text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_safe_checkout_update_to_deleted_blob() -> BitResult<()> { BitRepo::with_minimal_repo(|repo| { let target = commit! { foo < "updated content" }; rm!(repo: "foo"); let conflicts = bit_checkout!(repo: &rev!(target)).unwrap_err().try_into_checkout_conflict()?; assert_eq!(conflicts.len(), 1); Ok(()) }) }
rust_cleaned_test_functions.jsonl/62957
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 207 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34067, 68186, 8882, 2346, 39418, 45908, 368, 1464, 6495, 2077, 71698, 341, 262, 6495, 25243, 486, 4197, 7260, 2861, 37784, 22428, 23476, 91, 341, 286, 1077, 2169, 284, 5266, 0, 341, 1843, 15229, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_operator() { let x = hex2binary("38006F45291200").unwrap(); let (_, p) = parse_packet(&x).unwrap(); assert_eq!( p, Packet::OperatorPacket { version: 1, type_id: 6, subpackets: vec![ Packet::LiteralPacket { version: 6, type_id: 4, num: 10, }, Packet::LiteralPacket { version: 2, type_id: 4, num: 20 } ] } ) }
rust_cleaned_test_functions.jsonl/6776
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 493 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 40594, 368, 341, 286, 1077, 856, 284, 12371, 17, 25891, 445, 18, 23, 15, 15, 21, 37, 19, 20, 17, 24, 16, 17, 15, 15, 1827, 15454, 543, 286, 1077, 39464, 281, 8, 284, 4715, 21078, 2099, 87,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_minimize_constant_infinite_bound() { let quad = BoundedQuadratic::new(f64::NEG_INFINITY, f64::INFINITY, 0., 0., 1.); assert_eq!(quad.minimize(), (0., 1.)); }
rust_cleaned_test_functions.jsonl/19887
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 98 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7260, 11853, 34967, 1243, 25722, 19447, 368, 341, 286, 1077, 27082, 284, 425, 13082, 2183, 88678, 486, 931, 955, 21, 19, 486, 97127, 91110, 11, 282, 21, 19, 486, 687, 55990, 11, 220, 15, 2572, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_extract_markdown_links() { let input = "This is [a test](https://endler.dev). This is a relative link test [Relative Link Test](relative_link)"; let links: HashSet<Uri> = extract_links( &InputContent::from_string(input, FileType::Markdown), Some(Url::parse("https://github.com/hello-rust/lychee/").unwrap()), ) .into_iter() .map(|r| r.uri) .collect(); assert_eq!( links, [ website("https://endler.dev"), website("https://github.com/hello-rust/lychee/relative_link"), ] .iter() .cloned() .collect() ) }
rust_cleaned_test_functions.jsonl/93886
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 377 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39123, 18924, 2923, 25258, 368, 341, 286, 1077, 1946, 284, 330, 1986, 374, 508, 64, 1273, 9533, 2428, 1110, 408, 1536, 21523, 568, 1096, 374, 264, 8674, 2656, 1273, 508, 28442, 5948, 3393, 9533, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mime_override() { fn all_attachment(_: &mime::Name) -> DispositionType { DispositionType::Attachment } let mut srv = test::init_service( App::new().service( Files::new("/", ".") .mime_override(all_attachment) .index_file("Cargo.toml"), ), ); let request = TestRequest::get().uri("/").to_request(); let response = test::call_service(&mut srv, request); assert_eq!(response.status(), StatusCode::OK); let content_disposition = response .headers() .get(header::CONTENT_DISPOSITION) .expect("To have CONTENT_DISPOSITION"); let content_disposition = content_disposition .to_str() .expect("Convert CONTENT_DISPOSITION to str"); assert_eq!(content_disposition, "attachment; filename=\"Cargo.toml\""); }
rust_cleaned_test_functions.jsonl/35490
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 466 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 83624, 48576, 368, 341, 286, 5168, 678, 40868, 73834, 609, 49588, 486, 675, 8, 1464, 4093, 3487, 929, 341, 310, 4093, 3487, 929, 486, 33569, 198, 286, 555, 286, 1077, 5206, 43578, 284, 1273, 486...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_calculate_thumb_x_from_val() { assert_eq!( 0.0, calculate_thumb_x_from_val(0.0, 0.0, 100.0, 100.0, 32.0) ); assert_eq!( 34.0, calculate_thumb_x_from_val(50.0, 0.0, 100.0, 100.0, 32.0) ); assert_eq!( 68.0, calculate_thumb_x_from_val(100.0, 0.0, 100.0, 100.0, 32.0) ); }
rust_cleaned_test_functions.jsonl/80585
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 276 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24005, 11207, 46352, 3212, 5673, 6189, 368, 341, 286, 2060, 10714, 33673, 310, 220, 15, 13, 15, 345, 310, 11047, 46352, 3212, 5673, 6189, 7, 15, 13, 15, 11, 220, 15, 13, 15, 11, 220, 16, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serialize_envelope_attachments() { let event_id = EventId("9ec79c33ec9942ab8353589fcb2e04dc".parse().unwrap()); let mut envelope = Envelope::from_request(Some(event_id), request_meta()); let mut item = Item::new(ItemType::Event); item.set_payload( ContentType::Json, "{\"message\":\"hello world\",\"level\":\"error\"}", ); envelope.add_item(item); let mut item = Item::new(ItemType::Attachment); item.set_payload(ContentType::Text, &b"Hello\r\n"[..]); item.set_filename("application.log"); envelope.add_item(item); let mut buffer = Vec::new(); envelope.serialize(&mut buffer).unwrap(); let stringified = String::from_utf8_lossy(&buffer); insta::assert_snapshot!(stringified, @r###" {"event_id":"9ec79c33ec9942ab8353589fcb2e04dc","dsn":"https://e12d836b15bb49d7bbf99e64295d995b:@sentry.io/42","client":"sentry/client","version":7,"origin":"http://origin/","remote_addr":"192.168.0.1","user_agent":"sentry/agent"} {"type":"event","length":41,"content_type":"application/json"} {"message":"hello world","level":"error"} {"type":"attachment","length":7,"content_type":"text/plain","filename":"application.log"} Hello "###); }
rust_cleaned_test_functions.jsonl/103620
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 579 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88686, 6205, 18853, 98581, 368, 341, 286, 1077, 1538, 842, 284, 3665, 764, 445, 24, 757, 22, 24, 66, 18, 18, 757, 24, 24, 19, 17, 370, 23, 18, 20, 18, 20, 23, 24, 69, 7221, 17, 68, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_server_stale_meta() { let count = 3; let mut cluster = new_server_cluster(0, count); let pd_client = Arc::clone(&cluster.pd_client); // Disable default max peer number check. pd_client.disable_default_operator(); cluster.run(); cluster.add_send_filter(IsolationFilterFactory::new(3)); pd_client.must_remove_peer(1, new_peer(3, 3)); pd_client.must_add_peer(1, new_peer(3, 4)); cluster.shutdown(); let engine_3 = cluster.get_engine(3); let mut state: RegionLocalState = engine_3 .get_msg_cf(CF_RAFT, &keys::region_state_key(1)) .unwrap() .unwrap(); state.set_state(PeerState::Tombstone); let handle = get_cf_handle(&engine_3, CF_RAFT).unwrap(); engine_3 .put_msg_cf(handle, &keys::region_state_key(1), &state) .unwrap(); cluster.clear_send_filters(); // avoid TIMEWAIT sleep_ms(500); cluster.start().unwrap(); cluster.must_put(b"k1", b"v1"); must_get_equal(&engine_3, b"k1", b"v1"); }
rust_cleaned_test_functions.jsonl/119799
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 454 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12015, 1261, 1574, 13381, 368, 341, 262, 1077, 1760, 284, 220, 18, 280, 262, 1077, 5206, 10652, 284, 501, 12015, 28441, 7, 15, 11, 1760, 317, 262, 1077, 7744, 8179, 284, 19689, 486, 19982, 2099,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_process_store_ok() { solana_logger::setup(); let keys = vec![]; let (config_keypair, config_account) = create_config_account(keys.clone()); let config_pubkey = config_keypair.pubkey(); let my_config = MyConfig::new(42); let instruction = config_instruction::store(&config_pubkey, true, keys, &my_config); let keyed_accounts = [(true, false, config_pubkey, config_account.clone())]; assert_eq!( process_instruction(&instruction.data, &keyed_accounts), Ok(()) ); assert_eq!( Some(my_config), deserialize(get_config_data(config_account.borrow().data()).unwrap()).ok() ); }
rust_cleaned_test_functions.jsonl/36692
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 337 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11305, 14809, 19817, 368, 341, 286, 2048, 3362, 27413, 486, 15188, 543, 286, 1077, 6894, 284, 7486, 0, 15078, 286, 1077, 320, 1676, 3097, 12670, 11, 2193, 13500, 8, 284, 1855, 5332, 13500, 36131, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_calculate_monitoring_station_position_large_example() { let map = string_to_asteroid_map( ".#..##.###...#######\n\ ##.############..##.\n\ .#.######.########.#\n\ .###.#######.####.#.\n\ #####.##.#.##.###.##\n\ ..#####..#.#########\n\ ####################\n\ #.####....###.#.#.##\n\ ##.#################\n\ #####.##.###..####..\n\ ..######..##.#######\n\ ####.##.####...##..#\n\ .#####..#.######.###\n\ ##...#.##########...\n\ #.##########.#######\n\ .####.#.###.###.#.##\n\ ....##.##.###..#####\n\ .#.#.###########.###\n\ #.#.#.#####.####.###\n\ ###.##.####.##.#..##", ); assert_eq!( (AsteroidLocation::new(11, 13), 210), calculate_monitoring_station_position(&map) ); }
rust_cleaned_test_functions.jsonl/69386
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 616 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24005, 11207, 40112, 287, 44798, 9661, 45228, 39304, 368, 341, 286, 1077, 2415, 284, 914, 2346, 62, 2300, 588, 5376, 1006, 310, 5933, 2, 496, 565, 13, 14374, 1112, 97864, 59, 77, 5661, 1797, 770...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_erb_inout() { let sr = 24000; let n_fft = 192; let n_freqs = n_fft / 2 + 1; let hop = n_fft / 2; let nb_bands = 24; let state = DFState::new(sr, n_fft, hop, nb_bands, 1); let d = Uniform::new(-1., 1.); let mut input = Vec::with_capacity(n_freqs); let mut rng = rand::thread_rng(); for _ in 0..(n_freqs) { input.push(Complex32::new(d.sample(&mut rng), d.sample(&mut rng))) } let mut mask = vec![1.; nb_bands]; mask[3] = 0.3; mask[nb_bands - 1] = 0.5; let mut output = input.clone(); apply_band_gain(&mut output, mask.as_slice(), &state.erb); let mut cumsum = 0; for (erb_idx, erb_w) in state.erb.iter().enumerate() { for i in cumsum..cumsum + erb_w { assert_eq!(input[i] * mask[erb_idx], output[i]) } cumsum += erb_w; } }
rust_cleaned_test_functions.jsonl/104358
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 534 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 40499, 1243, 411, 368, 341, 286, 1077, 18962, 284, 220, 17, 19, 15, 15, 15, 280, 286, 1077, 308, 67059, 284, 220, 16, 24, 17, 280, 286, 1077, 308, 21790, 82, 284, 308, 67059, 608, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_create_program_spec_success() { let mut context_builder = ContextBuilder::new(); context_builder.log_in(&[RoleType::SpecCreator]); let conn = context_builder.db_conn(); let hw_spec = HardwareSpecFactory::default().name("HW 1").insert(conn); let values_list: InputValue = InputValue::list( [1, 2, 3].iter().map(|v| InputValue::scalar(*v)).collect(), ); let runner = QueryRunner::new(context_builder); assert_eq!( runner.query( QUERY, hashmap! { "hardwareSpecId" => InputValue::scalar(hw_spec.id.to_string()), "name" => InputValue::scalar("Program 2"), "description" => InputValue::scalar("description!"), "input" => values_list.clone(), "expectedOutput" => values_list, } ), ( json!({ "createProgramSpec": { "programSpecEdge": { "node": { "name": "Program 2", "slug": "program-2", "description": "description!", "input": [1, 2, 3], "expectedOutput": [1, 2, 3], } } } }), vec![] ) ); }
rust_cleaned_test_functions.jsonl/90805
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 787 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 25096, 13594, 18632, 368, 341, 262, 1077, 5206, 2266, 28532, 284, 9608, 3297, 486, 931, 543, 262, 2266, 28532, 1665, 1243, 2099, 58, 9030, 929, 486, 8327, 31865, 2558, 262, 1077, 4534, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_binds() -> Result<(), Box<dyn Error + Send + Sync>> { assert_eq!("10f20o30o10", &"?f?o?o?".binds(&[&10, &20, &30])); assert_eq!( "'abc'f'def'o'ghi'o'abc'", &"?f?o?o?".binds(&[&"abc", &"def", &"ghi"]) ); assert_eq!( "10f20o30o10", &String::from("?f?o?o?").binds(&[&10, &20, &30]) ); assert_eq!( "10f'AAA'oTRUEo10", &String::from("?f?o?o?").binds(&[&10, &"AAA", &true]) ); assert_eq!( "10f'AAA'o$oTRUE", &String::from("$1f$02o$$o$3$4").bind_nums(&[&10, &"AAA", &true]) ); assert_eq!( "1f1.5o0.0000001o1", &"?f?o?o?".binds(&[&1.0, &1.5, &0.0000001]) ); Ok(()) }
rust_cleaned_test_functions.jsonl/4401
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 526 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 8673, 368, 1464, 5714, 68843, 8261, 92846, 4600, 488, 11000, 488, 28937, 2452, 341, 286, 2060, 10714, 17223, 16, 15, 69, 17, 15, 78, 18, 15, 78, 16, 15, 497, 609, 43869, 69, 30, 78, 30,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_escaped_char() { assert_eq!(escaped_char(r"\u012345"), Ok(("45", '\u{0123}'))); assert_eq!(escaped_char(r"\U00012345"), Ok(("", '\u{012345}'))); }
rust_cleaned_test_functions.jsonl/21709
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 107 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 65826, 9232, 368, 341, 286, 2060, 10714, 10297, 65826, 9232, 2601, 11934, 84, 15, 16, 17, 18, 19, 20, 3975, 7622, 30873, 19, 20, 497, 5196, 84, 90, 15, 16, 17, 18, 92, 43284, 286, 2060, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_uuid_params() { test_type( "UUID", &[ ( Some(Uuid::parse_str("a0eebc99-9c0b-4ef8-bb6d-6bb9bd380a11").unwrap()), "'a0eebc99-9c0b-4ef8-bb6d-6bb9bd380a11'", ), (None, "NULL"), ], ) }
rust_cleaned_test_functions.jsonl/83314
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 211 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25540, 6745, 368, 341, 262, 1273, 1819, 1006, 286, 330, 24754, 756, 286, 609, 9640, 310, 2399, 394, 4329, 12317, 2423, 486, 6400, 2895, 445, 64, 15, 2127, 8904, 24, 24, 12, 24, 66, 15, 65, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_func_undefined_local() { Function::new( "function", &vec!["a".to_string()], &YolkExpr::Ident("b".to_string()), ) .unwrap(); }
rust_cleaned_test_functions.jsonl/131956
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 98 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9596, 62, 9614, 13564, 368, 341, 262, 5712, 486, 931, 1006, 286, 330, 1688, 756, 286, 609, 4083, 0, 1183, 64, 3263, 983, 3904, 73845, 286, 609, 56, 22604, 16041, 486, 28301, 445, 65, 3263, 983...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_where_clause() { let queries = ["where name = 'jon'", "where id = 5", "where name = 'bill' and age > 35"]; for q in queries.into_iter() { where_clause(q).expect(q); } }
rust_cleaned_test_functions.jsonl/114454
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 130 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 36814, 57530, 368, 341, 286, 1077, 19556, 284, 4383, 2870, 829, 284, 364, 34165, 38330, 286, 330, 2870, 877, 284, 220, 20, 756, 286, 330, 2870, 829, 284, 364, 29642, 6, 323, 4231, 861, 220, 18...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_ram_consumption() { // Regular debouncers assert_eq!( std::mem::size_of_val(&SmallPinDebouncer::new(2, PinState::Low)), 4 ); assert_eq!( std::mem::size_of_val(&SmallPinDebouncer::new(8, PinState::Low)), 4 ); assert_eq!( std::mem::size_of_val(&SmallPinDebouncer::new(9, PinState::Low)), 4 ); assert_eq!( std::mem::size_of_val(&SmallPinDebouncer::new(16, PinState::Low)), 4 ); }
rust_cleaned_test_functions.jsonl/2182
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 326 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62124, 69870, 560, 368, 341, 286, 442, 28800, 4222, 2981, 388, 198, 286, 2060, 10714, 33673, 310, 1460, 486, 10536, 486, 2141, 3575, 6189, 2099, 25307, 19861, 1912, 65, 79745, 486, 931, 7, 17, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_make_look_up_key() { let k = LookUpKey::new(b"da", 1); assert_eq!(k.internal_key(), &[100, 97, 1, 1, 0, 0, 0, 0, 0, 0]); assert_eq!(k.user_key(), &[100, 97]); assert_eq!( k.memtable_key().as_slice(), &[10, 100, 97, 1, 1, 0, 0, 0, 0, 0, 0] ); }
rust_cleaned_test_functions.jsonl/124312
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 198 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28230, 24271, 8237, 3097, 368, 341, 286, 1077, 595, 284, 9192, 2324, 1592, 486, 931, 1883, 1, 3235, 497, 220, 16, 317, 286, 2060, 10714, 10297, 74, 18264, 3097, 1507, 44590, 16, 15, 15, 11, 22...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_dive_depth() { let dive_commands = get_commands(); let dive = Dive::new(dive_commands); assert_eq!(dive.depth(), 60); }
rust_cleaned_test_functions.jsonl/110103
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 85 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 814, 533, 19061, 368, 341, 286, 1077, 29863, 44151, 284, 633, 44151, 543, 286, 1077, 29863, 284, 88517, 486, 931, 1500, 533, 44151, 317, 286, 2060, 10714, 10297, 67, 533, 40974, 1507, 220, 21, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_manager_serialize_deserialize_inconsistent_monitor() { // Test deserializing a ChannelManager with an out-of-date ChannelMonitor let chanmon_cfgs = create_chanmon_cfgs(4); let node_cfgs = create_node_cfgs(4, &chanmon_cfgs); let node_chanmgrs = create_node_chanmgrs(4, &node_cfgs, &[None, None, None, None]); let logger: test_utils::TestLogger; let fee_estimator: test_utils::TestFeeEstimator; let persister: test_utils::TestPersister; let new_chain_monitor: test_utils::TestChainMonitor; let nodes_0_deserialized: ChannelManager<EnforcingSigner, &test_utils::TestChainMonitor, &test_utils::TestBroadcaster, &test_utils::TestKeysInterface, &test_utils::TestFeeEstimator, &test_utils::TestLogger>; let mut nodes = create_network(4, &node_cfgs, &node_chanmgrs); create_announced_chan_between_nodes(&nodes, 0, 1, InitFeatures::known(), InitFeatures::known()); create_announced_chan_between_nodes(&nodes, 2, 0, InitFeatures::known(), InitFeatures::known()); let (_, _, channel_id, funding_tx) = create_announced_chan_between_nodes(&nodes, 0, 3, InitFeatures::known(), InitFeatures::known()); let mut node_0_stale_monitors_serialized = Vec::new(); for monitor in nodes[0].chain_monitor.chain_monitor.monitors.read().unwrap().iter() { let mut writer = test_utils::TestVecWriter(Vec::new()); monitor.1.write(&mut writer).unwrap(); node_0_stale_monitors_serialized.push(writer.0); } let (our_payment_preimage, _, _) = route_payment(&nodes[2], &[&nodes[0], &nodes[1]], 1000000); let nodes_0_serialized = nodes[0].node.encode(); route_payment(&nodes[0], &[&nodes[3]], 1000000); nodes[1].node.peer_disconnected(&nodes[0].node.get_our_node_id(), false); nodes[2].node.peer_disconnected(&nodes[0].node.get_our_node_id(), false); nodes[3].node.peer_disconnected(&nodes[0].node.get_our_node_id(), false); // Now the ChannelMonitor (which is now out-of-sync with ChannelManager for channel w/ // nodes[3]) let mut node_0_monitors_serialized = Vec::new(); for monitor in nodes[0].chain_monitor.chain_monitor.monitors.read().unwrap().iter() { let mut writer = test_utils::TestVecWriter(Vec::new()); monitor.1.write(&mut writer).unwrap(); node_0_monitors_serialized.push(writer.0); } logger = test_utils::TestLogger::new(); fee_estimator = test_utils::TestFeeEstimator { sat_per_kw: Mutex::new(253) }; persister = test_utils::TestPersister::new(); let keys_manager = &chanmon_cfgs[0].keys_manager; new_chain_monitor = test_utils::TestChainMonitor::new(Some(nodes[0].chain_source), nodes[0].tx_broadcaster.clone(), &logger, &fee_estimator, &persister, keys_manager); nodes[0].chain_monitor = &new_chain_monitor; let mut node_0_stale_monitors = Vec::new(); for serialized in node_0_stale_monitors_serialized.iter() { let mut read = &serialized[..]; let (_, monitor) = <(BlockHash, ChannelMonitor<EnforcingSigner>)>::read(&mut read, keys_manager).unwrap(); assert!(read.is_empty()); node_0_stale_monitors.push(monitor); } let mut node_0_monitors = Vec::new(); for serialized in node_0_monitors_serialized.iter() { let mut read = &serialized[..]; let (_, monitor) = <(BlockHash, ChannelMonitor<EnforcingSigner>)>::read(&mut read, keys_manager).unwrap(); assert!(read.is_empty()); node_0_monitors.push(monitor); } let mut nodes_0_read = &nodes_0_serialized[..]; if let Err(msgs::DecodeError::InvalidValue) = <(BlockHash, ChannelManager<EnforcingSigner, &test_utils::TestChainMonitor, &test_utils::TestBroadcaster, &test_utils::TestKeysInterface, &test_utils::TestFeeEstimator, &test_utils::TestLogger>)>::read(&mut nodes_0_read, ChannelManagerReadArgs { default_config: UserConfig::default(), keys_manager, fee_estimator: &fee_estimator, chain_monitor: nodes[0].chain_monitor, tx_broadcaster: nodes[0].tx_broadcaster.clone(), logger: &logger, channel_monitors: node_0_stale_monitors.iter_mut().map(|monitor| { (monitor.get_funding_txo().0, monitor) }).collect(), }) { } else { panic!("If the monitor(s) are stale, this indicates a bug and we should get an Err return"); }; let mut nodes_0_read = &nodes_0_serialized[..]; let (_, nodes_0_deserialized_tmp) = <(BlockHash, ChannelManager<EnforcingSigner, &test_utils::TestChainMonitor, &test_utils::TestBroadcaster, &test_utils::TestKeysInterface, &test_utils::TestFeeEstimator, &test_utils::TestLogger>)>::read(&mut nodes_0_read, ChannelManagerReadArgs { default_config: UserConfig::default(), keys_manager, fee_estimator: &fee_estimator, chain_monitor: nodes[0].chain_monitor, tx_broadcaster: nodes[0].tx_broadcaster.clone(), logger: &logger, channel_monitors: node_0_monitors.iter_mut().map(|monitor| { (monitor.get_funding_txo().0, monitor) }).collect(), }).unwrap(); nodes_0_deserialized = nodes_0_deserialized_tmp; assert!(nodes_0_read.is_empty()); { // Channel close should result in a commitment tx let txn = nodes[0].tx_broadcaster.txn_broadcasted.lock().unwrap(); assert_eq!(txn.len(), 1); check_spends!(txn[0], funding_tx); assert_eq!(txn[0].input[0].previous_output.txid, funding_tx.txid()); } for monitor in node_0_monitors.drain(..) { assert!(nodes[0].chain_monitor.watch_channel(monitor.get_funding_txo().0, monitor).is_ok()); check_added_monitors!(nodes[0], 1); } nodes[0].node = &nodes_0_deserialized; check_closed_event!(nodes[0], 1, ClosureReason::OutdatedChannelManager); reconnect_nodes(&nodes[0], &nodes[1], (false, false), (0, 0), (0, 0), (0, 0), (0, 0), (0, 0), (false, false)); reconnect_nodes(&nodes[0], &nodes[2], (false, false), (0, 0), (0, 0), (0, 0), (0, 0), (0, 0), (false, false)); claim_payment(&nodes[2], &[&nodes[0], &nodes[1]], our_payment_preimage); nodes[3].node.peer_connected(&nodes[0].node.get_our_node_id(), &msgs::Init { features: InitFeatures::empty() }); let reestablish = get_event_msg!(nodes[3], MessageSendEvent::SendChannelReestablish, nodes[0].node.get_our_node_id()); nodes[0].node.peer_connected(&nodes[3].node.get_our_node_id(), &msgs::Init { features: InitFeatures::empty() }); nodes[0].node.handle_channel_reestablish(&nodes[3].node.get_our_node_id(), &reestablish); let msg_events = nodes[0].node.get_and_clear_pending_msg_events(); assert_eq!(msg_events.len(), 1); if let MessageSendEvent::HandleError { ref action, .. } = msg_events[0] { match action { &ErrorAction::SendErrorMessage { ref msg } => { assert_eq!(msg.channel_id, channel_id); }, _ => panic!("Unexpected event!"), } } }
rust_cleaned_test_functions.jsonl/16898
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2441 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12144, 88686, 15768, 9050, 1243, 78399, 40112, 368, 341, 197, 322, 3393, 939, 2848, 4849, 264, 13434, 2043, 448, 458, 700, 8668, 18413, 13434, 30098, 198, 10217, 26023, 1645, 18343, 82, 284, 1855, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
9
#[test] fn test_load_ephemeral_account_fails() { request_stream_test( AccountLifetime::Ephemeral, Arc::new(Inspector::new()), |proxy, ahc_client_end| { async move { let expected_id = TEST_ACCOUNT_ID.clone(); assert_eq!( proxy.load_account(ahc_client_end, expected_id.into()).await?, Err(ApiError::Internal) ); Ok(()) } }, ); }
rust_cleaned_test_functions.jsonl/36822
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 352 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12411, 12476, 29032, 3253, 13500, 761, 6209, 368, 341, 286, 1681, 12673, 4452, 1006, 310, 8615, 74579, 486, 36, 59941, 3253, 345, 310, 19689, 486, 931, 7, 46230, 486, 931, 14702, 310, 760, 22803, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_my_queue() { let mut q = MyQueue::new(); q.push(1); q.push(2); assert_eq!(q.peek(), 1); assert_eq!(q.pop(), 1); assert!(!q.empty()); }
rust_cleaned_test_functions.jsonl/50352
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 124 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35686, 10841, 368, 341, 286, 1077, 5206, 2804, 284, 3017, 7554, 486, 931, 543, 286, 2804, 2552, 7, 16, 317, 286, 2804, 2552, 7, 17, 317, 286, 2060, 10714, 10297, 80, 41249, 1507, 220, 16, 317,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_ascii_5_gibi_to_file() { let tname = "ascii-5G"; let tmp_fn = format!("TESTFILE-{}.tmp", &tname); let (fix, mut ucmd) = at_and_ucmd!(); ucmd.args(&[ "status=none", "count=5G", "iflag=count_bytes", "if=/dev/zero", of!(tmp_fn), ]) .run() .no_stderr() .no_stdout() .success(); assert_eq!(5 * 1024 * 1024 * 1024, fix.metadata(&tmp_fn).len()); }
rust_cleaned_test_functions.jsonl/59401
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 241 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 50238, 62, 20, 1889, 39393, 2346, 2458, 368, 341, 262, 1077, 259, 606, 284, 330, 23324, 12, 20, 38, 876, 262, 1077, 4174, 15246, 284, 3561, 17223, 10033, 6041, 12, 46391, 5173, 497, 609, 83, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_pointer_encoding_ok() { use crate::endianity::NativeEndian; let expected = constants::DwEhPe(constants::DW_EH_PE_uleb128.0 | constants::DW_EH_PE_pcrel.0); let input = [expected.0, 1, 2, 3, 4]; let input = &mut EndianSlice::new(&input, NativeEndian); assert_eq!(parse_pointer_encoding(input), Ok(expected)); assert_eq!(*input, EndianSlice::new(&[1, 2, 3, 4], NativeEndian)); }
rust_cleaned_test_functions.jsonl/9400
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 217 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 21425, 37613, 19817, 368, 341, 286, 990, 17717, 486, 408, 1103, 487, 486, 20800, 43231, 280, 286, 1077, 3601, 4035, 310, 18021, 486, 35, 86, 36, 71, 10197, 80368, 486, 54219, 2089, 39, 45...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_flip_normal_create() { let yzrect = Rect::new( -1.0, 1.0, -1.0, 1.0, 0.0, &MaterialType::DiffuseLight(DiffuseLight::new(TextureType::ConstantTexture( ConstantTexture::new(&vect!(4, 4, 4)), ))), Axis::X, ); let r = Ray::new(&vect!(1, 0, 0), &vect!(-1, 0, 0), None); let mut hr_ans = HitRecord::new( vect!(0, 0, 0), 1.0, MaterialType::DiffuseLight(DiffuseLight::new(TextureType::ConstantTexture( ConstantTexture::new(&vect!(4, 4, 4)), ))), ); hr_ans.normal = vect!(1, 0, 0); hr_ans.texture_coord = Some(TextureCoord { u: 0.5, v: 0.5 }); let hr = yzrect.hit(&r, 0.0, 1.0); let flipnorm = FlipNormal::new(&yzrect); let flipped_hr = flipnorm.hit(&r, 0.0, 1.0); assert_eq!(hr.unwrap().normal, flipped_hr.unwrap().normal * -1.); }
rust_cleaned_test_functions.jsonl/126592
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 576 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 56012, 13973, 8657, 368, 341, 286, 1077, 379, 89, 2851, 284, 11920, 486, 931, 1006, 310, 481, 16, 13, 15, 345, 310, 220, 16, 13, 15, 345, 310, 481, 16, 13, 15, 345, 310, 220, 16, 13, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_it() { async fn do_test() { let (r, _w) = sys_util::pipe(true).unwrap(); let done = Box::pin(async { 5usize }); let pending = Box::pin(TestFut::new(r)); match futures::future::select(pending, done).await { Either::Right((5, pending)) => std::mem::drop(pending), _ => panic!("unexpected select result"), } // test that dropping the incomplete future removed the waker. assert_eq!(0, pending_ops()); } let fut = do_test(); crate::run_one_poll(Box::pin(fut)).unwrap(); // Example of starting the framework and running a future: async fn my_async(x: Rc<RefCell<u64>>) { x.replace(4); } let x = Rc::new(RefCell::new(0)); crate::run_one_poll(Box::pin(my_async(x.clone()))).unwrap(); assert_eq!(*x.borrow(), 4); }
rust_cleaned_test_functions.jsonl/29665
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 469 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14631, 368, 341, 286, 3312, 5168, 653, 4452, 368, 341, 310, 1077, 320, 81, 11, 716, 86, 8, 284, 5708, 18974, 486, 13768, 3715, 568, 15454, 543, 310, 1077, 2814, 284, 8261, 486, 13273, 18285, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_degrees() { let tests_cases = vec![ (None, None), (Some(f64::NAN), None), (Some(0f64), Some(Real::new(0f64).unwrap())), (Some(1f64), Some(Real::new(57.29577951308232_f64).unwrap())), ( Some(std::f64::consts::PI), Some(Real::new(180.0_f64).unwrap()), ), ( Some(-std::f64::consts::PI / 2.0_f64), Some(Real::new(-90.0_f64).unwrap()), ), ]; for (input, expect) in tests_cases { let output = RpnFnScalarEvaluator::new() .push_param(input) .evaluate(ScalarFuncSig::Degrees) .unwrap(); assert_eq!(expect, output, "{:?}", input); } }
rust_cleaned_test_functions.jsonl/9489
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 503 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 46057, 7858, 368, 341, 286, 1077, 7032, 41427, 284, 7486, 90515, 310, 320, 4064, 11, 2240, 1326, 310, 320, 8373, 955, 21, 19, 486, 45, 1093, 701, 2240, 1326, 310, 320, 8373, 7, 15, 69, 21, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_parse() { let tests = vec![ T("", 0, vec![]), T("", 1000, vec![]), T("foo", 0, vec![]), T("bytes=", 0, vec![]), T("bytes=7", 10, vec![]), T("bytes= 7 ", 10, vec![]), T("bytes=1-", 0, vec![]), T("bytes=5-4", 10, vec![]), T("bytes=0-2,5-4", 10, vec![]), T("bytes=2-5,4-3", 10, vec![]), T("bytes=--5,4--3", 10, vec![]), T("bytes=A-", 10, vec![]), T("bytes=A- ", 10, vec![]), T("bytes=A-Z", 10, vec![]), T("bytes= -Z", 10, vec![]), T("bytes=5-Z", 10, vec![]), T("bytes=Ran-dom, garbage", 10, vec![]), T("bytes=0x01-0x02", 10, vec![]), T("bytes= ", 10, vec![]), T("bytes= , , , ", 10, vec![]), T( "bytes=0-9", 10, vec![HttpRange { start: 0, length: 10, }], ), T( "bytes=0-", 10, vec![HttpRange { start: 0, length: 10, }], ), T( "bytes=5-", 10, vec![HttpRange { start: 5, length: 5, }], ), T( "bytes=0-20", 10, vec![HttpRange { start: 0, length: 10, }], ), T( "bytes=15-,0-5", 10, vec![HttpRange { start: 0, length: 6, }], ), T( "bytes=1-2,5-", 10, vec![ HttpRange { start: 1, length: 2, }, HttpRange { start: 5, length: 5, }, ], ), T( "bytes=-2 , 7-", 11, vec![ HttpRange { start: 9, length: 2, }, HttpRange { start: 7, length: 4, }, ], ), T( "bytes=0-0 ,2-2, 7-", 11, vec![ HttpRange { start: 0, length: 1, }, HttpRange { start: 2, length: 1, }, HttpRange { start: 7, length: 4, }, ], ), T( "bytes=-5", 10, vec![HttpRange { start: 5, length: 5, }], ), T( "bytes=-15", 10, vec![HttpRange { start: 0, length: 10, }], ), T( "bytes=0-499", 10000, vec![HttpRange { start: 0, length: 500, }], ), T( "bytes=500-999", 10000, vec![HttpRange { start: 500, length: 500, }], ), T( "bytes=-500", 10000, vec![HttpRange { start: 9500, length: 500, }], ), T( "bytes=9500-", 10000, vec![HttpRange { start: 9500, length: 500, }], ), T( "bytes=0-0,-1", 10000, vec![ HttpRange { start: 0, length: 1, }, HttpRange { start: 9999, length: 1, }, ], ), T( "bytes=500-600,601-999", 10000, vec![ HttpRange { start: 500, length: 101, }, HttpRange { start: 601, length: 399, }, ], ), T( "bytes=500-700,601-999", 10000, vec![ HttpRange { start: 500, length: 201, }, HttpRange { start: 601, length: 399, }, ], ), // Match Apache laxity: T( "bytes= 1 -2 , 4- 5, 7 - 8 , ,,", 11, vec![ HttpRange { start: 1, length: 2, }, HttpRange { start: 4, length: 2, }, HttpRange { start: 7, length: 2, }, ], ), ]; for t in tests { let header = t.0; let size = t.1; let expected = t.2; let res = HttpRange::parse(header, size); if res.is_err() { if expected.is_empty() { continue; } else { assert!( false, "parse({}, {}) returned error {:?}", header, size, res.unwrap_err() ); } } let got = res.unwrap(); if got.len() != expected.len() { assert!( false, "len(parseRange({}, {})) = {}, want {}", header, size, got.len(), expected.len() ); continue; } for i in 0..expected.len() { if got[i].start != expected[i].start { assert!( false, "parseRange({}, {})[{}].start = {}, want {}", header, size, i, got[i].start, expected[i].start ) } if got[i].length != expected[i].length { assert!( false, "parseRange({}, {})[{}].length = {}, want {}", header, size, i, got[i].length, expected[i].length ) } } } }
rust_cleaned_test_functions.jsonl/40537
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 5775 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 368, 341, 286, 1077, 7032, 284, 7486, 90515, 310, 350, 19814, 220, 15, 11, 7486, 0, 1294, 1326, 310, 350, 19814, 220, 16, 15, 15, 15, 11, 7486, 0, 1294, 1326, 310, 350, 445, 7975, 497...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
8
#[test] fn test_parse_quoted_max_age() { let h = Header::parse_header(&[b"max-age=\"31536000\"".to_vec()][..]); assert_eq!(h.ok(), Some(StrictTransportSecurity { include_subdomains: false, max_age: 31536000u64 })); }
rust_cleaned_test_functions.jsonl/37331
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 109 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 11280, 9253, 6345, 32053, 368, 341, 286, 1077, 305, 284, 12104, 486, 6400, 8757, 2099, 58, 65, 1, 2810, 42941, 4070, 18, 16, 20, 18, 21, 15, 15, 15, 2105, 3263, 983, 13251, 75453, 496, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_weight_iterators() { let mut gr = Graph::<_, _>::new(); let a = gr.add_node("A"); let b = gr.add_node("B"); let c = gr.add_node("C"); let d = gr.add_node("D"); let e = gr.add_node("E"); let f = gr.add_node("F"); let g = gr.add_node("G"); gr.add_edge(a, b, 7.0); gr.add_edge(a, d, 5.); gr.add_edge(d, b, 9.); gr.add_edge(b, c, 8.); gr.add_edge(b, e, 7.); gr.add_edge(c, e, 5.); gr.add_edge(d, e, 15.); gr.add_edge(d, f, 6.); gr.add_edge(f, e, 8.); gr.add_edge(f, g, 11.); gr.add_edge(e, g, 9.); assert_eq!(gr.node_weights_mut().count(), gr.node_count()); assert_eq!(gr.edge_weights_mut().count(), gr.edge_count()); // add a disjoint part let h = gr.add_node("H"); let i = gr.add_node("I"); let j = gr.add_node("J"); gr.add_edge(h, i, 1.); gr.add_edge(h, j, 3.); gr.add_edge(i, j, 1.); assert_eq!(gr.node_weights_mut().count(), gr.node_count()); assert_eq!(gr.edge_weights_mut().count(), gr.edge_count()); for nw in gr.node_weights_mut() { *nw = "x"; } for node in gr.raw_nodes() { assert_eq!(node.weight, "x"); } let old = gr.clone(); for (index, ew) in gr.edge_weights_mut().enumerate() { assert_eq!(old[EdgeIndex::new(index)], *ew); *ew = -*ew; } for (index, edge) in gr.raw_edges().iter().enumerate() { assert_eq!(edge.weight, -1. * old[EdgeIndex::new(index)]); } }
rust_cleaned_test_functions.jsonl/46750
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 759 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15876, 11723, 2973, 368, 341, 262, 1077, 5206, 1081, 284, 12165, 27638, 6878, 716, 6831, 931, 543, 262, 1077, 264, 284, 1081, 1364, 5084, 445, 32, 797, 262, 1077, 293, 284, 1081, 1364, 5084, 445...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_encode_2bytes() { let mut bytes = vec![]; encode_u64(&mut bytes, 256).expect("encode failed"); assert_eq!(bytes.len(), 2); let (decode_int, _) = decode_u64(&bytes).expect("decode err"); assert_eq!(decode_int, 256); }
rust_cleaned_test_functions.jsonl/68978
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 138 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11224, 62, 17, 9651, 368, 341, 286, 1077, 5206, 5820, 284, 7486, 0, 40901, 286, 16164, 7300, 21, 19, 2099, 6984, 5820, 11, 220, 17, 20, 21, 568, 17119, 445, 6180, 4641, 3071, 286, 2060, 10714,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ntype() -> Result<()> { test_opt(DhcpOption::NetBiosNodeType(NodeType::M), vec![46, 1, 4])?; Ok(()) }
rust_cleaned_test_functions.jsonl/41169
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 78 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 38945, 499, 368, 1464, 5714, 71698, 341, 286, 1273, 15032, 5432, 62169, 5341, 486, 6954, 33, 3530, 66137, 22078, 929, 486, 44, 701, 7486, 20703, 19, 21, 11, 220, 16, 11, 220, 19, 2467, 69493, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_example2() { assert_eq!( false, Solution::can_finish(2, vec![vec![1, 0], vec![0, 1]]), ); }
rust_cleaned_test_functions.jsonl/45827
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 98 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39304, 17, 368, 341, 286, 2060, 10714, 33673, 310, 895, 345, 310, 12478, 486, 4814, 42980, 7, 17, 11, 7486, 20703, 4083, 20703, 16, 11, 220, 15, 1125, 7486, 20703, 15, 11, 220, 16, 5053, 1326,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_scan_black_sword() { let result = Sequence::scan(Black, Sword, 0b0001110, 0b0110000, 7, 0); let expected = [Sequence::new(1, 5, Some(4), Some(5))]; assert_eq!(result, expected); let result = Sequence::scan(Black, Sword, 0b0010110, 0b0101000, 7, 0); let expected = [Sequence::new(1, 5, Some(3), Some(5))]; assert_eq!(result, expected); let result = Sequence::scan(Black, Sword, 0b0011010, 0b0100100, 7, 0); let expected = [Sequence::new(1, 5, Some(2), Some(5))]; assert_eq!(result, expected); let result = Sequence::scan(Black, Sword, 0b0011100, 0b0100010, 7, 0); let expected = [Sequence::new(1, 5, Some(1), Some(5))]; assert_eq!(result, expected); let result = Sequence::scan(Black, Sword, 0b0100110, 0b0011000, 7, 0); let expected = [Sequence::new(1, 5, Some(3), Some(4))]; assert_eq!(result, expected); let result = Sequence::scan(Black, Sword, 0b0101010, 0b0010100, 7, 0); let expected = [Sequence::new(1, 5, Some(2), Some(4))]; assert_eq!(result, expected); let result = Sequence::scan(Black, Sword, 0b0101100, 0b0010010, 7, 0); let expected = [Sequence::new(1, 5, Some(1), Some(4))]; assert_eq!(result, expected); let result = Sequence::scan(Black, Sword, 0b0110010, 0b0001100, 7, 0); let expected = [Sequence::new(1, 5, Some(2), Some(3))]; assert_eq!(result, expected); let result = Sequence::scan(Black, Sword, 0b0110100, 0b0001010, 7, 0); let expected = [Sequence::new(1, 5, Some(1), Some(3))]; assert_eq!(result, expected); let result = Sequence::scan(Black, Sword, 0b0111000, 0b0000110, 7, 0); let expected = [Sequence::new(1, 5, Some(1), Some(2))]; assert_eq!(result, expected); // multiple let result = Sequence::scan(Black, Sword, 0b00011100, 0b11100011, 8, 0); let expected = [ Sequence::new(1, 5, Some(1), Some(5)), Sequence::new(2, 6, Some(5), Some(6)), ]; assert_eq!(result, expected); // maybe overline let result = Sequence::scan(Black, Sword, 0b1001110, 0b0110001, 7, 0); let expected = []; assert_eq!(result, expected); // not overline let result = Sequence::scan(Black, Sword, 0b10011100, 0b01100010, 8, 0); let expected = [Sequence::new(1, 5, Some(1), Some(5))]; assert_eq!(result, expected); // multiple let result = Sequence::scan(Black, Sword, 0b0010110100, 0b1101001011, 10, 0); let expected = [ Sequence::new(1, 5, Some(1), Some(3)), Sequence::new(4, 8, Some(6), Some(8)), ]; assert_eq!(result, expected); }
rust_cleaned_test_functions.jsonl/56138
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1288 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28857, 40272, 643, 1158, 368, 341, 286, 1077, 1102, 284, 28871, 486, 16405, 7, 14417, 11, 35651, 11, 220, 15, 65, 15, 15, 15, 16, 16, 16, 15, 11, 220, 15, 65, 15, 16, 16, 15, 15, 15, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_valid_ses_verify_domain_identity() { let mock_response = MockResponseReader::read_response( "test_resources/generated/valid", "ses-verify-domain-identity.xml", ); let mock = MockRequestDispatcher::with_status(200).with_body(&mock_response); let client = SesClient::new(mock, MockCredentialsProvider, rusoto_region::UsEast1); let request = VerifyDomainIdentityRequest::default(); let result = client.verify_domain_identity(request).sync(); assert!(result.is_ok(), "parse error: {:?}", result); }
rust_cleaned_test_functions.jsonl/21982
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 249 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 8337, 643, 288, 35638, 20111, 46244, 368, 341, 286, 1077, 7860, 9655, 284, 14563, 2582, 5062, 486, 878, 9655, 1006, 310, 330, 1944, 35569, 79372, 14, 1891, 756, 310, 330, 9275, 12, 12446, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_one_step() { let inp = "11111 19991 19191 19991 11111"; let mut parsed = input_generator(inp); let mut total: usize = 0; one_step(&mut parsed, &mut total); assert_eq!(total, 9); }
rust_cleaned_test_functions.jsonl/131635
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 125 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11667, 11946, 368, 341, 286, 1077, 32344, 284, 330, 16, 16, 16, 16, 16, 198, 16, 24, 24, 24, 16, 198, 16, 24, 16, 24, 16, 198, 16, 24, 24, 24, 16, 198, 16, 16, 16, 16, 16, 876, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_extract_private_package_version_with_default_config() -> io::Result<()> { let config_name = "package.json"; let config_content = json::json!({ "name": "starship", "version": "0.1.0", "private": true }) .to_string(); let project_dir = create_project_dir()?; fill_config(&project_dir, config_name, Some(&config_content))?; expect_output(&project_dir, None, None)?; project_dir.close() }
rust_cleaned_test_functions.jsonl/19240
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 241 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39123, 26249, 26328, 9438, 6615, 9993, 5332, 368, 1464, 6399, 486, 2077, 71698, 341, 286, 1077, 2193, 1269, 284, 330, 1722, 4323, 876, 286, 1077, 2193, 7495, 284, 2951, 486, 2236, 0, 2262, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_valid_vm_config_serial_console() { vec![ ( vec!["cloud-hypervisor", "--kernel", "/path/to/kernel"], r#"{ "kernel": {"path": "/path/to/kernel"}, "serial": {"mode": "Null"}, "console": {"mode": "Tty"} }"#, true, ), ( vec![ "cloud-hypervisor", "--kernel", "/path/to/kernel", "--serial", "null", "--console", "tty", ], r#"{ "kernel": {"path": "/path/to/kernel"} }"#, true, ), ( vec![ "cloud-hypervisor", "--kernel", "/path/to/kernel", "--serial", "tty", "--console", "off", ], r#"{ "kernel": {"path": "/path/to/kernel"}, "serial": {"mode": "Tty"}, "console": {"mode": "Off"} }"#, true, ), ] .iter() .for_each(|(cli, openapi, equal)| { compare_vm_config_cli_vs_json(cli, openapi, *equal); }); }
rust_cleaned_test_functions.jsonl/4729
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1043 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8337, 39008, 5332, 25602, 51724, 368, 341, 286, 7486, 90515, 310, 2399, 394, 7486, 0, 1183, 12361, 2832, 1082, 31396, 497, 14482, 23248, 497, 3521, 2343, 32429, 58343, 8097, 394, 435, 55543, 515, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cycles() { struct Tests; #[service] impl Tests { #[cycles(100)] fn test_cycles(&self, ctx: ServiceContext) -> ServiceResponse<()> { ServiceResponse::<()>::from_succeed(()) } #[cycles(500)] fn test_cycles2(&self, ctx: ServiceContext) -> ServiceResponse<()> { ServiceResponse::<()>::from_succeed(()) } } #[cycles(200)] fn test_sub_cycles_fn1(ctx: ServiceContext) -> ServiceResponse<()> { ServiceResponse::<()>::from_succeed(()) } #[cycles(200)] fn test_sub_cycles_fn2(_foo: u64, ctx: ServiceContext) -> ServiceResponse<()> { ServiceResponse::<()>::from_succeed(()) } let t = Tests {}; let context = get_context(1000, "", "", ""); t.test_cycles(context.clone()); assert_eq!(context.get_cycles_used(), 100); t.test_cycles2(context.clone()); assert_eq!(context.get_cycles_used(), 600); test_sub_cycles_fn1(context.clone()); assert_eq!(context.get_cycles_used(), 800); test_sub_cycles_fn2(1, context.clone()); assert_eq!(context.get_cycles_used(), 1000); }
rust_cleaned_test_functions.jsonl/11474
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 503 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 68970, 368, 341, 262, 2036, 20150, 401, 262, 11506, 7936, 921, 262, 11605, 20150, 341, 286, 11506, 48421, 7, 16, 15, 15, 5563, 286, 5168, 1273, 68970, 2099, 721, 11, 5635, 25, 5362, 1972, 8, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_em_to_px() { let doc_text = br#" <html> <p>cool</p> </html> "#; let css_text = br#" * { color: inherit; } html { color: black; margin: 1em; } p { color: black; margin: 1em; } "#; let (doc,sss,stree,lbox, rbox) = standard_test_run(doc_text, css_text).unwrap(); let snode = stree.root.borrow(); println!("doc={:#?} snode={:#?}",doc,snode); //check html element assert_eq!(snode.specified_values.get("margin-left").unwrap(), &Length(1.0,Unit::Em)); }
rust_cleaned_test_functions.jsonl/101339
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 332 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22504, 2346, 67162, 368, 341, 262, 1077, 4629, 4326, 284, 1411, 55543, 366, 1551, 29, 366, 79, 29, 42196, 522, 79, 29, 690, 1551, 29, 5869, 280, 262, 1077, 15877, 4326, 284, 1411, 2, 698, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pss_padding_verify() { test::run( test_file!("rsa_pss_padding_tests.txt"), |section, test_case| { assert_eq!(section, ""); let digest_name = test_case.consume_string("Digest"); let alg = match digest_name.as_ref() { "SHA256" => &RSA_PSS_SHA256, "SHA384" => &RSA_PSS_SHA384, "SHA512" => &RSA_PSS_SHA512, _ => panic!("Unsupported digest: {}", digest_name), }; let msg = test_case.consume_bytes("Msg"); let msg = untrusted::Input::from(&msg); let m_hash = digest::digest(alg.digest_alg(), msg.as_slice_less_safe()); let encoded = test_case.consume_bytes("EM"); let encoded = untrusted::Input::from(&encoded); // Salt is recomputed in verification algorithm. let _ = test_case.consume_bytes("Salt"); let bit_len = test_case.consume_usize_bits("Len"); let is_valid = test_case.consume_string("Result") == "P"; let actual_result = encoded.read_all(error::Unspecified, |m| alg.verify(&m_hash, m, bit_len)); assert_eq!(actual_result.is_ok(), is_valid); Ok(()) }, ); }
rust_cleaned_test_functions.jsonl/954
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 768 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 778, 40726, 35638, 368, 341, 286, 1273, 486, 6108, 1006, 310, 1273, 2458, 17223, 60869, 620, 778, 40726, 32509, 3909, 4461, 310, 760, 2809, 11, 1273, 19096, 91, 341, 394, 2060, 10714, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_qualify_path_associated_item() { check_assist( add_missing_impl_members, r#" mod foo { pub struct Bar<T>; impl Bar<T> { type Assoc = u32; } trait Foo { fn foo(&self, bar: Bar<u32>::Assoc); } } struct S; impl foo::Foo for S { <|> }"#, r#" mod foo { pub struct Bar<T>; impl Bar<T> { type Assoc = u32; } trait Foo { fn foo(&self, bar: Bar<u32>::Assoc); } } struct S; impl foo::Foo for S { fn foo(&self, bar: foo::Bar<u32>::Assoc) { ${0:todo!()} } }"#, ); }
rust_cleaned_test_functions.jsonl/110447
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 300 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 64391, 1437, 2638, 58665, 657, 5634, 368, 341, 286, 1779, 12083, 380, 1006, 310, 912, 40447, 21007, 30397, 345, 310, 435, 2, 698, 2593, 15229, 341, 262, 6675, 2036, 4716, 3125, 10133, 262, 11605, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_files_dont_match() { let files_to_test = vec![ (("foo.rs", 1, 10), ("foo1.rs", 5, 12)), (("bar.rs", 1, 10), ("baz.rs", 5, 12)), (("bar.rs", 1, 10), ("bar.js", 5, 12)), (("foo/bar/baz.rs", 1, 10), ("/foo/bar/baz.rs", 5, 12)), (("foo\\\\bar\\baz.rs", 1, 10), ("foo/bar/baz.rs", 9, 12)), (("foo/1.rs", 1, 10), ("foo/2.rs", 5, 12)), ]; assert_no_files_match(files_to_test); }
rust_cleaned_test_functions.jsonl/28049
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 289 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10931, 814, 544, 10708, 368, 341, 286, 1077, 3542, 2346, 4452, 284, 7486, 90515, 310, 89101, 7975, 25638, 497, 220, 16, 11, 220, 16, 15, 701, 3489, 7975, 16, 25638, 497, 220, 20, 11, 220, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_inspect_log_nested() { let (inspector, mut node) = inspector_and_list_node(); inspect_log!(node, { k1: { sub1: "subval1", sub2: { subsub1: "subsubval1", }, sub3: 3u64, }, k2: if true { 10u64 } else { 20 } }); assert_data_tree!(inspector, root: { list_node: { "0": { "@time": AnyProperty, k1: { sub1: "subval1", sub2: { subsub1: "subsubval1", }, sub3: 3u64, }, k2: 10u64 } } }); }
rust_cleaned_test_functions.jsonl/96857
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 597 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34386, 987, 5224, 66279, 368, 341, 286, 1077, 320, 1330, 18997, 11, 5206, 2436, 8, 284, 44725, 8378, 2019, 5084, 543, 286, 24085, 5224, 10297, 3509, 11, 341, 310, 595, 16, 25, 341, 394, 1186, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_inv_mod_xn() { type F = GoldilocksField; let mut rng = thread_rng(); let a_deg = rng.gen_range(0..1_000); let n = rng.gen_range(1..1_000); let mut a = PolynomialCoeffs::new(F::rand_vec(a_deg + 1)); if a.coeffs[0].is_zero() { a.coeffs[0] = F::ONE; // First coefficient needs to be nonzero. } let b = a.inv_mod_xn(n); let mut m = &a * &b; m.coeffs.truncate(n); m.trim(); assert_eq!( m, PolynomialCoeffs::new(vec![F::ONE]), "a: {:#?}, b:{:#?}, n:{:#?}, m:{:#?}", a, b, n, m ); }
rust_cleaned_test_functions.jsonl/15042
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 438 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19996, 7480, 3212, 77, 368, 341, 286, 943, 434, 284, 7421, 321, 25183, 1877, 280, 286, 1077, 5206, 28422, 284, 4516, 66849, 543, 286, 1077, 264, 46057, 284, 28422, 22822, 9698, 7, 15, 496, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_position_read_after_skip() -> crate::Result<()> { let position_deltas: Vec<u32> = (0..1_000).collect(); let positions_data = create_positions_data(&position_deltas[..])?; assert_eq!(positions_data.len(), 1224); let mut position_reader = PositionReader::open(positions_data)?; let mut buf = [0u32; 7]; let mut c = 0; let mut offset = 0; for _ in 0..100 { position_reader.read(offset, &mut buf); position_reader.read(offset, &mut buf); offset += 7; for &el in &buf { assert_eq!(c, el); c += 1; } } Ok(()) }
rust_cleaned_test_functions.jsonl/110173
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 366 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9661, 6443, 19844, 44830, 368, 1464, 17717, 486, 2077, 71698, 341, 286, 1077, 2309, 814, 71906, 25, 11312, 34837, 18, 17, 29, 284, 320, 15, 496, 16, 62, 15, 15, 15, 568, 17384, 543, 286, 1077,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_new_verify() { let request = new("ns.example.com", 512).expect("error converting to http"); assert!(verify("ns.example.com", &request).is_ok()); }
rust_cleaned_test_functions.jsonl/29286
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 81 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5921, 35638, 368, 341, 286, 1077, 1681, 284, 501, 445, 4412, 7724, 905, 497, 220, 20, 16, 17, 568, 17119, 445, 841, 33437, 311, 1758, 797, 286, 2060, 10297, 12446, 445, 4412, 7724, 905, 497, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_cursor_left_on_selection() { let (mut ime, statechan, _actionchan) = set_up("abcdefghi", 1, 5); simulate_keypress(&mut ime, HID_USAGE_KEY_RIGHT, true, true); // right with shift let state = statechan.try_recv().unwrap(); assert_eq!(2, state.revision); assert_eq!(1, state.selection.base); assert_eq!(6, state.selection.extent); simulate_keypress(&mut ime, HID_USAGE_KEY_LEFT, true, false); let state = statechan.try_recv().unwrap(); assert_eq!(3, state.revision); assert_eq!(1, state.selection.base); assert_eq!(1, state.selection.extent); simulate_keypress(&mut ime, HID_USAGE_KEY_LEFT, true, false); let state = statechan.try_recv().unwrap(); assert_eq!(4, state.revision); assert_eq!(0, state.selection.base); assert_eq!(0, state.selection.extent); simulate_keypress(&mut ime, HID_USAGE_KEY_LEFT, true, false); let state = statechan.try_recv().unwrap(); assert_eq!(5, state.revision); assert_eq!(0, state.selection.base); assert_eq!(0, state.selection.extent); }
rust_cleaned_test_functions.jsonl/54276
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 536 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28601, 9579, 4470, 23672, 368, 341, 286, 1077, 320, 6984, 74434, 11, 1584, 5658, 11, 716, 1311, 5658, 8, 284, 738, 8237, 445, 56747, 72, 497, 220, 16, 11, 220, 20, 626, 286, 37453, 3097, 1873,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_force_transfer() { new_test_ext().execute_with(|| { Pallet::<Test>::force_transfer( Origin::root(), ASSET_ID, FROM_ACCOUNT, TO_ACCOUNT, TRANSFER_AMOUNT, true, ) .expect("force_transfer should work"); assert_eq!( Pallet::<Test>::total_balance(ASSET_ID, &FROM_ACCOUNT), INIT_AMOUNT - TRANSFER_AMOUNT ); assert_eq!( Pallet::<Test>::total_balance(ASSET_ID, &TO_ACCOUNT), INIT_AMOUNT + TRANSFER_AMOUNT ); }); }
rust_cleaned_test_functions.jsonl/9168
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 229 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 40739, 35403, 368, 341, 8638, 4452, 9927, 1005, 10257, 6615, 79453, 341, 197, 10025, 7464, 27638, 2271, 6831, 8833, 35403, 1006, 298, 197, 13298, 486, 2888, 3148, 298, 197, 1911, 5884, 3450, 345, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_wildcard_precedence() { assert!(rune! { bool => mod a { pub struct Foo; } mod b { pub struct Foo; } use {a::*, b::*}; use b::Foo; pub fn main() { Foo is b::Foo } }); assert!(rune! { bool => mod a { pub struct Foo; } mod b { pub struct Foo; } use {b::*, a::*}; use a::Foo; pub fn main() { Foo is a::Foo } }); assert!(rune! { bool => mod a { pub struct Foo; } mod b { pub struct Foo; } use a::*; use b::*; use a::Foo; pub fn main() { Foo is a::Foo } }); assert!(rune! { bool => mod a { pub struct Foo; } mod b { pub struct Foo; } use a::Foo; use a::*; use b::*; pub fn main() { Foo is a::Foo } }); }
rust_cleaned_test_functions.jsonl/54727
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 446 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1670, 695, 4951, 10442, 1998, 763, 368, 341, 262, 2060, 10297, 81, 2886, 0, 314, 1807, 6274, 286, 1463, 264, 314, 6675, 2036, 33428, 26, 456, 286, 1463, 293, 314, 6675, 2036, 33428, 26, 456, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_block_qc() { // Verify that it's impossible to create a block with QC that doesn't point to a parent. let signer = ValidatorSigner::random(None); // Test genesis and the next block let genesis_block = Block::make_genesis_block(); let genesis_qc = QuorumCert::certificate_for_genesis(); let payload = 42; let a1 = Block::make_block( &genesis_block, payload, 1, get_current_timestamp().as_micros() as u64, genesis_qc.clone(), &signer, ); let a1_qc = placeholder_certificate_for_block( vec![&signer], a1.id(), a1.round(), a1.quorum_cert().certified_block_id(), a1.quorum_cert().certified_block_round(), a1.quorum_cert().certified_parent_block_id(), a1.quorum_cert().certified_parent_block_round(), ); let result = panic::catch_unwind(|| { // should panic because qc does not point to parent Block::make_block( &a1, payload, 2, get_current_timestamp().as_micros() as u64, genesis_qc.clone(), &signer, ); }); assert!(result.is_err()); let a2 = Block::make_block( &a1, payload, 2, get_current_timestamp().as_micros() as u64, a1_qc.clone(), &signer, ); assert_eq!(a2.height(), 2); }
rust_cleaned_test_functions.jsonl/544
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 696 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7113, 8976, 66, 368, 341, 262, 442, 25429, 429, 432, 594, 11997, 311, 1855, 264, 2504, 448, 42607, 429, 3171, 944, 1459, 311, 264, 2681, 624, 262, 1077, 70039, 284, 32566, 7264, 261, 486, 11463,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_extract_struct_only_copies_needed_generics() { check_assist( extract_struct_from_enum_variant, r#" enum X<'a, 'b, 'x> { $0A { a: &'a &'x mut () }, B { b: &'b () }, C { c: () }, } "#, r#" struct A<'a, 'x>{ a: &'a &'x mut () } enum X<'a, 'b, 'x> { A(A<'a, 'x>), B { b: &'b () }, C { c: () }, } "#, ); }
rust_cleaned_test_functions.jsonl/36318
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 253 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39123, 15126, 18410, 666, 75541, 57426, 71963, 1211, 368, 341, 286, 1779, 12083, 380, 1006, 310, 8649, 15126, 5673, 31054, 46112, 345, 310, 435, 2, 698, 9018, 1599, 18291, 64, 11, 364, 65, 11, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_set_wait() { let (input, modification) = Modification::parse(argv!["wait:2d"]).unwrap(); assert_eq!(input.len(), 0); assert_eq!( modification, Modification { wait: Some(Some(*NOW + chrono::Duration::days(2))), ..Default::default() } ); }
rust_cleaned_test_functions.jsonl/28812
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 195 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2602, 18760, 368, 341, 286, 1077, 320, 1355, 11, 17030, 8, 284, 73855, 486, 6400, 15329, 0, 1183, 11489, 25, 17, 67, 45014, 15454, 543, 286, 2060, 10714, 10297, 1355, 19406, 1507, 220, 15, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_storage_class_parse() { let cases: [(&str, StorageClass, &str); 6] = [ ("EC:3", StorageClass { parity: 3 }, ""), ("EC:4", StorageClass { parity: 4 }, ""), ( "AB:4", StorageClass { parity: 4 }, "supported scheme is 'EC', but not 'AB'", ), ( "EC:4:5", StorageClass { parity: 4 }, "too many sections in 'EC:4:5'", ), ("EC:A", StorageClass { parity: 4 }, "invalid parity 'A'"), ("AB", StorageClass { parity: 4 }, "too few sections in 'AB'"), ]; for (storage_class_env, want_sc, expected_error) in cases.iter() { let result = parse_storage_class(storage_class_env); match result { Ok(result) => { assert_eq!(result.parity, want_sc.parity); assert_eq!("", *expected_error); } Err(err) => assert_eq!(err.to_string(), *expected_error), } } }
rust_cleaned_test_functions.jsonl/44021
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 613 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23310, 4790, 21039, 368, 341, 286, 1077, 5048, 25, 508, 2099, 495, 11, 14693, 1957, 11, 609, 495, 1215, 220, 21, 60, 284, 2278, 310, 3489, 7498, 25, 18, 497, 14693, 1957, 314, 49615, 25, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_ivar() { let cls = test_utils::custom_class(); let ivar = cls.instance_variable("_foo").unwrap(); assert_eq!(ivar.name(), "_foo"); assert!(<u32>::ENCODING.equivalent_to_str(ivar.type_encoding())); assert!(ivar.offset() > 0); #[cfg(feature = "malloc")] assert!(cls.instance_variables().len() > 0); }
rust_cleaned_test_functions.jsonl/7122
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 187 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 51411, 277, 368, 341, 286, 1077, 12790, 284, 1273, 17309, 486, 9163, 4790, 543, 286, 1077, 17509, 277, 284, 12790, 13066, 14635, 16975, 7975, 1827, 15454, 543, 286, 2060, 10714, 10297, 56398, 2644, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_expression_eval() { let mut ctx = EvalContext::new(Arc::new(EvalConfig::default_for_test())); let cases = vec![ ( ScalarFuncSig::CastStringAsReal, vec![Datum::Bytes(b"123".to_vec())], Datum::F64(123f64), ), ( ScalarFuncSig::CastStringAsDecimal, vec![Datum::Bytes(b"123".to_vec())], Datum::Dec(Decimal::from(123)), ), ( ScalarFuncSig::CastStringAsDuration, vec![Datum::Bytes(b"12:02:03".to_vec())], Datum::Dur(Duration::parse(b"12:02:03", 0).unwrap()), ), ( ScalarFuncSig::CastStringAsTime, vec![Datum::Bytes(b"2012-12-12 14:00:05".to_vec())], Datum::Time(Time::parse_utc_datetime("2012-12-12 14:00:05", 0).unwrap()), ), ( ScalarFuncSig::CastStringAsString, vec![Datum::Bytes(b"134".to_vec())], Datum::Bytes(b"134".to_vec()), ), ( ScalarFuncSig::CastIntAsJson, vec![Datum::I64(12)], Datum::Json(Json::I64(12)), ), ]; for (sig, cols, exp) in cases { let mut col_expr = col_expr(0); col_expr .mut_field_type() .set_charset(charset::CHARSET_UTF8.to_owned()); let mut ex = scalar_func_expr(sig, &[col_expr]); ex.mut_field_type() .set_decimal(convert::UNSPECIFIED_LENGTH as i32); ex.mut_field_type() .set_flen(convert::UNSPECIFIED_LENGTH as i32); let e = Expression::build(&mut ctx, ex).unwrap(); let res = e.eval(&mut ctx, &cols).unwrap(); if let Datum::F64(_) = exp { assert_eq!(format!("{}", res), format!("{}", exp)); } else { assert_eq!(res, exp); } } // cases for integer let cases = vec![ ( Some(types::UNSIGNED_FLAG), vec![Datum::U64(u64::MAX)], Datum::U64(u64::MAX), ), (None, vec![Datum::I64(i64::MIN)], Datum::I64(i64::MIN)), (None, vec![Datum::Null], Datum::Null), ]; for (flag, cols, exp) in cases { let col_expr = col_expr(0); let mut ex = scalar_func_expr(ScalarFuncSig::CastIntAsInt, &[col_expr]); if flag.is_some() { ex.mut_field_type().set_flag(flag.unwrap() as u32); } let e = Expression::build(&mut ctx, ex).unwrap(); let res = e.eval(&mut ctx, &cols).unwrap(); assert_eq!(res, exp); } }
rust_cleaned_test_functions.jsonl/6054
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1714 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28068, 21296, 368, 341, 286, 1077, 5206, 5635, 284, 58239, 1972, 486, 931, 4346, 1287, 486, 931, 10722, 831, 2648, 486, 2258, 5478, 4452, 7392, 286, 1077, 5048, 284, 7486, 90515, 310, 2399, 394, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_empty_password() { let value = HeaderValue::from_static("Basic QWxhZGRpbjo="); let scheme = Basic::parse(&value); assert!(scheme.is_ok()); let scheme = scheme.unwrap(); assert_eq!(scheme.username, "Aladdin"); assert_eq!(scheme.password, None); }
rust_cleaned_test_functions.jsonl/75151
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 146 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15124, 10122, 368, 341, 286, 1077, 897, 284, 12104, 1130, 486, 1499, 25360, 445, 15944, 1207, 54, 87, 71, 57, 8626, 16650, 7305, 45219, 286, 1077, 12859, 284, 14625, 486, 6400, 2099, 957, 626, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_var_key_syntax() { let some_key = "foo".to_string(); let another_key = "bar".to_string(); let result = hierarchy! { var some_key: { var another_key: "baz", } }; assert_data_tree!(result, foo: { bar: "baz", }); }
rust_cleaned_test_functions.jsonl/45834
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 193 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4612, 3097, 78894, 368, 341, 286, 1077, 1045, 3097, 284, 330, 7975, 3263, 983, 3904, 543, 286, 1077, 2441, 3097, 284, 330, 2257, 3263, 983, 3904, 543, 286, 1077, 1102, 284, 28922, 0, 341, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_many_targets() { let p = project() .file( "src/bin/a.rs", r#" fn main() {} #[test] fn bin_a() {} "#, ) .file( "src/bin/b.rs", r#" fn main() {} #[test] fn bin_b() {} "#, ) .file( "src/bin/c.rs", r#" fn main() {} #[test] fn bin_c() { panic!(); } "#, ) .file( "examples/a.rs", r#" fn main() {} #[test] fn example_a() {} "#, ) .file( "examples/b.rs", r#" fn main() {} #[test] fn example_b() {} "#, ) .file("examples/c.rs", "#[test] fn example_c() { panic!(); }") .file("tests/a.rs", "#[test] fn test_a() {}") .file("tests/b.rs", "#[test] fn test_b() {}") .file("tests/c.rs", "does not compile") .build(); p.cargo("test --verbose --bin a --bin b --example a --example b --test a --test b") .with_stdout_contains("test bin_a ... ok") .with_stdout_contains("test bin_b ... ok") .with_stdout_contains("test test_a ... ok") .with_stdout_contains("test test_b ... ok") .with_stderr_contains("[RUNNING] `rustc --crate-name a examples/a.rs [..]`") .with_stderr_contains("[RUNNING] `rustc --crate-name b examples/b.rs [..]`") .run(); }
rust_cleaned_test_functions.jsonl/95375
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 899 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22101, 41997, 368, 341, 262, 1077, 281, 284, 2390, 741, 286, 659, 1192, 1006, 310, 330, 3548, 8749, 14186, 25638, 756, 310, 435, 2, 698, 310, 5168, 1887, 368, 5613, 310, 11506, 1944, 60, 5168, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_tag_no_case() { init(); let input = "AbC".chars().collect::<Vec<char>>(); let p = tag_no_case("abc"); let r = p.parse_as_result(&input).unwrap(); assert_eq!(r, "abc"); }
rust_cleaned_test_functions.jsonl/16794
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 102 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9372, 6536, 19096, 368, 341, 262, 2930, 543, 262, 1077, 1946, 284, 330, 5830, 34, 3263, 19255, 1005, 17384, 27638, 10050, 21919, 37038, 262, 1077, 281, 284, 4772, 6536, 19096, 445, 13683, 3071, 26...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_projective_to_affine() { let a = G2Projective::generator(); let b = G2Projective::identity(); assert!(bool::from(G2Affine::from(a).is_on_curve())); assert!(!bool::from(G2Affine::from(a).is_identity())); assert!(bool::from(G2Affine::from(b).is_on_curve())); assert!(bool::from(G2Affine::from(b).is_identity())); let z = Fp2 { c0: Fp::from_raw_unchecked([ 0xba7a_fa1f_9a6f_e250, 0xfa0f_5b59_5eaf_e731, 0x3bdc_4776_94c3_06e7, 0x2149_be4b_3949_fa24, 0x64aa_6e06_49b2_078c, 0x12b1_08ac_3364_3c3e, ]), c1: Fp::from_raw_unchecked([ 0x1253_25df_3d35_b5a8, 0xdc46_9ef5_555d_7fe3, 0x02d7_16d2_4431_06a9, 0x05a1_db59_a6ff_37d0, 0x7cf7_784e_5300_bb8f, 0x16a8_8922_c7a5_e844, ]), }; let c = G2Projective { x: a.x * z, y: a.y * z, z, }; assert_eq!(G2Affine::from(c), G2Affine::generator()); }
rust_cleaned_test_functions.jsonl/47801
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 674 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16352, 533, 2346, 48914, 482, 368, 341, 262, 1077, 264, 284, 479, 17, 7849, 533, 486, 35851, 543, 262, 1077, 293, 284, 479, 17, 7849, 533, 486, 16912, 1428, 262, 2060, 10297, 2641, 486, 1499, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_byte_stream() { use serde_bytes; let small: [u8; 16] = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15]; assert_eq!( to_string(&small).unwrap(), "(0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15)" ); let large = vec![255u8; 64]; let large = serde_bytes::Bytes::new(&large); assert_eq!( to_string(&large).unwrap(), concat!( "\"/////////////////////////////////////////", "////////////////////////////////////////////w==\"" ) ); }
rust_cleaned_test_functions.jsonl/2826
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 337 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19737, 12673, 368, 341, 286, 990, 61570, 12524, 401, 286, 1077, 2613, 25, 508, 84, 23, 26, 220, 16, 21, 60, 284, 508, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_gridspace_from_char() { assert_eq!(GridSpace::from('.'), GridSpace::Open); assert_eq!(GridSpace::from('#'), GridSpace::Tree); }
rust_cleaned_test_functions.jsonl/59364
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 78 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15682, 3365, 1306, 5673, 9232, 368, 341, 286, 2060, 10714, 10297, 3543, 9914, 486, 1499, 87433, 701, 10587, 9914, 486, 5002, 317, 286, 2060, 10714, 10297, 3543, 9914, 486, 1499, 3515, 4567, 10587, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_partial_parses() { // parsing a part of the buffer should always result in errors and // nothing panics. for buff in ALL_BUFFERS.iter() { for i in 0..buff.len() { let partial_buff = &mut &buff[0..i]; let packet = partial_buff.parse_with::<_, IgmpPacket<_>>(()); assert_eq!(packet.is_err(), true) } } }
rust_cleaned_test_functions.jsonl/11285
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 223 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 52068, 77113, 288, 368, 341, 286, 442, 22314, 264, 949, 315, 279, 4147, 1265, 2677, 1102, 304, 5975, 323, 198, 286, 442, 4302, 7215, 1211, 624, 286, 369, 11522, 304, 13097, 62128, 4321, 19471, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_map_iter_mut() { let key_val_tuples = vec![ ("h", 8), ("d", 4), ("b", 2), ("e", 5), ("f", 6), ("a", 1), ("g", 7), ("c", 3), ]; let mut sgm = SgMap::<_, _, 8>::from_iter(key_val_tuples.into_iter()); assert_eq!(sgm.len(), 8); assert_eq!(sgm.first_key_value(), Some((&"a", &1))); assert_eq!(sgm.last_key_value(), Some((&"h", &8))); for (key, val) in sgm.iter_mut() { if (key != &"a") && (key != &"f") { *val += 10; } } assert_eq!(sgm.len(), 8); assert_eq!(sgm.first_key_value(), Some((&"a", &1))); assert_eq!(sgm.last_key_value(), Some((&"h", &18))); assert_eq!( sgm.into_iter().collect::<Vec<(&str, usize)>>(), vec![ ("a", 1), ("b", 12), ("c", 13), ("d", 14), ("e", 15), ("f", 6), ("g", 17), ("h", 18), ], ); }
rust_cleaned_test_functions.jsonl/18649
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 601 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5376, 11723, 29523, 368, 341, 262, 1077, 1376, 6189, 89269, 284, 7486, 90515, 286, 3489, 71, 497, 220, 23, 1326, 286, 3489, 67, 497, 220, 19, 1326, 286, 3489, 65, 497, 220, 17, 1326, 286, 3489...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_add_or_update_edges_add_nodes_error() { // test edge addition with MissingNodeStrategy::Error let graph = get_basic_graph(None); let new_edges = vec![Edge::with_weight("n4", "n5", &4.4)]; let graph = graph.add_or_update_edges(new_edges); assert!(graph.is_err()); }
rust_cleaned_test_functions.jsonl/100464
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 154 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 8734, 8882, 28026, 2891, 14896, 4096, 368, 341, 286, 442, 1273, 6821, 5256, 448, 35264, 1955, 19816, 486, 1454, 198, 286, 1077, 4771, 284, 633, 34729, 14738, 26717, 626, 286, 1077, 501, 2802...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_recovery() { use std::cmp::Ordering; #[derive(Debug)] struct Foo(&'static str, i32); impl PartialEq for Foo { fn eq(&self, other: &Self) -> bool { self.0 == other.0 } } impl Eq for Foo {} impl PartialOrd for Foo { fn partial_cmp(&self, other: &Self) -> Option<Ordering> { self.0.partial_cmp(&other.0) } } impl Ord for Foo { fn cmp(&self, other: &Self) -> Ordering { self.0.cmp(&other.0) } } let mut s = BTreeSet::new(); assert_eq!(s.replace(Foo("a", 1)), None); assert_eq!(s.len(), 1); assert_eq!(s.replace(Foo("a", 2)), Some(Foo("a", 1))); assert_eq!(s.len(), 1); { let mut it = s.iter(); assert_eq!(it.next(), Some(&Foo("a", 2))); assert_eq!(it.next(), None); } assert_eq!(s.get(&Foo("a", 1)), Some(&Foo("a", 2))); assert_eq!(s.take(&Foo("a", 1)), Some(Foo("a", 2))); assert_eq!(s.len(), 0); assert_eq!(s.get(&Foo("a", 1)), None); assert_eq!(s.take(&Foo("a", 1)), None); assert_eq!(s.iter().next(), None); }
rust_cleaned_test_functions.jsonl/4418
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 580 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 91475, 368, 341, 262, 990, 1460, 486, 7293, 486, 4431, 287, 401, 262, 11506, 27098, 42618, 5563, 262, 2036, 33428, 2099, 6, 1978, 607, 11, 600, 18, 17, 626, 262, 11605, 55039, 369, 33428, 341, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_notify() { let authority = create_example(); let mut catalog = Catalog::new(); catalog.upsert(authority.origin().clone(), Box::new(authority)); let mut io_loop = Runtime::new().unwrap(); let (stream, sender) = TestClientStream::new(Arc::new(Mutex::new(catalog))); let (bg, mut client) = ClientFuture::new(stream, Box::new(sender), None); io_loop.spawn(bg); let name = Name::from_str("ping.example.com").unwrap(); let message = io_loop.block_on(client.notify( name.clone(), DNSClass::IN, RecordType::A, None::<RecordSet>, )); assert!(message.is_ok()); let message = message.unwrap(); assert_eq!( message.response_code(), ResponseCode::NotImp, "the catalog must support Notify now, update this" ); }
rust_cleaned_test_functions.jsonl/33935
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 339 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 36654, 368, 341, 262, 1077, 11198, 284, 1855, 39304, 543, 262, 1077, 5206, 16403, 284, 31221, 486, 931, 543, 262, 16403, 17652, 6047, 48269, 487, 20248, 1005, 19982, 1507, 8261, 486, 931, 48269, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bytewise_should_preserve_final_newline_when_line_longer_than_fold() { new_ucmd!() .args(&["-w2", "-b"]) .pipe_in("1234\n") .succeeds() .stdout_is("12\n34\n"); }
rust_cleaned_test_functions.jsonl/23306
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 126 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3710, 83, 24350, 43378, 32116, 5852, 20676, 5921, 1056, 47636, 6528, 17799, 261, 51613, 61187, 368, 341, 262, 501, 68887, 2277, 0, 741, 286, 659, 2116, 2099, 1183, 12, 86, 17, 497, 6523, 65, 141...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rejoins_then_rejects_giant_certs() { let mut hj = HandshakeJoiner::new(); let msg = Message { typ: ContentType::Handshake, version: ProtocolVersion::TLSv1_2, payload: MessagePayload::new_opaque(b"\x0b\x01\x00\x04\x01\x00\x01\x00\xff\xfe".to_vec()), }; assert_eq!(hj.want_message(&msg), true); assert_eq!(hj.take_message(msg), Some(0)); assert_eq!(hj.is_empty(), false); for _i in 0..8191 { let msg = Message { typ: ContentType::Handshake, version: ProtocolVersion::TLSv1_2, payload: MessagePayload::new_opaque(b"\x01\x02\x03\x04\x05\x06\x07\x08".to_vec()), }; assert_eq!(hj.want_message(&msg), true); assert_eq!(hj.take_message(msg), Some(0)); assert_eq!(hj.is_empty(), false); } // final 6 bytes let msg = Message { typ: ContentType::Handshake, version: ProtocolVersion::TLSv1_2, payload: MessagePayload::new_opaque(b"\x01\x02\x03\x04\x05\x06".to_vec()), }; assert_eq!(hj.want_message(&msg), true); assert_eq!(hj.take_message(msg), None); }
rust_cleaned_test_functions.jsonl/130167
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 681 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1288, 7305, 1330, 68367, 1288, 583, 82, 1889, 5372, 666, 15546, 368, 341, 286, 1077, 5206, 35588, 284, 8536, 29661, 12292, 261, 486, 931, 543, 286, 1077, 3750, 284, 4856, 341, 310, 3582, 25, 704...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_local_affine_ins2() { let x = b"ACGTATCATAGATAGATAGGGTTGTGTAGATGATCCACAG"; let y = b"CGTATCATAGATAGATGTAGATGATCCACAGT"; let score = |a: u8, b: u8| if a == b { 1i32 } else { -1i32 }; let mut aligner = banded::Aligner::with_capacity(x.len(), y.len(), -5, -1, &score, 10, 10); let alignment = aligner.local(x, y); assert_eq!(alignment.xstart, 1); assert_eq!(alignment.ystart, 0); }
rust_cleaned_test_functions.jsonl/126744
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 240 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13564, 48914, 482, 34386, 17, 368, 341, 286, 1077, 856, 284, 293, 1, 1706, 25388, 828, 28196, 1890, 828, 1890, 828, 1890, 22254, 14903, 25388, 25388, 1890, 828, 38, 828, 3706, 1706, 1890, 876, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_doc_passthru() { let hdr = indoc! {" #include <cstdint> /// Elephants! struct A { uint32_t a; }; /// Giraffes! struct B { uint32_t a; }; /// Rhinos! inline uint32_t get_a() { return 3; } "}; let rs = quote! {}; run_test_ex( "", hdr, rs, directives_from_lists(&["A", "get_a"], &["B"], None), None, Some(make_string_finder( ["Giraffes", "Elephants", "Rhinos"].to_vec(), )), None, ); }
rust_cleaned_test_functions.jsonl/9907
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 355 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18869, 79578, 30077, 2672, 368, 341, 262, 1077, 36615, 284, 1257, 509, 0, 314, 698, 286, 671, 997, 366, 96975, 397, 286, 1048, 25949, 52567, 4894, 286, 2036, 362, 341, 310, 2622, 18, 17, 528, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_error() { assert_eq!( CellErrorType::from_str("#DIV/0!").unwrap(), CellErrorType::Div0 ); assert_eq!(CellErrorType::from_str("#N/A").unwrap(), CellErrorType::NA); assert_eq!( CellErrorType::from_str("#NAME?").unwrap(), CellErrorType::Name ); assert_eq!( CellErrorType::from_str("#NULL!").unwrap(), CellErrorType::Null ); assert_eq!( CellErrorType::from_str("#NUM!").unwrap(), CellErrorType::Num ); assert_eq!( CellErrorType::from_str("#REF!").unwrap(), CellErrorType::Ref ); assert_eq!( CellErrorType::from_str("#VALUE!").unwrap(), CellErrorType::Value ); }
rust_cleaned_test_functions.jsonl/71171
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 355 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 4096, 368, 341, 262, 2060, 10714, 33673, 286, 13972, 1454, 929, 486, 1499, 2895, 3584, 38827, 14, 15, 0, 1827, 15454, 3148, 286, 13972, 1454, 929, 486, 12509, 15, 198, 262, 1439, 262, 206...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rfind() { assert_eq!("hello".rfind('l'), Some(3u)); assert_eq!("hello".rfind(|&: c:char| c == 'o'), Some(4u)); assert!("hello".rfind('x').is_none()); assert!("hello".rfind(|&: c:char| c == 'x').is_none()); assert_eq!("ประเทศไทย中华Việt Nam".rfind('华'), Some(30u)); assert_eq!("ประเทศไทย中华Việt Nam".rfind(|&: c: char| c == '华'), Some(30u)); }
rust_cleaned_test_functions.jsonl/2420
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 251 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 3903, 368, 341, 286, 2060, 10714, 17223, 14990, 3263, 81, 3903, 492, 75, 4567, 4329, 7, 18, 84, 1106, 286, 2060, 10714, 17223, 14990, 3263, 81, 3903, 22428, 5, 25, 272, 25, 1762, 91, 272...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_creating_transaction_is_not_validator() { let mut testkit = create_testkit_with_validators(1); let (pub_key, sec_key) = gen_keypair(); let tx = TxTime { time: Utc::now() }.sign(INSTANCE_ID, pub_key, &sec_key); let block = testkit.create_block_with_transaction(tx); assert_eq!( *block[0].status().unwrap_err(), ErrorMatch::from_fail(&Error::UnknownSender).for_service(INSTANCE_ID) ); let snapshot = testkit.snapshot(); let schema = get_schema(&snapshot); assert!(schema.time.get().is_none()); assert!(schema.validators_times.get(&pub_key).is_none()); }
rust_cleaned_test_functions.jsonl/127516
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 263 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 72810, 28884, 6892, 7913, 64959, 368, 341, 262, 1077, 5206, 1273, 8226, 284, 1855, 4452, 8226, 6615, 8337, 2973, 7, 16, 626, 262, 1077, 320, 9585, 3097, 11, 5701, 3097, 8, 284, 4081, 3097, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_listen_syn_reject_ack() { let s = socket_listen(); let tcp_repr = TcpRepr { control: TcpControl::Syn, seq_number: REMOTE_SEQ, ack_number: Some(LOCAL_SEQ), ..SEND_TEMPL }; assert!(!s.accepts(&SEND_IP_TEMPL, &tcp_repr)); assert_eq!(s.state, State::Listen); }
rust_cleaned_test_functions.jsonl/1702
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 214 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 79286, 51393, 1288, 583, 48447, 368, 341, 286, 1077, 274, 284, 7575, 79286, 1428, 286, 1077, 28051, 68535, 284, 64876, 693, 649, 341, 310, 2524, 25, 64876, 3273, 486, 37134, 345, 310, 12981, 5500,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_lookup_density_income() { use super::geoip2::DensityIncome; let _ = env_logger::try_init(); let filename = "test-data/test-data/GeoIP2-DensityIncome-Test.mmdb"; let reader = Reader::open_readfile(filename).unwrap(); let ip: IpAddr = FromStr::from_str("5.83.124.123").unwrap(); let density_income: DensityIncome = reader.lookup(ip).unwrap(); assert_eq!(density_income.average_income, Some(32323)); assert_eq!(density_income.population_density, Some(1232)) }
rust_cleaned_test_functions.jsonl/42015
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 205 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27464, 53349, 67377, 368, 341, 262, 990, 2256, 486, 13052, 573, 17, 486, 66719, 58898, 280, 262, 1077, 716, 284, 6105, 27413, 486, 1539, 6137, 1428, 262, 1077, 3899, 284, 330, 1944, 13945, 12697, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_df_udf_udt() { let mut ctx = create_context(); ctx.register_scalar_function(Rc::new(STPointFunc {})); let schema = Schema::new(vec![ Field::new("city", DataType::Utf8, false), Field::new("lat", DataType::Float64, false), Field::new("lng", DataType::Float64, false), ]); let df = ctx .load_csv("test/data/uk_cities.csv", &schema, false, None) .unwrap(); // invoke custom code as a scalar UDF let func_expr = ctx.udf( "ST_Point", vec![df.col("lat").unwrap(), df.col("lng").unwrap()], DataType::Struct(vec![ Field::new("lat", DataType::Float64, false), Field::new("lng", DataType::Float64, false), ]), ); let df2 = df.select(vec![func_expr]).unwrap(); ctx.write_csv(df2, "./target/test_df_udf_udt.csv").unwrap(); let expected_result = read_file("test/data/expected/test_df_udf_udt.csv"); assert_eq!(expected_result, read_file("./target/test_df_udf_udt.csv")); }
rust_cleaned_test_functions.jsonl/2509
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 578 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10894, 71939, 69, 71939, 83, 368, 341, 286, 1077, 5206, 5635, 284, 1855, 8467, 1428, 286, 5635, 9929, 41652, 9174, 2785, 66, 486, 931, 40650, 2609, 9626, 4687, 3237, 286, 1077, 10802, 284, 12539, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ldabsh() { test_interpreter_and_jit_asm!( " ldabsh 0x3 exit", [ 0x00, 0x11, 0x22, 0x33, 0x44, 0x55, 0x66, 0x77, 0x88, 0x99, 0xaa, 0xbb, 0xcc, 0xdd, 0xee, 0xff, ], (), { |_vm, res: Result| { res.unwrap() == 0x4433 } }, 2 ); }
rust_cleaned_test_functions.jsonl/58970
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 232 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 50573, 370, 927, 368, 341, 262, 1273, 15318, 28637, 8378, 5374, 275, 67529, 33673, 286, 6228, 286, 26129, 370, 927, 220, 15, 87, 18, 198, 286, 4869, 756, 286, 2278, 310, 220, 15, 87, 15, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sources_get_script_version() { let (sources, _) = setup(); let c = PathBuf::from(env::var_os("CARGO_MANIFEST_DIR").unwrap()); let tests = c.join("tests"); let specifier = resolve_path(&tests.join("001_hello.js").to_string_lossy()).unwrap(); let actual = sources.get_script_version(&specifier); assert!(actual.is_some()); }
rust_cleaned_test_functions.jsonl/14292
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 52896, 3062, 14660, 9438, 368, 341, 262, 1077, 320, 39651, 11, 27439, 284, 6505, 543, 262, 1077, 272, 284, 7933, 15064, 486, 1499, 16978, 486, 947, 29387, 445, 34, 7581, 46, 25143, 91120, 8291, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_literal() { assert_eq!(parse_literal("302 bacon"), Ok((" bacon", 302))); assert_eq!(parse_literal("-32 fwef"), Ok((" fwef", -32))); // overflow errors assert!(parse_literal("10000000000 ohno").is_err()); assert_eq!(parse_literal("2897bacon"), Ok(("bacon", 2897))); // nothing to parse assert!(parse_literal("something 123 oh no").is_err()); // sign shenanigans are an error assert!(parse_literal("+-123").is_err()); assert!(parse_literal("++123").is_err()); assert!(parse_literal("--123").is_err()); }
rust_cleaned_test_functions.jsonl/985
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 278 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34100, 368, 341, 286, 2060, 10714, 10297, 6400, 34100, 445, 18, 15, 17, 40352, 3975, 7622, 30873, 40352, 497, 220, 18, 15, 17, 4945, 286, 2060, 10714, 10297, 6400, 34100, 13645, 18, 17, 33886, 8...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_key_derivation() { // Test vectors from BOLT 3 Appendix E: let secp_ctx = Secp256k1::new(); let base_secret = SecretKey::from_slice(&hex::decode("000102030405060708090a0b0c0d0e0f101112131415161718191a1b1c1d1e1f").unwrap()[..]).unwrap(); let per_commitment_secret = SecretKey::from_slice(&hex::decode("1f1e1d1c1b1a191817161514131211100f0e0d0c0b0a09080706050403020100").unwrap()[..]).unwrap(); let base_point = PublicKey::from_secret_key(&secp_ctx, &base_secret); assert_eq!(base_point.serialize()[..], hex::decode("036d6caac248af96f6afa7f904f550253a0f3ef3f5aa2fe6838a95b216691468e2").unwrap()[..]); let per_commitment_point = PublicKey::from_secret_key(&secp_ctx, &per_commitment_secret); assert_eq!(per_commitment_point.serialize()[..], hex::decode("025f7117a78150fe2ef97db7cfc83bd57b2e2c0d0dd25eaf467a4a1c2a45ce1486").unwrap()[..]); assert_eq!(chan_utils::derive_public_key(&secp_ctx, &per_commitment_point, &base_point).unwrap().serialize()[..], hex::decode("0235f2dbfaa89b57ec7b055afe29849ef7ddfeb1cefdb9ebdc43f5494984db29e5").unwrap()[..]); assert_eq!(chan_utils::derive_private_key(&secp_ctx, &per_commitment_point, &base_secret).unwrap(), SecretKey::from_slice(&hex::decode("cbced912d3b21bf196a766651e436aff192362621ce317704ea2f75d87e7be0f").unwrap()[..]).unwrap()); assert_eq!(chan_utils::derive_public_revocation_key(&secp_ctx, &per_commitment_point, &base_point).unwrap().serialize()[..], hex::decode("02916e326636d19c33f13e8c0c3a03dd157f332f3e99c317c141dd865eb01f8ff0").unwrap()[..]); assert_eq!(chan_utils::derive_private_revocation_key(&secp_ctx, &per_commitment_secret, &base_secret).unwrap(), SecretKey::from_slice(&hex::decode("d09ffff62ddb2297ab000cc85bcb4283fdeb6aa052affbc9dddcf33b61078110").unwrap()[..]).unwrap()); }
rust_cleaned_test_functions.jsonl/15104
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 816 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3097, 35345, 39127, 368, 341, 197, 197, 322, 3393, 22879, 504, 425, 35320, 220, 18, 64714, 468, 510, 197, 10217, 511, 4672, 15147, 284, 4520, 79, 17, 20, 21, 74, 16, 486, 931, 1428, 197, 10217...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_map_multithread() { let result: Vec<usize> = Executor::multi_thread(3, "search-test") .map(|i| Ok(i * 2), 0..10) .unwrap(); assert_eq!(result.len(), 10); for i in 0..10 { assert_eq!(result[i], i * 2); } }
rust_cleaned_test_functions.jsonl/113305
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 169 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5376, 26290, 410, 878, 368, 341, 286, 1077, 1102, 25, 11312, 90244, 29, 284, 56032, 486, 26268, 10814, 7, 18, 11, 330, 1836, 16839, 1138, 310, 659, 2186, 22428, 72, 91, 7622, 1956, 353, 220, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_boundary() { ::init_log(); debug!("Testing boundary (no split)"); let src = &mut TEST_VAL.as_bytes(); let mut reader = BoundaryReader::from_reader(src, BOUNDARY); let mut buf = String::new(); test_boundary_reader(&mut reader, &mut buf); }
rust_cleaned_test_functions.jsonl/80587
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 54004, 368, 341, 286, 3504, 2327, 5224, 1428, 286, 7390, 17223, 16451, 18732, 320, 2152, 6718, 66371, 286, 1077, 2286, 284, 609, 6984, 13602, 6096, 5357, 12524, 543, 286, 1077, 5206, 6604, 284, 76...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_double_map_err() { parse( "double_map_err", r#" mod swig_foreign_types_map {} mod swig_foreign_types_map {} "#, 64, FxHashMap::default(), ) .unwrap_err(); }
rust_cleaned_test_functions.jsonl/54589
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 152 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24598, 5376, 9266, 368, 341, 286, 4715, 1006, 310, 330, 4331, 5376, 9266, 756, 310, 435, 2, 698, 2593, 2021, 343, 78983, 9763, 5376, 5613, 2593, 2021, 343, 78983, 9763, 5376, 5613, 57676, 345, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_api_guidelines_c_good_err() { use apllodb_shared_components::ApllodbError; use std::error::Error; use std::fmt::Display; fn assert_error<T: Error + Send + Sync + 'static>() {} assert_error::<ApllodbError>(); fn assert_display<T: Display>() {} assert_display::<ApllodbError>(); }
rust_cleaned_test_functions.jsonl/79201
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 141 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11697, 43756, 10999, 666, 44781, 9266, 368, 341, 262, 990, 52920, 75, 16853, 20405, 23258, 486, 32, 80438, 16853, 1454, 280, 262, 990, 1460, 486, 841, 486, 1454, 280, 262, 990, 1460, 486, 12501, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_flatten_internally_tagged() { #[derive(Serialize, Deserialize, PartialEq, Debug)] struct S { #[serde(flatten)] x: X, #[serde(flatten)] y: Y, } #[derive(Serialize, Deserialize, PartialEq, Debug)] #[serde(tag = "typeX")] enum X { A { a: i32 }, B { b: i32 }, } #[derive(Serialize, Deserialize, PartialEq, Debug)] #[serde(tag = "typeY")] enum Y { C { c: i32 }, D { d: i32 }, } let s = S { x: X::B { b: 1 }, y: Y::D { d: 2 }, }; assert_tokens( &s, &[ Token::Map { len: None }, Token::Str("typeX"), Token::Str("B"), Token::Str("b"), Token::I32(1), Token::Str("typeY"), Token::Str("D"), Token::Str("d"), Token::I32(2), Token::MapEnd, ], ); }
rust_cleaned_test_functions.jsonl/59168
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 556 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5081, 14456, 4042, 932, 745, 9372, 3556, 368, 341, 262, 11506, 27098, 3759, 9050, 11, 48440, 11, 55039, 11, 11091, 5563, 262, 2036, 328, 341, 286, 11506, 47024, 49747, 14456, 5563, 286, 856, 25, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_init_no_config_path() { init!("true"); let cb = return_types_u32::Return_U32::new().unwrap(); assert_eq!(vcx_init(cb.command_handle, ptr::null(), Some(cb.get_callback())), error::INVALID_CONFIGURATION.code_num); }
rust_cleaned_test_functions.jsonl/127540
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 221 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6137, 6536, 5332, 2638, 368, 341, 286, 2930, 17223, 1866, 797, 286, 1077, 9858, 284, 470, 9763, 7300, 18, 17, 486, 5598, 6665, 18, 17, 486, 931, 1005, 15454, 543, 286, 2060, 10714, 10297, 7362, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_order_from_str_bid() { assert_eq!( order_from_str("8 1 2 0 0"), Ok(Order { side: Side::Bid, amount: 1, price: 2, timestamp: 0, strategy: Strategy::Limit }) ); }
rust_cleaned_test_functions.jsonl/64709
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 207 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7869, 5673, 2895, 62509, 368, 341, 286, 2060, 10714, 33673, 310, 1973, 5673, 2895, 445, 23, 220, 16, 220, 17, 220, 15, 220, 15, 4461, 310, 7622, 39692, 341, 394, 3108, 25, 16659, 486, 65452, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_demangle_lines() { let demangled_lines = demangle_lines(MANGLED_INPUT.lines(), None); for (expected, actual) in DEMANGLED_OUTPUT.lines().zip(demangled_lines) { assert_eq!(expected, actual); } }
rust_cleaned_test_functions.jsonl/25468
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 100 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 69403, 4044, 18323, 368, 341, 262, 1077, 2429, 38940, 18323, 284, 2429, 4044, 18323, 3189, 5218, 13639, 21022, 44061, 1507, 2240, 317, 262, 369, 320, 7325, 11, 5042, 8, 304, 50814, 5218, 13639, 23...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_execute_batch() { let db = checked_memory_handle(); let sql = "BEGIN; CREATE TABLE foo(x INTEGER); INSERT INTO foo VALUES(1); INSERT INTO foo VALUES(2); INSERT INTO foo VALUES(3); INSERT INTO foo VALUES(4); END;"; db.execute_batch(sql).unwrap(); db.execute_batch("UPDATE foo SET x = 3 WHERE x < 3") .unwrap(); assert!(db.execute_batch("INVALID SQL").is_err()); }
rust_cleaned_test_functions.jsonl/25503
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 305 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 44329, 14534, 368, 341, 286, 1077, 2927, 284, 10067, 19195, 10630, 543, 286, 1077, 5704, 284, 330, 37588, 280, 4293, 30776, 14363, 15229, 2075, 30381, 317, 4293, 39518, 12496, 15229, 14710, 7, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_path_word_element() { let (_, element) = path_element("a").unwrap(); assert_eq!(element, PathElement::Partial("a".to_string())); let (_, element) = path_element("abc").unwrap(); assert_eq!(element, PathElement::Partial("abc".to_string())); assert!(path_element("").is_err()); }
rust_cleaned_test_functions.jsonl/130545
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2638, 13533, 7894, 368, 341, 286, 1077, 39464, 2392, 8, 284, 1815, 7894, 445, 64, 1827, 15454, 543, 286, 2060, 10714, 10297, 6101, 11, 7933, 1691, 486, 37314, 445, 64, 3263, 983, 3904, 25138, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_partial_equals_part_info() -> Result<()> { let info_a: Box<dyn PartInfo> = Box::new(TestPartInfoA { field_a: 123, field_b: String::from("456"), }); let info_b: Box<dyn PartInfo> = Box::new(TestPartInfoB { field_a: String::from("123"), field_b: 456, }); assert_ne!(&info_a, &info_b); assert_eq!(&info_a, &info_a); assert_eq!(&info_b, &info_b); Ok(()) }
rust_cleaned_test_functions.jsonl/79497
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 219 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 52068, 61664, 10495, 3109, 368, 1464, 5714, 71698, 341, 262, 1077, 3546, 4306, 25, 8261, 92846, 3660, 1731, 29, 284, 8261, 486, 931, 31159, 5800, 1731, 32, 341, 286, 2070, 4306, 25, 220, 16, 17,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_io_handler_1dot0() { let mut io = IoHandler::with_compatibility(Compatibility::Both); io.add_method("say_hello", |_| Ok(Value::String("hello".to_string()))); let request = r#"{"method": "say_hello", "params": [42, 23], "id": 1}"#; let response = r#"{"result":"hello","id":1}"#; assert_eq!(io.handle_request_sync(request), Some(response.to_string())); }
rust_cleaned_test_functions.jsonl/95529
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16939, 10183, 62, 16, 16119, 15, 368, 341, 197, 10217, 5206, 6399, 284, 29655, 3050, 486, 4197, 2965, 53053, 7, 85880, 486, 20629, 626, 197, 53112, 1364, 9032, 445, 36790, 96724, 497, 66091, 7622,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_process_cpuid() { let num_entries = 5; let mut cpuid = CpuId::new(num_entries).unwrap(); let vm_spec = VmSpec::new(0, 1, false); cpuid.as_mut_slice()[0].function = PROCESSED_FN; assert!(MockCpuidTransformer {} .process_cpuid(&mut cpuid, &vm_spec.unwrap()) .is_ok()); assert!(cpuid.as_mut_slice().len() == num_entries); for entry in cpuid.as_mut_slice().iter() { match entry.function { PROCESSED_FN => { assert_eq!(entry.index, EXPECTED_INDEX); } _ => { assert_ne!(entry.index, EXPECTED_INDEX); } } } }
rust_cleaned_test_functions.jsonl/124872
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 425 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11305, 39811, 2423, 368, 341, 286, 1077, 1629, 26092, 284, 220, 20, 401, 286, 1077, 5206, 12490, 2423, 284, 356, 5584, 764, 486, 931, 8068, 26092, 568, 15454, 543, 286, 1077, 10995, 13594, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_cache_key() { let db = Connection::open_in_memory().unwrap(); let cache = &db.cache; assert_eq!(0, cache.len()); //let sql = " PRAGMA schema_version; -- comment"; let sql = "PRAGMA schema_version; "; { let mut stmt = db.prepare_cached(sql).unwrap(); assert_eq!(0, cache.len()); assert_eq!(0, stmt.query_row(&[], |r| r.get::<i32, i64>(0)).unwrap()); } assert_eq!(1, cache.len()); { let mut stmt = db.prepare_cached(sql).unwrap(); assert_eq!(0, cache.len()); assert_eq!(0, stmt.query_row(&[], |r| r.get::<i32, i64>(0)).unwrap()); } assert_eq!(1, cache.len()); }
rust_cleaned_test_functions.jsonl/54427
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 399 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11529, 3097, 368, 341, 286, 1077, 2927, 284, 11032, 486, 2508, 1243, 19195, 1005, 15454, 543, 286, 1077, 6500, 284, 609, 1999, 20087, 280, 286, 2060, 10714, 10297, 15, 11, 6500, 19406, 5231, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_first() { let board = parse(RAW_INPUT); assert_eq!(first_star(&board, &Slope { right: 3, down: 1 }), 7); }
rust_cleaned_test_functions.jsonl/118644
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 74 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12978, 368, 341, 286, 1077, 4479, 284, 4715, 2785, 14419, 21022, 317, 286, 2060, 10714, 10297, 3896, 31681, 2099, 2482, 11, 609, 50, 35327, 314, 1290, 25, 220, 18, 11, 1495, 25, 220, 16, 31706, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_ecdsa_send_dealings() { ic_test_utilities::artifact_pool_config::with_test_pool_config(|pool_config| { with_test_replica_logger(|logger| { let (mut ecdsa_pool, pre_signer) = create_pre_signer_dependencies(pool_config, logger); let (id_1, id_2, id_3, id_4, id_5) = ( create_transcript_id(1), create_transcript_id(2), create_transcript_id(3), create_transcript_id(4), create_transcript_id(5), ); // Only dealing for transcript 1 is issued by us. let dealing_1 = create_dealing(id_1, NODE_1); let dealing_2 = create_dealing(id_2, NODE_2); let dealing_3 = create_dealing(id_3, NODE_3); let change_set = vec![ EcdsaChangeAction::AddToValidated(EcdsaMessage::EcdsaSignedDealing(dealing_1)), EcdsaChangeAction::AddToValidated(EcdsaMessage::EcdsaSignedDealing(dealing_2)), EcdsaChangeAction::AddToValidated(EcdsaMessage::EcdsaSignedDealing(dealing_3)), ]; ecdsa_pool.apply_changes(change_set); // Set up the transcript creation request let t1 = create_transcript_param(id_1, &[NODE_1], &[NODE_2]); let t2 = create_transcript_param(id_4, &[NODE_1], &[NODE_3]); let t3 = create_transcript_param(id_5, &[NODE_1], &[NODE_4]); let block_reader = TestEcdsaBlockReader::for_pre_signer_test(Height::from(100), vec![t1, t2, t3]); let transcript_loader: TestEcdsaTranscriptLoader = Default::default(); let change_set = pre_signer.send_dealings(&ecdsa_pool, &transcript_loader, &block_reader); assert_eq!(change_set.len(), 2); assert!(is_dealing_added_to_validated( &change_set, &id_4, block_reader.tip_height() )); assert!(is_dealing_added_to_validated( &change_set, &id_5, block_reader.tip_height() )); }) }) }
rust_cleaned_test_functions.jsonl/86710
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1416 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 36844, 96780, 13565, 2259, 278, 819, 368, 341, 286, 17902, 4452, 94044, 486, 63722, 15709, 5332, 486, 4197, 4452, 15709, 5332, 22428, 10285, 5332, 91, 341, 310, 448, 4452, 25533, 15317, 27413, 22428...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cubic_self_intersections() { do_test( &CubicBezierSegment { from: point(-10.0, -13.636363636363636), ctrl1: point(15.0, 11.363636363636363), ctrl2: point(-15.0, 11.363636363636363), to: point(10.0, -13.636363636363636), }, &CubicBezierSegment { from: point(13.636363636363636, -10.0), ctrl1: point(-11.363636363636363, 15.0), ctrl2: point(-11.363636363636363, -15.0), to: point(13.636363636363636, 10.0), }, 4, ); }
rust_cleaned_test_functions.jsonl/14571
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 362 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 41181, 25637, 15318, 24661, 368, 341, 1066, 262, 653, 4452, 1006, 286, 609, 34, 41181, 95050, 21086, 341, 310, 504, 25, 1459, 4080, 16, 15, 13, 15, 11, 481, 16, 18, 13, 21, 18, 21, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1