text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_read_interested() { let mut r = Reader::new(); r.state = State::Len; let data = vec![0u8, 0, 0, 1, 2]; test_message(data, Message::Interested); }
rust_cleaned_test_functions.jsonl/46446
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 100 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 15318, 9980, 368, 341, 286, 1077, 5206, 435, 284, 25166, 486, 931, 543, 286, 435, 3467, 284, 3234, 486, 11271, 280, 286, 1077, 821, 284, 7486, 20703, 15, 84, 23, 11, 220, 15, 11, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_set() { assert_eq!(0xFFu8.with_bits(4..8, 2), 0x2F); assert_eq!(0xFFu8.with_bits(4.., 2), 0x2F); assert_eq!(0xFFu8.with_bits(0..4, 2), 0xF2); assert_eq!(0xFFu8.with_bits(..4, 2), 0xF2); assert_eq!(0xFFu8.with_bits(8..8, 0), 0xFF); assert_eq!(0xFFu8.with_bits(8.., 0), 0xFF); assert_eq!(0u32.with_bits(5..9, 0xF), 0b111100000); assert_eq!( 0xAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAu128 .with_bit(127, false) .with_bit(126, true), 0x6AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ); assert_eq!( 0xAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAu128.with_bits(126..128, 1), 0x6AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ); }
rust_cleaned_test_functions.jsonl/52223
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 311 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2602, 368, 341, 6948, 10714, 10297, 15, 9264, 84, 23, 18164, 20034, 7, 19, 496, 23, 11, 220, 17, 701, 220, 15, 87, 17, 37, 317, 6948, 10714, 10297, 15, 9264, 84, 23, 18164, 20034, 7, 19, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_generic_argument() { ok("class A[T](val: T)"); ok("class A[T](var val: T)"); ok("class A[T](let val: T)"); }
rust_cleaned_test_functions.jsonl/84185
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 86 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41232, 9025, 368, 341, 286, 5394, 445, 1040, 362, 20340, 9533, 831, 25, 350, 20996, 286, 5394, 445, 1040, 362, 20340, 9533, 947, 1044, 25, 350, 20996, 286, 5394, 445, 1040, 362, 20340, 9533, 114...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_weighted_choice() { // this makes assumptions about the internal implementation of macro_rules! t { ($items:expr, $expected:expr) => {{ let mut items = $items; let wc = WeightedChoice::new(&mut items); let expected = $expected; let mut rng = CountingRng { i: 0 }; for &val in expected.iter() { assert_eq!(wc.ind_sample(&mut rng), val) } }} } t!(vec!(Weighted { weight: 1, item: 10}), [10]); // skip some t!(vec!(Weighted { weight: 0, item: 20}, Weighted { weight: 2, item: 21}, Weighted { weight: 0, item: 22}, Weighted { weight: 1, item: 23}), [21,21, 23]); // different weights t!(vec!(Weighted { weight: 4, item: 30}, Weighted { weight: 3, item: 31}), [30,30,30,30, 31,31,31]); // check that we're binary searching // correctly with some vectors of odd // length. t!(vec!(Weighted { weight: 1, item: 40}, Weighted { weight: 1, item: 41}, Weighted { weight: 1, item: 42}, Weighted { weight: 1, item: 43}, Weighted { weight: 1, item: 44}), [40, 41, 42, 43, 44]); t!(vec!(Weighted { weight: 1, item: 50}, Weighted { weight: 1, item: 51}, Weighted { weight: 1, item: 52}, Weighted { weight: 1, item: 53}, Weighted { weight: 1, item: 54}, Weighted { weight: 1, item: 55}, Weighted { weight: 1, item: 56}), [50, 51, 52, 53, 54, 55, 56]); }
rust_cleaned_test_functions.jsonl/34897
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 979 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15876, 291, 31936, 368, 341, 286, 442, 419, 3643, 31846, 911, 279, 5306, 8129, 315, 79133, 23459, 286, 18072, 21407, 0, 259, 341, 310, 1711, 3615, 96011, 11, 400, 7325, 96011, 8, 589, 80505, 394...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_mut_slice_from() { let mut values = Vec::from_slice([1u8,2,3,4,5]); { let slice = values.mut_slice_from(2); assert!(slice == [3, 4, 5]); for p in slice.mut_iter() { *p += 2; } } assert!(values.as_slice() == [1, 2, 5, 6, 7]); }
rust_cleaned_test_functions.jsonl/58449
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 208 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29523, 26488, 5673, 368, 341, 286, 1077, 5206, 2750, 284, 11312, 486, 1499, 26488, 2561, 16, 84, 23, 11, 17, 11, 18, 11, 19, 11, 20, 2558, 286, 341, 310, 1077, 15983, 284, 2750, 744, 332, 26...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_int_decimal_strings() { let tests: Vec<(&str, i64)> = vec![ ("0", 0), ("-5", -5), ("9223372036854775807", i64::max_value()), ("0b1010", 0), ("1.23", 1), ]; for (input, expected) in tests { let args = HashMap::new(); let result = int(&to_value(input).unwrap(), &args); assert!(result.is_ok()); assert_eq!(result.unwrap(), to_value(expected).unwrap()); } }
rust_cleaned_test_functions.jsonl/119660
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 293 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4042, 74429, 33500, 368, 341, 286, 1077, 7032, 25, 11312, 27, 2099, 495, 11, 600, 21, 19, 16018, 284, 7486, 90515, 310, 3489, 15, 497, 220, 15, 1326, 310, 98670, 20, 497, 481, 20, 1326, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_diagnostic_timer_format() { let mut profile_timer = DiagnosticTimer::now(); println!("Debug Format: "); for _ in 0..20 { std::thread::spawn(move || { println!("{:?}", profile_timer); }); profile_timer.start_record(); std::thread::sleep(Duration::from_millis(10)); profile_timer.stop_record(); } println!("Display Format: "); for _ in 0..20 { std::thread::spawn(move || { println!("{}", profile_timer); }); profile_timer.start_record(); std::thread::sleep(Duration::from_millis(10)); profile_timer.stop_record(); } }
rust_cleaned_test_functions.jsonl/46223
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 383 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29477, 11953, 16255, 8955, 368, 341, 286, 1077, 5206, 5526, 16255, 284, 49988, 10105, 486, 3328, 1428, 286, 13751, 17223, 7939, 15042, 25, 7318, 286, 369, 716, 304, 220, 15, 496, 17, 15, 341, 31...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_create_without_indexes() { let tmp_dir = tempfile::tempdir().unwrap(); let path = tmp_dir.path().join("test_create_without_indexes"); let name = path.to_str().unwrap(); assert!( DocumentStore::open(name, vec![]).is_err(), "should not have been created" ); }
rust_cleaned_test_functions.jsonl/110730
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 163 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 39904, 50161, 368, 341, 286, 1077, 4174, 4334, 284, 54819, 486, 3888, 3741, 1005, 15454, 543, 286, 1077, 1815, 284, 4174, 4334, 3875, 1005, 5987, 445, 1944, 8657, 39904, 50161, 797, 286, 107...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rsquared() { let rng = &mut ::rand::thread_rng(); for _ in 0..1000 { let a = Fr::random(rng); let b: U256 = a.into(); let c = Fr::new(b).unwrap(); assert_eq!(a, c); } for _ in 0..1000 { let a = Fq::random(rng); let b: U256 = a.into(); let c = Fq::new(b).unwrap(); assert_eq!(a, c); } }
rust_cleaned_test_functions.jsonl/64633
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 219 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 47115, 34249, 368, 341, 262, 1077, 28422, 284, 609, 6984, 3504, 11335, 486, 4528, 66849, 1428, 262, 369, 716, 304, 220, 15, 496, 16, 15, 15, 15, 341, 286, 1077, 264, 284, 2869, 486, 11463, 875...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_broadcast_dependencies() { let (mut smp, peers) = SharedMempoolNetwork::bootstrap_validator_network(2, 1, None, None, false); let (peer_a, peer_b) = (peers.get(0).unwrap(), peers.get(1).unwrap()); // Peer A has transactions with sequence numbers 0 and 2 smp.add_txns( &peer_a, vec![TestTransaction::new(0, 0, 1), TestTransaction::new(0, 2, 1)], ); // Peer B has txn1 smp.add_txns(&peer_b, vec![TestTransaction::new(0, 1, 1)]); // A and B discover each other smp.send_new_peer_event(peer_a, peer_b, true); smp.send_new_peer_event(peer_b, peer_a, false); // B receives 0 smp.deliver_message(&peer_a, 1, true, true, false); // now B can broadcast 1 let txn = smp.deliver_message(&peer_b, 1, true, true, false).0; assert_eq!(txn.get(0).unwrap().sequence_number(), 1); // now A can broadcast 2 let txn = smp.deliver_message(&peer_a, 1, true, true, false).0; assert_eq!(txn.get(0).unwrap().sequence_number(), 2); }
rust_cleaned_test_functions.jsonl/54558
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 446 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 74923, 71841, 368, 341, 262, 1077, 320, 6984, 274, 1307, 11, 25029, 8, 4035, 286, 16990, 44, 3262, 1749, 12320, 486, 6281, 64959, 20966, 7, 17, 11, 220, 16, 11, 2240, 11, 2240, 11, 895, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_zinc_symbol_encode() { let value: Value = Value::make_symbol("test"); assert_eq!(value, Value::make_symbol("test")); assert_eq!(value.to_zinc_string(), Ok("^test".into())); }
rust_cleaned_test_functions.jsonl/77328
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 91 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6415, 2840, 21179, 11224, 368, 341, 262, 1077, 897, 25, 5162, 284, 5162, 486, 6927, 21179, 445, 1944, 797, 262, 2060, 10714, 10297, 957, 11, 5162, 486, 6927, 21179, 445, 1944, 14929, 262, 2060, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_zipmap_compress() { struct TestRdbHandler { map: HashMap<String, String>, } impl EventHandler for TestRdbHandler { fn handle(&mut self, data: Event) { match data { Event::RDB(rdb) => match rdb { Object::Hash(hash) => { assert_eq!("zipmap_compresses_easily", String::from_utf8_lossy(hash.key)); for field in hash.fields { let name = String::from_utf8_lossy(&field.name).to_string(); let val = String::from_utf8_lossy(&field.value).to_string(); self.map.insert(name, val); } } Object::EOR => { assert_eq!("aa", self.map.get("a").unwrap()); assert_eq!("aaaa", self.map.get("aa").unwrap()); assert_eq!("aaaaaaaaaaaaaa", self.map.get("aaaaa").unwrap()); } _ => {} }, Event::AOF(_) => {} } } } start_redis_test( "zipmap_that_compresses_easily.rdb", 10013, Rc::new(RefCell::new(TestRdbHandler { map: HashMap::new() })), ); }
rust_cleaned_test_functions.jsonl/93097
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 774 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 42131, 2186, 87845, 368, 341, 262, 2036, 3393, 49, 1999, 3050, 341, 286, 2415, 25, 10528, 3464, 11, 923, 12520, 262, 555, 262, 11605, 31957, 369, 3393, 49, 1999, 3050, 341, 286, 5168, 3705, 2099...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_call_giver() -> Result<(), Box<dyn std::error::Error>> { let giver_abi_name = "tests/samples/giver.abi.json"; let mut cmd = Command::cargo_bin(BIN_NAME)?; cmd.arg("config") .arg("--url") .arg(&*NETWORK) .assert() .success(); let mut cmd = Command::cargo_bin(BIN_NAME)?; cmd.arg("call") .arg("0:841288ed3b55d9cdafa806807f02a0ae0c169aa5edfe88a789a6482429756a94") .arg("sendGrams") .arg(r#"{"dest":"0:841288ed3b55d9cdafa806807f02a0ae0c169aa5edfe88a789a6482429756a94","amount":1000000000}"#) .arg("--abi") .arg(giver_abi_name) .assert() .success() .stdout(predicate::str::contains("Succeeded")); Ok(()) }
rust_cleaned_test_functions.jsonl/118312
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 388 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13429, 1889, 1524, 368, 1464, 5714, 68843, 8261, 92846, 1460, 486, 841, 486, 1454, 2452, 341, 262, 1077, 94515, 22885, 72, 1269, 284, 330, 23841, 2687, 4023, 4846, 1524, 22048, 72, 4323, 876, 262,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_and() { let compiled = compile("SET B 255\nSET C 345\nAND B C"); let out_cpu = test_program(compiled); assert_eq!(out_cpu.a.value, 0); assert_eq!(out_cpu.b.value, 89); assert_eq!(out_cpu.c.value, 345); assert_eq!(out_cpu.f.value, 0); }
rust_cleaned_test_functions.jsonl/63156
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 134 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8378, 368, 341, 262, 1077, 19697, 284, 19192, 445, 5884, 425, 220, 17, 20, 20, 1699, 5884, 356, 220, 18, 19, 20, 1699, 3976, 425, 356, 797, 262, 1077, 700, 21795, 284, 1273, 25096, 30008, 2181...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_default() { let c = TableCellProperty::new(); let b = c.build(); assert_eq!(str::from_utf8(&b).unwrap(), r#"<w:tcPr />"#); }
rust_cleaned_test_functions.jsonl/22959
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 91 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9993, 368, 341, 286, 1077, 272, 284, 84370, 3052, 486, 931, 543, 286, 1077, 293, 284, 272, 13239, 543, 286, 2060, 10714, 10297, 495, 486, 1499, 39453, 23, 2099, 65, 568, 15454, 1507, 435, 2, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_gen_compact_code_blocks() -> io::Result<()> { let entities = setup(); const ENTITY_FILES: [&str; 6] = [ include_str!("../../tests/compact/cake.rs"), include_str!("../../tests/compact/cake_filling.rs"), include_str!("../../tests/compact/filling.rs"), include_str!("../../tests/compact/fruit.rs"), include_str!("../../tests/compact/vendor.rs"), include_str!("../../tests/compact/rust_keyword.rs"), ]; assert_eq!(entities.len(), ENTITY_FILES.len()); for (i, entity) in entities.iter().enumerate() { let mut reader = BufReader::new(ENTITY_FILES[i].as_bytes()); let mut lines: Vec<String> = Vec::new(); reader.read_until(b';', &mut Vec::new())?; let mut line = String::new(); while reader.read_line(&mut line)? > 0 { lines.push(line.to_owned()); line.clear(); } let content = lines.join(""); let expected: TokenStream = content.parse().unwrap(); let generated = EntityWriter::gen_compact_code_blocks(entity, &crate::WithSerde::None) .into_iter() .skip(1) .fold(TokenStream::new(), |mut acc, tok| { acc.extend(tok); acc }); assert_eq!(expected.to_string(), generated.to_string()); } Ok(()) }
rust_cleaned_test_functions.jsonl/76351
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 771 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16322, 18177, 531, 4136, 25201, 368, 1464, 6399, 486, 2077, 71698, 341, 286, 1077, 14744, 284, 6505, 543, 286, 733, 73871, 48010, 25, 34336, 495, 26, 220, 21, 60, 284, 2278, 310, 2924, 2895, 172...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_text() { let mut schema_builder = Schema::builder(); let name = schema_builder.add_text_field("name", TEXT); let schema = schema_builder.build(); let index = Index::create_in_ram(schema); { let mut index_writer = index.writer_for_tests().unwrap(); index_writer.add_document(doc!(name => "hi")); index_writer.add_document(doc!(name => "this is a test")); index_writer.add_document( doc!(name => "some more documents with some word overlap with the other test"), ); index_writer.add_document(doc!(name => "hello hi goodbye")); index_writer.commit().unwrap(); } let searcher = index.searcher().unwrap(); let searcher_space_usage = searcher.space_usage().unwrap(); assert!(searcher_space_usage.total() > 0); assert_eq!(1, searcher_space_usage.segments().len()); let segment = &searcher_space_usage.segments()[0]; assert!(segment.total() > 0); assert_eq!(4, segment.num_docs()); expect_single_field(segment.termdict(), &name, 1, 512); expect_single_field(segment.postings(), &name, 1, 512); expect_single_field(segment.positions(), &name, 1, 512); assert_eq!(0, segment.fast_fields().total()); expect_single_field(segment.fieldnorms(), &name, 1, 512); // TODO: understand why the following fails assert_eq!(0, segment.deletes()); }
rust_cleaned_test_functions.jsonl/62189
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 674 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4326, 368, 341, 286, 1077, 5206, 10802, 28532, 284, 12539, 486, 17850, 543, 286, 1077, 829, 284, 10802, 28532, 1364, 4326, 5013, 445, 606, 497, 15762, 317, 286, 1077, 10802, 284, 10802, 28532, 132...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_filling() { let drawing_area = create_mocked_drawing_area(1024, 768, |m| { m.check_draw_rect(|c, _, f, u, d| { assert_eq!(c, WHITE.to_rgba()); assert_eq!(f, true); assert_eq!(u, (0, 0)); assert_eq!(d, (1023, 767)); }); m.drop_check(|b| { assert_eq!(b.num_draw_rect_call, 1); assert_eq!(b.draw_count, 1); }); }); drawing_area.fill(&WHITE).expect("Drawing Failure"); }
rust_cleaned_test_functions.jsonl/81492
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 342 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 9400, 368, 341, 286, 1077, 13330, 15030, 284, 1855, 34134, 291, 814, 1696, 15030, 7, 16, 15, 17, 19, 11, 220, 22, 21, 23, 11, 760, 76, 91, 341, 310, 296, 9093, 23021, 16979, 22428, 66, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_aes256_ccm_verify_fail() { let key = "7f4af6765cad1d511db07e33aaafd57646ec279db629048aa6770af24849aa0d"; let nonce = "dde2a362ce81b2b6913abc3095"; let aad = "404f5df97ece7431987bc098cce994fc3c063b519ffa47b0365226a0015ef695"; let ct = "353022db9c568bd7183a13c40b1ba30fcc768c54264aa2cd"; let tag = "0000a053c9244d3217a7ad05"; let out = decrypt_aead( Cipher::aes_256_ccm(), &Vec::from_hex(key).unwrap(), Some(&Vec::from_hex(nonce).unwrap()), &Vec::from_hex(aad).unwrap(), &Vec::from_hex(ct).unwrap(), &Vec::from_hex(tag).unwrap(), ); assert!(out.is_err()); }
rust_cleaned_test_functions.jsonl/110562
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 419 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 90958, 17, 20, 21, 28955, 76, 35638, 22121, 368, 341, 286, 1077, 1376, 284, 330, 22, 69, 19, 2577, 21, 22, 21, 20, 34455, 16, 67, 20, 16, 16, 1999, 15, 22, 68, 18, 18, 5305, 92139, 20, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_selector_pseudo_nth_of_type() -> Result { let html = r#" <!doctype html> <html lang="en"> <head> <meta charset="utf-8"> <title>:nth-of-type</title> </head> <body> <dl> <dt>dt1</dt> <dd>dd1</dd> <dd>dd2</dd> <dd>dd3</dd> <dt>dt2</dt> <dd>dd4</dd> <dt>dt3</dt> <dd>dd5</dd> <dd>dd6</dd> </dl> </body> </html> "#; let root = Vis::load(html)?; let dl = root.find("dl"); let type_child = dl.children(":nth-of-type(0)"); assert_eq!(type_child.length(), 0); let type_child = dl.find(":nth-of-type(1)"); assert_eq!(type_child.length(), 2); assert_eq!(type_child.text(), "dt1dd1"); let odd_type_childs = dl.find(":nth-of-type(odd)"); assert_eq!(odd_type_childs.length(), 5); assert_eq!(odd_type_childs.text(), "dt1dd1dd3dt3dd5"); let childs_type_3n = dl.find(":nth-of-type(3n)"); assert_eq!(childs_type_3n.length(), 3); assert_eq!(childs_type_3n.text(), "dd3dt3dd6"); let childs_type_3n_2n = childs_type_3n.filter(":nth-of-type(2n)"); assert_eq!(childs_type_3n_2n.length(), 1); assert_eq!(childs_type_3n_2n.text(), "dd6"); // prevs let childs_type_3n_2n_prevs = childs_type_3n_2n.prev_all(":nth-of-type(3n)"); assert_eq!(childs_type_3n_2n_prevs.length(), 2); assert_eq!(childs_type_3n_2n_prevs.text(), "dd3dt3"); Ok(()) }
rust_cleaned_test_functions.jsonl/58029
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 778 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28890, 620, 21952, 78342, 3575, 1819, 368, 1464, 5714, 341, 10217, 5272, 284, 435, 2, 698, 262, 71341, 50139, 5272, 397, 262, 366, 1551, 8688, 428, 268, 881, 414, 366, 1983, 397, 286, 366, 5490,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_program_little_endian() { const NUM: u32 = 0x12345678; const LE_BYTES: [u8; 4] = [0x78, 0x56, 0x34, 0x12]; let mut mem = Memory::new(1024); mem.program_le_bytes(&LE_BYTES).unwrap(); assert_eq!(NUM, mem.read_word(0).unwrap()); }
rust_cleaned_test_functions.jsonl/92785
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25096, 907, 2377, 87193, 368, 341, 286, 733, 15943, 25, 575, 18, 17, 284, 220, 15, 87, 16, 17, 18, 19, 20, 21, 22, 23, 280, 286, 733, 11148, 40705, 25, 508, 84, 23, 26, 220, 19, 60, 284,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_multipart_type_type_parsing() { let tests = vec![ MultipartParseTest { mime_type: ("multipart", "mixed"), result: Some(MimeMultipartType::Mixed), }, MultipartParseTest { mime_type: ("multipart", "alternative"), result: Some(MimeMultipartType::Alternative), }, MultipartParseTest { mime_type: ("multipart", "digest"), result: Some(MimeMultipartType::Digest), }, MultipartParseTest { mime_type: ("multipart", "encrypted"), result: Some(MimeMultipartType::Encrypted), }, MultipartParseTest { mime_type: ("multipart", "parallel"), result: Some(MimeMultipartType::Parallel), }, // Test fallback on multipart/mixed MultipartParseTest { mime_type: ("multipart", "potato"), result: Some(MimeMultipartType::Mixed), }, MultipartParseTest { mime_type: ("multipart", "signed"), result: Some(MimeMultipartType::Signed), }, // Test failure state MultipartParseTest { mime_type: ("text", "plain"), result: None, }, ]; for test in tests.into_iter() { let (major_type, minor_type) = test.mime_type; assert_eq!( MimeMultipartType::from_content_type((major_type.to_string(), minor_type.to_string())), test.result ); } }
rust_cleaned_test_functions.jsonl/112547
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 965 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 18204, 1819, 1819, 620, 28598, 368, 341, 286, 1077, 7032, 284, 7486, 90515, 310, 386, 18204, 14463, 2271, 341, 394, 45270, 1819, 25, 3489, 29542, 497, 330, 56685, 4461, 394, 1102, 25, 4329, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_map_append() { let mut a = SgMap::new(); a.insert(1, "1"); a.insert(2, "2"); a.insert(3, "3"); let mut b = SgMap::<_, _, DEFAULT_CAPACITY>::new(); b.insert(4, "4"); b.insert(5, "5"); b.insert(6, "6"); a.append(&mut b); assert!(b.is_empty()); assert_eq!(a.len(), 6); assert_eq!( a.into_iter().collect::<Vec<(usize, &str)>>(), vec![(1, "1"), (2, "2"), (3, "3"), (4, "4"), (5, "5"), (6, "6")] ); }
rust_cleaned_test_functions.jsonl/18651
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 270 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5376, 26041, 368, 341, 262, 1077, 5206, 264, 284, 328, 70, 2227, 486, 931, 1428, 262, 264, 7030, 7, 16, 11, 330, 16, 797, 262, 264, 7030, 7, 17, 11, 330, 17, 797, 262, 264, 7030, 7, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fp2_mul() { let mut a = Fp2::new( Fp::from_u64s_le(&[ 0x85c9f989e1461f03, 0xa2e33c333449a1d6, 0x41e461154a7354a3, 0x9ee53e7e84d7532e, 0x1c202d8ed97afb45, 0x51d3f9253e2516f, ]) .unwrap(), Fp::from_u64s_le(&[ 0xa7348a8b511aedcf, 0x143c215d8176b319, 0x4cc48081c09b8903, 0x9533e4a9a5158be, 0x7a5e1ecb676d65f9, 0x180c3ee46656b008, ]) .unwrap(), ); a *= &Fp2::new( Fp::from_u64s_le(&[ 0xe21f9169805f537e, 0xfc87e62e179c285d, 0x27ece175be07a531, 0xcd460f9f0c23e430, 0x6c9110292bfa409, 0x2c93a72eb8af83e, ]) .unwrap(), Fp::from_u64s_le(&[ 0x4b1c3f936d8992d4, 0x1d2a72916dba4c8a, 0x8871c508658d1e5f, 0x57a06d3135a752ae, 0x634cd3c6c565096d, 0x19e17334d4e93558, ]) .unwrap(), ); assert_eq!( a, Fp2::new( Fp::from_u64s_le(&[ 0x95b5127e6360c7e4, 0xde29c31a19a6937e, 0xf61a96dacf5a39bc, 0x5511fe4d84ee5f78, 0x5310a202d92f9963, 0x1751afbe166e5399 ]) .unwrap(), Fp::from_u64s_le(&[ 0x84af0e1bd630117a, 0x6c63cd4da2c2aa7, 0x5ba6e5430e883d40, 0xc975106579c275ee, 0x33a9ac82ce4c5083, 0x1ef1a36c201589d ]) .unwrap(), ) ); }
rust_cleaned_test_functions.jsonl/62481
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1569 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34160, 17, 24944, 368, 341, 286, 1077, 5206, 264, 284, 434, 79, 17, 486, 931, 1006, 310, 434, 79, 486, 1499, 7300, 21, 19, 82, 11751, 2099, 9640, 394, 220, 15, 87, 23, 20, 66, 24, 69, 24, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pod_spec_creation_with_multiple_containers() { let mut placeholder_limits1: ResourceQuantityType = BTreeMap::new(); placeholder_limits1.insert(RESOURCE_REQUIREMENTS_KEY.to_string(), Default::default()); placeholder_limits1.insert("do-not-change-this".to_string(), Default::default()); let placeholder_requests1 = placeholder_limits1.clone(); let mut placeholder_limits2: ResourceQuantityType = BTreeMap::new(); placeholder_limits2.insert(RESOURCE_REQUIREMENTS_KEY.to_string(), Default::default()); placeholder_limits2.insert("do-not-change-this".to_string(), Default::default()); let placeholder_requests2 = placeholder_limits2.clone(); do_pod_spec_creation_test( vec!["image1".to_string(), "image2".to_string()], vec![ Container { image: Some("image1".to_string()), resources: Some(ResourceRequirements { limits: Some(placeholder_limits1), requests: Some(placeholder_requests1), }), ..Default::default() }, Container { image: Some("image2".to_string()), resources: Some(ResourceRequirements { limits: Some(placeholder_limits2), requests: Some(placeholder_requests2), }), ..Default::default() }, ], ); }
rust_cleaned_test_functions.jsonl/1226
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 759 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 85337, 13594, 46163, 6615, 45233, 10260, 20568, 368, 341, 286, 1077, 5206, 5878, 31820, 16, 25, 11765, 17342, 929, 284, 425, 6533, 2227, 486, 931, 543, 286, 5878, 31820, 16, 7030, 7, 54260, 53927,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_iterator() { let dir = TempDir::new("storage_dir").unwrap(); let mut id_tracker = SimpleIdTracker::open(dir.path()).unwrap(); id_tracker.set_link(200.into(), 0).unwrap(); id_tracker.set_link(100.into(), 1).unwrap(); id_tracker.set_link(150.into(), 2).unwrap(); id_tracker.set_link(120.into(), 3).unwrap(); id_tracker.set_link(180.into(), 4).unwrap(); id_tracker.set_link(110.into(), 5).unwrap(); id_tracker.set_link(115.into(), 6).unwrap(); id_tracker.set_link(190.into(), 7).unwrap(); id_tracker.set_link(177.into(), 8).unwrap(); id_tracker.set_link(118.into(), 9).unwrap(); let first_four = id_tracker.iter_from(None).take(4).collect_vec(); assert_eq!(first_four.len(), 4); assert_eq!(first_four[0].0, 100.into()); let last = id_tracker.iter_from(Some(first_four[3].0)).collect_vec(); assert_eq!(last.len(), 7); }
rust_cleaned_test_functions.jsonl/2114
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 465 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13491, 368, 341, 286, 1077, 5419, 284, 19944, 6184, 486, 931, 445, 16172, 4334, 1827, 15454, 1428, 286, 1077, 5206, 877, 50264, 284, 8993, 764, 31133, 486, 2508, 14161, 3875, 6011, 15454, 1428, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_dh_generate_key_compute_key() { let dh1 = Dh::get_2048_224().unwrap().generate_key().unwrap(); let dh2 = Dh::get_2048_224().unwrap().generate_key().unwrap(); let shared_a = dh1.compute_key(dh2.public_key()).unwrap(); let shared_b = dh2.compute_key(dh1.public_key()).unwrap(); assert_eq!(shared_a, shared_b); }
rust_cleaned_test_functions.jsonl/54787
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 181 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 814, 71, 48851, 3097, 57028, 3097, 368, 341, 286, 1077, 34096, 16, 284, 43227, 486, 455, 62, 17, 15, 19, 23, 62, 17, 17, 19, 1005, 15454, 1005, 19366, 3097, 1005, 15454, 543, 286, 1077, 34096,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_raycast() { use crate::geom::euclid::approxeq::ApproxEq; use crate::path::Path; let mut builder = Path::builder(); builder.move_to(point(0.0, 0.0)); builder.line_to(point(1.0, 0.0)); builder.line_to(point(1.0, 1.0)); builder.line_to(point(0.0, 1.0)); builder.close(); let path = builder.build(); assert!(raycast_path( &Ray { origin: point(-1.0, 2.0), direction: vector(1.0, 0.0) }, path.iter(), 0.1 ) .is_none()); let hit = raycast_path( &Ray { origin: point(-1.0, 0.5), direction: vector(1.0, 0.0), }, path.iter(), 0.1, ) .unwrap(); assert!(hit.position.approx_eq(&point(0.0, 0.5))); assert!(hit.normal.approx_eq(&vector(-1.0, 0.0))); let hit = raycast_path( &Ray { origin: point(-1.0, 0.0), direction: vector(1.0, 0.0), }, path.iter(), 0.1, ) .unwrap(); assert!(hit.position.approx_eq(&point(0.0, 0.0))); let hit = raycast_path( &Ray { origin: point(0.5, 0.5), direction: vector(1.0, 0.0), }, path.iter(), 0.1, ) .unwrap(); assert!(hit.position.approx_eq(&point(1.0, 0.5))); assert!(hit.normal.approx_eq(&vector(-1.0, 0.0))); let hit = raycast_path( &Ray { origin: point(0.0, -1.0), direction: vector(1.0, 1.0), }, path.iter(), 0.1, ) .unwrap(); assert!(hit.position.approx_eq(&point(1.0, 0.0))); }
rust_cleaned_test_functions.jsonl/128686
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 913 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 51287, 368, 341, 262, 990, 17717, 486, 41916, 486, 20128, 75044, 486, 15707, 8371, 80, 486, 28588, 12606, 80, 280, 262, 990, 17717, 486, 2343, 486, 1820, 401, 262, 1077, 5206, 7363, 284, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mount_does_not_upgrade() -> anyhow::Result<()> { let (_kernel, current_task) = create_kernel_and_task(); let root_fs = TmpFs::new(); let root_node = Arc::clone(root_fs.root()); let _dev_node = root_node.create_dir(b"dev").expect("failed to mkdir dev"); let dev_fs = TmpFs::new(); let dev_root_node = Arc::clone(dev_fs.root()); let _dev_pts_node = dev_root_node.create_dir(b"pts").expect("failed to mkdir pts"); let ns = Namespace::new(root_fs.clone()); let mut context = LookupContext::default(); let dev = ns .root() .lookup_child(&current_task, &mut context, b"dev") .expect("failed to lookup dev"); dev.mount(WhatToMount::Fs(dev_fs), MountFlags::empty()) .expect("failed to mount dev root node"); let mut context = LookupContext::default(); let new_dev = ns .root() .lookup_child(&current_task, &mut context, b"dev") .expect("failed to lookup dev again"); assert!(!Arc::ptr_eq(&dev.entry, &new_dev.entry)); assert_ne!(&dev, &new_dev); let mut context = LookupContext::default(); let _new_pts = new_dev .lookup_child(&current_task, &mut context, b"pts") .expect("failed to lookup pts"); let mut context = LookupContext::default(); assert!(dev.lookup_child(&current_task, &mut context, b"pts").is_err()); Ok(()) }
rust_cleaned_test_functions.jsonl/80
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 692 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 57593, 96374, 7913, 67794, 368, 1464, 88964, 486, 2077, 71698, 341, 286, 1077, 5453, 23248, 11, 1482, 12184, 8, 284, 1855, 26876, 8378, 12184, 543, 286, 1077, 3704, 34470, 284, 350, 1307, 48300, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_scalar_multiplication() { let result: Matrix4x4<f64> = (1_f64 / 32_f64) * Matrix4x4::new( 7_f64, -1_f64, -1_f64, -1_f64, -1_f64, 7_f64, -1_f64, -1_f64, -1_f64, -1_f64, 7_f64, -1_f64, -1_f64, -1_f64, -1_f64, 7_f64 ); let expected: Matrix4x4<f64> = Matrix4x4::new( (1_f64 / 32_f64) * 7_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * 7_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * 7_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * -1_f64, (1_f64 / 32_f64) * 7_f64 ); assert_eq!(result, expected); }
rust_cleaned_test_functions.jsonl/129090
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 582 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41652, 91802, 1693, 368, 341, 286, 1077, 1102, 25, 11631, 19, 87, 19, 63895, 21, 19, 29, 284, 320, 16, 761, 21, 19, 608, 220, 18, 17, 761, 21, 19, 8, 353, 11631, 19, 87, 19, 486, 931, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_ascii_success() { let mut src: Vec<u8> = Vec::with_capacity(128); src.resize(128, 0); for i in 0..src.len() { src[i] = i as u8; } for i in 0..src.len() { assert!(is_ascii(&src[i..])); } }
rust_cleaned_test_functions.jsonl/27296
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 174 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 50238, 18632, 368, 341, 286, 1077, 5206, 2286, 25, 11312, 34837, 23, 29, 284, 11312, 486, 4197, 35603, 7, 16, 17, 23, 317, 286, 2286, 17382, 7, 16, 17, 23, 11, 220, 15, 317, 286, 369, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_service_config_discard_single_apply_panic() { let mut testkit = testkit_with_supervisor_and_service(1); let initiator_id = testkit.network().us().validator_id().unwrap(); let params = "apply_panic".to_owned(); let propose = ConfigProposeBuilder::new(CFG_CHANGE_HEIGHT) .extend_service_config_propose(params) .build(); testkit .create_block_with_transaction(sign_config_propose_transaction( &testkit, propose, initiator_id, )) .transactions[0] .status() .expect("Transaction with change propose discarded."); testkit.create_blocks_until(CFG_CHANGE_HEIGHT); let snapshot = testkit.snapshot(); let err = snapshot .for_core() .call_errors(testkit.height()) .get(&CallInBlock::after_transactions(SUPERVISOR_INSTANCE_ID)) .unwrap(); assert!(err.description().contains("Configure panic")); // Create one more block for supervisor to remove failed config. testkit.create_block(); assert_eq!(config_propose_entry(&testkit), None); check_service_actual_param(&testkit, None); }
rust_cleaned_test_functions.jsonl/93845
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 483 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12267, 5332, 37745, 567, 19487, 36551, 620, 31270, 368, 341, 262, 1077, 5206, 1273, 8226, 284, 1273, 8226, 6615, 23723, 31396, 8378, 12267, 7, 16, 317, 262, 1077, 98040, 842, 284, 1273, 8226, 2057...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_version_filetype_from_str() { assert_eq!( VersionFiletype::from_str("package.json").unwrap(), VersionFiletype::JSON ); assert_eq!( VersionFiletype::from_str("version.json").unwrap(), VersionFiletype::JSON ); assert_eq!( VersionFiletype::from_str("Cargo.toml").unwrap(), VersionFiletype::TOML ); assert_eq!( VersionFiletype::from_str("version.toml").unwrap(), VersionFiletype::TOML ); assert!(VersionFiletype::from_str("version.txt").is_err(),); }
rust_cleaned_test_functions.jsonl/46661
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 328 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9438, 2458, 1313, 5673, 2895, 368, 341, 286, 2060, 10714, 33673, 310, 6079, 1703, 1313, 486, 1499, 2895, 445, 1722, 4323, 1827, 15454, 3148, 310, 6079, 1703, 1313, 486, 5370, 198, 286, 1439, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_logging_statistics() { let mut runner = Runner::new(); let _query = runner.proxy.start_logging( "test", &mut vec![&mut Metric::Temperature(Temperature { sampling_interval_ms: 100, statistics_args: Some(Box::new(StatisticsArgs { statistics_interval_ms: 300 })), })] .into_iter(), 1_000, false, false, ); runner.run_server_task_until_stalled(); for i in 0..9 { runner.cpu_temperature.set(30.0 + i as f32); runner.gpu_temperature.set(40.0 + i as f32); runner.iterate_logging_task(); if i < 2 { // Check statistics data is not available for the first 200 ms. assert_data_tree!( runner.inspector, root: { MetricsLogger: { test: { TemperatureLogger: { "elapsed time (ms)": 100 * (1 + i as i64), "cpu": { "data (°C)": runner.cpu_temperature.get() as f64, "statistics": { "(start ms, end ms]": vec![std::i64::MIN, std::i64::MIN], "max (°C)": f64::MIN, "min (°C)": f64::MIN, "average (°C)": f64::MIN, } }, "/dev/fake/gpu_temperature": { "data (°C)": runner.gpu_temperature.get() as f64, "statistics": { "(start ms, end ms]": vec![std::i64::MIN, std::i64::MIN], "max (°C)": f64::MIN, "min (°C)": f64::MIN, "average (°C)": f64::MIN, } } } } } } ); } else { // Check statistics data is updated every 300 ms. assert_data_tree!( runner.inspector, root: { MetricsLogger: { test: { TemperatureLogger: { "elapsed time (ms)": 100 * (i + 1 as i64), "cpu": { "data (°C)": (30 + i) as f64, "statistics": { "(start ms, end ms]": vec![100 * (i - 2 - (i + 1) % 3 as i64), 100 * (i + 1 - (i + 1) % 3 as i64)], "max (°C)": (30 + i - (i + 1) % 3) as f64, "min (°C)": (28 + i - (i + 1) % 3) as f64, "average (°C)": (29 + i - (i + 1) % 3) as f64, } }, "/dev/fake/gpu_temperature": { "data (°C)": (40 + i) as f64, "statistics": { "(start ms, end ms]": vec![100 * (i - 2 - (i + 1) % 3 as i64), 100 * (i + 1 - (i + 1) % 3 as i64)], "max (°C)": (40 + i - (i + 1) % 3) as f64, "min (°C)": (38 + i - (i + 1) % 3) as f64, "average (°C)": (39 + i - (i + 1) % 3) as f64, } } } } } } ); } } // With one moreect. runner.iterate_logging_task(); assert_data_tree!( runner.inspector, root: { MetricsLogger: {} } ); }
rust_cleaned_test_functions.jsonl/66709
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 3563 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 59982, 49569, 368, 341, 286, 1077, 5206, 22259, 284, 44946, 486, 931, 1428, 286, 1077, 716, 1631, 284, 22259, 41103, 4962, 59982, 1006, 310, 330, 1944, 756, 310, 609, 6984, 7486, 20703, 5, 6984, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_parse() { let memo_instruction = CompiledInstruction { program_id_index: 0, accounts: vec![], data: vec![240, 159, 166, 150], }; let expected_json = json!({ "spl-memo": "🦖" }); assert_eq!( parse(&MEMO_PROGRAM_ID, &memo_instruction), Some(expected_json) ); let non_parsable_program_id = Pubkey::new(&[1; 32]); assert_eq!(parse(&non_parsable_program_id, &memo_instruction), None); }
rust_cleaned_test_functions.jsonl/121422
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 295 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 368, 341, 286, 1077, 21438, 54923, 284, 96471, 16664, 341, 310, 2025, 842, 3560, 25, 220, 15, 345, 310, 9618, 25, 7486, 20703, 1259, 310, 821, 25, 7486, 20703, 17, 19, 15, 11, 220, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_only_clips() { let x = b"GGAAAAAAAAAAAAA"; let y = b"TTTTAATTTGTGTAAAAAATAATA"; let base_score = Scoring::from_scores(-4, -4, 4, -7); let scoring = Scoring { xclip_prefix: 0, xclip_suffix: 0, yclip_suffix: 0, ..base_score }; let mut al = Aligner::with_scoring(scoring); let alignment = al.custom(x, y); assert_eq!(alignment.score, 0); }
rust_cleaned_test_functions.jsonl/16856
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 257 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18410, 6794, 3077, 368, 341, 286, 1077, 856, 284, 293, 1, 22254, 57905, 25699, 32, 876, 286, 1077, 379, 284, 293, 1, 14903, 14903, 32, 828, 14903, 25388, 25388, 25699, 32, 4485, 4485, 876, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_make_base_gaussian() -> Fallible<()> { let measurement = Result::from(opendp_meas__make_base_gaussian( util::into_raw(0.0) as *const c_void, "AllDomain<f64>".to_char_p()))?; let arg = AnyObject::new_raw(1.0); let res = core::opendp_core__measurement_invoke(&measurement, arg); let res: f64 = Fallible::from(res)?.downcast()?; assert_eq!(res, 1.0); Ok(()) }
rust_cleaned_test_functions.jsonl/80688
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 218 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28230, 7651, 1889, 46972, 368, 1464, 14785, 1238, 71698, 341, 286, 1077, 18662, 284, 5714, 486, 1499, 17096, 408, 79, 95786, 563, 6927, 7651, 1889, 46972, 1006, 310, 4094, 486, 18122, 16067, 7, 15...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_concatenation() { let a0 = DecimationNode::new(Complex::from(0.0), 1, 0, false); let a4 = DecimationNode::new(Complex::from(4.0), 1, 1, true); let a2 = DecimationNode::new(Complex::from(2.0), 1, 0, false); let a6 = DecimationNode::new(Complex::from(6.0), 1, 1, true); let a1 = DecimationNode::new(Complex::from(1.0), 1, 0, false); let a5 = DecimationNode::new(Complex::from(5.0), 1, 1, true); let a3 = DecimationNode::new(Complex::from(3.0), 1, 0, false); let a7 = DecimationNode::new(Complex::from(7.0), 1, 1, true); let concat = DecimationLeaf::generate_parent( DecimationLeaf::new(vec![a0, a4], vec![a2, a6], 1), DecimationLeaf::new(vec![a1, a5], vec![a3, a7], 1) ); let exp = DecimationLeaf::new(vec![a0, a4, a2, a6], vec![a1, a5, a3, a7], 2); let conc_lhs = concat.lhs .into_iter() .map(|node| node.element) .collect::<Vec<_>>(); let conc_rhs = concat.rhs .into_iter() .map(|node| node.element) .collect::<Vec<_>>(); let exp_lhs = exp.lhs .into_iter() .map(|node| node.element) .collect::<Vec<_>>(); let exp_rhs = exp.rhs .into_iter() .map(|node| node.element) .collect::<Vec<_>>(); assert_eq!(exp_lhs, conc_lhs); assert_eq!(exp_rhs, conc_rhs); }
rust_cleaned_test_functions.jsonl/586
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 819 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 57478, 268, 367, 741, 262, 341, 286, 1077, 264, 15, 284, 3714, 5465, 1955, 486, 931, 7, 31137, 486, 1499, 7, 15, 13, 15, 701, 220, 16, 11, 220, 15, 11, 895, 317, 286, 1077, 264, 19, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cp_arg_symlink() { let (at, mut ucmd) = at_and_ucmd!(); ucmd.arg(TEST_HELLO_WORLD_SOURCE) .arg("--symbolic-link") .arg(TEST_HELLO_WORLD_DEST) .succeeds(); assert!(at.is_symlink(TEST_HELLO_WORLD_DEST)); }
rust_cleaned_test_functions.jsonl/21242
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 151 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39811, 6057, 58530, 44243, 368, 341, 262, 1077, 320, 266, 11, 5206, 575, 8710, 8, 284, 518, 8378, 68887, 2277, 0, 543, 262, 575, 8710, 21186, 50320, 69235, 1593, 38913, 25430, 340, 286, 659, 858...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_commands() { let td: Vec<String> = vec![ "nop +0".to_string(), "acc +1".to_string(), "jmp -4".to_string(), ]; let commands = read_commands(&td).unwrap(); assert_eq!(commands[0], Command::Nop(0)); assert_eq!(commands[1], Command::Acc(1)); assert_eq!(commands[2], Command::Jmp(-4)); }
rust_cleaned_test_functions.jsonl/50506
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 213 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 44151, 368, 341, 286, 1077, 17941, 25, 11312, 3464, 29, 284, 7486, 90515, 310, 330, 62813, 488, 15, 3263, 983, 3904, 3148, 310, 330, 4475, 488, 16, 3263, 983, 3904, 3148, 310, 330, 61055, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_root_error_is_not_swallowed_on_parse_error() -> Result<(), String> { init(); let raw_schema = r#"/not/a/real/file"#; let error = Schema::parse_str(raw_schema).unwrap_err(); if let Error::ParseSchemaJson(e) = error { assert!( e.to_string().contains("expected value at line 1 column 1"), "{}", e ); Ok(()) } else { Err(format!( "Expected serde_json::error::Error, got {:?}", error )) } }
rust_cleaned_test_functions.jsonl/69042
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 278 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12993, 4096, 6892, 7913, 32581, 20967, 4470, 21039, 4096, 368, 1464, 5714, 68843, 923, 29, 341, 262, 2930, 1428, 262, 1077, 7112, 25371, 284, 435, 2, 3115, 1921, 14186, 14, 7951, 23903, 57676, 280...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_empty_can_be_expanded() { let mut r = Reader::from_str("<a />"); r.trim_text(true).expand_empty_elements(true); next_eq!(r, Start, b"a", End, b"a"); }
rust_cleaned_test_functions.jsonl/42067
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 90 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15124, 27421, 21263, 14214, 6465, 368, 341, 262, 1077, 5206, 435, 284, 25166, 486, 1499, 2895, 9639, 64, 6206, 797, 262, 435, 16419, 4326, 3715, 568, 32317, 15124, 22801, 3715, 317, 262, 1790, 107...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_handle_burn_from() { let (init_result, mut deps) = init_helper_with_config( vec![InitialBalance { address: HumanAddr("bob".to_string()), amount: Uint128(10000), }], false, false, false, true, 0, ); assert!( init_result.is_ok(), "Init failed: {}", init_result.err().unwrap() ); let (init_result_for_failure, mut deps_for_failure) = init_helper(vec![InitialBalance { address: HumanAddr("bob".to_string()), amount: Uint128(10000), }]); assert!( init_result_for_failure.is_ok(), "Init failed: {}", init_result_for_failure.err().unwrap() ); // test when burn disabled let handle_msg = HandleMsg::BurnFrom { owner: HumanAddr("bob".to_string()), amount: Uint128(2500), memo: None, padding: None, }; let handle_result = handle(&mut deps_for_failure, mock_env("alice", &[]), handle_msg); let error = extract_error_msg(handle_result); assert!(error.contains("Burn functionality is not enabled for this token.")); // Burn before allowance let handle_msg = HandleMsg::BurnFrom { owner: HumanAddr("bob".to_string()), amount: Uint128(2500), memo: None, padding: None, }; let handle_result = handle(&mut deps, mock_env("alice", &[]), handle_msg); let error = extract_error_msg(handle_result); assert!(error.contains("insufficient allowance")); // Burn more than allowance let handle_msg = HandleMsg::IncreaseAllowance { spender: HumanAddr("alice".to_string()), amount: Uint128(2000), padding: None, expiration: None, }; let handle_result = handle(&mut deps, mock_env("bob", &[]), handle_msg); assert!( handle_result.is_ok(), "handle() failed: {}", handle_result.err().unwrap() ); let handle_msg = HandleMsg::BurnFrom { owner: HumanAddr("bob".to_string()), amount: Uint128(2500), memo: None, padding: None, }; let handle_result = handle(&mut deps, mock_env("alice", &[]), handle_msg); let error = extract_error_msg(handle_result); assert!(error.contains("insufficient allowance")); // Sanity check let handle_msg = HandleMsg::BurnFrom { owner: HumanAddr("bob".to_string()), amount: Uint128(2000), memo: None, padding: None, }; let handle_result = handle(&mut deps, mock_env("alice", &[]), handle_msg); assert!( handle_result.is_ok(), "handle() failed: {}", handle_result.err().unwrap() ); let bob_canonical = deps .api .canonical_address(&HumanAddr("bob".to_string())) .unwrap(); let bob_balance = crate::state::ReadonlyBalances::from_storage(&deps.storage) .account_amount(&bob_canonical); assert_eq!(bob_balance, 10000 - 2000); let total_supply = ReadonlyConfig::from_storage(&deps.storage).total_supply(); assert_eq!(total_supply, 10000 - 2000); // Second burn more than allowance let handle_msg = HandleMsg::BurnFrom { owner: HumanAddr("bob".to_string()), amount: Uint128(1), memo: None, padding: None, }; let handle_result = handle(&mut deps, mock_env("alice", &[]), handle_msg); let error = extract_error_msg(handle_result); assert!(error.contains("insufficient allowance")); }
rust_cleaned_test_functions.jsonl/69609
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1927 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10630, 880, 399, 5673, 368, 341, 286, 1077, 320, 2327, 5287, 11, 5206, 48178, 8, 284, 2930, 10418, 6615, 5332, 1006, 310, 7486, 20703, 6341, 21190, 341, 394, 2621, 25, 11097, 13986, 445, 47086, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_undefined_default_parameter_removed() { test( "function f(x=undefined,y) { }", "function f(x,y) { }", ); test( "function f(x,y=undefined,z) { }", "function f(x,y ,z) { }", ); test( "function f(x=undefined,y=undefined,z=undefined) { }", "function f(x, y, z) { }", ); }
rust_cleaned_test_functions.jsonl/484
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 256 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 9614, 9993, 24899, 68248, 368, 341, 262, 1273, 1006, 286, 330, 1688, 282, 2075, 28, 9614, 7358, 8, 314, 220, 335, 497, 715, 286, 330, 1688, 282, 2075, 7358, 8, 1797, 314, 220, 335, 756, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_strict_mode_dup_func_parameters() { // Checks that a function cannot contain duplicate parameter let scenario = r#" 'use strict'; function f(a, b, b) {} "#; check_output(&[TestAction::TestStartsWith( scenario, "Uncaught \"SyntaxError\": ", )]); }
rust_cleaned_test_functions.jsonl/42876
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 137 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2895, 849, 7302, 51932, 9596, 18263, 368, 341, 262, 442, 24843, 429, 264, 729, 4157, 6644, 22513, 5733, 87079, 262, 1077, 15048, 284, 435, 2, 698, 262, 364, 810, 7304, 1010, 262, 729, 282, 2877,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_interaction_response() { let value = InteractionResponse { kind: InteractionResponseType::ChannelMessageWithSource, data: Some(InteractionResponseData { allowed_mentions: None, attachments: None, choices: None, components: None, content: Some("test".into()), custom_id: None, embeds: None, flags: Some(MessageFlags::EPHEMERAL), title: None, tts: None, }), }; serde_test::assert_tokens( &value, &[ Token::Struct { name: "InteractionResponse", len: 2, }, Token::Str("type"), Token::U8(4), Token::Str("data"), Token::Some, Token::Struct { name: "InteractionResponseData", len: 2, }, Token::Str("content"), Token::Some, Token::Str("test"), Token::Str("flags"), Token::Some, Token::U64(64), Token::StructEnd, Token::StructEnd, ], ); }
rust_cleaned_test_functions.jsonl/9464
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 833 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 97394, 9655, 368, 341, 286, 1077, 897, 284, 42707, 2582, 341, 310, 3093, 25, 42707, 53388, 486, 9629, 2052, 2354, 3608, 345, 310, 821, 25, 4329, 7, 31311, 2582, 1043, 341, 394, 5420, 30063, 25, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_version_priority_ord() { // sorting makes sense from a "greater than" generation perspective: assert!(Version::Stable(2).priority() > Version::Stable(1).priority()); assert!(Version::Stable(1).priority() > Version::Beta(1, None).priority()); assert!(Version::Stable(1).priority() > Version::Beta(2, None).priority()); assert!(Version::Stable(2).priority() > Version::Alpha(1, Some(2)).priority()); assert!(Version::Stable(1).priority() > Version::Alpha(2, Some(2)).priority()); assert!(Version::Beta(1, None).priority() > Version::Nonconformant("ver3".into()).priority()); assert!(Version::Stable(2).priority() > Version::Stable(1).priority()); assert!(Version::Stable(1).priority() > Version::Beta(2, None).priority()); assert!(Version::Stable(1).priority() > Version::Beta(2, Some(2)).priority()); assert!(Version::Stable(1).priority() > Version::Alpha(2, None).priority()); assert!(Version::Stable(1).priority() > Version::Alpha(2, Some(3)).priority()); assert!(Version::Stable(1).priority() > Version::Nonconformant("foo".to_string()).priority()); assert!(Version::Beta(1, Some(1)).priority() > Version::Beta(1, None).priority()); assert!(Version::Beta(1, Some(2)).priority() > Version::Beta(1, Some(1)).priority()); assert!(Version::Beta(1, None).priority() > Version::Alpha(1, None).priority()); assert!(Version::Beta(1, None).priority() > Version::Alpha(1, Some(3)).priority()); assert!(Version::Beta(1, None).priority() > Version::Nonconformant("foo".to_string()).priority()); assert!(Version::Beta(1, Some(2)).priority() > Version::Nonconformant("foo".to_string()).priority()); assert!(Version::Alpha(1, Some(1)).priority() > Version::Alpha(1, None).priority()); assert!(Version::Alpha(1, Some(2)).priority() > Version::Alpha(1, Some(1)).priority()); assert!(Version::Alpha(1, None).priority() > Version::Nonconformant("foo".to_string()).priority()); assert!(Version::Alpha(1, Some(2)).priority() > Version::Nonconformant("foo".to_string()).priority()); assert!( Version::Nonconformant("bar".to_string()).priority() > Version::Nonconformant("foo".to_string()).priority() ); assert!( Version::Nonconformant("foo1".to_string()).priority() > Version::Nonconformant("foo10".to_string()).priority() ); // sort orders by default are ascending // sorting with std::cmp::Reverse on priority gives you the highest priority first let mut vers = vec![ Version::Beta(2, Some(2)), Version::Stable(1), Version::Nonconformant("hi".into()), Version::Alpha(3, Some(2)), Version::Stable(2), Version::Beta(2, Some(3)), ]; vers.sort_by_cached_key(|x| Reverse(x.priority())); assert_eq!(vers, vec![ Version::Stable(2), Version::Stable(1), Version::Beta(2, Some(3)), Version::Beta(2, Some(2)), Version::Alpha(3, Some(2)), Version::Nonconformant("hi".into()), ]); }
rust_cleaned_test_functions.jsonl/116491
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1342 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9438, 38161, 67324, 368, 341, 286, 442, 28273, 3643, 5530, 504, 264, 330, 65235, 1091, 1, 9471, 13057, 510, 286, 2060, 10297, 5637, 486, 623, 480, 7, 17, 568, 23582, 368, 861, 6079, 486, 623, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_moduleinfo_from_json() { let info = super::ModuleInfo::try_from(MODULE_FOO_JSON).unwrap(); assert_eq!(info.module_name, "foo"); assert_eq!(info.path.len(), 1); assert_eq!(info.installed.len(), 2); }
rust_cleaned_test_functions.jsonl/18375
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 122 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10750, 2733, 5673, 9455, 368, 341, 286, 1077, 3546, 284, 2256, 486, 3332, 1731, 486, 1539, 5673, 3189, 9648, 1400, 19499, 25356, 568, 15454, 543, 286, 2060, 10714, 10297, 2733, 10076, 1269, 11, 33...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_binary_expr_operator_precedence( ) -> std::result::Result<(), nom::Err<ParseError<'static>>> { #[rustfmt::skip] let tests = [ ("42 + bar", vec![BinaryOp::Add]), ("42.42 + bar", vec![BinaryOp::Add]), ("42.42 + bar % 9000", vec![BinaryOp::Mod, BinaryOp::Add]), ("-42.42 + -bar % 9000", vec![BinaryOp::Mod, BinaryOp::Add]), ("foo + bar", vec![BinaryOp::Add]), ("foo + bar - baz", vec![BinaryOp::Add, BinaryOp::Sub]), ("foo + bar * baz", vec![BinaryOp::Mul, BinaryOp::Add]), ("foo * bar + baz", vec![BinaryOp::Mul, BinaryOp::Add]), ("foo * bar ^ baz", vec![BinaryOp::Pow, BinaryOp::Mul]), ("foo * bar ^ baz - qux / abc", vec![BinaryOp::Pow, BinaryOp::Mul, BinaryOp::Div, BinaryOp::Sub]), ]; fn extract_operators(expr: &Expr) -> Vec<BinaryOp> { match expr { Expr::BinaryOperation(e) => extract_operators(e.lhs()) .into_iter() .chain(extract_operators(e.rhs()).into_iter()) .chain(vec![e.op()].into_iter()) .collect(), Expr::UnaryOperation(_, e) => extract_operators(e.as_ref()), _ => vec![], } } for (input, expected_ops) in &tests { let (_, ex) = expr(None)(Span::new(input))?; assert_eq!(expected_ops, &extract_operators(&ex)); } Ok(()) }
rust_cleaned_test_functions.jsonl/879
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 821 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31761, 21915, 40594, 10442, 1998, 763, 1006, 262, 873, 1464, 1460, 486, 1382, 486, 2077, 68843, 9662, 486, 7747, 27, 14463, 1454, 18291, 1978, 20154, 341, 286, 11506, 35788, 12501, 486, 20599, 921, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_coalesce_none() { let mut v = vec![(1, 1), (3, 3)]; v.coalesce(1, (2, 2)); assert_eq!(v, [(1, 1), (2, 2), (3, 3)]) }
rust_cleaned_test_functions.jsonl/57406
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 89 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11393, 73250, 31488, 368, 341, 262, 1077, 5206, 348, 284, 7486, 0, 9697, 16, 11, 220, 16, 701, 320, 18, 11, 220, 18, 12587, 262, 348, 6830, 73250, 7, 16, 11, 320, 17, 11, 220, 17, 1106, 26...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_try_from_get_machine_config() { let (mut sender, receiver) = UnixStream::pair().unwrap(); let mut connection = HttpConnection::new(receiver); sender .write_all(b"GET /machine-config HTTP/1.1\r\n\r\n") .unwrap(); assert!(connection.try_read().is_ok()); let req = connection.pop_parsed_request().unwrap(); assert!(ParsedRequest::try_from_request(&req).is_ok()); }
rust_cleaned_test_functions.jsonl/43141
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 211 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53283, 5673, 3062, 38695, 5332, 368, 341, 286, 1077, 320, 6984, 4646, 11, 13964, 8, 284, 46995, 3027, 486, 12670, 1005, 15454, 543, 286, 1077, 5206, 3633, 284, 4823, 4526, 486, 931, 78126, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_v1() -> Result<(), Error> { let buffer = ByteView::open(fixture("symcache/compat/v1.symc"))?; let symcache = SymCache::parse(&buffer)?; // The symcache ID has changed from UUID to DebugId assert_eq!( symcache.debug_id(), "67e9247c-814e-392b-a027-dbde6748fcbf".parse().unwrap() ); let function = symcache .functions() .next() .expect("no functions in symcache")?; assert_eq!("_mh_execute_header", function.name().as_str()); Ok(()) }
rust_cleaned_test_functions.jsonl/16065
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 244 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2273, 16, 368, 1464, 5714, 68843, 4600, 29, 341, 262, 1077, 4147, 284, 10906, 851, 486, 2508, 94886, 445, 23802, 9360, 14, 18331, 5457, 16, 50901, 66, 2761, 37445, 262, 1077, 7886, 9360, 284, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_verify_bank_hash() { use BankHashVerificationError::*; solana_logger::setup(); let db = AccountsDb::new(Vec::new(), &ClusterType::Development); let key = solana_sdk::pubkey::new_rand(); let some_data_len = 0; let some_slot: Slot = 0; let account = AccountSharedData::new(1, some_data_len, &key); let ancestors = vec![(some_slot, 0)].into_iter().collect(); db.store_uncached(some_slot, &[(&key, &account)]); db.add_root(some_slot); db.update_accounts_hash_test(some_slot, &ancestors); assert_matches!( db.verify_bank_hash_and_lamports(some_slot, &ancestors, 1, true), Ok(_) ); db.bank_hashes.write().unwrap().remove(&some_slot).unwrap(); assert_matches!( db.verify_bank_hash_and_lamports(some_slot, &ancestors, 1, true), Err(MissingBankHash) ); let some_bank_hash = Hash::new(&[0xca; HASH_BYTES]); let bank_hash_info = BankHashInfo { hash: some_bank_hash, snapshot_hash: Hash::new(&[0xca; HASH_BYTES]), stats: BankHashStats::default(), }; db.bank_hashes .write() .unwrap() .insert(some_slot, bank_hash_info); assert_matches!( db.verify_bank_hash_and_lamports(some_slot, &ancestors, 1, true), Err(MismatchedBankHash) ); }
rust_cleaned_test_functions.jsonl/1379
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 745 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35638, 35733, 8950, 368, 341, 286, 990, 8547, 6370, 62339, 1454, 56162, 286, 2048, 3362, 27413, 486, 15188, 543, 286, 1077, 2927, 284, 40655, 7994, 486, 931, 49923, 486, 931, 1507, 609, 28678, 929...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_write_gtk_too_small_buffer() { Writer::new(FixedSizedTestBuffer::new(10)) .write_gtk(&Gtk::new(2, GtkInfoTx::BothRxTx, &vec![24; 5])) .expect_err("expected failure writing GTK KDE"); }
rust_cleaned_test_functions.jsonl/52434
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 122 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9165, 1889, 6242, 2346, 78, 31966, 7776, 368, 341, 286, 29404, 486, 931, 7832, 3286, 50, 1506, 2271, 4095, 486, 931, 7, 16, 15, 1171, 310, 659, 4934, 1889, 6242, 2099, 45103, 486, 931, 7, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_encode() { let input = "Hello, World!"; new_ucmd!() .pipe_in(input) .succeeds() .stdout_only("JBSWY3DPFQQFO33SNRSCC===\n"); // spell-checker:disable-line // Using '-' as our file new_ucmd!() .arg("-") .pipe_in(input) .succeeds() .stdout_only("JBSWY3DPFQQFO33SNRSCC===\n"); // spell-checker:disable-line }
rust_cleaned_test_functions.jsonl/23687
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 217 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11224, 368, 341, 262, 1077, 1946, 284, 330, 9707, 11, 4337, 26782, 262, 501, 68887, 2277, 0, 741, 286, 659, 13768, 1243, 5384, 340, 286, 659, 82, 29264, 82, 741, 286, 659, 36358, 18410, 445, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_matrix_transpose() { let matrix = Matrix2x3::new( 1_i32, 2_i32, 3_i32, 4_i32, 5_i32, 6_i32 ); let expected = Matrix3x2::new( 1_i32, 3_i32, 5_i32, 2_i32, 4_i32, 6_i32 ); let result = matrix.transpose(); assert_eq!(result, expected); }
rust_cleaned_test_functions.jsonl/129208
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 232 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10193, 7965, 2900, 368, 341, 286, 1077, 6172, 284, 11631, 17, 87, 18, 486, 931, 1006, 310, 220, 16, 5318, 18, 17, 11, 220, 17, 5318, 18, 17, 11, 715, 310, 220, 18, 5318, 18, 17, 11, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_update() { let db = &Database::new(Config::default()).unwrap(); let result = db.update(|txn| -> Result<()> { assert!(txn.update("1", Data::Int(1)).is_none()); assert_eq!(&Data::Int(1), txn.get("1").unwrap()); Ok(()) }); assert!(result.is_ok()); }
rust_cleaned_test_functions.jsonl/86758
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 238 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8882, 368, 341, 262, 1077, 2927, 284, 609, 5988, 486, 931, 33687, 486, 2258, 6011, 15454, 543, 262, 1077, 1102, 284, 2927, 5317, 22428, 73370, 91, 1464, 5714, 71698, 341, 7561, 2060, 10297, 73370,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_iterate_into_string() { let words = vec!["hello", " ", "world"]; let capitalized_words = words.iter().fold(String::default(), |acc, word| { format!("{}{}", acc, capitalize_first(word)) }); assert_eq!(capitalized_words, "Hello World"); }
rust_cleaned_test_functions.jsonl/80479
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 137 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11723, 349, 45514, 3904, 368, 341, 286, 1077, 4244, 284, 7486, 0, 1183, 14990, 497, 330, 3670, 330, 14615, 6332, 286, 1077, 97321, 18981, 284, 4244, 19471, 1005, 19961, 2242, 486, 2258, 1507, 760,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fail_struct_too_big() { let src_data = b"(test) a {a 1 b 2 c 3}"; let mut limits = yass_parser::ParserLimits::unlimited(); limits.max_struct_size = 2; let expected_error = yass_parser::ParserError::StructTooBig { pos: yass::Pos::new(0, 18) }; assert_eq!(yass_parser::parse(limits, src_data).unwrap_err(), expected_error); }
rust_cleaned_test_functions.jsonl/126512
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22121, 15126, 2346, 78, 36386, 368, 341, 262, 1077, 2286, 1769, 284, 293, 29209, 1944, 8, 264, 314, 64, 220, 16, 293, 220, 17, 272, 220, 18, 26259, 262, 1077, 5206, 13388, 284, 379, 395, 18517...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_locked_out_root_slot_child_pass() { let mut tower = Tower::new_for_tests(0, 0.67); let ancestors = vec![(1, vec![0].into_iter().collect())] .into_iter() .collect(); tower.lockouts.root_slot = Some(0); assert!(!tower.is_locked_out(1, &ancestors)); }
rust_cleaned_test_functions.jsonl/77027
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 169 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 60271, 6068, 12993, 27563, 17268, 15464, 368, 341, 286, 1077, 5206, 21271, 284, 21938, 486, 931, 5478, 32509, 7, 15, 11, 220, 15, 13, 21, 22, 317, 286, 1077, 37518, 284, 7486, 0, 9697, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_timer_no_binding() { let (met_tx, met_rx) = mpsc::channel(); let mut rec = MetricsRecorder::new(met_tx, true); // use Timer to make one timing let _rv = { // no binding means Timer does not live past the first line Timer::new(&mut rec, "cmd"); sleep_secs(0.25); () }; // flush the metrics so we can see them rec.flush_metrics(); // receive the metrics let metrics = met_rx.recv().unwrap(); // verify that the timing is correct let dur = metrics.first().get_timing().duration; assert!(eq_f64(0.0, dur, 0.01)); }
rust_cleaned_test_functions.jsonl/122145
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 257 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16255, 6536, 60815, 368, 341, 262, 1077, 320, 4059, 17805, 11, 2270, 24330, 8, 284, 296, 81984, 486, 10119, 543, 262, 1077, 5206, 1395, 284, 54190, 47023, 486, 931, 1255, 295, 17805, 11, 830, 62...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_upfront_shutdown_script() { // enforce it at shutdown message let mut config = UserConfig::default(); config.channel_options.announced_channel = true; config.peer_channel_config_limits.force_announced_channel_preference = false; config.channel_options.commit_upfront_shutdown_pubkey = false; let user_cfgs = [None, Some(config), None]; let chanmon_cfgs = create_chanmon_cfgs(3); let node_cfgs = create_node_cfgs(3, &chanmon_cfgs); let node_chanmgrs = create_node_chanmgrs(3, &node_cfgs, &user_cfgs); let nodes = create_network(3, &node_cfgs, &node_chanmgrs); let flags = InitFeatures::supported(); let chan = create_announced_chan_between_nodes_with_value(&nodes, 0, 2, 1000000, 1000000, flags.clone(), flags.clone()); nodes[0].node.close_channel(&OutPoint::new(chan.3.txid(), 0).to_channel_id()).unwrap(); let mut node_0_shutdown = get_event_msg!(nodes[0], MessageSendEvent::SendShutdown, nodes[2].node.get_our_node_id()); node_0_shutdown.scriptpubkey = Builder::new().push_opcode(opcodes::all::OP_RETURN).into_script().to_p2sh(); // Test we enforce upfront_scriptpbukey if by providing a diffrent one at closing that we disconnect peer nodes[2].node.handle_shutdown(&nodes[0].node.get_our_node_id(), &node_0_shutdown); let events = nodes[2].node.get_and_clear_pending_msg_events(); assert_eq!(events.len(), 2); match events[0] { MessageSendEvent::BroadcastChannelUpdate { .. } => {}, _ => panic!("Unexpected event"), } if let MessageSendEvent::HandleError { ref action, .. } = events[1] { match action { &ErrorAction::SendErrorMessage { ref msg } => { assert_eq!(msg.data,"Got shutdown request with a scriptpubkey which did not match their previous scriptpubkey"); }, _ => { assert!(false); } } } else { assert!(false); } let chan = create_announced_chan_between_nodes_with_value(&nodes, 0, 2, 1000000, 1000000, flags.clone(), flags.clone()); nodes[0].node.close_channel(&OutPoint::new(chan.3.txid(), 0).to_channel_id()).unwrap(); let node_0_shutdown = get_event_msg!(nodes[0], MessageSendEvent::SendShutdown, nodes[2].node.get_our_node_id()); nodes[2].node.handle_shutdown(&nodes[0].node.get_our_node_id(), &node_0_shutdown); let events = nodes[2].node.get_and_clear_pending_msg_events(); assert_eq!(events.len(), 1); match events[0] { MessageSendEvent::SendShutdown { node_id, .. } => { assert_eq!(node_id, nodes[0].node.get_our_node_id()) } _ => panic!("Unexpected event"), } // We test that if case of peer non-signaling we don't enforce committed script at channel opening let mut flags_no = InitFeatures::supported(); flags_no.unset_upfront_shutdown_script(); let chan = create_announced_chan_between_nodes_with_value(&nodes, 0, 1, 1000000, 1000000, flags_no, flags.clone()); nodes[0].node.close_channel(&OutPoint::new(chan.3.txid(), 0).to_channel_id()).unwrap(); let mut node_1_shutdown = get_event_msg!(nodes[0], MessageSendEvent::SendShutdown, nodes[1].node.get_our_node_id()); node_1_shutdown.scriptpubkey = Builder::new().push_opcode(opcodes::all::OP_RETURN).into_script().to_p2sh(); nodes[1].node.handle_shutdown(&nodes[0].node.get_our_node_id(), &node_1_shutdown); let events = nodes[1].node.get_and_clear_pending_msg_events(); assert_eq!(events.len(), 1); match events[0] { MessageSendEvent::SendShutdown { node_id, .. } => { assert_eq!(node_id, nodes[0].node.get_our_node_id()) } _ => panic!("Unexpected event"), } let chan = create_announced_chan_between_nodes_with_value(&nodes, 1, 0, 1000000, 1000000, flags.clone(), flags.clone()); nodes[1].node.close_channel(&OutPoint::new(chan.3.txid(), 0).to_channel_id()).unwrap(); let mut node_0_shutdown = get_event_msg!(nodes[1], MessageSendEvent::SendShutdown, nodes[0].node.get_our_node_id()); node_0_shutdown.scriptpubkey = Builder::new().push_opcode(opcodes::all::OP_RETURN).into_script().to_p2sh(); nodes[0].node.handle_shutdown(&nodes[1].node.get_our_node_id(), &node_0_shutdown); let events = nodes[0].node.get_and_clear_pending_msg_events(); assert_eq!(events.len(), 1); match events[0] { MessageSendEvent::SendShutdown { node_id, .. } => { assert_eq!(node_id, nodes[1].node.get_our_node_id()) } _ => panic!("Unexpected event"), } //// channel smoothly let chan = create_announced_chan_between_nodes_with_value(&nodes, 0, 1, 1000000, 1000000, flags.clone(), flags.clone()); nodes[1].node.close_channel(&OutPoint::new(chan.3.txid(), 0).to_channel_id()).unwrap(); let mut node_0_shutdown = get_event_msg!(nodes[1], MessageSendEvent::SendShutdown, nodes[0].node.get_our_node_id()); node_0_shutdown.scriptpubkey = Builder::new().push_opcode(opcodes::all::OP_RETURN).into_script().to_p2sh(); nodes[0].node.handle_shutdown(&nodes[1].node.get_our_node_id(), &node_0_shutdown); let events = nodes[0].node.get_and_clear_pending_msg_events(); assert_eq!(events.len(), 2); match events[0] { MessageSendEvent::SendShutdown { node_id, .. } => { assert_eq!(node_id, nodes[1].node.get_our_node_id()) } _ => panic!("Unexpected event"), } match events[1] { MessageSendEvent::SendClosingSigned { node_id, .. } => { assert_eq!(node_id, nodes[1].node.get_our_node_id()) } _ => panic!("Unexpected event"), } }
rust_cleaned_test_functions.jsonl/28342
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1968 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8237, 6951, 54804, 14660, 368, 341, 1572, 197, 322, 28162, 432, 518, 23766, 1943, 271, 10217, 5206, 2193, 284, 2657, 2648, 486, 2258, 543, 25873, 16195, 8743, 13, 1020, 19453, 14571, 284, 830, 280...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
9
#[test] fn test_remove_line_continuations_empty() { let example: Vec<char> = "".to_string().chars().collect(); let without_comments = chars_to_string(&remove_line_continuations(&example)); assert_eq!("", without_comments); }
rust_cleaned_test_functions.jsonl/126892
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 102 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18193, 6528, 68948, 37070, 15124, 368, 341, 286, 1077, 3110, 25, 11312, 21919, 29, 284, 44907, 983, 3904, 1005, 19255, 1005, 17384, 543, 286, 1077, 2041, 30359, 284, 23000, 2346, 3904, 2099, 5399, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_from_ref_to_fixed_array() { let ary : &[u8; 32] = &[ 1,0,1,2,1,0,1,2, 3,0,3,4,3,0,3,4, 5,0,5,6,5,0,5,6, 7,0,7,8,7,0,7,8 ]; let big : U256 = ary.into(); // the numbers are each row of 8 bytes reversed and cast to u64 assert_eq!(big, U256([504410889324070664, 360293493601469702, 216176097878868740, 72058702156267778u64])); }
rust_cleaned_test_functions.jsonl/45780
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 199 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 7793, 2346, 37839, 3858, 368, 341, 10217, 72921, 549, 44590, 84, 23, 26, 220, 18, 17, 60, 284, 609, 9640, 197, 197, 16, 11, 15, 11, 16, 11, 17, 11, 16, 11, 15, 11, 16, 11, 17, 345,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_position() { let data = BaseEntityData { position: [1.0, 2.0, 3.0].into(), rotation: [4.0, 5.0].into(), velocity: [6.0, 7.0, 8.0].into(), }; let pos = data.read_position().unwrap(); assert!(pos.x - 1.0 < std::f64::EPSILON); assert!(pos.y - 2.0 < std::f64::EPSILON); assert!(pos.z - 3.0 < std::f64::EPSILON); assert!(pos.yaw - 4.0 < std::f32::EPSILON); assert!(pos.pitch - 5.0 < std::f32::EPSILON); }
rust_cleaned_test_functions.jsonl/50447
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 298 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 9661, 368, 341, 286, 1077, 821, 284, 74082, 1043, 341, 310, 2309, 25, 508, 16, 13, 15, 11, 220, 17, 13, 15, 11, 220, 18, 13, 15, 936, 18122, 3148, 310, 12695, 25, 508, 19, 13, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_ban() { let route = Route::GetBan { guild_id: GUILD_ID, user_id: USER_ID, }; assert_eq!( route.to_string(), format!( "guilds/{guild_id}/bans/{user_id}", guild_id = GUILD_ID, user_id = USER_ID ) ); }
rust_cleaned_test_functions.jsonl/119880
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 245 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 880, 276, 368, 341, 286, 1077, 6021, 284, 9572, 486, 1949, 50241, 341, 310, 26411, 842, 25, 479, 18023, 3450, 345, 310, 1196, 842, 25, 13872, 3450, 345, 286, 2605, 286, 2060, 10714, 33673,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_data_loss_protect() { // We want to be sure that : // * we don't broadcast our Local Commitment Tx in case of fallen behind // * we close channel in case of detecting other being fallen behind // * we are able to claim our own outputs thanks to to_remote being static // TODO: this test is incomplete and the data_loss_protect implementation is incomplete - see issue #775 let persister; let logger; let fee_estimator; let tx_broadcaster; let chain_source; let mut chanmon_cfgs = create_chanmon_cfgs(2); // during signing due to revoked tx chanmon_cfgs[0].keys_manager.disable_revocation_policy_check = true; let keys_manager = &chanmon_cfgs[0].keys_manager; let monitor; let node_state_0; let node_cfgs = create_node_cfgs(2, &chanmon_cfgs); let node_chanmgrs = create_node_chanmgrs(2, &node_cfgs, &[None, None]); let mut nodes = create_network(2, &node_cfgs, &node_chanmgrs); let chan = create_announced_chan_between_nodes_with_value(&nodes, 0, 1, 1000000, 1000000, InitFeatures::known(), InitFeatures::known()); // Cache node A state before any channel update let previous_node_state = nodes[0].node.encode(); let mut previous_chain_monitor_state = test_utils::TestVecWriter(Vec::new()); nodes[0].chain_monitor.chain_monitor.monitors.read().unwrap().iter().next().unwrap().1.write(&mut previous_chain_monitor_state).unwrap(); send_payment(&nodes[0], &vec!(&nodes[1])[..], 8000000); send_payment(&nodes[0], &vec!(&nodes[1])[..], 8000000); nodes[0].node.peer_disconnected(&nodes[1].node.get_our_node_id(), false); nodes[1].node.peer_disconnected(&nodes[0].node.get_our_node_id(), false); // Restore node A from previous state logger = test_utils::TestLogger::with_id(format!("node {}", 0)); let mut chain_monitor = <(BlockHash, ChannelMonitor<EnforcingSigner>)>::read(&mut io::Cursor::new(previous_chain_monitor_state.0), keys_manager).unwrap().1; chain_source = test_utils::TestChainSource::new(Network::Testnet); tx_broadcaster = test_utils::TestBroadcaster{txn_broadcasted: Mutex::new(Vec::new()), blocks: Arc::new(Mutex::new(Vec::new()))}; fee_estimator = test_utils::TestFeeEstimator { sat_per_kw: Mutex::new(253) }; persister = test_utils::TestPersister::new(); monitor = test_utils::TestChainMonitor::new(Some(&chain_source), &tx_broadcaster, &logger, &fee_estimator, &persister, keys_manager); node_state_0 = { let mut channel_monitors = HashMap::new(); channel_monitors.insert(OutPoint { txid: chan.3.txid(), index: 0 }, &mut chain_monitor); <(BlockHash, ChannelManager<EnforcingSigner, &test_utils::TestChainMonitor, &test_utils::TestBroadcaster, &test_utils::TestKeysInterface, &test_utils::TestFeeEstimator, &test_utils::TestLogger>)>::read(&mut io::Cursor::new(previous_node_state), ChannelManagerReadArgs { keys_manager: keys_manager, fee_estimator: &fee_estimator, chain_monitor: &monitor, logger: &logger, tx_broadcaster: &tx_broadcaster, default_config: UserConfig::default(), channel_monitors, }).unwrap().1 }; nodes[0].node = &node_state_0; assert!(monitor.watch_channel(OutPoint { txid: chan.3.txid(), index: 0 }, chain_monitor).is_ok()); nodes[0].chain_monitor = &monitor; nodes[0].chain_source = &chain_source; check_added_monitors!(nodes[0], 1); nodes[0].node.peer_connected(&nodes[1].node.get_our_node_id(), &msgs::Init { features: InitFeatures::empty() }); nodes[1].node.peer_connected(&nodes[0].node.get_our_node_id(), &msgs::Init { features: InitFeatures::empty() }); let reestablish_0 = get_chan_reestablish_msgs!(nodes[1], nodes[0]); // Check we don't broadcast any transactions following learning of per_commitment_point from B nodes[0].node.handle_channel_reestablish(&nodes[1].node.get_our_node_id(), &reestablish_0[0]); check_added_monitors!(nodes[0], 1); { let node_txn = nodes[0].tx_broadcaster.txn_broadcasted.lock().unwrap().clone(); assert_eq!(node_txn.len(), 0); } let mut reestablish_1 = Vec::with_capacity(1); for msg in nodes[0].node.get_and_clear_pending_msg_events() { if let MessageSendEvent::SendChannelReestablish { ref node_id, ref msg } = msg { assert_eq!(*node_id, nodes[1].node.get_our_node_id()); reestablish_1.push(msg.clone()); } else if let MessageSendEvent::BroadcastChannelUpdate { .. } = msg { } else if let MessageSendEvent::HandleError { ref action, .. } = msg { match action { &ErrorAction::SendErrorMessage { ref msg } => { assert_eq!(msg.data, "We have fallen behind - we have received proof that if we broadcast remote is going to claim our funds - we can't do any automated broadcasting"); }, _ => panic!("Unexpected event!"), } } else { panic!("Unexpected event") } } // Check we close channel detecting A is fallen-behind nodes[1].node.handle_channel_reestablish(&nodes[0].node.get_our_node_id(), &reestablish_1[0]); check_closed_event!(nodes[1], 1, ClosureReason::ProcessingError { err: "Peer attempted to reestablish channel with a very old local commitment transaction".to_string() }); assert_eq!(check_closed_broadcast!(nodes[1], true).unwrap().data, "Peer attempted to reestablish channel with a very old local commitment transaction"); check_added_monitors!(nodes[1], 1); // Check A is able to claim to_remote output let node_txn = nodes[1].tx_broadcaster.txn_broadcasted.lock().unwrap().clone(); assert_eq!(node_txn.len(), 1); check_spends!(node_txn[0], chan.3); assert_eq!(node_txn[0].output.len(), 2); mine_transaction(&nodes[0], &node_txn[0]); connect_blocks(&nodes[0], ANTI_REORG_DELAY - 1); check_closed_event!(nodes[0], 1, ClosureReason::ProcessingError { err: "We have fallen behind - we have received proof that if we broadcast remote is going to claim our funds - we can\'t do any automated broadcasting".to_string() }); let spend_txn = check_spendable_outputs!(nodes[0], node_cfgs[0].keys_manager); assert_eq!(spend_txn.len(), 1); check_spends!(spend_txn[0], node_txn[0]); }
rust_cleaned_test_functions.jsonl/16941
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2134 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1769, 11193, 22357, 439, 368, 341, 197, 322, 1205, 1366, 311, 387, 2704, 429, 6260, 197, 322, 353, 582, 1513, 944, 12899, 1039, 8774, 9205, 478, 39850, 304, 1142, 315, 20866, 4815, 17642, 197, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_separable_filter_integer_kernel() { let image = gray_image!( 1, 2, 3; 4, 5, 6; 7, 8, 9); let expected = gray_image!( 21, 27, 33; 39, 45, 51; 57, 63, 69); let kernel = vec![1i32; 3]; let filtered = separable_filter_equal(&image, &kernel); assert_pixels_eq!(filtered, expected); }
rust_cleaned_test_functions.jsonl/35603
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 233 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3453, 49156, 8727, 31725, 26876, 368, 341, 286, 1077, 2168, 284, 17545, 4954, 33673, 310, 220, 16, 11, 220, 17, 11, 220, 18, 280, 310, 220, 19, 11, 220, 20, 11, 220, 21, 280, 310, 220, 22, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_column_name_in_error() -> Result<()> { use crate::{types::Type, Error}; let db = Connection::open_in_memory()?; db.execute_batch( "BEGIN; CREATE TABLE foo(x INTEGER, y TEXT); INSERT INTO foo VALUES(4, NULL); END;", )?; let mut stmt = db.prepare("SELECT x as renamed, y FROM foo")?; let mut rows = stmt.query([])?; let row = rows.next()?.unwrap(); match row.get::<_, String>(0).unwrap_err() { Error::InvalidColumnType(idx, name, ty) => { assert_eq!(idx, 0); assert_eq!(name, "renamed"); assert_eq!(ty, Type::Integer); } e => { panic!("Unexpected error type: {:?}", e); } } match row.get::<_, String>("y").unwrap_err() { Error::InvalidColumnType(idx, name, ty) => { assert_eq!(idx, 1); assert_eq!(name, "y"); assert_eq!(ty, Type::Null); } e => { panic!("Unexpected error type: {:?}", e); } } Ok(()) }
rust_cleaned_test_functions.jsonl/96472
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 685 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8744, 1269, 1243, 4096, 368, 1464, 5714, 71698, 341, 286, 990, 17717, 22964, 9242, 486, 929, 11, 4600, 2440, 286, 1077, 2927, 284, 11032, 486, 2508, 1243, 19195, 94136, 286, 2927, 7769, 14534, 100...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
8
#[test] fn test_update_nft_state_with_issuer_success() { let (mut context, tx) = create_test_context(Action::Update(UpdateCase::UpdateStateWithIssuer), NftError::NoError); let tx = context.complete_tx(tx); // run let cycles = context .verify_tx(&tx, MAX_CYCLES) .expect("pass verification"); println!("consume cycles: {}", cycles); }
rust_cleaned_test_functions.jsonl/33580
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 159 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8882, 1089, 723, 4387, 6615, 62, 66817, 18632, 368, 341, 262, 1077, 320, 6984, 2266, 11, 9854, 8, 4035, 286, 1855, 4452, 8467, 21905, 486, 4289, 7, 4289, 4207, 486, 4289, 1397, 2354, 98902, 701,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_simple_w1_1() { let mut scheduler = WorkstealingScheduler::default(); submit_graph_simple(&mut scheduler); connect_workers(&mut scheduler, 1, 1); scheduler.sanity_check(); let n = run_schedule_get_task_ids(&mut scheduler); assert_eq!(n.len(), 1); assert!(n.contains(&1)); scheduler.sanity_check(); let w = assigned_worker(&scheduler.graph, 1); finish_task(&mut scheduler, 1, w, 1); let n = run_schedule_get_task_ids(&mut scheduler); assert_eq!(n.len(), 2); assert!(n.contains(&2)); assert!(n.contains(&3)); let _t2 = scheduler.graph.tasks.get(&2).unwrap(); let _t3 = scheduler.graph.tasks.get(&3).unwrap(); assert_eq!(assigned_worker(&scheduler.graph, 2), 100); assert_eq!(assigned_worker(&scheduler.graph, 3), 100); scheduler.sanity_check(); }
rust_cleaned_test_functions.jsonl/27851
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 436 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30015, 1670, 16, 62, 16, 368, 341, 286, 1077, 5206, 28809, 284, 5547, 5342, 6132, 38878, 486, 2258, 543, 286, 9318, 14738, 30015, 2099, 6984, 28809, 317, 286, 4564, 43557, 2099, 6984, 28809, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_request_header() { let mem = create_anon_guest_memory(&[(GuestAddress(0), 0x1000)], false).unwrap(); let addr = GuestAddress(0); let sector = 123_454_321; // Test that all supported request types are read correctly from memory. let supported_request_types = vec![ VIRTIO_BLK_T_IN, VIRTIO_BLK_T_OUT, VIRTIO_BLK_T_FLUSH, VIRTIO_BLK_T_GET_ID, ]; for request_type in supported_request_types { let expected_header = RequestHeader::new(request_type, sector); mem.write_obj::<RequestHeader>(expected_header, addr) .unwrap(); let actual_header = RequestHeader::read_from(&mem, addr).unwrap(); assert_eq!(actual_header.request_type, expected_header.request_type); assert_eq!(actual_header.sector, expected_header.sector); } // Test that trying to read a request header that goes outside of the // memory boundary fails. assert!(RequestHeader::read_from(&mem, GuestAddress(0x1000)).is_err()); }
rust_cleaned_test_functions.jsonl/84864
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 502 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 7893, 8757, 368, 341, 286, 1077, 1833, 284, 1855, 12008, 263, 62739, 19195, 2099, 9697, 37804, 4286, 7, 15, 701, 220, 15, 87, 16, 15, 15, 15, 25035, 895, 568, 15454, 543, 286, 1077, 1078...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_debug() { assert_eq!( format!("{:?}", Scalar::zero()), "0x0000000000000000000000000000000000000000000000000000000000000000" ); assert_eq!( format!("{:?}", Scalar::one()), "0x0000000000000000000000000000000000000000000000000000000000000001" ); }
rust_cleaned_test_functions.jsonl/14273
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 160 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15446, 368, 341, 286, 2060, 10714, 33673, 310, 3561, 88928, 25, 52652, 35176, 486, 14154, 14702, 310, 330, 15, 87, 15, 15, 15, 15, 15, 15, 15, 15, 15, 15, 15, 15, 15, 15, 15, 15, 15, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_proccess_op_or_with_nested_and() { let filter = filter(); let mut op = Operator::Or(vec![ Operator::And(vec![ Operator::Eq(schema_id_tag(), unencrypted_target("Not Here".to_string())), Operator::Eq(cred_def_id_tag(), unencrypted_target("Not Here".to_string())) ]), Operator::And(vec![ Operator::Eq(schema_issuer_did_tag(), unencrypted_target("Not Here".to_string())), Operator::Eq(schema_name_tag(), unencrypted_target("Not Here".to_string())) ]), Operator::And(vec![ Operator::Eq(schema_name_tag(), unencrypted_target("Not Here".to_string())), Operator::Eq(issuer_did_tag(), unencrypted_target("Not Here".to_string())) ]), ]); assert!(Verifier::_process_operator("zip", &op, &filter).is_err()); op = Operator::Or(vec![ Operator::And(vec![ Operator::Eq(schema_id_tag(), unencrypted_target(SCHEMA_ID.to_string())), Operator::Eq(cred_def_id_tag(), unencrypted_target("Not Here".to_string())) ]), Operator::And(vec![ Operator::Eq(schema_issuer_did_tag(), unencrypted_target("Not Here".to_string())), Operator::Eq(schema_name_tag(), unencrypted_target("Not Here".to_string())) ]), Operator::And(vec![ Operator::Eq(schema_name_tag(), unencrypted_target("Not Here".to_string())), Operator::Eq(issuer_did_tag(), unencrypted_target("Not Here".to_string())) ]), ]); assert!(Verifier::_process_operator("zip", &op, &filter).is_err()); op = Operator::Or(vec![ Operator::And(vec![ Operator::Eq(schema_id_tag(), unencrypted_target(SCHEMA_ID.to_string())), Operator::Eq(cred_def_id_tag(), unencrypted_target(CRED_DEF_ID.to_string())) ]), Operator::And(vec![ Operator::Eq(schema_issuer_did_tag(), unencrypted_target("Not Here".to_string())), Operator::Eq(schema_name_tag(), unencrypted_target("Not Here".to_string())) ]), Operator::And(vec![ Operator::Eq(schema_name_tag(), unencrypted_target("Not Here".to_string())), Operator::Eq(issuer_did_tag(), unencrypted_target("Not Here".to_string())) ]), ]); Verifier::_process_operator("zip", &op, &filter).unwrap() }
rust_cleaned_test_functions.jsonl/71872
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1279 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2540, 1322, 10287, 8734, 6615, 66279, 8378, 368, 341, 286, 1077, 4051, 284, 4051, 543, 286, 1077, 5206, 1179, 284, 28498, 486, 2195, 25592, 90515, 310, 28498, 486, 3036, 25592, 90515, 394, 28498, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_scan_start_stop() { let table_id = 1; let pks = vec![1, 2, 3, 4, 5, 7, 10, 15, 20, 25, 26, 27]; let values: Vec<_> = pks .iter() .map(|pk| format!("value{}", pk).into_bytes()) .collect(); let test_data: Vec<_> = pks .into_iter() .map(|pk| table::encode_row_key(table_id, pk)) .zip(values.into_iter()) .collect(); let mut test_store = TestStore::new(&test_data); let (snapshot, start_ts) = test_store.get_snapshot(); let store = SnapshotStore::new(snapshot, start_ts, IsolationLevel::SI, true); // `test_take` is used to take `count` keys from the scanner. It calls `start_scan` at let test_take = |scanner: &mut Scanner<_>, count, expect_start_pk, expect_end_pk| { let mut range = KeyRange::new(); scanner.start_scan(&mut range); let mut keys = Vec::new(); for _ in 0..count { if let Some((key, _)) = scanner.next_row().unwrap() { keys.push(key); } else { break; } } let has_more = scanner.stop_scan(&mut range); if has_more || scanner.scan_mode == ScanMode::Forward { assert_eq!( range.get_start(), table::encode_row_key(table_id, expect_start_pk).as_slice() ); } else { assert_eq!(expect_start_pk, -1); } if has_more || scanner.scan_mode == ScanMode::Backward { assert_eq!( range.get_end(), table::encode_row_key(table_id, expect_end_pk).as_slice() ); } else { assert_eq!(expect_end_pk, -1); } keys }; let range = get_range(table_id, 1, 26); let mut scanner = Scanner::new(&store, ScanOn::Table, false, true, range.clone()).unwrap(); let mut res = test_take(&mut scanner, 3, 1, 4); res.append(&mut test_take(&mut scanner, 3, 4, 8)); res.append(&mut test_take(&mut scanner, 3, 8, 21)); res.append(&mut test_take(&mut scanner, 10, 21, -1)); let expect_keys: Vec<_> = [1, 2, 3, 4, 5, 7, 10, 15, 20, 25] .iter() .map(|pk| table::encode_row_key(table_id, *pk)) .collect(); assert_eq!(res, expect_keys); let mut scanner = Scanner::new(&store, ScanOn::Table, true, true, range).unwrap(); let mut res = test_take(&mut scanner, 3, 15, 26); res.append(&mut test_take(&mut scanner, 3, 5, 15)); res.append(&mut test_take(&mut scanner, 10, -1, 5)); assert_eq!(res, expect_keys.into_iter().rev().collect::<Vec<_>>()); }
rust_cleaned_test_functions.jsonl/121697
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1527 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28857, 4906, 19039, 368, 341, 286, 1077, 1965, 842, 284, 220, 16, 280, 286, 1077, 281, 2787, 284, 7486, 20703, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 11, 220, 22, 11, 220,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
7
#[test] fn test_metrics_report_update_check_failure_reason_omaha() { block_on(async { let config = config_generator(); let mut state_machine = StateMachineBuilder::new( StubPolicyEngine, StubHttpRequest, StubInstaller::default(), StubTimer, MockMetricsReporter::new(false), Rc::new(Mutex::new(StubStorage)), config, make_test_app_set(), ) .build() .await; state_machine.run_once().await; assert!(state_machine .metrics_reporter .metrics .contains(&Metrics::UpdateCheckFailureReason(UpdateCheckFailureReason::Omaha))); }); }
rust_cleaned_test_functions.jsonl/126407
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 448 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 37686, 14813, 8882, 7200, 43618, 38229, 62, 316, 13546, 368, 341, 286, 2504, 4470, 18285, 341, 310, 1077, 2193, 284, 2193, 25813, 543, 310, 1077, 5206, 1584, 38695, 284, 3234, 21605, 3297, 486, 93...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_t202() { init(); let result = t202(&WIFI_BSSID, &WIFI_SSID); println!("{}", result.len()); println!("{:?}", result); }
rust_cleaned_test_functions.jsonl/104749
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 99 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 528, 17, 15, 17, 368, 341, 286, 2930, 543, 286, 1077, 1102, 284, 259, 17, 15, 17, 2099, 54, 33988, 1668, 75100, 11, 609, 54, 33988, 1098, 36499, 317, 286, 13751, 79878, 1102, 19406, 1423, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_parser_invalid_signature() { let signature = "()Ljava/lang/List"; // no semicolon let res = JavaType::from_str(signature); match res { Ok(any) => { panic!("Unexpected result: {}", any); } Err(err) => { let error_message = err.to_string(); assert!(error_message.contains("Input: ()Ljava/lang/List")); } } }
rust_cleaned_test_functions.jsonl/100802
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 247 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18517, 31433, 39859, 368, 341, 286, 1077, 11957, 284, 67411, 37924, 25253, 76397, 5123, 442, 902, 5234, 38517, 198, 286, 1077, 592, 284, 7943, 929, 486, 1499, 2895, 92650, 626, 286, 2432, 592, 341...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_next_token() { let input = "let five = 5; let ten = 10; let add = fn(x, y) { x + y; }; let result = add(five, ten); "; let tests = [ token::Token{ ttype: token::LET, literal: String::from("let") }, token::Token{ ttype: token::IDENT, literal: String::from("five") }, token::Token{ ttype: token::ASSIGN, literal: String::from("=") }, token::Token{ ttype: token::INT, literal: String::from("5") }, token::Token{ ttype: token::SEMICOLON, literal: String::from(";") }, token::Token{ ttype: token::LET, literal: String::from("let") }, token::Token{ ttype: token::IDENT, literal: String::from("ten") }, token::Token{ ttype: token::ASSIGN, literal: String::from("=") }, token::Token{ ttype: token::INT, literal: String::from("10") }, token::Token{ ttype: token::SEMICOLON, literal: String::from(";") }, token::Token{ ttype: token::LET, literal: String::from("let") }, token::Token{ ttype: token::IDENT, literal: String::from("add") }, token::Token{ ttype: token::ASSIGN, literal: String::from("=") }, token::Token{ ttype: token::FUNCTION, literal: String::from("fn") }, token::Token{ ttype: token::LPAREN, literal: String::from("(") }, token::Token{ ttype: token::IDENT, literal: String::from("x") }, token::Token{ ttype: token::COMMA, literal: String::from(",") }, token::Token{ ttype: token::IDENT, literal: String::from("y") }, token::Token{ ttype: token::RPAREN, literal: String::from(")") }, token::Token{ ttype: token::LBRACE, literal: String::from("{") }, token::Token{ ttype: token::IDENT, literal: String::from("x") }, token::Token{ ttype: token::PLUS, literal: String::from("+") }, token::Token{ ttype: token::IDENT, literal: String::from("y") }, token::Token{ ttype: token::SEMICOLON, literal: String::from(";") }, token::Token{ ttype: token::RBRACE, literal: String::from("}") }, token::Token{ ttype: token::SEMICOLON, literal: String::from(";") }, token::Token{ ttype: token::LET, literal: String::from("let") }, token::Token{ ttype: token::IDENT, literal: String::from("result") }, token::Token{ ttype: token::ASSIGN, literal: String::from("=") }, token::Token{ ttype: token::IDENT, literal: String::from("add") }, token::Token{ ttype: token::LPAREN, literal: String::from("(") }, token::Token{ ttype: token::IDENT, literal: String::from("five") }, token::Token{ ttype: token::COMMA, literal: String::from(",") }, token::Token{ ttype: token::IDENT, literal: String::from("ten") }, token::Token{ ttype: token::RPAREN, literal: String::from(")") }, token::Token{ ttype: token::SEMICOLON, literal: String::from(";") }, token::Token{ ttype: token::EOF, literal: String::from("\0") }, ]; let mut l = Lexer::new(&input); let mut i = 0; for test in tests.iter() { match l.next_token() { Some(tok) => assert_eq!(&tok, test, "tests[{}]", i), None => assert!(false), } i += 1; } }
rust_cleaned_test_functions.jsonl/17194
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2267 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11257, 6458, 368, 341, 286, 1077, 1946, 284, 330, 1149, 4236, 284, 220, 20, 280, 1149, 5779, 284, 220, 16, 15, 401, 1149, 912, 284, 5168, 2075, 11, 379, 8, 341, 262, 856, 488, 379, 280, 2315...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_get_rooted_block() { let slot = 10; let entries = make_slot_entries_with_transactions(100); let blockhash = get_last_hash(entries.iter()).unwrap(); let shreds = entries_to_test_shreds(entries.clone(), slot, slot - 1, true, 0); let more_shreds = entries_to_test_shreds(entries.clone(), slot + 1, slot, true, 0); let unrooted_shreds = entries_to_test_shreds(entries.clone(), slot + 2, slot + 1, true, 0); let ledger_path = get_tmp_ledger_path_auto_delete!(); let blockstore = Blockstore::open(ledger_path.path()).unwrap(); blockstore.insert_shreds(shreds, None, false).unwrap(); blockstore.insert_shreds(more_shreds, None, false).unwrap(); blockstore .insert_shreds(unrooted_shreds, None, false) .unwrap(); blockstore .set_roots(vec![slot - 1, slot, slot + 1].iter()) .unwrap(); let parent_meta = SlotMeta { parent_slot: std::u64::MAX, ..SlotMeta::default() }; blockstore .put_meta_bytes(slot - 1, &serialize(&parent_meta).unwrap()) .unwrap(); let expected_transactions: Vec<TransactionWithStatusMeta> = entries .iter() .cloned() .filter(|entry| !entry.is_tick()) .flat_map(|entry| entry.transactions) .map(|transaction| { transaction .into_legacy_transaction() .expect("versioned transactions not supported") }) .map(|transaction| { let mut pre_balances: Vec<u64> = vec![]; let mut post_balances: Vec<u64> = vec![]; for (i, _account_key) in transaction.message.account_keys.iter().enumerate() { pre_balances.push(i as u64 * 10); post_balances.push(i as u64 * 11); } let signature = transaction.signatures[0]; let status = TransactionStatusMeta { status: Ok(()), fee: 42, pre_balances: pre_balances.clone(), post_balances: post_balances.clone(), inner_instructions: Some(vec![]), log_messages: Some(vec![]), pre_token_balances: Some(vec![]), post_token_balances: Some(vec![]), rewards: Some(vec![]), } .into(); blockstore .transaction_status_cf .put_protobuf((0, signature, slot), &status) .unwrap(); let status = TransactionStatusMeta { status: Ok(()), fee: 42, pre_balances: pre_balances.clone(), post_balances: post_balances.clone(), inner_instructions: Some(vec![]), log_messages: Some(vec![]), pre_token_balances: Some(vec![]), post_token_balances: Some(vec![]), rewards: Some(vec![]), } .into(); blockstore .transaction_status_cf .put_protobuf((0, signature, slot + 1), &status) .unwrap(); let status = TransactionStatusMeta { status: Ok(()), fee: 42, pre_balances: pre_balances.clone(), post_balances: post_balances.clone(), inner_instructions: Some(vec![]), log_messages: Some(vec![]), pre_token_balances: Some(vec![]), post_token_balances: Some(vec![]), rewards: Some(vec![]), } .into(); blockstore .transaction_status_cf .put_protobuf((0, signature, slot + 2), &status) .unwrap(); TransactionWithStatusMeta { transaction, meta: Some(TransactionStatusMeta { status: Ok(()), fee: 42, pre_balances, post_balances, inner_instructions: Some(vec![]), log_messages: Some(vec![]), pre_token_balances: Some(vec![]), post_token_balances: Some(vec![]), rewards: Some(vec![]), }), } }) .collect(); let confirmed_block_err = blockstore.get_rooted_block(slot - 1, true).unwrap_err(); assert_matches!(confirmed_block_err, BlockstoreError::SlotUnavailable); let confirmed_block_err = blockstore.get_rooted_block(slot, true).unwrap_err(); assert_matches!( confirmed_block_err, BlockstoreError::ParentEntriesUnavailable ); // Test if require_previous_blockhash is false let confirmed_block = blockstore.get_rooted_block(slot, false).unwrap(); assert_eq!(confirmed_block.transactions.len(), 100); let expected_block = ConfirmedBlock { transactions: expected_transactions.clone(), parent_slot: slot - 1, blockhash: blockhash.to_string(), previous_blockhash: Hash::default().to_string(), rewards: vec![], block_time: None, block_height: None, }; assert_eq!(confirmed_block, expected_block); let confirmed_block = blockstore.get_rooted_block(slot + 1, true).unwrap(); assert_eq!(confirmed_block.transactions.len(), 100); let mut expected_block = ConfirmedBlock { transactions: expected_transactions.clone(), parent_slot: slot, blockhash: blockhash.to_string(), previous_blockhash: blockhash.to_string(), rewards: vec![], block_time: None, block_height: None, }; assert_eq!(confirmed_block, expected_block); let not_root = blockstore.get_rooted_block(slot + 2, true).unwrap_err(); assert_matches!(not_root, BlockstoreError::SlotNotRooted); let complete_block = blockstore.get_complete_block(slot + 2, true).unwrap(); assert_eq!(complete_block.transactions.len(), 100); let mut expected_complete_block = ConfirmedBlock { transactions: expected_transactions, parent_slot: slot + 1, blockhash: blockhash.to_string(), previous_blockhash: blockhash.to_string(), rewards: vec![], block_time: None, block_height: None, }; assert_eq!(complete_block, expected_complete_block); let timestamp = 1_576_183_541; blockstore.blocktime_cf.put(slot + 1, &timestamp).unwrap(); expected_block.block_time = Some(timestamp); let block_height = slot - 2; blockstore .block_height_cf .put(slot + 1, &block_height) .unwrap(); expected_block.block_height = Some(block_height); let confirmed_block = blockstore.get_rooted_block(slot + 1, true).unwrap(); assert_eq!(confirmed_block, expected_block); let timestamp = 1_576_183_542; blockstore.blocktime_cf.put(slot + 2, &timestamp).unwrap(); expected_complete_block.block_time = Some(timestamp); let block_height = slot - 1; blockstore .block_height_cf .put(slot + 2, &block_height) .unwrap(); expected_complete_block.block_height = Some(block_height); let complete_block = blockstore.get_complete_block(slot + 2, true).unwrap(); assert_eq!(complete_block, expected_complete_block); }
rust_cleaned_test_functions.jsonl/9556
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 4232 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 12993, 291, 7113, 368, 341, 286, 1077, 9446, 284, 220, 16, 15, 280, 286, 1077, 10695, 284, 1281, 27563, 26092, 6615, 68182, 7, 16, 15, 15, 317, 286, 1077, 2504, 8296, 284, 633, 12195, 89...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_nfd_chars() { macro_rules! t { ($input: expr, $expected: expr) => { assert_eq!($input.nfd_chars().collect::<String>(), $expected.into_string()); } } t!("abc", "abc"); t!("\u1e0b\u01c4", "d\u0307\u01c4"); t!("\u2026", "\u2026"); t!("\u2126", "\u03a9"); t!("\u1e0b\u0323", "d\u0323\u0307"); t!("\u1e0d\u0307", "d\u0323\u0307"); t!("a\u0301", "a\u0301"); t!("\u0301a", "\u0301a"); t!("\ud4db", "\u1111\u1171\u11b6"); t!("\uac1c", "\u1100\u1162"); }
rust_cleaned_test_functions.jsonl/56855
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 389 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1089, 6902, 37418, 368, 341, 286, 18072, 21407, 0, 259, 341, 310, 1711, 1355, 25, 15169, 11, 400, 7325, 25, 15169, 8, 589, 341, 394, 2060, 10714, 0, 699, 1355, 1253, 6902, 37418, 1005, 17384, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_difference_bv1_longer() { let mut bv1: BitVec<usize> = BitVec::new(); let mut bv2: BitVec<usize> = BitVec::new(); bv1.set(8, true); bv2.set(0, true); bv1.difference(&bv2); assert!(!bv1.get(0)); assert!(bv1.get(8)); }
rust_cleaned_test_functions.jsonl/204
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 180 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 47525, 880, 85, 16, 17799, 261, 368, 341, 286, 1077, 5206, 56937, 16, 25, 6495, 10050, 90244, 29, 284, 6495, 10050, 486, 931, 543, 286, 1077, 5206, 56937, 17, 25, 6495, 10050, 90244, 29, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cmp() { let data: Vec<BigUint> = [ &[], &[1], &[2], &[-1], &[0, 1], &[2, 1], &[1, 1, 1] ] .iter().map(|v| BigUint::from_slice(*v)).collect(); for (i, ni) in data.iter().enumerate() { for (j0, nj) in data.slice(i, data.len()).iter().enumerate() { let j = j0 + i; if i == j { assert_eq!(ni.cmp(nj), Equal); assert_eq!(nj.cmp(ni), Equal); assert_eq!(ni, nj); assert!(!(ni != nj)); assert!(ni <= nj); assert!(ni >= nj); assert!(!(ni < nj)); assert!(!(ni > nj)); } else { assert_eq!(ni.cmp(nj), Less); assert_eq!(nj.cmp(ni), Greater); assert!(!(ni == nj)); assert!(ni != nj); assert!(ni <= nj); assert!(!(ni >= nj)); assert!(ni < nj); assert!(!(ni > nj)); assert!(!(nj <= ni)); assert!(nj >= ni); assert!(!(nj < ni)); assert!(nj > ni); } } } }
rust_cleaned_test_functions.jsonl/96889
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 879 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35193, 368, 341, 286, 1077, 821, 25, 11312, 27, 15636, 21570, 29, 284, 508, 609, 12995, 44590, 16, 1125, 44590, 17, 1125, 609, 7609, 16, 1125, 44590, 15, 11, 220, 16, 1125, 44590, 17, 11, 220,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_verify() { let secp256k1 = Secp256k1::new(); let message_arr = [5u8; 32]; let (privkey, pubkey) = secp256k1.generate_keypair(&mut thread_rng()).unwrap(); let message = SecpMessage::from_slice(&message_arr).unwrap(); let signature = secp256k1.sign(&message, &privkey).unwrap(); let pubkey_arr = pubkey.serialize_vec(&secp256k1, false); assert_eq!(pubkey_arr.len(), 65); let mut pubkey_a = [0u8; 65]; for i in 0..65 { pubkey_a[i] = pubkey_arr[i]; } let ctx_pubkey = PublicKey::parse(&pubkey_a).unwrap(); let ctx_message = Message::parse(&message_arr); let signature_arr = signature.serialize_compact(&secp256k1); assert_eq!(signature_arr.len(), 64); let mut signature_a = [0u8; 64]; for i in 0..64 { signature_a[i] = signature_arr[i]; } let ctx_sig = Signature::parse(&signature_a); secp256k1.verify(&message, &signature, &pubkey).unwrap(); assert!(verify(&ctx_message, &ctx_sig, &ctx_pubkey)); let mut f_ctx_sig = ctx_sig.clone(); f_ctx_sig.r.set_int(0); if f_ctx_sig.r != ctx_sig.r { assert!(!ECMULT_CONTEXT.verify_raw(&f_ctx_sig.r, &ctx_sig.s, &ctx_pubkey.clone().into(), &ctx_message.0)); } f_ctx_sig.r.set_int(1); if f_ctx_sig.r != ctx_sig.r { assert!(!ECMULT_CONTEXT.verify_raw(&f_ctx_sig.r, &ctx_sig.s, &ctx_pubkey.clone().into(), &ctx_message.0)); } }
rust_cleaned_test_functions.jsonl/129806
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 675 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35638, 368, 341, 262, 1077, 511, 4672, 17, 20, 21, 74, 16, 284, 4520, 79, 17, 20, 21, 74, 16, 486, 931, 1428, 262, 1077, 1943, 11210, 284, 508, 20, 84, 23, 26, 220, 18, 17, 935, 262, 107...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_enum_conversion() { test_file! { #[diplomat::bridge] mod ffi { enum MyEnum { A, B, C } struct MyStruct { a: u8, b: MyEnum, } #[diplomat::opaque] struct Foo(Box<u8>); impl Foo { pub fn get_struct(&self) -> MyStruct { MyStruct { a: 1, b: MyEnum::A } } } } } }
rust_cleaned_test_functions.jsonl/80567
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 425 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31054, 64132, 368, 341, 286, 1273, 2458, 0, 341, 310, 11506, 8579, 500, 80768, 486, 13709, 921, 310, 1463, 76956, 341, 394, 7618, 3017, 10766, 341, 503, 362, 11, 425, 11, 356, 198, 394, 456, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_status_ping_request_decode() { let mut cursor = Cursor::new(include_bytes!("../test/packet/status/ping_request.dat").to_vec()); let ping_request = PingRequest::decode(&mut cursor).unwrap(); assert_eq!(ping_request.time, 1577735845610); }
rust_cleaned_test_functions.jsonl/84709
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 131 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4773, 71661, 7893, 15227, 368, 341, 286, 1077, 5206, 8128, 4035, 310, 28067, 486, 931, 77863, 12524, 17223, 1244, 1944, 4322, 5709, 32518, 4322, 287, 7893, 9915, 1827, 983, 13251, 1423, 286, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_costoflife() { let txs = vec![ // insert one entry TxRecord::new("Test#1", "10.2311321").unwrap(), TxRecord::new("Test#2", "10.5441231").unwrap(), TxRecord::new("Test#3", "70.199231321").unwrap(), ]; // simple insert assert_eq!( cost_of_life(txs.iter(), &today()), parse_amount("90.97").unwrap() ); }
rust_cleaned_test_functions.jsonl/60254
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 244 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15890, 1055, 14450, 368, 341, 286, 1077, 9854, 82, 284, 7486, 90515, 310, 442, 5656, 825, 4343, 198, 310, 39850, 6471, 486, 931, 445, 2271, 2, 16, 497, 330, 16, 15, 13, 17, 18, 16, 16, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_char() { let mut rng = crate::new(); // Any failures manifest as a panic when debug assertions are enabled for _ in 0..9000 { let _: char = Standard.sample(&mut rng); } }
rust_cleaned_test_functions.jsonl/85583
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 73 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9232, 368, 341, 10217, 5206, 28422, 284, 17717, 486, 931, 1428, 197, 322, 5765, 27850, 14455, 438, 264, 21975, 979, 7390, 54836, 525, 8970, 198, 2023, 716, 304, 220, 15, 496, 24, 15, 15, 15, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_search(){ let json_value = from_str("{\"dog\":{\"cat\": {\"mouse\" : \"cheese\"}}}").unwrap(); let found_str = json_value.search("mouse").and_then(|j| j.as_string()); assert!(found_str.unwrap() == "cheese"); }
rust_cleaned_test_functions.jsonl/6563
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 117 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10716, 3032, 286, 1077, 2951, 3142, 284, 504, 2895, 99141, 18457, 92729, 4616, 11693, 314, 2105, 13237, 2105, 549, 7245, 1528, 2367, 2105, 75542, 1827, 15454, 543, 286, 1077, 1730, 2895, 284, 2951, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_delete_message_specific_reaction() { let emoji = emoji(); let route = Route::DeleteMessageSpecificReaction { channel_id: CHANNEL_ID, message_id: MESSAGE_ID, emoji: &emoji, }; assert_eq!( route.to_string(), format!( "channels/{channel_id}/messages/{message_id}/reactions/{emoji}", channel_id = CHANNEL_ID, emoji = emoji, message_id = MESSAGE_ID ) ); }
rust_cleaned_test_functions.jsonl/119902
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 316 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11353, 6462, 56592, 96631, 368, 341, 286, 1077, 42365, 284, 42365, 1428, 286, 1077, 6021, 284, 9572, 486, 6435, 2052, 47514, 87236, 341, 310, 5496, 842, 25, 58756, 3450, 345, 310, 1943, 842, 25, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_digest_of_canonical_request() { let creq = test_canonical_request("get-vanilla-query-order-key-case"); let expected = "816cd5b414d056048ba4f7c5386d6e0533120fb1fcfa93762cf0fc39e2cf19e0"; let actual = sha256_hex_string(creq.as_bytes()); assert_eq!(expected, actual); }
rust_cleaned_test_functions.jsonl/83741
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 159 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 52994, 3575, 27421, 22391, 7893, 368, 341, 286, 1077, 1884, 80, 284, 1273, 27421, 22391, 7893, 445, 455, 8273, 276, 6241, 65489, 23810, 16173, 38485, 797, 286, 1077, 3601, 284, 330, 23, 16, 21, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_program_entry_debug() { #[allow(clippy::unnecessary_wraps)] fn mock_process_instruction( _first_instruction_account: usize, _data: &[u8], _invoke_context: &mut InvokeContext, ) -> Result<(), InstructionError> { Ok(()) } #[allow(clippy::unnecessary_wraps)] fn mock_ix_processor( _first_instruction_account: usize, _data: &[u8], _context: &mut InvokeContext, ) -> Result<(), InstructionError> { Ok(()) } let builtin_programs = &[ BuiltinProgram { program_id: solana_sdk::pubkey::new_rand(), process_instruction: mock_process_instruction, }, BuiltinProgram { program_id: solana_sdk::pubkey::new_rand(), process_instruction: mock_ix_processor, }, ]; assert!(!format!("{:?}", builtin_programs).is_empty()); }
rust_cleaned_test_functions.jsonl/14507
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 546 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25096, 9078, 15446, 368, 341, 286, 11506, 7183, 9849, 45749, 486, 14931, 20122, 44074, 2625, 5563, 286, 5168, 7860, 11305, 54923, 1006, 310, 716, 3896, 54923, 13500, 25, 22301, 345, 310, 716, 691, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_proof_failure() -> Result<(), HwError> { let value = BigUint::from_u32(378).unwrap(); let threshold = BigUint::from_u32(402).unwrap(); assert_eq!(true, prove_and_verify(4, 32, &value, &threshold).is_err()); Ok(()) }
rust_cleaned_test_functions.jsonl/32788
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 131 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 86757, 43618, 368, 1464, 5714, 68843, 472, 86, 1454, 29, 341, 286, 1077, 897, 284, 6164, 21570, 486, 1499, 7300, 18, 17, 7, 18, 22, 23, 568, 15454, 543, 286, 1077, 12171, 284, 6164, 21570, 486...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_strip_accents() { let test_tuples = [ ("No accent here", "No accent here"), ("çà", "ca"), ("àgbọ̀n", "agbon"), ("cùis", "cuis"), ("Tiếng Việt", "Tieng Viet"), ("château", "chateau"), ("München", "Munchen"), ]; // Whe(source_text, expected_result) in test_tuples.iter() { let mut source_token = Token::new(source_text.to_string()); strip_accents(&mut source_token); assert_eq!(source_token.text, String::from(*expected_result)); }
rust_cleaned_test_functions.jsonl/13632
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 335 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 66130, 17737, 805, 368, 341, 286, 1077, 1273, 89269, 284, 2278, 310, 3489, 2753, 29100, 1588, 497, 330, 2753, 29100, 1588, 4461, 310, 3489, 3131, 6362, 497, 330, 924, 4461, 310, 3489, 6362, 9511, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_simple_operator_lt_plaintext_to_string() { let name1 = _random_vector(10); let value1 = _random_string(10); let query = Operator::Lt( TagName::PlainTagName(name1.clone()), TargetValue::Unencrypted(value1.clone()) ); let json = query.to_string(); let expected = format!(r#"{{"~{}":{{"$lt":"{}"}}}}"#, base64::encode(&name1), value1); assert_eq!(json, expected); }
rust_cleaned_test_functions.jsonl/11882
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 225 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30015, 40594, 39164, 6317, 1641, 427, 2346, 3904, 368, 341, 286, 1077, 829, 16, 284, 716, 11463, 12247, 7, 16, 15, 317, 286, 1077, 897, 16, 284, 716, 11463, 3904, 7, 16, 15, 626, 286, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_0459_example_2() { let s = "aba".to_string(); let result = false; assert_eq!(Solution::repeated_substring_pattern(s), result); }
rust_cleaned_test_functions.jsonl/91321
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 85 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 15, 19, 20, 24, 39304, 62, 17, 368, 341, 286, 1077, 274, 284, 330, 12004, 3263, 983, 3904, 543, 286, 1077, 1102, 284, 895, 401, 286, 2060, 10714, 10297, 36842, 486, 265, 41954, 5228, 917, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_is_str_latin1_fail() { let len = if cfg!(miri) { 32 } else { 256 }; // Miri is too slow let mut src: Vec<u16> = Vec::with_capacity(len); src.resize(len, 0); for i in 0..src.len() { src[i] = i as u16; } for i in 0..src.len() { let tail = &mut src[i..]; for j in 0..tail.len() { tail[j] = 0x100 + j as u16; let s = String::from_utf16(tail).unwrap(); assert!(!is_str_latin1(&s[..])); assert_ne!(check_str_for_latin1_and_bidi(&s[..]), Latin1Bidi::Latin1); } } }
rust_cleaned_test_functions.jsonl/27303
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 380 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 2895, 907, 14768, 16, 22121, 368, 341, 286, 1077, 2422, 284, 421, 13286, 10297, 19936, 72, 8, 314, 220, 18, 17, 335, 770, 314, 220, 17, 20, 21, 20066, 442, 14268, 72, 374, 2238, 6301, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_util_read_float() { let mut p = Tokenizer::new("abc"); assert_eq!(None, read_float(&mut p)); assert_eq!(Some('a'), p.peek()); let mut p = Tokenizer::new("-abc"); assert_eq!(None, read_float(&mut p)); assert_eq!(Some('-'), p.peek()); let mut p = Tokenizer::new("+abc"); assert_eq!(None, read_float(&mut p)); assert_eq!(Some('+'), p.peek()); let mut p = Tokenizer::new("123"); assert_eq!(Some("123".into()), read_float(&mut p)); assert_eq!(None, p.peek()); let mut p = Tokenizer::new("123abc"); assert_eq!(Some("123".into()), read_float(&mut p)); assert_eq!(Some('a'), p.peek()); let mut p = Tokenizer::new("123."); assert_eq!(Some("123.".into()), read_float(&mut p)); assert_eq!(None, p.peek()); let mut p = Tokenizer::new(".123"); assert_eq!(Some(".123".into()), read_float(&mut p)); assert_eq!(None, p.peek()); let mut p = Tokenizer::new("123.123"); assert_eq!(Some("123.123".into()), read_float(&mut p)); assert_eq!(None, p.peek()); let mut p = Tokenizer::new("1e5"); assert_eq!(Some("1e5".into()), read_float(&mut p)); assert_eq!(None, p.peek()); let mut p = Tokenizer::new("1e+5"); assert_eq!(Some("1e+5".into()), read_float(&mut p)); assert_eq!(None, p.peek()); let mut p = Tokenizer::new("1e-5"); assert_eq!(Some("1e-5".into()), read_float(&mut p)); assert_eq!(None, p.peek()); let mut p = Tokenizer::new("1.1e1a"); assert_eq!(Some("1.1e1".into()), read_float(&mut p)); assert_eq!(Some('a'), p.peek()); let mut p = Tokenizer::new("+123abc"); assert_eq!(Some("+123".into()), read_float(&mut p)); assert_eq!(Some('a'), p.peek()); let mut p = Tokenizer::new("-123abc"); assert_eq!(Some("-123".into()), read_float(&mut p)); assert_eq!(Some('a'), p.peek()); }
rust_cleaned_test_functions.jsonl/274
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 991 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18974, 6443, 17586, 368, 341, 286, 1077, 5206, 281, 284, 9660, 3135, 486, 931, 445, 13683, 797, 286, 2060, 10714, 10297, 4064, 11, 1349, 17586, 2099, 6984, 281, 1106, 286, 2060, 10714, 10297, 8373...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_externally_tagged_enum_containing_flatten() { #[derive(Serialize, Deserialize, PartialEq, Debug)] enum Data { A { a: i32, #[serde(flatten)] flat: Flat, }, } #[derive(Serialize, Deserialize, PartialEq, Debug)] struct Flat { b: i32, } let data = Data::A { a: 0, flat: Flat { b: 0 }, }; assert_tokens( &data, &[ Token::NewtypeVariant { name: "Data", variant: "A", }, Token::Map { len: None }, Token::Str("a"), Token::I32(0), Token::Str("b"), Token::I32(0), Token::MapEnd, ], ); }
rust_cleaned_test_functions.jsonl/59169
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 457 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 4301, 745, 9372, 3556, 31054, 10260, 2056, 5081, 14456, 368, 341, 262, 11506, 27098, 3759, 9050, 11, 48440, 11, 55039, 11, 11091, 5563, 262, 7618, 2885, 341, 286, 362, 341, 310, 264, 25, 600...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mgp_copy() { mock_mgp_once!(mgp_path_copy_context, |_, _, _| { mgp_error::MGP_ERROR_UNABLE_TO_ALLOCATE }); with_dummy!(|memgraph: &Memgraph| { unsafe { let path = Path::mgp_copy(std::ptr::null_mut(), &memgraph); assert!(path.is_err()); } }); }
rust_cleaned_test_functions.jsonl/101741
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 181 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 21888, 16096, 368, 341, 262, 7860, 717, 21888, 7630, 10297, 12311, 79, 2638, 16096, 8467, 11, 760, 6878, 8358, 85137, 341, 286, 13742, 79, 4096, 486, 44, 24430, 5414, 6735, 3494, 8650, 39333,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1