_id stringlengths 7 16 | description stringlengths 55 95.2k |
|---|---|
pmc-6538236-1 | A 63-year-old Albanian man with a past medical history of prostate cancer status post prostatectomy presented with tingling and numbness in his right upper and lower extremities. These symptoms were found to have persisted for at least a month. He denied smoking, alcohol use, and drug use. The patient’s daughter noticed he had an unsteady gait and required assistance when moving, which prompted an immediate visit to the emergency room.
On the day of admission, his vital signs were a temperature of 97.9 F, heart rate of 68 beats/min, blood pressure of 137/84 mmHg, and respiratory rate of 18 breaths per minute. Upon arrival, the patient was both alert and oriented to person, place, and time. On neurological examination, he showed right-sided hemiparesis with significant leg stiffness. The patient’s strength in his right arm was 4/5 but the strength in his right leg was 3/5. The left upper and lower extremities were unremarkable. Cranial nerves 2-10 showed no deficit, however, there was difficulty with shrugging the right shoulder. He was also unable to turn his head in the left direction. The patient showed an unsteady gait upon walking, which was compensated by his non-affected side. The rest of the physical examination was within normal limits. Laboratory values were within normal limits. The initial head computed tomography (CT) and follow-up magnetic resonance imaging (MRI) were negative for a stroke (Figures -).
CT of the cervical spine showed marked degenerative changes, including moderate to severe spinal canal stenosis at C4/C5 (Figure ). Subsequent MRI of the cervical spine was performed without contrast, which showed moderate to severe central stenosis with cord compression and mildly increased T2 signal at C4/C5 and C5/C6 (Figure ).
There were degenerative findings between levels C3-C7 along with hypertrophy of the facet joints. He was started on 1000 mg solumedrol. Shortly after, the patient’s range of motion improved in the upper extremities. He also stated that he was no longer feeling weakness in the right hand. However, leg stiffness and unstable gait persisted. He was recommended fusion of C4/C5 and C5/C6 vertebra for long-term treatment and increased quality of life. |
pmc-6538237-1 | Our patient, a 57-year-old African-American male with history of cerebral palsy, presented with severely altered mental status and alcohol intoxication in the setting of diabetic ketoacidosis. His Glasgow Coma Scale (GCS) score on admission was three. Computerized tomography (CT) scan and subsequent magnetic resonance imaging (MRI) revealed a left olfactory groove mass with surrounding hypodensity concerning for vasogenic edema (Figure ) as well as a right petroclival mass.
After the patient was treated medically for his diabetic ketoacidosis and intoxication, he underwent bifrontal craniotomy and resection of the left olfactory groove mass, cranialization of the frontal sinus, as well as pericranial flap placement. Postoperatively, the patient was treated with antibiotics and a dexamethasone taper. An immediate post-operative MRI revealed good resection and expected post-operative changes. The patient did well and remained afebrile, but it was noted that he had increased swelling at his operative site. He developed a markedly elevated leukocytosis on postoperative day (POD) three. Urinalysis and chest radiographs at that time were not concerning for infections. However, blood cultures drawn grew Serratia marcescens and the patient was initiated on intravenous meropenem 2 grams every eight hours. Repeat CT imaging obtained on POD 10 revealed an enlarging epidural fluid collection as well as a new subgaleal fluid collection as shown in Figure .
Subgaleal fluid aspiration taken at the time grew S. marcescens and the patient was taken back to the operating room for wound washout. Antibiotic sensitivity analysis performed on S. marcescens revealed a meropenem minimum inhibitory concentration (MIC) of </= 0.25 mcg/mL and a gentamicin MIC of </= 1 mcg/mL.
In the operating room, immediately upon opening the galea, a copious amount of pink-colored purulent material began to spill from the wound. The bone flap was then removed and a collection of purulent material was found in the epidural space. A small subdural empyema was also discovered and subsequently removed. The wounds were irrigated liberally with saline and bacitracin solution. Any abnormal appearing tissue was removed with debridement until there was no evidence of infection.
The bone flap was then extensively cleansed using betadine scrub and was soaked in half-strength peroxide prior to replacement. A total of four drains were placed (two epidural and two subgaleal) with one of each pair serving as inlets and the others as outlets connected to vacuum drains as shown in Figure .
Saline solution containing preservative-free gentamicin at a concentration of 20 mcg/mL was continuously infused through the drains at a rate of 10 mL/hour/drain for a period of five days. The patient tolerated the treatment well and was discharged from inpatient rehab three weeks following washout. The patient completed an eight-week course of intravenous meropenem followed by oral levofloxacin for a total of six months of antibiotic coverage.
At five-month follow-up, a repeat MRI demonstrated no signs of infection as shown in Figure . The patient had completely returned to his neurologic baseline and received radiation therapy for the remaining meningioma. |
pmc-6538401-1 | The patient was a 40-year-old woman who had been diagnosed with MCTD because of Raynaud’s phenomenon, swollen fingers, heartburn, polyarthralgia, and a high anti-U1RNP antibody titer two years before admission. Echocardiography performed in the same year of diagnosis was normal, so she had been taking no medication except nonsteroidal anti-inflammatory drugs for polyarthralgia.
She developed dyspnea on exertion and skin sclerosis after she became pregnant, one year and three months before admission. She thought that these symptoms were caused by the pregnancy. She delivered via cesarean section five months before admission, but her symptoms worsened later. She also began experiencing bilateral leg muscle pain one month before admission. On laboratory examination, thrombocytopenia (11.4 × 104/μL), hypocomplementemia (C3, 68 mg/dL), elevated CPK (981 IU/L), elevated NT-proBNP (614 ng/dL), and proteinuria (urinary total protein to urinary creatinine was 1.04 g/g creatinine) were detected one week before admission. On immunological examination, anti-U1RNP antibody, anti-DNA antibody, and anti-Sm antibody were positive, while anti-PM/Scl-100 antibody and anti-Th/To antibody were slightly positive (immunoblot assay). On pulmonary function test, vital capacity as percent of predicted (%VC) was 71%, forced expiratory volume in 1 s as percent of predicted (FEV1.0%) was 86%, and diffusing capacity of carbon monoxide/vital capacity as percent of predicted (%DLCO/VA) was 69%. On echocardiography, the left ventricular ejection fraction was 69% and tricuspid valve pressure gradient (TRPG) was 64 mmHg with no other ventricular regurgitation or stenosis; dilatation of the right atrium and ventricle and exclusion of the left ventricle at the early diastolic phase were detected. On the left ventricular (LV) inflow velocity pattern, deceleration time was 160 ms and E/A was 0.85. On the tissue Doppler imaging (TDI), e′ at the septal/lateral side were 6.9/14.4 cm/s. E/e′ at the septal/lateral side was 7.9/3.8 cm/s.
Connective tissue disease-associated PAH was suspected, for which she was admitted to our hospital. Her height and weight were 155 cm and 43 kg, respectively. Her vital signs were normal. A physical examination revealed ankyloglossia, bilateral leg muscle tenderness, and skin sclerosis that had spread to her face, neck, and both hands from the fingers to the forearms; the modified Rodnan’s skin score (mRSS) was 21 points []. The manual muscle testing (MMT) results were as follows: deltoid, 4/4; biceps, 3/4; iliopsoas, 5/5; quadriceps, 5/5; hamstring, 4/4; anterior tibia, 5/5; and gastrocnemius, 4/4. Dermoscopy revealed microvascular hemorrhage in the nailfold capillaries. The six-minute walk test (6MWT) was 240 m. The chest thoracic ratio (CTR) on the chest radiograph was 44% compared with 36% two years before admission. Chest computed tomography detected no interstitial lung disease or pulmonary thromboembolism. The ventilation and perfusion scintigraphy were normal. The short-tau inversion recovery (STIR) sequence of MRI of the bilateral leg muscles showed high signal intensity. The results of right heart catheterization were: mean pulmonary arterial pressure (PAP), 43 mmHg (systolic/diastolic pressure: 70/28 mmHg); pulmonary artery wedge pressure (PAWP), 15 mmHg; diastolic pressure gradient (DPG), 13 mmHg; pulmonary vascular resistance index, 839 dynes/s/cm-5/m2 (normal range: 200-400); and cardiac index (CI), 2.67 L/min/m2.
The patient fulfilled the SLE classification criteria [], and we started treatment with corticosteroids and intravenous cyclophosphamide. We also started riociguat two weeks after admission because she also fulfilled SSc classification criteria [] and we speculated that immunosuppressive therapy alone is insufficient because her PAH was derived from components of both SLE and SSc. After two months of treatment, her symptoms and laboratory data improved: CPK declined to 31 IU/L, C3 increased to 104 mg/dL, NT-pro BNP declined to 109 ng/dL, urinary total protein to urinary creatinine declined to 0.43 g/g creatinine, CTR on the chest radiograph declined to 37%, TRPG declined to 33 mmHg on follow-up echocardiogram, 6MWT improved to 400 m, and WHO-FC improved to class I; after this time, she was discharged. Although she could continue taking maximum-dose riociguat, she could not continue the cyclophosphamide pulse therapy after the third course due to acute reactions (fever and arthralgia). Therefore, we started mycophenolate mofetil. Her TRPG declined to 28 mmHg six months after treatment and her condition remained stable for one year. Her skin sclerosis continued improving dramatically (Table , Figure ). |
pmc-6538404-1 | A 20-year-old male presented to our emergency department with a one-day history of worsening central and epigastric abdominal pain associated with multiple instances of vomiting. He denied any intake, recent trauma, or any recent infective symptoms. He also complained of chest pain, shortness of breath, and lightheadedness. Our patient was a fit and well 20-year-old male with no significant medical or family history. He had a systolic blood pressure between 100 - 140 mmHg, was tachycardic between 100 - 115 beats per minute (bpm), and required increasing amounts of opiate analgesia. His haemoglobin was 129 g/l and the lipase level was within normal limits. Computed tomography (CT) scan showed moderate free fluid throughout the abdomen, particularly within the pelvis, of an intermediate density of 35 - 40 Hounsfield units and a lobulated heterogenous mass extending from the greater curvature of the stomach into the greater omentum measuring 11.7 x 6.3 x 13.7 cm, in keeping with a neoplasm, such as a gastrointestinal stromal tumour (Figures -). A follow-up with a CT angiogram was performed to consider treatment with angioembolisation if a blush was present. This scan showed caudal migration of the abdominal mass, as well as an interval increase in haemoperitoneum, but no evidence of an active arterial haemorrhage (Figure ). These findings were initially thought to be a bleeding neoplastic mass that had ruptured from its pedicle. Our patient became acutely tachypnoeic and peritonitic. The decision was made to perform an emergency diagnostic laparoscopy. The findings of the operation were 3 litres of haemoperitoneum with a large pelvic haematoma which corresponded to the heterogeneous mass seen on preoperative CT; however, no bleeding source was found. There was also a small haematoma in the lesser sac over the proximal greater curve of the stomach. The haematoma and blood from all four quadrants and the lesser sac were evacuated, and drains were inserted. The patient remained haemodynamically stable postoperatively; his haemoglobin had dropped from 129 g/L preoperatively to 87 g/L on Day 1 postoperatively but remained stable over the course of his recovery. A CT angiogram was repeated Day 2 postoperatively which confirmed no ongoing haemorrhage (Figure ). His recovery was uncomplicated, and further investigations to date with a consultation with the vascular medicine physicians have not identified the underlying cause of the spontaneous intraperitoneal haemorrhage. Further investigations will include a CT angiogram of his head and chest to exclude aneurysmal conditions. Our patient was discharged home on postoperative Day 5. |
pmc-6538406-1 | A 76-year-old female with a past medical history significant for hypertension and dyslipidemia was admitted to our hospital for generalized weakness and decreased oral intake. She reported a weight loss of approximately 20 pounds over the course of 45 days. She denied any fevers, chills, and upper or lower gastrointestinal symptoms.
She was being evaluated by her primary care doctor for abnormal liver enzymes. Her prior to admission medications included a statin and vitamin C. The statin was stopped by the primary care provider in lieu of the abnormal liver function tests. She denied any use of over-the-counter herbal medications or acetaminophen.
Other than the signs of dehydration, the remainder of the physical examination was unremarkable. Laboratory workup showed a normal white blood cell count of 9.6 K/uL (normal range (NR): 3.70 - 11.00 k/uL), hemoglobin of 15.3 g/dL (NR 11.5 - 15.5 g/dL), hypokalemia of 2.7 mEq/L (NR 3.7 - 5.1 mmol/L), and mild hypochloremia of 92 mEq/L (NR 97 - 105 mmol/L). Blood urea nitrogen (BUN) was 24 mg/dL (NR 7 - 21 mg/dL) and creatinine was 0.92 mg/dL (NR 0.58 - 0.96 mg/dL). Liver enzymes were found to be elevated: aspartate transaminase (AST) 756 U/L (NR 13 - 35 U/L), alanine aminotransferase (ALT) 611 U/L (NR 7 - 38 U/L), alkaline phosphatase (ALP) 192 IU/L (NR 32 - 117 U/L), total bilirubin 4.8 mg/dL (NR 0.2 - 1.3 mg/dL), and direct bilirubin 2 mg/dL (NR < 0.2 mg/dL). A viral hepatitis panel and secondary liver markers, including an autoimmune panel and serum ceruloplasmin level, returned normal. Ferritin was elevated at 2,346 ng/ml (NR 14.7 - 205.1 ng/ml) as was the transferrin saturation 44% (NR 15% - 57%), raising some concern for hemochromatosis.
Computed tomography (CT) of the abdomen without contrast was non-revealing. This was followed by an ultrasound of the right upper quadrant which was remarkable for gallbladder wall thickening and sludge but was otherwise unremarkable with no intra- or extrahepatic biliary duct dilatation. Murphy’s sign was negative sonographically, and the common bile duct was reported to be 2.5 mm in diameter. Magnetic resonance cholangiopancreatography (MRCP) again demonstrated gallbladder wall thickening in addition to pericholecystic fluid and sludge in the gall bladder (Figure ). Hepatobiliary iminodiacetic acid (HIDA) scan was consistent with acute cholecystitis as the gall bladder could not be visualized on the scan (Figure ).
The surgery team was consulted, and given the HIDA scan findings, a laparoscopic cholecystectomy was scheduled. Intraoperatively, a 1 cm perforated duodenal ulcer sealed by the body of an inflamed and edematous gallbladder with no evidence of fistulation was identified. Cholecystectomy and a modified Graham patch omentopexy were performed without any complications. Biopsies later returned negative for malignancy. Helicobacter pylori immunoglobulin G (H. pylori IgG) antibody tested positive, and the patient was started on triple therapy (i.e., amoxicillin, clarithromycin, and pantoprazole).
The postoperative course was uneventful. She started regaining her appetite and was able to tolerate a regular diet over the course of the next few days. Liver enzymes downtrended with a reported AST of 102 U/L, ALT of 120 U/L, ALP of 91 IU/L, and total bilirubin of 1.5 mg/dL on the day of discharge. |
pmc-6538410-1 | A 56-year-old female with a history of primary biliary cirrhosis, disease-related muscular weakness, and progressive respiratory failure with a tracheostomy presented from a nursing home with coffee ground emesis and respiratory distress. A percutaneous endoscopic gastrostomy tube was placed six months ago without any complications. On examination, the abdomen was soft, mildly tender to palpation around the PEG insertion site without any signs of peritonitis. Leakage around the PEG tube was noted with surrounding erythema and swelling. Granulation tissue was visible arising from the PEG tube tract. Laboratory examination showed 10,500 white blood cells/µL (70% neutrophils) and a hemoglobin of 12 gms/dl.
A computed tomography (CT) scan of the abdomen demonstrated erosion of the gastrostomy tube through the stomach wall (Figures -). A contrast study was not performed given the CT scan findings, for fear of causing peritonitis. An upper endoscopy revealed a gastrostomy tube whose internal bumper was found to be eroding into the wall of the gastric antrum (Figure ). There was surrounding erythema, inflammation, and ulceration. No signs of free perforation were seen on endoscopy. The patient was managed with removal of the existing gastrostomy tube and placement of a gastro-jejunal tube at another site, both performed by interventional radiology. The patient reported significant pain relief after the procedure and was discharged to complete a five day course of ciprofloxacin. |
pmc-6538411-1 | A 42-year-old Hispanic man with a history of tattoos covering 80% of his body surface area and regularly shaven legs presented for evaluation of an asymptomatic solitary leg lesion within a tattoo. Further history revealed that his leg tattoos were done in his early twenties with a touch-up three years prior. Subsequently, he developed a papule that was progressively increasing in size within the area that received additional tattoo pigment during the touch-up.
Cutaneous examination revealed a 5 x 5 mm dermal papule within the green tattoo pigmented area on the left pretibial leg (Figure ). There was a depression in the center of the papule. An excisional punch biopsy was performed.
Microscopic examination showed bone (with Haversian canals) in the upper dermis that was perforating through the overlying epidermis. The site of perforation demonstrated a keratin-plugged crater and extension of the adjacent hyperplastic epidermis into the dermis. A proliferation of small endothelial-lined vessels and a predominantly lymphocytic inflammatory infiltrate was located in the dermis beneath the site of perforation and surrounding the bone. Also present in the dermis, adjacent to the bone, was pigment from his green tattoo which appears as small black particles (Figure ).
He had no recurrence at six-month follow-up. |
pmc-6538945-1 | A male neonate weighing 2,020 g was given birth to by a 33-year-old Chinese mother (gravida 2, para 2) via cesarean section. The parents are non-consanguineous. During the first 5 weeks of pregnancy, the mother was treated with progesterone, and dydrogesterone until week 13 of gestation due to the signs of abortion. At week 24 of pregnancy, edema developed at the mother's lower limbs and gradually aggravated to anasarca at the end of the pregnancy. The mother was diagnosed with gestational diabetes at week 25 of gestation and her blood sugar levels fluctuated within a normal range through diet control. By 36 weeks, an ultrasound showed oligohydramnios and a normal heart silhouette, increased cardiothoracic ratio, and a small lung volume, indicating pulmonary hypoplasia (). The family history was unremarkable.
Labor was induced considering the oligohydramnios and a 3-h premature rupture of the fetal membrane at week 36. The placenta was grayish red and the focal purple red. No abnormalities were found in the umbilical cord. The Apgar scores of this neonate at 1 min and 5 min were 5 and 7, respectively. Ten minutes after birth, the neonate was admitted to the neonatal intensive care unit (NICU) for ventilation support due to tachypnea.
A physical examination on admission showed a weak response, weak crying, hoarseness, respiratory distress, positive signs of triple concave and anasarca. The neonate had many special clinical phenotypes (). The facial features included dysmorphic hypertelorism, down-slanting eyes, an eye movement disorder, ectropion, hypophasis, thickening of the helix, constriction of the auricular rim, curl of the auricle and auricle cartilage, a flat nasal bridge, small nostrils, and everted lips. Ichthyotic and collodion skin covered the entire body with a shiny, red and tight appearance and was very friable, much like a layer of gelatinous film. The skin on the hands, feet, groin and scrotum was peeling extensively, and red tender skin was exposed. The breath sounds were clear, and no rales were heard during the auscultation of both lungs. A continuous machinery rumbling murmur was heard at the upper left sternal edge. A 3/6 pansystolic murmur was heard all over the precordium but clearest at the left sternal edge. The abdomen was markedly distensible. The liver was 5 and 6 cm under the right costal margin and under processus xiphoideus, respectively. The spleen was 6 cm below the left costal margin. Both organs had an extremely firm, stone-like texture when palpated. The neonate was immobile unless upon stimuli, accompanied by flexion contractures at the elbow and knee joint, hypertonia, akinesia. Myoclonic movements were noted soon after birth. Myoclonic seizures manifested through limb jitters that lasted about 10 s before alleviation. The bilateral testis did not descend to the scrotum. The neonate had small microcaulia. Primitive reflexes were not elicited.
At birth, the CBC indicated a platelet count of 19,000/mm3, WBC 11,880/mm3, and hemoglobin at 143 g/L. At 2 d of age, the CBC indicated the platelet count at 8,000/mm3, WBC 13,170/mm3, and hemoglobin at 165 g/L.
A liver function test noted hypoproteinemia (TP 53.1 g/L, ALB 26.9 g/L); elevated enzymes (AST 123.4 U/L); and cholestasis (TBILI/ DBILI 43/28 μmol/L, TBA 25 μmol/L, γ-GT 183U/L, ALP 249 U/L), LDH 326 U/L at birth. The peak values of TBILI 89 U/L, DBILI 69 U/L, TBA 37 μmol/L, γ-GT 773 U/L, ALP 296 U/L, LDH 1055 U/L.
The initial coagulation test showed the following: PT of 25.7 s, APTT of 40.4 s, TT of 26.4 s, INR of 2.08, FIB 0.79 g/L.
The neonate underwent a bone marrow puncture at 5 d of age because he had no response to intravenous platelet and gamma globulin treatment. Bone marrow aspiration indicated proliferous granulocytic cells and erythroid cells. The ratio of lymphocytes was high. Three megakaryocytes were found in the whole smear. No Gaucher cells were found.
The pathology of the placenta, fetal membrane and umbilical cord showed chronic inflammation with placental villi denatured necrotic calcification focus and umbilical cord arteriovenous congestion and focal hemorrhage.
At birth, an echocardiography revealed (1) normal size of the atrium and ventricular chamber, normal thickness of the ventricular wall, normal structure of the valve; (2) normal connection and inner diameter of the aorta and pulmonary artery; (3) LVEF 62%; (4) CDFI: a patent ductus arteriosus with continuous left-to-right shunt signal between the root of the left pulmonary artery and the initial segment of the descending aorta, a beam width of 1.5 mm; ventricular septal defect with small left-to-right shunt signal in the middle segment of the ventricular septum during systole, a beam width of 1.2 mm, Vmax 3.0 m/ s, PGmax 37 mmHg measured by CW; a moderate reflux signal at the atrial side of the tricuspid orifice during systole, Vmax 3.3 m/ s, Pgmax 44 mmHg, moderate tricuspid regurgitation measured by CW, the pulmonary artery systolic pressure of 54 mmHg estimated by the degree of tricuspid regurgitation.
An abdominal ultrasound showed palpable hepatosplenomegaly and cholestasis. A genital ultrasound revealed that the bilateral testis had hydrocele. At 2 d of age, lung computed tomography indicated a lack of air in the lungs (), and a brain computed tomography revealed multiple hemorrhagic lesions in the left frontal, temporal and parietal lobes (). At 9 d of age, a craniocerebral MRI disclosed a small hemorrhagic lesion in the left parietal lobe accompanied with a widening of part of the external space. At 14 d of age, the neonate developed frequent tonic seizures and an electroencephalogram showed sharp waves, spike waves, and outburst suppressions. The sleep cycle was not observed. At 16 d of age, no hemorrhagic lesions were found in the craniocerebral MRI.
At 19 d of age, an echocardiography demonstrated LVEF 63%, VSD with small left-to-right shunt signal and a pulmonary artery systolic pressure of 47 mmHg. At 35 d of age, an echocardiography demonstrated LVEF 60%, VSD and a pulmonary artery systolic pressure of 38 mmHg.
Cytogenetic evaluation revealed 46 XY. No copy number variation associated with clinical symptoms was detected in the whole genome copy number variation analysis.
We correlated all the aforementioned manifestations with a possible metabolic disease. At 44 d of age, the leukocyte enzyme assay for β-glucocerebrosidase revealed an activity of 0.00 nmol/h/mg (control range: 10–25 nmol/h/mg), explicitly supporting the diagnosis of PLGD. Testing of the mother and father revealed serum β-glucocerebrosidase enzymatic activities of 13.3 and 17.8 nmol/h/mg, respectively. Urinary screening for metabolic disorders by GCMC was negative.
The proband's GBA sequencing analysis demonstrated two heterozygous mutations, Gly234Glu (c.701G>A; p.G234E) in exon 7and His413Pro (c.1238A>C; p.H413P) in exon 10 ().
Following admission to the NICU, the patient was given non-invasive respiratory support. Without sucking and swallowing, he was always kept fed through a gastric tube. With refractory thrombocytopenia, he was treated with 2 days of an intravenous infusion of gamma globulin (1 g/kg/d) and intermittent multiple transfusion of platelets; the platelet count fluctuated between 22,000 and 68,000/mm3. After treatment with intravenous infusion of vitamin K, ethamsylate and cryoprecipitate, anomaly coagulation parameters were improved. Levetiracetam, and phenobarbital were administrated orally to control the severe myoclonus, but the symptoms were poorly controlled. At 44 d of age, with the confirmation of PLGD diagnosis, the treatment was discontinued upon the parent's request. The patient was then discharged and taken home.
During the follow-up period, the patient kept gastric tube feeding, had no increase in physique, and gradually developed a pale face, obstinate hiccups, progressive neurological deterioration, hepatosplenomegaly, abdominal varicose veins, systemic edema (especially in the lower limbs and scrotum). He was supplied with humidified oxygen via a face mask, adequate caloric intake was ensured and excessive salt intake was avoided. He was also given dihydrochlorothiazide, spironolactone, and lanatoside C. However, respiratory failure, hepatic failure, and renal failure gradually occurred. The patient died at the age of 73 days. |
pmc-6539516-1 | A 47-year-old woman with a previous diagnosis of anaplastic oligoastrocytoma grade III with 40% Ki-67 labelling had a surgery in another hospital. She was referred to the A.C.Camargo Cancer Center for follow up care. Before chemoradiation therapy started, recurrence was detected and the patient underwent a second surgery. After the second surgery, histopathological analysis confirmed the evolution to a secondary GBM. The patient received chemotherapy (Temozolomide) and radiotherapy after the second surgery and had a survival of 16 months after the diagnosis. We received eight histologically distinct fragments from the second surgery, which were classified as high- or low-grade, by an experienced pathologist according to the 2016 World Health Organization Classification of Tumors of the Central Nervous System []. The tumor was obtained with patient informed consent. Protocol was approved by the Institutional Ethics Committee in 11/12/2012 (CEP #1692/12). |
pmc-6540360-1 | A 45 years old male patient, attended the neurology emergency department on 3rd January 2016 due to right limb numbness for 6 days and convulsive seizure for 3 days. Six days before the hospital visit, the patient experienced numbness in the right upper limb and instability while holding without obvious incentive but did not seek immediate medical intervention. Three days before admission, the patient experienced convulsive seizure in the right upper limb while remaining conscious, which was relieved after 1 min. Similar attacks occurred intermittently on six further occasions. The patient had a 3-year history of hypertension with the highest blood pressure being 180/110 mmHg. He also had a history of smoking and drinking lasting more than 30 years. He was born and has always lived in Beijing, with no history of contact with infested water, infectious zone, other radioactive substances or toxins. Upon admission, the patient was examined to be obese with no subcutaneous nodules. Neurological examinations showed full level muscle strength in the right upper limb, accompanied with diminished needling response. Emergency head CT scan (2016-1-1) showed lower density in the left parietal lobe. As the patient manifested as an acute onset of right limb weakness and hemiparesis,with low density lesions in the left occipital lobe on CT and a history of hypertension, the patient was hospitalised with a preliminary diagnosis of acute stroke and secondary epilepsy.
After hospitalisation, head MRI scan (2016-1-4) displayed a lesion in the left parietal lobe of unknown nature. After enhancement in the magnetic field, a larger area of oedema was found around the lesion in the left parietal lobe which could indicate glioma or other inflammatory diseases. Since the nature of the brain lesion did not match the characteristics of common cerebrovascular diseases, intracranial angiography DSA was used but found no obvious vascular abnormalities or stenosis. Further examinations including lumbar puncture, immune rheumatoid factors and parasite antibody detections were carried out. A raised cerebrospinal fluid pressure was found to (215 mm H2O) with no red or white blood cells present. After consultation within the neurology department, intracranial tumor was considered and therefore prepared for stereotactic biopsy of the brain. At this point, pathology results came back positive for Spirometra mansoni IgG. On further questioning the patient admitted that he had drank tap water and eaten frogs when travelling in another province during June–September 2015. Given his medical history, and results from head MRI and blood tests, the patient was considered to be infected with Spirometra mansoni and surgical intervention or antihelmintic chemotherapy was recommended .
The patient accepted pharmaceutical treatment and was given praziquantel (1600 mg, 20 mg/kg) 3 times a day for 10 days. During these 10 days, the patient reported occasional headache and was treated for dehydration before discharge from the hospital. The patient was also administration oral sodium valproate 500 mg 3 times a day to control seizures.
The patient was hospitalised again in March and July 2016 and treated with praziquantel (1600 mg,20 mg/kg) 3 times a day for 10 days. His headaches were eased with intravenous infusion of 20% 250 ml mannitol twice a day.
Lumbar puncture (Table Examination of cerebrospinal fluid), head MRI, blood biochemistry, conventional blood analysis and parasite antibody examinations (Table Spirometra mansoni IgG antibody) were also carried out on both occasions. On 13th Jul 2016, the patient was free from numbness and seizures in the upper limb.
Table displays the laboratory results of lumbar puncture performed on the three occasions when he was admitted to hospital and during the 1-year follow-up appointment. CSF analysis showed normal results except for a few white and red blood cells during his second hospital stay most likely resulting from the procedure itself. Table shows the Spirometra mansoni IgG result on three occasions. Note that the IgG result became negative during his third hospital stay following three courses of praziquantel treatment.,.
Enhanced head MRI scans were performed during the three hospital stays in January, March, and July 2016. Figure A-A3display head MRI scans performed on 8th January. The scans showedan abnormal horseshoe signal in the left parietal lobe with a low T1WI signal and a high T2WI + FLAIR signal. Enhanced scan showed irregular wreath in the lesion without enhancement in the surrounding. This type of abnormality in the left parietal lobe may indicate glioma. During the second hospital stay, the MRI scan carried out on 17th March showed abnormal small stripes of signal shadow in the left parietal lobe with a decreased range. It also showed clearer abnormal veil-like signal shadow in the left parietal lobe as compared to the previous MRI scan. These results may indicatethe presence of Spirometra within this area of the brain. During the third hospital stay, MRI scan on 7th July detected only minor abnormalities in the bilateral frontal lobes and parietal lobes indicating that the lesions has reduced significantly or resolved. The follow-up on 12th December showed no abnormality in the head MRI scan. MRI scans from each hospital visit are shown in Fig. . |
pmc-6540441-1 | A 23-year-old female patient who is known to have type 1 diabetes mellitus since the age of 12 years. Her blood sugar had been poorly controlled. She was transferred to our hospital from another institution in April, 2017 for evaluation of anasarca. Two months prior to her admission she started developing generalized body swelling with no associated arthritis, arthralgia or hair loss. There was no family history of similar illness. Her weight was 140 kg. Her weight prior to her illness was around 70 kg. Her exam was significant for massive anasarca involving all extremities, abdominal wall and back. She developed bilateral pleural effusions and pericardial effusion with tamponade. She later on developed bilateral foot drop, adrenal insufficiency, hypothyroidism, acute kidney injury and end stage renal disease (ESRD) (Fig. ). |
pmc-6540443-1 | A 42-year-old woman from India (Asian by ethnicity) without any known comorbidities developed gait and stance unsteadiness around 1 month prior to presenting to us. It was rapidly followed by development of tremulousness in both hands, particularly while reaching for a target. Her first medical contact was through an orthopedic surgeon when she suffered a fall at around 2 weeks after the onset of her illness. At that time, she was diagnosed was having a fracture of her right tibia and received plaster casting of her right leg. However, her neurological illness continued to go downhill as she developed intermittent abnormal twisted posturing of her right hand, suggestive of focal dystonia. Subsequently, she developed progressive deterioration of her cognitive function for around 2 weeks before coming to our care. Reduced attention span, impairment of short-term memory, behavioral abnormality, and language problems in the form of comprehension difficulty as well as irrelevant talking were the major features at the onset of her cognitive disturbance. On detailed questioning, her family members admitted to the presence of intermittent brief rapid involuntary jerks involving one limb at a time, suggestive of myoclonic jerks, which used to persist during sleep as well. Over the course of 3–4 days prior to admission, her higher mental function deteriorated severely enough amounting to akinetic mute state. There was no family history of similar illness. On neurological examination, she was found to have akinetic mute state, paratonia in both upper limbs and left lower limb, intermittent focal myoclonic jerks, and bilateral extensor plantar response. Keeping all these in mind, differential diagnoses were formulated: encephalopathy which might have been due to metabolic factors or an autoimmune process, or an infective pathology such as prion disease. She was investigated thoroughly; her blood count and metabolic parameters were within normal limits. Anti-thyroperoxidase (TPO) antibody in serum turned out to be negative. Anti-nuclear factor was also negative. CSF cytology and biochemical parameters were within normal limits and culture was negative. Tests for syphilis, human immunodeficiency virus (HIV), herpes simplex virus, human herpes virus-6, C-reactive protein, folate, vitamin B12, erythrocyte sedimentation rate, and homocysteine levels were all negative. Paraneoplastic markers in CSF also came to be negative. MRI of her brain revealed bilateral caudate nucleus and putaminal hyperintensity in T2/fluid-attenuated inversion recovery (FLAIR) sequence as well as in diffusion-weighted imaging (Fig. ). Restricted diffusion was also observed in multiple cortical areas, mostly in parieto-occipital and insular regions bilaterally (more on right side), resembling ribbon pattern. An EEG showed diffuse slowing of background activity with periodic sharp wave complexes along with intermittent triphasic waves (Fig. ). A diagnosis was provisionally established based on the positive result of 14-3-3 protein detection in CSF.
Once the diagnosis and prognosis were conveyed to our patient’s relatives, they decided to take her back to a local hospital for terminal care. The details of the follow-up, therefore, could not be obtained in this case. |
pmc-6540500-1 | In 2013, a 72-year-old Caucasian male patient with extensive history of sun exposure
presented with right eye pain and associated forehead dysesthesias. He was noted on
examination to have a palpable 3 mm dermal nodule within the right lateral eyebrow.
Biopsy revealed keratin-positive SCSCC with PNI. Staging computed tomography scans
revealed no evidence of metastasis. Mohs surgery performed in February 2014
confirmed a stage 1 lesion without extension to the epidermis and negative surgical
margins.
In August 2014, he developed double vision and right upper facial pain. He was found
to have a right cranial nerve (CN) VI palsy and partial CN III palsy. The etiology
of the right facial pain was not clear at the time. Magnetic resonance imaging (MRI)
of brain and computed tomography imaging in September 2014 were negative; however,
his symptoms progressively worsened. Repeat MRI of brain in February of 2015
revealed a new 0.6 × 0.5 cm right Meckel’s cave lesion. Due to the location and the
size of his central nervous system (CNS) lesion, it was not deemed safe for biopsy
by the neurosurgical team. Given the anatomical distribution and symptoms reported
by the patient, it was assumed that the SCSCC previously resected from the right
eyebrow had tracked along the VI branch of CN V through the cavernous sinus to the
right Meckel’s cave resulting in additional cranial neuropathies of CN III and CN
VI. The workup for other malignancies was negative. The patient received external
beam radiation to the area of the original SCSCC and brain. The radiation resulted
in significant improvement in the right upper facial pain. In February 2016, he
developed left arm weakness and underwent another surveillance MRI of brain that
showed a new extensive T2/FLAIR hyperintensity centered in the right brainstem with
a 1.2 cm enhancing lesion in the right pons. He underwent gamma knife therapy that
was completed in March 2016 with no recurrence of disease through June 2016.
However, in September 2016, he developed recurrent left upper and new lower sided
weakness and gait instability. Physical and occupational therapy evaluations at the
time showed profound left-sided leg weakness and foot drop requiring bracing and a
cane for ambulation. A repeat MRI revealed changes assumed to be
radiation-associated necrosis, and he was treated with pulse dose steroids. In
January 2017, he was admitted for profound weakness, despite MRI showing stable
disease. In May 2017, he presented with vertigo and left eye abduction deficits and
worsening left-sided weakness. An MRI showed interval increase in the enhancement of
the V3 portion of the right trigeminal nerve extending into the foramen ovale and
destruction of the clivus on the right side with involvement of the right sixth CN
().
At this point, the patient was no longer a candidate for any further radiation
treatments given extensive prior treatment. He was considered for the SWOG S1609
DART trial (Dual Anti-CTLA-4 and Anti-PD-1 Blockade in Rare Tumors), but the risks
of acquiring a biopsy for study enrollment from the brainstem lesion were felt to be
too great. The tumor specimen originally resected from the right eyebrow in 2013 was
sent for further profiling and found to have retained expression of PMS-2, MLH-1,
MSH-6, and MSH-2 PDL1, therefore was unlikely to be microsatellite instability high.
However, the PDL1 score was found to be between 1% and 5%. In July 2017, the patient
was started on pembrolizumab 200 mg every 3 weeks after his steroid dosing was
steadily lowered to prednisone 10 mg. Given the convenience of every 21-day dosing,
pembrolizumab was chosen over nivolumab. Within 6 weeks of starting PD1-inhibitors,
the patient experienced dramatic neurological improvement in his arm weakness and
gait. He regained the ability to walk without any assistance and has continued to
experience progressive reduction in his residual deficits of right face numbness and
paresthesia. During treatment with pembrolizumab, he did experience a mild rash,
which was evaluated by dermatology and felt to be more consistent with his known
history of rosacea than an immunotherapy-related rash. Repeat MRI as of November
2018 has demonstrated continued response with near complete resolution in
enhancement along the pontomedullary junction in the region of CN VI, with stable
disease at the right clivus, and with no new areas of enhancement (). |
pmc-6540546-1 | A 14-year old female patient from Bangladesh presented with serum total bilirubin levels around 250 μmol/L and conjugated bilirubin (measured as direct bilirubin using the Diazo method) of around 10 μmol/L, indicating a predominantly unconjugated hyperbilirubinemia. According to her parents’ description, her weight at birth was around 2000 g and 4 days after birth, her skin turned yellow. Clinical assessment revealed an unconjugated hyperbilirubinemia of 220 μmol/L without signs of erythrocyte hemolysis (major cause: ABO or Rh incompatibility). After undergoing phototherapy for 4 h a day for 4 consecutive days the serum total bilirubin levels were reduced to 153 μmol/L. The parents were advised to keep their daughter in the sunlight, but after a few months her serum total bilirubin increased again to over 300 μmol/L. From this point onward, the patient did not receive treatment and no clinical data is available because the family lives in the country side and has limited access to medical care. Between the age of 14 and 17 years her serum total bilirubin levels have been monitored and where stable around 200–250 μmol/L. Liver damage markers in serum were low (ALT) and a hemolytic cause of the hyperbilirubinemia was excluded with normal hemoglobin and reticulocyte levels (Table ). These serum bilirubin levels without any treatment are in line with those seen in Crigler-Najjar syndrome (CNs) type II, indicating a partial deficiency of UGT1A1. However, inducing the residual UGT1A1 activity by administrating phenobarbital (30 mg/day) did not result in a significant change in total bilirubin (Table ). The coding region and intron-exon boundaries of the UGT1A1 gene of the patient and parents was sequenced to determine what caused UGT1A1 deficiency and the absence of a response to phenobarbital.
Sanger sequencing was used to determine the nucleotide sequence of amplified fragments of UGT1A1 gene and promoter region as previously described [, ]. The purified amplicons were sequenced using the internal primers listed in Additional file : Table S1.
The patient was found to have two heterozygous mutations in the UGT1A1 gene (Fig. ). The first is a 3 nucleotides insertion in the HNF-1α binding site in the proximal promoter, which was also found in her mother. The second mutation is a two nucleotides deletion in exon 1 (266_267delGT), which was found in her father. This two nucleotide deletion has not been described in literature before and results in a frameshift with a predicted premature stop codon at position 279_281TAG in exon 1. |
pmc-6540571-1 | A 42-year-old woman was admitted to our hospital with a 1-month history of melena and mild abdominal pain. She denied nausea, vomiting, hematemesis, jaundice, cough, hemoptysis, fever, and/or menstrual abnormalities. She had no significant medical history or family history of pulmonary TB. She also denied tobacco or alcohol abuse. Upon admission, her general examination showed pallor, and abdominal examination revealed mild upper abdominal tenderness. Laboratory findings were as follows: hemoglobin 76 g/L, hematocrit 25.6%, mean corpuscular hemoglobin 25.3 pg/cell, erythrocyte sedimentation rate 36 mm/hour, and a C-reactive protein level of 24 mg/L. A T-SPOT.TB assay was performed and showed a positive result. Hepatic enzymes such as alkaline phosphatase, as well as bilirubin, albumin, prothrombin time, and partial prothrombin time showed no abnormalities. Additionally, the human immunodeficiency virus, a hepatitis panel, and tumor markers were negative. After treatment with pharmacological agents, such as proton-pump inhibitors and octreotide, active gastric variceal bleeding stopped.
Gastroduodenoscopic examination showed isolated gastric fundal varices with red color signs (Fig. a). Colonoscopic examination did not reveal any abnormality. Abdominal contrast-enhanced computed tomography (CECT) revealed non-enhanced masses of soft-tissue density in the lesser omentum and behind the head, body, and the tail of the pancreas, as well as multiple para-aortic lymph nodes and multiple small hypodense splenic lesions (Fig. b). CECT findings were suggestive of an infectious or metastatic disease or lymphatic cysts. Whole body [F-18]2-fluoro-2-deoxyglucose (FDG) positron emission tomography (PET)-CT was performed to evaluate for lymphoma and metastatic disease. This test showed hypermetabolic lymph nodes in the right supraclavicular fossa, right tracheoesophageal groove, the lesser omental and retropancreatic areas, the mesentery, the porta hepatis, the splenic hilum, and the retroperitoneum with maximum standardized uptake values (SUVmax) ranging from 5.3–7.5 (Fig. c). Additionally, the bone marrow showed hypermetabolic FDG activity with a SUVmax of 5.2. The PET/CT findings were suggestive of lymphoma.
Bone marrow biopsy revealed no abnormality. Subsequently, endoscopic ultrasonography (EUS) was performed and revealed a hypoechoic mass at the splenic hilum, compressing the splenic vein (Fig. d). EUS-guided fine-needle aspiration was performed to obtain tissues for histopathological examination. Histopathological examination showed sheets of inflammatory cells, primarily lymphocytes and macrophages along with some glandular tissue. CT-guided biopsy of the retroperitoneal lymph nodes was performed to establish a definitive diagnosis, and the histopathological examination of these biopsy specimens showed necrotizing granulomatous inflammation and microorganisms that stained positive with acid-fast stains (Fig. a-c).
Based on all the aforementioned findings, she was diagnosed with abdominal TB. Anti-TB treatment comprising rifampicin, isoniazid, and ethambutol was initiated following histopathological confirmation. After leaving our hospital, she went to a TB hospital for further treatment, where her doctor added pyrazinamide to the treatment. She received a 6-month regimen of rifampicin: 2HRZE/4HR. During the course of treatment, the patient experienced mild elevation of transaminase. Abdominal CECT showed a decrease in the size of the lesser omental and retropancreatic masses, as well as the para-aortic lymph nodes after 4-month anti-TB therapy (Fig. d). The patient was asymptomatic at her 12-month follow-up. |
pmc-6540646-1 | An otherwise healthy 15-week-pregnant woman in her 30s experienced fever, diarrhoea and abdominal pains while visiting relatives in Karachi, Pakistan during March and April 2019. In Pakistan, she had been treated with oral cefixime for 1 week. Upon return to Denmark, 2 weeks after initial symptoms, she presented to the emergency department but was not admitted as she was afebrile with normal pulse and blood pressure. No blood tests were done. Two days later, her family doctor admitted her to the Copenhagen University Hospital Hvidovre with fever and abdominal pain. The shows the sequence of antibiotic treatment starting from admission, with corresponding daily level of C-reactive protein (CRP; normal < 10 mg/L) and body temperature.
The day after admission (Day 2), an in-house PCR on a rectal swab was positive for Salmonella spp. Based on this finding and because fever and tachycardia continued, treatment with intravenous (iv) ceftriaxone 2 g once daily was started. On Day 4, Salmonella spp. was detected by direct matrix-assisted laser desorption/ionization (MALDI Sepsityper, Bruker, Billerica, United States (US)) in blood cultures drawn on Day 2 (Bactec, BD Diagnostics, New Jersey, US). On Day 5, S. Typhi was identified by agglutination test (Salmonella Antisera, SSI Diagnostica, Hilleroed, Denmark). Based on the results of antibiotic susceptibility testing (AST), reported below, treatment was changed to iv mecillinam (1 g three times/day), a decision also taken in consideration of the pregnancy since penicillins are generally considered safe during pregnancy. The patient deteriorated on this treatment and on Day 8, treatment was changed to azithromycin (500 mg/day iv). Because of continuing fever and further increase in CRP, meropenem (1 g three times/day) was added on Day 9. Subsequently, clinical improvement with defervescence and decreasing CRP was seen.
After finding the ceftriaxone-resistant S. Typhi, carriage of other multiresistant microorganisms was suspected and the patient was screened for faecal carriage of carbapenemase-producing microorganisms. After the detection of an OXA-48 carbapenemase-producing Escherichia coli, the patient was isolated to prevent spread.
The patient was discharged on Day 15 with oral azithromycin. The fetus remained healthy. |
pmc-6540962-1 | The index patient of this family study is a 32 year old female from Austria, who presented with a long standing history of myalgias and recurrent, exercise-induced rhabdomyolysis episodes accompanied by myoglobinuria. First symptoms occurred in childhood, around 5 years of age. After prolonged physical activity such as hiking or skiing she experienced severe myalgias and muscle weakness combined with dark colored urine. At this point, however, she did not seek medical attention and the episodes self-resolved. Several years later she moved to Australia, where she was admitted at the age of 32, to the acute medical unit of the Royal Adelaide Hospital (Australia) due to severe whole-body rhabdomyolysis with myoglobinuria. Her creatine kinase (CK) level was significantly raised to 45,560 U/L, but her kidney function was normal. She was treated with an intravenous fluid therapy and was kept in the hospital for the following 5 days, where her muscles aches gradually improved and her CK levels decreased. In her family history she reported that her maternal uncles were also affected by recurrent episodes of rhabdomyolysis and myoglobinuria.
A subsequent mutation analysis of the CPT2 gene using a custom 1,037 gene Roche 1 k Disease (R1kD) Seq Cap EZ capture kit on a NextSeq® Sequencing System instrument (Illumina, San Diego, CA, United States), revealed a homozygous c.338C > T mutation, confirming the diagnosis of the suspected adult muscular form of hereditary CPT II deficiency.
Thereupon, the Austrian family members of the index patient were invited to take part in this family case study. All participants gave written informed consent for genetic testing of the CPT2 c.338C > T variant as well as for their participation in the study and for publication of this case report. Genotyping analysis was performed by Sanger sequencing as described in the . The pedigree of the index patient together with results from genotyping is given in . Sequence analysis showed that all four maternal uncles of the index patient were homozygous for the CPT2 c.338C > T allele (participants 8, 9, 10, and 11 in the pedigree). Information on age at which symptoms first appeared, hospitalization due to rhabdomyolysis, nutrition, and sports activities was obtained by a standardized questionnaire.
All four maternal homozygous uncles aged between 57 and 61 years reported recurrent events of exercise-induced myalgia and rhabdomyolysis of various degrees, with first symptoms occurring during childhood, between five and eight years of age. Prior to this study, for three of them (participant 8, 10, and 11 in the pedigree) severe whole-body rhabdomyolysis accompanied by myoglobinuria, had led to hospitalization, at least once. Tandem mass spectrometry analysis of a muscle biopsy sample of participant 8 showed elevated long-chain acylcarnitine levels (C16 and C18:1), associated with CPT II deficiency. Furthermore, enzyme activity of CPT II in leukocytes was only at 3% of the control value, confirming diagnosis of CPT II deficiency for participant 8. Although a metabolic myopathy was suspected for participants 10 and 11, no further tests were performed and CPT II deficiency remained undiagnosed.
Moreover, one homozygous maternal uncle (participant 9) never sought medical attention, even though he experienced several episodes of rhabdomyolysis and myoglobinuria throughout his life.
Furthermore, we identified 15 family members as heterozygous carriers of the genetic variant (see pedigree). None of them, however, reported any clinical symptoms indicating CPT II deficiency.
The maternal grandmother of the index patient (#4 in the pedigree) died prior to this study and could, therefore, not be genetically tested. However, based on the established genotypes of her children multinomial distribution revealed that the odds for a homozygous genotype are 16 times higher as for the heterozygous genotype (statistical considerations are described in detail in the ). As for the deceased asymptotic paternal grandfather of the index patient (#1 in the pedigree) we assumed a heterozygous carriership to be most likely. |
pmc-6541038-1 | The proband was a 37-year-old man who was referred to our hospital with a 7-month history of progressive weight loss, slurred speech, limb stiffness, and blunt response. Seven months ago, the patient suffered from rapid emaciation with 20-kg weight loss in 2 months. Then, the patient gradually developed dysarthria and occasionally choked when drinking water. Three months later, the patient had upper limb tremors and clumsy hands. Four months later, blunt response, memory loss, and irritability were observed by his family. In the course of the disease, the patient had constipation, accompanied by sweating and sebaceous gland hypersecretion. He denied fever, headache, loss of consciousness, convulsions, muscular atrophy or fibrillation. The medical history information was collected in Feb 2018 when he was admitted to the inpatient department of our hospital. His parents, one elder brother, two elder sisters, and his son are all physically healthy.
On examination, he (high school degree) had a significant global cognitive decline with a mini-mental state examination (MMSE) score of 18/30 and a Montreal cognitive assessment scale (MoCA) score of 15/30. He had obvious dysarthria with bilateral reduced palatal movements, indicating pseudobulbar palsy. Tone was increased in the neck and right limbs. Hyperreflexes of the legs with ankle clonus were noticed, but bilateral pathological signs were negative. His gait had a slow and shuffling characteristic, and he had difficulty turning around. Both upper limbs showed slight postural tremor and clumsy rotation. Finger-nose coordination was slow with mild intention tremor, and poor heel–knee coordination was found on the left limbs.
Blood laboratory tests were normal/negative, including the serum erythrocyte sedimentation rate, C-reactive protein, vitamins (B1\B2\B6\B9\B12), thyroid function, adrenocorticotropic\sex hormone, renin-angiotensin-aldosterone, and antinuclear antibodies. Cerebrospinal fluid analysis of paraneoplastic antibodies, antibodies specific for demyelinating diseases of the central nervous system, autoimmune encephalitis and oligoclonal IgG bands were normal/negative. Syphilis serology and HIV tests were negative.
Brain T2 fluid-attenuated inversion recovery (Flair) and diffusion-weighted imaging (DWI) MRI showed multiple, patchy, symmetrical, and hyperintense lesions in the periventricular areas, corpus callosum, and deep white matter regions of the frontal and parietal lobes. The splenium of the corpus callosum showed a homogeneous hyperintense signal in both Flair and DWI. With disease progression, patchy white matter lesions, which were initially small dots, became more widespread and confluent in this patient. DWI images showed a sustained intense signal over time, which is very unlike DWI high signal in stroke disease. An MRI scan also showed enlarged lateral ventricles (-–).
Histopathological examination of brain biopsy showed white matter lesions with myelin and axon damage and neuroaxonal swelling (spheroid formation), accompanied by prominent gliosis in the frontal lobe (-,). The activated microglia and phagocytic cells appeared to be segregated (-–). Electron microscopy confirmed the loss of myelin and axons. The axons were swollen and spherical (-). Spheroids had a thin and discontinuous myelin sheath or no myelin sheath. Large numbers of neurofilaments and organelles were observed in the axoplasm (-). |
pmc-6541118-1 | A 61-year-old man was admitted to our hospital with a hematoma in the right kidney. This diagnosis had been made 20 days prior to his admission. His clinical symptoms included pallor and anemia, but physical examination revealed no rigidity or distension of the abdomen; however, he complained of discomfort on palpation in the right flank area. The initial routine laboratory tests showed the hemoglobin level 10 g / dL (normal range: 12-18) and platelet count was 85 x 103 / mm3 (normal, 130-450). The serum levels of blood urea nitrogen and creatinine, and urinalysis were within normal limits.
CT images () depicted a huge exophytic mass, measuring 16 cm in diameter, in the right kidney. The mass also exhibited extensive hemorrhage. The mass showed peripheral nodular enhancement, as shown on cortico-medullary-phase CT, accompanied by delayed centripetal filling on nephrographic and excretory-phase CT images. Meanwhile, MRI () demonstrated a tangled mesh of tumor vessels with signal voids in the periphery of the mass on coronal T2-weighted images, corresponding to the areas with strong enhancement on contrast-enhanced coronal MR images. There were no additional mass lesions observed in other solid organs in the abdomen. Based on these imaging findings, the differential diagnoses included hemangioma, angiosarcoma, and angiomyolipoma.
Using a transperitoneal approach, the patient underwent a radical right nephrectomy. The macroscopic appearance showed a huge mass in the right kidney that extended up to the perirenal space. The mass showed extensive hemorrhage and proliferation of the tumor vessels. The microscopic features revealed complex anastomosing channels with obvious vasoformation and endothelial papillae (). Immunohistochemical stains tested positive for ERG, CD 34, CD 31, and Ki-67. To make a differential diagnosis, we considered the pathologies of various vascular tumors, including angiosarcomas, hemangiomas, and hemangioendotheliomas. A final diagnosis of a primary renal angiosarcoma was made based on the aforementioned histological features. |
pmc-6541128-1 | A 36-year-old male patient with secondary infertility was admitted to our clinic. He had a 30-year-old wife with regular menstrual cycle and without gynecologic pathology on examination. He underwent right inguinal hernia repair three years prior to this first evaluation, after their first son was born. Sperm parameters were as follows: semen volume, 2.3cc; sperm count 3.0 × 106/ mL; motility, 0%; and Kruger morphology 0%. Follicle stimulating hormone (FSH = 3.0mUi / mL), luteinizing hormone (LH = 3.9mUI / mL) and testosterone levels (350.1ng / dL) were within the normal range.
On his physical examination, right testicular volume was normal (11.7cc) and left testis was hypotrophic and retractile (7.3cc). No varicoceles could be detected neither on physical nor on ultrasound examination. His medical history did not reveal significant factors. Even though the patient wasn't azoospermic, the severe spermatic oligoasthenoteratospermia was incompatible with the prior pregnancy history. As the couple had a prior son and the only relevant factor was the inguinal hernia repair, it was suspected that a right vas deferens obstruction had occurred, and the associated left testicular atrophy was responsible for the low semen parameters. Facing the diagnosis, they decided to undergo intracytoplasmic sperm injection (ICSI); but after five unsuccessful procedures, with two unexplained miscarriages, the couple returned to attempt a surgical treatment.
Surgical exploration of the testes was performed through a scrotal incision. After dissection of the vas deferens, a 23-gauge angiocatheter was placed into the lumen and contrast was injected to assure patency and confirm the diagnosis of obstruction (). The catheter was placed in the segment planned to perform the anastomosis, assuring a long distal segment with the adequate (right) testicle and a long proximal segment in the side of the adequate (left) vas deferens (). After confirming the presence of spermatic fluid, a sufficient length of normal vas on the contralateral side was tunneled through an opening in the scrotal septum, and the anastomosis was performed. A 2-layer end-to-end microsurgical anastomosis with 9-0 suture was performed ( and ).
After one month of the procedure, a control sperm analysis was performed, and revealed: semen volume, 2.3cc; sperm count 17.0 × 106/ mL; motility, 6%; and Kruger morphology 1%. After 3 months, the couple got pregnant and the baby was born healthy after an uneventful pregnancy. |
pmc-6541139-1 | The patient was a 35 years old woman with history of two early miscarriages and no long-term pregnancy. The physical examination revealed hirsutism and menstrual irregularity. In the anamnesis, an intramural myoma myomectomy operation was conducted through laparotomy; disc hernia and peptic ulcer were present. The patient was married for 7 years and underwent intrauterine insemination twice. Chromosome analysis performed on peripheral blood revealed a marker chromosome: 47XX+m. In ultrasonography examination, the patient was seen to have polycystic ovary appearance, but the uterus and endometrium were observed to be normal. Our case was coherent with polycystic ovarian syndrome (PCOS). On the second day of menstruation, a hormonal analysis was performed. The results were AMH- 6.4 ng / mL; Estradiol- 52.23 pg / mL; FSH- 6.16 mIU / mL; Lh- 21.22 mIU / mL; Prolactin- 10.35 ng / mL and TSH- 0.99 μIU / mL. Semen analysis was normal. Her body weight was 64 kg, and her BMI was 25 kg / m2. After a genetic consultation, polycystic ovary appearance, recurrent miscarriages and marker chromosome were taken into consideration, and IVF and preimplantation genetic diagnosis were planned. |
pmc-6541151-1 | A 64-year-old female was referred to the hospital by her gastroenterologist after a same-day colonoscopy revealed a large rectosigmoid mass resulting in near total rectal occlusion. She had a past medical history of tobacco smoking and NSCLC (T1bN3M0 stage IIIB) of the adenocarcinomatous type, diagnosed one year prior. She was thought to be in remission following radiation and immunotherapy with pembrolizumab.
On admission, she complained of progressively worsening right upper quadrant abdominal pain and constipation. Vital signs, physical examination, and laboratory testing were primarily benign. Computerized tomography (CT) imaging showed a severe colonic stool burden and a single soft tissue left upper lobe lung mass consistent with the patient’s NSCLC history. Also, a large soft tissue mass with mucosal invasion in the rectosigmoid colon was evident. She underwent an urgent colostomy, ileocecectomy, anastomosis, and rectosigmoid mass resection with tissue sampling. Histopathology favored poorly differentiated adenocarcinoma. H&E staining showed extensive necrosis, focal mucosal involvement, and negativity for regional lymph node carcinoma. Properly controlled immunohistochemical (IHC) staining was performed, which revealed a strong positive immunoreactivity for CK7 and positive TTF-1 Napsin-A, Moc-31, and Ber-EP4. Only minimal focal staining for p63, CK5, and CK6 was observed. The tumor tissue was negative for CDX2, CK20, CD45, MART-1, GCDFP-15, ER, synaptophysin, NCAM/CD56, and chromogranin. Mucicarmine staining was equivocal for intracytoplasmic mucin. This IHC staining profile (strongly positive CK7 and positive TTF-1/Napsin-A with negative CDX2/CK20) supported metastatic adenocarcinoma of lung origin, rather than primary colorectal adenocarcinoma. Her postoperative course was uneventful, and she was discharged after the operation.
The patient was started on systemic chemotherapy with carboplatin and pemetrexed followed by radiation to the pelvic region. After a few treatment cycles, she developed considerable pelvic pain, resulting in a significant performance status decline and experienced multiple infections requiring hospitalizations. Subsequent positron emission tomography (PET)-CT scans suggested refractory pelvic tumor growth. Additional radiation for the palliation of pain by reducing the pelvic tumor size was determined as reasonable. However, the patient experienced a debilitating stroke and was transferred to hospice care. |
pmc-6541157-1 | A 13-year-old Caucasian male sustained diaphyseal fractures of the left radius and ulna three months prior to the presentation in focus. The fractures were managed surgically with closed reduction and 3.0 mm intramedullary elastic nailing of the ulna and open reduction and internal fixation (ORIF) of the radius with a 3.5 mm dynamic compression plate (DCP). Follow-up at two months confirmed satisfactory progress and radiological evidence of the union. The patient was scheduled for elective removal of the elastic nail at three months.
One week prior to metalwork removal the patient tripped and fell onto his outstretched left hand. He presented with severe clinical deformity of the forearm and severe distal neurovascular deficit (Figure ). The hand was pale with an absent radial pulse, prolonged capillary refill time (CRT) and no digital signal on pulse oximetry. Furthermore, both sensory numbness and motor weakness in the distributions of both median and ulna nerves were noted.
Emergent closed reduction in the emergency department was only partially successful in restoring alignment, with restoration of the CRT but persistent neurological deficit. Post-reduction radiographs revealed persistent angular deformity of sixty degrees. Re-fracture of the ulna with plastic deformation of the flexible nail was again noted, as was a periprosthetic fracture at the distal margin of the radial plate (Figure ).
In view of the persisting neurological deficit, the patient was taken to the operating theater expediently. Further attempts at closed manipulation under general anesthesia were unsuccessful. The IM nail- though deformed- was intact allowing successful removal via the routine method from the proximal ulna entry point; however, satisfactory reduction could still not be gained. The radius was approached through the previous volar approach and re-plated, ensuring use of a longer 3.5 mm DCP to account for the previous screw holes. The ulna was then approached directly and internal fixation with a second 3.5 mm DCP performed. Postoperative recovery was untoward and the patient was discharged after overnight observation.
At two weeks follow-up there was complete resolution of both subjective and objective neurological deficits. Early active forearm rotation and elbow flexion were commenced at this stage with splinting of the wrist for comfort. At two-month follow-up, the radiographs revealed fracture union (Figure ). |
pmc-6541158-1 | A 55-year-old, divorced, multiparous Caucasian female was referred for psychiatric evaluation by her daughter and hospital staff due to her hallucinations and thoughts of suicide. The patient reported a delusion that three men had broken into her home with the intent to harm her and her daughter. Upon the daughter’s realization of the delusion, the patient was brought to the community hospital for assessment.
Upon psychiatric evaluation, the patient reported her hallucinations began four months prior as auditory hallucinations of a young girl and a rodent co-inhabiting the patient’s house. The patient also described gradually intensifying visual and tactile hallucinations of scabies crawling out of her skin, referred to as delusional parasitosis. The patient presented with self-inflicted excoriation and burn injuries to her extremities, face, and abdomen that were sustained in her efforts to rid herself of the parasitic delusions. The patient resorted to picking at her skin, applying bleach and ammonium-based cleaning products and scabicidal agents to her skin while enduring these delusions. The patient had previously claimed to have proof of parasitic specimens collected from her body that she had visualized under a magnifying glass, though she reported several dermatologists were unable to confirm her findings. The patient claimed that, eventually, she was able to communicate with the parasitic delusions, as she was unable to get rid of them and claimed the scabies eventually acquired personalities that she would talk to.
The event that led to the patient’s presentation for psychiatric evaluation involved persecutory delusions, parasitic delusions, and intrusive thoughts that she should swallow objects, though she reported she was able to dissuade herself from doing so. The patient endorsed poor concentration, memory loss over the past six months, as well as occasional feelings of helplessness, anhedonia, and insomnia. The patient admitted to a longstanding history of alcohol abuse, recent relapse, and noncompliance with her naltrexone prescription. Her last report of alcohol consumption was two days prior to admission wherein she consumed one bottle of plum wine over a span of two days.
The patient attributed the alcohol relapse and current disturbances to recent life stressors. She had assumed the role of caregiver for her mother who suffered from advanced dementia and had recently passed away. She also had increased interactions with her ex-husband whom the patient claimed had been physically and psychologically abusive towards her during their marriage. The patient voiced concern over the possibility of her current symptoms being related to a neuropathologic process such as dementia or Parkinson’s disease. She complained of a recent onset of fine tremor in her hands and intermittent ataxia of four months duration, for which she expressed interest in being evaluated by a neurologist during treatment.
In addition to these life stressors and history of alcohol abuse, the patient had a history of bipolar disorder, depression, attention deficit hyperactivity disorder (ADHD), and post-traumatic stress disorder from past sexual abuse sustained when she was a teenager. The patient denied any history of illicit substance abuse other than alcohol. The patient's non-psychiatric medical illness history was significant for hypertension and tachycardia. She reported past hospitalizations for the birth of her two children, both of which were vaginal, to term, and uncomplicated. She reported no past surgical history and no allergies. The patient's family history was significant for alcohol use disorder and cognitive impairment related to dementia. There was no evidence of psychiatric illness, including delirium, psychosis, mood disorders, or suicide in family history. The patient reported her alcohol use began at age 15 following an attack in which she was raped, after which she suffered from post-traumatic stress disorder and alcohol abuse. Her alcohol use steadily intensified in 2003 when her husband became increasingly abusive towards her. The patient reported consuming an of average one gallon of vodka each day until her first rehabilitation effort occurred in 2011. She denied irritability, anxiety, tremors, confusion, or seizures when abstaining from alcohol use at that time. She denied delusions and hallucinations when abstaining from alcohol in the past. She denied a history of suicidal behavior, drug abuse, or prior hospitalizations for alcohol intoxication. The patient was enthusiastic about her recovery efforts but reported her recent relapse as occupational stresses mounted and her mother’s health waned. Her alcohol abuse eventually cost the patient her job in 2014, so she assumed care of her mother who was then suffering from advanced dementia. At this time, the patient began seeing a community psychiatrist and alcohol rehabilitation treatments commenced for the second time. Under this provider’s care, the patient’s underlying psychiatric illnesses including bipolar disorder, depression, anxiety, and ADHD were also addressed. With the help of her family members, the patient successfully completed an intensive alcohol detoxification program before relapsing in 2015 following her mother’s death. The patient stated her alcohol use has contributed to her ongoing unemployment and recent tensions in her family.
The patient reported past non-compliance with her Adderall (mixed amphetamine salts) prescription dose of 30 mg per day and bupropion prescription of 450 mg per day for ADHD and depression, respectively. She indicated that occasionally, she would take twice her daily dose of Adderall and reported that recently she had been taking this medication as prescribed until three days prior to her admission for psychiatric evaluation.
The patient's physical exam was within normal limits with pertinent findings being the excoriated lesions along the patient’s shins, arms, and abdomen. A comprehensive mental status examination was found to be appropriate and her vital signs were normal, except for an elevated blood pressure that was addressed and controlled with hydrochlorothiazide 12.5 mg per day and metoprolol 100 mg twice per day. Her urinalysis and complete blood count results were within normal limits. The patient's comprehensive metabolic panel was significant for elevated aspartate aminotransferase (AST) and alanine aminotransferase (ALT). The patient's urine toxicology screen was positive for amphetamines and negative for cocaine, tetrahydrocannabinol (THC), phencyclidine (PCP), and other psychoactive substances. Her urine ethyl alcohol levels were less than 10 mg/dL. X-ray and non-contrast computed tomography scan imaging studies were ordered to rule out organic causes of hallucinosis or intracranial pathology and the results were unremarkable (Figure ). Outcomes of the patient's comprehensive neurological testing were similarly unremarkable. The patient's psychiatric evaluation revealed no evidence of psychomotor agitation, pressured speech, her mood was anxious, and affect was appropriate. There were no referential or paranoid ideations or loose associations. The patient denied any present thoughts of broadcasting, insertion, or withdrawal. She admitted to mild and infrequent visual and tactile hallucinations of bugs crawling out of her skin but stated that, at present, she had accepted that these hallucinations and the delusions of intruders in her home had not been real. She was unable to perform serial sevens or spelling words forward and backward on psychometric testing. The patient displayed poor insight, judgment, and impulse control during the examination.
Treatment of the patient’s skin lesions included cleaning with normal saline and silver sulfadiazine cream. Antipruritic antihistamine cream and topical mupirocin antibiotics were applied to the patient's skin.
The patient’s psychotic symptoms were addressed with 5 mg olanzapine daily that was administered at bedtime. The dosing of the patient’s 450 mg of bupropion was tapered and restarting the Adderall prescription was deferred. The reason for tapering the bupropion and deferring re-prescribing Adderall was because both medications have the potential to induce acute mania as a side effect. Psycho-education was provided to the patient regarding her currently prescribed medications and each potential adverse effect. The patient expressed strong motivation for future abstinence from alcohol and enthusiastically agreed to receive an extended-release injectable form of naltrexone prior to her discharge. |
pmc-6541159-1 | Herein, we present the case of a 67-year-old female breast cancer survivor who had a right lumpectomy for ductal carcinoma in 2012. She was clinically asymptomatic. However, a recent CT scan of the chest revealed a subcentimeter soft tissue nodule in the lower lobe of the right lung which was not appreciable on previous CT lung window films (no soft images were available). It was considered a possible granuloma but an 18FDG PET/CT was recommended for evaluation and surveillance of the nodule. The PET/CT was performed with 10.2 mCi of 18FDG after 60-minute skull to mid-thigh images were acquired using a low-dose, non-contrast enhanced CT protocol. The scan showed no morphological or functional evidence of tumor in either breast or hypermetabolic nodal and no hepatic, adrenal, pulmonary, or bony metastases. There was a redemonstration of the subcentimeter ametabolic soft tissue nodule in the lower lobe of the right lung with minimal infiltrate in the right lung base. The uterine fundus revealed an 18FDG non-avid hypodense area (Hounsfield unit (HU): -89.9) measuring 40 x 30 mm (anteroposterior (AP) and transverse (TV) dimensions) without regional nodes (Figure ). Based on the image characteristics, it was reported as a lipoma. An uneventful hysterectomy was performed after three weeks on request by the family, and the histopathology revealed a pure lipoma. |
pmc-6541161-1 | A 58-year-old male presented to the hospital with chief complaints of dyspnea on exertion associated with pleuritic chest pain and fatigue for two weeks prior to presentation. Medical history was significant for hypertension and hepatitis C genotype 1 treated with ledipasvir/sofosbuvir four years ago. HCV was successfully treated with achievement of sustained virologic response four years ago. The patient did not follow-up after treatment completion. On physical examination, mildly distended, non-tender abdomen was noted. Computed tomography (CT) angiogram of chest was done due to an elevated D-Dimer of 1878 ng/ml and the patient was found to have a segmental pulmonary embolism in the right lower lobe of the lung (Figure ). The patient was started on anticoagulation for the pulmonary embolism. A duplex ultrasonography of lower extremities was negative for deep vein thrombosis (DVT). In addition, the patient had an abnormal liver profile with an elevated aspartate transaminase (AST) of 416 U/L, alanine transaminase (ALT) of 95 U/L and alkaline phosphate of 474 U/L. The patient had serum albumin level at 3.2 g/dl and total serum bilirubin level at 0.9 mg/dl. Further imaging of the abdomen revealed a cirrhotic liver with infiltrative tumor nearly completely replacing the right hepatic lobe measuring 14.9 x 11.7 x 13.7 cm which was suspicious for HCC (Figure ). Tumor thrombus within the right portal vein, right hepatic vein extending to the IVC was also revealed. Echocardiogram revealed a possible thrombus (or mass) by the base of the RV appearing as a thrombus in transit. Further workup revealed an elevated alpha-fetoprotein (AFP) of 146 ng/ml. Cancer Antigen 19-9 was elevated to 125 U/ml whereas carcinoembryonic antigen was 1.7 ng/ml which was within normal limits. HCV RNA was detected to 82668 IU/ml. In the patient’s care, multiple sub-specialties were involved and a decision was made to continue anticoagulation due to the overall prothrombotic state of the patient. The patient was deemed not a surgical candidate due to the extent of the cancer and was referred to oncology outpatient for possible plan to start radiotherapy or chemotherapy with Sorafenib. The patient did not follow up with oncology and opted for palliative care, and died in hospice after four months. |
pmc-6541162-1 | A 55-year-old Malay lady with underlying myopia of both eyes sustained high myopia over the right eye with a -9.00 spherical dioptre and moderate myopia over the left eye with a -5.00 spherical dioptre. She presented with a two-week history of sudden-onset reduced vision over the left eye, associated with flashes of light and superior field defect. Otherwise, she denied any preceding trauma and no similar history over the fellow eye. She was relatively well with no constitutional symptoms. She was assessed at a district hospital and referred to the vitreoretinal center for rhegmatogenous retinal detachment after primary review noted that she had inferior retinal detachment with suspicion of a horseshoe tear present at the 6 o'clock position.
On examination, the patient had moderately tanned skin. Her visual acuity was 6/18 with a pinhole of 6/12 over the right eye and 6/60 over the left eye. Relative afferent pupillary defect (RAPD) was absent. An anterior segment examination was unremarkable. Intraocular pressure was 16 mmHg over the right eye and 14 mmHg over the left eye. Posterior segment examination showed myopic fundus bilaterally, with a tilted optic disc of the right eye. Fundus examination of the left eye showed the presence of bullous retinal detachment, extending from 5 o'clock to 9 o'clock, with shallow detachment over the macula (Figures -). The left optic disc was partially obscured by the detachment. A detailed examination with indentation by a vitreoretinal surgeon revealed a suspicious mass underneath the detached retina of the left eye, with no visible tear seen. The posterior segment of the right eye was otherwise normal. The systemic examination was also unremarkable with clear lungs, no palpable lymph nodes or breast lump, no palpable abdominal mass, and no hepatosplenomegaly.
B-scan demonstrated a hyperechoic choroidal mass at the posterior pole, with overlying huge subretinal fluid and retinal detachment (Figure ). Magnetic resonance imaging (MRI) of the orbit and brain showed a subretinal lesion measuring 1.2 cm x 1.0 cm x 1.2 cm, associated with retinal detachment. The lesion showed an iso-hyperintense signal on T1-weighted image, hypo-intense signal on T2-weighted image, and enhanced post contrast. The lens and optic nerve were still preserved. No retro-orbital enhancing mass was seen. There was also an absence of an extrascleral extension or intracranial lesion (Figure ). The test for tumor markers showed negative results (Table ).
Additional opinions from both oculoplastic and medical retina specialists were sought regarding diagnosis and treatment plans. The patient was then diagnosed with choroidal melanoma and planned for enucleation of her left eye. Unfortunately, the enucleation was not yet carried out, as she opted to delay the operation. She is otherwise fully aware of the possible consequences in the absence of timely intervention. Surveillance computed tomography (CT) of the thorax, abdomen, and pelvis was also done and showed no distant metastasis. Her liver enzymes were within normal range. |
pmc-6541164-1 | A 25-year-old female was hospitalized with generalized abdominal pain, low-grade fever, rigors, lethargy, and vomiting. Her medical history was significant for Down syndrome and Moya Moya disease complicated by multiple strokes and intracranial hemorrhage requiring an external ventricular drain and subsequent PEG tube placement for enteral support one month prior to presentation.
Vital signs on admission showed sinus tachycardia at 130 bpm, a temperature of 101 F and blood pressure of 110/65 mmHg. Abdominal examination revealed a distended, diffusely tender abdomen with evidence of bloody brownish exudate at the ostomy site. Pertinent laboratory studies included: elevated white blood cell count of 21 × 103 /μL (normal 4 to 11 x 103 /µL), hemoglobin of 9 gm/dL- which was relatively decreased from a previous value of 12 gm/dL (normal 11.5-15.5 gm/dL), metabolic acidosis with pH of 7.25 (normal 7.35-7.45) and elevated serum lactate of 7.27 mmol/L (normal 0.5-1 mmol/L).
The patient was transferred to the medical intensive care unit for suspected sepsis and was resuscitated with intravenous normal saline and broad-spectrum antibiotics. A few hours later, she started to have coffee ground emesis with a subsequent drop in her blood pressure.
The abdominal plain radiograph showed a dilated stomach. This was followed up by an abdominal computed tomography (CT) scan with intravenous contrast demonstrating a dilated distal esophagus and stomach with extensive stomach wall pneumatosis and portal venous gas concerning for acute ischemia, the PEG tube was displaced into the proximal duodenum (Figure -) with its tip at the point of caliber change (Figure -). Distal to the PEG tube tip, the third duodenum and the remaining small bowel were collapsed. There was no evidence of pneumoperitoneum.
The patient was diagnosed with iatrogenic anterograde gastroduodenal intussusception with the PEG tube acting as a lead point with complicating small bowel necrosis. Family members were counseled regarding the need for immediate surgical intervention. However, the patient’s family opted for comfort care measures. No surgical intervention was done and the patient was transferred under hospice care. |
pmc-6541165-1 | A 72-year-old woman with a medical history of coronary artery disease, ischemic cardiomyopathy, carotid artery stenosis, renal artery stenosis, chronic kidney disease, hypertension, and hyperlipidemia presented to the ED with two months of right lower extremity pain and swelling. She stated that both symptoms had worsened to the point where she was having difficulty ambulating. The patient also related new symptoms of tingling in her right foot that had started today. She revealed that she had a lower extremity ultrasound done 11 days ago with the onset of these symptoms.
Her initial vital signs were within normal limits. Her physical exam was remarkable for an enlarged, cold, discolored right lower extremity with calf tenderness and non-palpable or Dopplerable pulses in the foot. The vascular surgeon was consulted and recommended the patient be given a heparin bolus and placed on a heparin drip with a lower extremity venogram ordered for the morning. Meanwhile, a bilateral lower extremity ultrasound was done showing right-sided DVTs (Figure -). CT of the abdomen and pelvis was done without contrast due to the patient's chronic kidney disease. A ventilation perfusion scan (V/Q) was ordered and care was transferred to the inpatient team.
After the patient was admitted to the medical ward with a heparin drip in place, she underwent a ventilation-perfusion (V/Q) scan which showed a high probability of a PE (Figure ). CT abdomen without contrast on admission showed only bilateral hydronephrosis secondary to enlarged para-aortic lymph nodes.
During her hospitalization, she was maintained on the heparin drip for the management of her right-sided DVT. However, despite the heparin drip and maintenance of an appropriate partial thromboplastin time, her right leg pain and swelling did not improve. Vascular surgery took her to undergo a catheter-directed thrombolysis and angioplasty of right leg, after which her symptoms improved.
She underwent a left para-aortic lymph node biopsy and a subsequent inferior vena cava (IVC) filter placement. However, her hospital course was complicated and lengthened, as she required three lymph node biopsies due to insufficient and necrotic tissue on the prior biopsies. Her final biopsy was done on her right inguinal region and showed grade three follicular B cell lymphoma.
Her situation was further complicated when she developed acute right inguinal swelling and pain a few days after her biopsy while she was on the heparin. Concern for a possible arterial bleed led to a CT scan of the extremity which revealed a hyperdense fluid collection with air fluid levels within the anteromedial right thigh, measuring 6.4 x 13.2 x 14 cm without contrast extravasation. The patient was started on vancomycin and piperacillin-tazobactam for presumed infected hematoma and underwent urgent incision and drainage. Her antibiotics were stopped after two days when cultures from the site were negative for any organisms.
The patient ultimately underwent a bone marrow biopsy that showed CD-10 and CD-20 positive lymphocytes and minimal lymphocytic infiltration into the marrow. She was started chemotherapy and was transitioned to warfarin from low molecular weight heparin until her international normalized ratio (INR) was therapeutic and she was discharged home. |
pmc-6541166-1 | A 47-year-old male was brought via ambulance to the emergency department after being struck by another vehicle while driving his motorcycle. His past medical history was significant for non-ischemic cardiomyopathy with ejection fraction of 10%, stage III chronic kidney disease, hypertension, and polysubstance abuse. On presentation, blood pressure was 86/38 mm Hg, pulse 82 beats/min, respiratory rate 22 breaths/min, and oxygen saturation 92% on room air. Primary and secondary trauma surveys revealed Glasgow Coma Scale (GCS) of 7, gross head trauma, and multiple bilateral upper and lower extremity fractures. He was immediately intubated and fluid resuscitation was initiated.
Focused Assessment with Sonography for Trauma (FAST) was negative in the right upper quadrant, left upper quadrant, and pelvis. A bedside echocardiogram revealed severe global hypokinesis of both ventricles. While computed tomography (CT) images were being obtained for further evaluation, the patient became hypoxic and bradycardic. Bag mask ventilation was begun, and 0.5 mg atropine was administered. Oxygenation and bradycardia improved, but he then became hypotensive. Subsequently, a right subclavian central venous catheter was inserted, and he was started on inotropes and vasopressors. A 12-lead electrocardiography (ECG) was obtained and showed sinus rhythm with 2:1 AV block and inferior ST elevation myocardial infarction (Figure ). Serum troponin-I level was found to be elevated at 1.13 ng/mL.
The cardiac catheterization lab was activated emergently, and angiography revealed dissection of the mid right coronary artery (RCA) with 100% occlusion (Figures -). Angioplasty was successfully performed with placement of a 4.0 by 28 mm Rebel bare-metal stent in the mid RCA (Figure ). He was started on aspirin, clopidogrel, and amiodarone and transferred to the intensive care unit for further cares. Unfortunately, the patient continued to suffer from severe decompensated heart failure that progressed to multi-organ failure and ultimately passed away 10 days following admission. |
pmc-6541168-1 | A 77-year-old female who had previously been treated for Helicobacter pylori gastritis, presented with a six-month history of indigestion, heartburn, and abdominal bloating in 2012. An upper GI endoscopy was performed which revealed a duodenal bulb polyp. Biopsy of the duodenal polyp revealed a clonal population of malignant B-cells with a CD5+, CD10-, CD20+, CD23- immunophenotype. There was also over-expression of cyclin D1 consistent with a diagnosis of MCL.
The patient underwent a positron emission tomography/computed tomography (PET/CT) scan for staging which showed an enlarged inguinal lymph node and a nonenlarged left external iliac lymph node. There was no bone or central nervous system involvement and her bone marrow biopsy was normal. Because of the indolent nature of her presentation, observation alone was recommended and the patient was followed closely with regular clinic visits, monthly labs including a complete blood count (CBC) and lactate dehydrogenase (LDH) levels, as well as surveillance PET/CTs every three months.
In November 2014, the patient underwent a repeat upper endoscopy with endosonographic ultrasound and colonoscopy for surveillance which revealed an increase in the size of the duodenal bulb lesion as shown in Figure .
She was also noted to have abnormal mucosa in the ileocecal valve as illustrated in Figure .
Biopsy of the ileocecal valve revealed residual MCL. The patient was initiated on treatment with rituximab, cyclophosphamide, vincristine, and prednisone (R-CVP) and received a total of six cycles in 2015. She underwent regular surveillance with her oncologist and was noted to have no recurrence of her disease on repeat PET/CT scans. A repeat upper endoscopy with endoscopic ultrasound in December 2018 revealed normal appearance of the duodenal bulb. A repeat colonoscopy was also performed which revealed normal endoscopic appearance of the ileocecal valve as shown in Figure . |
pmc-6541169-1 | We report a case of a 43-year-old nulliparous woman who was referred for surgical management of her abnormal uterine bleeding/heavy menstrual bleeding (AUB/HMB), which was treated with combined oral contraceptives until her diagnosis of estrogen receptor/progesterone receptor (ER/PR) positive ductal carcinoma in situ (DCIS), in her right breast at age 42. Combined oral contraceptive treatment was therefore discontinued which worsened her AUB/HMB. Her past medical history was also significant for autoimmune disorders including fibromyalgia, Sjogren syndrome and rheumatoid arthritis (RA) that presented following treatment of Hurthle cell thyroid cancer. Her RA was treated with sulfasalazine and hydroxychloroquine.
When she presented to our clinic for management of her AUB/HMB, her DCIS of the breast was treated with a lumpectomy and radiotherapy and she was about to begin tamoxifen therapy. A hysterectomy was determined to be the best management option for her AUB/HMB as she was unable to use hormonal management, had multiple risk factors for endometrial cancer including diabetes mellitus and class III obesity, and was about to begin tamoxifen therapy which would also increase her risk for endometrial cancer. A bilateral salpingo-oophorectomy was recommended by her oncologist to decrease her risk of recurrence of breast cancer. She was scheduled for a robotic total laparoscopic hysterectomy and bilateral salpingo-oophorectomy (RTLH/BSO). Throughout the year prior to surgery she was empirically treated with fluconazole for vulvovaginal candidiasis on several occasions. Her last treatment was three weeks prior to surgery, which resolved her symptoms.
Her RTLH/BSO was uncomplicated and she tolerated the procedure well. She was discharged home on the same day in a stable condition. She presented to the emergency department on post-operative day three with fevers, tachycardia, headaches and nausea. On physical exam, erythema and edema were noted around the supraumbilical incision site with no drainage or separation of the skin. There was no evidence of a deep seroma, hematoma, crepitus, or peritonitis. Computed tomography (CT) imaging of the abdomen and pelvis showed no abnormal findings. Chest X-ray showed mild atelectasis. The infectious diseases team was consulted, and treatment for suspected cellulitis was initiated with vancomycin and piperacillin/tazobactam. Blood culture and antistreptolysin O titer were collected. Overnight, her temperature and white blood cell count (WBC) trended down but remained elevated. The general surgery team was consulted, and their assessment did not indicate an intrabdominal process. They believed the fevers were driven by the surgical site infection and recommended that her erythematous incision be opened to assess for possible abscess or hematoma and to assess the integrity of the fascia. This was performed, and her incision drained mostly serosanguinous fluid with no purulent matter. The fascia was intact.
Given her continued febrile episodes, the infectious diseases team exchanged piperacillin/tazobactam for meropenem. Her RA home medications were restarted to assure that a RA flare up was not a source of her fevers.
Her severe headaches did not respond to her home triptan medication or ketorolac. The neurology team was consulted, and a magnetic resonance imaging (MRI) of her brain was ordered, which did not reveal any acute process.
At the end of the third day of hospitalization, the blood cultures grew C. glabrata. Intravenous (IV) anidulafungin was initiated. After the addition of antifungals, her vital signs improved, and WBC dropped to normal range. Her headaches resolved. Vancomycin and meropenem were continued as treatment for her surgical site cellulitis. She eventually defervesced on post-operative day 10. She was continued on antifungals and antibiotics via peripherally inserted central catheter (PICC) for four weeks.
Consent was obtained by the patient to use this case for publication. |
pmc-6541452-1 | A 73-year-old woman who had never smoked presented with lung adenocarcinoma, which was diagnosed via bronchoscopy with biopsy of the left upper lobe, and underwent a left upper lobe lobectomy and lymph node dissection, which showed a stage IIB (pT2bN0M0) poorly differentiated adenocarcinoma. Sequenom mass spectrometry revealed an EGFR L858R mutation, and the patient was administered adjuvant erlotinib (100 mg daily). After 24.7 months of erlotinib, given no recurrence, adjuvant therapy was discontinued (). The patient was observed for 20.5 months, when imaging revealed new bilateral pulmonary nodules, right-sided paratracheal lymphadenopathy, and a sclerotic T11 lesion. Right upper lobe biopsy confirmed recurrent disease, and MSK-IMPACT testing showed the presence of EGFR L858R without EGFR T790M mutation. The patient restarted erlotinib (100 mg daily) with clinical and radiologic response for 12.5 months, at which time computed tomography revealed an increase in the dominant right upper lobe mass. Fluorescence in situ hybridization of right upper lobe biopsy material revealed MET amplification, and cell-free DNA testing was positive for EGFR T790M. MSK-IMPACT revealed an EGFR L858R mutation, no evidence of EGFR T790M, and a new METex14 (c.2899G>A) alteration and MET amplification (fold change, 2.5; ; Appendix ). Therapy was changed to osimertinib with savolitinib daily ( identifier: NCT02143466) for 1.4 months, after which savolitinib was stopped because of toxicity and single-agent osimertinib 80 mg daily was continued. Progressive disease in the lung was noted after 2.4 months of osimertinib (). Crizotinib 250 mg twice daily was then administered for 1.9 months, at which time further pulmonary progression of disease was noted (). Treatment was changed to combination osimertinib (80 mg daily) with crizotinib (250 mg twice daily). The combination was tolerated without any report of toxicity. At follow-up 2.3, 4.6, and 7.7 months after starting combination therapy, she had ongoing clinical benefit and stable disease by RECIST (version 1.1; −12.2% response; ). The patient continued to receive combination therapy with durable clinical and radiographic benefit for more than 9 months.
To define the role of METex14 in mediating resistance to EGFR TKIs, we generated two isogenic EGFR-mutant non–small-cell lung cancer (NSCLC) cell models using PC9 (exon 19 deletion) and H1975 cells (L858R and T790M) by transduction with lentiviral vectors driving expression of METex14 (). Western blot analysis showed that phosphorylation of EGFR and its downstream effectors AKT and ERK was inhibited by osimertinib in PC9 cells transduced with empty plasmids (PC9 empty), but phosphorylation of EGFR, METex14, and downstream effectors remained unaffected by osimertinib treatment in PC9 METex14 cells (). Notably, METex14 expression correlated with upregulation of phosphorylated EGFR in PC9 METex14 cells. In cell viability assays, the presence of METex14 reduced sensitivity to osimertinib by approximately 20-fold (half maximal inhibitory concentration: PC9 empty, 7.7 nM; PC9 METex14, 150.8 nM; ). Similar results were observed with H1975 models in western blotting and cell viability assay (half maximal inhibitory concentration: H1975 empty, 13.4 nM; H1975 METex14, 216.7 nM; (). PC9 METex14 cells showed a reduction in osimertinib-induced caspase 3/7 activation compared with PC9-empty cells (P < .001; ). Together, these results indicate that METex14 induces resistance to osimertinib in EGFR-mutant NSCLC cells.
We next investigated whether METex14-mediated resistance to EGFR TKIs could be overcome by combination therapy with EGFR and MET inhibitors. As expected, crizotinib inhibited METex14 phosphorylation in PC9 METex14 cells; however, phosphorylation of EGFR, AKT, and ERK remained largely unchanged (), suggesting that EGFR is still signaling effectively in PC9 METex14 cells. Similarly, crizotinib was ineffective at modulating growth of EGFR-mutated cell lines, with or without METex14 expression (). However, a combination of osimertinib and crizotinib inhibited activation of EGFR, MET, AKT, and ERK (). Moreover, addition of crizotinib restored the growth inhibitory effects of osimertinib in PC9 METex14 cells (). Identical results were observed in the H1975 model (). In agreement with these results, dual inhibition of EGFR and MET caused significantly higher activation of caspase 3/7 (). |
pmc-6541565-1 | A 43-year-old non-smoking female presented to our chest medicine clinic with mild exertional dyspnoea and dry cough for 1 month. There was no associated fever, chest pain, orthopnoea, paroxysmal nocturnal dyspnoea, dysphagia, abdominal pain, arthralgia, weakness of limbs, or skin eruption. Her past medical history was positive for obesity and type 2 diabetes mellitus, while her health status during childhood and adolescence, and her occupational and exposure histories, were unremarkable. Upon physical examination, auscultation of her chest detected enhanced bronchial sound diffusely in her lung fields. Her body temperature was normal. The rest of the examination was unremarkable. However, her CXR showed new patchy and linear infiltrates mainly in the peri-hilar and upper fields as compared with the film taken about one year ago (Fig. A, B). The subsequent computed tomography (CT) of the chest revealed multiple well-delineated opacities with a “crazy-paving” pattern predominantly involving her apical and upper lungs (Fig. D–F, H). Notably, these opacities were absent from her past radiographic images (Fig. A, G). The pulmonary function test reported normal lung volume and spirometry, but a mild impairment in the diffusion capacity for carbon monoxide (DLco; 64%). No significant structural anomaly or ventricular dysfunction was detected by the echocardiography. At first the patient declined any further invasive investigation and thus received a regular follow-up. Over the next 3 months, her symptoms and radiographic findings had remained stable. After thorough discussion, the patient finally agreed with invasive diagnostic studies for her lung lesions. Analysis of the bronchoalveolar lavage (BAL) fluid reported a turbid appearance but the presence of only few white blood cells (30/mm3, predominantly macrophages). Cultures of the lavage fluid yielded negative growth of any microbe, while the cytology reported no evidence of malignant cells. Due to the undiagnostic BAL, video-assisted thoracoscopic wedge-biopsy of her left-upper-lobe lung was subsequently performed. Microscopic examination of the biopsied tissue observed a well-preserved alveolar architecture with extensive acellular pinkish exudate in the alveolar space that stained positive for PAS (Fig. A–C). There was no evidence of microbes, including Pneumocystis carinii. The diagnosis of PAP was established histologically. Granulocyte-macrophage-colony stimulating factor (GM-CSF) auto-antibody could not be checked due to the unavailability at our institute, whereas serological tests for other auto-antibodies were all negative (Table ). Complete peripheral blood cell count showed no evidence of anaemia, hematologic malignancy, or myelodysplastic syndrome. Nevertheless, her serum level of lactate dehydrogenase (LDH) was mildly elevated (276 U/L; normal range, 135–225 U/L). The patient since then has been regularly followed at our hospital. The most recent CXR showed significant resolution of the infiltrates (Fig. C, taken about 17 months after that in Fig. A). Serial follow-up CT scans of the chest revealed migratory changes in those lung opacities, with dynamic antero-posterior shifts in her upper-lobe lesions, and fluctuating patches in her lower-lung zones (Fig. H–J). Serial pulmonary function tests revealed a declining trend in her forced vital capacity, and a mild but persistent impairment in her DLco (Table ). Meanwhile, her symptoms have remained relatively mild and stable. Her serum level of LDH checked one year later has returned to the normal range (Table ). |
pmc-6541760-1 | A 33-year-old female, who had undergone FP as palliation for a single ventricle anomaly at 6 years of age (), presented alphafetoprotein (AFP) of 3005 ng/mL. Computer Tomography (CT) showed features of CLD associated with a 3.4 x 4.5 cm solid hepatic lesion in segment V (). Considering the compensated cardiocirculatory condition (normal systolic heart function, no arrhythmias, good functional capacity) and the CLD grading (Model for End-Stage Liver Disease score: 9, Child-Turcotte-Pugh stage: A) a LLR was planned.
The patient was placed in supine position, with her legs apart to apply the French position and the surgeon stood between the patient’s legs. Four trocars (two 11 mm, one 12 mm, one 5 mm) were placed into the abdomen as shown in . After achieving a predetermined pressure of 10 mmHg, a 30-degree endoscope was inserted and a cirrhotic liver with small amount of ascites was visualized. The intraoperative ultrasound of the liver confirmed a 4 x 4.5 cm lesion of segment V near by the gallbladder and multiple regenerative nodules not suspicious of malignancy. Due to the close proximity of the lesion to the gallbladder, a conventional laparoscopic cholecystectomy was carried out.
With the assist of intraoperative ultrasound, an inner line was made on the liver surface with diathermy to mark the periphery of the tumor. Then, a radiofrequency ablation (RFA) with single needle probe was performed along the free-tumor margin of the hepatic lesion (2 cm outside -away from- the inner line of the tumor) in order to reduce the cut surface bleeding. The next step was an non-anatomical wedge resection of segment V. The parenchymal transection was performed without Pringle manoeuvre, by applying the harmonic scalper and the Cavitron Ultrasonic Surgical Aspirator (CUSA). Vessel structures were clipped by locked clips and then cut. The resected lesion and the gallbladder were extracted by endobag trough the supraomeblical trocar incision. The pneumoperitoneum was maintained at 8–10 mmHg through out the entire procedure and intraoperative blood losses were 100 mL.
During surgery, the anaesthetic management consisted of sevuforane/fentanyl and invasive central venous/arterial pressures monitoring to maintain a stable cardiac function and oxygenation, which were achieved by infusion of intravenous fluids (11 ml/Kg/h) and dopamine (3 mcg/Kg/min). A stable cardiac function was maintained during all intra- and peri-operative phases.
A well-differentiated HCC with trabecular growth pattern (Edmondson grade I; absence of vascular infiltration) of 4.5 × 4 x 4 cm (volume: 72 cm3). No malignant cells were found in surgical margins of 1 cm (R0 resection). For immunohistochemistry, the HCC showed positive glypican, while negative pattern for beta-catenine, glutamine synthetase and loss of expression of liver fatty acid binding protein.
Post-operative course was uneventful, characterized by stable liver and cardiac function; after 7 days the patient was discharged. After 3 months, AFP level was 30.14 ng/mL with negative CT. At 7 months from surgery HCC recurrence was detected and Sorafenib treatment combined with transarterial radioembolization was performed as downstage for combined heart-liver transplantation. |
pmc-6541936-1 | A 46-year-old woman with morbid obesity, hypertension, hyperlipidemia, active smoking, and bipolar disorder was evaluated for paroxysmal atrial fibrillation as an outpatient. A transthoracic echocardiogram showed a right atrial mass close to the RA-IVC junction. A transesophageal echocardiogram confirmed the presence of a pedunculated right atrial mobile bilobular mass measuring 2.1 × 1.8 cm, not arising from the interatrial septum with extension into the inferior vena cava (Figures –). A secundum atrial septal defect was also identified. The patient was referred to cardiac surgery for resection of a presumed right atrial myxoma given the possibility of embolization. The intraoperative TEE suggested the presence of one bilobulated mass arising low in the right atrium.
Using aortic and bicaval cannulation, a right atriotomy was performed and a discrete 2 × 3 cm mass was removed from the IVC-RA junction near the Eustachian valve. The right atrium was closed and the patient weaned from bypass. The specimen did not appear to be a myxoma, so it was sent for frozen section and interpreted as being ectopic liver tissue. In the interim, a repeat TEE showed an additional discrete 2 × 2 cm mass in the IVC near the hepatic veins. Femoral venous cannulation was then performed to allow for visualization of the IVC below the pericardial reflection. Through the same right atriotomy and using additional suction directly in the IVC, the IVC mass was visualized and resected. Both specimens were interpreted as showing partially encapsulated liver parenchyma with mild steatosis, fibrosis, ductal proliferation, and periductal chronic inflammation, consistent with ectopic hepatic tissue ().
Despite a brief period of cardiopulmonary bypass, the patient had persistent hypoxemic respiratory failure ascribed to her morbid obesity and underlying lung disease. She also developed extensive left lower extremity deep venous thrombosis from a presumed heparin-induced thrombocytopenia for which she was treated with argatroban and placement of an IVC filter. Because of chronic respiratory failure, she underwent tracheostomy and feeding tube placement, and she was placed on warfarin for intermittent atrial fibrillation due to her CHA2DS2-VASc score of 4. She gradually improved and was transferred to rehab where her tracheostomy tube and PEG tube were removed. A few months later, she looked quite well during an office visit. |
pmc-6541941-1 | A 22-year-old sexually inactive woman presented with a rapidly growing mass in the vulva and perianal region. The lesions appeared 3 months before presentation and developed rapidly. The patient had no sexual activity. She was a regular smoker and the medical history included Type 1 diabetes mellitus for 15 years. The serologic screening for Hepatitis B (HBsAg), Hepatitis C (Anti-HCV), Human Immunodeficiency Virus (Anti-HIV), and syphilis (VDRL) was negative. Patient had no history of sexual diseases. On physical examination, a giant mass thought of as a giant condyloma, extending from the mons pubis till the anal mucosal lining and distorting the labial and clitoral anatomy was observed []. Biopsy of the lesion revealed a condyloma. Under general anesthesia a Foley catheter was introduced. Partial skinning vulvectomy was performed with preservation of clitoral and labial anatomy and all condylomatous structures were removed. Incisions were sutured primarily using single mattress sutures with No: 2/0 polyglactin []. No complications developed during the operation. Mobility was restricted and oral antibiotics were used in the postoperative period and the Foley catheter was left in situ. On the postoperative 5th day, a 2-3 cm wound dehiscence involving the skin and subcuticular fatty tissue developed on the perineal area near the anal orifice and was treated with secondary healing using sitz baths, antibiotics, and topical creams []. Pathology report revealed condyloma acuminatum [Figures and ]. No recurrences developed during one year of follow-up. |
pmc-6541941-2 | A 20-year old sexually active woman presented with a giant vulvar mass involving the vulva and the anal area. Lesions began to develop 5 months before presentation and developed rapidly. Medical history was unremarkable. Serologic screening for Hepatitis B (HBsAg), Hepatitis C (Anti-HCV), Human Immunodeficiency Virus (Anti-HIV), and syphilis (VDRL) was negative. Patient had no history of sexually transmitted diseases. Physical examination of the patient revealed condylomatous masses extending from the lower perineum to the intergluteal folds []. Biopsy of the lesion revealed a condyloma. PAP-smear was obtained and the result was low-grade squamous intraepithelial lesion. Colposcopy was performed and biopsy was taken from acetowhite areas which revealed cervical intraepithelial neoplasia (CIN)-II and follow-up was planned for cervical dysplasia. Under general anesthesia the condylomatous lesions were excised sharply and the condylomatous tissues around the clitoris were cauterized in order to preserve the anatomy and innervation of the clitoris. Drains were inserted in the gluteal incisions []. No complications developed during the postoperative period. Pathology report revealed condyloma acuminatum [Figures and ]. No recurrences developed and the cervical dysplasia regressed during one year of follow-up. |
pmc-6541970-1 | An 83-year-old gentleman with a past medical history of diet-controlled diabetes mellitus type 2, gout, and hypertension presented to our institution with a 4-hour history of upper abdominal pain and lower chest tightness associated with dyspnoea, which was partially relieved by intravenous morphine and sublingual glyceryl trinitrate administered by ambulance paramedics. On arrival in the emergency department, a 12-lead ECG showed minimal anterior ST elevation (); therefore, a bedside echocardiogram was performed. This demonstrated hypokinesis of the apical third of the anterior, inferior, and lateral walls. Given the borderline ECG changes and regional wall motion abnormalities on echo, the patient was taken for emergency cardiac catheterisation.
Angiography revealed an occluded obtuse marginal 2 (OM2) branch of the circumflex artery () with minor disease in the other major epicardial arteries (Figures and ). Flow was restored following passage of the guidewire, and thrombus was clearly identifiable in the vessel. The lesion was treated with one 2.5 mm × 15 mm drug-eluting stent resulting in TIMI III flow ().
Ventriculogram done in the RAO projection revealed mid and apical hypokinesis and ballooning with preserved basal function (Figures and ). Ventriculogram from the LAO projection showed posterior wall hypokinesis more in keeping with the ischaemic territory affected by acute plaque rupture.
A venous blood gas revealed haemoglobin of 145 g/L (ref 120-170 g/L), normal electrolytes, and blood glucose of 8.7 mmol/L (ref 3.5-7.7 mmol/L). The patient's initial troponin I was 365 ng/L (ref <26 ng/L) and peaked at 17,180 ng/L the following day. His ECG evolved to show deep symmetrical T wave inversion across the anterolateral and limb leads, clearly more extensive than the distribution of the infarct artery () associated with the prolongation of the QT interval. Formal echocardiogram performed 6 hours following percutaneous coronary intervention (PCI) showed severe apical ballooning and hypokinesis extending to mid cavity with preservation of basal function, consistent with TTS. The posterolateral wall was also noted to be akinetic in keeping with a region of infarction. There was mild LV systolic dysfunction (EF 45%).
The patient was commenced on perindopril and atorvastatin in addition to dual antiplatelet therapy with aspirin and clopidogrel. On further questioning, no acute emotional triggers in the patient's life could be identified. On day 3 of the patient's admission, troponin was down trending at 8907 ng/L. He was discharged 4 days after presentation, following an uncomplicated inpatient stay. Follow-up echocardiography performed 6 weeks after discharge demonstrated restoration of normal LV systolic function and resolution of the previously seen regional wall motion abnormalities (). |
pmc-6541971-1 | A 57-year-old female with widely metastatic high-grade serous adenocarcinoma of the ovary was referred to our tertiary palliative care clinic by her oncologist for management of severe cancer-related pain. Following her original diagnosis, she underwent a number of multimodal disease-directed therapies, including surgical resection and chemotherapy. She had significant ongoing mixed somatic and neuropathic pain in the left lower back as well as her pelvis, both sites of known metastatic disease. The back pain was noted to be a deep sharp pain without radiation to her extremities, located primarily around the region of her nephrostomy tube and into the abdomen. She would also have sharp lancinating neuropathic pain in her pelvis due to tumor burden with prolonged periods of sitting, walking, or activity.
Initial treatment consisted of multimodal pharmacologic therapy including short-acting and long-acting opioids with nonopioid and adjuvant neuropathic agents. Despite these therapies, she had progressive pain and was ultimately increased to an opioid combination of morphine sulfate controlled-release (120 mg by mouth every 8 hours) and morphine sulfate immediate-release (30–45 mg by mouth every 3 hours as needed). Early changes yielded acceptable analgesia. Conversations and medication adjustments continued over the phone, given the distance between the patient's home and our institution. However, over several weeks' time, pain progressed despite further opioid increases. Given concern for escalating pain and poor response to several attempts at altering her opioid therapy, it was advised that she present for a consultation in the palliative medicine clinic. Fortunately, focused discussions with the patient and her family around the patient's goals of care were addressed with her palliative medicine team at every meeting. She was very clear that her top priority in her ongoing medical care was to achieve acceptable analgesia. During the interview in the clinic, the patient noted significant pain with generalized discomfort, a sense of restlessness, and new muscle fasciculations. Her husband accompanied her and noted intermittent confusion. Her physical exam featured delirium (Confusion Assessment Method positive) with diffuse myoclonus.
Out of concern for opioid-induced neurotoxicity (OIN), the patient was admitted to the hospital for analgesic control and treatment of what was felt to be a toxic encephalopathy. Despite the known shared metabolic pathway (phase II metabolism) between morphine and hydromorphone, the patient's opioids were rotated from oral morphine to parenteral hydromorphone as the clinical picture continued to unfold. Further workup revealed an unremarkable head CT and EEG. Clinical evaluations and laboratory assessments suggested that, in the setting of her declining physical and renal function (creatinine 1.0 mg/dL with prior baseline 0.6 mg/dL and estimated glomerular filtration rate (eGFR) 55 ml/min/BSA with prior baseline >60 ml/min/BSA), the delirium could be the result of an accumulation of active neurotoxic morphine metabolites (morphine-3-glucuronide). In addition, she was dehydrated, constipated, and had not slept in several days. Unfortunately, her delirium persisted despite correction of metabolic derangements, hydration, and an aggressive bowel regimen.
Urology was consulted, and a nuclear medicine dimercaptosuccinic acid (DMSA) scan revealed minimal function of the left kidney, despite the presence of a nephrostomy tube. Subsequent vascular radiological investigations revealed tumor-induced thrombosis with surmised infarction of her left kidney. It was concluded that the altered renal function due to infarction likely resulted in an inability to adequately excrete the morphine, and the accumulation of polar morphine metabolites resulted in OIN. As exemplified in this case, even with opioid rotation, centrally active metabolites of hydromorphone (hydromorphone-3-glucuronide) theoretically exist, given that it follows a similar phase II metabolic glucuronidation pathway as morphine, although the relative potency and effect of such hydromorphone metabolites are thought to be significantly less than morphine. The patient continued to have signs of OIN and was eventually transitioned to parenteral fentanyl, given that fentanyl is a unique medication that is largely hepatically metabolized into inactive metabolites. Despite common lore that fentanyl and methadone are agents that do no produce active metabolites and therefore do not elicit OIN, case reports of synthetic opioids eliciting OIN do exist in the literature [, ]. Unfortunately, despite aggressive supportive measures and conversion of parenteral hydromorphone to parenteral fentanyl without reduction for cross-tolerance, she continued to have persistent pain with minimal resolution of her systemic neurotoxicity.
Given the concern for poorly controlled cancer-associated pain, the palliative care and pain medicine teams collaborated from the initial visit with concerning symptoms of OIN. At our institution, the palliative clinic shares space within the pain clinic, and the collaboration required a simple conversation followed by same day pain consultation. Initially, the shared thought was moving directly to intrathecal (IT) TDD therapy, as this had been discussed over numerous palliative care visits as a potential option with her physicians and was in line with her goals to achieve enhanced pain control with limited side effects. However, given the underlying metastatic disease process and concurrent cancer treatments, she had a metabolic coagulopathy due to nutritional and micronutrient deficits that required correction with vitamin k to assist in the reversal of her international normalized ratio (INR), thus allowing for any type of procedural intervention.
Ultimately, given the persistent multifactorial delirium and rapidly changing situation, the pain medicine and palliative care teams convened a family conference with the husband, the patients' health-care power of attorney, to again address the current situation and make recommendations that seemed consistent with the patient's predetermined goals. Given the rapid progression of her symptoms despite aggressive attempts to correct potentially remediable factors, the shared medical decision-making discussion included moving forward with TDD, given that this therapy was thought to be the best chance for meeting the patients' goals for comfort and hope to have meaningful interaction with family by reducing the burden of systemic side effects from oral or parenteral opioid therapy. The patient's advanced directive was clear that she appointed her husband to make decisions on her behalf if she was ever in a situation where she was unable to provide consent. Informed consent was obtained through her appointed surrogate decision maker and designated health-care power of attorney.
After correction of her metabolic coagulopathy yielding an INR <1.2, she proceeded with placement of an intrathecal TDD system (Medtronic SynchroMed™ II 40 mL pump and Ascenda catheter). The pump reservoir was placed in her right lower abdominal quadrant, and the catheter tip was placed at T10. Her TDD system was efficiently titrated to achieve acceptable levels of analgesia using a combination of opioid (hydromorphone 2 mg/mL) and local anesthetic (bupivacaine 10 mg/mL). The initial postoperative settings were 0.5 mg/day of hydromorphone in a simple continuous mode without bolus dosing (2.5 mg/day of bupivacaine). Within 24 hours of TDD placement, the patient experienced near complete resolution of her toxic encephalopathy and was able to engage in meaningful conversation with her family and health-care teams. There were no signs or symptoms of opioid withdrawal. In the early postoperative phase, she required additional dosing of oral hydromorphone, but was responsive to 2 mg orally every 3 hours as needed for breakthrough postsurgical pain totaling three to four doses per day. Given the robust response to TDD therapy, the patient was able to participate in goals of care discussions with her interdisciplinary palliative care team and elected to discharge closer to home under the provision of hospice services postoperative day (POD) two. Prior to leaving the hospital, the TDD rate was increased to 0.8 mg/day of hydromorphone, and she was provided with a personal therapy manager (PTM) allowing 0.1 mg/dose every six hours totaling four doses per day. The dose remained stable for seven days. As her oncologic disease continued to evolve, her TDD system was adjusted by her hospice provider to accommodate her daily use of oral opioid therapy. The pump was again adjusted on postoperative day nine, yielding a basal rate of 1.4 mg/day of hydromorphone with four PTM boluses of 0.15 mg/dose of hydromorphone every six hours. This dose remained for POD 9–13, and she passed away peacefully with acceptable analgesia at home with her family under the auspices of hospice two weeks after TDD implantation. |
pmc-6541976-1 | Here, we report a case of a 71-year-old female diagnosed with MGD. The patient had no concurrent diseases and was not under any long-term medication. During a routine checkup, a hypercalcemia (3.7 mmol/l) with elevated parathyroid hormone (PTH: 233 pg/ml) was detected. Despite the very high serum calcium levels, the patient did not suffer from pHPT-specific symptoms such as kidney stones. A bone density measurement was not done. A preoperative neck and thyroid ultra-sonogram and a 99mTc-sestamibi SPECT/CT did not reveal an enlarged parathyroid adenoma in any location. An ultra-sonogram revealed a slightly enlarged multinodular thyroid and 99mTc-sestamibi SPECT/CT an uptake of radiotracers in the left lower thyroid, which intraoperatively turned out to be an inflammatory thyroid node.
Preoperative localization via Met-PET/CT showed a MGD with two areas suspected to be enlarged parathyroid glands (left lateral to the thyroid lobe and posterior mediastinum; ). Both diagnostic findings were extirpated in a two-stage procedure. First, a Kocher transverse collar incision was performed and the left thyroid area was explored. An enlarged left upper parathyroid gland (weight: 7.6 g, size: 4 × 2.5 × 1 cm) was extirpated, and a left caudal parathyroid gland was intraoperatively found to be normal in size (). Further, a lower pole resection of the left thyroid (histology: inflammatory goiter node) and a left-sided thymus resection (histology: atrophic thymus with a cyst) was performed. Intraoperative PTH levels declined from 342 pg/ml to 197 pg/ml 10 minutes after extirpation. Three months later, a right thoracotomy was performed, and an enlarged parathyroid gland was extirpated from the posterior mediastinum (weight: 10.2 g size: 5 × 2.3 × 1.5 cm; ). Afterwards, intraoperative PTH levels declined from 189 pg/ml to 43 pg/ml at 10 minutes after extirpation. The postoperative course was uneventful and patient was discharged after one week with normal serum calcium levels (2.3 mmol/l; PTH: 51 pg/ml). |
pmc-6541979-1 | A previously healthy 33-year-old woman was found unconscious at her house. She was exposed to CO from a faulty heater and the exposure time was unknown. She was last heard by her relatives 10 hours earlier, when she referred experiencing nausea, vomiting, and headache.
She was admitted to intensive care unit (ICU) with a Glasgow Coma Scale score of 9/15 (E4-M3-V2). Arterial blood gas sample analysis revealed metabolic acidosis and her HbCO level was 20.4 percent. Serum biochemistry disclosed elevated serum creatinine (1.33 mg/dL) and HS-Troponin T (188 ng/L). Due to her severe neurological symptoms, she was intubated and sedated with propofol. No evidence for alterations of brain tissue was found from either computed tomography (CT) or magnetic resonance imaging (MRI) at this point. HBOT (Drass Galeazzi Underwater Technology, Livorno, Italy) was performed immediately and 24 hours after admission (80 minutes' exposure at 2.5 atmospheres absolute, ATA). After 9 days, the patient showed some spontaneous movement. She gradually regained consciousness and both cardiac and kidney functions improved.
On the 15th day after her ICU admission, she started following commands and was subsequently weaned from the ventilator. She was discharged from the ICU and directed to the rehabilitation unit on the 18th day after admission. At first, the patient showed good adherence to rehabilitation program.
Disability Rating Scale (DRS) [] measured at this time revealed a score of 8/30, corresponding to moderately severe disability.
However, approximately 40 days after the exposure to CO, she was confused and suffered from slowing of psychomotor functions, impaired short-term memory, and reduced sustained attention. She was no more able to maintain the upright position. The symptoms gradually worsened in few days and she was transferred to our hospital. The patient was hypomimic and presented stereotyped movements, especially with her hands, when she was admitted to the facility. She was not oriented in time and space, had reduced ability to sustain attention, and had optic apraxia as well. Her speech was restricted to short phrases in response to specific requests and she had anterograde memory deficits. She demonstrated very poor awareness of her cognitive deficits. The overall raw score to the Mini-Mental State Examination (MMSE) [] was 6/30. DRS at this time reached the score of 16/30, corresponding to severe disability.
Motor system examination revealed rigid tetraparesis. There was significant truncal and nuchal extensor hypertonia. She had urinary and bowel incontinence. Examination of the other systems was normal.
Brain MRI performed on day 45 after exposition showed confluent bilateral and symmetric white matter hyperintense areas on T2 and Fluid Attenuated Inversion Recovery (FLAIR) sequences (). The hematologic, biochemical, and serological studies as well as HbCO levels were unremarkable. Electroencephalogram showed diffuse slow brain activity. Based on the clinical history and laboratory/imaging findings, the diagnosis of DNS was assumed.
Inpatient rehabilitation program consisted of 2 up to 3 hours of physical and speech therapy per weekday. Therapeutic rehabilitation techniques focused on obtaining a good trunk control in sitting position, readjustment to upright position, muscle strengthening for upper and lower limbs, initiation of gait training, and improvement of orientation and attention.
Rehabilitative treatment was performed concurrently with HBOT and ROS scavenger administration.
HBOT consisted of 40 sessions (two 35 minutes' oxygen breathing cycles with air breathing interval for 5 minutes at 2.5 ATA) with the following sequence: once a day for 20 days, no treatment for 15 days, once a day for 10 days, no treatment for 15 days, and lastly once a day for 10 days again.
ROS scavenger therapy consisted in intravenous high dose N-Acetylcysteine (12 g/die in continuous infusion) and low dosage of oral glucocorticoids (prednisone 25 mg/die).
Since the third session of HBOT, there was a significant improvement in her motor and cognitive skills: the patient became able to stand in upright position with arms on a surface. Her sustained attention began to last much longer and she became oriented in space and time. Language skills improved in both verbal comprehension and production.
After 100 days and 20 sessions of HBOT, she was able to walk for approximately 100 meters using a walker-rollator, however with some gait difficulties. MMSE raw score improved and reached the cut-off level for absence of cognitive impairment (24/30). Despite these improvements, the concurrent analytical neuropsychological evaluation showed performance deficits in several cognitive functions. For this reason, treatment was continued with 20 more sessions of HBOT, rehabilitation, and pharmacological therapy.
The neurological profile gradually improved until the time of discharge (i.e., at the end of the 40 HBOT sessions), when the patient appeared calm, lucid, and oriented and was able to relate to others. Complete motor recovery was observed within 150 days. DRS reached a score of 3/30, disclosing a partial residual disability.
At 18 months of follow-up, neuropsychological tests were all within normal range (see ). The patient was now independent in her activities of daily living and was able to return to her previous job.
recapitulates the timeline of patient's clinical evolution.
The neuropsychological evaluation was carried out in multiple sessions, each lasting approximately 1 hour. The patient was sitting and relaxing in a room at a comfortable temperature and was required to perform tests included in the battery named “Esame Neuropsicologico Breve” [], including a readapted version of the digit span test, trail-making test, word phonemic fluency, immediate and delayed recall of a short story, Brown-Peterson Interference Test, clock drawing test, verbal abstraction test, and Praxia test. To visually synthesize the cognitive skills' follow-up, we created a cognitive quotient (CQ) represented by the ratio between the number of tests under the normal performance range and the maximum obtainable score (two points for each).
MRI scans were performed on the 2nd, 30th, 45th, 60th, 150th, 180th, and 540th days after exposition. MRI images underwent a specific processing pipeline, aimed at improving the inspection and qualitative comparison of patient leukoencephalopathy across time-points. In brief, FLAIR images were first brain-extracted using the FSL brain extraction tool []. Afterwards, images were linearly transformed (FSL-flirt; 12 DOF affine registration []) to match a high-resolution MNI FLAIR template available at , using sinc as interpolation method and a final resolution of 1x1x8mm (Hanning window, 7 voxels window width). Finally, to further reduce differences in intensity and contrast among different time-points, preprocessed images were imported in MATLAB v8.5.0, adjusted (imadjust) and filtered using Contrast-limited Adaptive Histogram Equalization algorithm (adapthisteq). The results of this processing pipeline are presented in . |
pmc-6541983-1 | An 83-year old female with a past medical history of diverticulitis presented to the hospital with sharp, consistent, 7/10 abdominal pain that woke her up at 3 AM. The pain moved from the epigastric region to her right flank. She denied any other symptoms, including nausea/vomiting or fever/chills. The patient reported that she had eaten chicken breast at a restaurant earlier that evening. On physical exam, vital signs were stable and the abdomen exhibited diffuse tenderness. Laboratory studies revealed leukocytosis of 17.0, otherwise unremarkable. CT of the abdomen/pelvis was negative for free air/fluid collection but revealed a linear hyperdensity, approximately 2.7 cm x 2 mm, within the stomach, which penetrated through the gastric wall into the abdominal cavity ().
The patient was informed that the CT scan may suggest an ingested foreign body, which has likely perforated through the gastric wall. Treatment options were discussed, and the patient opted to have esophagogastroduodenoscopy with attempted endoscopic removal of the foreign body. Endoscopy revealed a region of inflammation and granulation tissue of the distal antral gastric mucosa. Biopsy forceps were used to obtain biopsies of the perforation site and debride the granulation tissue, but the foreign body could not be clearly visualized within the stomach and therefore could not be grasped with forceps for attempted endoscopic removal. The general surgery team arrived to assist with the removal and opted to perform exploratory laparotomy, revealing a 3 cm protruding chicken bone from the anterior surface of the distal gastric wall near the pylorus without any indication of peritonitis, free air, fluid collection, or purulence within the abdomen. As the chicken bone did perforate the gastric tissue, linear gastrostomy was performed to remove the retained foreign body.
The patient had a removal of the chicken bone, with the distal aspect measuring approximately 7 mm in a spatulated form (). She had primary sutured closure of the linear gastrostomy followed by normal saline instillation into the abdominal cavity and stomach insufflation to demonstrate no air leak. The abdominal wall was then closed without the need of a peritoneal drainage tube, and the patient was transferred to the recovery room. The patient had an uneventful hospital course with resolution of symptoms and did not require placement of nasogastric tube. She was started on a liquid diet the morning after surgery and slowly advanced to a full diet before discharge to home in stable condition. |
pmc-6541988-1 | A 27-year-old nulliparous woman presented with an increasing vulval lump for 2-year duration without any significant associated symptoms. She has no history of pain, discharge, or any bleeding from the area. She denied any history of previous vulvar lesion or any other systemic symptoms. Her past history and family history revealed nothing significant.
The physical examination revealed a hard, mobile, nodular, subdermal, mass measuring 30 × 20 mm over the mons pubis and it was about 2 cm superior to the clitoris and 1 cm lateral to the midline. It was fixed to the overlying skin which had a normal appearance. The lesion was nontender and on palpation there was no sign of discharge or bleeding. There were no palpable lymph nodes. Preoperative ultrasound scan showed no increased vascularity around the lump. An excision biopsy of the lesion was performed under regional anaesthesia. Macroscopically, the specimen measured 30 × 20 mm. The overlying skin was unremarkable. On slicing, the cut surface was pale tan. Microscopy revealed a poorly circumscribed, unencapsulated tumor composed of nests and strands of polygonal cells having abundant eosinophilic granular cytoplasm and small, central hyperchromatic nuclei. Cell margins are indistinct. The margins appear infiltrative. However, there is no nuclear or cytological atypia. There are no mitoses and excision margins are free of tumour. Immunohistochemistry showed that the tumor cells are S-100 positive. These features were compatible with a GCT without features of malignancy. On the follow-up appointment at 4 months after the excision procedure, the patient was asymptomatic. Microscopic appearance with Haematoxylin and Eosin and immunohistochemical staining has been shown in . |
pmc-6541993-1 | A 28-year-old male patient was admitted to endocrinology outpatient clinic with complaints of impaired balance, hearing loss, and numbness in the hands for a long time. There were type 1 diabetes mellitus, hypopituitarism, and short-term myoclonic jerks after head trauma in his medical history. The drugs he used were insulin aspart, insulin glargine, and carbamazepine. In the family history there was a consanguineous marriage between the parents. His family did not have any history of HDR syndrome. Vital signs upon admission found a blood pressure of 100/70 mmHg, heart rate of 84 beats/min, and body temperature of 36.6°C. He was not mentally retarded. In the neurological examination, the patient was awake, oriented, and cooperative with exam; cranial nerves, motor strength, sensory testing, and proprioception were all intact; only ataxic gait was present. Hair in the face and axillary and inguinal regions was decreased, bilateral testes were small, and gynecomastia was present. All other examinations were normal.
In laboratory examination, the following are found: leukocyte: 8.6 103/ml (4-10), hemoglobin: 10.8 gr/dl (12.1-17.2), MCV: 99.7 fL (82.2-99), platelet: 119 103/ml (150-400), glucose: 386 mg/dL (70-100), urea: 80 mg/dL (16.6-48.5), creatinine: 1.9 mg/dL (0.70-1.2), sodium: 161 mmol/L (136-145), potassium: 4.48 mmol/L (3.5-5.1), calcium: 5.68 mg/dL (8.4-10.2), phosphorus: 5.7 mg/dL (2.5-4.5), albumin: 4.02 g/dL (3.5-5.2), HbA1c: 7.6% (4-6), TSH: 1.42 mU/L (0.27-4.2), free T4: 0.546 ng/dL (0.93-1.7), free T3: 1.53 ng/L (2-4.4), iPTH: 19.90 ng/dL (12-88), FSH: 1.3 U/L (1.7 -12), LH: 7.67 IU/L (1.24-8.62), total testosterone: 8.88 ng/dL (249-836), cortisol: 10.15 mcg/dL (6.02-18.4), prolactin: 8.19 mcg/L (4.4- 15.2), B12: 273.2 ng/L (197-771), folic acid: 1.9 mcg/dL (3.89-20), urine analysis Ph: 5.5, density: 1014, microalbumin in spot urine: 0.34 mg/dl (0-2), microprotein in spot urine: 36.3 mg/dl (0-15), creatinine in spot urine: 227.61 (39-259) mg/dl, serum osmolarity: 394 mOsm/KgH2O (285-295), and urine osmolarity: 590 mOsm/KgH2O (50-1200). On abdominal ultrasonography, the size of left kidney was preserved, long axis of right kidney was 8.5 cm, and there was a minimal reduction in cortex thickness and a grade 1 increase in right kidney parenchyma echogenicity. As a result of laboratory and imaging findings, in addition to the diagnosis of type 1 diabetes mellitus and hypopituitarism, chronic kidney disease, primary hypoparathyroidism, and megaloblastic anemia due to folic acid deficiency were detected.
The audiogram showed a moderate mix type sensorineural hearing loss in the left ear and mild sensorineural hearing loss at increased frequencies in the right ear []. There were no pathological findings on eye examination. Bilateral symmetrical calcifications were detected in the basal ganglia, vermis, and cerebellum in brain CT []. There were no pathological findings in the pituitary MRI.
HDR syndrome was considered because of the diagnosis of primary hypoparathyroidism, hearing loss, and nondiabetic chronic kidney disease in addition to type 1 diabetes mellitus, hypopituitarism, and epilepsy. The patient's electrolyte and hormone replacement therapies were held. The symptoms and signs improved and the patient was taken to regular follow-up program. |
pmc-6541996-1 | A 61-year-old woman was diagnosed with anti-acetylcholine receptor antibody (ACh-R) positive MG in 2005. Initially, only ocular signs were present, but systemic symptoms arose over time showing a relapsing course. During her last myasthenic crisis in 2009 a thymectomy was performed and an immunosuppressive therapy with azathioprine in combination with pyridostigmine was initiated. Neurological symptoms were fully controlled without residual symptoms. Doses of azathioprine and pyridostigmine remained stable during the regular three-monthly neurologic screening visits. In March 2016 a MCPyV-positive MCC measuring > 5 cm in diameter with a tumor thickness of 22 mm was detected on her right gluteal side. After wide local excision of the primary tumor with a 3 cm safety margin and a negative sentinel lymph node biopsy of the right groin, she received an adjuvant radiotherapy of the primary tumor site. The patient underwent a rigorous follow-up scheme with clinical examinations and ultrasound of the regional lymph nodes every six weeks and yearly chest X-ray and abdominal ultrasound were planned. In September 2016, six months after the initial diagnosis of MCC, ultrasound of the right inguinal groin showed enlarged lymph nodes. A subsequent positron emission tomography (PET)-computed tomography (CT) confirmed right inguinal lymph node metastases. Additionally, metastases of the pancreatic tail and its surrounding lymph nodes were detected. To exclude a secondary malignancy, a biopsy from the pancreas was performed confirming MCC metastasis. Due to the extensive metastatic spread of the MCC, immune-checkpoint therapy with a PD-1 inhibitor was recommended by our interdisciplinary tumor board. The risks (i.e. exacerbation of preexisting MG with potential lethal outcome) and benefits (i.e. life-threatening metastatic MCC with a response rate of around 60% to PD-1/PD-L1 inhibitors) of PD-1/PD-L1 inhibitor therapy was discussed thoroughly with our neuromuscular specialists and the patient. As treatment with azathioprine has been identified as a risk factor for the development of non-melanoma skin cancer in transplant recipients and myasthenia patients [–] therapy for MG was switched from azathioprine to mycophenolatmofetil (MMF) (500 mg 1–0-1). After extensive education of the patient and the patients’ family, immunotherapy using PD-1 inhibitor pembrolizumab at a dose of 2 mg/kg every three weeks was started in November 2016. At the time of therapy initiation avelumab was neither approved for MCC nor available to our skin cancer unit []. Therefore, due to published overall response data at that time [], pembrolizumab was chosen.
Prior to initiation of immunotherapy, screening laboratories for hepatitis A, B and C, were performed and negative. The patient had no medical history for hepatotoxicity in the past, therefore marginally elevated transaminases were tolerated at start of PD-1 inhibitor therapy. Due to parallel induction of MMF and pembrolizumab, blood levels including liver enzymes were measured more frequently than normal. After one cycle of pembrolizumab, the patient’s liver enzymes started to rise slightly (grade 1 common toxicity criteria of adverse events (CTCAE; version 4.0)). The case was discussed in a multidisciplinary team meeting with gastroenterologists and neurologists, concluding that an immune-related hepatitis would rather be unlikely while treated with MMF suspecting MMF-induced toxic liver damage as the most likely diagnosis. At this time, a liver biopsy was not performed due to asymptomatic grade 1 hepatitis. Since levels of aspartate aminotransferase increased on day 15 and were still elevated on day 21, the second pembrolizumab infusion was paused as a precaution. In addition, MMF was switched to CsA at a dose of 2 mg/kg. Within two weeks, after a slight increase of the liver enzymes, transaminases decreased to initial values (Fig. ) and pembrolizumab was continued.
Eight weeks after the start of immunotherapy with pembrolizumab, but after only two infusions, the first regular staging with CT scans of the chest, abdomen and brain revealed a mixed response with partial response (PR) of the pancreatic tail tumor and progression of the lymph node metastases of the right groin. As the tumor of the right groin caused severe pain, surgery or localized radiation therapy was recommended. However, after the third course of pembrolizumab the patient reported significant decrease of pain, clinical examination could confirm dramatic regression of the inguinal lymph nodes. Therefore, immunotherapy continued without any further local treatment to the right groin. The patient was in constant surveillance by neurology specialists using the quantitative myasthenia gravis (QMG) score incl. measurement of vital capacity every 3 months and did not experience an exacerbation of MG at any time. She remained on treatment with CsA 125 mg/day and pyridostigmine 60 mg three times daily. The second staging after 23 weeks (six doses) showed further remission of the pancreatic metastasis and distinct remission of the lymph node metastases. So far, immunotherapy with pembrolizumab is still ongoing (27 doses) and CT-imaging of the abdomen revealed a persistent tumor regression of the right inguinal lymph node metastases and a no longer detectable metastasis at the pancreatic tail (Fig. ) for 65 weeks without any flare of the MG. |
pmc-6542005-1 | A 74-year-old woman was admitted with the chief complaint of subcutaneous masses, abdominal pain, and fever. Six months before the admission, the patient developed thrombocytopenia while being treated with antibiotics for pneumonia. At the time of admission, physical examination revealed a firm non-tender subcutaneous mass on the left upper arm (Fig. a) and two at the waist. Her abdomen was soft, but light tenderness was present in the upper abdomen without rebound tenderness. The liver and the spleen were not palpable below the costal margin. The laboratory tests results were as follows. (1) A white blood cell count of 3.48 × 109/L (reference range 3.5–9.5 × 109/L), an extremely low platelet count of 7.0 × 109/L (reference range 100–300 × 109/L) and haemoglobin of 96 g/L (reference range 115–150 g/L) were noted. (2) Serum protein electrophoresis showed a monoclonal band, which was determined to be of the IgM κ type by immunofixation (Fig. a). Serum protein quantitative analysis revealed 10.30 g/L IgM, 20.10 g/L kappa light chain, 7.04 g/L lambda light chain and kappa/lambda = 2.86 (reference range 2.20,13.00 and 6.50 g/L and reference ratio of 2.56, respectively). All the other immunoglobin (Ig) levels were normal. (3) Urinalysis result was 1 + (0.5 g/L) (reference range negative, 0 g/L) for protein. (4) Bone marrow aspiration and flow cytometry (FCM) analysis were normocellular. Computed tomographic (CT) scan showed a 2.0 cmx1.6 cm subcutaneous mass on the left upper arm and several ill-defined soft tissue lesions at the waist along with intra-abdominal lymphadenopathy and moderate splenomegaly (Fig. b&c). Abdominopelvic contrast-enhanced CT displayed multiple low-density plaques in the spleen (Fig. d). The patient underwent a needle biopsy of the subcutaneous mass on the left arm in a local hospital. After her admission, the subcutaneous mass at the right waist was excised, and laparoscopic splenectomy was performed.
(1) Macroscopically, the resected lumbodorsal specimen was a firm grey-brown mass measuring 5.5 cm × 3.0 cm × 1.5 cm in volume. Microscopic examination revealed diffuse proliferation in the subcutaneous tissue, which was composed of large polygonal and spindle histiocytes with abundant eosinophilic cytoplasm, round to ovoid eccentric nuclei, reticulate chromatin and median nucleoli (Figs. a&b). Needle-shaped crystals were confined to the cytoplasm, some of which were in parallel arrays (Fig. c). These crystal-containing cells were located in and around an intact lymph node measuring 0.8 cm in maximal dimension. The paracortical area of the lymph node was expanded by extensive infiltration of the crystal-containing cells and mature plasma cells (Fig. a). These crystal-containing cells were strongly positive for CD68/PGM1 (Fig. d) and CD163 and negative for S-100, desmin, SMA, MSA, and myogenin. Immunostain for IgM heavy chain was strong and diffuse (Fig. e). Immunostain for the κ light chain was relatively weak. Immunostains for the IgG heavy chain and λ light chain were negative (Fig. f). The plasma cells were characterized by CD38+, MUM1+, and kappa > lambda. Congo red staining was negative. BIOMED-2 multiplex PCR analysis showed diversity-joining gene segments of immunoglobin heavy chain (IgH-DH-JH) gene rearrangement (the monoclonal peak was at approximately 400 bp) and Igκ gene rearrangement. The MYD88 L265p mutation was not detected. The diagnosis of “CSH associated with IgH and Igκ rearrangements” was made with a comment that an underlying lymphoproliferative disorder should be suspected.
(2) Review of the needle biopsy of the mass on the left upper arm identified a similar cell population as the one at the waist, which was characterized by sheets of large rhabdoid cells with abundant deeply eosinophilic cytoplasm containing massive crystalline materials, eccentric irregular nuclei, and inconspicuous nucleoli.
(3) The spleen was enlarged to 15 cm × 10 cm × 8 cm and weighed 198 g with a smooth surface. Serial sectioning showed a grey irregular solid tumour measuring 3 cm × 1.5 cm × 1.3 cm at the splenic hilum mixed with adipose tissue and focal necrotic areas. Microscopic examination revealed diffuse infiltration of large cells with a round, oval or irregular nuclei, distinct nucleoli and scant cytoplasm, centroblast like (Fig. a-b). Frequent mitoses were observed (Fig. b). Immunohistochemically, the neoplastic cells were CD20+, Bcl6+, MUM1+, CD3p-, CD10-, CyclinD1- and CD43- (Fig. c-d). IgM was strongly positive in the cytoplasm of some neoplastic cells, while IgG, CD38, and CD138 were negative (Fig. e-g). The Ki-67 index was 80% (Fig. h). Fluorescence in situ hybridization (FISH) suggested BCL-6 rearrangements but the absence of dysregulations of BCL2 and MYC. In situ hybridization for Epstein-Barr virus-encoded RNA (EBER-ISH) was negative. A monoclonal peak of the IgH gene was detected at approximately 420 bp by commercial BIOMED-2 multiplex PCR system. These findings conformed to a diagnosis of DLBCL, non-GCB subtype (Hans algorithm). The pancreas was involved, while the liver was not. CSH lesions were not found in the spleen and the regional lymph nodes.
After splenectomy, the platelet count increased to 128 × 109/L. The patient was administered eight courses of rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) and was in partial remission (PR) 9 months after diagnosis. Positron emission tomography-computed tomography (PET-CT) scan showed resolution of the mass at the left arm, smaller lumbar subcutaneous masses and intraperitoneal lymphadenopathy (Fig. e-f). However, serum paraprotein levels remained elevated (IgM 4.01 g/L). Thus, the patient received four cycles of rituximab (600 mg/m2 day 1) plus lenalidomide (25 mg/m2 days 1–14 q28), and the MG was not visible (Fig. b) at a one-year follow-up. |
pmc-6542013-1 | A 30-year-old male presented with a six-month history of lower back pain and four weeks of fevers. CT abdomen/pelvis demonstrated a bulky retroperitoneal mass with bilateral retroperitoneal and left pelvic lymphadenopathy, and numerous omental deposits. He was subsequently referred to the Haematology Service at our institution with a presumptive diagnosis of lymphoma. Staging FDG-PET/CT demonstrated an intensely FDG-avid and bulky left retroperitoneal mass causing lateral displacement of the left kidney, with a maximum standardised uptake value (SUVmax) of 19. Numerous FDG-avid soft tissue deposits were seen in the bilateral retroperitoneal space. The left testis was notably absent in the scrotal sac, with an intensely FDG-avid (SUVmax 16.3) soft tissue lesion situated adjacent to the left inguinal canal, which had been presumed to reflect lymphomatous involvement of an external iliac node on prior CT (Fig. ). The constellation of absent left testicular activity and intensely FDG-avid retroperitoneal mass raised the prospect of metastatic seminoma, which was subsequently supported biochemically with a mildly elevated β-human chorionic gonadotrophin (β-hCG) at 56.3 IU/L (normal range < 2.6 IU/L); α-fetoprotein (AFP) was within the normal range. A bone marrow biopsy performed prior to the FDG-PET/CT was later found to reveal a normocellular marrow with no evidence of neoplastic involvement.
Interestingly, a targeted examination was incongruent with the FDG-PET/CT findings, with a palpable left testicular mass and absent left inguinal lymphadenopathy. Scrotal ultrasound also demonstrated two testicles, with the 19 mm heterogeneously hypoechoic left testicular mass compatible with malignancy. On retrospective review of the FDG-PET/CT, metastatic testicular GCT arising from a retractile left testis was deemed to be the most likely unifying diagnosis (Fig. ). Histological confirmation of seminoma was established following a CT-guided biopsy of the retroperitoneal mass, with immunohistochemistry positivity for CD117 (c-KIT) and Oct 3/4, and negative for cytokeratin AE1/AE3, S100 protein, CD45, desmin, and CD56. He was subsequently treated with Cisplatin-based chemotherapy. |
pmc-6542013-2 | A 42-year-old male presented with a one-week history of lower abdominal pain. Abdominal ultrasound demonstrated two large abdominopelvic masses which were corroborated on contrast-enhanced CT chest/abdomen/pelvis. Serum LDH was mildly elevated at 267 U/L (normal range 120–250 U/L), and with lymphoma being the initial top differential diagnosis, a staging FDG-PET/CT was performed (Figs. and ). The left retroperitoneal mass lesion measured 4.5 × 4.3 × 7.7 cm in size and the left pelvic mass was 8.9 × 6.9 × 11.9 cm, with both masses exhibiting intense FDG-avidity (SUVmax 21.4). A solitary right testis was noted in the scrotal sac.
Further questioning revealed a background of undescended testis at birth which was subsequently resected in childhood. Metastatic GCT became the primary differential diagnosis, further supported biochemically with a mildly elevated β-hCG at 6.4 IU/L. Subsequent ultrasound-guided biopsy of the left pelvic mass confirmed metastatic seminoma. He was subsequently commenced on BEP chemotherapy. |
pmc-6542013-3 | 33-year-old male presented with lower abdominal pain. Contrast-enhanced CT abdomen and pelvis revealed a large 7.8 × 8.0 × 8.3 cm pelvic mass, initially thought to be a soft tissue sarcoma. A staging FDG-PET/CT was performed which demonstrated intense FDG-avidity (SUVmax 12.4) in relation to the pelvic mass lesion, a mildly FDG-avid (SUVmax 4.9) left para-aortic node deemed highly suspicious for a retroperitoneal nodal metastasis, and, notably, an absent left testis (Fig. ).
Further history included the patient describing an absent left testis from birth which was never brought to medical attention. CT-guided biopsy of the pelvic mass revealed a seminoma with normal tumour markers. Open resection of the pelvic mass confirmed it to be arising from an intra-abdominal testis, with focal residual seminiferous tubules evident and showing germ cell neoplasia in situ (Fig. ). Restaging FDG-PET/CT performed 3 months post-surgical resection demonstrated interval progression of the pre-existing FDG-avid left para-aortic node, confirming metastatic involvement. He was subsequently commenced on BEP chemotherapy. |
pmc-6542033-1 | A 50-year-old Thai male presented with three episodes of generalized seizures and right-sided hemiparesis for 6 h before arrival. He had no previous seizures. He had a history of well-controlled diabetes mellitus and hypertension for 20 years and took metformin 1000 mg/day and diltiazem 60 mg/day. His past medical history revealed progressive slowness in thinking and walking, memory impairment, sleep-wake disturbance and mood disorder, which had slowly progressed for the past 20 years; however, it had rapidly worsened during last year of his life. He was diagnosed with organic mood disorder 5 years before this presentation and treated with risperidone 0.5 mg/day, sertraline 50 mg/day, and trihexyphenidyl 1 mg/day. Even with this treatment, his symptoms had been progressively worsening for the past 1 year to the point that he could not perform daily living activities, such as taking the correct medications. He was the fifth of seven children. His sister had a history of unexplained hearing loss, cognitive decline, and slowness of movement starting at the age of 20. When she was 40 years old, she developed visual and auditory hallucinations as well as recurrent transient ischaemic attacks with full recovery. The patient’s father and mother died at the ages of 70 and 78, respectively, and had no history of cognitive impairment or stroke. A mental status examination showed a good level of consciousness; however, he was mute and slow to respond to commands. A motor examination showed right-sided weakness (grade 2/5 for arm and grade 0/5 for leg) and generalized hyperreflexia except for right leg hyporeflexia and no sensory impairment. There was also mild right facial weakness. A CT of the brain showed diffuse white matter abnormalities, old multiple lacunar infarctions in the bilateral basal ganglia, thalamus, and left pons. The initial diagnosis was acute ischaemic stroke with seizures. He was prescribed 300 mg/day of aspirin and usual stroke care. Phenytoin was prescribed for seizure control. An MRI of the brain was performed on day 12 after admission. The results showed acute infarction of the left pons (Fig. ), several old lacunar infarcts surrounded by minimal gliosis in the bilateral putamen and thalamus as well as few scattered small, old infarcts surrounded by minimal gliosis in the bilateral frontal-parietal periventricular white matter without anterior temporal lobe lesion (Fig. a, b, and c). Surprisingly, a large number of microbleeds were found throughout the brain (Fig. d, e and f). The total numbers of cerebral microbleeds was 214 and 136 in lobar areas according to the Microbleeds Anatomical Rating Scale (MARS) []. After a comprehensive review of vascular risk factors, his HbA1C was 5.5%, and his serum LDL was 79 mg/dL. His blood pressure was well-controlled. None of these risk factors explained his symptoms and MRI findings. He had a history of unexplained cognitive impairment and mood disorder. In addition, his sister had a history of cognitive decline, psychiatric symptoms and transient ischaemic attack; therefore, a genetic condition, such as CADASIL, was suspected and confirmed by molecular genetic testing, which revealed a homozygous known pathologic variant, c.1672C > T (p. Arg558Cys), in the NOTCH3 gene. His clinical symptoms deteriorated, and he died of tracheobronchitis with secretion obstruction. |
pmc-6542044-1 | A 31-year-old Asian woman diagnosed as having unexplained infertility decided to undergo IVF treatment to achieve a successful pregnancy. She had no past systemic illness like diabetes mellitus or hypertension. She was started on birth control pills, Ovral L tablets (ethinyl estradiol 0.03 mg + levonorgestrel 0.15 mg), to prevent pregnancy before commencing IVF treatment. Daily injections of Gonal-f® (follitropin alfa injection) 225 IU were given during which time the stimulation was monitored using a combination of vaginal ultrasound and blood estrogen level every 2–3 days. The inability of blood estrogen levels to rise adequately prompted the physician to add 450 IU injectable Menopur®, which comprises 75 IU follicle- stimulating hormone (FSH) + 75 IU luteinizing hormone (LH), for multiple egg creation. Injectable Cetrotide® (cetrorelix acetate for injection) 0.25 mg subcutaneously was given for 5 days to prevent premature ovulation. Injectable Ovitrelle® (choriogonadotropin alfa) 250 μg/0.5 ml was given subcutaneously to prepare the largest mature follicles for ovulation. The egg was retrieved, fertilization was achieved, and embryo was transferred to our patient’s uterus for implantation. After embryo transfer, she was started on Endofert tablets (estradiol valerate) 2 mg daily for 2 months along with Susten tablets (progesterone) 200 mg twice daily supplements for the entire length of pregnancy. She had no high blood pressure or blood sugar during her pregnancy. She had a twin delivery. Currently, she is in her third month of post-partum period. She complained of seeing disturbing flashes in peripheral vision beginning in her third trimester. She described these flashes as usually occurring in the morning hours or while walking, coming in sets of three to four, occurring five–six times a day and lasting for less than 5–10 minutes. She says that her symptoms occur even now; however, with reduced frequency. Her flashes were not accompanied by other ocular symptoms such as pain, redness, photophobia, or decrease in vision. She gave no past or family history of migraine. She visited many retina specialists with complaints of persistence of symptoms. Her ocular examination was normal. A physician’s and a neurologist’s opinion were sought to rule out migraine. Plain magnetic resonance imaging (MRI) of her brain was normal. A diagnosis of IVF treatment-induced visual illusory palinopsia was suspected. She was counselled and reassured regarding her symptoms. |
pmc-6542061-1 | A 58-year-old white woman with a history of emphysema and chronic obstructive pulmonary disease (COPD) secondary to A1AD, who received lung transplantation 4 years prior, presented to dermatology with a 1-year history of painful nodules on the extensor surfaces of her upper extremities and back. She reported a 14-year one pack/day smoking history as well as fatigue, shortness of breath, cough, allergies, arthritis, leg swelling, muscle weakness, colitis, decreased appetite, nausea, light sensitivity, eye pain, and eye redness. She also reported depression and anxiety. She denied alcohol or drug use. She had completed high school and was now supported on disability. She also received emotional support from her husband who accompanied her to appointments and was involved in her healthcare. She had a family history of a cousin with cancer (type not reported). Following lung transplantation, she had been maintained on an immunosuppressive regimen of mycophenolate mofetil (MMF), tacrolimus, intermittent steroids, and a human alpha-1 proteinase inhibitor. Her post-transplant course was complicated by multiple respiratory viral and fungal infections, recurrent acute cellular rejection and lymphocytic bronchiolitis, chronic allograft dysfunction, recurrent lower extremity deep venous thrombosis, and an intermittent requirement for increases in her immunosuppressive therapy.
Five months later, she developed multiple tender, indurated erythematous plaques on her anterior tibial surfaces bilaterally, clinically suggestive of erythema nodosum. Excisional biopsies taken from both legs showed necrotizing granulomatous dermatitis and an inflammatory infiltrate involving the panniculus (Fig. ). An infectious workup with Gram, periodic acid–Schiff (PAS), and Fite stains did not reveal any microorganisms; there was no growth on short-term or long-term tissue cultures. A complete rheumatologic and hematologic workup, including serum protein electrophoresis (SPEP) and urine protein electrophoresis (UPEP), was unrevealing. IHC staining of the inflammatory infiltrate was positive for myeloperoxidase (neutrophilic marker), and CD68 and CD163 (histiocytic markers). A multifocal histiocytic malignancy was considered, but there were no markedly atypical cells with aberrant IHC staining to support that possibility. A repeat biopsy 1 month later showed similar findings, including presence of neutrophil-rich mixed (septal and lobular) panniculitis without vasculitis, and a diagnosis of presumptive A1AD panniculitis was made. The decision was made to increase the dose of human alpha-1 proteinase inhibitor therapy and prednisone with close follow-up.
For the following 6 months, she was seen regularly in our dermatology clinic and noted at each visit to have significant improvement in her symptoms and lesions. However, over the course of several weeks, she developed multiple painful, exophytic, firm nodules with ulceration in the areas of panniculitis (Fig. ). An excisional biopsy taken at that time revealed a dermal-based proliferation of large pleomorphic atypical spindle and rounded cells with marked cytological atypia, and a subset of bizarre giant cells with hyperchromatic nuclei, abundant cytoplasm, and frequent atypical mitotic figures. Focal necrosis and myxoid features were present (Fig. ). A repeat infectious workup was negative.
IHC was negative for melanocytic (S-100, Melan-A, HMB45), epithelial (low molecular weight cytokeratin, cytokeratin MNF116, p40, p63), follicular dendritic cell (CD21), interdigitating dendritic cell (S-100), Langerhans cell (CD1a), histiocytic (CD68, lysozyme), muscle (SMA and desmin), and endothelial cell markers (CD31 and CD34). Both CD10 (positive in mesenchymal tumors, non-specific) and p16 strongly stained the pleomorphic spindle and giant cells. Together, the lack of tissue-specific markers, the histopathology findings, and strong CD10 staining indicated a diagnosis of cutaneous undifferentiated pleomorphic sarcoma (UPS)/PDS, a diagnosis of exclusion. A full body positron emission tomography-computed tomography (PET-CT) scan was notable for multifocal increased fluorodeoxyglucose (FDG) uptake in our patient’s bilateral lower extremities without the presence of distant metastatic disease.
Several therapeutic options were considered, including: cytotoxic chemotherapies commonly used in sarcoma such as doxorubicin and ifosfamide or gemcitabine and docetaxel; kinase inhibitors (such as imatinib or pazopanib); and programmed cell death-1 (PD-1) and PD-1 ligand (PD-L1) inhibitors. Although PD-1 inhibitors have generally been disappointing in sarcoma treatment, preliminary results from a phase II study suggested possible efficacy particularly in the UPS subtype []. In the study, of the 76 patients treated with the PD-1 inhibitor pembrolizumab, an objective response rate of 22% was noted in the UPS subgroup, while no responses were seen in any of the other sarcoma subtypes studied. However, the use of such agents in organ transplant recipients is contraindicated due to a high risk of organ rejection.
Because of the presumed relationship between immunosuppression and sarcoma, the decision was made to discontinue MMF. Considering our patient’s poor overall baseline performance status and due to concerns of myelosuppression in combination with her immunosuppressive regimen [], she was not considered a candidate for combination therapy with doxorubicin and ifosfamide. Liposomal doxorubicin, however, has shown comparable efficacy and less toxicity compared to traditional doxorubicin and is often used for the treatment of advanced sarcoma in patients with poor performance status []. Given the safety profile of this combination therapy, the decision was made to proceed with liposomal doxorubicin 40 mg/m2 every 3 weeks.
After two cycles of doxorubicin and discontinuation of MMF, our patient experienced a reduction in the size of her lesions and improved pain at her 2-month follow-up visit (Fig. ). However, 2 weeks later, she was hospitalized with worsening fatigue, increasing dyspnea on exertion, and increasing oxygen requirements. A workup was positive for methicillin-susceptible staphylococcal aureus (MSSA) pneumonia. Acute cellular rejection or antibody-mediated rejection was also considered, although not definitively proven. Despite prompt initiation of appropriate therapy with antibiotics and steroids, her condition worsened, and she developed multi-organ failure in the setting of septic shock. She ultimately elected for comfort measures and died shortly after (timeline, Fig. ). |
pmc-6542082-1 | The patient was a 3 years old girl who for 2 months had symptoms and signs of disease with fever and reduced general condition. The last week she had nose bleedings, petechiae, and pain from the throat and abdomen. The initial blood tests showed hemoglobin 4.3 g/dL (normal 11–14 g/dL), leukocytes 72 × 109/L (normal 4 × 109/L–15 × 109/L), and thrombocytes 19 × 109/L (normal 150 × 109/L–450 × 109/L). The blood and bone marrow smears revealed that the patient had acute lymphoblastic leukemia. Immunophenotyping of peripheral blood showed 80% pre-B-lymphoblasts, in the bone marrow 88%. The patient was treated according to the NOPHO ALL 2008 protocol, high-risk group []. She started with induction treatment, but the bone marrow on day 15 showed 90% lymphoblasts. The treatment was therefore changed to block treatment according to the protocol, and on day 34 minimal residual disease (MRD) was less than 0.01%. Also repeated later measurements have shown MRD of less than 0.01%.
The G-banding analysis at diagnosis of bone marrow and blood metaphase cells revealed a normal karyotype, 46,XX, in all 25 examined metaphases (Fig. a). Interphase FISH analyses with the Cytocell (Cytocell, Banbury, Oxfordshire, UK) multiprobe ALL panel did not detect aberrations of MYC, CDKN2A, TCF3, MLL, and IGH, no ETV6-RUNX1 or BCR-ABL1 fusions, nor was hyperdiploidy seen in 200 examined nuclei (data not shown). FISH with the PDGFRB breakapart probe (Cytocell) showed loss of the distal part of the probe in 176 out of 201 examined interphase nuclei from white blood cells and 42 out of 100 examined interphase nuclei from bone marrow cells, suggesting a genetic breakpoint in the PDGFRB locus in 5q32 (Fig. b).
aCGH was performed with genomic DNA extracted from the patientʼs peripheral blood cells using the Maxwell 16 Instrument System and the Maxwell 16 Cell DNA Purification Kit (Promega, Madison, USA). Promegaʼs human genomic female DNA (Promega, Madison, USA) was used as reference DNA. For aCGH, the CytoSure array products were used (Oxford Gene Technology, Begbroke, Oxfordshire, UK) following the company’s protocols. The CytoSure Genomic DNA Labelling Kit was used for labelling of one μg of patient’s and reference DNA, the CytoSure Cancer +SNP array was used for hybridization, and the CytoSure Interpret analysis software was used to analyse the results.
aCGH revealed submicroscopic deletions in chromosome bands 5q32q35.3, 7q34 (within TCRB), 9p13 (PAX5), 10q26.13 (DMBT1), 14q11.2 (TRAC), and 14q32.33 (within the IGH locus) (Fig. c, Table ). The deletion on 5q was 30 Mb long, started between exons 8 and 9 of PDGFRB (5q32), and finished in the CANX locus (5q35.3). The result was in agreement with the FISH data obtained with the PDGFRB breakapart probe (Fig. b, c). Because both FISH and aCGH findings indicated a possible PDGFRB-fusion gene, one µg of the total RNA, extracted from the patient´s bone marrow at the time of diagnosis using miRNeasy Mini Kit (Qiagen Nordic, Oslo, Norway), was sent to the Genomics Core Facility at the Norwegian Radium Hospital, Oslo University Hospital () for high-throughput paired-end RNA-sequencing. For library preparation from total RNA the Illumina TruSeq RNA Access Library Prep kit was used according to Illuminaʼs protocol (Illumina, San Diego, CA, USA; ). Sequencing was performed on NextSeq 550 System (Illumina) and 16 million reads were generated.
Because the raw fastq RNA sequencing data were in the text-based format, we used the “grep” command-line utility to search for sequences which contained part of the ninth exon of PDGFRB []. Using the search term “TCCCTGTCCGAGTGCTGG”, which corresponds to 1713–1730 nt in the PDGFRB reference sequence with accession number NM_002609.3, only one 76 bp long sequence was extracted (Fig. a). BLAT of this sequence on the human genome browser-hg19 assembly () showed that the sequence between nucleotides 26–76 mapped on chromosome 5 at position 149510177–149510227 and was part of exon 9 of PDGFRB. The sequence between nucleotides 1–27 (GCCAGTTGGAAGTTCCAGCCACAGAAG) mapped on chromosome 7 at three different positions: (a) chr7:74172307–74172333 (exon 32 of general transcription factor Iii, GTF2I, reference sequence: NM_032999.3), (b) chr7: 74603796–74603822 (exon 22 of general transcription factor IIi pseudogene 1, GTF2IP1, reference sequence: NR_002206.3), and (c) chr7:72618618–72618644 (exon 22 of general transcription factor IIi pseudogene 4, GTF2IP4, reference sequence: NR_003580.2). These data were verified when we used the BLAST algorithm () to compare the sequence with the reference sequences NM_002609.3 (PDGFRB), NM_032999.3 (GTF2I), NR_002206.3 (GTF2IP1), and NR_003580.2 (GTF2IP4).
In order to confirm the existence of the GTF2I–PDGFRB fusion gene, reverse transcription (RT) and genomic PCR analyses were performed as previously described []. The primers used for PCR amplifications and Sanger sequencing analyses are shown in Table . RT-PCR with the primers GTF2I-3306F1/PDGFRB-1732R1 amplified an 84 bp long cDNA fragment. Sanger sequencing of the PCR products verified the fusion which was found upon searching the RNA sequencing data using the “grep” command (Fig. b). Thus, the leukemic cells carried either the fusion transcript GTF2IP1-PDGFRB, or GTF2I–PDGFRB, or GTF2IP4-PDGFRB. Genomic PCR with the primers GTF2I-3317F1 and PDGFRB-1737R1 amplified a single 1200 bp fragment which by Sanger sequencing was shown to be a hybrid genomic DNA fragment in which intron 8 of PDGFRB is fused with either intron 22 of GTF2IP1, intron 32 of GTF2I, or intron 22 of GTF2IP4 (Fig. c). Additional interphase FISH experiments were performed to detect the GTF2I–PDGFRB fusion gene (Fig. d–h). BACs RP11-21I20 and RP11-137E8 were retrieved from the Human “32K” BAC Re-Array library (BACPAC Resources, ). RP11-21I20, the probe for the PDGFRB gene, mapped to band 5q32 (Position: chr5: 149,320,375–149,496,703; UCSC Genome Browser on Human February 2009 GRCh37/hg19 Assembly) and was labeled red (Fig. d, e). RP11-137E8, the probe for the GTF2I gene, mapped to band 7q11.23 (Position: chr7: 73,944,720–74,129,587) and was labeled green (Fig. f, g). Detailed information about the FISH procedure was given previously []. Fluorescent signals were captured and analyzed using the CytoVision system (Leica Biosystems, Newcastle, UK). FISH analysis showed a fusion signal in 44 out of 100 examined interphase nuclei from bone marrow cells suggesting a GTF2I–PDGFRB fusion gene (Fig. h). Thus, FISH with specific probes for PDGFRB and GTF2I was crucial to show that a novel GTF2I–PDGFRB fusion gene had been formed (Fig. d–h).
Using the FusionCatcher software [] with the fastq files of the RNA sequencing data, an out-of-frame IKZF1–TYW1 fusion transcript was found (Fig. a).
RT-PCR with the primers IKZF1-469F1/TYW1-1282R1 (Table ) amplified a 319 bp long cDNA fragment which by Sanger sequencing was shown to contain IKZF1–TYW1 (Fig. b). The fusion point thus detected was identical to that found by analysis of the RNA sequencing data using the FusionCatcher software (Fig. a, b). In the IKZF1–TYW1 transcript, exon 4 of IKZF1 (nt 642 in sequence with accession number NM_006060 version 6) was fused out-of-frame to exon 8 of TYW1 (nt 1131 in NM_018264 version 4) (Fig. b).
The IKZF1–TYW1 fusion gene would encode a putative truncated 159 aa IKZF1 protein containing the first 140 aa of IKZF1 (NP_006051) and 19 aa from the fused TYW1. This protein would not contain the functional domains of the normal IKZF1 protein. Alterations of IKZF1 (often deletions) are strongly associated with BCR-ABL1-positive as well as Ph-like ALL [, ].
Additional interphase FISH experiments were performed to detect the IKZF1–TYW1 fusion gene using a home-made dual color dual fusion probe. The probes were made from commercial BACs which were purchased from BACPAC Resources Center (). The probe for the IKZF1 gene was constructed from a pool of the clones RP11-813K3 (Accesion number AC020743; Position: chr7: 50157413–50339940) and RP11-95E2 (Accesion number AC018705; chr7: 50475184–50648153) and was labeled red (Fig. c, d). The probe for the TYW1 gene was constructed from a pool of the clones RP11-458F8 (Accesion number AC073335; Position: chr7: 66297269–66454983) and RP11-166O4 (Accesion number AC006480; Position: Chr7: 66699524–66859231) and was labeled green (Fig. c, e).
FISH analysis showed double fusion signals in 91 out of 100 examined interphase nuclei from white blood cells suggesting an IKZF1–TYW1 fusion gene (Fig. f). |
pmc-6542137-1 | A 62-year-old male patient was admitted to our hospital because of epigastric pain for 3 months. Esophagogastroduodenoscopy was performed and a superficial esophageal lesion was found in the middle esophagus. White light endoscopy revealed a flat lesion with a gentle rising slope at the periphery of the lesion. There were scattered leukoplakia in the surface of the lesion and normal vascular network could not be seen in the lesion (Fig. a, b). Narrow-band imaging (NBI) under endoscopy revealed that the lesion exhibited an indistinct brownish area (Fig. c). Magnifying endoscopy with NBI (ME-NBI) showed that there were abnormal intra-papillary capillary loops with small-sized avascular area in the lesion which was then classified as type B1 according to the classification of the Japan Esophagus Society (JES classification) [] (Fig. d, e). Iodine staining (1%) revealed a less-stained lesion (Fig. f). A histopathological diagnosis of squamous cell carcinoma was obtained by an endoscopic biopsy. Endoscopic submucosal dissection (ESD) for the lesion was performed. Histopathological examination showed that the component of squamous cell carcinoma was seen in the superficial section of the mucosa. The surface of squamous cell carcinoma was covered by a small amount of non-neoplastic squamous epithelium. Meanwhile, basaloid hyperchromatic proliferated tumor cells were seen mainly in the mucosal lamina propria. The tumor cells formed solid nests and lobule structures with ribbon-like arrangement of sparse cytoplasm and round to ovoid hyperchromatic nuclei cells (Fig. a, b, c, d). Immunohistochemically, Ber-EP4 which is a monoclonal antibody to epithelial cells and a sensitive marker of basal cell carcinoma [] was positive. Chromogranin A which is a well-established marker of gastrointestinal neuroendocrine neoplasms [] was negative (Fig. e, f). In addition, some squamous cell cancer cell nests with globose expansile characteristics growing underneath the non-neoplastic squamous epithelium were found. Abnormal intrapapillary capillary loops were observed around the solid cancer cell nests (Fig. a, b). The lesion was histopathologically confirmed as BSCCE limited within the mucosal lamina propria and completely resected. There were no lymphovascular and neural invasions of cancer cells, and no cancer cells to be seen in the lateral and vertical margin of the resected specimen (the distance of the lesion to the closest margin of the resected specimen was 3.044 mm (Fig. ). |
pmc-6542319-1 | A 46-year-old female presented in 2017 with symptomatic right leg pain and aesthetic complaints relating to the right calf. Medical history showed a previous head trauma (car accident) with brain hematoma drainage and a saphenous vein operation. Physical examination revealed edema in the perimalleolar area and painful varicose veins, in the right calf (with considerable aesthetic impact) and left calf (with minor aesthetic impact). Venous scores at the first visit to our clinic were the following: Venous clinical severity score VCSS 10 and Aberdeen quality of life questionnaire 27.7.
Duplex examination conducted before the original venous operation (which had been performed in a different clinic in January 2016) had shown reflux in the left great saphenous vein and significant reflux in the right small saphenous vein. However, the operation actually performed was stripping of the right great saphenous vein. Both the left great saphenous vein and the right small saphenous veins were left in place untreated. After this procedure, symptoms had exacerbated progressively, and the aesthetics of the leg had deteriorated progressively.
Preoperative evaluation was normal. We performed a complete duplex scan, according to our routine, as published elsewhere. The patient had type 1b+2a shunt in the right leg and 4+2d shunt in the left leg. We suggested operating to treat the small saphenous vein in the right leg and the great saphenous vein in the left leg. We treated the patient using the CHIVA technique to preserve the remaining saphenous veins.
We performed the CHIVA procedure on both legs during the same operation. Local anesthesia was provided with a solution containing 10 mg/mL 20 mL of ropivacaine and 2% lidocaine, using 20 mL and 60 mL of saline. We routinely have an anesthetist in the operating room to guarantee patient safety and comfort, who is always advised to avoid sedation as much as possible. When necessary, an opioid-free sedation technique is employed. In the right leg, we ligated the small saphenous vein at its junction with a calf vein and ligated two N3 collaterals, leaving the small saphenous vein draining through two perforators. In the left leg, we ligated a collateral draining to the great saphenous vein from the inguinal ligament and an N3 draining reflux from the great saphenous vein to the calf. A total of 5 small incisions were made. The patient was discharged two hours after the operation wearing compressive stockings and taking 40 mg enoxaparin per day for 3 days, according to our postoperative routine.
On the sixth postoperative day, duplex scanning was performed, showing minor continuous reflux in the small saphenous vein of the right leg and even less reflux in the great saphenous vein on the left. The right small saphenous vein had been 7.4 mm before the operation and was 3.8 mm after. The left great saphenous vein had been 4 mm before the operation and had not decreased in size during the initial postoperative period. The patient scored pain at 3 on a 0-10 pain scale and had taken one 750 mg paracetamol tablet during the entire postoperative period. We made a full photographic record before and after the operation (
). There were no photographs or records of symptoms available from the original operation.
In relation to the wrong-site surgery, we comforted the patient and reported the case to both the previous surgeon and the patient safety surveillance team at the hospital where the operation had been performed. |
pmc-6542321-1 | The patient was an 86-year-old, white, male ex-smoker with dyslipidemia with a prior history of neuralgia of the trigeminal nerve, prostatism, and nephrolithiasis. He also had a history of coronary artery disease. He had undergone cardiac catheterization in 1986, via a right brachial access, with atheromatosis and 30% stenosis of the right coronary (RC), circumflex (CX), and anterior descending (AD) arteries. He had had endovascular treatment to repair an abdominal aortic aneurysm in 2010 and to repair an aneurysm of the left internal iliac in 2014.
In March 2016, he presented with progressive effort dyspnea. In view of suspected non-angina myocardial ischemia, he underwent cardiac catheterization, which revealed atheromatous lesions involving 50% of the proximal third of the AD and 80% of the mid third, 30% of the proximal third of the CX, and 50% of the proximal third, 90% of the mid third, 50% of the distal third of the RC. Angioplasty was conducted in two stages, with a 2-week interval. Diagnostic catheterization and stent angioplasty of the AD and RC were performed, with a total of three accesses, all via the left radial access, since the diagnostic procedure had revealed occlusion of the right brachial artery, related to a prior catheterization.
The symptoms improved significantly after angioplasty. However, 1 year after the intervention, the patient began to exhibit symptoms of dyspnea once more, this time unrelated to effort, and underwent investigation again in March 2017. An electrocardiogram revealed a sinusoidal rhythm with a frequency of 57. A stress echocardiogram with ejection fraction at 55% did not reveal evidence of ischemia or fibrosis. Polysomnography found an apnea-hypopnea index (AHI) of 3.8 (0 = apnea and 30 = hypopnea) and oxyhemoglobin saturation varying from 76 to 91% while asleep. Spirometry found forced vital capacity to be within expected limits, airflow mildly reduced, significant variations on the bronchodilator test, and mild obstructive ventilatory disorder. A chest CT found an expanded thoracic aorta, ectatic in the descending portion, with parietal calcifications, atheromatosis of supra-aortic vessels, and ectasia of the trunk of the pulmonary artery.
The patient was treated for bronchospasm, with discrete improvement of symptoms. The investigation into the cause of dyspnea was resumed in December 2017, with pulmonary perfusion scintigraphy, which found no significant abnormalities. An echocardiogram conducted in December 2017 revealed concentric left ventricle remodeling, preserved systolic function rated at 65% (Teicholz) and 69% (Simpson), mild mitral valve failure, aortic ectasia, redundant interatrial septum, with no shunting, discrete pulmonary arterial hypertension, with pulmonary artery systolic pressure (PASP) at 36 mmHg and left atrium enlargement.
At that time the patient did not exhibit any type of abnormal vital sign, had normal cardiac and pulmonary findings, and 90% saturation in room air. Blood gas analysis results were as follows: pH 7.446; PCO2 34.6; PO2 60.5; bicarbonate 23.3; and oxygen saturation 92.4. All lower limb pulses were present with no significant findings. Distal brachial pulses were absent in the right upper limb, whereas all pulses in the left upper limb were present, with swelling and thrill at the radial pulse.
The patient was referred to a vascular surgeon and underwent a duplex scan, which found a fistula between the radial artery and the cephalic vein at the level of the left wrist. Spectral flow analysis of the radial artery revealed a significant increase in diastolic velocity in the segment proximal of the fistula ( ), with reduction of diastolic velocity to normal levels beyond the fistula. In February 2018, the patient underwent surgery under local anesthesia with sedation to repair the fistula ( ).
The postoperative period was uneventful, with no complaints. At a 60-day follow-up visit he reported that his dyspnea had improved. A duplex scan showed that diastolic velocity in the segment proximal to the fistula had normalized ( ) and blood gas analysis results were as follows: pH 7.426; PCO2 34; PO2 64.6; bicarbonate 22; and oxygen saturation 93.3. |
pmc-6542322-1 | The patient was a 29-year-old female telemarketing operative, born and resident in São Paulo, Brazil, who was referred to a pulmonologist with a diagnosis of recurrent pneumonia. She reported symptoms of dyspnea in response to moderate effort, both during non-acute periods and during crises. Her previous medical history included episodes of recurrent pneumonia associated, initially, with dyspnea, coughing, chest pain, and fever from 5 years of age onwards. She had often presented at walk-in clinics, which treated her with antibiotics, achieving temporary resolution.
She stated that more recent crises had consisted of dyspnea only, with no fever, hemoptysis, chest pain, or coughing. She also stated that she did not smoke or drink. She was sedentary and her diet was regular. She denied any type of family history of pulmonary pathologies. Examinations requested as part of investigation included tomography with contrast and angiotomography (
). Examination of tomography findings identified a vascular malformation originating in the aorta involving the lower region of the right lung. the patient was diagnosed with right pulmonary sequestration. The therapeutic management approach chosen was embolization of the anomalous vessel, for which the patient was referred to the vascular surgery service.
Under local anesthesia with sedation, the patient was placed in dorsal decubitus. The right femoral artery was punctured, followed by catheterization of the anomalous artery branch ( ). A microcatheter was used to place eight controlled-release coils (Complex True Fill 3x10 and 4x10, Codman & Shurtleff, a Johnson & Johnson© franchise, Raynham, United States) into the branch to embolize it ( ). At the end of the surgical procedure ( ) and during the subsequent postoperative period, the patient remained free from any type of complication and did not need to be admitted to the intensive care unit.
The patient recovered well and was discharged at the end of the day after the operation. She is in outpatients follow-up with a pulmonologist and has been asymptomatic for 1 year, with no further pneumonia crises. |
pmc-6542774-1 | The patient was an 87-year-old female with a history of hypertension, type 2 diabetes mellitus (no medication, no neurological symptom, just follow-up), angina pectoris (she had medication such as β blocker and nitrate), and prior surgery for appendicitis. In early June 2016, she presented to our hospital emergency department with the primary complaints of hematemesis after eating, repeated vomiting, and melena. She was alert, and her body temperature was 36.7 °C. The blood pressure was 130/68 mmHg, and the regular heart rate was 76 beats/min. Her palpebral conjunctivae were indicative of anemia; there was tenderness in the epigastrium and peristaltic depression. A blood sample was collected (Table ), and anemia and hypoproteinemia were detected. Abdominal CT showed diffuse intestinal wall thickening and fluid accumulation from the duodenal horizontal portion through the entire jejunum, and marked dilation of the proximal jejunum to a maximum diameter of 7.5 cm (Fig. ). Although intestinal obstruction-like symptoms were confirmed, no obvious mechanism of obstruction could be identified; thus, a diagnosis of intestinal pseudo-obstruction was made. A clear trigger was not pointed out and a chronic progressive course was suspected. We considered malignant lymphoma, eosinophiric enteritis, SLE enteritis and Crohn disease as differential diseases. Upper gastrointestinal endoscopy was performed in emergency, duodenal mucosal edema, submucosal tumor-like protrusion, and duodenal dilation (Fig. ) were observed. A biopsy was performed, and samples from the duodenum and jejunum stained with hematoxylin-eosin showed inflammatory cell infiltration, primarily of the plasma cells; amyloid deposition was visualized on staining with Congo red (Fig. ). Immunostaining for amyloid A was negative, serum amyloid protein was low (5.0 µg/mL), and AL amyloidosis was diagnosed.
We performed lower gastrointestinal endoscopy 2 days later, but no inflammatory findings were observed and no abnormality was shown in biopsy. In addition, we examined small intestine with long scope and confirmed small ulcer and small bleeding in jejunum (Fig. ). As a cause of melena, we speculated as duodenal erosion, small ulcer in jejunum, and small intestine that could not be observed. It was speculated that continuous mild bleeding caused the decrease the level of Hb. We considered the investing of small intestine.
After hospital admission, the treatment included refraining from intake of food orally, gastrointestinal pressure reduction by insertion of a stomach tube, and administration of proton pump inhibitors, resulting in the resolution of the patient’s symptoms. We administrated her medications that improve peristalsis and enteral feeding product. Following admission, she was discharged on day 5.
After the discharge, we managed the patient by administering intestinal motility improving medications and oral nutrients, and no recurrence of symptoms was observed.
Regarding the informed consent, we got the informed consent prior to inclusion in the study. |
pmc-6542775-1 | The patient was a 48-year-old woman who had undergone a cesarean section at the age of 35 years. She underwent plain computed tomography (CT) as a screening before surgery for pectus excavatum, and was incidentally found to have a pelvic mass. She was examined by a local gynecologist but showed no remarkable findings and was then referred to our hospital for further investigation of the pelvic tumor. Her height was 169.0 cm; body weight, 52.7 kg; and BMI, 18.5 kg/m2. The white blood cell count was 3600/μL; hemoglobin level, 13.5 g/dL; and CRP level, 0.02 mg/dL. A blood test for tumor markers including carcinoembryonic antigen, CA19-9, and CA125 showed negative results. Abdominal plain radiography showed no remarkable findings. Abdominal enhanced CT (Fig. ) showed a 40-mm mass containing linear high-density areas. The capsule of the mass had a slight enhancement effect. It was not clear whether the mass was continuous with the intestinal tract. However, the mass contained air, thus raising the possibility that the mass was continuous with the intestinal tract. We, therefore, decided to perform transanal double-balloon enteroscopy for further investigation. The enteroscopic examination showed a small fistula that was likely caused by penetration of the ileum dozens of centimeters from the ileocecal valve (Fig. a). A yellow–brown, movable, and fibrous body was found in the fistula (Fig. b). Contrast enhancement via the fistula showed a defect in the enclosed cavity (Fig. ). When the body was grasped with forceps, the defect inside was found to be movable. The body was held, and part of it was extracted with forceps (Fig. c) and submitted for pathological examination (Fig. ). The examination of the extracted fibrous body suggested that it was gauze. On the basis these findings, the condition of the patient was diagnosed as gossypiboma penetrating the ileum. Presumably, the gauze had been left during the cesarean section because the patient had not undergone any other abdominal surgery. The diagnosis was explained to the patient and her family. The patient desired to undergo surgery for gossypiboma at the hospital where she had undergone the cesarean section, and was referred to that hospital. |
pmc-6542892-1 | A 75-year-old woman was admitted in our hospital after a right upper lobectomy and right S6b wedge resection for synchronous double lung cancer 5 years previously. The preoperative computed tomography (CT) images showed a right S2 tumor and a right S6b peripheral tumor (Fig. a, b). Metachronous double lung tumors in the right lower lobe (S6a and S9) and left diaphragmatic eventration were detected with CT and chest X-ray (Figs. c, d and ). The S6a tumor was a pure ground-glass nodule with a diameter of 27 mm; there was a distance from the basal segment. The S9 tumor diameter was 21 mm, and it was solid and near a bulla in the CT image. The two tumors were suspected to be double primary carcinomas and were located in resectable sites. The patient had mild dyspnea on exertion. The modified Medical Research Council (mMRC) dyspnea score [] was grade 2. In addition, the result of her pulmonary function test (PFT) was poor; her forced vital capacity (FVC), %FVC, forced expiratory volume in 1 second (FEV1), FEV1/FVC, and %FEV1 were 1.54 L, 70.0%, 0.92 L, 59.7%, and 58.6%, respectively (Table ). We first concluded that her pulmonary function was too low to undergo pulmonary resection. There was a possibility that her poor pulmonary function was partly due to the left diaphragmatic eventration and that it could be improved with diaphragm plication.
We first performed VATS diaphragm plication with CO2 insufflation. During the operation, the patient was positioned in a full lateral decubitus position. Four air-locking trocars were placed; the 12-mm trocars were inserted through the fifth intercostal space at the midaxillary line, the seventh intercostal space at the posterior axillary line, and the sixth intercostal space at the anterior axillary line. The 5-mm trocars were placed at the eighth intercostal space at the midaxillary line. CO2 gas was insufflated at 8 mmHg pressure through the trocar under thoracoscopic guidance. The diaphragm was sutured from the posterolateral portion to the anteromedial portion using 90-cm-long, #2-0 Ethibond® (Ethicon, USA) threads with interrupted sutures (Fig. ).
Two months after the procedure, she reported a very good improvement in her symptoms, and her PFT showed improvement; her FVC improved to 2.09 L, %FVC to 90.1%, FEV1 to 1.31 L, FEV1/FVC% to 62.7%, and %FEV1 to 73.2% (Table ). A chest X-ray revealed the expansion of the left lower lung and a flattened left hemidiaphragm (Fig. ). The result of the arterial blood gas analysis was improved; the preoperative
(PaO2) was 79.3 mmHg and the postoperative PaO2 was 93.7 mmHg (Table ).
Encouraged by the results, we decided to proceed with lung cancer surgery on the contralateral side and performed a right S6 wedge resection and right S9 segmentectomy for the double lung tumors. The tumors were diagnosed as double primary carcinomas. The surgical margins of the two tumors were both negative for malignancy. Three months following the last operation, her PFT values were acceptable (Table ). She was discharged and her respiratory symptoms have not deteriorated to date. The mMRC dyspnea score was grade 1. |
pmc-6542931-1 | A 40-year-old Japanese man was referred to Kochi Medical School Hospital for treatment of GPA. The diagnosis of GPA had been made by symptoms of multiple lung nodule, otitis media, sinusitis, skin ulcer, and periocular granuloma 20 years ago. Furthermore, histopathological finding from skin ulcer revealed granulomatous vasculitis and blood examination showed positive of cytoplasmic anti-neutrophil cytoplasmic antibody (C-ANCA). He had been treated for GPA by his general practitioner with corticosteroids and methotrexate for 20 years. He was started on anti-cluster of differentiation (CD) 20 antibody (rituximab) and prednisolone combination therapy due to fever and advance of skin vasculitis, after admission to our hospital. Rituximab was injected day 1 (500 mg/body), and prednisolone was taken orally from day 1 to 14 (30 mg/body). Skin vasculitis had improved slightly; however, he suffered high-grade fever and severe abdominal pain at day 14. Blood analysis revealed high levels of creatinine (1.93 mg/dL; normal range, 0.65–1.07 mg/dL) and blood urea nitrogen (24 mg/dL; normal range, 8–20 mg/dL). He was also found to have leukocytosis (white blood cell count, 30,200/μL; normal range, 3,300–8,600/μL), a C-reactive protein level of 11.41 mg/dL (normal range, < 0.14 mg/dL), and a procalcitonin level of 0.72 ng/mL (normal range, < 0.05 ng/mL).
Computed tomography showed mesenteric emphysema of the sigmoid colon with inflammatory changes in the surrounding tissue (Fig. ). After a clinical diagnosis of sigmoid colon perforation was made, we performed emergency surgery. During surgery, a sigmoid colon perforation of 3 cm in diameter was found. Although descending and sigmoid colon was edematous due to inflammation, there were no abnormal findings in the other part of the colon and small intestine. Resection of 23 cm of sigmoid colon and rectum with colostomy formation was performed in accordance with Hartmann’s approach (Fig. ). Histological examination of the colon showed ulcerative lesions without cancer (Fig. a), and vessels around the ulcer showed loss of wall structures and neutrophil infiltration (Fig. b–d).
The patient had a postoperative complication of superficial surgical site infection, which was treated by opening, draining, and debriding the wound. After the wound healed, he was treated with intravenous immune globulin. He was discharged from our hospital 55 days after the emergency surgery with no other complications. The patient was asymptomatic and received medical treatment for GPA after the sixth postoperative month. |
pmc-6542945-1 | A 68 years old man started therapy with colchicine for gout at 0.5 mg/day. His other medications included irbesartan, allopurinol, and rosuvastatin. He had a diagnosis of ankylosing spondylitis but was not receiving any active medical therapy for this condition. He had normal renal function. Two weeks after starting colchicine he developed subacute onset of proximal weakness primarily affecting his legs and causing difficulty with gait and rising from a chair. On presentation to hospital he had 2/5 hip flexor weakness, 3/5 hip extension, and 4/5 knee extensor/flexor weakness, with shoulder abduction and adduction 4/5 weakness. On sensory examination he had reduction of vibration sensory thresholds to his knees but otherwise normal proprioception and pinprick testing.
Investigations demonstrated an elevated CK to a maximum of 2,200 U/L (normal <350 U/L). EMG of the iliopsoas muscle revealed motor units with reduced amplitude and duration, and polyphasia, interpreted as representing myopathic changes. MRI (1.5T) of the leg muscles was acquired in coronal and axial planes with T1 and STIR sequences, from the top of the iliac crests to the ankles bilaterally, and was interpreted as unremarkable (). Muscle biopsy showed a vacuolar myopathy confirming the clinical suspicion of colchicine myopathy ().
Colchicine and rosuvastatin were withdrawn and CK levels normalized after 1 week. Weakness improved gradually toward normal during that time, although he still had 4/5 weakness in hip flexion. Follow-up after 2 months demonstrated complete resolution of clinical weakness, and his vibration sensory thresholds normalized (normal thresholds at medial malleoli bilaterally).
Eight months later the patient resumed treatment with rosuvastatin and has continued to use this agent without side effects after 2 years of follow-up. |
pmc-6542945-2 | The patient is a 72 years old man with a medical history of type 2 diabetes mellitus, chronic renal disease (GFR 29 ml/mn, secondary to above-mentioned diabetes), hypertension, and gout. He also had remote renal cell carcinoma, in remission following cryoablation. His medications included irbesartan, acarbose, repaglinide, allopurinol, rosuvastatin, and colchicine. He had three episodes of rhabdomyolysis over a 2 years period, separated by intervals of ~12 months, which presented clinically as proximal weakness, myalgias, and reduced mobility. Rhabdomyolysis was attributed to rosuvastatin, which was discontinued after the second episode, although he subsequently went on to have a reoccurance of rhabdomyolysis off statin therapy. His maximum CK levels were 4,021, 4,568, and 3,212 U/L, respectively in each of the three episodes. CK levels normalized in between episodes. After the third episode, he was referred to a neuromuscular specialist (HE). He had bilateral leg weakness causing difficulty with ambulation. EMG identified fibrillation potentials, positive sharp waves, with decreased amplitude, decreased duration and early recruitment upon muscle activation, interpreted as consistent with necrotizing myopathy. An MRI of the lumbar spine did not show any changes that would explain his weakness but did indicate degenerative disc disease particularly at the L3-5 levels. Muscle biopsy revealed vacuolar myopathy characterized by type I-specific central rimmed vacuoles that were reactive to acid phosphatase and immunoreactive to alpha-B-crystallin (). This was interpreted as being consistent with colchicine myopathy. After discontinuation of colchicine the CK normalized over a period of 2 weeks, and the patient's weakness gradually improved such that he returned to ambulating without walking aids. After 1.5 years of follow-up he has not had further episodes of elevated CK. |
pmc-6542981-1 | A 9-month-old infant presented with lethargy and respiratory failure. He had been diagnosed of herpangina 4 days before admission. Initial examination revealed bulbar palsy and flaccid tetraparesis. Brain and spinal cord MRI () showed dorsal brainstem and cervical T2-hyperintensities. CSF revealed pleocytosis, and enterovirus PCR was negative. EV-71 was isolated in throat and rectal specimens. Although methylprednisolone (30 mg/Kg/day, for 3 days) and IVIg (1 g/Kg/day for 2 days) were started, a few hours later he developed high fever, hemodynamic instability, and respiratory failure requiring mechanical ventilation. Due to the dramatic evolution, PEX was started 48 h after onset. Twelve hours later, a marked clinical response was observed and he was extubated after a second PEX session. Six PEX sessions were performed every other day. He continued to improve and no significant complications were observed. Two weeks later, he presented intention tremor that had disappeared at 3- and 12-month follow-up (mRS = 0). |
pmc-6542981-2 | A 37-year-old male, admitted to our hospital with severe headache, aphasia, focal motor seizures, and progressive tetraparesis. The previous week he had developed fever and oral ulcers. Two weeks earlier, his 3-year-old son had had a febrile exanthema and EV-71 had been isolated in the child's stool. Neurological examination of patient 3 revealed motor aphasia, right facial paralysis, flaccid tetraparesis and hyperreflexia. Brain MRI () revealed a left frontal cortical thickening in fluid-attenuated inversion recovery (FLAIR) images, hyperintense in diffusion weighted images (DWI), with leptomeningeal enhancement. Spinal cord MRI () revealed cervical and lumbosacral lesions. CSF showed pleocytosis and enterovirus PCR was negative. Enterovirus RNA was detected by PCR in stool specimens. Given the rapid deterioration and the signs of inflammation in the MRI, PEX therapy was initiated 72 h from the onset of the neurological symptoms. A striking clinical improvement was observed within 24 h after first session. Five sessions of PEX were performed every other day and no complications were observed. At 3- and 12-month follow-ups he was asymptomatic (mRS = 0). |
pmc-6542989-1 | Patient_12 was a 3-month-10-day-old male infant admitted to our hospital due to “discontinuous seizures for more than 3 months.” The boy was born at 38 + 2 weeks by normal vaginal delivery after an uneventful pregnancy and perinatal period to a G1P1 female, with a birth weight of 3.2 kg. Neonatal jaundice was noted and cured by blue light. A convulsive seizure occurred 3 days after birth, and the boy twitched three to four times each day without fever. He was sent to a local hospital and treated with ganglioside and oral vitamin AD drops for more than 1 month. When he was 2 months old, seizures without apparent cause occurred again, starting from two times a day and gradually to seven to eight times each day, accompanied by painful crying but without fever, vomiting, diarrhea, etc. He then visited our hospital and was diagnosed with “epileptic spasm.” Seizures were basically relieved after he was given phenobarbitone tablets, Keppra, and oral sodium valproate.
A scattered red pinpoint-size skin rash was found around the face, which retreated after pressing. Premature anterior fontanelle closure was noted, and cranial suture overlap of the frontal and parietal occipital lobes was obvious (). Hand clenching and an adducted thumb were noted (). A response of the auditory and visual test was not elicited. The infant had myotonia, and neuromuscular function monitoring revealed increased tension on both sides of the gastrocnemius muscle and hamstring during passive drafting. Congenital metabolic deficiency urine screening demonstrated lactic acid urine accompanied with glycerol and dicarboxylic acid increase and VPA+. Reproductive-related infectious disease tests showed that the patient was cytomegalovirus-IgG-positive and cytomegalovirus-IgM-positive and cytomegalovirus DNA detection result was <5.00E+02 copies/ml. An electrocardiogram indicated sinus tachycardia. A head MRI showed bilateral frontal temporal parietal lobe atrophy and peripheral cortical necrosis. Softened left frontal lobe and dilation of lateral ventricles were found ().
Trio-WES together with Trio-CNVseq was applied to the family. Trio-CNVseq was negative, whereas Trio-WES showed that the proband was with a hemizygous variant of c.452G>A,p.R151Q (NM_004208) in AIFM1. AIFM1 is documented to be responsible for the onset of combined oxidative phosphorylation deficiency 6 (COXPD6, MIM: 300816). The identified variant is recorded as rs752742151, and in addition to ExAC (MAF 0.0001), it is not included in any database. Standard interpretation according to ACMG guidelines () showed that the variant was PM1 + PM2 + PM and met the standard of “likely pathogenic.” The father matched the reference sequence, and the mother was heterozygous for this site, which was validated by Sanger sequencing (). Sequence alignment showed that the whole AIFM1 protein including R151, is highly conserved among species. Structural modeling indicated that R151 is located at the C terminal of the first α helix of 4lii (). The N terminal TA together with the liner loop region GGG, are involved in binding to the substrate, FADA. The R151Q mutation might disrupt the local structure of the first α helix, which in turn influences the binding of AIFM1 to FADA. In line with the aforementioned results, AIFM1 was considered as etiology, and the proband was diagnosed as COXPD6. |
pmc-6542989-2 | Patient_22 was a boy admitted to our hospital due to “difficulty standing” when he was 1 year and 8 months old. The mother was G2P2, and the boy had a healthy 4-year-old elder sister. Fetus preservation was undertaken at the initial stage of pregnancy due to bloody show. He was born at 32 weeks by normal vaginal delivery, with a birth weight of 3.3 kg. The proband could sit and turn over at 8 months and could speak at 1 year and 6 months; however, he could not stand alone. He preferred to shake his head during talking. No family member with such features existed.
Skull asymmetry was revealed and the head circumference was 48 cm. Delays in intelligence, motor, and language development, hemifacial hypertrophy (right), facial asymmetry, high forehead, hypertelorism, downturned corners of the mouth, strabismus, drooling, and protruding ears were found (). Facial ultrasound showed thickening of the subcutaneous fat layer and abnormality of the subcutaneous and muscular tissue. Additionally, multiple bulging masses in the back were noted (), and ultrasound demonstrated subcutaneous fat layer thickening. Slight pectus excavatum and lower limb asymmetry were revealed, and the right leg was approximately 0.5 cm larger than the left leg (). The boy had pes planus, and the second toe was crossed with the third toe in the right foot (). A head MRI showed multiple punctiform and patchy high signals on FLAIR sequences and demyelination in bilateral frontal and parietal white matter (). In addition, a thick corpus callosum was identified ().
Trio-WES demonstrated a hemizygous variant of c.256G>A,p.Glu86Lys (NM_153252) in BRWD3. BRWD3 mutations are identified to be the etiology of mental retardation, X-linked 93 (OMIM:300659). The variant for the patient is not included by any database to date. According to ACMG guideline () interpretation, the variant was PM1 + PM2 + PM1 and met the standard of “likely pathogenic.” The variant was inherited from his mother and was validated by Sanger sequencing (). Collectively, the boy was diagnosed with mental retardation, X-linked 93. |
pmc-6543005-1 | A 69-years-old Chinese female farmer was admitted to the department of neurology due to cognitive decline and drooling during the previous month. She had difficulty remembering recent events, and the involuntary drooling was especially obvious during sleep. These symptoms gradually worsened. She experienced sleepiness, and became lost when outside alone. Mild urinary incontinence developed; however, no dizziness, headache, fever, limb numbness, or weakness were reported.
She had a 20-years history of hypertension with irregular use of reserpine, and her blood pressure was not well-controlled. She did not smoke or drink alcohol. There were no exposures to toxic substances or drugs. Family history was unremarkable for cognitive disorders or cerebral hemorrhages.
General physical examination was normal and, on neurological examination, she was alert. Although she exhibited fluent speech without comprehension difficulties, orientation, and calculation were impaired. Short-term memory declined. The cranial nerves were intact. Muscle strength and tone were normal and symmetric. Deep tendon reflexes were symmetrical and moderate, and coordinated movements were ably performed. No pathological reflex was elicited. Given that the patient was illiterate, she could not undergo detailed neuropsychological tests. She scored 18 points on the Mini-Mental State Examination (MMSE), with loss of orientation, 3-step command, calculation, clock drawing, and recall (cut-off value for Chinese illiterate dementia patients is < 19 points).
Routine blood tests revealed a mildly reduced platelet count of 64 × 109/L (normal, 100–300 × 109/L). Thyroid function, folic acid, and vitamin B12 levels were normal. Syphilis and HIV serological tests were negative. Serum paraneoplastic antibodies and anti-neuronal antibodies for autoimmune encephalitis were all negative. Tumor markers, including carcinoembryonic antigen, carbohydrate antigens 125 and 19–9, and alpha-fetoprotein, were within normal ranges. Serum TORCH-immunoglobulin (Ig) M antibody test was negative. Cerebrospinal fluid (CSF) examination revealed a normal cell count and protein level of 0.4 g/L (normal range, 0.15–0.45 g/L). No CSF oligoclonal IgG bands were detected. CSF levels of amyloid β (Aβ) 40 and Aβ42 examined using ELISA were lower than normal controls (Aβ40, 4,500 pg/ml, normal 6,400 pg/ml; Aβ42, 325 pg/ml, normal 500 pg/ml, in our lab).
The patient underwent chest computed tomography, and abdominal, pelvic and breast ultrasound, which revealed no significant abnormalities. Initial brain magnetic resonance imaging (MRI) revealed multiple, asymmetrical subcortical white matter lesions, with U-fiber involved. These lesions were hyperintense on T2-weighted imaging, fluid attenuated inversion-recovery (FLAIR) and apparent diffusion coefficient (ADC) sequences, and were isointense on diffusion-weighted imaging (DWI) sequence. These neuroimaging findings were consistent with vasogenic edema. There was no parenchymal enhancement within the lesions. Other findings included chronic and subacute lacunar infarcts. Scattered hypointense lacunae were noted on DWI, while not prominent on other sequences. These lacunae suggested cerebral microbleeds. Subsequent susceptibility weighted imaging (SWI) confirmed diffuse microbleeds, mainly in the cortex (). Although the patient had a long history of poorly controlled hypertension, deep cerebral microbleeds were largely absent. According to the revised clinico-radiological diagnostic criteria, she was diagnosed with CAA-RI based on clinical features and specific neuroimaging findings ().
Due to the patient's concern about the side effects of large-dose glucocorticoids, she was administered intravenous methylprednisolone 120 mg daily for 5 days. Subsequently, 30 mg prednisone per day was administered with a 5 mg tapered reduction bi-weekly. Two months later, her memory improved and her MMSE score was 21 points. On follow-up brain MRI, diffuse white matter lesions largely improved with microbleeds unchanged (), and prednisone was discontinued 1 month later. The most recent follow-up, 18 months since disease onset, revealed no clinical relapse.
Genomic DNA was extracted from peripheral blood leukocytes. ApoE genotypes were determined using polymerase chain reaction and direct sequencing. According to the different combinations of codon 112 and 158 of the fourth exon of the ApoE gene, the patient was found to harbor the rare ε2/ε2 genotype. |
pmc-6543026-1 | A 50-year-old man consulted a primary doctor for jaundice that had lasted several weeks. Imaging showed a pancreatic head tumor and bile duct dilation; thus, he was referred to our hospital.
Jaundice was noted on examination, but no other symptoms, such as fever, abdominal pain, and nasal cavity and pharyngeal lesions, were noted. The following blood test results indicated obstructive jaundice: white blood cell count, 6700/µl; hemoglobin level, 12.0 g/dl; platelet count, 393,000/µl; glutamic oxaloacetic transaminase level, 61 IU/l; glutamic pyruvic transaminase level, 114 IU/l; lactate dehydrogenase level, 260 IU/l; total bilirubin, 6.3 mg/dl; direct bilirubin, 4.3 mg/dl; international normalized ratio, 1.05 (prothrombin time 89%); and C-reactive protein level, 0.09 mg/dl. His tumor markers were normal (carcinoembryonic antigen, 4.8 ng/ml; carbohydrate antigen 19–9, 1.0 U/ml; DUPAN-2, 12.0 U/ml; and SPan-1, 39.3 U/ml), but soluble interleukin 2-receptor levels were greatly increased (2770 U/ml). Abdominal contrast-enhanced computed tomography (CT) revealed a tumor at the head of the pancreas that invaded the portal vein, inferior vena cava, and celiac artery (Fig. ). The mass also caused pancreatic bile duct stenosis. Moreover, the peripheral bile duct was dilated, but not the main pancreatic duct. Positron emission tomography-CT showed enhanced fluorodeoxyglucose uptake in the lesion area and showed no lesions in the head and neck. Moreover, we confirmed that the tumor confined to the head of the pancreas. Endoscopic ultrasound-guided fine needle aspiration of the pancreatic tumor tissue was performed twice using a 25G needle, but there was no evidence of any lymphocytes that suggested lymphoma. Endoscopic retrograde cholangiopancreatography for pancreatic ductal scrub cytology, bile duct tissue, biliary cytology, and pancreatic juice cytology showed no malignancy.
Although a histological diagnosis was not established and the tumor markers were normal, we judged that the possibility of lymphoma was low; therefore, gemcitabine–nabpaclitaxel combination therapy was started after a diagnosis of locally advanced unresectable pancreatic duct cancer.
No adverse effects occurred, and thus, chemotherapy was shifted to an outpatient setting. However, the patient showed symptoms of bleeding approximately 1 month after discharge and was re-admitted. Upper gastrointestinal endoscopy showed a deep ulcer lesion that extended from the duodenal bulb to the inner wall of the descending part (Fig. ). Penetration due to direct infiltration of the tumor was considered, but the bleeding site was not identified. The patient was treated accordingly and discharged. However, he was admitted again for severe re-bleeding. Abdominal angiography showed hemorrhaging in the area of the ulcer; thus, coil hemostasis was performed. However, the necrotic area became more extensive despite treatment, and he died of disseminated intravascular coagulation 1 week after angiography.
Autopsy was performed after obtaining the family’s consent. We observed deep ulcerations extending from the duodenum to the head of the pancreas as well as diffuse white lesions that spread around the duct from the ulcer wall to the intrahepatic bile duct and gallbladder wall. Histologically, tumor cells with medium to large and polymorphic bare nuclear nuclei proliferated with the necrosis (Fig. a). Similar tumor cells were obtained from the spleen, lung, kidney, bone marrow, pancreas head, and adjacent lymph nodes, while arcuate cells were noted in the blood vessels. Diffuse proliferation was confirmed to be only present around the duct from the ulcer wall to the intrahepatic bile duct and gallbladder wall. Immunohistochemistry showed the following findings: CD3 (+) (Fig. b), CD5 (−), CD7 (+), CD20 (−), CD4 (−), CD8 (−), CD56 (+), TIA-1 (+), TdT, EBER-ISH (+) (Fig. c), AE 1/3 (−), MIB-1 (60–90%). Based on these findings, a pathological diagnosis of extranodal NK/T-cell lymphoma, nasal type, of the bile duct was made. |
pmc-6543565-1 | A previously healthy 23-year-old female complained of the sudden onset of abdominal pain and vomiting after eating supper and drinking alcohol. She presented to her local hospital’s emergency department. An abdominal computed tomography (CT) scan showed a collapsed cystic lesion and abdominal fluid. A ruptured splenic cyst was suspected, and so the patient was referred to our hospital. On arrival, the patient complained of upper abdominal pain. She stated that she had not suffered any diarrhea, hematemesis, or trauma, nor had she recently come into contact with any sick individuals or gone travelling. She was not taking any regular medication and had no relevant family medical history. She had a slightly elevated temperature (37.3 °C), but the rest of her vital signs were normal. An abdominal examination revealed rebound tenderness in the epigastric region. The initial laboratory tests demonstrated an elevated white blood cell count (18.4 × 103 /L) (predominantly due to increased numbers of neutrophils) and increased serum amylase levels (162 U/L), together with normal hemoglobin and C-reactive protein (CRP) levels. A coagulation screen produced normal results. However, the following tumor marker level measurements were obtained: CA19–9: 17580 U/L (normal: < 37 U/mL), CA125: 909.8 U/L (normal: < 35 U/mL), CEA: 2.5 ng/mL (normal: 5.3 ng/mL), and interleukin-2 receptor (IL-2R): 389 U/L (normal: < 530 U/L). An ascitic tap was obtained, which revealed the following results: lactate dehydrogenase (LDH): 904 U/L, serum total protein (TP): 5.0 g/dL, CA19–9: 490000 U/L, CA125: 24560 U/L, and CEA: 60.6 ng/mL (Table ). Abdominal fluid cytology revealed no evidence of malignancy. An abdominal CT scan showed a collapsed cystic lesion, measuring 12 × 12 × 8 cm, in the spleen and abdominal fluid in Morison’s pouch and around the liver and spleen. Moreover, an 8-mm cyst and a small collapsed cystic lesion were found posterior to the large cystic splenic lesion. No masses were found in the liver, pancreas, kidneys, or gastrointestinal tract. There was no evidence of contrast medium extravasation (Fig. ). Based on these results, we excluded a ruptured spleen and made a diagnosis of a ruptured splenic cyst. The differential diagnoses for ruptured epidermoid cysts include splenic pseudocyst, lymphangioma, primary mucinous cystadenocarcinoma, splenic lymphoma, and metastatic tumors. Cystic Echinococcosis were denied because she had denied any history of traveling abroad. There was no evidence of massive hemorrhaging, and an additional contrast-enhanced magnetic resonance imaging (MRI) scan was obtained on the following day. It showed a cystic lesion, which exhibited slightly hyperintense signals on the T1- and diffusion-weighted sequences and hyperintense signals on the T2-weighted sequence. No solid components or mural cysts were found in the cyst (Fig. ).
After one week, we removed the splenic cyst via laparoscopic fenestration. Exploration of the surgical field revealed abdominal fluid. The cyst was located at the upper pole of the spleen. We dissected the part of the greater omentum that had adhered to the cyst wall, drained the cyst cavity, and fenestrated the splenic cyst wall using an ultrasonic scalpel, before cauterizing the interior of the cyst wall (Fig. ). The patient had an uncomplicated postoperative course and was discharged on postoperative day 5.
A pathological examination revealed an epidermoid cyst. The cyst wall consisted of fibrous tissue and was lined by a single layer or several layers of squamous epithelium. Immunohistochemistry demonstrated that the epithelial cells were positive for CA19–9 and CEA (Fig. ). The patient’s serum levels of CA19–9 and CA125 were 1024 U/mL and 199 U/mL, respectively, at 2 weeks after surgery and had returned to normal at 4 postoperative months (Table ). A follow-up abdominal CT scan performed at 6 postoperative months did not show any recurrence. The patient was healthy at 15 postoperative months. |
pmc-6543568-1 | A 58-year-old man presented to the emergency room with 5 h of chest pain, which now has been aggravated (profuse sweating) and persistent for 0.5 h. An ECG (Fig. ) was obtained in the emergency room which showed a sinus rhythm at a rate of 64 bpm, tall and positively symmetrical T waves in leads V2–6, J point depression in leads V4–6 (2- to 3-mm) with upsloping ST-segment depression and in leads II, III, aVF with ST-segment depression 1-mm, suggesting acute myocardial ischemia. Troponin-I was increased, which was suggestive of acute extensive anterior wall MI. The patient was immediately transferred to the catheterization laboratory for percutaneous coronary intervention. However, the patient refused underwent percutaneous coronary intervention. According to acute MI, oxygen inhalation, ECG monitoring and conventional drug therapies were adopted. 1.5 h later, the chest pain relieved and the ECG (Fig. ) demonstrated the amplitude of tall and positively symmetrical T waves was slightly deceased in leads V2–6. There still existed J point depression in leads V3–6 with upsloping ST-segment depression. Obvious q waves appeared in leads V3–5, indicating that it has entered the acute phase MI. Then, the ECG (Fig. ) recorded 5 h after admission showed that q waves in leads V3–6 increased, the T wave, the J point depression and ST segments in V2–6 leads reverted to normal, indicating the pseudo-improvement of ST-T change. The next day, the ECG (Fig. ) revealed ST-segment elevation of leads V2–6 followed by T wave inversion, consistent with an ECG evolution from acute to subacute phase in patient with ST segment elevation MI (a large area). The patient agreed underwent coronary angiography and percutaneous coronary intervention. A coronary angiogram (Fig. ) demonstrated a 100% occlusion of midshaft LAD artery. The patient and his family members chose drug therapy. The next day after coronary angiography, the ECG (Fig. ) revealed the amplitude of ST-segment elevation decreased in leads V3–5. The patient revealed symptom-free 5 days after admission and then was discharged from the hospital. |
pmc-6543606-1 | A 74-year-old female patient attended the vascular surgery outpatient clinic and was referred to the hospital for revascularization of the distal arteries. She had necrotic ulcers in both legs, worse in the right. She reported pain, signs of local infection and myiasis on the lateral side of the ankle, tendon exposure, edema, and dry skin, but no signs of acute ischemia. Her underlying diseases were difficult to control: systemic arterial hypertension for 20 years; type II diabetes mellitus (DM) for 13 years; hypothyroidism; a stroke 6 years ago, chronic renal failure class IV; peripheral arterial occlusive disease, and postmenopausal osteoporosis. The patient referred to previous angioplasty performed 1 year earlier on the lower right leg due to peripheral arterial occlusive disease. Upon hospital admission, several sites of infection other than skin and soft tissue were discarded. Laboratory tests showed a normal leukocyte count and reactive C protein of 3.98 mg/dL (reference value: < 0.30 mg/dL). Empiric treatment with piperacillin-tazobactam (4.5 g IV 6/6 h) was initiated, which was prescribed for 5 days.
Two days after admission, surgical debridement was performed. Limb amputation was discussed, but rejected by the patient and family members. During the surgery, a fragment of the ulcer tissue was collected and sent to the hospital’s microbiology laboratory. In the staining procedure, a few gram-positive cocci and gram-negative bacilli were observed. The specimen was submitted for enrichment in the brain-heart infusion broth for 24 h/37 °C and later seeded in 5% sheep blood agar and MacConkey agar, incubated for 37 °C, and presented growth after 24 h. VITEK 2 system (bioMérieux, Marcy l’Etoile, France) identified Enterococcus faecalis, Stenotrophomonas maltophilia, and B. trematum. The isolate was subsequently identified as B. trematum, using VITEK MS (bioMérieux, Marcy l’Etoile, France) and confirmed by 16S rRNA gene sequencing with Illumina MiSeq (Illumina, San Diego, CA, USA). The oxidase test was negative. MICs were determined by Sensititre gram-negative MIC plate (Thermo Scientific, Waltham, MA, USA) (Table ).
After surgery, the intubated patient was transferred to the ICU, using vasoactive drugs through a central venous catheter. Three days later, she presented a worsening clinical condition. Oxacillin-resistant Staphylococcus hominis was isolated from a blood culture drawn through a peripheral vein. Piperacillin-tazoctam was replaced by meropenem (500 mg IV 24/24 h) and vancomycin (1 g IV 24/24 h), prescribed for 14 days. Four days later, levofloxacin (750 mg IV 24/24 h) was added for 24 days aiming at S. maltophilia isolated from the ulcer tissue.
The necrotic ulcers evolved without further complication and the patient’s clinical condition improved, leading to temporary withdrawal of the vasoactive drugs and extubation. However, the patient’s general condition and kidney function worsened, probably due to the severity of her underlying diseases, and she died from sepsis of cutaneous origin 58 days after hospital admission. Autopsy was not performed. Figure shows a timeline of the events. |
pmc-6543614-1 | A 48-year-old Sinhalese man with myasthenia gravis was presented to the department of radiology of a tertiary care hospital for upper gastrointestinal (GI) contrast study, for further evaluation of progressive dysphagia. Myasthenia gravis was diagnosed in May 2016 and he underwent thymectomy in November 2016 for thymic hyperplasia. From the point of diagnosis, he had two episodes of myasthenic crisis, precipitated by lower respiratory tract infections that required mechanical ventilatory support. Thereafter, he was on regular pyridostigmine, 50 mg/6 hourly, mycophenolate mofetil (MMF) 500 mg twice daily, and orally administered prednisolone therapy. He was able to perform his daily routines of life with negligible support. Meanwhile, he developed progressive dysphagia for solids initially and then for liquids for a 3-month duration. He was evaluated by a neurologist and referred to the surgical team for upper GI endoscopy. Since that was also uneventful, he was referred to our radiology unit for a contrast study. On admission to the radiology unit, he had normal respiratory parameters and his limb muscle power was grade 5/5. Due to the possible risk of aspiration, 10 ml of iohexol (Omnipaque™) was given under fluoroscopy guidance. As the contrast material had directly entered his right main bronchus, the procedure was abandoned and he was transferred to the accident and emergency treatment unit (ETU). Although he was able to maintain his air oxygen saturation above 90% with high flow oxygen via non-rebreather mask, effort of breathing drastically dropped 45 minutes after admission to the ETU including dropping of respiratory rate to 10 breaths per minute. Despite continuous treatment with nebulized salbutamol and intravenously administered metronidazole 500 mg stat dose, he eventually required endotracheal intubation with 3 mg midazolam and 10 mg atracurium administered intravenously. There was a drooping of eyelids, but it was very difficult to assess limb muscle power before intubation. According to the clinical scenario, the diagnosis of respiratory distress due to contrast aspiration was made and he was transferred to the ICU. Following admission, the diagnosis was questioned as there were no significant chest X-ray (CXR) abnormalities to cause the high degree of respiratory distress, except right apical segment collapse. He was then evaluated by a neurologist and the diagnosis was revised to myasthenic crisis, possibly due to aspiration pneumonitis caused by aspiration of contrast. Hence, intravenously administered immunoglobulin 20 g daily for 5 days was commenced with an increased dose of pyridostigmine 60 mg 6 hourly, MMF 750 mg twice daily, and prednisolone 40 mg daily. Although there was no clinical, microbiological, or serological evidence of infection, considering the high possibility of potential development of sepsis, intravenously administered ceftriaxone 1 g 8 hourly was initiated. In addition, there were no electrolyte abnormalities acting as a precipitant of myasthenic crisis. Mechanical ventilation was continued in a synchronized intermittent mandatory mode with fraction of inspired oxygen (FiO2) of 50%, positive end-expiratory pressure (PEEP) of 5 cmH2O, and pressure support 10 cmH2O. Respiratory support was gradually reduced over 72-hour period as there was remarkable improvement in his respiratory mechanics with the treatment. Meanwhile, there was a sudden de-saturation with evidence of subcutaneous emphysema on the right side of his neck and a subsequent CXR revealed complete collapse of his left lung, a hyperinflated right lung with slightly increased translucency on same side, with right-sided subcutaneous air (Fig. ). CXR findings raised the suspicion of right-sided pneumothorax. Since the cause of subcutaneous emphysema was occult in the CXR, non-contrast computed tomography (NCCT) of his chest was done and revealed total left lung collapse with ipsilateral mediastinal shift and left loculated pneumothorax. Subsequent bronchoscopy was negative. However, with regular chest physiotherapy, lung collapse improved. He was then gradually weaned off the ventilator and transferred to the general medical ward for continuation of care. Following an 18-day hospital stay, he was successfully discharged from the hospital with a tailing off dose of prednisolone. However, due to the high possibility of aspiration, he was advised to keep the nasogastric tube. Two weeks following discharge, during the first clinic visit, he was ambulant showing an improvement in swallowing. The nasogastric tube was removed and regular follow-up was planned. |
pmc-6543654-1 | A 17-year-old girl; a known case of a repaired high imperforate anus, repaired type-C tracheoesophageal malformation, and left renal agenesis; presented to King Abdullah University Hospital (KAUH) complaining of dysmenorrhea for 3 years duration. She was 14-year-old when she had her menarche. The menstrual cycle was irregular and associated with severe dysmenorrhea. She had the dysmenorrhea 4 days before the period, during the period and lasted 1 week after. The pain was slightly relieved by analgesics. The complaint was associated with vomiting, anorexia, and general fatigability. Prior medical and surgical history included two-steps primary anoplasty repair for imperforate anus which involved a temporary colostomy creation followed by posterior sagittal anorectoplasty. The tracheoesophageal fistula was repaired by resection of the fistula and anastomosis of the esophageal limbs. Examination revealed abdominal mass and tenderness.
Laboratory investigations were conducted and revealed elevated levels of cancer antigen 125 (CA 125) (241 U/ml) and CA 19–9 (67 U/ml). Other tests including complete blood count, kidney function test, CA 15.3, alpha-fetoprotein, lactate dehydrogenase, and human chorionic gonadotropin (hCG) were all within normal levels. Also, urinalysis and culture disclosed no abnormalities.
Abdominal and pelvic ultrasound was performed and showed a thick-wall left pelvic mass measuring 6 × 6 cm and another 7 × 8 cm left pelvic mass mostly endometrioma. Renal ultrasound confirmed the solitary right kidney with compensatory hypertrophy. Pelvic magnetic resonance imaging (MRI) revealed a normal uterus on the right side, a normal right ovary, a 7 × 8 cm left endometrioma, a tortuous dilated fluid-filled structure in the left hemipelvis mostly represented left-sided hematosalpinx, and a well-defined lesion with thick enhancing wall in the left hemipelvis measuring 6.7 × 5.7 × 5.6 cm with similar enhancement to the uterus in the right suggestive of MDA probably double uterus obstructed on the left side with large hematometra. (Figs. and ).
Initially the patient had diagnostic laparoscopy using the open technique, however, the patient had extensive adhesions and thus laparotomy with adhesiolysis was performed. At laparotomy, there was a right unicornuate uterus with a normal cervix and a non-communicating distended left rudimentary horn. Additionally, there was a left hematosalpinx of the left tube which was connected to the left horn, and a left endometrioma. The right ovary and tube looked normal. The single right ureter was also identified. The left non-communicating horn was resected. In addition, left salpingectomy and left ovarian cystectomy were performed. The right uterus and both ovaries were preserved. The diagnosis of class U4a uterine anomaly (unicornuate right uterus with rudimentary non-communicating cavitary left horn) was established (Fig. ). No intraoperative or immediate postoperative complications were detected. The patient was discharged on the fourth postoperative day. Histopathological examination of the specimen was reported as uterine rudimentary horn with unremarkable myometrium and secretory endometrium, and left endometriotic cyst. At 9 months follow up, the patient had regular menstrual cycles and the pain subsided completely. |
pmc-6543655-1 | Mr. SL is a 63-year-old entrepreneur who has been running his own business for about 30 years, achieving success and admiration from his peers. However, due to the economic crisis, he started facing financial difficulties and had problems in carrying out his business, paying salaries to his long-lasting employees, and supporting his family. After trying many options to get support from banks, he realized that his company was in danger. Because of this situation, he started experiencing sadness, insomnia, loss of appetite, hopelessness, and irritability. He described how he saw no way out, and he described himself as in a tunnel with no real solution to his economic problems. Things got worse as the crisis eroded the money he had saved for emergencies.
He also experienced unimaginable physical suffering with unpleasant sensations at the hypochondrium (the upper part of the abdomen) related to anxiety, and he sometimes had dyspnea. Despite these symptoms, he tried his very best to continue and attend to his work activities. After almost 3 months of feeling depressed, he started thinking about suicide. He reported that suicidal ideation gradually became the companion that could provide help and relief from the pain he was experiencing. Having realized that he could rely on suicide as a way out from his problems, he experienced both the pressure of the precarious economic state and a state of relief when lousy news regarding his debts continued to arrive. He thought that he would not be alive anymore in a week or two. A peculiar aspect of his psychopathological state was an “ossimoric” feature, that is, while he was experiencing the sadness and despair for what has happened to his life, he was still able to enjoy some activities such as maintaining his status and playing at his tennis club, as well as going out for dinner and other leisure activities.
After experiencing depression with suicidal ideation for a while, he then concluded that suicide was the only option left. Although he had spent a pleasant bank holiday, early in the morning on returning to work, he thought that he had to put an end to his life. He went to his office, got his gun and started driving at random for hours. He had left two letters for his children explaining what was behind his choice. He had switched off his cellular phone, and his family lost his track oh him for hours. Just before the moment when he decided to use the gun for killing himself, he thought he wanted to speak to a friend to ask him to support his family. This friend proved to be skilled in maintaining a conversation and supporting the patients’ wish to live. The conversation on the cellular phone helped police to trace the patient. Police officers stopped him and brought to a psychiatrist who diagnosed major depression and the need for psychiatric hospitalization.
However, after a few days, he was able to decide whether to remain or discharge himself. After returning home, his children noticed the poor mental state of their father and sought a consultation with the author. The patient underwent a full psychiatric evaluation, as well as an in-depth assessment of suicide risk, with an analysis of his reasons for living versus his reasons for dying. Although the patient was depressed, an intervention for the treatment of depression would not have provided relief for this man. Lithium was prescribed, in association with small doses of an atypical antipsychotic at night, and regular sessions of psychiatric evaluation combined with sessions of psychotherapy were scheduled. This treatment proved to be of great relief for the patient, and he reported a feeling of being understood by my collaborators and by me. He improved dramatically over 2 months and, despite having the same economic problems that had led him to contemplate suicide; he never reported suicidal ideation again. |
pmc-6543662-1 | A 37-year-old woman presented to our hospital with complaints of blurred vision in the right eye for 10 months. She had no family history of hereditary ocular diseases and no previous history of eye surgery or ocular trauma. In addition, the patient had bilateral varus deformity of distal interphalangeal joints on the little fingers. Also, her sister was born with uterus didelphys.
The best corrected visual acuity (BCVA) was hand motion in the right eye and 20/33 in the left eye. The refraction was + 4.25/− 0.50 × 90 in the left eye. Horizontal corneal diameters were apparently enlarged in both eyes (the right eye 14 mm/ the left eye 13.88 mm). Applanation intraocular pressure (IOP) were normal in both eyes. Main measures of the present case are summarized in Table .
Anterior segment photography showed mild iridal atrophy of both eyes, which subsequently lead to insufficiently dilated pupils with diameters no more than 5 mm. White cataract was observed in the right eye (Fig. ). Inspection by anterior segment optical coherence tomography (AS-OCT) (Cornea/Anterior Segment OCT SS-1000, Tomey Corporation, Japan) indicated bilateral augmented anterior chambers with backward iridal concavity on horizontal orientation, although the backward concavity in the right eye was markedly reduced before the surgery because of the swelling cataractous lens; while on vertical orientation iris revealed rather flat (Fig. a-d). Ultrasound biomicroscopy (UBM) (MEDA MD-300 L) showed opacified lens with the apparently elongated suspensory ligaments in the right eye. Partially peripheral anterior synechiae and pectinate ligaments at anterior chamber angle were also observed in both eyes. Ciliary processes were small and scleral processes were not apparent under UBM inspection (Fig. a-b).
On the basis of the above findings, the patient was diagnosed with bilateral anterior megalophthalmos complicating white cataract in the right eye.
The operation was performed by an experienced surgeon (Y.L.). A 2.6 mm temporal clear corneal incision was made under topical anesthesia. Viscoelastic agent (DisCoVisc, Alcon, Fort Worth, TX, USA) was then instilled to maintain the anterior chamber with small pupil. Following a continuous curvilinear capsulorhexis of 5.5 mm in size, hydrodissection, chopping, nucleus rotation, and phacoemulsification (CENTURION Vision System, Alcon, Fort Worth, TX, USA) were then performed. A 1-piece foldable IOL (+ 20.5 D, Human Optics PC Acrylic IOL, MC X11 ASP) with four frame haptics to increase intracapsular stability, was inserted into the capsular bag. After aspiration of residual viscoelastic, the incision was hydrated with balanced salt solution and checked for water tightness. Gentle operation was emphasized intraoperatively considering zonular weakness and the deep anterior chamber as the infusion bottle height was set to 75 cm and the phacoemulsification was carried out in a slow-motion mode (vacuum: 300 mmHg; aspiration flow rate: 28 cc/min). Postoperatively, Cravit Eye Drops (Alcon Laboratories, Inc., Fort Worth, TX, USA), Pred Forte Eye Drops (Allergan Pharmaceuticals, Inc., Dublin, Ireland), and Diclofenac Sodium Eye Drops (Shenyang Xingqi Pharmaceutical Co. Ltd, Shenyang, China), all 3 times a day for 4 weeks, were given.
One month after the surgery, the uncorrected visual acuity (UCVA) and BCVA of the right eye improved to 20/25 and 20/20. The actual postoperative refraction was + 1.50/− 0.50 × 115 in the right eye and the actual postoperative spherical equivalent (SE) was + 1.25 D. The IOP of the right eye was 18 mmHg. Postoperative inspection by AS-OCT indicated a low degree of IOL decentration and iridal backward concavity still remained on horizontal orientation with flat iris on vertical orientation (Fig. e, f). OPD-Scan III aberrometry (Nidek Co, Ltd, Gamagori, Japan) verified increased internal coma and tilt aberrations indicating slight dislocation of IOL after surgery (Table , Fig. ). Three months after the surgery, the visual acuity and the refractive status of the operated eye were stable and the IOP remained within normal range (15.0 mmHg OD and 17.8 mmHg OS). The IOL also showed good centering and stability during the follow-up.
The postoperative refractive error equals to the actual postoperative SE (+ 1.25 D) minus the predicted refraction calculated by IOL power calculation formulas as following:
In this case, we originally used the SRK/T formula for IOL power calculation and the postoperative refractive error turned out to be + 1.44 D during the follow-up. To find the most accurate power calculation formula with lowest postoperative refractive error for the challenging anterior megalophthalmos cases, we further applied the Haigis and Holladay II formulas (Table ).
The postoperative refractive error decreased to a rather low value as − 0.05 D after using the Haigis formula. As to the Holladay II formula, the postoperative refractive error was + 0.63 D. Therefore, compared to the SRK/T and the Holladay II formulas, the Haigis formula may be a more suitable choice according to our case, with higher accuracy and lower postoperative refractive error concerning to the IOL calculation in anterior megalophthalmos.
For genetic analysis, we obtained the blood samples of the patient, her son and her parents for whole-exome sequencing based on family to identify any gene mutations directly related to anterior megalophthalmos. However, no known or newfound related gene mutations were found (Table ). |
pmc-6544674-1 | An 18-year-old male patient with Hunter syndrome visited at the Department of Surgery at Tottori University Hospital for evaluation of a palpable mass in the right groin area. Computed tomography revealed a right indirect inguinal hernia containing the small intestine (Fig. ). He had a history of repeated admission to our hospital and pediatric treatments for pneumonia, heart failure, and convulsions after birth. He was small in stature (height, 133.7 cm; weight, 36.6 kg). We observed no apparent hernia on the left side; however, a wide hernia orifice was present. Therefore, we selected a laparoscopic approach instead of an anterior approach to check for an occult hernia on the left side.
We performed TAPP repair for the right-side inguinal hernia after confirming that no hernia was present on the other side under laparoscopy. After inserting a 12-mm trocar in the umbilicus and identifying the indirect inguinal hernia on the right side and the absence of a hernia on the left side, we inserted 5-mm trocars in the bilateral flank regions. Insertion of the trocars was very difficult because of the softness of the abdominal wall (Fig. a), which may have been due to Hunter syndrome. We cut the peritoneum outside of the hernia orifice (Fig. b), identified the spermatic cord and testicular artery, and dissected the preperitoneal space with gauze. We found a network of veins around the spermatic cord and testicular artery (Fig. c), and special care was required to avoid hemorrhage. We inserted a prosthetic mesh (16.0 × 10.8 cm) into the preperitoneal space and tacked it onto either side of the inferior epigastric artery, transverse abdominal muscle, abdominal rectus muscle, and Cooper’s ligament. The hernia orifice was completely covered, and the peritoneum was closed by suturing. Although the operation involved minimal bleeding, it took 1 h 53 min to complete because the softness of the abdominal wall and the patient’s shorter height made the operative procedure difficult. Although a mild convulsion and subsequent aspiration pneumonia after the operation prolonged his hospital stay, he recovered with appropriate treatments and was discharged on postoperative day 9. |
pmc-6544679-1 | A 77-year-old man was admitted to Shiga University of Medical Science (SUMS) Hospital complaining of abdominal pain and frequent episodes of non-bloody watery diarrhea, lasting for 2 months. His past medical history included a gastric ulcer 40 years earlier, hypertension, and chemotherapy for multiple myeloma. His current medications were aspirin, prednisolone, melphalan, and lansoprazole (LPZ). His body temperature was within the normal range. Physical examination revealed acute left abdominal pain and muscular defense. Laboratory results revealed a white blood cell count of 2100/μl (normal range, 3000–8000/μl), and (CRP) level was 0.19 mg/dl (normal range, < 0.30 mg/dl). Computed tomography (CT) showed a thickened bowel wall with edema involving free air around the colonic splenic flexure, and ascites was found on the liver surface (Fig. a, b). The patient was diagnosed as having peritonitis with colonic perforation. Emergency laparotomy was performed, and it was observed that the ascites contained intestinal fluid. The colon around the splenic angle was necrotic and edematous. We performed a left hemicolectomy. Macroscopic findings (Fig. ) showed edematous mucosa and tortuous longitudinal ulcer. Histopathological examination (Fig. ) revealed typical findings of CC, with a thick subepithelial collagenous band and deep ulcers with perforation. Active lymphocyte infiltration was observed in all layers of the colon. There was no evidence of acute ischemic colitis or inflammatory bowel disease.
Postoperative course was uneventful, and the patient was discharged on the 28th postoperative day. PPI-induced CC was suspected due to his past history; therefore, the PPI was subsequently changed from LPZ to RPZ. Following this change, he noted an improvement in diarrhea symptoms. |
pmc-6544680-1 | A 60-year-old man was admitted with cough. Chest computed tomography (CT) showed an 11-cm mass in the right upper lobe that was suspected of invading the right side of the superior vena cava (SVC) almost from the proximal end of the right internal jugular vein to the right atrium inflow (Fig. a, b). The patient did not present with signs or symptoms of SVC obstruction. Endobronchial ultrasound-guided transbronchial needle aspiration (EBUS-TBNA) showed leiomyosarcoma of the lung (Fig. a). 18F-fluorodeoxyglucose (FDG) positron emission tomography (PET)-CT showed the high accumulation of FDG in the pulmonary tumor with a maximal standardized uptake value of 16.83; the absence of any other accumulation allowed us to exclude metastasis from another site. We diagnosed the patient with primary pulmonary leiomyosarcoma.
We considered complete resection of the tumor to be very difficult because of the tumor invasion, particularly that to the right atrium inflow of the superior vena cava, so we performed chemotherapy (doxorubicin monotherapy) for five cycles. We discussed the regimen for neoadjuvant treatment in a conference with orthopedic surgeons and medical oncologists. The recommended regimen for advanced soft tissue sarcoma is doxorubicin monotherapy or the combination of doxorubicin and ifosfamide. However, given that the combination therapy results in bone marrow toxicity more frequently than monotherapy, we selected doxorubicin monotherapy for neoadjuvant treatment. After chemotherapy, the tumor size shrank to 5.6 cm, and the distance of suspected invasion to the superior vena cava was reduced, rendering the tumor resectable with a sufficient surgical margin between the inflow of the atrium and the tumor (Fig. c, d).
We performed right upper lobectomy with combined resection of the superior vena cava and reconstructed the blood flow by an artificial vascular graft between the left brachiocephalic vein and right atrial appendage. We were able to remove the dense adhesion around the right brachiocephalic vein and right atrium inflow of the superior vena cava. However, we had to resect the superior vena cava around the azygous vein combinedly. The pathological findings revealed tumor invasion to the superior vena cava at that point. The tumor was completely resected by surgery (Fig. b). Pathological findings showed leiomyosarcoma and positivity for smooth muscle actin (SMA) and h-caldesmon (Fig. c–e). The tumor was found to have arisen in the lung and invaded the superior vena cava. The vessel lumen of the superior vena cava was intact, and the tumor had invaded the superior vena cava from the outside. The pathological response to neoadjuvant chemotherapy was Ef.1a. The patient was still alive without recurrence at 17 months postoperatively. |
pmc-6544954-1 | A 9-year-old boy was brought to the urology clinic due to severe decreased urinary force and caliber since one month earlier. He has mentioned dysuria without other irritative lower urinary tract symptoms, intermittent hematuria, or downward urination. In past medical history, he was circumcised at the age of one year. In the physical examination, the glans, meatus and penile shaft seemed to be normal initially. Nevertheless, with precise inspection, a deep circular sharp cut in peno-glanular junction, was detected (Fig. ). In the operating room, under local anesthesia and loupe magnification(X4), we detected a neglected Plastibell remnant string, which was removed with an eye scissor, and a 6 French Foley catheter was inserted in the urethra for two weeks. The patient was referred to a tertiary urethral and penile reconstructive center. Unfortunately, the penile glans auto amputation spontaneously occured after 45 days during the daily activity with minimal bleeding (Fig. ). Foley catheter was again inserted for 2 weeks and a watch-full waiting approach for three months was recommended. He is now managed conservatively with daily urethral self-dilation and is candidate for future reconstructive surgery. |
pmc-6544955-1 | A 48-year-old female with progressing symptoms of dyspnea and palpitations for over 2 months was referred to cardiologist. Her medical history was unremarkable, she only had allergy to various chemical substances as she was working as a tailor. Auscultation of the heart revealed a loud systolic murmur throughout entire precordium with irradiation to the left shoulder blade. Hemodynamic parameters were normal, while the ECG showed left ventricular hypertrophy (LVH). Laboratory findings revealed a normocytic normochromic anemia (Hb 104 g/l, normal values 119-146 g/l) and elevated level of lactate dehydrogenase (LDH) without liver or renal dysfunction.
Transthoracic echocardiography (TTE) was performed. Several large masses in the left ventricle (LV) close to anterior and anterolateral mid-ventricular and apical segments were observed with one tumor (approximately 2.0 cm in length) partially obstructing LV outflow tract. Additional smaller tumor was seen in left atrium (LA) attached to the interatrial septum (IAS).
Cardiovascular magnetic resonance (CMR) was performed to assess specific characteristics of masses using a 1.5 T scanner (Siemens Magnetom Aera, Siemens AG Healthcare Sector, Erlangen, Germany) with an 18-channel phased array coil. Cine images (Fig. a) showed a 71 × 45 × 21 mm tumor with irregular borders in the LV attached to anterior and anterolateral walls. The mass was partially infiltrating LV myocardium and was isointense on non-contrast T1W spin-echo images (Fig. b). On T2W spin-echo images the tumor appeared hyperintense (Fig. c), early gadolinium enhancement was similar to myocardium. The tumor heterogeneously enhanced after administration of full dose of contrast agent (Fig. d). The diagnosis of malignant cardiac sarcoma was suspected. Also computed tomography (CT) of the chest and abdomen was performed, but there were no signs of other origin of malignancy or metastasis.
Open biopsy and cytoreductive surgery were performed. The masses from LV cavity, outflow tract and LA were removed, apical trabeculae were infiltrated by the tumor and complete resection was not possible. Histology revealed UPS. (Fig. ) Cardiomyocytes were infiltrated with tumor cells. The tumor was composed of pleomorphic cells with abundant mitoses and area of necrosis. Focal positivity of CD34, CD99 and TLE-1 were not specific. Tumor cells were negative for actin, desmin, CD34, CD117, S100P, EMA and panCK immunomarkers.
Postoperative CMR revealed no masses in the LA and LV outflow tract. Tumor related to the LV cavity was still present (Fig. ). Additionally, there was a pericardial effusion of 12 mm localized at LV inferior wall and right ventricle.
Chemotherapy with doxorubicin and ifosfamide was initiated. The scheme was: ifosfamide 3 g/m2/day 1-3 days, Mesna 100% ifosfamide dose, doxorubicin 75 mg/m2/day 1 day. Granulocyte-colony stimulating factors (GCSF) were given. According to CTCAE (Common Terminology Criteria for Adverse Events) only I grade neutropenia and thrombocytopenia were observed. Totally, 7 cycles were completed (total cumulative doxorubicin dose 525 mg/m2). Echocardiography and CMR were performed to assess the results of chemotherapy treatment and revealed a complete response – only signs of fibrosis without any signs of tumor were visible in CMR images (Fig. ). The chest and abdomen CT were repeated and did not demonstrate any findings suggesting metastasis.
Follow ups with TTE, CMR and chest, abdomen and pelvic CT is performed every 3 months. Twenty-six months from initial diagnosis the patient is still free of recurrence of tumor (Fig. ) with no compromises of the quality of life. |
pmc-6545025-1 | Patient A is a 10-year old right-handed female born following a pregnancy complicated by antenatal microcephaly noted on fetal ultrasound. She is of Chinese descent and has no family history of consanguinity or congenital anomalies. Her early development milestones were normal; she sat at 6 months, crawled at 8 months and walked at 12 months of age. Her mild intellectual disability was first apparent at the age of six years and she is now two years behind her peers academically, with no regression in development. She speaks two languages. She has an independent education plan. At birth her head circumference was not measured and by ten years of age the patient’s head circumference was 46 cm (2 SD below the mean). She has some dysmorphic facial features including prominent ears relative to her microcephaly, a tented mouth, and bilateral 5th finger clinodactyly. Neurological examination was otherwise unremarkable. Magnetic resonance imaging (MRI) at nine years of age revealed microcephaly, posteriorly predominant simplified cortical gyri, and areas of band and nodular heterotopia (Fig. ). No seizure-like activity has been described by the parents but a screening electroencephalogram (EEG) demonstrated occasional interictal sharp waves over the right central temporal areas in drowsiness and sleep, suggestive of a predisposition towards focal onset seizures, in addition to occasional, non-specific, generalized paroxysmal delta activity in sleep. Chromosomal microarray and biochemical screening for inborn errors of metabolism (as described elsewhere) were both unremarkable []. Clinical whole exome sequencing (Centogene AG, Rostock, Germany) revealed a novel, de novo TUBG1 missense mutation (NM_001070.4: c.202G > A; p.Asp68Asn), using a trio approach (proband plus parents), chosen due to the multiple potential causative genes. The parents consented to this report. |
pmc-6545029-1 | A 28-year-old Togolese woman was admitted to the Gynecology Department of Kara University Hospital with a 1-week history of bleeding and pelvic pain. She reported her age at first menstrual period as 14 years old and her age at first sexual intercourse as 15 years old. She did not smoke, drink alcohol, or take contraceptive pills. She did not report any history of sexually transmitted infections. The patient had no medical, obstetric, social, environmental, or special family history. She had never received an intervention, and she had a good psychosocial state.
Clinical examination revealed an axillary temperature of 38 °C, body weight of 54 kg, and height of 1.68 m. The patient’s blood pressure was 100/60 mmHg, and her pulse was good. Her general condition was good. Upon inspection, her conjunctivas were moderately hyperemic, and her abdomen palpated normally but was painful on palpation of the pelvic region. There was palpable lymphadenopathy in the region of the inguinal lymph nodes. Her gynecological speculum examination showed a macroscopically healthy uterine cervix. The result of examination of her external genitalia was normal. Her neurological examination and other investigations were unremarkable. The result of biological explorations, namely hemoglobin, was normal (13.5 g/dl). Her renal biology was normal (urea 0.22 g/L, creatinine 9 mg/L, blood glucose 0.9 g/L). The result of her hepatic evaluation was also normal (transaminases 19 IU/L, phosphatases 104 IU/L, γ-glutamyltransferase 21 IU/L). The result of her human immunodeficiency virus serology test was negative.
Abdominal ultrasound showed regular thickening of the endometrium, measuring 19 mm thick, and no substantial masses (Fig. ). Her ovaries were normal in size. Biopsy with curettage of the endometrium was performed.
Anatomopathological examination with hematoxylin and eosin (H&E) staining showed neoplastic cells of an epidermoid nature with bridges of unions arranged in lobules, often centered, with dyskeratotic maturation. Cellular atypia of epidermoid cells, particularly anisokaryosis, and mitotic figures were noted (Fig. ). Immunohistochemistry (IHC) investigations showed positivity for anti-epithelial membrane antigen markers and anti-pancytokeratin 1 (KL1+) markers of tumor cells (Figs. and ). The cells were negative for chromogranin A, actin, S100, estrogen receptor (ER), and progesterone receptor (PR). Positive staining for Ki-67 (antigen of cell multiplication) was observed in 50% of the tumor cells. In situ hybridization demonstrated HPV genotype 16/18. A diagnosis of PSCC of the endometrium associated with HPV genotype 16/18 was made.
Total hysterectomy with bilateral adnexectomy and bilateral inguinal dissection were performed. The inguinal dissection revealed a total of five ganglia (three lymph nodes on the right and two lymph nodes on the left). The cervix, fallopian tubes, and ovaries were macroscopically normal. Histologically, the tumor consisted of well-differentiated epidermoid cells with union bridges and dyskeratotic maturation invading the middle third of the myometrium. The diagnosis of a well-differentiated, invasive SCC of the endometrium was confirmed. There was no differentiation of adenocarcinoma, and no squamous metaplasia or dysplasia was observed. No tumor cells were seen in the cervix, the fallopian tubes, the ovaries, the omentum, or the lymph nodes.
The histoprognostic grade was classified as FIGO (International Federation of Gynecology and Obstetrics) stage IB, corresponding to pT1N0M0. The patient received three cycles of docetaxel (75 mg/m2, day 1, pump in) combined with carboplatin (200 mg/m2, day 1, drop in) chemotherapy.
After 3 and 6 months of follow-up, the patient was well, without recurrence. |
pmc-6545180-1 | The patient was a 69-year-old man with stage IIIB lung adenocarcinoma (T1bN3M0, Union for International Cancer Control 8th edition) with primary tumor in the left lower lobe and multiple lymph node metastases (#2R, 4R, 7 and 10L). He had no past medical history and complications. Both epidermal growth factor receptor mutations and anaplastic lymphoma kinase status were negative. The PD-L1 expression was 0%. He had received chemotherapy as an initial treatment because CRT was not suitable for the wide extent and size of the tumor. Four cycles of carboplatin, pemetrexed, and bevacizumab were administered. Subsequently, he was treated with pemetrexed and bevacizumab as maintenance therapy. Although the tumor decreased in size once, it regrew. As the tumor lesions were still large, but the tumor size was smaller than that before initial treatment, we judged that CRT was possible at this timing. Therefore, we decided to perform CRT followed by durvalumab as the next treatment on the cancer board. CRT was performed 1 month after the last administration of pemetrexed and bevacizumab. For the large tumor lesions, we prescribed up to 50 Gy in 2 Gy fractions with involved-field radiotherapy to avoid the occurrence of adverse effects. The dose was given through the parallel-opposed anteroposterior portals up to 30 Gy, and multiportal beams were used to reduce the dose in the spinal cord from 30 to 50 Gy. Weekly carboplatin (area under the curve, 2.0) and paclitaxel (40 mg/m2) were administered concomitantly. No major adverse events were observed during CRT. One month after CRT, the tumor decreased in size and there was no new lesion or adverse effect, such as esophagitis and pneumonitis. Therefore, durvalumab (10 mg/m2, every 2 weeks) was started.
After three courses of durvalumab (2.5 months after the completion of CRT), the patient experienced dysuria. The next day, he experienced muscle weakness of the lower limbs and difficulty in walking independently. Physical examination revealed bladder and rectal disturbance, muscle weakness in the lower limbs, and sensory loss in the lower body. Magnetic resonance imaging (MRI) was performed and revealed T2 signal hyperintensity involving the thoracic spinal cord (T5–T8 levels) (Fig. ). The thoracic spinal cord with T2 signal hyperintensity matched the irradiated site. The doses to the thoracic spinal cord were 30 Gy in 2 Gy fractions up to 30 Gy and 10 Gy in 1 Gy fraction from 30 to 50 Gy (Fig. ). Thus, the total dose was 40 Gy. There were no findings of infection and tumor cells in the cerebrospinal fluid. As there was no evidence of other causes, such as epidural metastasis or spinal cord compression secondary to vertebral metastases, and as T2 signal abnormalities matched the irradiated site of the thoracic spinal cord, we diagnosed radiation myelitis accompanying treatment for NSCLC. We stopped durvalumab administration and started steroid treatment. The patient received intravenous methylprednisolone pulses of 1.0 g/day for three consecutive days, followed by oral prednisolone at an initial dosage of 50 mg/day. The oral prednisolone was gradually tapered by 5 mg every 1 week. One week after the starting date of steroid treatment, muscle weakness in the lower limbs gradually improved and crutch walking independently became possible, though bladder and rectal disturbance remained. The follow-up MRI (1 week after onset) revealed significant improvement of the T2 signal abnormalities (Fig. ). |
pmc-6545183-1 | Patient: A 42-year-old female nonsmoker.
BMI: 26.6 kg/m2.
Medical history: nothing in particular.
Clinical course: She was referred to the Thoracic Surgery Department of Nagahama City Hospital because of an abnormal chest X-ray radiograph (left pulmonary hilar nodule, 3-cm diameter). A bronchoscopic biopsy revealed SCLC (LD: c-T2aN1M0; Stage IIA, Fig. a). However, her metastatic workup was negative, which comprised cranial magnetic resonance imaging (MRI) and bone scintigraphy. Accordingly, combined treatment with chemotherapy [60 mg/m2 cisplatin (day 1) + 60 mg/m2 irinotecan (days 1, 8, and 15)] and radiotherapy (total 36 Gy) was initiated, followed by thoracoscopic lobectomy 3 weeks after last chemotherapy (Fig. b). Immunohistochemical findings of lung tissue are shown in Fig. c–e. Of note, the surgical stage was yp-T1N0M0: Stage IA.
Figure shows the postoperative course. Nearly 4 years after receiving the first-line treatment, the pro-gastrin-releasing peptide (ProGRP) level exhibited a gradual increase. The patient underwent additional chemotherapy with amrubicin alone [45 mg/m2 (day 1, 2, 3), cisplatin + etoposide [80 mg/m2 cisplatin (day1) + 100 mg/m2 etoposide (day 1, 2, 3)], and carboplatin + irinotecan [AUC5 carboplatin (day1) + 50 mg/m2 irinotecan (day 1, 8, 15)]. Despite this treatment, the ProGRP level did not decrease. Positron emission tomography-computed tomography (PET-CT) revealed an abnormal accumulation in the left ovary. In addition, pelvic MRI revealed a solid tumor in the left ovary with an uneven contrast effect. Accordingly, she was referred to the Obstetrics and Gynecology Department.
We performed laparoscopic salpingo-oophorectomy 3 days after she visited our hospital. The left ovary had enlarged to 4 cm, and the external surface was smooth and formed bumps (Fig. ). There was no other metastatic site. Figure shows the pathological histology of the left ovarian tumor. In addition, all immunohistochemistry results for thyroid transcription factor-1 (TTF-1), synaptophysin, and chromogranin A were positive (Fig. ); these immunohistochemical test results have also been found to be positive in lung tumor tissue (Fig. ). These findings were consistent with metastatic SCLC in the ovary. Postoperatively, as the ProGRP level markedly decreased, we did not perform any additional treatment. 11 months after this recurrence, her carcinoma has not relapsed. |
pmc-6545187-1 | A 40-year-old man with a 3-month history of left VF impairment was referred to the Department of Ophthalmology at Hyogo College of Medicine in April 2018. His logarithm of the minimum angle of resolution (logMAR) corrected visual acuity (VA) was − 0.18, which converts to 1.5 in decimal notation. He showed a slightly decreased light reflex and a relative afferent pupillary defect. Optical coherence tomography revealed that his left circumpapillary retinal nerve fiber layer was slightly thinner than normal, while HAP showed a low-grade inferior altitudinal defect with a mean deviation (MD) of − 5.24 dB (p < 1%: Fig. ). Magnetic resonance imaging (MRI) showed widening and winding of the optic nerve (ON) with tram-track sign and a fusiform tumor measuring 10 × 6 × 8 mm (volume 0.35 cm3). The tumor was located on the left distal ON at the precanalicular portion (Fig. ). The patient was, therefore, diagnosed with ONSM.
He underwent 7-beam IMRT in May 2018, with a prescribed total dose of 50 Gy delivered in 25 fractions over 35 days without steroid medication before and during the precision radiotherapy. He was treated using a 6-MV X-ray Novalis unit™ (BrainLAB AG, Munich, Germany). With regard to treatment planning, we aimed to make the planning target volume as small as possible. The gross tumor volume (GTV) was determined using computed tomography and MRI fusion imaging. This ensured accuracy in GTV delineation (Fig. b, c). The tumor volume was calculated from contrast-enhanced 3-dimensional MRI with treatment planning carried out using i-PLAN Dose ver. 4.1.2™ (BrainLAB AG). We defined the GTV as the clinical target volume (CTV), and the CTV as the internal target volume (ITV). The planning target volume (PTV) was defined as the ITV plus the setup margin (SM) of 2 mm. As a dose-volume histogram (DVH) parameters, we defined DV for absorbed dose in fraction V% (or V cm3) of the volume in the organ. In dose constraints for organ at risks (OARs), we determined D2% and mean absorbed dose (Dmean) of the optic nerve, chiasm, and retina as upper limits of biologically equivalent dose at 2 Gy per fraction (EQD2) of 60 Gy and 45 Gy, respectively. In this case, we defined GTV of 0.35 cm3 using CT and MRI. Concerning a DVH parameter, D98% was 50.5 Gy for the GTV, D95% was 46.1 Gy for the PTV, and D2% and Dmean were 2.0/0.7 Gy, 53.9/28.2 Gy and 4.9/1.2 Gy for the retina, optic nerve and chiasm, respectively.
We prospectively aimed to detect any early changes in VF occurring during the IMRT course using weekly HAP. An early change in VF was observed during the IMRT. The patient had a low-grade inferior altitudinal defect that has been detected by HAP before treatment. Repeated weekly HAP showed significant stepwise improvements in VF with a change in the mean deviation (MD) of sensitivity depression. At a dose of 46 Gy, HAP showed near-complete disappearance of the VF deficit with an MD of − 1.37 dB (p < 0.1: Fig. ). Despite this marked improvement in VF, MRI showed little tumor reduction at a dose of 16 Gy (Fig. ). Although HAP showed complete disappearance of the VF defect with an MD of 0.21 dB, MRI showed continued widening and winding of the ON, as well as only partial regression of the tumor with post-treatment dimensions of 6.5 × 3.5 × 5 mm (volume 0.1 cm3) 2.5 months after IMRT was completed (Fig. ). |
pmc-6545191-1 | A 64-year-old male with a known VSD, who had not experienced any previous VSD-related complications, underwent a dental crown implantation without antibiotic prophylaxis in September 2016. Three months later he experienced fevers, sweats, and a dry cough, which spontaneously resolved after several weeks without antibiotic treatment. His symptoms recurred in June 2017 and at this time were associated with raised inflammatory markers. Further investigation, including a computed tomography (CT) chest, identified multiple peripheral lung lesions that were initially presumed to be malignant. Once again, his symptoms spontaneously resolved without any antibiotics. A follow-up CT chest in August 2017 identified resolution of the peripheral lung lesions, challenging the initial presumed diagnosis of malignancy.
A further CT chest was organized in November 2017, and on this occasion there was recurrence of lung lesions in new areas, suggestive of septic emboli with internal cavitation (Fig. A, B). At this time that patient complained of sweats and lethargy, and was consequentially hospitalized for further investigation of his relapsing remitting lung lesions.
On admission, four blood cultures all identified Streptococcus mutans. A transthoracic and transoesophageal echocardiogram was completed, which identified a perimembranous VSD but no endocardial vegetation (Fig. C). A CT pulmonary angiogram was performed to exclude a pulmonary embolus and to identify an appropriate lung lesion to biopsy.
A thoracoscopic lung biopsy was completed, which isolated S. mutans from the necrotizing lung abscesses. Furthermore, the patient complained of lower back pain, which was investigated with spinal magnetic resonance imaging and identified early L3-4 osteomyelitis without a complicating epidural abscess. As the patient was not haemodynamically compromised during admission, there was no need for urgent surgical repair of the VSD. The decision was made to treat the VSD-related IE medically, followed by an elective VSD repair following a completed course of antibiotics. Initial medical treatment included six weeks of intravenous benzylpenicillin and ceftriaxone, followed by three months of oral amoxicillin.
The patient represented in February 2018 with recurrent sepsis without bacteraemia while on oral amoxicillin as a step down for S. mutans endocarditis. At this time, transoesophageal echocardiogram demonstrated the known VSD, as well as thickening of the adjacent right ventricle myocardium. Antibiotics were re-escalated to intravenous benzylpenicillin and ceftriaxone for four weeks followed by VSD and tricuspid valve repair.
Intra-operatively, the VSD was debrided and closed with a bovine pericardial patch. The adjacent tricuspid valve was excised en-block and reconstructed using a sliding annuloplasty repair. Histopathology showed paucicellular fibrous tissue without evidence of active endocarditis, no organisms were cultured. Post-operatively, the patient received intravenous benzylpenicillin and ceftriaxone for two weeks followed by oral amoxicillin for three months. He made a full recovery. |
pmc-6545219-1 | A 28-year-old female presented with a palpable and painful nodule that had been present for five years in the right tibia. The pain was gradually aggravated in the last four months. On the day of presentation, the pain was so unbearable that it limited the movement of the right lower limb. Physical examination revealed a tenderness along the medial portion of the right proximal tibia. There was no external wound, bone friction or rubbing, swelling of the right popliteal lymph nodes or circulation disturbances. Clinical examination failed to show any features of neurofibromatosis, and her familial history was uneventful. Lesion resection and artificial bone graft were performed successively. The patient had a disease-free follow-up 8 months after the surgery.
A conventional anterior-posterior radiograph showed an osteolytic lesion, 2.0*1.6*1.4 cm in size, located in the medial superior metaphysis of the right tibia. The sclerotic rim was observed, indicating its non-aggressiveness (Fig. a). Magnetic resonance imaging demonstrated an oval eccentric osteolytic lesion in the right tibial medial condyle, with endosteal scalloping and cortical expansion but no cortical disruption, periosteal reaction or soft-tissue mass, which are also features that suggest non-aggressiveness (Fig. b-e).
2 months after the surgery, no recurrence was identified by the conventional radiograph (data not shown).
Gross examination showed solid tissues with firm, white cut surfaces, measuring 2 cm in aggregate. Histologically, low-power magnification revealed a well-circumscribed and unencapsulated lesion with variable cellularity. The relatively hypocellular areas, which was the predominant part of the neoplasm, presented with biphasic cellular morphology. One morphology of these areas exhibited epithelioid cells with bland nuclei and eosinophilic cytoplasm arranging in small clusters within the myxoid or collagenous matrix (Fig. a). The other showed cells bearing wavy and thin nuclei and elongated cytoplasmic processes in a lamellar pattern (Fig. b). On the immunohistochemical examination, the epithelioid cells were diffuse positive for S100 protein (Fig. c), focally positive for Collagen IV (Additional file : Figure S1), but negative for EMA. The cells with slender nuclei and elongated cytoplasmic processes stained positively for EMA in a membranous pattern (Fig. d), but were negative for S100 or Collagen IV. These two different morphological areas alternated with each other and exhibited blurred boundaries (Fig. a-c). Additionally, in some areas composed of epithelioid cells, several hypercellular nodules with distinct morphologies were observed. These vague nodular structures consisted of spindle cells arranged in a fascicular or storiform architecture. Focally, the cells exhibited a streaming or syncytial pattern (Fig. a). Immunohistochemically, most spindle cells were diffuse and uniformly positive for EMA (Fig. b) but negative for S100 (Fig. c); only a minority of cells displayed the opposite expression pattern. Due to the increased nuclear density, these vague nodular structures imparted an overall blue to purple colour with staining at low magnification (Fig. d). The abrupt transition between these hypercellular spindle cells areas and surrounding epithelioid cells areas were well demonstrated by the non-overlapping expression of EMA and S100(Fig. e-g). Most cells were positive for CD99, and the expression seemed to be stronger in EMA positive areas than in S100 positive areas (Additional file : Figure S2). Small-to-mid-sized blood vessels with hyalinized walls were scattered throughout the neoplasm. Lymphoid infiltration was also observed and was most prominent around the vessels. Necrosis, haemorrhage and atypical mitosis were absent, the mitotic activity was very low ranging from 0 to 2 per 50 HPF in the lesion, indicating its benign nature. The Ki-67 index was less than 1% throughout the neoplasm. Expression levels of other proteins explored in the study are listed in Table . FISH analysis targeting the rearrangement of SYT was negative (Additional file : Figure S3).
Based on the above findings, the present case was diagnosed as hybrid epithelioid schwannoma/perineurioma primarily occurring in the right tibia. |
pmc-6545224-1 | A 71-year-old Japanese man with no notable medical history, including autoimmune disease, was diagnosed as having gastric cancer and liver metastases in April 2017 (Fig. a–c): T2N0M1 cStage IV; Union for International Cancer Control (UICC) 7th edition. His maternal grandfather and his brother had gastric cancer. He drank 360 ml of rice wine every day and smoked approximately 50 cigarettes/day until 24 years ago.
Since May 2017, he received first-line chemotherapy comprising four cycles of cisplatin and tegafur, gimeracil, and oteracil potassium, followed by four cycles of second-line therapy with paclitaxel and ramucirumab. Although his liver metastases shrank, in December 2017 (that is, at 7 months after the initiation of chemotherapy) the primary tumor and metastases were found to have progressed.
He had no history of apparent autoimmune disease; his serum autoimmune disease-related markers were negative. During the second-line chemotherapy, his anterior chest and dorsal surfaces of his fingers became reddened, which was considered to be caused by ramucirumab. He had no difficulties in drinking or swallowing solid matter, and showed no obvious neurological dysfunction. Because it seemed he had no evidence that he had autoimmune disease, including dermatomyositis, we decided to initiate nivolumab as the third-line therapy.
Nivolumab (3 mg/kg) was administered in January 2018. A few hours after administration, he developed fever of 38 °C, which gradually dropped down to low-grade fever. Two weeks after administration he visited our hospital for the second treatment with nivolumab, he said he had been suffering from general fatigue, difficulty in swallowing, muscle aches, low-grade fever, face edema, and erythema of the nose, anterior chest, and dorsal surfaces of his fingers. He could easily drink water, but had difficulties in swallowing solid materials. He showed no obvious neurological dysfunction and had no trouble in walking by himself.
Blood tests showed an increase in the levels of creatine phosphokinase (CK; 300 U/L), aspartate aminotransferase (AST; 37 U/L), myoglobin (354 ng/mL), and C-reactive protein (CRP; 3.32 mg/dL). Before nivolumab administration, his CRP level had been slightly high (around 1.0 mg/dL), and his CK and AST levels had been within normal range. Because drug-associated myositis was suspected, he was immediately admitted to our hospital.
After admission, the difficulty in swallowing worsened at the end of January (approximately 20 days after nivolumab administration) and his CK and AST levels gradually increased to > 1000 and > 100, respectively, at 22 days after administration. Because of the worsening of his general condition, nivolumab treatment was suspended. Instead of nivolumab, treatment with prednisolone (0.5 mg/kg, 30 mg/body per day) was initiated at 22 days after nivolumab administration, as frequently applied for drug-induced dermatomyositis [].
However, the results of his blood test did not improve, and his general condition worsened. In late February (approximately 40 days after nivolumab administration), he became unable to stand up or eat. The skin lesion had spread over his ears, elbows, and knees, as well as his face, right shoulder, anterior chest, left hip, and fingers. A neurological examination indicated dysphagia, muscle weakness (mainly proximal), and depression of the tendon reflexes of his extremities. Because we considered that the steroid treatment (30 mg/body per day) was ineffective and that long-term high-dose prednisolone was harmful, we reduced the dose of prednisolone to 20 mg/body per day 41 days after starting nivolumab.
More examinations were needed to identify his disease condition correctly. Electromyography of his deltoid muscle and biceps brachii revealed a low motor unit potential (MUP), and magnetic resonance imaging (MRI) showed a heterogeneous high signal intensity in the bilateral femoris muscles in short-T1 inversion recovery (STIR) images, and a heterogeneous contrast enhancement in the bilateral femoris muscles (mainly proximal) in gadolinium-enhanced T1 images; these findings are suggestive of myositis (Fig. ). The condition of our patient (skin lesion, muscle weakness, elevation of CK level and CRP level, and electromyography findings) fulfilled the diagnostic criteria for dermatomyositis. A muscular biopsy was not performed because it was too invasive to our patient. Although he was negative for anti-Jo-1, −Scl-70, −RNP, −Sm, −Mi-2, −MDA5, and −ARS antibodies, his antinuclear antibody index was 80 and his anti-transcriptional intermediary factor 1-γ (TIF1-γ) antibody index was 111 (normal range < 32). Because anti-TIF1-γ is a marker for paraneoplastic dermatomyositis, our patient was suspected to have paraneoplastic dermatomyositis rather than nivolumab-induced myositis. Also, his reddened anterior chest and dorsal surfaces of his fingers before the initiation of nivolumab, which we had considered a ramucirumab-induced eruption, were actually the V-neck sign and Gottron’s papule on his fingers. The erythema of his fingers was hyperkeratotic, erythematous, flat papules with central atrophy, and on the dorsum of his metacarpophalangeal and interphalangeal joints, all of which were compatible with the symptoms of dermatomyositis []. Therefore, his diagnosis was changed from nivolumab-induced myositis to paraneoplastic dermatomyositis.
Because we assessed that the applied treatment of prednisolone (30 mg/body per day, tapering to 20 mg/body per day) was not effective, according to the standard treatment for resistant or severe paraneoplastic dermatomyositis [, ], steroid pulse treatment (methylprednisolone 1000 mg/day for 3 days, followed by tapering prednisolone from 120 mg/day to 30 mg/day at 129 after nivolumab administration) and intravenously administered immunoglobulin 30 g/day (400 mg/kg per day) for 5 days once a month three times beginning on day 45 after nivolumab administration were initiated. Our patient’s CK level rapidly decreased in response to the treatment (Fig. ), and his physical activity significantly improved. At 2 weeks after steroid pulse treatment initiation, he could walk by himself, and at 6 weeks he could walk smoothly and stand up with little help. While chemotherapy for his gastric cancer was not applied during the treatment of paraneoplastic dermatomyositis, his general condition improved, and his rehabilitation continued. Despite the improvement of his general condition, the dysphasia was not improved and he could not eat or drink. A nasogastric tube was inserted at day 128 for his nutrition, and tacrolimus, an immunosuppressive agent that is frequently used for resistant or severe dermatomyositis, was administered through it from day 129 after nivolumab administration. We tried to make it possible for him to be discharged from our hospital.
However, his general condition drastically worsened at day 130 after first nivolumab administration. To our regret, at day 142 after administration, he died due to rapid worsening of his gastric cancer. After his death, an autopsy was performed. According to the interim report, the cancer had progressed more than expected. The tumor spread throughout his whole body, and metastasized to his liver, lung, and abdominal cavity. Although muscles were normal in gross appearance, a pathological examination is still under investigation. |
pmc-6545489-1 | A 68-year-old female presented in 3/2018 with a high output small bowel fistula after several laparotomies and incisional hernia repair.
In 11/2008, an en bloc resection of ovaries, adnexa and uterus combined with lymphadenectomy and anterior rectal resection with protective ileostomy was performed because of a stage four cervix carcinoma. The operation was followed by chemotherapy and abdominal radiation. The gastrointestinal continuity was reconstruction 4/2009.
In 9/2016 the patient presented with an acute abdomen due to a spontaneous ileum perforation. The emergency operation revealed massive adhesions and a perforation of the small bowel in the lower abdomen, necessitating a small bowel resection. The postoperative course was eventful leading to an open abdomen, repeated abdominal lavage therapy and an ileostomy. 10/2016 the abdomen could be closed by inlay mesh implantation (Symbotex composite mesh 25x20 cm). The high output ileostomy required parenteral feeding via a venous catheter.
In 9/2017, the patient was readmitted for reconstruction of the small bowel continuity after continuous weight loss and signs of malnutrition. An end-to-end ileo-ileostomy was performed after extended adhesiolysis. However, the patient again developed a leakage at the anastomotic side and required several operative interventions. She was discharged with a high output small bowel fistula and a short bowel syndrome in 12/2017 under complete parenteral nutrition.
In 3/2018 the patient developed a second small bowel fistula and signs of infection at the midline incision and the abdominal wall. Parts of the mesh became visible. After antibiotic pretreatment, re-laparotomy with extirpation of the mesh, adhesiolysis, spare resection of the small bowel including the fistulas, ileo-ileostomy and reconstruction of the abdominal wall was performed in 4/18 (Figure 1 , Figure 2 , Figure 3 ) . From the intraoperative findings it was clear that the mesh eroded the small bowel and caused the fistulas.
The postoperative course was again eventful and resulted in fistula formation, but fortunately only a small low-output fistula developed. After 3 months of intensive wound-therapy, the patient was able to handle the low-output fistula like a small stoma and presented in 10/2018 with complete oral intake and a secretion of less than 5cc per day (Figure 4 ). |
pmc-6545489-2 | A 90-year-old male patient presented in 5/2018 with a high output small bowel fistula secreting through a 4x4 cm perforation of the skin and through the underlying mesh (Figure 5 ).
The patient had a history of transverse colon resection in 12/2008 (colon carcinoma T3, N0, MO), insufficiency of the anastomosis with repeated operative interventions and creation of a terminal ileostomy. In 7/2009 a hernia of the abdominal wall was repaired using a Proceed mesh. 10/2010 he underwent resection of liver metastasis (segment 2 and 3). The patient showed several comorbidities like hypertension, Parkinson’s disease and nephropathy that required hemodialysis.
An exploratory laparotomy with removal of the mesh and en bloc resection of two segments of the small bowel was performed (Figure 6 , Figure 7 , Figure 8 ). The closure of the abdominal wall without alloplastic material could only be achieved by doubling of the dermis after removal of the epithelium. He experienced a complicated clinical course with several re-explorations because of insufficiency of the small bowel anastomoses. Finally, again, an enterocutaneous fistula developed. The general condition of the patient decreased continuously and the patient died one month after the operation. |
pmc-6545490-1 | A 7-year-old girl with no significant past medical, surgical or family history was referred to our plastic surgery clinic as a case of a pigmented nevus that involved most of the scalp since birth. The nevus was associated with pruritus and serous discharge.
Local examination revealed a pigmented, thick, and corrugated lesion that involved almost her entire scalp leaving a strip of normal skin with a width of 10 cm (Figure 2 ). On full body examination, she was found to have scattered, hyper-pigmented lesions fully covered with hair on the lower back and the upper thighs with estimated sizes ranging from 2x 2 to 6x 6 cm (Figure 3 ).
Summary of the procedures done is shown in Table 1 , Figure 4 , Figure 5 , Figure 6 , and Figure 7 show single procedures.
All the specimens collected were sent to the histopathology lab and the report revealed that the specimens had nests and diffusely cellular sheets of benign melanocyte with superficial focal pigmentation and deep dermal maturation. Lateral margins and deeper margins were involved. Overall, there was no malignancy reported (Figure 8 , Figure 9 ).
Figure 10 shows the result 3 months after the last procedure.
Five years later and at the age of 13, she was seen with her parents in the clinic doing fine with a normally growing long hair and no complications (Figure 11 ). |
pmc-6545635-1 | A 50-year-old male, with end-stage renal disease (ESRD) secondary to hypertensive nephropathy, was selected to undergo creation of an AV fistula. He had undergone a radiocephalic fistula in his right arm that did not mature. After 6 months of hemodialysis via two tunneled cuffed dialysis catheters (one in the right internal jugular vein and another in the left), the patient presented to our institution for further evaluation. A venogram showed thrombosis of his radiocephalic fistula and no central venous obstruction. An ultrasound study revealed a cephalic vein that was 4.8 mm × 4.3 mm in diameter with no wall thickening. The brachial artery measured 5 mm × 5.3 mm with no wall thickening or calcification. He had triphasic waveforms in his brachial artery. The patient was briefed about his various vascular access options, and he agreed to proceed with a right brachiocephalic fistula construction using the Optiflow device. After discussing all the advantages and disadvantages, he signed the informed consent to be part of the OPEN (Optiflow PatEncy and MaturatioN) study.
The Optiflow device was inserted as per the manufacturer’s instructions. A 7-cm-long oblique incision was made in the antecubital fossa. The cephalic vein was mobilized and ligated distally. It was then moved to the brachial artery in a smooth line without tension or kinking. Before clamping the artery, the patient received 5000 U of heparin. The brachial artery was then clamped and an incision was made in the artery in the same plane and direction as the vein take-off angle. A vascular punch was used to make a circular arteriotomy 4 mm in diameter. The flanges of the Optiflow device were inserted into the artery using custom-made forceps. The vein was then attached to the Optiflow device. Four tacking stitches were placed in the adventitia between the artery and the vein. The subcutaneous tissues were closed using 3-0 Vicryl, and staples were used for skin closure. The operation was uneventful and a palpable thrill was noted at the anastomosis site after the operation (fistulogram—).
The new brachiocephalic fistula was cleared to be used for hemodialysis 5 weeks later. Seven weeks after the operation, the left internal jugular vein tunneled, cuffed dialysis catheter was removed, and hemodialysis was resumed via the right brachiocephalic fistula. A follow-up fistulogram conducted 9 weeks after the procedure showed no stenosis and good flow in the fistula and peri-anastomotic regions.
Eight months after the procedure, the patient was referred to us due to poor arterial blood flow during hemodialysis. A duplex ultrasound revealed increased flow velocity at the anastomosis site and decreased flow volume in the fistula. A venogram showed a 90% stenosis in the juxta-anastomotic area with aneurysmal dilation at this level (). Angioplasty could not be performed due to failure to cross the device in the outpatient vascular access center. A tunneled catheter was inserted. Four weeks later, the patient was taken to the hybrid operating room where the lesion was crossed via a retrograde approach using a 0.14 command ES (Abbott Laboratories, Abbott Park, IL). The patient underwent balloon angioplasty of the peri-anastomotic stenosis using a 4-mm AngioSculpt balloon (Angioscore Inc., Fremont, CA), followed by a 6-mm drug-coated Lutonix balloon (Bard Lutonix Inc., New Hope, MN) and leaving minimal residual stenosis ( and ()). Following the procedure, the patient resumed hemodialysis using the fistula after that.
Sixteen months following the Optiflow procedure (or 8 months post-angioplasty), the patient presented with fistula thrombosis for which thrombolysis and angioplasty were performed using the drug-coated balloon Admiral (Medtronic Inc, Santa Rosa, CA). Again crossing the arterial anastomosis was difficult and had to be carried out in the hybrid operating room. Four months later (20 months after the original procedure), the patient presented with restenosis at the same site. We revised his anastomoses to a more proximal site on the brachial artery: a new arteriovenous anastomosis was performed more proximally on the brachial artery after ligating the vein distal to the Optiflow device and excluding the device. His fistula is still functional at his last follow-up 24 months after his last procedure. |
pmc-6545665-1 | A 60-year-old Hispanic female with multiple comorbid conditions including
hypertension, type 2 diabetes mellitus, chronic kidney disease stage III with a
baseline creatinine of 1.3 mg/dL, baseline chronic obstructive pulmonary disease not
on home oxygen, and HIV on highly active antiretroviral therapy (HAART) therapy for
more than 10 years, compliant with her medications, visited emergency room with
nausea, vomiting, and inability to maintain a good oral intake. She also complained
of progressive fatigue over the past several weeks with no relieving factors. Her
HAART medications included tenofovir/emtricitabine with fosamprenavir. Her initial
workup revealed a serum creatinine of 1.6 mg/dL, phosphorus of 1.4 mg/dL, with rest
of her blood work in normal limits. Fractional urinary phosphorus excretion was
calculated at 40% despite low phosphorus levels indicating renal loss. Oral
phosphate repletion was started; however, tenofovir was continued as per Infectious
Disease recommendations. She was subsequently discharged with oral phosphorus
supplementation and was advised to follow-up with her primary care physician within
1 week. Before she could follow-up with her primary care physician, she was
readmitted with progressive fatigue, loss of appetite, and 1 episode of confusion at
home. Workup revealed very low serum phosphorus levels of 0.7 mg/dL. Intravenous
phosphorus was initiated for repletion, and after consultation with Nephrology and
Infectious Disease specialties, it was decided to stop tenofovir and monitor her
serum phosphorus levels. Before discharge, fractional urinary phosphorus excretion
showed improvement with a drop to 15%. Her symptoms improved and she was discharged
home. shows the
time course of tenofovir-associated hypophosphatemia in this patient. |
pmc-6545669-1 | A 49-year-old man presented in February 2017 with chest wall pain and weight loss, leading to the diagnosis of a ccRCC with metastases to the lungs and a rib (Fig. ). Based on his presentation with anemia, hypercalcemia, and the need for prompt initiation of systemic therapy, his International Metastatic Renal Cell Carcinoma Database Consortium (IMDC) scoring predicted a poor prognosis with a median survival of 7.8 months []. Initial management included a right radical cytoreductive nephrectomy, which required a partial hepatectomy. Pathological analyses showed a 9 cm ccRCC invading into the perirenal and renal sinus adipose tissue as well as the ipsilateral adrenal gland of ISUP grade 4 with extensive sarcomatoid differentiation. Eight out of eight lymph nodes were positive for metastatic disease. Staging was consistent with a pT4N1 tumor. IHC studies showed positivity for CK AE1/AE3, and CA-IX. CK7 was negative. PBRM1 and BAP1 were present suggestive of a wild-type state. PD-L1 was expressed in more than 30% of tumor cells. Given the age of the patient, germline testing was pursued using a CancerNext-Expanded genetic panel including genes such as VHL, BAP1, FLCN and PTEN, but did not reveal any mutations.
Within two hours of surgery, a sample of the patient’s tumor was implanted orthotopically into several NOD/SCID immunocompromised mice to generate a tumorgraft (or patient-derived xenograft, PDX) model (Fig. ). RCC tumorgrafts have shown promise as models in preclinical experimentation preserving the molecular genetics and biology of the corresponding patient tumor []. The patient’s tumor was particularly aggressive and a renal mass could be palpated as early as 18 days post-implantation, which is unusual []. After 83 days, the tumor had reached 1500 mm3 and was passaged to subsequent cohorts. Histological characterization of the tumorgraft revealed preservation of the morphology of the patient’s tumor, with extensive sarcomatoid differentiation and high levels of PD-L1 expression by IHC (Fig. a).
One month from initial staging scans, repeat computed tomography (CT) imaging revealed progression of lung and rib metastases. The patient enrolled in a clinical trial combining stereotactic ablative radiotherapy (SABR) and HD-IL2 []. He received SABR treatments to his left rib (25 Gy, one fraction) and a left lung metastasis (25 Gy, one fraction) followed by two courses of 600,000 international units/kg IV of HD-IL2 q 8 h. He received ten and nine doses of HD-IL2, two weeks apart. Subsequent imaging studies demonstrated improvement in the radiated lung and rib metastases (Fig. a). Otherwise, there was a mixed response with improvement in some non-radiated lung nodules, but also the development of new metastases in the lungs, lymph nodes, and right femur (Fig. b).
In June 2017, the patient was switched to pazopanib (800 mg PO qd). He also underwent a right total knee replacement followed by adjuvant radiation (20 Gy over 5 fractions). Repeat scans after three months demonstrated progression of existing lung and nodal metastases, and three new right shoulder metastases, which were painful (Fig. c).
One week later, the patient began nivolumab monotherapy (240 mg IV q 2 weeks). A few days after the initial infusion, the patient developed grade 2 dermatitis (by Common Terminology Criteria for Adverse Events, CTCAE) [] at the sites of prior rib and knee radiation, possibly related to radiation recall (Fig. d). Inflammation improved over the following month during which nivolumab was withheld. Upon resolution, the patient resumed treatment with nivolumab and received three additional doses without a dermatologic reaction.
Restaging CT scans three months after the initial nivolumab infusion showed a decrease in size of all lung metastases (Fig. e), stable disease at all other sites and no new lesions. The patient continued nivolumab for five additional infusions with interim development of grade 2 hypothyroidism managed with levothyroxine therapy, but then stopped infusions after the development of autoimmune colitis (confirmed by colonoscopy and biopsy; Fig. f).
CT and magnetic resonance (MR) scans at this time, eight months from initial nivolumab infusion, confirmed an iRECIST [] PR with an interval improvement in several sites including the shoulder metastases. Following resolution of the diarrhea, the patient received additional nivolumab but developed grade 3 autoimmune hepatitis requiring intravenous steroids and mycophenolate mofetil, and nivolumab was discontinued.
Seven months after the last infusion of nivolumab and 2 years since diagnosis, the patient remains off immunotherapy without progression and near complete resolution of shoulder metastases (Fig. e).
We radiolabeled atezolizumab, a monoclonal anti-PD-L1 antibody with a mutant Fc, with zirconium-89 [89Zr]. Zirconium-89 is a well-studied positron emitting radioisotope used to label antibodies with a half-life of 78 h, which is compatible with the slower pharmacokinetics of antibodies []. This allows imaging to be performed for several days after injection to improve tumor-to-background signal. Accumulation of the isotope in tumor sites over time and clearance from other sites improves contrast.
Methodologically, the antibody was conjugated to the chelator deferoxamine (DFO) at a molar ratio of 1:1.9 and radiolabeled with 89Zr (5 mCi per mg of DFO-atezolizumab conjugate) using previously published protocols [, ]. Briefly, the DFO-atezolizumab conjugate was incubated with neutralized 89Zr for 1 h, and the reaction was quenched with 50 mM diethylenetriamine pentaacetic acid. The radiolabeled antibody fraction was purified using the Zeba™ centrifugal spin columns (40 K MWCO) and eluted in 0.2 M sodium acetate buffer containing 5 mg/mL gentisic acid (pH 5.5–5.6). The conjugate had a specific radioactivity of 2–4 mCi/mg protein, with high radiochemical purity (≥ 99%). The immunoreactivity of the radiolabeled immunoconjugate was confirmed using an in vitro cell-based Lindmo assay [] and was 86.2 ± 4% (n = 6). In addition, the conjugate was tested for stability in plasma and was found to be quite stable (> 80% of 89Zr activity retained with atezolizumab in rat serum at 37 °C after 7 days).
Mice bearing the patient-derived tumorgrafts were injected intravenously (by tail-vein) with ~ 100 μCi of 89Zr-DFO-atezolizumab. A second tumorgraft line from a tumor expressing low levels of PD-L1 (< 1%) by IHC was chosen as a negative control (Fig. c). PD-L1 IHC procedures and interpretations were standardized (Biocare Medical, Clone ACI3171A,C; 1:300) and results were scored by a pathologist blinded to other results.
Mice were serially imaged on a Siemens Inveon PET/CT system. PET quantification was performed blinded. PET imaging at day 6 post-injection (d.p.i.) showed a statistically significant difference in 89Zr signal between the index patient tumorgrafts (4.2 ± 0.6% injected dose/g [%ID/g]; n = 3) and the controls (3.1 ± 0.5% ID/g; n = 3) (p = 0.028) (see Fig. ). Similar results were observed with a second independent cohort of tumorgrafts (5.2 ± 0.4% ID/g; n = 3) compared to the same control group (p = 0.002).
Differences in tumor uptake could not be accounted for by differences in tumorgraft volumes, which were not significantly different between the index and control groups (831.9 ± 473 mm3 versus 1010.3 ± 492.6 mm3; p = 0.62, respectively). Further, the tumor/muscle contrast in the index tumorgrafts was 4.4 ± 0.4, which is also significantly higher than controls (2.7 ± 0.6) (p < 0.05). (All statistical analyses were performed using GraphPad Prism 7 by un-paired t-tests without correction for multiple comparisons and an alpha value of 0.05.) Following the last PET scan, mice were sacrificed, and tumorgrafts and other vital organs were collected for IHC assays. IHC analyses of the tumorgrafts confirmed expected levels of PD-L1 expression. |
pmc-6545722-1 | Our patient was a 31-year-old Caucasian man with a medical history significant for pineal blastoma at the age of 3 years who had undergone tumor resection, chemotherapy, radiation, and ventriculoperitoneal shunt at that time. He presented to our institution with slurred speech, left-sided weakness, and left facial droop for the last 3 days prior to admission. His neurological examination was significant for lower left facial droop, mild dysarthria, 1/5 left lower and upper extremity strength, and some component of left-sided neglect. The patient was not given tissue plasminogen activator (tPA), because his symptoms presented outside the time window for tPA infusion.
He was found to have acute ischemic infarct of the right basal ganglia based on brain magnetic resonance imaging (MRI) (Fig. ), as well as incidental brain masses consistent with the diagnosis of meningioma (Fig. ). Further workup revealed right M1 occlusion on a brain magnetic resonance angiogram (Fig. ). He was admitted for a full stroke workup that was remarkable for low-density lipoprotein of 117 mg/dl, A1C of 5.9%, uneventful echocardiogram with ejection fraction of 60–65%, no patent foramen oval, and normal atrial size. Noticeably, the patient had a hypercoagulable workup that was unremarkable. He was started on “baby” acetylsalicylic acid (ASA) 81 mg, and his atorvastatin dose was increased from 20 mg prior to admission into 40 mg.
Two days after admission, the patient’s condition worsened with decreased left upper extremity and lower extremity strength. Subsequently, clopidogrel 300 mg was loaded, then the patient started on clopidogrel 75 mg daily in addition to ASA 81 mg. Repeated computed tomography of the head (CTH) and brain MRI were both stable with no worsening infarct or newly developed hemorrhage. During further investigation of the brain ischemic area, a computed tomographic perfusion (CTP) study with acetazolamide (Diamox; Teva Pharmaceuticals, North Wales, PA, USA) demonstrated evidence of baseline oligemia with post-Diamox steal phenomenon involving a large portion of the right MCA territory (type III response) with a small internal region of matched cerebral blood volume (CBV) defect (that is, infarct core). Also, the study showed evidence of pre-Diamox penumbra volume 132.52 ml and pre-Diamox infarct volume 14.97 ml (Fig. ). A conventional cerebral angiogram showed evidence of right M1 occlusion with collateral supply from the right anterior cerebral artery and right posterior cerebral artery (Fig. ). The neurosurgery preferred not to do bypass surgery and preferred to continue medical treatment.
After 5 admission days, the patient was discharged to the acute rehabilitation unit while receiving ASA and clopidogrel for 3 months, then only ASA for the rest of his life, in addition to atorvastatin 40 mg. He was also discharged on 30 days of cardiac event monitoring, which did not show any abnormal rhythm or atrial fibrillation later on. Three months after discharge, the patient was able to lift his left arm and leg antigravity but with spasticity that significantly improved with baclofen and botulinum toxin injection that were prescribed during his rehabilitation stay. Regarding the patient’s brain meningiomas, he was evaluated by the neurosurgery that recommended one year brain MRI follow up. |
pmc-6545747-1 | We report on an 80-year-old Caucasian woman on warfarin for atrial fibrillation who sustained a spontaneous, atraumatic, spinal subdural hematoma in the thoracic region. The patient awoke in the morning to use the bathroom. Approximately 1 hr after returning to her bed, she was unable to move bilateral lower extremities and was incontinent. She reported no back pain, headache, nausea, vomiting, or any constitutional symptoms. She was transferred to an outside hospital and underwent an MRI, which as read by an attending senior radiologist who suggested an epidural hematoma concentrated around the T4-T9 levels (Figures and ). She was reversed for an INR of 3.6 and then transferred to Albany Medical Center for further management. On examination, the patient was comfortable without any pain. She had a loss of bowel and bladder function and had no sensory or motor function below T5. The patient was seen by a fellowship-trained orthopaedic spine surgeon, and her spinal cord injury was classified as a T5 ASIA impairment scale A.
She was taken emergently to the OR approximately 30 hours after the initial onset of symptoms. After a T3-T11 laminectomy, the spinal cord was fully visible, but no epidural hematoma was noted. However, discoloration and bulging of the thecal sac were noted, and the dura was incised longitudinally from T2 to T10 revealing an expansive jelly-like blood clot. The hematoma was evacuated, and the dura closed with a 4′0-NUROLON.
Postoperatively, the patient had regained 1/2 sensory function in the bilateral lower extremities. At the 2-week mark, the patient was still incontinent, showed 2/2 sensory and 2/5 motor functions in select muscle groups in her bilateral lower extremities. The patient's spinal cord injury was classified as an L2 ASIA impairment scale C. An MRI demonstrated a multilevel decompressive thoracolumbar laminectomy (Figures and ), and the patient was discharged to a rehabilitation facility. At the two-month follow-up period, the patient had transitioned to a long-term nursing care facility and her neurological status remained unchanged. |
pmc-6545753-1 | This 22-year-old man of European descent presented with unspecific scrotal discomfort lasting for two weeks. Clinical history is uneventful. The patient is unmarried and has no children so far. He is an untrained workingman by profession. Both testicles were of normal size and nonsuspicious upon palpation with only some tenderness on the left scrotal side. Scrotal sonography revealed a 1 cm sized lobulated hypoechoic lesion at the cranial pole of the left testis () showing intense color duplex signals within the lesion (). Laboratory workup disclosed no abnormal results. Specifically, the germ cell tumor markers alpha fetoprotein, beta-human chorionic gonadotropin, and lactate dehydrogenase were within normal limits, as were the serum testosterone level (6.57 ng/ml; reference limits 2.4–8.7) and the gonadotropins LH (1.69 U/l) and FSH (2.78 U/l). Upon surgical exploration, a well circumscribed greyish-tan lesion of about 1 cm in size was identified at the cranial pole. Inguinal radical orchiectomy with placement of a silicone testicular implant and contralateral testicular biopsy were performed accordingly. The postoperative course was uneventful. Computed tomography of chest and abdomen did not reveal any metastases. No further treatment was applied. The patient is well and without recurrence of the disease one year after surgery.
Pathohistological analysis showed a well demarcated solid neoplasm of 8 mm in size (). Histologically, the lesion consisted of monomorphic cells resembling typical ovarian granulosa cells. Many of the cells had large nuclei with many of them having a grooved shape mirroring the appearance of coffee beans (). The growth pattern was solid in most parts of the neoplasm but in some areas microfollicular structures prevailed resembling Call-Exner bodies (). Mitotic figures were very rare. No necrotic areas were detected. The tumor-surrounding testicular tissue showed normal spermatogenesis. Germ cell neoplasia in situ was detected neither in the ipsilateral parenchyma nor in the contralateral testicular tissue. Immunohistochemical workup revealed positive staining of inhibin, vimentin, and calretinin () and negative staining for Oct 4 and chromogranin A. Staining of progesterone receptor was negative, too. The MIB-1 labeling index revealed a growth fraction of < 1%. The histopathological findings were thus consistent with the diagnosis of a benign adult type granulosa cell tumor of the testis. |
pmc-6545754-1 | A 73-year-old Caucasian woman presented to her primary care physician with a complaint of a painful breast mass. A history of trauma was solicited with the patient reporting that she had been bitten in the breast by a toddler in the weeks preceding her presentation. Per report, no palpable or painful breast abnormality was present prior to the episode of trauma. On physical examination, a well-circumscribed, approximately 2 cm, tender nodule was palpated. The patient was referred to radiology for imaging studies.
Mammography and ultrasonography of the left breast were performed (Figures and ). Imaging studies confirmed a 19 x 13 x 12 mm solid and cystic mass with internal vascularity. This lesion was located 20 mm from the nipple at the 1:00 location. The interpreting radiologist classified the lesion as BI-RADS 4—suspicious abnormality. Surgical consultation was sought, and the patient underwent excision. A 50 x 40 x 25 mm portion of fibrofatty breast tissue was received in pathology. Cross sectioning revealed a well-circumscribed solid nodule measuring 16 mm in greatest dimension. Intraoperative frozen section histologic studies confirmed a mesenchymal neoplasm with specific classification deferred to permanent sections. Histological assessment of paraffin-embedded tissue showed a well-circumscribed mesenchymal lesion () comprised of spindle cells surrounded by a fibrous pseudocapsule with a prominent pericapsular lymphoid cuff focally containing germinal centers (). The lesional spindled cells were present in sheet-like expanses with a syncytial appearance (). Scattered intrinsic lymphocytes and plasma cells were noted (). The lesional cells had open chromatin with predominantly single nucleoli. Moderate cellular pleomorphism was present with random nuclei enlarged to a ratio of 4:1 in comparison to the majority of lesional cells (). Mitoses were present at a rate of 2 to 3 per 10 high-power fields.
A battery of immunohistochemical tests was performed. The lesional cells were found to be strongly immunoreactive for desmin () and focally immunoreactive for p63. The lesional cells were nonreactive for all other markers, including CD34, CK5/6, ALK-1, and STAT6. The sample was then triaged for cytogenomics testing, and break-apart fluorescence in situ hybridization (FISH) studies [Vysis LSI EWSR1 (22q12) Dual-Color Probe, Abbott Molecular, Des Plaines, IL] confirmed an EWSR1 gene rearrangement (). The combined histomorphologic, immunohistochemical, and molecular findings together allowed for a definitive diagnosis of an AFH. |
Subsets and Splits
Exclude ER emergencies
Retrieves 100 descriptions that do not contain the terms 'ER' or 'emergency', providing a basic filter of the dataset.