now. Re: Worst Team in the NFL I voted for the Lions because they have been bad for a long long time! The NFL tries its best to set the league up in ways that allow bad teams to get good (draft, scheduling)...but the Lions just are never good! All content owned by CycloneFanatic.com - All rights reserved 2005-09. By viewing this website you agree to the Terms of Service, Site Rules and Legal Disclaimer. The words, views, images and opinions expressed or provided by users do not reflect the opinions or views of CycloneFanatic.com or Iowa State University. The names, words, symbols, and graphics representing Iowa State University are trademarks and copyrights of the University protected by the trademark and copyright laws of the United States of America and other countries and are used on this web site under license from the University. Original site design, premise & construction by Jeremy Lind.
2024-04-14T01:26:58.646260
https://example.com/article/8209
We, the parish of Our Lady of the Holy Rosary of Fatima, a Catholic community, in the suburbs of Dublin, are committed to Christ, valuing faith, love, trust, and unity. Inspired by the image of Christ and relying on the Holy Spirit, we are called to reach out with endless love to those who are searching for God and gather all into our Lord's home, to spread His Word, to educate our youth and to assist those in need. May we always make everyone welcome in to our parish community, especially immigrants who are in a strange land may we welcome and befriend them in Christ's name. On the publication of her book on "The South Circular Road, on the eve of the first world war". Cathy who lives in our area has contributed to the life of our parishes , not least but editing the popular book "By the sign of the Dolphin" and was the inspiration behind the DVD "In the Shadow of the Barn". She is an expert on local history and is sought after to share her knowledge in many settings. Her book is a compelling read and will be available in Rialto and Dolphins Barn Churches as well as many book stores. Price €9.98 We thank her for the many ways she has captures the local history for us and wish her well on her recovery from her recent illness ==================================== An evening with Michael Keogh"in Rialto Parish Centre on Wednesday 9th of October at 7:30pm"Dublin in the rare old times - good and bad"Come and enjoy an evening with friends, enjoy craic and a cuppa. Free admin, but donation if possible would be gratefully appreciated by the Rialto Variety Group towards their Christmas panto. Looking forward to seeing you there ============================================ HOSPICE COFFEE MORNING Many thanks to all who came to the Hospice Coffee Morning on Thursday 19th of September. The total amount raised was €480. ============================================== The next World Youth Day will be in Krakow, Poland in 2016 WYD 2013 Rio & Dublin World Youth Day takes place in Rio de Janeiro, Brazil in July from 23rd-28th July. A group of pilgrims from the Archdiocese will travel and participate at World Youth Day and a unique event is being planned in Dublin to celebrate with those who cannot make it to Brazil Rio in Dublin is especially aimed at young people who have either attended a World Youth Day or would like to savour some of the atmosphere of what takes place at World Youth Day. It will take place on the weekend of 27th/28th July in Church St Friary, Dublin 7. Registration is now open and demand is already high. Parishes with young people wishing to take part should e-mail wyd@dublindiocese.ie as soon as possible. The exciting programme includes: ·Pilgrim walks to Church St will take place from seven locations. ·Young people will be welcomed by members of the local Brazilian young people here in Dublin. ·Video links to Rio for some of the key ceremonies involving Pope Francis. ·A programme of catechesis, music, prayer - from late Saturday through to Sunday ·There will be an opportunity to participate on a justice programme in advance of Rio in Dublin (hosted by Magis Ireland) ·There are events for young people (16 and 18) and 18 and over ·Volunteers are now sought to help with the programmeFurther information is available on www.evangelisa ********************************************************* Choose Life: Prayer for the Child in the Womb Lord Jesus, you are the source and lover of life. Reawaken in us respect for every human life. Help us to see in each child the marvellous work of our Creator. Open our hearts to welcome every child as a unique and wonderful gift. Guide the work of doctors, nurses and midwives. May the life of a mother and her baby in the womb be equally cherished and respected. Help those who make our laws to uphold the uniqueness and sacredness of every human life, from the first moment of conception to natural death. Give us wisdom and generosity to build a society that cares for all. Together with Mary, your Mother, in whose womb you took on our human nature, Help us to choose life in every decision we take. We ask this in the joyful hope of eternal life with you, and in the communion of the Blessed Trinity. Amen. ************************************************* WORLD APOSTOLATE OF FATIME WILL HOLD A Eucharistic Vigil will be held here in our parish church on Friday 1st of February 2013 Commencing with Mass at 7.30pm and concluding with Benediction at 9.45pm
2023-12-24T01:26:58.646260
https://example.com/article/6304
Wal-Mart 403-201-5415 Tel: 403-201-5415 Are you the owner or manager of Wal-Mart? Is Department Stores the correct main category for this listing? Do you have more detailed information that would enhance this free listing? If so, please send details to the webmaster
2024-04-25T01:26:58.646260
https://example.com/article/9139
“And a voice came from heaven, ‘You are my beloved Messiah; with you I am well pleased.'” This declaration is the familiar pronouncement of God’s favor upon Jesus, at the time of his baptism. Well, not quite. That verse is actually from the Injil Sharif, a 2005 Bengali translation of the gospel of Mark. A missions agency based in Atlanta worked with translators in Bangladesh to produce a version of the gospels with a twist: the word “Son” in reference to Jesus is consistently replaced with “Messiah,” and “Father” with “Guardian.” The group in Bangladesh represents what is known in missions circles as an “Insider Movement.” Advocates of these initiatives say their followers believe Jesus as Savior, yet “remain inside their families, networks and communities, retaining the socio-religious identity of that group.”[1] The idea of encouraging believers to “remain” within Islam and “retain” their identity as a Muslim is one of the most controversial issues in missions today. Arguably the most contentious practice of some of these groups is to produce Bible translations that remove familial language for God, due to the offense Muslims have towards the idea that God is Father and Son. Thus, “Son” is removed from Mark 1:11 to read in the Bangladeshi translation, “You are my beloved Messiah.” Most Christians, however, have never heard of Insider Movements nor of these translations–though they may have been unwittingly supporting them. To address this issue, and to give guidance to their churches, the General Assembly of the Presbyterian Church in America (PCA) in June 2011 approved “A Call to Faithful Witness.” The key resolution of this overture declared “as unfaithful to God’s revealed Word, Insider Movement or any other translations of the Bible that remove from the text references to God as ‘Father’ (pater) or Jesus as ‘Son’ (huios), because such removals compromise doctrines of the Trinity, the person and work of Jesus Christ, and Scripture.” Because advocates of these translations can describe their work in ways that appear acceptable on the surface, the overture was intentionally specific and objective. Using terms other than “Father” or “Son” in the text was expressly deemed unfaithful. In other words, relegating those terms to the footnotes, or using “non-familial alternatives” would be compromising the very essence of the Christian faith. RUF National Coordinator, Rev. Tom Cannon, stepped down from his role on March 2, 2018. His resignation was received by the permanent committee with appreciation for his service and tenure as chairman. According to Will Huss, ... As the definition of marriage continues to be batted around in the wider religious community, two presbyteries have recommended that the PCA take further steps to reinforce its position on biblical marriage. Calvary and Grace presbyteries ... At the PCA’s first General Assembly (GA) in 1973, ruling elders made up 54 percent of the participants. At the 2016 Assembly, they made up 21 percent. An overture submitted to this year’s Assembly by Calvary ...
2023-12-19T01:26:58.646260
https://example.com/article/7741
The big vendors seems to stock the cheapest junk possible and incorrectly label the application. I agree with Steve. Have and continue to use Heartbeat for reasons mentioned above. You can call and obtain some quality answers to your needs, and they normally have in stock what they sell without the crazy shipping $$$ some charge. Let me give you another example why I deal with them. Dec. of 2005 I purchased something from them on ebay that was sold for good money. Early Jan. 2011 I find out its not really correct and I call to discuss but I'm thinking this will be interesting. Luckily I had everything paperwise but guess what, they took the part back and gave me a full credit. No big deal, no hassle, no arguments, just a discussion to understand what happened! That went a long way with me being a customer of Hearbeatcity. If you call ask for Brian as he's extremely helpful. hi there,i to have used heartbeat city in the past without any problems, i also like them as i can pay with paypal. which is handy for me living in australia.classic industries and national parts depot are other options also.good luck,rohan I would have to echo these comments too. Since Ecklers too over Rick's the service and treatment to people has gone down the tubes. My discounts have gone down the tube too. Although I was established as a dealer years ago when it was Rick's, now it's 15% off for me. And although I am a vendor to them too in the fact that I sell them books at a large discount, I still get the same poor treatment. No professional courtesy as another vendor to them. It's all about the bottom line and that's it..........too bad for them. I do feel sorry for the employees. Many are still there and are not happy with the situation either. I used to refer people to Rick's but not anymore. No referrals from CHP. Not the way they run that company now. It's pathetic. Jerry,I just cant believe how customer service and treatment how gone down the tubes so horribly. What is it with these businesses and how they treat a customer. Going back to the brake cleaner, i cant tell you how many times now i been back to two Wlamart stores nearby my home and get no call back on questions i had regarding this brake cleaner, yet they take my name and number and when i get there they tell me they forgot to call and they get a voice mail on this product they are trying to get for me, just unreal. Thanks for the heads up on Ricks, i will stay away from there for my restoration. I appreciate your calls back to me Jerry when i have a question about work to be done by you or other things in general. You understand the business and how customers want to be treated. I appreciate your professional service, thats huge to me. Not to blame the younger generation but where is the concern and courtersy. I would have to echo these comments too. Since Ecklers too over Rick's the service and treatment to people has gone down the tubes. My discounts have gone down the tube too. Although I was established as a dealer years ago when it was Rick's, now it's 15% off for me. And although I am a vendor to them too in the fact that I sell them books at a large discount, I still get the same poor treatment. No professional courtesy as another vendor to them. It's all about the bottom line and that's it..........too bad for them. I do feel sorry for the employees. Many are still there and are not happy with the situation either. I used to refer people to Rick's but not anymore. No referrals from CHP. Not the way they run that company now. It's pathetic. Not sure if this is my place to say, but you are totally off base with this comment...Jerry is simply stating his past experience with Ricks. Perhaps this hasn't happend with you, but it only takes one bad experience to ruin it for someone else. There is a parts dealer in San Bruno,Ca. called Steve's Camaros that's great to do business with. He's lots smaller than Rick's or Classic, but really knows first Gen Camaros, & stocks good quality stuff. Has a web page stevescamaros.com. He used to drag race Camaro's and has built many. Does anyone know the guy who owns HBC? I've tried to talk with them and e-mailed him directly about the radiator tags they make. I don't know about other models, but the one for the 68 Z28 is wrong. He says he modeled it after one he took off an original car, but they have IM for one of the tanks and it's supposed to be IH. I've gotten no where with him and he's blown me off. It's obviously wrong and I told him to check on here but I'm sure he thought I was nuts. I'd like to get one from him, but what's the point of an incorrect one?
2024-07-28T01:26:58.646260
https://example.com/article/7313
Introduction {#Sec1} ============ Pyroptosis is a newly identified programmed cell death (PCD), characterized by cell swelling, forming large bubbles on the plasma membrane and disruption of plasma membrane^[@CR1]^. Originally regarded as an innate immune mechanism that occurs in macrophages, monocytes, dendritic cells (DCs), and T cells upon the stimulations by pathogens or the products from pathogens^[@CR2],[@CR3]^, pyroptosis was found to be mediated by the pro-inflammatory caspases^[@CR4],[@CR5]^. More recently, pyroptosis was also found to be mediated by pro-apoptotic caspases in cancer cells and human primary cells after induced by chemotherapies^[@CR6],[@CR7]^. As a pro-inflammatory form of PCD, pyroptosis can protect multicellular organisms from invading pathogenic bacteria and microbial infections. However, its overactivation will lead to sepsis and lethal septic shock^[@CR8]^. Pro-inflammatory caspases that induce pyroptosis include caspase-1 in both human and mice, caspase-4 and -5 in human, and caspase-11 in mice. Caspase-1 mediated pyroptosis is often activated by cannonical inflammasomes^[@CR9]^, while caspase-4/5/11 mediated pyroptosis is often activated within non-canonical inflammasomes^[@CR10]^. Pyroptosis can also be induced by pro-apoptotic caspases, such as caspase-3^[@CR6],[@CR7]^ and caspase-8^[@CR11],[@CR12]^. Caspase-3 is often activated by the death receptor mediated apoptotic pathway through the activation of caspase-8 or the mitochondrial apoptotic pathway through the activation of caspase-9^[@CR13]^. Many anti-cancer drugs induced cancer cell death through the mitochondrial pathway, which was controlled by BCL2 family proteins. Two BCL2 family members, BAK and BAX can form pores on the mitochondrial outer membrane (MOM) after activation, resulting in the release of mitochondrial inter-membrane components, which will cause the activation of caspase cascade^[@CR14]--[@CR16]^. The cleavage of gasdermin family proteins GSDMD and GSDME mediate pyroptotic characteristics. GSDMD is cleaved by activated pro-inflammatory caspases after Asp275 (Asp276 in mouse), generating an N-terminal domain (GSDMD-N)^[@CR17]--[@CR19]^. Originally defined as a putative oncosuppressor protein^[@CR20]^, GSDME, is cleaved by caspase-3 after Asp270 generating an N-terminal GSDME (GSDME-N) upon the treatment of anti-cancer agents^[@CR6],[@CR7],[@CR21]^. Both GSDMD-N and GSDME-N oligomerize and form large pores on the plasma membrane to induce plama membrane disruption, leading to the release of cellular contents, including pro-inflammatory mediators, and alamins. While caspase-3 is a pro-apoptotic caspase, the cleavage of GSDME by activated caspase-3 after chemotherapy drug treatments provides a cross-talk between the pro-infammatory pryroptosis and anti-inflammatory apoptosis. GSDME expression levels vary in different cell types and tissues. High levels of GSDME lead to pyroptosis while cells with low levels undergo apoptosis upon chemotherapy treatments^[@CR9]^. In the presence of GSDME, chemotherapy drug-induced caspase-3 activation often leads to a pyroptotic characteristics^[@CR6],[@CR7]^, because pyroptosis progresses faster than apoptosis^[@CR18]^. Although GSDME cleaved by pro-apoptotic caspases convert apoptosis to pyroptosis, however, its regulation mechanisms are not clear. As one of the most common posttranslational modifications of proteins, palmitoylation is defined by the addition of saturated 16-carbon palmitic acid to specific cysteine residues^[@CR22]^ and plays an important role in multiple intracellular physiological processes^[@CR23]--[@CR26]^. 2-BP is one of the most commonly used palmitoylation inhibitors, which can directly and irreversibly inhibit the palmitoyltransferase activity of all DHHC (Asp-His-His-Cys) proteins^[@CR27]^. In this study, we not only found that chemotherapy-induced pyroptosis was mediated by the BAK/BAX-caspase-3-GSDME pathway, but also showed either BAK or BAX alone can mediate this process. More importantly, we found that GSDME was palmitoylated during chemotherapy-induced pyroptosis, while 2-BP could inhibit this process. Results {#Sec2} ======= BAK and BAX enable TNFα+CHX and navitoclax to induce pyroptosis {#Sec3} --------------------------------------------------------------- Previous studies have shown chemotherapy drugs induce pyroptosis through the GSDME cleavage^[@CR6],[@CR7]^, while bacteria or LPS induces pyroptosis through GSDMD cleavage^[@CR17]--[@CR19]^. Many cancer cells do not express GSDME due to its promoter methylation^[@CR28]--[@CR30]^. We first screened several cancer cell lines for the expression of GSDMD and GSDME (Fig. [1a](#Fig1){ref-type="fig"} and Supplementary Fig. [1a](#MOESM1){ref-type="media"}). The colorectal cancer cell line HCT116 was chosen because it expresses high levels of GSDME but not GSDMD (Fig. [1a](#Fig1){ref-type="fig"}).Fig. 1BAK/BAX deletion inhibits TNFα+CHX or navitoclax-induced pyroptosis.**a** Expresssion level of GSDMD and GSDME in various cell lines. **b** Expression of BAK/BAX in wild type (WT) and *BAK/BAX* double knockout (DKO) HCT116 cells. **c**, **d** At the indicated time points, the percentage of LDH release in the culture supernatants from HCT116 WT and DKO was measured after TNFα+CHX (**c**) or navitoclax (**d**) treatment. Error bars in this and subsequent figures: mean ± SD of three independent experiments. \**P* \< 0.05; \*\**P* \< 0.01; \*\*\**P* \< 0.001. **e**, **f** At the indicated time points, immunoblottings of GSDME, caspases, and cleaved caspases were performed in HCT116 WT and DKO cells treated with TNFα+CHX (**e**) or navitoclax (**f**). **g**, **h** After HCT116 WT and DKO cells were treated with TNFα+CHX (**g**) or navitoclax (**h**) for indicated time, representative microscopic images were taken. Scale bar in this and subsequent figures, 100 μm. **i**, **j** After TNFα+CHX (**i**) or navitoclax (**j**) treatment, HCT116 cells were collected at the indicated time points and stained with FITC-Annexin V and PI. The percentages of single PI positive, single FITC-Annexin V positive, and FITC-Annexin V/PI double positive HCT116 (WT or DKO) were detected by flow cytometry. Many anti-cancer drugs induce apoptosis through the BAK/BAX-dependent apoptosis pathway^[@CR31],[@CR32]^, however, whether this pyroptosis was dependent on BAK/BAX is not clear. To study this, wild type (WT) and BAK^−/−^BAX^−/−^ (DKO) HCT116 cells (Fig. [1b](#Fig1){ref-type="fig"}) were first treated with navitoclax, the BCL2, BCLxL, and BCLw inhibitor^[@CR33],[@CR34]^. After HCT116 cells were exposed to navitoclax (Supplementary Fig. [1b--d](#MOESM1){ref-type="media"}), we found navitoclax induced a concentration-dependent GSDME cleavage and also caspase-3, 7, and 9 cleavages (Supplementary Fig. [1b](#MOESM1){ref-type="media"}). Consistent with these observations, we observed the LDH release in WT HCT116 cells (Supplementary Fig. [1c](#MOESM1){ref-type="media"}) and pyroptotic morphologies, indicated by cell swelling and accompanied by large bubbles blown from the plasma membrane (Supplementary Fig. [1d](#MOESM1){ref-type="media"}). These observations together confirmed pyroptosis was induced in WT HCT116 cells upon navitoclax treatment. A time-course study of HCT116 cells treated with TNFα+CHX and navitoclax was further performed (Fig. [1](#Fig1){ref-type="fig"} and Supplementary Fig. [2](#MOESM2){ref-type="media"}). Both treatments induced a time-dependent pyrotosis in WT HCT116 cells, as indicated by the LDH release (Fig. [1c, d](#Fig1){ref-type="fig"}), the cleavage of GSDME (Fig. [1e, f](#Fig1){ref-type="fig"}), the observation of pyroptotic cell morphologies (Fig. [1g, h](#Fig1){ref-type="fig"}) and the increased percentages of Annexin V+ and/or PI+ cells (Fig. [1i, j, Table S1](#Fig1){ref-type="fig"} and Supplementary Fig. [2](#MOESM1){ref-type="media"}). In contrast to HCT116 WT cells, when DKO HCT116 cells were treated, both concentration-dependent and time-dependent pyroptosis were inhibited significantly, as indicated by the decrease of the percentage of LDH release (Fig. [1c, d](#Fig1){ref-type="fig"} and Supplementary Fig. [1c](#MOESM1){ref-type="media"}), the GSDME cleavage (Fig. [1e, f](#Fig1){ref-type="fig"} and Supplementary Fig [1b](#MOESM1){ref-type="media"}), the percentage of pyroptotic cell morphology (Fig. [1g, h](#Fig1){ref-type="fig"}), and the percentage of Annexin V+ and/or PI+ cells (Fig. [1i, j](#Fig1){ref-type="fig"}, Table [S1](#MOESM1){ref-type="media"} and Supplementary Fig [2](#MOESM1){ref-type="media"}). While GSDME has been suggested to be cleaved by activated caspase-3^[@CR6],[@CR7]^, we also observed the diminish of cleaved caspase-3, 7, and 9 in DKO HCT116 cells compared to WT (Fig. [1e, f](#Fig1){ref-type="fig"} and Supplementary [1b](#MOESM3){ref-type="media"}), in agreement with previous studies^[@CR35]^. We also tested these drugs in two other cell lines Hela and HeyA8 (Supplementary Figs. [3](#MOESM3){ref-type="media"} and [4](#MOESM4){ref-type="media"}), which also express high levels of GSDME. TNFα+CHX and navitoclax - induced time-dependent LDH release (Supplementary Fig. [3a, b](#MOESM1){ref-type="media"}) and pyroptotic cell morphorlogies in Hela cells (Supplementary Fig. [3c](#MOESM1){ref-type="media"}). Moreover, actinomycin D also induced Hela cell pyroptosis (Supplementary Fig. [4a, c](#MOESM1){ref-type="media"}). In HeyA8, which expressed both GSDME and GSDMD (Fig. [1a](#Fig1){ref-type="fig"}), TNFα+CHX induced a time-dependent LDH release and pyroptotic morphology (Supplementary Fig. [4b, d](#MOESM1){ref-type="media"}). These results suggested that anti-cancer drugs induce pyroptosis in multiple cancer cell lines. Among the above treatments, TNFα-induced caspase-3 activation could either directly induced by activated caspase-8 in Type I cells, or induced by the mitochondria pathway through BID cleavage in type II cells^[@CR36]--[@CR38]^. HCT116 has been previously reported to be a type II cell because of the low expression of cell surface death receptors^[@CR39],[@CR40]^. Consistent with this, BID knockdown attenuated the GSDME cleavage induced by TNFα+CHX but not navitoclax (Supplementary Fig. [5](#MOESM5){ref-type="media"}), further supporting the idea that BAK/BAX activation plays an essential role in chemotherapy-induced pyroptosis. Pyroptosis can be mediated by sole BAK or BAX {#Sec4} --------------------------------------------- To further assess the contribution of BAK and BAX in GSDME-dependent pyroptosis, BAK or/and BAX were knocked down by siRNAs (Fig. [2a](#Fig2){ref-type="fig"}). As shown in Fig. [2b](#Fig2){ref-type="fig"}, the LDH released by TNFα+CHX was signicantly inhibited by the knock-down of either BAK or BAX (except siBAK \#2 at 6 hour). Moreover, the LDH release by navitoclax was also decreased at 12 h by all the siRNAs, suggesting that both BAK and BAX contributed to the LDH release (Fig. [2c](#Fig2){ref-type="fig"}). In addition, both the single BAK and BAX knockdowns showed more LDH release than the BAK/BAX double knockdowns (Fig. [2b, c](#Fig2){ref-type="fig"}), again arguing that either BAK or BAX had the ability to induce LDH release. The phase-contrast images of morphology further supported the above results (Fig. [2d, e](#Fig2){ref-type="fig"}). Consistent with these observations, caspase-3, 7, 9 and the GSDME cleavage also decreased remarkably after BAK or BAX siRNA treatments (Supplementary Fig. [6](#MOESM6){ref-type="media"}). These observations aligned the view that BAK or BAX alone could mediate chemotherapy-induced pyroptosis.Fig. 2Either BAK or BAX knockdown decreases TNFα+CHX or navitoclax-induced pyroptosis.**a** Efficiency of BAK and/or BAX knockdown was detected by immunoblotting. **b--e** After BAK siRNA, BAX siRNA, BAK siRNA+BAX siRNA, or negative control siRNA were transfected into HCT116 cells by Lipofectamine RNAiMAX, cells were reseeded into 24-well plate followed by treatment of TNFα+CHX (**b**, **d**) or navitoclax (**c**, **e**) for 24 h. Culture supernatants were collected to measure the percentage of LDH release (**b**, **c**) and phase contrast images were taken (**d**, **e**) at the indicated time points. Caspase-3 activity is required in BAK/BAX-mediated pyroptosis {#Sec5} ------------------------------------------------------------- Activated caspase-3 have been reported to cleave GSDME to induce pyroptosis^[@CR6],[@CR7]^. Moreover, caspase-9 and subsequent caspase-3, 7 are all activated after chemotherapy-induced BAK/BAX activation^[@CR41],[@CR42]^. To identify the caspase(s) responsible for GSDME cleavage, the pan-caspase inhibitor Q-VD-OPh was first used. Pre-incubation of Q-VD-OPh not only abolished TNFα+CHX or navitoclax-induced caspase-3, 7, 9 and GSDME cleavage (Fig. [3a, b](#Fig3){ref-type="fig"}), but also diminished the LDH release in WT but not in DKO HCT116 cells at 12 h (Fig. [3c, d](#Fig3){ref-type="fig"}). The morphological changes also supported the above results (Supplementary Fig. [7a, b](#MOESM1){ref-type="media"}). Moreover, the percentage of Annxin V positive cells (but not PI positive or PI/Annexin V double positive cells) decreased significantly in the WT group after Q-VD-OPh pre-treated compared to the controls (Fig. [3e, f](#Fig3){ref-type="fig"} and Table [S2](#MOESM1){ref-type="media"}). To further specify if caspase-3 is critical, we knocked down caspase-3 in HCT116 cells (Fig. [3g](#Fig3){ref-type="fig"}). Indeed, knockdown of caspase-3 by two different siRNAs significantly reduced the LDH release induced by TNFα+CHX and navitoclax at 6 h (Fig. [3h, i](#Fig3){ref-type="fig"}). Moreover, pre-treatment of the caspase-3 specific inhibitor Q-DEVD-OPh treatment also significantly reduced the LDH release induced by TNFα+CHX and navitoclax (Supplementary Fig. [7c, d](#MOESM1){ref-type="media"}). Taken together, the results suggested caspase-3 was required for TNFα+CHX and navitoclax-induced pyroptosis.Fig. 3Caspase-3 is required for TNFα+CHX and navitoclax-induced pyroptosis.**a**, **b** Immunoblottings of GSDME, caspases, and cleaved caspases in HCT116 WT and DKO cells treated with TNFα+CHX (**a**) or navitoclax (**b**) in the absence or presence of Q-VD-OPh at the indicated time points were performed. **c**, **d** The percentage of LDH release in the culture supernatants from HCT116 WT and DKO was measured after TNFα+CHX (**c**) or navitoclax (**d**) treatments in the absence or presence of Q-VD-OPh at the indicated time points. **e**, **f** After HCT116 WT and DKO cells were treated with TNFα+CHX (**e**) or navitoclax (**f**) in the absence or presence of Q-VD-OPh, the percentages of single PI positive, single FITC-Annexin V positive, and FITC-Annexin V/PI double positive cells were detected by flow cytometry at the indicated time points. **g** Efficiency of caspase-3 knockdown was detected by immunoblotting. **h**, **i** After HCT116 WT cells were transfected with caspase-3 siRNAs followed by TNFα+CHX (**h**) or navitoclax (**i**) treatments, culture supernatants were collected to measure the percentage of LDH release. GSDME is crucial in anti-cancer drug-induced pyroptosis {#Sec6} ------------------------------------------------------- Further, two siRNAs targeting GSDME were applied. While more than 50% of GSDME was knocked down by either siRNA (Fig. [4a](#Fig4){ref-type="fig"}), the knockdown cells displayed lower levels of both uncleaved and cleaved GSDME after TNFα+CHX or navitoclax treatments (Fig. [4b, c](#Fig4){ref-type="fig"}). Moreover, the caspase-3, 7, and 9 cleavage were not decreased and even increased compared to the control cells (Fig. [4b, c](#Fig4){ref-type="fig"}), in agreement with the idea that GSDME cleavage was downstream of caspases activations^[@CR6],[@CR7]^. More caspase-3, 7, and 9 cleavages were observed after GSDME knockdown, which might because more living cells with caspase activations were harvested when pyroptosis was blocked. Furthermore, TNFα+CHX and navitoclax-induced LDH releases were significantly reduced in GSDME knockdown cells (Fig. [4d, e](#Fig4){ref-type="fig"}), suggesting that the LDH release was downstream of GSDME cleavage^[@CR6],[@CR7]^. In addition, cells with pyroptotic morphology also decreased apparently after GSDME knockdown (Fig. [4f--i](#Fig4){ref-type="fig"}). Taken together, these results suggested that GSDME played a key role in BAK/BAX-caspase-3 mediated pyroptosis induced by TNFα+CHX and navitoclax.Fig. 4GSDME knockdown decreases pyroptosis induced by TNFα+CHX or navitoclax.**a** Efficiency of GSDME knockdown was detected by immunoblotting. **b**--**e** After HCT116 cells were transfected with GSDME siRNAs and negative control, cells were reseeded and treated with TNFα + CHX (**b, d**) or navitoclax (**c, e**) for the indicated time. The cells were collected for immunoblotting analysis (**b**, **c**) and culture supernatants were collected to detect the percentage of LDH release (**d**, **e**). **f**--**i** After HCT116 cells were transfected with GSDME siRNAs and negative control siRNA, cells were reseeded and treated with TNFα+CHX (**f**, **g**) or navitoclax (**h**, **i**). Phase contrast images were taken at the indicated time points (**f**, **g**) and the percentage of pyroptotic cells was calculated (**h**, **i**). GSDME is modified during anti-cancer drug-induced pyroptosis {#Sec7} ------------------------------------------------------------ TNFα+CHX and navitoclax not only induced pyroptosis in HCT116 cells, but also in Hela cells and HeyA8 (Supplementary Figs. [3](#MOESM1){ref-type="media"} and [4](#MOESM1){ref-type="media"}). The anti-cancer drugs induced GSDME cleavage was further investigated in these cells (Fig. [5a--d](#Fig5){ref-type="fig"}). In Hela cells, a time dependent of GSDME cleavage upon TNFα+CHX treatment was observed (Fig. [5a](#Fig5){ref-type="fig"}). However, cleaved GSDME decreased after 6 h treatment, which might be because of the cell death or the further degradation of the GSDME fragments. Interestingly, after TNFα+CHX treatment, not only the degradation of GSDME, but a shift of the GSDME-C band at 3 h was also found, suggesting a potential modification. This shifted band of GSDME-C was also observed upon other chemotherapy treatments or in other cell lines, such as in Hela cells treated with actinomycin D, or in HeyA8 and Ovcar3 cells treated with TNFα+CHX (Fig. [5b--d](#Fig5){ref-type="fig"}). Knock-down of GSDME with two different siRNAs confirmed that both bands of GSDME-C were specific (Supplementary Fig. [8a](#MOESM1){ref-type="media"}). Although GSDME-C could be recognized by the GSDME antibody in western blotting (Fig. [5a--d](#Fig5){ref-type="fig"} and Supplementary Fig. [8a](#MOESM1){ref-type="media"}), it could not be harvested in an immuno-precipitation assay using the same antibody (Supplementary Fig. [8b](#MOESM1){ref-type="media"}), limiting our further identification.Fig. 5GSDME is modified during anti-cancer drug-induced pyroptosis.**a**, **b** After Hela cells were treated with TNFα+CHX (**a**) or actinomycin D (**b**) for the indicated time, the cells were subjected to immunoblotting. **c**, **d** TNFα+CHX treated Ovcar3 and HeyA8 cells for the indicated time and then harvested for immunoblotting. **e** The potential palmitoylation sites were predicted by CSS-Palm 4.0. **f** Sequence alignment of the potential palmitoylation site of GSDME from Danio rerio to Homo sapiens. Asterisk represents the conserved Cysteine residues were highlighted. **g**, **h** After Hela cells were pre-incubated with broad-spectrum palmitoylation inhibitors 2-BP followed by the treatment of TNFα+CHX for the indicated time, the cells were subjected to immunoblotting (**g**). Numbers indicated the ratio of optical density of shifted GSDME-C band to the unshifted GSDME-C band were obtained from four independent assays by using ImageJ software (**h**). GSDME is normally cytosolic, and the inhibitory C-terminal domain is cleaved by activated caspase-3 during pyroptosis, resulting in the translocation of GSDME-N to the plasma membrane^[@CR6],[@CR7]^. While palmitoylation has been predicted to modify the gasdermin family proteins^[@CR43]^, we speculated that the GSDME modification might be palmitoylation. To test the idea, the potential palmitoylation sites on GSDME was predicted using CSS-Palm 4.0. We first test several known palmitoylated proteins on this program, such as CD9, CLIP3, HRAS, RHOB, GRK6, GAP43, CKAP4, NRAS, and TGS4, all of which indicated positive results and the right palmitoylation sites (Table [S4](#MOESM1){ref-type="media"}). Further analysis also indicated GSDME could be palmitoylated, while residues C407 and C408 were the targeted sites (Fig. [5e](#Fig5){ref-type="fig"}), both of which were conserved from Danio rerio to Homo sapiens (Fig. [5f](#Fig5){ref-type="fig"}). Moreover, pre-treatment of 2-BP, the palmitoylation inhibitor, caused a significant decrease of this shifted GSDME-C band (Fig. [5g, h](#Fig5){ref-type="fig"}), supporting the idea that the GSDME-C modification was palmitoylation. 2-BP inhibited TNFα+CHX induced pyroptosis but not total cell death {#Sec8} ------------------------------------------------------------------- To assess the effect of 2-BP on TNFα+CHX induced Hela cell death, Annexin V/PI double staining assay was first used (Fig. [6a](#Fig6){ref-type="fig"} and Table [S3](#MOESM1){ref-type="media"}). Between solvent group and 2-BP group, no significant differences were observed in total cell death (Annexin V+ and/or PI+). However, less PI+ cells were detected by flow cytometry and fluorescence microscope in 2-BP group (Fig. [6a--c](#Fig6){ref-type="fig"} and Table [S3](#MOESM1){ref-type="media"}). Because one of the major differences between pyroptosis and apoptosis is the integrity of plasma membrane^[@CR9]^, the PI+ cells in a short time point might represent pyroptosis better than apoptosis. Thus, 2-BP significantly inhibited TNFα+CHX induced pyroptosis, but not apoptosis. We also found the release of LDH was significantly decreased in the 2-BP treated group compared to control at 9 h and 12 h (Fig. [6d](#Fig6){ref-type="fig"} and Supplementary Fig. [9](#MOESM9){ref-type="media"}), further supporting the idea that 2-BP could inhibit TNFα+CHX induced pyroptosis.Fig. 62-BP treatment inhibited TNFα+CHX induced pyroptosis.**a** After 2-BP and TNFα+CHX treatment, Hela cells were collected at the indicated time points and stained with FITC-Annexin V and PI. The percentages of single PI positive, single FITC-Annexin V positive and FITC-Annexin V/PI double positive cells were detected by flow cytometry. **b**, **c** After 2-BP and TNFα+CHX treatment for the indicated time, Hela cells were subjected to Hoechst 33342 and PI double staining. Fluorescent microscopic images were taken at the indicated time points (**c**) and the ratio of PI positive cells were determined by Image J software (**b**). **d** After Hela cells were treated with 2-BP and TNFα+CHX for the indicated time, the culture supernatants were collected to measure the percentage of LDH release. **e**, **f** After Hela cells were transfected with GSDME WT or C407A/C408A mutant followed by the treatment of TNFα+CHX for the indicated time, cells and supernatants were collected for immunoblotting with anti-GSDME and anti-*β*-actin antibodies (**e**) and LDH detection (**f**). **g** 24 h after 3× Flag-tagged GSDME-N and WT or mutated S-tagged GSDME-C were co-transfected, Hela cells were treated with DMSO or 2-BP for 6 h, then cells were harvested for co-immunoprecipitations by anti-Flag antibody. The inputs were also subjected to immnuoblotting to show the expression levels. Asterisk represents unspecific band. The predicted palmitoylation sites on GSDME were then mutated to alanine and transfected into Hela cells 24 h followed by TNFα+CHX treatments. A shift of the GSDME-C band was again observed in the WT GSDME transfected cells (Fig. [6e](#Fig6){ref-type="fig"}). Moreover, when the potential palmitoylation sites C407/C408 were mutated, the shifted GSDME-C band was diminished (Fig. [6e](#Fig6){ref-type="fig"}), providing further evidence that this shifted GSDME-C band was a palmitoylation. However, the shifted band was not abolished, suggesting GSDME may exist other palmitoylation sites or even other posttranslational modifications. Further, compared to the overexpression of WT GSDME, the palmitoylation site mutated GSDME also induced less LDH release at both 3 h and 6 h (Fig. [6f](#Fig6){ref-type="fig"}). C-terminal of GSDMD (GSDMD-C) can still bind to GSDMD-N after cleavage to inhibit its pro-pyroptotic functions^[@CR18]^. Therefore, 2-BP might inhibit pyroptosis through two possible mechanisms: by inhibiting the GSDME conformation change, which affects the identification and binding between caspase-3 and GSDME; or by inhibiting the modification of GSDME-C, which might facilitate the inhibitory GSDME-C release from GSDME-N after cleavage. Neither 2-BP treatment nor the palmitoylation site mutant inhibited GSDME cleavage (Figs. [5g and 6e](#Fig6){ref-type="fig"}), suggesting 2-BP might inhibit pyroptosis through the latter mechanism. To test this, a co-immunoprecipitation assay was performed. As shown in Fig. [6g](#Fig6){ref-type="fig"}, in the control group, the interaction between GSDME-N and GSDME-C was barely visible (lane 2). In contrast, interactions between GSDME-N and GSDME-C were observed in both 2-BP pretreated group or in the palmitoylation site mutant group (lane 3 and 4), supporting the idea that palmitoylation facilitated their dissociations. Several ZDHHC family proteins interact and palmitoylate GSDME {#Sec9} ------------------------------------------------------------- Palmitoylation is catalyzed by a family of enzymes that share a DHHC domain^[@CR44]^. There are 23 ZDHHC proteins (ZDHHC1-24, ZDHHC10 is omitted) in humans^[@CR44]--[@CR46]^. As shown in Fig. [7a](#Fig7){ref-type="fig"}, the co-immunoprecipitation assay indicated ZDHHC 2/4/6/7/11/12/15/22/23 could interact with GSDME. Moreover, a reverse co-immunoprecipitation assay supported the interactions (Fig. [7b](#Fig7){ref-type="fig"}). Previous studies have shown ZDHHC proteins have different intracellular localizations^[@CR22]^. Using the immunohistochemistry results from the Human Protein Atlas (HPA)^[@CR47]^, ZDHHC-4/12/23 only expressed in nucleus and ZDHHC-22 did not express in both colorectal cancer (CRC) and cervical cancer (CESC), which did not match the subcellular distribution of GSDME (Fig. [7c, d](#Fig7){ref-type="fig"}). Thus, ZDHHC-2/6/7/11/15 were potential enzymes to interact with and palmitoylate GSDME.Fig. 7GSDME interacts with ZDHHCs.**a**, **b** After 3×Flag-tagged GSDME and indicated HA-tagged ZDHHCs were co-transfected into 293T cells, co-immunoprecipitations were performed using an anti-Flag antibody (**a**) or an anti-HA antibody (**b**). The inputs were also subjected to immunoblotting to show the expression levels. **c** The expression of GSDME and different ZDHHCs in CESC and CRC were summarized based on the immunohistochemistry results from the Human Protein Atlas. **d** Venn diagram was performed to show the expression patterns of different ZDHHCs in CESC and CRC, including expression level and subcellular distributions. **e** 24 h after Hela cells transfected with the indicated ZDHHC plasmids and then cells were incubated with actinomycin D for the indicated time. The cells were collected for immunoblotting. Numbers indicated the ratio of optical density of shifted GSDME-C band to the unshifted GSDME-C band. Arrows indicated the expression of different ZDHHC proteins. Hela cells were then transfected with ZDHHC-2/6/7/11/15 respectively, and treated with actinomycin D, which induced a slower palmitoylation of GSDME-C compared to TNFα+CHX (Fig. [5a, b](#Fig5){ref-type="fig"}). In contrast to empty vector, after the transfection of ZDHHC-2/7/11/15 but not ZDHHC-6, the shifted band of GSDME-C increased (Fig. [7e](#Fig7){ref-type="fig"}), suggesting that GSDME-C could be palmitoylated by ZDHHC-2/7/11/15, and also providing further evidences that the shifted band of GSDME-C was a palmitoylation. Taken together, the results in Fig. [7](#Fig7){ref-type="fig"} suggested ZDHHC-2/7/11/15 could interact with and palmitoylate GSDME-C during chemotherapy treatments. Discussion {#Sec10} ========== In the present study, we found that several chemotherapy drugs induced cancer cell pyroptosis were mediated by the BAK/BAX-caspase-3-GSDME pathway. Furthermore, GSDME was palmitoylated on its C-terminal (GSDME-C) to promote its dissociation from GSDME-N during treatments, resulting in increased chemotherapy drug-induced pyroptosis. The palmitoylation inhibitor 2-BP could therefore inhibit chemotherapy drugs induced pyroptosis. These results suggested a model shown in Fig. [8](#Fig8){ref-type="fig"}.Fig. 8The model of chemotherapy-induced pyroptosis was indicated.MOMP pathway inducers, such as TNFα+CHX, navitoclax and etoposide can activate BAK/BAX to permeabilize the MOM and release cytochrome c into the cytosol. Cytochrome c then activates caspase-9 and subsequent caspase-3, which will cause cell apoptosis or pyroptosis. In pyrototic pathway, GSDME is cleaved by caspase-3 to gnenrate GSDME-N and GSDME-C, where GSDME-N could directly oligomerize and cause plasma membrane lysis. Palmitoylation inhibitors inhibit GSDME-C palmitoylation, therefore inhibit its dissociation from GSDME-N and subsequent pyroptotic characteristics, including LDH release and the formation of plasma membrane bubbles. At least three different pathways have been reported to initiate pyroptosis. The first is a pathogen-induced pyroptosis pathway, in which bacteria and microbial infections caused the activation of caspase-1/4/5/11 followed by the cleavage of GSDMD, resulting in the pore formation on the cell plasma membrane^[@CR17]--[@CR19],[@CR48]^. The second is also initiated by pathogens, where cytosolic LPS causes the caspase-11 dependent cleavage of pannexin-1 followed by the activation of the purinergic receptor P2X ligand-gated ion channel (P2X7), resulting in intracellular ATP release^[@CR49]^. The third is induced by chemotherapy drugs in cancer cells, where activated caspase-3 induced GSDME cleavage^[@CR6],[@CR7]^. Moreover, the caspase-1-GSDMD mediated pyroptosis pathway is different from the caspase-3-GSDME pathway, because the latter cannot induce IL-1β activation and release^[@CR50]^. In this study, we found TNFα+CHX, and navitoclax both induced pyroptotic cell morphologies, LDH release and GSDME cleavage, suggesting pyroptosis was induced by both drugs. Because caspase-3 was activated in this process, we think both pyroptosis and apoptosis were induced. Apoptotic cells theoretically keep the integrity of the cell membrane, thus the PI+ cells might represent pyroptotic cell death more than apoptotic cell death (Fig. [1i, j](#Fig1){ref-type="fig"} and [Supplementary Fig. 2](#MOESM3){ref-type="media"}). On the other hand, due to some other forms of cell death also exhibit PI+, a more specific marker for pyroptotic cell death is still urgently needed. GSDME knockdown not only diminished the pyroptotic morphology induced by TNFα+CHX and navitoclax, but also diminished the LDH release after both treatments, suggesting the important role of GSDME in the induction of pyroptosis, in agreement with previous studies^[@CR7],[@CR51],[@CR52]^. Although GSDME knockdown significantly decreased the LDH release and pyroptotic morphology, however, both were not completely diminished in our study, which might because GSDME was only about half knocked-down. Upstream of the cleavage of GSDME, chemeotherapy drugs such as cisplatin, topotecan, and doxorubicin have been reported to activate pro-apoptotic caspase-3^[@CR7]^. In this study, we found that the pan-caspase inhibitor Q-VD-OPh could completely abolish the pyroptosis (Fig. [3](#Fig3){ref-type="fig"}), in agreement with the essential role of caspases in pyroptosis^[@CR6],[@CR7],[@CR17]--[@CR19]^. Moreover, when caspase-3 was knocked down or specifically inhibited, the pyroptosis induced also significantly decreased, suggesting that caspase-3 was essential. The treatments of TNFα+CHX^[@CR39]^ and navitoclax^[@CR53]^ have been previously reported to activate MOMP effector proteins BAK and BAX, thereby causing the cytochrome c release. Our results supported the idea that BAK and BAX activation were upstream of GSDME cleavage (Fig. [1](#Fig1){ref-type="fig"} and Supplementary Figs. [1](#MOESM1){ref-type="media"} and [2](#MOESM1){ref-type="media"}). Further, our results indicated that either BAK or BAX knockdown could attenuate but not abolish the LDH release, the GSDME cleavage and pyroptotic morphology (Fig. [2](#Fig2){ref-type="fig"} and Supplementary Fig. [6](#MOESM6){ref-type="media"}), suggesting that sole BAK and BAX could activate the caspase cascade and subsequent pyroptosis pathways. Although GSDME have been reported to participate the chemotherapy-induced pyroptosis^[@CR6],[@CR7]^, however, how this process is regulated is not clear. Interestingly, a shift of GSDME-C was observed on the western blotting during TNFα+CHX treatment, suggesting a potential modification. We have tried to harvest this GSDME-C fraction (Supplementary Fig. [8b](#MOESM1){ref-type="media"}) for further identification (i.e. Mass Spectrum), however, the immuno-precipitation assay could only harvest the GSDME-N, but not GSDME-C. Previous studies have shown one of the gasdermin family proteins GSDMA could be palmitoylated, thus we speculated whether this band admits the same modification. Firstly, using CSS-Palm 4.0, GSDME was indicated to be palmitoylated at C407/C408. Secondly, when the palmitoylation inhibitor 2-BP or potential palmitoylation site mutations were applied (Figs. [5g](#Fig5){ref-type="fig"} and [6e](#Fig6){ref-type="fig"}), this shifted band was diminished, suggesting that the modification was a palmitoylation. Finally, some palmitoylation enzymes (ZDHHC proteins) were found to interact with GSDME and induce the GSDME-C band shift (Fig. [7](#Fig7){ref-type="fig"}), further supporting the idea that GSDME was palmitoylated by these enzymes. Although these experiments support this modification is a palmitoylation of GSDME-C, a mass spectrum experiment is needed to further confirm this idea in the future. Palmitoylation is a kind of posttranslational modification that adds saturated 16-carbon palmitic acid to specific cysteine residues, which may influence GSDME-dependent pyroptosis. Posttranslational modifications are found in many other cell death mechanisms, for example, the core necroptotic execution protein MLKL (mixed lineage kinase domain-like protein) was phosphorylated by RIPK3 before its membrane association^[@CR54],[@CR55]^. Therefore, the role of GSDME palmitoylation on drug-induced pyroptosis was investigated. Indeed, this palmitoylation could promote TNFα+CHX induced pyroptosis, which was supported by at least two pieces of evidence. First, cells pre-incubated with palmitoylation inhibitor 2-BP, decreased the LDH release and the PI positive cells after TNFα+CHX treatment (Fig. [6b--d](#Fig6){ref-type="fig"} and Supplementary Fig. [9](#MOESM9){ref-type="media"}). Second, the predicted palmitoylation site mutant C407A/C408A also released less LDH compared to WT GSDME after TNFα+CHX treatment (Fig. [6f](#Fig6){ref-type="fig"}), although this GSDME mutant still induced high percentage of LDH release after TNFα+CHX treatment (Fig. [6f](#Fig6){ref-type="fig"}), which might due to the existence of high endogenous GSDME expression (Fig. [1a](#Fig1){ref-type="fig"}). Further experiments, such as the usage of GSDME knock-out cells or cells without GSDME expressing might help reduce the effect of endogenous GSDME. On the other hand, we could not rule out the possibility that there may exist other palmitoylation sites or even other kind of posttranslational modifications, because the shifted GSDME-C band and LDH release were not totally inhibited in the mutant group (Fig. [6e, f](#Fig6){ref-type="fig"}). Although we observed several evidences of the transformation of cell death from pyroptosis to apoptosis, such as the PI+ positive cells were decreased while the total cell death were not changed, however, due to the limited probes to discern the two types of cell death, the effect is not big. On the other hand, as previously indicated, TNFα+CHX induced HCT116 cell death includes both pyroptosis and apoptosis, which also limited the phenomenon. Nonetheless, 2-BP transformed part of pyroptotic cells to apoptotic. After cleavage, the active N-terminal of gasdermin family protein translocates and binds to the lipid bilayers of plasma membrane to induce LDH release and the pyroptotic morphology^[@CR56]--[@CR59]^. Moreover, previous study has found the C-terminal of GSDMD can still be an inhibitory of its N-terminal after cleavage, which inhibits its pro-pyroptotic function^[@CR18]^. We found that both the palmitoylation inhibitors and the palmitoylation site mutant increased the interaction of GSDME-C to GSDME-N (Fig. [6g](#Fig6){ref-type="fig"}), providing a potential explanation for the promoted pyroptosis by GSDME-C palmitoylation. Finally, palmitoylation have shown to be promising targets in the treatment of melanoma^[@CR60]^ and breast tumor^[@CR61]^. In our study, we found the palmitoylation inhibitor 2-BP diminished the pyroptosis induced by chemotherapy drugs. Our results indicated 2-BP inhibited chemotherapy-induced pyroptosis (Fig. [6b, c](#Fig6){ref-type="fig"}). However, the total cell death were not changed (Fig. [6a](#Fig6){ref-type="fig"}), suggesting 2-BP transformed pyroptotic cells to apoptotic. When caspase-3 was activated, cells could either become apoptotic or pyroptotic, depending on GSDME activation (Fig. [8](#Fig8){ref-type="fig"}), therefore, the inhibition of pyroptosis downstream of caspase-3 will transform the cells to apoptosis. While pyroptosis was suggested to be involved in the chemotherapy-induced reverse effects such as disruption of the immune system and weight loss in animal studies, our findings offered new targets to achieve the transformation between chemotherapy-induced pyroptosis and apoptosis. In summary, we identified that BAK and BAX were required for TNFα+CHX and navitoclax-induced pyroptosis and sole BAK or BAX could mediate this process. Moreover, caspase-3 activation and GSMDE cleavage were essential in this pyrotosis pathway. In addition, GSDME-C was found to be palmitoylated by several ZDHHC proteins, which promoted drug-induced pyroptosis. The palmitoylation inhibitor 2-BP could inhibit GSDME-C palmitoylation, and therefore inhibit chemotherapy-induced pyroptosis. Materials and methods {#Sec11} ===================== Antibodies and reagents {#Sec12} ----------------------- Antibodies for GSDME (ab225893) and GSDMD (ab209845) were purchased from Abcam. Antibody for β-acin (TA811000) was purchased from OriGene. Antibody for S-tag was kindly gifted by Scott H. Kaufmann (Mayo Clinic, Rochester, MN). Antibody for Flag-tag (F4049) was from Sigma-Aldrich. Other antibodies used in this study include Caspase-1 (2225S), Caspase-3 (9662S), cleaved Caspase-3 (9664S), Caspase-7 (12827S), Caspase-9 (9502S), BAK (12105S), BAX (5023S), BID (8762S), and HA tag were purchased from Cell Signaling Technology (CST). The secondary antibodies including horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (7074S) and HRP-conjugated goat anti-mouse IgG (7076S) were from CST. Reagents were purchased as followings: recombinant human TNFα (rcyc-htnfs) from InvivoGene; cycloheximide (HY-12320), navitoclax (HY-10087), actinomycin D(HY-17559), broad spectrum caspase inhibitor Q-VD-OPh (HY-12305) from MedChemExpress; caspase-3 inhitor Q-DEVD-OPh (1175-1) from Biovision, protease inhibitor cocktail tablets (04693132001) from Roche; protein G sepharose (17-0618-01) from GE Healthcare; Lipofectamine 2000 (11668-019) and Lipofectamine RNAiMAX (13778-150) from Invitrogen; anti-Flag M2 magnetic beads (M8823) and 2-BP (238422) from Sigma-Aldrich; CytoTox 96 Non-Radio cytotoxicity assay kit (G1780) from Promega; Hoechst 33342/PI double stain kit (CA1120) from Solarbio; and FITC annexin V appotosis kit I (556547) from BD Biosciences. Cell culture and treatments {#Sec13} --------------------------- The human colon cancer cell lines HCT116 wild type and *BAK*^−/−^*BAX*^−/−^ (DKO), the mouse embryonic fibroblasts MEFs, the human ovarian cancer cell lines including Ovcar3, Ovcar5, Ovcar8, A2780, HeyA8, OV90, COV362, SKOV3, Ovise, and the hematoma cell lines including V937, MOLT-3, MOLT-4, THP-1, SKW6.4, H9, Jurkat, K562, KG1a, RL, ML-1, HL-60, HT, and MV4-11 were kind gifts from Scott H. Kaufmann (Mayo Clinic, Rochester, MN). The mouse macrophage cell lines Raw264.7, Raw264.7-ASC, and the iBMDM (immortalized bone-marrow-derived macrophages) were kindly gifted by Jiahuai Han (Xiamen University, China). The human cervical cancer cell line Hela was gifted by Xin Ye (Institute of Microbiology, Chinese Academy of Sciences). The human embryonic kidney cell line 293T and lung cancer cell line A549 were purchased from CCTCC (China Center for Type Culture Collection). Cell characterization (polymorphic short tandem repeat profiling) and contamination tests were performed. The wild type and DKO HCT116 cells were maintained in McCoy's 5 A; the 293 T, Hela, MEFs, iBMDM, Raw264.7, and A549 were maintained in DMEM; and all the ovarian cell lines and the lymphohematopoietic cell lines were grown in RPMI-1640. All cells were cultured at 37 °C with 5% CO~2~, supplemented with 10% FBS (fetal bovine serum, FB25015, Clark) and 1% PS (penicillin-streptomycin, SV30010, Hyclone). For navitoclax or TNFα+CHX treatments, cells were pre-seeded overnight until cell density reached \~60%. The culture medium was switched to fresh medium containing relevant drugs and incubated for a period of time as indicated. To inhibit caspase activity or palmitoylation, cells were pre-incubated for 1 h with Q-VD-OPh or 2-BP, respectively. Unless otherwise specified, the concentrations of the drugs used are: 2 μM for navitoclax, 20 ng/mL for TNFα, 10 μg/mL for CHX, 50 μM for Q-VD-OPh, 50 μM for 2-BP, and 50 μM for actinomycin D. Plasmids and transfection {#Sec14} ------------------------- The plasmids encoding HA-tagged ZDHHCs were kindly gifted from Xu Wu (Harvard Medical School, Boston, USA). The plasmid encoding 3× Flag tagged GSDME was kindly gifted by Feng Shao (National Institute of Biological Sciences, Beijing, China). Mutations were generated by site-direct mutagenesis using Fast Mutagenesis Systm (FM111-01) from Transgen. All plasmids were verified by DNA sequencing. Transient transfection of 293T and Hela cells were performed using Lipofectamin 2000 following the manufacturer's instructions. Briefly, log phase cells growing in antibiotic-free medium were transiently transfected with the indicated plasmids with a ratio of plasmids: reagent at 1:2 (W/V). After incubation in antibiotic-free medium for 6 h followed by complete medium for another 24 h, cells were treated with drugs or solvent as indicated. At the completion of the incubation, cells were harvested for western blotting and flow cytometry, or the culture supernatants were harvested for the measurement of the percentage of LDH release. RNA interference {#Sec15} ---------------- The siRNA sequences were shown in Table [S5](#MOESM1){ref-type="media"}. For siRNA knockdown, HCT116 cells were cultured to \~60% confluence at the time of transfection. Transfection of siRNA was performed using the Lipofectamine RNAiMAX according to the manufacturer's protocol. The transfected cells were grown in antibiotic-free medium for 24 h and then re-seeded for further 24 h before drug treatments. The knockdown efficiency was examined by immunoblotting. Microscopy images {#Sec16} ----------------- Cells were seeded in 6-, 12-, or 24-well plates. After treatments, static bright field images of indicated cells were captured using an Olympus CKX53 at room temperature supplemented with TCapture in blinded experiments. The pictures were processed using ImageJ software. Pyroptotic cells (cells with large bubbles) were counted from 200 random cells under microscopic fields in blinded experiments and the percentage was calculated using the equation pyroptotic cells/total cells × 100% from three independent experiments. Hoechst 33342/PI double staining {#Sec17} -------------------------------- Cells were seeded in 24-well plates for 24 h and followed by treated as indicated. The cells were then stained with Hoechst 33342 (1 μg/μL) and PI (1 μg/μL) for 30 min at 4 °C. After that, the Leica DMI4000B was used to visualize and take pictures. Three fields per well were randomly selected for counting the stained cells by Image J software. LDH release assay {#Sec18} ----------------- Cells were seeded in 6-, 12-, or 24-well plates and treated as indicated. Culture supernatants were harvested and centrifuged at 300×*g* for 10 min after treatments. Aliquots of supernatants were transferred into 96-well plates, and subjected to the CytoTox 96 assay kit. The percentage of LDH release was calculated using the equation (LDH~sample~ − LDH~background~)/(LDH~maximum~−LDH~background~) × 100%, where LDH~sample~, LDH~background~, and LDH~maximum~ are the OD~490~ measured for the drug treated, untreated, and lysis solution (provided in the kit) treated supernatants, respectively. Each sample was tested in triplicates to obtain the average. Western blotting {#Sec19} ---------------- Both cells and culture supernatants were harvested for western blotting. After washing, cell sediments were lysed in RIPA lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS) with cocktail, and sonicated. The total protein concentration was measured by BCA protein assay kit (P0011, Beyotime). Samples were denatured in sample loading buffer (50 mM Tris-HCl, pH 6.8, 2% SDS (W/V), 0.1% BPB (W/V), 10% glycerol (V/V), and 1% β-mercaptoethanol (V/V)). Samples were then separated by SDS-PAGE and transferred to PVDF membranes followed by blocking. The membrane was then incubated overnight with primary antibody against indicated proteins, followed by incubated with HRP-conjugated secondary antibodies. All proteins were visualized with the Tanon High-sig ECL Western Blotting substrate (180-501, Tanon, China). The gray-scale values of GSDME-C and shifted GSDME-C were captured by ImageJ. Flow cytometry {#Sec20} -------------- Cells were seeded to density about \~60% before drug treatments. Cells were harvested, washed with cold PBS, and stained with the FITC-labeled Annexin V and PI using the FITC Annexin V appotosis kit I. Data was obtained using CytoFLEX (Beckman Coulter) and analyzed by CytExpert software. Co-immunoprecipitation {#Sec21} ---------------------- In all, 24 h after transfection, cells were harvested and lysed in lysis buffer (20 mM Tris (pH 7.5), 150 mM NaCl, 1% Triton X-100) containing a protease inhibitor cocktail. In total, 1000 μg of supernatants were incubated with Flag magnetic beads or protein G beads pre-coupled with HA antibody at 4 °C overnight. After washing, beads bound proteins were then released by heating them for 15 min at 100 ºC in sample loading buffer. Samples were subjected to western blotting and probed with the indicated antibodies. Statistical analysis {#Sec22} -------------------- All data was analyzed using GraphPad Prism software. Data was shown as means ± SD. The levels of significance for comparison between samples were determined by Student's *t*-test. *P* \> 0.05 was considered not significant (ns). \**P* \< 0.05, \*\**P* \< 0.01, \*\*\**P* \< 0.001. Supplementary information ========================= {#Sec23} Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Figure 7 Supplementary Figure 8 Supplementary Figure 9 Supplementary Figure Legends Edited by M. Agostini **Publisher's note** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. These authors contributed equally: Lei Hu, Meng Chen Supplementary information ========================= **Supplementary Information** accompanies this paper at (10.1038/s41419-020-2476-2). This work is supported by the National Natural Science Foundation of China (No. 21772201, No. 81572948), and the innovative program of Development Foundation of Hefei Center for Physical Science and Technology (2018CXFX007). We thank Kaufmann SH, Jiahuai Han, and Xin Ye for the cell lines, and Xu Wu and Feng Shao for the ZDHHCs and GSDME plasmids. H.D. conceived and designed the study. L.H., M.C., X.C., C.Z., Z.F., and H.W. performed the experiments. H.D. and L.H. wrote the paper. All authors reviewed the manuscript. The authors declare that they have no conflict of interest.
2023-12-19T01:26:58.646260
https://example.com/article/3969
Category: Fitness Nowadays, it is very alarming that a huge number of people all over the world are considered obese. Some people may think that it is just a simple condition. But the thing is, it is not just all about being overweight. Obesity comes with several health problems and most of these are life threatening. So, if you have weighed yourself out lately and you know for a fact that your weight is no longer healthy, you should take the necessary steps as early as possible. Do not wait for the time when you can already feel the symptoms of health conditions like heart disease, diabetes, and other ailments that are related to being overweight. You need to find the best way on how to fight obesity. How you can fight obesity There are so many ways on how to fight obesity. The first thing that you need to focus on is, of course, your weight. You should come up with a diet plan that is effective in getting rid of the extra pounds. You can even utilize weight loss supplements like Pure Cambogia Ultra. Here are some great tips on how to fight obesity. Observe proper nutrition Take a look at the foods that you have been eating. Which of them are healthy and which are not? Are you into junk foods? If you are, that is one of the biggest things that you need to eliminate. When you say ‘junk foods’, it doesn’t refer to only the candies and chips that you are consuming. It includes all the unhealthy foods that you are taking in everyday. With the help of supplements, there is no doubt that you will be able to achieve a healthier weight in no time as long as you also observe proper nutrition. Instead of dwelling on fatty foods and other unnecessary snacks, you should increase your intake of fresh fruits and vegetables. Increase your activity level Having a sedentary lifestyle is not healthy at all. Instead of you sitting on the couch watching TV all day long, you should start increasing your activity level. There are many exercises and physical activities that you can engage yourself in. You can always go to the gym and work out for, at least, one or two hours. If you do this regularly, you will be able to increase your metabolism, which will make it easier for you to shed the extra pounds.
2024-02-24T01:26:58.646260
https://example.com/article/4547
Q: Stored value generating [object HTMLInputElement] I have an indexedDB and using it for a login function. I'm trying to populate a form with the users information when they log in. However the form populates with [object HTMLInputElement] instead of the users info. This is where I take the user (db key) to access the Object (the user) EDITThis is my site where it's running: http://www3.carleton.ca/clubs/sissa/html5/admin.html My site editor is updating it as I save, so there may be changes to the site script as I try new things. This is where I take the user (db key) to access the Object (the user) function loginCheck(user,pass){ db.transaction("users").objectStore("users").get(user).onsuccess = function(event) { var loggedUser = event.target.result; if(!loggedUser){ alert('Sorry, Username does not exist. Please try again.'); }else if(pass !== loggedUser.pw ){ alert('Incorrect log in combination. Please try again.'); }else{loggedIn(loggedUser);} } } function loggedIn(loggedUser){ var u=loggedUser; alert('Welcome '+u.fn+' '+u.ln+' to Macroplay'); //function to populate fields alert('get values called'); getValues(u); //session store var signedin = 'user'; var username = u.userName; newLocal(signedin,username); alert('local storage set'); } I use this function getValues to store the various fields I want from the object. EDIT: I declared the variable test as global and stored the users first name (fn). The alerts show the correct name but the populate still gives me undefined. var test; function getValues(loggedUser){ var u = loggedUser; alert('storing first name'); test = u.fn; alert('First name = '+test); lName = u.ln; users = u.userName; pass = u.pw; email = u.em; dob = u.dob; tel = u.tel; bio = u.bio; school = u.scl; alert('user values stored'); if(u.gender == 'M'){ gender[0].checked= true ; }else{gender[1].checked= true ;} } This is the function I use to populate the form that's giving me [object HTMLInputElement] function populateFields(){ alert('Name of populated field: '+test); fName.value = test; lName.value = lName; users.value = users; pass.value = pass; email.value = email; dob.value = dob; tel.value = tel; bio.value = bio; terms.disabled = true; school.value = school; alert('populate fields done'); save.value = 'Update'; signin.innerHTML = 'Log Out'; registerLabel.innerHTML = 'Account Information'; //open user info form var accountInfo = document.getElementsByTagName('details'); accountInfo[1].open = open; } A: Just look at one line: fName.value = fName You are setting the value property of fName to fName itself. Rather than creating numerous global variables, just use loggedUser directly in populateFields(): fName.value = loggedUser.fn; Edit: Looking at your site, I see the important bit you left out. populateFields() is being called after the page reloads. So, populateFields() does not have access to any variable created before the page reloaded. Since I'm helping you with homework, I don't want to just hand you the answer on a silver platter. The trick is that the user data must be retrieved from the database and made available to populateFields() before it is called, or from within the function. You can make the user object available as a global variable, but it may be better to pass it in as a parameter. You probably want to also cancel the form submission: document.getElementById("loginForm").onsubmit = function (e) { e.preventDefault(); } And then just call populateFields() directly from loggedIn() instead of getValues().
2023-08-09T01:26:58.646260
https://example.com/article/3063
Denervation of the renal arteries in metabolic syndrome: the DREAMS-study. Chronic elevation of sympathetic nervous system is a key factor in metabolic syndrome. Because renal denervation (RDN) is thought to modulate sympathetic activity, we performed the Denervation of the Renal Arteries in Metabolic Syndrome (DREAMS)-study to investigate the effects of RDN on insulin sensitivity and blood pressure (BP) in patients with metabolic syndrome. Twenty-nine patients fulfilling the criteria for metabolic syndrome and who used a maximum of 1 antihypertensive or 1 antidiabetic drug or 1 of both gave informed consent and were treated by RDN. Glucose tolerance tests and 24-hour ambulatory BP measurements were performed at baseline, at 6 and 12 months of follow-up. Moreover, we performed self-monitored BP measurements at home every month. To assess sympathetic activity, we performed muscle sympathetic nerve activity and heart rate variability measurements at baseline and follow-up. The majority of the included patients was men (57%), mean body mass index was 31±5 kg/m(2). Median insulin sensitivity as assessed by the Simple Index assessing Insulin Sensitivity oral glucose tolerance test did not change at 6- and 12-month follow-up (P=0.60 and P=0.77, respectively). Mean 24-hour BP decreased by 6±12/5±7 mm Hg 12 months after RDN (P=0.04/0.01). However, self-monitored BP measurements data showed no reduction over time. Measurements of sympathetic activity showed no reduction in systemic sympathetic activity. In conclusion, RDN did not lead to a significant improvement of insulin sensitivity ≤12 months after treatment. Although a significant reduction in ambulatory BP was observed in this nearly drug-naïve population, the self-monitored BP measurements data suggest that this may be explained by regression to the mean. Moreover, no effect in systemic sympathetic activity was observed.
2024-05-28T01:26:58.646260
https://example.com/article/5924
--- abstract: 'We show that if a curve that any curve immersed in $\R^3$ has everywhere positive torsion after any inflection points, it develops a type-II singularity under curve shortening flow.' address: 'Ohio State University, Columbus, OH 43210' author: - 'Gabriel J. H. Khan' title: ' A Condition Ensuring Spatial Curves Develop Type-II Singularities Under Curve Shortening Flow' --- \[theorem\][Conjecture]{} \[theorem\][Proposition]{} \[theorem\][Question]{} \[theorem\][Lemma]{} \[theorem\][Corollary]{} \[theorem\][Observation]{} \[theorem\][Procedure]{} Introduction ============ Let $\gamma$ be a smooth immersion from $S^1$ to $R^n$. We then define the following differential equation. $$\label{eq:CSF} \partial_t \gamma = \kappa N$$ where $\kappa$ is the curvature and $N$ is the unit normal vector. We will study solutions to this equation, which consist of a family of curves $\gamma_t$ with $t \in [0,~\omega)$ which satisfy   with $\gamma_0 = \gamma$. This is commonly referred to as curve shortening flow and is the simplest example of mean curvature flow. Michael Gage and Richard Hamilton proved short time existence and analyticity of the flow [@GH] and Matthew Grayson proved that the flow continues so long as curvature remains bounded [@G]. However, since the flow is the $L^2$ gradient flow for length of the curve (hence the name), a singularity must emerge as some time $\omega$. A blow-up singularity is Type I if $\lim_{t \to \omega} M_{t} \cdot (\omega - t)$ is bounded and Type II otherwise where $$M_{t} = \sup_{p \in \gamma_t} \kappa^2(p).$$ We use the results of [@A] throughout and assume familiarity with this work. Theorem and Proof ================= \[Type II singularities\] Given a curve $\gamma$ in $\R^3$ which not contained in any plane, under the curve shortening flow $\gamma_t$ develops a type II singularity. Suppose $\gamma_0$ does not lie in any plane. Then, for all $t$ where the flow is defined, the torsion $\tau$ is non-zero as the flow is real-analytic so without loss of generality, the torsion is not everywhere zero. Now suppose $\gamma$ develops a type I singularity at time $\omega$. Then, under renormalization as described in [@A], $\gamma_t$ approaches an Abresch-Langer solution [@AL] with finite winding number in the $C^\infty$ sense [@A]. For any such Abresch-Langer curve $S$, $\sup_{p \in S} \k(p) \cdot L < \infty$ where $L$ is the length of S, i.e. $$L= \int_S ds.$$ Since $\gamma$ converges to some S, the functional $D(t) = \sup \k_t \cdot L_t$ for $t \in [0, \omega)$ and converges to a finite limit at $\omega$. Let $D= \lim_{t \to \omega} D(t)$. Furthermore, given that $\gamma$ develops a type-I singularity, all blow up sequences are essential and since the curve converges to an Abresch Langer solution, any sequence ${p_m, t_m}$ such that $\lim_{m \to \infty} t_m = \omega$ , by the rough planarity theorem of [@A], $$\lim_{t \to \omega} \sup_{p \in \gamma_t} \frac{\tau}{\k}(p) = 0$$ where $\tau$ is the torsion of $\gamma_t(p)$. A consequence of the fact that all sequences are essential is that there exists a time $c \in [0, \omega)$ such that for all $t \in [c, \omega)$, $\gamma_t$ has no inflection points so torsion is defined everywhere on the curve. Suppose torsion is positive for all time after $c$. Now we consider the $L^1$ norm of torsion on the curve $\gamma_t$ for $t \in [c, \omega)$. $$||\tau||_1 = \int_{\gamma_t} |\tau | \, ds$$ We parametrize $\gamma_t$ smoothly by $u \in [0, 2\pi)$ and utilize the calculations from [@A] and [@AG] for the following few calculations. $$\int_{\gamma_t} |\tau | \, ds = \int_0^{2\pi}|\tau| \cdot v \, du \textrm{ where } v^2 = \langle \partial_u \gamma_t,\partial_u \gamma_t\rangle.$$ Taking the derivative with respect to time, we obtain $$\partial_t\int_{\gamma_t} |\tau | \, ds = \partial_t \int_0^{2\pi}(|\tau|\cdot v)\, du = \int_0^{2\pi} \partial_t (|\tau|\cdot v)\, du$$ We then calculate this explicitly. $$\begin{aligned} \int_\gamma \partial_t |\tau|\cdot v\, du & = & \int_\gamma \partial_t (\tau\cdot v) \, du \\ & = & \int_0^{2\pi} (\partial_t \tau) \cdot v + (\partial_t v) \cdot \tau \, du\\ & = & \int_0^{2\pi} \left( 2\k^2\tau + \partial_s \left(\frac{2\tau}{\kappa} \partial_s \kappa \right) + \partial_s^2 \tau) \right) \cdot v \\ & & + -\k^2 \, v \, \cdot\tau \, du\\ & = & \int_0^{2\pi} \k^2\, \tau \, v \, du + \int_0^{2\pi} \left(\partial_s \left(\frac{2\tau}{\kappa} \partial_s \kappa \right) + \partial_s^2 \tau\right) \cdot v \, du \\ & = & \int_\gamma \k^2\, \tau \, ds + \int_\gamma \partial_s \left(\frac{2\tau}{\kappa} \partial_s \kappa \right) + \partial_s^2 \tau \, ds\\ & = & \int_\gamma \k^2\, \tau \, ds + \left(\frac{2\tau}{\kappa} \partial_s \kappa + \partial_s \tau\right)|_{\partial \gamma}\\ \end{aligned}$$ Since the boundary of $\gamma$ is empty, $$\partial_t ||\tau||_1 = \int_{\gamma_t} \k^2\cdot |\tau| \, ds > 0.$$ Therefore the $L^1$ norm is positive and increasing and so approaches a positive (possibly infinite) limit as t goes to $\omega$. However, $$\sup_{p \in \gamma_t} \tau (p)\cdot L_t \geq ||\tau||_1(t) > 0$$ so $\liminf_{t \to \omega}\sup_{p \in \gamma_t} \tau (p)\cdot L_t \geq \lim_{t \to \omega} ||\tau||_1(t) = C > 0.$ But then $$\lim_{t \to \omega}\sup_{p \in \gamma_t} \frac{\tau}{\k} \geq \frac{C}{D} > 0.$$ $$\Rightarrow \Leftarrow$$ Therefore $\gamma$ cannot develop a type I singularity and so develops a type II singularity. Going Forward ============= A standard maximum principle argument shows that if a curve develops a type I singularity, if its torsion is ever everywhere positive after the last inflection point at time $c$, it remains positive for all time. Suppose there is a time $d > c$ such that $\inf_{p \in \gamma_d} \tau = 0$. Suppose that $\tau(p) = 0$. Then, $$\begin{aligned} \partial_t \tau(p) & = & \partial_s^2 \tau + 2 \frac{1}{\k}(\partial_s \kappa) (\partial_s \tau) + \frac{2\tau}{\k} \left(\partial_s^2\k - \frac{1}{\k} (\partial_s \k)^2 + \k^3 \right) \\ & = & \partial_s^2 \tau + 2 \frac{1}{\k}(\partial_s \kappa) (\partial_s \tau) \textrm{ since $\tau = 0.$} \\ & = & \partial_s^2 \tau \geq 0 \textrm{ since $\partial_s \tau = 0$ and $p$ minimizes $\tau.$} \\\end{aligned}$$ Therefore, after the last inflection point, there is always at least two points for which torsion vanishes and the torsion has positive and negative sections. Furthermore, for any type I singularity, the $L^1$ norm of torsion must go to zero at the singularity. [99]{} U. Abresch and J. Langer, The Normalized Curve Shortening Flow and Homothetic Solutions, *J. Differential Geom*,**23** (1986), 175–196 S. J. Altschuler, Singularities of the Curve Shrinking Flow for Space Curves, *J. Differential Geom* **34** (1991), 491–514. S. J. Altschuler and M. A. Grayson, Shortening Space Curves and Flow Through Singularities, *J. Differential Geom* **35** (1992), 283–298. M. Gage and R. S. Hamilton, The Heat Equation Shrinking Convex Plane Curves,*J. Differential Geom* **23** (1986), 69–96. M. A. Grayson, The Heat Equation Shrinks Embedded Plane Curves To Round Points,*J. Differential Geom* **26** (1987), 285–314.
2023-10-06T01:26:58.646260
https://example.com/article/6728
Investigation of tau-2 positive microglia-like cells in the subcortical nuclei of human neurodegenerative disorders. An anti-tau monoclonal antibody tau-2 was demonstrated to react with the cells which characteristically appeared in the subcortical nuclei of certain neurodegenerative disorders. These cells had rod-like cell bodies and elongated processes, whose morphology was consistent with that of reactive microglia (tau-2 positive microglia-like cells; TPMC). TPMC were diffusely scattered in the subcortical nuclei, especially the putamen, irrelevant to focal tissue injury such as infarcts and amyloid deposits. TPMC were positively immunostained with anti-ferritin antibody, but negatively with LN3, anti-GFAP, other kinds of anti-tau and anti-neurofilament antibodies. TPMC were found in some cases of Alzheimer type dementia and diffuse Lewy body disease, but not in the cases of Parkinson's disease, Pick's disease and control without neurological disorder. Similar microglia-like cells were found around infarctic foci and amyloid cores of senile plaques, regardless of the disorder. They were, however, different from TPMC in that they were positively immunostained with LN3.
2023-10-11T01:26:58.646260
https://example.com/article/2831
St. Cloud State Huskies 6' Logo Table Throw - Red$99.99Dress up your tailgate with this St. Cloud State Huskies table throw. Crisp graphics highlight your dedication to the greatest team in the nation, while adding a touch of fun to your gear. This throw ... St. Cloud State Huskies 6' Logo Table Throw$99.99Dress up your tailgate with this St. Cloud State Huskies table throw. Crisp graphics highlight your dedication to the greatest team in the nation, while adding a touch of fun to your gear. This throw ...
2024-02-16T01:26:58.646260
https://example.com/article/9628
Overview ======== Current evidence for predictive, preventive, and personalized strategy for endometrial hyperplasia -------------------------------------------------------------------------------------------------- Women\'s health and gender-related pathology remain the priorities for predictive, preventive, and personalized medicine (PPPM) \[[@B1],[@B2]\]. Relevance of endometrial hyperplasia (EH) study is primarily due to a high risk for malignant transformation and the problems associated with menstrual irregularities, dysfunctional uterine bleeding, and anemia in women. Endometrial hyperplasia has a significant place in the structure of gynecological morbidity in women of reproductive age and is one of the most frequent causes of hospitalization in gynecology hospital (10% to 18%) \[[@B3]\]. Endometrial hyperplasia may cause endometrial cancer in up to 50% of cases \[[@B4]\]. The incidence of endometrial adenocarcinoma, which ranks first among genital malignancies, not only has remained high but in recent years has tended to significantly increase in many countries, including Ukraine, and according to long-term prognosis, it will not diminish anytime soon \[[@B3],[@B5]\]. Endometrial cancers are the most common gynecologic cancers in developed countries \[[@B6]\]; therefore, careful search for malignancy, particularly in women with multiple risk factors, is advised by many researchers in daily practice \[[@B6],[@B7]\]. With the high rate of endometrial hyperplasia recurrence, the risks of malignancy require further improvement and new approaches to diagnosis and treat of this disease should be found \[[@B8]\]. Additional studies on histological features and immunohistochemical profiles are needed to find associations between endometrioid and high-grade endometrial carcinoma and endometrial pathology. Differences in the immunohistochemical expression of p53, B cell lymphoma 2 (Bcl-2), bax, estrogen receptor (ER), and progesterone receptor (PR), androgen receptor (AR), progesterone receptor antagonists (PA), etc. should be properly assessed to find *the most common diagnostic pitfalls and helpful morphological and immunohistochemical markers.* Endometrial hyperplasia in reproductive-aged women -------------------------------------------------- The endometrium of reproductive-aged women undergoes cyclic developmental changes in response to the steroids - estrogen and progesterone. The highest score of *ERs* and *PRs is observed in the epithelial and stromal cells* of the normal endometrial uterine at the early proliferative phase; then, throughout the secretory phase, the ER and PR scores decline. In typical endometriotic lesions, the ER and PR scores are constantly high, but they are independent of the menstrual cycle. The expression pattern of ER mRNA is reported mostly in parallel with that of ERs. In typical endometriosis, ERs and PRs are found in both glandular epithelial cells and in their surrounding stromal cells. Expression of ER mRNA was found in typical endometriotic peritonea and in the pelvic peritoneum with columnar epithelial cells, but not in the normal pelvic peritoneum (mesothelium). Estrogen receptors and PRs were found negative in the mesothelium but were positive in the nuclei of fibroblasts in the connective tissue \[[@B9]\]. Gregory et al. postulated that an increased in the coactivator expression may render the endometrium to be more sensitive to estrogen \[[@B10]\]. Specific coactivator expression patterns were found in the fertile endometrium and in anovulatory (proliferative) and clomiphene-induced ovulatory (secretory) women with polycystic ovarian syndrome (PCOS), who have a higher likelihood of developing estrogen-induced endometrial hyperplasia and cancer. Women with PCOS exhibited elevated levels of amplified in breast cancer-1 (AIB1) and transcriptional intermediary factor-2 expression in both the epithelial and stromal cells \[[@B10]\]. Their receptors are regulated by steroid receptor coactivators of the p160 family, namely steroid receptor coactivator-1, AIB1, and transcriptional intermediary factor-2, in the human endometrium obtained prospectively from normal fertile women throughout the menstrual cycle. Glandular AIB1 increases in the late secretory phase \[[@B10]\]. The authors described an increased expression of ERα (an estrogen-induced gene product) during the menstrual cycle in the PCOS endometrium and overexpression of p160 in the endometrium of women with PCOS. These data explain the poor reproductive performance observed in PCOS and the increased incidence of endometrial hyperplasia and cancer noted in this group of women. The effects of estradiol (E), progesterone (P), and PA were studied on the endometrium of rhesus macaque \[[@B11]\]. Ovariectomized macaques were treated with implants of E and P to induce precisely controlled, artificial menstrual cycles. During these cycles, treatment with E alone induces an artificial endometrial epithelial cell proliferation and increased expression of stromal and epithelial ER and PR. Androgen receptor E in the endometrial stroma is also upregulated. Progesterone acts on the E-primed endometrium to induce secretory differentiation and causes suppression of epithelial and stromal ER, epithelial PR, and stromal AR in the functionalis zone. However, epithelial ER and PR are retained in the basalis zone during the secretory phase. When potent PA are administered acutely at the end of an E(2) + P-induced cycle, menses typically ensues similarly to P withdrawal at the end of the menstrual cycle. When PAs are administered chronically, there is significant blockage of all P-dependent effects including upregulation of ER, PR, and AR and suppression of glandular secretory function. However, chronic PA administration also inhibits estrogen-dependent endometrial cell proliferation and growth. This experimental data endometrial anti-proliferative effect is the basis of the clinical use of PA to control various diseases such as endometriosis \[[@B11]\]. Atypical endometrial hyperplasia -------------------------------- Atypical endometrial hyperplasia (AEH) has the highest cancer threat; the prevalence of endometrial carcinoma in patients who had a community hospital biopsy diagnosis of AEH was high (42.6%). When considering management strategies for women who have a biopsy diagnosis of AEH, clinicians and patients should take into account the considerable rate of concurrent carcinoma \[[@B12]\]. Malignant tumors after AEH diagnosis demonstrate features of good prognosis with endometrioid morphology, lower grade, and early stage, although the overall positive predictive value of AEH is expected at 37% to 48% in the current routine practice \[[@B13]\]. ### Endometrial cancer Endometrial cancer is frequently seen in women with post-menopausal bleeding and endometrial hypertrophy in ultrasound examination, especially when the endometrial image is non-homogenous and irregular. However, the rarest endometrial cancers were affirmed in post-menopausal women with the ultrasound image of fluid in the uterine cavity with thin endometrium \[[@B14]\]. Endometrial cancers are classified into *types I and II* based on light microscopic appearance, clinical behavior, and epidemiology. This classification of endometrial cancers considers genetic analysis, and histologic subtypes are underscored by systematic changes in a limited set of genes. Common genetic changes in endometrioid endometrial cancers include, but are not limited to, microsatellite instability or specific mutation of PTEN, K-ras,12,22-28, and β-catenin genes \[[@B15]\]. Type I comprises 70% to 80% of newly diagnosed cases of endometrial cancer, is associated with unopposed estrogen exposure, and is often preceded by a pre-malignant disease. Type II of endometrial cancers has a non-endometrioid histology (usually papillary serous or clear cell) with an aggressive clinical course. Hormonal risk factors have not been identified, and there is no readily observed pre-malignant phase. Combined molecular, histomorphometric, and clinical outcome analysis of premalignant lesions has provided a clearer multidisciplinary definition of endometrial pre-cancers, known as EIN. Genetic and endocrine disease mechanisms have been integrated into a multistep model for oncogenesis in which hormonal exposures act as selection factors for mutated endometrial cells \[[@B15]\]. The findings of Kounelis et al. \[[@B16]\] indicate the differences in immunohistochemical profiles of endometrioid and serous carcinomas. Thus, uterine papillary serous adenocarcinomas (UPSA) show a significantly higher p53 expression than uterine endometrioid adenocarcinomas; there is no significant difference in Bcl-2 and bax expression between both histologic types. Overexpression of p53 is associated with high-grade endometrioid carcinoma and advanced-stage tumors, while ER and PR expressions were associated with low-grade and early-stage tumors. Bcl-2 immunopositivity is more common in low-grade, early-stage adenocarcinomas rather than in high-grade, advanced-stage adenocarcinomas, but the difference was not statistically significant. Bax immunopositivity is associated with well-differentiated and early-stage tumors. There was a significant inverse relationship between bax and p53 reactivity, especially in tumors of endometrioid type \[[@B16],[@B17]\]. Early detection of p53 nuclear accumulation may help to identify precursor lesions of UPSA. Bcl-2 persistence is frequently associated with endometrial carcinoma, and failure to inactivate Bcl-2 expression probably is related to the development of endometrial carcinoma \[[@B17]\]. The presence of testosterone receptors in estrogen receptor-positive endometrial carcinomas may be involved in the mechanism of cell proliferation in these tumors. The strong staining reaction for testosterone receptors in the endometrial glands can be considered one of the features of invasive malignancy \[[@B18]\]. Bartoschet et al. \[[@B19]\] suggest differential diagnosis between the different subtypes of endometrial carcinomas including (1) endometrioid versus serous glandular carcinoma, (2) papillary endometrioid (not otherwise specified, villoglandular and non-villous variants) versus serous carcinoma, (3) endometrioid carcinoma with spindle cells, hyalinization, and heterologous components versus malignant mixed Müllerian tumor, (4) high-grade endometrioid versus serous carcinoma, (5) high-grade endometrioid carcinoma versus dedifferentiated or undifferentiated carcinoma, (6) endometrioid carcinoma with clear cells versus clear cell carcinoma, (7) clear cell versus serous carcinoma, (8) undifferentiated versus neuroendocrine carcinoma, (9) carcinoma of mixed cell types versus carcinoma with ambiguous features or variant morphology, (10) Lynch syndrome-related endometrial carcinomas, and (11) high-grade or undifferentiated carcinoma versus non-epithelial uterine tumors. As carcinomas in the endometrium are not always primary, this becomes the differential diagnosis between endometrial carcinomas and other gynecological, as well as with extra-gynecologic metastases. Breast cancer patients receiving tamoxifen (Tam) are at an increased risk for developing endometrial carcinomas, possibly due to the partial estrogenic effect of Tam on endometrial cells. Progestational therapy has not routinely been included in Tam regimens. The consistent finding of ER and PR expression in the endometria of post-menopausal women receiving Tam further supports the suspected estrogenic effect exerted by Tam on endometrial cells. Progestational therapy could be beneficial in the prevention of Tam-induced abnormal endometrial proliferations \[[@B20]\]*.* Mutter et al. showed that 43% of histologically normal pre-menopausal endometria contain rare glands that fail to express the *PTEN* tumor suppressor gene because of mutation and/or deletion. This persists between menstrual cycles. Histopathology of PTEN-null glands is initially unremarkable, but with progression, they form distinctive high-density clusters. These data are consistent with a progression model in which initial mutation is not rate limiting \[[@B21]\]. A physiologic process of *apoptosis* involved in the cyclic growth of normal endometrium \[[@B22],[@B23]\] can be induced by extrinsic factors such as chemotherapeutic drugs and radiation \[[@B24]\]; the oncoprotein Bcl-2 is a well-known regulator of cellular apoptosis, inhibiting physiologic process \[[@B25]\]. Progestin-induced apoptosis may occur during the early period of treatment for endometrial hyperplasia \[[@B26]\]. Fas-Fas binding plays a fundamental role in the regulation of the immune system, triggers apoptosis, and may be involved in the development of endometrial hyperplasia \[[@B27]\]. Bax/Bcl-x may be the major control mechanisms of apoptosis in advanced carcinomas; other members of the Bcl-2 family may also be under hormonal control \[[@B28]\]. Fas-related apoptotic pathway is also involved in the regulation of apoptosis in the endometrial tissue and promotes the development and progression of endometrial neoplasia, considering a significant increase of Fas, caspase-3, and M30 expressions in carcinomas \[[@B29]\]. Transition of endometrial epithelium from hyperplasia to cancer seems to involve both increased apoptosis and decreased Bcl-2 expression. Flow cytometric evaluation of M30 and Bcl-2 expression levels, with SPF, in curettage specimens from post-menopausal patients complaining of bleeding provides a quantitative assessment of endometrial apoptosis, anti-apoptosis, and proliferation. Further studies are needed to determine the relationship among these three processes as indicators of the biological behavior of gynecological tumors \[[@B30]\]. Evidence for the existence of *adult stem*/*progenitor cells* in human and mouse endometrium is now emerging because functional stem cell assays are being applied to uterine cells and tissues \[[@B31]\]. Polyps ------ Polyps from the endometrium cause abnormal uterine bleeding, infertility, and pelvic pain \[[@B32]\]. Endometrial polyps undergo cyclic changes in the expression of their proteins related to proliferation and apoptosis during the menstrual cycle, similar to those of the cycling endometrium \[[@B33]\]. The concentrations of ER and PR in the glandular epithelium were significantly higher in endometrial polyp than in the normal endometrium. The concentrations of these receptors in the glandular epithelium and stroma were similar in the post-menopausal and pre-menopausal patients \[[@B34]\]. Mittal et al. concluded that endometrial polyps may be a result of a decrease in ER and PR expression in stromal cells. Because of these receptor-negative stromal cells, endometrial polyps may relatively be insensitive to cyclic hormonal changes \[[@B32]\]; while the concentrations of ER and PR in glandular epithelium were higher in polyps than in the normal endometrium, the concentrations of these receptors in the glandular epithelium and stroma are similar in the post-menopausal and pre-menopausal patients. The study by Peng \[[@B35]\] that measured the expression of hormone receptors (estrogen receptor and progesterone receptor) in endometrial polyps and compared the results to surrounding endometrial tissue in women prior to menopause showed that the expression of estrogen receptor was higher whereas the expression of progesterone receptor was lower than that of the adjacent endometrial tissue. The results suggest that the abnormal expression of hormone receptor contributes to endometrial polyp formation. Fujishita et al. demonstrated the expression of ERs, ER mRNA, and PRs in the columnar cells of the pelvic peritonea and typical endometriosis, but not in the normal mesothelium. These results suggest that endometriosis may originate from the columnar cells with ERs and PRs in the pelvic peritoneal lining \[[@B9]\]. Endometrial polyps can appear in menopausal women receiving hormone replacement therapy despite the presence of progestins to oppose the action of estrogens \[[@B36]\]. Hormone replacement therapy (HRT) impacts on the expression of Ki-67, Bcl-2, and c-erb.B2 in endometrial polyps during menopause and may cause endometrial polyp involution by decreasing proliferation and stimulating apoptosis \[[@B37]\]. *Vereide AB* showed that proteins in the apoptotic cascade are regulated by gestagen; stromal Bcl-2 expression is a potential biomarker which can separate responders of gestagen treatment from non-responders after oral administration \[[@B38]\]. Part of the molecular mechanisms of progestin therapy for endometrial hyperplasia is through the upregulation of Fas/FasL expression \[[@B27]\]. Dysregulation of Fas/FasL expression in hyperplastic endometrium may be part of the molecular mechanisms for non-responders to progestin treatment. Intermittent, rather than continuous, progestin treatment may be more effective clinically for the treatment of endometrial hyperplasia. Taylor et al. \[[@B39]\] demonstrated three significant differences found between the endometrium and the polyps. Polyps taken from the proliferative phase of the cycle displayed a significantly elevated expression of Bcl-2 and a weak or no expression of progesterone receptors. Secretory phase polyps displayed an elevated expression of estrogen receptors. A localized increase in Bcl-2 expression and consequential decline or cessation of apoptosis are important mechanisms underlying the pathogenesis of endometrial polyps. Elevated Bcl-2 expression results in failure of the polyp tissue from undergoing normal cyclical apoptosis during the late secretory phase \[[@B39]-[@B41]\]. This may mean that the polyp is not shed along with the rest of the endometrium during menstruation. However, estrogen may have a role in the development of post-menopausal endometrial polyps, either by direct stimulation of localized proliferation or by stimulation of proliferation via other pathways, such as activation of Ki67 or through inhibition of apoptosis via Bcl-2. The c-erbB-2 is unlikely to play any role in the development of these lesions \[[@B42]\]. Ki-67 and c-erbB2 overexpressions are frequent in endometrial polyps in post-menopausal women \[[@B43]\]. Endometrial polyps in menopausal patients receiving HRT respond only to estrogens, but not to progestins. The unopposed estrogenic action on polyps may favor the development of pre-malignant hyperplasia and carcinoma \[[@B44]\]. Ultrasound ---------- Ultrasound diagnosis has been successfully used to differentiate tumors of the uterus and appendages \[[@B45]-[@B52]\]. Transvaginal ultrasound is a cost-minimizing screening tool for perimenopausal and post-menopausal women with vaginal bleeding \[[@B45]\] and is preferred over uniform biopsy of post-menopausal women with vaginal bleeding because it (1) is a less invasive procedure, (2) is generally painless, (3) has no complications, and (4) may be more sensitive for detecting carcinoma than blind biopsy. Transvaginal sonography is rarely non-diagnostic. A limitation of ultrasound is that an abnormal finding is not specific: ultrasound cannot always reliably distinguish between benign proliferation, hyperplasia, polyps, and cancer; that should not be seen as a crucial limitation because tissue sampling is required in either case. Ultrasonography also may be used as a first-line investigation in other populations with abnormal uterine bleeding. In a multicenter, randomized, controlled trial of 400 women with abnormal uterine bleeding by Davidson and Dubinsky \[[@B45]\], the investigators found that transvaginal sonography combined with Pipelle endometrial biopsy and outpatient hysteroscopy was as effective as inpatient hysteroscopy and curettage \[[@B45]\]. Occasionally (in 5% to 10% of cases), a woman\'s endometrium cannot be identified on ultrasound, and these women also need further evaluation. Transvaginal ultrasonography has a poor positive predictive value but has a high negative predictive value for detecting serious endometrial diseases in *asymptomatic post-menopausal women*\[[@B46]\]. A limit of M-echo thickness at 8 mm \[[@B47]\] or 10 mm \[[@B48]\] was suggested for this category of patients, as the upper limit for normal thickness was also suggested on a value of 9 mm in women receiving treatments associated with thicker endometria (estrogen alone and cyclical combinations) \[[@B49]-[@B51]\]. The negative predictive value for ultrasonography was high (99%) when the threshold for endometrial thickness was 5 mm. This high negative predictive value is not a justification for the use of ultrasonography in screening since 53% of the women with normal biopsies were reported to have an endometrial thickness of at least 5 mm \[[@B46]\]. Nordic multicenter study showed that the risk of finding pathologic endometrium at curettage when the endometrium is \<4 mm as measured by transvaginal ultrasonography is 5.5%. Thus, in women with post-menopausal bleeding and an endometrium \<4 mm, it would seem justified to refrain from curettage \[[@B52]\]. According to Fleischer et al., the sampling rate of women with an endometrial thickness \>6 mm was too low (45%) for confidence interval in the positive predictive value of 2%. Despite a high negative predictive value (99%), transvaginal ultrasonography may not be an effective screening procedure for the detection of endometrial abnormality in untreated post-menopausal women who are without symptoms \[[@B53]\]. Ultrasound imaging of endometrium with atypical hyperplasia in post-menopausal women was found non-homogenous and irregular, and the rarest was in the cases of affirmed fluid in uterine cavity \[[@B14]\]. According to statements of the Consensus of Society of Radiologists \[[@B54]\], the following recommendations were used to create an algorithm for evaluating women with post-menopausal bleeding: • Because post-menopausal bleeding is the most common presenting symptom of endometrial cancer, when post-menopausal bleeding occurs, clinical evaluation is indicated; • Either transvaginal sonography or endometrial biopsy could be used safely and effectively as the first diagnostic step. Whether sonography or endometrial biopsy is used initially depends on the physician\'s assessment of patient risk, the nature of the physician\'s practice, the availability of high-quality sonography, and patient preference. Similar sensitivities for detecting endometrial carcinoma are reported for transvaginal sonography, when an endometrial *thickness \>5 mm* is considered abnormal, and for endometrial biopsy, when 'sufficient' tissue is obtained. Currently, with respect to mortality, morbidity, and quality-of-life end points, there are insufficient data to comment as to which approach is more effective \[[@B55]-[@B57]\]. A combination of transvaginal sonography, Pipelle endometrial biopsy, and outpatient hysteroscopy (1) has similar efficacy to inpatient hysteroscopy and curettage for the investigation of abnormal uterine bleeding; (2) hysteroscopy will detect some fibroids and polyps missed by a combination of transvaginal ultrasound and Pipelle endometrial sampling; (3) the quality of histological samples obtained by outpatient Pipelle were comparable to those obtained by formal inpatient curettage; and (4) outpatient procedures were well tolerated, with good patient acceptability \[[@B58]\]. Sonoelastography ---------------- Today, a new non-invasive method of examination, *sonoelastography* (SEG), which is based on the ultrasonic examination of tissues softness, is constantly developing. SEG as a tissue strain imaging was first described in 1991 \[[@B59]\]. The phenomenon is based on the fact on inverse scattering ultrasonic signal in mild compression and relaxed (i.e. approximately 2%) insonated tissue during the study. The main advantage of such a diagnosis is its high sensitivity. However, there is still a lack of evidence regarding endometrial assessment using SEG. Thus, Preis et al. \[[@B60]\] in a group of 35 perimenopausal patients obtained a sensitivity value of sonoelastography for endometrium hyperplasia as high as 100%. However, the bigger group of patients has to be analyzed to confirm specificity and accuracy. Recently, we suggested the use of blue-green-red (BGR) sonoelastography artefact as a sign to indicate the presence of fluid content in cavities for predicting the liquid content and the possibility for puncture. Ovarian cyst sonoelastography can be effective for liquid detection and has an 88% positive predictive value \[[@B61]\]. Treatment --------- Taking into account the fact that the sensitivity to hormone therapy and prognosis of EH in women is largely determined by receptor status, which depends on the clinical stage and degree of histological differentiation of endometria, the aim of our study was to determine the characteristics of endometrial receptors using immunohistochemical methods \[[@B3],[@B8]\]. On the other hand, we are aware of a percentage of patients whose progestin treatment does not give the desired results; we believe that it is this category of patients that is subject to special individual approach to treatment and observation. After hormonal treatment, EH relapses occurred in 15%, 9% to 27%, and 2% of patients due to the morphological heterogeneity of endometrial proliferation. The sensitivity to therapy and prognosis are largely determined by the receptor status. Existing methods such as cryosurgery, laser destruction and electrodestruction, and thermoablation may lead to irrevocable destruction of the endometrium. The practice of minimally invasive ablation made possible the removal of the endometrium basal layer. Hysteroresection of the endometrium is considered to be the most reliable technique for the management of endometrial pathology and uterine bleeding because it provides information on the histologic characteristics of endometrium, removal of the tissue within a prescribed depth, and coagulation of bleeding sites. Hysteroscopy is likely to become the new gold standard in the future because of its ability to visualize directly the endometrium and perform directed biopsies as indicated. As office-based hysteroscopy becomes more practical and widespread, the technique may become more cost effective. An evaluation plan using transvaginal sonography as the initial screening evaluation followed by endometrial biopsy or, more likely, hysteroscopy is likely to become the standard of care. In recent years, with the introduction of new endoscopic technology, the range of surgical treatment methods for this category of patients has expanded, particularly for those patients with concomitant somatic pathology. One of these innovative treatments is endometrial ablation, the essence of which is the hysteroscopic removal of the basal layer in order to achieve amenorrhea \[[@B3]\]. Reliable visual control ensures efficiency of minimally invasive technologies in all spheres of gynecologic practices. It remains unproven whether certain patients at higher risk for carcinoma should proceed directly to invasive evaluation. Patients on tamoxifen with persistent recurrent bleeding, those with significant risk factors for carcinoma, and patients with life-threatening hemorrhage comprise this group. Further studies are still necessary to evaluate high-risk patients and determine whether ultrasound or biopsy is really the most cost-effective initial test \[[@B45]\]. These facts confirm the need to determine a new integrative view assessing the state of receptor systems and sonography data for each case, to reach a *personalized treatment strategy*. The *aims* of this strategy were as follows: • to assess the state of receptor systems in endometrial hyperplasia, • to evaluate the capabilities of ultrasound diagnostics and sonoelastography for diagnosis of endometrial pathology and control minimally invasive treatment, • to develop algorithm for personalized treatment for patients with endometrial hyperplasia with regard to age, integrative assessment of immunohistochemical, and radiology biomarkers. Methods ======= We included in the study 313 white Ukrainian women aged 25 to 45 years who were treated at the Gynecology Center of the Clinical Hospital 'Pheophania' from January 2010 to June 2013; they were divided into the following: group 1 (*n* = 112) with glandular cystic hyperplasia, group 2 (*n* = 98) with endometrial polyps, and group 3 (*n* = 103) with atypical endometrial hyperplasia; 82 women who underwent hysteroscopic investigation for infertility before the cycles of *in vitro* fertilization were included as the control group. Age of women included in the observation group ranged from 20 to 45 years, and the average was 38.0 ± 2.3 years. Diagnosis of EH was combined with dysfunctional uterine bleeding (82.3%), inflammatory diseases of genitals (77.4%), and endocrine diseases, such as obesity, thyroid disease, and diabetes (35.5%), which, together with sensitivity of maintaining reproductive to hormone therapy functions, were considered for personalized treatment. The patients were distributed into the groups with non-significant difference among groups as regards to age. The *design* of the study was prospective and non-randomized. All patients underwent general clinical examination, which included clinical and biochemical blood tests; blood tests for HIV, RW, HBS-Ag, and HCV-Ag; clinical urine tests; ECG; ultrasound; chest X-rays; and a study of vaginal biotope (microflora), according to protocols of the Ministry of Health of Ukraine. In the study group, diagnostic search was conducted using ultrasound to maintain hysteroresection. The resulting material was subjected to a histological study to determine the receptor of the endometrium cells applying immunohistochemical method, depending on the outcome of patients who later designed the appropriate medical tactics. Ultrasonography --------------- All patients underwent clinical examination, transvaginal ultrasound (US) scanning including sonoelastography and 3D/4D technology. Months (1, 3, 6, and 12) after hysteroresectoscopy, we evaluated the endometrial structure, thickness, margins, with myometrium within the TV US diagnostic protocol. Ultrasound scanning using transvaginal probes of the ultrasound scanner HITACHI 7500 (Tokyo, Japan) with a frequency of 5--8 MHz was carried out before, immediately after, and 1and 6 months after the intervention. To define the sonoelastography patterns and the comparative analysis, we used a visual grading system (grades 1--5), which was adopted according to the color variation. The color scheme was red (soft), green (medium stiffness), and blue (hard). Three-dimensional US imaging was performed on Siemens Elegra (Munich, Germany). The uterus was scanned in the coronal and longitudinal projections. The thickest anteroposterior diameter of the endometrial stripe was measured in the sagittal plane. Hysteroresection ---------------- Hysteroresectoscopies were performed using an 8-mm unipolar resectoscope (Karl Storz GmbH & Co., KG, Tuttlingen, Germany). After 6 months, we performed a control hysteroscopy with endometrial biopsy to assess therapy effectiveness. On the first stage, the nature of the pathological process in the endometrium was determined by conducting diagnostic hysteroscopy with mandatory scraping of the walls of the uterus with pathohistological verification of the diagnosis. On the second phase, hysteroscopic endometrial ablation was carried out with subsequent follow-up. During the year, we performed ultrasonography of the endometrium on the control with the definition of the M-echo (at 1, 3, 6, and 12 months after hysteroresectoscopy), which clarified the nature of the menstrual function. Written informed consent was obtained from all patients for the publication of this report and any accompanying images. Pathology --------- Endometrial biopsies were performed mainly in the late proliferative stage phase. Sections were stained with hematoxylin and eosin. Estrogen receptor (SP1), progesterone receptor (SP2), Ki67, and p53 were measured on paraffin sections using the manufacturer\'s recommended protocol (Thermo Scientific, Waltham, MA, USA), as presented in Table [1](#T1){ref-type="table"}. For evaluation of reactions, we used a point scale assessment developed by the manufacturer, and immunohistochemical reaction to receptors counted positive in the presence of at least three points. ###### Immunohistochemistry markers **Marker** **Clone** **Catalogue number** ----------------------------- ----------- ---------------------- Estrogen receptor (SP1) SP1 RM-9101-S Progesterone receptor (SP2) SP2 RM-9102-S Ki-67 (SP6) SP6 RM-9106-S p53 Y5 RM-2103-S As a de-masking maneuvre, we heated glasses on a steam bath. For immunohistochemistry reaction, we used rabbit monoclonal antibodies. To visualize the results of immunohistochemical reaction, we used the peroxidase of universal set, UltraVision LP Detection System: HARP Polymer (RUT). Background fabric painting was provided with hematoxylin. The medical ethics commissions of the Clinical Hospital 'Pheophania' of State Affairs Department approved the study. Mann--Whitney U test was used to perform a comparison between groups. Results ======= Analysis of the work found that glandular cystic hyperplasia of the endometrium occurs during anovulatory cycles which tend to be longer than the normal menstrual cycle after prolonged persistence of follicles, most of which frequently occur in women 40--45 years who are bleeding prior to amenorrhea for 1 and 2--5 months. The extended phase of anovulatory cycles results from prolonged high concentration of estrogen, resulting in endometrial hyperplasia which is processed as glandular (non-atypical complex hyperplasia) or glandular cystic (simple non-atypical hyperplasia) endometrial hyperplasia. A hysteroscopic image of glandular cystic hyperplasia is shown in Figure [1](#F1){ref-type="fig"}. ![Hysteroscopic image of glandular cystic hyperplasia of the endometrium.](1878-5085-4-24-1){#F1} In the histological examination, no distribution on the compact and spongy layers was revealed and glands were unevenly distributed in the stroma; the second type was characterized by cystic expanded glands. Thus, in contrast to *atypical* hyperplasia, the number of glands did not increase, but due to proliferation of the glandular epithelium, each tube was lengthened and had a winding form. Therefore, the histological sections are determined as if the number of glands increased. There are three options for hormonal endometrial proliferation: it could proliferate in the most frequently occurring patterns, characterized by an equal proliferation of glands and stroma (65%); the structure could have a predominance of stromal proliferation (25%); and the structure could be dominated by the proliferation of glands (10%). The content of estradiol and progesterone receptors in epithelial cells and stroma with glandular cystic hyperplasia of the endometrium with immunohistochemical study is presented in Figure [2](#F2){ref-type="fig"}. ![**Glandular cystic hyperplasia.** Coloring by hematoxylin-eosin (×40).](1878-5085-4-24-2){#F2} In patients with glandular cystic hyperplasia, the concentration of estradiol receptors in epithelial cells was significantly higher as compared to that in the control group. Thus, the content of estradiol receptors in epithelial cells was 75.6%, while the rate in the control group was 43.3% (Figure [3](#F3){ref-type="fig"}). ![Content of estradiol and progesterone receptors (%) in the endometrium with glandular cystic hyperplasia.](1878-5085-4-24-3){#F3} Our findings did not show significant changes in stromal content in these groups (30.9% in the group with glandular hyperplasia and 29.6% in the control group). In our opinion, this is due to the type of hyperplasia. Glandular cystic hyperplasia is usually characterized by irregular proliferation of glandular and stromal components due to irregular activation of the receptor system of glands and stroma; the number of progesterone receptors in epithelial cells and stroma in patients with glandular cystic hyperplasia was slightly higher than in the control group (69.3% in the epithelial cells and 62.2% in the stroma in patients with glandular cystic hyperplasia; 52.4% and 48.5% in the control group, respectively). This fact confirms the role and relative hyperestrogenemia and hypoprogesteronemia at the cellular level for the proliferative state of the endometrium. As the results of our research, the hormone levels do not always determine the degree of proliferation; a significant role in the pathogenesis of endometrial hyperplasia has a certain value of steroid hormone receptors that causes the sensitivity of endometrial cells. Immunohistochemical reaction in the endometrium with glandular cystic hyperplasia of antibodies with estrogen and progesterone is shown in Figures [4](#F4){ref-type="fig"} and [5](#F5){ref-type="fig"}. ![Immunohistochemical reaction in the endometrium with glandular cystic hyperplasia of antibodies with estrogen (×40).](1878-5085-4-24-4){#F4} ![Immunohistochemical reaction in the endometrium with glandular cystic hyperplasia of antibodies with progesterone (×40).](1878-5085-4-24-5){#F5} While assessing receptor status in the immunohistochemical study, we also determined the level of proliferative activity using the proliferative marker Ki-67. As already was established, glandular cystic hyperplasia in most cases was characterized by increased proliferation of the glandular component and irregular stromal proliferation. This was confirmed when the determining proliferative marker expression was used in glandular cystic hyperplasia. Thus, in functionally active glands, Ki-67 expression increases in some places up to 50% with an almost negative reaction in glandular cystic hyperplasia. Following this concept, we determined the distribution of steroid receptors in patients with endometrial polyps (Figure [6](#F6){ref-type="fig"}). ![**Hysteroscopy of intrauterine lesions. (A)** Fibrous endometrial polyp and **(B)** submucosal fibromyoma.](1878-5085-4-24-6){#F6} According to our findings, uterine polyp is a local lesion of exophytic growth, derived from the basal layer of the endometrium. In the early stages of development, polyps look like small proliferates located in the basal section of the endometrium on the verge of the myometrium. Microscopically, these foci are different from the surrounding normal endometrium disordered clusters of tubular and glandular structures with low row indifferent epithelium type, surrounded by a dense cellular stroma. The basal growth area of glandular proliferation penetrates the upper layers of the endometrium, pushing them through expansive growth and bulges above the surface as exophytic lesion. The surface of the polyp is often covered with a layer of functional endometrium that participates in the cyclic changes as the neighbouring endometrium and is rejected in phase desquamation. A hysteroscopic imaged of intrauterine lesions: endometrial polyp and submucosal fibromyoma are shown in Figure [6](#F6){ref-type="fig"}. Histology of one type of polyp, namely glandular cystic polyp, is shown in Figures [7](#F7){ref-type="fig"} and [8](#F8){ref-type="fig"}. ![**Glandular cystic endometrial polyp.** Coloring by hematoxylin-eosin (×40).](1878-5085-4-24-7){#F7} ![Hysteroscopic image of glandular endometrial polyp.](1878-5085-4-24-8){#F8} In analyzing the immunohistochemical data of receptor status in women with endometrial polyps, we found a similar trend in the distribution of receptors in patients with glandular cystic hyperplasia. Thus, in a group of polyps, we have identified some differences: the number of estradiol receptors in the stroma was significantly higher than those in the control group; they were 48.2% and 29.6%, respectively. The content of progesterone receptors in the stroma was 58.1% and 55.9% of endometrial epithelium, whereas in the control group, the content of progesterone receptors in the stroma was 48.5% and 52.4% in endometrial epithelium (Figure [9](#F9){ref-type="fig"}). ![The content of estradiol and progesterone receptors (%) in the endometrium with endometrial polyps.](1878-5085-4-24-9){#F9} According to conventional pathogenesis paradigms, polyp is a hyperplastic process in the endometrium in response to any stimulation (inflammation, hormonal imbalances, etc.) that is not of tumor origin. The results of our studies demonstrate that an imbalance of receptor status is also relevant for the development of polyps, most notably an imbalance of estrogen receptors in epithelial and endometrial stroma. Immunohistochemical reaction in the endometrium with polyps of antibodies with estrogen and progesterone is shown in Figures [10](#F10){ref-type="fig"} and [11](#F11){ref-type="fig"}. ![Immunohistochemical reaction in the endometrium with glandular cystic polyp of antibodies with estrogen (×40).](1878-5085-4-24-10){#F10} ![**Immunohistochemical reaction in the endometrium with glandular cystic polyp of antibodies with estrogen (×40)**.](1878-5085-4-24-11){#F11} Pathological proliferation of the endometrium, which loses hormonal hyperplasia characteristics and has the emergence of patterns inherent to malignant tumor, is called *atypical endometrial hyperplasia*. According to the degree of prevalence, diffuse and focal types are distinguished; according to the proliferation of glandular and stromal components, simple and complex forms are distinguished. Histologically, we determined in atypical endometrial hyperplasia the glands with numerous ramifications and papillary projections that protruded into the lumen of glands; they are strongly sinuous, with irregular shape. Here and there, glands are closely located to each other without stromal layers and are separated by a narrow strip of connective tissue only. The epithelial cells of glands acquired the features of tumor processes: reduction of nuclear/cytoplasmic ratio, hyperchromatosis, nuclear polymorphism, etc. There were proliferation and increased mitotic activity and abnormal mitosis. Atypical endometrial hyperplasia is shown in Figure [12](#F12){ref-type="fig"}. ![**Atypical glandular hyperplasia of the endometrium.** Coloring by hematoxylin-eosin (×40).](1878-5085-4-24-12){#F12} The content of estradiol receptors in patients with atypical hyperplasia was significantly different from that of the control group, as estradiol receptors in the epithelial cells with atypical hyperplasia amounted to 65.2%; in the stroma, 42.6% (in the control, they were 43.3% and 29.6%, respectively; Figure [13](#F13){ref-type="fig"}). ![The content of estradiol and progesterone receptors in the endometrium with atypical endometrial hyperplasia.](1878-5085-4-24-13){#F13} There was a significant difference in the content of progesterone receptors in the endometrial stroma (81.8%), which was characterized by a sharp increase in what we believe was a prognostic criterion for determining the subsequent treatment strategy. Percentage of progesterone receptors in epithelial cells was 44.3%, whereas in the control, it was 52.4%. The increased concentration of progesterone receptors in the stroma was probably due to relative hypoprogesteronemia and thus was compensatory anti-proliferative in nature. However, this trend was not inherent for all observations; in 18.8% patients with atypical hyperplasia, we determined low levels of estrogen receptors on the decreased progesterone receptors\' background. Ultrasonography data -------------------- The study identified the most reliable ultrasound symptoms of EH as follows: heterogeneity of the internal structure; unclear, uneven outer contour; increasing thickness of the M-echo and intensity of endometrial vascularization; fluid in the uterine cavity; polypoid inclusions; and the registration of vascular signals in the subendometrial zone. Ultrasound symptoms of EH are presented in Table [2](#T2){ref-type="table"}. ###### Ultrasound symptoms of endometrial hyperplasia **US symptom** **Glandular cystic hyperplasia** **Endometrial polyps** **Atypical endometrial hyperplasia** ---------------------------------------- ---------------------------------- ------------------------ -------------------------------------- Non-homogenous and irregular margins 22% 27% 72% Mean M-echo thickness 21 ± 2.1 mm 17 ± 1.8 mm 22 ± 2.2 mm Hypoechoic areas 32% 44% 60% Fluid in uterine cavity 25% 15% 38% Hypervascularity on Doppler imaging 15% 42% 57% RI 0.58 0.7 0.62 Prevalence       Stiffness (compared to myometrium) 45% 92% 65% Isoelasticity (compared to myometrium) 35% 8% 27% Softness (compared to myometrium) 30% \- 7% BGR 12% \- 45% Non-homogenous and irregular margins were significantly higher in AEH than in both groups (*P* \< 0.01). Mean M-echo thickness was found to be non-significant. Hypoechoic areas, hypervascularity on Doppler imaging, and stiffness (Figures [14](#F14){ref-type="fig"} and [15](#F15){ref-type="fig"}) were more specific for AEH than for glandular cystic hyperplasia (*P* \< 0.01, *P* \< 0.01, *P* \< 0.01, respectively; Figure [16](#F16){ref-type="fig"}). Fluid in the uterine cavity and BGR artefact were found to be specific for AEH (*P* \< 0.01; Figure [17](#F17){ref-type="fig"}); BGR appearance correlated to the presence of fluid in the uterine cavity (*r* \> 0.97; Figure [18](#F18){ref-type="fig"}). ![**Endometrial polyp (*P*). (A)** Stiff polyps on SEG, *arrow* indicates invisible polyp in *grey scale* that was detected on SEG; **(B)** Dopplerography of polyp vessel, RI = 0.7.](1878-5085-4-24-14){#F14} ![**Sonoelastography of endometrial lesion.***Soft pattern* on SEG helps to exclude the polyp.](1878-5085-4-24-15){#F15} ![**Glandular cystic hyperplasia that is softer than the myometrium on SEG.***E* endometrium.](1878-5085-4-24-16){#F16} ![**AEH endometrium (*E*) that is softer than the myometrium on SEG**. Fluid inclusions and BGR artefact (+) are denoted by an *arrow*.](1878-5085-4-24-17){#F17} ![**Polyp fluid in the uterine cavity.** BGR artefact marks a fluid in the uterine cavity in AEH. Sonoelastography appearance of shades of color (*blue*, *green*, and *red*) through stratification artefact - BGR - a sign indicating the presence of fluid in cavities.](1878-5085-4-24-18){#F18} Personalization of conservative treatment for AEH ------------------------------------------------- With the main principle in determining the treatment strategy for reproductive age patients which is maintaining reproductive functions as sensitivity to hormone replacement therapy (31% observation), we performed a minimally invasive hysteroresectoscopy loop of 2 mm, with subsequent progestin hormone therapy (endometrin), subsequent ultrasound, and histological control. In women with endometrial abnormalities, scanty menstruation was relatively rare (up to 3 days, 4.8%); menstrual blood loss is in moderate intensity, lasting 4--6 days (8.0%), is more common, and was found in 21.9% patients. For patients with low expression of progesterone receptor, we performed a personalized therapeutic strategy considering age and comorbidities. In cases of increased progestin receptors, we administered GnRH agonists (Diferelin) for 6 months; it was followed by recovery of menstrual function and purpose of progestins (4.8% observations). We found that in a group of reproductive-aged women, conservative treatment was effective in 143 patients (45%), and we have observed a normalization of menstrual function and ultrasound characteristics of the endometrium. We considered a dynamic observation of ovary states for conservative therapy (Figure [19](#F19){ref-type="fig"}). ![**Ultrasonograms of ovaries. (A)** Polycystic ovarian syndrome (PCOS) - enlarged to 55 mm in length with small fluid inclusions. **(B)** Hyperstimulated ovary: BRG artefact in follicles.](1878-5085-4-24-19){#F19} In 82 patients (25.8%) older than 35 years, ablative surgery was performed: hysteroresectoscopy to eliminate atypical and basal layers in a single block. In 4.8% of women, we observed EH relapse (polyposis) during progestin therapy, which required re-hysteroresectoscopy, followed by appointment of GnRH agonists (Diferelin) for 6 months and progestins (endometrin). In our opinion, the cause of EH recurrence was insufficient electrodestruction due to the specific anatomy of the uterus (Figure [20](#F20){ref-type="fig"}). In the 22.6% of patients with AEH and comorbidities (large uterine fibroids, ovarian cystadenoma), hystero/oophorectomies were performed. ![**Polyp relapse.** The personalized image of the guided intervention was considered as the polyp was located close to the thinning of the uterine wall (*arrow*).](1878-5085-4-24-20){#F20} Quality of interventions needs the personalization of minimally invasive treatment of endometrial pathology ----------------------------------------------------------------------------------------------------------- Duration of surgery was 34.7 ± 9.3 min on average, while duration of hospitalization was 3.5 ± 1.2 h. The end point was the radical removal of diseased tissue; there was no recurrence of pathological processes in the endometrium. Our research has shown that the use of methods of hysteroscopic endometrial ablation in 88.8% of patients had no endometrial dynamics by ultrasound, reducing the size of the uterus in relation to the original. However, the dynamic follow-up examination at 6 months was found to be 11.2% in women; M-echo increased in thickness, and there was vaginal bleeding from the genital tract, which was the reason for the control of hysteroscopy in order to clarify the state of the cavity cancer and determine the cause of recurrent disease process. Dissection was done using a hysteroscope and other instruments, and the hysteroscopy control was found to have a uterus filled with adhesions (yellowish white color). Among 38 (11.9%) patients, 28 (8.8%) were detected to have endometrial tissue angles in the uterine tube, and 3.0% of the patients had their endometrium localized in an isthmus area. Regenerated endometrium is marked by single pink islands surrounded by scar tissue. All patients underwent repeat resection of the endometrium. The presence of proliferative endometrial tissue was confirmed morphologically. In our opinion, the cause of EH relapse was insufficient electrodestruction on specific uterine anatomy. In 22.6% of patients with AEH and comorbidities (large uterine fibroids, ovarian cystadenoma), hystero/oophorectomies were performed. Ultrasound for prediction treatment outcome ------------------------------------------- In all patients, hysteroresection was successful with no early complication diagnosed. In 241 patients (75.7%), US showed normalization of the endometrial structure and smooth margins of the myometrium. In 76 patients (23.8%), fibrotic lesions and rough margins of the myometrium were revealed. Endometrial pathology recurrence after 6 month was revealed in seven patients (2.2%) and malignancy in nine patients (2.8%). In 19 patients (5.9%), no US data were found, while clinical symptoms (e.g., uterine bleeding) called for intervention. False negative US results were noted in six patients (2.8%) (Figure [21](#F21){ref-type="fig"}). ![**Uterine cavity after hysteroresection.** Sonogram of unfavorable outcome.](1878-5085-4-24-21){#F21} Traumatic injuries of the myometrium ------------------------------------ In two patients, after 6 months, *arteriovenous malformation* (AVM) was revealed. AVM can occur after uterine curettage or surgery. After a traumatic injury, pseudo-aneurisms can occur as acquired arteriovenous malformation, arteriovenous fistula, and direct rupture of blood vessels (Figure [22](#F22){ref-type="fig"}). ![**Arteriovenous malformation in the anterior myometrium wall.** Hysteroscopy was performed 7 months ago. **(A)** In a three-dimensional ultrasound angiography on the anterior myometrium wall, the tortuous vascular plexus is determined with interconnected arteries and veins. **(B)** The blood outflow from the plexus artery to the vein in the endometrium with spectral arterial flow (speed up to 4 cm/s) changed by venous flow (up to 1 cm/s) while transducer was kept in fixed position.](1878-5085-4-24-22){#F22} Three-dimensional model-guided approach for the optimization of patient-specific operating technique ---------------------------------------------------------------------------------------------------- The causes of disease process recurrence, according to our study, were a number of factors, namely the lack of resection and electrodestruction in corners of the uterus, due to anatomical features (deep corners, the presence fibromatous nodes, distorting the angle region of the uterus), and the lack of degradation of the mouths of the fallopian tube ball electrode and the neck-loop-peresheechnogo uterine segment electrode. The analysis of this work has allowed us to identify the risk of recurrence of EH on the survey stage and, in the future, to make adjustments to the operational technique of hysteroscopic endometrial ablation. According to expert recommendations from World EPMA Congress 2011 in Bonn, it recommended to implement the concept of model-guided medicine (CARS \[[@B1]\]). We apply a three-dimensional modeling based on ultrasound data segmentation and conjoin the models \[[@B62]\] with those created from different source data of visual information (CT, MRI, and post-operative photogrammetry) in a single three-dimensional environment for planning intervention under the ultrasound guidance in real time. The three-dimensional modeling becomes a base of initiation for the model-guided interventions on female genitals \[[@B62]\]. Sonosurgery ----------- Sonosurgery \[[@B63]\] is a collection of minimally invasive surgical techniques performed with continuous ultrasound imaging and the use of endoscopic tools. It is a surgical discipline which requires the compliance of aseptic and medical art conditions and should be performed in the operating unit by experienced personnel. By medical art, we understand mastery in surgical techniques and ability to perform ultrasound examination by a physician. However, the simplicity and minimal tissue trauma in sonosurgical procedures will lead them to be done in an operating room, similar to procedures in interventional ultrasonography. Sonosurgical techniques are performed just like conventional surgery and orthopedics, but the use of ultrasound equipment can reduce the operating duration and reduce invasive procedures to affected tissues. Discussion ========== Considering anti-proliferative properties of progesterone in relation to endometrium, such levels should probably be regarded as a phase of exhaustion of compensatory processes, which we believe is the subclinical stage of transformation of atypical hyperplasia to the endometrial carcinoma. A slight decrease in estrogen receptor in the transformation of carcinoma can be explained by the disappearance of the biological need for the external support of proliferative activity in case of malignancy due to damage in the genetic apparatus and run their own system of uncontrolled cell growth in the endometrium. These data confirmed the results of the determination of the proliferative activity of the proliferative marker Ki-67; it was determined to have a significant increase of 40% to 50% in the epithelium of the glands while no changes in the stroma were revealed, as compared to glandular hyperplasia. Thus, our analysis of the ratio of receptor in tissue and endometrial stroma and observation of patients during personalized treatment allowed us to conclude as follows: 1\. In glandular EH, the concentration of estradiol receptors in epithelial cells was 75.6% and 30.9% in the stroma, whereas the rate in the control group was 43.3% and 29.6%, respectively, indicating the sharp increase (1.8 times) of estrogen receptors in the endometrium. Analysis of the distribution of receptors for progesterone showed them having a slight increase in the endometrium and in the stroma (1.3 times). 2\. Distribution of receptor systems in endometrial polyps characterized by a significant increase in the number of estradiol receptors in the stroma which was significantly higher than that in the control group was 48.2% and 29.6%, respectively (1.7 times). The content of progesterone receptors in the stroma was 58.1% and was 55.9% in the endometrial epithelium in the control group; the content of progesterone receptors in the stroma was 48.5% and was 52.4% in the endometrial epithelium. 3\. Receptor-negative feature of patients with atypical endometrial hyperplasia has a significant difference in the content of progesterone receptors in the endometrial stroma (81.8%). The content of estradiol receptors in patients with atypical hyperplasia was significantly different from that of the control group, namely estradiol receptors in epithelial cells with atypical hyperplasia amounted to 65.2%; in the stroma, 42.6% (in the control, 43.3% and 29.6% respectively). This receptor combination, we believe, is the prognostic criteria for determining the subsequent treatment strategy as the method of screening for uterine cancer pathology. 4\. On the basis of immunohistochemical studies, with a certain level of receptors for estrogen, progesterone, and proliferative marker Ki-67, it is an undoubted fact that the carcinogenesis of endometrial tumors plays an important role not only on the hormonal status (hormone levels in the blood), but also on the so-called receptor imbalance directly in the endometrium. From the morphological point of view of the sharp variations in the receptor status of the endometrium, it can be interpreted as a risk factor for the development of mutations in the genetic apparatus and thus tumor development. 5\. In relation to further management of patients with different types of receptor status, we believe that increasing the percentage of patients having a decrease in both receptors for progesterone and estrogen causes endometrial hyperplasia. In fact, inefficient use of hormone therapy in these patients underscores the need not only for histological and hormonal studies but also for complements of the diagnostic algorithm for determining relationships in the endometrial receptor system that will allow pathogenetic therapy. Thus, each individual pathological pattern of the definition of receptors and their relationship further defines personalized pathogenetic tactics, tailored to the person. 6\. Ultrasound has sensitivity, specificity, positive and negative predictive values, and accuracy which were 96%, 85%, 82%, 94%, and 84%, respectively, for early detection of endometrial hyperplasia and prediction outcome of a minimally invasive treatment program. SEG had a sensitivity and specificity of 91% and 83%, respectively, for polyp diagnosis. 7\. The study of hormone receptor status in patients with EH allows to clearly define the treatment policy and to avoid relapse, optimizing treatment and observation of such patients. 8\. Pharmacotherapy combined with minimally invasive surgery enabled to treat patients with EH and significantly reduced radical interventions and time of treatment. 9\. Performing conservative interventions and personalized pharmacotherapy with subsequent use of GnRH agonists and progestin on the second stage is an effective treatment of recurrent EH, which enabled significantly to reduce the number of radical interventions and time of treatment. Consolidation of the PPPM concept --------------------------------- Thus, our analysis of the ratio of receptors in the tissue and endometrial stroma in observed patients allowed us to conclude as follows. ### Personalized medical approach Each individual pathological pattern of the definition of receptors and their relationship combined with US biomarkers defines further *personalized* tactics. Three-dimensional model-guided approach is necessary to perform case-specific intervention. ### Predictive medical approach These receptor combination patterns are *predictive criteria* for determining the subsequent treatment strategy as the method of screening for uterine cancer pathology. The sharp variations in the endometrium receptor status can be interpreted as a risk factor for development of genetic mutations and carcinogenesis. ### Preventive medical approach Our results may lead to the initiation of programs to prevent endometrial cancer and improve the quality of life. It is recommended to promote programs for the introduction of ambulatory 'office' of hysteroscopic operations that will raise the operative outpatient gynecological care to a new level of efficiency and safety. Study limitation ---------------- Quantitative shear-wave sonoelastography and contrast-enhanced US were not applied in this study. Particularly, genetic and cellular mechanisms were out of assessment. The study was non-randomized and non-blinded. The confounders as collateral pathologies were present and not profoundly studied. Future outlooks and expert recommendations ------------------------------------------ We suggest further studies to include virus status, immune response, gene damage, and actions of promising substances as nanomaterials (e.g., nanoceria, nanogold) for complex impact on *female health* and collateral pathologies, and to initiate comparative studies to establish science-based treatment algorithms and updated screening programs. After approval, they should develop safe and effective personalized treatments. Collateral pathologies related to the studies --------------------------------------------- Metabolic disturbances in obesity causes a number of diseases, namely cardiovascular diseases, and a number of tumor sites of lung cancer, breast cancer, uterine cancer, and ovarian cancer; in women, there is a violation of ovarian menstrual cycle called dyslipidemia. Obesity reduces life expectancy by 3--5 years, and sometimes, in severe forms, for 15 years \[[@B1],[@B2]\]. The incidence of endometrial cancer is related to increasing age and, with 39% of cases, is attributed to obesity \[[@B64]\]. The recent data, regarding women\'s differential responses to lifestyle changes, support another branch of research with gender nutrition emphasis within predictive, preventive, and personalized medicine \[[@B65]\]. Illustrated were extensive interrelations among viral action, cellular oxidative stress, gene damage, multiple immune pathways and proteomic changes in cancer related to diabetes mellitus, and many chronic disorder developments \[[@B66]\]. Many of the chronic diseases are also related to virus infection (human papillomavirus (HPV), herpesvirus), followed by gene damage and immune mechanisms involvement \[[@B66],[@B67]\]. HPV infection is attributed to 80% of all human cancers and was supposed to play a central role in the development of breast cancer \[[@B66],[@B68]\]. It was described as a novel improved multimodal diagnostic approach for breast cancer risk assessment, which utilizes a combination of conventional, analytical methodologies for the creation of pathology-specific biomarker patterns \[[@B2],[@B68]\]. Many endocrine, neurologic, autoimmunity, osteoporotic, and neurodegenerative diseases \[[@B69]\] are strongly related to the hormonal status in women. Expanding the immunologic study ------------------------------- The study is promising to signal pathways imbalance of pro- anti-inflammatory cytokines, toll-like receptors in carcinogenesis, and cancer relapse in virus-induced malignancies. Considering the ability of group factors, e.g., probiotics, which can promote effective immune response and initiate an effective immune defence, probiotic/immunobiotic application might be promising while integrating the personalized approach. Biotherapy ---------- The study of different molecular pathways and the correlation of immunohistochemical findings with histologic grade and clinical stage could help in predicting biologic behavior and planning treatment in patients who are diagnosed as having these tumors \[[@B16]\]. The fundamental studies on endometrial stem/progenitor cells may provide new insights into the pathophysiology of various gynecological disorders associated with abnormal endometrial proliferation, including endometrial cancer, endometrial hyperplasia, endometriosis, and adenomyosis \[[@B31]\]. Genetic studies --------------- Discovery of somatically mutated cells in human tissues has been less frequent than would be predicted by *in vitro* mutational rates \[[@B21],[@B67]\]. Nanotechnologies ---------------- Nanoparticles of cerium dioxide and gold \[[@B70],[@B71]\] were reported against oxidative damage, working as anti-ageing agent. Treatment with nanoceria results in the increase in the number of oocytes in follicles at metaphases I and II, increase in the number of living granulosa cells, and decrease in the number of necrotic and apoptotic cells \[[@B70]\]. In combination with anti-cancer theranostic application, it is a promising direction to develop in PPP gynecology and reproductive medicine. Mathematical modeling approach ------------------------------ Most processes found in medicine are non-linear, chaotic, and have a high level of complexity; creating a reliable mathematical model and use of information technology at all stages of the treatment process from the expression of the pathological processes to the implementation of therapeutic interventions associated with patient and physician perception of these phenomena, and making decisions in the absence of input parameters for the creation of self-controlled systems based on forecasts of future medical errors are important tasks \[[@B72]\]. Previously, we reported \[[@B73]\] the approach solving combinatorial (correctable) problems of selection options of negative prognostic indicators for interventional radiology/surgery mistakes to ensure a high level of patient safety as well as study-level skills and minimal training required for training programs for interventional medicine by applying the *stochastic method of branches and boundaries*. We suggest that this study would have a follow-up to assess the multi-parameter data by novel mathematical model according to which the medical process is recognized as a complex system like the 'black box' \[[@B74]\]. This process (EH progression) is described by some of the primary indicators (US and immunohistochemical biomarkers). Thus, primary indicators and output rate are stochastic in nature and are presented as statistical information. The 'best' mathematical model of the medical process is studied using a special algorithm for processing statistical data \[[@B2]\]. We would recommend the application of one minimal model to solve tasks as simple as possible. *Fractal geometry* is a promising opportunity, especially the application of fractal analysis in complex systems of visual diagnostics including radiology and histology data in order to expand its diagnostic capabilities by increasing the information content for intelligent decision modeling to reduce subjectivity in the perception and interpretation \[[@B75]\]. This approach was successfully applied for hepatic oncology \[[@B76]\]. Education for preventive measures --------------------------------- Educational programs and individual preventive facilities are the important task for the PPPM concept in women\'s health. Dissemination of information is necessary in order to popularize screening programs and patient participation approaches against risk factors including obesity, fat diet, diabetes, menstrual cycle disorders, alertness in never having been pregnant, receiving hormonal therapy, endocrine pathology, cancer prehistory, and family history. The material for dissemination and lecturing should be standardized (well translated, to be easily understood) in order to facilitate the work. Support of preventive educational activity with long-term commitment of private and public funding programs is required. Potential economical impacts ---------------------------- The cost of new gynecological cancers in developing countries in 2009 totalled to US\$1.087 billion compared to the US\$11.913 billion spent in developed countries \[[@B77]\]; in 2009, cancer costs in the European Union (EU) were estimated at €126 billion, in particular, for corpus uteri, it was €4.554 billion. The preventive campaigns for organizational diagnostic tests/programs with focus on prediction and prevention are available at low costs (ultrasound, most valid biomarkers) and should valuably benefit the economy. Obesity as a condition associated to endometrial pathology and uterine cancer accounts for the burden related to the treatment of these preventable diseases (about €59 billion a year in EU; US\$71.1 billion in the USA). The combined medical costs attributable to obesity and overweight are projected to double every decade and will account for 16%--18% of the total US healthcare expenditure by 2030 \[[@B78]\]. Thus, considering integrative medical approach within the PPPM paradigm directed to women\'s health should lead to significant *indirect economic benefits*. Promoting programs for the introduction of personalized outpatient gynecological care as the patient-centerd medical home (PCMH) model based on prediction and prevention is expected to be more cost effective than treatment on advanced diseases in large centers. With the concluding points, we can formulate the following proposals (expert recommendations): 1\. For the EU, an international women\'s health project including the study of integrative diagnosis and treatment of endometrial pathology in regards to preserving the reproductive function should be created. There should be a sufficient evidence study to determine relationships in endometrial receptor system, genetics, immune pathways to complement the diagnostic algorithm that will allow the development of novel treatments and model-guided approach. 2\. For Ukraine, it is recommended to promote programs for the introduction of personalized outpatient (office) gynecological care as the patient-centered medical home (PCMH) model for healthcare delivery with a high level of efficiency and patient safety; it is also recommended that there should be project participation in partnership with the EU to follow up experimental and clinical trials and to involve related institutions and centers to the study. Conclusions =========== The study of hormone receptor status combining with US/sonoelastography data in patients with endometrial hyperplasia allows for the clear definition of the treatment policy and reduction of relapse. Transvaginal sonography in complex application with sonoelastography is a highly diagnostic screening test for endometrial pathology. Performing hysteroresectoscopy and the subsequent use of GnRH agonists (Diferelin) and a progestin (endometrin) in the second stage is an effective treatment of recurrent EH and significantly reduces radical interventions and time of treatment. Pre-operative ultrasound/radiology data analysis allows the following: to simulate the upcoming surgery, to set the anatomical features of the pathologic process, to prevent intra-operative complications, and to identify areas of risk for the development of recurrence. Abbreviations ============= AEH: Atypical endometrial hyperplasia; AR: Androgen receptor; EH: Endometrial hyperplasia; ER: Estrogen receptor; PCOS: Polycystic ovarian syndrome; PPPM: Predictive preventive, and personalized medicine; PR: Progesterone receptor; UPSA: Uterine papillary serous adenocarcinomas. Competing interests =================== The authors declare to have no competing interests. Authors' contributions ====================== VMG was responsible for the idea of the study and the study organization; performed diagnosis, treatment of patients, and data analysis; and prepared the article. VAB participated in the study organization and analysis of the study. OVK performed the immunohistochemical survey. OMD participated in the examination of patients and in data analysis. MYS did the analysis of the study and participated in preparing article. RVB participated in the study organization, in the diagnosis, and in the treatment of patients; performed ultrasound survey; performed literature review; participated in the analysis of the study; described interdisciplinary systematization and prospects; and drafted the article. All authors read and approve the manuscript. Authors' information ==================== VMG is a doctor of medicine and philosophy and is a medical doctor in Center of Gynecology in the Clinical Hospital 'Pheophania' of the State Affairs Department. VAB is a doctor of medicine, philosophy, and science and is a professor at the Third Department of Obstetrics and Gynecology in Bogomolets National Medical University, Kyiv. OVK is a doctor of medicine and philosophy and is the head of the Department of Pathology in the Clinical Hospital 'Pheophania' of the State Affairs Department. OMD is a doctor of medicine and philosophy and is medical doctor at the Kyiv Perinatal Center and JSC SPC 'DiaprofMed'. MYS is a doctor of medicine, philosophy, and science; is a professor and corresponding member of the National Academy of Sciences of Ukraine; and is the director of the Inteferon Department of Zabolotny Institute of Microbiology and Virology, NAS of Ukraine, Kyiv. RVB is a doctor of medicine and philosophy; is a medical doctor in the Center of Ultrasound diagnostics in the Clinical Hospital 'Pheophania' of the State Affairs Department; and is the National Representative of the European Association for Predictive, Preventive and Personalised Medicine (EPMA) in Ukraine. Acknowledgements ================ We acknowledge the contribution of the staff of the Clinical Hospital 'Pheophania' who were involved in the diagnosis and treatment of patients. We acknowledge Prof. Olga Golubnitschaja of Friedrich-Wilhelms University of Bonn, Germany for providing help in the consolidation of the integrative view on PPPM in women\'s health, and we are thankful for the kind help of the EPMA Journal editorial team and BioMed Central team in improving the text of the article.
2024-04-08T01:26:58.646260
https://example.com/article/4676
Q: Graphics don't appear when adding if statement in update() void I was working to create my first game with a simple 2d game engine. Anyways, each time I add if (input.KEY_RIGHT) x++;, the canvas doesn't load. It only shows the background of the JPanel. But when I delted if (input.KEY_RIGHT) x++;, it will work. PLease let me know why it doesn't work. package net.james222.game; import java.awt.*; import java.awt.image.BufferedImage; import javax.swing.JFrame; /** * Main class for the game */ public class Game extends JFrame { public InputHandler input; private static final long serialVersionUID = 1L; boolean isRunning = true; int fps = 30; int windowWidth = 500; int windowHeight = 500; BufferedImage backBuffer; Insets insets; int x = 0; public static void main(String[] args) { Game game = new Game(); game.run(); System.exit(0); } /** * This method starts the game and runs it in a loop */ public void run() { initialize(); while(isRunning) { long time = System.currentTimeMillis(); update(); draw(); // delay for each frame - time it took for one frame time = (1000 / fps) - (System.currentTimeMillis() - time); if (time > 0) { try { Thread.sleep(time); } catch(Exception e){} } } setVisible(false); } /** * This method will set up everything need for the game to run */ void initialize() { setTitle("Game Tutorial"); setSize(windowWidth, windowHeight); setResizable(false); setDefaultCloseOperation(EXIT_ON_CLOSE); setVisible(true); insets = getInsets(); setSize(insets.left + windowWidth + insets.right, insets.top + windowHeight + insets.bottom); backBuffer = new BufferedImage(windowWidth, windowHeight, BufferedImage.TYPE_INT_RGB); } /** * This method will check for input, move things * around and check for win conditions, etc */ void update() { if(input.KEY_RIGHT) x++; } /** * This method will draw everything */ void draw() { Graphics g = getGraphics(); Graphics bbg = backBuffer.getGraphics(); bbg.setColor(Color.WHITE); bbg.fillRect(0, 0, windowWidth, windowHeight); bbg.setColor(Color.BLACK); bbg.drawOval(x, 10, 20, 20); g.drawImage(backBuffer, insets.left, insets.top, this); } } A: Painting is Swing is typically done withing the paintComponent method of a component extending from JComponent (typically JPanel) You should never use getGraphics. This is simply a snap shot of the state of the component after the last paint cycle and may return null if the component hasn't begin painted yet. It's contents will also be overriden on the next paint cycle. Start by taking a look at Performing Custom Painting Painting in AWT and Swing I would also encourage you to use the key bindings API over KeyListener (not that I can see you actually using any sort of input event handler at all)... I would also encourage you to take a look at Concurrency in Swing and Initial Threads as you are violating the single thread model of Swing. Java/Swing is a complex API/framework with very specific requirements for it's use. While it is extremely flexible, it does require you to understand how it works so you can take the fullest advantage of it. I would put aside your gaming aspirations while you come to grips with these concepts as it will make your life a million times simpler
2023-12-20T01:26:58.646260
https://example.com/article/1126
Q: Rally query for tasks related to a user story with a specific parent How do I write a Rally query to give me all the Rally tasks for a user story which has a parent user story that has a specific ID? For an ID of "S666", this works for tasks: (WorkProduct.FormattedID = "S666") And this works for user stories: (Parent.FormattedID = "S666") However, when I try the following: (WorkProduct.Parent.FormattedID = "S666") Then I get this error: Could not parse: Could not traverse to "Parent" on type Artifact in the query segment "WorkProduct.Parent.FormattedID" A: Unfortunately you won't be able to do this directly from the task endpoint due to the error you found above. Since the WorkProduct field on Task is of type Artifact (not necessarily a story- could be a Defect, etc.) it has no Parent field. However you should be able to query for stories where (Parent.FormattedID = "S666") and include Tasks (and any fields on Task you're interested in) in your fetch. "/hierarchicalrequirement.js?query=(Parent.FormattedID = "S666")&fetch=Tasks,FormattedID,Name,Owner,State,Actuals,Estimate,ToDo"
2023-11-16T01:26:58.646260
https://example.com/article/3825
--- author: - Pan Hu - Boris Motik - | Ian Horrocks\ Department of Computer Science, University of Oxford\ Oxford, United Kingdom\ firstname.lastname@cs.ox.ac.uk bibliography: - 'references.bib' title: Optimised Maintenance of Datalog Materialisations --- Acknowledgments {#acknowledgments .unnumbered} =============== This work was supported by the EPSRC projects MaSI$^3$, DBOnto, and ED$^3$.
2024-05-07T01:26:58.646260
https://example.com/article/5667
/* * Copyright (C) 2013-2019 Free Software Foundation, Inc. * * This file is part of GNU lightning. * * GNU lightning is free software; you can redistribute it and/or modify it * under the terms of the GNU Lesser General Public License as published * by the Free Software Foundation; either version 3, or (at your option) * any later version. * * GNU lightning is distributed in the hope that it will be useful, but * WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY * or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public * License for more details. * * Authors: * Paulo Cesar Pereira de Andrade */ #include <lightning.h> #include <lightning/jit_private.h> #include <stdio.h> #include "lib/jit_names.c" jit_int16_t _szs[jit_code_last_code]; int main(int argc, char *argv[]) { FILE *fp; jit_word_t offset; int code, size, max; if ((fp = fopen(JIT_SIZE_PATH, "r")) == NULL) exit(-1); while (fscanf(fp, "%d %d\n", &code, &size) == 2) { if (_szs[code] < size) _szs[code] = size; } fclose(fp); max = 0; for (offset = 0; offset < jit_code_last_code; offset++) if (max < _szs[offset]) max = _szs[offset]; if ((fp = fopen(JIT_SIZE_PATH, "w")) == NULL) exit(-1); #if __X64 || __X32 # if __X64 fprintf(fp, "#if __X64\n"); # if __X64_32 fprintf(fp, "# if __X64_32\n"); # else fprintf(fp, "# if !__X64_32\n"); # endif # else fprintf(fp, "#if __X32\n"); # endif #else fprintf(fp, "#if __WORDSIZE == %d\n", __WORDSIZE); #endif #if defined(__arm__) # if defined(__ARM_PCS_VFP) fprintf(fp, "#if defined(__ARM_PCS_VFP)\n"); # else fprintf(fp, "#if !defined(__ARM_PCS_VFP)\n"); # endif #elif defined(__mips__) # if __WORDSIZE == 32 # if NEW_ABI fprintf(fp, "#if NEW_ABI\n"); # else fprintf(fp, "#if !NEW_ABI\n"); # endif # endif #elif defined(__powerpc__) fprintf(fp, "#if defined(__powerpc__)\n"); fprintf(fp, "#if __BYTE_ORDER == %s\n", __BYTE_ORDER == __BIG_ENDIAN ? "__BIG_ENDIAN" : "__LITTLE_ENDIAN"); # if __WORDSIZE == 32 fprintf(fp, "#if %s\n", # if !_CALL_SYSV "!" # endif "_CALL_SYSV" ); # endif #endif fprintf(fp, "#define JIT_INSTR_MAX %d\n", max); for (offset = 0; offset < jit_code_last_code; offset++) fprintf(fp, " %d, /* %s */\n", _szs[offset], code_name[offset]); #if defined(__arm__) fprintf(fp, "#endif /* __ARM_PCS_VFP */\n"); #elif defined(__mips__) # if __WORDSIZE == 32 fprintf(fp, "#endif /* NEW_ABI */\n"); # endif #elif defined(__powerpc__) fprintf(fp, "#endif /* " # if !_CALL_SYSV "!" # endif "_CALL_SYSV" " */\n"); fprintf(fp, "#endif /* __BYTE_ORDER */\n"); fprintf(fp, "#endif /* __powerpc__ */\n"); #endif #if __X64 || __X32 # if __X64 fprintf(fp, "# endif /* __X64_32 */\n"); fprintf(fp, "#endif /* __X64 */\n"); # else fprintf(fp, "#endif /* __X32 */\n"); # endif #else fprintf(fp, "#endif /* __WORDSIZE */\n"); #endif fclose(fp); return (0); }
2023-12-24T01:26:58.646260
https://example.com/article/5363
Compact Discs (CDs), Digital Versatile Discs (DVDs), and the like have leaded the market of optical recording media hitherto. However, a further increase in capacity of optical recording media has been demanded with distribution of high-definition televisions and a rapid increase in data handled by Personal Computers (PCs) in recent years. In order to respond to such a demand, high-capacity optical recording media compatible with blur laser, such as a Blu-ray Disc (BD) (registered trademark) have appeared, and a market of new high-capacity optical recording media has been launched. A technique of providing multiple recording layers in order to further increase recording capacity in high-density optical recording media such as a DVD and a BD has widely been employed. Particularly, development of a multilayered optical recording medium provided with three or more recording layers has been advanced in recent years. However, a signal property deteriorates due to interlayer stray light if multiple recording layers are provided. If three or more recording layers are provided in particular, stray light from parts other than a recording layer from which an information signal is intended to be read increases, and therefore, the signal property particularly significantly deteriorates. For this reason, a technique of effectively suppressing an influence of the stray light and enhancing the signal property has been examined for the multilayered optical recording medium in the related art. PTLs 1 and 2 disclose techniques of removing an influence of multiple reflection caused by the stray light by setting the thickness of a spacer between information recording layers so as to satisfy a predetermined relationship.
2024-04-09T01:26:58.646260
https://example.com/article/6090
456 P.2d 875 (1969) CITY OF SANTA FE, A Municipal corporation and a political subdivision of the State of New Mexico, Plaintiff-Appellant, v. Joe O. GONZALES and Vangie Gonzales, his wife, Defendants-Appellees. No. 8755. Supreme Court of New Mexico. July 14, 1969. Dean S. Zinn, Santa Fe, for plaintiff-appellant. Bigbee & Byrd, Santa Fe, for defendants-appellees. OPINION TACKETT, Justice. This case was filed in the District Court of Santa Fe County, New Mexico, to condemn property in Santa Fe for street purposes. The appeal deals with the property known as Tract 2-7 owned by Joe O. Gonzales and Vangie Gonzales, his wife, defendants-appellees. The case was tried to a jury; however, the trial court, after refusing to allow the City's expert witness to testify as to market value, directed a verdict for defendants Gonzales. The City appealed, alleging that the trial court erred in directing a verdict against plaintiff. The City of Santa Fe filed this condemnation action under § 22-9-39, N.M.S.A., 1953 Comp., 1967 Pocket Supp., as part of a so-called "Inner Loop" project, which was a complete taking of Gonzales' property located on the southeast corner of Hickox and Gomez Streets. The City deposited with the clerk of the district court $10,600, representing the amount offered for the property. The answer alleged the highest and best use for the property was for residential rental purposes and claimed $26,500 as just compensation. Defendants withdrew the $10,600 deposited by the City without prejudice to litigate for additional compensation. Judgment on the directed verdict in favor of defendants was entered on October 31, 1967, for the sum of $25,000, less the $10,600 withdrawn, leaving a difference of $14,400, plus interest at 6% per annum from March 22, 1967, until paid. The main issue complained of in this case is the refusal of the trial court to allow plaintiff's expert appraiser (Rogers) to testify as to the fair market value of the property in question; notwithstanding, after a detailed and lengthy examination into Rogers' qualifications as a real estate appraiser, the trial court accepted his qualifications as an expert appraiser. Mr. Gonzales, the owner of the property condemned, testified that the fair market value of his property was from $25,000 to $30,000. His expert witness testified that the fair market value was $25,000. When Rogers was called by plaintiff, he testified, that, in making the appraisel, he went out and familiarized himself with the property; that he examined the property a number of times in May 1966, and was on the property about every other day from May until August 1966; that he took pictures of the property, studied strip maps and aerial photographs, collected market data for the area, measured the property, inspected the exterior premises, looked through windows in one apartment but was never able to get inside; that, in addition, he made a study to determine if the neighborhood was static, declining or improving; and that, on the date of the taking, the building and premises had not changed from the time he first viewed the property. At this point in the proceedings, the trial court ruled that since Rogers had not seen the inside of the apartments he could not testify as to the fair market value of the property, and that he could not give an opinion with respect to comparability. The trial court did allow Rogers to explain his approaches to determine fair market value, i.e., market value, income and cost estimate approach. Rogers then testified that the best indicator of fair market value was the income approach. When Rogers attempted to give his opinion as to the fair market value of the property on the income approach, the trial court sustained an objection, refusing to allow Rogers to testify further. A tender of proof was then made in the absence of the jury, which was refused. The trial court held, as a matter of law, that there was no substantial or reliable evidence offered by the City upon which a jury could return a verdict. With this we cannot agree. Appellant's contention is that, in passing upon the testimony of Rogers, the trial court failed to distinguish between the admissibility of evidence and the weight or credibility attached thereto. With this contention we agree. Opinions of real estate appraisers on fair market value must be considered in connection with related facts on which they are based, and a satisfactory explanation must be given as to how the witness arrived at his conclusion. City of Albuquerque v. Chapman, 76 N.M. 162, 413 P.2d 204 (1966). This requirement was met by the appraiser Rogers in the instant case. 32 C.J.S. Evidence § 546(117) at p. 436. We recognize the settled rule that a broad discretion is vested in the trial court in passing on the admissibility of opinion evidence in cases such as this, and, ordinarily, its rulings will not be disturbed on appeal. See Transwestern Pipe Line Company v. Yandell, 69 N.M. 448, 367 P.2d 938 (1961). However, his discretion is not absolute and may not be exercised so as to impede either party in adequately presenting his case. United States v. Lowrie, 246 F.2d 472 (4th Cir.1957); State v. Oakley, 163 Tex. 463, 356 S.W.2d 909, 95 A.L.R.2d 1207 (1962). Appellant City was not allowed to adequately present its case. There is no issue present here concerning the admissibility of an opinion by the expert based on the elements considered by him. Nothing is involved beyond the trial court's exclusion of the expert's opinion because he had not been inside the premises, and because he had no direct knowledge of items of income and expense used as a basis for his opinion. The record is clear that the testimony of Rogers was not based on conjecture, speculation or surmise, as, indeed, it could not be and be entitled to be admitted. See Fitzgerald v. Fitzgerald, 70 N.M. 11, 369 P.2d 398 (1962). The rule with respect to the admissibility of hearsay evidence of expert witnesses in condemnation cases has been relaxed. Annot. 12 A.L.R.3d 1064 and 95 A.L.R.2d 1217. Such cases are recognized as special proceedings because of the practicalities present in developing proof of value through an expert. State ex rel. State Highway Commission v. Burks, 79 N.M. 373, 443 P.2d 886 (1968). In an old case, Pierce v. City of Boston, 164 Mass. 92, 41 N.E. 227 (1895), an expert carpenter was permitted to testify as to the value of a building, even though he had not seen the interior thereof. The court held it was for the jury to determine what weight should be given his testimony. As an expert carpenter and builder, he would have been competent to express an opinion without having seen the house at all. In Farr v. State Highway Board, 122 Vt. 156, 166 A.2d 187 (1960), it was held that testimony of expert witnesses in condemnation cases, who had not viewed the land, was admissible. In Iowa Development Co. v. Iowa State Highway Com'n, 255 Iowa 292, 122 N.W. 2d 323 (1963), it was held: "* * * The rule as to competency of value witnesses is to be liberally construed in favor of admissibility and if there is evidence of knowledge of values the extent of the witness qualifications ordinarily goes to the weight of the evidence rather than to its admissibility. * * *" Compare State ex rel. Morrison v. Jay Six Cattle Co., 88 Ariz. 97, 353 P.2d 185 (1960); State Highway Com'r v. National Fireproofing Corp., 127 N.J.L. 346, 22 A.2d 268 (1941). It was error for the trial court to refuse to allow Rogers to testify. Compare, State v. Chavez (decided June 9, 1969), 80 N.M. 394, 456 P.2d 868 (1969). Likewise, under the circumstances, it was error to direct a verdict against the City of Santa Fe. The case is reversed and remanded to the trial court with direction to reinstate the cause on the docket, afford the City of Santa Fe a new trial, and proceed in a manner consistent with this opinion. It is so ordered. MOISE and COMPTON, JJ., concur.
2023-09-17T01:26:58.646260
https://example.com/article/8789
All Sermons For Prophecy “This parable, like the preceding, sets forth the loss of something which with proper search may be recovered, and that with great joy. But the two parables represent different classes. The lost sheep knows that it is lost. It has left the shepherd and the flock, and it cannot recover itself. It represents those who […] Revelation 13:8-9 In the last days, nearly the whole world, those “whose names are not written in the book of life,” with “worship” this beast. The day is coming soon when the majority of humankind will obey a few supporting the authority of the Papacy above the commands of God, and will thus worship the […] The Trump Card (Updated) – Walter Veith in Copenhagen – October 2017 Has the Trump administration brought us any closer to the fulfillment of Bible prophecy? With the election of Donald Trump as the president of the United States, prophecy can finally reach the point of fulfillment, when Church and State comes together to enact […] Globalism is a key prophetic marker that is a major component of end-time events. Its maturation has been accelerated especially since the end of the 1980s when the Berlin wall came down. Globalism and socialism have been part of the Roman Catholic agenda, and political leaders have consistently complied with the hidden elite behind the […] “The world is a theater, and the actors, its inhabitants, are preparing to act their part in the last great drama. God is lost sight of. With the great masses of humanity, there is no unity, except as men confederate to accomplish their selfish purposes. God is looking on. His purposes in regard to His […] “The world is filled with storm and war and variance. Yet under one head–the papal power–the people will unite to oppose God in the person of His witnesses. What is it that gives its kingdom to this power? Protestantism, a power which, while professing to have the temper and spirit of a lamb and to […]
2024-06-13T01:26:58.646260
https://example.com/article/8190
english9149.jpg 640x625 1600x1561 Full size: Size:Full size: 1600x1561 next last first previous Advanced Search Photo Properties summary details Aperture Value f/8 Focal Length 50 mm ISO 100 Shutter Speed Value 1/120 sec next last first previous
2024-02-11T01:26:58.646260
https://example.com/article/7625
Graves of Zionist Leaders Desecrted The graves of several Zionist founders of the State of Israel at Mount Herzl National Ceremony were desecrated overnight. Slogans denouncing archaeological excavations in the Negev, at a site where there are alleged to be ancient Jewish graves, were daubed on the tombstones of Theodor Herzl, Zalman Shazar, Levi Eshkol, Golda Meir and Zeev Jabotinsky. The slogans were signed “Keshet,” a group suspected by the police to consist of ultra-Orthodox zealots. The identity of the members are not known. Keshet also claimed responsibility for three previous incidents of desecration.
2023-12-16T01:26:58.646260
https://example.com/article/7381
a cautionary tale about the folly of superficiality that is itself endlessly superficial .
2023-08-06T01:26:58.646260
https://example.com/article/6363
package com.shekhargulati.java8_tutorial.ch01; public class App3 implements E, F { @Override public void doSth() { F.super.doSth(); } public static void main(String[] args) { new App3().doSth(); } } interface E { default void doSth() { System.out.println("inside E"); } } interface F { default void doSth() { System.out.println("inside F"); } }
2024-01-15T01:26:58.646260
https://example.com/article/2908
Q: How a sound is played in c++ simple question i asked myself yesterday, if an os is multitask, it will be able to play sound and do other stuff at the same time, because of task managing right ? But, why the sound is great and do not have any interference ? thanks per avance A: Not sure how this is related to c++, but when you play sound on a computer, it consumes resources by entering CPU cycles. Sound is seemingly "great" because CPUs nowadays are much more capable, and the extra load has a negligible effect on system performance, and you don't have stutters due to depletion of resources. If you are talking about signal interference, this is about circuit/PCB design, not about the OS or CPU scheduling.
2023-11-24T01:26:58.646260
https://example.com/article/4108
Install [https://aur.archlinux.org/packages.php?ID=2880 metasploit] or [https://aur.archlinux.org/packages.php?ID=23031 metasploit-svn] from the [[AUR]]. + Install [https://aur.archlinux.org/packages.php?ID=2880 metasploit] or [https://aur.archlinux.org/packages.php?ID=23031 metasploit-svn] or [https://aur.archlinux.org/packages/metasploit-git/ metasploit-git] from the [[AUR]]. Contents Overview Consider the MSF to be one of the single most useful auditing tools freely available to security professionals today. From a wide array of commercial grade exploits and an extensive exploit development environment, all the way to network information gathering tools and web vulnerability plugins. The Metasploit Framework provides a truly impressive work environment. The MSF is far more than just a collection of exploits, it's an infrastructure that you can build upon and utilize for your custom needs. This allows you to concentrate on your unique environment, and not have to reinvent the wheel.
2023-12-06T01:26:58.646260
https://example.com/article/1579
Symbol Matches Symbol Starts With Company Matches Barclays fined $109 million for trying to hide 'the deal of the century' Barclays has been slapped with a record fine for trying to keep a huge deal with super rich clients so secret it bought a new safe just to store the documents. The U.K. Financial Conduct Authority fined Barclays £72 million ($109 million) on Thursday for trashing its own rules on making background checks on clients and the origin of their cash, and whether they figured on international sanctions lists. Barclays(BCS) said there was no evidence a crime had been committed, and that it "continues to apply significant resources and training to ensure compliance with all legal and regulatory requirements." But regulators said the lengths a handful of Barclays employees went to hide the £1.9 billion transaction ($2.8 billion), including from the bank's own staff, "threatened confidence in the U.K. financial system." The FCA said Barclays bent over backwards to accommodate a number of "ultra high net worth clients" and earn its £52 million commission. The bank had failed to perform proper due diligence that should have thrown up a number of red flags, the FCA said, adding it had tripled the size of the fine to act as a deterrent to others. Known as an "elephant deal" inside Barclays, the transaction took place in 2011-2012. One senior banker said it could be "the deal of the century," according to the regulators. Barclays would not comment on whether former CEO Bob Diamond, who resigned in July 2012 in the wake of the Libor rigging scandal, was aware of the deal. The bank would have faced an even heftier penalty had it not cooperated with investigators at an early stage. The FCA gave no details of the clients, or their countries of origin, but described them as "politically exposed people," which it defines as individuals outside the U.K. who may have been in a position to abuse their public position for private gain. When Barclays asked its clients about the origin of the money, it was told the cash came from landholdings, real estate and commercial activities. The FCA said this answer was "wholly inadequate and virtually meaningless." Red Flags According to the regulator, Barclays: 1. Did not sufficiently corroborate the clients' stated source of wealth and source of funds for the transaction. 2. Omitted client names from internal systems, meaning the bank could not carry out crosschecks against international sanctions and court order lists. 3. Relied on public Internet pages to verify the clients' sources of wealth. 4. Rushed the deal through so quickly the bank had received the cash before it had any assurance as to the source of the funds. 5. Opened and closed offshore accounts quickly just to process this transaction. The Safe Perhaps most alarming are the steps the bankers took to keep the deal hidden from colleagues. Some of the documents related to the trade were held in hard copy by Barclays "in a safe purchased specifically for storing information relating to the business relationship." When regulators went to the bank to investigate, "few people within Barclays knew of the existence and location of the safe," the FCA said. Neither Barclays nor the FCA would comment on where the safe was located.
2024-03-25T01:26:58.646260
https://example.com/article/4802
William Fellowes, 2nd Baron de Ramsey William Henry Fellowes, 2nd Baron de Ramsey (16 May 1848 – 8 May 1925), was a British Conservative politician. De Ramsey was the eldest son of Edward Fellowes, 1st Baron de Ramsey, and Hon. Mary Julia Milles. Ailwyn Fellowes, 1st Baron Ailwyn, was his younger brother. He purchased a commission as a cornet in the Life Guards on 16 March 1867; he retired as a captain on 21 July 1877. He succeeded his father as Member of Parliament for Huntingdonshire in 1880, a seat he held until 1885 when the constituency was abolished, and then represented Ramsey until August 1887, when he inherited the barony on his father's death and entered the House of Lords. In 1890 de Ramsey was appointed a Lord-in-waiting (government whip in the House of Lords) in the Conservative administration of Lord Salisbury, a post he held until the Conservative defeat in the 1892 general election. Family Lord de Ramsey married Lady Rosamond Jane Frances Spencer-Churchill, daughter of John Churchill, 7th Duke of Marlborough, in 1877. He thereby became the brother-in-law of Lord Randolph Churchill and the uncle (through marriage) of Winston Churchill. Lady de Ramsey died in 1920. Lord de Ramsey survived her by five years and died in May 1925, aged 76. He was succeeded in the barony by his grandson Ailwyn, his son and heir apparent Captain the Hon. Coulson Churchill Fellowes having died on active service in the First World War. Hon. Alexandra Frances Anne Fellowes (29 June 1880 – 16 September 1955), married Brig.-Gen. Hon. Ferdinand Charles Stanley Hon. Coulson Churchill Fellowes (8 February 1883 – 22 October 1915), married first Gwendolen Dorothy Jefferson and secondly Hon. Lilah O'Brien Ailwyn Fellowes, 3rd Baron de Ramsey (1910–1993) Hon. Reginald Ailwyn Fellowes (20 January 1884 – 19 March 1953), married Marguerite Séverine Philippine Decazes de Glücksbierg more usually known as Daisy Fellowes Hon. Gladys Cecil Georgina Fellowes (4 January 1885 – 4 August 1952), married Captain Heneage Greville Finch, Lord Guernsey Hon. Hermione Frances Caroline Fellowes (31 July 1886 – January 1972), married 1. Brig.-Gen. Lord Esmé Charles Gordon-Lennox and secondly Rolf Cederström, Baron Cederström Hon. Sybil Inna Mildred Fellowes (24 October 1888 – 18 May 1948), married James Butler, 5th Marquess of Ormonde Notes References External links http://www.leighrayment.com/ http://www.stirnet.com/ (subscription only) Category:1848 births Category:1925 deaths Category:Barons in the Peerage of the United Kingdom Category:Conservative Party (UK) Baronesses- and Lords-in-Waiting Category:Conservative Party (UK) MPs for English constituencies Category:UK MPs 1880–1885 Category:UK MPs 1885–1886 Category:UK MPs 1886–1892 Category:British Life Guards officers
2024-01-17T01:26:58.646260
https://example.com/article/6005
907 P.2d 601 (1995) The PEOPLE of the State of Colorado, Petitioner, v. Joseph PADILLA, Respondent. No. 94SC144. Supreme Court of Colorado, En Banc. December 11, 1995. As Modified on Denial of Rehearing January 8, 1996. *602 Gale A. Norton, Attorney General, Stephen K. ErkenBrack, Chief Deputy Attorney General, Timothy M. Tymkovich, Solicitor General, John Daniel Dailey, Deputy Attorney General, Robert Mark Russel, First Assistant Attorney General, Matthew S. Holman, Assistant Attorney General, Criminal Enforcement Section, Denver, for Petitioner. David F. Vela, State Public Defender, Katherine Brien, Deputy State Public Defender, Denver, for Respondent. *603 Justice LOHR delivered the Opinion of the Court. The defendant, Joseph Padilla, pled guilty in Denver District Court to one count of assault in the first degree.[1] At his sentencing hearing, the defendant filed a motion to suppress the use of three prior felony convictions in the sentencing determination on the ground that these convictions were unconstitutionally obtained. The sentencing court denied the motion as barred by the statute of limitations, section 16-5-402, 8A C.R.S. (1986), noting the defendant's failure to plead justifiable excuse or excusable neglect, statutorily recognized exceptions to the time limitation. See § 16-5-402(2)(d). The court then sentenced the defendant to eighteen years imprisonment. In People v. Padilla, 878 P.2d 4 (Colo.App.1993), the Colorado Court of Appeals held that the pleading requirements applied by the sentencing court were appropriate under this court's decision in People v. Wiedemer, 852 P.2d 424 (Colo.1993). However, the court of appeals noted that Wiedemer was not decided until after the sentencing court's determination in this case and held that the pleading requirements did not apply retroactively. Therefore, the court of appeals remanded the case to the sentencing court with directions that the defendant be allowed to present evidence of justifiable excuse and excusable neglect and, if successful in proving either of those circumstances, be allowed to present evidence that the prior convictions were invalid. We granted certiorari to consider whether a defendant is entitled to an evidentiary hearing on the validity of prior convictions at a discretionary sentencing proceeding.[2] Because we find that a discretionary sentencing proceeding is not the proper forum in which to challenge prior convictions, we now hold that the defendant is not entitled to an evidentiary hearing on the validity of prior convictions during such a proceeding. Therefore, we reverse the court of appeals' judgment and return the case to that court with directions to affirm the judgment and sentence entered by the district court. I. On April 30, 1991, the defendant was arrested in connection with an assault on his wife that left her with extensive injuries. The defendant was charged with one count each of second degree assault[3] and third degree assault.[4] The prosecution subsequently amended the charges to add three habitual criminal counts pursuant to section 16-13-101, 8A C.R.S. (1986). The habitual criminal counts were based on the defendant's three prior felony convictions: (1) a 1970 robbery conviction in Adams County; (2) a 1973 second degree murder conviction in Jefferson County; and (3) a 1973 second degree murder conviction in Denver. Pursuant to a plea agreement, the prosecution added one count of first degree assault,[5] to which the defendant pled guilty, and dropped the remaining charges, including the habitual criminal counts. The parties stipulated to a sentencing range of four to twenty years imprisonment. In the presentence investigation report, the reporting probation officer listed the defendant's three prior convictions as factors for the sentencing court to consider in assessing punishment. At the sentencing hearing, the defendant moved to suppress the use of these prior felony convictions for sentence enhancement purposes. The defendant alleged that all three convictions were unconstitutionally obtained and thus could not be considered by the sentencing court in selecting a sentence. Specifically, the defendant asserted that his 1970 robbery conviction and his 1973 second degree murder conviction were invalid because, among other reasons, when he offered the guilty pleas upon which those convictions were based he did not understand *604 the nature of the charges filed against him or the scope of his constitutional and statutory rights. In addition, he challenged the validity of his 1973 conviction for second degree murder, which was based on a jury verdict, because, among other reasons, he was not advised of his right to testify and was denied effective assistance of counsel. In ruling on the defendant's motion, the sentencing court noted that the statute of limitations period for collateral attacks on prior convictions, prescribed by section 16-5-402, 8A C.R.S. (1986), had expired with respect to each of his three prior convictions. Because the defendant did not aver in his motion that the delay was based on justifiable excuse or excusable neglect, the court refused to consider the validity of the underlying convictions. The court also refused defense counsel's offer to make an oral record regarding justifiable excuse or excusable neglect. The court proceeded with the sentencing hearing and explicitly relied to some degree on the prior convictions in sentencing the defendant to eighteen years imprisonment. The defendant appealed his sentence to the court of appeals, asserting, among other arguments, that the time bar on collateral attacks codified at section 16-5-402 is unconstitutional on its face and as applied, and that the trial court erred in raising the time bar issue on its own initiative. The defendant sought an opportunity to present evidence of justifiable excuse and excusable neglect as well as evidence that his prior convictions were unconstitutionally obtained. The court of appeals, in People v. Padilla, 878 P.2d 4 (Colo.App.1993), upheld the constitutionality of section 16-5-402 and the sentencing court's decision to raise the time bar issue. The court of appeals further held that motions attacking prior convictions after the expiration of the limitations period for collateral attacks must affirmatively plead the existence of justifiable excuse or excusable neglect. Id. at 6-7. The court of appeals based its holding on this court's decision in People v. Wiedemer, 852 P.2d 424 (Colo.1993), which addressed the application of the time bar to motions to vacate prior convictions under Crim.P. 35(c). However, the court of appeals held that the Wiedemer pleading requirements did not apply retroactively. Accordingly, because the defendant in this case was sentenced prior to the Wiedemer decision, the court held that the defendant's motion was not barred by his failure to comply. Padilla, 878 P.2d at 7. The court of appeals remanded the case to the district court with the following instructions: The cause is remanded to the trial court with directions that the trial court consider such evidence as defendant may wish to present in an attempt to show that his untimely attack on these prior convictions was the result of justifiable excuse or excusable neglect. Should the court conclude that defendant's untimely attack was not the result of justifiable excuse or excusable neglect, then subject to an appeal of that decision, defendant's sentence is affirmed. Should the court determine that defendant's untimely filing was, in fact, the result of justifiable excuse or excusable neglect, then the court must determine the validity of defendant's allegations that the prior convictions were obtained in violation of his constitutional rights. In the event either or both of the prior convictions at issue[[6]] are determined to have been so obtained, defendant must be resentenced based on that determination. Id. Without specifically addressing the issue, the court of appeals, by the terms of its order, assumed that the defendant was entitled to an evidentiary hearing on the validity of prior convictions during the sentencing proceeding. The prosecution petitioned this court for certiorari review of the court of appeals' decision. We granted certiorari to determine (1) whether the defendant is entitled to an evidentiary hearing under the pleading and evidentiary standards applicable to a collateral attack under Crim.P. 35(c) to challenge the validity of prior convictions during a discretionary *605 sentencing hearing, and (2) whether the pleading requirements for justifiable excuse and excusable neglect set forth in People v. Wiedemer, 852 P.2d 424, 440 n. 15 (Colo.1993), apply purely prospectively. II. We have consistently held that due process considerations prevent the use of criminal convictions obtained in violation of an individual's constitutional rights for the purpose of enhancing punishment in a subsequent criminal proceeding. E.g., People v. Quintana, 707 P.2d 355, 359 (Colo.1985) (unconstitutional convictions "cannot be used in a later criminal proceeding to establish guilt or enhance punishment"); People v. Gandy, 685 P.2d 165, 167 (Colo.1984) (principle is "axiomatic"); Watkins v. People, 655 P.2d 834, 837 (Colo.1982) (unconstitutionally obtained conviction cannot support enhanced punishment in a subsequent proceeding). However, we have not specifically addressed the distinct issue presented in this case: is a defendant entitled to an evidentiary hearing to challenge the constitutional validity of prior convictions during a discretionary sentencing proceeding? Because a defendant has opportunities to challenge prior convictions at other stages of the criminal process, and because extensive evidentiary hearings are inconsistent with discretionary sentencing, we now hold that a defendant is not entitled to present information or receive an evidentiary hearing on the validity of prior convictions during a discretionary sentencing proceeding. Accordingly, we need not address the issue of whether the defendant's suppression motion was barred by his failure to comply with the pleading requirements for postconviction review set forth in Wiedemer, 852 P.2d at 440 n. 15. III. The defendant asserts that the sentencing court's refusal to grant him an evidentiary hearing on the validity of his prior convictions deprived him of due process. Therefore, we begin our analysis with a review of the potential constitutional underpinnings for the right to an evidentiary hearing at sentencing claimed by the defendant. A. In Custis v. United States, ___ U.S. ___, 114 S.Ct. 1732, 128 L.Ed.2d 517 (1994), the United States Supreme Court addressed the issue of a defendant's right to challenge the validity of prior convictions at a subsequent sentencing hearing in which the prior convictions will affect the defendant's sentence. The defendant in Custis was convicted of possession of a firearm by a felon. At the sentencing hearing, the prosecution moved for mandatory enhancement of the defendant's sentence under the Armed Career Criminal Act (ACCA), 18 U.S.C. § 924(e) (1988), based on three prior state felony convictions. Custis, ___ U.S. at ___, 114 S.Ct. at 1734. The defendant challenged the use of two of the convictions on the ground that they were constitutionally infirm. The defendant argued that he had been denied effective assistance of counsel in the prior proceedings, among other alleged constitutional infirmities. Id. The Supreme Court held that in the absence of a claim that the disputed convictions were obtained in violation of his right to counsel, the defendant had no federal constitutional right to attack those convictions during the federal sentencing process. Id. at ___, 114 S.Ct. at 1738-39. The Court singled out the failure to appoint counsel for an indigent defendant as a "unique constitutional defect" that compromises the very essence of the legal process. Id. at ___, 114 S.Ct. at 1738. Due to this unique impact, the Court held that a defendant's right to attack convictions tainted by this defect in the sentencing forum is constitutionally protected. However, the Court noted that allegations of other improprieties, such as ineffective assistance of counsel or invalid guilty pleas, do not rise to the same constitutional level. Id. Thus, a defendant does not have a constitutional right to relitigate these issues at sentencing. The Court based its decision in part on administrative and policy concerns. The Court noted the administrative difficulties inherent in assessing claims of ineffective assistance of counsel and failure to assure that a guilty plea was voluntary when such claims *606 "may date from another era, and may come from any one of the 50 states." Custis, ___ U.S. at ___, 114 S.Ct. at 1738-39. The Court also cited principles of finality of judgments to support its limitation. "`[I]nroads on the concept of finality tend to undermine confidence in the integrity of our procedures' and inevitably delay and impair the orderly administration of justice." Id. at ___, 114 S.Ct. at 1739 (quoting United States v. Addonizio, 442 U.S. 178, 184 n. 11, 99 S.Ct. 2235, 2240 n. 11, 60 L.Ed.2d 805 (1979)). We are cognizant of the differences between the federal sentencing process at issue in Custis, in which the existence of a prior felony mandated sentence enhancement, and the discretionary sentencing format before us today, in which the existence of a prior felony is simply one of the factors to be considered by the court in exercising discretion in sentencing. The facts of this case, however, do not require us to determine whether the Custis holding is applicable to discretionary sentencing. The defendant did not, and based on the record apparently cannot, allege that he was denied counsel during the proceedings that gave rise to his three prior convictions. Therefore, we need not address whether Custis guarantees a defendant a constitutional right to challenge at a discretionary sentencing hearing prior convictions obtained in violation of the defendant's right to counsel. We do conclude, however, that the Custis decision is dispositive of the defendant's claim that he has a federal constitutional right to challenge his prior convictions at the discretionary sentencing proceeding on bases other than that he was indigent and denied counsel. Custis limited the constitutional grounds for attacking a prior conviction in the context of sentencing under the ACCA, a mandatory punishment enhancement statute. In the present case, the defendant seeks to challenge his convictions during a discretionary sentencing proceeding, a type of proceeding in which the defendant is traditionally afforded fewer protections. Compare Williams v. New York, 337 U.S. 241, 249-51, 69 S.Ct. 1079, 1084-85, 93 L.Ed. 1337 (1949) (due process does not prevent court from utilizing information obtained from out-of-court sources and set forth in probation reports in imposing discretionary sentence) with Specht v. Patterson, 386 U.S. 605, 608-11, 87 S.Ct. 1209, 1211-13, 18 L.Ed.2d 326 (1967) (due process requires that offender receive full panoply of procedural protections in sentencing proceeding to determine whether he meets statutory criteria of dangerousness and thus qualifies for mandatory sentence of one day to life under Colorado's Sex Offenders Act). Because a federal constitutional right to challenge prior convictions during mandatory enhanced sentencing procedures attaches only if a defendant alleges a denial of appointed counsel, such a right cannot logically be said to extend any further in the context of discretionary sentencing. The defendant's motion to suppress alleged that his prior convictions were invalid for a host of reasons, none of which was the denial of counsel. Consequently, he has no federal constitutional right to assert these challenges at sentencing. B. The defendant argues that even in the absence of a federal constitutional right to attack prior judgments of conviction at sentencing, we should recognize such a right under the Colorado Constitution. We disagree. In Wiedemer, 852 P.2d at 438, we held that the right to postconviction relief is not rooted in the Colorado Constitution, but rather derives from statutory authority. We decline the defendant's invitation to create a new constitutional right to pursue the alternative form of postconviction relief sought in this case. The defendant contends that our failure to recognize a right to a hearing on the constitutionality of prior convictions at sentencing will compromise the due process rights protected by our consistent prohibition on the use of constitutionally invalid convictions in subsequent cases. See supra part II; see also Quintana, 707 P.2d at 359; Gandy, 685 P.2d at 167; Watkins, 655 P.2d at 837. According to the defendant, the sentencing court violated this prohibition when it denied him the opportunity to present evidence to support his allegations that his prior convictions were constitutionally infirm and *607 then considered those convictions in assessing punishment. The defendant's contentions are based primarily on our prior holdings in the context of habitual criminal proceedings. E.g., Quintana, 707 P.2d at 359, Watkins, 655 P.2d at 837. Under Colorado's habitual criminal sentencing statute, a defendant who is convicted of any of certain enumerated felonies, and who has a prior criminal record that includes the threshold number and class of prior convictions described in the statute, shall be adjudicated an habitual criminal. See § 16-13-101, 8A C.R.S. (1995 Supp.). If so adjudged, the defendant receives a mandatory sentence under the statute that is in excess of the sentencing range to which the defendant would have been exposed if sentenced only on the basis of the underlying conviction. Because the establishment of a prior conviction results in automatic sentence enhancement, habitual criminal defendants are entitled to heightened procedural safeguards against infringement of their due process rights through the use of potentially invalid prior convictions. We do not agree, however, that the same heightened protection is required for defendants subject to discretionary sentencing, in which the existence of prior convictions does not mandate enhanced punishment. The discretionary sentencing process is conducted pursuant to section 16-11-102, 8A C.R.S. (1986 & 1995 Supp.), and Crim.P. 32(b). Following a determination of guilt in a felony case, a probation officer prepares for the court a presentence report which includes, but is not limited to, "information as to the defendant's family background, educational history, employment record, and past criminal record." § 16-11-102(1)(a). The sentencing court then considers this information and any information presented at the sentencing hearing and exercises broad discretion in weighing the various factors and fixing punishment. People v. Blizzard, 852 P.2d 418, 419 (Colo.1993); People v. Watkins, 200 Colo. 163, 166, 613 P.2d 633, 635-36 (1980) (discretionary sentencing "requires the weighing of various factors and striking a fair accommodation between the defendant's need for rehabilitation or corrective treatment and society's interest in safety and deterrence"). Consequently, a defendant's prior convictions are but one factor of many considered by the court in selecting a sentence, and these convictions do not trigger mandatory enhancement. Unlike in a habitual criminal proceeding, a defendant's sentence is not entirely dependent on the defendant's prior convictions and would not necessarily be invalidated by the presence of information in the presentence report concerning a constitutionally invalid conviction. The sentencing range to which the defendant is exposed is not affected by the establishment of prior convictions. In recognition of the more limited impact of individual sentencing factors in discretionary sentencing, we have not required adherence to heightened due process standards of evidentiary presentation. The prosecution is not required to prove any of the sentencing factors by evidence presented in accordance with the due process procedures required in a guilt trial on the merits of the case. Wolford v. People, 178 Colo. 203, 208, 496 P.2d 1011, 1013 (1972); see also CRE 1101(d)(3) (rules of evidence are inapplicable in sentencing proceedings); cf. Williams, 337 U.S. at 246-51, 69 S.Ct. at 1082-85 (noting the historical and practical reasons for different evidentiary rules governing trial and sentencing procedures and holding that "[t]he due process clause should not be treated as a device for freezing the evidential procedure of sentencing in the mold of trial procedure"). Given their status as merely one of those sentencing factors, prior convictions need not be proven beyond a reasonable doubt, and the sentencing court may afford these convictions the presumption of regularity that attaches to final judgments. See Parke v. Raley, 506 U.S. 20, 28-30, 113 S.Ct. 517, 523, 121 L.Ed.2d 391 (1992) ("presumption of regularity" attaches to judgments that have never been appealed, "even when the question is waiver of constitutional rights") (citations omitted). Because the defendant is not subject to mandatory sentence enhancement based on the use of these convictions, an opportunity to rebut this presumption in a discretionary sentencing proceeding is not constitutionally required. *608 Contrary to the defendant's contention, these restrictions on a defendant's ability to challenge prior convictions affect only the procedural method of addressing these convictions and not the substantive rights of defendants. In People v. Germany, we stated: Thus, while the state may enact reasonable requirements for collateral challenges to prior criminal convictions, thereby ensuring that claims will be raised at a time when they may be easily determined and necessary corrective action taken, it may not do so without providing a criminally accused a meaningful opportunity to challenge allegedly unconstitutional convictions which the government seeks to use against him in a pending criminal prosecution. 674 P.2d 345, 350 (Colo.1983). Our determination that a defendant has no constitutional right to challenge prior convictions at a discretionary sentencing hearing merely directs such challenges into more appropriate channels where they can be handled with minimum disruption to the criminal justice process. Defendants are not left without recourse to remedy constitutional defects in prior convictions. Other avenues of review are available, both before and after sentencing, including timely direct appeal of the prior conviction to the court of appeals or the supreme court, and a postconviction motion to vacate under Crim.P. 35(c). Each of these methods is designed to provide defendants with an opportunity to challenge the validity of past judgments, and these options provide defendants with a sufficient and meaningful opportunity to attack an allegedly unconstitutional conviction. Other states undoubtedly have analogous procedures for challenging the constitutionality of criminal convictions. Accordingly, we are satisfied that defendants have access to adequate means to protect themselves against the use of invalid prior convictions without yet another opportunity to challenge these convictions at sentencing. Therefore, a prior conviction not previously adjudicated invalid may be considered by the court as a sentencing factor without running afoul of the prohibition against using constitutionally invalid convictions to enhance a sentence.[7] IV. Because we find no constitutional support for the defendant's claim to an evidentiary hearing on the validity of prior convictions during his discretionary sentencing proceeding, we now look for evidence of such a right in the Colorado statutes that govern the processes of sentencing and postconviction review. A. As explained above, discretionary sentencing is governed by section 16-11-102, 8A C.R.S. (1986 & 1995 Supp.), and Crim.P. 32(b). Prior to the sentencing hearing, the court receives a presentence report prepared by a probation officer which contains information regarding the defendant's past family, educational, employment, and criminal record. After receiving the presentence report, the court must grant the defendant "an opportunity to make a statement in his own behalf and to present any information in mitigation of punishment." § 16-11-102(5), 8A C.R.S. (1986); Crim.P. 32(b). This right to present information is limited, however, by the context of the proceeding in which it occurs. *609 The purpose and function of discretionary sentencing in the administration of criminal justice necessarily limit the scope of the sentencing proceedings. The discretionary sentencing process is intended to allow individualized sentencing; the court tailors a sentence consistent with the defendant's prior behavior and other factors. See Williams, 337 U.S. at 248-50, 69 S.Ct. at 1083-85; Watkins, 200 Colo. at 166, 613 P.2d at 635-36. The sentencing process differs from the guilt phase of a trial; the defendant has already been found guilty of the crime for which he is to be punished and his due process rights are correspondingly limited. McMillan v. Pennsylvania, 477 U.S. 79, 86-87, 106 S.Ct. 2411, 2416-17, 91 L.Ed.2d 67 (1986). Thus, the sentencing hearing is designed to proceed expeditiously, see Crim.P. 32(b) ("Sentence shall be imposed without unreasonable delay."), and the procedures in a sentencing hearing are less formal than in a trial on the merits, see, e.g., CRE 1101(d)(3) (rules of evidence not applicable in sentencing proceedings). The sentencing court reviews the information provided in the presentence report and at the sentencing hearing and exercises broad discretion in weighing the various factors and selecting a sentence. Williams, 337 U.S. at 247, 69 S.Ct. at 1083; Blizzard, 852 P.2d at 419; Watkins, 200 Colo. at 166, 613 P.2d at 635-36. Given this flexible and expedited procedural context, the sentencing forum is ill-suited to resolving complex factual issues. To avoid compromising the flexibility of the sentencing process, we have resisted defendants' efforts to expand their right to present information and have not interpreted that right to encompass an evidentiary hearing. Although a defendant has a right to be heard regarding the accuracy of matters in his presentence report, the prosecution is not required to prove the sentencing factors by the same quality of evidence required in a guilt trial on the merits of the case. Wolford, 178 Colo. at 208, 496 P.2d at 1013. Other courts have also recognized the need to limit the defendant's right to be heard at sentencing to prevent the sentencing hearing from becoming a trial. See United States v. Giltner, 889 F.2d 1004, 1008 (11th Cir.1989) ("While due process requires that appellant be afforded the opportunity to refute the information brought against him at sentencing,... it does not require that appellant be given the opportunity to call and cross-examine witnesses to rebut the information.") (citations omitted); see also United States v. Byrd, 995 F.2d 536, 540 n. 5 (4th Cir.1993) cert. denied, ___ U.S. ___, 114 S.Ct. 2140, 128 L.Ed.2d 868 (1994) (stating that federal statutory language providing that no limits may be placed on the information considered by a sentencing court does not create a right to assert constitutional challenges to prior convictions) (citing United States v. Custis, 988 F.2d 1355, 1361 n. 2 (4th Cir.1993), aff'd, ___ U.S. ___, 114 S.Ct. 1732, 128 L.Ed.2d 517 (1994)). Were we to endorse the defendant's position that an evidentiary hearing on the validity of prior convictions is required during sentencing, the entire discretionary sentencing process would be disrupted. The sentencing court would be required to play the role of a second trial court, revisiting testimony and other evidence already brought before a prior tribunal. In Williams, the United States Supreme Court recognized the potentially disastrous impact on the administration of criminal justice if all sentencing factors were required to be proved through an evidentiary proceeding: "[T]he modern probation report draws on information concerning every aspect of a defendant's life. The type and extent of this information make totally impractical if not impossible open court testimony with cross-examination. Such a procedure could endlessly delay criminal administration in a retrial of collateral issues." 337 U.S. at 250, 69 S.Ct. at 1085-86 (footnotes omitted). This warning is particularly apt in the present case. The defendant challenged the use of three prior convictions, each more than twenty years old. For each conviction, the defendant raised at least six grounds for invalidation that will require the presentation of evidence and the determination of complex issues. The resolution of these challenges would delay the sentencing process indefinitely. We decline to interpret section 16-11-102 or Crim.P. 32(b) in a manner that compromises the effectiveness of discretionary *610 sentencing. These provisions do not guarantee the defendant an evidentiary hearing on the validity of his prior convictions during the sentencing process. B. We next examine the postconviction review statute, § 18-1-410, 8B C.R.S. (1986 & 1995 Supp.). This section establishes an entitlement to apply for postconviction review, § 18-1-410(1), but defers to the Colorado Rules of Criminal Procedure for procedural guidelines, § 18-1-410(2)(a). The rule governing postconviction remedies is Crim.P. 35(c). Although Rule 35(c) does not specifically authorize postconviction review during a sentencing proceeding, neither does it place any explicit time limitations on when review may be sought. However, the rule does require the defendant to file the motion for relief in the court that imposed sentence, i.e., the jurisdiction in which the challenged conviction originated. This requirement suggests that postconviction challenges under Rule 35(c) are not appropriate during sentencing proceedings for subsequent crimes because the court presiding over the second proceeding often will not have jurisdiction over the prior conviction. The defendant in the present case, however, attempts to distinguish his motion to suppress the use of his prior convictions in the sentencing hearing from an application for postconviction relief under Rule 35(c). According to the defendant, because a suppression motion does not result in the vacation of the underlying conviction, with attendant potential retrial, it represents an administrative gain over the more cumbersome Rule 35(c) procedure.[8] Although we recognize the differences between the two types of relief, we are not convinced that the distinctions are relevant to the issue of the propriety of challenges to prior convictions during discretionary sentencing proceedings. In the situation presented here, a motion to suppress prior convictions and a motion to vacate these same convictions are merely different means of obtaining the same end—prevention of the use of those convictions in a subsequent proceeding. Regardless of which motion is filed, the sentencing court must undertake a full evaluation of the constitutionality of the prior convictions before making any determination as to their use. Consequently, a motion to suppress, if accompanied by an automatic evidentiary hearing, would cause a delay in the sentencing process equal to any slowdown associated with a motion to vacate. Thus, to allow full suppression hearings at sentencing would effectively negate the administrative advantages of discretionary sentencing by circumventing the limitations that currently prevent other postconviction challenges during sentencing.[9] In Wiedemer, we did not distinguish between suppression motions and Rule 35(c) motions for the purposes of applying the statute of limitations for collateral attack, 852 P.2d at 432, and we do not find any basis to distinguish between the two types of motions here. The defendant has not cited any distinct statutory authority to support the attachment of special hearing rights to suppression motions at sentencing. Accordingly, we find no support in the postconviction relief provisions for the defendant's claim of right to an evidentiary hearing. V. For the foregoing reasons, we conclude that an evidentiary hearing on the constitutional validity of prior convictions during discretionary sentencing is neither constitutionally nor statutorily guaranteed. If, as in the present case, the defendant has not attacked the constitutional validity of his prior convictions before the sentencing hearing, he retains the right to challenge the convictions after sentencing under Crim.P. *611 35(c)[10] or comparable procedures available in other states. If such a challenge is successful, he may then apply for reopening of any sentence entered after consideration of the invalid convictions. Accord Custis, ___ U.S. at ___, 114 S.Ct. at 1739. We reverse the judgment of the court of appeals and return the case to that court with directions to affirm the judgment and sentence entered by the district court. NOTES [1] § 18-3-202, 8B C.R.S. (1986 & 1991 Supp.). [2] We use the term "discretionary sentencing proceeding" to denote a proceeding in which the establishment of a prior conviction or convictions is a factor to be considered by the court in exercising discretion in arriving at the sentence but does not mandate an increased sentence. [3] § 18-3-203, 8B C.R.S. (1986 & 1991 Supp.). [4] § 18-3-204, 8B C.R.S. (1986). [5] § 18-3-202, 8B C.R.S. (1986 & 1991 Supp.). [6] Although the court of appeals refers to only two prior convictions in its remand order, the defendant's motion to suppress and other documentation in the record establish that the defendant sought to suppress all three of his prior convictions. [7] The defendant cites several of our earlier cases in support of his position that postsentencing challenges provide inadequate protection against the use of prior convictions. See, e.g., Apodaca v. People, 712 P.2d 467 (Colo.1985); Bales v. People, 713 P.2d 1280 (Colo.1986). However, these cases were decided in the context of motions to suppress the use of prior convictions for impeachment purposes and are inapposite to the present situation. In Apodaca and Bales, the defendants moved for a ruling on the validity of prior convictions immediately prior to commencement of their trials for subsequent crimes. We held that the trial courts' failure to rule on the defendants' challenges before they were required to decide whether to testify impermissibly chilled the defendants' constitutional rights to testify in their own defense. Apodaca, 712 P.2d at 473; Bales, 713 P.2d at 1282. As we discussed in part III, supra, the sentencing court's denial of the defendant's challenge in this case did not adversely affect any constitutional right or entitlement. Accordingly, the ability to challenge after completion of the sentencing process provides sufficient protection to the defendant. [8] The defendant argues that motions to vacate prior convictions will result in subsequent retrials of those convictions and clog the court system. In this case, however, the defendant has completed the sentences for his prior crimes and is not likely to be retried. [9] Suppression would also leave the conviction in place, with the result that an additional proceeding in the court in which the conviction was obtained would be necessary to prevent future use of the conviction in other cases. [10] In any future motion filed pursuant to Rule 35(c), the defendant must comply with the Wiedemer pleading requirements regarding justifiable excuse and excusable neglect to overcome the statutory time bar of section 16-5-402, 8A C.R.S. (1986). People v. Wiedemer, 852 P.2d 424, 440 n. 15 (Colo.1993).
2024-02-29T01:26:58.646260
https://example.com/article/2071
The Oprah Winfrey Network documents just how far the parents of two transgender men have come in this week’s episode of Our America. Three years after investigating the lives and transitions of trans men Ty and Landon, host Lisa Ling caught up with them while attending San Francisco’s Pride parade with their parents. Ty and Landon seem to be doing great, and their parents seem to be doing even better. At the beginning of the segment below, Ty recalls the first time he attended a gay pride parade. “Maybe one day my family will come to this,” he said. In the update episode that aired this week, Ty got all he wished for and so much more. His mother, Kim, sat down to tell him she’s found inspiration in his transition: “You’ve always known who you are and who you wanted to be. And just in the last three years, the man that you have become, that’s why I’ve quit my job and gone back to school. You have inspired me so much.” Check out a clip from Our America below, and head over to Oprah.com for more info on the episode.
2023-09-24T01:26:58.646260
https://example.com/article/2886
package pomodoro import com.intellij.AbstractBundle import org.jetbrains.annotations.NonNls import org.jetbrains.annotations.PropertyKey import java.lang.ref.Reference import java.lang.ref.SoftReference import java.util.* /** * Copied from [com.intellij.ui.UIBundle]. */ object UIBundle { private var ourBundle: Reference<ResourceBundle>? = null @NonNls private const val PATH_TO_BUNDLE = "messages" @JvmStatic fun message(@PropertyKey(resourceBundle = "messages") key: String, vararg params: Any): String = AbstractBundle.message(bundle, key, *params) private val bundle: ResourceBundle get() { var bundle: ResourceBundle? = null if (ourBundle != null) bundle = ourBundle!!.get() if (bundle == null) { bundle = ResourceBundle.getBundle(PATH_TO_BUNDLE) ourBundle = SoftReference(bundle) } return bundle!! } }
2023-08-13T01:26:58.646260
https://example.com/article/6648
Stereotactic anatomical localization in complex sinus surgery: A systematic review and meta-analysis. It is recognized that stereotactic anatomical localization (SAL) is a useful tool in endoscopic sinus surgery (ESS), but it may be most beneficial for complex rather than routine sinus procedures. This review sought to determine the safety and efficacy of SAL in complex indications for ESS. PubMed, EMBASE, Centre for Reviews and Dissemination, and the Cochrane Library were searched from inception up to April 4, 2014. English studies comparing ESS with and without SAL in complex cases were included. Complex surgery included revision surgery, inverted papilloma, extensive sinus disease, or biopsy of tumors that are not exophytic. Safety outcomes included total, major, minor, orbital, dural, and major hemorrhage complications. Efficacy outcomes included operation completion, revision surgery, and patient-reported outcomes. Meta-analysis generated fixed-effects Mantel-Haenszel odds ratios (OR) and confidence intervals (CI). A total of 2,381 studies were identified, of which nine met the inclusion criteria. Meta-analyses indicated a reduction in the likelihood of total (OR = 0.58; 95% CI, 0.37-0.92), major (OR = 0.36; 95% CI, 0.18-0.75), and orbital complications (OR = 0.38; 95% CI, 0.17-0.83). There was no demonstrated benefit of SAL at reducing revision surgery (OR = 0.64; 95% CI, 0.38-1.08), major hemorrhage (OR = 0.77; 95% CI, 0.29-2.06), or minor complications (OR = 0.85; 95% CI, 0.48-1.50). Due to the rare outcomes under investigation, the included primary studies largely lacked the power to identify a statistically meaningful effect of SAL in ESS. However, meta-analyses of primary studies demonstrated a decreased likelihood of total, major, and orbital complications in complex ESS with the use of SAL.
2024-02-23T01:26:58.646260
https://example.com/article/7821
add_executable(snmpapi_winetest util.c testlist.c) set_module_type(snmpapi_winetest win32cui) add_importlibs(snmpapi_winetest snmpapi msvcrt kernel32) add_rostests_file(TARGET snmpapi_winetest)
2024-03-27T01:26:58.646260
https://example.com/article/8906
Has anyone tried putting their figures in the speeder and was successfull? It took me 10 minutes to put Anakin & Obi-Wan in Anakin's Speeder and it still looks bad. I tried putting Zam in her speeder but I had no luck. Maybe for an extra buck Hasbro should of put these figures in the Speeders- even if it's like the Luke in the FX X-wing. If anyone has successfully put these figs in the speeders, please let me know.
2024-01-06T01:26:58.646260
https://example.com/article/6331
/*---------------------------------------------------------------------------/ / FatFs - FAT file system module configuration file R0.11 (C)ChaN, 2015 /---------------------------------------------------------------------------*/ #define _FFCONF 32020 /* Revision ID */ /*---------------------------------------------------------------------------/ / Functions and Buffer Configurations /---------------------------------------------------------------------------*/ #define _FS_TINY 1 /* 0:Normal or 1:Tiny */ /* This option switches tiny buffer configuration. (0:Normal or 1:Tiny) / At the tiny configuration, size of the file object (FIL) is reduced _MAX_SS / bytes. Instead of private sector buffer eliminated from the file object, / common sector buffer in the file system object (FATFS) is used for the file / data transfer. */ #define _FS_READONLY 0 /* 0:Read/Write or 1:Read only */ /* This option switches read-only configuration. (0:Read/Write or 1:Read-only) / Read-only configuration removes basic writing API functions, f_write(), / f_sync(), f_unlink(), f_mkdir(), f_chmod(), f_rename(), f_truncate(), / f_getfree() and optional writing functions as well. */ #define _FS_MINIMIZE 0 /* 0 to 3 */ /* The _FS_MINIMIZE option defines minimization level to remove some API functions. / / 0: All basic functions are enabled. / 1: f_stat(), f_getfree(), f_unlink(), f_mkdir(), f_chmod(), f_utime(), / f_truncate() and f_rename() function are removed. / 2: f_opendir(), f_readdir() and f_closedir() are removed in addition to 1. / 3: f_lseek() function is removed in addition to 2. */ #define _USE_STRFUNC 2 /* 0:Disable or 1-2:Enable */ /* This option switches string functions, f_gets(), f_putc(), f_puts() and / f_printf(). / / 0: Disable string functions. / 1: Enable without LF-CRLF conversion. / 2: Enable with LF-CRLF conversion. */ #define _USE_FIND 1 /* This option switches filtered directory read feature and related functions, / f_findfirst() and f_findnext(). (0:Disable or 1:Enable) */ #define _USE_MKFS 1 /* 0:Disable or 1:Enable */ /* This option switches f_mkfs() function. (0:Disable or 1:Enable) / To enable it, also _FS_READONLY need to be set to 0. */ #define _USE_FASTSEEK 1 /* 0:Disable or 1:Enable */ /* This option switches fast seek feature. (0:Disable or 1:Enable) */ #define _USE_LABEL 1 /* 0:Disable or 1:Enable */ /* This option switches volume label functions, f_getlabel() and f_setlabel(). / (0:Disable or 1:Enable) */ #define _USE_FORWARD 1 /* 0:Disable or 1:Enable */ /* This option switches f_forward() function. (0:Disable or 1:Enable) */ /* To enable it, also _FS_TINY need to be set to 1. */ /*---------------------------------------------------------------------------/ / Locale and Namespace Configurations /----------------------------------------------------------------------------*/ #define _CODE_PAGE 437 /* The _CODE_PAGE specifies the OEM code page to be used on the target system. / Incorrect setting of the code page can cause a file open failure. / / 1 - ASCII (No extended character. Valid for only non-LFN configuration.) / 437 - U.S. (OEM) / 720 - Arabic (OEM) / 737 - Greek (OEM) / 775 - Baltic (OEM) / 850 - Multilingual Latin 1 (OEM) / 858 - Multilingual Latin 1 + Euro (OEM) / 852 - Latin 2 (OEM) / 855 - Cyrillic (OEM) / 866 - Russian (OEM) / 857 - Turkish (OEM) / 862 - Hebrew (OEM) / 874 - Thai (OEM, Windows) / 932 - Japanese Shift-JIS (DBCS, OEM, Windows) / 936 - Simplified Chinese GBK (DBCS, OEM, Windows) / 949 - Korean (DBCS, OEM, Windows) / 950 - Traditional Chinese Big5 (DBCS, OEM, Windows) / 1250 - Central Europe (Windows) / 1251 - Cyrillic (Windows) / 1252 - Latin 1 (Windows) / 1253 - Greek (Windows) / 1254 - Turkish (Windows) / 1255 - Hebrew (Windows) / 1256 - Arabic (Windows) / 1257 - Baltic (Windows) / 1258 - Vietnam (OEM, Windows) */ #define _USE_LFN 3 /* 0 to 3 */ // ArduSat Client 0 #define _MAX_LFN 255 /* Maximum LFN length to handle (12 to 255) */ /* The _USE_LFN option switches the LFN feature. / / 0: Disable LFN feature. _MAX_LFN and _LFN_UNICODE have no effect. / 1: Enable LFN with static working buffer on the BSS. Always NOT thread-safe. / 2: Enable LFN with dynamic working buffer on the STACK. / 3: Enable LFN with dynamic working buffer on the HEAP. / / When enable the LFN feature, Unicode handling functions (option/unicode.c) must / be added to the project. The LFN working buffer occupies (_MAX_LFN + 1) * 2 bytes. / When use stack for the working buffer, take care on stack overflow. When use heap / memory for the working buffer, memory management functions, ff_memalloc() and / ff_memfree(), must be added to the project. */ #define _LFN_UNICODE 0 /* 0:ANSI/OEM or 1:Unicode */ /* This option switches character encoding on the API. (0:ANSI/OEM or 1:Unicode) / To use Unicode string for the path name, enable LFN feature and set _LFN_UNICODE / to 1. This option also affects behavior of string I/O functions. */ #define _STRF_ENCODE 3 /* 0:ANSI/OEM, 1:UTF-16LE, 2:UTF-16BE, 3:UTF-8 */ /* When _LFN_UNICODE is 1, this option selects the character encoding on the file to / be read/written via string I/O functions, f_gets(), f_putc(), f_puts and f_printf(). / / 0: ANSI/OEM / 1: UTF-16LE / 2: UTF-16BE / 3: UTF-8 / / When _LFN_UNICODE is 0, this option has no effect. */ #define _FS_RPATH 2 /* 0 to 2 */ /* This option configures relative path feature. / / 0: Disable relative path feature and remove related functions. / 1: Enable relative path feature. f_chdir() and f_chdrive() are available. / 2: f_getcwd() function is available in addition to 1. / / Note that directory items read via f_readdir() are affected by this option. */ /*---------------------------------------------------------------------------/ / Drive/Volume Configurations /---------------------------------------------------------------------------*/ #define _VOLUMES 2 /* Number of volumes (logical drives) to be used. */ #define _STR_VOLUME_ID 0 /* 0:Use only 0-9 for drive ID, 1:Use strings for drive ID */ #define _VOLUME_STRS "SD1","SD2","SD3","SD4" /* _STR_VOLUME_ID option switches string volume ID feature. / When _STR_VOLUME_ID is set to 1, also pre-defined strings can be used as drive / number in the path name. _VOLUME_STRS defines the drive ID strings for each / logical drives. Number of items must be equal to _VOLUMES. Valid characters for / the drive ID strings are: A-Z and 0-9. */ #define _MULTI_PARTITION 0 /* 0:Single partition, 1:Enable multiple partition */ /* This option switches multi-partition feature. By default (0), each logical drive / number is bound to the same physical drive number and only an FAT volume found on / the physical drive will be mounted. When multi-partition feature is enabled (1), / each logical drive number is bound to arbitrary physical drive and partition / listed in the VolToPart[]. Also f_fdisk() function will be enabled. */ #define _MIN_SS 512 #define _MAX_SS 512 /* These options configure the range of sector size to be supported. (512, 1024, / 2048 or 4096) Always set both 512 for most systems, all type of memory cards and / harddisk. But a larger value may be required for on-board flash memory and some / type of optical media. When _MAX_SS is larger than _MIN_SS, FatFs is configured / to variable sector size and GET_SECTOR_SIZE command must be implemented to the / disk_ioctl() function. */ #define _USE_TRIM 1 /* This option switches ATA-TRIM feature. (0:Disable or 1:Enable) / To enable Trim feature, also CTRL_TRIM command should be implemented to the / disk_ioctl() function. */ #define _FS_NOFSINFO 1 /* 0 to 3 */ /* If you need to know correct free space on the FAT32 volume, set bit 0 of this / option and f_getfree() function at first time after volume mount will force / a full FAT scan. Bit 1 controls the last allocated cluster number as bit 0. / / bit0=0: Use free cluster count in the FSINFO if available. / bit0=1: Do not trust free cluster count in the FSINFO. / bit1=0: Use last allocated cluster number in the FSINFO if available. / bit1=1: Do not trust last allocated cluster number in the FSINFO. */ /*---------------------------------------------------------------------------/ / System Configurations /----------------------------------------------------------------------------*/ #define _FS_NORTC 0 #define _NORTC_MON 11 #define _NORTC_MDAY 1 #define _NORTC_YEAR 2015 /* The _FS_NORTC option switches timestamp feature. If the system does not have / an RTC function or valid timestamp is not needed, set _FS_NORTC to 1 to disable / the timestamp feature. All objects modified by FatFs will have a fixed timestamp / defined by _NORTC_MON, _NORTC_MDAY and _NORTC_YEAR. / When timestamp feature is enabled (_FS_NORTC == 0), get_fattime() function need / to be added to the project to read current time form RTC. _NORTC_MON, / _NORTC_MDAY and _NORTC_YEAR have no effect. / These options have no effect at read-only configuration (_FS_READONLY == 1). */ #define _FS_LOCK 8 /* 0:Disable or >=1:Enable */ /* The _FS_LOCK option switches file lock feature to control duplicated file open / and illegal operation to open objects. This option must be 0 when _FS_READONLY / is 1. / / 0: Disable file lock feature. To avoid volume corruption, application program / should avoid illegal open, remove and rename to the open objects. / >0: Enable file lock feature. The value defines how many files/sub-directories / can be opened simultaneously under file lock control. Note that the file / lock feature is independent of re-entrancy. */ #define _FS_REENTRANT 1 /* 0:Disable or 1:Enable */ #define _FS_TIMEOUT 1000 /* Timeout period in unit of time ticks */ #define _SYNC_t HANDLE /* O/S dependent sync object type. e.g. HANDLE, OS_EVENT*, ID and etc.. */ /* The _FS_REENTRANT option switches the re-entrancy (thread safe) of the FatFs / module itself. Note that regardless of this option, file access to different / volume is always re-entrant and volume control functions, f_mount(), f_mkfs() / and f_fdisk() function, are always not re-entrant. Only file/directory access / to the same volume is under control of this feature. / / 0: Disable re-entrancy. _FS_TIMEOUT and _SYNC_t have no effect. / 1: Enable re-entrancy. Also user provided synchronization handlers, / ff_req_grant(), ff_rel_grant(), ff_del_syncobj() and ff_cre_syncobj() / function, must be added to the project. Samples are available in / option/syscall.c. / / The _FS_TIMEOUT defines timeout period in unit of time tick. / The _SYNC_t defines O/S dependent sync object type. e.g. HANDLE, ID, OS_EVENT*, / SemaphoreHandle_t and etc.. */ #define _WORD_ACCESS 1 /* 0 or 1 */ /* The _WORD_ACCESS option is the only platform dependent option. It defines / which access method is used to the word data on the FAT volume. / / 0: Byte-by-byte access. Always compatible with all platforms. / 1: Word access. Do not choose this unless under both the following conditions. / / * Address misaligned memory access is always allowed to ALL instructions. / * Byte order on the memory is little-endian. / / If it is the case, _WORD_ACCESS can also be set to 1 to reduce code size. / Following table shows allowable settings of some processor types. / / ARM7TDMI 0 *2 ColdFire 0 *1 V850E 0 *2 / Cortex-M3 0 *3 Z80 0/1 V850ES 0/1 / Cortex-M0 0 *2 x86 0/1 TLCS-870 0/1 / AVR 0/1 RX600(LE) 0/1 TLCS-900 0/1 / AVR32 0 *1 RL78 0 *2 R32C 0 *2 / PIC18 0/1 SH-2 0 *1 M16C 0/1 / PIC24 0 *2 H8S 0 *1 MSP430 0 *2 / PIC32 0 *1 H8/300H 0 *1 8051 0/1 / / *1:Big-endian. / *2:Unaligned memory access is not supported. / *3:Some compilers generate LDM/STM for mem_cpy function. */
2023-10-24T01:26:58.646260
https://example.com/article/3198
#include "models/profile.h" #include <QDateTime> #include <QDir> #include <QFile> #include <QFileInfo> #include <QFileInfoList> #include <QJsonArray> #include <QJsonDocument> #include <QJsonObject> #include <QSet> #include <QSettings> #include <utility> #include "commands/commands.h" #include "downloader/download-query-manager.h" #include "functions.h" #include "logger.h" #include "models/favorite.h" #include "models/md5-database.h" #include "models/monitor-manager.h" #include "models/site.h" #include "models/source.h" Profile::Profile() : m_settings(nullptr), m_commands(nullptr), m_md5s(nullptr), m_monitorManager(nullptr), m_downloadQueryManager(nullptr) {} Profile::Profile(QSettings *settings, QList<Favorite> favorites, QStringList keptForLater, QString path) : m_path(std::move(path)), m_settings(settings), m_favorites(std::move(favorites)), m_keptForLater(std::move(keptForLater)), m_commands(nullptr), m_md5s(nullptr), m_monitorManager(nullptr), m_downloadQueryManager(nullptr) {} Profile::Profile(QString path) : m_path(std::move(path)) { m_settings = new QSettings(m_path + "/settings.ini", QSettings::IniFormat); // Load sources QStringList dirs = QDir(m_path + "/sites/").entryList(QDir::Dirs | QDir::NoDotAndDotDot); for (const QString &dir : dirs) { Source *source = new Source(this, m_path + "/sites/" + dir); if (source->getApis().isEmpty()) { source->deleteLater(); continue; } m_sources.insert(source->getName(), source); m_additionalTokens.append(source->getAdditionalTokens()); for (Site *site : source->getSites()) { m_sites.insert(site->url(), site); } } // Load favorites QSet<QString> unique; QFile fileFavoritesJson(m_path + "/favorites.json"); if (fileFavoritesJson.open(QFile::ReadOnly | QFile::Text)) { const QByteArray data = fileFavoritesJson.readAll(); QJsonDocument loadDoc = QJsonDocument::fromJson(data); QJsonObject object = loadDoc.object(); QJsonArray favorites = object["favorites"].toArray(); for (auto favoriteJson : favorites) { Favorite fav = Favorite::fromJson(m_path, favoriteJson.toObject(), this); if (!unique.contains(fav.getName())) { unique.insert(fav.getName()); m_favorites.append(fav); } } } else { QFile fileFavorites(m_path + "/favorites.txt"); if (fileFavorites.open(QFile::ReadOnly | QFile::Text)) { QString favs = fileFavorites.readAll(); fileFavorites.close(); QStringList words = favs.split("\n", QString::SkipEmptyParts); m_favorites.reserve(words.count()); for (const QString &word : words) { Favorite fav = Favorite::fromString(m_path, word); if (!unique.contains(fav.getName())) { unique.insert(fav.getName()); m_favorites.append(fav); } } } } // Load view it later QFile fileKfl(m_path + "/viewitlater.txt"); if (fileKfl.open(QFile::ReadOnly | QFile::Text)) { QString vil = fileKfl.readAll(); fileKfl.close(); m_keptForLater = vil.split("\n", QString::SkipEmptyParts); } // Load ignored QFile fileIgnored(m_path + "/ignore.txt"); if (fileIgnored.open(QFile::ReadOnly | QFile::Text)) { QString ign = fileIgnored.readAll(); fileIgnored.close(); m_ignored = ign.split("\n", QString::SkipEmptyParts); } // Make a backup of MD5s in case the multi-location change broke everything if (QFile::exists(m_path + "/md5s.txt") && !QFile::exists(m_path + "/md5s.txt.bak")) { QFile::copy(m_path + "/md5s.txt", m_path + "/md5s.txt.bak"); } // Load MD5s m_md5s = new Md5Database(m_path + "/md5s.txt", m_settings); // Load auto-complete QFile fileAutoComplete(m_path + "/words.txt"); if (fileAutoComplete.open(QFile::ReadOnly | QFile::Text)) { QString line; while (!(line = fileAutoComplete.readLine()).isEmpty()) { m_autoComplete.append(line.trimmed().split(" ", QString::SkipEmptyParts)); } fileAutoComplete.close(); } // Load custom auto-complete QFile fileCustomAutoComplete(m_path + "/wordsc.txt"); if (fileCustomAutoComplete.open(QFile::ReadOnly | QFile::Text)) { QString line; while (!(line = fileCustomAutoComplete.readLine()).isEmpty()) { m_customAutoComplete.append(line.trimmed().split(" ", QString::SkipEmptyParts)); } fileCustomAutoComplete.close(); } m_commands = new Commands(this); // Blacklisted tags const QStringList &blacklist = m_settings->value("blacklistedtags").toString().split(' ', QString::SkipEmptyParts); for (const QString &bl : blacklist) { m_blacklist.add(bl); } QFile fileBlacklist(m_path + "/blacklist.txt"); if (fileBlacklist.open(QFile::ReadOnly | QFile::Text)) { QString line; while (!(line = fileBlacklist.readLine()).isEmpty()) { line = line.trimmed(); if (!line.startsWith('#')) { m_blacklist.add(line.split(" ", QString::SkipEmptyParts)); } } fileBlacklist.close(); } // Monitors m_monitorManager = new MonitorManager(m_path + "/monitors.json", this); // Downloads m_downloadQueryManager = new DownloadQueryManager(m_path + "/restore.igl", this); // Complete auto-complete static QStringList specialCompletes = { "grabber:alreadyExists", "grabber:inMd5List", "grabber:downloaded", "grabber:favorited" }; m_autoComplete.reserve(m_autoComplete.count() + m_customAutoComplete.count() + m_favorites.count() + specialCompletes.count()); m_autoComplete.append(m_customAutoComplete); for (const Favorite &fav : qAsConst(m_favorites)) { m_autoComplete.append(fav.getName()); } m_autoComplete.append(specialCompletes); m_autoComplete.removeDuplicates(); m_autoComplete.sort(); } Profile::~Profile() { sync(); if (m_settings != nullptr) { m_settings->deleteLater(); } qDeleteAll(m_sources); delete m_commands; delete m_monitorManager; delete m_downloadQueryManager; } void Profile::sync() { if (m_path.isEmpty()) { return; } syncFavorites(); syncKeptForLater(); syncIgnored(); // MD5s m_md5s->sync(); // Custom auto-complete QFile fileCustomAutoComplete(m_path + "/wordsc.txt"); if (fileCustomAutoComplete.open(QFile::WriteOnly | QFile::Text | QFile::Truncate)) { fileCustomAutoComplete.write(m_customAutoComplete.join("\r\n").toUtf8()); fileCustomAutoComplete.close(); } // Update commands settings auto *oldCommands = m_commands; auto *newCommands = new Commands(this); m_commands = newCommands; delete oldCommands; // Blacklisted tags QFile fileBlacklist(m_path + "/blacklist.txt"); if (fileBlacklist.open(QFile::WriteOnly | QFile::Text | QFile::Truncate)) { fileBlacklist.write(m_blacklist.toString().toUtf8()); fileBlacklist.close(); } m_settings->remove("blacklistedtags"); // Sync settings if (m_settings != nullptr) { m_settings->sync(); } } void Profile::syncFavorites() const { QFile fileFavorites(m_path + "/favorites.json"); if (fileFavorites.open(QFile::WriteOnly | QFile::Text | QFile::Truncate)) { // Generate JSON array QJsonArray favoritesJson; for (const Favorite &fav : qAsConst(m_favorites)) { QJsonObject unique; fav.toJson(unique); favoritesJson.append(unique); } // Generate result QJsonObject full; full["version"] = 1; full["favorites"] = favoritesJson; // Write result QJsonDocument saveDoc(full); fileFavorites.write(saveDoc.toJson()); fileFavorites.close(); } } void Profile::syncKeptForLater() const { QFile fileKfl(m_path + "/viewitlater.txt"); if (fileKfl.open(QFile::WriteOnly | QFile::Text | QFile::Truncate)) { fileKfl.write(m_keptForLater.join("\r\n").toUtf8()); fileKfl.close(); } } void Profile::syncIgnored() const { QFile fileIgnored(m_path + "/ignore.txt"); if (fileIgnored.open(QFile::WriteOnly | QFile::Text | QFile::Truncate)) { fileIgnored.write(m_ignored.join("\r\n").toUtf8()); fileIgnored.close(); } } QString Profile::tempPath() const { const QString override = m_settings->value("tempPathOverride", "").toString(); if (!override.isEmpty() && QFile::exists(override)) { return override; } const QString tmp = QDir::tempPath(); const QString subDir = "Grabber"; QDir(tmp).mkpath(subDir); return tmp + QDir::separator() + subDir; } void Profile::purgeTemp(int maxAge) const { const QDir tempDir(tempPath()); const QFileInfoList tempFiles = tempDir.entryInfoList(QDir::Files); const QDateTime max = QDateTime::currentDateTime().addSecs(-maxAge); int purged = 0; int failed = 0; for (const QFileInfo &tempFile : tempFiles) { const QDateTime lastModified = tempFile.lastModified(); if (lastModified < max) { if (QFile::remove(tempFile.absoluteFilePath())) { purged++; } else { failed++; } } } log(QString("Temp directory purged of %1/%2 files (%3 failed)").arg(purged).arg(tempFiles.count()).arg(failed), Logger::Info); } void Profile::addFavorite(const Favorite &fav) { const int already = m_favorites.removeAll(fav); m_favorites.append(fav); if (already == 0) { m_autoComplete.append(fav.getName()); } syncFavorites(); emit favoritesChanged(); } void Profile::removeFavorite(const Favorite &fav) { m_favorites.removeAll(fav); if (QFile::exists(m_path + "/thumbs/" + fav.getName(true) + ".png")) { QFile::remove(m_path + "/thumbs/" + fav.getName(true) + ".png"); } syncFavorites(); emit favoritesChanged(); } void Profile::emitFavorite() { syncFavorites(); emit favoritesChanged(); } void Profile::addKeptForLater(const QString &tag) { m_keptForLater.removeAll(tag); m_keptForLater.append(tag); syncKeptForLater(); emit keptForLaterChanged(); } void Profile::removeKeptForLater(const QString &tag) { m_keptForLater.removeAll(tag); syncKeptForLater(); emit keptForLaterChanged(); } void Profile::setIgnored(const QStringList &tags) { m_ignored = tags; syncIgnored(); emit ignoredChanged(); } void Profile::addIgnored(const QString &tag) { m_ignored.removeAll(tag); m_ignored.append(tag); syncIgnored(); emit ignoredChanged(); } void Profile::removeIgnored(const QString &tag) { m_ignored.removeAll(tag); syncIgnored(); emit ignoredChanged(); } QPair<QString, QString> Profile::md5Action(const QString &md5, const QString &target) { return m_md5s->action(md5, target); } /** * Check if a file with this md5 already exists; * @param md5 The md5 that needs to be checked. * @return A QString containing the path to the already existing file, an empty QString if the md5 does not already exists. */ QStringList Profile::md5Exists(const QString &md5) { return m_md5s->exists(md5); } /** * Adds a md5 to the _md5 map and adds it to the md5 file. * @param md5 The md5 to add. * @param path The path to the image with this md5. */ void Profile::addMd5(const QString &md5, const QString &path) { m_md5s->add(md5, path); } /** * Removes a md5 from the _md5 map and removes it from the md5 file. * @param md5 The md5 to remove. */ void Profile::removeMd5(const QString &md5, const QString &path) { m_md5s->remove(md5, path); } void Profile::addAutoComplete(const QString &tag) { m_customAutoComplete.append(tag); } void Profile::addSite(Site *site) { m_sites.insert(site->url(), site); emit sitesChanged(); } void Profile::removeSite(Site *site) { m_sites.remove(site->url()); emit siteDeleted(site); emit sitesChanged(); } void Profile::setBlacklistedTags(const Blacklist &blacklist) { m_blacklist = blacklist; emit blacklistChanged(); } void Profile::addBlacklistedTag(const QString &tag) { m_blacklist.add(tag); emit blacklistChanged(); } void Profile::removeBlacklistedTag(const QString &tag) { m_blacklist.remove(tag); emit blacklistChanged(); } QString Profile::getPath() const { return m_path; } QSettings *Profile::getSettings() const { return m_settings; } QList<Favorite> &Profile::getFavorites() { return m_favorites; } QStringList &Profile::getKeptForLater() { return m_keptForLater; } QStringList &Profile::getIgnored() { return m_ignored; } Commands &Profile::getCommands() { return *m_commands; } QStringList &Profile::getAutoComplete() { return m_autoComplete; } Blacklist &Profile::getBlacklist() { return m_blacklist; } const QMap<QString, Source*> &Profile::getSources() const { return m_sources; } const QMap<QString, Site*> &Profile::getSites() const { return m_sites; } const QStringList &Profile::getAdditionalTokens() const { return m_additionalTokens; } MonitorManager *Profile::monitorManager() const { return m_monitorManager; } DownloadQueryManager *Profile::downloadQueryManager() const { return m_downloadQueryManager; } QList<Site*> Profile::getFilteredSites(const QStringList &urls) const { QList<Site*> ret; for (const QString &url : urls) { if (m_sites.contains(url)) { ret.append(m_sites.value(url)); } } return ret; }
2024-03-07T01:26:58.646260
https://example.com/article/6190
875 F.2d 866 Unpublished DispositionNOTICE: Sixth Circuit Rule 24(c) states that citation of unpublished dispositions is disfavored except for establishing res judicata, estoppel, or the law of the case and requires service of copies of cited unpublished dispositions of the Sixth Circuit.John Wesley RALPH, Petitioner-Appellant,v.Al. C. PARKE, Warden, Kentucky State Reformatory, Respondent-Appellee. No. 88-6193. United States Court of Appeals, Sixth Circuit. May 30, 1989. Before MERRITT and BOYCE F. MARTIN, Jr., Circuit Judges and LIVELY, Senior Circuit Judge. ORDER 1 This case has been referred to a panel of the court pursuant to Rule 9(a), Rules of the Sixth Circuit. Upon examination of the briefs and record, this panel unanimously agrees that oral argument is not needed. Fed.R.App.P. 34(a). 2 John Wesley Ralph, a pro se Kentucky prisoner was convicted, after a jury trial, of two counts of murder. Pursuant to the jury's deliberations, Ralph was sentenced to two concurrent life terms. After pursuing a direct appeal to the Supreme Court of Kentucky, Ralph sought a petition for a writ of habeas corpus from the district court pursuant to 28 U.S.C. Sec. 2254. In his petition to the district court, Ralph raised the following issues: (1) that he was deprived of a fair trial under the sixth and fourteenth amendments because persons under 25 years of age and over 65 years of age were systematically excluded from the grand jury; (2) that his confession should have been suppressed at trial because neither his waiver of Miranda rights nor his confession were knowingly, intelligently, and voluntarily made; (3) that the trial court's failure to define extreme emotional disturbances for the jury was a denial of due process; and (4) that the trial court did not follow the mandatory sentencing provisions set forth in Ky.Rev.Stat. Sec. 532.050. Following the district court's dismissal of his petition for habeas corpus relief, Ralph filed a timely notice of appeal with the court. On appeal, Ralph raises the same issues which were identified in his petition for the writ of habeas corpus and in addition asserts that he was denied the right to amend his petition by the district court after he learned that one of the state's expert witnesses had perjured himself and that he was denied access to relevant portions of the trial transcript pursuant to Rules 5 and 7 of the Rules governing Sec. 2254 cases in the United States District Courts. Petitioner also seeks the appointment of counsel and a new evidentiary hearing before the district court. 3 Upon review, we conclude the district court properly dismissed Ralph's petition for habeas corpus relief. 4 Ralph lacks standing to challenge the exclusion from the grand jury pool of persons over 65 and under 25. A challenge to the makeup of a state grand jury is made under the equal protection clause of the fourteenth amendment because the fifth amendment right to a grand jury has not been applied to the states. Casteneda v. Partida, 430 U.S. 482, 492 (1977); Hurtado v. California, 110 U.S. 516 (1884). Since Ralph was 46 or 47 at the time of trial, he lacks standing to challenge the under-representation of persons over 65 and under 25 from the grand jury pool, as he is not a member of either group. Aldridge v. Marshall, 765 F.2d 63, 69 (6th Cir.1985); Ford v. Seabold, 841 F.2d 677, 681 (6th Cir.1988). 5 Based upon the circumstances surrounding Ralph's confession, we conclude that the absence of police coercion in procuring the confession precludes any finding of inadmissibility under the fourteenth amendment, and, consequently, the admissibility of Ralph's confession is to be decided under state law. Colorado v. Connelly, 479 U.S. 157, 167 (1986). On direct appeal, the Supreme Court of Kentucky upheld the trial court's finding that Ralph's confession was admissible; that decision on intoxication and the state law evidentiary issues in the case are binding on this court. Wainwright v. Goode, 464 U.S. 78, 84 (1983) (per curiam). 6 The trial court's failure to merely define "extreme emotional disturbance" did not render the entire trial so fundamentally unfair as to merit habeas relief. Henderson v. Kibbe, 431 U.S. 145, 154 (1977); Thomas v. Arn, 704 F.2d 865, 868-69 (6th Cir.1983). 7 Ralph's contention that the trial court failed to follow the mandatory sentencing procedures of Ky.Rev.Stat. Sec. 532.050 is without merit since the trial court's action was approved by the Supreme Court of Kentucky. In addition, this is purely a question of state law and the ruling of the state's highest court is binding on this court. Wainwright, 464 U.S. at 84. 8 The district court's denial of Ralph's attempt to amend his petition, after he learned of the perjury of one of the state's expert witnesses, was harmless error. Based upon a review of the record, we conclude it is unlikely that the perjured testimony influenced the jury and the use of the testimony simply does not require the conviction to be set aside. Wernert v. Arn, 819 F.2d 613, 617 (6th Cir.1987). 9 Ralph's contention that he was denied access to relevant portions of the trial transcript is without merit. Although Rule 5, Rules Governing Section 2254 cases in the United States District Courts, places the burden on the state to identify and attach all relevant portions of the trial transcript to its answer, such identification and presentation is discretionary with the district court. Sizemore v. District Court, 50th Judicial District, Boyle County, Kentucky, 735 F.2d 204, 207 (6th Cir.1984). In this situation, since the state provided the entire trial transcript to the district court, we conclude that the district court's denial of Ralph's motion was not error since Ralph adequately identified the issues in his brief and the district court was capable of reviewing the transcript to determine if Ralph's contentions were meritorious. 10 Accordingly, Ralph's motions for the appointment of counsel and for a new evidentiary hearing before the district court are hereby denied and the district court's judgment is hereby affirmed pursuant to Rule 9(b)(5), Rules of the Sixth Circuit.
2023-12-05T01:26:58.646260
https://example.com/article/1735
Q: Time Picker Android How to set previous selected value in TimePicker? I mean, click on TextView, TimePicker dialog occurs, then I select the time and set it in the TextView, e.g. 12:30 PM on TextView. After that, if I want to change the time, click again to TextView and then TimePicker dialog should show the previous selected value. So the TimePicker should display 12:30 PM. How can I do that? A: If you create Time Picker Dialog with onCreateDialog and call it it will automatically store the previous value. @Override protected Dialog onCreateDialog(int id) { switch (id) { case 0: TimePickerDialog timeDlg = new TimePickerDialog(this, new TimePickerDialog.OnTimeSetListener() { @Override public void onTimeSet(TimePicker view, int hourOfDay, int minute) { // TODO Auto-generated method stub if (hourOfDay > 12) { hourOfDay = hourOfDay - 12; time = " PM"; } else if (hourOfDay < 12 && hourOfDay != 0) { time = " AM"; } else if (hourOfDay == 12) { time = " PM"; } else if (hourOfDay == 0) { hourOfDay = 12; time = " AM"; } Toast.makeText( getApplicationContext(), new StringBuilder().append(pad(hourOfDay)) .append(":").append(pad(minute)) .append(time), Toast.LENGTH_SHORT) .show(); } }, 12, 00, false); timeDlg.setMessage("Set Time:"); timeDlg.setOnCancelListener(new OnCancelListener() { @Override public void onCancel(DialogInterface dialog) { // TODO Auto-generated method stub Toast.makeText(getApplicationContext(), "Dismiss", Toast.LENGTH_SHORT).show(); } }); return timeDlg; } return null; } Use showDialog(id); to Show the Dialog.
2024-01-01T01:26:58.646260
https://example.com/article/9218
<?php declare(strict_types=1); /* * This file is part of PHPUnit. * * (c) Sebastian Bergmann <sebastian@phpunit.de> * * For the full copyright and license information, please view the LICENSE * file that was distributed with this source code. */ namespace PHPUnit\Framework\Constraint; use SplObjectStorage; /** * @no-named-arguments Parameter names are not covered by the backward compatibility promise for PHPUnit */ final class TraversableContainsEqual extends TraversableContains { /** * Evaluates the constraint for parameter $other. Returns true if the * constraint is met, false otherwise. * * @param mixed $other value or object to evaluate */ protected function matches($other): bool { if ($other instanceof SplObjectStorage) { return $other->contains($this->value()); } foreach ($other as $element) { /* @noinspection TypeUnsafeComparisonInspection */ if ($this->value() == $element) { return true; } } return false; } }
2024-05-10T01:26:58.646260
https://example.com/article/4955
Protein-calorie malnutrition in a community hospital. An assessment of protein-calorie status was performed on 200 consecutive adult nonobstetric admissions to a private hospital from two group family practices. Anthropometric measurements, serum albumin level, and total lymphocyte count were determined at admission and weekly if the patient remained in the hospital. Nonnutritional factors affecting muscle protein stores and serum albumin level were taken into account. A total of 63 patients (31.5%) were found to be malnourished. The most common conditions associated with decreased protein stores were hypoxic cardiopulmonary disease, gastrointestinal disease, neuromuscular or arthritic impairment, organic brain syndrome, and febrile illness. Although nonnutritional factors accounted for many instances of protein depletion, expecially milder degrees of depletion, nevertheless protein calorie malnutrition was highly prevalent in this population.
2023-12-15T01:26:58.646260
https://example.com/article/3361
South Korea’s biggest bank, KB Kookmin, is set to launch crypto custody service for cryptocurrencies like BTC and ETH. According to a local news report on Friday, KB Kookmin has filed a trademark application for KB Digital Asset Custody (KBDAC) with the Korean Intellectual Property Office. The Korean Intellectual Property Office claims the bank applied for the use of KBDAC as a trademark which relates to investment, advisory and trading of cryptocurrencies. According to the office, trademark registration takes a minimum period of 6 months and a maximum of 2 years. The trademark application which was filed on January 31, 2020 stated that the bank could launch the service soon. According to the report, a trademark application generally implies that an entity has started branding products and services. In addition, it also implies that much of the development work has been finished. According to an official from the bank, KBDAC is related to what the bank decided to cooperate with Atomrigs Lab in June last year. However, he didn’t give out the time during which KBDAC will be launched. The KB Kookmin bank partnered with Atomrigs Lab on June 11, 2019 to create a crypto custody service. Atomrigs Lab creates a product which secures cryptocurrencies using multi-party computation (MPC) cryptography technology. Instead of a fixed private key, this technology generates random key shares. This solution prevents hackers from stealing cryptocurrencies with just one piece of private key. It also enables the owner of the wallet to recover even if the piece of private key is lost or stolen. The bank claims to be using KBDAC in more than 20 types of industries. Since there are many types of KBDAC industries, the bank has made a brand in consideration of separation as a virtual asset management subsidiary in the future. Featured image courtsy KB Kookmin.
2023-08-10T01:26:58.646260
https://example.com/article/2214
This story is from When foods get famous, an episode of The Food Chain on BBC World Service. It was presented by Emily Thomas and produced by Emily Thomas and Simon Tulett. To listen to more episodes of The Food Chain, please click here. Adapted by Bryan Lufkin. Avocado toast. Kale shakes. Goji berry smoothies. Quinoa bowls. If foods were celebrities, these would be just a handful of the treats that have received the red-carpet treatment in the last few years. But why do some fruits and vegetables become the A-listers of the food industry – highly desired produce with the ability to jump-start profits and shape the daily eating habits of billions? Why is that kale and avocado have seen such a meteoric rise in popularity and sit centre stage basking happily in the spotlight while the humble carrot or poor old turnip remain firmly on the Z-list? The answer is complicated and complex. How avocados conquered the world Let’s start with the avocado – a millennial darling that’s often found these days spread on toast at bistros for a bloated price. So famous is the avocado and so strong is its pull on hungry millennials, it’s hard to find a company that isn’t trying to cash in on the soft green fruit’s star power. Take UK company Virgin Trains, which started a marketing campaign last year it dubbed “#Avocard”. After the company sold out of new railcards, it decided to give customers aged between 26 and 30 who showed up at a station holding an avocado a discount on train tickets. (Millennial response was mixed, with some finding the promotion patronising.)
2023-09-01T01:26:58.646260
https://example.com/article/5112
Q: Azure Web App Service - How to force non WWW to go to WWW? I have an Azure Web App on the Standard App Service. I am able to access the site by going to http://www.websitename.com but unable to access the website via http://websitename.com. How can I get the web address with the non www. to go to the www. version? In my DNS Configuration for the domain my A Name record is pointing at the IP Address of the Web App in Azure, and the CName record at the Azurewebsites.net domain. A: In the Azure portal, you will need to add both www.websitename.com and websitename.com as host names for the Web App, so that Azure knows to send traffic to it.
2023-11-09T01:26:58.646260
https://example.com/article/3552
#region Copyright & License Information /* * Copyright 2007-2020 The OpenRA Developers (see AUTHORS) * This file is part of OpenRA, which is free software. It is made * available to you under the terms of the GNU General Public License * as published by the Free Software Foundation, either version 3 of * the License, or (at your option) any later version. For more * information, see COPYING. */ #endregion using System.Collections.Generic; using OpenRA.Graphics; using OpenRA.Mods.Common.Traits; using OpenRA.Primitives; using OpenRA.Traits; namespace OpenRA.Mods.D2k.Traits { [Desc("Create a palette by applying a scale and offset to the colors in another palette.")] class PaletteFromScaledPaletteInfo : TraitInfo { [PaletteDefinition] [FieldLoader.Require] [Desc("Internal palette name")] public readonly string Name = null; [PaletteReference] [FieldLoader.Require] [Desc("The name of the palette to base off.")] public readonly string BasePalette = null; [Desc("Allow palette modifiers to change the palette.")] public readonly bool AllowModifiers = true; [Desc("Amount to scale the base palette colors by.")] public readonly float Scale = 1.0f; [Desc("Amount to offset the base palette colors by.")] public readonly int Offset = 0; public override object Create(ActorInitializer init) { return new PaletteFromScaledPalette(this); } } class PaletteFromScaledPalette : ILoadsPalettes, IProvidesAssetBrowserPalettes { readonly PaletteFromScaledPaletteInfo info; public PaletteFromScaledPalette(PaletteFromScaledPaletteInfo info) { this.info = info; } public void LoadPalettes(WorldRenderer wr) { var remap = new ScaledPaletteRemap(info.Scale, info.Offset); wr.AddPalette(info.Name, new ImmutablePalette(wr.Palette(info.BasePalette).Palette, remap), info.AllowModifiers); } public IEnumerable<string> PaletteNames { get { yield return info.Name; } } } class ScaledPaletteRemap : IPaletteRemap { readonly float scale; readonly int offset; public ScaledPaletteRemap(float scale, int offset) { this.scale = scale; this.offset = offset; } public Color GetRemappedColor(Color original, int index) { return Color.FromArgb(original.A, (int)(scale * original.R + offset).Clamp(0, 255), (int)(scale * original.G + offset).Clamp(0, 255), (int)(scale * original.B + offset).Clamp(0, 255)); } } }
2023-09-01T01:26:58.646260
https://example.com/article/8970
Q: how can i use two databases with spring-boot I trying to use two databases in my project so i follow this link: this link but just like example i create one Interface and extend CrudRepository public interface UsuarioRepository extends CrudRepository<TbUsuario, Long>{} so where i use? @Bean @Primary @ConfigurationProperties(prefix="spring.datasource") public DataSource primaryDataSource() { return DataSourceBuilder.create().build(); } @Bean @ConfigurationProperties(prefix="spring.secondDatasource") public DataSource secondaryDataSource() { return DataSourceBuilder.create().build(); } to specify my datasource?? A: You need to configure two Datasources, two EntityManagerFactories, and two TransactionManagers. Have a look at section 67.7 Use Two EntityManagers in the Spring Boot docs and 4.1.2. Annotation based configuration in the Spring Data JPA docs. You also need to disable datasource auto configuration in the Application class. An example showing how to put all this stuff together can be found here. Good luck!
2024-03-28T01:26:58.646260
https://example.com/article/7645
Sucker Creek (Osborne Township) Sucker Creek is a stream in geographic Osborne Township in the Unorganized North Part of Nipissing District in Northeastern Ontario, Canada. It is in the Saint Lawrence River drainage basin and is a tributary of Little Sucker Lake. Sucker Creek forms part of the border of Jocko Rivers Provincial Park. Course Sucker Creek begins at the southern tip of Sucker Lake and flows southeast along a boggy course to the northwest side of Little Sucker Lake. Little Sucker Lake flows via the Jocko River and the Ottawa River to the Saint Lawrence River. The creek has one, unnamed right tributary, arriving mid-course from an unnamed lake. See also List of rivers of Ontario References Category:Rivers of Nipissing District
2024-02-12T01:26:58.646260
https://example.com/article/8763
Q: Are spaces shaped like the digits 0, 8 and 9 homeomorphic topological spaces? Consider the topological spaces shaped like the numerals "0", "8" and "9" in $\mathbb{R}^{2}$. Are they homeomorphic? I have an approach that doesnt look very rigorous to me. I wanted to know how to formalize this if its correct. 0 and 8 are not homeomorphic since excluding one point of 0 the space is still connected, but excluding the "tangent point" of 8, we have a disconnected space. Same idea for 8 and 9. The space 9 is union of one circle and one arc. The arc is homeomorphic to the circle, so we can view 9 as a union of two circles, then 8 and 9 are homeomorphic PS: the topology of the spaces is induced by topology of $\mathbb{R}^{2}$. A: $0$ has no cut points. $8$ has exactly one cut point. $9$ has infinitely many cutpoints. To show there are no homeomorphisms among $0,8,9$ use the exercise. Exercise. Prove if $f:X\to Y$ is homeomorphism and $p$ cutpoint of $X$, then $f(p)$ is cutpoint of $Y$. Also show an arc is not homeomorphic to a circle.
2024-03-24T01:26:58.646260
https://example.com/article/3225
What\'s new?•Infectious disease are continuously emerging•Most known human pathogens are zoonoses•Most that are not zoonoses have zoonotic origins•Globalization and human invasiveness creates more opportunities for emergence•Global surveillance and research consortia and novel technologies will allow for more frequent and more rapid detection of novel pathogens Introduction {#sec1} ============ In the 1970s, with antibiotics and vaccines at hand and the eradication of smallpox within reach, there was a general optimism that infectious diseases would soon be a thing of the past. 'If \[...\] we retain a basic optimism and assume no major catastrophes occur \[...\] the most likely forecast about the future of infectious disease is that it will be very dull'.[@bib1] The pandemic of HIV crushed this optimism and infectious diseases were put back on the global health agenda of which the 1992 publication 'Emerging Infections: Microbial Threats to Health in the United States'[@bib2] is a landmark. Since then, the ongoing antimicrobial resistance development among many different pathogens, the continuous emergence of (mostly) viruses with potential for human-to-human or pandemic spread, the intentional release of pathogens as terrorist weapons and the heated debates about experiments to make avian influenza viruses transmissible in ferrets are continuously reminding us that infectious diseases are far from dull. Definitions {#sec2} =========== 'Emerging infectious diseases' are defined as 'those whose incidence in humans has increased within the past two decades or threatens to increase in the near future. Emergence may be due to the spread of a new agent, to the recognition of an infection that has been present in the population but has gone undetected, or to the realization that an established disease has an infectious origin. Emergence may also be used to describe the reappearance (or re-emergence) of a known infection after a decline in incidence'.[@bib2] Zoonotic emergence {#sec3} ================== **Pathogen:** there are 1400 known human pathogens, the majority (60%) of which are transmitted to humans zoonotically and depend on an animal reservoir for their survival. An additional smaller proportion (5--10%) is environmentally transmitted, and the remainder consists of pathogens that can be maintained by an exclusively human-to-human transmission cycle. Among emerging infections, the proportion of zoonotic infections is even higher (73%), indicating that the human--animal interface presents a risk for emergence.[@bib3] In addition, almost all (now) established strictly human pathogens have zoonotic origins:[@bib3], [@bib4] these pathogens have moved from animals into humans and fully adapted to them during many millennia of human and pathogen evolution. **Human:** because most human pathogens rely on an animal or environmental reservoir, the interactions between human populations and their surrounding ecosystem determine the local pathogen spectrum, and the interpopulation interactions determine the spread of these pathogens. Historically, there have been several profound and distinct transitions in human environmental and interpopulation interactions that have radically changed the spectrum and causes of infectious disease in human populations ([Table 1](#tbl1){ref-type="table"} ). Today, we are living through the fourth great historical transition. The invasiveness of human activity into all geographic areas of the world, the globalization of economic activities and culture, the speed and accessibility of distant contact, the spread and intensification of urbanization, and our increasing reliance on either intricate or massive technology, are reshaping the relations between humans and microbes.[@bib5] Table 1Transitions in human environmental and interpopulation interactions through timeTransition, timeMajor changePrehistoric transition, millions of years agoFrom tree-dwelling to savannah, hunter-gathererHistoric transitions•first (local), 5000--10,000 years agoSettlements, crop and livestock domestication•second (continental), 1000--3000 years agoIntracontinental military and commercial contacts•third (intercontinental), from AD 1500European exploration and imperialism•fourth (global), todayGlobalization, urbanization, climate change **The species jump:** the species jump that initiates a first human infection by a new agent is often brought about by a novel or unusual physical contact between potential pathogen and human. Such contacts usually occur because of cultural, social, behavioural or technological change on the part of humans that affects the human--animal interface. The potential for subsequent spread of this 'new' infectious disease will depend on many different factors, including environmental or social factors. These changes and factors are the drivers of emergence and are listed in [Table 2](#tbl2){ref-type="table"} .[@bib2] Table 2Biological, social and environmental drivers of emergence of infectious disease•Microbial adaptation and change•Susceptibility to infection•Climate, weather and the environment•Economic development and land use•Human demographics and behaviour•Technology and industry•International travel and commerce•Breakdown in public health•Poverty and social inequality•War and conflict•Urban decay•Lack of political will•Intentional biological attacks Biologically, the species jump is often more a transition process involving several stages rather than a single event. These stages are displayed in [Figure 1](#fig1){ref-type="fig"} .[@bib6] The pathogen has to overcome various biological barriers (interspecies, intrahuman and interhuman) to move from one stage to the next, to be able finally to cause sustained human-to-human transmission.[@bib7] Based on data from 1940 onwards, the hotspots for emergence of infectious diseases were mapped for zoonotic infections from wildlife and domestic animals, and for drug-resistant and vector-borne organisms. [Figure 2](#fig2){ref-type="fig"} shows that these hotspots are primarily located in South and South East Asia, South and Central America and Subsaharan Africa.[@bib8], [@bib9] Figure 1Adapted from Wolfe ND et al. Origins of major human infectious diseases. Nature 2007; 447 (7142).Reprinted by permission from Macmillan Publishers Ltd.Figure 2Global hotspots for emerging diseases originating in wildlife.From Morse SS, Mazet JA, Woolhouse M, Parrish CR, Carroll D, Karesh WB et al. Prediction and prevention of the next pandemic zoonosis. *Lancet*. 2012 Dec 1;**380**:1956--65. With permission from Elsevier. Various international consortia and large research programmes have been established in an attempt to predict and prevent, or prepare for and mitigate, these novel emergence events, summarized in a recent issue of *The Lancet*.[@bib8] Technical advances enable us to detect and characterize these agents much more rapidly than ever before (e.g. availability of whole genome sequences of influenza virus A/H7N9 influenza or *Escherichia coli* O104:H4 within days).[@bib10], [@bib11] Non-zoonotic emergence {#sec4} ====================== The emergence of novel zoonotic pathogens is appealing to the imagination and draws plenty of popular and scientific media attention, but does not necessarily represent the largest threat from infectious diseases. There is a rapid and increasing spread of antimicrobial drug resistance among bacteria and other pathogens, and the development of novel antimicrobial agents has almost come to a stop because drug companies do not consider them profitable: a combination that may set us back to the pre-antibiotic era. Drug resistance is a threat not only to the successful treatment of HIV, malaria and tuberculosis, but also, increasingly, of hospital- and community-acquired infections from 'normal' Gram-positive and Gram-negative bacteria. Failure of vaccination programmes because of bad press or religious conviction in developed countries can cause re-emergence of highly infectious viruses, such as those that cause measles or rubella, within years, as has happened in the UK and the Netherlands. Global food production and distribution processes may give rise to widely disseminated foodborne infections that are hard to tackle, as with *E. coli* O104:H4 in and out of Germany, recently. Finally, in South East Asia, while H5N1 and H7N9 influenza viruses attract most international attention, hand, foot and mouth disease, caused by the exclusively human pathogen, enterovirus 71, is now associated annually with hundreds of thousands of hospitalizations of children under 5, with a mortality of around 0.1%,[@bib12] showing that humans can also be a source of emerging infections ([Table 3](#tbl3){ref-type="table"} ).Table 3Selection of important emerging infectious diseases from the last decade2013Influenza virus A/H7N92012Middle East respiratory syndrome (MERS) -- coronavirus2011*Escherichia coli* 0104:H42010Huaiyangshan virus, associated with severe fever and thrombocytopenia syndrome (SFTS)2009Influenza virus A/H1N1pdm092008*Plasmodium knowlesi*Lujo virus2005Human retroviruses HTLV3 and HTLV42004Re-emergence of influenza virus A/H5N12003SARS coronavirusAdapted from [www.hpa.org.uk](http://www.hpa.org.uk/){#intref0015} Conclusion {#sec5} ========== For daily medical practice it is important for doctors, and especially infectious disease physicians, to be aware of events of emergence and countries where processes of emergence and species-jumping are occurring (e.g. by subscribing to ProMED, WHO influenza update or others). It is crucial that for each patient the history should include a travel history, which involves more than asking merely for the name of the country that a patient has visited. In the end, despite sophisticated surveillance programmes, it is usually an astute clinician who, after having seen or heard one or two extraordinary patient histories, makes the connection and sees the first signs of an event of emergence.
2024-03-22T01:26:58.646260
https://example.com/article/3054
Q: Updating Models Due to my little confidence with Django and my sheer horror at the thought of seriously messing up my beautiful project, I shall ask for proper advice/instructions here. The database that my Django project is sitting on top of has been changed (a few field types have been changed) and my models are now out-of-sync. Funnily enough, my Django still works (God knows how) but I still want to update the models. How do I go about doing this the proper way. Thank you very much indeed in advance. Marked as answered. My actual discover was: ./manage.py inspectdb > <file> //Hands you all the tables from the database. //Then you update the models accordingly. SIMPLE! :) A: It's probably a bit late, but you might want to take a look at South, which is a migrations system for Django. The normal practice for your situation would be to run manage.py reset appname, where appname is the name of the app which contains the models you've changed. You'll obviously want to dump the data in the affected tables first (find out what tables are going to be affected by running manage.py sqlreset appname). Finally, it's quite possible your site is still running happily because you've not restarted the webserver (I'm assuming you're talking about a production environment, the development server reloads most changes automatically).
2023-10-24T01:26:58.646260
https://example.com/article/4722
v = 159073/48 - 3314. Is v bigger than o? False Let h be 1 + 15/(-9) + 16/24. Suppose h = 3*w - 3*p + 58 + 5, -3*w - 78 = 2*p. Which is smaller: w or -49/2? -49/2 Suppose -4*w + 2*q + 18 = 0, 5*w - 19 = 2*q - 3*q. Suppose v + w*v = -30. Suppose -30 = 4*z - 2*m, 18*m = -5*z + 13*m - 30. Which is smaller: v or z? z Let y be (-82)/(-3) - (-4)/6. Let r = 97 + -84. Let m(s) = -s**3 + 14*s**2 - 11*s + 3. Let d be m(r). Is y equal to d? False Let t be 16/264*11 - 200/(-108). Is 2/9 at most t? True Let i be 2 - ((-34731)/57585 - -3) - (-28)/70. Which is smaller: i or 1? i Suppose -4*t + j - 357 = 0, 13*j - 88 = t + 14*j. Let w = -1193 + 1103. Is w at least as big as t? False Suppose 4*r = -k + 29, 4*r - 2*k - 26 = -4*k. Suppose r*y = -y + 4*y. Let b be -1 + -1 + (-240)/(-138). Is y equal to b? False Suppose -1359 = -3*u - 6*t - 4053, u + 928 = 3*t. Is -904 equal to u? False Let c be (1 - 0)/(-6) + (-120)/(-558). Let q(i) = 5*i + 10. Let g be q(-2). Which is bigger: g or c? c Let k = 724474924/9599 - 75474. Let q = -364792/143985 - k. Which is smaller: -4 or q? -4 Suppose -p + l + 180 = 38, 422 = 3*p - l. Let n = -1673 - -1813. Do p and n have different values? False Let o = -1 - -2. Let h(q) = -4 - o - 2 - 3 - 30*q. Let b be h(-2). Is 50 >= b? True Suppose -77 = -2*z + 1427. Suppose z - 40 = 8*i. Let n be ((-17)/4 - -4) + i/36. Which is smaller: 3 or n? n Let q = 4.02264 + -0.25264. Which is smaller: -0.1 or q? -0.1 Let q = 306.45604 - -0.04396. Is q at most as big as 1? False Let b = 25088.3 + -25155. Are b and -2/7 equal? False Let l be 14/(-16)*2*18/21273. Do 1 and l have different values? True Let y be (246 - 246)/(1 + (-8)/2). Let m = 1.4 + -1. Is m < y? False Let b = 577/14 + -236/7. Let c = -2.501 + 3.001. Is b less than c? False Suppose -2*n + n = -v + 1354, -5*n - 3*v - 6818 = 0. Which is greater: n or -1? -1 Suppose 45 - 45 = 6*z. Let a be ((-30)/18)/((-54)/4). Is z > a? False Let p(u) = u**3 + 2*u**2 + u + 7. Let v be p(-5). Let c = v + 47. Let d be (-1 - -5) + (-8 - c). Is 22 greater than or equal to d? True Suppose -3*o - 5*n + 142 = 475, -2*o + 3*n - 241 = 0. Let l be 117/o - 0 - -1. Suppose 30*g = 9*g - 21. Which is smaller: g or l? g Let o = -35440 - -35451. Which is bigger: o or -23? o Let i = -631.95 - -113.95. Which is bigger: -17 or i? -17 Let m = -3462 + 4314. Is 4256/5 greater than or equal to m? False Suppose -m + 17 = 2*u - 9, 10 = 2*u - 3*m. Let y be (-86)/u + (7 - (-632)/(-88)). Which is greater: y or -4? -4 Suppose -2*x + 797 = h, 487*h - 489*h = -5*x - 1603. Does 794 = h? False Let j be ((-546)/455)/(1 + 7/(-10)). Let z(b) = -49*b - 190. Let t be z(j). Which is greater: -57 or t? t Suppose 2*v = p + 3, 0 = -5*v + 5 + 5. Which is greater: p or -2/121? p Suppose -5*r - 97*z - 28 = -101*z, -4*r - 14 = -2*z. Which is greater: -16905 or r? r Let r be (-5016)/266 + 19 - (2246/371)/(-2). Is r > 4? False Suppose 17*k - 532 = -56. Suppose -k = -7*y - 42. Which is greater: 43 or y? 43 Let l(g) = -11*g**2 + 24*g. Let u be l(2). Suppose 15 = -h - 3*s, 23 - 3 = 5*h - u*s. Which is smaller: -8 or h? -8 Let d = -33 - -161. Suppose 0 = -4*z + 2*o - d, 5*z + 96 = 2*z - 5*o. Which is greater: -29 or z? -29 Let o = 4079.147 + -4076. Let s = o + -3.24. Is s less than -1? False Let d = -884 - -882. Let p = -27 + 30.4. Is d not equal to p? True Suppose 324909*r = 324906*r + 51. Let y(k) = -k**2 - 7 - 8 + 11*k + 10. Let l be y(10). Is r at least l? True Let b(s) be the first derivative of -s**4/4 - 4*s**3 + 8*s**2 - s - 1. Let k be b(-13). Let r be (-8)/(-30) - (-2 + k/(-15)). Does -2/5 = r? True Let h(b) = 21*b - 54. Let s be h(-16). Let w be (72/s)/((-63)/(-20) + -3). Which is smaller: 0 or w? w Let s = -741632725/5331 - -139117. Which is smaller: 1 or s? s Let z be 104/(-110) - 6/(-15). Let s be (-2)/(-15) - 2773/(-15). Let l = s - 185. Is l less than or equal to z? False Let l = 12422 - 21358. Which is greater: -1/4 or l? -1/4 Let i = 976 - 976. Suppose 0 = 2*j + 4*g + 8, 3*j - 4*g - 38 = -0*g. Let x be (j/(-27) - i) + 534/2160. Is x smaller than 1? True Let d = -74 + 64. Let b(l) = l**2 + 10*l + 24. Let r be b(d). Let i be (-6)/9 - r/(-117). Which is smaller: -1 or i? -1 Let m(n) = 12*n - 29. Let f(u) = 7*u - 16. Let a(q) = -5*f(q) + 3*m(q). Let v(h) = h**2 + 3*h - 5. Let l be v(-5). Let c be a(l). Is c at most as big as -16? False Let h = 3959 + -3714. Which is smaller: 1718/7 or h? h Let x(g) = -g + 7. Let v be x(0). Let u be (-236 - -237) + ((-46)/(-10))/1. Is u less than v? True Suppose 4*y - 4*p = -48, 0 = 3*y - 4*p - p + 46. Let l(r) = 2*r**3 + 15*r**2 + 4*r - 21. Let m be l(y). Which is greater: m or 6/269? 6/269 Let s be 261 - (-9 + 11 - (-6)/(-2)). Let a = s - 262. Is a less than or equal to -4/87? False Let u = -5121 - -5132.9. Is -0.045 smaller than u? True Let a = -58798 + 762858/13. Is -118 < a? True Let m = 18449/618 - 179/6. Is -66 at least as big as m? False Suppose 4*d - 47 + 11 = 0. Suppose -2*f = -11 - d. Which is smaller: 126/13 or f? 126/13 Suppose -819 = 8*g + 205. Let p = -52 - g. Which is greater: p or 4? p Let r = -0.33605 + 0.35605. Is 0.1651 equal to r? False Suppose 113 = g + 111, -g + 7038 = 4*r. Is 1760 smaller than r? False Let c = 351338/17 + -20661. Let z be (1 - (3 + 0))*(28 - 25). Let d = z + c. Are 0.2 and d equal? False Let c(h) = 7*h**2 + 45*h - 13. Suppose -22 = 14*m + 76. Let l be c(m). Which is greater: l or 196/13? 196/13 Suppose -5*n = -25, 4*g - n = 7*g + 175. Let u = -673 + 614. Which is greater: u or g? u Let j = 756 - 763. Let r = 0.97 + -0.17. Let i = r + 0.2. Which is smaller: i or j? j Let s be 26*2 - (-3)/(1 + 2). Let i(z) = -2*z**2 - 19*z + 8. Let n be i(-12). Let v = s + n. Which is smaller: v or -1/6? -1/6 Let b be (-4 - -9) + (-2 - 1). Suppose 6*n = b*n - 24. Let u be 2/(-4) + (-1)/3 + -5. Which is smaller: u or n? n Let r be 666/(-518) - 1629/7. Is r < 40? True Let g = 1164 + -1321. Is -473/3 at least g? False Suppose 5*z = -3*n - 51, -4*n = -4*z - 43 - 17. Let h(s) = -6*s**2 - 15*s + 43. Let j be h(2). Do z and j have the same value? False Let l = 201.49 + -197.59. Which is greater: 0 or l? l Suppose 0 = 28*s + 90 - 176 - 250. Is s less than 0.54? False Let d = -2.82 - -3.4. Let i = 2.42 + d. Which is bigger: -3 or i? i Let f be (17/(-204))/((-24)/(-4248)). Which is smaller: f or 0.3? f Let p = -21614/51615 + -1/1665. Let o(d) = -d + 4. Let x be o(4). Is x at most as big as p? False Let i(t) = 8*t**3 - 9*t**2 + 11*t - 3. Let g(k) = 17*k**3 - 18*k**2 + 23*k - 6. Let q(d) = 6*g(d) - 13*i(d). Let s be q(4). Which is bigger: s or 6/89? 6/89 Let r be (-3448)/32 + (-2)/8. Let l = r - -144. Suppose -f + 175 = 4*f. Is l less than f? False Let k(z) = -9*z - 19. Let n be k(-6). Suppose u - 2*u - p = n, -4*u - 5*p = 142. Let m be (-24)/132 + (-17)/u. Which is smaller: -1/5 or m? -1/5 Let t = -63.7 + 62.924. Let n = 48.224 - t. Which is smaller: n or 0? 0 Suppose -614*n + 609*n + 5*f = 1145, -3*n - 2*f - 672 = 0. Which is bigger: n or -227? n Let c(p) = 283*p - 267. Let d be c(1). Is d > -53? True Let m = 19322 + -19329. Is m bigger than -53/8? False Suppose -449 = -4*o + 3*q - 54, q = 3*o - 300. Let w = o - 224. Are w and -123 non-equal? False Let t be 10 + (-6 - -5)*3. Let m be t/((-294)/(-12))*7/415. Which is smaller: 0 or m? 0 Suppose 1263 = -15*q + 2*f, 11*f = -4*q + 10*f - 346. Which is greater: q or -71? -71 Let s = 19 - 14. Let w be 10 - 0/10 - 3. Which is smaller: w or s? s Let q = 7.208 - 6.308. Are q and 4/23 nonequal? True Let d be (-5)/21 + -2 + (5 - 68/28). Is 921 < d? False Let o(k) be the first derivative of k**3/3 + 6*k**2 + 24*k - 11. Let z be o(-10). Suppose 2*m - 22 = 2*h - 0*m, h = -z*m + 14. Is h <= -5? True Let s = -3617 + 3827. Is s smaller than 6? False Let g = 46175 - 34677408/751. Which is smaller: 1 or g? g Let h = 3054 - 3053. Let w = -166 + 1160/7. Is h at most w? False Let b = -5 - -9. Let t = -55917 + 55922. Are t and b nonequal? True Let i = 24816 - 24839. Which is smaller: i or 0? i Let c = 4447/22 + -202. Let q(z) = 3*z**3 - 17*z**2 - z - 13. Let f(a) = -a**3 + a**2. Let l(x) = 4*f(x) + q(x). Let w be l(-13). Is c less than w? False Let i(v) = -9*v**2 + 38*v + 76. Let k(c) = 5*c**2 - 20*c - 38. Let w(n) = -6*i(n) - 11*k(n). Let s be w(-8). Which is smaller:
2023-10-16T01:26:58.646260
https://example.com/article/9501
--source include/have_innodb.inc SET @start_global_value = @@global.innodb_status_output; SELECT @start_global_value; # # exists as global only # --echo Valid values are 'ON' and 'OFF' select @@global.innodb_status_output in (0, 1); select @@global.innodb_status_output; --error ER_INCORRECT_GLOBAL_LOCAL_VAR select @@session.innodb_status_output; show global variables like 'innodb_status_output'; show session variables like 'innodb_status_output'; --disable_warnings select * from information_schema.global_variables where variable_name='innodb_status_output'; select * from information_schema.session_variables where variable_name='innodb_status_output'; --enable_warnings # # show that it's writable # set global innodb_status_output='OFF'; select @@global.innodb_status_output; --disable_warnings select * from information_schema.global_variables where variable_name='innodb_status_output'; select * from information_schema.session_variables where variable_name='innodb_status_output'; --enable_warnings set @@global.innodb_status_output=1; select @@global.innodb_status_output; --disable_warnings select * from information_schema.global_variables where variable_name='innodb_status_output'; select * from information_schema.session_variables where variable_name='innodb_status_output'; --enable_warnings set global innodb_status_output=0; select @@global.innodb_status_output; --disable_warnings select * from information_schema.global_variables where variable_name='innodb_status_output'; select * from information_schema.session_variables where variable_name='innodb_status_output'; --enable_warnings set @@global.innodb_status_output='ON'; select @@global.innodb_status_output; --disable_warnings select * from information_schema.global_variables where variable_name='innodb_status_output'; select * from information_schema.session_variables where variable_name='innodb_status_output'; --enable_warnings --error ER_GLOBAL_VARIABLE set session innodb_status_output='OFF'; --error ER_GLOBAL_VARIABLE set @@session.innodb_status_output='ON'; # # incorrect types # --error ER_WRONG_TYPE_FOR_VAR set global innodb_status_output=1.1; --error ER_WRONG_TYPE_FOR_VAR set global innodb_status_output=1e1; --error ER_WRONG_VALUE_FOR_VAR set global innodb_status_output=2; --error ER_WRONG_VALUE_FOR_VAR set global innodb_status_output=-3; select @@global.innodb_status_output; --disable_warnings select * from information_schema.global_variables where variable_name='innodb_status_output'; select * from information_schema.session_variables where variable_name='innodb_status_output'; --enable_warnings set global innodb_status_output=DEFAULT; select @@global.innodb_status_output; --disable_warnings select * from information_schema.global_variables where variable_name='innodb_status_output'; select * from information_schema.session_variables where variable_name='innodb_status_output'; --enable_warnings --error ER_WRONG_VALUE_FOR_VAR set global innodb_status_output='AUTO'; # # Cleanup # SET @@global.innodb_status_output = @start_global_value; SELECT @@global.innodb_status_output;
2024-01-10T01:26:58.646260
https://example.com/article/3575
Newport Finish Second NEWPORT 38, BRIDGEND 29 Newport grabbed the consolation prize of finishing second in the Welsh/ Scottish League after completing the double over Bridgend. But there were no real celebrations at Rodney Parade as the Black and Ambers were left wondering what might have been had they not lost two successive home league games against Neath and Cardiff. Having led the table comfortably three weeks ago, the Gwent side took on the Ravens just 24 hours after Llanelli's victory at Cardiff had given the Scarlets the title thanks to Stephen Jones' last gasp kick. However, they made slight amends by finishing the season on a high - sharing eight tries in a hard fought victory over the Ravens. Shane Howarth, broken nose and all, kicked three early penalties to give the home side a cushion before the Black and Ambers were awarded a penalty try when Simon Raiwalui was obstructed just a yard from the line as he awaited a scoring pass. Dafydd James gave Bridgend some much needed cheer when he linked with John Devereux to sweep over for a try that Cerith Rees improved but Jason Forster was on the mark for Nepwort three minutes later. Adrian Garvey's try for Newport eased any nerves but a penalty try for Bridgend kept matters in the melting pot. Andrew Joy bagged Bridgend's third try and after Rod Snow had driven over for Newport's fourth James waltzed through a gaping hole in the Newport back division for Rees to convert. But Howarth made sure with an injury time penalty to seal the win. SCORERS Newport: Tries: Penalty try, Jason Forster, Adrian Garvey, Rod Snow; Cons: Shane Howarth 3; Pens: Shane Howarth 4. Bridgend: Tries: Dafydd James 2, Penalty Try, Andrew Joy; Cons: Cerith Rees 3; Pen: Cerith Rees. Wales reached their first semi-final since 2013 in the opening round of this season's HSBC World Rugby Sevens Series in Dubai. WRU TV's Graeme Gillespie recaps on what proved to be an eventful tournament Wales and Ospreys back row James King, who came through the North Wales age grade system, nominated North Wales Regional Community Rugby Manager Marc Roberts, in the WRU's 'Diolch' initiative where squad players thanked those who played a part in their rise to the top. Beating Merthyr has boosted Carmarthen Quins hopes of reaching a top eight spot in the Principality Premiership. Quins captain Haydn Pugh is delighted with his team's progress and is determined that everyone from the Under 6s through to the senior team, enjoys the ride. When the Wales squad were asked to nominate individuals who played a big part in their early playing days, Wales and Dragons full back and wing Hallam Amos thought of his former Monmouth School rugby coach John Bevan. Sam Cross and Luke Treharne have been named as co-captains of the Wales Sevens side as head coach Gareth Williams names his 12-man squad to play in the first leg of the HSBC World Series in Dubai next weekend. Bedwas head coach Steve Law and players Nicky Griffiths and Alun Rees extol the virtues of the close knit club as they prepare to host third place RGC 1404 - who are one place head of them on the Principality Premiership points table - on Saturday. Many of the Wales squad have said Diolch (thank you) to someone who played an important part in their early playing days by nominating them to be invited to the Wales v South Africa match. One person, Gowerton Comprehensive geography teacher Mr Dean Mason was nominated by two of his former pupils, Dan Biggar and Sam Davies. The second WRU disability rugby pilot has been delivered, this time in Caerphilly schools, culminating in a festival at the Caerphilly Centre of Sporting Excellence, Ystrad Mynach tomorrow. Plans are in place to set up a Disability Rugby Club in Newbridge to provide long-term playing opportunities. WRU TV: Hear from inside the Wales camp as Neil Jenkins discusses this weekend's clash with South Africa and how the squad are looking to put in a strong performance to round of the 2016 Under Armour Series
2024-06-05T01:26:58.646260
https://example.com/article/7427
Women’s soccer remains fresh The Owls’ former forward and captain Niki Conn has been a fixture and face of women’s soccer for four years. Her efforts will be missed as Temple enters the season with one of its youngest rosters in recent memory, without Conn. Conn, who started in 68 matches at Temple, led the Owls in scoring each of her four seasons. Her career total of 27 goals is tied for second-most goals in school history and her 62 career points ranks third in school history. “[Conn] was one of the most prolific goal scorers that this program has ever seen,” coach Matt Gwilliam said. “You cannot replace a Niki Conn.” Gwilliam said he sees five to six players that could step in to help fill the hole left by Conn, saying that it will be a collective group effort. With such a young team, Gwilliam said that people do not expect much during the maturation process. “This group is going to grow as a team and we are hoping to catch some teams by surprise this season,” Gwilliam said. Gwilliam said he expects senior midfielder Jourdan Brill and senior forward Morgyn Seigfried to play a large role this season. Along with Brill and Seigfried, senior captain Kate Yurkovic is expected to lead the young Temple squad both on and off the field. “[Yurkovic] is a great leader, I have never questioned her leadership and I expect a lot out of her this year,” Gwilliam said. Yurkovic sees her responsibility as captain as a nice feeling, but understands everyone else still has their own responsibilities on the field. “With a younger team, you have to watch over the freshman a little more and be a better example for them,” Yurkovic said. “They need somebody to help them out, whereas the older girls already know what to do.” Last season, Yurkovic played in all 18 of Temple’s matches, scoring one goal and notching one assist. Yurkovic was also able to learn a thing or two about how to be a captain and a leader from Conn. “I watched her last year and how she handled the team,” Yurkovic said. “I try to handle the team the same way she did.” Although Yurkovic acknowledges that there cannot be another Conn right away, she believes that a few of the young players can step up and be a goal scorer for the Owls if they can continue to be aggressive on the field. “I would personally like to score more goals this season,” Yurkovic said. “[Conn] did a great job for us, but we need to score more and move on after the regular season.” With 15 freshman, one sophomore, seven juniors and seven seniors, the Owls will have one last shot at a run in the Atlantic 10 Conference tournament before joining the Big East next season. “Everyone is going to be a key player if everyone does their job,” Yurkovic said. “Not one person will run the show. It will be a collective group effort.” Freshman forward Brendi Ernst said she chose Temple for the campus, the coaching staff and the accessibility for family outside of Gettysburg, Pa., to attend Temple matches. First recruited by Gwilliam while he was at Virginia Tech, Ernst chose to follow Gwilliam to Temple after considering a few other schools, including Gwilliam’s former school. Ernst has yet to hit the field this season due to a left foot injury she acquired this summer with her club team. “I trained really hard after winning nationals this summer and then it all caught up to me,” Ernst said. “Coach Gwilliam is very nice and is very understanding of my injury and keeping me positive while I have been down.” Along with Ernst, freshman midfielder Paige Rachel is joining the Owls for her first season at Temple. She said that she chose Temple because she wanted to move farther away from her home in New Hampshire. Rachel said that both Gwilliam and Yurkovic have been really helpful and supportive to her and the entire team. “The whole team has high expectations,” Rachel said. “I want to help out in any way I can.” Get us delivered to your inbox Sign up for weekly updates from The Temple News The Temple News has been the paper of record for the Temple University community since it first printed as Temple University Weekly on Sept. 19, 1921. The award-winning student publication, editorially independent of Temple, now publishes every Tuesday and daily online. The Temple News distributes 5,000 printed copies, free of charge, to the university’s primary locations in the Delaware Valley.
2024-02-26T01:26:58.646260
https://example.com/article/4248
UNITED STATES AIR FORCE COURT OF CRIMINAL APPEALS UNITED STATES v. Senior Airman BRITTNEY L. HALL United States Air Force ACM 38241 (recon) ____ M.J. ____ 1 August 2014 Sentence adjudged 16 October 2012 by GCM convened at Minot Air Force Base, North Dakota. Military Judge: Michael A. Lewis (sitting alone). Approved Sentence: Dishonorable discharge, confinement for 30 months, forfeiture of all pay and allowances, reduction to E-1, and a reprimand. Appellate Counsel for the Appellant: Major Matthew T. King. Appellate Counsel for the United States: Lieutenant Colonel C. Taylor Smith; Major Jason S. Osborne; Captain Matthew J. Neil; and Gerald R. Bruce, Esquire. En Banc ALLRED, MARKSTEINER, HECKER, MITCHELL, and WEBER Appellate Military Judges OPINION OF THE COURT UPON RECONSIDERATION This opinion is subject to editorial correction before final publication. MARKSTEINER, S.J., delivered the opinion of the Court, in which ALLRED, C.J., HECKER, S.J., MITCHELL, J., and WEBER, J., join. WEBER, J., filed a concurring opinion. MARKSTEINER, Senior Judge: A general court-martial composed of a military judge sitting alone convicted the appellant, consistent with her pleas, of violating a lawful order on divers occasions; larceny of military property of a value of over $500; aggravated assault with a loaded firearm; and obstructing justice, in violation of Articles 92, 121, 128, and 134, UCMJ, 10 U.S.C. §§ 892, 921, 928, 934. The adjudged sentence consisted of a dishonorable discharge, confinement for 42 months, forfeiture of all pay and allowances, reduction to E-1, and a reprimand. Pursuant to a pretrial agreement, the convening authority approved only 30 months of confinement. He approved the remainder of the sentence as adjudged. The appellant did not raise any issues on appeal, but this Court specified the following issue pertaining to the appellant’s larceny conviction, which involved her entering into a marriage for the purpose of obtaining basic allowance for housing (BAH): Whether the appellant’s plea of guilty to larceny was rendered improvident by the appellant’s providency inquiry statements that “a few days, a week, a week and a half” after the marriage ceremony the appellant and her purported husband “decided to give [the marriage] a try.” In addition to the specified issue, we also examined the providence of the appellant’s plea to the larceny charge with respect to whether BAH is “military property.” After evaluating those issues, we found the appellant’s plea provident, and affirmed the conviction with the exception of the words “military property.” United States v. Hall, 73 M.J. 645 (A.F. Ct. Crim. App. 2014). On 6 June 2014 we granted the Government’s motion for en banc reconsideration, thereby vacating our previous decision, in order to correct that portion of the decision that conflicts with our superior court’s precedent regarding the status of BAH as military property. Having now so reconsidered, we affirm. Background The appellant was an Airman First Class (A1C) assigned to her first duty station at Minot Air Force Base (AFB), North Dakota. Unmarried enlisted military members assigned to Minot AFB were required to live in the on-base dormitories until they reached the rank of Senior Airman (SrA) and had over three years of service. As of September 2010, the appellant was unmarried, had not attained the rank of Senior Airman, and had less than three years of service. Thus, she was required to live in the dormitories and was not entitled to BAH. Desiring to live off base, the appellant engaged in a practice known as “ghosting.” Ghosting is a term used to describe an Airman who maintains a dormitory room on base 2 ACM 38241 (recon) but actually lives off base. Airmen who ghost pay for their off-base residences out of pocket. While ghosting, the appellant actually lived in a two-bedroom apartment in the city of Minot. She shared the apartment with a male, A1C JY, whom she had previously dated, and a female, SrA NK, with whom she had, at the time, a romantic relationship. Like the appellant, A1C JY and SrA NK were also ghosting. In September 2010, the three engaged in a conversation with SrA CB who also lived in their apartment complex. The appellant and her roommates discussed the financial hardships they were enduring because they were paying for the apartment out of their own pockets. SrA CB suggested that if the appellant and A1C JY got married, they could both receive BAH and be better able to afford living off base. Over the next week or so, the appellant and A1C JY discussed the idea of getting married in order to receive BAH. They decided to do so and on 28 September 2010 were married in a civil ceremony. On the day of the marriage, the appellant provided a copy of the marriage certificate to the Minot AFB finance office and began receiving BAH with an effective date of 28 September 2010. Both the appellant and A1C JY continued to receive BAH until A1C JY separated from active duty on 14 May 2011. On 5 December 2011, the appellant returned to the finance office to update her status to reflect that her husband had separated from active duty. She then started to receive BAH at the increased “with dependent” rate. Additionally, she received back-dated “with dependent” rate BAH retroactively starting on the date A1C JY left active duty. It is undisputed that on 28 September 2010, when the appellant and A1C JY were married, they had no intention of establishing a life as husband and wife. However, during the Care1 inquiry, the appellant made various statements indicating that at some point after the marriage began they did attempt to live as husband and wife. The military judge noted that she appeared to be qualifying her answers to his questions about the marriage, and he inquired further about it. The appellant reaffirmed that at the time of the marriage ceremony she did not intend to live as husband and wife with A1C JY. She said, however, that they “actually decided to give it a try” a “few days . . . a week, week and a half” after they were married because they had been living together and they “felt like [they] could make it work.” In response to a question from the military judge, the appellant stated she thought she was really married and she and A1C JY acted like a married couple by doing the things married couples do. She said she and A1C JY would go out, share money, spend time together, and be intimate, “the things that anybody in a . . . committed relationship would do except for the fact that we were legally married.” 1 United States v. Care, 40 C.M.R. 247 (C.M.A. 1969). 3 ACM 38241 (recon) The court-martial recessed overnight. The next day, the military judge asked the appellant if she thought the marriage was a sham marriage. The appellant agreed it was a sham marriage. The military judge concluded the marriage was a sham, articulated his basis for doing so, and found the plea to larceny to be provident. He then entered findings of guilty in accordance with the appellant’s pleas. Despite the appellant’s vacillation during the Care inquiry, we find nothing in the record before us, considered in its entirety, presenting a substantial basis in law or fact causing us to question the providence of the appellant’s guilty plea. We hold that a marriage that is a sham at its inception remains a sham for purposes of acquiring housing allowances to which one or both parties to that sham marriage would not otherwise be entitled. Providency of the Plea We review a military judge’s decision to accept a guilty plea for an abuse of discretion and review questions of law arising from the guilty plea de novo. See United States v. Inabinette, 66 M.J. 320, 322 (C.A.A.F. 2008). “In doing so, we apply the substantial basis test, looking at whether there is something in the record of trial, with regard to the factual basis or the law, that would raise a substantial question regarding the appellant’s guilty plea.” Id.; see also United States v. Prater, 32 M.J. 433, 436 (C.M.A. 1991) (A plea of guilty should not be overturned as improvident unless the record reveals a substantial basis in law or fact to question the plea.). “In reviewing the providence of Appellant’s guilty pleas, we consider his colloquy with the military judge, as well any inferences that may reasonably be drawn from it.” United States v. Carr, 65 M.J. 39, 41 (C.A.A.F. 2007) (citing United States v. Hardeman, 59 M.J. 389, 391 (C.A.A.F. 2004)). At trial, the military judge must (1) have ensured the appellant understood the facts supporting her guilty plea (“what” she did); (2) have ensured the appellant understood how the law applies to those facts (“why” she is guilty); and (3) be satisfied that the appellant is actually guilty. See United States v. Medina, 66 M.J. 21, 26 (C.A.A.F. 2008) (citing Care, 40 C.M.R. at 250-51); United States v. Jordan, 57 M.J. 236, 238 (C.A.A.F. 2002). A military judge abuses his discretion when accepting a plea if he does not ensure the accused provides an adequate factual basis to support the plea during the providency inquiry. See United States v. Care, 40 C.M.R. 247, 250-51 (C.M.A. 1969). This is an area in which the military judge is entitled to significant deference. Inabinette, 66 M.J. at 322. BAH as “Military Property” The appellant was charged with stealing military property in the form of BAH. BAH is “military property” of the United States. United States v. Dailey, 37 M.J. 463, 464 (C.M.A. 1993) (“[BAH] funds are appropriated by Congress; their defined purpose is 4 ACM 38241 (recon) to boost morale and to ensure subsistence of servicemembers and their families. They are ‘clearly distinguishable from salary’ and, when improperly made, do not transform into the individual’s property. These appropriated funds are surely military property.” (citations omitted)).2 Having reviewed the record and applied the appropriate legal tests as described above, we find no error in the military judge’s conclusion as to the nature of BAH as military property. Nature and Legal Status of the Appellant’s Marriage We reject the proposition that the appellant was ever in a valid marriage for purposes of being entitled to military benefits flowing from that marriage. Although the validity of a marriage is ordinarily a question of fact to be decided in accordance with state law, state law is not determinative where a service member enters into a sham marriage to fraudulently obtain government benefits or to commit immigration fraud. Lutwak v. United States, 344 U.S. 604, 611 (1953); United States v. Bolden, 28 M.J. 127, 130 (C.M.A. 1989). As noted in Bolden: Perhaps under that [state] law—which, according to accepted principles of conflict of laws, would govern the validity of the marriage—participation in a marriage ceremony is insufficient to create a valid marriage, if the parties never intended to live together as husband and wife. In that event, completion of the marriage ceremony clearly would not shield [the appellant] from conviction of larceny. 28 M.J. at 129. We conclude that regardless of the legitimacy of her marriage under North Dakota law, the appellant was not entitled to use this marriage to claim housing allowance benefits. In Bolden, our superior court upheld an appellant’s conviction for conspiring to defraud the government out of housing allowance money by orchestrating a sham marriage between the appellant’s friend, Bahre, and his girlfriend, Willoughby. See Bolden, 28 M.J. at 131. Although the history and living arrangements between Bahre and Willoughby differed from those between the appellant and A1C JY, the Court’s overarching rationale for upholding Bolden’s conviction is equally applicable to the case now before us. In both cases, the parties to the sham marriages undertook courses of conduct specifically intending—with singular focus—to gain access to government- funded payment streams to which they would not otherwise be lawfully entitled. 2 Our holding to the contrary in United States v. Thomas, 31 M.J. 794 (A.F.C.M.R. 1990) is therefore overruled. 5 ACM 38241 (recon) “Even if the marriage was valid under [state] law,” our task would be to “inquire whether Congress intended for a servicemember to receive a quarters allowance as a married person if the marriage was a sham.” Bolden, 28 M.J. at 129-30 (citing Lutwak, 344 U.S. at 605 (holding validity of marriage not determinative in case of servicemen convicted of engaging in sham marriages with non-citizens where purpose of marriages was to circumvent immigration laws)). In Bolden, our superior court noted it was “convinced that when Congress authorized a basic allowance for quarters for a servicemember with ‘dependents,’” Congress “did not intend that the term include a person who was linked to a servicemember by only a sham marriage.” Id. at 130. The Court further noted Congress “never intended to encourage or subsidize the sort of arrangement into which [Bahre and Willoughby] entered,” and “there is nothing unfair in imposing criminal liability on a servicemember who seeks to obtain allowances from the Government by entering into a fake marriage.” In light of Lutwak, the Court was “convinced that Congress meant to impose such liability.” Id. at 130-131. “The crucial issue in determining the legitimacy of a marriage is not the couple’s way of life within the marriage but the spouses’ intent at the time the marriage was contracted.” Note, The Constitutionality of the INS Sham Marriage Investigation Policy, 99 HARV. L. REV. 1238, 1249 (1986). Under U.S. immigration law, a sham marriage is void from the start for purposes of securing residency status. In Matter of Awwal, the U.S. immigration service held that even in a case where the U.S. citizen stepparent of an alien stepson had demonstrated “active parental interest,” the child enjoyed no advantageous immigration status customarily available to stepchildren because the father’s original marriage to the boy’s mother was a sham. 19 I. & N. Dec. 617, 619-21 (B.I.A. 1988). “A sham marriage is invalid from its inception.” Id. at 621. See also 8 U.S.C. § 1325 (“Any individual who knowingly enters into a marriage for the purpose of evading any provision of the immigration laws shall be imprisoned for not more than 5 years, or fined not more than $250,000, or both.”). Military law follows suit. In Bolden, the trial judge instructed the members: [A] sham marriage is void under the law of this country as against public policy and such a marriage can have no validity. Mutual consent is necessary to every contract and no matter what forms or ceremonies the parties go through indicating the contrary, they do not contract if they do not in fact assent. Marriage is no exception to this rule. If the spouses agree to a marriage only for the sake of representing it as such to the outside world, they have never really agreed to be married at all. They must assent to enter into the relation as it is ordinarily understood and it is not ordinarily understood as merely a pretense or a cover to deceive others. United States v. Bolden, 23 M.J. 852, 854 (A.F.C.M.R. 1987) (emphasis added). Affirming our holding in Bolden, our superior court concluded that “the Government’s 6 ACM 38241 (recon) evidence was legally sufficient to sustain the findings of guilty and the instructions adequately informed the court members of the applicable legal principles.” Bolden, 28 M.J. at 131. In a later decision, our superior court expressly stated the test for determining whether a marriage is a sham entered into solely for the purpose of obtaining government benefits is whether “the two parties have undertaken to establish a life together and assume certain duties and obligations,” as this is “the common understanding of a marriage.” United States v. Phillips, 52 M.J. 268, 272 (C.A.A.F. 2000) (citing Lutwak, 344 U.S. at 611). This focus on the state of mind of the parties at the inception of the marriage is consistent with Congress’ enactment of 37 U.S.C. § 423, which states: [P]ayment of an allowance, based on a purported marriage . . . before judicial annulment or termination of that marriage, is valid, if a court of competent jurisdiction adjudges or decrees that the marriage was entered into in good faith on the part of the spouse who is a member of a uniformed service or if, in the absence of such a judgment or decree, such a finding of good faith is made by the Secretary concerned or by a person designated by him to investigate the matter. (emphasis added). Through this statute, Congress is electing not to recoup from a military member allowances which were paid to her when she entered into a marriage in good faith but where that marriage was later found to be invalid.3 Bolden, 28 M.J. at 130 (“Congress did not intend to impose criminal liability on persons who had failed to satisfy technical legal requirements but were living together as husband and wife in a good faith belief that they were married . . . .”). In contrast, if a determination is made (by a court or a military service Secretary) that the marriage was entered into in bad faith, the military member would not be entitled to keep the money previously paid to her. 3 The Department of Defense has implemented this provision via regulations. “A member’s lawful spouse . . . [is] always [a] dependent[] for housing allowances purposes,” but “[a]ny case in which the validity of a member’s marriage is questioned is a case of doubtful relationship.” Joint Federal Travel Regulation, Vol. 1, Uniformed Service Members, ¶¶ U10102, U10104 (1 October 2009). Some circumstances are listed where the Department will (and will not) recognize marriages as valid for housing allowances purposes (common law marriages, foreign nation divorces, etc.). Id. ¶ U10104. Under “Purported Marriage,” it notes that a member with “no lawful spouse” due to a void marriage cannot receive a housing allowance at the dependent rate. Id. Upon discovery of the marriage invalidity (a listed example being a spouse who already had a preexisting marriage), the housing allowances must stop but the member may retain payments already received if they are “validated” by a process through which a “determination on the validity of a marriage (doubtful cases) or for validation of [past] payments” is made. Within that process, payments of allowances based on a “purported marriage . . . are valid if . . . [a] court of competent jurisdiction adjudges or decrees that the military member entered the marriage in good faith,” or, in the absence of such a decree, “a finding of good faith is made by the Secretary of the Military Service” or his/her designee. Department of Defense Financial Management Regulation, Vol. 7A, Ch. 50, ¶ 500601 (July 2006) (emphasis added). “Payments based on invalid marriages are considered erroneous payments or overpayments unless validated.” Id. ¶ 500603. 7 ACM 38241 (recon) Others skeptical of the position we take today may posit that people can get married for a variety of reasons. For example, some marry to gain approval of a family member, or to share in raising a child. “In an era of two-career relationships, the timing of marriage and the nature of marital living arrangements may be heavily influenced by such unromantic factors as tax laws, occupational benefits, and professional opportunities.” Phillips, 52 M.J. at 273 (Effron, J., dissenting). Who is to say what is a “sham” or an “invalid” reason for marriage? Congress. In enacting the authorization for housing allowance, Congress answered the question about who is authorized to receive funds from the government to provide for a dependent. See Bolden, 28 M.J. at 130. What we hold today is simply this: It is not the absence of a perfect or ideal “love, honor, and cherish” motivation of the parties that renders the consequences flowing from the appellant’s actions in the case before us criminal; rather, it is the affirmative presence of a singularly focused illicit one—an intent to fraudulently acquire a government payment stream—that does so. Because we find her marriage to be void for housing allowance purposes from the outset, we do not find any relevance in the appellant’s decision to “make a go” of her marriage or in her described behavior after the date of her marriage ceremony. She admitted entering into the marriage in bad faith and therefore she is not entitled to the housing allowance benefit Congress intended to support legitimate spouses and other valid dependents of military personnel. Though the appellant attempted to recast her actions in as favorable a light as possible during the Care inquiry by initially equivocating on various points, the military judge pressed where he needed to and in so doing established the following facts, which we find sufficient to leave her guilty plea undisturbed. In light of these facts, we uphold the military judge’s decision that the appellant’s plea was not invalidated by her asserted belief that within “a few days . . . a week, a week and a half” the appellant thought she was legally married, that they acted like husband and wife, that she believed she was married, and that she conducted herself as though she was married. The military judge recognized the appellant described a matter that may be inconsistent with her plea. Subsequently, he conducted additional inquiry such as to clarify the appellant’s admission she was not entitled to the money, and only acquired possession of the funds under false pretenses with a criminal state of mind. As the appellant explained: I deceived the Air Force because when me and [A1C JY] initially got married, we did not establish—or we did not intend to establish a marital life together. And when I went back in December to the Finance office to get BAH with-dependent rate, we had not established a life together at that point. The appellant admitted she entered into the marriage ceremony in bad faith, clarifying, “[W]e got married just to be able to stay off base. It wasn’t for me and him to 8 ACM 38241 (recon) establish a life together when we first got married.” The appellant further explained, “At the time when we did initially—or when we got married, it wasn’t under good faith or for the reason of binding two people as one in a marriage.” The appellant also admitted, “[W]e got the marriage certificate under false pretenses.” Prior to the sham marriage, the appellant lived with SrA NK, who was her then current girlfriend, and with A1C JY, whom she had previously dated. The appellant spent some nights in A1C JY’s room and other nights in SrA NK’s room. There is no indication the marriage in any way altered the sleeping arrangements or relationships among the roommates. Quite to the contrary, by early February 2011 A1C JY had moved out, and the appellant and SrA NK moved into a rented house together along with another roommate. Notably, also in February 2011, the appellant threatened SrA NK with a loaded gun because of concerns that SrA NK had cheated on her. On these facts, we do not agree that the appellant believed she and A1C JY “lived together as husband and wife.” See Phillips, 52 M.J. at 272 (observing that evidence of a spouse’s romantic relationships with others “made it more probable that [the married couple] intended to continue their separate lives and relationships” where those relationships existed before and continued after the marriage). As to sharing money, the appellant offered no specifics except that, after A1C JY moved out, “When he would call and tell me he needed money, I would give it to him.” When asked why she provided money to A1C JY when he would call and ask for it, she answered, “Because he needed it, and I’ve always been there for him to help him out, whatever he needed.” When the judge asked her to specify whether she was required to support him because they were married or for some other reason, she answered, “Well, I was required to provide him support, but it was because he—me and him are really, really close, sir.” Nothing about her statement suggests her decision to occasionally “help out” A1C JY financially was part of “establish[ing] a life together and assum[ing] certain duties and obligations,” see Phillips, 52 M.J. at 272, or that she did so because she was lawfully responsible for A1C JY as her spouse. She did not say she and A1C JY shared bills, split grocery or other living expenses, paid taxes as a married couple, or in any way meaningfully managed their finances as married couples customarily do. Rather, she offered nothing beyond broad generalities constituting little more than what appears to be an effort to minimize her misconduct in the eyes of others present in the courtroom. Considering the entire record before us, including this appellant’s demonstrated propensity to attempt to shape the evidence as favorably as possible to her advantage,4 4 The appellant was also convicted of wrongfully endeavoring to influence Senior Airman (SrA) NK’s testimony as a witness during the appellant’s Article 32, UCMJ, 10 U.S.C. § 832, investigation by, inter alia, providing SrA NK with a handwritten list of things she should tell the investigating officer regarding the nature of their relationship and when it started. 9 ACM 38241 (recon) and in light of the discretion accorded to a military judge when evaluating the providence of an accused’s guilty plea, we find nothing in the appellant’s meandering, off again–on again statements during the Care inquiry to reveal a substantial basis in law or fact sufficient to cause us to question the plea. See Inabinette, 66 M.J. at 322. Rather, those statements reflect the reality Judge Cox observed in United States v. Garcia, 44 M.J. 496, 498 (C.A.A.F. 1996) (quoting United States v. Penister, 25 M.J. 148, 153 (C.M.A. 1987) (Cox, J., concurring)): Often an accused is reluctant to admit to a particular aspect of an offense. However, that should not vitiate his guilty plea if he recognizes that the evidence against him will prove the point, and he admits his guilt to the offense. We should not overlook human nature as we go about the business of justice. One aspect of human beings is that we rationalize our behavior and, although sometimes the rationalization is “inconsistent with the plea,” more often than not it is an effort by the accused to justify his misbehavior. A good trial judge can usually sort out the guilty plea and determine if an accused is so pleading because he has committed the offense charged. In the case before us, we believe the trial judge effectively sorted out the appellant’s narrative and appropriately accepted her guilty plea. Accordingly, as to the Specification of Charge IV, we find the military judge did not abuse his discretion by accepting the appellant’s plea of guilt. Conclusion The approved findings and sentence are correct in law and fact and no error materially prejudicial to the substantial rights of the appellant occurred.5 Articles 59(a) and 66(c), UCMJ, 10 U.S.C. §§ 859(a), 866(c). 5 This Court’s initial decision was issued on 11 April 2014, but due to our grant of reconsideration en banc more than 540 total days have elapsed since the case was first docketed with us. See United States v. Moreno, 63 M.J. 129, 142 (C.A.A.F. 2006). Assuming the total appellate processing of this case raises a presumption of unreasonable delay, we examine the four factors set forth in Barker v. Wingo, 407 U.S. 514, 530 (1972): (1) the length of the delay; (2) the reasons for the delay; (3) the appellant’s assertion of the right to timely review and appeal; and (4) prejudice. We find that the appellate delay in this case was harmless beyond a reasonable doubt. See Moreno, 63 M.J. at 135-36; see also United States v. Harvey, 64 M.J. 13, 24 (C.A.A.F. 2006). We are cognizant of our ability to provide relief in the absence of prejudice but decline to do so in this case. See United States v. Tardif, 57 M.J. 219, 225 (C.A.A.F. 2002). 10 ACM 38241 (recon) Accordingly, the approved findings and sentence are AFFIRMED. Senior Judge MARKSTEINER participated in this decision and authored the opinion of the Court prior to his reassignment. Judge TELLER was not a member of the Court when it reconsidered this case en banc and did not participate. WEBER, Judge, concurring: I fully concur with the Court’s opinion detailing the reasoning behind “sham marriage” cases. I also agree with the opinion that the appellant did not call into question the providency of her plea by stating that, after the sham marriage began, she and her co- conspirator made some attempt to “give it a try.” I write separately simply to stress that a military judge enjoys “broad discretion” in deciding to accept a guilty plea, and this decision will not be overturned unless the record as a whole shows “a substantial basis in law and fact for questioning the guilty plea.” United States v. Inabinette, 66 M.J. 320, 322 (C.A.A.F. 2008) (quoting United States v. Prater, 32 M.J. 433, 436 (C.M.A. 1991)) (internal quotation marks omitted). The appellant clearly and repeatedly admitted that she entered into the “marriage” for the sole purpose of defrauding the U.S. Government out of housing allowances. Her providency inquiry revealed that throughout most if not all of the charged time frame, the appellant and her “husband” were not living together as husband and wife in any true sense of the phrase. The military judge recognized that the appellant’s statements about what occurred after the sham marriage commenced raised some issue that required further exploration. He thoroughly and methodically explored this issue, giving the appellant plenty of time to discuss this matter with her defense counsel. Time and again, the appellant reiterated that she understood the issue raised by her statements, repeated that she was guilty because her intent was to defraud the government out of housing allowances through a sham marriage, and reiterated her desire to plead guilty. The military judge did exactly what he should have, and there is no “substantial basis” for questioning the plea. Given the significant deference he enjoys in deciding whether to accept a guilty plea, I would end the analysis there. FOR THE COURT LEAH M. CALAHAN Deputy Clerk of the Court 11 ACM 38241 (recon)
2024-01-04T01:26:58.646260
https://example.com/article/4299
donovanmtaip.dbblog.net Advertisements General information: The ip address of donovanmtaip.dbblog.net is 198.101.14.56.The location of this domain is :West Palm Beach-Florida - United States .ISP:Cloud South TLD:net LENGTH : 23 WORDS : donovanmtaip Domain NS donovanmtaip.dbblog.net Checked at :2018-12-19. You can update this page one day later.
2024-07-02T01:26:58.646260
https://example.com/article/5575
THE BACK-UP SUPPLY THAT CUTS YOUR ENERGY COSTS AND GENERATES REVENUE A battery storage system is a reliable emergency supply (with a response time of less than 0.2 seconds) that is constantly working to reduce your energy costs. Unlike a diesel generator a battery energy storage system can provide revenue-generating services for the distribution and transition networks, resulting in an unrivalled return on investment (ROI). WHAT ARE THE KEY BENEFITS? Just like a swiss army knife, a battery energy storage system provides a multitude of benefits: Security and quality of supply Reduced net energy spend Generate an income Future proof against volatile energy prices HOW A BATTERY ENERGY STORAGE SYSTEM SAVES YOU MONEY? • PROTECTION AGAINST POWER CUTS Battery energy storage systems act as an emergency back-up supply, keeping your business running during a power cut. Think of what the cost of a power outage means for your business in terms of unexpected downtime, staff costs, damaged tools, wasted product, pressure on order deadlines… £££ • REDUCTION IN TRANSMISSION NETWORK COSTS The charges you pay to National Grid are based upon average demand during three half-hour periods between November and February (known as Triads). As these are usually between 4-7pm on a weekday, having a lower usage during the Triads will reduce your TRANSMISSION NETWORK USE OF SYSTEM (TNUOS) electricity charges. • REDUCTION IN CAPACITY MARKET LEVY This is charged per kWh of electricity used during peak demand times (4-7pm, weekdays between November and February). Using less during these times will reduce the charge on your electricity bill. HOW A BATTERY ENERGY STORAGE SYSTEM GENERATES AN INCOME? By working with a third party aggregator (which we can arrange), your battery energy storage system can generate revenue streams without any impact on the service it provides to you. • REVENUE FROM ANCILLARY SERVICES TO NATIONAL GRID National Grid has an obligation to maintain system frequency at 50Hz. Your battery energy storage system can provide a balancing service to National Grid called FIRM FREQUENCY RESPONSE (FFR). • REVENUE FROM CAPACITY MARKET The Distribution Network Operators have a constant need to balance supply and demand on the network. Your battery energy storage system can generate a revenue by providing power to the grid on demand – called DEMAND RESPONSE. • REVENUE FOR EXPORTING ELECTRICITY You battery energy storage system can earn per kWh exported through your POWER PURCHASE AGREEMENT (PPA) and the GENERATOR DISTRIBUTION USE OF SYSTEM (GDUOS) paid by the Distribution Network Operator. Our Address Unit 5, Buckholt Business Centre, Buckholt Drive, Worcester. WR4 9ND. ENQUIRE This email address is being protected from spambots. You need JavaScript enabled to view it.0330 223 4566
2024-02-20T01:26:58.646260
https://example.com/article/7794
How To Stop Dog Chewing: Part 2 Will This Dog Chewing Ever Stop? If you've jumped ahead to this page because you want to know how to stop dog chewing you are getting ahead of yourself. Please at least skim through the information in Part 1 about why your dog is chewing as it is vitally important even though some of the solutions may be common to different reasons. So, to answer the question, "will my dog ever stop chewing?," the answer is—no. Once teething is over they may slow down somewhat, but dogs love to chew and getting them to stop completely is futile. As you find ways to diminish the need to chew as much, discourage them from chewing inappropriate things and redirecting them to things they are allowed to chew you will eventually be successful. It takes time and patience. There will be slip-ups. It's also important to not react angrily and scold your dog after-the-fact. Using a stern voice if you catch them in the act is one thing, but scolding them half an hour (or even five minutes) after they've chewed your shoes is worse than pointless. It may result in the opposite effect and even cause new behavioral problems to develop. Practical Ways You Can Stop Your Dog From Chewing One of the key ways to stop your dog from chewing inappropriate things is to redirect them to things you want them to chew. There are a few solutions to help stop dog chewing and when used together will be most effective. As mentioned above it is a good idea the minimize the inappropriate things laying around or within reach of your dog to chew on. The next level is to discourage your dog from chewing on the things you don't want them to. While it's great to be vigilant and stop them before they start or right in the act and then trade them for an appropriate chew toy or treat it's not possible to watch them every second. That's where special sprays with a bad taste can be used. You just spray them on whatever it is you don't want your dog chewing. There are several commercial versions of dog chewing deterrent sprays available like Grannick's Bitter Apple. Some have tried hot spices like Tabasco sauce with varying degrees of success. However, these can wear off and need to be reapplied occasionally. While you are training your dog about what not to chew you also want to show them what you want them to chew instead. It's a good idea to have a variety of chew toys with different shapes and textures. For example, nylabones and Kongs. These are quit durable and some can be filled with yummy things like cheese or peanut butter to make them all the more attractive. You can also keep bully sticks on hand for a change. While you might not mind if your dog chews on your old shoes, it's a bad idea to let them. It just makes things confusing and that much more difficult for your dog to differentiate between what is and what is not okay to chew on. Besides, there are a lot of harmful things on shoes that can damage your dog's teeth or be swallowed. To help with the pain of teething a good approach is to fill things like a Kong with soup and freezing them. Another alternative is to moisten a cloth and freeze it. Chewing on cold things like this can really help reduce the discomfort from teething. Go, And Chew No More—No Bad Stuff Anyway So, I hope some of these ideas of how to stop dog chewing will help. Just remember to first find out why your dog is chewing things and then take positive steps to guide them to more appropriate behavior. Confirm with your vet that there isn't a medical cause before you just focus on behavioral issues. I know it's hard to stay positive when you come home and your living room is trashed, the legs of your dining room table have been gnawed down to nubs or your last pair of shoes have been shredded (and you're looking at having to wear flip-flops to work tomorrow), but with a bit of dissuasion, redirection, consistency and love, you'll train your Aussie to know what they can and definitely cannot chew on.
2024-06-26T01:26:58.646260
https://example.com/article/7024
Oxalate toxicity in renal cells. Exposure to oxalate, a constituent of the most common form of kidney stones, generates toxic responses in renal epithelial cells, including altered membrane surface properties and cellular lipids, changes in gene expression, disruption of mitochondrial function, formation of reactive oxygen species and decreased cell viability. Oxalate exposure activates phospholipase A2 (PLA2), which increases two lipid signaling molecules, arachidonic acid and lysophosphatidylcholine (Lyso-PC). PLA2 inhibition blocks, whereas exogenous Lyso-PC or arachidonic acid reproduce many of the effects of oxalate on mitochondrial function, gene expression and cell viability, suggesting that PLA2 activation plays a role in mediating oxalate toxicity. Oxalate exposure also elicits potentially adaptive or protective changes that increase expression of proteins that may prevent crystal formation or attachment. Additional adaptive responses may facilitate removal and replacement of dead or damaged cells. The presence of different inflammatory cells and molecules in the kidneys of rats with hyperoxaluria and in stone patients suggests that inflammatory responses play roles in stone disease. Renal epithelial cells can synthesize a variety of cytokines, chemoattractants and other molecules with the potential to interface with inflammatory cells; moreover, oxalate exposure increases the synthesis of these molecules. The present studies demonstrate that oxalate exposure upregulates cyclooxygenase-2, which catalyzes the rate-limiting step in the synthesis of prostanoids, compounds derived from arachidonic acid that can modify crystal binding and may also influence inflammation. In addition, renal cell oxalate exposure promotes rapid degradation of IkappaBalpha, an endogenous inhibitor of the NF-kappaB transcription factor. A similar response is observed following renal cell exposure to lipopolysaccharide (LPS), a bacterial cell wall component that activates toll-like receptor 4 (TLR4). While TLRs are primarily associated with immune cells, they are also found on many other cell types, including renal epithelial cells, suggesting that TLR signaling could directly impact renal function. Prior exposure of renal epithelial cells to oxalate in vitro produces endotoxin tolerance, i.e. a loss of responsiveness to LPS and conversely, prior exposure to LPS elicits a similar heterologous desensitization to oxalate. Renal cell desensitization to oxalate stimulation may have profound effects on the outcome of renal stone disease by impairing protective responses.
2024-01-17T01:26:58.646260
https://example.com/article/2082
Today came the release of our first look into the live-action Fullmetal Alchemist trailer. Now not to point out how terrible the live-action Attack on Titan movie was, I am going to be pretty skeptical about how this movie will turn out. That being said, you can decide for yourself after watching the trailer below: The teaser shows actor Ryōsuke Yamada dressed up as the famous main character Edward Elric and tells us to expect the film in the winter of 2017. So hype or not, expect to see more about this movie in the upcoming months. Below is the official announcement from the Fullmetal Alchemist twitter account.
2023-11-19T01:26:58.646260
https://example.com/article/7311
Henry Fillmore is best known for his outpouring of successful marches. This becomes even more impressive when one realizes that he also wrote under eight names. He is also known as the 'father of the Trombone smear' because of the wide acceptance of LASSUS TROMBONE and fourteen other compositions of this nature. Larry Clark greatly reduces any technical difficulties, leaving intact the great glissando effects that your audiences (and your trombone players) will love! (2:33)Series: Belwin Young BandLevel: 2 (Easy) Related Product Components $3.95 1st B-flat Clarinet $3.95 1st B-flat Trumpet $3.95 1st F Horn $3.95 1st Percussion $3.95 2nd B-flat Clarinet $3.95 2nd B-flat Trumpet $3.95 2nd Percussion $3.95 B-flat Bass Clarinet $3.95 B-flat Tenor Saxophone $3.95 Baritone B.C. $3.95 Baritone T.C. $3.95 Bassoon $3.95 E-flat Alto Saxophone $3.95 E-flat Baritone Saxophone $3.95 Flute $3.95 Mallets $3.95 Oboe $7.00 Score $3.95 Timpani $3.95 Tuba After checking the boxes of the parts desired, click the "Print Now" button at the top of this page. Part quantities may then be edited.
2024-06-28T01:26:58.646260
https://example.com/article/7802
Effects of laminar shear stress on IL-8 mRNA expression in endothelial cells. In order to demonstrate that IL-8 mRNA expression in endothelial cells is not only regulated by chemical factors, but also by mechanical factors, in this article, after pretreating cultured human umbilical vein endothelial cells (HUVECs) with shear stress for different time, we employed both RT-PCR to assay IL-8 mRNA expression and immunocytochemical staining to detect NF-kappaB activation in HUVECs. We found that: (i) IL-8 mRNA expressed little in HUVECs untreated or pretreated with low laminar shear stress for 0.5 hour; IL-8 mRNA expression was increased when HUVECs were pretreated with low laminar shear stress for 1 hour, and increased further when pretreated for 2 hours; (ii) the immunoreactivity of NF-kappaB p65 in the nuclei of HUVECs untreated or pretreated with low laminar shear stress for 0.5 hour was negative, while it became weak positive in the nuclei of HUVECs pretreated with shear stress for 1 hour and positive in the nuclei of HUVECs pretreated for 2 hours. The results imply that low laminar shear stress was capable of inducing IL-8 gene expression and activating NF-kappaB, which were both time-dependent. The induction of IL-8 gene expression by laminar shear stress is probably due to the activation of NF-kappaB. We suggest that IL-8 mRNA expression in endothelial cells induced by low shear stress may play a key role in the pathogenesis and development of both inflammation and arterioatherosclerosis.
2024-04-27T01:26:58.646260
https://example.com/article/6512
[Logistic model in diagnosis of lung cancer]. Specificity of the diagnosis of lung cancer (l.c.) based upon clinical and radiological criteria was investigated in patients who died in Hospital of Lung Diseases in Lódź between in 1985 and 1989. Autopsy revealed diagnostic errors in 37% cases. Twenty most common disease features were taken into consideration. Logistic analysis helped to create clinical-mathematical model which allows for interpretation of disease features in two distinct categories: l.c. (non-neoplasmatic lung disease). Eight features proved to be significant (changes in RBC, weight loss, chest pain, increased sputum production, haemoptisis, hilar tumor, pleural effusion, peripheral round shadow on chest X-ray). Diagnostic usefulness of the model was checked in prospective study a group of patients who died from properly diagnosed l.c. (499 cases). Our model allowed for proper diagnosis of neoplasmatic cause of the disease with higher probability than morphological methods (including both intravital and autopsy examination).
2023-08-29T01:26:58.646260
https://example.com/article/8099
Support A cookie is a piece of data stored by your browser or device that helps websites like this one recognize return visitors. We use cookies to give you the best experience on BNA.com. Some cookies are also necessary for the technical operation of our website. If you continue browsing, you agree to this site’s use of cookies. Marketing Services Bloomberg Next marketing services allow clients to elevate their brands and extend their reach through our established and trusted expertise, enhanced with engaging event production, appealing design, and compelling messaging. The Trump administration appealed a World Trade Organization ruling that found the U.S. government maintained a series of illegal subsidies to the Boeing Co. for the production of its 737MAX aircraft. The U.S. contested the WTO’s June 9 compliance decision that said a $325 million dollar Washington state tax cut for Boeing disadvantaged its European competitor—Airbus Group SE—in violation of international trade rules. The appeal marks the latest stage of a decades-long aircraft dispute between the U.S. and the European Union that followed the dissolution of their 1992 bilateral agreement on trade in large civilian aircraft. Three WTO appellate body judges will now evaluate the merits of the U.S. appeal and attempt to issue a ruling by Nov. 8, although that date may be extended due to a series of delays and staffing shortages. Challenges WTO Methodology In a WTO filing published Sept. 18, the U.S. said the panel erred in its interpretation of various WTO agreements and failed to make an objective assessment of the mater in issuing its ruling. The U.S. contested 10 aspects of the ruling including the scope, calculations, and methodologies applied in the June 9 ruling. Among the Trump administration’s complaints about the ruling, the U.S. said the appellate body: did not have authority to evaluate procurement contracts between Boeing and the U.S. Department of Defense; incorrectly calculated the approximate rate of subsidization stemming from the Washington state tax cuts; did not objectively assess the price differences between Boeing and Airbus’s various sales campaigns; and inaccurately determined that the Washington state tax cuts resulted in genuine and substantial loses to Airbus sales in various countries. The U.S. filed the appellate request on Aug. 10, but the WTO did not publish it until Sept. 18. Mixed Ruling The Sept. 18 filing makes good on U.S. Trade Representative Robert Lighthizer’s prior threat to appeal the WTO ruling despite the fact that it generally favored the U.S. The June 9 compliance ruling rejected the EU’s allegations that dozens of state and federal programs provided Boeing with billions of dollars in illegal U.S. subsidies. The compliance panel, however, did side with the EU’s argument that Washington state did not end a business and occupancy tax reduction for Boeing’s production of 152 737MAX aircraft to companies in Canada, Iceland, and the United Arab Emirates. Following the ruling, Lighthizer claimed victory in the case and urged the EU to forge a negotiated settlement to remove all WTO-inconsistent subsidies. EU Appeal Pending The EU appealed the compliance ruling on June 29 and claimed the WTO erred when it declared billions of state and federal subsidies for Boeing complied with international trade rules. The WTO appellate body is reviewing the merits of the EU’s appeal and is slated to issue a ruling before the end of the month, although the ruling could undergo delays. The U.S. and the EU agreed in 2012 that, in the case of an appeal, they would “enable the appellate body to circulate its report to the members within 90 days from the date of notification of the appeal to the DSB.“ This past summer the seven-member WTO appellate body lost two of its panelists and many cases have undergone delays because of the complexity of the proceedings under review. All Bloomberg BNA treatises are available on standing order, which ensures you will always receive the most current edition of the book or supplement of the title you have ordered from Bloomberg BNA’s book division. As soon as a new supplement or edition is published (usually annually) for a title you’ve previously purchased and requested to be placed on standing order, we’ll ship it to you to review for 30 days without any obligation. During this period, you can either (a) honor the invoice and receive a 5% discount (in addition to any other discounts you may qualify for) off the then-current price of the update, plus shipping and handling or (b) return the book(s), in which case, your invoice will be cancelled upon receipt of the book(s). Call us for a prepaid UPS label for your return. It’s as simple and easy as that. Most importantly, standing orders mean you will never have to worry about the timeliness of the information you’re relying on. And, you may discontinue standing orders at any time by contacting us at 1.800.960.1220 or by sending an email to books@bna.com. Put me on standing order at a 5% discount off list price of all future updates, in addition to any other discounts I may quality for. (Returnable within 30 days.) Notify me when updates are available (No standing order will be created). This Bloomberg BNA report is available on standing order, which ensures you will all receive the latest edition. This report is updated annually and we will send you the latest edition once it has been published. By signing up for standing order you will never have to worry about the timeliness of the information you need. And, you may discontinue standing orders at any time by contacting us at 1.800.372.1033, option 5, or by sending us an email to research@bna.com. Put me on standing order Notify me when new releases are available (no standing order will be created)
2023-08-13T01:26:58.646260
https://example.com/article/7754
<snippet> <prefix>cvsCtx-lineJoin</prefix> <description><![CDATA[设置线条的交点样式。基础库 1.9.90 起支持]]></description> <body><![CDATA[ cvsCtx.lineJoin = '${1:bevel}'; ]]></body> </snippet>
2023-10-27T01:26:58.646260
https://example.com/article/3681
With the development of touch panel, the demand of thin and rigid cover glass for the touch panel has been increasing. The traditional computer numerical control (CNC) tool is inapplicable for machining the thin and rigid cover glass. The laser processing is capable of machining without contacting the workpiece so that it is applicable for machining the thin and rigid cover glass. Thus, the CNC processing is gradually replaced with the laser processing in the manufacture of the touch panel.
2024-06-01T01:26:58.646260
https://example.com/article/8306
1. Introduction {#sec1-molecules-25-01786} =============== Globally, cardiovascular diseases (CVDs) remain the leading cause of mortality and morbidity \[[@B1-molecules-25-01786]\]. Although advances have been made in cardiovascular research, CVDs are still responsible for 31% of all deaths worldwide \[[@B2-molecules-25-01786]\]. In general, cardiac diseases are viewed as a chain of events known as the CVD continuum, which if untreated, eventually leads to heart failure (HF) and sudden death \[[@B3-molecules-25-01786],[@B4-molecules-25-01786]\]. Currently, more than 26 million patients have been diagnosed with HF \[[@B5-molecules-25-01786]\]. The prognosis for patients with HF remains poor with 50% of patients dying within five years of diagnosis \[[@B6-molecules-25-01786]\]. Cardiac hypertrophy, a thickening of the heart wall in response to increased cardiac stress, occurs early on in the CVD continuum and is considered as a compensatory response that permits normal cardiovascular function at rest \[[@B7-molecules-25-01786],[@B8-molecules-25-01786]\]. However, prolonged hypertrophy is now recognized as a credible surrogate endpoint of HF and a major risk factor for heart disease, including coronary artery disease (CAD), arrhythmia, and hypertension \[[@B9-molecules-25-01786]\]. Therefore, studying cardiac hypertrophy is important to identify new therapeutic options that could prevent and/or treat CVDs in the early stages. Cymbopogon, a genus of plants with many species known for their high essential oil content, are widely distributed throughout the tropical and subtropical regions of Asia, Africa, and America \[[@B10-molecules-25-01786]\]. The use of *Cymbopogon* species in traditional medicine is well documented. Several illnesses, such as coughs, fever, infections, cancer, and digestive disorders, have reportedly been treated using various species of *Cymbopogon* worldwide \[[@B10-molecules-25-01786],[@B11-molecules-25-01786]\]. Moreover, in vivo and in vitro studies have revealed beneficial pharmacological effects of *Cymbopogon* spp., including anticancer, cardioprotective, anti-inflammatory, antioxidant, antidiabetic, anticholinesterase, antibacterial, and antifungal properties \[[@B12-molecules-25-01786],[@B13-molecules-25-01786],[@B14-molecules-25-01786],[@B15-molecules-25-01786],[@B16-molecules-25-01786],[@B17-molecules-25-01786],[@B18-molecules-25-01786]\]. One species of interest is *C. proximus* (common names: Halfabar or Maharaib), a strongly aromatic common grass widely distributed in parts of Southern Egypt and Northern Sudan. *C. proximus* has been used for several decades by the inhabitants of these regions as a diuretic and antispasmodic agent due to its potent ability to induce smooth-muscle relaxation \[[@B19-molecules-25-01786]\]. *C. proximus* reportedly possesses many biological properties, including hypoglycemic, antipyretic, bronchodilation, antibacterial, anticonvulsant, and antiemetic activities \[[@B15-molecules-25-01786],[@B20-molecules-25-01786],[@B21-molecules-25-01786],[@B22-molecules-25-01786],[@B23-molecules-25-01786]\]. Interestingly, *C. proximus* has been shown to exhibit a hypotensive effect in normotensive rats and protect against nitro-L-arginine methyl ester (L-NAME)-induced hypertension \[[@B23-molecules-25-01786],[@B24-molecules-25-01786]\]. At the cellular level, extracts of *C. proximus* have been shown to have antioxidant, anti-inflammatory, and antiapoptotic properties \[[@B20-molecules-25-01786],[@B22-molecules-25-01786]\]. These findings indicate that *C. proximus* may be a potential protective agent against cardiac diseases. To the best of our knowledge, no research has evaluated the effect of *C. proximus* against cardiac remodeling with a focus on myocardial hypertrophy and fibrosis. We hypothesized that *C. proximus* essential oil would confer cardioprotection against isoproterenol-induced cardiac hypertrophy and fibrosis. The findings from this research may provide the first evidence for the potential use of *C. proximus* as a modulator of cardiac remodeling. This is especially important with the current need to identify new alternative medicines that are natural and safe. 2. Results {#sec2-molecules-25-01786} ========== 2.1. Gas Chromatography--Mass Spectrometry (GC-MS) Analysis {#sec2dot1-molecules-25-01786} ----------------------------------------------------------- Analysis of the *C. proximus* essential oil by GC-MS identified forty different chemical constituents, which represented 93.27% of the total oil extract. The main components included elemol (23.54%), piperitone (19.86%), α-eudesmol (7.63%), and β-eudesmol (11.35%), which together comprised 62.38% of the oil. A complete listing of the GC-MS results is shown in [Table 1](#molecules-25-01786-t001){ref-type="table"}. 2.2. Effect of *C. Proximus* Oil and/or Isoproterenol on Body and Heart Weights {#sec2dot2-molecules-25-01786} ------------------------------------------------------------------------------- Isoproterenol treatment caused a significant increase of 23% in the ratio of heart weight to body weight (HW/BW) compared with that of the control group (*p* \< 0.001). On the other hand, rats pretreated with *C. proximus* oil displayed a 69% reduction in the isoproterenol-mediated increase of HW/BW compared with that of the isoproterenol group (*p* = 0.017). Furthermore, no significant difference in HW/BW was found between the control group and the group treated with *C. proximus* oil alone ([Figure 1](#molecules-25-01786-f001){ref-type="fig"}). 2.3. Effect of *C. Proximus* Oil and/or Isoproterenol on Hypertrophy Markers {#sec2dot3-molecules-25-01786} ---------------------------------------------------------------------------- In addition to increased heart mass, pathological cardiac hypertrophy is characterized by the activation of the fetal gene program, thereby changing the expression of different genes including ANP, BNP, and β-MHC. Thus, the expression of these genes is one of the most consistent markers of pathological cardiac hypertrophy \[[@B25-molecules-25-01786],[@B26-molecules-25-01786],[@B27-molecules-25-01786]\]. To investigate whether *C. proximus* oil and/or isoproterenol treatment altered the expression level of hypertrophy markers, we measured cardiac expression of ANP, BNP, and β-MHC. Isoproterenol alone caused significant induction of ANP, BNP and β-MHC expression with mRNA levels increasing 52-fold (*p* \< 0.001), 12.5-fold (*p* \< 0.001), and 0.7-fold (*p* = 0.02), respectively ([Figure 2](#molecules-25-01786-f002){ref-type="fig"}). However, relative to those in isoproterenol-treated rats, pretreatment with *C. proximus* oil significantly decreased the isoproterenol-mediated induction of ANP, BNP and β-MHC by 73% (*p* = 0.004), 59% (*p* = 0.007), and 91% (*p* = 0.024), respectively ([Figure 2](#molecules-25-01786-f002){ref-type="fig"}). 2.4. Effect of *C. Proximus* Oil and/or Isoproterenol on Myocardial Architecture {#sec2dot4-molecules-25-01786} -------------------------------------------------------------------------------- Histopathological examination of cardiac tissue sections from the control group revealed typical cell distribution and normal myocardium architecture, demonstrating variable fiber diameters and central positions of the nuclei. However, examination of cardiac tissue sections from isoproterenol- treated rats revealed moderate cardiomyocyte degeneration, necrosis, pyknosis, and a 71% increase in cross-sectional area of cardiac myocytes cells compared to that of the control group (*p* \< 0.001). Pretreatment with *C. proximus* oil resulted in a less severe necrosis and a 33% decrease in cross-sectional area of cardiac myocytes compared to that of the isoproterenol group (*p* = 0.005; [Figure 3](#molecules-25-01786-f003){ref-type="fig"}). However, the pretreatment with *C. proximus* oil did not restore this response to the control levels (*p* \< 0.001). 2.5. Effect of *C. Proximus* Oil and/or Isoproterenol on Myocardial Fibrosis {#sec2dot5-molecules-25-01786} ---------------------------------------------------------------------------- To assess the degree of myocardial fibrosis in response to *C. proximus* oil and/or isoproterenol, heart sections were stained with Masson's trichrome and the percentages of fibrotic tissue in the images were determined using ImageJ software. Collagen volume fraction (CVF) values in the isoproterenol-treated group increased 242% compared with that in the control group *(p* \< 0.001). However, the pretreatment with *C. proximus* oil significantly reduced the elevated CVF levels induced by isoproterenol by 66% (*p* = 0.006) ([Figure 4](#molecules-25-01786-f004){ref-type="fig"}). 2.6. Effect of *C. Proximus* Oil and/or Isoproterenol on the Level of Fibrosis Markers {#sec2dot6-molecules-25-01786} -------------------------------------------------------------------------------------- To further assess the extent of changes in myocardial fibrosis mediated by *C. proximus* oil and/or isoproterenol, we measured mRNA levels of fibrotic markers Pro I and Pro III. Isoproterenol treatment resulted in significant induction of Pro I and Pro III expression with 17.8-fold (*p* \< 0.001) and 17.9-fold increases (*p* = 0.004), respectively. However, these increases of Pro I and Pro III mRNA levels were significantly reduced by 80% (*p* \< 0.001) and 77% (*p* = 0.004), respectively, when the rats were pretreated with *C. proximus* oil ([Figure 5](#molecules-25-01786-f005){ref-type="fig"}). 3. Discussion {#sec3-molecules-25-01786} ============= The results of the present study provide the first evidence that *C. proximus* may confer cardioprotection against cardiac remodeling. Despite advances made in cardiovascular research over the last decades, therapeutic options available for the treatment for HF are limited to agents that either delay disease progression such as β-blockers or only control symptoms such as diuretics \[[@B28-molecules-25-01786]\]. Hence, there is an urgent need to identify new therapeutic agents that either prevent the initiation of HF in high risk patients or regress cardiac hypertrophy during its progression \[[@B29-molecules-25-01786]\]. Over the years, plants have been highly valued around the world as a rich source of therapeutic agents for the treatment and prevention of numerous diseases and illnesses. It is estimated that 80% of cardiovascular drugs are derived from plant origins \[[@B30-molecules-25-01786],[@B31-molecules-25-01786]\]. However, to the best of our knowledge, there has been no research conducted to investigate the cardioprotective effect of *C. proximus* against cardiac remodeling. Therefore, the current study was performed to examine the capacity of *C. proximus* to protect rats from isoproterenol-induced cardiac hypertrophy and fibrosis. Our study revealed cardioprotective effects of *C. proximus* against isoproterenol-induced cardiac hypertrophy and fibrosis. These findings are evidenced by the prevention of increased HW/BW ratios caused by the administration of isoproterenol to rats pretreated with *C. proximus* oil, which maintained ratios close to those of the control group. In addition, *C. proximus* precluded elevated levels of hypertrophy markers caused by isoproterenol treatment as demonstrated through significant reduction in mRNA levels of ANP, BNP, and β-MHC. Moreover, isoproterenol treatment caused deterioration in cardiomyocyte architecture and increased cell surface area. However, *C. proximus* attenuated these observed effects when administrated prior to the administration of isoproterenol. Histological analysis revealed that isoproterenol treatment induced fibrosis by increasing collagen deposition in the heart. The induction of CVF by isoproterenol was significantly prevented in the group of animals pretreated with *C. proximus* oil, which indicated *C. proximus* had the ability to protect the heart from myocardial fibrosis, a hallmark of cardiac remodeling. Furthermore, isoproterenol-induced elevated mRNA levels of fibrosis markers, including Pro I and Pro III, were significantly reversed by pretreatment with *C. proximus* oil. The dose of *C. proximus* used in our study was chosen based on the study of El Tahir et al. \[[@B24-molecules-25-01786]\]. In their study, *C. proximus* oil causes significant changes in the heart rate only after the administration of the oil at a higher dose (1600 µL/kg). However, 800 µL/kg did not cause significant changes in the heart rate \[[@B24-molecules-25-01786]\]. Therefore, it is unlikely that the effects observed in our study are due to heart rate changes. In addition, *C. proximus* has been shown to exhibit a hypotensive effect in normotensive rats and protect against (L-NAME)-induced hypertension \[[@B23-molecules-25-01786],[@B24-molecules-25-01786]\]. However, it is evident that repeated administration of small doses of isoproterenol to animals causes cardiac hypertrophy and fibrosis without changing the blood pressure \[[@B32-molecules-25-01786],[@B33-molecules-25-01786],[@B34-molecules-25-01786]\]. Thus, it is highly unlikely that *C. proximus* acted as an antihypertensive agent in the absence of hypertensive stimuli in our study. Interestingly, several species of *Cymbopogon* are reported to possess cardiovascular benefiting properties. For instance, extracts of *C. citratus* have been shown to protect against isoproterenol-induced cardiotoxicity \[[@B35-molecules-25-01786]\]. Moreover, extracts from *C. citratus* and *C. winterianus* are shown to reduce blood pressure by modulating the calcium pathway and decreasing heart rate by activating cardiac muscarinic receptors \[[@B36-molecules-25-01786],[@B37-molecules-25-01786]\]. Also, *C. citratus* and *C. jwarancusa* extracts are reported to possess antioxidant, antidiabetic, and hypolipidemic properties and protect against endothelial dysfunction \[[@B10-molecules-25-01786],[@B11-molecules-25-01786],[@B12-molecules-25-01786],[@B17-molecules-25-01786],[@B18-molecules-25-01786],[@B21-molecules-25-01786]\]. Of specific interest, *C. proximus* extracts are reported to possess profound antioxidant effects and are able to decrease blood pressure in both normotensive and hypertensive rats \[[@B21-molecules-25-01786],[@B23-molecules-25-01786],[@B24-molecules-25-01786]\]. Although the chemical compositions of these Cymbopogon species vary, they share some components. For instance, the essential oils of *C. proximus* and *C. jwarancusa* contain a considerable amount of piperitone, carene, β-caryophyllane, and elemol. *Cymbopogon citratus* and *C. winterianus* contain high amounts of geraniol, geranial, and cadinol isomers. Considerable amounts of elemol and limonene have also been reported in both *C. proximus* and *C. winterianus* \[[@B11-molecules-25-01786],[@B38-molecules-25-01786],[@B39-molecules-25-01786],[@B40-molecules-25-01786]\]. Our present findings, along with the results of previous studies, highlight the potential protective effects of Cymbopogon species against CVDs. Several molecular responses and molecules are well documented to play pivotal roles in the development of cardiac dysfunction and hypertrophy. These include, but are not limited to, inflammatory cytokines, matrix metalloproteinase, oxidative stress, and apoptosis \[[@B41-molecules-25-01786],[@B42-molecules-25-01786]\]. Based on results obtained from GC-MS analysis, the crude *C. proximus* essential oil was comprised of various components that ranged in volume from 0.105% to 23.54%. These findings are consistent with an analysis previously reported \[[@B24-molecules-25-01786]\]. Interestingly, some of the components identified are reported to exhibit various effects on the aforementioned signaling molecules of cardiac hypertrophy. For instance, thymol is reported to protect the heart against isoproterenol-induced myocardial infarction and cardiac hypertrophy via anti-apoptotic effect \[[@B43-molecules-25-01786]\]. In addition, elemol, β-elemene, terpinolene, β- caryophyllene, and thymol, which represented more than 33% of the total essential oil, are known to suppress several pro-inflammatory cytokines, including TNF-α, IL-1β, and IL-6 \[[@B44-molecules-25-01786],[@B45-molecules-25-01786],[@B46-molecules-25-01786],[@B47-molecules-25-01786],[@B48-molecules-25-01786]\]. In addition, production of pro-inflammatory cytokines IL-4, IL-8, and IL-12 was inhibited by elemol, thymol, and β-elemene, respectively \[[@B49-molecules-25-01786],[@B50-molecules-25-01786],[@B51-molecules-25-01786]\]. Moreover, β-caryophyllene decreased the production of matrix metalloproteinases MMP-3 and MMP-9 and the pro-apoptotic markers Bax, p53, and active caspase-3 \[[@B45-molecules-25-01786],[@B52-molecules-25-01786],[@B53-molecules-25-01786]\]. In addition, the major *C. proximus* essential oil extract constituents α-eudesmol and β-eudesmol protect cells from apoptosis by increasing levels of antioxidant enzymes. These pathways counteract the effects of free radicals by decreasing NADPH oxidase and the production of superoxide \[[@B54-molecules-25-01786],[@B55-molecules-25-01786]\]. Modulations of these pathways using genetic approaches and/or pharmacological interventions are shown to be protective against cardiac dysfunction \[[@B41-molecules-25-01786],[@B42-molecules-25-01786]\]. These findings suggest a possible mechanism by which *C. proximus* and its constituents may have produced the protective effects reported in our current study. Identifying the major active constituents of *C. proximus* essential oil, along with the potential mechanisms responsible for the protective effect, requires additional investigation. 4. Materials and Methods {#sec4-molecules-25-01786} ======================== 4.1. Chemicals and Reagents {#sec4dot1-molecules-25-01786} --------------------------- Isoproterenol was obtained from Sigma-Aldrich (St. Louis, MO, USA) and TRIzol reagent was purchased from Invitrogen Co. (Grand Island, NY, USA). The High-Capacity cDNA Reverse Transcription Kit (Catalog\# 4368814) and SYBR^®^ Green PCR Master Mix (Catalog\# 4309155) were purchased from Applied Biosystems (Foster City, CA, USA). Hematoxylin and eosin (H&E) and Masson's trichrome staining kits were purchased from Nanjing SenBeiJia Biological Technology Co., Ltd. (Nanjing, China). Real-time polymerase chain reaction (PCR) primers were designed by members of our laboratory and synthesized by Integrated DNA Technologies Incorporation (San Diego, CA, USA). The primer sequences are shown in [Table 2](#molecules-25-01786-t002){ref-type="table"}. 4.2. Plant Material {#sec4dot2-molecules-25-01786} ------------------- *C. Proximus* (Hochst. ex A. Rich.) Stapf, family *Poaceae* was purchased from a local market in Alexandria, Egypt. The identity of the plant material was confirmed by Prof Saniya Kamal at the Department of Botany, College of Science, Alexandria University, Alexandria, Egypt. 4.3. Preparation of *C. Proximus* Oil {#sec4dot3-molecules-25-01786} ------------------------------------- Essential oil was prepared from dry powdered *C. proximus* plant material (250 gm) using a hydrodistillation method for a period of 5 h \[[@B56-molecules-25-01786]\]. The essential oil was separated and dried over anhydrous sodium sulphate, which yielded a 5.4% *w*/*w* final product. 4.4. GC/MS Analysis {#sec4dot4-molecules-25-01786} ------------------- GC/MS analysis was carried out using an Agilent 7890 Gas Chromatograph (Agilent, Santa Clara, CA, USA) with an MSD System equipped with a HP-5MS capillary column (30 m × 0.25 mm i.d., 0.25 μm coating). Aliquots (1 mL) of *C. Proximus* oil diluted to a concentration of 5 parts per million (ppm) were then injected into the GC/MS autosampler using the split-less mode. The column temperature was maintained at 70 °C for 5 min and programmed to then increase at a rate of 5 °C/min to 290 °C, which was isothermally held for 5 min. The detector and injector temperatures were 290 °C and 280 °C, respectively. The carrier gas was helium (99.999% purity) at a flow rate of 1.0 mL/min. The significant quadrupole mass analyzer (QMS) operating parameters included electrospray ionization at 70 eV with a scan mass range of 30 to 600 *m*/*z*. The *C. proximus* oil components were identified by comparing their mass spectra with the National Institute of Standards and Technology (NIST 2017) database. The analysis and processing of the results were controlled using MassHunter software (Agilent Technologies Inc., Santa Clara, CA, USA). The identity of peaks was verified by comparing their mass spectra against commercially available libraries (Wiley GC/MS Library, MassFinder 3 Library) as previously described \[[@B57-molecules-25-01786],[@B58-molecules-25-01786]\]. 4.5. Gas Chromatography (GC) Analysis {#sec4dot5-molecules-25-01786} ------------------------------------- GC spectra obtained under the conditions described above were used to identify each peak by comparing their respective relative retention index (RRI) to a series of n-alkanes. The quantity of each compound was estimated based on computerized peak area measurements. 4.6. Animals {#sec4dot6-molecules-25-01786} ------------ The study complied with the Law of Ethics of Research on Living Creatures published by the National Committee of BioEthics (NCBE), Saudi Arabia and the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 8023, revised 1978). All experimental procedures involving animals were approved by the Bioethics Committee, Prince Sattam Bin Abdulaziz University (No. 201902003). Male albino rats weighing 200--250 g were obtained from the Lab Animal Care Unit, Pharmacy College, Prince Sattam Bin Abdulaziz University (Al-Kharj, KSA). All animals were housed on a 12-h light/dark cycle with food and water available ad libitum. 4.7. Experimental Design and Treatment Protocol {#sec4dot7-molecules-25-01786} ----------------------------------------------- Male albino rats were randomly divided into four groups (6 rats/group). The first group received a daily intraperitoneal (IP) injection of vehicle (saline + olive oil). The second group received a daily IP injection of *C. proximus* oil (800 µL/kg/d) with the dose being based on a previous report \[[@B24-molecules-25-01786]\]. The third group received a daily IP injection of isoproterenol (5 mg/kg/d). The fourth group received a daily IP injection of both isoproterenol (5 mg/kg/d) and *C. proximus* oil (800 µL/kg/d). The administration of oil was started four days prior to the isoproterenol administration and continued concurrently thereafter for an additional 3 d. The dose and period of isoproterenol administration were selected based on our previous study \[[@B8-molecules-25-01786]\]. All animal groups were euthanized 24 h after the last dose of treatment. Hearts were quickly excised, washed with saline, blotted with filter paper, and measured, followed by immediately being frozen in liquid nitrogen. The hearts were stored at −80°C until further analysis. 4.8. Histological Examination {#sec4dot8-molecules-25-01786} ----------------------------- For histological examinations, heart cross-sections were immediately collected after sacrificing the animals and fixed in 4% formalin at room temperature. The tissues were embedded with paraffin and cut into 3-μm thick sections. The tissue sections were then deparaffinized with xylene and rehydrated with graded ethanol prior to histological staining. For structural analysis, hear tissue sections were stained with H&E using a standard protocol. Images were obtained using a Leica SCN400 Slide Scanner (Leica Biosystems, Wetzlar, Germany) at 200 × magnification. The images were then analyzed using Leica SCN400 Image Viewer software. Random microscopic fields of sections from each animal were selected for analysis. Cell surface area (CSA) of randomly selected cardiomyocytes (10--15 per section) was measured using ImageJ software (National Institute of Health, Bethesda, MD, USA). To visualize and measure collagen deposits, heart tissue sections were stained with Masson's trichrome according to standard methods. Fibrous tissue stained blue, cytoplasm red, and the cell nuclei black. Cardiac fibrosis was visualized at 200 × magnification using the Leica SCN400 Slide Scanner and the images analyzed using the Leica SCN400 Image Viewer software. CVF was quantified by calculating the area percentage of collagen staining using ImageJ software. 4.9. RNA Extraction and Complementary DNA (cDNA) Synthesis {#sec4dot9-molecules-25-01786} ---------------------------------------------------------- Total RNA was isolated from the frozen tissues using TRIzol reagent according to the manufacturer's instructions and quantified by measuring absorbance at 260 nm using a Genova Nano micro-volume spectrophotometer (Jenway^®^, Staffordshire, UK). Purity of the RNA was determined according to 260/280 absorbance ratios (\>1.8). First strand cDNA was synthesized using a High- Capacity cDNA Reverse Transcription Kit, according to the manufacturer provided instructions. Briefly, 1.5 µg of total RNA from each sample was added to a mixture of 2.0 µL 10× reverse transcriptase buffer, 0.8 µL 25× dNTP mix (100 mM each), 2.0 µL 10× reverse transcriptase random primers, 1.0 µL MultiScribe reverse transcriptase, and 4.2 µL nuclease-free water. The final reaction mixture was maintained at 25 °C for 10 min, heated to 37 °C for 120 min, heated to 85 °C for 5 min, and finally cooled to 4 °C. 4.10. Quantification of mRNA Expression by Quantitative Real-Time PCR {#sec4dot10-molecules-25-01786} --------------------------------------------------------------------- Quantitative analysis of specific mRNA expression was performed using real time-PCR. Briefly, 1.5 µg cDNA was subjected to PCR amplification using 96-well optical reaction plates in an ABI Prism 7500 System (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's protocol. The 25-µL PCR reaction mixture contained 0.25 µL 10-µM forward primer and 0.25 µL 10-µM reverse primer (100 nM final concentration of each primer), 12.5 µL SYBR Green Universal Master Mix, 10.6 µL nuclease-free water, and 1.4 µL cDNA as template. Rat primer sequences for atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), β-myosin heavy chain (β-MHC), procollagen I (Pro I), procollagen III (Pro III), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) are listed in [Table 2](#molecules-25-01786-t002){ref-type="table"}. The real- time PCR data was analyzed as relative gene expression using the 2--∆∆Ct method as previously described \[[@B59-molecules-25-01786]\]. Briefly, the fold change in levels of target genes between the treated and untreated groups were normalized to the level of GAPDH and compared according to the following equation: fold change = 2−∆ (∆Ct), where ∆Ct = Ct(target) − Ct(GAPDH) and ∆ (∆Ct) = ∆Ct(treated) − ∆Ct(untreated). 4.11. Statistical Analysis {#sec4dot11-molecules-25-01786} -------------------------- Statistical analysis of the results from the different experimental groups was performed using SigmaPlot^®^ for Windows (Systat Software, Inc, CA, USA). All data are expressed as means ± SEM. One- way analysis of variance (ANOVA) followed by the Tukey--Kramer multiple comparison test was conducted to assess significant differences between treatment groups. Duplicate reactions were performed for each experiment and the results are presented as the means of six independent experiments ± S.E.M. The differences were considered statistically significant when *p* \< 0.05. 5. Conclusions {#sec5-molecules-25-01786} ============== Our study revealed the cardioprotective effects of *C. proximus* essential oil against isoproterenol- induced cardiac hypertrophy and fibrosis. These findings were evidenced by first, significant decreases in HW/BW ratios; second, significant decreases of hypertrophy markers ANP, BNP, and β-MHC mRNA levels; third, significant decreases of fibrosis markers Pro I and Pro III mRNA levels; and fourth, significant decreases in CVF and the inhibition of cardiomyocyte architecture deterioration caused by isoproterenol. Together, these findings pinpoint the importance of *C. proximus* as a potential treatment for cardiac diseases. While the cardioprotective effects of *C. proximus* essential oil were clear, the current findings lack details regarding the correlation between pure components of the essential oil extract and the observed effects. This limitation may be addressed in a future study. The authors thank Abubaker M. Hamad for technical assistance in performing the histological examinations. **Sample Availability:** Samples of the *C. proximus* oil are available from the authors. Conceptualization, H.N.A., M.S.A.-K., K.M.A., and F.F.A.; methodology, H.N.A., M.S.A.-K., K.M.A., and F.F.A.; validation, H.N.A., M.S.A.-K., K.M.A., and F.F.A.; Formal analysis, H.N.A., M.S.A.-K., K.M.A., M.A.S. and F.F.A.; investigation, H.N.A., M.S.A.-K., K.M.A., and F.F.A.; writing---original draft preparation, H.N.A., M.S.A.-K., K.M.A., and F.F.A.; writing---review and editing, H.N.A., M.S.A.-K., K.M.A., and F.F.A. All authors have read and agreed to the published version of the manuscript. This research was funded by the Deanship of Scientific Research at Prince Sattam Bin Abdulaziz University, grant number \[2016/03/6630\]. The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. ![Effect of *Cymbopogon proximus* essential oil (CPEO) on body weight (BW) and heart weight (HW) of rats. Male albino rats were injected intraperitoneally daily with vehicle (saline + olive oil) as the control, CPEO (800 µL/kg/d), isoproterenol (ISO; 5 mg/kg), or CPEO (800 µL/kg/d) plus isoproterenol (5 mg/kg). CPEO administration was started 4 d prior to isoproterenol administration and continued concurrently thereafter for an additional 3 d. The HW/BW ratio (mg/g) was determined for each animal after 7 d of treatment with vehicle, CPEO, ISO, or a combination of ISO+CPEO. The results are presented as the means of six independent experiments ± SEM. \* *p* \< 0.05 compared to control, \# *p* \< 0.05 compared to ISO-treated rats.](molecules-25-01786-g001){#molecules-25-01786-f001} ![Effect of *Cymbopogon proximus* essential oil (CPEO) and/or isoproterenol (ISO) on hypertrophy markers. Male albino rats were injected intraperitoneally daily with vehicle (Control), PEO (800 µL/kg/d), ISO (5 mg/kg), or CPEO (800 µL/kg/d) plus ISO (5 mg/kg). Oil administration was started 4 d prior to ISO administration and continued concurrently thereafter for an additional 3 d. Expression of hypertrophic genes ANP (**a**), BNP (**b**), and β-MHC (**c**) in heart tissue based on mRNA levels measured using quantitative real-time polymerase chain reaction. The results are presented as the means of six independent experiments ± SEM. \* *p* \< 0.05 compared to control, \# *p* \< 0.05 compared to ISO-treated rats.](molecules-25-01786-g002){#molecules-25-01786-f002} ![Effect of *Cymbopogon proximus* essential oil (CPEO) and/or isoproterenol (ISO) on myocardial architecture. Male albino rats were injected intraperitoneally daily with vehicle (Control), CPEO (800 µL/kg/d), ISO (5 mg/kg), or CPEO (800 µL/kg/d) plus ISO (5 mg/kg). Oil administration was started 4 d prior to ISO administration and continued concurrently thereafter for an additional 3 d. Histological examination and pathological changes in heart tissue. (**a**) Representative images of hematoxylin and eosin (H&E)-stained fields are shown for the left ventricles of rats of the control group and rats treated with ISO+CPEO or ISO alone (magnification, × 200), (necrosis (N); degeneration (D); pyknotic changes in the nuclei (arrows)) (**b**) Mean cross-sectional areas of cardiomyocytes from left ventricles of rats from the indicated experimental groups were calculated and are shown. The results are presented as the means of four independent experiments ± SEM. \* *p* \< 0.05 compared to control, \# *p* \< 0.05 compared to ISO-treated rats.](molecules-25-01786-g003){#molecules-25-01786-f003} ![Effect of *Cymbopogon proximus* essential oil (CPEO) and/or isoproterenol (ISO) on myocardial fibrosis. Male albino rats were injected intraperitoneally daily with vehicle, CPEO (800 µL/kg/d), ISO (5 mg/kg), or CPEO (800 µL/kg/d) plus ISO (5 mg/kg). Oil administration was started 4 d prior to ISO administration and continued concurrently thereafter for an additional 3 d. Histological analysis and pathological changes in cardiac tissue. (**a**) Representative Masson's trichrome staining of left ventricles of control group rats and rats treated with ISO+CPEO or ISO alone. (**b**) Quantitative analysis of myocardial collagen volume fraction (CVF) in the left ventricles of rats of the experimental and control groups. The results are presented as the means of four independent experiments ± SEM. \* *p* \< 0.05 compared to control, \# *p* \< 0.05 compared to ISO-treated rats.](molecules-25-01786-g004){#molecules-25-01786-f004} ![Effect of *Cymbopogon proximus* essential oil (CPEO) and/or isoproterenol (ISO) on levels of fibrosis markers. Male albino rats were injected intraperitoneally daily with vehicle, CPEO (800 µL/kg/d), ISO (5 mg/kg), or CPEO (800 µL/kg/d) plus ISO (5 mg/kg). Oil administration was started four days prior to ISO administration and continued concurrently thereafter for an additional 3 d. Gene expression levels of fibrosis markers Pro I (**a**) and Pro III (**b**) were determined in the heart using quantitative real-time polymerase chain reaction. The results are presented as the means of six independent experiments ± SEM. \* *p* \< 0.05 compared to control, \# *p* \< 0.05 compared to ISO-treated rats.](molecules-25-01786-g005){#molecules-25-01786-f005} molecules-25-01786-t001_Table 1 ###### Components of *Cymbopogon proximus* essential oil. No. Component Name Yield % ^1^ ----- ------------------------------------------ ------------- 1 Elemol 23.54 2 Piperitone 19.86 3 β-Eudesmol 11.35 4 α-Eudesmol 7.63 5 β-Elemene 4.61 6 τ-Cadinol 3.87 7 Terpinolene 3.48 8 β-Selinenol 2.55 9 3-Cyclohexen-1-one, 2-isopropyl-5-methyl 2.44 10 4-Carene 1.66 11 Shyobunol 1.46 12 α-Terpineol 1.21 13 Cadina-1(10),4-diene 1.13 14 (−)-Guaia-6,9-diene 0.75 15 Limonene 0.66 16 Terpinolene 0.56 17 β-Caryophyllane, 4,8-epoxy 0.52 18 cis-Calamenene 0.51 19 trans-Geranylgeraniol 0.49 20 Epi-Cubenol 0.49 21 Espatulenol 0.49 22 2-Carene 0.44 23 Cuparene 0.38 24 Thymol 0.30 25 (Z)-β-ocimene 0.29 26 Ermacrene B 0.26 27 α-Dihydroagarofuran 0.26 28 γ-Muurolene 0.26 29 Caryophyllene oxide 0.24 30 Shyobunol 0.23 31 α-Selinene 0.20 32 Espatulenol 0.19 33 *p*-Mentha-1,5-dien-8-ol 0.15 34 Anethole 0.14 35 Cadinene 0.13 36 Aromandendrene 0.12 37 δ-Elemene 0.12 38 Isocaryophyllene 0.12 39 Allo-Ocimene 0.11 40 α-Amorphene 0.11 Total 93.27 ^1^ Percentages of yield were calculated based on concentrations obtained according to gas chromatography using an HP-5MS capillary column. The quantitative estimation of each compound was determined based on computerized peak area measurements. molecules-25-01786-t002_Table 2 ###### Sequences of primers used for real-time polymerase chain reaction. Gene Forward Primer (5′--3′) Reverse Primer (5′--3′) ------------- ------------------------- ------------------------- ANP ^a^ GCTTCGGGGGTAGGATTGACA GGCAATGCGACCAAGCTGT BNP ^b^ TTTCCTTAATCTGTCGCCGCT CTAAAACAACCTCAGCCCGTCA β-MHC ^c^ GCCGAGTCCCAGGTCAACAA GTAATTCGAGGGCAGGAACCC Pro I ^d^ CGGCTCCTGCTCCTCTTAGG CACTCGCCCTCCCGTTTTTG Pro III ^e^ TGGGATGCAACTACCTTGGT AGGTGTAGAAGGCTGTGGAC GAPDH ^f^ CAGTGCCAGCCTCGTCTCAT CAAGAGAAGGCAGCCCTGGT ^a^ atrial natriuretic peptide; ^b^ brain natriuretic peptide; ^c^ β-myosin heavy chain; ^d^ procollagen I; ^e^ procollagen III; ^f^ glyceraldehyde 3-phosphate dehydrogenase.
2024-06-25T01:26:58.646260
https://example.com/article/2407
Osborne has set Labour a trap. As Rafael Behr clearly explains, either Labour supports the benefits changes that see devastating real-term cuts to the most vulnerable, or they are left arguing in the Commons in support of people on benefits, playing into the hands of the worst stereotypes of the party in terms of public spending and supporting so called "scroungers". So what to do? The party has to be clear about one thing. Work is the best way to support people out of poverty and get the economy moving again. Labour. The clue is in the name. Talk to some members, and you would think the worst news from the Autumn Statement for poorer people were the benefit cuts. It wasn’t. The worst news for poorer people was that growth will be negative this year and stagnate for much longer than we thought. Without jobs, there is no hope. The first point the party has rightly emphasised is that most people being hit by these benefit cuts will be in work. Ed Balls has been good at articulating this so far, breaking down the false stereotype the chancellor presents us with between "strivers" and "scroungers". But I'm not talking about that argument, which I believe we've already won with the public. I'm talking about how we defend benefits for those who are out of work. The "strivers" who spend eight to ten hours a day applying for jobs without so much as a word back. How do we make their benefits seem fair to the working person who lives next door? One answer - which I’m putting out for discussion rather than a definitive solution - is a jobs guarantee. If someone capable of working has been unable to find work in a year, then the state guarantees them a job and pays them at least the minimum wage. Labour shouldn't support any further erosion of benefits in parliament until that promise has been kept. Evidence suggests that this scheme worked well under the Future Jobs Fund, which offered a six month placement to unemployed young people until the government axed it. In fact DWP’s own research showed it delivered a net benefit of £7,750 per participant. Others such as Stephen Timms and Richard Layard have researched what it would be like to extend it to all ages. Putting this suggestion to someone in Ed’s office, they reasonably argued that it still does nothing for those people who are in work on benefits. That's true, and a devastatingly sad reality for those struggling to afford Christmas and pay their bills in the new year. But as I’ve argued before, pushing the living wage is a much better way of helping the working poor than subsidising low wage jobs through tax credits, particularly when money is tight. Obviously the most important reason for a jobs guarantee is that it gives people a chance to help themselves. But it also has strategic advantages. It shows that Labour is being constructive and allows us to defend benefits from a position that resonates with the public. At a time when there are so many more claimants than jobs, it shows the Conservatives up for hitting people who are desperate to find work but can't find it. And on a deeper and more fundamental level, it may even cause a rebellion among the Liberal Democrats and give them cause to side with us in the Commons, defeating the government’s present measures altogether.
2024-07-06T01:26:58.646260
https://example.com/article/2545
Randomized multicentre trial of filgrastim as an adjunct to combination chemotherapy for Hodgkin's disease. West of Scotland Lymphoma Group. This study was intended to ascertain whether the adjunctive administration of filgrastim (r metHuG-CSF, Amgen) would influence the dose intensity of chemotherapy or the morbidity of myelosuppression in patients receiving MOPP or MOPP/EVAP hybrid chemotherapy for Hodgkin's disease. In a prospective randomized trial, two regimens for the treatment of Hodgkin's disease were compared. The substudy described here randomized patients receiving either regimen to receive filgrastim on the days when chemotherapy was not administered. During chemotherapy, parameters of myelosuppression were documented, including dose delays, the severity and duration of neutrophil and platelet nadirs, infective episodes, and resulting hospital admissions. In the MOPP arm, 13/25 eligible patients, and, in the MOPP/EVAP arm, 12/22 eligible patients, received filgrastim. The use of filgrastim made no statistically significant difference to the administered dose intensity for either MOPP (P = 0.57, 95% confidence interval (CI) 15-point increase to 8-point reduction) or MOPP/EVAP (P = 0.53; 95% CI 7-point increase to 11-point reduction). In patients receiving MOPP, filgrastim reduced the median duration of leucopenia (P = 0.007) and the severity of the white blood cell nadir (P = 0.036); however, no statistically significant effect (at the 5% level) was seen in platelet or haemoglobin nadirs, the number of days of in-patient hospitalization, the number of admissions for infective complications, the incidence, grade or duration of infections, or the incidence of febrile neutropenia. In patients receiving MOPP/EVAP, filgrastim had no significant effect on the duration or depth of leucopenia but was associated with a reduction in the median haemoglobin (P = 0.002) and platelet nadirs (P = 0.015). No effect on the above listed sequelae of myelosuppression was influenced by the administration of filgrastim. This study, although small, suggests that the routine use of filgrastim, aimed at influencing the administered dose intensity of conventional dose chemotherapy in Hodgkin's disease, is not warranted.
2023-10-10T01:26:58.646260
https://example.com/article/1950
Did you know that Michael Brown, the unarmed black 18-year-old said to have been killed by a white Ferguson police officer earlier this month, is actually still alive? And that his well-publicized corpse was instead a dummy? And that Brown may never have existed at all, and that his parents are actors? Did you know this elaborate hoax was orchestrated to distract us from "arch-Zionist crimes, including the Israelis categorical failure in Gaza, where they were defeated by the Palestinians"? If you believe the "mainstream" version of events, these theories say, you’re being duped by the government. What’s really happening in Ferguson isn’t the product of years of economic inequality and racial tension. So what is happening? The conspiracy theories vary. Alex Jones of InfoWars claims the Department of Justice has teamed up with Communists and the Black Panthers "to hijack what were largely peaceful protests that have turned increasingly violent in recent days." And in a video titled "Army Admits Plan to Execute Americans En Masse," he says that the military has a secret battle plan "to use lethal force against unarmed non-violent Americans"—namely African Americans. "This is the attempt to start the civil war, where they will then stage terror attacks, blame it on the Liberty movement during a race war," he says, "and then have the feds come in and crush the inner city people and the, quote, mainly white militia, as a pretext for restoring order." He even invoked the tactics of the Islamic State and the Nazis. D.C. Clothesline's Dean Garrison posted a video by YouTube user DAHBOO77 ("Underworld World News") claiming to show an "agent provocateur" throwing a smoke bomb back at police. The evidence? That he was acting alone, but "police never once interacted with this man."
2024-01-29T01:26:58.646260
https://example.com/article/3699
A woman was injured when she fell two stories during an Algiers apartment fire Friday evening (April 4), according to the New Orleans Fire Department. Three others, an adult and two children, who had been trapped on a balcony escaped unharmed from the blaze at the Cypress Run Apartments, 6101 Tullis Drive. The unidentified 24-year-old woman fell as another resident attempted to lower her from the burning building, according to the fire department. New Orleans EMS reported the woman was transported to LSU Interim with serious injuries, but was talking and conscious. Firefighters said they arrived on the scene about five minutes after receiving the 911 call at 5:56 p.m., and saw two adults and two children on a third-floor balcony. The fire department said no one else was injured, and the fire was brought under control with the help of 44 firefighters by 6:14 p.m. The fire was caused by a dryer on the first floor, the fire department said. Firefighters credited the quick thinking of a woman who closed the door to the utility room containing the dryer, preventing the fire from spreading.
2023-09-04T01:26:58.646260
https://example.com/article/2441
ZONING AGENDA July 16, 1987 The following are among requests scheduled to be heard July 22 at a public hearing of the District of Columbia Board of Zoning Adjustment. The meeting will begin at 9 a.m. in Room 9 of the District Building, 1350 Pennsylvania Ave. NW. For more information, call 727-6311. NORTHEAST U ST., 132 -- A special exception requested by Chi Mo Yang to change a restaurant with seating to a takeout delicatessen in a residential zone. NANNIE HELEN BURROUGHS AVE., 4810 -- Variances requested by the D.C. Department of Housing and Community Development to build a medical and office building on vacant land in a mixed-use zone. NORTHWEST Q ST., 2230 -- Variances requested by William E. Brock to build an apartment atop an existing garage in a residential zone. MACARTHUR BLVD., 4434 -- A special exception requested by MACMED Limited Partnership to construct a medical building in a residential zone. MORRISON ST., 3725-3729 -- A special exception requested by Safeway Stores Inc. to continue to operate an accessory parking lot in a residential zone. Under District regulations, parking lot permits must be renewed periodically. ONTARIO RD., 2805 -- Variances requested by Mary Lee Stein and Mark Rosenman to build an addition to a single-family house in a residential zone. 25TH ST., 914 -- Variances requested by Milton Carrow to build an addition to a single-family house in a residential zone. SOUTHEAST MARTIN LUTHER KING JR. AVE., 3501 -- A special exception requested by Resurrection Baptist Church to operate a child development center for 50 children, ages 2 to 15 years, in a residential zone.
2023-08-18T01:26:58.646260
https://example.com/article/1670
Trust Wallet, Binance’s official multi-cryptocurrency wallet has added support for Ripple’s XRP coin making a late entrance to the wallet after all the rest of the top 5 coins on the Coinmarketcap list. Ripple’s is ranked third after Bitcoin and Ethereum in terms of market cap. In addition, Trust Wallet has also enabled purchases of cryptocurrency through credit cards thanks to a partnership between Binance and the payment processing company Simplex. With this integration, Trust Wallet users will now be able to purchase Bitcoin, Bitcoin Cash, Litecoin, Ripple’s XRP and Ethereum with major credit and debit cards directly through the wallet’s interface. This announcement comes barely a month after Binance enabled purchasing of cryptocurrency in its platform through both debit and credit cards, an integration that was made possible with the help of Simplex. The addition of Ripple’s XRP blockchain brings the total number of blockchains supported on the Trust Wallet to 18. Initially, Trust was purely an Ethereum blockchain wallet but following the July 2018 acquisition by Binance, Trust revised its vision and roadmap to pursue a multi-currency product. So far it has integrated Bitcoin, Litecoin, Bitcoin Cash, Tron, Dash, as well as Ethereum’s token ecosystem including ERC-20, 223 and 721 non-fungible tokens. In a blog post on the Binance blog, Binance stated that Trust Wallet will be the native wallet for the forthcoming Binance DEX which is currently in test phase. Binance DEX has been built atop the also soon to be launched Binance blockchain dubbed Binance Chain which is expected to launch in the coming 2nd quarter. Trust Wallet will also be integrated with Ledger’s Nano S hardware wallet giving Binance users endless options to keep their funds safe and easy to access no matter what platform they would like to access. Viktor Radchenko, founder of the Trust Wallet says that they: “want to increase access to crypto and decentralized applications for all users,” and therefore “adding credit card payments is one piece to furthering cryptocurrency adoption and realizing our larger vision in helping to bring the freedom of money, and we will continue to integrate more blockchains and features to Trust. Our recent open-sourcing of Trust Wallet Core also makes it easy for developers to integrate new blockchains and we encourage everyone to check out the library,” he added.
2024-02-21T01:26:58.646260
https://example.com/article/1199
Q: Does Jekyll work with Pow? How do I get Jekyll to work with Pow? A: Thanks to the @mipadi answer, I learned that Pow automatically serves static files in the public directory of your application, so just configure Jekyll to change the directory where Jekyll will write files to from _site (the default) to public. Since public doesn't start with an underscore (_), you also have to add it to the list of files & directories to exclude. The relevant parts of my _config.yaml look like this: destination: public exclude: ["CNAME", "Rakefile", "README.md", "public"] Then, just do the usual: cd ~/.pow ln -s /path/to/myjekyllsite And navigate to http://myjekyllsite.dev/. Pow public directory trailing slash issue: Going to http://myjekyllsite.dev/projects should automatically redirect to http://myjekyllsite.dev/projects/ but didn't. A: Here's an approach that doesn't require overriding any of the normal Jekyll defaults: Install rack-jekyll: gem install rack-jekyll Add config.ru with the following contents: require "rack/jekyll" run Rack::Jekyll.new And now symlink your project directory into ~/.pow as you normally would.
2024-06-12T01:26:58.646260
https://example.com/article/3242
Hayward Leaders Receive Catalytic Funds for Next Five Years March 11, 2014 San Francisco Foundation News; March 3, 2014 JACKSON TRIANGLE AND HARDER/TENNYSON NEIGHBORHOODS WIN $300,000 AWARD SAN FRANCISCO –– The Koshland Committee of The San Francisco Foundation has selected the Jackson Triangle and Harder/Tennyson communities in the City of Hayward as the recipient of its 2014 Daniel E.Koshland Civic Unity Award. This launches a five-year effort to improve the quality of life for people living in the area and to support the growth and leadership of neighborhood residents. Jackson Triangle and Harder/Tennyson are two neighborhoods located in Hayward. It is defined as the area between West Jackson Street, Huntwood Street, West Tennyson Road, Whitman Street and the 880 Nimitz freeway. Public and private funders are investing deeply in these two neighborhoods through programs that are a strong match to the core of The San Francisco Foundation’s work in community development, investing in community schools, and building out healthy thriving neighborhoods through transit oriented development. “There are multiple initiatives and attention that is being placed in the Jackson Triangle and Harder Tennyson neighborhoods,” said Koshland Program DirectorRetha Robinson. “Our work with the community will help to make linkages between these initiatives and neighborhood leaders stronger.” Over the next five years, public and private funders are investing deeply in these two neighborhoods through programs including the Promise Neighborhood Grant to Jackson Triangle. One of five recipients, this federal grant of $25 million over the next five years will give students in this low-income area academic, social, and community support to succeed in school. California State University, East Bay is lead agency on the project modeled after the Harlem Children’s Zone, a comprehensive program that creates access to social services to children and youth to break the cycle of poverty through education. In Harder/Tennyson, Alameda County Supervisor Richard Valle is leading the Tennyson Corridor Initiativealong with many key members of the community, to bring vocational training, health services, childcare, and education services along the Tennyson Corridor, a very underserved area. “District 2 thanks the Koshland Committee of The San Francisco Foundation for recognizing the strong commitment our Hayward communities have to improve their neighborhoods,” said Supervisor Valle. “We look forward to supporting collaborative efforts in the Tennyson/Harder neighborhood as we work with the community to bring comprehensive services to their neighborhood.” The Hayward City Council has also approved of the development of The South Hayward BART Transit Village, ensuring that the next phase of community development will include affordable housing for low-income residents, ensure access to grocery stores, and transit linked to regional opportunities.
2023-09-03T01:26:58.646260
https://example.com/article/3687
I want to make some changes on active desktop wallpaper like adding watermark. For that I need to get the path of active wallpaper path. adding watermark I can do. This can be done using JNA library, but i can't able to access the file path.
2024-02-13T01:26:58.646260
https://example.com/article/9168
The long term goals of our research programs are: (i) to develop an understanding of the basis of catalysis by antibodies, (ii) to determine the physiological or pathophysiological functions of peptidolytic antibodies, and (iii) to develop catalytic anti-peptide antibodies for use as research and therapeutic tools. Specific endopeptidase activity of human autoantibodies to VIP has been reported. Recent findings suggest that immunization with VIP elicits catalytic antibodies and that dissociated light chains from VIP antibodies display increased catalytic activity. These observations raise new questions concerning the antibody catalytic function and its relation to the binding function. This proposal will address these questions through investigation of available murine monoclonal antibodies elicited against VIP, examination of hybrid antibody oligomers and, determination of catalytic and binding antibody responses to VIP and other polypeptides. The specific objectives of the proposed studies are: 1. To characterize the catalytic and binding properties of murine monoclonal antibodies to VIP and their component L- and H-chains (turnover number, Km, Kd, peptide bond specificity, epitope specificity and susceptibility to product inhibition); 2. To clone and express the cDNA for the H- and L-chains; 3. To prepare hybrid antibodies with catalytic activity. 4. To investigate the catalytic antibody response to peptides without homology to VIP and peptides designed to feature structural motifs found in VIP. The antibodies will be screened by direct methods for detection of peptidase activity using antigen or antigen analogs as substrate. Various chromatographic and electrophoretic methods will be applied. Products are isolated and identified by peptide sequencing and FAB-mass spectrometry. Standard DNA methods will be used to obtain cDNA from hybridoma cells, amplify the cDNA by PCR, and clone the cDNA.
2023-10-12T01:26:58.646260
https://example.com/article/5518
These are photos from touring Shanghai Touring Shanghai Full size After finishing our touring in Hangzhou, we drove back to Shanghai. I would have likely done the drive back at night so that we used our touring time better, but that's the way the touring company set it up. This is the great view from the Bund looking at the Oriental Pearl TV Tower . Full size I thought my buddy Chris Gorman would get a kick out of this since he was one of the first people I knew who wanted a computer in his car. Full size Yup, this is for real. I'm not sure what prompts one to check into the department of intestines. Are you looking to buy intestines? Are you having issues with them? Full size We had the afternoon off to wander and so we decided to check out a German beer house in Shanghai at the Paulaner in Xintiandi. Here is Natalia enjoying some kind of fruity mojito and I'm having a beer. We actually found a Japanese department store, which was like finding an oasis in the desert. It was organized, had Western food (albeit ludicrously expensive), and had clean floors. We picked up more Perrier and a Rogue beer as well as Natalia found gummi bears and Woolite to do her own laundry. The Shanghai Museum Full size Allan had arranged to move our museum date to this morning from tomorrow aft so that we would have more free time to roam so that's where we started our day. The Shanghai museum hasn't changed that much from when I was first here. The pottery and coin areas were still the most impressive sections. Here is some very beautiful furniture in the Museum. Full size A photo showing all of the Ethnic Minorities (one of Natalia's favourite terms). Full size These are all little Buddhas with one larger Buddha on it. I'm sure this is culturally significant, but I just think it looks neat. Full size Natalia, outside the Shanghai Museum. Allan and I talked about how most Chinese don't have a 3rd (middle) name any more and how common it is to have students with exactly the same name now. It seems quite ridiculous to me to hear pinyin sounds for words that are surprisingly short have such a range of meanings. The short answer is that the same word can have very different meanings depending on tone, but that's hard to infer without the accents on the pinyin that no one uses. Full size Next, we walked through Nanjing road to see some of the shopping district of the city. We saw a lot of people trying to sell us stuff and I was surprised to learn that locally in Shanghai, it's illegal to have major knockoff brands in regular shops so now vendors try to show you a pamphlet and then get you into their side street illegal shop. Too funny. This is Alan showing Natalia around. Full size Our next stop was the Jade Buddha temple, which on its own was a regular Buddhist temple with the two halls and incense everywhere. I thought this bird was a nice carved sculpture. Full size What made this temple so spectacular were the two jade sculptured Buddhas from Burma that are 1000 years old-ish that were brought here by a monk. Very cool and large white jade, which would be priceless. The temple now also contains a much larger reclining Buddha made of marble (this one that Natalia is near), donated from Singapore, and visitors may mistake this larger sculpture for the original, smaller piece. Yuyuan Gardens Full size The next stop was the Yuyuan gardens and old town, where we wandered around the old shopping district and then went through the gardens themselves. Here are some goldfish (coi) rocking out in the pond. Full size Natalia, some lotus plants, a pond, and a nice-looking temple. Full size The old ginkgo trees and the rocks and lakes were the most impressive features here but the gardens themselves are quite nice for sure. I left here determined to have a rock climbing actual wall in our backyard at some point. Full size Natalia is pretending to be the carved dragon in the roof here. Full size We hit up a dumpling shop that had a 40 RMB minimum per person (including Allan) so it cost us $20 for some dumplings and beer, but the dumplings were very good. Even when we went back at night, the dumpling line-up downstairs was still very long. Full size Alan was showing us how to eat the dumplings. Surprisingly - you put them in sauce and eat them. Yummy! Tianzefang shopping area Full size The Tianzefang old shopping area was quite neat and I enjoyed the small shops and mostly the photography and the painting shops. I took a photo of this girl (with Natalia as a prop) to show that even in China, there are hipsters. Full size This may have been Natalia's least favourite bathroom in Shanghai. She actually walked out without using the facilities and then proceeded to rant about how terribly dirty the whole country is. Full size Before we went to China, my friend Erik went on a bit of a tirade about how I'd decided to 'design my own baby' and that's what Natalia and I would do for a family (since I'm an engineer). Well, it turns out that China IS the world's factory. Acrobatic Show - Pujiangching - Shanghai Acrobatic Troupe. Our evening acrobat show was definitely the highlight of this day though. The acrobats were very talented and had some mind boggling moves and shows of strength. Full size I really enjoyed the Acrobat show. Find more about the troupe HERE . Full size This guy was unreal as he proceeded to take chairs and build up his tower even higher, while he was balanced on it. I almost couldn't watch. Of course, you're not supposed to take photos, but everyone was. Break for a story So, we were in our van with our driver and guide heading home from the acrobat show. As we're coming down the alley from the show, a security guard hops in front of us and tells us to go to the right. We go out that way, find a weird path under a building over a ramp, and then promptly drive down two huge steps and wreck the undercarriage of the car as we drive into what's obviously a pedestrian area. After the driver got out (he couldn't even open his door - he had to climb over our guide), he cursed a mean streak all the way back to the security guard and hauled him back over to have a look at the car. He was fuming and by the time it was over, there were 5 other people along with our driver and the guard (including some random guy in a wife beater) arguing over who owed who compensation. Unreal. That would have turned into fisticuffs and possibly shooting in the absence of cops in the western world. 20 mins later and a promise to show back up the next day with insurance papers meant we were on our way. No one wants cops around since it actually costs everyone more as they have to pay off the cops. Zhujiajiao Water Village Full size We drove out to Zhujiajiao water village and wandered around in the heat. This village was established over 1700 years ago. Here we see the rice wraps that the locals were selling. It smelled intensely awesome, similar to the rice packs that get served at Dim Sum. Full size We saw women selling fish for release in order to establish Taoist balance or something, but then they will simply recatch the fish and start again. The same is true of turtles. Too funny. I'd say it's better for their bank balance. China exhibit at the World Expo Full size We were then dropped off at the Expo site just as the rains and wind were starting and by the time we had walked to where Allan said the ticket office was, the rains were in full monsoon condition. The ticket office was closed and we were in the middle of torrential downpour so we hunkered down while the very violent thunder and lightning worked overhead and 30 mins later, we sorted out that we had been dropped off at the wrong spot and walked back to the ticket office before going into the China Pavilion. Check out item 8 in the list of things you can't do at the Exhibit. Full size The pavilion itself was a beautiful building, all done in red and in the shape of some manner of house on stilts. Full size Inside the pavilion was an interesting display of Chinese views of themselves and how they see the future. It's clear that they see themselves having made the leap to modernity in the last 30 years, even though large portions of the population haven't come close to that. It was amusing to see how much of the other patrons were clearly from smaller communities as the staring and gawking started again at this site. Full size It was kind of a surreal mix of Disneyland, Epcot Centre, and mass propaganda. This is a small ride taking us around another display showing how amazing the Chinese civilization is. Full size We took the subway back over to Nanjing road and wandered there looking for a decent non-Chinese dinner option, but after being told that we didn't pass their dress code at the Radisson New World, we went back down the elevator and ate at Burger King. Full size Then, we walked through the lights of Nanjing and the Bund and eventually wound our way back to Yuyuan area so that Natalia could have DQ ice cream. This is the only reason she's smiling here. Full size Yes, even in China, I have to ride things. This is a turtle with a dragon head! That might be a first for me. Full size Throughout the trip, Natalia and I had an ongoing bet to see how many people we could spot on a single regular-sized scooter. While this wasn't the winner (5 was actually), I thought the dog sitting on this scooter was funny. Full size This sign, near our hotel, made me laugh. What great imagery! Shanghai Propaganda Museum Full size Since today was our day to walk around on our own, we proceeded to walk about 2-3km to the propaganda poster museum (Nate's suggestion), which turned out to be quite excellent. They had hundreds of vintage posters up on the walls and many more in the back rooms. With both English and French explanations, I easily spent an hour walking through here. There was a strong anti-American slant to just about all of these posters. Full size We had lunch at Oscar's pub, a Chinese attempt at a pub. It was right by the US consolate so I thought it might have hope. With 5 beer on tap and reasonable priced non-Chinese lunches, I think this was a winner. I had mushroom/bacon pasta and Natalia had chicken parm. They both came with salad and a Chinese congee-like soup, but all-in-all (especially after 2 full-size pints), it was a stellar lunch. Full size We then took another Nate suggestion and tried to make our way to the go-kart track. While it wound up being a solid distance from the subway (about a 40 min walk by the East China Normal Univ), we did find it and Natalia got to try her first go-kart ever. She made a bad call of wearing a dress though and she wound up concerned about flashing the go-kart people with her dress and so she really didn't enjoy it at all. Maybe next time though. An hour or so later and we were back to the hotel. In the spirit of not eating Chinese, we made a reservation at the Indian place in the hotel (Tandoor) and then had one of the nicest meals (definitely the most expensive) of our trip to date.
2023-10-27T01:26:58.646260
https://example.com/article/6540
The gastroenterologist's guide to management of the post-liver transplant patient. The management of the post-liver transplant patient is complex and involves a large interdisciplinary team. After referral to a transplant center, evaluation and listing, and eventual transplantation, the patient is cared for closely by the transplant center. Once deemed ready for discharge, the patient returns to the primary care provider for ongoing management of the various issues that increase in incidence post transplant such as osteoporosis, cardiovascular, and renal diseases, as well as metabolic syndrome. The role of the gastroenterologist is not well defined, but certainly, he or she may be called upon for the initial evaluation and ongoing management of gastrointestinal as well as hepatobiliary issues. This includes but is not limited to the investigation of abnormal liver tests, non-specific gastrointestinal complaints such as nausea, vomiting, or diarrhea, biliary complications, and even recurrent hepatic disease. Having familiarity with post-transplant immunosuppressive agents, drug interactions, and potential infectious and malignancy-related complications of transplant is essential, as the primary gastroenterologist may be expected in some situations to field the initial work-up, if patient access to the transplant center is limited. The aim of this review is to summarize the gastroenterologist's role in the management of the post-liver transplant patient.
2023-10-24T01:26:58.646260
https://example.com/article/9572
--###################################################################################################### --##### --##### MISE À JOUR Base de données de Leed --##### Date : 06/03/2014 --##### Version Leed : v1.7 --##### --##### Préfixe des tables : ##MYSQL_PREFIX## est remplacé automatiquement --##### --##### Feature(s) : --##### - Pliage des articles - issues : #87 --##### --###################################################################################################### -- insertion du paramétrage par défaut INSERT INTO `##MYSQL_PREFIX##configuration` (`key`, `value`) VALUES ('articleDisplayMode','summary'); -- suppression des anciennes variables DELETE FROM `##MYSQL_PREFIX##configuration` WHERE (`key` = 'articleDisplayContent'); DELETE FROM `##MYSQL_PREFIX##configuration` WHERE (`key` = 'articleView');
2023-09-27T01:26:58.646260
https://example.com/article/1970