_id stringlengths 7 16 | description stringlengths 55 95.2k |
|---|---|
pmc-6555747-1 | A 30-year-old woman visited the hospital due to right lower quadrant pain over the period of 1 week. A laparoscopic myomectomy was performed 4 years ago because of a broad ligament leiomyoma, which was about 10 cm in size. Laboratory findings included a routine blood examination, and a C-Reactive Protein (CRP) test, with tumor markers all found to be within normal ranges. The pelvic Magnetic Resonance Imaging (MRI) scan showed some nodules at the posterior margin of the bladder that were considered to be endometriosis, and some pelvic effusion that was significant on the right side. It was also noted that there was a mass shadow at the lower right ureter (medial to the iliopsoas muscle), with distention of the lower right ureter (Fig. ). The patient also underwent computed tomography (CT) scans to enable the practitioners to observe the size of the abdominal mass and its surroundings. The CT images revealed a region occupying the middle right ureter that was considered to be a retroperitoneal aggressive fibroma, which led to severe hydronephrosis on the right kidney and upper ureter, and a right pelvic effusion (Fig. ). After more detailed examinations were conducted, there were no obvious abnormalities detected in the brain, heart, liver, gallbladder, spleen, pancreas or blood. The color Doppler ultrasound demonstrated that there was a hypoechoic mass next to the right iliac vessels that was closely related to the adjacent ureter. This resulted in severe hydronephrosis of the right kidney and a right upper ureteral dilatation (Fig. ). Ndzengue et al. [] reported a case of a pelvic desmoid tumor simulating a uterine leiomyoma recurrence. The patient that presented at our hospital had a history of uterine leiomyoma. We subsequently organized a multidisciplinary consultation to determine the next stage of her treatment plan. According to the patient’s surgical history, the next step would be determined after reviewing the results of the last surgical pathological wax, because the pathological nature of the retroperitoneal mass was uncertain.
Consequently, a laparoscopic pelvic tumor resection with assistance from a Da Vinci robot was successfully conducted. A local peritoneal protuberance was observed in the right iliac vascular area. The parietal peritoneum was incised above the mass and it was carefully freed along the edge of the mass. The size of the tumor was about 6.0 cm × 5.0 cm × 3.0 cm. It had invasively grown and it was wrapped around the right ureter and the right ovarian arteries and veins. It was stuck to the psoas muscle and the iliac vessels. According to preoperative preparations and intraoperative conditions, a decision was made to cut off the right ureter, the right ovarian arteries and veins, and completely remove the tumor and the two masses that were located in front of the broad ligament on the right hand side of the uterus. The sizes of the masses were approximately 1.5 cm × 1.0 cm × 1.0 cm. The right ureter was anastomosed and put into a double J tube. A pathological diagnosis of an intraoperative frozen sample determined that it was a spindle cell soft tissue tumor, and the two masses were leiomyomas. Postoperative pathology tests of the pelvic mass determined that it was aggressive fibromatosis that had invaded the ureteral wall (Fig. ). The uterine surface nodules were also leiomyomas. Microscopically, the tumor cells were arranged sparsely in a spindle shape with blood vessels of different sizes found in the interstitial tissue. Immunohistochemical findings were found to be partially positive for smooth muscle actin (SMA) and desmin, and less than 5% ki-67 of positive cells were seen in the lesion. A detailed re-examination was performed 3 months after the initial surgery, to determine the structure and function of the ovaries. The transvaginal color Doppler ultrasonography was able to determine that the ovaries were normal in size with several follicular echoes. The blood supply to the right ovary was good. There were no obvious abnormalities in the uterus or pelvic cavity (Fig. ). The pelvic MRI and the CT scan of the whole abdomen determined that there were no abnormal lesions in the pelvis. Simultaneously, the endocrine function of the patient’s ovaries was found to be normal, and she was able to self-maturate after removing the double J tube. |
pmc-6555838-1 | A 72-year-old man had been followed up at our hospital, for short bowel syndrome. He had a choledochoduodenostomy for a bile duct stone 38 years prior to this visit and underwent an extensive small intestine excision (residual small intestine, 16 cm) 32 years previously because of strangulation ileus. Therefore, he had required home parenteral nutrition (long-term intravenous hyperalimentation, IVH) for more than 30 years.
He experienced liver dysfunction and presented at our clinical department. He smoked 10 cigarettes/day for 45 years and sometimes drank. His height was 156 cm, he weighed 44.3 kg, and he had a body mass index of 18.3 kg/m2.
Physical examination revealed a scar in the midline incision and no tenderness and a palpable mass in the abdomen.
The laboratory data showed the following elevated values: aspartate aminotransferase (AST) 55 IU/L, alanine aminotransferase (ALT) 57 IU/L, lactate dehydrogenase (LDH) 317 IU/L, γGTP 445 IU/L, and alkaline phosphatase (ALP) 1067 IU/L. Tumor markers were slightly elevated, with CEA of 11 ng/ml and CA19-9 of 37 U/ml. Liver infection and hepatitis B and C tests were negative. The other laboratory data were within normal ranges.
Abdominal ultrasonography revealed a papillary mass of 40 × 30 mm that was slightly brighter than the surrounding liver tissue in the left hepatic duct, and the distal left intrahepatic bile duct was dilated (Fig. ).
Abdominal enhanced CT also revealed a mass of 40 × 30 mm in the left hepatic duct and a lymph node of 12 mm in the hepatic hilar region (Fig. ).
The 18F-fluorodeoxyglucose-PET (FDG-PET) showed abnormal accumulation in the left bile duct (the maximum standardized uptake value [SUV] max = 4.6) and in the hepatic hilar lymph node (SUV max = 12.3) (Fig. ).
Endoscopic retrograde cholangiogram (ERC) showed a filling defect in the left bile duct and dilation of the left intrahepatic bile duct (Fig. ). However, we could not identify mucus discharge with the endoscope. The bile cytology was class IV, and step biopsy from a root of the left intrahepatic bile duct was negative.
We diagnosed cholangiocarcinoma (derived from IPNB) with lymph node metastasis and performed extended left hepatectomy, caudate lobectomy, and lymph node dissection (lymph node; 8a, 8p, 12a) without bile duct resection.
The operative method was as follows: we confirmed that his liver was green, hard, and elastic using long-term IVH and performed lymph node dissection at first and liver resection without the Pringle maneuver because the postoperative adhesions after choledochoduodenostomy were massive. Moreover, we exposed the left bile duct and removed a villous tumor of the bile duct using an anterior wall incision. We separated a root of the left bile duct, sewed up, and closed after we checked during the surgery that the bile duct stump was negative (Fig. ).
The reason for this operative strategy was that the patient did not have enough small intestine necessary for a choledochojejunostomy because of his short bowel syndrome.
Histopathological findings showed papillary adenoma, with well-differentiated nuclear atypia and partially invasive, poorly differentiated adenocarcinoma in the bile duct. There was biliary intraepithelial neoplasia-1 (BilIN-1) around the tumor in the bile duct, and the liver tissue was normal (Fig. ). The hepatic hilar lymph node was positive.
Immunohistochemistry revealed that CK7, CK19, and MUC5AC were positive in the papillary region (Fig. ).
We could confirm the continuous change from adenoma to well-differentiated adenocarcinoma and well-differentiated adenocarcinoma to poorly differentiated adenocarcinoma. Thus, we diagnosed cholangiocarcinoma derived from IPNB.
The patient’s postoperative course was good, and he was discharged on the 15th day after surgery. However, he had para-aortic lymph node recurrence 10 months later and has received chemotherapy with gemcitabine. |
pmc-6555996-1 | In April 2018, a 14-year-old Caucasian boy with acute onset of affective FEP was referred to the Child Neuropsychiatry Unit of the Polyclinic Hospital of Bari. Since the age of 12 he presented with debilitating intestinal symptoms as mucohemorragic diarrhea (discharge frequency, > 10/day), tenesmus, and abdominal pain, resulting in severe disability impairing his general and social well-being. He was diagnosed as having UC on the basis of clinical, laboratory, instrumental, and histologic criteria. In accordance with the “Guidelines for Management of Pediatric Ulcerative Colitis” [], he was treated with conventional therapies (mesalazine, prednisone, metronidazole, azathioprine, and biological agents such as infliximab and adalimumab) with no clinical response. Before elective surgery, a medical treatment with thalidomide was started, as an off-label option for patients with primary refractory IBD, and a clinical response was gradually observed. Two months later, he showed an acute onset of irritable mood, decreased need for sleeping, abnormally increased activity, disorganized behavior and speech, and thought alterations including inflated self-esteem and flight of insight-lacking ideas. These symptoms prompted the discontinuation of thalidomide and a mesalazine-based treatment was restarted. After admission at our Child Neuropsychiatry Unit, he was found to have no history of obstetric complications, neurological or psychiatric diseases, or substance abuse and no psychopathological symptoms prior to this acute episode. His parents reported a normal achievement of early childhood neurodevelopmental milestones and a normal intelligence quotient (IQ) was assessed. General and neurological examination, laboratory tests, and a brain magnetic resonance imaging resulted in normal ranges. An electroencephalogram showed slow waves including isolated spikes in the right temporal and parietal regions. After a mild improvement of symptoms, he developed a grossly disorganized behavior, with conceptual disorganization, auditory and visual hallucinations, delusion and suspiciousness, hostility, social and emotional withdrawal, somatic concerns, anxiety, and tension. Psychopathological assessment was performed by the use of Positive and Negative Syndrome Scale (PANSS). His PANSS total score was 115, while PANSS subscale scores were 29 for positive, 26 for negative, and 60 for general psychopathological symptoms. After proper informed consent, a treatment with antipsychotics and mood stabilizers (risperidone 6 mg/day, levosulpiride 72 mg/day, valproic acid 1000 mg/day) was started, leading to progressive improvement of psychopathological symptoms. During this phase his GI symptomatology remained silent, with 2–3 regular bowel movements/day and no blood or mucus emissions.
After a 6-month follow-up, a psychopharmacological maintenance with risperidone (4 mg/day) and valproic acid (1000 mg/day) ensured a partial remission of symptomatology. His PANSS total score was 71, with subscale scores of 11 for positive symptoms, 21 for negative symptoms and 39 for general psychopathological symptoms. On the other hand, only mesalazine efficiently controlled GI symptoms (2–3 regular bowel movements/day and no abdominal pain, diarrhea or rectal bleeding). Therefore, according to Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5) criteria, a diagnosis of partial remission of a first episode of schizoaffective disorder was formulated. |
pmc-6556029-1 | A 32-year-old Japanese primigravida visited another clinic because of atypical vaginal bleeding, wherein an endometrial mass was detected by transvaginal ultrasonography following which she was referred to our hospital for evaluation and treatment. Her body mass index was 33.8 kg/m2; magnetic resonance imaging (MRI) revealed the presence of a 25 mm mass at the uterine endometrium that was suspected to be endometrial cancer (Fig. a). No metastasis was detected using systemic computed tomography. Serum levels of the tumor markers carcinoembryonic antigen, cancer antigen 125, and carbohydrate antigen 19–9 were 1.2 ng/mL, 11.7 U/mL, and 7.9 U/mL, respectively. An endometrial biopsy suggested endometrioid carcinoma G1, which is categorized as low-grade endometrial carcinoma, and she received medroxyprogesterone acetate (MPA) therapy (600 mg/day) for 6 months. Afterwards, routine examination that included transvaginal ultrasonography, pelvic MRI, and endometrial cytology showed no evidence of the tumor. Six years after MPA therapy, an endometrial mass 24 mm in size was detected using MRI, indicating a recurrence (Fig. b). The patient underwent a total abdominal hysterectomy, bilateral salpingo-oophorectomy, and partial omentectomy. She has had no recurrence since the surgery (5 months).
The uterine body showed a tumor of the size 40 × 23 mm in the left wall with a yellow-whitish cut surface (Fig. c). The tumor was histologically found to be endometrial carcinoma with an unusual epithelial component exhibiting variable patterns such as tubular (30%), glandular (30%), papillary (5%), and solid (30%) structure, mimicking mesonephric carcinoma of the cervix (Fig. a, b). Additionally, the tumor had a heterologous element of cartilaginous cells (5%) with no atypia (Fig. c). The tumor was confined to the uterine body where the infiltration reached the inner half of the myometrium, but with no extension into the cervix, adnexae, and omentum (International Federation of Gynecology and Obstetrics stage IA [pT1a pNX cM0]). No associated mesonephric remnants or lesions were seen. No other neoplasias were present in the ovaries, fallopian tubes, cervix, or omentum. Immunohistochemical analysis of the surgical sample showed that the tumor cells were positive for TTF-1 (focal, strong), GATA-3 (focal, strong), CD10 (focal, strong), p53 (focal, weak), CA125 (focal, strong), CK7 (diffuse, strong), and p16 (focal, strong). Moreover, they were negative for ER, PgR, calretinin, hepatocyte nuclear factor-1-β, napsin A, androgen receptor, and Wilms’ tumor 1 (WT-1) protein (Fig. d–f) (Table ). On molecular testing, KRAS mutation (c.35G > C, p.G12A; Gly12Ala) was detected in this endometrial cancer.
The initial endometrial biopsy showed the following: the tumor was found to have a coexistence of usual and unusual carcinomas in which the former was a low-grade endometrial carcinoma, i.e., endometrioid carcinoma G1 (70%), and the latter was composed of the same components as the surgical sample (30%) (Fig. a). On immunohistochemical analysis of the initial biopsy (Table ), the endometrioid carcinoma component was diffuse positive for ER and PgR, but negative for TTF-1 and GATA-3 (Fig. b, c). The unusual epithelial components showed a transitioning pattern with a mixture of ER- and TTF-1-positive cells within the same glands, representing Müllerian and Wolffian duct markers, respectively (Fig. d–f). On molecular testing, same KRAS mutation (c.35G > C, p.G12A; Gly12Ala) was detected in the initial biopsy.
Based on these findings, a coexistence of endometrioid carcinoma G1 and MLA in the uterine body was diagnosed at the biopsy. After MPA therapy, tumor composed of only the component of MLA was found as recurrence. |
pmc-6556038-1 | A 60-year old man presented to our clinic with abdominal pain and vomiting soon after dinner. Three years prior to this event, he underwent radical thoracoscopic esophagectomy followed by reconstruction of the gastric conduit through the posterior sternum, for esophageal cancer. Past medical history was not significant for any medical condition, such as diabetes, or medication that might cause autonomic disorders.
On admission, his vital signs were normal, and a routine blood test did not indicate any abnormalities. Physical examination with direct palpation revealed right upper abdominal pain without rebound tenderness. Enhanced computed tomography (CT) scans showed distension of only the gastric conduit without ischemia and without distension of the small intestine (Fig. ). Based on these findings, we initially diagnosed the patient with postoperative upper intestinal obstruction caused by adhesions.
At that time, conservative treatment with nasogastric tube drainage and intravenous fluid supplementation was initiated. The patient’s symptoms gradually subsided and oral feeding was initiated 3 days after the conservative treatment. However, immediately after oral feeding, vomiting recurred. An endoscopic study was then performed for further examination, and a bezoar obstruction at the pylorus ring (Fig. ) was observed.
We initially failed to remove the bezoar endoscopically because of its large size; hence, we attempted enzymatic dissolution. Three days after the first endoscopic study, the bezoar was disintegrated using a snare and extracted during a second endoscopy (Fig. ). The second endoscopic study revealed an ulcer at the same location as the bezoar (Fig. ); hence, we administered a proton pump inhibitor. The patient recovered uneventfully and presented with no complications during the 1-year follow-up interval. |
pmc-6556223-1 | A 3-year-old Middle Eastern boy presented with a defect in the midline of his neck. He was born at full term by normal vaginal delivery and had no significance in his past medical history. There was no family history of congenital defects or consanguinity. The anomaly was located in the ventral midline of his neck (Fig. ). The superior aspect was composed of a skin tag leading to a short mucosa-like raw surface. Inferiorly, there was a sinus present with a greenish, thick residue occluding the opening. There was no contracture of the neck. He did not appear to be troubled by the lesion and a full examination was otherwise normal, except for adenoidal hypertrophy.
He had an MRI done elsewhere, indicating a soft tissue mass without any fistula tract. Despite contrast material being injected through the opening at the caudal end of the lesion, the diagnosis of MCC was established. No evidence of any other neck anomaly was found (Fig. ). The sinus, less than 1 cm in length, was found to extend caudally to the suprasternal notch. There were no attachments to underlying structures.
A surgical removal and immediate closure with multiple Z-plasties were performed. Surgical removal was done with an incision 1–2 mm from the periphery of the lesion, deepened down to the supraplatysmal plane (Fig. ). During the surgery, the sinus at the caudal end of the lesion was probed and followed caudally until it ended, which was found to be approximately 2 cm long. This underdeveloped fistula tract ended right above the thymus gland. The cranial end of the defect had a fibrous band extending up to the mandible and this band was resected together with the cervical lesion. The midline lesion was found to be superficial and hence the excision was done at the subdermal level. A double Z-plasty was found to be sufficient for the closure. Closure was done with 5–0 vicryl interrupted sutures at the subcutaneous level and 6–0 rapid vicryl interrupted sutures for skin closure (Fig. ).
A pathological examination of the specimen confirmed our clinical diagnosis. The findings were consistent with stratified squamous epithelial cells covering the cleft with few adnexial structures at the dermal level (Fig. ).
One month follow-up examination revealed an uneventful healing period, with redness along the incision scar and some nodularities, which were most probably due to the subcutaneous suture material. He was able to move his head in all directions without any restriction or pain (Fig. ).
A 14-month follow-up examination showed an acceptable level of scarring causing no restriction of neck movements (Figs. and ). |
pmc-6556236-1 | A 36-year-old woman (G4,P2), at the 15th gestational week of twin-pregnancy following IVF-embryo transfer, was found to have a solid adrenal mass on a regular checkup. MRI revealed a 11×7.5 cm right suprarenal hypervascular mass with mixed signal intensity in T2-weighted images (). The diagnosis of PC was confirmed by laboratory analysis (). The patient had no genetic testing and her family history was not indicative of any hereditary disease. She had two previous vaginal deliveries (14 and 11 years ago) and a history of one abortus at 10-week gestation two years earlier. The patient confirmed that she had no symptoms relating to PC in her previous deliveries. She had no genetic testing and her family history was not indicative of hereditary disease. She was asymptomatic and normotensive and had no hemodynamic instability during pregnancy. She was asymptomatic and normotensive and had no hemodynamic instability during pregnancy. Perinatological ultrasonography revealed normal morphology of dichorionic and diamniotic male and female fetuses.
A multidisciplinary team consisting of urologists, anesthesiologists, endocrinologist, and obstetricians focused on the therapeutic approach. The patient did not receive any medical treatment for alpha or beta blockade preoperatively. She underwent laparotomy with a subcostal incision and transperitoneal tumor resection at 17 weeks of gestation (). During surgery blood pressure (BP) was stabilized with phentolamine and esmolol, with occasional bouts of brief hypertensive periods up to 240 mm Hg systolic pressure. A hypervascular mass with fragile large veins was dissected free of the upper pole of the right kidney, between the vena cava and the lower border of the liver. The estimated blood loss was 1100 ml. The patient was transfused with 3 units of erythrocyte suspensions. The postoperative period was uneventful and she remained hemodynamically stable. Histopathological examinations were in accordance with a PC.
She had a normal subsequent course of pregnancy and cesarean section delivery of healthy twins at term. Nine months after delivery, follow-up ultrasonography revealed no recurrent mass. Urinary and plasma catecholamine levels were in normal range. |
pmc-6556238-1 | A 67-year-old man presented to our clinic with acute-onset spastic quadriparesis. During the previous 2 years, he had been under follow-up at 3-month intervals in our clinic following decompressive laminectomy for lumbar spinal canal stenosis and fusion surgery for ossification of the ligamentum flavum of the thoracic spine. In April 2016, he suddenly noticed quadriparesis. He could not stand or walk, but did not present to our clinic until his scheduled follow-up visit 2 weeks later. Manual muscle testing (MMT) confirmed right-dominant quadriparesis (). Patellar and Achilles tendon reflexes were hypoactive, suggesting likely spinal canal stenosis and ossification of the ligamentum flavum. He had a spastic, broad-based steppage gait and needed a walker for ambulation.
Emergent magnetic resonance imaging (MRI) revealed an epidural mass in the right ligamentum flavum at the C4-C5 level (Figures –). The mass was isointense in T1WI and low to isointensity in T2WI. Computed tomography (CT) scanning confirmed that there was no ossification in the mass (Figures and ). Given the acute and rapidly deteriorating clinical presentation, we thought this case was intraligamentous hematoma in the ligamentum flavum in the cervical spine. However, cervical MRI scan that had been acquired 2 years earlier to investigate neck pain (Figures and ) revealed that the tumor was present at that time but was smaller and not compressing the spinal cord. Therefore, the differential diagnosis was soft tissue tumor as well as hematoma. We performed emergency decompression surgery with removal of the epidural lesion. We removed the mass en bloc along with the right C4 and C5 lamina (). The mass was 10 mm × 10 mm in size, and there was an appearance of cartilaginous tissue rather than a hematoma (Figures and ). Decompression of the dura mater was confirmed intraoperatively after the removal of the mass. Hematoxylin-eosin staining showed cartilaginous tissue, there were no atypical cells, and the final diagnosis was chondromatous lesion (). The mass presented 2 years before, and we made a diagnosis of intraligamentous chondroma of the cervical spine. Postoperatively, the quadriparesis and MMT results improved, and he was able to resume walking. At the one-year follow-up, the patient's MMT results were almost normal and he could walk independently with a cane. No recurrence was observed on follow-up MRI (). |
pmc-6556243-1 | A 54-year-old male with a history of influenza infection complicated by severe acute respiratory distress syndrome (ARDS) requiring veno-venous extracorporeal membrane oxygenation (ECMO) support for 64 days was discharged to a long-term acute care facility from our hospital. Unfortunately, seventeen days after discharge, the patient deteriorated and was readmitted with complaints of abdominal pain and nonbloody vomiting. The patient's condition rapidly progressed to septic shock requiring vasopressor support. Right upper quadrant ultrasound, computed tomography (CT) scan, and magnetic resonance cholangiography were negative for cholangitis, cholecystitis, or other acute intra-abdominal surgical pathologies. Because of worsening hemodynamic status, the patient was taken to the operating room. Initially, diagnostic laparoscopy was performed, but due to difficulties with the insufflation, it was converted into laparotomy. The gallbladder was found to be necrotic and perforated. The patient underwent subtotal cholecystectomy because of the inability to remove the gallbladder infundibulum because of its strong adherence to the duodenum. The pathology report came back as chronic cholecystitis.
Approximately three weeks after surgery, the patient started to have worsening abdominal pain, intolerance to enteral nutrition, and recurrent signs of sepsis. The patient was started on systemic antibiotics and antifungal therapy. Repeat CT scan of the abdomen and pelvis with intravenous contrast showed extensive peritoneal thickening and enhancement in the right perihepatic region and simple appearing left-sided ascitic fluid (see ). Paracentesis of the left-sided fluid collection demonstrated an elevated WBC but no organisms. The patient underwent an imaging-guided percutaneous pigtail catheter placement into the perihepatic fluid collection. The fluid culture was positive for Enterococcus faecalis, Candida tropicalis, and Klebsiella oxytoca. Infectious disease consultation was obtained. The pigtail drain output was minimal (approximately 10–15 milliliters for every 24 hours), and the patient's tachycardia and marked leukocytosis persisted. Bedside ultrasound was performed which showed proper pigtail drain location within the fluid (see ) and complex appearing intra-abdominal fluid with septation (see Figures and ). After consultation with surgical team, the decision was made to instill rtPA via the pigtail catheter into the infected fluid. The patient received 4 mg of rtPA once a day for three days in total. The output over several days increased, and approximately 1 liter of fluid was drained. The patient tolerated the intra-abdominal rtPA well with no hemodynamic, hematological, or short-term intra-abdominal complications. Subsequently, the pigtail catheter was removed due to the resolution of the fluid collection. The patient made a gradual but full recovery and did not require subsequent laparotomy or drainage. |
pmc-6556244-1 | An 83-year-old female presented to the emergency department with two weeks of vague abdominal pain. Her past medical history was significant for open splenectomy for spontaneous rupture three years prior to presentation and subsequent ventral hernia repair with mesh. She denied history of pancreatitis, diabetes mellitus, nor family history of gastrointestinal disease or malignancy. She was found to have a UTI and leukocytosis of 20,000, with LFTs and lipase within normal limits. Initial CT demonstrated abdominal fluid collections around the stomach and pancreatic tail, extending to segment two of the liver (Figures –). She was subsequently admitted and treated with IV piperacillin-tazobactam for her UTI. On hospital day (HD) 2, she underwent IR-guided drain placement for percutaneous drainage of the abdominal fluid collection—aspirate gram stain revealed only scant WBCs and culture grew no organisms. The aspirate contained elevated amylase (>15,000 IU/L), suggesting pancreatic leak. Repeat CT revealed continued abdominal fluid collections requiring drain repositioning—ultimately three drains were placed to achieve adequate drainage. She was discharged and subsequently returned to the emergency room 23 days after initial presentation with nausea, abdominal discomfort, and persistent leukocytosis. Repeat CT revealed air and an enlarging fluid collection around one of her abdominal drains, which required IR-guided drain replacement. She was then started empirically on IV piperacillin-tazobactam. Analysis of the abdominal fluid cultures grew gram-negative rods. Repeat evaluation of her initial CT demonstrated potential pancreatic duct dilation in the mid pancreas (), and an EUS was performed to evaluate for abnormalities that may have precipitated the initial pancreatic leak. EUS revealed an ill-defined 17 mm × 10 mm mass in the body of the pancreas—an EUS-guided shark core aspiration of the mass was positive for adenocarcinoma (). Serum CA19-9 was 11.1 U/mL and serum CEA was 5.5 ng/mL. She subsequently underwent an open distal pancreatectomy with pathology demonstrating a stage pT3N1 17 mm invasive moderately differentiated ductal adenocarcinoma of the pancreatic body, in addition to pancreatic intraepithelial neoplasia. Pathology was positive for perineural invasion and lymphatic invasion, with negative proximal pancreatic and retroperitoneal margins. Immunohistochemistry revealed negative ALK and PDL-1 expression and preserved MLH1, MSH2, MSH6, and PMS2 expression. Her postoperative course was uncomplicated, and she was discharged on POD 20 to a skilled nursing facility. |
pmc-6556245-1 | A 41-year-old woman was admitted to our ED with a facial dog bite that occurred 4 days before. Her dog was sitting in her lap when, without an obvious reason, he bit her in the face. Because of the initial mild complaints without visible bleeding, the patient did not seek medical attention at the time.
Only three days later, she began to feel affected and developed fever as well as a rash with marbled skin on her whole back, her extremities, and her face (). The medical history included a chronic alcoholism with long-term abstinence and obesity. She was admitted to the next general hospital where she showed signs of systemic inflammatory response syndrome (SIRS) with tachypnea (30/min), fever (39°C), tachycardia (140/min), thrombopenia, and leucocytopenia as well as hypoglycemia (50 mg/dl). There was no evidence of chest or abdominal infection. Because of progressive hemodynamic instability under treatment with norepinephrine, she was transferred to our university hospital. Endotracheal intubation and mechanical ventilation were initiated shortly after admission, and the initial antibiotic treatment with ciprofloxacin and amoxicillin/clavulanic acid was escalated to fosfomycin, clindamycin, and meropenem. After initial fluid resuscitation, the hemodynamic therapy was continued with norepinephrine and goal-directed infusion therapy. Multiorgan failure included the circulatory system, renal and hepatic insufficiency, and disseminated intravascular coagulation () with clear signs of purpura fulminans and necrosis to both feet (). Despite high doses of antibiotics and optimal sepsis treatment, there was no sign of stabilization within the following days. Due to progressive acute renal failure in septic shock, hemodialysis (CVVHDF) was necessary for 10 days and had to be continued intermittently. Twelve days after the beginning of treatment, there was 16S-RNA verification via PCR for C. canimorsus. Despite all efforts to cultivate this germ before beginning antibiotic treatment in multiple blood cultures, the detection could not be achieved. In the following weeks, the patient developed secondary infection with PAS-positive yeast and Enterococcus faecium. A CT showed cerebral and hepatic septic lesions, whereas no endocarditis was seen in repeated transesophageal echocardiograms. Additionally, a surgical tracheostomy was performed. Because of relevant bleeding signs and a positive DIC score, recurrent transfusions (RBC, 3 WBC, and FFP) were necessary. Constant surgical treatment including several necrosectomies of facial wounds was vital.
Finally, the patient sustained massive hemodynamic instability and suffered cardiac arrest. No resuscitative efforts were undertaken due to the alleged patient's will in accordance with the patient's relatives. The patient died because of massive septic shock. |
pmc-6556246-1 | The patient was a 64-year-old woman with systemic lupus erythematosus, thrombophlebitis of the lower legs, cerebral infarction with left hemiparesis, and colostomy after perforation of the sigmoid colon. She was treated with prednisolone, tacrolimus, mizoribine, edoxaban, limaprost, famotidine, sulfamethoxazole-trimethoprim, sertraline, eszopiclone, and minodronic. On the morning of her presentation, the patient felt epigastric abnormality. Thereafter, hematemesis occurred twice, leading her to call an ambulance in the afternoon. Upon arrival, her vital signs were as follows: Glasgow Coma Scale, E4V5M6; blood pressure, 110/76 mmHg; pulse rate, 78 beats per minute; and her peripheral oxygen saturation on 6 liters of oxygen per minute, 98%. A physiological examination revealed preexisting bilateral leg edema with pigmentation and left hemiparesis. Electrocardiography before securing venous route and blood examination revealed ST segment elevation in leads II, III, and aVF (). Chest roentgenography showed cardiomegaly and cardiac ultrasound showed hypokinesis at the inferior wall. The results of a biochemical blood analysis on arrival were as follows: white blood cell count, 11,500/μL; hemoglobin, 9.6 g/dL; platelet count, 16.8 ×104/μL; total protein, 6.1 g/dL; total bilirubin, 0.5 mg/dL; aspartate aminotransferase, 86 IU/L; alanine aminotransferase, 8 IU/L; blood urea nitrogen, 13.7 mg/dL; creatinine, 0.49 mg/dL; sodium, 143mEq/L; potassium, 3.6mEq/L; chloride, 106mEq/L; creatine phosphokinase, 1000 IU/L; troponin T, 13250 (26.2 >) pg/mL; prothrombin time, 12.7 (11.7) s; activated partial thromboplastin time, 30.1 (30.2) s; fibrinogen, 326 mg/dL; and D-dimmer, 0.79μg/mL. She was diagnosed with acute myocardial infarction with upper esophagogastroduodenal bleeding. As her vital signs were stable and her level of hemoglobin decreased by just 1.1 g/dl in comparison to the previous day when she had visited the dermatology department of Numazu City Hospital, she underwent emergency coronary angiography (CAG). CAG demonstrated 99% stenosis at section #2, complete occlusion at section #4 (), and 75% stenosis at section #6. She underwent right coronary angioplasty with stent placement. The prescriptions of edoxaban and sertraline were stopped, famotidine was switched to lansoprazole, and treatment with aspirin, clopidogrel, rosuvastatin, and carvedilol was initiated. After angioplasty, her course was uneventful. Her creatinine kinase level peaked at 5655 IU/L on the 2nd hospital day, and her minimum level of hemoglobin was 8.3 g/dl on the 7th hospital day without transfusion. On the 15th hospital day, esophagogastroduodenoscopy revealed esophageal erosion and superficial gastritis (). She was discharged on foot the following day. |
pmc-6556248-1 | A 57-year-old asymptomatic man with no significant past medical history was found to have an enlarged cardiac silhouette on a routine chest radiograph (). Magnetic resonance imaging (MRI) revealed a 9 cm pericardial cyst in the right cardiophrenic angle that was associated with right atrial compression (Figures , , and ). Although the pericardial cyst wall showed contrast uptake, no uptake within the cyst was observed on first-pass or delayed images. There was no compression of the airway or superior vena cava (SVC) and the pericardial cyst had not eroded into the heart. The patient was not at high risk for hydatid cysts and he did not have any history of fever, suggesting that an infectious cause for his pericardial cyst is unlikely. He did not have any history of chest trauma or intrathoracic surgery. The absence of hypertension, hematuria, and a positive family history made a diagnosis of autosomal dominant polycystic kidney disease (ADPKD) unlikely. The patient was scheduled for resection of the pericardial cyst using VATS. Preoperative electrocardiographic findings, complete blood count results, serum creatinine levels, liver function tests, and serum electrolyte levels were normal.
On the day of surgery, the physical exam, including heart and lung auscultation, was unremarkable and the vital signs were within normal limits (blood pressure of 119/75 mmHg, heart rate of 83 beats per minute, respiratory rate of 14 per minute, blood oxygen saturation of 97% on room air, and temperature of 36.9°C). A left radial arterial line and two large-bore intravenous catheters were placed. The patient was adequately hydrated with intravenous administration of normal saline. He was transferred to the operating room and placed in the supine position on the operating table. The standard American Society of Anesthesiologists monitors were placed on the patient. The pericardial cyst did not compress the patient's right bronchus or the SVC, and therefore, he was able to tolerate the supine position with no shortness of breath or hemodynamic instability. The patient was preoxygenated and general anesthesia was induced by slow intravenous administration of etomidate 0.2 mg/kg and fentanyl 1 μg/kg. Neuromuscular blockade was achieved by intravenous administration of succinylcholine 1.5 mg/kg. Ephedrine 0.1 mg/kg was administered following induction to minimize the hemodynamic effects of the induction agents and positive pressure ventilation. A 37-French left-sided double-lumen endobronchial tube (DLT) was placed. The patient was placed in the left lateral decubitus position. Anesthesia was maintained with oxygen (fraction of inspired oxygen of 0.6), air, and sevoflurane (1 minimum alveolar concentration). The right lung was collapsed and neuromuscular blockade was induced with rocuronium 0.6 mg/kg. A 1-cm incision was made in the posterior axillary line at the fifth intercostal space. A metal port was placed and a 10-mm, 30° thoracoscope was placed through the incision. A 2-cm incision was made above the fifth intercostal space at the mid axillary line to access the cyst. The pericardial cyst was found to be firm, and had some calcifications on the surface (Figures , , and ). The cyst was easily separated from the pericardial fat. However, it was attached to the anterior chest wall. Following separation of the cyst from the anterior chest wall some bleeding occurred from the distal right internal mammary artery. The bleeding was controlled with Enseal and clips. The cyst was large, and hence, access to the superior aspect of the cyst was difficult. Therefore, an 18-gauge needle was used to aspirate the cyst fluid. Approximately 300 ml of brown, murky, nonodorous fluid was aspirated from the cyst before it was completely resected (). The patient remained hemodynamically stable throughout the procedure and the DLT was removed in the operating room at the end of the procedure. Postoperative pain was managed with an intercostal nerve block using 10 ml of 0.5% bupivacaine and patient controlled analgesia pump using hydromorphone (intravenously, 0.2 mg every 10 minutes). The patient's postoperative course was uneventful, and he was discharged on postoperative day 1 in a stable condition. Cyst fluid cultures were negative. |
pmc-6556251-1 | A 25-year-old male patient was referred to our Department in Bassum, Lower Saxony, Germany, to receive apicoectomy on the maxillary left second molar. Together with the referral, the radiographic history of the relevant tooth was provided (Figures –). The patient, whose medical history was noncontributory, complained of persistent pain reactions and tenderness of this tooth after a first endodontic treatment six months ago. Clinical examination showed a sufficient composite restoration, a painful tenderness to percussion, and no reaction to cold test. Tooth mobility and periodontal pockets were inconspicuous. No submucosal swelling was observed. The pretreatment radiograph showed an apical radiolucency on the mesial root and three radiopaque root fillings (two distal and one mesial), which led to the diagnosis of a chronic apical periodontitis. This straight radiographic evaluation of the examined tooth revealed no unusual anatomy (). But the X-ray image after the first endodontic treatment was taken mesial angulated, and here, a second previously untreated mesial root is visible (). Therefore, instead of the proposed apicoectomy, the decision was made to re-treat the root canals.
After the injection of 1 ml local anesthesia containing 40 mg articaine hydrochloride and 0.005 mg epinephrine (Septanest, Septodont, Saint-Maur-des-Fossés, France) and isolation with a rubber dam, the occlusal filling was removed. During the access preparation, the second (mesial), untreated palatal root canal orifices were found. Due to issues in the time management in the first treatment session, only the previously untreated root canal was explored with a manual instrument ISO 15, irrigated with 2.5% NaOCl, and corticosteroid- and tetracycline-containing paste (Ledermix®, RIEMSER Pharma, Greifswald, Germany) was applied with a lentulo spiral filler (ISO 25, Dentsply DeTrey, Konstanz, Germany). The access cavity was filled with Cavit (ESPE, Seefeld, Germany). Two weeks later, the patient described a symptom-free and painless period since the last treatment. During the second session, the gutta-percha in the coronal third of the root canals was removed with a diamond-coated ultrasonic tip (Komet Dental, Lemgo, Germany) and eucalyptus oil (Apotheke Gesundheitszentrum, Bassum, Germany) was applied for ten minutes. Afterwards, the gutta-percha was removed from the three filled canals (mesiobuccal, distobuccal, and distopalatal), and the canals were cleaned as well as shaped with a reciprocating instrument (R25, Reciproc®, VDW, Munich, Germany). The files were cleaned from the gutta-percha debris every three reciprocating units (“pecks”) according to the manufacturer's protocol. After the working length was reached (19 mm each canal (apex to the corresponding tooth cusps)), which was determined using an electronic apex locator (VDW.GOLD® RECIPROC®, VDW, Munich, Germany), the residual obturation material was removed ultrasonically (REDO setting, VDW.ULTRA®, VDW, Munich, Germany). The previously untreated canal (mesiopalatal) was also cleaned and shaped with a reciprocating instrument (R25, Reciproc®, VDW, Munich, Germany). Then, the root canals and especially the apical region were enlarged (R40, Reciproc®, VDW, Munich, Germany). During the instrumentation process, the canals were irrigated with 2.5% NaOCl, 2% CHX, and 18% EDTA and the liquids were activated ultrasonically (IRRI setting, VDW.ULTRA®, VDW, Munich, Germany). Afterwards, the disinfection was carried out with Ca(OH)2 (Calcicur®, VOCO, Cuxhaven, Germany), and the coronal seal was performed with Cavit (3M ESPE, Seefeld, Germany). Two weeks later, the canals were reentered and Ca(OH)2 was removed by using 2.5% NaOCl, 2% CHX, and 18% EDTA and obturated with appropriate gutta-percha mastercones (ISO 40, VDW, Munich, Germany) along with an AH plus sealer (Dentsply DeTrey, Konstanz, Germany) using the lateral condensation technique (). The permanent restoration was carried out using Tetric EvoCeram (Ivoclar Vivadent, Schaan, Liechtenstein). The postendodontic radiograph demonstrated two mesial-located apices (). To verify this rare anatomy, a 3D cone beam computed tomography (CBCT) (KaVo OP 3D DVT, KaVo Dental, Biberach an der Riβ, Germany) was performed and analyzed (). The patient gave his informed consent for the publication of this communication. |
pmc-6556252-1 | A 24-year-old female patient presented to the Department of Oral and Maxillofacial Surgery at Homerton University Hospital in East London, UK, with a 4-week history of suspicious upper lip swelling. This patient was referred by her general practitioner on the urgent head and neck cancer referral pathway.
The patient's primary concern was the sudden onset of a large upper lip swelling with associated pain. The patient was not forthcoming and defensive when questioned regarding precipitating factors or possible trauma to the region. She was medically fit and healthy with no risk factors for oral cancer, such as smoking and alcohol consumption [].
On extraoral examination, the patient appeared to be well with no clinical signs of systemic illness. In general, the upper lip was disproportionately enlarged with an incompetent lip seal (). On close examination, a 2 cm × 1 cm firm, erythematous, swelling was noted in the upper right lip. The lesion was not encroaching on the midline and there was no associated cranial nerve deficit or lymphadenopathy. At the vermillion border, there was a puncture wound on a background of traumatised tissue adjacent to the firm swelling (). The lesion was painful on palpation with no suppuration, induration, or ulceration noted. Intraoral examination revealed a concurrent firm swelling within the labial sulcus. Dental health was unremarkable, and there were no signs of systemic infection.
Upon revision of the patient's electronic health-care record, it was noted that the patient had attended the Accident and Emergency Department at the Homerton University Hospital four weeks prior. The clinical clerking from this visit showed the main complaint to be swelling of the upper lip following self-injection of a dermal filler, purchased over the internet. When questioned again directly by the OMFS team regarding the true mode of injury, the patient revealed that she had purchased the filler material over the internet. The patient was uncertain of the name of the website or the filler material. She was unaware if the material was nonpermanent (temporary), semipermanent, or permanent []. |
pmc-6556259-1 | A 14-year-old boy was referred to a previous hospital with intermittent fever and joint pain. Laboratory findings revealed inflammatory change (C-reactive protein [CRP], 12.91mg/dL; ferritin, 246 ng/mL; soluble IL-2 receptor [sIL2R], 1389U/mL), normal white blood cell (WBC) count, 6880/μL, with 2% lymphoblasts, moderate thrombocytopenia (platelet [PLT] was 6.4 x 104/μL), normal transaminase levels, high lactate dehydrogenase (LDH), 1315U/L, and slightly abnormal blood coagulation test. Bone marrow aspiration showed that 56.2% of nucleated cells were lymphoblasts with immature nuclei, high N/C ratio, and positive staining for PAS. Flow cytometry revealed positivities for CD19, CD20, CD22, c-CD79, CD38, CD99 and HLA-DR, and a weak positivity for CD10. Although gene rearrangement, which frequently occurs in ALL, was not detected, low-hypodiploid with 36 or 37 chromosomes was detected in a chromosome test. Based on these findings, the diagnosis of B-lymphoblastic lymphoma (BLL) with hypodiploid was made. The patient was judged to have high-risk ALL and was scheduled to receive multidrug chemotherapy followed by high-dose chemotherapy with allo-HSCT.
Multidrug chemotherapy according to the JPLSG ALL-B12 protocol, which is BFM-based, consisting of steroid, Vincristine, anthracyclines, and L-asparagenase [], was administered to the patient. After induction chemotherapy, he attained a complete clinical remission on day 33 after initiation. During intensification courses, minimal residual disease-polymeric chain reaction (MRD-PCR) targeting immunoglobulin heavy chain (IgH) in bone marrow was not detected. The patient was transferred to our hospital and underwent allogeneic bone marrow transplantation (BMT) with a conditioning regimen including 12 Gy total body irradiation, etoposide, and cyclophosphamide. A donor mismatched for two HLA antigens, -C and -DR, was selected due to a small number of candidates. Tacrolimus and short-term methotrexate (MTX), 15mg/m2 on day 1 and 10mg/m2 on days 3, 6, and 11, were administered as basic GVHD prophylaxes. The clinical course summary after HSCT is shown in . Seven days after transplantation, engraft syndrome induced high-grade fever and progressive systemic erythema (Stage 3). G-CSF, 5μg/kg/day of Lenograstim was administered from day 5 but was stopped on day 17 to prevent immune reaction overload. Erythema and fever showed no improvement, and CRP rose to 20.2mg/dL at peak value. Therefore, 1.33mg/kg/day (80mg) of methylprednisolone was added to tacrolimus and administered to the patient from day 7, improving the immune reactive symptoms. However, watery diarrhea appeared and gradually increased up to 5000~6000ml/day. Engraftment of neutrophil cells (neutrophil count ≧ 500/μL for 3 days) was observed 14 days after transplant. Cytomegalovirus (CMV) DNA in blood was consistently negative. A methylprednisolone pulse from day 18 to 20 was followed by the administration of 2mg/kg of mPSL and MMF with dietary restrictions on day 21, but the watery diarrhea did not improve. Severe hypoalbuminemia (1.6~2.0 g/dL) progressed due to intestinal tract leaking, and replacement of FFP and albumin on consecutive days was unavoidable in order to maintain blood circulation. Severe hypocalcemia was observed, and an intensive supplement of calcium preparation was also required. Colonoscopy showed edematous surface and scattered erosion from ascending colon to rectum, colonoscopic biopsy revealed desquamated epithelium, interstitial edema, disordered structure of ducts, and submucosal fibrosis. Apoptosis with nuclear dust was observed occasionally in epithelium as a feature of gastrointestinal GVHD. There were no cells with inclusion body formation (). After acute gastrointestinal GVHD was confirmed, MSC therapy at a dose of 2×106 hMSCs/kg twice per week was added to daily methyl prednisolone treatment on day 28. To avoid steroid-related side effects, mPSL was gradually tapered: 80mg from day 26 to 29, 60mg from day 30 to 33, 40mg from day 34 to 37, and 20mg from day 38. At the fifth dose of hMSC, the volume of diarrhea decreased to around 1500ml/day, and eventually to 200ml/day, with stool form at the eighth dose. An additional 4 doses were administered weekly following the twice-per-week induction dose, and MSC therapy was finished after a total of 12 doses. Albumin and calcium concentrations were easily maintained without replacement. Dietary restrictions were gradually removed, and methyl prednisolone was successfully tapered without relapse of intestinal symptoms. At day 60, the mPSL dose was increased to 40mg per day due to fever caused by GVHD. The fever had a good response to steroids and was transient, allowing for a smooth tapering of mPSL to 5mg of oral prednisolone. A chromosome test of bone marrow (BM) cells on day 88 revealed the complete replacement of the BM cells by female type (donor type, 46,XX). At 130 days after transplant, the patient was discharged. Although the patient requires a low dose of steroid for the treatment of appetite loss and gastrointestinal discomfort, he is in stable condition and has been without disease relapse at one year after transplant. |
pmc-6556260-1 | A 47-year-old previously healthy female presented with generalised body swelling, disproportionate ascites, loss of appetite, and loss of weight for four months' duration. She denied any fever, night sweats, yellowish discolouration of the eyes, hematemesis, melena, chronic cough, and haemoptysis. She reported no history of orthopnoea and paroxysmal nocturnal dyspnoea, and her urine output remained normal.
Her past medical history was not significant for any liver, renal, or cardiac disease. She denied any past or contact history of TB. She reported no use of alcohol or herbal medications and no intravenous drug abuse. She was in a monogamous relationship and she denied any family history of liver or renal disease.
She was afebrile on admission and her vitals included a pulse rate within normal limits. On exam, she was emaciated with a body mass index of 18, and she had significant ascites with mild ankle oedema. She was anicteric and did not have any lymphadenopathy, hepatosplenomegaly, or the peripheral stigmata of chronic liver disease. Respiratory system and cardiovascular examinations were within normal limits. On eye exam, there was no evidence of choroid tubercles.
The initial laboratory findings are summarised in .
The anaemia workup, including serum iron studies, vitamin B12, and folate testing, was normal. A blood picture revealed normochromic normocytic anaemia and thrombocytosis, suggestive of anaemia of chronic disease. Thyroid function tests were normal. She did not have any proteinuria, and her international normalised ratio (INR) was normal. Repeated blood cultures, urine culture, and sputum culture were sterile, and a human immunodeficiency virus (HIV) fourth-generation test was negative. CA 125 was mildly elevated to 175 U/ml (<46 U/ml).
The initial chest x-ray (CXR) was normal, and her transthoracic two-dimensional echocardiography showed normal systolic and diastolic functions and no evidence of constrictive pericarditis. A transvaginal ultrasound (US) did not reveal any ovarian pathology. Meanwhile, an abdomen US revealed a mildly hyperechoic liver with moderate ascites. Contrast Enhanced Computed Tomography (CECT) of the abdomen and pelvis revealed a normal-sized liver with evidence of heterogenicity of the liver parenchyma with minimal nodularity of the liver surface and moderate ascites with no portal vein thrombosis or lymphadenopathy. The spleen, gallbladder, biliary tract, and intestines were normal, as were the ovaries. The findings were in favour of possible decompensated chronic liver disease (CLD). However, the CLD workup did not reveal any potential aetiology (). Upper gastrointestinal endoscopy (UGIE) was normal and did not show any evidence of portal gastropathy or varices.
The initial diagnosis of possible cryptogenic CLD was made, and the patient was started on spironolactone and furosemide. Even though the diagnostic paracentesis was planned on admission, it was delayed due to the patient's refusal, but we were to do initiate after a few days. The analysis of the ascitic fluid revealed an exudative picture. There was no evidence of spontaneous bacterial peritonitis, and the ascitic fluid cytology was negative for malignant cells.
With elevated inflammatory markers and an exudative type of ascites, we decided to proceed with further investigations to rule out possible peritoneal TB. The ascitic fluid acid-fast bacilli (AFB) test was negative. The ascitic fluid bacterial, TB culture, and TB Gene Xpert were negative. The tuberculin sensitivity test (Mantoux) was positive at 17 mm without ulceration. Her repeated sputum for AFB, TB culture, and GeneXpert were negative.
Because the clinical picture did not fit the imaging findings, we decided to proceed with diagnostic laparoscopy and peritoneal biopsy. The laparoscopy was in favour of miliary TB () and the peritoneal biopsy revealed granulomatous inflammation with caseous necrosis favouring TB. She was started on anti-TB treatment (ATT), and on initial follow-up, she showed improvement in her clinical, biochemical, and radiological parameters. Her fever settled with ATT, and her ESR was 15 mm/1st hour and CRP was 12 mg/l at 3 weeks after the initiation of ATT. |
pmc-6556265-1 | The patient was a 74-year-old woman who had undergone colectomy for adenocarcinoma of the sigmoid colon at the age of 72 years. Before the colectomy, she had been found to have a tumor measuring approximately 25 mm in the left lobe of the thyroid that was diagnosed as an adenomatous goiter by fine-needle aspiration. Two years after her surgery, a 6-month follow-up computed tomography (CT) scan revealed enlargement of the thyroid tumor, but she remained asymptomatic. Blood tests revealed a small increase in CA 19-9 (from 3.5 ng/ml 6 months earlier to 8.9 ng/ml) and in carcinoembryonic antigen (CEA) (from 1.7 ng/ml to 4.6 ng/ml). Her thyroid function tests were normal. Physical examination and laryngoscopy revealed a firm elastic nodule in the thyroid gland and left vocal fold paralyzed in the midline position. The maximum phonation time (MPT) was 10 seconds. There was no cervical lymphadenopathy. Ultrasonographic examination of the neck revealed a solid tumor in the left thyroid lobe with a diameter of 35 × 25 × 20 mm. CT showed spread of this mass to the tracheoesophageal groove, suggesting invasion of the left recurrent laryngeal nerve (RLN; ). Fine-needle aspiration cytology of the thyroid tumor showed a few clusters of elongated tumor cells with hyperchromatic dark nuclei on a background of benign hepatocytes, and the mass was reported as metastatic adenocarcinoma. Positron emission tomography-CT showed focal uptake in the left thyroid lobe with no evidence of distant metastasis (). Therefore, the diagnosis was metastasis of adenocarcinoma to the left thyroid gland. We then performed a hemithyroidectomy with resection of the left RLN and immediate reconstruction using the ansa cervicalis nerve (). The tumor was observed to be adherent to the adjacent structures, i.e., the trachea and external muscle of the esophagus as well as the left RLN. The surgical margin was confirmed to be adequate, and the decision was made not to resect the right thyroid lobe. There were no postoperative complications, and the patient was discharged home 5 days after surgery. Hematoxylin and eosin staining of the tumor showed a normal thyroid goiter and adenocarcinoma similar to that in the sigmoid cancer specimen (Figures and ). The adenocarcinoma was occupying almost the entire left lobe of the thyroid. Immunohistochemistry showed that the adenocarcinoma was positive for CDX2 and negative for thyroglobulin or TTF-1 (thyroid transcription factor 1) (Figures –), which confirmed a colorectal origin. The diagnosis was solitary metastasis of sigmoid cancer to the thyroid gland. CEA and CA19-9 levels returned to normal within 2 months postoperatively. Adjuvant chemotherapy with uracil-tegafur/leucovorin was initiated, and 24 months after surgery the patient remains alive without recurrence. She got a breathy voice with MPT of 6 seconds immediately after surgery, but her vocal fold tone has recovered to MPT of 10 seconds. |
pmc-6556266-1 | A 37-year-old woman, G1P1, was referred to our hospital due to an increase in size of a tumor in her vulva. The mass was first pointed out to her during her delivery one year earlier. The patient had no apparent symptoms. Magnetic resonance imaging (MRI) of the pelvis showed a well-circumscribed mass in the vulva (). The patient underwent resection of the tumor, and the tumor was subjected to histological examination. There was no apparent evidence of recurrence one year after the resection.
Grossly, the tumor mass was located in the subcutis and measured 73×29 mm. There was no fibrous capsule, but the tumor was well circumscribed. The cut surface showed a yellowish-white mass with gelatinous change. No hemorrhage or necrosis was observed.
On histopathological examination (), the boundary between tumor and adjacent tissue was clear. Tumor cells were short and spindle-shaped without prominent atypia, arranged in no overt architecture. No necrosis or mitoses were identified. The stroma was edematous and myxoid; fine collagen as well as dense collagen was detected in some regions. The vast majority of blood vessels were small-sized with thin walls. Some medium-sized blood vessels were also identified within the lesion (). There was no specific distribution pattern of the vascularity. Immunohistochemical studies were performed using the primary antibodies listed in . On immunohistochemical analysis, most tumor cells showed positivity for vimentin, ER, PgR, and desmin. Some tumor cells showed positive for alpha-SMA and CD34. The tumor cells were uniformly negative for S100 protein (). The Ki-67 labeling index was less than 2%. |
pmc-6556268-1 | Our case is a 49-year-old Hispanic female who presented to our hospital with multiple episodes of chest pain. The onset of her pain was 5 days prior to admission. She complained of left sided pain “5 out of 10” intensity described as chest tightness. The pain was nonradiating and not precipitated by activity, inspiration, or position. The patient stated that she would have almost 5 episodes of pain daily with each episode lasting 2-5 minutes in length. This was not associated with any diaphoresis, shortness of breath, vomiting, or abdominal pain. The frequency and intensity of her pain episodes increased which led her to come to the emergency department. Her past medical history is significant for hypertension and difficult-to-control asthma requiring frequent hospital admissions. In the past she was on medication for “high cholesterol” but stopped taking it years ago as she was never told she had very high cholesterol levels. She denied any history of abnormal lipid profile, myocardial infarction or angina, congestive heart failure, or diabetes mellitus. Her medications included inhaled fluticasone and vilanterol combination, albuterol inhalation as needed, losartan, meloxicam, montelukast, verapamil, omalizumab, and intermittent short courses of prednisone for asthma exacerbations. She denied any alcohol consumption or illicit drug use. She admitted to smoking about a quarter pack a day for 15-20 years and quit 13 years ago. Family history was significant for hypertension in her mother, and a sister with stroke at the age of 44. There was no family history of dyslipidemia.
On physical examination she was found to have temperature of 97.8 degrees F, heart rate of 92 bpm, respiratory rate of 19/min with oxygen saturation of 96% on room air, and blood pressure of 152/98 mmHg. Her body mass index (BMI) was 27.7 on admission. Cardiovascular examination revealed chest wall tenderness to palpation on the upper left side. On auscultation there were no significant murmurs. Slight wheezing was audible in bilateral lung fields on auscultation. Examination of the skin did not reveal any xanthomas or xanthelasmas. Ophthalmologic examination did not reveal corneal arcus or lipemia retinalis. The examination of the nervous system and the head and neck was within normal limits.
Relevant laboratory results on admission were as follows. Initial blood draw when centrifuged on gross examination was heavily lipemic (see ). Subsequent lipid panel studies were ordered which were significant for serum triglyceride (TG) of >10,000 mg/dL, serum cholesterol of 1,029 mg/dL, direct measure low density lipoprotein (LDL) of 33 mg/dL, and high-density lipoprotein (HDL) of 22 mg/dl. Other pertinent lab values included WBC count 7900/cumm, Hb of 11.6 g/dL, serum lipase of 160 units/dL, which was 46 units/dL when repeated and consistently remained within normal limits during hospitalization, serum sodium 130 mmol/L, serum magnesium of 5.2 mg/dL, and blood glucose of 111 mg/dL (random). Serum TSH was 2.39 mcIU/mL and HbA1c was of 5.3%. Initial troponin was of <0.03 ng/mL. Bicarbonate on admission was 22 mmol/L. EKG showed normal sinus rhythm with no ST-T wave changes. Chest X-ray was normal.
The patient was started on conservative management. She was kept nothing by mouth except medications for one day and started on IV regular insulin drip at a rate of 4 units/hr with IV fluids containing 5% dextrose to prevent hypoglycemia along with heparin 5000 units subcutaneously every 8 hours. Heparin drip was not initiated because PTT could not be accurately measured secondary to lipemia. She was also started on gemfibrozil, atorvastatin, and niacin at the time of admission. All of her home medications were stopped. A cardiac diet with no fats and no carbohydrates was initiated by day 2. Cardiology was consulted. Echocardiogram was done which was normal with an EF of 72%.
The patient's old medical record was reviewed to obtain previous lipid panel test results. Her lipid panel from 2016 revealed a serum triglyceride of 212 mg/dL and serum cholesterol of 182 mg/dL.
Lipid panel was repeated daily over the course of 9 days with significant decrease in patient's triglyceride and cholesterol levels. On day 9, serum triglyceride levels came down to 825 mg/dL and serum cholesterol was noted to be 360 mg/dL (see ). Her diet was slowly advanced to a low fat and low carbohydrate diet which she tolerated well.
The patient also underwent treadmill myoview stress SPECT study once the serum triglyceride levels were < 2000 mg/dL in view of chest pain, which was normal. The patient's chest pain and serum triglyceride levels improved. She did not require any other interventions besides insulin drip and subcutaneous heparin. She was discharged on day 9 in medically stable condition and was closely monitored as outpatient. She was discharged on Rosuvastatin, Fenofibrate, and prescription omega-3 fatty acids. Repeat lipid panel was done in one month after discharge and the serum triglyceride levels were found to be 142 mg/dL and serum cholesterol of 117 mg/dL. Apolipoprotein B level was measured at 186 mg/dL. The patient was instructed for further genetic testing after discharge but did not follow up after this. |
pmc-6556272-1 | We report the case of a 64-year-old man with previous history of multiple left sided childhood ear infections requiring multiple grommets. He also had a history of mixed hearing loss since 2015, which had been managed conservatively.
On 21st February 2017, whilst on holiday, the patient suffered right sided otitis media (OM). The OM was complicated by pneumococcal sepsis, requiring ICU admission for observation and treatment. The patient was eventually discharged on a course of oral antibiotics. A computerised tomography (CT) scan of his head carried out during his admission was reported as normal. He was left with reduced hearing in the right ear due to right sided otitis media with effusion that resolved spontaneously on follow-up 6 months later.
The patient became unwell again while on holiday on 20th April 2018. He presented to his local emergency department with confusion, photophobia, and agitation on the background of a 2-day history of right sided otalgia.
The CT head scan showed signs of right temporal lobe encephalitis and right middle ear opacification.
The patient underwent surgical management of the OM, with myringotomy, washout, and right sided grommet insertion on 20/04/2018. He was then treated with intravenous ceftriaxone and rifampicin but had to undergo sedation due to the severity of agitation.
He eventually settled on antibiotics and was discharged home from ICU for ENT follow-up at his local hospital. |
pmc-6556281-1 | A female patient, 34 years old at the time of the first visit, was referred to us to correct her gingival esthetic problem caused by the formation of gingival/mucosal overgrowths. Gingival outgrowths localized in the second, third, and fourth quadrants, corresponding to the position of premolars and canine roots, were identified during an oral examination. Their consistency appeared hard and unmovable, and they presented a normal gingival color. The lesions were asymptomatic, and the morphology did not change over time ().
The anamnestic investigation revealed a history of FGG surgery in 2004 (8 years before our first examination) in each site that was treated for gingival recessions; allergic reactions to nonsteroidal anti-inflammatory drugs, paracetamol, cephalosporin, penicillin and its derivatives, and macrolide antibiotics; absence of any systemic conditions affecting metabolism; and altered wound healing (cutaneous keloids and hypertrophic scars).
The hypothesis of exostosis formation was suggested by the following clinical observations: benign aspect, nodular and hyperplastic tissue, hard and stable on palpation, not symptomatic, and localized in canine and premolar areas involved in a surgical procedure that could have acted as a promoter event.
We decided to perform an excisional surgery, followed by a histologic and molecular evaluation. The Review Board of the Research Center in Oral Implantology of the Università degli Studi di Milano in Milan, Italy, approved the treatment and research protocol before the first surgery.
All procedures were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. The patient was informed about the formulated medical hypothesis and the need for surgical intervention to remove the lesions and analyze the specimen. The patient agreed to the surgery and signed a written informed consent form. The surgery was planned after a complete evaluation of the patient's systemic conditions that confirmed an absence of clinical contraindications.
All surgeries were performed in three different sessions by the same operator, with more than ten years of experience in the field of oral surgery (LF), and following the same protocol. The first surgical event involved a lesion localized in the second quadrant. Local anesthesia was performed with articaine 4% + epinephrine 1 : 100.000, voiding injection in the lesion area. The lesion was first isolated by incisions with a microblade following its external border; after that, the incision was continued above the periosteum, removing the tissue covering the exostosis. Then, with a 15C blade, a full-thickness incision was performed coronally to the lesion and the exostosis surface was exposed using a periosteal elevator. The full-thickness incision was extended in the mesiodistal direction in order to have a better view of the surgical site. Gingival fragments obtained from the overgrown gingiva were collected for histological and molecular characterization. A carbide bur, mounted on a rotary instrument and under sterile saline solution irrigation, was used to remove the bone structure in order to recreate a plane surface. To obtain a primary closure of the flap after the removal of the lesion, a partial thickness incision was performed in the free alveolar mucosa. The flap was then sutured with a 6/0 nonresorbable suture (ETHILON™ Nylon Suture, Ethicon ®, Cincinnati, OH, United States). After flap closure, an infiltration of 4 mg corticosteroid (BENTELAN 4 mg/2 mL, Defiante Farmaceutica S.A., Madeira, Portugal) was performed, to prevent the recurrence of overgrowths in the short term. The last surgical procedure was performed within 4 months of the first visit.
The follow-up visits revealed small relapses after 18 months from the surgical intervention that were asymptomatic and did not affect aesthetics and function. The recurrences observed in the second and fourth quadrants were linearly arranged along the incision of the periosteum that occurred during the surgery, while the lesion treated in the third quadrant showed a more evident relapse.
One gingival fragment was processed for histological analysis while another fragment was cultured for in vitro evaluations. Moreover, to characterize the pathological gingiva, a fragment from the healthy papilla was obtained from the same patient for comparison.
Immediately after surgery, each tissue fragment was fixed in 4% formalin in 0.1 M phosphate-buffered saline (PBS), pH 7.4, routinely dehydrated and paraffin-embedded. Serial sections of 5 μm were obtained. Sections were stained with freshly made hematoxylin-eosin (Sigma-Aldrich, St Louis, MO, United States) to evaluate cell and tissue morphology.
To evaluate fibrillary collagen, slides were deparaffinized and immersed for 30 minutes in saturated aqueous picric acid containing 0.1% Sirius Red F3BA (Sigma-Aldrich, St. Louis, MO, United States), a staining method that specifically marks collagen []. The sections were observed under a light and polarized microscope (Nikon Eclipse E600, Nikon, Tokyo, Japan) and photographed with a calibrated digital camera (DXM1200, Nikon, Tokyo, Japan) at a 20x magnification.
Human gingival fibroblasts were obtained from a gingival fragment covering the exostosis and from a gingival fragment obtained from the patient's healthy gingiva. Tissue fragments were washed with sterile PBS, plated in T25 flasks, and incubated in DMEM containing 10% heat-inactivated fetal bovine serum (FBS) and antibiotics (100 U/mL penicillin, 0.1 mg/mL streptomycin) at 37°C in a humidified atmosphere with 5% CO2. Fibroblasts that grew out from the explant were trypsinized (0.025% trypsin-0.01% EDTA) for secondary cultures and plated in T75 flasks, as previously described [, ]. Human gingival fibroblasts were used between the fourth and fifth passages. Molecular evaluations were performed in samples cultured for 24, 48, and 72 h. All evaluations were performed on duplicate cultures for each sample.
Cell morphology of cultured gingival fibroblasts was analyzed by phase-contrast microscopy using a Leica DM IL microscope. Cell viability was determined by Trypan blue exclusion. Growth curves were obtained after plating cells in 6-well plates (150,000 cells/well). After the attachment, the cells were counted after 24, 48, and 72 h.
Total RNA was isolated from cultured fibroblasts as previously described []. Briefly, 1 μg of total RNA was reverse-transcribed in a 20 μL final volume of reaction mix (Bio-Rad, Segrate, Milan, Italy). Gene expression for the tissue inhibitor of matrix metalloproteinase 1 (TIMP-1), lysyl oxidase (LOX), and focal adhesion kinase (FAK) was assessed. GAPDH was used as internal control for normalization of the differences in the amount of total RNA in each sample. The following primers were used: GAPDH: sense CCCTTCATTGACCTCAACTACATG, antisense TGGGATTTCCATTGATGACAAGC, antisense GGAACCAGGATGACCAGATGTACC; TIMP-1: sense GGCTTCTGGCATCCTGTTGTTG, antisense AAGGTGGTCTGGTTGACTTCTGG; LOX: sense GGATACGGCACTGGCTACTT, antisense GACGCCTGGATGTAGTAGGG; and FAK: sense GTCTGCCTTCGCTTCACG, antisense GAATTTGTAACTGGAAGATGCAAG.
Amplification was performed in a 96-well plate in a final volume of 20 μL per well containing 10 μL of 1x SYBR Green Supermix (Bio-Rad, Italy), 2 μL of template, and 300 pmol of each primer, and each sample was analyzed in triplicate in an iQ5 thermal cycler (Bio-Rad, Italy) after 40 cycles. After determining the cycle threshold (Ct), gene expression levels relative to that of GAPDH were calculated by the 2ΔCt method.
Slot blot analysis was used to assess type I collagen (COL-I), type III collagen (COL-III), and matrix metalloproteinase-1 (MMP-1) protein levels secreted by gingival fibroblasts in cell culture supernatants, as previously described []. Briefly, protein content in cell culture media was determined by a colorimetric assay (DC Protein Assay, Bio-Rad, Italy); 100 μg of total proteins per sample (final volume of 200 μL of Tris-buffered saline (TBS)) was spotted onto a nitrocellulose membrane using a Bio-Dot SF apparatus (Bio-Rad, Italy). After blocking for 1 h with 5% skimmed milk in TBST (TBS containing 0.05% Tween-20), pH 8, membranes were incubated for 1 h at room temperature in a monoclonal antibody to COL-I (1:1000 in TBST) (Sigma, Italy), to COL-III (1:2000 in TBST) (Sigma, Italy) and to MMP-1 (1 μg/ml in TBST, Millipore). After washing with TBST, membranes were incubated in HRP-conjugated rabbit anti-mouse serum for 1 h (1 : 6000 in TBST to detect COL-I and COL-III or 1 : 40,000 in TBST to detect MMP-1, respectively) (Sigma, Italy). Immunoreactive bands were revealed by the Opti-4CN substrate or Amplified Opti-4CN substrate (Bio-Rad, Italy) and quantified by densitometric scanning (UVBand, Eppendorf, Italy).
Serum-free cell culture media were mixed 3 : 1 with sample buffer (containing 10% SDS), as previously described [, ]. Five μg of total protein per sample was run under nonreducing conditions without heat denaturation on 10% polyacrylamide gel (SDS-PAGE) copolymerized with 1 mg/mL of type I gelatin at 4°C. After SDS-PAGE, the gels were washed twice in a renaturing buffer (2.5% Triton X-100, Tris-HCl 50 mM) for 30 min each and incubated overnight in a substrate buffer at 37°C (Tris-HCl 50 mM, CaCl2 5 mM, NaN3 0.02%, pH 7.5). After staining the gels with Coomassie Brilliant Blue R-250, MMP gelatinolytic activity was detected as clear bands on a blue background. Bands were quantified by densitometric scanning (UVBand, Eppendorf, Italy).
Data, expressed by mean ± standard deviation (SD), were analyzed by t-test. p values less than 0.05 were considered significant. |
pmc-6556283-1 | Our hospital admitted a 54-year-old woman complaining of strong, right-sided, hypogastric pain two hours after muscle training. The pain was exacerbated by breathing and moving. She was not taking anticoagulants and did not have any known blood dyscrasia. Her vital signs were pulse rate 80 beats/minute and rhythmic, blood pressure 115/85 mmHg, respiratory rate 18 breaths/minute, body temperature 37.8°C, and arterial oxygen saturation 97%. The patient had no symptoms of fever, nausea, chills, vomiting, or diarrhea. Physical examination revealed muscle defense and a tender, palpable 10 cm mass in the abdomen. Bruising around the umbilicus and flank was noted. Bowel sounds were normoactive. Testing revealed a white blood cell count of 11200 /mm3 (3500-9500 /mm3), hemoglobin 13.4 g/dL (12.1-15.1 g/dL), hematocrit 38% (37-46 %), and platelet count 365 x 103 cells /mm3 (150-450 x 103 cells /mm3). Her serum electrolyte, renal function, and urinalysis test results were not notable.
Abdominal computed tomography (CT) was performed to determine the reasons for acute abdomen, along with acute appendicitis. Enhanced abdominal CT revealed a right rectus sheath hematoma with extravasated contrasting agent (). The hematoma extended downward into the lower abdominal wall and pelvis. Axial and sagittal CT images showed the rectus sheath hematoma with several 6 x 4 x 18 cm areas of active extravasation. Since her vital signs were stable, we started her on conservative therapy and discharged her four days after admission. |
pmc-6556287-1 | A 55-year-old male with past medical history of congestive heart failure with ejection fraction of 30%, chronic kidney disease, atrial fibrillation, and alcohol abuse, presented with sudden onset of severe abdominal pain. Admission vitals were stable with the significant except oxygen saturation of 70% on room air. Labs on admission were significant for lactic acid of 5.3 mmol/L (), Acute Kidney Injury (AKI), and subtherapeutic INR of 1.5 on Coumadin. Urine toxicology screen was positive for cocaine use. CT scan of the abdomen was initially unremarkable. The patient was subsequently admitted to the ICU for severe acute hypoxic respiratory failure with potential for decompensation and clinical suspicion of mesenteric ischemia given his subtherapeutic INR in the setting of atrial fibrillation along with sudden onset of abdominal pain and elevated lactic acid without a clear cause. Cocaine abuse may have also been a contributing factor to sudden ischemia. A later repeat CT scan revealed nonspecific bowel wall thickening, and a transesophageal echocardiogram performed revealed an active left atrial thrombus, making mesenteric ischemia a higher differential. Due to the added possibility of sepsis and worsening renal function, there was no clear opportunity for surgical intervention, and conservative management was initiated through heparin drip and BiPAP showing initial clinical improvement. By hospital day 3, however, he suddenly became unresponsive. At that time, his labs revealed blood sugar of less than 10 mg/dl and worsening renal failure. The patient was aggressively managed and given multiple ampules of Dextrose 50% and infusion of Dextrose 5% was started (). Because of further decompensation of renal function, he was started on Continuous Renal Replacement Therapy (CRRT) as well. Despite these measures, his blood sugar continued to have multiple episodes reaching 40 mg/dl. His IV fluids were switched to Dextrose 10% drip and eventually to Dextrose 20% drip because of persistent episodes of hypoglycemia, also requiring intermittent IV Glucagon. The patient had no family or personal history of DM and HbA1c tested during hospitalization was 5.6%. Further testing including cortisol, pro-insulin, insulin, and C-peptide levels was within normal limits. A sulfonylurea screen was also negative. Liver function tests were within normal limits with exception of development of supratherapeutic INR of 4.4 despite not being on Coumadin, suggestive of underlying liver disease. Endoscopic Ultrasound did not reveal any pancreatic mass. The patient was subsequently transferred to a tertiary care center for further investigative work-up and management of persistent hypoglycemia. During this time, the patient had developed abdominal ascites. Paracentesis and analysis of the ascitic fluid was suggestive of underlying hepatic cirrhosis. Given the patient's history of severe alcohol abuse, it was more likely that the underlying hepatic illness was alcoholic liver cirrhosis. To confirm this, a biopsy was offered but the patient refused. It was determined that the patient's persistent hypoglycemia was likely secondary to critical illness along with and underlying background of severe hepatic and renal failure. The patient's overall prognosis was poor and his condition declined rapidly despite adequate advanced care and paracentesis. He refused any further intervention and opted for hospice care. An autopsy was not performed. |
pmc-6556296-1 | A 28-year-old female with a history of morbid obesity (BMI 50), type 2 diabetes, and a recent unrelated left knee injury and ankle sprain that was managed nonoperatively presented after being struck by an automobile traveling approximately 25 mph and an initial loss of consciousness. The initial vital signs were HR 116, BP 103/85, RR 24, and O2 saturation 100% on room air. The initial chest X-ray (CXR) was within normal limits. The patient was noted to have bilateral nasal bone fractures and a right L2 transverse process fracture which were managed nonoperatively. Other injuries included fractures of the left clavicle, left fibular neck, and left ankle; she was scheduled for open reduction and internal fixation (ORIF) of the left clavicle and left ankle, under regional anesthesia (with interscalene/superficial cervical plexus and popliteal blocks), and general anesthesia to secure her airway due to her BMI and trauma history (risk of aspiration). Induction (with midazolam, fentanyl, propofol, succinylcholine, esmolol, and sevoflurane) and intubation were uneventful.
Prior to prepping and during manipulation of her knees, the patient had sudden-onset hypoxia and hypotension, and her vital signs were HR 145 from 105, BP 86/46 from 149/131, and O2 sat 71% from 100% on ventilator FiO2 96%, and her EtCO2 decreased to 12 from 39. The patient was manually ventilated and noted to have good tidal volumes, reasonable compliance, and clear, bilateral breath sounds. Assistance was requested to assist with temporizing and diagnosing the underlying condition. Albuterol was given, and a fiberoptic bronchoscope demonstrated clear airways with endotracheal tube above the carina. A pneumothorax was ruled out with CXR given the recent interscalene block and history of trauma. The vital signs did not improve. 200 mcg epinephrine was administered, arterial and central lines were placed, and an intraoperative TEE was performed emergently. Her vital signs immediately improved: HR 121, BP 141/85, O2 sat 100% on ventilator FiO2 96%, EtCO2 27.
TEE showed dilated right ventricle (RV), severe RV dysfunction that spared the RV apex (McConnell's sign), a large patent foramen ovale (PFO) with right-to-left shunting, and a large PE with subtotal occlusion of the right pulmonary artery (PA); the left ventricle (LV) was normal. The PE Response Team, Cardiothoracic surgery (CS), Interventional Radiology (IR), and CSICU were consulted. The surgery was aborted, and the patient was transferred to the CSICU intubated. She was stabilized and then transferred to the IR suite for catheter-directed injection of tissue plasminogen activator and thrombectomy. A large occlusive embolus was found in the main right lower lobe PA, and the procedure improved PA pressures (54/24 to 48/20) and flow into the subsegmental branches of the right lower lung. No inotropic support was needed. The patient was left intubated and transferred back to CSICU on a heparin infusion. Her hospital course was complicated by thrombocytopenia and she was started on argatroban infusion due to concern for heparin induced thrombocytopenia. An inferior vena cava filter was placed, and several days later, the patient was transferred to the floor and underwent the ORIFs without any complications. Duplex ultrasound did not reveal any residual deep vein thrombosis (DVT). Transcranial Doppler ultrasound during hospital course revealed shunting, high intensity transient signals, and possible emboli. Plans were made for percutaneous closure of the PFO a week later. |
pmc-6556304-1 | A 50-year-old Caucasian female with a history of difficult-to-control asthma since 1994 and chronic rhinitis presented to the hospital with severe jaw and ear pain in late February of 2009. She had been suffering from intermittent pain for a few months and underwent bilateral myringotomy tube placement about a month prior for recurrent otitis media with some benefit. The pain was distributed over the rami of the mandible bilaterally with radiation to her ears. She denied any fever, night sweats, weight loss, purulent nasal discharge, odynophagia, dysphagia, or shortness of breath. No significant history of travel or sick contact including contact to TB patients. The patient was a past smoker with 15 pack year history of smoking.
Vital signs on admission showed a BP of 101/63 mm·Hg, pulse of 105 beats/minute, temperature of 97.9 F, respiratory rate of 18 breaths/min, and SPO2 of 96% on room air. Physical examination revealed a patient in moderate distress. Bilateral tenderness was elicited while palpating the mandibular rami. The myringotomy tubes were intact without and significant drainage. The nasal mucosa appeared normal without any evidence of erythema, epistaxis, or discharge. The rest of the physical examination was unremarkable. The laboratory data are shown in .
Urinalysis showed trace proteinuria and no RBC cast. Electrocardiogram and a chest X-ray were normal. She underwent a CT scan of her neck with contrast which was unremarkable except left maxillary sinus thickening. However, the apical part of the lungs showed multiple nodules bilaterally. A dedicated high-resolution CT scan of the chest revealed multiple bilateral nodules, 5–11 mm in diameter. The largest nodule was noted in the lingula that measured 11 × 9 mm. There was also evidence of pericarditis and small pericardial effusion. Given her long standing history of uncontrolled asthma, upper airway symptoms, eosinophilia, and multiple pulmonary nodules, a clinical diagnosis of EGPA was made and the patient underwent an extensive rheumatologic workup which is shown in .
The patient underwent an open lung biopsy of the lingular nodule as well as a pericardial biopsy. The histopathology was consistent with necrotizing granulomatous vasculitis with extravascular eosinophilic infiltrate. The histopathology slides are shown in Figures and . The diagnosis of EGPA was confirmed.
The patient was started on high-dose prednisone and azathioprine in March 2009. She initially did well, but in August 2009 the patient was admitted to the hospital with pulmonary edema secondary to heart failure with reduced ejection fraction (HFrEF). The echocardiogram showed an EF of 25–30% with biventricular dilatation and global hypokinesis. No wall motion abnormality was identified. Cardiac catheterization was negative for coronary artery disease. No endomyocardial biopsy was performed. Given the high incidence of cardiac involvement in EGPA and a negative coronary angiogram, the myocardial dysfunction was thought to be secondary to EGPA and she was started on IV cyclophosphamide. Over the course of next 6 months, the patient completed 6 cycles of IV cyclophosphamide and started on mycophenolate. Steroid taper was continued. Her EF recovered completely, but she suffered from multiple vertebral body compression fractures and developed cushingoid appearance secondary to chronic steroid therapy. Between September 2009 and July 2011, she suffered from 2 episodes of sinusitis which was treated with short course of antibiotic. Her disease remained well controlled with normal inflammatory markers.
During an office visit in July 2011, the patient was noted to have depressed nasal ridge (). Physical examination showed nasal mucosal erythema. The patient underwent reconstruction of her nasal bridge in July 2013. Since 2011, the patient has been managed with mycophenolate without any incidence of exacerbation and is doing well currently. |
pmc-6556310-1 | L.O., a 58-year-old female married white patient, with previous history of subtotal hysterectomy in 2012 due to endometriosis, was diagnosed in 2016 with invasive endocervical adenocarcinoma, being treated with colpectomy and brachytherapy. During follow-up, progression of the disease was detected, with metastases in the liver, the peritoneum, and the vaginal dome. In 2017, she was submitted to the excision of the peritoneal implants, the hepatic lesion, the omentum, the vaginal dome, the tuba, and the left ovary. Pathological analysis confirmed metastatic lesions in the vaginal dome and peritoneum, without neoplasia in the other resected tissues. She was submitted to adjuvant chemotherapy with carboplatin and paclitaxel weekly and bevacizumab every 21 days. About 2 weeks after the last surgery she complained of moderate amount of continuous urinary loss through the vagina and the use of 3 to 4 PADs per day. Despite the continuous loss, she continued to urinate through the urethra. Urinary urgency episodes were also reported, with no response to oxybutynin and mirabegron. Recurrent urinary tract infection was not present. A complete evaluation was performed with specular examination, urethrocystography, and contrasted computed tomography, with no lesions identified. Cystoscopy was then performed and revealed a 3mm diameter infratrigonal fistulous lesion, right under the left meatus ().
Patient underwent robot-assisted repair of the vesicovaginal fistula, with transperitoneal access. First, the patient was positioned in lithotomy and a cystoscopy was performed, identifying the fistulous orifice right under the left ureteral meatus. An ureteral catheter was placed thought the urethra in the left ureter. The position was then changed to a steep Trendelemburg and 5 ports were inserted: one 12mm optic port (3cm above the umbilicus and 1cm left of the middle line), three 8mm robotic ports (at the umbilicus level, symmetrically placed 2 ports on left and right pararectal line, and one more port placed up from the iliac crest on the left side), and one 5mm assistant port (placed up from the iliac crest of the right side). After the ports were placed, the robot was docked and the laparoscopy initiated. Right at the beginning of the laparoscopy, a lot of adherences were visualized, needing a careful adhesiolysis of the bowel from the surrounding structures. With the bladder well dissected, a transversal cystotomy was performed, to expose the vesical side of the fistula (Figures and ). The fistula was dissected with a good margin of healthy tissue until vaginal side (). The synthesis was initiated with a barbed 3-0 continuous suture (V-Loc™), closing the vagina. The vesical side was closed in 2 layers, using the same suture (). In the end of procedure, a 4.7mm ureteral stent and an 18Fr bladder catheter were placed (). The bladder was also closed with the 3-0 barbed suture (V-Loc™). Total operative time was 87 minutes, estimated blood loss was less than 50mL, and the length of hospitalization was 30 hours. Bladder catheter remained for 2 weeks and the ureteral stent for 4 weeks. After the withdrawal of bladder catheter, patient remained well, without further complaints and no longer losing urine. |
pmc-6556326-1 | The patient (XX), a 35-year-old woman, was admitted to the Inpatient Unit of the Psychiatric Clinic of the University of Pisa for a major depressive episode. She was not married, was unemployed despite her educational achievement, and lived alone in her own house receiving an invalidity pension. She reported a family history of psychiatric disorders (a brother with panic disorder). XX was afflicted by multiple medical comorbidities, such as obstructive sleep apnea syndrome, polycystic ovary syndrome, hypertension, irritable bowel syndrome, and severe obesity (Body Mass Index was 39).
At the time of hospitalization, she reported low mood, abulia, decreased energy, apathy, anhedonia, feelings of sadness and inadequacy, and severe thoughts of death with suicide plans. She reported herself to be very anxious, tense, and irritable, with panic attacks (intense fear, palpitation, shaking, sweating, and sensation of smothering), and referred to staying at home all day because the streets smelled badly and noises were too unbearable to be sustained. Eating and sleep behavior patterns were totally disrupted. The clinical and diagnostic evaluation revealed also how XX presented narrow and unusual interests (particularly numbers and statistic and horror movies), strict adherence to her peculiar routine, difficulties to begin or carry on relationships, cognitive inflexibility, hyperreactivity to sounds, tastes, and lights, affective dysregulation, self-harm behaviors, marked impulsivity, and feeling of emptiness. All these symptoms were associated with low adaptation and social withdrawal. When inserted in a social context, she often put on big headphones to isolate herself and avoid noises.
Born in Ecuador, XX referred feelings of social incompetence, marked anxiety, excessive adherence to routines, rigidity of thinking, and distress to daily life change since she was a child. Since late childhood, she also reported severe weight instability with binge eating episodes associated with excessive and rigid food selection. At the age of 20, she had moved from Ecuador to a city in south Italy, where she attended a humanities faculty and at the age of 22 she reported her first full blown mood episode with mood deflection, abulia, apathy, anhedonia, irritability, marked ruminations, thoughts of death, progressive impairment in her adherence to sameness, and tendency to social isolation. All this symptomatology diminished without treatments within some months. In the same period, her eating behaviors got worse with an increase of binge episodes without compensatory behaviors and, consequently, progressive weight gain. At the age of 23, after the achievement of the university degree, she moved to another European country, where she attended an MSc program in Astrophysics, developing just a few months later a new depressive episode, complicated by self-harming behaviors (she began to cut herself on legs and arms) in order to face sadness, emotional pain, and other negative emotions. For these symptoms, she first contacted a psychiatrist and was treated with citalopram (up to 20 mg/day). At the age of 25 years, she suspended the pharmacological treatment starting a cognitive-behavioral psychotherapy focused on her social and eating behavioral difficulties, which she continued until the time of the current hospitalization. From the age of 27 to the age of 31 years, she reported progressive worsening of the mood symptoms and global functioning despite various treatments with SSRIs (escitalopram, paroxetine, and fluoxetine), followed by a hypomanic episode, for which she was started on mood stabilizers (carbamazepine). At the age of 31, she graduated in the MSc in Astrophysics and returned to a city of central Italy, reporting after a few months later a new severe depressive episode, associated with daily self-cutting behavior and suicide ideation with need of the hospitalization at the Psychiatric Clinic of the University of Pisa.
XX was admitted with diagnosis of bipolar disorder comorbid with anxiety and eating disorder.
During her hospitalization, XX was also administered the following assessment instruments on the basis of her personality and symptomatology: the Structured Clinical Interview for DSM-5 Disorders (SCID-5), the Autism-Spectrum Quotient (AQ) [], the Ritvo Autism and Asperger Diagnostic Scale (RAADS-R) [], the Adult Autism Subthreshold Spectrum (AdAS Spectrum) [], the Trauma and Loss Spectrum (TALS-SR) [], and the Ruminative Response Scale (RRS), reviewed and translated in Italian [, ].
By means of the SCID-5, a diagnosis of bipolar disorder type II, comorbid with panic disorder and binge eating disorder, emerged. Further, a first diagnosis of autism spectrum disorder without intellectual disability also resulted by the assessment instruments. A history of repeated sexual abuses during her childhood by a familiar member also emerged. During her hospitalization, XX received psychopharmacological treatment firstly with mood stabilizer (lithium 600 mg), antidepressants (amitriptyline 25 mg), and antipsychotic (perphenazine 2 mg). Upon diagnostic evaluation reported, we changed amitriptyline with sertraline 50 mg and perphenazine with aripiprazole 5 mg, showing a significant clinical global improvement. Furthermore, after discharge from the hospitalization, the patient resumed a cognitive-behavioral psychotherapy focused on traumatic process elaboration.
The patient fulfilled the following scales and gave written informed consent to the processing of health data for research purposes.
The AQ is a self-report measure of autistic traits in patients from normal to high IQ. It is constituted by 50 questions, grouped in five different areas: social skill, attention switching, attention to detail, communication, and imagination.
The RAADS-R is the revised version of the Ritvo Autism Asperger's Diagnostic Scale [] and includes four domains (social relatedness, circumscribed interests, language and communication, and sensorimotor and stereotypies).
The AdAS Spectrum is part of the “Spectrum Project” and it is conceived to identify the lifetime symptomatology of the entire autism spectrum, from subthreshold traits to the symptoms that fulfill the diagnostic criterion. It includes 160 items grouped in seven domains: childhood/adolescence, verbal communication, nonverbal communication, empathy, inflexibility and adherence to routine, restricted interests and rumination, and hyper- and hyporeactivity to sensory input.
The TALS-SR is a self-report measure of lifetime stress related spectrum. It includes 116 items, grouped in 9 domains: loss events, grief reactions, potentially traumatic events, reactions to losses or upsetting events, reexperiencing, avoidance and numbing, maladaptive coping, arousal, and personal characteristics/risk factors.
The RRS is an instrument to quantify the tendency to ruminative thinking of the patient; it is composed by 22 items that inspect 3 dimensions: depression thoughts, brooding, and reflection.
The patient reported a total of 38 over 50 at the AQ with the following scores at its domains: social skill (10 over 10), attention switching (9 over 10), communication (9 over 10), attention to detail (5 over 10), and imagination (5 over 10). She also showed a total score of 146 over 240 at the RAADS-R with these succeeding domains scores: social relatedness (74 over 117), circumscribed interests (27 over 42), language and communication (12 over 21), and sensorimotor and stereotypies (33 over 60). XX reported 99 over 160 at the AdAS Spectrum with the highest score in the nonverbal communication (20 over 28), inflexibility and adherence to routine (22 over 43), restricted interests and rumination (17 over 21), and hyper-/hyporeactivity to sensory input (12 over 17) domains, followed by childhood/adolescence (12 over 21), verbal communication (12 over 18), and empathy (4 over 12) domains. XX reported 47 positive items over 116 at the TALS-SR. In particular, she reported the following traumatic events: unwanted sexual advances and physical or sexual abuse, also corroborated by the endorsement of being victim of a crime, besides changes in homes, caregivers, schools, jobs; painful break-up of relations; divorce in the family; loss or death of a cherished pet; repeated failure in school or at work; and serious accident or injury. Further, she endorsed the following scores at TALS-SR domains: loss events (4 over 10), grief reactions (11 over 27), potentially traumatic events (8 over 21), reaction to losses or upsetting events (10 over 18), reexperiencing (4 over 9), avoidance and numbing (3 over 12), maladaptive coping (4 over 8), arousal (1 over 5), and personal characteristics/risk factors (2 over 6). She reported 64 over 88 at the RRS: brooding (28 over 44), depression (20 over 24), and reflection (16 over 20). |
pmc-6556328-1 | A 39-year-old woman with no medical history was referred to the Department of Gynecology at our facility after experiencing abdominal pain for the previous 2 weeks. She exhibited no additional symptoms and biological data were normal. Ultrasonography of the pelvis revealed a large mass extending from the right side of the uterine body to the adnexal region. The mass appeared solid and hypoechoic with sound attenuation. Serum levels of carcinoembryonic antigen, carbohydrate antigen 19-9, and carbohydrate antigen 125 were within normal ranges.
The patient then underwent computed tomography (CT) and MRI. Plain CT and contrast-enhanced CT revealed a large solid mass with cystic areas (Figures and ). T1-weighted MRI depicted a mass in the right adnexal region with high signal intensity relative to that of the myometrium (). On T2-weighted MRI, the solid component of the mass exhibited low signal that contained small areas of hyperintensity, and the signal intensity of the large cystic component was high (). Diffusion-weighted imaging depicted high signal intensity relative to that of the endometrium (). In precontrast fat-saturated T1-weighted imaging, the mass exhibited slightly high signal intensity (). On early-phase contrast-enhanced fat-saturated T1-weighted imaging, the mass exhibited marked high signal intensity (). On delayed-phase contrast-enhanced 3D fat-saturated T1-weighted imaging, the mass exhibited slightly high signal intensity (). The preoperative diagnosis was endometrioma with related malignant tumor, such as clear cell carcinoma or endometrioid carcinoma.
The surgical specimen from right adnexectomy consisted of a 12 × 9 × 7 cm mass with a yellowish-white cut surface, a cystic component containing dark yellow fluid, a smooth internal surface, and an almost solid component (). Microscopy examination revealed multiple small cystic spaces that contained mucinous fluid or hemorrhage and ovarian stromal intervening fibrous tissues and multiple vascular spaces(). Mucus-producing tumor cells with moderate atypia were detected in the papillary-structured architecture. (). Closely packed small cysts and microcysts densely filled with mucinous fluid or hemorrhage resembled solid components. On the basis of microscopic examination of a lot of H&E sections, which were prepared to detect malignancy, the tumor was finally diagnosed as an ovarian mucinous borderline tumor of gastrointestinal type. Recovery was uneventful and the patient was discharged 7 days after surgery. No local or systemic recurrence has been detected in the 4 years after the surgery. |
pmc-6556338-1 | The patient was a 65-year-old woman without notable antecedents presented to our institution for progressive left hip pain for approximately 8 months. It was a mechanical pain of the hip well relieved by the usual analgesics. The appearance of walking distance and the poor response to analgesics forced her to consult in our center.
The BMI was 35,5. The walk was almost normal. There was no cutaneous scar on the lateral side of the left hip or on the ipsilateral buttock. There was a good trophicity of the abductors. Lateral rotation and abduction were markedly diminished. The rest of the exam was strictly normal. The pelvis AP () and lateral () left hip radiographs revealed signs of hip osteoarthritis. We concluded that it was a symptomatic left hip osteoarthritis that was more and more disabling in an obese woman of 71 years with no particular history. We indicated THA by posterolateral approach.
In the operating room, after the skin incision and subcutaneous haemostasis, we discovered in the adipose tissue about 5 cm thick a kind of well-circumscribed shell of about 2.5 cm of axis. Her incision gave rise to a whitish, thick color, looks a little oily collection (), resembling a purulent collection (). A sample for bacteriological investigation in a lab was carried out. The hull with its clear boundaries within the gluteal fat was resected and entrusted to the pathologist. All the neighborhood tissues were healthy (very localized lesion).
In front of this collection which appeared to be purulent, we limited ourselves to the resection of this hull, the cleaning of the wound, and the deferred implantation of the prosthesis.
Cytobacteriological examination of the specimen revealed its greasy appearance, epithelial and lymphocytic cells; there were no visible germs. Histological examination of the resected shell revealed a fibrous wall with chronic inflammatory remodeling made of lymphocytes and plasma cells with no necrosis centers.
In the light of these laboratory results, we conducted the interview of the patient, who reported a notion of malaria for about two months to the screen treated with an intramuscular injection on the right buttock of the compounds derived from artemisinin. We found the result of the thick drop before the injection which was positive and that of the injection which had not been negated; the patient was then successfully treated orally. The sample was sent to a lab for confirmation by artemether identification by thin layer chromatography (TLC).
A sample of 40 g of human fat was treated with ethyl acetate (50 ml × 3) after filtration on Whatman paper, the solvent was evaporated, and the residue was taken up with acetone (40 ml) constituting the sample to be analyzed. Artemether was purchased from a local pharmaceutical company.
Implementation of the TLC: solution to be analyzed: 20 μl of sample; control: artemether (80 mg/mL), 10 μl deposit; support: silica gel GF254; mobile phase (10 ml): dichloromethane, ethyl acetate (7/3); and developer: 25 ml anisaldehyde reagent, 5 ml concentrated acetic acid, 450 ml ethanol, and 25 ml concentrated sulfuric acid. Using a capillary tube, 20 μl of the sample was deposited on the plate (silica gel GF254), the control 10 μl. The plate is placed in a tank previously saturated with the migration or elution solvent (mobile phase) which covers the bottom of the tank at 5 mm height. The migration of eluting solvent causes the substances contained in the samples at various speeds; spots are formed characterizing the substances present in the sample.
The plate was removed from the tank as soon as the solvent front reached about 9 cm. The plate was dried and observed under a UV lamp at 254 nm and then revealed with the developer which will characterize the artemether in human fat.
The plate then shows an orange spot on the left side of the sample and a spot with the same color on the right side of the control; the two spots have the same front report as shown in . This indicates that there was artemether in this human fat sample. |
pmc-6556339-1 | A 1.5m, 50-year-old female weighing 136.1kg (BMI 58.5 kg/m2) presented for a videolaryngoscopy with bronchoscopy and T-tube exchange. She had a history of type 2 diabetes mellitus, obstructive sleep apnea, hypothyroidism, and lymphoma. Following chemotherapy and radiation therapy, the patient developed tracheomalacia and tracheal stenosis, rendering her T-tube dependent. Preoperatively, the patient's vitals were within normal limits and stable. She denied any known drug allergies.
The intraoperative electrocardiogram (ECG) was sinus rhythm. Given the uncertainty by the surgical team regarding the potential difficulty of exchange, the decision was made to start the case under sedation with dexmedetomidine. A loading dose of dexmedetomidine was given (1 mcg/kg) over a period of 10 minutes, without any hemodynamic effects, and was then continued at 0.4 mcg/kg/h. Once the patient was rendered unresponsive to verbal stimuli, the T-tube exchange was attempted. As the level of anesthesia was still insufficient for the exchange, deepening of the anesthetic was requested. The anesthesia circuit was connected to the T-tube and sevoflurane was administered at 0.5 minimum alveolar concentration (MAC). As a subsequent attempt at exchange was still unsuccessful due to inadequate anesthesia, the surgeon requested muscular paralysis. The dexmedetomidine infusion was therefore stopped, the inhalational anesthetic was increased to 1 MAC, and 50 mg of rocuronium was administered to the patient. Within 5 minutes the T-tube was successfully exchanged and confirmed with direct laryngoscopy.
Upon termination of the surgical procedure, a peripheral nerve stimulator was used to evaluate the patient's depth of muscle paralysis. TOF stimulation of the ulnar nerve revealed 0/0 twitches with no recovery noted after tetany. In order to achieve complete reversal promptly, a sugammadex dose was calculated at 16 mg/kg, totaling 2177.6 mg. Due to our limited experience with this large dose, 1200 mg (55% of the calculated dose) was administered instead. Within about 30 seconds of the drug administration, it was noted that that the patient's heart rate precipitously decreased to 35 bpm and was immediately followed by asystole. At this point the surgeons were alerted of the sudden change in hemodynamic status; however prior to commencing chest compressions, the patient's heart rate spontaneously rebounded to the 90s (about 15 seconds total). Shortly afterwards, the patient began breathing spontaneously and TOF stimulation showed 4/4 twitches. The patient emerged from anesthesia and was transferred to the post anesthesia care unit (PACU) where a cardiology consult was obtained.
Postoperatively, the patient's 12 lead ECG showed normal sinus rhythm without any abnormalities. The patient was monitored overnight on telemetry with all blood work, including troponins, returning within normal limits. An echocardiogram showed no regional wall motion abnormalities and a preserved ejection fraction. The patient was successfully discharged home the following day. |
pmc-6556350-1 | We present the case of an 18-year-old female with cystic mediastinal lymphangioma. She initially presented to a peripheral hospital with left-sided chest pain and worsening shortness of breath, and no constitutional symptoms. She was found to have a large left-sided pleural effusion on CT thorax, presumed to be parapneumonic. She was started on antibiotic therapy including cephalexin and azithromycin. Initial thoracentesis was performed and 700ml of murky blood-tinged fluid drained. A 10.2 French Wayne pigtail catheter was inserted and approximately 2 liters of similar fluid was drained. Despite the chest tube, she had evidence of a persistent large, loculated left-sided pleural effusion and was transferred to our Tertiary Care Centre for further management. At presentation to our centre, she was found to have elevated white blood cell count of 15.4 x 109/L and platelet count of 634 x 109/L. A bedside chest tube insertion was undertaken, with subsequent CT thorax demonstrating no change in the size of the large left complex collection (). Therefore, the presence of an underlying abscess with a possible underlying necrotic mass was considered, and interventional radiology was consulted with the view to biopsy or drain depending on context characteristics. The fluid collection appeared extra pleural to the IR upon review of the CT. The thoracic radiologist agreed. Ultrasound revealed a multiseptated rounded extra parenchymal thoracic collection. A chest tube was inserted under ultrasound and fluoroscopic guidance, with 500 ml of serosanguineous fluid drained. Cytology did not reveal malignancy. The patient was discharged on Levofloxacin. Follow-up CT in one month demonstrated accumulation of the fluid, not expected in the case of a presumed empyema after adequate drainage. The patient underwent video-assisted thoracic surgery (VATS), which was converted to open thoracotomy upon discovery of a cystic structure extending into the mediastinum. The mass was partially resected and talc pleurodesis was performed. Histopathology revealed the diagnosis of mediastinal lymphangioma, demonstrating an irregular multiloculated cyst wall composed of channels and papillae and lined by bland flat cells. Cells were positive for D2-40, CD31, and CD34. The wall was composed of mature fibrovascular and adipose tissue. The outer aspects of the wall were lined by mesothelial cells. |
pmc-6556351-1 | A 36-year-old homeless man was brought to hospital by concerned citizens due to drowsiness. A history was not able to be obtained from him as he had become mute. On examination, he had a Glasgow Coma Scale (GCS) of 9—eye movement 3, verbal response 1, and motor response 5. He was febrile (38.5°C), tachycardic (HR 115 bpm) with normal blood pressure, and normal oxygen saturation and respiratory rate. He was found to have injection marks on his arms and forearms, suggesting that he was an intravenous drug user. He was incontinent of urine and had reduced lateral gaze of the right eye with dysconjugate eye movements. Primitive reflexes including glabellar tap and the rooting reflex were present. Other neurological examination findings were limited due to poor patient cooperation, but no other clear neurological signs were elicited.
Urgent investigations were performed which revealed a peripheral blood leukocytosis with an eosinophilia (3.34 × 109/L, reference interval (RI) 0.04–0.44 × 109/L). Renal function was normal, and liver function tests were mildly deranged with a mixed obstructive and hepatitic picture. He was tested and found to have chronic hepatitis C virus infection, but was negative for human immunodeficiency virus and hepatitis B virus infections. A lumbar puncture revealed intracranial hypertension with an opening pressure of 25 cm H2O (RI 5–15 cm H2O). There was a cerebrospinal fluid (CSF) pleocytosis (465 × 106/L white blood cells), with predominantly polymorphonuclear cells (85%) and 516 × 106/L red blood cells. The CSF protein was mildly elevated (1.12 g/L [RI] 0.15–0.45 g/L), and the glucose was low (2.3 mmol/L [RI] 2.5–5.5 mmol/L). He was treated with empirical antibacterial and antiviral therapy for meningoencephalitis. CSF bacterial culture, India ink stain, cryptococcal antigen, flow cytometry, and polymerase chain reaction (PCR) for herpes simplex virus, varicella zoster virus, and enteroviruses were all negative. Initial computed tomography (CT) of the brain was unremarkable, and magnetic resonance imaging of the brain (MRIB) did not reveal any abnormalities; however, the quality of the images was degraded due to motion artefact. He deteriorated further in his conscious state to the extent that he was comatose with involuntary shaking of limbs. He was intubated and transferred to intensive care unit for further care. An electroencephalogram did not show any epileptiform activity. Giemsa stain on CSF was requested and revealed that a third of the polymorphonuclear cells were eosinophils. Repeat MRIB (while the patient was comatose and intubated) revealed linear and punctate haemorrhagic lesions throughout the cerebrum and cerebellum on susceptibility-weighted images maximum intensity projection (SWI mip) sequence (Figures and ). These findings were consistent with helminth migration. There was also leptomeningeal enhancement in the right cerebellar folia () and evidence of widespread meningitis on MRIB. A brain biopsy was performed which revealed eosinophilic meningoencephalitis without detection of helminths, vasculitis, or malignancy (). A CT chest was also performed which revealed bibasal ground-glass changes, potentially consistent with helminthic migration. Bronchial alveolar washings obtained via bronchoscopy revealed eosinophil accumulation but did not reveal any helminthic larvae.
The patient was started on therapy for suspected Angiostrongylus cantonensis meningoencephalitis with albendazole (15 mg/kg daily) and prednisolone (50 mg daily) orally. His GCS improved significantly, but he complained of worsening headache within the first 48 hours of treatment. After 3 days of albendazole and prednisolone treatment, the headache improved markedly and he was fully alert and communicating coherently. Further history was sought and revealed that he had headache, fevers, agitation, unsteady gait, and occasional urinary incontinence for a few months prior to hospital presentation. He denied any slug ingestion or recent travel history. There were no residual neurological deficits, and the peripheral eosinophilia resolved promptly after commencement of treatment. On serological testing, Angiostrongylus cantonensis IgG antibodies were positive in the cerebrospinal fluid (2.52 IU, RI 1.0) and serum (3.99 IU, RI 1.0). Cysticerca IgG was also positive in the serum and CSF; however, the confirmatory immunoblot test against Cysticerca was negative, and the clinical and radiological findings were more consistent with angiostrongyliasis. The source of this Angiostrongylus infection remained unclear. He discharged against medical advice after 8 days in hospital, and he was provided another 2 weeks' worth of albendazole and a weaning course of prednisolone. He was offered outpatient follow-up appointments, but he failed to attend. He was next clinically assessed seven months later and stated that he had been adherent to the prescribed medications after discharge. He had no apparent complications from the suspected neuroangiostrongyliasis. |
pmc-6556355-1 | We present a 33-year-old nulliparous female who presented at our institution with a 3-year progressive headache and was associated with expressive aphasia. MRI of the brain revealed 4 masses including 2 dominant mass lesions (6.0 and 4.5 cm) having irregular lobulations in the bilateral temporal lobes consistent with metastatic disease (). Past medical history revealed that unilateral salpingo-oophorectomy with omentectomy, peritoneal washing, and pelvic lymph node samplings were performed twice, 8 and 4 years prior, respectively. Both specimens had serous borderline tumor, one of which had a 1 mm focus of microinvasion.
The fluid sample from the current cystic mass in the brain revealed neoplastic cells forming papillary clusters with smooth contoured edges on the smear (). Tissue sample of the brain lesion showed clusters of broad papillae with hierarchical branching and is lined by polygonal to columnar serous epithelium with mild to moderate atypia (). Immunohistochemical staining shows positive staining for PAX 8, WT-1, and CK7 and negative staining for CK20 (Figures –). The morphologic features and immunoprofile are in keeping with a diagnosis of the previous ovarian tumor. |
pmc-6556524-1 | A 26-year-old man presented with complaints of nasal obstruction for 2 years. He was having nasal obstruction on and off as was on repeated use of topical nasal drops He also complained of an associated headache on and off which was more localized in the right side. He also complained of swelling of the right cheek for the same duration of time. The swelling was insidious in onset and progressively enlarging in size. There was no history of pain, nasal congestion, facial numbness, or any oroantral surgery in the past. However, he gave a history of blunt trauma over his right cheek 5months back. There was no significant family history relevant to the disease. On Inspection, we could see a diffuse swelling of the right cheek with the mild erythematous change of the overlying skin (). On palpation, the swelling was firm, nontender and slightly mobile. Examination of the oral cavity revealed a bulge over the right gingivobuccal sulcus. He was then planned for a CT scan of the paranasal sinus which revealed opacified and expanded right maxillary sinus withlow-density lesion ∼53*44 mm and scalloping and resorption of posteroinferior, medial and superolateral walls and widening of osteomeateal complex (). The features were suggestive of right maxillary mucocele.With the diagnosis above he was planned for Caldwell Luc sinusectomy by a team of Otorhinolaryngology Head and Neck Surgeons under General Anesthesia. Intraoperatively cystic mass ()containing thick mucopurulent content was identified and the around 25 ml of fluid was drained out. All walls of the maxillary sinus appeared thinned out. A large middle meatal antrostomy was performed after exenterating the anterior ethmoidal cells. The histopathological report was consistent with the diagnosis of mucocele. |
pmc-6556552-1 | The patient was a 51-year-old, female sex, blood group O, with advanced decompensated primary biliary cirrhosis presenting with refractory ascites, sarcopenia, portal hypertension and significant jaundice. The United Kingdom Model for End-Stage Liver Disease (UKELD) score was 61 [, , ] and she was listed for LT. This patient received a DCD liver from a 74-year-old, male sex, donor. Further donor details are presented in . Recipient laboratorial data on the index admission for transplantation were summarised in .
The graft had normal hepatic artery anatomy, but an extensive atheromatous plaque up to the GDA. During implantation, the graft GDA was divided obliquely along the main hepatic artery stem and an endarterectomy was done. A plaque free portion of the hepatic artery above the GDA was obtained for direct anastomosis to the native CHA at the GDA junction; thereafter, a short, straight and non-redundant arterial reconstruction was performed. The anastomosis width was just over 6 mm, there were good pulse waves and the resistance index was confirmed by doppler ultrasound intra-operatively.
Surgical times are presented in . In terms of postoperative complications, this patient developed renal dysfunction and fluid overload in the immediate post-operative period, requiring temporary renal support. Additionally, further respiratory infection required the intensive care unit (ICU) up to post-operative day (POD) 9. Patient also developed delayed graft function with prolonged cholestasis. The bilirubin level was 266 mmol/L on POD 29 and it improved gradually down to 69 mmol/L by POD 49 when the patient was discharged. It was within the normal range (18 mmol/L) after 3 months of the transplant. During hospitalisation 4500 units of low molecular heparin and 75 mg of aspirin were given daily from POD 1 onward, as per unit protocol. The haemoglobin level was maintained around 80 g/L and platelets on an average of 80,000 counts until POD 5. Immunosuppression was standard, and the biochemistry was within the normal range at 4 months follow up. An ultrasound scan at 4 months post-transplant showed patent graft vessels and a non-dilated biliary system without evidence of HAT or hepatic artery stenosis (, ). |
pmc-6556623-1 | A 37-year-old man who had been HIV-positive for 2 years later became poorly adherent to first-line antiretrovirals (defaulted for more than 6 months). He re-presented at our facility again with low CD4 count (98 cells per µL) and high viral load (> 10 000.00 copies/mL) and had developed progressive, generalized, asymmetrical, non-scaly, maculo-papular, hyperpigmented focally nodular cutaneous lesions involving the head, neck, trunk (anteriorly and posteriorly), and the proximal upper and lower limbs, especially on the medial surfaces with the largest nodule reaching 2.5 cm in diameter, over a period of 3 months ( and ). He was on a first-line highly active antiretroviral therapy regimen (zidovudine/lamivudine/nevirapine) before defaulting. We conducted a skin biopsy for histopathology.
The laboratory received a small tissue fragment measuring 3 cm × 2 cm × 2 cm fixed in 10% buffered formalin. Tissue was sectioned following processing and embedding in paraffin wax. Light microscopy conducted on the haematoxylin and eosin stained tissue revealed a cellular nodular tumor composed of slit and sieve-like spaces containing red blood cells. These spaces were lined by plump dark cells with eosinophilic cytoplasm. In another focus within the lesion was a lobular lesion composed of enlarged keratinocytes whose nuclei were distended by eosinophilic amorphous bodies, consistent with molluscum bodies ( and ). These findings are pathognomonic of both Kaposi sarcoma and Molluscum contagiosum (coexisting). |
pmc-6556739-1 | A 55-year-old healthy woman was referred to our institution with a two-year history of progressive dysphagia to solids (). She reported a recent episode of solid food getting stuck in her throat, which prompted presentation to an outside endoscopist. The patient reported no alcohol use. She was a former smoker with a 15 pack-year history, but had quit over 20 years prior. The patient had a past medical history of gastroesophageal reflux disease, for which she was taking omeprazole, and hypothyroidism. She had no known history of any esophageal dysmotility disorder. There was a history of diabetes mellitus in her mother and son.
Physical exam and laboratory testing were unremarkable. Esophagography demonstrated a filling defect in the upper thoracic esophagus. Computed tomography (CT) demonstrated an 8 cm mass. Endoscopic ultrasound (EUS) demonstrated a pedunculated mass with a submucosal origin beginning at 20 cm from the incisors on the right side of the neck (). The lesion was felt to have the characteristic appearance of a FVP and the patient elected to proceed with resection.
The exploration began via a right cervical approach. The recurrent laryngeal nerve was identified and the cervical esophagus was mobilized. The mass was palpable on the posterior esophageal wall at the thoracic inlet. Upon a short myotomy, no stalk was identified and the mass could not be delivered to the neck. The cervical incision was closed and a right thoracotomy was performed. The mass was seen extending from the level of the azygos vein to the thoracic inlet. The esophageal muscular layer was intact. Following myotomy, the soft mass, which was densely adhered to the mucosa, was visualized and dissected from the underlying mucosa. It became evident that the mass maintained its attachment to a portion of the mucosa. Complete mobilization revealed the mass to be a lipoma at the tip of a large midesophageal diverticulum traveling in a submucosal plane. Repeat endoscopy demonstrated an ostium in the esophageal wall opening into a blind-ending pouch. The diverticulum was fully mobilized and resected using a stapler (). Mucosal closure was reinforced with overlying muscle and a pleural flap.
The patient was diagnosed with a large midesophageal diverticulum with a lead point lipoma. The patient’s postoperative course was uncomplicated. A postoperative esophagogram demonstrated no esophageal leak or obstruction. Pathology demonstrated a 7.5 cm diverticulum with a 4.5 cm lipoma without malignancy. At follow-up on the nineteenth postoperative day, the patient was tolerating a diet without dysphagia. |
pmc-6556741-1 | A 3-year-old female child was referred to our Head and Neck Department complaining about right-sided neck swelling since 2 months ago. The case had no pain in swelling, fever, trauma, dysphagia, and dyspnoea. Physical examination revealed a palpable mass of 4×3 cm in the right side carotid triangle that was firmly consistent, as well as nontender and nonfluctuant in nature. There was no evidence indicating the movement of swelling on deglutition. Overlying skin was reported to be normal. In addition, there were no signs of inflammation. Cervical lymph nodes were normal and systemic examination was unremarkable.
Applied Examinations
No abnormality was observed in the results of haemogram, chest X-ray, and blood chemistries. Computed tomography scan showed a well-circumscribed, isodense, and nonenhancing soft tissue mass with a size of 46×40 mm along the carotid space on right side. Bilateral thyroid gland appeared to be normal in size, shape, and echogenicity. Bilateral submandibular glands, parotid glands, and carotid arteries appeared normal. Laryngeal and parapharyngeal structures were also normal. The diagnosis was carotid body tumor and fine-needle aspiration cytology was not performed.
Procedure:
The patient was subjected to excision of the cervical mass. She underwent the surgery under general anesthesia with orotracheal intubation. A horizontal incision was carried out on the right side of the neck from the posterior border of right sternomastoid to the midline. The subplatysmal flap was elevated.
After dissecting the fibers of strap muscles, the swelling was discovered encasing the right common carotid artery from which it was carefully dissected and separated (). The mass was completely removed as the adjacent structures were not infiltrated. The right-sided common carotid artery and internal jugular vein were preserved (). Then it was followed by an uneventful recovery. The clinical follow-up of the patient has demonstrated no recurrence so far.
Gross Examination:
The excised mass was greyish white, 4x3x1 cm in size, as well as soft and cystic. In the incised section, the cystic cavity was noted at one end, along with papillary projections.
Histological examination:
Histopathological examination showed that the tumor consisted of large round to oval cells having vesicular nuclei with prominent nucleoli and scanty eosinophilic cytoplasm. The tumor cells were observed in zellballen pattern. Intervening fibrocollagenous stroma was infiltrated by mononuclear cells and congested blood vessels. Microscopic features were also suggestive of carotid body tumor.
The results of immunohistochemistry showed immunoreactivity to Mi-2 protein (CD99), vimentin with paranuclear immunopositivity for pancytokeratin. The tumor is immunonegative for leukocyte common antigen (LCA/CD45), S100 protein, desmin, myogenin, synaptophysin, cluster of differentiation 31, ETS-related gene, and transducin-like enhancer of split-1. Immunohistochemical findings were confirmatory for ES (-). The results of a positron emission tomography scan of the whole body were normal. Then the patient was treated by means of radiotherapy. |
pmc-6556744-1 | A 74-year old man, farmer, came to Ear Nose Throat Outpatient Department with a swelling in the neck on the right side, just below the lower jaw, since one month. It was insidious in onset and gradually progressive. There was no fever, pain over the swelling or change in the size of the swelling during the meals. The patient was a known case of coronary artery disease on a pacemaker.
The examination revealed a single 4×2.5 cm swelling in the neck below the right lower margin of the mandible extending anteriorly 3 cm from the midline to the right, posteriorly 3cm from the mastoid tip, superiorly till the lower margin of ramus of the mandible, and inferiorly 2 cm below the lower margin of the ramus of the mandible (). The palpation of the swelling revealed a nontender and firm to hard mobile mass with no local rise in the temperature. The surface was smooth and the skin over the swelling was pinchable. The swelling was neither bimanually palpable nor ballotable.
The ultrasound showed an irregular heterogeneous hypoechoic lesion in the right submandibular space measuring 37×23 mm with mild internal vascularity. The submandibular gland appeared separate but compressed. Few small subcentimeter-sized right level II, level III, level V, left level II nodes, and likely reactive nodes were also noted. Fine needle aspiration was suggestive of spindle cell neoplasm. Lab parameters were within normal limits. The swelling was excised under general anesthesia. Intraoperatively, a 3.5×2.5 cm mobile swelling was identified in the right submandibular space, separate from the submandibular gland, superior and lateral to it, and suspected to be arising from a thin nerve lateral to mylohyoid ().
No lymph nodes were identified. The specimen was removed in toto and sent for histopathological examination.Grossly, it was an unencapsulated lesion covered by adipose tissue ().
Microscopy showed fascicles of spindle cells, scattered myofibroblastic cells with hyperchromatic nuclei and nucleoli against a background of lymphocytes, plasma cells, and scattered lymphoid follicles. In addition, brisk mitoses were observed in the spindle cells. Lack of zonation ruled out the diagnosis of nodular fasciitis. A differential diagnosis of spindle cell carcinoma was ruled out with immunohistochemistry (IHC).
A panel of IHC showed diffuse and strong immunoreactivity for vimentin in spindle cells and focal positivity for smooth muscle actin. The spindle cells were negative with anaplastic lymphoma kinase (ALK), cytokeratin, desmin, S100, and CD117. Focal reactivity with cyclin D1 favored a diagnosis of inflammatory myofibroblastic tumor (IMT) (). The case then received radiotherapy 60 Gray divided into 30 fractions over 6 weeks. The patient had no evidence of recurrence or residual disease six months post-surgery. |
pmc-6556747-1 | A 28-year-old male presented with a history of intermittent mild-to-moderate epistaxis for 14 years. He experienced 3–4 episodes of epistaxis per year, which stopped spontaneously. The symptom was associated with progressively worsening right nasal obstruction, hyposmia, and headache. He had no neck swelling or stigmata of tuberous sclerosis.Nasal endoscopy showed a reddish mass, with prominent blood vessels arising from the right lateral wall of the post-nasal space extending to the nasopharynx ().
A computed tomography (CT) scan of the paranasal sinuses showed a lobulated non-enhancing mass at the right posterior nasal space arising from right posterior end of the inferior turbinate ().
Coblator-assisted endoscopic removal of the tumor was performed under general anesthesia. The lesion was vascular, and copious bleeding was encountered during surgery. Intraoperative blood loss was 200 ml. The patient was discharged 2 days post surgery.
Grossly, the tumor was a well-circumscribed homogenous whitish tissue measuring 4.0×3.0×2.5 cm, with numerous intervening small blood vessels (). Histologically, the section of the lesion shows an admixture of haphazardly arranged mature adipose tissue, smooth muscle fibers and thick-walled blood vessels. The lesion is partly lined by the respiratory epithelium ().
The intervening blood vessels are composed of arteries, arterioles, capillaries, venules, and veins. No atypical cell or evidence of malignancy was seen. Immunohistochemically, the endothelium of the vessel was positive for CD31, the elastic tissue of the vessel wall was positive for elastic Van Gieson (EVG), and the smooth muscle bundle fibers were positive for smooth muscle actin (SMA) and desmin. The melanocyte marker HMB-45 was negative. The histopathology examination was consistent with nasal angiomyolipoma.
At a 2-year follow-up, the patient was asymptomatic, and endoscopic examination showed no recurrence of the tumor. |
pmc-6556748-1 | A 35-year-old woman presented to the ear, nose, and throat outpatient department of the hospital with the swellings of right-sided neck, one in the region of the angle of the right jaw and the other below the right jaw (corresponding to submandibular region). She first noticed these swellings about 2-3 years ago when they were about the size of a bean. The swellings gradually progressed in size. There was no history of pain, fever, trauma, difficulty in mouth opening or facial nerve weakness. There were no comorbidities or history of addictions. On examination, she was found to have swellings present in relation to the right parotid and submandibular regions. The parotid swelling was about 2.5×2.5 cm in size, non-tender, firm, lobulated, mobile with normal overlying skin.
The swelling in the submandibular area was also about 2×2 cm in size, non-tender, firm, lobulated, mobile with normal overlying skin (). Facial nerve functions were within normal limits. Mouth opening was normal and there was no bulge in tonsillar fossa or the floor of the mouth.
Fine needle aspiration cytology (FNAC) from both the lesions showed a cellular smear with abundant chondromyxoid matrix associated with singly scattered and poorly cohesive myoepithelial cells with plasmacytoid appearance. There was no atypia. The features were suggestive of a pleomorphic adenoma.
A contrast-enhanced computed tomography (CT) scan of face and neck showed a well-defined, slightly lobulated mass lesion involving right parotid gland, suggestive of mild heterogeneous contrast enhancement. Another well-defined smooth marginated tumor with no significant contrast enhancement involved right submandibular gland. The radiographic appearance of tumors in both the locations was suggestive of a benign pathology ().
With the presumptive diagnosis of pleomorphic adenoma of right parotid and submandibular region, the patient was planned for right-sided superficial parotidectomy and right submandibular gland excision under general anesthesia. A modified Blair incision with cervical extension was performed to surround the submandibular area. The superficial parotidectomy and submandibular gland excision were performed after raising skin and subplatysmal flaps, which preserved the function of the facial nerve and its branches (). Intraoperatively, the tumors in both the locations were firm and lobulated. The treatment policy was the excision of entire tumors, superficial lobe of the parotid gland, and entire submandibular gland (). Postoperative period was uneventful and facial nerve functions were normal.
On gross pathological examination, the parotid and submandibular gland tumors were measured 34×25×22 mm and 45×25×20 mm, respectively. Serial slicing of the tumor showed grey white firm well-circumscribed lesion with pushing margins, with a surrounding rim of normal salivary gland tissue. Microscopic inspection showed both the tumors were surrounded by a capsule. The biphasic population of epithelium and mesenchymal cells were observed with epithelial cells in glands and myoepithelial cells embedded in the chondromyxoid stroma. The investigated regions had no necrosis or significant atypia. The final histopathological diagnosis of parotid and submandibular gland pleomorphic adenoma was performed postoperatively (). |
pmc-6556751-1 | A five-month-old male infant presented to the Department of Pediatrics with nocturnal coughs, dyspnea, episodic biphasic stridor with apneas, and intense drooling without dysphagia, three months before referral. On physical examination, using a tongue depressor during crying, the cystic appearance of a mass attached to the epiglottis emerged apparently. The results of a flexible laryngoscopy showed a rounded pink mass which was pedunculated in the vallecula. Moreover, the mass obstructed the airway at the supraglottic level and was mobile in synchrony with respiratory movements and crying. A non-contrast-enhanced computed tomography scan was performed and a smooth-edged homogeneous mass (approximately 1.5 cm in diameter) was detected in the vallecula. After the identification of a pedunculated mass in the vallecula, the patient underwent a direct laryngoscopy (). Endoscopic transoral excision of the lesion was performed by cold dissection plus electrocautery (the FiO2 was previously decreased to 30% preventing the combustion of the airway, ().
The patient remained intubated for 48 h, and he was subsequently extubated without complications and was prepared completely asymptomatic for discharge to home on day four after surgery. Histological evaluation showed fat and smooth muscle with a combination of nerves, vessels, and salivary glands, distributed in a disorganized manner (). During postoperative follow-up, the patient has remained asymptomatic. An eight-month follow-up laryngoscopy was performed without persistence or recurrence of the mass. |
pmc-6556752-1 | A 27-year-old woman without past medical history in her 37th week of pregnancy was the victim of a gunshot wound to her lower abdomen while being robbed and attacked by two unidentified burglars. The patient was brought by paramedic personnel to the emergency room 30 min after the violent attack. Upon arrival, a tachycardic and hypotensive patient was encountered. On examination, she presented a 50/30 blood pressure without palpable peripheral pulses; nonetheless, the fetus was noted to be active. The women’s abdomen was diffusely tender and rigid, and a single bullet entrance wound, without an exit wound in the lower left abdomen was seen (A). The cervix was closed, and no blood was found on rectal examination. Patient was reanimated and transported immediately to the operating room for an emergency laparotomy by a team of general surgeons, obstetricians, pediatricians, and pediatric surgeons.
Under general anesthesia at laparotomy, a 1 × 0.5 cm gunshot injury to the uterine fundus along with 300cc of clear amniotic fluid with whitish lumps and 700cc of blood clots were discovered in her abdomen. After a thorough exploration, no other injury was identified, and no bullet or fragment was found. An extensive peritoneal lavage was completed and an emergency cesarean section was performed (B).
A 2600 g male infant with a 6 Apgar score was delivered. During reanimation, the infant presented with severe respiratory distress and a penetrating entry wound in the infant’s right thoracoabdominal region without an exit wound was seen (C). Due to the nature of the injuries, an emergency consultation with the pediatric surgeon was required. A right posterolateral thoracotomy was performed. A 5 × 5 mm laceration to the inferior lobe of the right lung and a 1 × 0.5 cm right diaphragmatic injury were discovered (A). However, the bullet was nowhere to be found in the thorax. A diaphragmatic lesion was noticed, and the abdominal cavity was explored. Intestinal fluid (50 cc) was found in the infant’s abdomen along with a 2 cm bowel injury, 50 cm distal to the ligament of Treitz that encompassed 30% of the intestinal circumference. (B). The rest of the abdomen appeared normal, and the 2 × 1 cm bullet was found near the root of the mesentery between the intestinal loops (C).
With these findings, surgery was straightforward. Primary closure of the infants’ pulmonary and diaphragmatic injury was completed, and a right chest tube was set up. The extraction of the bullet was accomplished without difficulties. After that, a thorough lavage of the baby’s peritoneal cavity was performed, followed by debridement of the injured bowel and a primary closure in a single layer fashion with an absorbable suture (Vicryl, Ethicon, Johnson & Johnson, Seoul, Korea) (). Following surgery, the mother was stable and transferred to the ward for postoperative care and recovery while the neonate was admitted to the intensive care unit (ICU) for further postoperative care and respiratory support.
Breast milk diet was initiated on the second postoperative day, and as the infant showed a good clinical development, thoracic drainage was removed on the 6th postoperative day, and the infant was transferred from the ICU to the general ward with his mother. After a 2-week cycle of broad-spectrum antibiotics, our patient and her newborn were discharged in good health and no further treatment was prescribed. In follow up controls, after 5 months, the two patients were doing well. |
pmc-6556755-1 | A 40-year-old male not known to have any chronic medical illness, presented complaining of epigastric and left upper quadrant pain for 1 month, associated with intermittent nausea and vomiting, and aggravated by fatty meals, with no other associated symptoms. He had frequent visits to the emergency department where he was managed with analgesia and antacids with mild symptomatic improvement. Clinical examination was unremarkable with no evidence of jaundice or abdominal tenderness. His blood test results showed a normal complete blood count, kidney function, and liver function. Chest X Ray revealed dextrocardia with stomach fundic gas shadow on Right side (). Abdominal ultrasonography revealed transpositioning of the solid organs with a left sided liver and gallbladder with a solitary stone and mild wall thickening. We elected to perform a Magnetic Resonance Cholangiopancreatography to delineate the anatomy and to rule out any anomalies within the biliary tree. It confirmed the previously noted findings, showed no evident anomaly within the biliary tree, and confirmed the diagnosis of situs inversus totalis (, ). The patient was Scheduled for an elective laparoscopic cholecystectomy.
The Operating room equipment arrangement was adjusted as Mirror Image of Routine Laparoscopic cholecystectomy (). The Monitor was placed on left side of the patient. The surgeon with the camera assistant were on right side of the patient and the first assistant was on left side of the patient. The abdomen was scrubbed and draped in the standard aseptic technique. The first infraumbilical 11 mm trocar introduced and pneumoperitoneum induced using the open technique. Three 5 mm trocars were placed, at the xiphisternum which was used for the surgeon’s left hand, at the left midclavicular line 2 cm below the costal margin which was used as working port for the surgeon’s right hand and at left anterior axillary line 5 cm from the costal margin which was used for retraction of the gallbladder fundus by the second assistant, respectively. Inspection of the abdominal cavity confirmed the presence of situs inversus totalis, with the liver and the gallbladder positioned in the left side (). The Calot’s triangle was identified. The peritoneum overlying the gallbladder infundibulum was then incised and the cystic duct and cystic artery identified and circumferentially dissected, till the critical view was obtained. The cystic duct and cystic artery were then doubly clipped and divided, through the subcostal port using the right hand. The gallbladder was dissected from its peritoneal attachments using electrocautery and was retrieved using Endoscopic bag through the infraumbilical port. The total operative duration was 80 min, which was longer than the conventional laparoscopic cholecystectomy performed in patient without underlying anatomical variation. It can be attributed to the modification in the technique required to adjust to the mirror image anatomy.
The patient had an uneventful postoperative course and was discharged on postoperative day 1. Pathological examination of the gallbladder confirmed the presence of gallstones with chronic cholecystitis. No postoperative complications were noted during his follow up in the outpatient department. |
pmc-6556791-1 | A 43-year-old female patient with Hashimoto's thyroiditis was diagnosed with seropositive RA (anti-CCP 140, ref <20) in April 2013 when she presented with bilateral wrist, PIP, elbow, shoulder, knee, and ankle synovitis. She was started on prednisone taper at 20 mg/day and methotrexate 10 mg once a week optimized in increments up to 25 mg/week, with calcium, vitamin D, and folic acid supplements. Despite this therapy and despite significant improvement, there was recurrent, intermittent low-grade synovitis in both wrists. In mid-2016, X-rays revealed early erosions in the left ulnar styloid and capitate as well as the bases of the left second and third metacarpal bones. It was then decided, in January 2016, to start her on targeted therapy with tofacitinib 5 mg bid. The patient had rapid favorable response, and within 3 months, she was in clinical remission. The dose of methotrexate was progressively tapered down and stopped by the end of December 2016. The patient then remained in remission. Unfortunately, a routine laboratory test on June 23, 2016, showed leukocytosis of 27,500. The hemoglobin count was 11.3, and the platelet count was 610,000. A repeat CBC 5 days later confirmed leukocytosis with a WBC of 32,300 (7% metamyelocytes, 3% myelocytes, and 2% promyelocytes), hemoglobin count of 10.6, and platelet count of 703,000. Tofacitinib was discontinued, and the patient was referred to hematology/oncology.
Initial blood work was positive for t(9; 22) BCR-ABL (p210 b3a2) on FISH analysis. Bone marrow aspirate and biopsy showed myeloid and megakaryocytic hyperplasia with 2% blasts and a myeloid-to-erythroid ratio of 10 : 1. The karyotype showed t(9; 22) detected in all the examined cells. The flow cytometry showed that 5-6% of flow events express early myeloid markers.
The patient was diagnosed with chronic myelogenous leukemia (CML), and she was started on imatinib 400 mg. Two weeks later, blood tests showed a WBC of 18,200, platelet count of 514,000 and hemoglobin count of 9.9 that later further dropped to 6.5 with significant fatigue. Therefore, imatinib was decreased to 300 mg/day. Three months later, the patient remained in clinical remission for rheumatoid arthritis with hematological remission with WBC 4,700, Hg 12.5, and platelets 291,000. Her repeat quantitative PCR for BCR-ABL was 0.86%. |
pmc-6556792-1 | An Asian male infant was born by vaginal delivery at 39 weeks of gestation, with a birth weight of 3410 g, to a 34-year-old mother (gravida: 3; parity: 1; preterm: 0; miscarriage: 1; liveborn: 1) with pregnancy notable for fetal diagnosis of left-sided CDH. Maternal obstetrical history was significant for an ectopic pregnancy and an uncomplicated birth of a healthy, term male infant. Family history was significant for a maternal uncle who died at 21 years of age and another maternal uncle and two maternal male cousins who died in early childhood, all due reportedly to adrenal issues. Given prenatal diagnosis and family history, both parents underwent Sema4 expanded carrier screening with no significant findings. Both parents screened negative for congenital adrenal hyperplasia. Amniocentesis revealed karyotype as 46,XY.
Physical examination at birth was notable for decreased breath sounds on the left side of the chest consistent with CDH, scaphoid abdomen, upslanting palpebral fissure, high-arched palate, smooth philtrum, and mild ankyloglossia. Skin exam was normal with no hyperpigmentation. Testes were descended bilaterally with a normal phallus.
Preoperative renal ultrasound was significant for mild bilateral hydronephrosis. Echocardiogram on day of life 2 revealed moderate pulmonary hypertension. He underwent uncomplicated repair of CDH on day of life 3. He remained hemodynamically stable before, during, and in the immediate postoperative period. He was extubated on day of life 8, successfully transitioned to room air by day of life 10, and reached full oral feeds by day of life 14. On day of life 17, he was noted to have decreased oral feeding and a brief episode of self-resolved bradycardia. A rule-out-sepsis workup was initiated. Soon after, the patient developed a prolonged generalized seizure, unresponsive to intravenous phenobarbital, and required emergent intubation.
Initial laboratory results were notable for severe hyponatremia (Na+: 111 mmol/L) and hyperkalemia (K+: 9.2 mmol/L), a glucose level of 51 mg/dL, an arterial pH of 7.49, and a bicarbonate level of 16 mmol/L (reference range: 25–32 mmol/L) (Figures and ). He was treated with intravenous hypertonic saline, calcium gluconate, furosemide, an insulin infusion, dextrose 12.5% infusion, and albuterol nebulization. He was started on dopamine infusion secondary to systemic hypotension. Given this compilation of symptoms, adrenal insufficiency was suspected and hydrocortisone was initiated.
Over the next 48 hours, electrolyte derangements resolved. Blood, urine, and cerebrospinal fluid cultures were negative, and antibiotics were discontinued. Magnetic resonance imaging of the brain was normal. Initial video electroencephalogram was significant for epileptiform discharges but no seizures. An extensive endocrine evaluation was conducted. Some initial diagnostic labs were unable to be sent before the patient received hydrocortisone and hypertonic saline. Available labs were notable for low aldosterone (5.4 ng/dL, reference range: 7–99 ng/dL), normal dehydroepiandrosterone sulfate (87 μg/dL, reference range: 32–431 μg/dL), and normal 17-hydroxyprogesterone (159 ng/dL, reference range: <199 ng/dL). The sample for plasma renin was of insufficient quantity. The cortisol level was sent after starting hydrocortisone and thus deemed inconclusive.
Renal sonogram revealed a normal right adrenal and nonvisualized left adrenal gland. In view of the unconfirmed etiology and unrevealing testing by then, the baby was trialed off hydrocortisone on day of life 22, but hyponatremia and hyperkalemia recurred the following day with Na+ of 116 mmol/L and K+ of 9.9 mmol/L. The repeat cortisol level at this time was normal at 10.1 μg/dL, and renin and aldosterone levels could not be obtained because of insufficient sample. Hydrocortisone was restarted, along with fludrocortisone and sodium chloride (NaCl) supplements. Enteral feeds were restarted with low mineral formula, Similac® PM 60/40. He had an additional episode of electrolyte derangement on day of life 43, which was managed by adjusting the dosage of hydrocortisone, fludrocortisone, and NaCl supplementation. Prior to discharge at 10 weeks of age, aldosterone remained low (3.8 ng/dL, reference range: 7–99 ng/dL), with normal renin levels (20.5 ng/ml/hr, reference range: 2.4–37 ng/mL/hr) on treatment. Newborn screening and microarray sent during admission were normal. He was subsequently discharged home on hydrocortisone, fludrocortisone, and NaCl supplements.
We considered the diagnosis of congenital adrenal hypoplasia (AHC) and requested DNA test of the NR0B1 gene that is associated with AHC. Single gene sequencing and deletion/duplication analysis of the NR0B1 gene (NM_000475.4) identified a variant of uncertain significance (VUS): c.1142T>C (p.Leu381Pro). This variant has never been reported before and is not present in population databases []. Different missense variants at this codon have been reported in individuals affected with X-linked AHC []. Missense pathogenic variants in NR0B1 and the variant seen in our patient are located in the same protein domain []. These publications suggest that the leucine residue and the structural domain it resides may be critical for the NR0B1 protein (DAX1) function [, ]. The mother was found to carry the same variant, which was absent in the 14-year-old unaffected brother. Therefore, this variant is likely clinically significant and is consistent with a diagnosis of X-linked AHC in our patient.
At 15 months of age, the patient is receiving physical and feeding therapy for oropharyngeal dysphagia. He is walking, has words, and is increasing his solid intake. He is currently on physiologic hydrocortisone, fludrocortisone, and NaCl supplementation. He has not had any electrolyte abnormalities since discharge from the hospital. He is followed every 2-3 months and will be monitored closely during adolescence for pubertal signs, as most children with AHC do not go into spontaneous puberty. |
pmc-6556798-1 | A 40-year-old nulliparous woman with no past medical history, other than endometriosis, presented to the emergency room with severe chest tightness of one day duration. She described chest tightness while exercising on a bicycle after 10 minutes. The next day she developed a severe hacking cough at work during a conference call. The cough was associated with disorientation and severe chest tightness. This prompted her to present to the emergency department in February 2018. The patient is a pharmacist, nonsmoker, and denies illicit drug use or recent travel. She had endometrial laser ablation with myomectomy in 2006. Hormonal contraceptives have been used since 2004 and were stopped three months before presentation in hopes of conception. Her last menstrual period was four days before the onset of symptoms. On physical examination, she had chest tightness localizing to the right side and decreased right sided breath sounds. All the routine laboratory work and vital signs were normal. The CXR showed a large right spontaneous pneumothorax with what approved to be a 5.6 cm pleural mass at the right lung base ().
Following the pneumothorax diagnosis, the patient underwent emergent right thoracostomy with pigtail catheter placement. A repeat CXR revealed marked re-expansion of the lung but persistence of the right cardiophrenic opacity of unclear etiology. A follow-up CTof chest showed a 33 mm diaphragmatic defect with a 5.8 x 4.6 x 3.9 cm area of herniated liver corresponding to the presumed pleural mass ().
Following complete thoracic imaging the patient underwent video-assisted thoracoscopic surgery (VATS), mechanical pleurodesis, and open repair of the right diaphragmatic defect by Dr. Emily Cassidy (Figures and ). Intraoperatively, the lungs appeared grossly normal. An obvious diaphragmatic defect was noted in the posteromedial portion of the central tendon of the diaphragm with a sizable protrusion of liver in to the chest cavity. There was an attempt to dissect liver adhesions from the diaphragm. Extensive liver adhesions forced conversion of the right VATS to a posterior lateral muscle sparing thoracotomy. Electrocautery and blunt dissection were used to separate the liver and diaphragm. Once the liver hernia was completely reduced, the diaphragm was repaired using multiple interrupted prolene pledgeted horizontal mattress sutures. Later, right parietal pleurectomy was performed by scoring the pleura posteriorly, anteriorly throughout the entire chest cavity. At the apex as well as the base, where pleurectomy was difficult, mechanical pleurodesis using a Bovie scratch pad was perfomred. A 24-french chest tube was placed at the apex of the chest cavity and 24-french blake was placed at the level of diaphragm.
Intraoperatively, an endometrial implant (blue berry spot) was noted on the chest wall (), but the endometrial implant was not successfully biopsied for pathology evaluation due to the extent of liver adhesions and due to conversion of procedure from VATS to open thoracotomy.
On postoperative day three, the patient began her menstrual cycle. She was evaluated by a gynecologist consultant who recommended hormonal therapy, leuprolide a Gonadotropin releasing hormone (GnRH) analogue, to begin 2-3 weeks postoperatively for a period of 6-12 months for hormonal suppression to reduce the risk of recurrent pneumothorax. GnRH analogs are highly effective at suppressing ovarian hormone production and inhibition of growth of endometrial tissue. Due to a persistent air leak, the patient's chest tube was transitioned to a Heimlich valve to facilitate home discharge. We believed that the persistent air leak indicated there was some minor defect in the visceral pleura that was too small to identify intraoperatively. The patient was discharged on postoperative day eight and was seen as an outpatient by the cardiothoracic surgeon. At this time, there was resolution of air leak and removal of the chest tube. Patient was also seen after two months in a primary care clinic for follow-up visit with no issues. |
pmc-6556803-1 | The patient is a 57-year-old female who underwent cardiac catheterization via the right common femoral artery two weeks prior to developing a large, symptomatic right common femoral artery pseudoaneurysm ().
The patient began complaining of groin pain two weeks after cardiac catheterization. She has a past medical history of aortic valve replacement secondary to aortic valve infective endocarditis, hyperlipidemia, and hypertension.
She underwent two attempts of ultrasound-guided thrombin injection of the pseudoaneurysm. On ultrasound, the size of the pseudoaneurysm was found to be 5 cm × 3 cm × 4.6 cm. The neck of the pseudoaneurysm was measured to be 0.8 cm long. The two attempts involved using a 21 gauge needle to administer 1000 units and 2000 units of thrombin, respectively, into the pseudoaneurysm under ultrasound guidance and with the assistance of compression. Due to the size of the aneurysmal cavity and a relatively large pseudoaneurysm neck, injections were found to be unsuccessful on follow-up ultrasound (Figures and ). It was then decided to attempt endovascular closure of the neck of the pseudoaneurysm. All risks were discussed with the patient.
After identification by the attending surgeon, the patient was transferred to the procedure room table in the catheterization lab. The patient received IV sedation, and local anesthesia was used prior to ultrasound-guided percutaneous access to the left common femoral artery. During the procedure, vital signs, including blood pressure, heart rate, respiratory rate, and oxygen saturation, were monitored by an ACLS certified nurse.
After a 21 gauge needle was placed into the projection of the vessel lumen, a guidewire was placed into the left iliac artery. An angiographic catheter and guidewire were used to perform selective cannulation of the contralateral right common iliac artery. Then, a 6 French long access sheath was placed to perform an angiogram. The neck of the pseudoaneurysm was visualized (), and a 0.014 guidewire was placed into the proximal portion of the neck.
A 21 gauge needle was used to cannulate the proximal portion of the neck percutaneously from the right groin. The previously placed guidewire was used as a landmark to place the tip of the 21 gauge needle into the pseudoaneurysm. After blood return was noticed from the needle, a 0.018 guidewire was placed into the lumen of the right common femoral artery. A 6 French access sheath was placed over the guidewire. Fluoroscopy was then used to visualize the deployment of a vessel closure device (VASCADE 6 French). This was done without difficulty, and the collagen patch was positioned outside the vessel wall in the area of the pseudoaneurysm neck. Interval angiogram revealed partial occlusion of the pseudoaneurysm neck ().
It was then decided to place an occlusive 8 mm balloon into the lumen of the right common femoral artery to facilitate pseudoaneurysm thrombosis. The balloon was insufflated up to 8 ATM for 600 seconds. This was done twice in total. Interval angiogram then revealed complete occlusion of the pseudoaneurysm blood flow (Figures and ).
All wires and catheters were removed at this point, and a left common femoral artery access sheath was kept in overnight. Postoperatively, the patient had no complications, and formal ultrasound confirmed complete thrombosis of the pseudoaneurysm. The access sheath was then removed without issue. There were no ischemic complications due to balloon occlusion in the immediate postoperative period. |
pmc-6556829-1 | An 85-year-old woman with severe aortic valve stenosis (AS) was admitted to undergo transcatheter aortic valve implantation. She had a history of cerebral infraction, with no remarkable family history. Recently, she experienced chest pain, clammy sweat, and anorexia; she visited a local doctor for AS treatment.
She complained of chest and back pain and developed fever after undergoing preoperative transesophageal echocardiography (TEE). The next day, the symptoms did not improve and computed tomography (CT) revealed prominent mediastinal emphysema and pleural effusion. Upper gastrointestinal endoscopy confirmed esophageal perforation located 30 cm from the incisors (A), and gastrografin contrast revealed mediastinum leakage ().
She was diagnosed with thoracic esophageal perforation. Radical thoracotomy surgery (primary repair or resection) was difficult because she was elderly and had severe AS. Therefore, two-stage surgery and indirect approach, comprising cervical esophagostomy to avoid contamination, gastrostomy for decompression, and jejunostomy for nutrition, was adopted. Reconstruction was planned after the mediastinitis and perforation were healed.
An emergency operation was performed 32 h after TEE under general anesthesia; a 12-mm trocar for the laparoscope was placed through the umbilicus, and four 5-mm ports were placed in the left upper, right upper, left middle, and right middle quadrants. We washed the contaminated mediastinum with saline through the esophageal hiatus from the abdominal cavity side and placed the drainage tube in the mediastinum. We then performed gastrostomy and jejunostomy laparoscopically, followed by cervical esophagostomy using a tube. Esophageal dissection was performed by an autosuture device (operation time: 2 h 14 min; blood loss: minimal).
Postoperatively, clinical course was good. At 11 days postoperatively, CT revealed almost complete resolution of the mediastinal air and cavity and the mediastinal drain was removed.
At 22 days postoperatively, endoscopic retrograde observation via gastrostomy revealed a healed perforation (B), and the cervical esophageal stump that was separated during surgery was connected; it became patent spontaneously (A). Endoscopic findings confirmed that the recanalized segment’s lumen was strong, and we assessed the recanalized segment’s continuity by CT. Anastomotic surgery was unnecessary; however, because of esophageal stenosis, endoscopic balloon dilation was necessary. After four sessions of dilation (B), she could orally consume food without additional surgery. Currently, she can walk with assistance and has a good oral intake (). |
pmc-6556853-1 | We report a case of 22-years-old man, without past parotid inflammation, trauma or history of surgery, presented with slowly progressive and a palpable mass over the left parotid since 4 years.
Initial clinical examination demonstrated a palpable, pulsatile and non-fixed mass, measuring 3 cm in diameter, with small neck masses. He had no weakness of her facial nerves().
We refer patient for ultrasound examination with Doppler of the lesion that strongly suggested the vascular nature of the mass. A contrast MRI study was requested owing to the finding of clinical and ultrasound examination. MRI demonstrated a well encapsulated lesion, 20 mm in diameter, in the superficial lobe of the left parotid gland. This lesion was hyperintense T1 and T2 confirming the diagnosis of pseudoaneurysm mimicking an intra-parotid mass (, ). No fine needle aspiration was performed.
Following discussion with the patient, the decision was to perform a surgical resection of the pseudoaneurysm starting by a superficial parotidectomy with identification and dissection of facial nerve after ligation of the facial artery. The patient was operated without incident, with a good postoperative warning ().
Definitive histological examination confirmed the diagnosis of pseudoaneurysm of the external carotid artery with Angiolymphoid hyperplasia and eosinophilia compatible with Kimura diseases.
The patient is undergoing regular review in the outpatient clinic at 3-month intervals during one year, and has been advised to contact the department of internal medicine for more investigations especially renal function tests, revealed without anomalies. |
pmc-6557198-1 | A 22 year-old woman presented with headache for three months with a preoperative Karnofsky performance score (KPS) of 90. Magnetic resonance imaging (MRI) revealed a heterogeneous contrast enhancing right temporal intra-axial tumor (3.2cm x 3.6cm x 4.0cm) with evidence of leptomeningeal spread (LMS) at the right ambient cistern (). Craniotomy with near total excision was performed and the histological diagnosis was an isocitrate dehydrogenase-1 (IDH-1) wildtype, MGMT promoter methylated epithelioid glioblastoma with BRAF mutation. During the early postoperative period the patient rapidly developed communicating hydrocephalus that required ventriculoperitoneal (VP) shunting. Within a week the shunt became blocked with tumor-fibrin clots that required external ventricular drainage (EVD). A three-week MRI scan revealed focal tumor recurrence with diffuse intracranial and cervical spinal cord LMS (). The patient’s consciousness deteriorated to a Glasgow Coma Score (GCS) of 10/15 (E2V3M5) and her KPS dropped to 30 requiring nasogastric tube feeding. Given the patient’s poor neurological state and her reliance on EVD, temozolomide CCRT was not considered possible. Because of the BRAF mutation findings, combined dabrafenib 150mg BD and trametinib 4mg daily systemic therapy was started. A single session of whole brain radiotherapy (3Gy) was also administered with the aim to enhance blood brain barrier drug permeability. The patient had considerable clinical improvement two weeks after treatment initiation with full recovery of consciousness. She was able to wean off the EVD and nasogastric tube. Three weeks after starting combined BRAFi/MEKi therapy a MRI revealed substantial tumor regression (). The patient largely tolerated the target therapy experiencing grade II cutaneous adverse reactions. After a course of rehabilitation the patient was discharged home with a KPS of 80. Tumor tissue targeted gene panel analysis was performed by next-generation sequencing (NGS) and the results are summarized in .
After three months of combined target therapy the patient developed progressive neck pain within a week. She also suffered from rapid weight loss and deterioration in KPS to 50. An MRI revealed a recurrent lesion in the contralateral mesial temporal lobe with LMS over the cervical and upper thoracic cord (). CSF collected for cytology showed malignant tumor cells and next generation sequencing of CSF for cell-free DNA found high levels of BRAF mutant DNA indicating acquired treatment resistance. Since the tumor cells harbored a borderline high mutational load (17.1 mutations per megabase) with low microsatellite instability (only one of the five mononucleotide repeat markers of the pentaplex polymerase chain reaction panel was positive), the PD-1 checkpoint inhibitor nivolumab was added concurrently with the BRAFi/MEKi therapy (). Whole brain radiotherapy was not given due to the rapid deterioration in functional performance and for concerns that the simultaneous administration of BRAFi therapy could cause severe neurotoxicity and cutaneous adverse reactions. The patient’s condition continued to deteriorate and palliative spinal radiotherapy (15Gy over five fractions) was finally prescribed. In spite of such salvage treatments there was further disease progression and the patient died seven months after diagnosis. |
pmc-6557198-2 | A 22 year-old man with good past health and G6PD deficiency presented with a two-month history of headache. A MRI brain () showed a 5.4 x 5.8 x 5.2cm right frontal lobe contrast-enhancing intra-axial tumor that extended into the right lateral ventricle. Craniotomy with subtotal resection was performed with CSF specimens revealing the presence of tumor cells. The pathological diagnosis was an epithelioid glioblastoma (IDH-1 wildtype, MGMT promoter methylated) with as high as 20 mitotic figures detected per ten high power field. Further molecular tests showed TERT mutation and absence of EGFR amplification. NGS targeted gene panel testing confirmed the presence of BRAF mutation ().
Originally temozolomide CCRT was planned, but the patient rapidly developed a focal tumor recurrence, diffuse LMS and communicating hydrocephalus that required VP shunting (). With a KPS of only 40 the patient was considered physically unfit for chemo-irradiation and was prescribed the BRAFi, vemurafenib 960mg BD (dabrafenib was not used due to G6PD deficiency). After only two days of treatment, the patient reported a significant alleviation of his headache and a three-week MRI confirmed significant tumor regression (). The MEKi, cobimetinib (60mg daily) was subsequently added. The patient’s clinical condition improved considerably reaching a KPS of 80 and he was discharged home after a short course of rehabilitation. He tolerated the combined target therapy and only developed a grade II photosensitivity rash. A four-week MRI scan showed good treatment response with partial tumor regression ().
In anticipation that tumor resistance could arise as with our first patient, standard temozolomide CCRT was started. Vemurafenib and cobimetinib were stopped one week beforehand to minimize the risk of cutaneous photosensitivity and neurotoxicity. But only after one week of CCRT the patient developed severe neck pain with a computed tomography (CT) scan revealing local recurrence and hydrocephalus (). Chemo-irradiation was stopped with revision of the VP shunt performed. Combined target therapy was resumed 10 days later, but the patient continued to have multiple episodes of shunt occlusion due to the elevated CSF tumor-fibrin clot load and eventually required an EVD. CSF cell-free DNA testing also detected persistently high levels of BRAF mutated DNA that signified possible drug resistance (). The patient was not considered fit for resumption of CCRT therefore a selective cyclin-dependent kinase 4/6 inhibitor, palbociclib was started at 75mg daily, 60% of maximum dose, for 21 days per 28 days cycle, concurrently with vemurafenib 960mg BD. Two weeks later an endoscopic third ventriculostomy was performed and the patient was able to wean off the drain.
The patient tolerated this new target therapy combination well and resulted in a pronounced recovery of consciousness although his overall KPS remained poor at 40. Whole brain radiotherapy was not resumed due to the patient’s poor performance status and concerns that synergistic adverse effects could arise when given concomitantly with BRAFi therapy. Follow-up CT scanning showing stable disease and palbociclib was stepped up to 100 mg for the second cycle. However, the treatment response was transient and after eight weeks of therapy the patient developed severe intratumoral hemorrhage and succumbed resulting in an overall survival of 7.5 months. |
pmc-6557424-1 | A 75-year-old woman status-post surgical aortic valve replacement (AVR)
with a #21 LivaNova Sorin Mitroflow bioprosthesis (London, UK) 7 years prior,
referred for management of bioprosthetic aortic stenosis (AS). Transesophageal
echocardiogram (TEE) revealed a reduced left ventricular ejection fraction
(LVEF) of 35%, severe AS and insufficiency (AI), severe mitral regurgitation
(MR) with mild dilatation of the mitral valve annulus, and a 3 cm left atrial
appendage thrombus (see ). Her Society of Thoracic Surgeons
(STS) risk score was calculated at 9.9% for isolated AVR. Computed tomography
(CT) of the chest showed a profoundly calcified aortic BHV embedded within the
aortic wall and coronary ostia. Surgical AVR would have necessitated complex
aortic root revision and, given the patient’s age, medical
co-morbidities, and calcified coronary ostia, we planned a surgical VIV
implantation using a transcatheter valve. Following redo sternotomy, initiation
of cardiopulmonary bypass (CPB), endocardial CryoMAZE procedure, and left atrial
appendage ligation, a mitral valve repair with a #30 Carpentier-Edwards Physio
II ring (Irvine, CA) was performed. Oblique aortotomy revealed findings
consistent with the CT scan. A VIV procedure was predicted to provide adequate
hemodynamics after valve excision (). The BHV leaflets and posts were excised, and a #23 Medtronic Evolut
valve (Minneapolis, MN) was deployed within the prior sewing ring, positioned
such that the bottom of the Evolut frame was 2 mm below the surgical valve
sewing ring (see ). The coronary ostia were subsequently noted to
be patent and the aorta was patched with bovine pericardium. Finally, the
tricuspid valve was repaired using a #28 Carpentier-Edwards MC3 ring (Irvine,
CA).
The patient was weaned from CPB, and TEE demonstrated excellent valvular
function without leak. The patient was extubated on postoperative day (POD) #2
and had a permanent pacemaker placed on POD#10 for a prolonged sinoatrial pause.
There was no evidence of AI or AS, mean gradient was 12 mmHg, and all aortic
dimensions were within normal limits on transthoracic echocardiogram from
POD#11. The patient was discharged to a rehabilitation facility on POD#14 and
was doing well at 3 year follow-up without increase in valve gradients (see
). |
pmc-6557424-2 | An 84-year-old woman status-post surgical mitral valve replacement with a
#27 Medtronic Hancock II (Minneapolis, MN) bioprosthesis 12 years prior,
referred for management of severe MR. TEE revealed a small left ventricular
outflow tract (LVOT) and large bioprosthetic struts. Due to concern for LVOT
obstruction which precluded a full transseptal mitral VIV procedure, in
conjunction with elevated surgical risk (Society of Thoracic Surgeons risk score
of 13.2% for mitral valve replacement), direct surgical VIV implantation was
performed (). Following redo
sternotomy and initiation of CBP, a left atriotomy revealed a mitral BHV with
tears in 2 of 3 leaflets. All leaflets were excised, and a #26 Edwards
Lifesciences Sapien XT (Irvine, CA) valve was inserted through the atriotomy and
deployed within the prior valve frame with adequate LVOT clearance, positioning
the atrial end of the Sapien XT frame just at the base of the sewing ring of the
bioprosthetic valve with –1 mm left atrial protrusion (). Given the height of the surgical valve (19
mm) and height of a fully expanded #26 Sapien XT, this ensured no additional
ventricular protrusion of the Sapien XT valve beyond the surgical valve struts.
Gentle atrial retraction was applied to the valve during deployment to optimize
LVOT clearance and achieve the proper position. The patient was weaned from CBP
without incident, and TEE revealed a trace, hemodynamically-insignificant
paravalvular leak.
Shortly after admission to the ICU, increasing sanguineous chest tube
output and vasopressor requirements prompted return to the OR for
re-exploration. The patient was placed on CBP and an inferolateral left
ventricular wall perforation was identified and directly repaired. This injury
was likely due to balloon nose cone perforation of the Sapien XT valve balloon,
as deployment was performed without wire access. TEE on POD#1 was negative for
bioprosthesis dysfunction, and the patient was extubated on POD#2. Her
postoperative course was complicated by atrial fibrillation. She was discharged
to home on POD#9 and was doing well at follow-up (see ). |
pmc-6557939-1 | A 15-year-old male without any symptoms was referred to our hospital because he was noted as having an abnormal shadow on chest X-ray at a health checkup. No abnormal findings were observed on his hematological and biochemical examinations. On chest computed tomography (CT), a 40 × 33-mm wide tumor shadow with clear boundaries in the right pulmonary hilar area was found. The tumor was strongly enhanced in the early phase. Abnormal findings were not found in the lung field and mediastinum (Fig. a–c). Bronchoscopic examination was performed under topical anesthesia. The lateral segment of the lower lobe of the right bronchus was narrowed by compression of the tumor although the endobronchial mucosa was intact. Endobronchial ultrasound-guided transbronchial needle aspiration (EBUS-TBNA) was performed but no specific findings were obtained from the cytological and histological evaluation. However, the patient was admitted to our department for surgery because 18F-fluorodeoxyglucose positron emission tomography (FDG-PET) showed abnormal accumulation in only the tumor; SUV (standard uptake value) max was 4.4 (Fig. d), which suggested potential malignancy. Due to the possibility of a malignant tumor, right middle and lower lobectomy was necessary due to its localization, and depending on the intraoperative findings, it was also necessary to perform right pneumonectomy. We informed the patient and his mother of this before surgery and obtained their consent. However, from the imaging morphology of the tumor and lack of evidence of malignancy in EBUS-TBNA, we also kept in mind before surgery the possibility of benign tumors including Castleman’s disease. We decided to make a final decision on the procedure based on the findings of the intraoperative macroscopic findings and the intraoperative frozen section diagnosis.
On operative findings, the tumor existed between the middle and lower lobes of the right lung with no pleural involvement. The interlobar pulmonary artery was revealed on the back side of the tumor. We performed 18Ga needle biopsy for intraoperative frozen section diagnosis, which showed only chronic inflammation findings. Moreover, macroscopically, no tumor invasion into the pulmonary vessels, bronchi, and lung parenchyma was found. Therefore, only the tumor enucleation was performed (Fig. a). An intraoperative frozen section diagnosis of the removed tumor found suspected Castleman’s disease. Therefore, we decided not to do further resection.
The extirpated specimen was a 30 × 23-mm smooth and well-encapsulated tumor. Histologically, the lesion had a fibrous capsule with clear boundaries consisting of lymph follicle hyperplasia. There were clearly hyalinizing concentric fibrotic nests around the lymph follicle and vessel hyperplasia on the hyalinizing wall. There were almost no plasma cells outside the follicle. Histological diagnosis was that of HV type CD (Fig. b). The postoperative course was good, there were no complications, and he was discharged home on the fifth postoperative day. The patient is now under follow-up observation with no recurrence seven years after the operation.
HV type CD is common in young people. The most common sites of this disease are in the cervix, mediastinum, abdomen, and retroperitoneum [], but it is very rare in the pulmonary hilum. HV type CD is usually discovered by chance in regular health checkups with almost no accompanying specific symptoms. In radiological findings, enhanced CT shows a contrasted tumor with clear boundaries in general, especially in the HV type. High contrast is promptly recommended for vessel hyperplasia with hyalinizing inside the tumor []. In addition, some reports recently found that FDG-PET sometimes shows light-to-moderate accumulation [–]. However, in any case, the findings are not specific for CD, making it very difficult to reach the diagnosis by radiological findings alone. Moreover, from the reports so far, definitive diagnosis by preoperative biopsy seems difficult [–]. Similarly, the preoperative diagnosis of our case could not be made because of insufficient biopsy specimens for the pulmonary hilar mass.
Keller et al. retrospectively examined six localized HV type CD patients who received partial resection, biopsy, or observation alone. They reported that disease progression was noted at four years after surgery in one patient and, in another patient, complete resection was performed eight years after an initial biopsy and observation following the onset of symptoms []. Moreover, Biçakçioğlu et al. reported that 17 of the 19 CD cases, including seven cases in the pulmonary hilum, in which surgery was performed were localized, and that 15 cases in which complete resection was performed had no recurrence []. Therefore, the recommended treatment strategy for localized HV type CD is complete resection. We found ten cases of resection of HV type CD in the pulmonary hilum in which detailed clinical information including surgical procedure could be obtained from the articles searched with the terms: Castleman’s disease AND pulmonary AND surgery in PubMed (Table ) [–, –]. One case reported by Luo et al. was described as “whole resection” and the details were unknown about surgical procedure []. Lobectomy or more extensive surgery was performed in seven of these nine cases. In only one of seven cases was intraoperative frozen section diagnosis performed []. In three of six cases, lobectomy was performed because malignancy of the tumor could not be ruled out [, , ]. Moreover, in the other case, there was no mention in the article why lobectomy was performed []. If intraoperative frozen section diagnosis was performed on these four cases with benign diseases as in this present case of CD, it may have been possible to select a procedure that would have preserved pulmonary function. Tumor enucleation was performed in two cases. In one of two cases, intraoperative frozen section diagnosis was performed []. We performed only tumor enucleation considering both the localized FDG-PET accumulation and the intraoperative frozen section diagnosis without major bleeding to carefully separate the tumor from surrounding tissue. The patient is now under follow-up observation with no recurrence seven years after the operation.`` |
pmc-6557949-1 | A 91-year-old woman presented with severe abdominal pain and vomiting. She revealed a 12-h history of abdominal pain that had suddenly worsened and was associated with vomiting 1 h prior to presentation. She was otherwise healthy and denied the regular use of any medications.
A physical examination showed a blood pressure of 96/58 mmHg, heart rate of 95 beats/min, respiratory rate of 24 breaths/min, and hypothermia. An abdominal examination showed a diffusely rigid abdomen with rebound tenderness over the entire abdomen and reduced bowel sounds. Contrast-enhanced abdominal computed tomography showed a paraesophageal hernia in which part of the stomach was incarcerated (Fig. ). Free air and ascites were observed in the hernia sac and peritoneal space. The patient developed gastrointestinal perforation-induced peritonitis; however, the association between the incarcerated hernia and the perforation was unclear.
An emergency laparotomy was performed through the upper abdominal midline incision, and we observed that part of the stomach was incarcerated within the paraesophageal hernia sac, which also contained ascitic fluid that appeared like gastric fluid. After reducing the stomach, we detected a perforation measuring 7 cm on the posterior wall of the gastric fundus (Fig. ). The affected part of the stomach showed full-thickness necrosis, for which we performed total gastrectomy with Roux-en-Y reconstruction. During the operation, the patient’s hemodynamics was unstable; thus, hernia repair only involved closure of the orifice, and fundoplication was not performed. The operative time was 3 h 22 min and the amount of bleeding was limited to 104 ml. The resected specimen showed an ischemic necrosis–induced perforation measuring 7 × 4.5 cm on the posterior wall of the gastric fundus (Fig. ). Postoperatively, the patient remained hemodynamically unstable despite maximal resuscitative efforts and died on postoperative day 2.
After the operation, the patient remained hemodynamically unstable despite maximal resuscitative efforts. We considered that the distributive shock was affected by the surgery and sepsis on postoperative day 1. However, her condition deteriorated on postoperative day 2. Although we suspected a major leakage, considering her age and hemodynamics, we did not conclude that reoperation would improve her condition effectively. Thus, we informed her family about her condition and decided on nonoperative management. She died on postoperative day 2. |
pmc-6557958-1 | A 54-year-old Korean male was referred to the uveitis service with the diagnosis of intermittent vitreous hemorrhage of unknown etiology in the left eye for 2 years. A week prior to presentation, the patient sustained trauma to his left arm resulting in a deep vein thrombosis. A thrombolectomy resulted in an incidental diagnosis of diffuse large B cell lymphoma, an activated B cell (ABC) subtype, from axillary lymph nodes. A review of systems revealed no history of severe infections, immunosuppression, nor intravenous drug use.
On presentation, the visual acuity was 20/20 in the right eye and 200E at 1 ft in the left eye. Examination of the left eye was notable for diffuse keratic precipitates and 1+ anterior chamber cell, as well as 4+ vitreous cell with intraretinal hemorrhage (Fig. a, b). Fundus autofluorescence, fluorescein angiography (FA), indocyanine green (ICG, Fig. e–h), and optical coherence tomography (OCT, Fig. a, b) of the left eye were limited due to the vitritis. B-scan ultrasound noted a serous retinal detachment without any retinal breaks (Fig. c). All imaging studies of the right eye were normal. Infectious and inflammatory work-up was negative, including normal CBC, Quantiferon, FTA-ABS, angiotensin-converting enzyme, and Toxoplasmosis IgG and IgM antibodies.
A diagnostic and therapeutic pars plana vitrectomy was performed. An exudative retinal detachment with significant subretinal yellow-white deposits, sclerotic vessels, and intraretinal hemorrhages was noted (Fig. ). No retinal breaks were identified, and no drainage of subretinal fluid was performed. Vitreous samples as well as the cassette were sent for microbiology, cytology, flow cytometry, pathology, and PCR.
Post-operatively, the patient was placed on topical steroids as well as oral valacyclovir. However, all vitreous microbiological studies were negative. Follow-up FA can be seen in Fig. . Pathology specimens demonstrated atypical CD20-positive lymphocytes consistent with large B cell lymphoma (Fig. ). Histology and flow cytometry demonstrated a monoclonal B cell lymphoproliferative process, positive for CD19 and CD20 overexpression. Additional studies can be seen in Table below. On further systemic work-up, orbital ultrasound, MRI of the head, orbit, face, and neck as well as whole body PET scan and cerebrospinal fluid analysis were normal.
The patient underwent intrathecal methotrexate and rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) with simultaneous intravitreal methotrexate (0.4 mg/0.1 ml) and rituximab (1 mg/0.1 ml). After five injections of methotrexate and four injections of rituximab, there was a complete resolution of the exudative retinal detachment as well as resolution of subretinal infiltrate and hemorrhage as seen on fundus photos and OCT (Fig. ) and improvement in best corrected visual acuity to 20/200. |
pmc-6557966-1 | A 43-year-old male patient, with previous history of renal colic, presented to Al-Mowasat University Hospital in 2016 with a chief complaint of colic pain in the left upper quadrant. Physical examination was within normal limits. On ultrasonography (US), the spleen measured 14cm in its greatest dimension. Besides, it showed a hypo-echoic cyst-like mass that measured about 7cm. The patient underwent diagnostic/therapeutic splenectomy. During surgery, there were some adhesions between the spleen and the diaphragm. Afterwards, the resected spleen was sent to the pathology department of the hospital. Macroscopically, the specimen measured (14×10×5) cm, and weighed 355g. On resecting, a gross tumor of (7×6×5.5) cm was noted within the spleen invading the capsule. Histosections were consistent with large B-cell lymphoma. Immunohistological staining was performed and showed the following: large cells were positive for CD20, BCL-2, whereas the surrounding small cells were stained positive for CD3. Based on pathological findings, a diagnosis of T-cell-rich B-cell lymphoma was established. Further staging including peripheral blood smear, bone marrow biopsy and CT scan for neck, chest and abdomen became negative. Thus, the involvement of other sites was ruled out. Later, the patient completed immunochemotherapy courses of R-CHOP. At the time of the follow-up examination 3 years after the initial diagnosis, the patient was alive, well and without evidence of recurrence.
Histopathology sections
The sections revealed splenic tissue with infiltration of red pulp cords, sinusoids and scattered residual white pulp islands by sheets of pleomorphic large cells resembling popcorn cells. These cells had pale and indistinct cytoplasm, vesicular nuclei with small central nucleoli and frequent mitotic figures. There was a background of small lymphocytes and often histiocytes. The tumor cells invaded the spleen capsule. Neither granuloma nor necrosis was observed ().
Immunohistochemistry staining was positive for CD20 on large cells, CD3 on small lymphocytes, BCl2 on large cells, CD30 on some large cells, and CD34 on residual red pulp sinusoids, but negative for both CD15 and EMA (-).
Bone marrow Biopsy
The erythroid, myeloid, megakaryocytic lineages were well differentiated (M/E =5/2). No sign of infiltration, fibrosis, and proliferative disease was observed within BM.
The immunohistochemistry staining revealed positivity for MPO, LCA, CD20, and CD3 within normal distribution (12)
The histopathological sections confirmed the diagnosis of TCRBCL of the spleen. |
pmc-6557967-1 | A 62-year-old male patient with MM IgG kappa, ISS 1, anemia (10.3g/dl [normal range 13.5 – 17-5g/dl]) and two isolated bone lesions in the spine was referred to the cancer center for treatment initiation (laboratory findings [standard values in parentheses]: β2-microglobulin, 3.2mg/l [0.8 – 2.4mg/l]; M-gradient, 0.26g/dl, 4% [0g/dl, 0%]; 90% bone marrow infiltration with plasmatic cells [0.5 – 3.0%]; serum free light chain ratio, 8.72 [0.26-1.65]; body weight: 65 kilogram).
His medical history involved diabetes mellitus, atopic dermatitis and Bechterew´s disease with severe arthrosis of the right hip causing a wheelchair-dependency most time of the day. A noticeable bleeding history was documented: the patient suffered from nose bleeding since he was a child as well as intermittent severe gastrointestinal bleeding episodes due to angiodysplasia in the jejunum and ileum, which were controlled by local endoscopic interventions at accessible sites. However, an open appendectomy as a child and inguinal hernia repair two years ago were performed without major bleeding events. The family history for bleeding disorders was negative. There were no specific findings in the full body examination.
The patient was referred to our department of hemostaseology for further diagnostic workup of the reported bleeding episodes in advance of the planned induction therapy for the MM. The coagulation tests showed VWF: Ag 12% [60 – 150%], VWF: Act < 4% [47,8 - 173,2%], VIII:C 13.6% [68 - 133%], aPTT 51s [25-37sec], bleeding time epinephrin>220sec [84 – 160sec], bleeding time ADP > 227sec [68-121sec]), a reduced platelet aggregation induced by ristocetin of 9% [89-100%] and ADP of 63% [88-100%] and normal levels of coagulation factor IX and XIII. Multimer analysis revealed absence of all proportions of VWF, compatible with type 3 VWD. Administration of VWF concentrate in combination with antifibrinolytics was recommended in case of acute bleeding. Presence of an inhibiting autoantibody against VWF was excluded in our and a reference laboratory.
The patient was treated with four induction cycles of VCD (Bortezomib 1,3mg/m2 d1,4,8,11; Cyclophosphamid 900mg/m2 d1; Dexamethason 40mg d1-12) and one cycle of CAD (cyclophosphamide 1g/m2 d1; adriamycin 15g/m2 d1-4; dexamethasone 40mg d1-4) for stem-cell mobilization, accompanied by standard of care supportive therapy. The patient suffered from two self-limiting mild bleeding events and low-grade polyneuropathy. A cumulative dose of 18250 units (95IE/kg bodyweight per day) of a plasma-derived FVIII/VWF combination concentrate (Haemate P) was administered on three consecutive days for continuous central-line insertion-site bleeding during stem cell collection. The patient achieved a stable disease after completion of the induction therapy.
The patient was re-referred to our department in advance of the planned consolidation therapy for nose bleeding that was not manageable with local compression for more than 24hours. We administered an initial dose of 6000 units (92 units/kg bodyweight) of Haemate P, but low concurrent recovery values with less than 10% VWF: Act three hours after VWF administration (see ) indicated a rapid clearance of VWF. We hypothesized a MM associated AVWD and administered immunoglobulines (IVIg) 1g per kg bodyweight for four consecutive days. A rapid recovery of VWF and reoccurrence of all proportions of VW multimers could be documented on day 2 after one dose of 60g IVIg. In line with the laboratory findings, the formerly uncontrolled nose bleeding stopped after the first IVIg dose. Administration was repeated once (60g IVIg) to maintain normal VWF levels throughout the consolidation therapy (). Impairment of platelet aggregation, however, was not ameliorated by IVIg administration.
Consolidation was performed with high-dose melphalan at a dose of 200 mg per square meter of body-surface area supported with autologous stem cell transplantation (ASCT) using 2.57 x 106 CD34+ cells per kilogram bodyweight (melphalan 100mg/m2 d-3, d-2; stem cell support d0). The patient suffering from neutropenic fever was successfully treated with antibiotics and no bleeding events were identified. An immediate and sustainable rise of VWF and FVIII after ASCT was documented (). In addition, ristocetin-induced thrombocyte aggregation and in-vitro bleeding time normalized 5 weeks after ASCT. The patient achieved a partial remission according to the international response criteria evaluated 9 weeks after consolidation therapy. Coagulation factors were normal at last follow-up, 40 weeks after ASCT. There were no clinical signs or symptoms of bleeding. |
pmc-6558170-1 | The patient, a 43-year-old man with no prior medical history, who worked as a veterinarian, was admitted to the critical care department of Qilu hospital of Shandong University (Jinan, China) due to high-grade fever of 11 days' duration, headache of 9 days' duration and tonic-clonic seizures as well as coma of 8 days' duration. His hands were punctured by a knife used during the autopsy process of dead swine 4 days before his initial symptom (fever) occurred. At the 3rd day after the initial symptoms, he developed status epilepticus and coma, requiring endotracheal intubation, treatment with intravenous midazolam as well as valproate, and he was treated in the intensive care unit (ICU) of the local hospital for 8 days. Lumbar puncture indicated an opening pressure of 230 mmH2O (80–180 mmH2O). However, the patient could not provide other detailed results from CSF (cerebrospinal fluid) and serum. On the 4th day after initial symptoms, plain CT (computer tomography) brain imaging was normal (). On 8th day after initial symptoms, plain CT brain imaging showed hypo-density in the bilateral basal ganglia, bilateral occipital lobe and left limbic lobe (). With the suspicion of viral encephalitis, he was started on antiviral therapy (Ribavirin), immunoglobulin and corticosteroids treatment (Methylprednisolone) along with antibiotic therapy (Meropenem and Linezolid) on an empirical basis in the local hospital. He was transferred to our hospital for concerns of infectious etiologies and was immediately empirically started on meropenem, linezolid and acyclovir (10 mg/kg/8 h). On examination during his admission to our hospital, his Glasgow Coma Scale (GCS) was 3/15 (Eye-opening, 1/4; Motor response, 1/6; Verbal response, 1/5). Although he had neck stiffness and Kernig signs, long tract signs, such as hyperreflexia, Hoffman's signs as well as Babinski signs, were not detected. Examination of his cardiovascular, respiratory, and abdominal systems was normal. His vital signs included blood pressure (BP) of 120/70 mmHg, heart rate 100 bpm, temperature 38°C, and SpO2 99% on inspired oxygen at 35% with mechanical ventilation. In addition, spontaneous breaths were not detected. All antibiotics were discontinued at the 3rd day of treatment at our hospital and only antiviral therapy [acyclovir (10 mg/kg/8 h)] was preserved, for a total of 2 weeks. After 1 month of treatment, he was still dependent on tracheostomy and gastrostomy tubes, but has been weaned off mechanical ventilation. The patient was voluntarily discharged to another hospital for further rehabilitation of neurological function. |
pmc-6558230-1 | We report a case of a 37-year-old previously healthy expatriate male, who presented to the emergency department with scalp swelling since four months.
He was referred to surgery out-patient clinic for assessment of the scalp swelling. He presented to Surgery outpatient clinic after a lapse of four months due to unspecified reasons.
The swelling was gradually increasing in size, associated with mild pain. The patient had no history of trauma, fever, weight loss or any other associated symptoms. Past medical, surgical and family history were negative for any malignancy. He was a nonsmoker, nonalcoholic who worked as a laborer.
On examination, there was a solitary scalp swelling () measuring 7 × 7 cm in size, with a crusted surface. It was a spherical, smooth, subcutaneous lesion on the scalp at the back of the head, 6 cm posterior to left mastoid process. The lesion was tense, freely mobile. It was non-pulsatile, non-compressible, non-reducible and was not trans-illuminating. There was no clinically evident lymphadenopathy. Neck and throat examination was unremarkable. No other abnormal findings were identified.
The provisional diagnosis of sebaceous cyst was made with differentiation diagnoses of dermoid cyst or scalp lipoma.
Urgent CT scan head was done to rule out any intracranial extension as seen in cases of dermoid cysts, which showed 7 × 3.6 × 7.7 cm subcutaneous extracranial cystic lesion with no intracranial extension ().
The swelling was increasing in size with passage of time of almost eight months from the initial detection by the patient. The possibility of primary malignant lesion or malignant transformation of a benign cyst would have been one of the differentials. The patient’s delayed presentation first to ED and then to surgery OPD prompted the surgery team as crucial factor in posting the patient for urgent excision. Nevertheless, the possibility of malignant lesion was kept in mind during the operation.
Intraoperatively, the patient was found to have a left parietooccipital extracranial scalp lesion with both cystic and soft tissue components, infiltrating the galea aponeurotica and surrounding muscles. Efforts were made for complete excision of the mass, and primary closure was done.
The entire specimen was sent for histopathological examination. The specimen comprised of several fragments of tissue and pieces of skin. The sections showed fragments of cyst wall lined by malignant squamous epithelium with no benign epithelial component identified (A–C). Foci of dermal invasion with desmoplastic stroma reaction were seen. The histopathological differential diagnosis included a CPDSCC, malignant PTT and trichilemmal carcinoma. Given the poorly differentiated nature of the epithelium and lack of a benign cyst component, the diagnosis of cystic poorly differentiated squamous carcinoma was favored.
The patient was discussed in skin multidisciplinary team (MDT) meeting. PET scan and neck ultrasound were performed to examine for disease extent.
Re-excision and reconstruction were performed after a negative PET scan and ultrasound of the neck. The histopathology showed no residual tumor. Post-op, the patient did well ().
Long-term follow-up was not possible, as the patient left for his native country. |
pmc-6558365-1 | An 8-years-old boy presented with high fever, photosensitivity, and hypersensitivity to mosquito bites and then received the diagnosis of NK-cell-type CAEBV. These manifestations have gradually relieved until 12 years of age. The comprehensive genetic analysis of peripheral blood-derived DNA revealed one reported pathological mutation of SH2D1A gene hemizygously (c. 7G > T, p.Ala3Ser) (, ). During the following 13 years, he has continued to have photosensitivity alone. Repeated laboratory tests have shown unremarkable titers of anti-EBV antibodies indicating past infection and low titer of EBV genome copies in peripheral blood (7.3 × 102/ml), with no any evidence of cytopenia, dysgammagulobulinemia, or elevation in soluble interleukin (IL)-2 receptor. |
pmc-6558365-2 | A 2-years-old boy had suffered from intermittent fever, diarrhea, and hypersensitivity to mosquito bites. An EBV genome load was high in CD19+ B cells (5.6 × 103 copies/μgDNA) and slightly positive levels in CD16+ NK cells (8.1 × 101 copies/μgDNA). The comprehensive genetic analysis of peripheral blood-derived DNA determined a reported hemizygous variant of XIAP gene (c.1045_1047delGAG, p.Glu349del) (, ). NK cell activity was 18 %lysis (reference range; 18–40). After the diagnosis of chronic EBV+B-LPD, four courses of anti-CD20 antibody (Rituxan®, Chugai Pharmaceutical Co., LTD., Tokyo, Japan) therapies led to a complete disappearance of the EBV genome in circulation and an improvement in hypersensitivity to mosquito bites. Six months after rituximab therapies, a reappearance of B cells in the peripheral blood without the detection of EBV genome indicated the eradication of EBV-B-LPD. However, EBV genome level was again positive (1.5 × 103 copies/μgDNA of whole peripheral blood) 10 months after rituximab therapy, but there were no symptoms or abnormal data, including immunoglobulin levels, in the follow-up screening tests. |
pmc-6558365-3 | A 1-year-old boy developed fever, skin eruptions, and hepatoplenomegaly with pancytopenia, hyperferritinemia (5,181 ng/ml), and elevated soluble IL-2 receptor (6,797 U/ml). Anti-EBV antibodies indicated a primary infection of EBV. High EBV loads in peripheral blood and CD8+ T cells of the patient (1 × 105 copies/ml and 1 × 106 copies/μgDNA, respectively) led to the diagnosis of EBV-HLH. NK-cell activity was 30 %lysis in normal (reference range; 18–40). Additional two courses of etoposide injection (100 mg/m2) were needed to control the relapsing HLH after the immunomodulation therapy using high-dose intravenous immunoglobulin, oral cyclosporine, and prednisolone. Circulating levels of EBV genome came to be undetectable after the immunochemotherapy. The comprehensive genetic analysis of peripheral blood-derived DNA determined a hemizygous variant of the XIAP gene (c.1045_1047delGAG, p.Glu349del). He is alive and well, without sequelae or dysgammaglobulinemia at 7 years of age. The numbers of CD19+IgD−CD27+ switched memory B cells and CD4+CD45RA−CXCR5+ follicular helper T cells were not decreased (data not shown). |
pmc-6558365-4 | A 24-years-old woman was hospitalized because of dyspnea and hoarseness. The patient had received the diagnosis of NK-cell and CD4+ T-cell-type CAEBV because of recurrent fever and hypersensitivity to mosquito bites at age 14 years. Histopathological and molecular studies of the cutaneous lesion indicated clonal proliferation of EBV-infected cells. Thereafter, clinical resolution and declining levels of EBV load in circulation had allowed no treatment and observation. After admission, an urgent tracheostomy prevented airway obstruction by the laryngeal mass (). She was then transferred to our hospital for further management. Fluorodeoxyglucose-positron emission tomography (FDG-PET) showed increased levels of uptake in the stomach and terminal ileum as well as the laryngeal lesion (). Circulating EBV DNA was at undetectable levels. However, histopathological and molecular analysis of the laryngeal lesions demonstrated a proliferation of EBER-positive CD4+ cells and increased copy number of EBV-DNA (2–4 × 103 copies/μgDNA). The comprehensive genetic analysis of peripheral blood-derived DNA identified a heterozygous variant of XIAP gene (c.1045_1047delGAG, p.Glu349del) alone. A histocompatible sister aged 20 years carried the same XIAP variant. The anti-EBV antibody titers and undetectable EBV DNA in circulation verified a past infection of EBV in the healthy sister. The gene expression analysis indicated no skewing inactivation of X chromosome among DNA samples obtained from the bone marrow cells, PBMCs, and laryngeal tumor of the patient as well as PBMC of the sister (data not shown). After four courses of combined chemotherapies with cyclophosphamide, pirarubicin, vincristine, steroid, and etoposide (CHOP-VP), the patient underwent bone marrow transplantation from the sister. The laryngeal lesion disappeared after a compete donor chimerism was achieved (). However, systemic but not local proliferation of EBV-infected donor-derived CD4+ T cells (1 × 104 copies/ml of whole peripheral blood and 3 × 103 copies/μgDNA of CD4+T cells, respectively) developed 2 months posttransplantation (). Discontinuation of immunosuppresants and donor lymphocyte infusions effectively controlled the posttransplantation LPD, but she died of uncontrollable severe graft-vs.-host-disease with Candida sepsis.
None of the four patients had a positive family history suggesting PID and/or chronic EBV disease. The clinical profile and treatment course of these patients are summarized in . |
pmc-6558454-1 | The first case was of a man in his 80s with squamous cell lung cancer of the right upper lobe (Fig a). The tumor was cT2aN0M0 stage IB according to the Union for International Cancer Control (UICC) 7th edition. We decided to administer TRT at a total dose of 60 Gy in 12 fractions (Fig b). Twelve months after TRT, tumor regrowth was observed, and the patient was administered nivolumab at a dose of 3 mg/kg (170 mg). After 13 courses of nivolumab (24 months after TRT), the patient experienced discomfort in the anterior chest. A diagnosis of grade 3 OP was made (Fig c). |
pmc-6558454-2 | The second case was of a man in his 70s with squamous cell lung cancer of the right lower lobe. He underwent surgery for pT3N1M0 stage IIIA NSCLC. However, mediastinum lymph node metastasis developed near the surgical area after neoadjuvant chemotherapy (Fig a). He was administered TRT at a total dose of 45 Gy in 15 fractions (Fig b). One month after the completion of three-dimensional conformal radiotherapy (3D-CRT), nivolumab was administered at 3 mg/kg (240 mg). After the first nivolumab treatment (2 months after 3D-CRT), the patient presented with a dry cough and dyspnea. A clinical diagnosis of grade 3 OP was made (Fig c). |
pmc-6558454-3 | The third case was of a man in his 60s who had an unknown pathological type of cancer in the right hilum (Fig a). He was diagnosed with cT4N2M0 stage IIIB NSCLC. He was administered three courses of neoadjuvant chemotherapy to reduce the radiation field and then received 3D-CRT at a total dose of 60 Gy in 30 fractions (Fig b). Fourteen months after 3D-CRT was completed, right pleural effusion had increased and tumor regrowth was observed. Thus, nivolumab was administered at 3 mg/kg (153 mg). Twelve months after the first nivolumab administration (27 months after 3D-CRT), a diagnosis of grade 2 OP was made (Fig c). |
pmc-6558493-1 | A 66-year-old woman had a parasagittal meningioma found incidentally (Figure A). The tumor was accompanied by extensive invasion into the superior sagittal sinus and the skull (Figure B), with peritumoral edema (Figure C). Although the preoperative diagnosis was a meningioma of WHO Grade II or higher, the intraoperative frozen-section indicated a diagnosis of benign meningioma of WHO Grade I. The intraoperative iFC revealed relatively low PI (Figure D, 4.8%). Due to severe adhesion, some small pieces strongly adhering to the cortical arteries and veins were therefore intentionally left. Postoperative immunohistochemistry showed low MIB-1 LI (2.3%; Figure E). The patient was discharged with mild weakness in the right leg. Follow-up MR images obtained at 3 years after the surgery showed no sign of recurrence. |
pmc-6558493-2 | A 56-year-old man suffered from generalized seizure and was diagnosed with an irregularly shaped sphenoid ridge meningioma on the left side. During surgery, iFC indicated that the PI of the specimen obtained from the dural attachment (Figure A, circle) was elevated to 14.5% (Figure B). In contrast, the PI of the specimen from the part encasing the middle cerebral artery (MCA) bifurcation (Figure A, arrowhead) was much lower (3.0%) than that of the attachment (Figure C). Because the tumor was severely adhered to the MCA bifurcation, this small residue was left to avoid major neurological deficits (Figure D, arrow). Postoperative histological diagnosis was atypical meningioma of WHO Grade II. The MIB-1 LI was 25.0% at the attachment (Figure E) and 2.0% near the MCA bifurcation (Figure F). After adjuvant radiation to the attachment and residual mass, the patient was discharged with no neurological deficit. No tumor growth was observed during a 1.5-year follow-up. |
pmc-6558516-1 | A 5-year-old boy presented to the emergency room with epistaxis following an impacted pencil over the left nostril. He admitted to inserting the blunted end into his left nostril and was pushed by his sibling from behind. He fell forward on his face causing impaction of the pencil into his left nostril. His mother claimed that they have successfully pulled out the pencil and the epistaxis subsequently resolved. Upon review, he was hemodynamically stable, alert and conscious. Anterior rhinoscopy showed part of the pencil shaft embedded in the left nasal cavity. The child was however uncooperative for further assessment of the extent of the injury. Otherwise, there was no external wound and deformity over the craniofacial region, bilateral eye examination and neurological examinations were unremarkable. Radiograph of the skull (Figure 1) showed faint pencil shadow over the left nasal cavity projecting towards the anterior skull base.
He was brought into the operating theatre for examination under anesthesia. Intraoperatively, the pencil was impacted firmly in the left nostril and nasal septum (Figure 2). The pencil was removed with ease using a Tilley's forceps. There was a posterior nasal septal perforation following the removal of the pencil. The embedded pencil measured 8 cm in length and 1 cm in diameter (Figure 3A). An indentation mark with part of the lacerated septal cartilage was found covering the anterior skull base. Pulsatile clear fluid from the skull base was demonstrated immediately after removal of the pencil further which confirmed the skull base fracture with CSF leak (Figure 3B). We postulated that the blunt end of the pencil served as the entry point via left nostril, penetrated the nasal septum with the extension of the injury to the anterior skull base.
After removal of the foreign body, the CSF leakage was repaired with autologous graft by placing the septal cartilage and abdominal fat on to the defect until the CSF leakage ceased. The septal mucosal graft was repositioned on top of the fat graft and covered with Gelfoam and tissue glue.
Post-operatively, he was ventilated for 24 hours and kept under bed rest with intravenous ceftriaxone administered for one week in view of overwhelming intraoperative findings. Computed Tomography (CT) scan of the brain, skull base and paranasal sinuses post-operatively showed right cribriform plate fracture with small pneumocranium (Figure 4). No evidence of intracranial hemorrhage was seen. Post-extubation, his pupils were equal and reactive bilaterally with no neurological deficits. The neurosurgical team suggested for conservative management. He was discharged well one-week post-surgery. Subsequent nasendoscopy during regular outpatient visits up to one year did not show any CSF leak. |
pmc-6558585-1 | A 55-year-old male patient presented to local hospital for an enlarged sub-mandibular lymph nodes with no pain in 2006, and no further examine and treatment were taken. Two years later, the patient referred to the hematology department of our hospital because of progressive systemic lymphadenectasis, splenomegaly, and thrombocytopenia without fever. The count of white blood cells (WBC) and lymphocyte in peripheral blood (PB) was 30 × 109/L and 10 × 109/L, respectively. The phenotype of malignancy of bone marrow (BM) was CD20(+), CD23(+), CD5(+), CD3(−), TdT(−), MPO(−). Finally, the patient was diagnosed as CLL, Rai stage IV, in 2008. Earlier, the patient responded to FC (Fludarabine, CTX) regimen, and then failed to response to the alternate regimen, as shown in Figure . In December 2014, the patient suffered from a systemic lymph node enlargement and systemic symptoms (B-symptoms), including weight loss, fever and night sweats. Immunohistochemical assay revealed the lymphoma cells were CD19(+), CD20(+), CD79a(+), BCL-2(+), BCL-6(−), CD10(−), CD43(+), Mum-1(−), CD5(−), CyclinD(−), Ki-67(30% +). A disappearance of lymphatic structure and diffuse proliferation of medium-sized lymphoid cells were found in lymph node. The patient was diagnosed as DLBCL (Non-germinal center B-cell type, Non-GCB) transformed from CLL, also known as RS. Figure reveals the transformation of the RS patient from CLL to DLBCL. After receiving a series of treatments but did not achieved a satisfactory therapeutic effect, the patient was enrolled in our ongoing CART-19 clinical trial. The details of therapeutic process of the patient suffering RS are summarized in Figure .
Following the protocol of CART-19 clinical trial, the patient received pretreatment of FC (Fludarabine, 30 mg/m2, 3 days; CTX, 60 mg/kg, 3 days) without severe side effects, such as inflammation of urinary and digestive tracts, edema. Peripheral neuropathy was also monitored. And then, 3.55 × 108 autologous CART-19 cells infusion were separated three times, 20% of CART-19 cells infused on day 0, 30% on day +1, the rest 50% was infused on day +2. |
pmc-6558603-1 | Our report refers to a 46-year-old female patient who presented to our hospital. She had noticed a firm, space-occupying lesion in the left cervical soft tissue that had been increased in size slowly over a period of several months. According to the patient, a cervical lymph node biopsy had been performed in the same localization 12 years ago. Apart from a nonspecific inflammation, the course had been inconspicuous. In the clinical examination, the cervical mass was palpable. It felt firm and could be moved independently of the skin, but not independently of the cervical soft tissue. Ultrasound revealed a solid structure with complete dorsal acoustic attenuation. Computer tomography of the cervical soft tissue showed a solid structure measuring approx. 24 × 21 × 33 mm, which seemed to be consistent with a calcification and which had no contact to adjacent bony structures (see ). Intraoperatively, a hard, bony, smoothly covered mass with a largest diameter of approximately 4 cm was completely extirpated, with primary closure of the wound. Postoperative healing was free of complications. The formalin-fixated specimen had size of 37 × 22 × 22 mm, and the weight was 12 g (see ). Histopathology of the specimen processed with a haematoxylin and eosin staining revealed a round, bony mass smoothly covered by a narrow lamella of connective tissue. Beneath the surrounding compact bone, the structure consisted of cancellous bone tissue with regular medullary cavities enclosing yellow marrow, as well as differently sized areas of mature hematopoietic bone marrow, suggesting an ectopic formation of regularly differentiated bone tissue (see ). |
pmc-6558605-1 | A 21-year-old Kazakh man was referred to the National Research Center for Oncology and Transplantation in Astana, Kazakhstan, in October 2017 because of portosystemic shunts secondary to portal vein thrombosis. The past medical history did not reveal abdominal trauma, previous surgery, omphalitis, gastrointestinal bleeding, or hepatitis. The patient had been healthy until March 2017, when he developed lumbar pain, malaise, peripheral oedema, and nausea and began to lose weight. In May 2017, he felt right upper quadrant discomfort and developed abdominal distension; an abdominal ultrasound revealed splenomegaly and ascites. Liver cirrhosis was suspected. Alanine aminotransferase and aspartate aminotransferase levels were within the normal range; HBsAg, anti-HCV, and tumour markers (CEA, Ca19-9, and alpha- fetoprotein) were negative, total protein and albumin levels were reduced (49.2 g/L and 22.6 g/L, respectively), and total cholesterol increased (6.6 mmol/L; normal 3.1-5.2). Urea, creatinine, and electrolyte levels were normal. An EGDS showed superficial distal gastritis; oesophageal or gastric varices were not detected.
In June 2017, an abdominal CT scan confirmed the presence of splenomegaly and mild ascites and detected voluminous paraoesophageal varices, left splenorenal shunts, and hepatomegaly. A Doppler ultrasound of the liver showed no flow in the portal vein and its branches and enlarged splenic vein (diameter 1.7 cm) with laminar blood flow. The patient received a provisional diagnosis of portal vein thrombosis and was started on IV heparin, which was stopped four days later because of worsening thrombocytopenia. Further serologic tests revealed subclinical hypothyroidism and hypergammaglobulinemia (25.8%); ANA and AMA were negative. A urine test showed proteinuria (1.3 to 2.0 g/L) and microscopic haematuria (18-22 RBC/high power field). The patient was started on spironolactone 100 mg/day and torasemide 5 mg/day.
In October 2017, he was admitted to the National Research Center for Oncology and Transplantation and underwent mesentericoportography, which showed hepatic arterial buffer response, an indirect sign of reduced or absent blood flow in the portal vein. An abdominal ultrasound did not visualise the portal vein and showed an enlarged spleen. Lab tests revealed mild leukopenia (3.6 WBC/μL), normocytic normochromic anaemia (Hb 9.8 g/dL), thrombocytopenia (80,000 platelets/μL), proteinuria (2.1 g/L), and microscopic haematuria. Further tests revealed that the patient was heterozygous for both factor V Leiden (FV) and methylenetetrahydrofolate reductase (MTHFR) genes; methionine synthase (MTR) A2756G mutation was not detected. IgM and IgG anticardiolipin antibodies and antiphospholipid antibodies were negative, and homocysteine levels were normal.
A revision of the images of the CT scan performed in June 2017 revealed voluminous collaterals between the left renal and the splenic veins, paraoesophageal varices, dilatation of the superior mesenteric vein with lack of visualization of the intrahepatic portal branches, dilatation of the left renal vein with a possible filling defect, and enlarged left kidney ().
In May 2018, the patient was admitted to another hospital where an echocardiography showed global enlargement of the cardiac chambers and hypertrophy of the posterior wall of the left ventricle (1.3 cm) with normal ejection fraction, II degree mitral valve regurgitation, I degree aortic regurgitation, and no signs of pulmonary hypertension. Arterial blood pressure monitoring revealed Max BP – 173/86 mm Hg, Average BP - 145/73 mm Hg, max BP (night) 141/70 mm Hg, and average BP (night) – 122/57 mm Hg. Indices of average BP were elevated during night and day, being 92% and 58%, respectively. A kidney biopsy showed moderate to severe mesangial hyper cellularity, dilation of mesangial matrix with focal lymphocytic stasis in the capillary space, basal membrane thickening of capillary loops with well-defined fuchsinophilic granules and focal total glomerulosclerosis (16%), grade II epithelial renal tubular dysplasia, diffused moderate fibrosis of the interstitium, tubular atrophy, intimal fibrosis, and hypertrophy of the arterial muscle layer of middle calibre with narrowing of one artery to 1/3 (Figures and ). A diagnosis of membranoproliferative glomerulonephritis was made and the patient was started on methylprednisolone (64 mg/day, tapering down to 16 mg/day maintenance dose) and perindopril 10 mg/day. Unfortunately the response to treatment was not optimal, leakage of ascitic fluid from the umbilicus developed, and further deterioration of the renal function led to haemodialysis. No episodes of bleeding or clinically symptomatic thrombosis occurred after the diagnosis. |
pmc-6558607-1 | A 45-year-old woman, on a regimen of steroids for a diagnosis of Behçet's disease or systemic lupus erythematosus, was admitted with pyrexia, cough, and worsening dyspnea of a week's duration. She had a history of small bowel resection for intestinal necrosis and had been on parenteral nutrition since then. She presented a fever of 39.1°C, tachycardia of 116/min, and hypoxia with oxygen saturation of 94% in nasal oxygen cannula. A grade 3/6 regurgitant diastolic murmur was heard in the left third intercostal space on auscultation. She soon fell into respiratory failure and was immediately supported by mechanical ventilation. The ratio of the arterial oxygen pressure and the fraction of inspired oxygen (PaO2/FiO2) was initially calculated as 105. Chest radiography and computed tomography revealed diffuse extensive consolidation in bilateral fields corresponding with DAH (). This diagnosis was confirmed by bronchoalveolar lavage with increasing bloody secretion in three consecutive aliquots. In a peripheral blood examination, the white blood cell count was 11,540/mm3, hemoglobin 6.6 g/dL, and platelet count 132,000/mm3. Aspartate aminotransferase, alanine aminotransferase, and lactate dehydrogenase were 18, 16, and 164 IU/L, respectively. Renal function was slightly affected, with a creatinine level of 1.5 mg/dL. C-reactive protein was elevated to 12.3 mg/dL. Blood cultures afterward grew Staphylococcus warneri. Echocardiography showed aortic regurgitation and a mobile vegetation of 15 × 9 mm in size on the commissure between the left and right coronary cusps. Left ventricular function was preserved with an ejection fraction of 62%. The patient was diagnosed with bacterial endocarditis [] complicated with respiratory distress related to the DAH.
At this point, she was judged not to tolerate cardiac surgery because of the exacerbating bleeding and respiratory failure related to heparinized extracorporeal circulation. The management plan was as follows: (1) antibiotic and inotropic therapies with diuretics for the bacterial endocarditis and heart failure, (2) steroid pulse and hemostatic drug therapies for DAH, and (3) postponement of cardiac surgery until sufficient improvement in respiratory function unless circulation collapses. Nevertheless, the respiratory function initially made little improvement despite adequate cardiac condition. Because the clot in the alveolar space could not be excreted in the usual supine position, a tracheotomy followed by aggressive positional changes to include an abdominal position was planned. The tracheotomy was performed on hospital day 12. Thereafter, respiratory function gradually improved although mechanical ventilation was still needed, and the PaO2/FiO2 ratio reached 356 on hospital day 31. Methylprednisolone was then adjusted to a maintenance dose of 40 mg/day, and daptomycin was administered at 210 mg/day. The white blood cell count was 8,210/mm3 with a shift to the left, and C-reactive protein was 10.2 mg/dL. Repeated echocardiography revealed worsening aortic regurgitation suggesting the disruption of the commissure between the left and right coronary cusps and the mildly enlarged vegetation. We decided to perform the valve surgery in this timing when the respiratory distress improved.
J shaped partial sternotomy was performed between the second intercostal space and the xiphoid process. A cardiopulmonary bypass was equipped with right femoral artery perfusion and right atrial drainage. A 19 mm St. Jude Medical mechanical prosthesis (St. Jude Medical, St. Paul, MN, USA) was inserted with subannular reinforcement [] using a rifampicin-soaked woven Dacron graft (Vascutek, Terumo, Inchinnan, UK) to prevent valve detachment associated with Behçet's disease. Respiratory function was well maintained, and mechanical ventilation support was discontinued on the seventh postoperative day. The control of infection was satisfactory. The patient was discharged home following closure of the tracheotomy. Methylprednisolone therapy was continued at the maintenance dose of 40 mg/day during the operative and postoperative days. Daptomycin was also used at the same dose of 210 mg/day, and ampicillin sodium/sulbactam sodium was added only on the day of operation. |
pmc-6558611-1 | A 62-year-old otherwise healthy woman presented with three to four months of mechanical right groin pain radiating to the right buttock. She had a history of a benign soft-tissue mass in the right thigh that had been biopsied 10 years earlier, and the patient was told it was a myxoma. No other workup was done at the time, and no other lesions were clinically detectable. She had been very active and played tennis regularly. She was assessed with a hip ultrasound for her right groin pain and was prescribed physiotherapy. During physiotherapy, she felt a snap in her right groin and was no longer able to ambulate without a walker. Initial radiographs demonstrated a lucent intramedullary lesion within the subtrochanteric region—further characterized by a focally aggressive appearance with cortical destruction and lytic expansion of the lesser trochanter (Figures and ). A ground-glass appearance, typical of fibrous dysplasia, was also noted in the mid-femoral shaft ().
Further workup included a Computed Tomography (CT) scan of the chest, abdomen, and pelvis which showed multiple hepatic and renal cysts but no evidence of a primary carcinoma or lung metastases. Bloodwork including serum protein electrophoresis was normal. A Total Body Bone Scan (TBBS) revealed increased uptake in the right proximal femur and two areas of relatively mild uptake in the mid femur. Fat-suppressed T2 Magnetic Resonance Imaging (MRI) displayed an intermediate to high signal lesion within the medullary cavity of the proximal and mid right femoral shaft (). In line with the initial radiographs in which two benign sites of fibrous dysplasia were noted, in the third proximal lesion, there was cortical destruction with an extraosseous soft-tissue mass in the region of the lesser trochanter. Additionally, in keeping with the known myxoma, a soft-tissue T2 hyperintense mass within the medial distal thigh was also present (). On further review of the MRI images, five other myxomas were seen. The imaging features were consistent with Mazabraud's Syndrome, with sarcomatous transformation of benign fibrous dysplasia in the proximal femur.
Due to the high risk of fracture, the patient was immediately placed on bedrest and a biopsy was not performed—as a preventative measure to reduce fracture risk. She was taken to the operating room and underwent wide resection of the proximal right femur with endoprosthetic reconstruction via a lateral approach. Along with bony specimens, one of the soft-tissue masses was also excised and sent to pathology for investigation (Figures and ). Pathology later confirmed a high-grade osteosarcoma in the setting of fibrous dysplasia and a benign myxoma (Figures –). There were no complications during the procedure.
Postoperatively, the patient stayed in the hospital for one week, with physiotherapy beginning on postoperative day one. Her postoperative course followed the normal trajectory of recovery with no major complaints or issues at her two-week follow-up. The patient declined adjuvant chemotherapy. The standard management of osteosarcoma at our center would include wide surgical excision with neoadjuvant or adjuvant chemotherapy (methotrexate- and doxorubicin-based multidrug regimens). The patient is being followed to assess for complications and local or systemic relapse every three months with radiographs of the femur and chest. At one year postoperatively, there have been no complications or evidence of disease relapse. |
pmc-6558625-1 | A 21-year-old woman sought care to replace the resin restoration of her fractured anterior tooth. The existing restoration had a poor color match and excess material (). Considering the age of the patient, the possibility of reversibility of the procedure, the time, and the cost, a direct adhesive restorative system was planned to restore the tooth.
After prophylaxis, the dentin and enamel color were selected using the Essentia, GC, resin system. For enamel color selection, each of the two enamel colors (light enamel and dark enamel) were placed on the tooth and polymerized (). The light enamel replicated the patient's tooth best. The dentin color was selected by applying the three dentin colors (light dentin, medium dentin, and dark dentin) on the patient's tooth and polymerizing. Light dentin was selected ().
After making a silicone putty matrix, the existing restoration was removed with abrasive disks (Sof-Lex, dark red, 3M; thick granulation). A beveled margin was made with the same disk (). The operative field was isolated and the gingiva displaced with ligated rubber dam (). The adjacent teeth were protected with polyester tape. The enamel surface was conditioned with 37% phosphoric acid (), and the adhesive (G-BOND, GC) was then applied on the facial and lingual surfaces () and polymerized according to the manufacturer's instructions.
The silicone matrix was positioned lingually to provide a well-contoured restoration (). Resin matching the lingual enamel was applied with the matrix in position (LE). After polymerization of this increment with the matrix in position, the lingual and incisal contour was established (). Dentin resin was then applied to the middle third (LD), leaving room for the creation of a dentinal lobe in the incisal region (). The incisal halo was made by using the opalescent translucent resin of the OM system (), followed by a layer of white stain on that halo to simulate the opacity of this region (). The dentin mamelons were made with clear resin (), and opalescent resin was applied between the mamelons (). The enamel layer was applied to the facial surface and spread with the aid of a polyester strip and brush (Kota 4A) ().
Each increment was polymerized with an LED unit (Radii-cal, SDI) for the time recommended by the manufacturer. After removal of the rubber dam, any excess was removed, and the incisal edge adjusted.
In the following appointment, the restoration was finished and polished with sequential grit abrasive disks (Sof-Lex Pop-on, 3M). Rubber points and composite polishing paste applied with a felt disk were used to obtain the final gloss (). The final restoration can be seen in Figures and . The definitive appearance of the restored smile can be seen in . |
pmc-6558627-1 | A 61-year-old woman with Hashimoto's thyroiditis was hospitalized for new-onset hypokalemia two weeks following initiation of hydrochlorothiazide. Five years earlier, the patient had been diagnosed with a metastatic lung neuroendocrine tumor, while imaging for chronic cough revealed a lung lesion, subcarinal lymph node, and liver nodule. Follow-up PET scan had shown FDG avidity at those sites without brain involvement. Subcarinal node biopsy showed malignant cells with neuroendocrine features including nuclear molding, “salt and pepper” chromatin, and apoptosis. Immunohistochemical staining was positive for chromogranin, synaptophysin, and CD56, with an initial Ki67 index <5%. Plasma chromogranin A was 120 ng/mL (0-95 ng/mL). Morning cortisol and ACTH were normal at 9.3 mcg/dL (5.0-25.0 mcg/dL) and 19 pg/mL (6-58 pg/mL), respectively. Treatment with temozolomide and capecitabine was initiated with near resolution of the liver metastasis and stable disease was achieved for 2 years. However, disease progression characterized by new dedifferentiated metastases (Ki-67 index > 20%) to the liver, vertebra, brain (parietal region), shoulder soft tissue, ovary, and orbits subsequently occurred. Sequential treatment with radioembolization of hepatic metastases, octreotide, gamma knife, everolimus, and lanreotide was pursued over the course of 3 years.
On the day of admission, the patient presented from home with diffuse pain, chronic fatigue, and weakness. She denied fevers, chills, weight changes, and easy bruisability and had no history of recent fractures. Exam revealed an ill-appearing woman with a BMI of 27.8 and normal vital signs. She was not overtly Cushingoid; there was no facial plethora, supraclavicular/dorsocervical fullness, acanthosis, hirsutism, striae, or ecchymoses. Proximal muscle weakness, trace pretibial edema, and 1+ reflexes without delayed relaxation were noted. Laboratory evaluation demonstrated hypokalemia, metabolic alkalosis, mild hypernatremia, elevated hemoglobin A1c, transaminitis, elevated alkaline phosphatase, and hypothyroidism (). Morning cortisol was 48 mcg/dL (4.8-19.5) and was 61 mcg/dL after a 1 mg dexamethasone suppression test (<1.8). ACTH was 141 pg/mL (6-58) and urinary free cortisol was 7544 mcg/24h (<45). MRI showed multiple new orbital and brain metastasis, including a new 0.97 x 0.74 cm sellar/suprasellar lesion involving the pituitary stalk. The patient was found to have diabetes insipidus and treated with nightly desmopressin.
Although pituitary Cushing's was a possible diagnosis when considering a sellar/suprasellar lesion and a high plasma ACTH level in isolation, the patient had several features that pointed away from Cushing's disease and towards EAS: she had rapid onset of symptoms, severe hypokalemia, and an extremely high urinary free cortisol level (7544 mcg/24h). Furthermore, the appearance of the sellar/suprasellar lesion late in the timeline after spread of the lung NET to other regions of the body, the lesion's involvement of the pituitary stalk, and the patient's diabetes insipidus all strongly suggested that it was a metastasis of the NET. We did not perform inferior petrosal sinus sampling because of low clinical suspicion for Cushing's disease and because the patient was too ill to undergo this procedure.
Given high suspicion for EAS, plasma POMC and AgRP were measured as part of a Columbia University Medical Center IRB-approved research protocol in patients with ACTH-dependent Cushing's syndrome []. POMC was measured using an immunoradiometric assay (IRMA) that detects POMC (31-kDa) and pro-ACTH (22-kDa) but not ACTH or other ACTH precursors, as previously described [], and AgRP was measured by ELISA []. POMC level was 80 fmol/mL (7-32 fmol/mL) and AgRP level was 884 pg/mL (42-118 pg/mL), supporting the diagnosis of EAS [].
Hydrochlorothiazide was discontinued but hypokalemia requiring 120-200 mEq of daily potassium chloride repletion persisted until spironolactone was uptitrated to 50mg twice daily. Home levothyroxine was increased from 50 to 75mcg daily. Ketoconazole was deferred in the setting of diffuse hepatic metastases. Metyrapone was initiated and aggressively uptitrated, but hypercortisolism persisted and the patient died from multifocal pneumonia shortly after presentation.
Retrospective histologic examination of the subcarinal lymph node and liver biopsy specimens from the time of initial NET diagnosis confirmed ACTH immunoreactivity (Ventana Medical Systems: AB2335961) in rare malignant cells (). A progressive increase in the number of malignant cells displaying strong ACTH immunoreactivity was observed in subsequent biopsy specimens obtained at least 3.5 years after diagnosis. While AgRP immunoreactivity (R&D Systems: AB355537) was absent from the initial tumor specimens, rare cells with AgRP immunoreactivity were observed in later biopsy specimens. |
pmc-6558684-1 | The patient is a 32-year-old male without any significant past medical history. He is an active duty United States Air Force (USAF) Joint Surveillance Target Attack Radar System (JSTARS) pilot who was at an informal, outdoor military function with his unit when he was struck with a water balloon launched by a slingshot into his left eye. The patient was not wearing any glasses or eye protection. Two physicians were on scene and immediately evaluated him in the field. On presentation, the patient complained of blurry vision, mild left eye pain, and a bloody nose. He denied any double vision. Physical exam was significant for periorbital swelling, mild injection of the sclera, and moderate epistaxis. Visual fields were grossly assessed and within normal limits. All extraocular movements were intact despite mild pain on left lateral gaze. The pupils were equal, round, and reactive, and there was not complete 360° subconjunctival hemorrhage. The patient was asked if he experienced any changes in vision, which he denied. During our examination, the patient attempted to clear some of his epistaxis by blowing his nose, and he immediately developed subcutaneous emphysema with increased pain in his left eye. He was escorted to the nearby emergency department for further evaluation. Computed tomography (CT) of his orbits demonstrated a nondisplaced left medial orbital wall fracture with orbital and subcutaneous emphysema (Figs. and ). The patient was administered intravenous ampicillin/sulbactam and transferred to another hospital for evaluation by a plastic surgeon.
The plastic surgeon determined he was not a surgical candidate, stating the patient’s fracture was nondisplaced and without other serious comorbidities, such as exophthalmos or extraocular muscle entrapment. Our patient was then discharged. On follow-up the next week, the surgeon recommended conservative treatment and that the patient be ‘cleared for full duty and flight status.’ Follow-up with an optometrist noted no significant ocular trauma and no change in visual acuity. Finally, a flight surgeon evaluated him at the patient’s duty station. After thorough examination noting complete resolution of the patient’s symptoms and with the concurrence of the plastic surgeon, the patient was returned to flying status 4 weeks after his initial injury.
We followed up with the patient several months later to discuss his injury and its relation to his flying career. Fortunately, he reported no further symptoms on the ground or in the air, and he has had no other instances of subcutaneous or orbital emphysema. |
pmc-6558687-1 | A 61 year-old man was admitted with a 103 ° F fever, confusion, weakness and slurred speech after hemodialysis. He had a history of viridans streptococcal mitral valve endocarditis, end stage renal disease on hemodialysis, atrial fibrillation not on anticoagulation due to GI bleeding, and monoclonal gammopathy of undetermined significance. He had a productive cough for a week without any identifiable sick contact. Physical examination was notable for an agitated edentulous man with a left central facial palsy, severe dysarthria, and a systolic murmur at the left lower sternal border. His lungs were clear to auscultation and there was no stigmata of endocarditis.
The patient was initially treated empirically for pneumonia and worked up for stroke. However, the treatment plan was quickly modified when a transthoracic echocardiogram on day two of admission revealed two echogenic structures consistent with vegetations: 0.4 × 0.4 cm on the anterior leaflet of the mitral valve, and the other 0.7 × 1.8 cm attached to left coronary cusp of the aortic valve (Fig. ). There was also thickening of the aortic root suggestive of abscess formation. Two sets of blood culture grew Gram-positive rods after 37.5 h incubating in anaerobic bottles (Fig. ), and after 86 h in aerobic bottles. The organism was identified as A. neuii by MALDI-TOF MS on day five of admission. Serial brain MRI scans revealed multiple bilateral infarcts on day two with increased number of infarcts and a small focus of hemorrhage on day five. The patient was diagnosed with infective endocarditis by A. neuii complicated by aortic root abscess and presumed cerebral septic emboli.
The patient was initially treated with vancomyin and piperacillin/tazobactam until A. neuii was identified. Subsequently, he was treated with ampicillin and gentamicin for two days, followed by ampicillin for the rest of his hospitalization. The choice of ampicillin was based on a large series that studied susceptibility to antibiotics of Actinomyces species [], and a previously successfully treated A. neuii endocarditis case []. Antibiotic susceptibility was not tested for our patient because he responded to the treatment well, and repeat blood cultures were all negative. A CT angiography of the brain and neck on day six ruled out mycotic aneurysm. It was concluded that the risk of further septic embolization outweighed the risk of intracranial hemorrhage, and the patient underwent aortic valve replacement, debridement of aortic root subannular abscess, mitral valve repair, and repair of a fistula between the aorta and left atrium on hospital day fourteen. A 2.5 × 0.6 cm vegetation on the aortic valve and a vegetation on the mitral chordae tendineae were removed. There was no microscopic evidence of bacterial elements on the aortic valve based on histopathology with Gram stain, and culture did not grow any organisms. The patient’s post-operative course was complicated by shock requiring intraaortic balloon pump, and a cardiac arrest from ventricular fibrillation 10 days after surgery. He recovered without further neurological deterioration, and was discharged to a nursing facility two months after heart surgery. He received 12 weeks of IV ampicillin followed by 11 months of oral doxycycline.
One year after the diagnosis of A. neuii endocarditis, while on chronic doxycycline, the patient had a fever and a bacteremia with coagulase negative Staphylococcus and group B Streptococcus. The bacteremia was sterilized after the initiation of antibiotic therapy and there was no growth from subsequent blood cultures. Transthoracic echocardiogram showed a small, mobile echogenic density on the non-coronary cusp of the bioprosthetic aortic valve. The patient refused to undergo transesophageal echocardiogram to further evaluate the prosthetic valve, so he was treated empirically for possible prosthetic valve endocarditis. The patient was cured from infection after two weeks of IV vancomycin and gentamicin, followed by four weeks of IV vancomycin. He had been taking oral doxycycline in addition to his IV antibiotics.
The patient eventually died of a sudden cardiac arrest after hemodialysis. This was 15 months after the diagnosis of A. neuii infective endocarditis, and four weeks after discontinuation of oral doxycycline. The family declined autopsy.
Primary infective endocarditis caused by Actinomyces spp. is rare. After PubMed (search term ((actinomyces spp) OR actinomyces) AND ((infective endocarditis) OR endocarditis)) and additional bibliographical search, we found 26 human cases dating back to 1939 (Table ), after excluding four reports, two with bacteria that have been subsequently reclassified to different genera [, ], one report with possible direct extension of pulmonary actinomycosis to the endocardium [], and one with primary IUD-associated actinomyosis and secondary endocarditis []. Cases were reported at all ages (6–87 years old). Two thirds of patients were men. The most commonly identified species were A. israelii (19%) and A. viscosus (15%). Twenty-two cases involved left-sided valves (mitral 9; aortic 5; prosthetic aortic 3; both mitral and aortic 4; undetermined 1). Risk factors included valvular disease (41%), poor dental hygiene or dental procedure (36%), and prosthesis (14%). All four right-sided cases were associated with intravenous drug use [, , , ].
Most left-sided endocarditis patients had indolent courses. This did not seem to vary over time. However, the mortality and complications have improved significantly over time. Five of eight patients reported before 1990 died and five had embolic events (brain, spleen, kidneys, small bowel and skin), whereas only two of 14 cases reported after 1990 died, and only one had emboli to skin. Despite temporal courses of a subacute endocarditis, where stigmata of endocarditis are more common, only one report described Roth’s spots []. It is unclear whether this was related to virulence factors from Actinomyces spp., or simply the rarity of these complications []. Right-sided endocarditis cases had more acute and fulminant courses, and were all complicated by septic emboli to the lungs. Two (50%) of them had polymicrobial endocarditis [, ], which might have contributed to more complicated clinical courses. All four right-sides cases survived and all were reported after the year of 2000. Irrespective of the side of endocarditis, most patients were treated with a prolonged course of penicillin or β-lactam antibiotics. Four cases had surgery (three aortic valves [, , ] and one Eustachian valve [], an embryologic remnant of the valve of the inferior vena cava).
Two cases of infective endocarditis by A. neuii were previously reported [, ]. Both were in older men with preexisting aortic valvular anomalies (one had a bicuspid valve and the other a prosthetic valve). Both presented with subacute endocarditis, large aortic vegetations (2 cm) and root abscesses. The patient with a native valve underwent surgery []. Both patients were cured from the infection. One was initially treated with ampicillin, then ceftriaxone due to interstitial nephritis, and finally doxycycline for 9 months []. The other was treated with penicillin, followed by amoxicillin for 12 months []. |
pmc-6558698-1 | An 11-year-old female patient with no previous history presented with right conjunctival injection and photophobia. The patient had previously been treated with fluorometholone 0.1% eye drops; however, the same symptoms recurred twice in 1 year. At presentation, her best-corrected decimal visual acuity (BCVA) was 0.4 in the right eye and 1.2 in the left eye. Intraocular pressures (IOPs) of the right and left eyes were 17 and 16 mmHg, respectively (Normal range: 10–21 mmHg). Slit-lamp examination showed ciliary injection and diffuse fine keratic precipitates. Micro-hypopyon and an anterior chamber cell grade of 3+ (based on the Standardization of Uveitis Nomenclature Working Group classification []) were observed; posterior synechiae were also present in the right eye. (Fig. ) Fundus examination of the right eye was hazy and lacked clarity. The left eye exhibited no apparent abnormalities in the anterior chamber or fundus. Fluorescein angiography (FA) of the right eye revealed diffuse vascular leakage and optic disc leakage. (Fig. ) The patient did not complain of arthralgia or genital ulcers, but had a history of recurrent oral ulcers. On the basis of these findings, the patient was diagnosed with unilateral panuveitis. The differential diagnosis was as follows: Behçet’s disease, juvenile idiopathic arthritis-related uveitis, HLA-B27-related uveitis, A20 haploinsufficiency, and sarcoidosis. Dexamethasone eye drops (0.1%, instilled hourly), tropicamide/phenylephrine eye drops (four times/day), 1% atropine eye drops (once/day), and prednisolone (15 mg/day orally) therapies were initiated for inflammation of the right eye. Further investigation revealed ileocecal ulcers and HLA-B51 positivity. Interferon-gamma release assay and tuberculin tests for tuberculosis infection, raid plasma regain assay, and Treponema pallidum antibody hemagglutination test for syphilis were negative; angiotensin-converting enzyme, antinuclear antibody, matrix metalloproteinase-3, and anti-citrullinated protein antibody levels were within the normal range. A20 haploinsufficiency was thought to be less likely in this patient, due to the absence of a family history of autoimmune diseases, genital ulcers, and fever spikes [, ]. In Behçet’s disease, oral ulcers heal without scars, uveitis typically involves the posterior chamber, and retinal vasculitis manifests with a fern-like pattern; in contrast, A20 haploinsufficiency is characterised by anterior uveitis []. Because of the presence of typical ocular symptoms and recurrent oral ulcers, the patient was diagnosed with the incomplete type of Behçet’s disease, in accordance with the Japanese diagnostic criteria for Behçet’s disease (revised in 1987) []. Inflammation in the anterior chamber and BCVA gradually improved after the treatment. However, a relapse occurred in the right eye and new-onset uveitis appeared in the left eye during the tapering of prednisolone. Adalimumab was administered subcutaneously to avoid the side effects of systemic corticosteroid. [] The patient was 12-year-old and weighed 36 kg when adalimumab was started. Since there is no indication regarding the dose of adalimumab for paediatric Behçet’s disease, we administered 40 mg every 2 weeks without a loading dose, in accordance with the recommended dose for treatment of juvenile idiopathic arthritis-associated uveitis. The duration of uveoretinitis prior to starting adalimumab was 11 months. After beginning administration of adalimumab, the patient complained of transient abdominal pain, which resolved spontaneously. BCVA improved to 1.5 in both eyes and the anterior chamber cell grade improved to < 0.5+ within 2 weeks. (Fig. ) Within 4 weeks, laser flare photometry values dramatically improved from the peak value of 48 ph/ms (physiological value approximately 3 ph/ms) in both eyes, to 3–4 ph/ms in the right eye and 2–3 ph/ms in the left eye. (Fig. ) FA revealed improvement of retinal vasculitis. (Fig. ) Oral ulcers healed without scars after adalimumab administration. Ileocecal ulcers were completely resolved on the follow-up colonoscopy, which was performed 3 months after initiation of the therapy. The inflammation has remained well-controlled by administration of adalimumab without local or systemic corticosteroid for 17 months. No side effects of adalimumab have been observed. |
pmc-6558698-2 | A 14-year-old female patient reported blurry vision in the left eye for the past 8 months and had been diagnosed with uveitis at another clinic. Despite the administration of local and systemic corticosteroid, inflammation persisted; therefore, the patient was referred to our clinic. The patient presented with fine keratic precipitates and anterior chamber cell grade of 2+ in the left eye. The vitreous cell grade was 1+ in the right eye and 2+ in the left eye. FA showed diffuse fern-like capillary leakage and optic disc hyperfluorescence of the left eye. (Fig. ) The BCVA was 1.2 in both eyes, and the IOPs of the right and left eyes were 16 and 22 mmHg, respectively. Non-ocular manifestations were oral ulcers and shoulder arthralgia. Skin or genital lesions were not observed. The differential diagnosis was as follows: Behçet’s disease, A20 haploinsufficiency, and idiopathic retinal vasculitis. Interferon-gamma release assay and tuberculin tests for tuberculosis infection, raid plasma regain assay, and Treponema pallidum antibody hemagglutination test for syphilis were negative; angiotensin-converting enzyme, antinuclear antibody, matrix metalloproteinase-3, and anti-citrullinated protein antibody levels were within the normal range. There was no family history of autoimmune diseases and colonoscopy revealed no abnormality. Behçet’s disease was suspected and the patient was referred to a paediatrician for further investigation. She tested negative for HLA-B51. Additionally, the following treatment (initiated in the previous clinic) was continued: 0.1% dexamethasone eye drops (four times/day), tropicamide/phenylephrine eye drops (once/day), and prednisolone (5 mg/day orally). In accordance with the Japanese diagnostic criteria for Behçet’s disease (revised in 1987), the patient was diagnosed with the incomplete type of Behçet’s disease on the basis of the presence of a typical ocular symptom and recurrent oral ulcers []. Retinal vasculitis recurred in both eyes; therefore, initiation of adalimumab was proposed to the patient; however, it was initially declined due to financial restrictions. Thus, prednisolone was increased to 20 mg/day, and methotrexate was initiated at 6 mg/day. (Fig. ) A maximum of 12 mg methotrexate was administered; however, the patient experienced nausea and the inflammation relapsed. Subcutaneous adalimumab injection was then introduced, and prednisolone was slowly tapered. The patient was 15-year-old and weighed 53 kg when adalimumab was initiated, thus we administered 80 mg as a loading dose, followed by 40 mg every 2 weeks, starting 1 week after the loading dose, in accordance with the recommended dose for treatment of adult uveitis. The duration of uveoretinitis prior to starting adalimumab was 13 months. The anterior chamber cell grade improved from 3+ in both eyes to 0 and 0.5+ in the right and left eyes, respectively, within 7 weeks after beginning adalimumab administration. (Fig. ) The peak values of laser flare photometry were 131.8 ph/ms in the right eye and 71.4 ph/ms in the left eye; these improved to 4–5 ph/ms and 10–12 ph/ms, respectively. (Fig. ) BCVA remained ≥ 1.5 in both eyes. Oral ulcers and arthralgia were improved after adalimumab therapy. The inflammation subsided, and local and systemic corticosteroid therapies were discontinued. The follow-up period of adalimumab was 12 months at the time this report was written, and the patient had not experienced any side effects. |
pmc-6558824-1 | A 68-year-old man was referred to Kindai University in 2004 with bilateral uveitis of unknown cause. The right eye had lost vision due to suspected Candida keratitis after penetrating keratoplasty, which was performed in 2007. A mild anterior chamber inflammation and keratic precipitates with small corneal oedema, followed by refractory secondary glaucoma, caused bullous keratopathy in the left eye that necessitated DSAEK in 2011. The clinical findings observed during these periods, such as unilateral high intraocular pressure and corneal oedema with keratic precipitates, were suggestive of cytomegalovirus (CMV) corneal endotheliitis. A diagnosis of CMV corneal endotheliitis was made based on detection of CMV DNA in the aqueous humour after DSAEK. Corneal grafting failed even with administration of 0.5% ganciclovir eye drop six times with 0.1% fluorometholone eye drop four times daily for more than a year. After the second DSAEK in 2013, 1.0% voriconazole, 0.5% ganciclovir, and 0.1% betamethasone phosphate eye drops continued to be administered four times daily for 2 years. In 2015, the patient presented with small crystalline opacities in the centre of the cornea that progressed extremely slowly and had multiplied by 2017 (Fig. a). The patient complained visual disturbance without any eye pain or foreign body sensation when the corneal opacity covered the visual axis, although he did not exhibit any subjective symptoms when the keratitis occurred for the first time. Gram staining of the scraped cornea revealed an unstained small oval microorganism (Fig. b) that was only visible by Fungiflora Y staining (Fig. c). Given the past episode of vision loss of the other eye due to suspected Candida keratitis, we administered two doses of voriconazole by intrastromal injection. Since the treatment was ineffective, penetrating keratoplasty was performed. The excised corneal tissue was fixed with formalin, embedded in paraffin, and processed for histological analysis.
Histologically, numerous oval organisms, 1.3–2.6 μm in diameter, were found throughout the corneal stroma. The organisms could be identified by haematoxylin and eosin staining and Ziehl–Neelsen staining, and fluoresced under ultraviolet illumination by Fungiflora Y and Uvitex 2B staining, but were unstained with periodic acid-Schiff reaction and Grocott’s staining (Fig. a, b). For TEM observation, ultrathin sections were prepared from the targeted area of paraffin sections after osmification and embedding in Epon blocks by the inverted beam capsule method []. They were observed with an HT 7700 microscope (Hitachi High-Technologies, Tokyo, Japan). A polar tube with multiple loose coils—which is consistent with the morphology of microsporidia—was detected in the spore-like elements of the microorganisms by TEM (Fig. ). The corneal graft remains transparent and no clinical findings suggestive of recurrence of microsporidial keratitis nor graft rejection is found with administration of 0.1% betamethasone phosphate eye drop four times daily at 1 year and half postoperatively. |
pmc-6558845-1 | A 29 year-old male presented a right flank mass and lower extremity edema in August 2015. He had no past medical history of illness, but a family history of uterine myoma in his sister, aunt, cousin, and grandmother and of skin leiomyomatosis in his grandmother, father, and uncle. His sister was later diagnosed with RCC in May 2016 (Fig. ). Magnetic resonance imaging (MRI) of the abdomen revealed an 8 cm-sized mass in the right kidney that invaded the renal vein into infra-diaphragmatic IVC, obstructing and causing thrombosis of the infrarenal inferior vena cava and both iliac veins, with conglomerated lymph nodes (LNs) at retrocaval and aortocaval stations (Fig. a). Kidney mass biopsy revealed type 2 papillary renal cell carcinoma.
Because the massive thrombus and lymph nodes were deemed unresectable, he was administered temsirolimus from September 2015, but best response was stable disease. However, the primary mass and lymph node had enlarged in March 2016, indicating progressive disease (Fig. b).
Because there is no standard treatment after temsirolimus in non-clear cell RCC and he maintained a good performance status, he underwent retroperitoneal lymph node dissection, IVC tumor thrombectomy, and radical nephrectomy in March 2016. Pathologic diagnosis was papillary type 2 RCC (Fig. ). However, 1 month after surgery, follow-up CT demonstrated multiple liver metastases (Fig. c). Axitinib was started in May 2016, but the disease progressed, in liver, retroperitoneal LNs, and spine (Fig. d).
Considering his age at onset and family history of skin disease and uterine myoma, and tumor histology, HLRCC was suspected, and thus he and his family underwent germline FH mutation testing, which demonstrated the presence of mutation in FH exon 5 (c.688A > G, p.Lys230Glu). Although this specific mutation has not been reported in HLRCC, mutation in FH c. 689 A > G (p.Lys203Arg) had been reported to be pathogenic (rs752232718), and thus, we considered his kidney cancer was HLRCC-associated RCC. Immunohistochemical staining with anti-FH antibody (mousemonoclonal, clone J-13, 1:10000, SC-100743, SANTACRUZ, CA, USA) demonstrated no expression of FH in tumor cells (Fig. d). Based on a preliminary report, in which it was suggested bevacizumab and erlotinib in combination may be effective in HLRCC-associated RCC [], we administrated bevacizumab (10 mg/kg every 2 weeks) and erlotinib (150 mg daily) from June 2016. After treatment, metastatic lesions in liver, LNs, and bone decreased rapidly, achieving partial response (Fig. e). As of Dec 2017, 18 months after start of bevacizumab plus erlotinib, this good response is maintained and the patient remains symptom free. |
pmc-6558859-1 | A 17-year-old Malay female with no significant past medical history presented with rashes over the neck and trunk and swollen lips. She had been unwell for 2 days prior to hospital attendance with symptoms of fever, sore throat, and running nose and red itchy eyes. She had attended her family physician 1 day before presentation to hospital and had been prescribed paracetamol, dequalinium lozenges, loratidine/pseudoephrine nasal spray, and co-amoxiclav tablets, of which she had taken two doses.
Inspection of the patient’s skin revealed scattered dusky, flaccid blisters demonstrating positive Nikolsky’s sign (Fig. ). These were distributed over the face (including hairline and scalp), neck, anterior trunk, and back (Fig. ). Most of her arms and all of her legs were spared. There was no evidence of secondary cutaneous infection. Mucosa erosions were seen on the lips as well as the labial surfaces. Opthalmic examination demonstrated injected conjunctiva with pseudomembranes of the upper and lower palpebral conjunctiva. Corneal examination showed a 6-mm epithelial defect on the right side. Skin punch biopsy demonstrated sub-epidermal splitting, necrotic keratinocytes in the epidermis, and apoptotic debris (Fig. a, b). These clinical and histological findings were consistent with a diagnosis of Stevens-Johnson Syndrome. Severity of illness score for toxic epidermal necrolysis (SCORTEN score) on admission was 2. The trigger for her SJS remains uncertain. ALDEN scoring for all drugs was − 3; onset of red eye symptom was taken as probable index day []. Infectious screening for human immunodeficiency virus, respiratory viral panel (influenza A and B, respiratory syncytial viruses A and B, coronaviruses), Mycoplasma (Acute titre), and Epstein-Barr virus serology were negative. Serum herpes simplex virus (HSV) IgM was positive, but nasopharyngeal HSV 1 and 2 cultures were negative.
The patient was admitted to our ICU with tachycardia and tachypnoea, although blood pressure and peripheral oxygen saturation were within normal limits at the time of admission. The patient subsequently developed significant pulmonary and renal complications which are described below. A timeline of significant events and trend of renal function is outlined in Fig. .
Blood tests on admission showed acute kidney injury (creatinine 104 mmol/L). Our patient’s serum creatinine continued to worsen during admission despite adequate fluid replacement. Gross haematuria was noted from urinary catheter on the third day of admission. Urine analysis was negative for casts with 90% isomorphic red blood cells, suggesting urological origin of haematuria. On the fifth day of admission, her urine output dropped significantly. Bedside ultrasound revealed bilaterally enlarged collecting system, and subsequent CT-KUB confirmed bilateral hydronephrosis and mild hydro-ureters with the presence of dependent debris in pelvicalyceal system and ureters (Fig. , right). Rigid cystoscopy showed normal urethra, but bleeding from both ureteric openings and clots in the collecting system. Fluoroscopy confirmed filling defects (Fig. , left). Bilateral ureteric stents were deployed intra-operatively. Subsequently, her urine output improved dramatically with immediate improvement in creatinine and resolution to baseline within a few days of stenting.
Our patient had respiratory distress on admission, and nasoendoscopy revealed mild arytenoid and supraglottic swelling. Respiratory condition worsened on day 2 of admission; the patient became progressively more tachypnoeic with increasing secretion load and required supplemental oxygen. Due to work of breathing, she was initially trialled on non-invasive ventilation (NIV) which was soon switched to high-flow nasal cannula (Fi02 0.3, flow rate 30 L/min) in view of inability to clear secretions whilst on NIV. Twenty-four hours later, at the end of day 3 of admission, she developed sudden onset severe respiratory distress with desaturation and required intubation and mechanical ventilation. Clinical examination demonstrated extensive subcutaneous emphysema. Chest X-ray confirmed presence of right-sided pneumothorax, small left-sided pneumothorax, and pneumomediastinum (Fig. , left). A chest tube was inserted for the right-sided pneumothorax. Pneumomediastinum and contralateral pneumothorax remained stable on several follow-up images throughout the hospital stay, including CT scan for characterisation (Fig. , right). Upper gastrointestinal endoscopy excluded mucosal tear in the pharynx or oesophagus. She was successfully extubated on day 7, and chest tube was removed on day 9. |
pmc-6558877-1 | A 56-year-old Hispanic man with a past medical history of alcohol and cocaine abuse was initially evaluated in our clinic after presenting to the emergency department with sudden-onset abdominal pain and one episode of emesis. The patient stated that this was the first time an episode like this had ever occurred in him, and he described the pain he had felt as epigastric in location, nonradiating, and 8/10 on a numeric rating scale. He denied any other symptoms, including weight loss, changes in appetite, and changes in stool. However, when asked about back pain, he recalled that he had been experiencing dull, intermittent left back pain for the past 2–3 years that radiated to his left rib cage at the midaxillary line. He described the pain as 4/10 in severity at its worst and denied feeling any pain on his right side.
The patient reported being a smoker in the past but that he had quit approximately 15 years earlier. He also reported using cocaine once per week and heavy drinking of liquor during certain months of the year. His past medical history was otherwise noncontributory; however, he did report inconsistent visits with his last primary care provider. His social history was significant for his occupation as a landscaper, which had caused the patient to disregard his back pain as being a work-related injury.
The result of his complete physical examination was unremarkable, except for his body mass index being clinically overweight at 26.6 kg/m2. His abdomen was soft and nondistended, and his bowel sounds were normal. Basic laboratory tests were performed during his hospital admission and revealed an elevated blood glucose level (612 mg/dl; reference range < 140 mg/dl) and an elevated hemoglobin A1C (13.3%; reference range < 5.7%). Abdominal/pelvic computed tomography (CT) with intravenous contrast revealed abnormalities suggestive of malignancy in the pancreatic tail and multiple liver metastases (Figs. and ). An elevated cancer antigen 19-9 tumor marker (15,453 U/ml; reference range < 37 U/ml) was also noted, which was strongly suggestive of pancreatic carcinoma. A CT-guided needle biopsy of the liver was performed, and results were consistent with a poorly differentiated primary pancreatic adenocarcinoma. Immunohistochemical analysis revealed neoplastic cells that were CK7+/CK20− and positive for CDX2, MUC5AC, and PODXL1, which was highly suggestive of a primary pancreaticobiliary neoplasm. Thus, a diagnosis of stage IV pancreatic tail adenocarcinoma with multiple liver metastases was made.
During follow-up 1 month later, prior to the start of chemotherapy, the patient stated that he had been experiencing worsening left back pain; however, had not experienced any epigastric pain, nausea, or vomiting since his hospital admission. He described the pain as now constant and radiating anteriorly to the left lower ribs at the midclavicular line. The pain was rated as 8/10 on a numeric rating scale, and the patient reported that even the pressure of putting a shirt on hurt him and that he could only now lie on his right side. On physical examination, the region was exquisitely tender to palpation, but the result of the remainder of his examination was unremarkable. The patient was then started on a FOLFIRINOX chemotherapy regimen (5-fluorouracil /leucovorin, irinotecan, and oxaliplatin). |
pmc-6558882-1 | A 5-year-old girl presented with a pyogenic mass and pain of the scalp for 8 days, plus fever for 2 days. Surgical incision and drainage of the mass was performed, and cefuroxime and metronidazole was administered intravenously in the local hospital, but there was no obvious improvement. The skin lesions gradually increased, part of which formed an ulcer surface, and the purulent secretion increased. A fever began 2 days prior to admission, with a highest temperature of 39 °C. So, she came to our clinic for further diagnosis and treatmenton February 12, 2018. The patient was living in the countryside and had a history of dog contact; however, she was too young to recall a history of trauma. She was normally healthy with no similar diseases, other infectious diseases, or genetic diseases in her family.
Cutaneous examination revealed several ulcers of different sizes fused into a large 10 by 12 cm tender erythematous boggy swelling over the scalp with significant loss of hair, and yellowish-brown to hemorrhagic crusts. Removal of the crusts revealed seropurulent discharge. There was obvious stench and tenderness in the lesions (Fig. a).
A routine blood test showed the white blood cell count to be 12.41 × 109/L (4–109/L), consisting of 8.90 × 109/L (2–7 × 109/L) neutrophils at a percentage of 71.70% (25–60%). The erythrocyte sedimentation rate (ESR) was 43 mm/h (0–20 mm/h). Routine urine, fecal, liver function, and renal function examinations revealed no obvious abnormalities. Bacterial culture yielded growth of Staphylococcus aureus.
Affected hair and excretion from the ulcer were collected and prepared for fluorescent brightening agents and Evans blue staining using a 10% potassium hydroxide (KOH) solution. We found fungi with septate hyphae inside the hair root (Fig. a). These samples were then inoculated onto Sabouraud agar (OXOID, Inc., Basingstoke, Hampshire, U.K.) and Czapek’s agar (OXOID, Inc., Basingstoke, Hampshire, U.K) and incubated at 30 °C. Growth was apparent within 15 days on all agar plates. The colonies were initially gray and fluffy and spread rapidly; eventually, the colonies became hairy and reached a diameter of 8 cm (Fig. b).
DNA was extracted following the Quick CTAB and PCR protocols as described previously []. The sequences of ribosomal internal transcribedspacer (ITS) and β-tubulin (BT2)were amplified (Table ). DNA from each isolate was amplified by PCR in 12.5 ml reaction volumes using the primers and protocols described previously []. Blast results of the sequences in GenBank revealed that ourisolate belonged to Aspergillusprotuberuswith 99–100% similarity to depositeditems.The phylogenetic tree was made using MEGA v. 7.0.3.Phylogenetic analysis of concatenated loci ITS and BT2 showed that the reported clinical isolate (Temporarynamed Xian01) was definitivelynested within the A.protuberus species cluster (Fig. ).
The patient was diagnosed with scalp mycosis caused byA.protuberus, and secondary S.aureus infection. She began a treatment course oforal terbinafine (125 mg/day, 14 days) and methylprednisolone(8 mg/day, 5 days), intravenous mezlocillin sodium, sulbactam sodium (1.875 g/day, 7 days), compound glycyrrhizin (20 ml/day, 14 days), a wet dressing of ethacridine lactate and topical naphthotifen ketoconazole ointment, and fusidic acid cream. After the above described treatment, all the original lesions formed scabs without purulent secretions. Fluorescence microscopy for fungal detection showed negative result. The patient continued treatment with oral terbinafine (125 mg/day, 42 days that was decreased to 125 mg/two days, 14 days) and compound glycyrrhizin(25 mg/day, 56 days), with topical naphthotifen ketoconazole ointment. This treatment regimen cured the patient without adversely affecting liver function or resulting in other adverse drug-related events. Most of the patient’s hair regrew with only small areas of alopecia left (Fig. b). No relapse was observed during the 6 months of follow-up. |
pmc-6558884-1 | A 43-year-old man was diagnosed with metastatic prostate cancer (Gleason score 4 + 4) in November 2013. Laboratory data showed that the prostate-specific antigen (PSA) level was 18.6 ng/mL, and digital rectal examination indicated a stony hard mass in the prostate that was suspected to be local advanced prostate cancer. Magnetic resonance imaging revealed a prostate tumor invading the seminal vesicle and a metastasis of the pubic bone (Fig. a). Based on these results, the patient underwent neoadjuvant androgen deprivation and docetaxel therapy, followed by laparoscopic prostatectomy, extended lymphadenenolectomy, and metastatectomy of the pubic bone in March 2014. Pathological examination revealed residual adenocarcinoma in the prostate and pubic bone (pathological T stage 3b, positive surgical margin). After the operation, he received adjuvant radiation therapy (66 Gy) to the pelvic floor. His serum PSA level decreased to < 0.01 ng/mL but gradually increased to 0.14 ng/mL. He was then re-initiated on docetaxel in December 2015, although computed tomography (CT) and bone scan did not show obvious metastatic lesions. His PSA level decreased to < 0.01 ng/mL in April 2016 after 7 cycles of docetaxel chemotherapy but slightly increased to 0.17 ng/mL in July 2016. Positron emission tomography-CT indicated five tiny nodules in the bilateral lungs (Fig. b). Biopsy specimens are difficult to obtain and might not reflect the precise extent of the disease owing to heterogeneity in patients with CRPC. Therefore, we performed liquid biopsy to isolate circulating tumor cells (CTCs) using the ClearCell FX System, which is an automated CTC enrichment system that is powered by a microfluidics biochip []. To count the CTCs isolated using this system, we performed immunostaining using the following antibodies: mouse anti-pan human keratin (C11) monoclonal antibody (mAb) (keratin 4, 5, 6, 8, 10, 13, and 18; Cell Signaling, Danvers, MA, USA), mouse anti-human cytokeratin mAb (CK3-6H5, Miltenyi Biotec GmbH, Bergisch Gladbach, Germany), mouse anti-human EpCAM (VU1D9) mAb (Cell Signaling), goat N-terminal androgen receptor (AR; N-10) polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and rabbit CD45 (D9M81) mAb (Cell Signaling). Additionally, we performed nuclear staining using 4′,6-diamidino-2-phenylindole []. Overall, 156 CTCs were detected per 7.5 mL, and almost all CTCs were AR negative in the nucleus (Fig. ). Therefore, we diagnosed the five tiny nodules as lung metastases from docetaxel-resistant CRPC with few AR-signaling-dependent cancer cells.
The patient was initiated on CBZ (25 mg/m2) according to the standard protocol in August 2016, instead of a second-generation AR-targeting agent (enzalutamide or abiraterone) []. Following 2 cycles of CBZ chemotherapy, the PSA level decreased to < 0.01 ng/mL and the lung metastases completely disappeared, with a reduced CTC count of < 5. To date, the patient has been receiving intermittent CBZ chemotherapy. |
pmc-6558895-1 | This subject was a 22-year-old man with B-ALL who had third bone marrow (BM) relapse before enrollment on to our compassionate clinical protocol using TanCAR-T 19/22 cells. He was diagnosed with B-ALL with more than 100 × 109/L WBC count and normal karyotype in January 2016. After complete remission (CR) 2, he underwent haplo-HSCT from his father 10 months after the original diagnosis. He had suffered hemorrhagic cystitis and stage 1 gastrointestinal acute GVHD within 2 months post haplo-HSCT, which resolved with 15 daily doses of methylprednisolone 50 mg followed by 5 daily doses of methylprednisolone 100 mg. Three months after discontinuation of the cyclosporine A and methylprednisolone, his disease relapsed with 6.4% marrow blasts when he still had full donor chimerism, then rapidly progressed with 56.5% marrow blasts by flow cytometry 10.6 months post haplo-HSCT, and undetectable donor chimerism was noted at the same time. He received salvage chemotherapy with MOEP (3 daily doses of mitoxantrone 10 mg, vindesine 4 mg, 3 daily doses of etoposide 100 mg, and 5 daily doses of dexamethasone 15 mg) and had severe bone marrow depression and no response with 65.4% marrow blasts 1 month after the first cycle of MOEP. Then, he was treated on our haplo-CAR-T 19 cell protocol. He received cytoreduction chemotherapy with vindesine and methylprednisolone plus hydroxyurea and lymphodepleting therapy with daunorubicin and cyclophosphamide, and his marrow blasts dropped to 12.7% prior to haplo-CAR-T 19 cell infusion. Haplo-CAR-T 19 cells at a dose of 4.91 × 106/kg (2.89 × 107 T cells/kg, 17% transfection efficiency) were administered and induced MRD-negative CR (MRD-CR) and full donor chimerism within 2 weeks after infusion. The infused haplo-CAR-T 19 cells exhibited rapid expansion and peaked with 15,281 copies per microgram DNA within the first 2 days after infusion, but dropped from 3374 copies per microgram DNA at day 7 to 468 copies per microgram DNA at day 12; methylprednisolone 160 mg and dexamethasone 5 mg were used at day 11 for treatment of the infusion-related grade 3 cytokine release syndrome (CRS). He experienced stage 3 skin acute GVHD within 1 month after haplo-CAR-T 19 cell infusion, which was under control with 5 daily doses of methylprednisolone 40 mg plus cyclosporin A 80 mg administered from day 31 after haplo-CAR-T 19 cell infusion. However, 1 month after obtaining MRD-CR, his disease exhibited florid progression with WBC count increasing from 1.59 × 109 to 12.52 × 109/L and corresponding percentage of circulating blasts increasing from 1.39 to 67.37% within 2 weeks; his bone marrow exhibited highly active cellular proliferation with 59.67% blasts that had the expression pattern CD19+ CD34+ CD10+ CD22+ CD38+ CD58+ CD33+ CD20− CD13− CD15−. At the same time, undetectable haplo-CAR-T 19 cells and donor chimerism were documented.
In this case, other therapies including TanCAR-T 19/22 cells rather than salvage chemotherapy or reinfusion of CAR-T 19 cells could be a potential treatment option for this patient due to the poor response to salvage chemotherapy and poor persistence of infused CAR-T 19 cells. However, higher tumor burden and short-term interval post discontinuation of steroid greatly increased the risk of failure of the generation of autologous CAR-T cells; florid progression of the disease made waiting till steroid tapered off was less feasible. Donor-derived TanCAR-T 19/22 cell therapy was an optimal approach to overcome this problem, but as well known, haplo-CAR-T cell therapies were not to be advocated routinely in the setting of prior GVHD requiring steroid mainly due to raised concern for the high risk of GVHD reactivation. After more careful consideration of the clinical benefits and risks of the second haplo-CAR-T cell infusion, he was enrolled on to our compassionate clinical protocol using haplo-TanCAR-T 19/22 cells. His father underwent apheresis, and the peripheral blood mononuclear cells (PBMCs) were used to prepare the TanCAR-T 19/22 cells. He received cytoreduction chemotherapy with vindesine 4 mg and five daily doses of methylprednisolone 80 mg and three daily doses of hydroxyurea 3 g followed by a lymphodelpeting chemotherapy with idarubicin at a total dose of 30 mg and cyclophosphamide at a total dose of 3 g. Planned bone marrow aspiration after the abovementioned chemotherapy and prior to haplo-TanCAR-T 19/22 cell infusion was not performed due to poor compliance of the patient. Two days later, he was treated with haplo-TanCAR-T 19/22 cells at a total dose of 4.72 × 106 TanCAR-T 19/22 cells per kilogram (3.05 × 107 T cells per kilogram, 15% transfection efficiency) administered via fractioned dosing (D0, 30%; D1, 70%) for safety consideration (Figs. and ).
The materials and methods used in TanCAR-T 19/22 production have been described previously [–], with the exception of the construct of the CAR and the source of PBMCs used for manufacturing the TanCAR-T 19/22 cells. TanCAR-19/22 was a tandem CAR molecule, consisting of an anti-CD22 scFv derived from mouse m971 mAb [] and anti-CD19 scFv derived from the mouse FMC63 mAb [], joined in tandem, human CD8α hinge and transmembrane domain, and human CD137 and CD3ζ signaling domains. A schematic of the TanCAR-19/22 is shown in Fig. a. PBMCs used for manufacturing the TanCAR-T 19/22 cells were collected by leukapheresis rather than fresh peripheral blood (PB).
Flow cytometry was used for the determination of the TanCAR-19/22 transfection efficiency and quantification of the haplo-TanCAR-T 19/22 cells in clinical specimens using a Biotin-SP-AffiniPure Goat Anti-Mouse IgG, F (ab') 2 Fragment Specific (Jackson ImmunoResearch, USA) and PE Streptavidin antibody (BD Biosciences, USA). Haplo-TanCAR-T 19/22 cells in clinical specimens also were measured by qPCR as described [].
The extent of donor engraftment in clinical specimens was assessed by using short tandem repeat amplification and fluorescence labeling multiplex PCR combined with capillary electrophoresis as described [].
Serum interleukin (IL)-2, IL-6, IL-8, and IL-10 and tumor necrosis factor-α levels were batch analyzed as described [].
BM before haplo-TanCAR-T 19/22 cell protocol showed predominant blast cells with an absence of normal BM precursors. BM flow cytometry at day 14 after haplo-TanCAR-T 19/22 cell infusion indicated that there were 0.73% residual marrow blasts. Of note, those residual leukemic blasts exhibited the expression pattern CD34+ CD10+ CD22+ CD38+ CD33+ CD19− CD20−, which were undetected by flow cytometry by day 28 in the absence of further therapy (Fig. a). Given the incomplete recovery of platelet and absolute neutrophil count by day 28, this patient achieved a MRD-CRi by day 28 after infusion. There was no evidence of blasts in BM either by BM smear or by flow cytometry at serial time points thereafter for 14 months (Fig. b and Additional file : Figure S1). BM had reconstitution of normal hematopoiesis by day 56 with the exception of platelet count that still unrecovered at a level of 36 × 109/L as the time of this report. Full donor chimerism was established at day 14 post infusion and remained stable thereafter.
After infusion, haplo-TanCAR-T 19/22 cells expanded and peaked at a level of 30.7% of circulating T cells at day 12 followed by a contraction phase with a low level of 0.45% of circulating T cells by day 28. This was coincident with the elimination of circulating B cells that were almost undetected at day 28 by flow cytometry. Haplo-TanCAR-T 19/22 cells were still measurable with a low level of 2.29% of circulating T cells and the circulating B cells still had not recovered as the time of this report (Fig. c and Additional file : Figure S2). Haplo-TanCAR-T 19/22 cells were also present by flow cytometry at all the response evaluation time points in BM obtained at response evaluation, and chronic B cell aplasia was documented (Fig. d and Additional file : Figure S2). An overall concordance between the expansion and persistence of haplo-TanCAR-T 19/22 cells in PB measured by flow cytometry and qPCR was observed. As the time of this report, TanCAR-19/22 DNA remained detectable on qPCR with 1134 and 396 copies per microgram DNA in PB and BM, respectively (Fig. e).
After haplo-TanCAR-T 19/22 cell infusion, he experienced grade 3 CRS graded according to the UPenn grading scale [, ]. Fever of up to 38.8 °C occurred within 24 h after haplo-TanCAR-T 19/22 cell infusion, lasting 11 days and becoming afebrile at day 12 after treated with a lower dose of tocilizumab at 160 mg (1.6 mg/kg) and etanercept 50 mg at day 8 (Fig. a). Multiple serum cytokines had markedly increased 7 days post infusion and almost returned to baseline values by day 41 (Fig. b, c), where interleukin (IL)-6 levels peaked at 3377 pg/mL (88-fold over baseline) at day 11. Aspartate aminotransferase and lactate dehydrogenase significantly elevated 8 to 10 days after infusion, peaked at 1529.1 U/L (38-fold over upper limit of normal) and 2027.8 U/L (13-fold over baseline) at day 12, respectively, and returned to baseline values by day 21 with best support care (Fig. d, e). He also exhibited coagulation dysfunction with prolonged activated partial thromboplastin time, elevated D-dimer, and fallen fibrinogen concentrations, as well as capillary leak with grade 2 hypoalbuminemia in spite of intensive supplementation of protein during the CRS, which resolved by day 23 (Fig. f–h).
The prior stage 3 skin acute GVHD that was under control was reactivated and rapidly progressed to stage 4 skin GVHD with new-onset local skin ulcerations particularly in the scrotal skin and mouth mucosa 11 days after haplo-TanCAR-T 19/22 cell infusion (Fig. a). The concentration of serum total bilirubin continually elevated from day 12 and increased to 134 μmol/L at day 21 (Fig. b). Given the rapidly progressive skin GVHD manifestations and liver involvement, lower-dose methylprednisolone at 20 mg daily as the initial dose with subsequent tapering in an effort to balance the benefits and risks of systemic immunosuppression was implemented from day 21 and discontinued by day 39. Skin rash and serum total bilirubin improved significantly after those treatments. However, stage 3 gut GVHD manifestations mainly including diarrhea occurred from day 50, and the serum total bilirubin elevated again, suggesting a grade 3 acute GVHD. Sixteen doses of methylprednisolone 20 mg per day were administered again from day 78, significantly controlling diarrhea and serum total bilirubin. This patient subsequently exhibited moderate chronic GVHD mainly manifested as scleroderma, diarrhea, and weight loss. Persistent thrombocytopenia with platelet count ranging from 15 × 109 to 43 × 109/L without platelet transfusion could be acknowledged as a manifestation of chronic GVHD in the setting of reconstitution of normal hematopoiesis. The systemic immunosuppressive treatment was tapered within 2 months with methylprednisolone 4 mg every other day and methotrexate 5 mg once a week and sirolimus 1 mg daily as a minimum maintenance dose from day 154 to the time of this report (Fig. b), keeping the chronic GVHD under good control. |
pmc-6559270-1 | A 23-year-old HIV-negative man presented with 4 days of fever, dyspnea, and pleuritic chest pain. He was previously healthy. He had immigrated from Vietnam 4 months prior. Computed tomography of the chest confirmed a left-sided pleural effusion without evidence of empyema ().
Thoracentesis revealed a lymphocytic predominant exudative effusion with mildly elevated adenosine deaminase. Acid-fast bacilli (AFB)-induced sputum smears were negative, but Xpert MTB/RIF nucleic acid amplification testing was positive for Mycobacterium tuberculosis without rifampin resistance. He was started on therapy with rifampin, isoniazid, ethambutol, and pyrazinamide (RHZE) and discharged home.
Approximately 9 weeks later, final sensitivity results of the AFB sputum and pleural fluid culture returned, showing Mtb with resistance to INH at drug concentrations of 0.2 and 1.0 mcg/ml and susceptibility at 5.0 mcg/ml (agar proportion method, solid media). This was thought to represent low-level INH resistance. At this point, the patient had already completed 9 weeks of therapy, and he was clinically much improved with resolution of presenting symptoms and dramatic improvement in his imaging. He completed 6 months of therapy with RHZE and remained clinically well at a 3-month posttreatment follow-up visit. |
pmc-6559383-1 | A 61-year-old man with a previous medical history of hypertension, diabetes mellitus, and hyperlipidemia presented with acute pressure-like chest pain and shortness of breath. Physical examination revealed a heart rate of 71 beats per minute (bpm), a blood pressure of 144/71 mmHg, and an oxygen saturation of 96%. On cardiopulmonary examination, he had a normal S1 and S2 with no appreciable murmur, rub, or gallop and with clear lung fields bilaterally. Peripheral pulsations were 2+ and symmetric, and there was no evidence of lower extremity edema. His family history was notable for hypertension, diabetes, and myocardial infarction in his mother. The patient denied any tobacco, ethanol, or illicit drug use.
Blood tests showed elevated concentrations of troponin I (0.32 ƞg/ml; normal < 0.04 ƞg/ml) and brain-type natriuretic peptide (186 pg/ml; normal < 101 pg/ml). His complete blood count and chemistry panel were otherwise unremarkable. An electrocardiogram (EKG) revealed a first-degree heart block and intra-ventricular conduction delay, with a QRS of 136 milli-seconds and pathological Q waves in the inferior leads (Figure ). He was diagnosed with non-ST elevation myocardial infarction (NSTEMI) and was administered dual antiplatelets therapy and heparin.
Echocardiography revealed impaired left ventricular systolic function of 30%-35%. Contrast-enhanced imaging of the left ventricle showed evidence of apical and peri-apical and mid to apical anterolateral akinesia and dilation along with preservation of the basilar segment (Figure ). These echocardiographic findings were indicative of TCM and left anterior descending (LAD) artery occlusion. Coronary angiogram revealed 90% stenosis in the middle segment of the RCA (Figure ), with a thrombolysis in myocardial infarction (TIMI) flow of II. However, no significant stenotic lesions were found in the LAD and circumflex arteries. A drug-eluting stent was inserted into the RCA, resulting in 0% residual stenosis and a TIMI flow of III.
The patient was discharged home on guideline-directed medical therapy. Repeat echocardiography four weeks later demonstrated resolution of the wall motion abnormalities along with restoration of normal left ventricular ejection fraction (Figure ). |
pmc-6559384-1 | Two brothers presented to us, both with similar symptoms. Our first patient was an eight-year-old male who presented with an inability to stand or walk since the past two months, along with bilateral foot deformities. According to his father, the patient had developed a difficulty in walking and in climbing stairs, accompanied by frequent falls - about six months back. Gradually, he had lost the ability to walk even with support and was mainly confined to his bed-although he could sit up and crawl.
The patient’s intelligence was unaffected by the illness; he had no history of trauma, fever, fits, incontinence, or syncope and did not display vision, speech, or hearing abnormalities. A detailed review of the gastro-intestinal, genitourinary, respiratory, and cardiovascular systems showed no abnormality. The patients’ parents were first cousins, albeit unaffected by the disease themselves. However, out of five siblings, two of the patient’s sisters (12 and 14 years of age) and one brother (five years old) were affected by a similar illness. The patient had had an unremarkable birth history, had reached all the relevant milestones timely and was said to be taking a nutritionally adequate diet. As per the parents, all his vaccinations were complete and the past medical history was clear.
On general examination, the patient was well oriented in time, place, and person with his vitals, height, and weight all within the normal ranges. Regarding system-wise examination, the central nervous system examination showed no signs of wasting or abnormal tone in the upper limbs, the power in both the upper limbs was 4/5, and the deep tendon reflexes were normal when elicited. However, the bulk of both the lower limbs was decreased, with the right lower limb being slightly more wasted than the left. The tone was decreased as well and power in both the lower limbs was 2/5. The deep tendon reflexes of the lower limbs were absent. On further examination, Babinski sign was negative and the pupils were bilaterally and equally, reactive to light. The gait of the patient could not be assessed as he could not stand. However, there were no signs pointing towards cerebellar or cranial nerve dysfunction and mental functions and speech proved to be intact. On sensory examination, a higher threshold to pain and temperature was noted.
On examination of the musculoskeletal system, the patient had marked wasting in the anterior compartments of both legs. He demonstrated a bilateral foot drop with pes cavus (Figure )-more pronounced on the left side - and his feet were kept in a plantar, fixed position in the relaxed state. Contractures on the knees and Achilles tendon were seen. The upper limbs did not show any marked abnormality other than contractures over the interphalangeal joints of the fingers, with the skin prominently thicker there. The examinations of all the other systems were unremarkable.
As per laboratory investigations: the complete blood count, electrolytes, and creatine-phosphokinase levels were all within the normal ranges. The nerve conduction velocities were markedly decreased. A sural nerve biopsy was carried out and a subtotal reduction in myelin fibers was noted, along with focal endo-neuronal edema. No granuloma formation or inflammatory component could be identified. Based on the clinical, hereditary, and investigative findings, the patient was diagnosed with CMT disease, type 2.
In terms of management, no specific medical treatment is available, but the patient was referred to the orthopedic and rehabilitation departments to manage the foot deformity.
Our second patient, brother of the first patient, was a five-year-old male who presented with difficulty in walking and frequent falls since the past two months. Gradually, his condition had progressed and his distal weakness had worsened, due to which he had been unable to walk without support since the past two weeks. Unlike his brother, the patient could still walk with support, although by dragging his feet. There was no significant difference in the history and examinations of this patient when compared to his brother and similar investigations were carried out, wherein the sural nerve biopsy showed nerve bundles with adequate myelin. Based on the above information, a diagnosis of CMT disease was made here as well and the child was similarly referred to the orthopedic and rehabilitation departments.
Concerning the apparent autosomal recessive mode of inheritance, the parents of the boys were counseled accordingly regarding the implications of having more children in future and the manner in which their children could further propagate the condition. Additionally, they were counseled to bring in their affected daughters with reportedly similar symptoms for an evaluation and any possible rehabilitation as well, even though the parents described their status as nonambulatory. |
pmc-6559385-1 | A 35-year-old Hispanic male presented to the emergency department for sudden onset worsening headaches over the past four days. Headaches were diffusely felt, not localized to a specific head region, and not relieved by over the counter pain medication. There was no associated trauma, fever, night sweats, loss of consciousness, photophobia, neck stiffness, or visual disturbances. His past medical history was significant for migraine headaches, type 2 diabetes mellitus, and benign essential hypertension. Physical exam revealed Glasgow Coma Scale score of 3T on 15L of oxygen, pupils 2-2.5 mm bilaterally, inability to arouse by voice or painful stimulation, and paralysis of upper and lower extremities bilaterally. Vitals include (heart rate = 89/min, blood pressure = 159/78 mmHg, temperature = 37°C, respiratory rate = 22/min, and oxygen saturation = 99% on 15L of oxygen). Labs were significant for respiratory alkalosis (blood pH 7.54, pCO2 27.5 mmHg), normal oxygenation (159.3 mmHg), and negative urinary toxicology screen.
A head CT scan revealed a 1.5 cm hematoma in the left thalamus with expansion into the lateral ventricle (Figure ). Cerebral angiogram demonstrated complete stenosis of the left internal carotid artery (ICA) and partial stenosis of the right ICA (Figures -). Diagnostic studies coupled with clinical presentation were compatible with a diagnosis of MMD. Patient treatment was initialized with emergent bedside right ventriculostomy (with opening pressure of 11 cmH2O) for intracranial pressure monitoring and for diversion of cerebrospinal fluid and hematoma. This patient ultimately underwent surgical revascularization. The procedure included a left superficial temporal artery-left middle cerebral artery bypass without any complications. |
pmc-6559392-1 | A 77-year-old male with symptomatic severe calcific aortic valve stenosis was referred for an elective TAVR. ECHO at presentation, in addition to severe aortic stenosis, showed moderate aortic insufficiency (Figure ), thickened and calcified mitral valve with mild transvalvular gradient (3.5 mmHg). The patient underwent a transfemoral TAVR with a 29-mm Sapien 3 valve (Edwards Lifesciences, Irvine, CA). The 24-h follow-up transthoracic echocardiogram performed on the patient in stable clinical condition, with the heart rate of 60 bpm, revealed well-seated aortic valve prosthesis with a significant improvement in aortic insufficiency (Figure ). However, despite stable hemodynamics and normal heart rate, there was a significant worsening in the mitral valve stenosis parameters: mean trans-mitral pressure gradient increased from 3.5 to 9 mmHg, mitral valve peak velocity increased from 149 to 238 cm/s, and pressure half-time increased from 110 to 170 ms.
It is well known that mitral stenosis severity/gradient may be underestimated in patients with elevated LVEDP secondary to significant aortic insufficiency. We postulate that successful treatment of aortic valve stenosis and insufficiency with TAVR led to a decline in LVEDP which unmasked pre-existing significant mitral valve stenosis. |
pmc-6559393-1 | A 78-year-old woman was involved in a motor vehicle collision while traveling approximately six weeks before presenting to our institution. She initially had high cervical neck pain at the time of the event but no other neurologic symptoms. She was brought to a local trauma center at the time of the event, and a computed tomographic angiography (CTA) of the neck revealed a Levine and Edwards Type II fracture with bilateral C2 pars and pedicle fractures extending into the vertebral body with anterolisthesis of C2 on C3 (see Figure ). Also seen was a tortuous right dominant vertebral artery that filled a large C2 transverse foramen with a congenitally small pedicle (see Figure ). Her vertebral artery on the left appeared to contribute very little to her posterior circulation. There was no evidence of radiographic vascular injury. She was advised to undergo surgical fixation at the time of her injury, however, she elected to wait until she returned home. She was discharged from the outside hospital with a hard cervical collar and presented to our institution for further evaluation over a month later. After discussing the possible treatment options, including continued conservative treatment with continued external orthosis vs. surgical intervention, the patient elected for surgical intervention. The risks and benefits of the surgical options were discussed with her in detail, including an anterior approach at C2-3, or a posterior C1-3 fusion. The patient elected to have a posterior fusion to avoid the possible swallowing complications of a high cervical exposure and other possible risks of an anterior approach..
Informed consent was obtained and the patient was brought to the operating room. Neurophysiologic monitoring was utilized to establish baseline motor and somatosensory evoked potentials. After application of cranial pinions, the patient’s neck was brought into a neutral and slightly flexed position under live fluoroscopy. A post-positioning film showed the patient’s anterolisthesis had reduced and the fractured pedicle showed improved alignment (see Figure ). Motor-evoked potentials and somatosensory-evoked potentials showed no change from baseline. A cranial reference frame was attached to the head clamp for CT-guided intraoperative navigation (see Figure ). Attachment of the cranial reference frame to the head clamp was a key step to ensure maximal accuracy of the optical system during instrumentation, as the posterior elements of C2 would not be stable enough to accept the spinous process clamp after exposure.
After exposure of the posterior elements from C1-3 and the C1 lateral masses, an O-arm spin was performed for navigation registration. The left C2 pedicle was accessed using a navigated drill. The fracture line in the middle of the pedicle was crossed with the drill bit into the vertebral body. Careful palpation of the drill track with a ball-tipped probe did not show any breaches. The hole was tapped with a navigated 3.5-mm tapered tap. A 4.0 mm x 24 mm screw was slowly advanced across the fracture into the C2 vertebral body. Care was taken during screw placement to ensure purchase across the fracture so that the tip of the pedicle screw did not push the vertebral body anteriorly. Bilateral C1 and C3 lateral mass screws were then placed. The right C2 pedicle was skipped due to her congenital abnormality and the risk of vertebral artery injury. An intraoperative CT scan showed excellent hardware placement (see Figure ). A cortico-cancellous piece of iliac crest was harvested and contoured to an appropriate dimension for placement between the C1 and C2 lamina. The laminae were decorticated and a piece of iliac crest graft was placed in between. Bilateral titanium rods were cut and placed. The wound was closed in layers and the patient awoke with no complications. She was placed in a hard cervical collar post-operatively. Postoperative X-ray images were obtained after the patient mobilized and showed stability of the construct (see Figure ). |
pmc-6559395-1 | A 22-year-old female patient reported to our clinic and complained of pain in the right side of her face and neck for one year. The pain was spontaneous in nature, its intensity was dull to moderate, and it was of intermittent nature. The pain aggravated while opening the mouth or moving the head and neck from side to side. She also experienced pain during swallowing, with an associated foreign body sensation in the throat. Her medical history is noncontributory. She underwent surgical removal of impacted teeth one year before for the same complaint; however, she did not have any relief from symptoms.
On an extraoral examination, the face was symmetrical (Figure ). There was no palpable mass or tenderness in the involved region. There was no tenderness in the muscles of mastication during palpation. No tenderness was elicited in the temporomandibular joints during mandibular movements. On an intraoral examination, the patient experienced extreme tenderness on palpating the right tonsillar fossa. A bony mass was palpable in the same region.
An orthopantomogram was taken for the patient, and it revealed an increase in the length of the styloid process on the right side (Figure ). This finding was further analyzed with computed tomography three-dimensional reconstruction imaging. Image analysis revealed an elongated right styloid process measuring 35.8 mm and the left side styloid process was 26 mm (within normal limits) (Figure ). These findings led to the confirmatory diagnosis of Eagle’s syndrome.
The elongated styloid process on the right side was removed through the intraoral surgical approach at the level of the tonsillar fossa. The patient was free of symptoms one month after surgery, and after six months, the patient was completely asymptomatic. |
pmc-6559397-1 | A 61-year-old female patient was evaluated at our university hospital for a perirectal tumor of unknown origin. Her past medical history included dyslipidemia and non-neoplastic postmenopausal vaginal bleeding. She had undergone a hysterectomy and bilateral salpingo-oophorectomy two years prior to the actual episode. Her medication included hormone replacement therapy (HRT).
The patient presented initially with macroscopic hematuria. A urological assessment, including a cystoscopy, did not reveal any identifiable cause for her complaint. An abdominopelvic computed tomography (CT) scan was performed as part of the investigation and showed a hypodense left perirectal mass with enhancing borders and ischiorectal extension (Figure ). An abscess was initially suspected. The patient’s symptoms consisted of suprapubic pain for the past year and lower back pain during defecation, which did not support the infectious premise. Abdominal and vaginal examinations were normal. A rectal examination revealed a soft left extraluminal lump.
Pelvic magnetic resonance imaging (MRI) revealed a left perirectal mass of 10.6 x 10.7 x 4.9 cm, which was in contact with the left posterolateral vaginal wall (Figure ). Transrectal ultrasonography showed a nonspecific left perirectal mass (Figure ).
A fine needle biopsy was performed but was inconclusive. A positron-emission tomography (PET) scan showed a mild hypermetabolic state in the mass, but it could not differentiate between a benign or malignant condition. No metastases were objectified. Our tumor board recommended a surgical resection, and the patient consequently underwent an open uncomplicated tumoral excision. The mass was not visible intraoperatively until the pouch of Douglas was opened. The rectum was left in place.
The pathological examination found a myxoid tumor without atypia or significant mitotic activity. Expression of estrogen (ER) and progesterone receptors (PR) was positive. Histological and immunohistochemical (IHC) features were consistent with an AA with positive microscopic margins.
The patient recovered uneventfully, except for a local pelvic abscess which was treated with antibiotics and percutaneous drainage. An abdominopelvic CT scan performed three months after the surgery showed no signs of recurrence. |
pmc-6559397-2 | A 46-year-old healthy female patient was evaluated at our institution for a perirectal mass of unknown etiology. Her past medical history was unremarkable. The patient reported a perineal mass in the standing position. Her only other symptom consisted of mild occasional dysuria. Rectal and vaginal examinations were normal.
An endovaginal ultrasound performed one year before the present events to assess a known voluminous fibroma made no mention of a pelvic mass. An ultrasound of the perineal soft tissues found a hypoechogenic and heterogeneous mass of 4 x 5 cm beneath the paramedian region of the buttock. Endoscopic ultrasound showed a pelvic heterogenous mass that did not seem to originate from the rectal wall. A pelvic MRI and scan were performed and revealed a tubular structure of 13 x 7.5 x 3.5 cm in the right parametrium. It was centered around the right adnexal region, crossing the pelvic floor, reaching the ischiorectal fossae, and continuing as digital extensions in the soft tissue of the buttock (Figure ). No invasion of the muscles, sphincters, or vaginal wall was noted. The possible suspected etiologies included an endometrioma, a parametrial cyst, a low-grade sarcoma, or another mesenchymal tumor. The absence of soft tissue infiltration ruled out an inflammatory cause. A PET scan showed a mild metabolism in the tumor, suggesting a cystic lesion. The diagnosis of a low-grade mesenchymal tumor could not, however, be excluded.
This unusual case was discussed at the institutional tumor board meeting and the decision was to proceed with surgical excision. The patient underwent an open surgical resection of the tumor. Due to a voluminous uterine fibroma that limited access to the pelvic cavity, an abdominal hysterectomy was performed. The pathological examination found a lesion with a proliferation of paucicellular spindle cells in a myxoid stroma and medium to thick-walled vessels of variable caliber. The stroma was without atypia. No mitoses or necrosis were identified. The histological aspect and immunohistochemical profile were consistent with the diagnosis of AA. The evaluation of the uterine specimen revealed two leiomyomas of 1.5 cm and 5.5 cm.
The patient’s evolution was satisfactory one month after the surgery with no symptoms suggesting a possible recurrence. An MRI performed four months after the procedure showed a right perirectal longitudinal tissular density with a length of 6 cm (Figure ). Imaging could not confirm if it was a recurrent mass, a surgical scar, or an incomplete excision. Due to a positive ER and PR, the decision of the tumor board was to initiate tamoxifen. One month later, the patient reported the feeling of a perineal mass, similar to the one felt prior to surgery. Another MRI was performed and showed a progression of the tissular density that extended upward to a length of 10 cm. The case was further discussed with the Gynecology-Oncology team and the joint decision was to start a luteinizing hormone-releasing hormone (LHRH) agonist.
Three months later, a repeat MRI found a considerable improvement with a sharp decline in the lesion’s extent, now measuring 3.1 x 2.3 x 1.6 cm. One year after the surgical excision, the lesion’s dimensions had further decreased to a length of 2.6 cm. An MRI 32 months after the surgery found a small residual centimetric lesion. After four years, an MRI revealed a thin image of residual fibrocicatricial tissue. After five and eight years, respectively, a repeat MRI showed no signs of recurrence and stability of a small residual local scar (Figure ). |
pmc-6559437-1 | A 52-year-old Caucasian gentleman presented to the hospital with a three-week history of shortness of breath. His past medical history was notable for diabetes mellitus type 2, human immunodeficiency virus (HIV) controlled with highly active retroviral medications, and chronic hepatitis C. His shortness of breath was mainly exertional and was associated with a dry cough. He denied fever, hemoptysis, wheezing, and chest pain. He reported a 60-pound weight loss in the few months prior to this illness. He was a seven-year former smoker with a pack/year index of 40. He denied alcohol and recreational drug use. His family history was notable for coronary artery disease in both parents. His medications included metformin and a combination pill of elvitegravir, cobicistat, emtricitabine, and tenofovir. His cluster of differentiation-4 (CD4) count was checked within the past year and was found to be 364. He reported compliance with all medications.
He was seen in an urgent care clinic and was prescribed levofloxacin with little improvement in his symptoms. He was referred to the hospital after computed tomography (CT) of the chest showed diffuse infiltrates. The chest x-ray was not available for review at the time of his hospital visit.
His chest x-ray and chest CT showed diffuse reticulonodular opacities involving all lung lobes, as well as bilateral pleural effusions (Figures -). Given his history of HIV, empiric treatment for pneumocystis pneumonia with sulfamethoxazole/trimethoprim was started. A CT scan of the abdomen and pelvis, which was done to evaluate for potential malignancy given his history of significant weight loss, revealed a mass in the body of the pancreas, as well as a left paraaortic mass.
The origin of the paraaortic mass was uncertain on the CT scan but could be from the left adrenal gland as opposed to paraaortic lymphadenopathy.
Diagnostic thoracentesis was done, and the cytology showed clusters of gland-forming cells consistent with a diagnosis of adenocarcinoma. A diagnosis of Stage 4 pancreatic cancer with the lymphangitic spread of the tumor to the lungs was made. The repeat CD4 count was 365. Respiratory cultures for bacteria and fungi were negative. Antibiotic therapy was stopped. A pancreatic biopsy was planned, but the patient’s respiratory status declined before the biopsy could be done. He was intubated and mechanically ventilated for acute hypoxic respiratory failure. The family decided to withdraw mechanical support after one week and the patient succumbed to death. The total time between the patient’s first medical contact and his death was less than six weeks.
Interstitial pulmonary diseases and infectious diseases were considered as the preliminary diagnoses in our case presentation because of the patient’s clinical picture, smoking, and HIV history. Differential diagnoses of sarcoidosis, interstitial lung disease (ILD), pneumocystis pneumonia, vasculitis, pneumonia, lymphoma, and Kaposi’s sarcoma should also be considered. |
Subsets and Splits
Exclude ER emergencies
Retrieves 100 descriptions that do not contain the terms 'ER' or 'emergency', providing a basic filter of the dataset.