_id stringlengths 7 16 | description stringlengths 55 95.2k |
|---|---|
pmc-6533965-1 | A six-year-old girl with CKD (single kidney, congenital) undergoing peritoneal
dialysis presented with fever and a lesion suggestive of linear erythema throughout
the marginal gingiva. The patient reported pain in the gingival region and
difficulty eating and drinking.
The initial diagnosis was pneumonia with febrile neutropenia and hypoalbuminemia. Due
to the clinical condition, the patient was admitted to pediatric ICU. After a few
days of hospitalization, the entire length of the marginal and attached gingiva,
both on the buccal and palatal sides, showed white coloration suggestive of necrosis
(). No dental caries was
observed.
A fragment of the marginal gingiva was collected for screening culture, in which the
presence of P. aeruginosa was detected. As the pathogen was also
detected in blood and nasal secretion cultures, the case was diagnosed as septic
shock.
Systemic antibiotic therapy was started (vancomycin, ampicillin-sulbactam, amikacin,
piperacillin-tazobactam and polymyxin B) and after a period of hospitalization, a
gradual elimination of necrotic gingival mucosa was observed. A hard tissue with
bone appearance was present in the remaining normal gingiva, but presented as a
fragile structure ().
Pathological tooth mobility was present as well as bone loss especially between the
first permanent molars and incisors both in the upper and lower jaws (). There was clinical insertion loss but
without periodontal pockets ().
Supragingival scraping sessions and application of 0.12% chlorhexidine were performed
during the ICU stay. After biopsy of the gingival tissue and the exposed hard
tissue, the presence of inflammatory hyperplastic gingivitis was confirmed and the
hard tissue was confirmed as bone tissue ( and ). The bone tissue was
submitted to culture, which also showed the presence of P.
aeruginosa. Systemic antibiotic therapy based on levofloxacin was
established for another fifteen days.
Bone lesions and some deciduous teeth with high mobility were surgically removed,
under antibiotic prophylaxis; antibiotic therapy was maintained postoperatively for
seven days. The collected material was sent for histopathology and culture
examinations ().
Histopathology showed a chronic inflammatory process in necrotic tissue, resulting in
the diagnosis of chronic osteomyelitis. P. aeruginosa was not
detected in culture examination.
Fifteen days later, the patient had significant oral health improvement (). After the six-month treatment period,
the human immunodeficiency virus (HIV) was detected, although the patient had
negative serology in previous tests. |
pmc-6533967-1 | A sixty-four-year-old renal transplant recipient woman presented at the hospital six
years after transplantation. She had had a history of fever, hypotension, and
asthenia with 36 hours of evolution associated with seven kilograms of weight loss
in three months. Physical examination revealed white spots in the mouth and a rash
on the back (). The patient had anemia
(Hb 8.4 g/dL, Ht 23.0%), leukopenia (2.3×109/L), C reactive protein (10.8
mg/dL) and ferritin (13.253 ng/mL) above the normal range, and acute graft
dysfunction (Cr 3.0 > 4.0mg/dL). Liver function was not compromised (albumin
3.7g/dL, aspartate aminotransferase 32 U/L, alanine aminotransferase 29 U/L). Her
immunosuppression regimen at admission was prednisone (5 mg/day) and azathioprine (2
mg/Kg/day), and the basal serum creatinine (Cr) value was 3.0 mg/dL.
On the day of her admission, hemocultures were performed to search for fungus and
mycobacterium. Polymerase chain reaction (PCR) for CMV and Epstein Barr virus (EBV),
latex agglutination test for cryptococcus, and serology for Histoplasma
capsulatum and Trypanosoma cruzi were also done. From
that day, an empiric treatment with vancomycin, meropenem, and ganciclovir was
started aiming to treat a possible bacterial infection or a viral opportunistic
one.
CMV antigenemia was negative but PCR unveiled 546 copies of the virus. A decision was
made to perform a biopsy of the cutaneous lesion and cultivate fungi and
mycobacteria. For further investigation, image tests such as a thoraco-abdominal
computerized tomography scan (CT) and an echocardiogram were done, which did not
reveal any abnormality. A myelogram showed erythroid hyperplasia and an upper
digestive endoscopy showed an ulcerative esophagitis with intranuclear inclusions
and some esophageal candidiasis lesions. Fluconazole was associated with the current
antimicrobial and antiviral regimen (vancomycin, meropenem and gancyclovir).
The clinical condition of the patient declined, she had melena and mucocutaneous
bleeding with hemodynamic instability, which evolved to disseminated intravascular
coagulation (DIC). We empirically started liposomal amphotericin B to cover
histoplasmosis and a four-drug treatment for tuberculosis. The patient did not
improve and became unstable, needing mechanical ventilation and vasopressor support.
She had acute hepatitis due to liposomal amphotericin B hepatotoxicity and died 7
days after starting the treatment for histoplasmosis.
The diagnosis of sepsis-like histoplasmosis was done after laboratory results
obtained post-mortem. Histoplasma capsulatum was found in blood
cultures and serology by double immunodiffusion and immunoblotting (band H and M).
The microbiology of the skin biopsy also isolated H.
capsulatum. |
pmc-6533970-1 | Case 1. A 38-year-old woman with SLE for seven years, presented polyarthritis,
serositis, proteinuria, and acute renal failure. She was ANA positive and
anti-Sm positive. The renal biopsy identified Class III lupus nephritis
associated to membranous findings (class V). There was only partial remission
following six monthly pulses of metilprednisolone and cyclophosphamide and then
switched to maintenance with MMF. The current hospitalization was due to fever,
followed by acute mental confusion and worsening of proteinuria. Infection
screening included blood and urine cultures, imaging exams, and cerebrospinal
fluid puncture, but results were not conclusive. She received vancomycin and
ceftriaxone empirically with no clinical improvement and after 3 weeks, a pp65
antigenemia was requested and showed positivity. By this time, a confirmation of
CMV by the viral load from whole blood was obtained. Treatment with ganciclovir
was started, followed by fever disappearance and clinical and laboratory
improvement, including partial reduction of proteinuria. |
pmc-6533970-2 | Case 2. A 9-year-old girl who developed SLE during the previous year
characterized by hemolytic anemia, polyarthritis, pleuritis, pericarditis, and
proteinuria. She presented positivity to ANA, anti-dsDNA and lupus anticoagulant
test as well as complement consumption. The condition evolved into a severe
disseminated disease including cardiac valvar lesions, pancreatitis, and renal
dysfunction. Dialysis, mechanical ventilation, and several blood transfusions
were required. She also presented generalized convulsive crisis followed by
hemodynamic instability, and had a long stay in the intensive care unit. She was
submitted to several microbiological studies and antibiotic schemes. Besides,
she was submitted to different immunosuppressive therapy attempts with
corticosteroids pulse therapy, plasmapheresis, cyclophosphamide, intravenous
immunoglobulin and rituximab. After an initial clinical improvement and
hemodynamic stabilization, she persisted with low-grade fever and leukopenia. At
this stage, she had a positivity for anti-CMV/IgM, and a further investigation
for pp65 antigenemia was positive. She was treated with ganciclovir for six
weeks, until pp65 antigenemia became negative. After a long hospitalization, she
had a progressive clinical improvement and hospital discharge. |
pmc-6533970-3 | Case 3. A 49-year-old woman diagnosed with SLE three years before had skin
lesions, alopecia, and was ANA positive including positivity to anti-Sm,
anti-dsDNA, and complement consumption. Three months before the admission, she
developed lupus nephritis with nephrotic range proteinuria, dysmorphic
hematuria, and a positive direct Coombs. Nephritis was treated with endovenous
corticosteroids and cyclophosphamide. She was admitted due to fever, mental
disorientation, and hallucinations. She was empirically treated with
antibiotics. Screening for CMV infection showed positive but low pp65
antigenemia, and no specific treatment for CMV was performed. She evolved
well. |
pmc-6533970-4 | Case 4. A 45-year-old SLE female patient who had been admitted eight years before
for photosensitivity, oral ulcer, polyarthritis, hemiparesis, retinal
vasculitis, depression and polyneuropathy associated with lymphocytopenia and
hemolytic anemia. She presented positive ANA, anti-Sm, anti-dsDNA, C3 and C4
consumption, and proteinuria. Her initial treatment included prednisone and MMF.
After four years, a pulmonary tuberculosis occurred. One year before admission,
she presented biopsy-confirmed lupus panniculitis having developed bilateral
breast nodules including steatonecrosis with some gross microcalcifications. The
current hospitalization was due to fever and dyspnea with a diagnosis of
pneumonia, which progressed to sepsis. She was submitted to several blood
transfusions. The general clinical status had no significant improvement, when
an investigation for CMV using pp65 antigenemia was positive. Specific treatment
for CMV with ganciclovir started with a fast initial improvement, including the
start of weaning from mechanical ventilation. However, on the tenth day of
ganciclovir treatment an unexpected clinical worsening occured, with decreasing
consciousness and death. A positive DNA-viral load for CMV was still
present. |
pmc-6533970-5 | Case 5. An 18-year-old woman diagnosed with SLE five years before, when she
presented malar exanthema, polyarthritis, pleural effusion, and lupus nephritis
(IV) with proteinuria of 3.2 g/day (anti-dsDNA positive). She was taking MMF,
prednisone, and hydroxychloroquine. Two months before the current
hospitalization she was hospitalized for sepsis after a cutaneous trauma on her
thigh followed by infection. Blood culture identified S.
pyogenes and she was treated with antibiotics. However, there was
only partial improvement and after three weeks she presented erythematous
cutaneous lesions, splenomegaly, diffuse lymph node enlargement,
hypertriglyceridemia, and low serum fibrinogen. A diagnosis of macrophage
activation syndrome was stablished. A pp65 antigenemia investigation was
positive. Initially, the treatment included intravenous immunoglobulin and high
doses of prednisone, without having been treated with ganciclovir. After a good
clinical response, she was discharged from hospital. |
pmc-6533970-6 | Case 6. A 40-year-old woman with history of SLE for fifteen years, characterized
by urticarial vasculitis, polyarthritis, haemolytic anemia, and positive ANA.
She had evolved with periods of reactivation and remission of cutaneous and
hematological manifestations. Over time, the treatment included
hydroxychloroquine, azathioprine, dapsone, methotrexate, and cyclosporine with
variable responses, and in addition, low dose of steroids. Current
hospitalization was due to fever, low back pain and criteria for urinary sepsis.
There was nephrotic range proteinuria and an investigation confirmed left renal
vein thrombosis. A diffuse infiltrate was also present in the right lower lobe
of the lungs associated with hepatosplenomegaly. Pp65 antigenemia was positive,
but no specific antiviral treatment was prescribed. There was initial
improvement with antibiotic therapy for urinary infection and the patient was
discharged of the intensive care unit. However, because of clinical worsening
two weeks later and maintained pp65 antigenemia positivity, ganciclovir was
started. There was a significant clinical improvement, and after 15 days, the
laboratorial monitoring showed negative pp65 antigenemia. |
pmc-6533970-7 | Case 7. A 27-year-old man was diagnosed with SLE, clinically characterized by
pleurisy, arthritis, and non-nephrotic proteinuria associated with positivity
for antinuclear antibodies (ANA), anti-double stranded DNA (anti-dsDNA),
anti-Sm, and complement consumption. Because a purulent pleural fluid and
positivity for adenosine deaminase (ADA) was found, he was treated for
tuberculosis. After three months, he developed bacterial endocarditis. A blood
culture was positive for coagulase-negative staphylococci. Since then, he has
been under several and prolonged antibiotic therapies as well as blood
transfusions. He was using oral corticosteroid and presented persistent fever.
Pp65 antigenemia was positive and ganciclovir treatment was started. There was
fever decrease, but occasional peaks were still observed until the end of the
third week on ganciclovir. Gallium scintigraphy showed endocardial uptake and a
transesophageal echocardiogram revealed mitral perforation. A new antibiotic
approach was carried out. He also used high doses of intravenous
immunoglobulins. A right-sided Parsonage-Turner plexopathy, which was attributed
to CMV infection, completely improved with the use of ganciclovir. He was
referred to cardiac surgery due to valve injury. |
pmc-6533973-1 | A 48-year-old white female with end-stage renal disease due to adult polycystic
kidney disease was admitted for deceased donor kidney transplantation in April 2015.
She had started renal replacement therapy with hemodialysis 7 years before and was
in good general health with no significant co-morbidities. The donor was a
2-year-old female who suffered anoxic encephalopathy. At organ retrieval, donor
serum creatinine was 0.58 mg/dL. Donor and recipient presented 4 HLA (ABDR)
mismatches, cross matching was negative and no anti-donor specific HLA antibodies
were found in the recipient’s serum. The kidneys were implanted “en bloc” and the
transplant was performed after 18 hours of cold ischemia in static preservation on
Euro-Collins solution. Immunosuppressive regimen consisted of Basiliximab®
induction, tacrolimus, sodium mycophenolate, and steroids. The graft presented
immediate function and the patient was discharged at post-operative day 36 (POD).
During hospitalization, she presented a urinary tract infection and was submitted to
antibiotic treatment for 10 days. The blood tacrolimus level three weeks before
discharge was 15 µg/mL (receiving tacrolimus 7 mg twice daily orally). The dosage
was immediately reduced to 5 mg twice daily, and three days after dose adjustment
the blood level was 11.4 µg/mL; a new dose adjustment to 4 mg twice daily was done.
At discharge, serum creatinine was stable at 1.6 mg/dL and blood tacrolimus level
around 10 µg/mL. On the 19th POD, sodium mycophenolate was replaced by azathioprine
due to severe diarrhea not responsive to dose fractioning and reduction.
Three days after discharge she was admitted to the emergency room complaining of
severe headache, visual blurring, and confusion. Blood pressure was 180/100 mmHg,
axillary temperature 38°C, and the general physical examination revealed no
abnormalities. On neurological examination, she was confused, hallucinating, and
disoriented. She presented transient visual alterations and left hemianopia without
signs of meningeal irritation. Laboratory work up revealed stable graft function
(serum creatinine 1.53 mg/dL), anemia (hemoglobin 7.7 g/dL) with normal white blood
cell counts, slightly increased C reactive protein (10 mg/dL) and 10.3 ng/mL
tacrolimus blood level. She received iv esmolol for blood pressure control and
empiric iv antibiotics until cultures results. A brain CT scan disclosed extensive
hypo-density at the sub cortical white and gray matter of the parietal and occipital
lobes. Erasure of the cortical sulci, most evident on the cerebral hemispheres
recesses, was also present, and PRES was considered in the differential diagnosis
(). The magnetic resonance imaging
(MRI) showed hyperintensity on T2/FLAIR of the temporo-occipital and fronto-parietal
regions in the upper convexity, without diffusion or bleeding signals ().
Tacrolimus was discontinued from immunosuppressive therapy. In the next two days, the
patient had complete reversal of neurological symptoms. Cyclosporine was started at
100 mg twice a day reaching a blood level of 146 ng/mL. The graft function remained
stable and at two years after transplantation, the patient is enjoying good general
condition and good graft function (serum creatinine 1.2 mg/dL), protein-creatinine
ratio on random urine sample of 0.35 mg/mg, without new episodes of altered mental
status or other neurologic signs. |
pmc-6533988-1 | A twenty-year-old male has been followed up at the Clinic Hospital of Federal
University of Paraná due to medical history of epistaxis, ecchymosis, and
petechiae since infancy. At first, Bernard-Soulier syndrome was suspected due to
macrothrombocytopenia and tendency of bleeding. When he was 17 years old,
hearing loss and hypertension were detected along with mild renal failure,
microhematuria and nephrotic-range proteinuria. Renal biopsy could not be
performed due to risk of bleeding (platelets count: 7000/µL). Cataracts were
excluded by ophthalmological evaluation. Due to the clinical suspicion of
MYH9-RD, genotyping of the patient and of his parents was
performed. A de novo missense mutation in exon 1 of the
MYH9 gene [c.287C > T; p.Ser(TCG)96(TTG)Leu] was
detected (). Actually, neither his
parents nor his brother and sister had clinical manifestation of
MYH9-RD. Enalapril (20 mg/day) was initiated for renal
protection. The patient did not adhere to treatment and was lost to follow-up.
Two years later, he returned to the outpatient clinic complaining of foamy
urine, peripheral edema, and hypertension (160/120 mmHg). Laboratory tests
detected worsening of renal function and persistent proteinuria. shows the evolution of laboratory
parameters during the follow-up. |
pmc-6533989-1 | A 57-year-old Caucasian man with past medical history of hypertension and mild
osteoarthritis, presented to the emergency department from the outpatient clinic
with complaints of hematuria and acute renal failure (serum creatinine 3.6
mg/dL, baseline serum creatinine 0.9 mg/dL, six weeks before). Four days prior
to the presentation, the patient was seen by the primary care for possible
sinusitis, dysuria, and mild hematuria. Amoxicillin was prescribed for three
days for a presumed urinary tract infection. The patient reported some fatigue,
denied smoking or the use of alcohol and illicit drugs. Current medications
included amlodipine 10 mg/day and hydralazine 50 mg BID, which was started six
weeks before for better blood pressure control. There was no significant finding
on the physical examination. The urinalysis revealed hematuria and low-grade
proteinuria. Microscopic examination of the urine sediment revealed numerous
dysmorphic red blood cells, several red blood cell casts, and occasional white
blood cells. Renal ultrasound was normal. A diagnosis of hydralazine-induced DIV
was considered and the medication was discontinued. Serology was positive for
AHA, cANCA by immunofluorescence and PR3 by ELISA at 52 AU/mL, and an ANA titer
at 1:1,115 with a homogenous pattern. Serum levels of C3 and C4 complements were
normal. Antibodies to pANCA and MPO were not detected. Serology for anti-GBM,
hepatitis panel, and HIV was negative. The patient was treated with high-dose
pulse steroid therapy (500 mg/day for three days). However, the renal failure
continued to progress (serum creatinine 4.0 mg/dL) and the patient required
dialysis therapy due to hyperkalemia (K 5.6 mmol/L) and acidosis (serum
bicarbonate 13). Kidney biopsy revealed pauci-immune necrotizing
glomerulonephritis with increase in 20% of glomeruli (). The diagnosis of hydralazine-induced DIV was
made. The patient was treated with pulse steroid and rituximab. Renal function
stabilized and dialysis was discontinued after four sessions. He was discharged
on day twelve with normal electrolytes and serum creatinine of 3.4 mg/dL. PR3
and ANA were undetectable (). Two
years later, the patient remained stable but with an advanced CKD stage III
(serum Cr 2.8 mg/dL and eGFR 42). His blood pressure remained around
130-140/85-90 mmHg with amlodipine 10 mg/dL, chlorthalidone 12.5 mg/day, and
ramipril 10 mg/day. |
pmc-6533989-2 | An 87-year-old Caucasian man with past medical history of hypertension (HTN),
dementia, and CKD III presented to the hospital with altered mental status and
AKI. There was no report of fever, chills, dysuria, hematuria, rashes,
arthralgia or myalgia. His medications included hydralazine, isosorbide
mononitrate, furosemide, doxazosin, atorvastatin, aspirin, duloxetine, and
pantoprazole. The patient was on hydralazine for a total of five years with the
most recent dose of 100 mg thrice per day (TID), increased from 50 mg TID three
years ago. There was no significant finding on the physical examination. The
laboratory work revealed serum Cr 10.41 mg/dL and BUN 102 mg/dL (baseline 2.27
and 42 one year before). Urinalysis showed hematuria and +1 proteinuria.
Protein/Cr ratio was 3.1 gm and ESR 41 mm/hr. Serology was positive for pANCA by
immunofluorescence at 1:160, MPO by ELISA at 25 AU/mL, AHA at 3.1 units,
anti-chromatin antibodies at 31 U, ANA titer at 1:640 with homogeneous pattern,
positive dsDNA by ELISA and crithidia at 1:160, C3 at 50.4 mg/dL, and C4 at 11.1
mg/dL. Serology for anti-GBM, cANCA/PR3, and hepatitis panel was all negative
(). Renal ultrasound was
normal. Patient was started on emergency hemodialysis. Hydralazine-induced DIV
was suspected given positive vasculitis serologic workup. The patient received a
pulse dose steroid course and then started on plasmapheresis. Subsequently, he
underwent a kidney biopsy, which showed pauci-immune focal crescentic
glomerulonephritis confirming the diagnosis (). Unfortunately, the kidney function did not show signs of
recovery and rituximab therapy was initiated. After receiving two doses,
however, further treatment was held due to dialysis catheter-induced bacteremia.
Due to the rapidly deteriorating mental status and overall condition of the
patient, the family decided to withdraw care and transfer the patient to hospice
service. |
pmc-6533990-1 | A 36-year-old man with CKD of undetermined etiology started peritoneal dialysis (PD).
After 3 years, he switched to HD due to an episode of fungal peritonitis. He
remained clinically stable during the first year of HD and never presented any signs
or symptoms related to mineral and bone metabolism disorders, such as bone pain,
pruritus, muscular weakness, pathological fracture, signs of vascular calcification
or neurological symptoms. His physical examination was normal. Overtime he developed
asymptomatic hyperparathyroidism, presenting serum intact parathyroid (iPTH) levels
of 467 pg/mL, P of 3.8 mg/dL, calcium (Ca) of 9.5 mg/dL, alkaline phosphatase (AP)
of 92 IU/L, and Al of 13 mcg/L [methodology: graphite furnace-atomic absorption
spectrometry (GFAAS); reference range: < 30 mcg/L].
At this moment, the patient was included in a clinical study, and a transiliac bone
biopsy was performed. The sample obtained consisted of two cortical and trabecular
bone samples revealing the diagnosis of osteitis fibrosa. Unexpectedly, the
coloration of solochrome azurine was positive for Al, covering 50% of the bone
surface.
-
Pearls' staining was positive for iron in
a similar extent ( to ). Treatment with desferoxamine at 5 mg/kg once
a week for 6 months was initiated, with follow-up exams revealing serum levels of Ca
10.2 mg/dL, P 2.2 mg/dL, iPTH 263 pg/mL, AP 47 IU/mL, and Al 4.7 mcg/L. At the end
of the treatment, the patient was still asymptomatic and without signs of Al
intoxication or bone disease. One year after being submitted to bone biopsy the
patient underwent renal transplantation.
The unexpected diagnosis of Al deposition has led to the investigation of sources of
exposure, such as medications, water for HD, polyelectrolyte concentrates, and PD
solution bags. Review of medical records has shown the patient had never used
antacids, Al-based P binders, or any medications that could deliberately contain Al.
In the last 3 years, he had never presented alterations in annual serum Al levels
(GFAAS, reference range: < 30 mcg/L). Al
detection analyses in HD water treated by reverse osmosis provided negative results
(two samples, separated by one year) (methodology: inductively-coupled plasma
optical emission spectrometry; reference range < 10 µg/L).
We tested bone tissue samples, water used in the dialysis unit, polyelectrolyte
concentrate solutions, and PD solution bags using inductively-coupled plasma mass
spectrometry (ICP-MS) with laser ablation (LA) techniques. The chemical elements
present in the sample were ionized by high plasma temperature. Only ions
Fe+ and Al+ were selected, generating a signal
proportional to their quantities in the samples. The technique is based on the use
of a laser for ablating the sample, and the vapor generated in the process is
transported by an inert gas (argon) to the inductively coupled plasma torch.
LA-ICP-MS lecture can be converted to an imaging mode containing the distribution of
metal in the tissue.
-
This qualitative analysis was performed on
bone tissue using the LA-ICP-MS technique, through a Perkin-Elmer brand equipment
(DRC-e model) and a LA unit (New Wave-UP213). The images were treated with the
software LA-iMageS. Using a slide obtained
from the same fragment of bone tissue, the presence of Al and Fe deposits was
confirmed, with clear discrimination between them (-).
Samples of water (N = 4), polyelectrolyte concentrate solutions (N = 5; two different
trademarks), and PD solution bags (N = 1), were normalized with the addition of a
standard concentration of 50 µg/L of Al. The accuracy of the method was evaluated
using the certified reference material of trace elements in natural waters (SRM
1640A), obtaining a value of 52.9 ± 1.2 µg/L, compared with the certified value of
52.6 ± 1.8 µg/L. The results show that all analyzed samples by means of the ICP-MS
method were negative for Al (). |
pmc-6533997-1 | A 50-year-old female, undergoing regular hemodialysis for 3 years due to
polycystic kidney disease, was submitted to a renal transplant in 2014. By that
time, the patient had negative serological tests for CMV, hepatitis B and C,
toxoplasma, HIV and syphilis. The donor was a 65-year-old female, CMV-positive,
who suffered an ischemic stroke.
The recipient received thymoglobulin as induction therapy and was maintained on
prednisone, mycophenolate sodium, and tacrolimus. She underwent universal
prophylaxis for CMV infection with intravenous ganciclovir (5 mg/kg) 5 days
after transplant, according to the institutional protocol: twice a day (week 1 and week 2 post-transplant, PT);
three times a week (week 3 and week 4 PT); twice a week (week 5 up to week 8
PT), once a week (week 9 up to week 12 PT). The dose of ganciclovir was adjusted
for the patient's renal function.
Monitoring of viral reactivation was implemented during the period of use of
pharmacological prophylaxis. The patient underwent CMV monitoring by pp65
antigenemia test weekly during first 3 months PT. A PCR test was also performed
in plasma at week 8 PT to test the accuracy of pp65 test, as a part of a
protocol. The BKV monitoring included urinary tests for decoy cells and RT-PCR
biweekly during the first three months PT. RT-PCR for BKV was performed in
plasma at end of week 8 and week 12 PT.
At week 4 PT, a low BK viral load in urine was detected (104.5 copies/mL).
Urinary decoy cells were found at week 6 PT (), persisting until week 11 PT. The patient presented positive
pp65 test at week 7 (194 cells/200,000 white cells), when the transplant team
decided to increase the dosing of ganciclovir. CMV pp65 test persisted positive
at week 8 PT (965 cells/200,000 white cells), when CMV DNA was also detected in
blood (1294 copies/mL) and clinically significant BK viral load (>10⁷
copies/mL) was detected in urine. BKV was negative in plasma.
At week 10 PT, the patient returned for evaluation with fever, myalgia, and
malaise. At week 11 PT on clinical examination, she complained of adynamia, and
asthenia, and presented with pallor, tachypnea, and tachycardia. Laboratory
analysis showed positive pp65 test (1449 cells/200,000 white cells) anemia (red
cells 2.24 x 106/mm3 and hemoglobin 6.7 g/dL), leukocytosis (11,800 x 103/mm3),
hypertriglyceridemia (1,500 mg/dL), hyperuricemia (14 mg/dL), and high levels of
serum ferritin (7,193 ng/dL). CT scan revealed pleural and pericardial
effusions. Blood and urine samples were collected for cultures. Since the
patient completed 4 of the 8 HLH-2004 diagnostic criteria, we asked for a hematology consultation. She was then
submitted to a bone marrow aspiration, which revealed hemophagocytosis (). The bone marrow was negative for
CMV (immunohistochemistry) and no morphological signs of parvovirus infection
were detected. Once HLH diagnosis was confirmed, she received a high dose of
intravenous immunoglobulin (400 mg/kg/daily for 4 days) and dexamethasone (weeks
1 and 2 - 10 mg/m 2 daily; weeks 3 and 4 - 5 mg/m 2 daily; weeks 5 and 6 - 2.5
mg/m 2 daily; week 7 - 1.25 mg/m 2 daily; and week 8 - dose tapering to
zero).
Both urine and blood cultures were positive for E. coli;
cefepime was prescribed and immunosuppressive drugs were temporarily withdrawn.
A graft biopsy was indicated due to increase of creatinine from 2.3 to 3.9
mg/dL. The sample showed a mild interstitial nephritis and rare nuclear and
cytoplasmic inclusions in glomeruli () CMV-positive by immunohistochemistry (). There were no signs of rejection or BKV
nephropathy (immunohistochemical staining for SV40 T antigen in the renal tissue
and BKV in plasma were negative), despite clinically significant BK viral load
(>107 copies/mL) in urine at week 8 and week 12 PT. The patient completed
treatment for bacterial infection. She was discharged 20 days after admission in
use of prednisone, ganciclovir, tacrolimus, and sirolimus. Laboratory exams at
the day of discharge showed normal levels of triglycerides, leukocytes, and
serum ferritin of 2,000 ng/dL. The patient also recovered graft function,
leaving the hospital with a creatinine level of 2.0 mg/dL. Ganciclovir was
maintained until the 4th month PT, after two consecutive negative pp65 tests,
one week apart. |
pmc-6534000-1 | A previously healthy five-year-old girl was taken to the emergency unit on account of periorbital and tibial edema developing for three weeks. Edema worsened in the morning and improved throughout the day. She had had productive cough for five days without fever or other symptoms.
Her maternal grandfather had thrombophilia (unknown type) and was on chronic anticoagulant therapy.
Initial examination revealed she had normal blood pressure, periorbital and tibial edema, and that her body weight had increased by 20% since the last time she had been weighed seven months prior. The main findings derived from her tests were nephrotic proteinuria (urine protein to creatinine ratio: 6.9 mg/mg), hypoalbuminemia, and hypercholesterolemia (). She was initially diagnosed with NS and prescribed corticosteroids (prednisolone 60 mg/m2/day). Her respiratory condition deteriorated within the first three days of hospitalization; she was afebrile and had persisting proteinuria and edema. On day 3 of hospitalization she was started on amoxicillin (80 mg/kg/day), and on day 5 of corticosteroid therapy the edema regressed and her body weight decreased by 1.5 kg (7%); her condition was stable until day 7. On day 8 she started waking up with headaches in the middle of the night associated to morning vomiting. She was hemodynamically stable, her blood pressure was within normal range, and she did not have exanthems, meningeal or focal neurological signs.
Computed tomography (CT) scans showed "hyperdense lateral sinuses and torcular herophili" (). Additional contrast-enhanced CT scans confirmed filling defects in the right transverse sinus when compared to the contralateral sinus. The patient was thus diagnosed with right transverse sinus thrombosis. She was referred to a tertiary hospital () and was started on subcutaneous enoxaparin followed by warfarin (target INR 2-3). She was kept on corticosteroids.
Her headaches gradually improved and she became asymptomatic after two days of antithrombotic therapy. On day 13 of hospitalization, she no longer had proteinuria. The patient was discharged with a prescription of warfarin and corticosteroids after spending 23 days in hospital.
Tests for prothrombotic factors (performed after she had been on prednisolone for eight days and one day without proteinuria) did not show alterations: protein C 180% (N > 51%), protein S 88% (N > 53%), homocysteine 4 umol/L (N > 0.88 umol/L), lupus anticoagulant test - negative, antithrombin 149% (N > 76%), normal Leiden factor V, PRT 20210GA, and MTHFR677CT; her tests were negative for antinuclear and cytoplasmic antibodies, anti-SSA60, SSB, Sm, RNP, Scl70, JO1, cardiolipin, IgG, and IgM antibodies.
A multidisciplinary team covering the areas of pediatric nephrology, neurology, and hemostasis followed the patient. Control head MRI scans taken three months later showed the vessel was patent again, and the patient was started on corticosteroid therapy (6 weeks of daily prednisolone 60mg/m2/day followed by 6 weeks at a dosage of 40mg/m2/day in alternate days). She was taken off anticoagulants ten months after the initial event.
The patient had three other episodes of NS in contexts of viral upper airway infections seven, ten, and eleven months later. In one of the episodes she had low plasma antithrombin levels. She did not experience complications in the form of thromboembolic events. |
pmc-6534002-1 | A 54-year-old man, who underwent a liver transplant two years ago as a treatment
for end-stage liver disease caused by alcoholic cirrhosis, was admitted because
of a 4-week progressive muscle weakness involving the lower and upper
extremities. He was unable to walk alone at presentation and physical
examination revealed flaccid weakness of proximal muscles (2/5 strength grade)
without hypotrophy or sensory deficit. He was hydrated, had regular heart rhythm
(60 bpm), blood pressure of 120/80 mmHg, and unremarkable pulmonary and
abdominal examinations. The man had no previous medical history of hypertension,
diabetes mellitus or kidney disease. He also described that six months earlier,
he started treatment with trimethoprim-sulfamethoxazole due to the appearance of
diffuse nodules in the skin and subcutaneous, the biopsy of which was consistent
with paracoccidioidomycosis (PCM). Other outpatient medications were propranolol
for prevention of esophageal variceal bleeding and tacrolimus for prophylaxis
against graft rejection.
Initial laboratory tests () showed
severe hyperkalemia (9.25 mEq/L) and the electrocardiogram revealed "peaked" T
waves, widened and flattened P waves, prolonged PR interval, and widened QRS
complex, as illustrated in .
Immediate stabilization of the myocardial cell membrane with iv injection of 10
mL of 10% calcium gluconate over two minutes and rapid shifting of potassium to
the intracellular space by iv injection of insulin with glucose (10 units of
regular insulin plus 100 mL of 50% glucose in 30 minutes), 8.4% sodium
bicarbonate (150 mEq IV in 30 minutes), and beta-agonists inhalation (fenoterol
20 drops = 5 mg) were the initial priorities. After these interventions, the
electrocardiogram normalized ().
Volume expansion with 0.9% saline solution (2 L in 2 hours) followed by iv
injection of 40 mg furosemide generated a high urinary volume that contributed
for body potassium elimination. Due to the persistence of severe acidosis,
another infusion with 100 mEq of bicarbonate was performed. Calcium polystyrene
sulfonate, a chelating agent, was subsequently given (30 g orally three times a
day) because of its delayed action.
Once hyperkalemia was identified and therapeutic interventions initiated, a urine
sample was promptly collected. It is important to emphasize that when an
electrolytic disturbance is detected, a urine sample must be immediately
collected, since therapeutic interventions may alter pH and electrolyte
concentrations in the urine, possibly distorting correct interpretations and
diagnosis. Urine tests in the emergency department have short turnaround time,
usually within one hour, and can be helpful to guide the correct diagnosis and
treatment.
As depicted in , arterial blood gas
revealed marked metabolic acidosis with normal serum anion-gap (plasma
[Na+] - [HCO3-] - [Cl-]), and an isolated
urine sample showed apparent noraml urinary acidification (urine pH: 5.0).
Urinary AG (urine [Na+] + [K+] - [Cl-]) was +18
and calculated transtubular potassium gradient was 2.3 (TTKG = [K+
urine
* Osmplasma] / [K+
plasma
* Osmurine]). Urine osmolality can be estimated using the
following formula: Osmurine = (2 * [Na+
mEq/L + K+
mEq/L]) + (Glucosemg/dL/18) + (Ureamg/dL/6).
Fractional excretion of magnesium was 9%, calculated by FEMg% =
100* [Mg+2
urine x Crplasma] / [0.7 * Mg+2
plasma x Crurine]. Serum magnesium concentration is
multiplied by 0.7 in order to adjust for magnesium filtered by the kidney.
Because of renal hyperkalemia without advanced decreased of GFR, plasma
aldosterone and plasma renin activity analysis were required. Serum cortisol,
plasma ACTH, and abdominal computed tomography (CT) were indicated since PCM is
known to involve the adrenal gland. Drug-induced nephrotoxicity was also evoked
as a possible diagnosis and the above-mentioned medications were temporarily
suspended and tacrolimus was replaced by mycophenolate. |
pmc-6534016-1 | A 70-year-old Caucasian man with long-term type 2 diabetes mellitus, arterial hypertension, dyslipidemia, and past smoking habits was admitted in the nephrology department with unspecific complaints of weakness and weight loss (5 kg in 3 months) associated with a rapidly progressive renal failure. His outpatient medications were metformin, simvastatin and enalapril. There was no history of new medications, surgical interventions, or other medical procedures. On admission, he was afebrile with a normal blood pressure. The physical examination was unremarkable.
Initial laboratory studies showed normocytic and normochromic anemia (Hb 10.5 g/dL), mild thrombocytopenia with normal lactate dehydrogenase, serum creatinine of 7.64 mg/dL (ten days before the value was 4 mg/dL), with normal anion-gap metabolic acidosis, C reactive protein of 4.1 mg/dL, and erythrocyte sedimentation rate (ESR) of 100 mm/h. Urine sediment had no alterations. Urinary protein/creatinine ratio was 297 mg/g. Laboratory studies performed 3 months before showed no anemia (Hb of 13g/dL) and a serum creatinine of 1.2 mg/dL.
Renal ultrasound revealed normal kidneys and no dilation of the urinary system. Chest X-ray was unremarkable. Based on this presentation a rapidly progressive glomerulonephritis was suspected. Considering the severity of renal impairment, empiric therapy with pulse methylprednisolone followed by oral prednisolone (1 mg/Kg/day) was initiated before the additional laboratory evaluation was available.
Complementary studies revealed hypertriglyceridemia (201 mg/dL) and hypercholesterolemia (total cholesterol of 211 mg/dL and LDL of 105 mg/dL). Viral serologies were negative, peripheral blood cultures were sterile, and complement levels (C3 and C4), antinuclear antibodies, serum electrophoresis, and anti-neutrophil cytoplasmic antibodies were normal.
Kidney biopsy was performed ( and ). Light microscopy showed slit-like cholesterol clefts within arteries and arterioles lumen, with cellular inflammatory reaction and lumen occlusion. Glomerular basal membrane thickening and mesangial expansion was also present with interstitial fibrosis, lymphocytic infiltration, and tubular atrophy. Immunofluorescence revealed linear IgG deposit and albumin. Electron microscopy was not performed. These alterations were compatible with atheroembolic renal disease and diabetic nephropathy (stage IIb).
The patient showed a significant improvement with serum creatinine decreasing to 4.14 mg/dL at discharge. Prednisolone in tapering doses plus statin and antiagregation therapy with acetylsalicylic acid was prescribed.
Ten days later, he presented a sudden unilateral vision loss. Ophthalmological examination () revealed the presence of Hollenhorst plaques on retina and retinography confirmed the presence of retinal emboli. Clopidogrel was added to the previous therapeutic schema.
To better assess the extension of the vascular disease, a body tomography was performed, which revealed multiple vascular calcifications with irregular thrombosis in alternated aortic segments. Additionally, carotid ultrasound showed bilateral atherosclerotic disease, without major hemodynamic alterations.
Three months after the initial episode, the patient was asymptomatic, had a further improvement of renal function (serum creatinine of 1.4 mg/dL), and vision loss was also partially recovered. |
pmc-6534017-1 | A.G., a retired 75-year-old Caucasian female residing in Curitiba with a history of CKD secondary to hypertensive nephrosclerosis, had been managed conservatively for nearly two years. Two months prior to the start of renal replacement therapy (January 2015), she was started on an erythropoiesis-stimulating agent (epoetin alfa); at the time, her hemoglobin (Hb) level was below 10 g/dl.
At the start of hemodialysis (March 2015, ), the patient was anemic (Hb = 8.5 g/dl) and with absolute iron deficiency (serum ferritin: 10.1 ng/ml; serum iron: 20,6 µg/dl; transferrin saturation: 4.3%). She was started on intravenous iron hydroxide and the dose of subcutaneous EPO was escalated to a weekly 12,000 IU. Her workup improved, with hemoglobin reaching 12,0 g/dl in May 2015 and iron stores normalizing (serum iron: 156.1 µg/dl; ferritin: 409 ng/ml; and transferrin saturation: 45.3%), while dialysis adequacy was satisfactory (KT/V > 1.2). Between July and October 2015, while on EPO therapy, her hemoglobin dropped significantly and gradually to below 8,0 g/dl despite changes in EPO dosage, which prompted the need for blood transfusions on account of symptomatic anemia and hospitalization to further investigate the causes of anemia unresponsive to EPO.
On the second semester of 2015 and on the first semester of 2016 the patient underwent examination by upper gastrointestinal (UGI) endoscopy and colonoscopy, which revealed she was not suffering from GI bleeding. Direct and indirect Coombs tests were negative for hemolysis; her reticulocyte count was low (< 10,000 / µL), while bilirubin and lactate dehydrogenase levels were normal; her parathyroid hormone level was < 500 pg/ml (). Despite treatment with EPO in doses > 50 UI/kg 3x/week (12,000 IU a week), the patient had persistent asthenia and weakness associated with low hemoglobin levels and required monthly blood transfusions.
In June 2016, after extensive blood testing, bone marrow examination with myelography found erythroid hypoplasia and normal presentations in the other cell series (granulocytic, lymphocytic, and platelet) without infiltration of neoplastic cells. The analysis of all information available suggested the patient had PRCA associated with anti-EPO antibodies. In July 2016 she was tested for anti-EPO antibodies and EPO therapy was suspended. On the following month test results showed she was positive for neutralizing anti-EPO antibodies. Treatment with EPO was discontinued and the patient was started on immunosuppressant therapy (prednisone 1 mg/kg/day with further de-escalation; and cyclosporine 4 mg/kg/day, divided in two doses).
Hemoglobin levels improved gradually after the introduction of immunosuppressant therapy. Values reached their best levels between September and October of 2016 (9.2 g/dl), and since then the patient has not been offered packed red blood cells. Immunosuppressant therapy was discontinued after four months on account of side effects (esophageal candidiasis and persistent hand tremors). Nevertheless, hemoglobin levels have been stable and the patient has been off epoetin alfa. |
pmc-6534017-2 | J.W.S.A., a 66-year-old male Caucasian physician residing in Curitiba, Brazil, had advanced CKD secondary to adult polycystic kidney disease. He had been managed conservatively for five years and started hemodialysis (HD) in June 2014 (). At the time he had been taking epoetin alfa regularly for two years, and in the month after the start of HD he was found to have severe sudden onset anemia (Hb < 7.0 g/dl) with normal iron stores (serum iron: 58.5 µg/dl; ferritin: 380 µg/L; and transferrin saturation: 20.9%).
Endoscopic examination (UGI endoscopy and colonoscopy) did not reveal sources of active bleeding. Between July and December 2014, the patient needed monthly transfusions with packed red blood cells due to symptomatic anemia. He underwent the same diagnostic examination procedures described for the patient discussed in Case 1 (), including bone marrow testing, which showed erythroid hypoplasia and normal presentations in the other cell series (granulocytic, lymphocytic, and platelet). In October 2014, PRCA related to anti-EPO antibodies was considered. Blood tests revealed the patient was positive for neutralizing anti-EPO antibodies. The patient was taken off epoetin alfa in November 2014 and was started on cyclosporine and prednisone at doses similar to the ones described for the patient in Case 1. His hemoglobin levels began to improve gradually since January 2015. He no longer needed transfusions and was kept on cyclosporine until May 2015 as recommended by the hematology team, when he underwent kidney transplantation (deceased donor). The patient is currently well. |
pmc-6534021-1 | A previously healthy 55-year-old female without known comorbidities was admitted to the General Practice Clinic of Hospital Geral Dr. Waldemar Alcântara (HGWA). She complained of weakness, paresthesia, and a burning sensation in her lower limbs she had been feeling for three years along with macular hyperchromic lesions on the soles of her feet. The patient went to a dermatologist nine months prior to admission and was diagnosed with contact eczema. She was prescribed topical corticosteroids and a moisturizing agent. One month before hospitalization the patient had pain, hyperemia, and bullous lesions on her right foot, which ruptured spontaneously letting out a serous secretion. She improved after taking unspecified medication. Five days prior to admission the patient developed oliguria, lower limb edema, and abdominal pain - mainly in the hypogastrium - along with nausea and hyporexia. She went to an Emergency Unit and was found to have a serum creatinine (SCr) level of 21.94 mg/dL and a blood urea nitrogen (BUN) level of 260 mg/dL, which triggered her referral to the hospital cited above. A test run six months prior to her arrival at the hospital read SCr = 0.7 mg/dL and blood urea= 37.4 mg/dL. Upon admission, she was found to be generally well and hydrated, pale 2+/4+, eupneic, conscious and oriented. Her heart was normal on auscultation while crackles were heard bilaterally on the bases of her lungs. She had a flaccid distended abdomen on account of fat accumulation and complained of pain on her hypogastrium upon palpation. No evidence of visceromegaly was found. Her peripheral pulses were palpable, and she had lower limb edema 1+/4+ and hyperchromic scar tissue-like lesions on the soles of her feet (). Examination of the upper limbs revealed the interosseous muscles of her right hand were atrophied. Neurological examination showed she had predominantly distal paresis of the lower limbs (grade IV on the left and III on the right leg), grade IV paresis of the upper limbs, and anesthesia on the soles of her feet.
Lab tests performed upon admission () were negative for HIV, syphilis, and hepatitis B and C. Tests for cytoplasmic (c-ANCA) and perinuclear (p-ANCA) antineutrophil cytoplasmic antibodies were negative; ANCA was atypical; the test for cryoglobulins was negative. Serum protein electrophoresis showed polyclonal increases of alpha-1-globulin and gamma globulins. Ultrasound examination of the kidneys and urinary tract showed normal-sized kidneys with irregular contours (RK: 9.1 x 4.3 cm, LK: 9.2 x 5.0 cm) and good corticomedullary differentiation. Transthoracic echocardiogram showed good cardiac function (EF 61%) and no vegetation. Fat pad biopsy was negative for amyloidosis. Electroneuromyography revealed distal mixed axonal demyelinating sensorimotor polyneuropathy with a predominant axonal component and preferential involvement of the right leg, producing severe impairment of the lower limbs and moderate to mild dysfunction of the upper limbs, as seen in cases of infectious neuropathies (including Hansen's disease), uremia, and vasculitis.
The patient was started on hemodialysis three times a week. Neurological assessment showed she had multibacillary Hansen's disease (positive for bacilli agglomerates). The patient was prescribed polychemotherapy with rifampicin, dapsone, and clofazimine. The choice was made to prescribe prednisone 1mg/kg/day two weeks after the start of treatment for Hansen's disease, since the patient had signs consistent with RPGN; she was waiting to undergo a kidney biopsy, which was performed only after 27 days of steroid therapy. The pathology specimen was satisfactory and featured 22 glomeruli and two medium-caliber vessels. Ten glomeruli had global sclerosis and three had fibro-cellular crescents (). The other glomeruli had mild mesangial proliferation (); findings such as polymorphonuclear infiltration and subepithelial or mesangial deposits (humps) were not seen. Mild to moderate interstitial fibrosis (), acute tubular necrosis, and benign nephrosclerosis were also described. Immunofluorescence showed strong and diffuse labeling for C3 (3+ in 4+) in the mesangium, and barely positive results for IgA (1+ in 4+) in the mesangial compartment, following a pattern similar to that of C3 ( and ). |
pmc-6534358-1 | A 52-year-old man underwent gastroduodenoscopy for the examination of mild abdominal fullness, revealing multiple whitish nodules or plaques at the second portion of the duodenum (). A histological diagnosis of grade 1 follicular lymphoma was made on the basis of the findings of distinct follicular-pattern proliferation of monotonous atypical small lymphoid cells (, ) that were positive for CD20, CD10, and bcl2. IGH- BCL2 was positive by fluorescence in situ hybridization (FISH) analysis. A colonoscopy identified similar lesions at the terminal ileum, which was also histologically confirmed as follicular lymphoma (). Computed tomography (CT), along with bone marrow and cerebrospinal fluid examinations, failed to detect other nodal or extranodal lesions. Serum LDH value was within a normal range. On the basis of those findings, DFL at stage I of the Lugano International Conference Classification was diagnosed. A ‘watch and wait’ policy was chosen, and no treatment was given. A follow-up physical examination and blood tests were given every 2 to 3 months, and CT and endoscopic examinations were performed every 1 to 2 years. However, the patient started complaining of abdominal fullness and upper abdominal pain 7.6 years after the diagnosis was made when he was 60 years old. Gastroduodenoscopy and CT had been performed as routine follow-up 1 and 5 months before the onset, respectively; no significant changes had been documented. However, CT revealed a 6 cm tumor at the duodenum () and swelling of multiple lymph nodes in the abdominal cavity with significant uptake by positron emission tomography (PET, ). PET also detected lesions at the thoracic and lumbar vertebrae. Histological findings of the sample obtained from the abdominal tumor by CT-guided biopsy showed the diffuse proliferation of large atypical lymphoid cells, which were positive for CD20, CD10, bcl2, bcl6, and negative for CD3 and Cyclin D1 (). Both IGH-BCL2 and MYC rearrangements were positive by FISH analysis. Follicular component was no longer identified. On the basis of these findings, histological transformation of DFL to diffuse large B-cell lymphoma of germinal center B-cell subtype was diagnosed. The International Prognostic Index was determined as high risk (age, 60; LDH, high (431 U/L); performance status, 1; clinical stage, IV; extranodal sites; two). In the clinical course, serum soluble interleukin-2 receptor was increased to 2026 U/mL. Neither R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone) nor R-ESHAP (rituximab, etoposide, cytarabine, cisplatin, and methylprednisolone) chemotherapy was effective, and the disease progressed. For symptom relief, local field radiotherapy was given, but the response was poor. He succumbed due to disease progression 7 months after the histological transformation and 8 years after the diagnosis of DFL.
Our English-language literature search identified only 7 additional cases of histological transformation of DFL [, , -]. There was another case in a recent report, but we excluded it because of the possibility of systemic FL involving the duodenum []. The characteristics of those cases are summarized in . The median age was 49 years (range, 44-73) at the diagnosis of DFL. The histological grade of FL at diagnosis was 1 in most of the cases, and the clinical stage was I in all. In addition to the duodenum, 2 patients had lesions at the ileum. All but one case (Case 2) had been managed with watch and wait policy without receiving systemic chemotherapy. The time from the diagnosis of DFL to histological transformation ranged from the time of diagnosis to 7 years after diagnosis. In two patients, histological transformation was confirmed at the time of diagnosis of DFL (Cases 6 and 7). Except for our present case, the outcomes after the histological transformation of DFL were favorable, with good responses to CHOP-based chemotherapies. |
pmc-6534519-1 | A 35-year-old woman with a history of autoimmune hemolytic anemia and longtime prednisone taken presented with headache, fever and altered mental status. Neurological examination revealed meningeal irritation and bilateral pathological reflex of Babinski sign. Brain MRI showed bilateral and multiple hypointense T1 (not shown) and hyperintense T2 soap bubble-like gelatinous pseudocysts at the periventricular white matter, basal ganglia, midbrain and dentate nucleus, with mild post-gadolinium enhancement at bilateral basal ganglia (Fig. a–e). Lumbar puncture was performed with cerebral spinal fluid (CSF) pressure of 350 mmH2O. CSF was clear with a protein level of 359 mg/L (normal range: 150–450 mg/L), a glucose level of 0.54 mmol/L (normal range 2.22–3.89 mmol/L), but without leukocytes. India ink staining of CSF found Cryptococcus neoformans (Fig. f) and fungal spores. Fungal culture and cryptococcal capsular polysaccharide antigen test of CSF confirmed CNS cryptococcal infection. Subsequently, blood culture also revealed cryptococcal infection. Serum HIV test of this patient was negative. However, lymphocyte count in the peripheral blood was as low as 0.03 × 109/L (normal range: 1.10–3.20 × 109/L). Peripheral blood lymphocyte subsets analysis revealed a significant reduction of all kinds of immune cells, especially the extremely reduced CD4 + T lymphocytes and NK cells (Table ). Ultrasonography showed splenomegaly. Based on these findings, cryptococcal meningoencephalitis was diagnosed in this immunocompromised patient. Though received standard antifungal treatment, the patient died of cerebral hernia 3 weeks later. |
pmc-6534842-1 | A 58-year-old Swiss woman presented to our hospital with a history of ascending numbness in both legs evolving over the preceding 12 months. Three weeks before initial evaluation, she had developed rapid, painless worsening of her symptoms. Her main complaints were motor weakness and loss of fine motor skills. Sicca syndrome and Raynaud’s phenomenon had been present for more than 10 years. The patient denied having joint pain. Clinical examination revealed distally accentuated, symmetric, flaccid tetraparesis with areflexia accompanied by hypesthesia up to the knees and elbows for all sensory qualities. After administration of intravenous methylprednisolone for suspected inflammatory polyneuropathy, the patient had her first generalized tonic-clonic seizure. Despite the administration of levetiracetam, another two generalized seizures occurred 24 h later, after which the patient showed psychomotor slowing, right-sided hemianopia, and central paresis of the right arm.
The initial electroencephalogram (EEG) after the first seizure showed slowing of both occipital lobes with temporal acceleration. This finding was more pronounced on the left side and over the right hemisphere. Electrophysiological studies revealed a severe axonal sensorimotor proximal symmetric polyneuropathy with sensory proximal symmetric accelerated defiance.
Laboratory testing demonstrated rheumatoid factor, an antinuclear antibody titer of > 1:1280, and antibodies to SSA/Ro and SSB/La together with hypocomplementemia. Type II cryoglobulins were detectable (cryocrit of 5.4%). Antibodies against double-stranded DNA (deoxyribonucleic acid) were absent. Saxon and Schirmer tests confirmed severely decreased tear and saliva production. Biopsy (Fig. ) of labial minor salivary glands showed periductal lymphocytic infiltration with a focus score > 1. On the basis of the positive anti-SSA as well as the salivary gland biopsy having a focus score > 1 and a Schirmer test < 5 mm in 5 min, the 2017 ACR-EULAR classification criteria for pSS were formally fulfilled. Because there was prominent hypergammaglobulinemia with markedly elevated light chains, a bone marrow biopsy was performed, which showed < 10% plasma cells. Flow cytometry demonstrated expansion of clonal plasma cells with restricted kappa light chains.
Primary lumbar puncture showed hypergammaglobulinemia with markedly increased light chains. Repeat lumbar punctures during the disease course confirmed monoclonal gammopathy of undetermined significance (MGUS) of the immunoglobulin M kappa type.
Initial magnetic resonance imaging (MRI) of the brain performed after the first seizure showed multiple, bihemispheric, confluent white matter hyperintensities (WMHs) with contrast enhancement (Fig. ). The parotid gland on both sides and the left submandibular gland were diffusely enlarged with multiple small cystic areas and tiny contrast-enhancing nodules (Fig. ). MRI was performed 3 days after the first imaging because of rapid clinical worsening, which demonstrated a fulminant disease progression (Fig. ). Consequently, a biopsy of one of the enhancing lesions in the right frontal lobe was done. The right frontal dura and slightly thickened right pia mater were also biopsied and sent for pathological and microbiological testing. The histopathological results were noncontributory and did not suggest a specific pattern or definitive diagnosis. The possibility of microglial activation was discussed. There was no evidence of CNS vasculitis; infection with cytomegalovirus, herpes simplex virus, JC virus (human polyomavirus 2, formerly John Cunningham virus), or Toxoplasma gondii; or lymphoma infiltrates.
pSS was suspected in light of the patient’s sicca syndrome and results of laboratory testing. The labial minor salivary gland biopsy showed no evidence of another underlying rheumatological disorder such as systemic lupus erythematosus. The fulminant worsening of symptoms led us to consider an additional lymphoma in the course of long-standing SS as a differential diagnosis. However, progression of the CNS lesions under administration of steroids as well as the results of the bone marrow biopsy argued against this diagnosis. No evidence for an immunoglobulin G4 (IgG4)-related disease was found in the biopsy of the salivary glands, and results of serological testing for hepatitis C were negative. Results of the bone marrow biopsy and flow cytometry were interpreted as MGUS.
After the patient had her third seizure, five sessions of plasma exchange were conducted over 8 days. After the second generalized seizure and until plasmapheresis, the patient showed reduced vigilance and psychomotor slowing. Thereafter, cyclophosphamide was administered monthly, along with oral steroids. Plasmapheresis led to a rapid improvement of the patient’s condition. After the seventh cycle of cyclophosphamide therapy, the patient was able to walk unaided for up to 1 h and carry out everyday activities independently. Steroids were gradually tapered. MRI performed after the second cycle of cyclophosphamide demonstrated complete resolution of the contrast-enhancing WMHs (Fig. ). Six months after initial presentation, cryoglobulins were no longer detectable. Treatment was changed to rituximab given every 6 months. Furthermore, intermittent depressive mood led to a switch of the antiepileptic therapy from levetiracetam to lamotrigine after 6 weeks. The patient is still taking lamotrigine and is seizure-free. Under therapy with lamotrigine, the patient had normal EEGs with normal basic activity and no typical epilepsy signals.
The patient recovered quickly and was able to resume everyday life within 3 months after leaving the hospital. The patient is currently doing well with no signs of relapse 1.5 years after initial presentation and has returned to work. |
pmc-6534884-1 | A 42-year-old Arabic man presented to general surgery emergency with a 5-day history of constipation, progressive abdominal pain, nausea, and vomiting. His last bowel movement had been 3 days ago. There was no significant past medical history, particularly of chronic constipation, psychiatric disease, or abdominal surgery.
On examination, his vital signs were: temperature 37.5 °C, pulse 115/minute, respiratory rate 26/minute, and blood pressure 90/60 mmHg. An abdominal examination revealed a massive distension of his abdomen without signs of peritonitis. His abdomen was tympanic to percussion. There were no umbilical or groin hernias. A digital rectal examination demonstrated an empty rectal vault without intraluminal masses. An abdominal X-ray revealed a large bowel obstruction with a “U-shaped” loop in the left upper abdomen (Fig. ).
Blood investigations showed leukocytosis at 12.0 × 109/L, C-reactive protein (CRP) at 34 mg/l, and serum sodium and potassium levels were within normal limits.
An abdominal CT could not be done due to functional renal failure.
After initial resuscitation with intravenously administered fluids, analgesics, and antibiotics, a decision was taken to proceed with an emergency laparotomy. Intraoperative findings (Fig. ) were of a transverse colon volvulus rotated in a 360° clockwise direction on its mesentery. The point of twist was found in the left upper quadrant (Fig. ). The bowel was intact without signs of ischemia (Fig. ). A significant disparity in the size of the obstructed proximal and collapsed distal colon to the site of the volvulus was noticed. The transverse colon was mobile and increased in length. The volvulus was delivered into the incision and detorsed. An extended right hemicolectomy was carried out with end-to-side ileocolic anastomosis.
Our patient’s postoperative course was uneventful. He was discharged from hospital 6 days following admission. On histologic examination, the appearance was consistent with a subacute progressive volvulus of the transverse colon. No acute inflammation, infarction, granulomas, dysplasia, malignancy, or vascular abnormality was noticed. |
pmc-6534894-1 | We describe the case of a 63-year-old man, Caucasian, affected by non-ischemic dilated cardiomyopathy who did not drink alcohol, did not smoke tobacco, and did not have diabetes. He had an implantable cardioverter defibrillator implanted, in New York Heart Association (NYHA) IV class, and left bundle branch block (LBBB; QRS duration of 145 ms). He was referred for CRT-D upgrade, awaiting cardiac transplantation, despite optimal medical therapy: b-Blockade, loop-diuretic, angiotensin-converting enzyme (ACE) inhibitor, K-sparing agent, and ivabradine. Standard clinical imaging protocol revealed a dilated left ventricle with an end-systolic volume (ESV) of 380 ml, an ejection fraction (EF) of 4.8% as measured by the modified Simpson’s method, and severe FMR, assessed by qualitative estimation with two-dimensional color flow Doppler approach, showing a very large central jet and reaching the posterior wall of the left atrium (see Fig. and Additional file 1: Video S1).
He underwent the implant of a CRT-D device with a quadripolar left ventricular (LV) lead placed in the posterolateral branch of the coronary sinus. After recording the right ventricle (RV)-to-LV electrical delay at each of the four LV rings, we chose the A1 unipolar vector for LV pacing (greatest electrical delay 80 ms).
At 13-day post-implant follow-up, he showed worsening heart failure (HF) symptoms and only A2 unipolar LV vector configuration, with interventricular (VV) interval of 0 ms, was suitable for simultaneous biventricular activation (Fig. ).
Echo-PIV was then used, during the acute study with contrast agent bubbles, to evaluate the orientation and relative magnitude of blood-induced intraventricular forces in correspondence of different pacing settings.
Without pacing stimulation (CRT OFF, Fig. a, and Additional file 2: Video S2) the intraventricular flow was dominated by rotation without evident inflow–outflow dynamics. As a result the intraventricular forces were predominantly transverse and not aligned along the LV axis (Fig. a1) as quantified by the large value of their mean angle φ (φ = 55.6°, this angle ranges from 0°, when forces are aligned with the LV axis, to 90°). A first setting option (CRT ON, VV delay 0 ms, Fig. b and Additional file 3: Video S3) changed the orientation of intraventricular forces (Fig. b1) reducing the angle (φ = 45°), and increasing the delay (CRT ON, VV delay − 30 ms, Fig. c and Additional file 4: Video S4) improved the alignment (Fig. c1) reducing the angle (φ = 40.3°). Eventually, the sequential biventricular activation with delay − 50 ms (Fig. d and Additional file 5: Video S5) provided the best alignment of intraventricular forces (Fig. d1, φ = 38.8°).
No reduction of FMR by three-dimensional FVCD, during the same acute study with shutdown versus reactivation of device, was demonstrated, as shown in Figure and by comparing Additional file 6: Video S6 and Additional file 7: Video S7.
The data acquisition time, by three-chamber apical view, for each three-dimensional color Doppler data set was approximately 5 seconds, and it took less than 3 minutes to analyze the average regurgitation volume, with automated anatomy detection of the LV endocardial border, mitral annulus (MA), LV outflow (LVOT), and placement of three-dimensional hemispheric flow sampling planes in the MA and LVOT. The software of three-dimensional FVCD computed the flow volumes as the area under the curve of both the MA and LVOT flow in three cardiac cycles, and FMR volume was calculated by subtracting LVOT stroke volume from MA stroke volume.
Our patient showed an improvement of NYHA class (III versus IV) and LV EF (26.6% versus 4.8%). Significant reduction of ESV (288 ml versus 380 ml) and persistent improvement of diastolic function were obtained. The regularized function is noticeable in Additional file 8: Video S8 (to be compared with Additional file 1: Video S1) and it is summarized in Fig. . At follow-up, a significant reduction of FMR (mean value regurgitant volume, 42.2 ml versus 65.3 ml) was estimated (Fig. , Additional file 9: Video S9, Table ).
The intraventricular forces estimated by echo-PIV were still partially dominated by the longitudinal path of pressure gradient (Fig. and Additional file 10: Video S10) with φ = 43.1°. |
pmc-6534895-1 | A 57-year-old Caucasian male patient received a liver transplant in 1998 for alcoholic cirrhosis and hepatocellular carcinoma. In 2006, diffuse large B-cell lymphoma (post-transplant lymphoproliferative disease) was diagnosed and successfully treated with chemotherapy. The patient’s previous medical history also included psychiatric illness and post-traumatic epilepsy. His maintenance immunosuppressive treatment consisted of tacrolimus (trough levels 5–6 μg/l) and prednisone 5 mg qd.
Since 2014, routine control exams revealed slight intermittent transaminase elevation, attributed to suspected alcohol consumption. In August 2016, the patient presented with ascites and laboratory evidence of graft dysfunction (INR 1.3, albumin 34 g/l, total bilirubin 47 μmol/l, creatinine 99 μmol/l), without any signs of encephalopathy. Child-Pugh stage and MELD score were B9 and 14, respectively. Transaminases were moderately elevated (ALT 63 U/l, AST 110 U/l) and associated with some degree of cholestasis (alkaline phosphatase 240 U/l, γ-GT 502 U/l). Hepatitis B and hepatitis C as well as cytomegalovirus infections were ruled out by PCR. There was no significant increase in Epstein-Barr virus DNA which remained in the usual range for the patient (24,000 cp/ml).
Serology for both anti-HEV IgM and IgG was positive and so was PCR for HEV RNA in plasma (7.0 log10 IU/ml). Sequence analyses revealed infection with rabbit HEV (genotype 3ra) []. Positive HEV RNA could be found retrospectively in a stored serum sample from 2014, confirming the diagnosis of decompensated graft cirrhosis due to chronic hepatitis E.
Tacrolimus was reduced to yield trough levels around 2 μg/l, along with prednisone 5 mg qd. However, as HEV RNA did not decrease, RBV was introduced in September 2016, with trough levels between 1129 and 3700 ng/ml. Under this treatment, liver function tests normalized and there was a complete resolution of ascites. HEV RNA dropped but reached a plateau at 3 log10 IU/ml after 12–16 weeks of RBV therapy (Fig. ). Thus, SOF 400 mg qd was added on a compassionate use basis from February to July 2017, i.e. for a total of 24 weeks.
Shortly after SOF introduction, HEV RNA became undetectable in plasma and remained so throughout the period of combination therapy (Fig. ). Trough levels of the major SOF metabolite GS-331007 were in the expected concentration range for a patient with moderately impaired renal function (332–1966 ng/ml). HEV RNA in stool became negative 2 months after the introduction of SOF but a positive result was observed 2–3 months later, towards the end of combination therapy. In July 2017, SOF was stopped. Despite the maintenance of RBV, this resulted in the reappearance of HEV RNA in plasma and stool. After stop of RBV at the end of February 2018, HEV viremia remained relatively low for about 3 months (range, 3.7–4.8 log10 UI/ml) but increased again increased significantly to 6.1 log10 IU/ml in July 2018. Hence, RBV treatment was resumed in August 2018, with a slow decline in HEV RNA in plasma and stools, which both became undetectable at the end of November 2018, i.e. after more than 3 months (Fig. ). The patient is now well and still under RBV treatment at the time of writing of this report in January 2019.
Sequencing of the polymerase region of open reading frame 1 in plasma samples obtained before (August 2016) and after RBV treatment (July 2018) revealed, as expected for rabbit HEV (genotype 3ra), a preexisting lysine in amino acid position 1634, which persisted throughout the observation period. Interestingly, among other amino acid changes observed, selection of an asparagine instead of a lysine was noted in position 1383 (K1382 N). Both the preexisting lysine in position 1634 and the selected asparagine in position 1383 had previously been identified in patients with RBV failure (reviewed in ref. [])
To conclude, SOF appeared to exert some antiviral effect during combination therapy, resulting in negativation of HEV RNA in plasma. However, sustained viral clearance could not be achieved. |
pmc-6534929-1 | A 63-year-old woman was admitted to our hospital with back pain persisting for 4 months and a 2-day history of fever and right chest pain. On admission, her height and weight were 154 cm and 50 kg, respectively. She had no history of other diseases, including autoimmune disease, diabetes, bronchiectasis, old healed tuberculosis, trauma, or acupuncture. The patient had visited two other hospitals, where contusion of the thoracic spine had been diagnosed by MRI (two months before admission) and contrast CT (three weeks before admission) (Fig. a, b), despite no history of trauma. She had received symptomatic therapy with an anti-inflammatory agent from both hospitals, but her back pain had persisted.
Initial laboratory data included a white blood cell count of 7580/μl (85.0% neutrophils) and a C-reactive protein of 8.26 mg/dl. CT showed a right-sided pleural effusion (Fig. c). Right pleuritis was diagnosed and the patient was treated with ampicillin/sulbactam for 11 days, but this was not effective (Fig. d). She subsequently underwent thoracoscopic curettage followed by drainage of pus from the pleural cavity for 7 days using 22 and 24 Fr double lumen trocars, and administration of cefoperazone/sulbactam for the same period (Fig. e). General bacterial culture of pus obtained at surgery was negative, but culture for acid-fast bacteria (mycobacteria growth indicator tube (MGIT) system; BACTEC MGIT 960) proved to be positive after the 7-day treatment period. The pathogen was identified as M. abscessus complex by DNA-DNA hybridization [], and was confirmed to be M. abscessus ssp. abscessus, but not M. abscessus ssp. massilense or M. abscessus ssp. bolletii [], by multiplex PCR [] and rpoB sequence analysis []. Since there was no previous report of primary empyema due to M. abscessus ssp. abscessus and the patient had no underlying disease suggesting a source of infection, the result was considered to represent contamination and further treatment was not provided. However, CT performed one month later revealed progression of a previously overlooked paravertebral lesion to involve the lung (Fig. f). M. abscessus ssp. abscessus was detected from lavage fluid of the paravertebral lesion recovered by bronchoscopic examination. Two months after admission (5 weeks after initial detection of M. abscessus ssp. abscessus), treatment with imipenem/cilastatin (IPM/CS: 1 g/day i.v.), amikacin (AMK: 400 mg/day i.v.), and clarithromycin (CAM: 800 mg/day p.o.) was initiated based on a diagnosis of VO due to M. abscessus ssp. abscessus, with paravertebral abscess caused by direct spread. An antibiotic susceptibility test was performed with air-dried microplates containing serial dilutions of antimicrobial agents and modified Middlebrook 7H9 broth [], revealing that the minimum inhibitory concentration (MIC) of CAM for the pathogen was 0.25 μg/ml on day 3 and 1.0 μg/ml on day 14. These data indicated that the pathogen remained susceptible to CAM (MIC ≤2.0 μg/ml on days 3 and day 14) and did not develop inducible resistance (susceptible on day 3 with MIC ≥8.0 μg/ml at day 14), according to the Clinical Laboratory Standards Institute Guideline [, ].
After continuation of treatment for three months, both the MRI-confirmed VO and the paravertebral abscess showed improvement (Fig. a, b, d, e, g, h), so she was switched to oral antibiotic therapy (faropenem (FRPM) 600 mg/day, levofloxacin (LVFX) 500 mg/day, and CAM 800 mg/day). After that, further improvement was observed and the antimycobacterial treatment was completed within 2 years (Fig. c, f, i). No other combination therapy was administered during this period. No evidence of recurrence has been detected during follow-up for 4 months after the end of treatment. |
pmc-6534931-1 | Proband D, a 26-year-old man, complained of recurrent jaundice for 8 years and splenomegaly for more than 6 years. Physical examination revealed cutaneous and icteric sclera; the spleen was palpable 60 mm below the costal margin. His serum total bilirubin (TBIL) was 73.1 μmol/l and his direct bilirubin (DBIL) was 7.3 μmol/l. The complete blood count revealed hemoglobin 125 g/l, reticulocytes 0.334 × 1012/l, mean corpuscular volume (MCV) 85.7 fl, mean corpuscular hemoglobin (MCH) 28.4 pg and MCHC 332 g/l, and spherocytes accounted for 13.6% of red blood cells (RBCs). Abdominal ultrasonography detected cholelithiasis in addition to splenomegaly. Serum hepatitis B virus surface antigen was positive, while liver biopsy showed no cirrhosis (Table ).
Proband W, a 24-year-old girl, was diagnosed with HS complicated with jaundice and cholelithiasis and underwent cholecystectomy and splenectomy less than 5 years ago. Before the operation, her spleen was palpable 100 mm below the costal margin. Her serum TBIL was 74.0 μmol/l, and her DBIL was 19.4 μmol/l. The complete blood count revealed hemoglobin 114 g/l, reticulocytes 0.373 × 1012/l, MCV 79.8 fl, MCH 29.9 pg and MCHC 374 g/l. Spherocytes accounted for 15.0% of RBCs (Table ). She was re-evaluated clinically. Her TBIL was 27.3 μmol/l, and her DBIL was 7.3 μmol/l. Her hemoglobin was 163 g/l, reticulocytes was 0.081 × 1012/l, MCV was 88.4 fl, MCH was 32.0 pg, and MCHC was 364 g/l. Spherocytes accounted for 30.0% of RBCs (Table ).
Proband D and proband W are cousins (their mothers are sisters). Of the proband W’s immediate family members, splenomegaly and elevated reticulocytes, spherocytes and serum bilirubin were detected in her mother and brother. Her mother’s spleen was palpable 32 mm below the costal margin. Her TBIL was 31.7 μmol/l, and her DBIL was 12.6 μmol/l. her was hemoglobin 114 g/l, reticulocytes was 0.145 × 1012/l, MCV was 84.7 fl, MCH was 30.1 pg and MCHC was 355 g/l. Spherocytes accounted for 19.6% of RBCs. Her brother’s spleen was palpable 27 mm below the costal margin. His TBIL was 29.2 μmol/l, and his DBIL was 12.1 μmol/l. his hemoglobin was 150 g/l, reticulocytes was 0.188 × 1012/l, MCV was 92.5 fl, MCH was 33.0 pg, and MCHC was 356 g/l. Spherocytes accounted for 18.0% of RBCs. In addition, slightly elevated reticulocytes (0.138 × 1012/l), serum bilirubin (TBIL19.3 μmol/l) and spherocytes (10.0% of RBCs) also existed in proband W’s father, while his spleen was not enlarged (details in Table ).
However, no splenomegaly was found in proband D’s immediate family members. Only slightly elevated reticulocytes (0.084 × 1012/l) and spherocytes (8.0% of RBCs) were detected in his father. No HS clinical features or laboratory findings, such as spherocytes, raised MCHC or reticulocytosis, were found in his mother, who is the sister of proband W’s mother (details in Table ).
Proband D’s father was also discovered to be a hepatitis B virus (HBV) carrier. Elevated serum lactate dehydrogenase (LDH) (307.4 U/L) was detected only in proband W’s brother but not in any other family members (Table ).
Peripheral vein blood was drawn from the probands and their immediate family members after they signed informed consents. The genomic DNA was extracted and the genomic DNA library was constructed according to Agilent’s protocol. WES services were provided by the Chigene Bioinformatics Institute (Beijing, China). Exomes were captured by Nimblegen kits, and next-generation sequencing (NES) was conducted with an Illumina HiSeq. The results were aligned to the University of California Santa Cruz, human genome assembly 19 (UCSC.hg19; /) reference sequence. VCFtools program of the SAMTools software, version 0.1.16 (/) was used to identify and call variants, including single-nucleotide polymorphisms (SNPs) and indels. ANNOVAR was used to annotate the variants. There are 48,747 variants and 49,276 variants were identified in proband D and proband W respectively. The strategies of data filtering were on the basis of the published documents [, ].
WES revealed that proband D was heterozygous for the c.C4873T (p.R1625X) mutation within exon 23 of SPTB, which were confirmed by Sanger sequencing of the polymerase chain reaction (PCR) products. Primers are as following: forward 5′- GGTCTCTCAAAGCTGGAATGA − 3′, reverse 5′- AAATTGGTGCTCTCAGGTCA -3′. PCR products were sequenced and analyzed using Phred-Phrap-Consed version 12.0 software (). Sequencing results were compared with the reference sequences for SPTB (GenBank accession no. NM_001024858). Then, the detected mutations were searched in the 1000 Genomes Project database and Exome Aggregation (). The SPTB R1625X mutation was not present in any of his immediate family members (Fig. ). This mutation introduced a premature stop codon at amino acid residue 1625, which created a truncated β-spectrin protein, and was predicted to be disease-causing by the analytical software. The truncated protein lack of the ankyrin binding domain and the tetramerization domain has been proved to lead to inefficient incorporation of the mutant protein into the skeleton and result in HS (Fig. ) [–]. In addition, it has been previously identified as a pathogenic mutation [, ]. Therefore, combined with the patient’s clinical diagnosis of HS, the SPTB R1625X was identified as a pathogenic mutation, and was causative for HS development in proband D according to the American College of Medical Genetics (ACMG) guidelines []. The SPTB R1625X mutation was determined to be a de novo mutation in proband D.
Meanwhile, WES revealed that proband W was heterozygous for the c.G1469A (p.R490H) mutation within exon 13 of SLC4A1, which was confirmed by Sanger sequencing of the PCR products. Primers for PCR were as following: forward 5′-TTGACTGACCGGCTTCTTCT-3′, reverse 5′-AGGACACAATGGCTCAGTCT-3′. Sequencing results were compared with the reference sequences for SLC4A1 (GenBank accession no. NM_000342). The SLC4A1 R490H was also present in her mother and brother (Fig. ). SLC4A1 gene codes band 3 protein, the predominant glycoprotein of RBCs membrane. Band 3 consists of 14 transmembrane (TM) segments and short helical (H) segments linking TM segments. HS-related mutations are common in the TM segments. This mutation predicted a change from arginine to histidine at highly conserved amino acid residue 490, which was located at the N-terminus boundary of the fourth putative TM segment of band 3, and the substitution could destabilize the helix and position of the segment in the bilayer of red blood cell membrane (Fig. ) []. And the mutation was predicted to be disease-causing by the analytical software. In addition, it has been previously reported as a pathogenic mutation [, ]. Therefore, combined with the patient’s clinical diagnosis of HS, SLC4A1 R490H was probably as a pathogenic mutation and was causative for HS development in proband W, her mother and brother according to the ACMG guidelines [].
In addition, with the combination of WES and Sanger sequencing, no additional genomic defects involved in HS-related symptoms, such as uridine diphosphate glucuronosyl transferase 1A1 (UGT1A1) deficiency involved in jaundice, have been detected in the whole family. |
pmc-6535189-1 | A 6-year-old Moroccan boy with asthma was admitted to our emergency department because of acute dyspnea and persistent dry cough. Two days prior to his admission, he had fever, cough, and wheezing. He was initially treated with oral antibiotics (azithromycin 10 mg/kg/day) and nebulized salbutamol at his pediatrician’s office. However, owing to the worsening of his condition and the appearance of cervical swelling, he was referred to our department. Since age 3 years, the child had been diagnosed with intermittent asthma, had been well-monitored, and had been placed on outpatient treatment. Viral triggers were common with this patient. His family had an average socioeconomic level. Their home was airy and sunny without any pets. There was not any exposure to smoke from tobacco. The child had no particular pathological history. He had never been hospitalized for a severe crisis. He had nonfrequent recurrent wheezing episodes that occurred three to four times per year and were treated with bronchodilators and oral steroids when necessary. There was no family history of atopy. According to the parents, the patient had no history of food allergy, trauma, choking episode, FB aspiration, or any recent viral infection triggers for an acute asthma exacerbation. His physical examination showed the following: respiratory distress with perioral cyanosis, tachypnea (respiratory rate, 46/min) and hypoxia (oxygen saturation, 84% in room air), bilateral wheezing, and a cervical swelling with crepitations on the neck. His temperature was 38.3 °C. His hemodynamic state was stable (pulse rate, 110 beats/minute; blood pressure, 100/60 mmHg). The patient was conscious. The result of his neurological examination was normal. A chest x-ray showed SCE, PM, bilateral hyperinflation, and absence of radio-opaque FB (Fig. ). The laboratory tests showed the following values: white blood cell count 17,000 cells/μl, hemoglobin 11.5 mg/dl, platelet count 220,000/μl, C-reactive protein 38 mg/L, urea 15 mg/dl, creatinine 0.8 mg/dl, and prothrombin time 100%. The boy was initially treated as having an acute asthma exacerbation complicated by PM and was administered oxygen, intravenous steroids (hydrocortisone 5 mg/kg/6 h), nebulized salbutamol, and amoxicillin-clavulanic acid (100 mg/kg/day). The evolution was made worse by respiratory distress (increase of respiratory rate at 54/min, decrease of oxygen saturation at 78% in room air) and extension of swelling that progressed from the neck to the face and shoulders. Owing to insufficient clinical and radiographic improvement under the appropriate treatment, the possibility of a differential diagnosis, especially that of FB aspiration, was considered. Thus, a rigid bronchoscopy (size 5.0) was performed under general anesthesia on the second day, which showed the FB (pumpkin seed) located at the entry of the right main bronchus (Fig. ). After removal of the FB, a complete resolution of clinical signs was observed. The child was discharged to home the next day and was placed on outpatient treatment. Radiographic control after 10 days showed complete recovery. The evolution was normal after 2 years of follow-up with two asthma attacks treated on an outpatient basis with nebulized salbutamol. |
pmc-6535340-1 | A 7-year-old girl presented to our emergency department after horse riding accident. Although the event was unwitnessed, most likely the patient fell off the horse and was stepped onto the chest by one of the hind hoofs. At arrival in the trauma bay, she was placed on a stretcher in prone position, chest propped up on the arms, displaying signs of severe dyspnea with tachypnea, increased work of breathing, and both inspiratory and expiratory stridor. Her oxygen saturation (SaO
2
) was stable around 90% after application of supplemental oxygen. The patient was fully aware and conscious (Glasgow Coma Scale 15), but agitated. On physical examination, there were bruises on the throat and right upper chest with massive subcutaneous emphysema of the upper chest, neck, and face. The patient was given sedatives, leading to desaturation. Still, there was no obvious difference in breath sounds on both sides, so bilateral needle thoracostomy was performed, and the patient was endotracheally intubated (
). After intubation and positive-pressure ventilation, oxygen saturation and blood pressure dropped. At this time, right tension pneumothorax was diagnosed, and two 17-mm thoracostomy tubes were placed.
A massive air leak was appreciated from the chest tubes (
). The SaO
2
improved to 84%. Computed tomography (CT) scan showed a complete avulsion of the right main stem bronchus at the level of the carina, a residual pneumothorax with mediastinal shifting, atelectasis of the right lung, as well as emphysema of the mediastinum and soft tissue (
). The only skeletal thoracic injury was a fracture of the contralateral left first rib. The blood gas showed acidosis (pH 7.16), and hypercapnia (partial pressure of carbon dioxide 63 mm Hg).
The patient was taken to the operating room immediately. With positive-pressure ventilation, oxygen saturation dropped continuously in spite of two working thoracostomy tubes and manual high frequency, low tidal ventilation. Single lung ventilation of the contralateral lung was our primary approach for ventilation during thoracotomy. An attempt of bronchoscopy-guided selective left main stem intubation failed because of impaired visualization due to blood in the airway. During bronchoscopy, the patient desaturated (SaO
2
<10% for 5 minutes, heart rate dropped to 60/min).
The patient was placed in left lateral decubitus position and immediate, salvage posterolateral thoracotomy was performed. The defect was identified at the level of the carina, leaving no proximal bronchial stump to place a clamp. Temporary occlusion of the defect with the surgeons' finger allowed some ventilation of the left lung to gradually improve the oxygen saturation. Placing the finger on the defect, however, partially occluded the left main bronchus at the same time, prohibiting selective intubation and sufficient ventilation of the left lung. We decided to place a 3-0 polypropylene suture for retraction at the caudal rim of the tracheal defect, which allowed simultaneous occlusion of the defect and patency of the left main stem bronchus. Hence, intubation under visual and tactile guidance with a preloaded 5.0 tube, using bronchoscope as “guidewire,” was possible (
). After cardiorespiratory stabilization, the reconstruction of the bronchus was performed. The anastomosis was completed with a posterior running 3-0 polypropylene. The anterior wall was closed with interrupted sutures knotted outside the lumen. There was no tension on the anastomosis and no air leak at under-water testing. A single chest tubes was left in place postoperatively.
After surgery, pressure-controlled ventilation was continued on the intensive care unit. Broad-spectrum antibiotics were administered. Body temperature was lowered to 35°C over a period of 48 hours for neuroprotection. On the second postoperative day, bronchoscopy was performed showing an intact anastomosis, so that the breathing tube was retracted into the trachea 2 cm above the level of the carina. The patient was extubated on postoperative day 7 and discharged from the hospital on postoperative day 24 after weaning of sedatives and antimicrobial treatment of colonization of the trachea with
Enterobacter cloacae
according to our microbiologists' protocol. On physical examination, an alar scapula persisted. Neurologic exam was unremarkable. |
pmc-6535422-1 | A 45-year-old female presented with complaints of blurring of vision in the left eye for the last 20 days with a history of very severe itching on the abdomen and back. She was a known case of hypertension on treatment for the last 2 years. She had been diagnosed to have T. corporis infection by a dermatologist in the past, however, was non-compliant with the treatment. There was no history of intake of steroids in any form. Best corrected visual acuity (BCVA) was 6/6, N6 in the right eye and 6/9, N8 in the left eye. Applanation tonometry recorded intraocular pressures of 19 mmHg and 18 mmHg respectively. Anterior segment was within normal limits. Fundus examination of the right eye was normal and the left eye examination showed a diffuse yellowish retinochoroiditis patch with irregular margins at the inferotemporal arcade [Fig. a]. Fundus autofluorescence (FAF) of the left eye also showed an ill-defined area of hyperautofluorescence along the inferotemporal arcade. [Fig. b]. OCT of the left eye through the macula showed shallow subretinal fluid with hyperreflective dots and passing through the retinochoroitidis patch showed increased retinal thickening with a pigment epithelial detachment and subretinal fluid. [Fig. a, b]. Left eye fundus fluorescein angiography showed three hyperfluorescent areas along the inferotemporal arcade increasing in size and intensity with blurring of margins in the late phases [Fig. ].
On general examination, she had extensive reddish color erythematous plaque-like skin lesions over the abdomen and back (Fig. a, b). Hematological investigations showed hemoglobin 11 g/dl, total leucocyte count 9600 cells/cu mm, differential leucocyte count showed increased eosinophils to 12, absolute eosinophil count was raised to 1150 cells/cu mm, ESR was raised to 50 mm first hour, kidney and thyroid function tests were normal, urine examination showed increased pus cells and epithelial cells, the Mantoux test for tuberculosis was negative, and Treponema pallidum hemagglutination assay (TPHA) was negative for syphilis. She was sent for a dermatologist’s opinion who diagnosed her with T. corporis infection and started her on oral itraconazole 200 mg twice a day for 2 weeks followed by once a day for 1 month and Elovera lotion for local application on skin lesions.
On follow-up at 2 weeks, she was symptomatically better, and retinochoroidal lesion had started healing and skin lesions improved drastically [Fig. a, b]. A similar outcome was noted at third and eighth week of follow-ups. At 12th week, healed patches of choroidal lesions were seen and she improved to 6/6, N6 in the left eye [Fig. a]. FAF of the left eye did not show any active lesions [Fig. b]. OCT scan of the left eye through the macula showed resolved subretinal fluid and through the retinochoroiditis lesion showed decreased retinal thickening with resolved PED and subretinal fluid [Fig. a, b]. |
pmc-6535643-1 | We report a case of a 56-year-old male medically free with a history of long travel two days prior to his presentation to another hospital complaining of: left leg swelling, pain & shortness of breath of 2 days duration where he was diagnosed as a case of extensive deep left femoral vein thrombosis & pulmonary embolism. He was kept on systemic thrombolytic therapy & heparin. Two days later, the patient condition started to deteriorate so he was referred to our facility for further management. When he presented to our facility he was in respiratory & pain distress, but hemodynamically stable. Left Lower limb examination showed (): cyanosis, severe edema, blistering of skin extending up to the scrotum. Also there was severe tenderness all over the limb with exacerbation of pain on passive stretching of anterior compartment & left foot drop. CT angiogram of chest & CT venogram lower limbs showed: Extensive thrombosis of the left popliteal vein extending to the left common iliac vein till beginning of the inferior vena cava & pulmonary embolism. The patient was diagnosed as a case of 'Phlegmasia Cerulea Dolens’ of left leg, compartment syndrome with pulmonary embolism (PE).
So, fasciotomy was done then he was shifted to the angio suite for pharmaco-mechanical thrombolysis. Under ultrasound guidance & putting the patient in a prone position, the occluding thrombus was accessed distally from popliteal vein & a retrograde venogram was done, which showed a thrombus that almost completely occluding the popliteal vein () extending all the way up to ilio-femoral veins with no contrast passing through to the inferior vena cava (I.V.C). Subsequently a hydrophilic guide wire was passed through the thrombus into the I.V.C. followed by infusion catheter delivering the tPA & heparin infusion to the sheath was established. Then the patient was shifted to the ICU for monitoring. After 18 h, the patient was brought back to the angio suite & a venogram was done which showed lysis of most of the thrombus burden (). The remaining thrombus was cleared with mechanical thrombectomy catheter. However, there was narrow segment in the left common iliac vein at the confluence (). Intravascular ultrasound (IVUS) revealed a compression of the vein by the crossing of left common iliac artery making the diagnosis of May-Turner syndrome. Then the vein was stented with a size 16mm, length 21mm self-expandable wall stent with no residual stenosis left ). Subsequent session of debridement of necrotic tissue of the affected compartment post fasciotomy was done and a negative-pressure wound therapy was adopted to improve the wound healing.
Then the wound was closed by delayed primary closure. The patient condition continued to improve, the arterial system became intact (clinically & radiologically), and he was discharged with anticoagulant (NOAC) and follow-up with physiotherapy to manage his partial foot drop, which was resolved completely later on. A coagulation profile has been done for our patient which turned to be negative. Hence, the cause of our patient condition is most likely 2ry to the prolonged travailing with the coexisting May---Turner syndrome. |
pmc-6535815-1 | The patient, a 65-year-old male, was admitted to ICU after thoracic surgery, with a mitral valve replacement and a CABG (coronary artery bypass graft), in 2017. The patient, who had a kidney transplant in 2010, developed postoperative kidney failure and continuous renal replacement therapy (CRRT) dialysis was commenced. Furthermore, the patient developed atrial fibrillation, pulmonary oedema, and subsequently respiratory distress. Thus, the patient was orally intubated, as intermittent CPAP (Continuous Positive Airway Pressure) or periods with NIV (noninvasive ventilation) were insufficient to maintain sufficient respiratory support. Attempts to extubate were unsuccessful, and, on the sixth postoperative day, it was decided to perform a surgical tracheostomy, which was made with a tracheostomy tube size 8 inserted. Over the next days, patient's respiratory status was improving, and the patient was at times able to maintain saturation (SaO2) at 95-98% on 3-5L/min 100% oxygen on a speaking valve up till 7 hours per day. During this, the patient was developing delirium and was fingering his tracheostomy tube, even with increasing effort to attenuate his symptoms.
Before the incident, there had been two reinsertions of the tracheostomy tube that had both proven problematic but possible, as such if the problem was persisting, the patient could be intubated orally (previous Cormack Lehane grade (CL) 1), which was the information given at handover at the beginning of the night shift.
When called to assist the patient at approximately 11 pm, there had been one failed attempt to reinsert the tube by the nurse. The patient was wheezing but managing on speaking valve with a SaO2 above 96%. First attempt to reinsert the tube was unsuccessful. Following this, was the use of a suction catheter as a guide attempted, after removal of the speaking valve with a flow of 5L oxygen, but unsuccessful, however.
The patient expresses increased difficulty, breathing became more restless, and the patient attempted to grab the tube. Therefore, the speaking valve with oxygen flow was reconnected, as a flow of 5L had been sufficient to maintain SaO2 prior to the attempted replacement of the tube.
From this point, subcutaneous emphysema started to develop almost immediately, and the speaking valve was disconnected right away. As soon as a ventilation bag/mask was ready, the tracheostomy tube was removed, and a nurse covered the tracheostomy while the patient was preoxygenated, and preparations for a rapid sequence induction for oral intubation of the patient were made, having the difficult airway trolley and video laryngoscope (a Storz C-MAC video laryngoscope) readily accessible by the bed.
As soon as equipment and drugs were at ready at hand, the rapid sequence induction was made, and the patient was attempted intubated with a size 8 tube with a guide using a Mac 3 blade on a standard laryngoscope (CL 2). Nevertheless, the tube met resistance and could not be inserted. The second attempt was made, using video laryngoscope, vocal cords fully visible, size 8 tube inserted but could not be advanced into the trachea. Call for help from another anaesthetist was made and a third attempt was made using a size 7 tube, same problem. Saturation dropped below 80, and the patient was bag/mask ventilated. When help arrived, the patient's saturation had been elevated to 94-96 percent as ventilation was still possible, although subcutaneous emphysema was progressing. Meanwhile, a nurse had been asked to retrieve and ready a flexible bronchoscope.
The second anaesthetist toke over and attempted intubation with a size 6 tube. Vocal cords were fully visible, but the progression of emphysema had limited the view since the first attempt was made. The tube was inserted to 24 cm mark using some force, the cuff was inflated, and ventilation was attempted. There was no sound when auscultation was made, no CO2 returned, and saturations started to fall. Hereafter, bag-mask ventilation was no longer possible and a cannot intubate, cannot oxygenate (CICO) situation was present, and saturation plunged further. Size 6 tube was reinserted, past vocal cords that were just visible due to the still increasing intratracheal emphysema. It was not possible to ventilate the patient. Meanwhile, equipment for cricothyrotomy (a tracheal hook and scalpel for rapid four-step technique) had been requested. Palpation was at this point extremely difficult due to the massive subcutaneous emphysema, and digital exploration of the surgical tracheostomy was performed. The tracheal cartilage cranial from incision was palpable, and the endotracheal tube was found exciting the trachea into a via falsa anterior to the trachea as shown in . Subsequently, the tube was pulled back at digitally guided into the trachea, where the cuff was inflated, and tube could be held in place supporting the inflated cuff with a finger. Ventilation was now possible, and saturation started to rise and reached 95% shortly after that.
Following that the thoracic surgeon called (no in-house ENT surgeon was available) to reestablish a surgical airway.
Meanwhile, the patient became increasingly cardiac rhythm unstable and had a relapse of arterial fibrillation with a frequency of 105 to 200 beats per minute, while holding a mean atrial pressure (MAP) above 65 mmHg with a variable need for inotropic support. Cardiac instability was likely due to subcutaneous emphysema in the mediastinum. FATE (Focus Assessed Transthoracic Echocardiography) was inconclusive as the massive subcutaneous emphysema made it impossible to visualise the heart, as seen on the X-ray .
Patient stabilised with increasing MAP and fewer episodes with tachycardia. Therefore, Transesophageal Echocardiography (TEE) was refrained from initially. |
pmc-6535821-1 | A 69-year-old Caucasian male presented to the hospital with new onset dyspnea on exertion on walking 50 feet for past 3 weeks. Past medical history included hypertension, hyperlipidemia, atrial fibrillation of 2-month duration, and complete atrioventricular block status after permanent pacemaker placement a year preceding to current presentation. His home medications included lisinopril, metoprolol, apixiban, and atorvastatin. His laboratory work-up on presentation was unremarkable except mild elevation of uric acid at 8.5 mg/dl. HIV status was checked and was negative. Transthoracic echocardiography revealed pericardial effusion with evidence of pericardial tamponade and right ventricular wall hypertrophy. Pericardial window was performed, and pericardial fluid cytology was negative for any malignant cells. The patient was eventually discharged and referred to a heart failure specialist due to concerns for cardiac amyloidosis based on the right ventricular hypertrophy and conduction disease. A cardiac MRI was performed and showed a large mass, involving right ventricular (RV) lateral wall with a maximum thickness of 3 cm. Mass was hyperintense to myocardium on T2 and isointense on T1 (). Left ventricular ejection fraction (EF) calculated using cardiac MRI was 41–43%. Cardiac biopsy of the RV mass was performed using an endovascular approach via the right internal jugular vein in the cardiac catheterization lab, assisted by intracardiac echocardiography. Additional work-up at that time included a coronary angiogram that showed absence of obstructive coronary disease. Immunohistochemistry (IHC) markers on the mass were positive for CD45, CD20, PAX-5, BCL2, BCL6, and MUM-1 and negative for CD5, CD10, and cyclin D1 (). Ki-67 on the mass was 50–60%; EBER was negative along with FISH for MYC, BCL2, and BCL6. Findings from IHC were consistent with diffuse large B-cell lymphoma, nongerminal center subtype. Bone marrow biopsy performed as staging work-up was negative for any lymphoma involvement. The PET scan showed increased FDG (F-18 fluorodeoxyglucose) uptake in right atrium, right ventricle, and left ventricle with no abnormal uptake outside of the heart (). The patient after getting a transthoracic echocardiography which confirmed EF at 45% was started on dose-adjusted R-EPOCH with 20% dose reduction in doxorubicin dose for the first cycle. In addition, he was noted to be chronically RV paced (99%) on pacemaker interrogation. It was decided that he may have had cardiomyopathy due to the RV pacing, and thus, he was upgraded to a biventricular pacemaker. After tolerating the first cycle, the patient was given full-dose doxorubicin starting the 2nd cycle. The interim PET scan after 2 cycles of R-EPOCH showed complete response (CR). The patient subsequently received 4 more cycles of R-EPOCH and continues to be in CR (confirmed by PET scan) 18 months after treatment. The patient also received dexrazoxane with 2nd, 3rd, and 4th cycles of chemotherapy to reduce cardiotoxicity of doxorubicin, given his existing cardiomyopathy. After chemotherapy, the patient's left ventricular EF is stable at 47% along with improvement in his atrial fibrillation. He remains on surveillance with 6 monthly echocardiography with a plan of getting cardiac MRI at 2 years after treatment completion. |
pmc-6535822-1 | A 43-year-old female presented to the emergency department with a history of a liquid chemical exposure to the right eye with a household liquid cleaner containing 6% sodium hypochlorite. Examination demonstrated a central 5 mm corneal epithelial defect and diffuse conjunctival injection. The corneal stroma was edematous. The eye was treated with topical atropine 1% BID, prednisolone acetate 1% QID, tobramycin-dexamethasone ointment QHS, ofloxacin QID, doxycycline 100 mg by mouth BID, vitamin C 1 tab by mouth daily, and preservative-free artificial tears QID. The patient was seen two days later and a 3 mm central stromal infiltrate was noted. Fortified vancomycin 50 mg/ml and tobramycin 15 mg/ml were added topically every hour while awake. The patient was referred to our clinic two days later and found to have a 3 mm anterior stromal infiltrate with fluffy borders with an overlying 5 mm epithelial defect consistent with infectious keratitis. A one millimeter hypopyon was present (). The cornea was cultured for bacteria and fungus. All steroid containing medications were stopped. Cultures were negative. The cornea remained unchanged over the next week. The patient was taken to surgery for a corneal biopsy, repeat corneal cultures, cryotherapy, and a conjunctival flap. These cultures grew Candida dubliniensis and Candida albicans. Sensitivities to antifungal agents were obtained ().
The eye was treated with hourly topical natamycin 5% and the infection resolved over the next three weeks (). She is awaiting a corneal transplant due to resultant corneal opacity. |
pmc-6535824-1 | A 68-year-old male with a history of treatment-refractory depression, general anxiety disorder, type 2 diabetes mellitus, and benign prostatic hyperplasia presented to our outpatient psychiatric clinic with worsening symptoms of depression including social withdrawal, problems with self-care and inattentiveness. Initially diagnosed with major depressive disorder and general anxiety disorder in 2001, his symptoms initially included depressive mood, anhedonia, psychomotor retardation, hopelessness, and suicidal ideation and were previously well managed with bupropion (150 mg/day) and lorazepam (0.5 mg/day). However, his treatment was ultimately modified to duloxetine (30 mg/day) and agomelatine (25 mg/day) given the signs and symptoms of worsening depression noted on presentation.
Following 1 month of treatment with the modified regimen, the patient represented with complaints of unsteady gait, dizziness, nausea, general malaise, poor appetite, constipation, and insomnia. He was subsequently admitted to the hospital for a further workup. Upon interview and examination, he scored 35 on the Hamilton Depression Rating Scale; 91 on the Cognitive Abilities Screening Instrument, Chinese Version, and 35 on the Beck Anxiety Inventory, suggesting severe depression and anxiety without cognitive impairment. Admission laboratory findings were notable for a sodium level of 130 mmol/L (reference range: 135-147 mmol/L) and chloride level of 94 mmol/L (reference range: 98-107 mmol/L) as well as normal renal function: glomerular filtration rate 105 mL/min/1.73 m2 (reference range: >90 mL/min/1.73 m2); creatinine: 65.416μmol/L (reference range for male: 50-110μmol/L); blood urine nitrogen: 6 mmol/L (reference range: 2.9-7.1 mmol/L), thyroid function: thyroid-stimulating hormone: 2.21 mIU/L (reference range: 0.34-5.60 mIU/L); free thyroxine: 12.87 pmol/L (reference range: 6.94-18.01 pmol/L), and adrenal function: basal serum cortisol level: 563.66 nmol/L (reference range: 170-635 nmol/L). Over the course of the patient's hospitalization, his serum sodium level further decreased to 127 mmol/L and his baseline sodium level prior to the initiation of his latest medication regimen was noted to be 137 mmol/L. A hyponatremia workup was subsequently initiated. He was noted to have an effective serum osmolality of 260 mmol/kg (reference range: 285–300 mmol/kg), urine sodium level of 42 mmol/L (reference: variable), and urine osmolality of 557 mmol/kg (reference range: 300–900 mmol/kg). The patient's symptoms were ultimately attributed to duloxetine-induced hyponatremia associated with SIADH. As a consequence, the duloxetine was discontinued and he was initiated on a high-salt diet, leading to resolution of his hyponatremia (serum sodium: 135 mmol/L) and symptoms including unsteady gait, dizziness, nausea, general malaise, and poor appetite within 8 days (). Due to his history and persistent symptoms of depression, he was started on escitalopram titrated from 5 mg/day to 15 mg/day. Ultimately, he was cross-titrated from the selective serotonin reuptake inhibitor (SSRI) escitalopram to the noradrenergic and specific serotonergic antidepressant mirtazapine given concern for the potential development of hyponatremia again while on a SSRI. After 6 weeks of hospitalization, the patient had less psychomotor retardation, dysphoria, and somatic complaints. With improvement in his depression and resolution of his hyponatremia, he was discharged. |
pmc-6535833-1 | A 37-year-old Hispanic male with a history of B-cell acute lymphocytic leukemia (ALL) presented to the emergency department with left sided flank pain and hematuria. He was previously treated with multiple lines of therapy including several chemotherapy regimens with relapsed/refractory disease. He underwent CAR-T cell therapy in April 2017 and achieved complete remission. He went on to have a mismatched allogeneic hematopoietic stem cell transplant in August 2017 which was complicated by E. coli bacteremia and BK cystitis induced hematuria. Soon after, he presented to clinic with acute renal failure and had a ureteral stent placed for left hydronephrosis. Imaging at that time showed symmetric enlargement and decreased density of the kidneys. Serum BK/adenovirus studies were negative. Urine cytology showed benign urothelial cells. Repeat bone marrow biopsy at that time showed 80% cellularity with 80% lymphoblasts. The patient was started on Inotuzumab in March 2018. Repeat bone marrow biopsy following cycle 1 showed no evidence of residual B-cell ALL.
The patient then presented to the emergency department in May 2018 with left sided flank pain and hematuria. Laboratory analysis demonstrated creatinine of 3.9 mg/dL compared to a baseline of 0.6-0.9 mg/dL just 2 weeks earlier. Urinalysis showed negative nitrites, negative leukocyte esterase, >500 protein, 6-10 WBC, 3-5 RBC, and few granular and hyaline casts. Imaging at that time was unchanged from prior imaging, showing symmetric kidney enlargement (). Negative work-up included BK viral load, ANCA, anti-GBM antibody, and complement levels. Urine eosinophils were positive. Repeat bone marrow biopsy showed diffuse involvement of B-cell ALL, consistent with relapse. Blood chemistries and uric acid were not consistent with tumor lysis syndrome. Fine needle aspiration of the kidney was performed and demonstrated diffuse invasion of the renal parenchyma by lymphoblasts with positive CD20, CD79, and TdT stains consistent with renal invasion by ALL (). The patient had significant oliguria during the first week of hospitalization, with a low daily output of 600mL on day 4. The patient was started on cycle 2 of Inotuzumab as well as Solumedrol 125mg daily for two days, then Prednisone 80mg daily for 5 days followed by a prolonged taper. The patient had significant improvement in hematuria, oliguria, and flank pain following initiation of treatment. His creatinine trended down to 1.5 mg/dL prior to discharge. The patient never required hemodialysis. Unfortunately, several weeks after discharge, the patient presented to the hospital with sepsis secondary to pneumonia and ultimately passed away. |
pmc-6535836-1 | A 10-year-old Ethiopian boy presented to Tikur Anbessa Specialized Hospital, Addis Ababa, Ethiopia, with a sudden onset of weakness over his lower extremities. It had started 10 days earlier, accompanied by incontinence of urine and feces. He also had long-standing epigastric pain. He had no fever, diarrhea, cough, unconsciousness, abnormal body movements, or trauma. He had no close contact with a chronic cougher. He had received all scheduled vaccines during infancy, including four doses of oral polio vaccine, except hepatitis B vaccine, because he was born 1 year earlier than the incorporation of a routine three-dose series of hepatitis B vaccines into the national vaccination schedule. (He presented to our center in 2016.) Upon examination, he had an axillary temperature of 38.0 °C and tachycardia (115 beats per minute). He had a hard and tender hepatomegaly of 16-cm total span (10 cm below the right costal margin). Neurologic examination revealed a sensory level at T10, power of 0/5 of bilateral lower extremities, areflexia, and hypotonic anal tone.
Investigations confirmed a normal complete blood count and erythrocyte sedimentation rate of 25 mm/hr. The patient’s liver enzymes were elevated: alanine aminotransferase 160 U/L and aspartate aminotransferase 136 U/L. Alkaline phosphatase was 761 U/L, and serum albumin was 3.4 mg/dl. His coagulation profile, renal function, serum electrolytes, blood and urine cultures, and human immunodeficiency virus and hepatitis C serologies were negative. His hepatitis B surface antigen was positive. Additional serologic testing to identify the state of his hepatitis B infection was not accessible.
Thoracolumbar magnetic resonance imaging outlined a T9 vertebral body collapse with marrow signal change showing T1 isointensity and T2 heterogeneous hyperintensity. An epidural and paravertebral soft tissue swelling extending from T7 to T11 with postcontrast enhancement was seen to significantly compress the spinal cord. Differential diagnoses of tuberculosis spondylitis and metastases were considered.
Workup for a primary malignancy showed elevated serum lactate dehydrogenase (599 U/L) but normal serum uric acid, chest x-ray, and abdominal ultrasound. Computed tomography of the abdomen (Fig. a–d) revealed multiple well-defined, different-sized, solid hepatic masses with invasion and thrombosis of the right portal vein branch. The liver had a heterogeneous attenuation. The thoracic vertebral body had collapsed with an adjacent soft tissue mass extending into the spinal canal and prevertebral space.
Serum α-fetoprotein (AFP) was greater than 40,000 IU/L, and an ultrasound-guided fine needle aspirate showed moderately pleomorphic polygonal cells with round nuclei and ample granular eosinophilic cytoplasm. Thus, a diagnosis of HCC with vertebral metastases was confirmed. The boy’s parents were counseled on the prognosis of the illness, following which they decided against further medical care and opted for home palliative care. |
pmc-6535841-1 | The parents brought a 28-day-old male child to the Dermatology outpatient department of Manipal Teaching Hospital, Pokhara, Nepal with the complaints of yellowish discoloration of the nail with slight swelling of the upper part of the middle finger of the left hand for one week. Mother reported that the baby had been suckling this finger since birth. The baby was well two weeks back when he developed slight yellowish discoloration of the middle finger of the left hand. The stain spread proximally with increasing thickness of the nail. There was no family history of fungal infections, psoriasis, lichen planus, Darrier’s disease, or yellow nail syndrome. There were no other risk factors suggestive of HIV infection in the parents. The baby was delivered at 39 weeks of gestational age via normal vaginal delivery and weighed 3250 g. There was no history of perinatal hypoxia. His developmental milestones were appropriate for his age.
On examination, the physical activities of baby were as per his age. There was noticeable yellowish discoloration of the nail of the middle finger of the left hand distally with yellowish subungal hyperkeratotic debris. Pitting or whitish deposits on the nail were not evident. Examination of the skin revealed no lesions suggestive of fungal infections, psoriasis, lichen planus or Darrier’s disease. Scalp hairs were healthy. Oral and genital surfaces were normal without any lesions suggestive of mucosal candidiasis. Systemic examination was within normal limits. It was provisionally diagnosed as onychomycosis. The nail was trimmed, and parents were counselled to come for follow-up every month, keeping in view that the condition may be self-limiting. However, at two months follow up, increased discoloration and thickness of the nail without the involvement of glabrous skin was observed. Nail specimens (nail clippings) and oral swabs were sent for laboratory diagnosis.
Before collecting the sample, the nail and distal meta-phalangeal areas were thoroughly cleaned with alcohol to remove skin contaminants. The discolored portion of the nail was clipped; the nail bed and underside of the nail plate were scraped with the help of a sterile serrated curette after discarding the outermost debris. Avoiding injury to the nail plate and bleeding, as much of nail material as possible from the advancing infected edge closest to the cuticle, and the site close to the lateral nail edges was collected.
The material thus obtained was divided into four aliquots; one for direct microscopy using a 30% potassium hydroxide wet mount, second for fluorescent microscopy using calcofluor white, the third part was subjected to histopathological examination and, the fourth portion was cultured onto a set of two Sabouraud Dextrose Agar (SDA) with chloramphenicol. Swabs were also obtained from the oral cavity of the baby and were subjected to direct microscopy and culture.
The direct smear examinations and the histopathological examination revealed yeast cells with pseudohyphae (Fig. ). C. albicans was isolated from the nail specimen and the oral swab. The isolates were identified by conventional methods and confirmed by MALDI-TOF mass spectrometry (matrix-assisted laser desorption ionization-time of flight mass spectrometry). Antifungal sensitivity testing of the isolates from the nail and oral cavity was performed by microbroth dilution method (Clinical & Laboratory Standards Institute guidelines). Both isolates had similar minimum inhibitory concentration (MIC) values (μg/mL): fluconazole (2), voriconazole (0.1), caspofungin(0.06), amphotericin B (1), and anidulafungin (0.03).
The lesion was graded to be of severity index 22 on the onychomycosis severity index scale []. It is considered as severe infection [area of involvement: 3, the proximity of disease to the matrix: 4, the presence of dermatophytoma (patch/streaks) or subungual hyperkeratosis (> 2 mm): 10]. Blood investigations such as complete blood count, liver function test, renal function test, random blood sugar and routine urinalysis were within normal limits. The child was treated with fluconazole syrup 6 mg/kg/week and 5% amorolfine nail lacquer once/week. After three months of therapy, the patient completely recovered with the development of a healthy nail plate. |
pmc-6535853-1 | A 39-year-old man was involved in a high-velocity motor vehicle accident. He sustained an open fracture of the right elbow, with significant loss of the external humeral condyle and partial loss of the olecranon. This fracture was classified as a Gustillo type IIIA injury. There was no neurovascular compromise. The patient was treated in a community center, close to the accident, where he received surgical care (debridement and partial excision of the olecranon). The wound was fully closed. The upper arm was then immobilized in a splint (). IV antibiotics (cefazolin-gentamicin) were started for 5 days.
The day following his elbow surgery, the patient fell in a staircase and sustained a C7-C8 and C8-T1 fracture-dislocation. This injury caused neurologic damage (quadriparesis), and his right arm became his only functional limb. Following this injury, the patient was moved to our tertiary center to get spinal fusion. During the spinal surgery, the elbow was tested under fluoroscopy. The patient's elbow showed varus instability and a positive pivot shift test. A CT scan of the elbow was obtained the following day and showed bony loss from the external humeral condyle and subluxation of the radial head ().
We decided to treat the patient's elbow surgically. The surgery underwent nine days after the initial trauma (after transfer from the community center, spine procedure and elbow imaging). A posterior approach to the elbow was used along with an extensive elbow debridement. A tricortical iliac crest graft was then collected from the patient's right side to replace the humeral condyle bone loss. A tendinous graft was collected from his third and fourth extensor digitorum longus tendons to reconstruct the lateral collateral ligament. The tendinous graft was fixed to the bone graft through two tunnels (anterior to posterior and lateral to medial). The iliac crest graft was then fixed to the humerus with a cancellous screw. A five-hole one-third tubular plate was used as buttress. The graft was left prominent on the lateral side to improve lateral stability of the elbow. The lateral collateral ligament was then reconstructed by fixing the tendinous graft to the proximal ulna with two bundles. We took care to preserve our reconstructed lateral collateral ligament's isometry during flexion and extension movements. Reduction and stability of the elbow joint were verified under fluoroscopy. The wound was closed with staples, and a posterior splint was applied for three weeks. 14 days postoperative X-rays are presented on . At three weeks following the surgery, passive and active ranges of motion were initiated.
While wearing the splint, the patient developed a pressure wound on the lateral side of his elbow (at the site of the reconstruction). This wound later complicated into a Nocardia septic arthritis, which required surgical debridement. Four months after the reconstruction, range of motion was 30-120 degrees with full pronation and supination, without any evidence of instability.
Two months later, instrumentation was removed and a rotational flap was done to increase soft tissue coverage of the articulation. Five months after that procedure, the patient developed a Nocardia osteomyelitis of the humerus and was treated with 6 weeks of IV antibiotics (penicillin) and a surgical debridement. The patient responded well to our treatment. Eleven months after the initial intervention, range of motion of the joint ranged from 30 to 120 degrees of flexion, without clinical instability. Osteosynthesis was achieved according to X-rays of the elbow (). |
pmc-6535862-1 | A 19-year-old female patient had undergone surgical fat grafting to the forehead with postsurgical sequela of a necrotic hairless lesion, approximately 130 cm2 in area, with a triangular shape, that had remained for longer than a year in the right frontotemporal region of her scalp (). In total, 4,550 FUs were harvested from the occipital scalp by the strip excision method and transplanted at a density of approximately 35 FUs/cm2. The patient underwent a single surgical session that lasted 5.5 hours. At the twelve-month follow-up, the graft survival rate was 75%. The preoperative POSAS was 20 for the patient scale and 18 for the observer scale; the postoperative scores were 8 and 7 for the patient and observer scales, respectively. |
pmc-6535862-2 | A 42-year-old female patient had a forehead lift using Endotine fixation (Endotine™ forehead bioabsorbable implant, MicroAire Aesthetics, Charlottesville, VA, USA) two years previously, which led to skin necrosis on her left frontotemporal scalp (). The affected area was round and 2 x 3 cm2 in area, and 210 FUs harvested from the occipital scalp by the FUE method were transplanted into the lesion at a density of 35 FUs/cm2. The operation lasted 1.3 hours, and only a single session was required. The graft survival at the 12-month follow-up was 80%. The preoperative POSAS of the patient scale was 12 and that of the observer scale was 9; the postoperative POSAS was of the patient scale was 5 and that of the observer scale was 3. |
pmc-6535862-3 | A 33-year-old female had an approximately 7 x 1 cm2 lesion consisting of a postsurgical linear scar on her frontal scalp due to forehead implant insertion three years earlier (). In total, 245 FUs were harvested from the occipital scalp using the FUE method and transplanted into the lesion. The operation time was 1.5 hours, and the transplantation was performed at a density of 35 FUs/cm2. She underwent only one procedural session and achieved an 85% survival rate at the 12-month follow-up. The preoperative POSAS scores were 14 for the patient scale and 13 for the observer scale; the postoperative POSAS scores were 6 for the patient scale and 4 for the observer scale. |
pmc-6535862-4 | A 28-year-old male patient with a wide forehead had undergone a forehead reduction surgery one year previously, which resulted in a postsurgical linear hairless scar approximately 20 x 1 cm2 in area near his hairline (). A total of 700 FUs were harvested from the occipital scalp by the FUE method and transplanted into the lesion at a density of 35 FUs/cm2. The operation lasted 2.5 hours, and a single session was required. At his 12-month follow-up visit, the graft survival rate was approximately 80%, and the POSAS had decreased from 10 on the patient scale and 8 on the observer scale preoperatively to 6 and 4, respectively, at the postoperative evaluation. Instead of performing forehead reduction surgery, which results in an incision line scar as a secondary complication, hair transplantation can be used as a primary treatment for camouflaging a wide forehead. |
pmc-6535864-1 | A 92-year-old man was admitted to hospital with a general decline in functional status. A comprehensive geriatric assessment revealed low mood without evidence of cognitive impairment, and a diagnosis of depression was made. The patient was prescribed mirtazapine 7.5 mg nocte per oral, and the following day, he became increasingly unstable. Two days later, the patient was found unresponsive in bed.
There was no history of head trauma, and no seizure activity was observed. Vital signs were unremarkable, while respiratory, cardiovascular, and abdominal examinations were normal. However, neurological examination revealed diminished mental status. The patient did respond to a deep, painful stimulus but his eyes remained closed, and there was no verbal response. The patient had brisk deep tendon reflexes and showed plantar reflexes of the extensor. Blood tests (including those for urea, electrolytes, glucose, calcium, magnesium, Vitamin B12 and folate levels, C-reactive protein, thyroid function, and full blood count) were normal. An electrocardiogram displayed normal sinus rhythm, and an emergency magnetic resonance brain scan demonstrated no evidence of acute intracranial pathology.
The patient's level of consciousness gradually returned to normal after 4 hours. The antidepressant-induced sedation was suspected of being the cause, and mirtazapine was immediately stopped. There was no subjective improvement in mood after withdrawal of mirtazapine. Three days later, the patient was re-prescribed on mirtazapine 3.75 mg nocte. Though he appeared expressionless, he gradually became more responsive after a week. Following the reduction of mirtazapine dose, the patient did not experience any more episodes of extreme sedation during a 2-month follow-up. |
pmc-6535867-1 | An 82-year-old man was referred to our hospital for the evaluation of bloody stools. He had a medical history of hypertension. A colonoscopy revealed a semicircumferential rectal adenocarcinoma at 20 cm from the anal verge, and computed tomography revealed no evidence of lymph node metastasis or distant metastasis. He underwent a laparoscopic anterior resection. His pathological diagnosis was stage T3N0M0. For anastomosis, DST was performed using a 60 mm linear stapler and a 31 mm circular stapler. He required a blood transfusion for postoperative melena and was discharged 20 days postoperatively.
The patient experienced frequent diarrhea 1 month after surgery, and a sensation of fullness in the abdomen appeared 2 months after surgery. He was hospitalized with a large intestinal obstruction 4 months after surgery. The colonoscopy revealed severe stenosis at 15 cm from the anal verge (). A staple was confirmed there, and he was diagnosed with anastomotic stenosis. Endoscopic balloon dilation was performed several times (), allowing the passage of loose stool. Mucosal injury occurred during the last dilation (), making further balloon dilation difficult. He was discharged with drug treatment.
Nine months after surgery, the patient was hospitalized again with a large intestinal obstruction. The colonoscopy revealed the complete obstruction of the anastomotic site (). Based on previous history, the diagnosis of anastomotic stenosis resistant to endoscopic treatment was made. We decided to perform surgical decompression of the colon.
Under general anesthesia, the abdominal cavity was laparoscopically investigated. However, the anastomotic site was difficult to visualize owing to postoperative severe adhesion in the pelvis. We performed colostomy with double orifices on the anal side as close as possible in the sigmoid colon. The colonoscopy confirmed that colostomy was 10 cm to the oral side from the anastomotic stenosis. We decided to perform a reresection of anastomotic stenosis using a circular stapler. |
pmc-6535868-1 | A 37-year-old male with known Down syndrome and epilepsy and taking carbamazepine was brought by his family to the emergency room with a large protruded tongue within 30 minutes of the incident ().
The patient was vitally stable; however, he was slightly agitated. The otolaryngology team had been consulted immediately for further evaluation of the patient's status. History from the patient's family showed that they believed the patient was engaging in aggressive behavior, and he has a history of multiple tongue tractions leading to sudden severe tongue swelling. The examination was unremarkable, except for a huge protruded swollen tongue, which was diffused with no confined collection or sign of hematoma. Fixable nasolaryngoscopy relieved bilateral vocal cord movement, and there was no laryngeal edema. The neurology team was consulted to rule out active seizure, and they cleared him. The decision was to intubate the patient to secure the upper airway and then admit him to the intensive care unit (ICU). The patient consented to endotracheal intubation and possible tracheostomy in case intubation failed. The patient was successfully undergoing orotracheal intubation in the operating room. Then, a CT scan was done, which revealed some artifacts due to endotracheal intubation, with evidence of an enlarged diffused edematous hypertrophic tongue muscle protruded outside the oral cavity and deviated to the left side due to tube insertion from the right side (Figures and ). In addition, the CT scan showed no evidence of mass lesions, collection, abnormal enhancement in postcontrast series, or sizable lymphadenopathy. Thereafter, he was transferred while intubated to the ICU, and he was connected to mechanical ventilation. He was kept on midazolam, fentanyl, and dexamethasone at 8 mg intravenously for Q6h to relieve swelling, as well as pantoprazole for 4 days. Furthermore, a removable bite block was placed on the teeth to prevent tongue biting, and wet gauze was applied to the exposed part of the tongue. Subsequently, the swelling dramatically improved, and another nasolaryngoscopy was performed, which revealed no laryngeal or base of tongue edema. Formerly, he was extubated successfully and transferred to the ward. The patient was observed in the ward for 1 day and then discharged. The patient now has complete resolution of his symptom without any recurrence after 6 months of follow-up. |
pmc-6535872-1 | A 52-year-old Caucasian female presented to her general practitioner with a one-week history of nausea, pruritus, and painless jaundice with associated pale stools and dark urine. This occurred approximately one month following commencement of a turmeric supplement among other medications. She rarely consumed alcohol, was a nonsmoker, and had no history of tattoos, illicit drug use, or recent travel. She had no prior history of liver disease and had normal liver function tests three months before. Her medical history was notable only for oligoarticular osteoarthritis.
On presentation she was found to have a bilirubin of 162 μmol/L with a hepatocellular profile on liver function tests (ALT 2591U/L, AST 1770U/L, ALP 263U/L, and GGT 370U/L) and preserved hepatic synthetic function (INR 1.0, albumin 32 g/L) (). She was jaundiced, with no hepatomegaly or clinical features of chronic liver disease on examination. With progressive jaundice over the subsequent days she was referred to the emergency department, at which point her bilirubin peaked at 536 μmol/L.
Approximately one month prior to presentation she had commenced one tablet per day of Ancient Wisdom Modern Medicine® High Potency Turmeric (375mg curcuminoids and 4 mg black pepper per tablet), along with a flaxseed oil supplement and occasional diclofenac use for arthritic pain. Her long-term medications of cholecalciferol 50mcg daily and ascorbic acid 500 mg daily along with a levonorgestrel 52 mg intrauterine device had been unchanged for at least a year. There was no recent history of paracetamol use.
Upon admission, all oral medications and supplements were ceased. Apart from a detectable hepatitis B core antibody (surface antigen negative, surface antibody positive, and HBV viral load, not detectable), the remainder of this screen was unremarkable with negative hepatitis A, C, and E serology, negative CMV, EBV, VZV, and HSV IgM and PCR, negative liver-kidney, mitochondrial, smooth muscle, antinuclear, anti-tissue transglutaminase and anti-deamidated gliadin antibodies. Plasma eosinophil count, serum copper, and ceruloplasmin were all within normal limits, and paracetamol level was undetectable. Abdominal ultrasonography showed patent portal and hepatic veins with no biliary duct dilatation.
Due to lack of significant improvement by day four of admission (bilirubin 534μmol/L, ALT 1686U/L, ALP 252U/L, and GGT 400U/L) a liver biopsy was performed. Histology showed nonspecific inflammatory changes with generally preserved hepatic architecture and no fibrosis. A florid inflammatory cell infiltrate comprising lymphocytes, histiocytes, neutrophils, scattered eosinophils, and minimal plasma cells were noted in the portal tracts with associated interface hepatitis and reactive changes in bile duct epithelium. A drug reaction was the favored differential.
She was discharged day 12 of admission (bilirubin 260μmol/L, ALT 1232U/L) with the presumptive diagnosis of diclofenac induced liver injury. By two months after admission her LFTs had normalized (bilirubin 21μmol/L, ALT 33U/L) and she was discharged from the clinic.
At this point she recommenced the turmeric supplement (1125mg curcuminoids per day) as sole therapy for her arthritis. Three weeks later her nausea recurred and repeat liver function tests showed an acute hepatitis (ALT 2093U/L, AST 1030U/L, and bilirubin 60μmol/L). Repeat viral serology was unremarkable. She was advised to cease the turmeric supplement, and two months later her liver function tests had again normalized. The calculated Roussel UCLAF causality assessment method (RUCAM) score pertaining to the causal implication of the turmeric supplement was 9 or “highly probable”, augmented by the rechallenge [].
The turmeric supplements were sent for analysis. A sample of the supplement was pulverized, dissolved in methanol to a concentration of 1 mg/mL, and filtered through a 0.45 μm polyvinylidene fluoride filter. The filtrate was diluted and analyzed by a validated liquid chromatography quadruple time-of-flight (LC-QTOF) mass spectrometry method. Results were compared to a toxicology library containing approximately 1400 compounds, including medications, illicit drugs, and over-the-counter medicines. A detailed method is published elsewhere []. A further sample was analyzed by inductively coupled plasma (ICP) mass spectrometry for the presence of trace and toxic elements. The turmeric supplement tested negative for drugs, adulterants, or toxic heavy metals. |
pmc-6535872-2 | A 55-year-old man of Italian background presented to his general practitioner for a routine checkup and was found to have an asymptomatic transaminitis on blood panel (ALT of 1149U/L, bilirubin 23μmol/L, ALP 145U/L, and GGT 302U/L). He occasionally drank alcohol, was a nonsmoker, and had no recent travel history or risk factors for viral hepatitis. Examination was unremarkable. His background history included idiopathic thrombocytopenic purpura, hypertension, gout, and osteoarthritis, with regular medications including long-term Telmisartan, Atenolol, and Lercanidipine. He had no known liver history with normal liver function tests one year prior. His only new medication was commencement of a turmeric supplement five months prior.
He was referred to a hepatologist and underwent a screen for causes of acute hepatitis. Apart from a positive ANA titre of 1:160, screening was unremarkable. Hepatic synthetic function was preserved with a normal INR and albumin of 45 g/L. Abdominal ultrasonography showed diffuse steatosis, but no ductal or vascular pathology. A drug reaction was suspected, and the turmeric supplement was ceased.
Close follow-up occurred over the subsequent four months. Near normalization of liver function tests occurred by one month (ALT 96U/L, bilirubin 10μmol/L) with further improvement by four months after cessation (ALT 46U/L, bilirubin 11 μmol/L). The turmeric supplement was the presumed cause of the hepatitis and as such the patient was not rechallenged. The RUCAM score was 6, or “probable” []. The turmeric supplement was not known, and therefore further analysis could not be performed on the supplement. |
pmc-6535877-1 | A 33-year-old Japanese woman, para 0-0-1-0, with no known family and past histories of the disease, was referred to our institution at 23 weeks of gestation because of fetal forearm defect as detected by ultrasound examination at 21 weeks and 5 days of gestation. Ultrasound examination () revealed short forearms of 7 mm and 9 mm and short humeri and femurs (–2.1 standard deviation, SD). The fetal estimated body weight was 450 g (–1.3 SD). Fetal MRI at 26 weeks of gestation revealed short forearms and hypoplasty of hand fingers (). The serum analyses of the mother showed no TORCH syndrome, and the exposure of drugs as teratogen was denied. No other anomalies were found. However, fetal growth restriction (FGR) became evident thereafter, leading to intrauterine fetal death (IUFD) occurring at 29 weeks of gestation. A stillbirth baby was of 798 g in body weight and 33.0 cm in length. External examination showed a low hairline, synophrys, low-set ear, hypertrichosis, and smooth long philtrum with thin lips (). The neck appeared short and broad. Finally, CdLS was diagnosed. Autopsy and genetic and chromosomal analyses were declined. |
pmc-6535879-1 | A 74-year-old female presented to the emergency department (ED) with upper abdominal pain and melanotic stools. She had an elective open juxtarenal abdominal aortic aneurysm repair a month before her index presentation. She was hemodynamically stable. Her pertinent initial labs showed a hemoglobin of 6.7 g/dl (baseline 9.6 g/dl) with a hematocrit of 23%. Patient did not have any fever or leukocytosis. A CT abdomen with contrast done in the ED for abdominal pain showed nonspecific findings, i.e, irregularity of the “aneurysmal sac” with a small amount of fluid around the sac (see ) which was read by the radiologist as early postsurgical changes. She was admitted and was started on proton pump inhibitors. An esophagogastroduodenoscopy (EGD) was performed that revealed mild duodenitis. Her hemoglobin remained stable the next couple of days, and she was discharged home with a 6-8-week course of proton pump inhibitors. Two months later, she presented again with similar complaints with a drop of hemoglobin. A repeat EGD was performed that did not reveal any obvious source of bleeding, and she was discharged home after stabilization.
A month later, she came for the third time into the ED with abdominal pain, hematochezia, and profound hypotension. Her pertinent laboratory findings include leukocytosis, low hemoglobin and hematocrit, thrombocytopenia, and transaminitis. She was resuscitated with IV fluids and blood transfusions. She was started on broad spectrum antibiotics after blood cultures were drawn. A CT abdomen and pelvis was performed which showed tiny foci of air at the anterior aspect of the native aneurysm wrap just inferior to the location where duodenum crosses (see ). At that time, a decision was made to perform push enteroscopy instead of simple EGD to evaluate second and third portion of duodenum which showed an aortoduodenal fistula with infected graft adherent to the bowel wall and extruding purulent exudate (see ). She underwent emergent surgical excision of the infected graft and bypass grafting to restore vasculature. Her blood cultures and cultures from the graft revealed methicillin-resistant Staphylococcus aureus (MRSA) and Streptococcus agalactiae. Aggressive management was continued with proper antibiotics in the intensive care unit, but her condition deteriorated, and she expired within several days. |
pmc-6535882-1 | A 24-year-old pregnant woman (G2P1) was referred to us due to suspected bilateral ovarian cysts at 8 weeks of gestation. She had undergone ovarian cystectomy twice under open surgery: left and right ovarian cystectomy for mature cystic teratoma and mucinous cystadenoma, respectively. She had no additional medical history or familial medical history. Transvaginal ultrasound and magnetic resonance imaging (MRI) (Figures and ) revealed two pelvic cysts. The left-sided unilocular cyst was 9 cm in diameter. The right-sided multilocular cyst was 5 cm in diameter. We diagnosed this condition as bilateral ovarian cysts.
Although the serum levels of tumor markers (CA125, CA19-9, and CEA) were normal for a pregnant woman, considering the large size of the cyst, cyst resection was attempted at 14 weeks; however, it was converted to probe laparotomy. Marked adhesion around the cysts, posterior uterus, and Douglas' pouch made cyst resection impossible as extensive adhesiolysis may cause uterine damage and also uterine contractions after surgery. Gross examinations revealed no metastatic lesions or lymph node swelling. Abdominal fluid cytology revealed no malignant cells.
At 32 weeks of gestation, MRI revealed that the left-sided cyst size had increased to 27 cm in diameter (Figures and ), although she was asymptomatic. As shown in , the right-sided multilocular cyst became very close to the left monocytic cyst. At this stage, the left large monocytic cyst appeared to merge with the smaller right multilocular cyst, forming a large cyst occupying the entire pelvic cavity, which was later confirmed by laparoscopic findings.
This large cyst showed no solid-part or papillary growth. The serum levels of tumor markers remained normal. Malignant ovarian tumor could not be ruled out but was considered less likely. We weighed merits and demerits between relaparotomy for tumor resection during pregnancy and a wait-and-see approach for several weeks; the former is likely to require extensive adhesiolysis and may cause preterm delivery. We decided on the latter strategy, since resection should be performed in the event of a size increase or images indicative of malignancy. The fetus normally developed without fetal growth restriction.
Cesarean section and tumor resection were performed at 37+4 weeks of gestation, yielding 3,012-g male infant with Apgar score 8/9 at 1/5 minutes, respectively. The infant did not have congenital abnormalities. After the completion of cesarean section, we ruptured the wall of this large cyst, with care to avoid the cyst content entering into the abdominal cavity. A large amount of serous fluid was drained. This large cyst was a multicystic cyst (5 cm), considered to be the right multicystic ovarian cyst that had been observed from the first trimester. The wall of the large cyst showed marked adhesion to the peripheral peritoneal cavity. We resected it as widely as possible together with right salpingo-oophorectomy (Figures and ). The left ovary was macroscopically normal, and thus there was no evidence of the left ovarian tumor. The resected tumor consisted of a large unilocular cyst with serous fluid and a mucinous cystadenoma (Figures and ). In the former, lining epithelium was absent in many parts () and mucinous epithelium was occasionally found in continuity with the cyst wall of the latter (right ovarian cystadenoma). No malignant cells were found in the resected specimen. Immunohistochemistry revealed focally positive staining for estrogen and progesterone receptors on the resected cyst wall (Figures and ). At 12 months after the delivery, left ovary remained normal and the retention cyst did not recur. An informed consent for this reporting was obtained from this patient. |
pmc-6535884-1 | A previously healthy 11-year-old girl presented with 8 days of fever, night sweats, and subjective weight loss. Her fevers occurred every 12 hours and reached a maximum of 39.4°C. Additional symptoms included headaches, dizziness, nausea, intermittent right-sided abdominal pain, and anorexia. The patient also reported an intermittently pruritic rash on her arms. She had no respiratory symptoms, emesis, or diarrhea.
Past medical history was significant for multiple episodes of bronchiolitis requiring hospitalization before age 2, varicella with severe mucosal involvement requiring hospitalization for nasogastric feeding at age 4, and hepatitis A at age 7. Growth and neurologic development were normal. The patient was born in Central America and immigrated to the U.S. 4 years prior. Exposure history was significant for consumption of unpasteurized cow milk while in Central America. A maternal uncle had been recently diagnosed with tuberculosis, but the patient had not had contact with him for more than 4 years. There was no other significant family history.
Physical exam revealed a thin female (weight 33.1 kg, 22% for age; body mass index 15.5 kg/m2, 16%) with enlarged, mobile, nontender cervical lymph nodes bilaterally but no palpable axillary or inguinal lymph nodes. There were small erythematous papules on the flexor surface of her left antecubital fossa and right first metacarpophalangeal joint. She had mild abdominal tenderness most significant in the right upper quadrant, but no hepatosplenomegaly or mass.
Laboratory values at admission on day of illness (DOI) 9 were notable for leukopenia, anemia, and mildly elevated C-reactive protein (CRP) (). The erythrocyte sedimentation rate was greater than 145 mm/hr. Aspartate and alanine aminotransferase were elevated. Cerebrospinal fluid (CSF) analysis showed no leukocytes and normal protein and glucose. A fourth-generation antigen-antibody test was positive for antibodies to HIV-1. HIV RNA PCR demonstrated 294,000 copies/mL in peripheral blood and 504 copies/mL in CSF; initial CD4 T-lymphocyte count was 52 cells/mm3.
Computed tomography scan demonstrated innumerable small nodules throughout the bilateral lungs and lymphadenopathy in the cervical, axillary, hilar, mediastinal, and retroperitoneal regions. The largest nodal conglomerate in the retroperitoneum measured 4.4 cm (). Pathology of a bone marrow biopsy demonstrated hypocellularity and noncaseating granulomas. Lymph node biopsy revealed plasmacytosis and increased histiocytes with no evidence of malignancy. Acid-fast bacillus, Fite, and methenamine silver stains were negative in both tissues. Bronchoscopy revealed no significant airway edema or erythema, and no secretions. Evaluation for tuberculosis (TB) and non-TB mycobacterial infections was negative, including QuantiFERON-TB Gold, mycobacterial cultures, and/or TB PCR from sputum, bronchoalveolar lavage (BAL) fluid, lymph node tissue, blood, stool, and/or CSF. Serum antibodies to Toxoplasma gondii, Treponema pallidum, Brucella species, Coccidioides immitis, and Histoplasma capsulatum were negative. However, urine and serum H. capsulatum antigens were positive with values greater than the upper limits of quantification. Ultimately, H. capsulatum grew in fungal cultures from blood, BAL fluid, and lymph node tissue.
Treatment was initiated with liposomal amphotericin B (5 mg/kg/day) on DOI 24. ART consisting of dolutegravir and emtricitabine-tenofovir alafenamide was begun on DOI 26. The patient began to feel subjectively better and appetite improved, but spiking fevers up to 42°C persisted until DOI 37. Hospital course was complicated by pancytopenia thought to be secondary to disseminated fungal infection, acute kidney injury attributed to liposomal amphotericin B, and liver enzyme elevation that was likely multifactorial. Per hospital protocol, the acute kidney injury was monitored with daily weights, serum creatinine measurements, and strict documentation of intakes and outputs. Oral itraconazole (10 mg/kg/day) was initiated on DOI 36 given improving fevers and decreasing CRP and serum H. capsulatum antigen. Liposomal amphotericin B was discontinued on DOI 46. Throughout the course of treatment, serum itraconazole and dolutegravir were monitored to ensure therapeutic levels were obtained. At discharge on DOI 47, the patient's CD4 T-cell count had improved to 215 cells/mm3 and HIV RNA PCR had decreased to 127 copies/mL.
Discussion with the patient's mother revealed that she was also living with HIV and was adherent to ART with an undetectable viral load. The mother reported receiving prenatal care during her pregnancy but was unsure whether she was tested for HIV. The patient was born via cesarean section due to eclampsia and was not breastfed. The mother was diagnosed with HIV when the patient was 4 years old. The mother reported that the patient had not been exposed to her blood and had never received a blood transfusion. She also denied any suspicion of sexual abuse. An investigation by the Colorado Department of Public Health and Environment determined that vertical transmission was the most likely source of infection. During the hospital stay, a multidisciplinary team collaborated with the patient's mother to disclose the diagnosis to the patient and provide support. |
pmc-6536011-1 | A 39 year-old incarcerated male with no prior medical history initially presented to our institution from another facility 11 years ago for an episode of necrotizing pancreatitis. The etiology of initial pancreatitis was unclear.
Six months later, the patient returned to our hospital with abdominal pain. Computed tomography (CT) of the abdomen showed a large peripancreatic fluid collection and gallbladder sludge. He then underwent a cholecystectomy.
The patient presented to the hospital, one year after his index hospitalization, with ascites that was refractory to diuretics. Magnetic resonance imaging of the abdomen showed splenic vein thrombosis that extended into the portal venous system, not seen on his previous imaging studies. The patient had a peritoneal-venous shunt placed by surgery. A liver biopsy was performed demonstrating low-grade nodular regenerative hyperplasia (NRH) changes with mild perivenular sinusoidal dilatation, and mild portal fibrosis without evidence of bridging or chronic biliary obstruction (). Workup for other common etiologies of hepatic injury including viral and autoimmune sources were negative.
The patient was lost to follow-up for 7 years and eventually returned with melena. An esophagogastroduodenoscopy (EGD) conducted during that admission showed large esophageal varices in the distal esophagus and isolated gastric varices in the fundus of the stomach.
Second liver biopsy was performed, demonstrating incomplete septal cirrhosis (ISC) and more advanced NRH (). Corresponding with the progression of and increase in INR. At the time of his first biopsy, the patient maintained a serum albumin consistently between 3.5-4.5 g/dL. At the time of his subsequent biopsy, he demonstrated persistent hypoalbuminemia between 2.0-2.9 g/dL, despite ensuring adequate nutrition. His INR was initially in the range of 1.2-1.3, and eventually ranged from 1.6-1.9. At baseline, aspartate aminotransferase (AST) and alanine aminotransferase (ALT) remained within normal limits and stable between the biopsies. The alkaline phosphatase baseline increased over fourfold during this period ().
The patient was referred to transplant surgery, and selective splenic arterial embolization was recommended to reduce inflow to his gastric varicies. This procedure was performed by interventional radiology (IR), but only the proximal splenic artery could be embolized with collateral flow from the distal splenic, left gastric, dorsal pancreatic, and gastroepiploic branches, which reconstituted blood flow.
He had subsequent admissions for melena and hematemesis. Eventually, a transjugular intrahepatic porto-systemic shunt and splenic vein recanalization with angioplasty and stent placement was performed by IR. Following this procedure, he did not have any overt gastrointestinal bleeding for six months, after which he presented with melena again; IR performed a visceral angiogram and venogram the left hepatic and dorsal pancreatic arteries were demonstrated to supply the spleen and were embolized ().
An attempt to catheterize the gastroepiploic artery was performed, but canalization was unsuccessful due to its tortuosity. The patient tolerated the partial splenic embolization with no significant subsequent bleeding, and was eventually discharged home. |
pmc-6536019-1 | A 58-year-old Caucasian male, with a 10-year history of ulcerative colitis, almost one year After the diagnosis, had developed anal fistulas, perianal abscesses and villous adenoma. However, multiple stool samples and colonoscopic biopsies had ruled out co-existent superinfections. Consecutively, the patient had a proctocolectomy with ileal pouch-anal anastomosis, followed by small bowel resections due to adhesions complications. This resulted in a 90 cm small intestine, with a permanent end ileostomy being performed. After his multiple operations resulting in a short bowel, he was treated parenterally via a central venous catheter (Hickman line). Since then, the patient has had multiple central venous catheter-associated infections and has had his line changed several times. The patient was under the care of St Mark’s hospital and had no significant family or social history. He was admitted to the Emergency Department, at Milton Keynes University Hospital, presenting with fever and rigors. Blood tests were manifested by anaemia and raised inflammatory markers. The patient was put on several anti-motility and anti-secretory medications (Loperamide, Codeine phosphate and Omeprazole) to reduce the stoma output.
The patient had no other symptoms aside from feeling generally unwell, fever and rigors. Initial assessment revealed a heart rate of 108, a respiration rate of 24, an SpO2 of 93%, a temperature of 38.9° C, a blood pressure of 154/94 mmHg and a GCS score of 15/15. With the exception of abdominal surgical scars and a Hickman line over the left side of chest, general physical examination was unremarkable including normal heart sounds with no added sounds. The Hickman line was not loose or disconnected. The line was not blocked. The patient’s stoma was situated in the right iliac fossa. There were no signs of swelling, bruising, pain, bleeding, redness, or oozing around the exit site. There were no signs of parastomal hernia, prolapse, retraction, infarction, bleeding or erosions. However, the patient complained of tenderness around the stoma site. Further inspection also revealed a high stoma output of 7.2 litres per day, one day prior to the admission; which might have contributed to the electrolyte and water imbalance (). Chest x-ray and ECG were unremarkable. Urinalysis revealed hematuria and proteinuria. Multiple sets of peripheral and central blood cultures were taken. Growth, detected in blood cultures, resembled Staphylococcus epidermis. Since there were no other signs of line involvement, the current Hickman line was kept in-situ and the patient was treated with antibiotics and monitored closely. The patient was managed with IV fluids, analgesia, antiemetics and with several IV antibiotics (Flucloxacillin, Teicoplanin, Gentamicin and Tazocin) following the advie of microbiologist. Over the course of Vancomycin therapy, the patient had no further temperature spikes and the C-reactive protein value returned to the normal limits.
The patient was then referred to a dietitian to be commenced on semi-elemental diet (Vital 1.5). The BMI was measured at 24.5kg/m2 with a Must score of 0. His estimated nutrition requirements are shown in . The hospital protocol for high stoma output is 500ml of oral fluids and 1litre of St Mark’s solution. Initially, the patient was started on 8 bottles per day of Vital 1.5 (2400kcal/18.0% Protein, 49.0% Carbohydrate, 33.0% Fat) in addition to the St Mark’s solution. Due to the large stoma output, he was on large amount of fluids that gradually reduced following an improvement in the stoma output by semi-elemental diet contribution. There were no changes in medications that could have accounted to the stoma output drop.
Three days post-admission, the dose of Vital 1.5 was increased to 10-15 bottles (3000kcal-4500 kcal/18.0% Protein, 49.0% Carbohydrate, 33.0% Fat) per day in addition to his fluid intake that was restricted to 3 litre of overall and 2 litres of IV fluid. Following a further improvement in the stoma output, the patient was advised to stop the Codeine phosphate, Loperamide, the St Mark’s solution and further reducing/adjusting his fluid intake. However, the patient only agreed to stop the St Mark’s solution. 1 litre of Plasma-Lyte was to be administered in case of dehydration. The introduction of semi-elemental diet (Vital 1.5kcal) has led the stoma output to drop swiftly to 2 litres/day, 9 days post admission ().
Fluid balance charts in hospital inpatients have been used to monitor the fluid balance (). The patient maintained a stable BMI and the electrolytes returned to within the normal limits (). Prior to discharge, a full vitamin screen was performed, to act as a baseline for future reference. Furthermore, the patient was told to continue monitoring his weight, fluid balance and stoma output. Consent was obtained from the patient for publication of this case report. |
pmc-6536042-1 | We describe the case of a 21-month-old female patient from southwest Colombia, who was the second child of a 34-year-old mother and a nonconsanguineous 36-year-old father, both without a significant family history. The mother’s pregnancy was uncomplicated, and prenatal ultrasounds were normal. A cesarean delivery was performed at 38 weeks because of the breech position of the baby. The birth weight was 3,324 g (48th centile). The baby showed spontaneous neonatal adaptation with APGAR 9 and 10 at 1 and 5 minutes, respectively. She was released jointly with her mother on the second day after birth.
At three months of age, she was assessed by a neuropediatrics service for generalized hypotonia associated with psychomotor development delay. At six months of age, a low weight and height were documented as well as generalized hypertrichosis. The occurrence of this neurological symptoms together with persistent hypertrichosis at 12 months led to an assessment by a pediatric endocrinologist, who ruled out an androgenic hormone disorder (normal testosterone levels, α-OH-progesterone and somatomedin). At that age, she was also assessed by a pediatric gastroenterologist who diagnosed moderate gastroesophageal reflux that required pharmacological management. Later, at 20 months of age, she presented with two episodes of urinary infection, one of them complicated by pyelonephritis.
Regarding her development, she achieved cephalic support at 12 months, and assisted sitting at 18 months. At the age of 21 months, she did not exhibit age-appropriate language development.
The paraclinical tests performed on the patient included Normal brain MRI performed at 10 months of age. A renal ultrasound, dimercapto succinic acid renal scan and voiding cystourethrography were performed at 20 months of age and were reported to be normal. Other studies performed at this time were karyotype, blood and urine metabolic screening, creatinine phosphokinase, complete blood count, fasting glucose test, transthoracic echocardiogram, auditory and visual evoked potentials; all of them were reported as normal. X-rays of the extremities performed at 21 months of age showed bilateral congenital hip dislocation.
At 21 months of age, she was referred for genetic assessment because of delayed psychomotor development, generalized hypotonia, low height, and hypertrichosis. Her weight was 8,7 kg (-2,2 SD) and her height was 72 cm (-3,83 SD). Physical examination revealed round facies, thick eyebrows, synophrys, long eyelashes, downslanted palpebral fissures, hypertelorism, long philtrum, Dennis Morgan folds, and excessive thick facial hair mainly in the frontal region (). Generalized hypertrichosis was present and more pronounced on the back and around the mammillae (). Other findings included mild generalized hypotonia, broad feet, and irritability without hyperactivity.
Further investigation was performed using whole exome sequencing (WES) in the trio approach with a massive sequencing platform (CeGaT-GmbH, Tübingen, Germany). WES was performed on the sequencing coding and flanking intronic regions using the HiSeq2500/4000 system (Illumina®, San Diego, CA, US). The CASAVA 1.8 analysis package (Illumina®, San Diego, CA, US) was used to demultiplex the sequencing reads. The trimmed reads were mapped to the human reference genome (GRCh38) using the Burrows-Wheeler aligner software. A novel frameshift pathogenic variant in the heterozygous state of the KMT2A gene (v1. NM_001197104.1) was identified: c. 4177dupA (p. Ile1393Asnfs*14). This variant was not identified in either of the patient’s parents and has not been reported previously in population databases. This variant generates a change in the reading frame that results in the premature truncation of the protein or degradation of the messenger RNA. This finding was confirmed by Sanger sequencing and was compatible with the diagnosis of WDSTS. No other gene variants were identified in this case.
According to the American College of Medical Genetics and Genomics (ACMG) Guidelines for the Interpretation of Sequence Variants , this variant is classified as pathogenic (PVS1, PS2, PM2, and PP3 criteria). The variant functional prediction software tools SIFT (https://sift.bii.a-star.edu.sg/), Functional Analysis through Hidden Markov Models FATHMM () and Polymorphism Phenotyping v2 (Polyphen-2 http: // genetics. bwh.harvard.edu/pph2/) classified it as a deleterious/damaging variant (disease causing) because of its high evolutionary conservation.
The de novo inheritance of the mutation was explained to her parents, as was the recurrence risk that varies from 3% to 5% in future pregnancies . The patient's follow-up plan includes annual renal and cardiac tests to assess other syndrome-associated features that may not yet be present in the patient due to the young age of the diagnosis. Neurological follow-up includes a therapy intervention for the hypotonia and the possible intellectual commitment.
The patient’s parents provided written informed consent for the publication of her case report and accompanying images. |
pmc-6536564-1 | A 47-year-old male who complained of upper abdominal pain and vomiting was referred to our hospital. He was a heavy drinker and had a past history of hospitalization for alcoholic chronic pancreatitis. Laboratory data revealed elevated levels of amylase (245 IU/L), CRP (14.99 mg/dl), and white blood cell count (14900/μL). Plain abdominal computed tomography (CT) showed a cystic lesion of 7 cm in size in the lumen near the second part of the duodenum. The cystic lesion showed high density inside. The pancreas was slightly enlarged, and the main pancreatic duct was dilated. Calcifications were seen in the uncus of the pancreas (Fig. a). Gastrointestinal endoscopy revealed that the lumen of the duodenum was deformed by a submucosal tumor-like mass and the endoscope could not pass through it (Fig. b). However, active bleeding was not seen in the lumen of the duodenum. A submucosal tumor or hematoma of the duodenum or a pancreatic pseudocyst associated with chronic pancreatitis was suspected. On the fourth day of hospitalization, his hemoglobin level had decreased from 14.0 to 11.1 g/dl. Contrast-enhanced CT demonstrated a high-density spot on the wall of the cystic lesion (Fig. c). A pancreatic pseudocyst complicated with intracystic hemorrhage was preliminary considered. Angiography was immediately performed, and a pseudoaneurysm was identified in the branch of the anterior superior pancreaticoduodenal artery (ASPDA) (Fig. d). The pseudoaneurysm was successfully treated with transcatheter arterial embolization (TAE). Anemia did not progress after that. Upper gastrointestinal series demonstrated a filling defect in the duodenum, while the inside of the cystic lesion was not contrasted (Fig. a). Magnetic resonance cholangiopancreatography (MRCP) was performed but did not show a communication between the cyst and the pancreatic and biliary ducts. Follow-up CT on the 27th day after TAE showed that the cyst had decreased in size to 2 cm and obstruction of the duodenum was gradually improved (Fig. b). Surgical treatment was considered for the pancreatic pseudocyst with intracystic hemorrhage. However, he refused an operation and was discharged on the 34th day after TAE.
Two years later, abdominal pain and vomiting recurred. The cyst was enlarged again, and CT showed that it contained high-density fluid. Recurrence of a pancreatic pseudocyst with intracystic hemorrhage was suspected because of anemia progression. TAE was performed in the branches of the ASPDA and posterior superior pancreaticoduodenal artery (PSPDA). After TAE, the size of the cyst decreased and symptoms were relieved. However, the same symptoms recurred 2 months later. We obtained informed consent for surgical treatment, and we performed subtotal stomach-preserving pancreatoduodenectomy (SSPPD). Intraoperatively, severe inflammatory adhesion was noted around the pancreas head and the border between the pancreas and the cystic lesion was unclear. Macroscopically, a cystic mass of 5 cm in size was adjacent to the second part of the duodenum on the pancreas side and was close to the ampulla (Fig. a). A pinhole-sized communication was identified between the cyst and the duodenum lumen. Microscopically, the cyst was filled with mucus and the wall of the cyst was composed of gastric mucosa and shared a common proper muscle layer with the duodenum. Chronic ulcers and erosions were seen in the cyst (Fig. b, c). Ectopic gastric mucosa was observed in non-ulcerative region (Fig. d). Based on these findings, a diagnosis of duodenal duplication cyst was made. The patient’s postoperative course was uneventful, and he was discharged on the 30th day after the operation. |
pmc-6536737-1 | A 13-year-old boy presented with a one year history of exophthalmia in the left eye, without any nasal symptoms. There was no history of local trauma or systemic disease, and he was operated on 6 months ago under a rhinoscopic approach when a marsupialization of the cyst was done with pathological examination showing characteristics of an aneurysmal cyst. He was actually admitted for recidivism of the same lesion.
Clinical examination showed exophthalmia of the left eye without loss of visual acuity ().
Rhinoscopy found a well-defined mass, sitting at the level of the left ethmoidal sinus, smooth and pink. The other side was normal ().
Tomodensitometry showed an oval multiloculated lesion more extensive in the anteroposterior plan replacing the ethmoidal cells measuring 39 × 23 × 35 mm. This lesion has regular walls, duplicated by place. Its content is made of multiple stalls with a liquid level realized by blood outside as it pushes the globe and the right internal muscles without signs of invasion, responsible for an exophthalmia grade I. Inside it fills the nasal fossa and pushes the septum without a free interface. At the top it displaces the ethmoidal roof inward without endocranial invasion. It is responsible for fluid retention at the level of the left maxillary sinus, and through posterior ethmoid cells invasion it is responsible for the narrowing of the optical channel, whereas the frontal and sphenoidal sinuses are free ().
Surgical intervention involved the total excision of the tumor with all its walls, in addition to the orbital medial wall and its periorbital by endoscopic approach. This was assisted by ENT navigation system which was helpful to determine the skull base, the orbit and the carotid canal because landmarks are modified by the tumor ().
Histopathology found fusocelular carcinomatous proliferation in the herring bone with calcification, presence of multinucleate elements showing atypia estimated at 3/10 fields. Those tissues are negative for desmin and CD 34 and positive for vimentin ().
The multidisciplinary team deciding on the treatment options included surgeons, oncologists, radiotherapists and radiologists. The decision was made to treat the patient with radiotherapy, but the patient refused. The alternative was to closely monitor the patient, with monthly clinical and endoscopic examinations. No recidivism was actually found after one year of follow-up. |
pmc-6536741-1 | A woman, 70 years old, with dyspnoea (New York Heart Association scale, NYHA class III), referred for severe aortic regurgitation. At the transthoracic echocardiography (TTE) aortic valve presented with an annulus diameter of 23 mm, a mean gradient of 7 mmHg and a severe AR with a pressure half time (PHT) inferior at 300 msec. The effective regurgitant orifice was 0,3 cm2 and the regurgitant volume was 65 ml. The AR was associated with a left ventricular dilatation with a left ventricle end diastolic volume (LVEDV) of 160 ml, left ventricle end diastolic (LVEDD) and systolic (LVESD) diameters of 57 mm and 41 mm, and a normal ejection fraction (60%). The patient was previously treated for a myocardial infarction with drug eluting stents in the right coronary artery (RCA) and in the circumflex artery, and with another drug eluting stent in RCA for late in-stent restenosis. She had a stenosis of 55% of the left internal carotid artery and severe peripheral vascular disease. Preoperative Chest X-ray () and computed tomography (CT) of the thorax () confirmed the presence of a PA. In particular, CT showed heavy and diffuse calcifications involving all the aortic annulus and the aortic root and numerous large spots of calcium from the sinotubular junction to the upper portion of the ascending aorta. These findings allowed for a diagnosis of type IB PA.
The patient’s expected operative risk, calculated according to the logistic European System for Cardiac Operative Risk Evaluation (EuroSCORE II), was 2,24%.
We evaluated the available options and decided for an aortic valve replacement (AVR) with a sutureless Perceval valve (LivaNova, Saluggia, Italy) implanted in full sternotomy.
The ascending aorta was cannulated in a restricted safe area, previously identified on CT images, by Seldinger technique (EOPAtm, Medtronic-Inc, Minneapolis-USA), then cardiopulmonary bypass was instituted, and the aorta was clamped in a non-calcified ascending aorta segment. Myocardial protection was obtained with a single dose of warm blood cardioplegia delivered selectively in the two coronary ostia. Aortic valve leaflets were removed, and a Perceval valve (M-size) was implanted without using the 3 guiding sutures, because of huge and totally diffusing calcifications involving the aortic annulus and the aortic root. To correctly position the valve in the native annulus, the surgeon found the solution of carefully measuring the distance between the nadir of each cusp and the aortotomy. Closure of the aortotomy was reinforced with two layers of autologous pericardium. The cardiac arrest time was 45 min, the cardio-pulmonary bypass (CPB) time was 59 min. Intraoperative transoesophageal echocardiographic assessment showed no paravalvular leakages (PVL). The patient was extubated 7 h later in the intensive care unit. The correct position of the valve was confirmed by the postoperative TTE.
In the postoperative period we noticed an atrial fibrillation with left bundle branch block and an asystole of 7 s; those findings lead us to decide to implant a bicameral pacemaker. The patient was discharged on the 7th postoperative day.
At 2 years follow-up the patient was in NYHA class I and TTE showed no PVL (), a mean gradient of 11 mmHg, LVEDV, LVESD and LVEDD of 85 ml, 32 mm and 43 mm, and left ventricular ejection fraction was 66%. |
pmc-6536804-1 | An 86-year-old woman presented with persistent pain and swelling of her right knee 16 months after infection-related revision knee arthroplasty. A sinus tract was visible on the medial side of the distal thigh. Purulent discharge emptied on pressure. The elderly woman suffered from congestive heart failure, hypertension, aortic stenosis which had previously required aortic valve replacement surgery and had an ASA score of 3. The X-ray showed a knee revision arthroplasty with cemented femoral and tibial stem anchorage without any obvious signs of loosening or osteolysis (Fig. A).
A two-stage procedure as curative therapy strategy was planned and carried out for the patient. During the first intervention, a significant loss of the patellar tendon due to the infection and the previous interventions was found. After thorough debridement, titanium rods were coated with Copal® cement (Heraeus, Wehrheim, Germany), to which was added vancomycin (40g Copal® cement + 2g vancomycin powder) in a silicon tubing technique. The rods were placed in the medullary canal of the femur and tibia. Additionally, a cement spacer was placed in the dead space, which resulted from removal of the knee prosthesis and bone resection (Fig. B).
Initial empiric antibiotic therapy with ampicillin /sulbactam 2000mg/1000mg three times a day was started, and changed as to vancomycin i.v. after the diagnosis of S. epidermidis, with a relatively high resistance profile, including resistance against methicillin, rifampicin and fluoroquinolones (Fig. ).
On postoperative day 18, an unplanned revision surgery was necessary due to persistent wound secretions with repeated debridement and the antibiotic PMMA-spacer and cement-coated rods were changed. Biopsies taken during this intervention remained sterile.
After subsequent uneventful wound healing and improved laboratory parameters (leucocyte count, C-reactive protein levels) stage 2 surgical procedure was planned. Due to the loss of the patellar tendon with subsequent loss of active knee extension and a history of recurrent prosthetic joint infection, knee arthrodesis was advocated.
Pre-operative planning was done using an intramedullary knee arthrodesis system (OsteoBridge®, Merete GmbH, Berlin, Germany). Femoral and tibial locking intramedullary implants with a diameter of 16 mm for the femur and 14 mm for the millimeters with a length of 200 mm each were selected (Fig. A). Connection of these two intramedullary implants was planned with a central spacer consisting of two part with a length of 50 mm and a diameter of 40 mm each. The femoral and tibial intramedullary components as well as the central spacer connecting the femoral and tibial parts were pre-operatively coated with a 90 nm thick siloxane-microsilver coating (HyProtect™, Bio- Gate AG, Nürnberg, Germany) with a relatively low amount of silver (Fig. B). The silver concentration of the implant was 2.7 µg/cm2 with a total silver content of the implant of around 825 µg.
Knee arthrodesis surgery was carried out three months after the removal of the prosthesis and the silver coated arthrodesis device was implanted without any problems (Fig. B). Samples taken during this revision also remained sterile and postoperative X-rays showed correct implantation of the knee arthrodesis device (Fig. C).
I.v. vancomycin was administered for 2 weeks followed by linezolid 600mg p.o. for additional 4 weeks.
After arthrodesis surgery, the further course was uneventful. Blood samples as well as drainage fluid were tested for silver content 24 and 48 hours after surgery. Silver blood concentrations after 48 hours remained under the detection limit of 2 ppb, whereas the silver concentrations in the wound drainage fluid reached 170 and 57 ppb 24 and 48 hours post- operatively, respectively. The patient was followed up regularly in our outpatient clinic for meanwhile 26 months. Full weight-bearing has been possible since inpatient treatment. No silver-specific adverse events such as argyria occurred over the whole follow-up period. No signs or symptoms of recurrent infection were present as well as inflammatory markers continued to remain inconspicuous. Silver serum concentrations remained below the detection limit of 2 ppb. X-rays after 26 months showed stable implant conditions (Fig. D). |
pmc-6536806-1 | A 55-year-old immunocompetent male was involved in a motor vehicle collision 2 years prior to presenting to our institution. He sustained an open ankle fracture after being ejected from the driver's seat into a pasture ditch, sustaining lacerations from barbed wire and resulting in a grossly contaminated open fracture. He was initially managed with irrigation and debridement (I&D) and placement of an external fixator. He subsequently underwent definitive fixation but during the next two years, experienced episodic drainage from incisions that was managed symptomatically with oral antibiotics. He had persistent pain which led him to seek evaluation at our institution.
Upon presentation to our clinic, he was noted to have a severe planovalgus alignment, two draining sinuses, radiographic hardware failure (Figure ), and elevated inflammatory markers including a white blood cell (WBC) count of 11 K/mm3, C-reactive protein (CRP) of 18.7 mg/L, and Erythrocyte Sedimentation Rate (ESR) of 18 mm/hr. He was diagnosed with an infected nonunion with underlying chronic septic arthritis of the tibiotalar joint and osteomyelitis of the distal tibia and fibula and scheduled for a staged ankle fusion following eradication of his infection. At our index surgery, the patient underwent a complete hardware removal with the exception of a broken screw tip from the most proximal fibular screw, extensive debridement of the ankle including excision of 11 centimeters (cm) of diseased distal fibula, 1.5cm of tibial plafond, and 0.5cm of talar dome, placement of an antibiotic spacer to the residual tibiotalar joint (impregnated with 2 grams of vancomycin and 2.4 grams of tobramycin per 40 grams of cement), and application of a ringed (Ilizarov) external fixator (Figure ). Intraoperatively, multiple tissue cultures were obtained and found to be positive for Enterococcus faecalis, Enterobacter cloacae, and Mycobacterium senegalense, which grew from regular bacterial cultures.
Postoperatively, the patient was started on a 4-week regimen of piperacillin-tazobactam for the E. faecalis and E. cloacae osteomyelitis followed by a 6-week regimen of imipenem, ciprofloxacin, and minocycline for his M. senegalense based on the in vitro antibiotic susceptibilities from the culture (Table ). Three months after his index surgery, he continued to have drainage from 2 sites and the decision was made to undergo a repeat I&D with placement of a new antibiotic spacer (impregnated with vancomycin and tobramycin). Intraoperatively, the distal tibia had the appearance of persistent infection including purulence and caseous material which was cultured and noted to be positive for Bacillus species (not anthracis) and persistent M. senegalense growth, again from regular bacterial cultures (Table ). At this point, based on the recurrent isolation of M. senegalense, the decision was made to continue imipenem and change the oral antibiotics to linezolid and azithromycin for another three months. Finally, after finishing 3 more months of imipenem, it was replaced with doxycycline to complete another 3 months of an all oral regimen.
Four months later, he had closure of all wounds, demonstrated downtrending inflammatory markers (WBC, ESR, CRP), and was felt to be ready for fusion. During the procedure, no purulence was encountered, iliac crest autograft was utilized to augment the tibiotalar fusion and compression through the joint was achieved through the ringed external fixator (Figure ). Multiple tissue cultures were taken intraoperatively with no growth noted and postoperatively he was continued on his regimen of linezolid, azithromycin, and doxycycline.
Six months postoperatively, he had a successful fusion with no sinus tracts or drainage (Figure ). He was able to have his ringed external fixator removed and one year postoperatively the patient continues to do well, fully weightbearing through the extremity and has not shown any signs of recurrence (Figure ). |
pmc-6536928-1 | A 67 year-old female with gastric adenocarcinoma underwent subtotal gastrectomy and Roux-en-Y gastrojejunostomy. She then received adjuvant treatment consisting of 2 cycles of adjuvant carboplatin and capecitabine (1000 mg/m2 twice daily for 14 days), followed by radiation therapy to the tumor bed with concurrent capecitabine (1000 mg/m2 twice daily). Each course of treatment was free of mucositis, diarrhea, or hand-foot syndrome, but was associated with extreme lethargy. On the third cycle of carboplatin and capecitabine, she self-administered folate 1 mg/d. On days 5 to 14 of capecitabine, she suffered frank delirium. She presented to a local emergency room on day 6 where computerized tomography (CT) scan of the brain was normal, and was sent home without a diagnosis. Seven days after finishing capecitabine, her oncologist noted persistent confusion and gait ataxia, and admitted her to the hospital (hereafter referred to as “first hospitalization”). Plasma ammonia was 158 µmol/L (normal less than 30 µmol/L). With oral lactulose, plasma ammonia declined to 29 µmol/L, confusion resolved, and lactulose was discontinued.
Seven months after first hospitalization, the patient was hospitalized for hyperammonemia associated with a urinary tract infection, and was restarted on daily lactulose. Nineteen and 21 months after the first hospitalization, the patient was hospitalized with hyperammonemia. Lactulose was started, and supplemented successively with neomycin, rifaximin, and glycerol phenyl butyrate.
The patient suffered weight loss from 69 to 42 kg and progressive muscle weakness. Six years after first hospitalization, sensory and nerve conduction studies and needle electromyography were normal. Laminectomy at L4-L5 failed to relieve leg weakness.
Eight years after first hospitalization, the patient was hospitalized for hyperammonemia 3 times in 2 months. CT scan detected a portosystemic from the inferior mesenteric vein to the internal iliac vein, which in retrospect, had been present immediately after gastrectomy (Figure ). Liver biopsy showed minimal (5%) macrovesicular steatosis, mild periportal fibrosis, and mild to moderate parenchymal iron deposition, which occurs in the setting of a portosystemic shunt. The shunt was occluded via percutaneous transhepatic catheter. Plasma ammonia declined to normal, demonstrating the physiological importance of the shunt. The patient was able to discontinue neomycin, and glycerol phenylbutyrate, but continues taking rifaxamin, and intermittent lactose in the form of Kristalose. |
pmc-6536950-1 | A 19-year-old man was brought to the emergency department following a road traffic accident after his motorcycle skidded and hit the road divider. His Glasgow Coma Scale (GSC) on initial examination was 12/15. He sustained laceration of his upper lip and tongue, comminuted fracture of the right mandible parasymphysis, and avulsed teeth 11, 12, 41, 42, 43, and 44 (). He was intubated immediately for airway protection. An emergency head CT scan showed that he also sustained depressed fracture of the frontal bone with subdural and epidural hemorrhage. CT scan also showed right parasymphysis mandible fracture and dislocated left condyle (). The left condyle was dislocated anteriorly and superiorly into the infratemporal fossa medial to the zygomatic arch. There were no fractures of the condyle and zygomatic arch.
He underwent emergency craniotomy with evacuation of blood clot by the neurosurgical team. In the same setting, the facial laceration injury was sutured and an arch bar with intraosseous wiring was placed to stabilize the fractured mandible. Condyle dislocation reduction was also attempted. Due to the orotracheal intubation tube, the occlusion was not assessed following reduction. The patient was then transferred to the intensive care unit (ICU) subsequently with the orotracheal intubation kept in place. Following extubation 5 days later, it was noted that the patient kept his mouth open without any closure movement. There was also excessive drooling of saliva due to the inability to close his mouth. On examination, his mandible movement appeared restricted and the mandible was unable to move in any direction. He was not obeying instruction well. Multiple manual reduction attempts at bedside were unsuccessful.
An open reduction and internal fixation was planned for the right parasymphysis of mandible fracture, and it was planned to perform reduction of the dislocated condyle on the left side. Owing to the patient's neurological injury, the surgery could only be done 2 weeks after the injuries were sustained. In view of the ASD condyle and the prolonged period of dislocation, we anticipated difficult reduction. This was discussed with the patient and his family, and it was decided if the need for open or surgical reduction arises, they prefer surgical approach to be done intraorally. During the surgery under general anesthesia with muscle relaxation, initial attempts were made to reduce the left condylar dislocation by using manual traction by Hippocratic method and then with the assistance of a mouth gag but proved to be unsuccessful. Our next attempt was to release the intraosseous wiring at the parasymphysis fracture site effectively rendering the mandible in two separate pieces to simulate mandibulotomy-assisted reduction as described by previous clinicians [, ]. Once this was not successful, we went ahead with an intraoral condylotomy on the left side by piezoelectric surgery. First, a coronoidectomy was done to get access to the condyle. Then, the condylar neck was osteotomized using the piezosurgery, and the mandible was then able to be pushed back into occlusion. Finally, open reduction and fixation of the right parasymphysis fracture was performed and stable occlusion was achieved.
Postoperative CT scan confirmed the reduction of the dislocation (). There was a slight deviation of the jaw to the left and mouth opening was 19 mm. Occlusion was acceptable and elastics were placed for 6 weeks. Jaw exercises were encouraged, and review after 2 months postoperatively showed improvement in mouth opening at 40 mm with stable occlusion. The patient was then referred to a prosthodontist for further rehabilitation and treatment of the missing teeth.
On 1-year follow-up, the patient presented with no complaint. Clinically, there was no tenderness at the joint or muscle of mastication on palpation or during movement. However, there was mild asymmetry of the jaw with the chin deviated 2 mm to the left (). Mouth opening was maintained at 40 mm with deviation to the left on opening (). Occlusion was good with upper and lower dentures in place. CT scan shows union between the condyle head and the condylar process stump (). Its position remains as seen immediately after surgery. The stump of the condylar process meanwhile has remodeled to form a neocondyle. |
pmc-6536961-1 | 63-year-old woman who had suffered from the right medial knee pain for 5 years and was not responsive to conservative treatment was admitted to our clinics. 30° varus-valgus stress X-ray indicated that the patient had an intact MCL and LCL. After the detailed physical examination and reviewing of X-ray images, it was decided that UKR would be the most suitable option for the patient with anteromedial knee osteoarthritis. After spinal anesthesia application and sedation, the UKR surgery was performed with a standard minimal invasive midline vertical incision and a medial parapatellar approach; the patella was removed laterally but not dislocated or everted. The patient received a medial partial knee implant with a mobile-bearing insert (medium size with 4 mm thickness; Oxford®, Zimmer Biomet Inc., Warsaw, IN, USA). Following the UKR surgery (), weight bearing was allowed as tolerated by the patient and a standard postoperative physiotherapy was started on the first postoperative day. The patient was discharged at postop 2nd day when she met the following criteria: independent ability to get dressed, to get in and out of the bed, and to sit and rise from a chair/toilet; independence in personal care; and mobilization with crutches. After discharge, a home-based exercise program was given to the patient. At postoperative follow-up, our patient acquired a full knee RoM in the postop 1st month and returned to independent daily activities without any external support in the postop 3rd month.
At postoperative 1st year after first UKR application, the patient fell down while getting on a public bus; this caused that the right knee of the patient was exposed to the valgus force vector. After that moment, the patient heard a pop sound and felt an incredible pain that prohibited the flexion and/or extension of the medial side of the right knee. And then she was admitted to our emergency department. The first evaluation was performed, and the patient was diagnosed with a grade 3 MCL rupture and the UKR insert dislocation (). Having completed the preoperative preparations, the patient was operated on the same day. After anesthetic administration, a surgery with a standard minimal invasive midline vertical incision and a medial parapatellar approach (to a previous incision site) was performed to change the mobile-bearing insert with the same size (medium-sized mobile-bearing insert with 4 mm thickness; Oxford®, Zimmer Biomet Inc., Warsaw, IN, USA). After having changed the mobile-bearing insert, the MCL structures were repaired and anchored to its femoral origin with a 5 mm titanium anchor. Following the surgery, weight bearing and full RoM with a hinged knee brace were allowed as tolerated by patient and a standard postoperative physiotherapy was started on the first postoperative day. Crutches were recommended for 2 to 3 weeks to enable the patient to regain a normal gait. The brace was used continuously for 4 weeks and thereafter during the day for 2 weeks. After the physiotherapy program administration, the patient was discharged at postop 1st day.
The patients were evaluated regarding pain intensity (Numeric Pain Rating Scale (NPRS)), active range of motion (RoM), and quality of life (Short-Form 12 Health Survey (SF-12 Health Survey)). Functional capacity was evaluated using the Iowa Level of Assistance Scale (ILAS), Iowa Ambulation Velocity Scale (IAVS), Hospital for Special Surgery (HSS) knee score, and Timed Up and Go (TUG) test. Rehabilitation program and outcome evaluation were conducted by one clinical physiotherapist at preoperative period (before the first UKR application), at discharge (postop 2nd day after the first UKR surgery), and at postop 2nd year (after 2 years from the MCL repair and the insert change). The evaluation results are shown in . |
pmc-6537016-1 | A 20-year-old woman presented with multiple hyperpigmented patches involving the entire right hemibody and left upper back since birth. The patches were asymptomatic and became darker during puberty. There was no family history of similar disorders. On skin examination, multiple well-defined, irregular-border hyperpigmented patches were observed on the entire right side of the body with alternate areas of pigmentary change and sharp demarcation at anterior midline, resembling a checkerboard mosaic pattern. Moreover, there were dark brown patches on left upper back extending towards left shoulder and left chest. Further examination showed left breast hypoplasia and a slight smaller circumference of right leg comparing to the left (). Ultrasonography of breasts confirmed relatively small size of left breast with normal appearance of fibroglandular tissue. Plain-film X-rays of both legs found no bony abnormalities with an equal leg length and similar shadow of muscle masses. Considering this evidence, the smaller right leg most likely results from subcutaneous fat hypoplasia.
On histopathology of the skin biopsy from left upper back and right abdomen, both sites exhibited acanthosis, slightly increased number of melanocytes along the basal layer of epidermis, mild elongation, and bridging of hyperpigmented rete ridges, compatible with Becker nevus. |
pmc-6537017-1 | A 14-year-old girl presented to our hospital in February 2012 with complaints of painful swelling of the right thigh for 8 months and difficulty in walking. There was no history of trauma, fever, or other constitutional symptoms. Magnetic resonance imaging (MRI) showed right proximal femur lesion. Biopsy from the same was reported as malignant small round cell tumour suggestive of Ewing's sarcoma. Tumour cells were immunopositive for CD99 and negative for CD3, CD79a, MPO, and desmin. There was no systemic metastasis on further evaluation. She received 6 cycles of chemotherapy with vincristine, ifosfamide, doxorubicin, and etoposide (VIDE) followed by a wide local excision of the tumour with endoprosthesis insertion on 06/09/2012. Surgical specimen histopathology examination did not show viable tumour. Margins were free of tumour. She had received further 8 cycles of vincristine, ifosfamide, and actinomycin D (VAI). She was on regular follow-up. In 2016, she had presented with abdominal pain with low-grade fever and unquantified weight loss. Ultrasound abdomen showed epigastric mass measuring 8 cm × 7.5 cm.
On computed tomography (CT) of the abdomen and pelvis (), a 9 cm × 11 cm × 10 cm (anteroposterior×craniocaudal×transverse) well-defined exophytic mixed solid-cystic mass was located along the lesser curvature of the stomach bulging into the superior and inferior recesses of the lesser sac. The lesion had thick, irregular walls and enhancing solid components interspersed within. Multiple enhancing intratumoral vessels were present. Mass was seen abutting the inferior surface of the left lobe of the liver superiorly, the pancreatic body posteroinferiorly with no definite invasion. There was no loss of fat plane with adjacent structures. No lymphadenopathy or ascites was noted.
Upper gastrointestinal endoscopy showed a mucosal bulge along the lesser curvature of the body of the stomach and proximal antrum (). A single deep mucosal ulcer was noted in the mid-body along the lesser curvature with surrounding mucosal edema and erythema and friability. Clinical differentials considered were gastrointestinal stromal tumour (GIST), lymphoma, and adenocarcinoma. Metastasis was considered unlikely in view of the stomach being a rare site. However, biopsy from the lesion was reported as malignant round cell tumour, immunopositive for CD99 and FLI-1. Immunohistochemistry marker for CK, DOG, desmin, and TdT was negative ruling out epithelial tumours, GIST, rhabdomyosarcoma, and lymphoblastic lymphomas, respectively. Bone marrow examination did not reveal metastatic infiltration. No suspicious lesions were seen on bone scintigraphy. CT thorax was negative for lung metastasis.
After discussion with the multidisciplinary tumour board (MDT), it was considered to be a metastatic lesion from previous Ewing sarcoma and it was planned to offer her systemic chemotherapy followed by assessment for gastrectomy. She received 6 cycles of chemotherapy with irinotecan and temozolomide till 07/03/17.
She underwent total gastrectomy with end-to-side esophagojejunal stapled anastomosis and feeding jejunostomy on 07/04/17 (surgical specimen is seen in ). At surgery, an exophytic lesion along the lesser curvature of the stomach with mucosal involvement adherent to the transverse mesocolon was found. There was no ascites or liver or nodal metastasis.
Surgical specimen histopathological examination was reported as malignant round cell tumour (viable tumour: 80-85%), consistent with Ewing's sarcoma. Hematoxylin and eosin staining showed characteristic uniform cells with the round nuclei, small nucleoli with scant-to-moderate clear cytoplasm (Figures and ). Margins were free of tumour. Omentum was noted to have focal tumour deposit. Eight perigastric lymph nodes with reactive hyperplasia. On immunohistochemistry, the tumour cells were diffusely positive for CD99 (). In view of poor response to chemotherapy, following discussion with the multidisciplinary tumour board, it was decided to rule out anaplastic large-cell lymphoma. Pathologist had a re-look at her biopsy and surgical specimen slides. Lymphoma and GIST IHC panel was negative. FLI-1 was positive on immunohistochemistry (). Reverse transcription polymerase chain reaction (RT-PCR) on the gastric resection specimen was negative for EWS-FLI-1 types 1 and 2, EWS-ERG, and EWS-FEV translocations. After ruling out epithelial tumours, rhabdomyosarcoma, lymphoma, and GIST, the likelihood of having a RT-PCR negative Ewing's sarcoma that is known to have an incidence of 10-15% was considered.
It was decided to offer her radiation therapy in view of poor response to chemotherapy and omental deposit by the MDT team. A renogram was performed prior to initiation of RT, and an informed consent was obtained. She received intensity-modulated radiotherapy to a dose of 50.4 Gy in 28 fractions, delivered once a day over 5 and a half weeks. She received further chemotherapy with irinotecan and temozolomide till July 2017.
At the last follow-up in March 2018, the patient was doing well without evidence of the disease. |
pmc-6537023-1 | A 2-year-old male was referred to the Pediatric Surgery Department of the Yaoundé Gynaeco-Obstetric and Pediatric Hospital from the Western region of Cameroon, with an enlarged bladder, dribbling urine with overflow incontinence. He presented with progressive dysuria from age 3 months, without fever or hematuria, but with repeated urinary tract infections. Proteus vulgaris sensitive to ceftriaxone was isolated in one of the urine samples. He was circumcised at 6 months and there was no family history of urolithiasis.
On clinical examination, the infant was a well-developed, well-nourished male, with a temperature of 37.5°C, a heart rate of 106 beats per minute, a respiratory rate of 25 cycles per minute, and a weight of 12 kg. A tense and sensitive bladder was palpated in the suprapubic region as well as a hard mass, at the base of the penis (). There was no costovertebral angle tenderness. An abdominal scout film showed a rounded opacification beneath the pubic symphysis (). Voiding radiographs confirmed interruption to flow in the penile urethra with proximal urethral dilatation (). The bladder was markedly distended; there was no vesicoureteral reflux. The postvoid residual volume was significant (). Ultrasonography of the urinary tract did not reveal abnormalities in the upper unit. Urine culture revealed E. coli sensitive to ceftriaxone. Blood count, urea, and creatinine were normal.
A suprapubic cystostomy was performed at bedside. At urethroscopy, a stone completely obstructing the lumen and encrusted in the urethral wall, prevented endoscopic extraction (). Urethrotomy was therefore performed. An elongated 6 mm x 9 mm lithiasis with a crystalline surface was extracted (). A Foley catheter (Ch 10) was left in place for 21 days.
The postoperative period was normal and the infant was discharged from hospital with normal voiding. He has remained asymptomatic at 1-, 3-, and 6-month follow-up visits.
The results of infrared spectrophotometric analysis of the calculus are as follows:Nucleus: urate ammonium acid (15%), calcium oxalate monohydrate (70%), and calcium oxalate dihydrate (15%) Surface: calcium oxalate dihydrate (100%)
A urinary metabolic assessment for hyperoxaluria will complete the work-up as soon as funding is available. |
pmc-6537023-2 | A fourteen-year-old boy presented at the Emergency Department of the Yaoundé Gynaeco-Obstetric and Pediatric Hospital complaining of inability to urinate for over 20 hours despite the sensation of a full bladder. He was born at term, had normal urine flow at birth, and was treated for a urinary tract infection at 9 months. He was circumcised at 9 years of age without complications. The present symptoms began 1 month previously with pollakiuria and painful micturition with no fever or hematuria. Physical examination revealed an agitated child, writhing with pain in the hypogastric region, and a palpable full bladder (). Vital signs were normal. There was no costovertebral angle tenderness. The testes were both descended and the penis presented a stenotic meatus. Palpation of the body of the penis did not reveal any masses. 600 ml of clear urine was drained from an urgent bedside 8 Fr cystostomy (). However urinalysis was positive for nitrites and leukocyturia. Blood urea nitrogen and creatinine were normal; there was marked leukocytosis at 11000/mm3. An abdominal ultrasound showed grade 2 right ureterohydronephrosis. A scout film confirmed an ovoid calculus in the proximal part of the anterior urethra (). A voiding cystourethrogram showed a partially obstructed urethra and absence of passive as well as active vesicoureteral reflux (). The patient received amoxicillin-clavulanic acid. Definitive management under general anaesthesia consisted of meatotomy and open perineal urethrostomy. An encrusted urethral stone (13 mm x 6 mm) with a speculated surface was extracted (). An indwelling Foley catheter (12 Fr) was left in place for 10 days. The patient was given Oxybutynin for bladder spasms and amoxicillin-clavulanic acid as long as the indwelling catheter was in place. |
pmc-6537187-1 | A 10 years and 10 months old girl was admitted into our hospital with a complaint of recurrent wheezing and breathlessness during exercise for several months five years ago. At that time, respiratory tract infection, foreign body aspiration, airway developmental anomalies, cardiovascular diseases, and tumors, assessed by chest computed tomography (CT), CT angiography (CTA), bronchoscopy, and echocardiography, were excluded. The diagnosis of asthma was considered, based on the history of allergic rhinitis, elevated level of serum eosinophil (6.8 × 109/L, reference, 0–0.8 × 109/L), and immunoglobulin E (IgE, 1128 IU/mL; reference: 0–165 IU/mL), a reversible airway obstruction detected by spirometry (resulting in a ≥ 12% increase in the predicted FEV1) and a positive response to the therapy of rapid acting β2-agonist and inhaled glucocorticoids. The child’s adherence to the treatment and adequate performance of the inhalation technique were confirmed. Yet, her asthma was refractory to initial treatment. The symptoms of asthma were gradually brought under control, with the use of double inhaled glucocorticosteroid and leukotriene modifier, over a period of three years, at which time the dosage was gradually decreased. Eight months prior to the current admission, all drugs had been withdrawn, without a relapse of asthma. However, symptoms of allergic rhinitis did not resolve, with intermittent elevation of serum levels of eosinophils persisting. Additionally, the patient complained of recurrent petechia on her lower limbs, occurring on average once per year, over the past three years. Unfortunately, all these signs failed to gain clinicians’ attention and no further examinations were performed.
At this time, she was admitted to our hospital with a one-month history of lower extremity numbness, arthralgia and myalgia of lower limbs with claudication, but without fever, edema, fatigue or weight loss. There was no history of trauma prior to the onset of these symptoms. On admission, the physical examination revealed decreased skin temperature of both lower limbs, swelling of the left calf, subcutaneous nodules and palpable purpura below the knee. Pulse of the dorsal pedis and radial arteries were absolutely absent. No other positive findings were identified. For the auxiliary examination, a peak eosinophilia of 7.33 × 109/L (51.5%, reference: 0–8%) was detected on complete blood analysis. An elevated serum level of IgE (referred to 1710 IU/mL) and erythrocyte sedimentation rate (ESR) of 34 mm/h (reference: 0–26 mm/h) were observed. The possibility of tuberculosis or parasite infection was not considered as there was no history of probable contact, as well as negative results on the BCG, PPD test and T-SPOT, with no specific parasite antibodies identified (Fascioliasis, Clonorchiasis, Paragonimiasis, Schistosomiasis, Toxoplasma). As well, all other laboratory tests were within normal limits, including urinalysis, hepatic function, renal function, myocardial function, coagulation function, blood gas analysis, serum level of glucose, blood ammonia, lipid panel, C-reaction protein (CRP), autoantibody, antineutrophil cytoplasmic antibodies (ANCAs, including p-ANCA and c-ANCA) and human leucocyte antigen-B27 (HLA-B27). Marrow cytology inspection suggested a proliferation of granulocytes and an elevated percentage of eosinophil, which excluded the possibility of common blood system diseases. Remarkably, extensive occlusion of the anterior tibial and dorsal pedis arteries were identified, bilaterally, using a vascular ultrasound examination. Electromyogram (EMG) revealed a deficit of both motor and sensory fibers of peripheral nerves, suggestive of a peripheral neuropathy. Combined with the significant history of asthma, eosinophilia> 10%, recurrent petechia, peripheral neuropathy, and the vascular findings, the suspicion of EGPA was strongly raised.
However, since EGPA rarely occurs in children, more comprehensive examinations were carried out to confirm our hypothesis. A change of ground-glass opacities and nodule was found on the middle lobe of the right lung on chest CT imaging (Fig. a). The skin biopsy, obtained from a petechia on the patient’s left lower extremity, demonstrated eosinophilic infiltration and necrotizing vasculitis, characterized by neutrophils and mixed lymphocyte infiltration, striking fibrinoid necrosis, endothelial and muscle cell necrosis in peri-vascularly and the dermis, but absence of granuloma formation. Based on the 1984 Lanham criteria [] and the 1990 American College of Rheumatology (ACR) criteria [], the diagnosis of EGPA was ultimately established. There was no evidence of ear, nose and throat (ENT), ocular, gastrointestinal, and cardiac manifestations. Hydrocortisone (10 mg/kg/d) treatment was initiated for a period of five days, subsequently followed by oral prednisone (1 mg/kg/d). The treatment was sufficient to achieve partial control of her status.
Unfortunately, five days later, the purpura attacked her lower limbs, as well as an ulceration with purulent exudate, sized 3 cm*4 cm in the left leg (Fig. b). She was treated with the antibiotics and debridement for a period of 3 days, but with any remission. New findings were observed on vascular ultrasound, namely, occlusion of the distal portion and of the posterior tibial arteries, and thrombo-arteritis of the radial and ulnar arteries. Systemic CTA identified extensive stenosis and/or occlusion of shank and foot arteries with formation of collateral vessels (Fig. c-d). For our low recognition and poor awareness of EGPA in children, we failed to perform a comprehensive evaluation for vasculitis and provide the patient with an inadequate therapy of corticosteroid (hydrocortisone) during her initial period of hospitalization. After the overall evaluation of her condition, intravenous methylprednisolone (15 mg/kg/d) was initiated for three days, and then a sequential therapy of oral prednisone (2 mg/kg/d) was continued. Antithrombotic treatment (clopidogrel: 25 mg daily, intracutaneous injection of nadroparin: 88.5 IU /Kg q12h, phentolamine: 5 μg/kg/min) was also initiated. The administration of oral methotrexate (12.5 mg per week) was started on day 7 after the end of the methylprednisolone treatment. Ultimately, control of the vasculitis was achieved and the patient was discharged home after the purpura gradually disappeared and the ulcer healed, with a return to normal levels of peripheral eosinophil count and ESR. Oral medication was prescribed, consisting of prednisone, methotrexate, clopidogrel, folic acid, and beraprost sodium. After a six-month period of stability in the disease status, methotrexate was continued, with tapering of the prednisone, without relapse. |
pmc-6537199-1 | A 2-year old, otherwise healthy, Khmu boy presented to the emergency department of a pediatric referral hospital in North-Central Laos with a two-day history of progressively worsening abdominal pain, hematemesis, and distension. This was associated with fevers, dark stools, and poor oral intake. The patient had been born at home and had no prior contacts with healthcare.
On physical examination, the child alternated between irritability and listlessness. He appeared moderately dehydrated, with associated tachycardia and fever to 39.2 °C. His abdomen was distended, rigid, diffusely tender, with percussion tenderness and absent bowel sounds. The patient had bounding peripheral pulses with flash capillary refill. His left hemiscrotum was notably enlarged with a reducible inguinal hernia.
On further investigation of the patient’s history, his mother reported that he had inguinal swelling since birth. After a delay, while re-assessing recent trauma history, the family finally reported a history of dog bite to the scrotum by a stray 2 days prior to the development of symptoms. On closer examination, the patient’s scrotum showed two small puncture marks at opposing locations on the anterior and posterior surfaces of the left hemiscrotum. There was minimal erythema around the posterior wound, but not the anterior. Neither wound demonstrated purulence, induration, tenderness, or other signs of infection. The child had suffered no other injuries during his encounter with the dog and the parents had cleaned the skin wounds at home.
Initial studies revealed leukopenia (white blood cell count 3.3 × 10^9 cells/L), anemia (hemoglobin 11.3 g/dL) and uremia (blood urea nitrogen 63 mg/dL). The patient’s electrolytes were within normal limits, and a rapid typhoid test was negative. A lateral decubitus abdominal X-ray demonstrated air fluid levels with a sentinel loop of dilated small bowel (Fig. ). He was fluid resuscitated with normal saline, then given broad-spectrum antibiotic coverage with ceftriaxone and lincomycin. He also received tetanus toxoid, and rabies vaccine due to the unknown vaccination status of the canine. Despite this resuscitation, the patient became progressively more tachycardic, and his mental status declined into obtundation. Given the patient’s acute abdomen and deteriorating status, he was taken urgently to the operating theatre.
During open laparotomy, the patient was noted to have purulent material throughout his abdominal cavity. Small bowel contents were herniated into the scrotum, and were manually reduced. His small bowel had two puncture perforations (Fig. ). He ultimately had 2 cm of small bowel resected, and the inguinal hernia was repaired. On post-operative multidisciplinary review with the surgical and medical teams, the patient’s mechanism of injury was identified as a penetrating puncture into the herniated small bowel contents in his scrotum. The tract traveled superiorly to the testes and spared the spermatic cord.
The patient’s clinical course was complicated by the development of a delayed anastomotic leak requiring repeat laparotomy on post-operative day 14 with placement of an ileostomy. He had a prolonged inpatient stay following his second operation, complicated by extensive time nil per os due to concern for ongoing anastomotic leak, severe weight loss, and high-output ostomy losses. He was switched to hydrolyzed formula with slow reintroduction of F100 with improvement in his diarrhea and subsequent weight gain. Neither of his testicles were compromised in the course of his injury, or subsequent surgeries. He was discharged home after 54 days in the hospital. He returned 3 months later and his ileostomy was reversed during an uncomplicated surgery and he was ultimately discharged home in good condition. |
pmc-6537215-1 | A 33-year-old pregnant woman, G1P0, at a gestational age of 23 + 4 weeks was referred to our hospital on November 3, 2017. Color Doppler ultrasound imaging showed a hyperechogenic mass in the fetal left ventricle, measuring 1.8 cm × 1.57 cm, broadening of the left lateral ventricle (1.11 cm) and a strong dot-like echo in the left ventricle (Fig. a), and cardiac rhabdomyoma was suspected. On November 7, 2017, approximately 30 mL of amniotic fluid was collected by ultrasound-guided transabdominal puncture for conventional chromosomal G-banding karyotype analysis and CMA with the BioChip Detection System of Affymetrix GeneChip following the manufacturer’s instructions (Zhejiang Biosan Biochemical Technologies Co., Ltd.; Hangzhou, China). G-banding analysis revealed a 46, XY karyotype, with no abnormal karyotype detected, and CMA detected a 1.8 Mb-duplication of the chromosome 15q13.2q13.3 region (arr [hg19] 15q13.2q13.3(31,073,668-32,920,694)× 3) containing 7 genes (TRPM1, KLF13, OTUD7A, CHRNA7, FAN1, MIR211 and RAHGAP11A), which occurred in the region between BP4-BP5 on chromosome 15q13.3 (Fig. ).
At a gestational age of 28 + 3 weeks (December 7, 2017), color Doppler ultrasound reexaminations displayed multiple strong echoes in the fetal left ventricle (measuring 3.3 cm × 2.03 cm), compression of the left ventricular outflow tract, obvious enlargement of the tumor, and a 0.92 cm internal diameter of posterior horn of the left lateral ventricle (Fig. b). On January 15, 2018 (34 weeks of gestation), fetal brain magnetic resonance imaging (MRI) in Fujian Provincial Maternity and Children’s Hospital (Fuzhou, China) revealed abnormal morphology of the left frontal lobe with irregular extension of anterior horn of the left ventricle (Fig. c and d). Lissencephaly in the left frontal lobe and cortical dysplasia were therefore diagnosed. On January 25, 2018 (35 + 2 weeks of gestation), color Doppler ultrasound reexaminations of the fetal heart displayed multiple hyperechogenic masses (measuring 4.35 cm × 3.13 cm) in the fetal left ventricle, abnormal morphology of anterior horn of the left lateral ventricle with broadening of the internal diameter (2.02 cm) (Fig. a and b), indicating a high likelihood of cardiac rhabdomyoma. After careful consideration, the pregnant woman and her family decided to terminate pregnancy. Labor was induced and a 3 kg male infant was delivered. Anatomical findings showed a solid space-occupying lesion in the fetal left ventricle (approximately 4 cm × 3 cm) (Fig. a). Histology of the fetal heart specimen revealed typical spider-shaped cells, which were consisted of abundant glycogen-rich cytoplasm and cytofilaments that were extended and radiated to pericellular regions, and pathologic examinations confirmed that the solid space-occupying lesion in the fetal left ventricle was cardiac rhabdomyoma (Fig. b, c and d). Next-generation sequencing revealed no mutations in the tuberous sclerosis complex 1 (TSC1) gene or TSC2 gene in the fetus. On August 12, 2018, peripheral blood was sampled from the fetus’ parents, and subjected to CMA. Then, a 2.5 Mb-duplication of the chromosome 15q13.2q13.3 region (arr [hg19] 15q13.2q13.3(30,386,398-32,915,089)× 3) was detected in the woman, and no mutations were identified in the TSC1 or TSC2 gene. These testing suggested that the fetal chromosome with the microduplication was inherited from his mother.
The pregnant woman reported a regular menstrual cycle, a natural pregnancy, and smooth pregnancy, and she had no special discomfort, no smoking or alcohol consumption history, no family history of fetal anomaly, and no history of viral infections. In addition, she denied oral administration of special medications during the pregnancy. During the pregnancy, non-invasive prenatal testing (NIPT) revealed a low risk, and color Doppler ultrasound imaging of the woman heart displayed no remarkable abnormality of cardiac structure or functions.
This study was approved by the Ethics Review Committee of Fuzhou Municipal First Hospital Affiliated to Fujian Medical University (approval no. FZSY-201700132). Written informed consent was obtained from the fetus’s parents following a detailed description of the study purpose. All experimental procedures described in this study were in accordance with international and national laws, regulations and guidelines. The pregnant woman and her husband involved in this study agreed to publish related demographic and clinical features. |
pmc-6537247-1 | Patient 1 is a 61-year-old female with mesial temporal lobe epilepsy and bilateral
hippocampal sclerosis who presented with a 3-day history of delirium. She arrived in
the ER mildly confused with constant eye blinking. EEG revealed generalized 2 to 3
Hz semirhythmic delta activity superimposed on rhythmic theta and alpha activity
with eye blink artifacts occurring at a rate of ~1/s (: top). The findings were consistent
with NCSE without coma with impaired consciousness (SE:B2bc; ) and with oculoclonic status
(SE:A3d; ). After
treatment with lorazepam 4-mg IV and levetiracetam 2000-mg IV, she was admitted to
the ICU and CEEG was started. Oculoclonic status ceased but NCSE persisted on
levetiracetam 1500-mg IV q12. Lacosamide 300-mg IV was loaded the next day followed
by 200-mg IV q12. On day 3, valproate 2000-mg IV was also loaded followed by 1000-mg
IV q12h, but this was stopped 2 days later because of hyperammonemia. On day 4, the
dose of levetiracetam was increased to 2000-mg IV q12h. She developed third-degree
atrioventricular block and symptomatic bradycardia, which resolved when the dose of
lacosamide was reduced to 100-mg IV q12h. Despite all these measures, NCSE persisted
but third-line treatment with anesthesia was not justified since she remained awake
and conversant (albeit confused). Instead, dexamethasone was started on day 5. A
10-mg IV load was administered followed by 5.2-mg IV q6h. Three days after starting
dexamethasone, CEEG showed complete resolution of epileptiform activity (: bottom); and her
mental status also started to normalize. Dexamethasone was continued for 2 more days
at a lower dose of 5.2-mg IV q12h before it was finally discontinued. She remained
on levetiracetam and lacosamide with no seizure recurrence. |
pmc-6537247-2 | Patient 2 is a 56-year-old female with a recent history of seizures attributed to
left frontal hemorrhage from head trauma 2 months prior to admission. She was taking
levetiracetam 1000-mg PO q12h. She was found unresponsive and brought to the ER
where she had a 60-second episode of focal to bilateral tonic-clonic seizure.
Initial treatment consisted of lorazepam 4-mg IV and levetiracetam 1500-mg IV
loading dose followed by 500-mg IV q12h. EEG on day 2 showed left frontal interictal
sharp waves. Her mental status improved and she became less somnolent. She was
seizure-free for 4 days before she had a 30-second focal clonic seizure involving
the right face and hand with impaired awareness. She became inattentive and
somnolent again so levetiracetam was increased to 1000-mg IV q12h. On day 5, she
started having continuous right face and hand jerking and EEG showed 0.5 to 1/s
lateralized periodic discharges (sharp waves) over the left hemisphere that were
time-locked to the jerks (: top). The findings were consistent with epilepsia partialis continua
(EPC; SE:A3b; ).
Brain MRI revealed acute left temporoparietal infarction in addition to old
traumatic brain lesions. After lacosamide 100-mg IV q12h was added, myoclonic jerks
stopped and she became more alert. On day 9, she started having focal aware clonic
seizures, which resembled the initial EPC except for lack of persistence
(t1 < 30 seconds). The dose of lacosamide was increased to 150-mg
IV q12h, but focal clonic seizures continued to occur frequently (~1/hour).
Dexamethasone 10-mg IV was loaded followed by 4-mg IV q6h. After 3 days on
dexamethasone, she became seizure-free (: bottom). Dexamethasone was
discontinued 25 hours after the last seizure. She remained seizure-free on
levetiracetam and lacosamide. |
pmc-6537247-3 | Patient 3 is a 51-year-old male with a history of right frontal and parietal
hemorrhage due to head trauma 6 months prior to admission. He had seizures in the
past and was recently admitted due to tonic-clonic seizures, which was controlled
with levetiracetam, lacosamide, and carbamazepine. He was discharged on these 3
AEDs, but only took levetiracetam 1000-mg PO q12h prior at home. He started
exhibiting left face, arm, and leg jerking at home. On admission, EEG showed 0.5 to
1/s periodic sharp and delta waves superimposed on irregular slow waves over the
right hemisphere with maximum voltage over the right frontocentral region (: top). The discharges
were time-locked to the left face, arm, and leg jerks consistent with EPC (SE:A3b;
). To abort
EPC, the dose of levetiracetam was increased to 2000-mg IV q12h and lacosamide was
started at a dose of 200-mg IV q12h. Left face and arm jerking stopped, but EPC
persisted with jerking restricted to the left leg. Dexamethasone was started at 4-mg
IV q6h (loading dose was not given). Seizures stopped completely 3 days after
initiating dexamethasone (: bottom). Dexamethasone was discontinued the next day and she remained
seizure-free on levetiracetam and lacosamide. |
pmc-6537247-4 | Patient 4 is a 75-year-old female with a history of metastatic breast cancer who
presented in stupor with intermittent 60-second episodes of right lower extremity
jerking. EEG showed 0.5 to 1/s lateralized (left > right) periodic discharges
with sharp morphology and superimposed semirhythmic delta activity (: top). The findings
were consistent with NCSE without coma with impaired consciousness (SE:B2bc; ) with recurrent
focal clonic seizures (t1 30-60 seconds). She was intubated for airway protection
and propofol was started at 10-µg/kg/min IV. She was also loaded with 1500-mg IV of
levetiracetam followed by 1000-mg IV q12h. Brain MRI was normal. In the ICU, she
continued to have focal clonic seizures (1-2/hour) and CEEG showed persistent NCSE.
Fosphenytoin 2000-mg IV was loaded followed by 150-mg IV q8h. Propofol was
uptitrated but she became hypotensive at 40 µg/kg/min. Midazolam drip was started
and burst suppression was sustained for 2 days with 60 to 80 mg/kg/min of IV
midazolam. Every time midazolam was weaned off, epileptiform discharges reappeared.
Lacosamide 750-mg IV q12h IV was added. CEEG showed persistent NCSE with periodic
sharp waves appearing more localized over the left frontocentral region. Focal
clonic seizures also started to involve the right face and arm in addition to the
leg. On day 6, dexamethasone 10-mg IV was loaded followed by 4-mg IV q6h. Four days
after dexamethasone was started, all clinical seizures stopped but 0.3 to 0.5/s
lateralized periodic discharges persisted in EEG (: bottom). Dexamethasone was
continued for 2 more days after she stopped seizing. She remained seizure-free on
levetiracetam, lacosamide, and phenytoin. |
pmc-6537276-1 | A 56-year-old man was presented to the emergency department 8 hours after a fall from
his own height with pain, bruising, and inability to move his arm. On clinical
examination he had loss of the normal contour of the deltoid and the acromion was
prominent posteriorly and laterally. Ηe was holding his injured arm but he could not
extend the elbow, the wrist (wrist drop) actively, and fingers from neutral
position. The neurological examination that followed revealed numbness along the
radial border of the forearm in the distribution of the radial sensory nerve. Median
and ulnar nerve were intact and peripheral pulses were present. A plain AP X-ray and
axillary view confirmed the diagnosis of anterior shoulder dislocation (). The dislocation was
reducted under sedation using Kocher technique and post-reduction radiographs
affirmed the right position of the humeral head in the glenoid, but sensory
paresthesia and drop hand remained ( and ). The shoulder was immobilized in an arm sling, a wrist splint was
applied, and the patient was discharged taking instructions. In the follow-up, a few
days later a shoulder magnetic resonance imaging (MRI) revealed a rotator cuff tear
(), and 3 weeks
after the injury, EMG and nerve conduction studies showed no response in latency and
conduction velocities (1.6 ms, 4.7 mV) in the radial motor nerve distribution, which
indicated a complete radial nerve palsy. The patient started physiotherapy for the
wrist and the fingers with the goal to maintain a full passive range of motion in
all joints. Patient performed passive, assistive, and self-assistive movements and
stretches to wrist maintaining the ROM (range of motion). Passive movements using
continuous passive motion equipment were used to reduce stiffness and pain due to
edema and inability to straighten the fingers. To regain muscle strength the patient
was encouraged to do hand and finger exercises using physiotherapy tools such as
silicone relief pressure hand grip and gripper resistance bands. A shoulder
rehabilitation program started 6 weeks after his fall with passive, assistive
movements to increase ROM and to reduce stiffness and pain in the joint. An exercise
regime was given to regain gradually the strength and the neuromuscular control of
the shoulder while education of proprioception was critical in returning safely to
functional activities. The importance of early intervention following early
diagnosis is to prevent muscle atrophy, the development of secondary deformities,
and to maintain adequate muscle trophism during re-innervation. |
pmc-6537283-1 | A 12-year 7-month-old Caucasian female with no significant medical or family history
was referred to pediatric endocrinology for progressively worsening acne, hirsutism,
and a deep voice. She described excessive hair growth to the face, chest, abdomen,
and back. She denied salt craving, increased thirst, or prolonged illnesses, and
denied dizziness, headaches, or vision changes. She had breast development for about
2.5 years and was premenarchal. Review of her growth chart demonstrated linear
growth acceleration around age 9 to 10 years with stable height for the past year
and a body mass index at the 29th percentile.
On physical examination, she was a normotensive, normocardic female with a deep
voice. She had mild acne on the face and upper chest, significant hirsutism with a
Ferriman-Gallwey Score of 22 (upper lip: 4, chin: 4, chest: 3, upper abdomen: 2,
lower abdomen: 3, thighs: 3, lower back: 2, and upper back: 1) as seen in to and grade 1 acanthosis
nigricans to the neck. Her pubertal examination revealed mild clitoromegaly (5 cm
long by 0.5 cm wide) with slightly enlarged labia minora that were larger than the
labia majora, Tanner stage V pubic hair and axillary hair, and Tanner stage III
breast development.
Initial laboratory values drawn at 2 pm are shown in and demonstrated a 46 XX karyotype,
and estrogen, prolactin, follicle stimulating hormone (FSH), and luteinizing hormone
(LH) in the pubertal range with LH–FSH ratio greater than 2:1. Electrolytes and
thyroid function were normal. Notably, the patient had an elevated androstenedione
and testosterone, and a borderline elevated 17-hydroxyprogesterone. A bone age was
read as 14 years (close to 2 standard deviations advanced).
Due to the borderline elevated 17-hydroxyprogesterone, a 250-µg adrenocorticotrophic
hormone (ACTH) stimulation test was performed. Nine am laboratory values
prior to the stimulation test demonstrated multiple elevated steroids and androgens
including 17-hydroxypregnenolone, 17-hydroxyprogesterone, 11-deoxycortisol,
dehydroepiandrosterone (DHEA), androstenedione, and testosterone (). Additionally,
she had a normal progesterone, estrone, and estradiol. There was minimal response of
any axis to ACTH. This pattern of elevation and response was not consistent with a
single enzyme defect causing CAH raising concern for an autologous
androgen–producing tumor.
Based on results of the ACTH stimulation test, abdominal/pelvic imaging was obtained.
Abdominal magnetic resonance imaging showed normal adrenal glands and no focal
lesion. Pelvic ultrasound was notable for normal size ovaries (2.1 × 3.6 × 3.1 cm on
the right and 2.5 × 2.7 × 2.7 cm on the left) with small peripheral cysts and normal
blood flow and an anteverted uterus measuring 4.5 × 1.7 × 3.7 cm with a suboptimally
visualized endometrial stripe.
Due to concern for a hormone-secreting mass too small to visualize, a
dexamethasone-suppressed ACTH stimulation test was performed to further delineate
the source of elevated androgens. Adrenal androgens (progesterone,
deoxycorticosterone, 11-deoxycortisol, and cortisol) suppressed whereas the ovarian
androgens (11-hydroxypregnenalone, 17-hydroxyprogesterone, DHEA, androstenedione,
and testosterone) did not suppress, as shown in indicating an ovarian source of
androgen production. This led to the presumptive diagnosis of PCOS.
With a suspected PCOS, metabolic laboratory tests were performed and were normal
except for elevated fasting and postprandial insulin concentrations as shown in
. As the
family’s primary treatment goal was to decrease hirsutism, the patient was started
on 100 mg spironolactone daily and a 20 µg estrogen combined oral contraceptive. A
lower dose estrogen was selected as she was premenarchal with incomplete breast
development. Given her elevated postprandial insulin she was also started on 1000 mg
of metformin twice a day, with a titration to full dose over a month.
After 3 months of multidrug treatment, the patient’s androgen (DHEA, androstenedione,
and total testosterone) and glucocorticoid (17-hydroxyprogesterone,
17-hydroxypregnenolone, and 11-desoxycortisol) concentrations normalized confirming
the presumption that the androgen source was the ovaries, and that she did not have
an autonomously secreting mass. She had menarche with 2 days of very light bleeding
rather than full menses and mild improvement in hirsutism and acne, with no changes
in her voice. At that time, she was transitioned to a 30 µg estrogen containing
combined oral contraceptive with a non-androgenic progesterone and then achieved
full menses. At her 6-month follow-up, her hormone profile remained consistent with
oral contraceptive therapy, and her hirsutism was dramatically improved ( and ). She was also menstruating
regularly. Her voice was still unchanged. |
pmc-6537356-1 | A 47-year-old woman with noninfectious chronic uveitis and persistent cystoid macular edema (CME) was referred to our institution due to a dislocated IOL in the vitreous chamber in August 2010. A vitrectomy was performed, and the dislocated IOL was removed and exchanged with a sclerally-fixated IOL using a knotless zigzag-shaped intrascleral suture (Z-suture) []. Due to the persistent uveitis-related CME, Ozurdex® was injected into the left eye. At that moment, the BCVA in her left eye was 20/100. Thirteen days after the Ozurdex® implantation, the patient presented with diffuse corneal edema, and her visual acuity was counting fingers. The Ozurdex® implant was detected in the inferior angle of the anterior chamber (Fig. a). Eighteen hours after detection, the implant was removed. This surgical technique involved a temporally located clear corneal tunnel created with a 2.75-mm slit knife (Fig. a) and paracentesis at the 10 o’clock position (Fig. b). Viscoelastic material was injected through the paracentesis into the anterior chamber, and the Ozurdex® implant was freed from the anterior chamber angle (Fig. c). Twenty-gauge alligator forceps were used to grip the implant at its long axis in order to avoid the disintegration of this brittle implant (Fig. d).
Following surgery, the BCVA in her left eye was 20/200. An anterior segment examination showed diffuse corneal edema and a stable, well-positioned, sclerally-fixated IOL (Fig. b). Six months later, a Descemet membrane endothelial keratoplasty (DMEK) procedure was performed. Two and 9 days after the DMEK, rebubbling procedures were performed using an intracameral air injection due to a partially detached graft. Three months later, her BCVA had improved to 20/100. |
pmc-6537356-2 | In 2011, a 76-year-old man was referred to our institution with a dislocated pseudophakic IOL due to pseudoexfoliation syndrome (PEX). Five years earlier, he underwent a unilateral cataract extraction with a capsular tension ring and an endocapsular IOL implantation. After performing an explantation of the capsular bag, capsular tension ring, and dislocated IOL, a limited anterior vitrectomy and implantation of a sclerally-fixated IOL were performed []. This patient developed pseudophakic CME due to Irvine-Gass syndrome. Because the CME did not respond to topical steroids, nonsteroidal anti-inflammatory agents (NSAIDs), peribulbar steroid injections, or anti-VEGF agents, an uncomplicated Ozurdex® injection was performed. At that time, his BCVA was 20/50.
Twenty-four days after the fourth Ozurdex® injection, the patient was referred with complaints of worsening blurry vision and discomfort in his left eye due to corneal decompensation after the migration of the dexamethasone implant into the anterior chamber (Fig. b). His BCVA had decreased to 20/100. A clinical diagnosis of corneal decompensation with bullous keratopathy was made, and an Ozurdex® explantation was proposed and agreed upon. Two hours after detection, he underwent the explantation procedure using the same technique as that described in the previous case. Three months after the dexamethasone implant explantation, the corneal edema had decreased, and his visual acuity was 20/50. |
pmc-6537356-3 | An 84-year-old woman underwent a complicated cataract surgery with a vitrectomy and a sclerally-fixated IOL in March 2017 []. She developed pseudophakic CME due to Irvine-Gass syndrome. At that time, her BCVA was 20/50. Due to her poor response to topical NSAIDS, oral carbonic anhydrase inhibitors, and a peribulbar steroid injection, an Ozurdex® injection was performed. Sixty-six days after insertion, the intravitreal Ozurdex® implant had migrated into the anterior chamber. In February 2018, this patient’s anterior segment examination showed diffuse corneal edema and an Ozurdex® implant in the inferior angle of the anterior chamber. At that time, her visual acuity had decreased to hand movement. Three hours after detection, the Ozurdex® implant was removed from the anterior chamber; however, her vision remained at hand movement with bullous keratopathy. This patient is being scheduled for a DMEK. |
pmc-6537356-4 | A 69-year-old woman suffering from noninfectious chronic uveitis with persistent CME in her left eye was referred to our institution. In November 2006, a cataract surgery was performed with a capsular tension ring implantation into the capsular bag due to partial zonular dehiscence. In order to exclude infectious uveitis, a diagnostic vitrectomy and surgical posterior capsulotomy were performed. After this surgery, the BCVA in her left eye was 20/100. Due to the persistent uveitis-related CME, an Ozurdex® injection was administered in the left eye. This patient returned 4 days later with diffuse corneal edema and Descemet membrane folds (Fig. c). An anterior segment examination showed anterior chamber dislocation of the dexamethasone implant. At this point, her visual acuity was 20/400. Due to the corneal decompensation and decrease in vision, the dexamethasone implant in the anterior chamber was removed surgically. Postoperatively, her BCVA had improved to 20/100, and her cornea was clear. |
pmc-6537365-1 | A 2-year-old girl had an accident of spoke injury. On the day of the accident, she visited a clinic, where she was diagnosed with a laceration on her left ankle. Because the bone fracture was less likely, ultrasonography or x-ray was not examined. She received wound cleaning and an oral antibiotic. However, she stopped visiting the clinic on her parents’ decision after a few days. Six months after the accident, she had a fever at 39 °C, general fatigue and localized pain at the left ankle. She revisited the clinic and received oral third-generation cephalosporin. On the same day (Day 1), she presented with generalized tonic-clonic convulsions for 5 min. The convulsion stopped spontaneously. She was transferred to our hospital because her consciousness remained disturbed after the convulsion. On admission, her body temperature was 39.8 °C, heart rate 160/min, blood pressure 120/82 mmHg, and respiratory rate 50/min. Capillary refilling time was 3 s. Consciousness was evaluated as GCS 7 (E1V2M4). The left ankle was swollen. Laboratory tests showed leukocyte counts of 10,700 /μL with 90% neutrophils. C-reactive protein and procalcitonin were 9.6 mg/dL and 55.5 ng/mL, respectively. Ammonia levels and coagulation studies were normal. The cerebrospinal fluid contained nucleated cells at 1/μL, total protein 17 mg/dL, and glucose 81 mg/dl. IL-6 and IL-8 levels were increased to 37.1 and 455.2 ng/ml in the cerebrospinal fluids, respectively. After the diagnosis of sepsis, she received the administration of cefotaxim and vancomycin. Repeated tests of blood culture proved bacteremia with methicillin- susceptible Staphylococcus aureus (MSSA). No pathogens were detected in the cerebrospinal fluid (Fig. ). The cellulitis on her ankle was thought to be the focus of systemic infection. However, the diagnosis was not confirmed until MRI was taken on day 3 of admission.
Her consciousness did not recover during the next 24 h. Electroencephalograms showed poorly organized background activity, consisting of frontal-dominant, diffuse high-voltage slow waves. Epileptiform discharges were not evident (Fig. a). Brain magnetic resonance imaging revealed the T2-prolonged lesions in the mesial frontal cortex of the right hemisphere, accompanying the feature of reduced diffusion on diffusion-weighted imaging (DWI, b factor of 1000 s/mm2) and apparent diffusion coefficient mapping (Fig. b, upper). Based on the diagnosis of SAE, intensive care was started with 1 g/kg intravenous immunoglobulin (IVIG) for 2 days and 0.5 mg/kg/day edaravone infusion for 4 days. We used both agents because we had not removed the possible complications of SAE with immunocompromised state, autoimmune, hyper-inflammatory or secondary ischemia, including Moyamoya disease [–].
From the third day of admission, her consciousness began to recover. However, swelling of the left ankle further progressed. T1-weighted image of the left lower leg detected high-intensity signals with enhancement in the adjacent regions of soft tissues Osteomyelitis was not detected (Fig. ). Subcutaneous abscess was surgically drained, from the culture of which MSSA was also isolated. On the fourth day, the swelling on her ankle improved and her consciousness became clear. On the 10th day after admission, brain MRI showed no abnormal findings (Fig. b, lower). She was discharged from our hospital on the 14th day of admission (Fig. ). Immunological tests did not support evidence for primary immunodeficiency or immunocompromised status (data not shown). She has been fully recovered, and presently attends preschool without any neurological disability. |
pmc-6537418-1 | A 21-year-old Caucasian male was admitted to a hospital (collaborating institution) in Southern Germany in late summer with newly manifested jaundice as well as a seven-day-history of myalgia, retro-orbital headaches, fatigue, recurrent fever, and nausea. Since the beginning of his illness, myalgia — especially in the calf region — intensified, causing the patient an increasing difficulty in walking. He reported an episode of gum bleeding after cleaning his teeth. There was no history of traveling abroad in the last months and no recent contact with animals. Two weeks prior to the onset of his symptoms the patient sustained a minor knee injury resulting in a skin abrasion while bathing in the river Isar close to Munich, Germany.
The patient works as a computer scientist and has no relevant medical history. Weight and height upon admission were recorded to be 90 kg and 189 cm, respectively (BMI = 25.2 kg/m2). Alcohol, nicotine, or drug anamnesis was negative. No medication or allergies were reported.
On examination, the patient appeared tired, but he displayed no neurological abnormalities. Body temperature was 36.8 °C, pulse 90 bpm, blood pressure 114/75 mmHg, respiratory rate 16 bpm, and oxygen saturation 99% while breathing ambient air. The lungs and heart auscultation was unremarkable, the abdomen was soft and non-tender. The skin and scleral inspection revealed jaundice and a slight gum bleeding was observed during the examination of the oral cavity. Upon pressure, tenderness in the thighs and calves was reported.
Abdominal ultrasound upon admission to the hospital revealed hepatosplenomegaly and no signs of intra- or extrahepatic cholestasis. White-cell count was 9.9 G/L (87% neutrophils and 3.5% lymphocytes), platelet count 39 G/L, and hemoglobin 13.3 g/dl. Serum sodium level was 123 mmol/l, potassium 3.15 mmol/l, and creatinine 2.8 mg/dl (248 μmol/l) with glomerular filtration rate of 31 ml/min/1.73m2. C-reactive protein was 15.4 mg/dl, procalcitonin 2.86 ng/ml, and interleukin-6 was 66.4 pg/ml. Aspartate aminotransferase was 92 U/L, alanine aminotransferase 65 U/l, total bilirubin 17.3 mg/dl (with direct bilirubin reaching 14.7 mg/dl), gamma-glutamyltransferase 47 U/l and alkaline phosphatase 108 U/l. Creatine kinase was 1197 U/l, prothrombin time international normalized ratio 1.2, and partial-thromboplastin time 33 s. Urinalysis revealed a pH of 8, 3+ protein (6.3 g protein/12 h), 5–10 leukocytes per high power field, and 0–2 erythrocytes per high power field. An overview of laboratory test results with the corresponding reference ranges is shown in Table .
On day 1 upon admission an empiric intravenous antimicrobial regime with doxycycline (100 mg every 24 h) and ceftriaxone (2 g every 24 h) was initiated while a selection of tests in search for microbial and viral agents was pending. The patient received intravenous fluid and electrolyte replacement. Within 48 h upon admission, hypokalemia (2.32 mmol/l) and hyponatremia (113 mmol/l) worsened significantly without signs of acid-base dysregulation in blood gas analysis. Creatinine increased to 4.37 mg/dl (386 μmol/l), and a polyuria with up to 7.2 L urine output /24 h was documented. The patient was transferred to the intensive care unit (ICU) at the initial collaborating institution and — approximately 48 h later — transferred to the ICU at our university hospital. Starting from day 4 since the initial admission creatinine levels started to decrease, polyuria was in regress and potassium and sodium levels normalized. In addition, platelet count improved and C-reactive protein decreased. The patient remained afebrile. Despite the gradually improving general condition of the patient, serum bilirubin levels were constantly rising starting from day 1 since admission, reaching its maximum on day 4 (54 mg/dl total bilirubin, 39 mg/dl direct bilirubin). Aspartate and alanine aminotransferases, alkaline phosphatase and gamma-glutamyltransferase remained normal or mildly elevated (Table ).
Urine and blood cultures revealed no growth. Screening tests for hepatotropic viruses (hepatitis A, B, C, and E) as well as HIV, Epstein-Barr virus, and cytomegalovirus were negative. Elevated IgG antibodies to herpes simplex virus (HSV 1 and 2) were detected while IgM antibodies remained within the normal range, suggesting an earlier or latent infection with HSV virus. Quantitative serology assays for hantavirus, Chlamydia, Brucella, and Rickettsia (rickettsii/conorii) showed no evidence for infection with these pathogens. Urine test for Legionella antigen was negative. Within normal range were: antinuclear antibodies (ANA), antimitochondrial antibodies (AMA), anti-liver/kidney microsomal antibodies type 1 (anti-LKM-1), anti-soluble liver antigen antibody/liver-pancreas (a-SLA/LP), anti-liver membrane antibodies (LMA), anti-liver specific protein antibodies (LSP), and perinuclear- and cytoplasmic-antineutrophil cytoplasmic antibodies (p-ANCA and c-ANCA) whereby autoimmune hepatitis could be ruled out. Normal levels of serum copper (110 μg/dl, reference range: 70–140 μg/dl) as well as serum ceruloplasmin (0.44 g/l, reference range: 0.2–0.6 g/l) allowed to dismiss Wilson’s disease from diagnostic consideration.
The presumptive diagnosis of icteric leptospirosis was strengthened by detection of antileptospiral IgM antibodies with the use of ELISA in the acute phase serum specimen (38 U/ml, reference range: < 15 U/ml, SERION ELISA classic Leptospira IgG/IgM, Virion Serion, Würzburg, Germany) and confirmed by an accredited PCR method using proprietary primers at the Institute for Medical Microbiology and Hygiene at the University of Regensburg, Germany. The therapy with doxycycline was discontinued (total duration of 3 days) and the regime with ceftriaxone carried on as a targeted monotherapy (total duration of 12 days).
The patient was discharged home after a total of 12 days of hospitalization (3 days at the ICU). The general condition upon discharge was reported as good; fatigue was declining and the remaining symptoms, with the exception of jaundice (total bilirubin 6.2 mg/dl), subsided.
Throughout hospitalization and a 3-month follow-up period, indocyanine green plasma disappearance rates were recorded multiple times. For each measurement, 25 mg of the ICG dye were dissolved in 5 ml of distilled water, and a dose of 22.5 mg (0.25 mg/kg body weight) was injected intravenously. ICG-PDR was determined via non-invasive, transcutaneous pulse dye densitometry with the use of the LiMON device (Pulsion Medical Systems SE, Feldkirchen, Germany). Initial concentration at time “0” was set to be 100% and plasma disappearance rate was calculated as percentage change over time (%/min) []. Normal values for ICG-PDR are considered to be 18–25%/min [, ]. The measured ICG-PDR values, total bilirubin and alanine aminotransferase serum levels are displayed in Fig. .
Initially severely reduced ICG-PDR (2%/min on day 5 upon initial admission) gradually improved within several days to reach almost normal level on day 10 upon initial admission to hospital (17.4%/min). Approximately 7 weeks after initial hospitalization, ICG-PDR was recorded to be within normal range (23.7%/min) and reached 33.4%/min on day 85. While ICG-PDR values rapidly normalized in parallel with clinical improvement, serum bilirubin levels were slowly decreasing (44.4 mg/dl on day 5 and 9.0 mg/dl on day 10 upon hospitalization), and it was only until 7 weeks upon admission that they reached normal levels (Fig. ). Mild elevation of serum alanine aminotransferase was at its peak of 124 U/l on day 12 upon hospitalization (Table ) and reached close to normal levels by week 7 upon admission (Fig. and Additional file ). Within the 3-month follow-up period, fatigue resolved and the patient reported no remaining symptoms. |
pmc-6537448-1 | A 33-year-old Greek woman was found to have hypothyroidism following a thorough investigation of migraines, after a road traffic accident. The event was complicated with craniocerebral injury necessitating tracheostomy. Her past medical history included RA of 3-year duration treated with methotrexate (2.5 mg three times per day), and topiramate medication for migraines (200 mg twice a day). On clinical examination, the thyroid gland was painless and not palpable. Laboratory tests confirmed a positive rheumatoid factor (RF) with normal antithyroglobulin (anti-TG) and thyroid peroxidase antibodies (anti-TPO) (16 U/ml and 16.7 U/ml, respectively). An ultrasound-guided fine needle aspiration biopsy performed in a private clinic showed distinct nodules in the lower pole of the left thyroid lobe, which were reported as being suggestive, though not conclusive, of malignancy (category V Bethesda) []. She was put on thyroxine (T4) treatment and when she became euthyroid with thyroid-stimulating hormone (TSH) of 0.89 μIU/ml, triiodothyronine (T3) of 1.30 ng/mL, and T4 of 7.2 μg/dl, she was subjected to a total thyroidectomy in our hospital.
The resected thyroid specimen, received in three pieces (4 × 3 × 1.5 cm; 4.5 × 2.7 × 1 cm; and 5 × 2.5 × 1 cm), was surrounded by multiple adhesions; its total weight was 36 g. Two of the specimens exposed a cut surface composed of clusters of small irregular follicles separated by reticular connective tissue, while the gland architecture of the third specimen (5 × 2.5 × 1 cm) was replaced in part by five small areas of amorphous necrotic tissue. On microscopic examination the necrotizing lesions (0.2 to 0.4 cm in greatest diameter) corresponded to rheumatoid nodules, composed of a central area of fibrinoid necrosis surrounded by palisading histiocytes; these, in turn, were encircled by fibroblasts, lymphocytes, and plasma cells (Fig. ). There was a proliferation of small blood vessels around the nodule, lacking any perivascular inflammation. Yet, the surrounding thyroid tissue showed focal lymphocytic thyroiditis, with typical germinal centers, alternating with stromal fibrosis. No evidence of infection, sclerosing thyroiditis, thyroid carcinoma, or lymphoma was noted. |
pmc-6538105-1 | A 59-year-old woman presented to our outpatient department with complaints of fever and loin pain of one-week duration. She had no previous history of hematuria or loin pain and denied any history of recent instrumentation or catheterization. She had no comorbid diseases. General and systemic examinations of the patient were normal except for bilateral renal angle tenderness. Her blood urea was 80 mg/dl and serum creatinine was 1.9 mg/dl. The blood counts were within normal limits and her daily urine output was 2500 ml. Urine analysis revealed plenty of pus cells and culture of the urine revealed Escherichia coli and hence she was started on appropriate antibiotics. Ultrasonogram of the kidney ureter and bladder revealed bilateral gross hydroureteronephrosis with renal cortical thickness of only 5 mm. Ultrasonography also revealed bilateral double J stents in situ with associated encrustations in both the renal and vesical ends. On further probing, the patient recollected total hysterectomy performed for fibroid uterus 32 years ago for which prophylactic bilateral ureteric stent placement was performed. As she was asymptomatic, the patient never made it to remove the stents. Noncontrast computed tomography was done, which revealed bilateral gross hydroureteronephrosis with thinning of cortex in both the kidneys (Figure ). There were bilateral ureteric double J stents with heavy encrustation in both the renal and vesical ends (Figure ). Contrast-enhanced computed tomography was avoided on account of the persistently high renal parameters. The patient was not affordable for diuretic renogram study and hence it was decided to proceed with the removal of the stents after a course of antibiotic. We decided to remove the stents in one sitting, thereby mitigating the possibility of a forgotten stent again.
After obtaining informed consent, the patient underwent cystoscopy that showed heavy encrustation with stones of size 3 cm around the vesical ends of the stents (Figure ). Hence, using a stone punch, the encrustations were removed leaving the stents intact. The vesical end of one stent was uncurled and pulled out of the urethral meatus and held under traction by an assistant while a semirigid ureteroscope was inserted into the corresponding ureter (Figure ). Ureteroscopy revealed complete encrustation of the ureteric part which was fragmented using pneumatic lithotripter working up all the way to the pelviureteric junction (Figure ). A dilated ureter aided in passing the semirigid ureteroscope up into the renal pelvis. The renal end also had heavy encrustation with a stone of size around 3 cm, which was fragmented using pneumatic lithotripter, while the assistant maintained traction on the stent, thereby bringing the encrusted renal end into the upper ureter. This avoids stone fragments migrating back into the renal pelvis. Intravenous furosemide also was employed to aid in flushing the fragments out of the renal pelvis. The stents were extruded out once all the encrustations were fragmented and removed. The contralateral ureteric stent also had heavy encrustation in ureteric part and renal end and hence the same steps were repeated. Intraoperative fluoroscopy was done to ensure complete stone removal. The entire procedure was carried out under antibiotic cover. In view of the extensive endoscopic manipulation and edema, bilateral ureteric catheters were placed and brought out to be removed after three days during the same hospital stay. The postoperative period was uneventful with improvement in serum creatinine, which settled to a nadir value of 1.2 mg/dl. |
pmc-6538107-1 | A 13-year-old boy, a diagnosed case of KTS, was referred to our hospital with complaints of vertigo for three months. His previous medical history included an intracranial bleed for which he was hospitalized four years ago. There was no history of surgery or radiotherapy. He was born at term after an uncomplicated pregnancy. His developmental milestones were normal. His family history did not show any precedent occurrence of cavernomas, intracerebral hemorrhage, or KTS.
His general physical examination revealed left upper and lower extremity hemihypertrophy and cutaneous angiomatosis of the lower extremities, which were associated with painless varicose veins (Figure ). Multiple cutaneous port-wine stains with telangiectasia were also observed in the left hand, left anterior chest, and the entire back, which had been evident since birth (Figures -). There was no evidence of syndactyly, polydactyly, congestive cardiac failure, and pulmonary hypertension. No focal neurological deficits were present.
Magnetic resonance imaging (MRI) brain, dated August 20, 2009, showed a focal area of abnormal signal intensity noted within the midline involving the medial parietal cortex on the left side as well as the corpus callosum (Figure ). After radiographic scans and workup, it was decided to treat this case of a cavernous angioma with Gamma Knife (Elekta, Stockholm, Sweden) radiosurgery using a dose of 16 Gy at 50%, an isodose line to the target volume of 2.4 cm3. Gamma Knife model 4C was used to treat this case. The first follow-up contrast MRI done on October 6, 2013, showed that there was a re-demonstration of a focal area of abnormal signal intensity noted within the midline area involving the medial parietal cortex on the left side as well as the corpus callosum. Furthermore, some necrotic changes within the lesion, with perilesional edema, were also noted. On January 12, 2018, the second follow-up MRI revealed a more than 50% reduction in the previously targeted left parietal angioma and no evidence of new hemorrhages, demonstrating good lesion control (Figure ). |
pmc-6538108-1 | A 38-year-old male patient reported to the department of oral and maxillofacial surgery at Thai Moogambigai Dental College and Hospital in Chennai, Tamil Nadu, India. The patient’s chief concern was swelling in his upper left back tooth region. History revealed the swelling was painless and gradually grew over one year to its present size. There were no other symptoms (e.g., numbness, dysphagia, stridor, speech, or masticatory difficulties) due to the lesions. There was no history of trauma, fever, or similar swelling elsewhere in the body. Past medical history revealed the patient was healthy and had no systemic diseases nor deleterious habits. Past dental history revealed extraction of 25 two years prior to presentation.
On general physical examination, the patient was moderately built and conscious, with a normal gait. His vital signs were within normal limits. The extraoral examination showed no facial asymmetry or lymphadenopathy.
On intraoral examination, we noted a single, ovoid-shaped swelling measuring 3 cm x 2 cm in the left posterolateral surface of the hard palate. The swelling extended anteriorly from the region of 23 to the region of 27, posteriorly. Medially, it extended from the midline of the hard palate and distal aspect of the region of 27 laterally (Figure ). The overlying mucosa appeared healthy and smooth with no secondary changes. On palpation, the swelling was unilocular, nontender, nonpulsatile, firm, and immovable with well-defined margins. The mucosa over the lesion was stretched and nonpinchable.
The results of the patient’s routine blood investigations were within normal limits. Intraoral hard tissue examination revealed no anomalies of the teeth in relation to the lesion. The orthopantomogram did not reveal pathological changes in the bone structures. Due to the clinical examination, outlook, and history of the lesion, we decided to surgically excise the lesion with local anesthesia.
A crevicular incision was made from mesial papilla of 22 to the distal papilla of the region of 27 using a No. 15 Amkay Surgical Bard-Parker® blade (Amkay Products Pvt. Ltd., Maharashtra, India) (Figure ). The mucoperiosteal flap was reflected, and the whole encapsulated tumor mass was excised along with the mucoperiosteum and the eroded bone of the palate with the boundary line localized in the surrounded healthy tissue (Figure ). Hemostasis was achieved and wound closure done using 3-0 silk.
The histopathological examination of the mass revealed parakeratinized stratified squamous epithelium along with connective tissue. The underlying connective tissue showed a well-encapsulated mass of sheets and islands of myoepithelial cells and very few duct-like spaces filled with eosinophilic material. Islands of myoepithelial cells were surrounded by eosinophilic myxoid material (Figure ). This confirmed the diagnosis of PA. The postoperative period was uneventful. The patient is under regular follow-up, and there is no evidence of recurrence after six months of follow-up. |
pmc-6538110-1 | A 37-year-old asymptomatic adult male with previously diagnosed L-TGA presented to the clinic to establish care. He reported normal development without cyanosis or functional limitation. On physical exam, III/VI holosystolic murmur and S4 were appreciated. The electrocardiogram demonstrated left axis deviation and Q waves in the early right precordial leads. Transthoracic echocardiogram demonstrated atrial to ventricular (AV) and ventricular to arterial (VA) discordance consistent with corrected transposition of the great arteries, as seen in Figure . There was a restrictive perimembranous ventricular septal defect and moderate right ventricular dilation with decreased systemic right ventricular function. Following these findings, cardiac computed tomography angiography was performed to further assess the congenital anomaly, as seen in Figure . |
pmc-6538111-1 | A three-year-old male presented to the emergency department (ED) with the chief complaint of one episode of hemoptysis that occurred just prior to arrival. His adopted mother stated that he had cold-like symptoms for the past few days prior to arrival, and on the day of arrival, he began to cough up blood. She brought the blood-tinged rag with her to the ED. He had vomited the night prior, as well as on the morning prior to arrival, and had diarrhea during that same time frame. His adopted mother said that the diarrhea and vomit were not blood-tinged. There had been no change to his urine output. She stated that he had a fever the night prior, as well as on the morning of presentation, with a maximum temperature of 101º F. His adopted mother said that he attends daycare, and that multiple children in his daycare had recently come down with respiratory syncytial virus (RSV).
His adopted mother stated that he was born full term with no complications. She also said that he had multiple bronchitis infections since his adoption, which she stated was at a few months of age. According to her, he is up to date on all vaccinations. Due to his adoption status, his family history was unknown.
His temperature on arrival to the ED was 98.7º F. He had a pulse rate of 131 beats per minute, a respiratory rate of 22 breaths per minute, and a blood pressure of 89/60. Physical exam revealed the presence of clear rhinorrhea as well as diffuse crackles and expiratory wheezing in all lung quadrants.
A complete blood count and comprehensive metabolic panel were all within normal limits. Chest radiographs in two views were performed, and it was determined that no acute lung abnormalities or pulmonary infiltrates were present (Figures -). A hemoccult test was done on the blood-tinged rag which confirmed that the substance was blood. It was estimated that the total amount of blood on the rag was significantly less than 5 mL. This placed him in the category of scant hemoptysis.
Throughout his stay in the ED, he did not have any additional episodes of hemoptysis. An albuterol breathing treatment was performed, which he tolerated well. On re-auscultation of his lungs, the crackles and expiratory wheezing had resolved. Given his afebrile status and prior exposure to RSV, it was determined that he likely contracted RSV from his classmates. He remained stable throughout his entire stay and was discharged home with instructions to follow up with his pediatrician. It was also recommended that they follow up with a pediatric pulmonologist for evaluation of his extensive history of bronchial infections. |
pmc-6538113-1 | A 16-year-old female was admitted in the ear, nose, and throat (ENT) ward of Dr. Ruth KM Pfau, Civil Hospital Karachi (CHK) with the complaint of ulcers in oral cavity, facial swelling along with oral and nasal discharge for the past one month. According to past history, the patient had a prior episode of DKA one month back which was managed in a local hospital setup in her hometown, Punjab. As part of that management, continuous use of oxygen mask led to the development of ulcer at the nasal bridge, which was not timely addressed. The nasal wound progressed, associated with swelling of the face and erosion of nasal bridge, septum, and palate. A yellowish foul-smelling discharge also appeared, which was occasionally blood tinged. There was no history of ulcers in the past.
On examination (O/E), the patient was conscious and well oriented to time, place, and person. Upon inspection, a defect was observed over the dorsum of her nose, about 3 cm in diameter, an absent columella, and complete absence of the nasal septum (Figure ). On eye examination, the left eye revealed decreased vision along with corneal opacities, haziness (Figure ), and discharge from middle canthal region. Pupillary reflex was also absent in the left eye. The oral cavity inspection showed missing maxillary premolar and molar teeth and a 1 cm oronasal fistula. The rest of the examination was unremarkable.
Laboratory investigations revealed hemoglobin A1c (HbA1c) of 10.5 % [Normal (N) = 4-5.6], random blood sugar (RBS) of 500 mg/dL (N = 79-160), serum potassium (K) of 3.2 mEq/L (N = 3.5-5.0), and a hemoglobin (Hb) of 8.3 g/dL (N = 11.9-15.0).The patient, despite being on an insulin regimen, had her RBS fluctuating in a broad range (60-600 mmol/L). Based on the history, presentation and examination, a working clinical diagnosis of MM infection was made. Treatment with intravenous (IV) injection of Ampho B (50 mg), clindamycin (later replaced by augmentin), and IV vancomycin was shortly started.
A CT scan of paranasal sinuses was ordered. It revealed opacification of bilateral maxillary and ethmoid sinuses with hyperdense foci extending into the left orbit (Figure ). Findings were also suggestive of a superimposed fungal infection with intraorbital extension.
The patient underwent a sinonasal debridement procedure in which the infected maxillary and frontal sinuses were surgically removed and the tissue specimen was sent for histopathologic evaluation. The biopsy report later confirmed the presence of MM, which showed broad, nonseptate fungal hyphae having right-angular branches. A brain MRI following the debridement found mucosal thickening over maxillary, left frontal, ethmoid, and sphenoid sinuses. MRI also revealed few hypointense signals invading the cribriform plate and involving the cavernous sinus and temporal lobe posteriorly (Figures -). Three months later, another debridement along with washout of the sinuses was performed. In a second brain MRI, post debridement and medical treatment, a marked improvement was reported in comparison with previous MRI; however, a new onset of left optic canal extension was observed. It was decided to continue Ampho B for a long term as the infection had not resolved. This, however, resulted in hypokalemia, which was K = 2.6 mEq/mol and continued to fluctuate.
Throughout the course of her treatment, repeated expert advice was sought from departments of ophthalmology, dental surgery, and infectious disease. Only to add to the complications, the patient was found partially resistant to Ampho B following the extended treatment duration of nearly eight months. As the infection did not resolve, MM progressed to her temporal lobe and debridement of her infected eye was not preferred keeping in light her quality of life. The patient, after being admitted for an extensive period of 10 months, has been discharged with life-long Ampho B although her prognosis remains poor. The patient is currently followed up in an outpatient department (OPD). |
pmc-6538114-1 | A 29-year-old male presented for two weeks of excruciating holocranial cephalgia accompanied by fever, myalgia, and diarrhea. He developed facial paresis with nonfocal paresthesia, bilateral scotomas, and a self-resolved erythematous patch along his inner thigh weeks prior. He endorsed dog ticks at home in Miami, Florida, but denied bites. Visual fields showed inferotemporal compromise bilaterally. Left gaze was restricted by horizontal binocular diplopia. Cranial nerves were otherwise intact and the remainder of the neurological exam was unremarkable, though he was incapable of sustaining right handgrip. Western blot demonstrated positive IgM and negative IgG for Borrelia burgdorferi. Electrocardiogram was negative. Lumbar puncture revealed clear cerebrospinal fluid (CSF) of 84 white blood cells, 96% lymphocytes, and 110 protein. Despite an atypical geographical context, he received a presumptive diagnosis of early disseminated Lyme meningitis that was treated empirically with doxycycline. Subsequent CSF polymerase chain reaction was negative for B. burgdorferi, B. lonestari, and tick-borne encephalitis. The viral panel was positive for Echovirus 30 and Coxsackie B5. His headache and vision improved gradually; however, the patient experienced distress from misdiagnosis with a life-threatening and contagious illness affecting family contact and financial burden from prolonged work leave. |
pmc-6538116-1 | A 69-year-old male with no past medical history presented with generalized fatigue and exertional shortness of breath. His initial vitals were significant for heart rate of 135 bpm with blood pressure of 108/70 mmHg. On examination, he was noted to be tachycardic with an irregular rhythm. He was also noted to have bibasilar rales and distended jugular vein. Electrocardiogram (EKG) confirmed atrial fibrillation with a rapid ventricular rate. His CHA2DS2-VASc (congestive heart failure, hypertension, age ≥75, diabetes mellitus, prior stroke or transient ischemic attack, vascular disease, age 65 to 74, female) score was 1 with HAS-BLED (hypertension, abnormal renal/liver function, stroke, bleeding history or predisposition, labile international normalized ratio, elderly (>65 years), drugs/alcohol concomitantly) score of 1 indicating need for anticoagulation with low risk for any major bleeding. He was started on intravenous heparin and diltiazem drip. His hospital course was complicated by cardiac arrest with pulseless electrical activity. He was successfully resuscitated with the return of spontaneous circulation after 8 minutes of cardiopulmonary resuscitation (CPR). Post-cardiac arrest transthoracic echocardiogram (TTE) revealed reduced ejection fraction of 10%-15% with features of LVNC. The ratio of noncompacted to compacted myocardium was 2.1 (Figure ).
Also, there was evidence of left ventricular thrombus in the apical part as seen in Figure arrow. Brain magnetic resonance imaging (MRI) done for neurological prognostication revealed multiple strokes and the decision was made to withdraw care. |
pmc-6538117-1 | A 72-year-old woman with a history of hypertension, hyperlipidemia, gastroesophageal reflux disease, gout, and polymyalgia rheumatica, and a family history of cancer began noticing a gradual loss of vision in both eyes over the course of one year. The declining vision was initially attributed to cataracts, and the patient underwent surgical intervention without noticeable improvement. Following the cataract surgery, the patient had persistent and progressive loss of vision, however, a retinal specialist did not identify any retinal pathology. Further investigation of her vision loss revealed coinciding hearing loss, prompting an MRI and subsequent referral to neurosurgery.
Upon evaluation by neurosurgery, she was found to have fully intact facial symmetry, cognitive function, and upper and lower extremity strength and sensation. Apart from the aforementioned vision and hearing issues, the patient also noticed occasional epistaxis and sinus congestion, which had been treated as a sinus infection several times over the previous year. She was also found to have disconjugate gaze along with a significantly proptotic left eye with 20/60 vision. She denied any headaches, personality changes, focal weakness, numbness, or tingling.
MRI with contrast showed a large enhancing mass, with possible intrinsic bone formation, measuring 7.6 x 2.2 x 6.3 cm (Figures -). The mass extended into the left nasal cavity, inferiorly into the nasopharynx, and superiorly into the anterior cranial fossa. It was noted that there was a destruction of the ethmoid sinus along with mass effects on the left medial rectus muscle and the left optic nerve without an abnormal signal in the optic nerves. The mass displaced the optic chiasm superiorly.
CT without contrast was performed to further evaluate the tumor and facilitate potential operative planning (Figures -) The results of the CT scan showed a large bone-forming mass centered in the ethmoid bone, invading the ethmoid sinuses, nasal cavity, left frontal lobe, planum sphenoidale, optic canals with intracranial extension, and left orbit, with retained secretions in the sinuses. A developing mucocele was present in the sphenoid sinus associated with thinning of the bony walls. Based on imaging findings, the differential included an undifferentiated sinonasal carcinoma, osteosarcoma, or, less likely, esthesioneuroblastoma.
A biopsy of the soft tissue nasal mass was obtained and submitted to the pathology department for evaluation. Hematoxylin and eosin (H&E) stained slides showed sclerotic edematous fibrous tissue infiltrated by lobules of cohesive basophilic tumor cells with a focal pseudorosette architecture. The tumor cells have a high nuclear to cytoplasmic ratio with scant eosinophilic cytoplasm, inconspicuous nucleoli, and scattered mitotic figures (Figure ). Necrosis was not identified. Immunohistochemical stains demonstrated tumor cells strongly positive for CD56 and synaptophysin with focal chromogranin staining (Figure ). An S100 stain highlighted peripheral sustentacular cells. Immunohistochemical stains CD99, CD45, and AE1/3 were all negative. In situ hybridization for Epstein Barr virus ribonucleic acid (RNA) was negative. The tumor morphology and immunophenotype confirmed the diagnosis of esthesioneuroblastoma.
After discussing the findings of the radiology studies, biopsy results, and treatment options available for esthesioneuroblastoma, the patient declined treatment of the tumor and was referred to hospice for end-of-life care. |
pmc-6538118-1 | A five-year-old boy weighing 11 kg, was brought to a public tertiary care hospital in Karachi, Pakistan by his parents. His chief complaints were described as a diffuse rash over the body, swelling of the head and bulging of both eyes as well as swelling of the gums. These symptoms were progressive and relapsing, with the rash being present since the past 18 months and having extended to a breakout over the head, neck, back, chest and perineum over the last month and the swelling and bulging having progressed over the past year.
According to his mother, the child had been in absolute good health until the age of two years, when he developed a spontaneous fracture of his right clavicle. The family was counseled and told the fracture would heal without any intervention. At two-and-a-half-years of age, the family sought a dental consult for a spontaneously broken tooth which was described to them as a developmental problem of the mandible. Further on, at three years of age, the child developed an infected oral ulcer, a severe swelling of his gums and had two episodes of a yellowish ear discharge for which he underwent drainage. His bodily rash made its first appearance six months after that, at 3.5 years of age, presenting as yellow lesions with pus filled discharge over the head, palms, soles and genital area - albeit, healing afterwards. The swelling of the right side of the head and bulging of both eyes started at the age of four years, with the proptosis gradually progressing to its current state upon presentation and associated with dimness of vision in the right eye. The child had previously been misdiagnosed as a case of Papillon-Lefevre syndrome (rare ectodermal dysplasia characterized by palmoplantar keratoderma associated with early onset periodontitis) two years ago and prescribed fluconazole, but to no avail. He was the third offspring of a consanguineous marriage, fully vaccinated and developmentally appropriate.
On general examination, the child was conscious and well oriented, although he had had a single episode of a minute long, tonic seizure, 15 days back. He appeared underweight and shorter than the desired height for his age. He was in respiratory distress, with a respiratory rate of 50 per minute, harsh vesicular breathing and prominent bilateral crepts. His apex beat was shifted and there was a notable gallop rhythm in the heart sounds. Gastrointestinal examination showed a distended abdomen with prominent veins and a palpable liver (5 cm below the right costal margin) and spleen. He was moderately anemic, had grade 3 clubbing and moderate, bilateral, pitting, pedal edema. There was no cyanosis or jaundice. The cervical submandibular lymph nodes were palpable, as was a single node in the left axillary region - each being 1 cm in size.
Upon local examination: the head showed frontal and parietal swellings - each measuring about 5 cm by 4 cm and nontender on palpation. The ophthalmic examination showed bilateral proptosis, more on the right and with a hazy cornea, but with both pupils reactive to light. The oral cavity examination showed a gingival swelling. The skin rash appeared to be scaly, papular seborrheic dermatitis - mainly on the scalp, neck, back, palms, soles and genital area, covered with pustules and having progressed to a lacy depigmented rash after healing, in some places (Figure ).
Laboratory investigations revealed a hemoglobin of 6.6 g/dL, white blood cells - 29.7/mm3 (56% neutrophils, 39% lymphocytes), platelets - 113 x 109/L and a serum ferritin was 362 ng/ml which was significantly higher than the range for his age. The ultrasound of the abdomen exhibited an enlarged liver, bilaterally enlarged and moderately hydronephrotic kidneys and minimal pelvic ascites, without any enlarged lymph nodes. The echocardiography showed an enlarged left ventricle with generalized dysfunction and an ejection fraction of 35%. His computed tomography (CT) scan revealed an evident ground glass haze in the lungs, with thickening of skull bones, especially at the base of skull and bilateral sphenoid bones that raised the possibility of fibrous dysplasia. However, the septal thickening with ground glass haze noted in both lung fields, cardiomegaly, hepatomegaly (16.5 cm) and bilateral hydronephrosis - all suggested a more widespread, multi-system involvement, raising the possibility of LCH.
Further, the magnetic resonance imaging (MRI) of the brain and orbits showed evidence of a focal lesion, causing an erosive destruction of the calvarium within the frontoparietal region on the right side, 3 cm by 6.5 cm and another lesion causing erosive changes within the superior parietal calvarial region (the lytic lesions can be seen in the X-ray attached as Figure ). Both these lesions portrayed intracranial invasion with diffuse infiltration of meninges and compression over the cerebral cortex. Additionally, lobulated meningeal enhancement could be seen along the tentorial region bilaterally. There was diffuse and bilateral enlargement of the extraocular muscles, more marked on the right side, with involvement of the lacrimal glands. Due to limited financial resources, a bone marrow biopsy could not be ordered but a fine needle aspiration cytology (FNAC) was carried out and reported numerous multinucleated cells, foamy phagocytic histiocytes and few polymorphonuclear cells. Based on these findings, a diagnosis of malignant histiocytosis, specifically LCH, was made.
The child was started on etoposide (150 mg/m2) and prednisone (40 mg/m2/day), alongside supportive oxygen inhalation, broad spectrum antibiotics, antifungals, inotrope support, treatment for heart failure with IV furosemide and oral captopril, parenteral nutrition, a xanthine oxidase inhibitor and calcium carbonate in tablet form. He responded well to this treatment - his cardiac and renal status improved and blood pressure normalized. He is currently on the continuation phase of his treatment and regularly follows up at the oncology ward. |
pmc-6538120-1 | A 71-year-old male presented with metastatic clear-cell RCC. In November 2016, he was incidentally found on imaging to have a left renal mass but declined further workup and was lost to follow-up. The patient was subsequently noted on routine laboratories in September 2017 to have creatinine elevation to 1.45 mg/dL from an unknown baseline. Renal ultrasound revealed a solid left kidney mass measuring up to 10 cm. Systemic imaging with computed tomography of the chest, abdomen, and pelvis showed a 13.5 x 7.6 cm enhancing, exophytic mass of the left kidney and innumerable bilateral pulmonary nodules concerning for metastatic malignancy. Cytoreductive nephrectomy was performed in November 2017 and pathology showed clear-cell RCC with sarcomatoid features. Approximately five weeks later, he was initiated on systemic treatment with sunitinib 50 mg daily, six-week cycles with a two-weeks on, one-week off schedule.
Laboratories at baseline showed hemoglobin 9.1 g/dL and MCV 88.1 fL. Imaging with computed tomography after three cycles of sunitinib showed a partial response; however, serial laboratories showed the development of worsening macrocytic anemia with hemoglobin 6.6 g/dL and MCV 106.9 fL. Further laboratory workup showed total bilirubin 2.6 mg/dL, direct bilirubin 0.2 m/dL, lactate dehydrogenase 210 U/L, and haptoglobin 27 mg/dL. Direct antiglobulin testing was negative and iron studies, thyroid function tests, and liver tests were normal. Notably, the patient was found to have significant deficiencies in cobalamin (<146 pg/dL; normal, 213-816) and folate (5.9 ng/dL; normal, > 7) and peripheral smear showed numerous hypersegmented neutrophils. Testing for antibodies against parietal cells and the intrinsic factor was negative. There were no prior values of cobalamin or folate for comparison. On review of history, the patient endorsed a balanced diet with adequate intake of sources of folate and cobalamin, had no history of gastrointestinal surgeries, and denied significant alcohol use. Treatment of nutritional deficiencies was initiated with folic acid one milligram by mouth daily and cobalamin intramuscular 1000 mcg for one dose followed by cobalamin one gram by mouth daily. The patient was transfused with two units of packed red blood cells. Although there was some concern that these findings represented toxicity from sunitinib, given evidence of clinical benefit the decision was made to continue treatment with close monitoring of hematologic parameters.
Repeat laboratories during cycle four of sunitinib showed stable blood counts and normalization of cobalamin (813 pg/dL) and folate (>20 ng/mL) levels, however during cycle five the patient complained of worsening fatigue and exertional dyspnea, and laboratories showed worsening macrocytic anemia with hemoglobin 7.1 g/dL and MCV 108.0 fL. Cobalamin and folate levels remained normal. The patient was transfused with two units packed red blood cells and sunitinib was held.
After four weeks of sunitinib, laboratories showed hemoglobin 9.2 g/dL and MCV 100.5 fL, and the patient reported a marked improvement in energy. Sunitinib was restarted at a reduced dose of 37.5 mg daily on two weeks on and one week off schedule. The patient was also started on a regimen of parenteral cobalamin (1000 mcg subcutaneous daily for seven days, then weekly for four weeks, then monthly) and continued on oral folate. Following one cycle, hemoglobin was relatively stable at 8.6 g/dL and MCV had improved to 93.9 fL. Labs for several cycles thereafter showed stable levels of hemoglobin, folate, and cobalamin. Current treatment plans are to continue sunitinib with close hematological monitoring and ongoing supplementation with oral folate and parenteral cobalamin. |
pmc-6538121-1 | An eight-year-old male child presented to the pediatric department of Dr. Ruth KM Pfau, Civil Hospital Karachi (CHK) in January 2019 with the complain of ulcer on his right foot, high-grade intermittent fever without chills, and rigors and swelling in the same foot for the past three years, one month, and one week, respectively. He also had a history of urine dribbling and physical delayed development. He was a known case of MMC that was reconstructed at one month of age. As a congenital abnormality, he was also born with CF deformity for which PM was started as a treatment at four years of age. After the removal of the first cast which was applied for six months, his mother noticed ulcer on the right foot which was spreading but went untreated.
On examination (O/E), the patient was found alert and active, lying comfortably in bed. His heart rate (HR) was 88 beats/min, blood pressure (BP) was 110/80, respiratory rate (RR) was 26 breaths/min, and he was febrile with 103°F body temperature. Upon evaluation of the right foot, we found local non-tender edema over the dorsum along with ulcer and sinuses discharging pus with palpable posterior tibial artery. A scar mark was present on his back which was due to MMC repair. Upon central nervous system (CNS) examination, motor system evaluation of lower limbs revealed increased tone, slightly exaggerated reflexes especially increased dorsiflexion with the knee flexed accompanied by clonus and a power of 5/5. All other systems were unremarkable.
Laboratory investigations revealed hemoglobin (Hb) of 7.7 gm/dl, mean corpuscular volume (MCV) of 67.9 fl (Normal [N] = 76-96), mean corpuscular hemoglobin concentration (MCHC) of 28.2 gm/dl (N = 32-36), total leukocyte count (TLC) of 19.2 x 103/μL (N = 4-11) and platelet count (PLT) of 468 x 103/μL (N = 150-400). The level of C-reactive protein (CRP) was found to be 269.1 mg/L (N = <5). The clotting profile showed an international normalized ratio (INR) of 1.09 and prothrombin time (PT) of 11.4 seconds. Blood glucose, liver function tests, blood urea, and serum creatinine were not remarkable.
Electrophysiology tests, nerve conduction velocity (NCV) and electromyography (EMG), concluded the involvement of multiple lumbosacral roots on the right side and L4-L5-S1 roots on the left side. Multiple abscesses extending into deep tissues were revealed by ultrasound (US) scan of the right foot. On further investigation via a Doppler scan of the same foot, right dorsalis pedis artery (DPA) showed monophasic flow with normal peak systolic velocities which was suggestive of mild arterial insufficiency secondary to surrounding abscesses. Based on these findings, magnetic resonance imaging (MRI) of the right foot was ordered which demonstrated lytic center with a ring of sclerosis in tarsal bones (Figure ). A triple-phase technetium 99 (Tc-99) based bone scan was done which showed increased uptake in all three phases, therefore, suggested OM involving tarsal bones of the right foot. Keeping in view the provided history, clinical presentation, lab results and the radiologic findings of this patient, a diagnosis of OM secondary to PM for the treatment of CF was made.
The patient was initially started with intravenous (IV) ceftriaxone 900 mg 12-hourly along with vancomycin 360 mg 8-hourly. IV administration of provasc and dexamethasone were also given to relieve pain. Pus drainage was also done. After two weeks, ceftriaxone was replaced by IV ciprofloxacin 180 mg 12-hourly with the same dose of vancomycin. After another two weeks, ciprofloxacin was replaced by IV meropenem 360 mg 8-hourly again with the same dose of vancomycin. This regimen was also given for two weeks. The patient clinically subsided foot swelling and fever. Locally, the ulcer also healed leaving scarred skin (Figure ). He ended up with the monotherapy of meropenem 360 mg 8-hourly as a prophylaxis to complete the antimicrobial course. |
pmc-6538226-1 | A 54-year-old man presented in 2015 with a 12-month history of persistent left nasal obstruction and nasal discharge, as well as episodes of self-resolving epistaxis. He was first treated for presumed nasal polyps and sinusitis without improvement. The patient is known to have hypertension. He denied any history of tobacco or alcohol use and had no prior history of radiation.
On physical examination, the patient had a Karnofsky Performance Status (KPS) of 90%. On fiber-optic examination, there was evidence of a mass filling the left nasal cavity. No palpable cervical lymphadenopathy was noted. There was no evidence of neurological deficits, and cranial nerves, II to XII, were intact.
A computed tomography (CT) scan and magnetic resonance imaging (MRI) of the head and paranasal sinuses revealed a large, enhancing soft tissue mass (6.1 x 4.9 x 4.1 cm) centered in the sphenoid sinus with an invasion of the base of the skull and clivus(Figure ). There was also the destruction of the greater wings of the sphenoid, more on the left side, with an invasion of the left pterygopalatine fossa and extension into the left masticator space. The mass involved the sellar region and the cavernous sinus, as well as the internal carotid artery canals. The internal carotid arteries were still patent. The mass was extending and invading the posterior aspect of the ethmoid air cells. There was complete opacification of the left nasal cavity and the maxillary sinuses with obliteration of the ostiomeatal complexes by mucosal disease.
A transnasal biopsy of the lesion was performed. Morphological examination revealed well-vascularized sheets and cords of uniform round cells with a moderate amount of pink, finely granular cytoplasm. Tumor cells were strongly and diffusely positive for synaptophysin (Syn), chromogranin A (CgA), CD56, and cytokeratin AE1/AE3. They were negative for CK7, CK20, and S-100. The Ki-67 proliferative index was less than 1%. The pathological diagnosis was a typical carcinoid neuroendocrine tumor of the sphenoid sinus (Figure ).
A CT scan of the chest and galium positron emission tomography (PET) scan revealed no evidence of regional or distant metastasis. Clinical staging of this tumor, based on the American Joint Committee on Cancer (AJCC) TNM staging system for the nasal cavity and paranasal sinuses [], was T4bN0M0.
The patient was seen by a head and neck surgeon who considered that the tumor was unresectable. The patient was treated with definitive intensity-modulated radiation therapy (IMRT). He received a total dose of 60 Gy in 30 fractions (Figure ). During radiation treatment, the patient developed a grade 1 dermatitis and partial alopecia. No grade 2 or higher toxicities were reported.
The patient had a follow-up galium PET/CT scan (three months after completion of IMRT) that showed a significant decrease in metabolic activity. The size was stable, and there was evidence of central necrosis (Figure -). During his last follow-up, three years after diagnosis, a CT scan of the neck, chest, abdomen, and pelvis showed a stable tumor and no evidence of metastatic disease (Figure ) |
pmc-6538227-1 | A 32-year-old female presented with complaints of fatigue and tingling sensation in extremities. Physical exam was unremarkable without evidence of lymphadenopathy or hepatosplenomegaly. Laboratory findings were significant for hemoglobin (Hb) at 17.2 g/dL, white blood cell (WBC) count at 9 x 103/µL, and platelets 594x 103/µL. She had no fever, weight loss, joint pains or other systemic symptoms. Work up for thrombocytosis was initiated. Bone marrow biopsy showed mildly hypo-cellular marrow (40%) with normal trilineage hematopoiesis, no evidence of malignancy. Janus kinase 2 (JAK2) exon 12 mutation was negative. One month later, she presented to the emergency department (ER) with left-hand weakness and numbness. Computed tomography (CT) scan showed bilateral cervical chain lymphadenopathy and 6 x 4.5 cm soft tissue mass in the paraspinal muscle of the thoracic inlet invading the T1 and posterior rib with pathologic compression fracture (Figure ).
Open biopsy with cervical thoracic fixation from C4-T5 was done. Pathology showed neoplastic infiltration by lambda restricted monoclonal plasma cells. Flow cytometry of the tumor showed 3% lambda restricted plasma cells (Figure ).
A complete skeletal survey was negative for lytic lesions. Serum protein electrophoresis showed immunoglobulin (Ig) G lambda restricted M spike of 0.2 g/dL. Lactate dehydrogenase (LDH) was normal. Beta-microglobulin level was 2.7 mg/L. Positron emission tomography (PET) scan showed lytic lesions in her iliac bones and sacrum. A diagnosis of multiple myeloma was made and Revlimid/Velcade/Dexamethasone (RVD) regimen was given. Following treatment, her platelet count became normal at 275 x 103/µL. She had a repeat bone marrow biopsy and it was again normal with negative calreticulin (CALR) gene mutation, negative fluorescence in situ hybridization (FISH) for myeloma and MPDs and normal cytogenetics. JAK 2 mutation analysis was positive. The patient does not have any primary bone marrow fibrosis. She went on to have an autologous stem cell transplant and is currently on maintenance Revlimid therapy. |
pmc-6538228-1 | A frail, 80-year-old woman, known case of hypertension and chronic myeloid leukemia (CML) presented to the emergency department (ED) with a history of dull pain in the lower abdomen since the past four days. Along with this, she complained of absolute constipation, with three episodes of dark-colored non-projectile vomiting for four days. Her past medical history showed the presence of melena, constipation and gastroesophageal reflux disease (GERD), while her past surgical history revealed a laparoscopic cholecystectomy for cholelithiasis a long time ago. She is currently taking anti-hypertensive medications, hydroxyurea for CML and oral antacids to relieve abdominal pain when needed.
On examination (O/E), the patient was afebrile, comfortably lying on the bed and well oriented to time place and person with no signs of dehydration. Initial vitals included blood pressure (BP) of 150/100 mmHg, a regular pulse of 80 beats/min and a respiratory rate of 16 breaths/min. On inspection of the abdomen, she had diffuse abdominal distention, and while on palpation, she had mild diffuse tenderness at the right iliac fossa region, which was radiating towards left iliac fossa. Lastly, on auscultation, sluggish gut sounds were heard. No lymph nodes were palpable. Afterward, a nasogastric tube (NG) was inserted, which drained 200 ml of green-colored aspirate within 12 hours. The patient had negative Howship-Romberg sign and Hannington-Kiff sign. The hernial orifices were clinically normal, and the rectal examination was negative.
Blood investigations revealed thrombocytosis and neutrophilic leukocytosis with a total leukocyte count (TLC) of 42.6x109/L. Serum electrolytes were abnormal which became normalized after adequate intake of fluid. The abdominal ultrasound reports showed dilated bowel loops and increased bowel gases. Left-sided small, simple renal cortical cysts were also noted. The chest and abdominal CT scans revealed dilated bowel loops and free gas under the diaphragm (Figure ). The radiographs were reviewed and meticulously analyzed, and a right obturator hernia was identified.
The patient was then taken to the operating room for exploratory laparotomy. The procedure displayed 1 cm perforation in ileum on the anti-mesenteric side, which was 20 cm away from the ileocolic junction with obturator hernia of Richter’s type just distal to perforation. The loops of ileum were seen trapped between right pectineus and obturator externus muscle. This finding was pathognomonic of small bowel obstruction secondary to obturator hernia.
Hernial sac was reduced after performing adhesions and bowel decompression. A 10-cm resection of necrotic ileum was performed, then a two-layered primary end-to-end anastomosis was made using vicryl 3/0 followed by herniorrhaphy using a double-layer mesh for the closure of the obturator foramen. The midline incision was then closed in layers.
Finally, the patient developed metabolic acidosis on the fourth postoperative day which was immediately managed. Post-operative ultrasound of the abdomen and pelvis revealed right-sided mild pleural effusion and mild bilateral hydronephrosis. The patient had a satisfactory recovery and was doing well during the follow-up. |
Subsets and Splits
Exclude ER emergencies
Retrieves 100 descriptions that do not contain the terms 'ER' or 'emergency', providing a basic filter of the dataset.