chapter
stringlengths 1.97k
1.53M
| path
stringlengths 47
241
|
|---|---|
Gregor Johann Mendel was a German-speaking Moravian scientist and Augustinian friar who gained posthumous fame as the founder of the modern science of genetics. Though farmers had known for centuries that crossbreeding of animals and plants could favor certain desirable traits, Mendel's experiments established many of the rules of heredity, now referred to as the laws of Mendelian inheritance.
• 3.2.1: Introduction
Genetics is the study of heredity. Johann Gregor Mendel set the framework for genetics long before chromosomes or genes had been identified, at a time when meiosis was not well understood. Mendel selected a simple biological system and conducted methodical, quantitative analyses using large sample sizes. Because of Mendel’s work, the fundamental principles of heredity were revealed.
• 3.2.2: Mendel’s Experiments and the Laws of Probability
In 1865, Mendel presented the results of his experiments with nearly 30,000 pea plants to the local Natural History Society. He demonstrated that traits are transmitted faithfully from parents to offspring independently of other traits and in dominant and recessive patterns.
• 3.2.3: Characteristics and Traits
The genetic makeup of peas consists of two similar or homologous copies of each chromosome, one from each parent. Each pair of homologous chromosomes has the same linear order of genes; hence peas are diploid organisms. The same is true for many other plants and for virtually all animals. Diploid organisms utilize meiosis to produce haploid gametes, which contain one copy of each homologous chromosome that unite at fertilization to create a diploid zygote.
• 3.2.4: Laws of Inheritance
Mendel generalized the results of his pea-plant experiments into four postulates, some of which are sometimes called “laws,” that describe the basis of dominant and recessive inheritance in diploid organisms. As you have learned, more complex extensions of Mendelism exist that do not exhibit the same F2 phenotypic ratios (3:1). Nevertheless, these laws summarize the basics of classical genetics.
• 3.2.5: Key Terms
• 3.2.6: Chapter Summary
• 3.2.7: Visual Connection Questions
• 3.2.8: Review Questions
• 3.2.9: Critical Thinking Questions
Thumbnail: Pea plants were used by Gregor Mendel to discover some fundamental laws of genetics. (Flicker-Christian Guthier-CC:A).
3.02: Mendel's Experiments and Heredity
Figure 12.1 Experimenting with thousands of garden peas, Mendel uncovered the fundamentals of genetics. (credit: modification of work by Jerry Kirkhart)
Genetics is the study of heredity. Johann Gregor Mendel set the framework for genetics long before chromosomes or genes had been identified, at a time when meiosis was not well understood. Mendel selected a simple biological system and conducted methodical, quantitative analyses using large sample sizes. Because of Mendel’s work, the fundamental principles of heredity were revealed. We now know that genes, carried on chromosomes, are the basic functional units of heredity with the capability to be replicated, expressed, or mutated. Today, the postulates put forth by Mendel form the basis of classical, or Mendelian, genetics. Not all genes are transmitted from parents to offspring according to Mendelian genetics, but Mendel’s experiments serve as an excellent starting point for thinking about inheritance.
3.2.02: Mendels Experiments and the Laws of Probability
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the scientific reasons for the success of Mendel’s experimental work
• Describe the expected outcomes of monohybrid crosses involving dominant and recessive alleles
• Apply the sum and product rules to calculate probabilities
Figure 12.2 Johann Gregor Mendel is considered the father of genetics.
Johann Gregor Mendel (1822–1884) (Figure 12.2) was a lifelong learner, teacher, scientist, and man of faith. As a young adult, he joined the Augustinian Abbey of St. Thomas in Brno in what is now the Czech Republic. Supported by the monastery, he taught physics, botany, and natural science courses at the secondary and university levels. In 1856, he began a decade-long research pursuit involving inheritance patterns in honeybees and plants, ultimately settling on pea plants as his primary model system (a system with convenient characteristics used to study a specific biological phenomenon to be applied to other systems). In 1865, Mendel presented the results of his experiments with nearly 30,000 pea plants to the local Natural History Society. He demonstrated that traits are transmitted from parents to offspring independently of other traits and in dominant and recessive patterns. In 1866, he published his work, Experiments in Plant Hybridization,1 in the proceedings of the Natural History Society of Brünn.
Mendel’s work went virtually unnoticed by the scientific community, which believed, incorrectly, that the process of inheritance involved a blending of parental traits that produced an intermediate physical appearance in offspring. The blending theory of inheritance asserted that the original parental traits were lost or absorbed by the blending in the offspring, but we now know that this is not the case. This hypothetical process appeared to be correct because of what we know now as continuous variation. Continuous variation results from the action of many genes to determine a characteristic like human height. Offspring appear to be a “blend” of their parents’ traits.
Instead of continuous characteristics, Mendel worked with traits that were inherited in distinct classes (specifically, violet versus white flowers); this is referred to as discontinuous variation. Mendel’s choice of these kinds of traits allowed him to see experimentally that the traits were not blended in the offspring, nor were they absorbed, but rather that they kept their distinctness and could be passed on. In 1868, Mendel became abbot of the monastery and exchanged his scientific pursuits for his pastoral duties. He was not recognized for his extraordinary scientific contributions during his lifetime. In fact, it was not until 1900 that his work was rediscovered, reproduced, and revitalized by scientists on the brink of discovering the chromosomal basis of heredity.
Mendel’s Model System
Mendel’s seminal work was accomplished using the garden pea, Pisum sativum, to study inheritance. This species naturally self-fertilizes, such that pollen encounters ova within individual flowers. The flower petals remain sealed tightly until after pollination, preventing pollination from other plants. The result is highly inbred, or “true-breeding,” pea plants. These are plants that always produce offspring that look like the parent. By experimenting with true-breeding pea plants, Mendel avoided the appearance of unexpected traits in offspring that might occur if the plants were not true breeding. The garden pea also grows to maturity within one season, meaning that several generations could be evaluated over a relatively short time. Finally, large quantities of garden peas could be cultivated simultaneously, allowing Mendel to conclude that his results did not come about simply by chance.
Mendelian Crosses
Mendel performed hybridizations, which involve mating two true-breeding individuals that have different traits. In the pea, which is naturally self-pollinating, this is done by manually transferring pollen from the anther of a mature pea plant of one variety to the stigma of a separate mature pea plant of the second variety. In plants, pollen carries the male gametes (sperm) to the stigma, a sticky organ that traps pollen and allows the sperm to move down the pistil to the female gametes (ova) below. To prevent the pea plant that was receiving pollen from self-fertilizing and confounding his results, Mendel painstakingly removed all of the anthers from the plant’s flowers before they had a chance to mature.
Plants used in first-generation crosses were called P0, or parental generation one (Figure 12.3). After each cross, Mendel collected the seeds belonging to the P0 plants and grew them the following season. These offspring were called the F1, or the first filial (filial = offspring, daughter or son) generation. Once Mendel examined the characteristics in the F1 generation of plants, he allowed them to self-fertilize naturally. He then collected and grew the seeds from the F1 plants to produce the F2, or second filial, generation. Mendel’s experiments extended beyond the F2 generation to the F3 and F4 generations, and so on, but it was the ratio of characteristics in the P0−F1−F2 generations that were the most intriguing and became the basis for Mendel’s postulates.
Figure 12.3 In one of his experiments on inheritance patterns, Mendel crossed plants that were true-breeding for violet flower color with plants true-breeding for white flower color (the P generation). The resulting hybrids in the F1 generation all had violet flowers. In the F2 generation, approximately three quarters of the plants had violet flowers, and one quarter had white flowers.
Garden Pea Characteristics Revealed the Basics of Heredity
In his 1865 publication, Mendel reported the results of his crosses involving seven different characteristics, each with two contrasting traits. A trait is defined as a variation in the physical appearance of a heritable characteristic. The characteristics included plant height, seed texture, seed color, flower color, pea pod size, pea pod color, and flower position. For the characteristic of flower color, for example, the two contrasting traits were white versus violet. To fully examine each characteristic, Mendel generated large numbers of F1 and F2 plants, reporting results from 19,959 F2 plants alone. His findings were consistent.
What results did Mendel find in his crosses for flower color? First, Mendel confirmed that he had plants that bred true for white or violet flower color. Regardless of how many generations Mendel examined, all self-crossed offspring of parents with white flowers had white flowers, and all self-crossed offspring of parents with violet flowers had violet flowers. In addition, Mendel confirmed that, other than flower color, the pea plants were physically identical.
Once these validations were complete, Mendel applied the pollen from a plant with violet flowers to the stigma of a plant with white flowers. After gathering and sowing the seeds that resulted from this cross, Mendel found that 100 percent of the F1 hybrid generation had violet flowers. Conventional wisdom at that time (the blending theory) would have predicted the hybrid flowers to be pale violet or for hybrid plants to have equal numbers of white and violet flowers. In other words, the contrasting parental traits were expected to blend in the offspring. Instead, Mendel’s results demonstrated that the white flower trait in the F1 generation had completely disappeared.
Importantly, Mendel did not stop his experimentation there. He allowed the F1 plants to self-fertilize and found that, of F2-generation plants, 705 had violet flowers and 224 had white flowers. This was a ratio of 3.15 violet flowers per one white flower, or approximately 3:1. When Mendel transferred pollen from a plant with violet flowers to the stigma of a plant with white flowers and vice versa, he obtained about the same ratio regardless of which parent, male or female, contributed which trait. This is called a reciprocal cross—a paired cross in which the respective traits of the male and female in one cross become the respective traits of the female and male in the other cross. For the other six characteristics Mendel examined, the F1 and F2 generations behaved in the same way as they had for flower color. One of the two traits would disappear completely from the F1 generation only to reappear in the F2 generation at a ratio of approximately 3:1 (Table 12.1).
The Results of Mendel’s Garden Pea Hybridizations
Characteristic Contrasting P0 Traits F1 Offspring Traits F2 Offspring Traits F2 Trait Ratios
Flower color Violet vs. white 100 percent violet
• 705 violet
• 224 white
3.15:1
Flower position Axial vs. terminal 100 percent axial
• 651 axial
• 207 terminal
3.14:1
Plant height Tall vs. dwarf 100 percent tall
• 787 tall
• 277 dwarf
2.84:1
Seed texture Round vs. wrinkled 100 percent round
• 5,474 round
• 1,850 wrinkled
2.96:1
Seed color Yellow vs. green 100 percent yellow
• 6,022 yellow
• 2,001 green
3.01:1
Pea pod texture Inflated vs. constricted 100 percent inflated
• 882 inflated
• 299 constricted
2.95:1
Pea pod color Green vs. yellow 100 percent green
• 428 green
• 152 yellow
2.82:1
Table 12.1
Upon compiling his results for many thousands of plants, Mendel concluded that the characteristics could be divided into expressed and latent traits. He called these, respectively, dominant and recessive traits. Dominant traits are those that are inherited unchanged in a hybridization. Recessive traits become latent, or disappear, in the offspring of a hybridization. The recessive trait does, however, reappear in the progeny of the hybrid offspring. An example of a dominant trait is the violet-flower trait. For this same characteristic (flower color), white-colored flowers are a recessive trait. The fact that the recessive trait reappeared in the F2 generation meant that the traits remained separate (not blended) in the plants of the F1 generation. Mendel also proposed that plants possessed two copies of the trait for the flower-color characteristic, and that each parent transmitted one of its two copies to its offspring, where they came together. Moreover, the physical observation of a dominant trait could mean that the genetic composition of the organism included two dominant versions of the characteristic or that it included one dominant and one recessive version. Conversely, the observation of a recessive trait meant that the organism lacked any dominant versions of this characteristic.
So why did Mendel repeatedly obtain 3:1 ratios in his crosses? To understand how Mendel deduced the basic mechanisms of inheritance that lead to such ratios, we must first review the laws of probability.
Probability Basics
Probabilities are mathematical measures of likelihood. The empirical probability of an event is calculated by dividing the number of times the event occurs by the total number of opportunities for the event to occur. It is also possible to calculate theoretical probabilities by dividing the number of times that an event is expected to occur by the number of times that it could occur. Empirical probabilities come from observations, like those of Mendel. Theoretical probabilities, on the other hand, come from knowing how the events are produced and assuming that the probabilities of individual outcomes are equal. A probability of one for some event indicates that it is guaranteed to occur, whereas a probability of zero indicates that it is guaranteed not to occur. An example of a genetic event is a round seed produced by a pea plant.
In one experiment, Mendel demonstrated that the probability of the event “round seed” occurring was one in the F1 offspring of true-breeding parents, one of which has round seeds and one of which has wrinkled seeds. When the F1 plants were subsequently self-crossed, the probability of any given F2 offspring having round seeds was now three out of four. In other words, in a large population of F2 offspring chosen at random, 75 percent were expected to have round seeds, whereas 25 percent were expected to have wrinkled seeds. Using large numbers of crosses, Mendel was able to calculate probabilities and use these to predict the outcomes of other crosses.
The Product Rule and Sum Rule
Mendel demonstrated that pea plants transmit characteristics as discrete units from parent to offspring. As will be discussed, Mendel also determined that different characteristics, like seed color and seed texture, were transmitted independently of one another and could be considered in separate probability analyses. For instance, performing a cross between a plant with green, wrinkled seeds and a plant with yellow, round seeds still produced offspring that had a 3:1 ratio of yellow:green seeds (ignoring seed texture) and a 3:1 ratio of wrinkled:round seeds (ignoring seed color). The characteristics of color and texture did not influence each other.
The product rule of probability can be applied to this phenomenon of the independent transmission of characteristics. The product rule states that the probability of two independent events occurring together can be calculated by multiplying the individual probabilities of each event occurring alone. To demonstrate the product rule, imagine that you are rolling a six-sided die (D) and flipping a penny (P) at the same time. The die may roll any number from 1–6 (D#), whereas the penny may turn up heads (PH) or tails (PT). The outcome of rolling the die has no effect on the outcome of flipping the penny and vice versa. There are 12 possible outcomes of this action (Table 12.2), and each event is expected to occur with equal probability.
Twelve Equally Likely Outcomes of Rolling a Die and Flipping a Penny
Rolling Die Flipping Penny
D1 PH
D1 PT
D2 PH
D2 PT
D3 PH
D3 PT
D4 PH
D4 PT
D5 PH
D5 PT
D6 PH
D6 PT
Table 12.2
Of the 12 possible outcomes, the die has a 2/12 (or 1/6) probability of rolling a two, and the penny has a 6/12 (or 1/2) probability of coming up heads. By the product rule, the probability that you will obtain the combined outcome 2 and heads is: (D2) x (PH) = (1/6) x (1/2) or 1/12 (Table 12.3). Notice the word “and” in the description of the probability. The “and” is a signal to apply the product rule. For example, consider how the product rule is applied to the dihybrid cross: the probability of having both dominant traits (for example, yellow and round) in the F2 progeny is the product of the probabilities of having the dominant trait for each characteristic, as shown here:
$3 4 × 3 4 = 9 16 3 4 × 3 4 = 9 16$
On the other hand, the sum rule of probability is applied when considering two mutually exclusive outcomes that can come about by more than one pathway. The sum rule states that the probability of the occurrence of one event or the other event, of two mutually exclusive events, is the sum of their individual probabilities. Notice the word “or” in the description of the probability. The “or” indicates that you should apply the sum rule. In this case, let’s imagine you are flipping a penny (P) and a quarter (Q). What is the probability of one coin coming up heads and one coin coming up tails? This outcome can be achieved by two cases: the penny may be heads (PH) and the quarter may be tails (QT), or the quarter may be heads (QH) and the penny may be tails (PT). Either case fulfills the outcome. By the sum rule, we calculate the probability of obtaining one head and one tail as [(PH) × (QT)] + [(QH) × (PT)] = [(1/2) × (1/2)] + [(1/2) × (1/2)] = 1/2 (Table 12.3). You should also notice that we used the product rule to calculate the probability of PH and QT, and also the probability of PT and QH, before we summed them. Again, the sum rule can be applied to show the probability of having at least one dominant trait in the F2 generation of a dihybrid cross:
$( 1 4 × 3 4 ) + ( 3 4 × 1 4 ) = 3 16 + 3 16 = 6 16 = 3 8 ( 1 4 × 3 4 ) + ( 3 4 × 1 4 ) = 3 16 + 3 16 = 6 16 = 3 8$
The Product Rule and Sum Rule
Product Rule Sum Rule
For independent events A and B, the probability (P) of them both occurring (A and B) is (PA × PB) For mutually exclusive events A and B, the probability (P) that at least one occurs (A or B) is (PA + PB)
Table 12.3
To use probability laws in practice, we must work with large sample sizes because small sample sizes are prone to deviations caused by chance. The large quantities of pea plants that Mendel examined allowed him to calculate the probabilities of the traits appearing in his F2 generation. As you will learn, this discovery meant that when parental traits were known, the offspring’s traits could be predicted accurately even before fertilization.
Footnotes
• 1Johann Gregor Mendel, Versuche über Pflanzenhybriden Verhandlungen des naturforschenden Vereines in Brünn, Bd. IV für das Jahr, 1865 Abhandlungen, 3–47. [for English translation see http://www.mendelweb.org/Mendel.plain.html]
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.02%3A_Mendel%27s_Experiments_and_Heredity/3.2.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Explain the relationship between genotypes and phenotypes in dominant and recessive gene systems
• Develop a Punnett square to calculate the expected proportions of genotypes and phenotypes in a monohybrid cross
• Explain the purpose and methods of a test cross
• Identify non-Mendelian inheritance patterns such as incomplete dominance, codominance, recessive lethals, multiple alleles, and sex linkage
Physical characteristics are expressed through genes carried on chromosomes. The genetic makeup of peas consists of two similar, or homologous, copies of each chromosome, one from each parent. Each pair of homologous chromosomes has the same linear order of genes. In other words, peas are diploid organisms in that they have two copies of each chromosome. The same is true for many other plants and for virtually all animals. Diploid organisms produce haploid gametes, which contain one copy of each homologous chromosome that unite at fertilization to create a diploid zygote.
For cases in which a single gene controls a single characteristic, a diploid organism has two genetic copies that may or may not encode the same version of that characteristic. Gene variants that arise by mutation and exist at the same relative locations on homologous chromosomes are called alleles. Mendel examined the inheritance of genes with just two allele forms, but it is common to encounter more than two alleles for any given gene in a natural population.
Phenotypes and Genotypes
Two alleles for a given gene in a diploid organism are expressed and interact to produce physical characteristics. The observable traits expressed by an organism are referred to as its phenotype. An organism’s underlying genetic makeup, consisting of both physically visible and non-expressed alleles, is called its genotype. Mendel’s hybridization experiments demonstrate the difference between phenotype and genotype. When true-breeding plants in which one parent had yellow pods and one had green pods were cross-fertilized, all of the F1 hybrid offspring had yellow pods. That is, the hybrid offspring were phenotypically identical to the true-breeding parent with yellow pods. However, we know that the allele donated by the parent with green pods was not simply lost because it reappeared in some of the F2 offspring. Therefore, the F1 plants must have been genotypically different from the parent with yellow pods.
The P1 plants that Mendel used in his experiments were each homozygous for the trait he was studying. Diploid organisms that are homozygous at a given gene, or locus, have two identical alleles for that gene on their homologous chromosomes. Mendel’s parental pea plants always bred true because both of the gametes produced carried the same trait. When P1 plants with contrasting traits were cross-fertilized, all of the offspring were heterozygous for the contrasting trait, meaning that their genotype reflected that they had different alleles for the gene being examined.
Dominant and Recessive Alleles
Our discussion of homozygous and heterozygous organisms brings us to why the F1 heterozygous offspring were identical to one of the parents, rather than expressing both alleles. In all seven pea-plant characteristics, one of the two contrasting alleles was dominant, and the other was recessive. Mendel called the dominant allele the expressed unit factor; the recessive allele was referred to as the latent unit factor. We now know that these so-called unit factors are actually genes on homologous chromosome pairs. For a gene that is expressed in a dominant and recessive pattern, homozygous dominant and heterozygous organisms will look identical (that is, they will have different genotypes but the same phenotype). The traits of the recessive allele will only be observed in homozygous recessive individuals (Table 12.4).
Human Inheritance in Dominant and Recessive Patterns
Dominant Traits Recessive Traits
Achondroplasia Albinism
Brachydactyly Cystic fibrosis
Huntington’s disease Duchenne muscular dystrophy
Marfan syndrome Galactosemia
Neurofibromatosis Phenylketonuria
Widow’s peak Sickle-cell anemia
Wooly hair Tay-Sachs disease
Table 12.4
Several conventions exist for referring to genes and alleles. For the purposes of this chapter, we will abbreviate genes using the first letter of the gene’s corresponding dominant trait. For example, violet is the dominant trait for a pea plant’s flower color, so the flower-color gene would be abbreviated as V (note that it is customary to italicize gene designations). Furthermore, we will use uppercase and lowercase letters to represent dominant and recessive alleles, respectively. Therefore, we would refer to the genotype of a homozygous dominant pea plant with violet flowers as VV, a homozygous recessive pea plant with white flowers as vv, and a heterozygous pea plant with violet flowers as Vv.
The Punnett Square Approach for a Monohybrid Cross
When fertilization occurs between two true-breeding parents that differ in only one characteristic, the process is called a monohybrid cross, and the resulting offspring are monohybrids. Mendel performed seven monohybrid crosses involving contrasting traits for each characteristic. On the basis of his results in F1 and F2 generations, Mendel postulated that each parent in the monohybrid cross contributed one of two paired unit factors to each offspring, and every possible combination of unit factors was equally likely.
To demonstrate a monohybrid cross, consider the case of true-breeding pea plants with yellow versus green pea seeds. The dominant seed color is yellow; therefore, the parental genotypes were YY for the plants with yellow seeds and yy for the plants with green seeds, respectively. A Punnett square, devised by the British geneticist Reginald Punnett, can be drawn that applies the rules of probability to predict the possible outcomes of a genetic cross or mating and their expected frequencies. To prepare a Punnett square, all possible combinations of the parental alleles are listed along the top (for one parent) and side (for the other parent) of a grid, representing their meiotic segregation into haploid gametes. Then the combinations of egg and sperm are made in the boxes in the table to show which alleles are combining. Each box then represents the diploid genotype of a zygote, or fertilized egg, that could result from this mating. Because each possibility is equally likely, genotypic ratios can be determined from a Punnett square. If the pattern of inheritance (dominant or recessive) is known, the phenotypic ratios can be inferred as well. For a monohybrid cross of two true-breeding parents, each parent contributes one type of allele. In this case, only one genotype is possible. All offspring are Yy and have yellow seeds (Figure 12.4).
Figure 12.4 In the P generation, pea plants that are true-breeding for the dominant yellow phenotype are crossed with plants with the recessive green phenotype. This cross produces F1 heterozygotes with a yellow phenotype. Punnett square analysis can be used to predict the genotypes of the F2 generation.
A self-cross of one of the Yy heterozygous offspring can be represented in a 2 × 2 Punnett square because each parent can donate one of two different alleles. Therefore, the offspring can potentially have one of four allele combinations: YY, Yy, yY, or yy (Figure 12.4). Notice that there are two ways to obtain the Yy genotype: a Y from the egg and a y from the sperm, or a y from the egg and a Y from the sperm. Both of these possibilities must be counted. Recall that Mendel’s pea-plant characteristics behaved in the same way in reciprocal crosses. Therefore, the two possible heterozygous combinations produce offspring that are genotypically and phenotypically identical despite their dominant and recessive alleles deriving from different parents. They are grouped together. Because fertilization is a random event, we expect each combination to be equally likely and for the offspring to exhibit a ratio of YY:Yy:yy genotypes of 1:2:1 (Figure 12.4). Furthermore, because the YY and Yy offspring have yellow seeds and are phenotypically identical, applying the sum rule of probability, we expect the offspring to exhibit a phenotypic ratio of 3 yellow:1 green. Indeed, working with large sample sizes, Mendel observed approximately this ratio in every F2 generation resulting from crosses for individual traits.
Mendel validated these results by performing an F3 cross in which he self-crossed the dominant- and recessive-expressing F2 plants. When he self-crossed the plants expressing green seeds, all of the offspring had green seeds, confirming that all green seeds had homozygous genotypes of yy. When he self-crossed the F2 plants expressing yellow seeds, he found that one-third of the plants bred true, and two-thirds of the plants segregated at a 3:1 ratio of yellow:green seeds. In this case, the true-breeding plants had homozygous (YY) genotypes, whereas the segregating plants corresponded to the heterozygous (Yy) genotype. When these plants self-fertilized, the outcome was just like the F1 self-fertilizing cross.
The Test Cross Distinguishes the Dominant Phenotype
Beyond predicting the offspring of a cross between known homozygous or heterozygous parents, Mendel also developed a way to determine whether an organism that expressed a dominant trait was a heterozygote or a homozygote. Called the test cross, this technique is still used by plant and animal breeders. In a test cross, the dominant-expressing organism is crossed with an organism that is homozygous recessive for the same characteristic. If the dominant-expressing organism is a homozygote, then all F1 offspring will be heterozygotes expressing the dominant trait (Figure 12.5). Alternatively, if the dominant expressing organism is a heterozygote, the F1 offspring will exhibit a 1:1 ratio of heterozygotes and recessive homozygotes (Figure 12.5). The test cross further validates Mendel’s postulate that pairs of unit factors segregate equally.
Visual Connection
Visual Connection
Figure 12.5 A test cross can be performed to determine whether an organism expressing a dominant trait is a homozygote or a heterozygote.
In pea plants, round peas (R) are dominant to wrinkled peas (r). You do a test cross between a pea plant with wrinkled peas (genotype rr) and a plant of unknown genotype that has round peas. You end up with three plants, all which have round peas. From this data, can you tell if the round pea parent plant is homozygous dominant or heterozygous? If the round pea parent plant is heterozygous, what is the probability that a random sample of 3 progeny peas will all be round?
Many human diseases are genetically inherited. A healthy person in a family in which some members suffer from a recessive genetic disorder may want to know if they have the disease-causing gene and what risk exists of passing the disorder on to their offspring. Of course, doing a test cross in humans is unethical and impractical. Instead, geneticists use pedigree analysis to study the inheritance pattern of human genetic diseases (Figure 12.6).
Visual Connection
Visual Connection
Figure 12.6 Alkaptonuria is a recessive genetic disorder in which two amino acids, phenylalanine and tyrosine, are not properly metabolized. Affected individuals may have darkened skin and brown urine, and may suffer joint damage and other complications. In this pedigree, individuals with the disorder are indicated in blue and have the genotype aa. Unaffected individuals are indicated in yellow and have the genotype AA or Aa. Note that it is often possible to determine a person’s genotype from the genotype of their offspring. For example, if neither parent has the disorder but their child does, they must be heterozygous. Two individuals on the pedigree have an unaffected phenotype but unknown genotype. Because they do not have the disorder, they must have at least one normal allele, so their genotype gets the “A?” designation.
What are the genotypes of the individuals labeled 1, 2, and 3?
Alternatives to Dominance and Recessiveness
Mendel’s experiments with pea plants suggested that: (1) two “units” or alleles exist for every gene; (2) alleles maintain their integrity in each generation (no blending); and (3) in the presence of the dominant allele, the recessive allele is hidden and makes no contribution to the phenotype. Therefore, recessive alleles can be “carried” and not expressed by individuals. Such heterozygous individuals are sometimes referred to as “carriers.” Further genetic studies in other plants and animals have shown that much more complexity exists, but that the fundamental principles of Mendelian genetics still hold true. In the sections to follow, we consider some of the extensions of Mendelism. If Mendel had chosen an experimental system that exhibited these genetic complexities, it’s possible that he would not have understood what his results meant.
Incomplete Dominance
Mendel’s results, that traits are inherited as dominant and recessive pairs, contradicted the view at that time that offspring exhibited a blend of their parents’ traits. However, the heterozygote phenotype occasionally does appear to be intermediate between the two parents. For example, in the snapdragon, Antirrhinum majus (Figure 12.7), a cross between a homozygous parent with white flowers (CWCW) and a homozygous parent with red flowers (CRCR) will produce offspring with pink flowers (CRCW). (Note that different genotypic abbreviations are used for Mendelian extensions to distinguish these patterns from simple dominance and recessiveness.) This pattern of inheritance is described as incomplete dominance, denoting the expression of two contrasting alleles such that the individual displays an intermediate phenotype. The allele for red flowers is incompletely dominant over the allele for white flowers. However, the results of a heterozygote self-cross can still be predicted, just as with Mendelian dominant and recessive crosses. In this case, the genotypic ratio would be 1 CRCR:2 CRCW:1 CWCW, and the phenotypic ratio would be 1:2:1 for red:pink:white.
Figure 12.7 These pink flowers of a heterozygote snapdragon result from incomplete dominance. (credit: “storebukkebruse”/Flickr)
Codominance
A variation on incomplete dominance is codominance, in which both alleles for the same characteristic are simultaneously expressed in the heterozygote. An example of codominance is the MN blood groups of humans. The M and N alleles are expressed in the form of an M or N antigen present on the surface of red blood cells. Homozygotes (LMLM and LNLN) express either the M or the N allele, and heterozygotes (LMLN) express both alleles equally. In a self-cross between heterozygotes expressing a codominant trait, the three possible offspring genotypes are phenotypically distinct. However, the 1:2:1 genotypic ratio characteristic of a Mendelian monohybrid cross still applies.
Multiple Alleles
Mendel implied that only two alleles, one dominant and one recessive, could exist for a given gene. We now know that this is an oversimplification. Although individual humans (and all diploid organisms) can only have two alleles for a given gene, multiple alleles may exist at the population level such that many combinations of two alleles are observed. Note that when many alleles exist for the same gene, the convention is to denote the most common phenotype or genotype among wild animals as the wild type (often abbreviated “+”); this is considered the standard or norm. All other phenotypes or genotypes are considered variants of this standard, meaning that they deviate from the wild type. The variant may be recessive or dominant to the wild-type allele.
An example of multiple alleles is coat color in rabbits (Figure 12.8). Here, four alleles exist for the c gene. The wild-type version, C+C+, is expressed as brown fur. The chinchilla phenotype, cchcch, is expressed as black-tipped white fur. The Himalayan phenotype, chch, has black fur on the extremities and white fur elsewhere. Finally, the albino, or “colorless” phenotype, cc, is expressed as white fur. In cases of multiple alleles, dominance hierarchies can exist. In this case, the wild-type allele is dominant over all the others, chinchilla is incompletely dominant over Himalayan and albino, and Himalayan is dominant over albino. This hierarchy, or allelic series, was revealed by observing the phenotypes of each possible heterozygote offspring.
Figure 12.8 Four different alleles exist for the rabbit coat color (C) gene.
The complete dominance of a wild-type phenotype over all other mutants often occurs as an effect of “dosage” of a specific gene product, such that the wild-type allele supplies the correct amount of gene product whereas the mutant alleles cannot. For the allelic series in rabbits, the wild-type allele may supply a given dosage of fur pigment, whereas the mutants supply a lesser dosage or none at all. Interestingly, the Himalayan phenotype is the result of an allele that produces a temperature-sensitive gene product that only produces pigment in the cooler extremities of the rabbit’s body.
Alternatively, one mutant allele can be dominant over all other phenotypes, including the wild type. This may occur when the mutant allele somehow interferes with the genetic message so that even a heterozygote with one wild-type allele copy expresses the mutant phenotype. One way in which the mutant allele can interfere is by enhancing the function of the wild-type gene product or changing its distribution in the body. One example of this is the Antennapedia mutation in Drosophila (Figure 12.9). In this case, the mutant allele expands the distribution of the gene product, and as a result, the Antennapedia heterozygote develops legs on its head where its antennae should be.
Figure 12.9 As seen in comparing the wild-type Drosophila (left) and the Antennapedia mutant (right), the Antennapedia mutant has legs on its head in place of antennae.
Evolution Connection
Evolution Connection
Multiple Alleles Confer Drug Resistance in the Malaria ParasiteMalaria is a parasitic disease in humans that is transmitted by infected female mosquitoes, including Anopheles gambiae (Figure 12.10a), and is characterized by cyclic high fevers, chills, flu-like symptoms, and severe anemia. Plasmodium falciparum and P. vivax are the most common causative agents of malaria, and P. falciparum is the most deadly (Figure 12.10b). When promptly and correctly treated, P. falciparum malaria has a mortality rate of 0.1 percent. However, in some parts of the world, the parasite has evolved resistance to commonly used malaria treatments, so the most effective malarial treatments can vary by geographic region.
Figure 12.10 The (a) Anopheles gambiae, or African malaria mosquito, acts as a vector in the transmission to humans of the malaria-causing parasite (b) Plasmodium falciparum, here visualized using false-color transmission electron microscopy. (credit a: James D. Gathany; credit b: Ute Frevert; false color by Margaret Shear; scale-bar data from Matt Russell)
In Southeast Asia, Africa, and South America, P. falciparum has developed resistance to the anti-malarial drugs chloroquine, mefloquine, and sulfadoxine-pyrimethamine. P. falciparum, which is haploid during the life stage in which it is infectious to humans, has evolved multiple drug-resistant mutant alleles of the dhps gene. Varying degrees of sulfadoxine resistance are associated with each of these alleles. Being haploid, P. falciparum needs only one drug-resistant allele to express this trait.
In Southeast Asia, different sulfadoxine-resistant alleles of the dhps gene are localized to different geographic regions. This is a common evolutionary phenomenon that occurs because drug-resistant mutants arise in a population and interbreed with other P. falciparum isolates in close proximity. Sulfadoxine-resistant parasites cause considerable human hardship in regions where this drug is widely used as an over-the-counter malaria remedy. As is common with pathogens that multiply to large numbers within an infection cycle, P. falciparum evolves relatively rapidly (over a decade or so) in response to the selective pressure of commonly used anti-malarial drugs. For this reason, scientists must constantly work to develop new drugs or drug combinations to combat the worldwide malaria burden.2
X-Linked Traits
In humans, as well as in many other animals and some plants, the sex of the individual is determined by sex chromosomes. The sex chromosomes are one pair of non-homologous chromosomes. Until now, we have only considered inheritance patterns among non-sex chromosomes, or autosomes. In addition to 22 homologous pairs of autosomes, human females have a homologous pair of X chromosomes, whereas human males have an XY chromosome pair. Although the Y chromosome contains a small region of similarity to the X chromosome so that they can pair during meiosis, the Y chromosome is much shorter and contains many fewer genes. In fact, when Nettie Stevens discovered that the X and Y chromosomes were the determinants of sex, she differentiated them only by size. (Note that in this case and in the description below, the terms X and Y chromosome were not used at the time.) When a gene being examined is present on the X chromosome, but not on the Y chromosome, it is said to be X-linked.
Eye color in Drosophila was one of the first X-linked traits to be identified. Thomas Hunt Morgan mapped this trait to what became known as the X chromosome in 1910. Like humans, Drosophila males have an XY chromosome pair, and females are XX. In flies, the wild-type eye color is red (XW) and it is dominant to white eye color (Xw) (Figure 12.11). Because of the location of the eye-color gene, reciprocal crosses do not produce the same offspring ratios. Males are said to be hemizygous, because they have only one allele for any X-linked characteristic. Hemizygosity makes the descriptions of dominance and recessiveness irrelevant for XY males. Drosophila males lack a second allele copy on the Y chromosome; that is, their genotype can only be XWY or XwY. In contrast, females have two allele copies of this gene and can be XWXW, XWXw, or XwXw.
Figure 12.11 In Drosophila, several genes determine eye color. The genes for white and vermilion eye colors are located on the X chromosome. Others are located on the autosomes. Clockwise from top left are brown, cinnabar, sepia, vermilion, white, and red. Red eye color is wild-type and is dominant to white eye color.
In an X-linked cross, the genotypes of F1 and F2 offspring depend on whether the recessive trait was expressed by the male or the female in the P1 generation. With regard to Drosophila eye color, when the P1 male expresses the white-eye phenotype and the female is homozygous red-eyed, all members of the F1 generation exhibit red eyes (Figure 12.12). The F1 females are heterozygous (XWXw), and the males are all XWY, having received their X chromosome from the homozygous dominant P1 female and their Y chromosome from the P1 male. A subsequent cross between the XWXw female and the XWY male would produce only red-eyed females (with XWXW or XWXw genotypes) and both red- and white-eyed males (with XWY or XwY genotypes). Now, consider a cross between a homozygous white-eyed female and a male with red eyes. The F1 generation would exhibit only heterozygous red-eyed females (XWXw) and only white-eyed males (XwY). Half of the F2 females would be red-eyed (XWXw) and half would be white-eyed (XwXw). Similarly, half of the F2 males would be red-eyed (XWY) and half would be white-eyed (XwY).
Visual Connection
Visual Connection
Figure 12.12 Punnett square analysis is used to determine the ratio of offspring from a cross between a red-eyed male fruit fly and a white-eyed female fruit fly.
What ratio of offspring would result from a cross between a white-eyed male and a female that is heterozygous for red eye color?
Discoveries in fruit fly genetics can be applied to human genetics. When a female parent is homozygous for a recessive X-linked trait, she will pass the trait on to 100 percent of her offspring. Her male offspring are, therefore, destined to express the trait, as they will inherit their father's Y chromosome. In humans, the alleles for certain conditions (some forms of color blindness, hemophilia, and muscular dystrophy) are X-linked. Females who are heterozygous for these diseases are said to be carriers and may not exhibit any phenotypic effects. These females will pass the disease to half of their sons and will pass carrier status to half of their daughters; therefore, recessive X-linked traits appear more frequently in males than females.
In some groups of organisms with sex chromosomes, the sex with the non-homologous sex chromosomes is the female rather than the male. This is the case for all birds. In this case, sex-linked traits will be more likely to appear in the female, in which they are hemizygous.
Human Sex-linked Disorders
Sex-linkage studies in Morgan’s laboratory provided the fundamentals for understanding X-linked recessive disorders in humans, which include red-green color blindness, and Types A and B hemophilia. Because human males need to inherit only one recessive mutant X allele to be affected, X-linked disorders are disproportionately observed in males. Females must inherit recessive X-linked alleles from both of their parents in order to express the trait. When they inherit one recessive X-linked mutant allele and one dominant X-linked wild-type allele, they are carriers of the trait and are typically unaffected. Carrier females can manifest mild forms of the trait due to the inactivation of the dominant allele located on one of the X chromosomes. However, female carriers can contribute the trait to their male children, resulting in the male exhibiting the trait, or they can contribute the recessive allele to their female children, resulting in the children being carriers of the trait (Figure 12.13). Although some Y-linked recessive disorders exist, typically they are associated with infertility in males and are therefore not transmitted to subsequent generations.
Figure 12.13 The male offspring of a person who is a carrier of a recessive X-linked disorder will have a 50 percent chance of being affected. A female will not be affected, but she will have a 50 percent chance of being a carrier like the female parent.
Link to Learning
Link to Learning
Watch this video to learn more about sex-linked traits.
Lethality
A large proportion of genes in an individual’s genome are essential for survival. Occasionally, a nonfunctional allele for an essential gene can arise by mutation and be transmitted in a population as long as individuals with this allele also have a wild-type, functional copy. The wild-type allele functions at a capacity sufficient to sustain life and is therefore considered to be dominant over the nonfunctional allele. However, consider two heterozygous parents that have a genotype of wild-type/nonfunctional mutant for a hypothetical essential gene. In one quarter of their offspring, we would expect to observe individuals that are homozygous recessive for the nonfunctional allele. Because the gene is essential, these individuals might fail to develop past fertilization, die in utero, or die later in life, depending on what life stage requires this gene. An inheritance pattern in which an allele is only lethal in the homozygous form and in which the heterozygote may be normal or have some altered nonlethal phenotype is referred to as recessive lethal.
For crosses between heterozygous individuals with a recessive lethal allele that causes death before birth when homozygous, only wild-type homozygotes and heterozygotes would be observed. The genotypic ratio would therefore be 2:1. In other instances, the recessive lethal allele might also exhibit a dominant (but not lethal) phenotype in the heterozygote. For instance, the recessive lethal Curly allele in Drosophila affects wing shape in the heterozygote form but is lethal in the homozygote.
A single copy of the wild-type allele is not always sufficient for normal functioning or even survival. The dominant lethal inheritance pattern is one in which an allele is lethal both in the homozygote and the heterozygote; this allele can only be transmitted if the lethality phenotype occurs after reproductive age. Individuals with mutations that result in dominant lethal alleles fail to survive even in the heterozygote form. Dominant lethal alleles are very rare because, as you might expect, the allele only lasts one generation and is not transmitted. However, just as the recessive lethal allele might not immediately manifest the phenotype of death, dominant lethal alleles also might not be expressed until adulthood. Once the individual reaches reproductive age, the allele may be unknowingly passed on, resulting in a delayed death in both generations. An example of this in humans is Huntington’s disease, in which the nervous system gradually wastes away (Figure 12.14). People who are heterozygous for the dominant Huntington allele (Hh) will inevitably develop the fatal disease. However, the onset of Huntington’s disease may not occur until age 40, at which point the afflicted persons may have already passed the allele to 50 percent of their offspring.
Figure 12.14 The neuron in the center of this micrograph (yellow) has nuclear inclusions characteristic of Huntington’s disease (orange area in the center of the neuron). Huntington’s disease occurs when an abnormal dominant allele for the Huntington gene is present. (credit: Dr. Steven Finkbeiner, Gladstone Institute of Neurological Disease, The Taube-Koret Center for Huntington's Disease Research, and the University of California San Francisco/Wikimedia)
Footnotes
• 2Sumiti Vinayak, et al., “Origin and Evolution of Sulfadoxine Resistant Plasmodium falciparum,” Public Library of Science Pathogens 6, no. 3 (2010): e1000830, doi:10.1371/journal.ppat.1000830.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.02%3A_Mendel%27s_Experiments_and_Heredity/3.2.03%3A_Characteristics_and_Traits.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Explain Mendel’s law of segregation and independent assortment in terms of genetics and the events of meiosis
• Use the forked-line method and the probability rules to calculate the probability of genotypes and phenotypes from multiple gene crosses
• Explain the effect of linkage and recombination on gamete genotypes
• Explain the phenotypic outcomes of epistatic effects between genes
Mendel generalized the results of his pea-plant experiments into four postulates, some of which are sometimes called “laws,” that describe the basis of dominant and recessive inheritance in diploid organisms. As you have learned, more complex extensions of Mendelism exist that do not exhibit the same F2 phenotypic ratios (3:1). Nevertheless, these laws summarize the basics of classical genetics.
Pairs of Unit Factors, or Genes
Mendel proposed first that paired unit factors of heredity were transmitted faithfully from generation to generation by the dissociation and reassociation of paired factors during gametogenesis and fertilization, respectively. After he crossed peas with contrasting traits and found that the recessive trait resurfaced in the F2 generation, Mendel deduced that hereditary factors must be inherited as discrete units. This finding contradicted the belief at that time that parental traits were blended in the offspring.
Alleles Can Be Dominant or Recessive
Mendel’s law of dominance states that in a heterozygote, one trait will conceal the presence of another trait for the same characteristic. Rather than both alleles contributing to a phenotype, the dominant allele will be expressed exclusively. The recessive allele will remain “latent” but will be transmitted to offspring by the same manner in which the dominant allele is transmitted. The recessive trait will only be expressed by offspring that have two copies of this allele (Figure 12.15), and these offspring will breed true when self-crossed.
Since Mendel’s experiments with pea plants, researchers have found that the law of dominance does not always hold true. Instead, several different patterns of inheritance have been found to exist.
Figure 12.15 The child in the photo expresses albinism, a recessive trait.
Equal Segregation of Alleles
Observing that true-breeding pea plants with contrasting traits gave rise to F1 generations that all expressed the dominant trait and F2 generations that expressed the dominant and recessive traits in a 3:1 ratio, Mendel proposed the law of segregation. This law states that paired unit factors (genes) must segregate equally into gametes such that offspring have an equal likelihood of inheriting either factor. For the F2 generation of a monohybrid cross, the following three possible combinations of genotypes could result: homozygous dominant, heterozygous, or homozygous recessive. Because heterozygotes could arise from two different pathways (receiving one dominant and one recessive allele from either parent), and because heterozygotes and homozygous dominant individuals are phenotypically identical, the law supports Mendel’s observed 3:1 phenotypic ratio. The equal segregation of alleles is the reason we can apply the Punnett square to accurately predict the offspring of parents with known genotypes. The physical basis of Mendel’s law of segregation is the first division of meiosis, in which the homologous chromosomes with their different versions of each gene are segregated into daughter nuclei. The role of the meiotic segregation of chromosomes in sexual reproduction was not understood by the scientific community during Mendel’s lifetime.
Independent Assortment
Mendel’s law of independent assortment states that genes do not influence each other with regard to the sorting of alleles into gametes, and every possible combination of alleles for every gene is equally likely to occur. The independent assortment of genes can be illustrated by the dihybrid cross, a cross between two true-breeding parents that express different traits for two characteristics. Consider the characteristics of seed color and seed texture for two pea plants, one that has green, wrinkled seeds (yyrr) and another that has yellow, round seeds (YYRR). Because each parent is homozygous, the law of segregation indicates that the gametes for the green/wrinkled plant all are yr, and the gametes for the yellow/round plant are all YR. Therefore, the F1 generation of offspring all are YyRr (Figure 12.16).
Visual Connection
Visual Connection
Figure 12.16 This dihybrid cross of pea plants involves the genes for seed color and texture.
In pea plants, round seed shape (R) is dominant to wrinkled seed shape (r) and yellow peas (Y) are dominant to green peas (y). What are the possible genotypes and phenotypes for a cross between RrYY and rrYy pea plants? How many squares do you need to do a Punnett square analysis of this cross?
For the F2 generation, the law of segregation requires that each gamete receive either an R allele or an r allele along with either a Y allele or a y allele. The law of independent assortment states that a gamete into which an r allele sorted would be equally likely to contain either a Y allele or a y allele. Thus, there are four equally likely gametes that can be formed when the YyRr heterozygote is self-crossed, as follows: YR, Yr, yR, and yr. Arranging these gametes along the top and left of a 4 × 4 Punnett square (Figure 12.16) gives us 16 equally likely genotypic combinations. From these genotypes, we infer a phenotypic ratio of 9 round/yellow:3 round/green:3 wrinkled/yellow:1 wrinkled/green (Figure 12.16). These are the offspring ratios we would expect, assuming we performed the crosses with a large enough sample size.
Because of independent assortment and dominance, the 9:3:3:1 dihybrid phenotypic ratio can be collapsed into two 3:1 ratios, characteristic of any monohybrid cross that follows a dominant and recessive pattern. Ignoring seed color and considering only seed texture in the above dihybrid cross, we would expect that three quarters of the F2 generation offspring would be round, and one quarter would be wrinkled. Similarly, isolating only seed color, we would assume that three quarters of the F2 offspring would be yellow and one quarter would be green. The sorting of alleles for texture and color are independent events, so we can apply the product rule. Therefore, the proportion of round and yellow F2 offspring is expected to be (3/4) × (3/4) = 9/16, and the proportion of wrinkled and green offspring is expected to be (1/4) × (1/4) = 1/16. These proportions are identical to those obtained using a Punnett square. Round, green and wrinkled, yellow offspring can also be calculated using the product rule, as each of these genotypes includes one dominant and one recessive phenotype. Therefore, the proportion of each is calculated as (3/4) × (1/4) = 3/16.
The law of independent assortment also indicates that a cross between yellow, wrinkled (YYrr) and green, round (yyRR) parents would yield the same F1 and F2 offspring as in the YYRR x yyrr cross.
The physical basis for the law of independent assortment also lies in meiosis I, in which the different homologous pairs line up in random orientations. Each gamete can contain any combination of paternal and maternal chromosomes (and therefore the genes on them) because the orientation of tetrads on the metaphase plane is random.
Forked-Line Method
When more than two genes are being considered, the Punnett-square method becomes unwieldy. For instance, examining a cross involving four genes would require a 16 × 16 grid containing 256 boxes. It would be extremely cumbersome to manually enter each genotype. For more complex crosses, the forked-line and probability methods are preferred.
To prepare a forked-line diagram for a cross between F1 heterozygotes resulting from a cross between AABBCC and aabbcc parents, we first create rows equal to the number of genes being considered, and then segregate the alleles in each row on forked lines according to the probabilities for individual monohybrid crosses (Figure 12.17). We then multiply the values along each forked path to obtain the F2 offspring probabilities. Note that this process is a diagrammatic version of the product rule. The values along each forked pathway can be multiplied because each gene assorts independently. For a trihybrid cross, the F2 phenotypic ratio is 27:9:9:9:3:3:3:1.
Figure 12.17 The forked-line method can be used to analyze a trihybrid cross. Here, the probability for color in the F2 generation occupies the top row (3 yellow:1 green). The probability for shape occupies the second row (3 round: 1 wrinkled), and the probability for height occupies the third row (3 tall:1 dwarf). The probability for each possible combination of traits is calculated by multiplying the probability for each individual trait. Thus, the probability of F2 offspring having yellow, round, and tall traits is 3 × 3 × 3, or 27.
Probability Method
While the forked-line method is a diagrammatic approach to keeping track of probabilities in a cross, the probability method gives the proportions of offspring expected to exhibit each phenotype (or genotype) without the added visual assistance. Both methods make use of the product rule and consider the alleles for each gene separately. Earlier, we examined the phenotypic proportions for a trihybrid cross using the forked-line method; now we will use the probability method to examine the genotypic proportions for a cross with even more genes.
For a trihybrid cross, writing out the forked-line method is tedious, albeit not as tedious as using the Punnett-square method. To fully demonstrate the power of the probability method, however, we can consider specific genetic calculations. For instance, for a tetrahybrid cross between individuals that are heterozygotes for all four genes, and in which all four genes are sorting independently and in a dominant and recessive pattern, what proportion of the offspring will be expected to be homozygous recessive for all four alleles? Rather than writing out every possible genotype, we can use the probability method. We know that for each gene, the fraction of homozygous recessive offspring will be 1/4. Therefore, multiplying this fraction for each of the four genes, (1/4) × (1/4) × (1/4) × (1/4), we determine that 1/256 of the offspring will be quadruply homozygous recessive.
For the same tetrahybrid cross, what is the expected proportion of offspring that have the dominant phenotype at all four loci? We can answer this question using phenotypic proportions, but let’s do it the hard way—using genotypic proportions. The question asks for the proportion of offspring that are 1) homozygous dominant at A or heterozygous at A, and 2) homozygous at B or heterozygous at B, and so on. Noting the “or” and “and” in each circumstance makes clear where to apply the sum and product rules. The probability of a homozygous dominant at A is 1/4 and the probability of a heterozygote at A is 1/2. The probability of the homozygote or the heterozygote is 1/4 + 1/2 = 3/4 using the sum rule. The same probability can be obtained in the same way for each of the other genes, so that the probability of a dominant phenotype at A and B and C and D is, using the product rule, equal to 3/4 × 3/4 × 3/4 × 3/4, or 81/256. If you are ever unsure about how to combine probabilities, returning to the forked-line method should make it clear.
Rules for Multihybrid Fertilization
Predicting the genotypes and phenotypes of offspring from given crosses is the best way to test your knowledge of Mendelian genetics. Given a multihybrid cross that obeys independent assortment and follows a dominant and recessive pattern, several generalized rules exist; you can use these rules to check your results as you work through genetics calculations (Table 12.5). To apply these rules, first you must determine n, the number of heterozygous gene pairs (the number of genes segregating two alleles each). For example, a cross between AaBb and AaBb heterozygotes has an n of 2. In contrast, a cross between AABb and AABb has an n of 1 because A is not heterozygous.
General Rules for Multihybrid Crosses
General Rule Number of Heterozygous Gene Pairs
Number of different F1 gametes 2n
Number of different F2 genotypes 3n
Given dominant and recessive inheritance, the number of different F2 phenotypes 2n
Table 12.5
Linked Genes Violate the Law of Independent Assortment
Although all of Mendel’s pea characteristics behaved according to the law of independent assortment, we now know that some allele combinations are not inherited independently of each other. Genes that are located on separate non-homologous chromosomes will always sort independently. However, each chromosome contains hundreds or thousands of genes, organized linearly on chromosomes like beads on a string. The segregation of alleles into gametes can be influenced by linkage, in which genes that are located physically close to each other on the same chromosome are more likely to be inherited as a pair. However, because of the process of recombination, or “crossover,” it is possible for two genes on the same chromosome to behave independently, or as if they are not linked. To understand this, let’s consider the biological basis of gene linkage and recombination.
Homologous chromosomes possess the same genes in the same linear order. The alleles may differ on homologous chromosome pairs, but the genes to which they correspond do not. In preparation for the first division of meiosis, homologous chromosomes replicate and synapse. Like genes on the homologs align with each other. At this stage, segments of homologous chromosomes exchange linear segments of genetic material (Figure 12.18). This process is called recombination, or crossover, and it is a common genetic process. Because the genes are aligned during recombination, the gene order is not altered. Instead, the result of recombination is that maternal and paternal alleles are combined onto the same chromosome. Across a given chromosome, several recombination events may occur, causing extensive shuffling of alleles.
Figure 12.18 The process of crossover, or recombination, occurs when two homologous chromosomes align during meiosis and exchange a segment of genetic material. Here, the alleles for gene C were exchanged. The result is two recombinant and two non-recombinant chromosomes.
When two genes are located in close proximity on the same chromosome, they are considered linked, and their alleles tend to be transmitted through meiosis together. To exemplify this, imagine a dihybrid cross involving flower color and plant height in which the genes are next to each other on the chromosome. If one homologous chromosome has alleles for tall plants and red flowers, and the other chromosome has genes for short plants and yellow flowers, then when the gametes are formed, the tall and red alleles will go together into a gamete and the short and yellow alleles will go into other gametes. These are called the parental genotypes because they have been inherited intact from the parents of the individual producing gametes. But unlike if the genes were on different chromosomes, there will be no gametes with tall and yellow alleles and no gametes with short and red alleles. If you create the Punnett square with these gametes, you will see that the classical Mendelian prediction of a 9:3:3:1 outcome of a dihybrid cross would not apply. As the distance between two genes increases, the probability of one or more crossovers between them increases, and the genes behave more like they are on separate chromosomes. Geneticists have used the proportion of recombinant gametes (the ones not like the parents) as a measure of how far apart genes are on a chromosome. Using this information, they have constructed elaborate maps of genes on chromosomes for well-studied organisms, including humans.
Mendel’s seminal publication makes no mention of linkage, and many researchers have questioned whether he encountered linkage but chose not to publish those crosses out of concern that they would invalidate his independent assortment postulate. The garden pea has seven pairs of chromosomes, and some have suggested that his choice of seven characteristics was not a coincidence. However, even if the genes he examined were not located on separate chromosomes, it is possible that he simply did not observe linkage because of the extensive shuffling effects of recombination.
Scientific Method Connection
Scientific Method Connection
Testing the Hypothesis of Independent AssortmentTo better appreciate the amount of labor and ingenuity that went into Mendel’s experiments, proceed through one of Mendel’s dihybrid crosses.
Question: What will be the offspring of a dihybrid cross?
Background: Consider that pea plants mature in one growing season, and you have access to a large garden in which you can cultivate thousands of pea plants. There are several true-breeding plants with the following pairs of traits: tall plants with inflated pods, and dwarf plants with constricted pods. Before the plants have matured, you remove the pollen-producing organs from the tall/inflated plants in your crosses to prevent self-fertilization. Upon plant maturation, the plants are manually crossed by transferring pollen from the dwarf/constricted plants to the stigmata of the tall/inflated plants.
Hypothesis: Both trait pairs will sort independently according to Mendelian laws. When the true-breeding parents are crossed, all of the F1 offspring are tall and have inflated pods, which indicates that the tall and inflated traits are dominant over the dwarf and constricted traits, respectively. A self-cross of the F1 heterozygotes results in 2,000 F2 progeny.
Test the hypothesis: Because each trait pair sorts independently, the ratios of tall:dwarf and inflated:constricted are each expected to be 3:1. The tall/dwarf trait pair is called T/t, and the inflated/constricted trait pair is designated I/i. Each member of the F1 generation therefore has a genotype of TtIi. Construct a grid analogous to Figure 12.16, in which you cross two TtIi individuals. Each individual can donate four combinations of two traits: TI, Ti, tI, or ti, meaning that there are 16 possibilities of offspring genotypes. Because the T and I alleles are dominant, any individual having one or two of those alleles will express the tall or inflated phenotypes, respectively, regardless if they also have a t or i allele. Only individuals that are tt or ii will express the dwarf and constricted alleles, respectively. As shown in Figure 12.19, you predict that you will observe the following offspring proportions: tall/inflated:tall/constricted:dwarf/inflated:dwarf/constricted in a 9:3:3:1 ratio. Notice from the grid that when considering the tall/dwarf and inflated/constricted trait pairs in isolation, they are each inherited in 3:1 ratios.
Figure 12.19 This figure shows all possible combinations of offspring resulting from a dihybrid cross of pea plants that are heterozygous for the tall/dwarf and inflated/constricted alleles.
Test the hypothesis: You cross the dwarf and tall plants and then self-cross the offspring. For best results, this is repeated with hundreds or even thousands of pea plants. What special precautions should be taken in the crosses and in growing the plants?
Analyze your data: You observe the following plant phenotypes in the F2 generation: 2706 tall/inflated, 930 tall/constricted, 888 dwarf/inflated, and 300 dwarf/constricted. Reduce these findings to a ratio and determine if they are consistent with Mendelian laws.
Form a conclusion: Were the results close to the expected 9:3:3:1 phenotypic ratio? Do the results support the prediction? What might be observed if far fewer plants were used, given that alleles segregate randomly into gametes? Try to imagine growing that many pea plants, and consider the potential for experimental error. For instance, what would happen if it was extremely windy one day?
Epistasis
Mendel’s studies in pea plants implied that the sum of an individual’s phenotype was controlled by genes (or as he called them, unit factors), such that every characteristic was distinctly and completely controlled by a single gene. In fact, single observable characteristics are almost always under the influence of multiple genes (each with two or more alleles) acting in unison. For example, at least eight genes contribute to eye color in humans.
Link to Learning
Link to Learning
Eye color in humans is determined by multiple genes. Use the Eye Color Calculator to predict the eye color of children from parental eye color.
In some cases, several genes can contribute to aspects of a common phenotype without their gene products ever directly interacting. In the case of organ development, for instance, genes may be expressed sequentially, with each gene adding to the complexity and specificity of the organ. Genes may function in complementary or synergistic fashions, such that two or more genes need to be expressed simultaneously to affect a phenotype. Genes may also oppose each other, with one gene modifying the expression of another.
In epistasis, the interaction between genes is antagonistic, such that one gene masks or interferes with the expression of another. “Epistasis” is a word composed of Greek roots that mean “standing upon.” The alleles that are being masked or silenced are said to be hypostatic to the epistatic alleles that are doing the masking. Often the biochemical basis of epistasis is a gene pathway in which the expression of one gene is dependent on the function of a gene that precedes or follows it in the pathway.
An example of epistasis is pigmentation in mice. The wild-type coat color, agouti (AA), is dominant to solid-colored fur (aa). However, a separate gene (C) is necessary for pigment production. A mouse with a recessive c allele at this locus is unable to produce pigment and is albino regardless of the allele present at locus A (Figure 12.20). Therefore, the genotypes AAcc, Aacc, and aacc all produce the same albino phenotype. A cross between heterozygotes for both genes (AaCc x AaCc) would generate offspring with a phenotypic ratio of 9 agouti:3 solid color:4 albino (Figure 12.20). In this case, the C gene is epistatic to the A gene.
Figure 12.20 In mice, the mottled agouti coat color (A) is dominant to a solid coloration, such as black or gray. A gene at a separate locus (C) is responsible for pigment production. The recessive c allele does not produce pigment, and a mouse with the homozygous recessive cc genotype is albino regardless of the allele present at the A locus. Thus, the C gene is epistatic to the A gene.
Epistasis can also occur when a dominant allele masks expression at a separate gene. Fruit color in summer squash is expressed in this way. Homozygous recessive expression of the W gene (ww) coupled with homozygous dominant or heterozygous expression of the Y gene (YY or Yy) generates yellow fruit, and the wwyy genotype produces green fruit. However, if a dominant copy of the W gene is present in the homozygous or heterozygous form, the summer squash will produce white fruit regardless of the Y alleles. A cross between white heterozygotes for both genes (WwYy × WwYy) would produce offspring with a phenotypic ratio of 12 white:3 yellow:1 green.
Finally, epistasis can be reciprocal such that either gene, when present in the dominant (or recessive) form, expresses the same phenotype. In the shepherd’s purse plant (Capsella bursa-pastoris), the characteristic of seed shape is controlled by two genes in a dominant epistatic relationship. When the genes A and B are both homozygous recessive (aabb), the seeds are ovoid. If the dominant allele for either of these genes is present, the result is triangular seeds. That is, every possible genotype other than aabb results in triangular seeds, and a cross between heterozygotes for both genes (AaBb x AaBb) would yield offspring with a phenotypic ratio of 15 triangular:1 ovoid.
As you work through genetics problems, keep in mind that any single characteristic that results in a phenotypic ratio that totals 16 is typical of a two-gene interaction. Recall the phenotypic inheritance pattern for Mendel’s dihybrid cross, which considered two noninteracting genes—9:3:3:1. Similarly, we would expect interacting gene pairs to also exhibit ratios expressed as 16 parts. Note that we are assuming the interacting genes are not linked; they are still assorting independently into gametes.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.02%3A_Mendel%27s_Experiments_and_Heredity/3.2.04%3A_Laws_of_Inheritance.txt
|
allele
gene variations that arise by mutation and exist at the same relative locations on homologous chromosomes
autosomes
any of the non-sex chromosomes
blending theory of inheritance
hypothetical inheritance pattern in which parental traits are blended together in the offspring to produce an intermediate physical appearance
codominance
in a heterozygote, complete and simultaneous expression of both alleles for the same characteristic
continuous variation
inheritance pattern in which a character shows a range of trait values with small gradations rather than large gaps between them
dihybrid
result of a cross between two true-breeding parents that express different traits for two characteristics
discontinuous variation
inheritance pattern in which traits are distinct and are transmitted independently of one another
dominant
trait which confers the same physical appearance whether an individual has two copies of the trait or one copy of the dominant trait and one copy of the recessive trait
dominant lethal
inheritance pattern in which an allele is lethal both in the homozygote and the heterozygote; this allele can only be transmitted if the lethality phenotype occurs after reproductive age
epistasis
antagonistic interaction between genes such that one gene masks or interferes with the expression of another
F1
first filial generation in a cross; the offspring of the parental generation
F2
second filial generation produced when F1 individuals are self-crossed or fertilized with each other
genotype
underlying genetic makeup, consisting of both physically visible and non-expressed alleles, of an organism
hemizygous
presence of only one allele for a characteristic, as in X-linkage; hemizygosity makes descriptions of dominance and recessiveness irrelevant
heterozygous
having two different alleles for a given gene on the homologous chromosome
homozygous
having two identical alleles for a given gene on the homologous chromosome
hybridization
process of mating two individuals that differ with the goal of achieving a certain characteristic in their offspring
incomplete dominance
in a heterozygote, expression of two contrasting alleles such that the individual displays an intermediate phenotype
law of dominance
in a heterozygote, one trait will conceal the presence of another trait for the same characteristic
law of independent assortment
genes do not influence each other with regard to sorting of alleles into gametes; every possible combination of alleles is equally likely to occur
law of segregation
paired unit factors (i.e., genes) segregate equally into gametes such that offspring have an equal likelihood of inheriting any combination of factors
linkage
phenomenon in which alleles that are located in close proximity to each other on the same chromosome are more likely to be inherited together
model system
species or biological system used to study a specific biological phenomenon to be applied to other different species
monohybrid
result of a cross between two true-breeding parents that express different traits for only one characteristic
P0
parental generation in a cross
phenotype
observable traits expressed by an organism
product rule
probability of two independent events occurring simultaneously can be calculated by multiplying the individual probabilities of each event occurring alone
Punnett square
visual representation of a cross between two individuals in which the gametes of each individual are denoted along the top and side of a grid, respectively, and the possible zygotic genotypes are recombined at each box in the grid
recessive
trait that appears “latent” or non-expressed when the individual also carries a dominant trait for that same characteristic; when present as two identical copies, the recessive trait is expressed
recessive lethal
inheritance pattern in which an allele is only lethal in the homozygous form; the heterozygote may be normal or have some altered, nonlethal phenotype
reciprocal cross
paired cross in which the respective traits of the male and female in one cross become the respective traits of the female and male in the other cross
sex-linked
any gene on a sex chromosome
sum rule
probability of the occurrence of at least one of two mutually exclusive events is the sum of their individual probabilities
test cross
cross between a dominant expressing individual with an unknown genotype and a homozygous recessive individual; the offspring phenotypes indicate whether the unknown parent is heterozygous or homozygous for the dominant trait
trait
variation in the physical appearance of a heritable characteristic
X-linked
gene present on the X, but not the Y chromosome
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.02%3A_Mendel%27s_Experiments_and_Heredity/3.2.05%3A_Key_Terms.txt
|
12.1 Mendel’s Experiments and the Laws of Probability
Working with garden pea plants, Mendel found that crosses between parents that differed by one trait produced F1 offspring that all expressed the traits of one parent. Observable traits are referred to as dominant, and non-expressed traits are described as recessive. When the offspring in Mendel’s experiment were self-crossed, the F2 offspring exhibited the dominant trait or the recessive trait in a 3:1 ratio, confirming that the recessive trait had been transmitted faithfully from the original P0 parent. Reciprocal crosses generated identical F1 and F2 offspring ratios. By examining sample sizes, Mendel showed that his crosses behaved reproducibly according to the laws of probability, and that the traits were inherited as independent events.
Two rules in probability can be used to find the expected proportions of offspring of different traits from different crosses. To find the probability of two or more independent events occurring together, apply the product rule and multiply the probabilities of the individual events. The use of the word “and” suggests the appropriate application of the product rule. To find the probability of two or more events occurring in combination, apply the sum rule and add their individual probabilities together. The use of the word “or” suggests the appropriate application of the sum rule.
12.2 Characteristics and Traits
When true-breeding or homozygous individuals that differ for a certain trait are crossed, all of the offspring will be heterozygotes for that trait. If the traits are inherited as dominant and recessive, the F1 offspring will all exhibit the same phenotype as the parent homozygous for the dominant trait. If these heterozygous offspring are self-crossed, the resulting F2 offspring will be equally likely to inherit gametes carrying the dominant or recessive trait, giving rise to offspring of which one quarter are homozygous dominant, half are heterozygous, and one quarter are homozygous recessive. Because homozygous dominant and heterozygous individuals are phenotypically identical, the observed traits in the F2 offspring will exhibit a ratio of three dominant to one recessive.
Alleles do not always behave in dominant and recessive patterns. Incomplete dominance describes situations in which the heterozygote exhibits a phenotype that is intermediate between the homozygous phenotypes. Codominance describes the simultaneous expression of both of the alleles in the heterozygote. Although diploid organisms can only have two alleles for any given gene, it is common for more than two alleles of a gene to exist in a population. In humans, as in many animals and some plants, females have two X chromosomes and males have one X and one Y chromosome. Genes that are present on the X but not the Y chromosome are said to be X-linked, such that males only inherit one allele for the gene, and females inherit two. Finally, some alleles can be lethal. Recessive lethal alleles are only lethal in homozygotes, but dominant lethal alleles are fatal in heterozygotes as well.
12.3 Laws of Inheritance
Mendel postulated that genes (characteristics) are inherited as pairs of alleles (traits) that behave in a dominant and recessive pattern. Alleles segregate into gametes such that each gamete is equally likely to receive either one of the two alleles present in a diploid individual. In addition, genes are assorted into gametes independently of one another. That is, alleles are generally not more likely to segregate into a gamete with a particular allele of another gene. A dihybrid cross demonstrates independent assortment when the genes in question are on different chromosomes or distant from each other on the same chromosome. For crosses involving more than two genes, use the forked line or probability methods to predict offspring genotypes and phenotypes rather than a Punnett square.
Although chromosomes sort independently into gametes during meiosis, Mendel’s law of independent assortment refers to genes, not chromosomes, and a single chromosome may carry more than 1,000 genes. When genes are located in close proximity on the same chromosome, their alleles tend to be inherited together. This results in offspring ratios that violate Mendel's law of independent assortment. However, recombination serves to exchange genetic material on homologous chromosomes such that maternal and paternal alleles may be recombined on the same chromosome. This is why alleles on a given chromosome are not always inherited together. Recombination is a random event occurring anywhere on a chromosome. Therefore, genes that are far apart on the same chromosome are likely to still assort independently because of recombination events that occurred in the intervening chromosomal space.
Whether or not they are sorting independently, genes may interact at the level of gene products such that the expression of an allele for one gene masks or modifies the expression of an allele for a different gene. This is called epistasis.
3.2.07: Visual Connection Questions
1.
Figure 12.5 In pea plants, round peas (R) are dominant to wrinkled peas (r). You do a test cross between a pea plant with wrinkled peas (genotype rr) and a plant of unknown genotype that has round peas. You end up with three plants, all which have round peas. From this data, can you tell if the round pea parent plant is homozygous dominant or heterozygous? If the round pea parent plant is heterozygous, what is the probability that a random sample of 3 progeny peas will all be round?
2.
Figure 12.6 What are the genotypes of the individuals labeled 1, 2, and 3?
3.
Figure 12.12 What ratio of offspring would result from a cross between a white-eyed male and a female that is heterozygous for red eye color?
4.
Figure 12.16 In pea plants, round seed shape (R) is dominant to wrinkled seed shape (r) and yellow peas (Y) are dominant to green peas (y). What are the possible genotypes and phenotypes for a cross between RrYY and rrYy pea plants? How many squares do you need to do a Punnett square analysis of this cross?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.02%3A_Mendel%27s_Experiments_and_Heredity/3.2.06%3A_Chapter_Summary.txt
|
5.
Mendel performed hybridizations by transferring pollen from the _______ of the male plant to the female ova.
1. anther
2. pistil
3. stigma
4. seed
6.
Which is one of the seven characteristics that Mendel observed in pea plants?
1. flower size
2. seed texture
3. leaf shape
4. stem color
7.
Imagine you are performing a cross involving seed color in garden pea plants. What F1 offspring would you expect if you cross true-breeding parents with green seeds and yellow seeds? Yellow seed color is dominant over green.
1. 100 percent yellow-green seeds
2. 100 percent yellow seeds
3. 50 percent yellow, 50 percent green seeds
4. 25 percent green, 75 percent yellow seeds
8.
Consider a cross to investigate the pea pod texture trait, involving constricted or inflated pods. Mendel found that the traits behave according to a dominant/recessive pattern in which inflated pods were dominant. If you performed this cross and obtained 650 inflated-pod plants in the F2 generation, approximately how many constricted-pod plants would you expect to have?
1. 600
2. 165
3. 217
4. 468
9.
A scientist pollinates a true-breeding pea plant with violet, terminal flowers with pollen from a true-breeding pea plant with white, axial flowers. Which of the following observations would most accurately describe the F2 generation?
1. 75% violet flowers; 75% terminal flowers
2. 75% white flowers in a terminal position
3. 75% violet flowers; 75% axial flowers
4. 75% violet flowers in an axial position
10.
The observable traits expressed by an organism are described as its ________.
1. phenotype
2. genotype
3. alleles
4. zygote
11.
A recessive trait will be observed in individuals that are ________ for that trait.
1. heterozygous
2. homozygous or heterozygous
3. homozygous
4. diploid
12.
If black and white true-breeding mice are mated and the result is all gray offspring, what inheritance pattern would this be indicative of?
1. dominance
2. codominance
3. multiple alleles
4. incomplete dominance
13.
The ABO blood groups in humans are expressed as the IA, IB, and i alleles. The IA allele encodes the A blood group antigen, IB encodes B, and i encodes O. Both A and B are dominant to O. If a heterozygous blood type A parent (IAi) and a heterozygous blood type B parent (IBi) mate, one quarter of their offspring will have AB blood type (IAIB) in which both antigens are expressed equally. Therefore, ABO blood groups are an example of:
1. multiple alleles and incomplete dominance
2. codominance and incomplete dominance
3. incomplete dominance only
4. multiple alleles and codominance
14.
In a mating between two individuals that are heterozygous for a recessive lethal allele that is expressed in utero, what genotypic ratio (homozygous dominant:heterozygous:homozygous recessive) would you expect to observe in the offspring?
1. 1:2:1
2. 3:1:1
3. 1:2:0
4. 0:2:1
15.
If the allele encoding polydactyly (six fingers) is dominant why do most people have five fingers?
1. Genetic elements suppress the polydactyl gene.
2. Polydactyly is embryonic lethal.
3. The sixth finger is removed at birth.
4. The polydactyl allele is very rare in the human population.
16.
A farmer raises black and white chickens. To his surprise, when the first generation of eggs hatch all the chickens are black with white speckles throughout their feathers. What should the farmer expect when the eggs laid after interbreeding the speckled chickens hatch?
1. All the offspring will be speckled.
2. 75% of the offspring will be speckled, and 25% will be black.
3. 50% of the offspring will be speckled, 25% will be black, and 25% will be white.
4. 50% of the offspring will be black and 50% of the offspring will be white.
17.
Assuming no gene linkage, in a dihybrid cross of AABB x aabb with AaBb F1 heterozygotes, what is the ratio of the F1 gametes (AB, aB, Ab, ab) that will give rise to the F2 offspring?
1. 1:1:1:1
2. 1:3:3:1
3. 1:2:2:1
4. 4:3:2:1
18.
The forked line and probability methods make use of what probability rule?
1. test cross
2. product rule
3. monohybrid rule
4. sum rule
19.
How many different offspring genotypes are expected in a trihybrid cross between parents heterozygous for all three traits when the traits behave in a dominant and recessive pattern? How many phenotypes?
1. 64 genotypes; 16 phenotypes
2. 16 genotypes; 64 phenotypes
3. 8 genotypes; 27 phenotypes
4. 27 genotypes; 8 phenotypes
20.
Labrador retrievers’ fur color is controlled by two alleles, E and B. Any dog with the ee__ genotype develops into a yellow lab, while B_E_ dogs become black labs and bbE_ dogs become chocolate labs. This is an example of _____.
1. epistasis
2. codominance
3. incomplete dominance
4. linkage
21.
Which of the following situations does not follow the Law of Independent Assortment?
1. A blond person and a brown-haired person produce three offspring over time, all of who have blond hair.
2. A white cow crossed with a brown bull produces roan cattle.
3. Mating a hog with a sow produces six female piglets.
4. Men are more likely to experience hemophilia than women.
3.2.09: Critical Thinking Questions
22.
Describe one of the reasons why the garden pea was an excellent choice of model system for studying inheritance.
23.
How would you perform a reciprocal cross for the characteristic of stem height in the garden pea?
24.
Mendel performs a cross using a true-breeding pea plant with round, yellow seeds and a true-breeding pea plant with green, wrinkled seeds. What is the probability that offspring will have green, round seeds? Calculate the probability for the F1 and F2 generations.
25.
Calculate the probability of selecting a heart or a face card from a standard deck of cards. Is this outcome more or less likely than selecting a heart suit face card?
26.
The gene for flower position in pea plants exists as axial or terminal alleles. Given that axial is dominant to terminal, list all of the possible F1 and F2 genotypes and phenotypes from a cross involving parents that are homozygous for each trait. Express genotypes with conventional genetic abbreviations.
27.
Use a Punnett square to predict the offspring in a cross between a dwarf pea plant (homozygous recessive) and a tall pea plant (heterozygous). What is the phenotypic ratio of the offspring?
28.
Can a human male be a carrier of red-green color blindness?
29.
Why is it more efficient to perform a test cross with a homozygous recessive donor than a homozygous dominant donor? How could the same information still be found with a homozygous dominant donor?
30.
Use the probability method to calculate the genotypes and genotypic proportions of a cross between AABBCc and Aabbcc parents.
31.
Explain epistasis in terms of its Greek-language roots “standing upon.”
32.
In Section 12.3, “Laws of Inheritance,” an example of epistasis was given for the summer squash. Cross white WwYy heterozygotes to prove the phenotypic ratio of 12 white:3 yellow:1 green that was given in the text.
33.
People with trisomy 21 develop Down’s syndrome. What law of Mendelian inheritance is violated in this disease? What is the most likely way this occurs?
34.
A heterozygous pea plant produces violet flowers and yellow, round seeds. Describe the expected genotypes of the gametes produced by Mendelian inheritance. If all three genes are found on the same arm of one chromosome should a scientist predict that inheritance patterns will follow Mendelian genetics?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.02%3A_Mendel%27s_Experiments_and_Heredity/3.2.08%3A_Review_Questions.txt
|
The gene is the physical unit of inheritance, and genes are arranged in a linear order on chromosomes. The behaviors and interactions of chromosomes during meiosis explain, at a cellular level, the patterns of inheritance that we observe in populations. Genetic disorders involving alterations in chromosome number or structure may have dramatic effects and can prevent a fertilized egg from developing altogether.
• 3.3.1: Introduction
The gene is the physical unit of inheritance, and genes are arranged in a linear order on chromosomes. The behaviors and interactions of chromosomes during meiosis explain, at a cellular level, the patterns of inheritance that we observe in populations. Genetic disorders involving alterations in chromosome number or structure may have dramatic effects and can prevent a fertilized egg from developing altogether.
• 3.3.2: Chromosomal Theory and Genetic Linkage
The Chromosomal Theory of inheritance, proposed by Sutton and Boveri, states that chromosomes are the vehicles of genetic heredity. Neither Mendelian genetics nor gene linkage is perfectly accurate; instead, chromosome behavior involves segregation, independent assortment, and occasionally, linkage. Sturtevant devised a method to assess recombination frequency and infer the relative positions and distances of linked genes on a chromosome on the basis of the average number of crossovers.
• 3.3.3: Chromosomal Basis of Inherited Disorders
The number, size, shape, and banding pattern of chromosomes make them easily identifiable in a karyogram and allows for the assessment of many chromosomal abnormalities. Disorders in chromosome number, or aneuploidies, are typically lethal to the embryo, although a few trisomic genotypes are viable. Because of X inactivation, aberrations in sex chromosomes typically have milder phenotypic effects. Aneuploidies also include instances in which segments of a chromosome are duplicated or deleted.
• 3.3.4: Key Terms
• 3.3.5: Chapter Summary
• 3.3.6: Visual Connection Questions
• 3.3.7: Review Questions
• 3.3.8: Critical Thinking Questions
Thumbnail: Chromosomes are threadlike nuclear structures consisting of DNA and proteins that serve as the repositories for genetic information. The chromosomes depicted here were isolated from a fruit fly’s salivary gland, stained with dye, and visualized under a microscope. Akin to miniature bar codes, chromosomes absorb different dyes to produce characteristic banding patterns, which allows for their routine identification. (credit: modification of work by “LPLT”/Wikimedia Commons; scale-bar data from Matt Russell)
3.03: Modern Understandings of Inheritance
Figure 13.1 Chromosomes are threadlike nuclear structures consisting of DNA and proteins that serve as the repositories for genetic information. The chromosomes depicted here were isolated from a fruit fly’s salivary gland, stained with dye, and visualized under a microscope. Akin to miniature bar codes, chromosomes absorb different dyes to produce characteristic banding patterns, which allows for their routine identification. (credit: modification of work by “LPLT”/Wikimedia Commons; scale-bar data from Matt Russell)
The gene is the physical unit of inheritance, and genes are arranged in a linear order on chromosomes. Chromosome behavior and interaction during meiosis explain, at a cellular level, inheritance patterns that we observe in populations. Genetic disorders involving alterations in chromosome number or structure may have dramatic effects and can prevent a fertilized egg from developing.
3.3.02: Chromosomal Theory and Genetic Linkage
Learning Objectives
By the end of this section, you will be able to do the following:
• Discuss Sutton’s Chromosomal Theory of Inheritance
• Describe genetic linkage
• Explain the process of homologous recombination, or crossing over
• Describe chromosome creation
• Calculate the distances between three genes on a chromosome using a three-point test cross
Long before scientists visualized chromosomes under a microscope, the father of modern genetics, Gregor Mendel, began studying heredity in 1843. With improved microscopic techniques during the late 1800s, cell biologists could stain and visualize subcellular structures with dyes and observe their actions during cell division and meiosis. With each mitotic division, chromosomes replicated, condensed from an amorphous (no constant shape) nuclear mass into distinct X-shaped bodies (pairs of identical sister chromatids), and migrated to separate cellular poles.
Chromosomal Theory of Inheritance
The speculation that chromosomes might be the key to understanding heredity led several scientists to examine Mendel’s publications and reevaluate his model in terms of chromosome behavior during mitosis and meiosis. In 1902, Theodor Boveri observed that proper sea urchin embryonic development does not occur unless chromosomes are present. That same year, Walter Sutton observed chromosome separation into daughter cells during meiosis (Figure 13.2). Together, these observations led to the Chromosomal Theory of Inheritance, which identified chromosomes as the genetic material responsible for Mendelian inheritance.
Figure 13.2 (a) Walter Sutton and (b) Theodor Boveri developed the Chromosomal Theory of Inheritance, which states that chromosomes carry the unit of heredity (genes). Eleanor Carothers (c), was the first to provide physical evidence supporting the theory.
The Chromosomal Theory of Inheritance was consistent with Mendel’s laws, which the following observations supported:
• During meiosis, homologous chromosome pairs migrate as discrete structures that are independent of other chromosome pairs.
• Chromosome sorting from each homologous pair into pre-gametes appears to be random.
• Each parent synthesizes gametes that contain only half their chromosomal complement.
• Even though male and female gametes (sperm and egg) differ in size and morphology, they have the same number of chromosomes, suggesting equal genetic contributions from each parent.
• The gametic chromosomes combine during fertilization to produce offspring with the same chromosome number as their parents.
Despite the lack of direct evidence that chromosomes carry traits, the compelling correlation between chromosome behavior during meiosis and Mendel's abstract laws led scientists to propose the Chromosomal Theory of Inheritance. Critics pointed out that individuals had far more independently segregating traits than they had chromosomes. About ten years after the theory was proposed, Eleanor Carothers was the first to discover physical evidence supporting it; she observed independent chromosome assortment in grasshoppers. Then, after several years of carrying out crosses with the fruit fly, Drosophila melanogaster, Thomas Hunt Morgan provided additional experimental evidence to support the Chromosomal Theory of Inheritance.
Genetic Linkage and Distances
Mendel’s work suggested that traits are inherited independently of each other. Morgan identified a 1:1 correspondence between a segregating trait and the X chromosome, suggesting that random chromosome segregation was the physical basis of Mendel’s model. This also demonstrated that linked genes disrupt Mendel’s predicted outcomes. That each chromosome can carry many linked genes explains how individuals can have many more traits than they have chromosomes. However, researchers in Morgan’s laboratory suggested that alleles positioned on the same chromosome were not always inherited together. During meiosis, linked genes somehow became unlinked.
Homologous Recombination
In 1909, Frans Janssen observed chiasmata—the point at which chromatids are in contact with each other and may exchange segments—prior to the first meiotic division. He suggested that alleles become unlinked and chromosomes physically exchange segments. As chromosomes condensed and paired with their homologs, they appeared to interact at distinct points. Janssen suggested that these points corresponded to regions in which chromosome segments exchanged. We now know that the pairing and interaction between homologous chromosomes, or synapsis, does more than simply organize the homologs for migration to separate daughter cells. When synapsed, homologous chromosomes undergo reciprocal physical exchanges at their arms in homologous recombination, or more simply, “crossing over.”
To better understand the type of experimental results that researchers were obtaining at this time, consider a heterozygous individual that inherited dominant maternal alleles for two genes on the same chromosome (such as A and B) and two recessive paternal alleles for those same genes (such as a and b). If the genes are linked, one would expect this individual to produce gametes that are either AB or ab with a 1:1 ratio. If the genes are unlinked, the individual should produce AB, Ab, aB, and ab gametes with equal frequencies, according to the Mendelian concept of independent assortment. Because they correspond to new allele combinations, the genotypes Ab and aB are nonparental types that result from homologous recombination during meiosis. Parental types are progeny that exhibit the same allelic combination as their parents. Morgan and his colleagues, however, found that when they test crossed such heterozygous individuals to a homozygous recessive parent (AaBb × aabb), both parental and nonparental cases occurred. For example, 950 offspring might be recovered that were either AaBb or aabb, but 50 offspring would also result that were either Aabb or aaBb. These results suggested that linkage occurred most often, but a significant minority of offspring were the products of recombination.
One of the experiments in Morgan's lab involving the crosses of flies for two traits, body color (gray or black) and wing shape (normal and vestigial), demonstrated the recombination events that lead to the development of nonparental phenotypes (Figure 13.3).
Visual Connection
Visual Connection
Figure 13.3 This figure shows unlinked and linked gene inheritance patterns. In (a), two genes are located on different chromosomes so independent assortment occurs during meiosis. The offspring have an equal chance of being the parental type (inheriting the same combination of traits as the parents) or a nonparental type (inheriting a different combination of traits than the parents). In (b), two genes are very close together on the same chromosome so that no crossing over occurs between them. Therefore, the genes are always inherited together and all the offspring are the parental type. In (c), two genes are far apart on the chromosome such that crossing over occurs during every meiotic event. The recombination frequency will be the same as if the genes were on separate chromosomes. (d) The actual recombination frequency of fruit fly wing length and body color that Thomas Morgan observed in 1912 was 17 percent. A crossover frequency between 0 percent and 50 percent indicates that the genes are on the same chromosome and crossover sometimes occurs.
In a test cross for two characteristics such as the one here, can the recombinant offspring's predicted frequency be 60 percent? Why or why not?
Genetic Maps
Janssen did not have the technology to demonstrate crossing over so it remained an abstract idea that scientists did not widely believe. Scientists thought chiasmata were a variation on synapsis and could not understand how chromosomes could break and rejoin. Yet, the data were clear that linkage did not always occur. Ultimately, it took a young undergraduate student and an “all-nighter” to mathematically elucidate the linkage and recombination problem.
In 1913, Alfred Sturtevant, a student in Morgan’s laboratory, gathered results from researchers in the laboratory, and took them home one night to mull them over. By the next morning, he had created the first “chromosome map,” a linear representation of gene order and relative distance on a chromosome (Figure 13.4).
Visual Connection
Visual Connection
Figure 13.4 This genetic map orders Drosophila genes on the basis of recombination frequency.
Which of the following statements is true?
1. Recombination of the body color and red/cinnabar eye alleles will occur more frequently than recombination of the alleles for wing length and aristae length.
2. Recombination of the body color and aristae length alleles will occur more frequently than recombination of red/brown eye alleles and the aristae length alleles.
3. Recombination of the gray/black body color and long/short aristae alleles will not occur.
4. Recombination of the red/brown eye and long/short aristae alleles will occur more frequently than recombination of the alleles for wing length and body color.
As Figure 13.4 shows, by using recombination frequency to predict genetic distance, we can infer the relative gene order on chromosome 2. The values represent map distances in centimorgans (cM), which correspond to recombination frequencies (in percent). Therefore, the genes for body color and wing size were 65.5 − 48.5 = 17 cM apart, indicating that the maternal and paternal alleles for these genes recombine in 17 percent of offspring, on average.
To construct a chromosome map, Sturtevant assumed that genes were ordered serially on threadlike chromosomes. He also assumed that the incidence of recombination between two homologous chromosomes could occur with equal likelihood anywhere along the chromosome's length. Operating under these assumptions, Sturtevant postulated that alleles that were far apart on a chromosome were more likely to dissociate during meiosis simply because there was a larger region over which recombination could occur. Conversely, alleles that were close to each other on the chromosome were likely to be inherited together. The average number of crossovers between two alleles—that is, their recombination frequency—correlated with their genetic distance from each other, relative to the locations of other genes on that chromosome. Considering the example cross between AaBb and aabb above, we could calculate the recombination's frequency as 50/1000 = 0.05. That is, the likelihood of a crossover between genes A/a and B/b was 0.05, or 5 percent. Such a result would indicate that the genes were definitively linked, but that they were far enough apart for crossovers to occasionally occur. Sturtevant divided his genetic map into map units, or centimorgans (cM), in which a 0.01 recombination frequency corresponds to 1 cM.
By representing alleles in a linear map, Sturtevant suggested that genes can range from linking perfectly (recombination frequency = 0) to unlinking perfectly (recombination frequency = 0.5) when genes are on different chromosomes or genes separate very far apart on the same chromosome. Perfectly unlinked genes correspond to the frequencies Mendel predicted to assort independently in a dihybrid cross. A 0.5 recombination frequency indicates that 50 percent of offspring are recombinants and the other 50 percent are parental types. That is, every type of allele combination is represented with equal frequency. This representation allowed Sturtevant to additively calculate distances between several genes on the same chromosome. However, as the genetic distances approached 0.50, his predictions became less accurate because it was not clear whether the genes were very far apart on the same or on different chromosomes.
In 1931, Barbara McClintock and Harriet Creighton demonstrated the crossover of homologous chromosomes in corn plants. Weeks later, Curt Stern demonstrated microscopically homologous recombination in Drosophila. Stern observed several X-linked phenotypes that were associated with a structurally unusual and dissimilar X chromosome pair in which one X was missing a small terminal segment, and the other X was fused to a piece of the Y chromosome. By crossing flies, observing their offspring, and then visualizing the offspring’s chromosomes, Stern demonstrated that every time the offspring allele combination deviated from either of the parental combinations, there was a corresponding exchange of an X chromosome segment. Using mutant flies with structurally distinct X chromosomes was the key to observing the products of recombination because DNA sequencing and other molecular tools were not yet available. We now know that homologous chromosomes regularly exchange segments in meiosis by reciprocally breaking and rejoining their DNA at precise locations. Aurora Ruiz-Herrera, for example, studies the occurrence of genetic breakpoints at locations in the chromosomes known as fragile sites. By identifying chromosomal fragile sites that are shared between humans and other primates, Ruiz-Herrera has provided a deeper understanding of mammalian and specifically human evolution.
Link to Learning
Link to Learning
Review Sturtevant’s process to create a genetic map on the basis of recombination frequencies here.
Mendel’s Mapped Traits
Homologous recombination is a common genetic process, yet Mendel never observed it. Had he investigated both linked and unlinked genes, it would have been much more difficult for him to create a unified model of his data on the basis of probabilistic calculations. Researchers who have since mapped the seven traits that Mendel investigated onto a pea plant genome's seven chromosomes have confirmed that all the genes he examined are either on separate chromosomes or are sufficiently far apart as to be statistically unlinked. Some have suggested that Mendel was enormously lucky to select only unlinked genes; whereas, others question whether Mendel discarded any data suggesting linkage. In any case, Mendel consistently observed independent assortment because he examined genes that were effectively unlinked.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.03%3A_Modern_Understandings_of_Inheritance/3.3.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe how a karyogram is created
• Explain how nondisjunction leads to disorders in chromosome number
• Compare disorders that aneuploidy causes
• Describe how errors in chromosome structure occur through inversions and translocations
Inherited disorders can arise when chromosomes behave abnormally during meiosis. We can divide chromosome disorders into two categories: abnormalities in chromosome number and chromosomal structural rearrangements. Because even small chromosome segments can span many genes, chromosomal disorders are characteristically dramatic and often fatal.
Chromosome Identification
Chromosome isolation and microscopic observation forms the basis of cytogenetics and is the primary method by which clinicians detect chromosomal abnormalities in humans. A karyotype is the number and appearance of chromosomes, and includes their length, banding pattern, and centromere position. To obtain a view of an individual’s karyotype, cytologists photograph the chromosomes and then cut and paste each chromosome into a chart, or karyogram. Another name is an ideogram (Figure 13.5).
Figure 13.5 This karyotype is of a female human. Notice that homologous chromosomes are the same size, and have the same centromere positions and banding patterns. A human male would have an XY chromosome pair instead of the XX pair. (credit: Andreas Blozer et al)
In a given species, we can identify chromosomes by their number, size, centromere position, and banding pattern. In a human karyotype, autosomes or “body chromosomes” (all of the non–sex chromosomes) are generally organized in approximate order of size from largest (chromosome 1) to smallest (chromosome 22). The X and Y chromosomes are not autosomes. However, chromosome 21 is actually shorter than chromosome 22. Researchers discovered this after naming Down syndrome as trisomy 21, reflecting how this disorder results from possessing one extra chromosome 21 (three total). Not wanting to change the name of this important disorder, scientists retained the numbering of chromosome 21 despite describing it having the shortest set of chromosomes. We may designate the chromosome “arms” projecting from either end of the centromere as short or long, depending on their relative lengths. We abbreviate the short arm p (for “petite”); whereas, we abbreviate the long arm q (because it follows “p” alphabetically). Numbers further subdivide and denote each arm. Using this naming system, we can describe chromosome locations consistently in the scientific literature.
Career Connection
Career Connection
Geneticists Use Karyograms to Identify Chromosomal AberrationsAlthough we refer to Mendel as the “father of modern genetics,” he performed his experiments with none of the tools that the geneticists of today routinely employ. One such powerful cytological technique is karyotyping, a method in which geneticists can identify traits characterized by chromosomal abnormalities from a single cell. To observe an individual’s karyotype, a geneticist first collects a person’s cells (like white blood cells) from a blood sample or other tissue. In the laboratory, the geneticist stimulates the isolated cells to begin actively dividing. The geneticist then applies the chemical colchicine to cells to arrest condensed chromosomes in metaphase. The geneticist then induces swelling in the cells using a hypotonic solution so the chromosomes spread apart. Finally, the geneticist preserves the sample in a fixative and applies it to a slide.
The geneticist then stains chromosomes with one of several dyes to better visualize each chromosome pair's distinct and reproducible banding patterns. Following staining, the geneticist views the chromosomes using bright-field microscopy. A common stain choice is the Giemsa stain. Giemsa staining results in approximately 400–800 bands (of tightly coiled DNA and condensed proteins) arranged along all 23 chromosome pairs. An experienced geneticist can identify each band. In addition to the banding patterns, geneticists further identify chromosomes on the basis of size and centromere location. To obtain the classic depiction of the karyotype in which homologous chromosome pairs align in numerical order from longest to shortest, the geneticist obtains a digital image, identifies each chromosome, and manually arranges the chromosomes into this pattern (Figure 13.5).
At its most basic, the karyogram may reveal genetic abnormalities in which an individual has too many or too few chromosomes per cell. Examples of this are Down Syndrome, which one identifies by a third copy of chromosome 21, and Turner Syndrome, which is characterized by the presence of only one X chromosome in females instead of the normal two. Geneticists can also identify large DNA deletions or insertions. For instance, geneticists can identify Jacobsen Syndrome—which involves distinctive facial features as well as heart and bleeding defects—by a deletion on chromosome 11. Finally, the karyotype can pinpoint translocations, which occur when a segment of genetic material breaks from one chromosome and reattaches to another chromosome or to a different part of the same chromosome. Translocations are implicated in certain cancers, including chronic myelogenous leukemia.
During Mendel’s lifetime, inheritance was an abstract concept that one could only infer by performing crosses and observing the traits that offspring expressed. By observing a karyogram, today’s geneticists can actually visualize an individual's chromosomal composition to confirm or predict genetic abnormalities in offspring, even before birth.
Chromosome Number Disorders
Of all of the chromosomal disorders, chromosome number abnormalities are the most obviously identifiable from a karyogram. Chromosome number disorders include duplicating or losing entire chromosomes, as well as changes in the number of complete sets of chromosomes. They are caused by nondisjunction, which occurs when homologous chromosome pairs or sister chromatids fail to separate during meiosis. Misaligned or incomplete synapsis, or a spindle apparatus dysfunction that facilitates chromosome migration, can cause nondisjunction. The risk of nondisjunction occurring increases with the parents' age.
Nondisjunction can occur during either meiosis I or II, with differing results (Figure 13.6). If homologous chromosomes fail to separate during meiosis I, the result is two gametes that lack that particular chromosome and two gametes with two chromosome copies. If sister chromatids fail to separate during meiosis II, the result is one gamete that lacks that chromosome, two normal gametes with one chromosome copy, and one gamete with two chromosome copies.
Visual Connection
Visual Connection
Figure 13.6 Nondisjunction occurs when homologous chromosomes or sister chromatids fail to separate during meiosis, resulting in an abnormal chromosome number. Nondisjunction may occur during meiosis I or meiosis II. Credit: Rao, A. and Tag, A. Department of Biology, Texas A&M University.
Which of the following statements about nondisjunction is true?
1. Nondisjunction only results in gametes with n+1 or n–1 chromosomes.
2. Nondisjunction occurring during meiosis II results in 50 percent normal gametes.
3. Nondisjunction during meiosis I results in 50 percent normal gametes.
4. Nondisjunction always results in four different kinds of gametes.
Aneuploidy
Scientists call an individual with the appropriate number of chromosomes for their species euploid. In humans, euploidy corresponds to 22 pairs of autosomes and one pair of sex chromosomes. An individual with an error in chromosome number is described as aneuploid, a term that includes monosomy (losing one chromosome) or trisomy (gaining an extraneous chromosome). Monosomic human zygotes missing any one copy of an autosome invariably fail to develop to birth because they lack essential genes. This underscores the importance of “gene dosage” in humans. Most autosomal trisomies also fail to develop to birth; however, duplications of some smaller chromosomes (13, 15, 18, 21, or 22) can result in offspring that survive for several weeks to many years. Trisomic individuals suffer from a different type of genetic imbalance: an excess in gene dose. Individuals with an extra chromosome may synthesize an abundance of the gene products, which that chromosome encodes. This extra dose (150 percent) of specific genes can lead to a number of functional challenges and often precludes development. The most common trisomy among viable births is that of chromosome 21, which corresponds to Down Syndrome. Short stature and stunted digits, facial distinctions that include a broad skull and large tongue, and significant developmental delays characterize individuals with this inherited disorder. We can correlate the incidence of Down syndrome with maternal age. Older people are more likely to become pregnant with fetuses carrying the trisomy 21 genotype (Figure 13.7).
Figure 13.7 The incidence of having a fetus with trisomy 21 increases dramatically with maternal age.
Link to Learning
Link to Learning
Visualize adding a chromosome that leads to Down syndrome in this video simulation.
Polyploidy
We call an individual with more than the correct number of chromosome sets (two for diploid species) polyploid. For instance, fertilizing an abnormal diploid egg with a normal haploid sperm would yield a triploid zygote. Polyploid animals are extremely rare, with only a few examples among the flatworms, crustaceans, amphibians, fish, and lizards. Polyploid animals are sterile because meiosis cannot proceed normally and instead produces mostly aneuploid daughter cells that cannot yield viable zygotes. Rarely, polyploid animals can reproduce asexually by haplodiploidy, in which an unfertilized egg divides mitotically to produce offspring. In contrast, polyploidy is very common in the plant kingdom, and polyploid plants tend to be larger and more robust than euploids of their species (Figure 13.8).
Figure 13.8 As with many polyploid plants, this triploid orange daylily (Hemerocallis fulva) is particularly large and robust, and grows flowers with triple the number of petals of its diploid counterparts. (credit: Steve Karg)
Sex Chromosome Nondisjunction in Humans
Humans display dramatic deleterious effects with autosomal trisomies and monosomies. Therefore, it may seem counterintuitive that human females and males can function normally, despite carrying different numbers of the X chromosome. Rather than a gain or loss of autosomes, variations in the number of sex chromosomes occur with relatively mild effects. In part, this happens because of the molecular process X inactivation. Early in development, when female mammalian embryos consist of just a few thousand cells (relative to trillions in the newborn), one X chromosome in each cell inactivates by tightly condensing into a quiescent (dormant) structure, or a Barr body. The chance that an X chromosome (maternally or paternally derived) inactivates in each cell is random, but once this occurs, all cells derived from that one will have the same inactive X chromosome or Barr body. By this process, females compensate for their double genetic dose of X chromosome. In so-called “tortoiseshell” cats, we observe embryonic X inactivation as color variegation (Figure 13.9). Females that are heterozygous for an X-linked coat color gene will express one of two different coat colors over different regions of their body, corresponding to whichever X chromosome inactivates in that region's embryonic cell progenitor.
Figure 13.9 In cats, the gene for coat color is located on the X chromosome. In female cats' embryonic development, one of the two X chromosomes randomly inactivates in each cell, resulting in a tortoiseshell pattern if the cat has two different alleles for coat color. Male cats, having only one X chromosome, never exhibit a tortoiseshell coat color. (credit: Michael Bodega)
An individual carrying an abnormal number of X chromosomes will inactivate all but one X chromosome in each of her cells. However, even inactivated X chromosomes continue to express a few genes, and X chromosomes must reactivate for the proper maturation of female ovaries. As a result, X-chromosomal abnormalities typically occur with mild intellectual and physical disorders or disabilities, as well as sterility. If the X chromosome is absent altogether, the individual will not develop in utero.
Scientists have identified and characterized several errors in sex chromosome number. Individuals with three X chromosomes, triplo-X, are phenotypically female but express developmental delays and reduced fertility. The XXY genotype, corresponding to one type of Klinefelter syndrome, corresponds to phenotypically male individuals with small testes, enlarged breasts, and reduced body hair. More complex types of Klinefelter syndrome exist in which the individual has as many as five X chromosomes. In all types, every X chromosome except one undergoes inactivation to compensate for the excess genetic dosage. We see this as several Barr bodies in each cell nucleus. Turner syndrome, characterized as an X0 genotype (i.e., only a single sex chromosome), corresponds to a phenotypically female individual with short stature, webbed skin in the neck region, hearing and cardiac impairments, and sterility.
Duplications and Deletions
In addition to losing or gaining an entire chromosome, a chromosomal segment may duplicate or lose itself. Duplications and deletions often produce offspring that survive but exhibit abnormalities. Duplicated chromosomal segments may fuse to existing chromosomes or may be free in the nucleus. Cri-du-chat (from the French for “cry of the cat”) is a syndrome that occurs with nervous system abnormalities and identifiable physical features that result from a deletion of most 5p (the small arm of chromosome 5) (Figure 13.10). Infants with this genotype emit a characteristic high-pitched cry on which the disorder’s name is based.
Figure 13.10 This figure shows an individual with cri-du-chat syndrome at two, four, nine, and 12 years of age. (credit: Paola Cerruti Mainardi)
Chromosomal Structural Rearrangements
Cytologists have characterized numerous structural rearrangements in chromosomes, but chromosome inversions and translocations are the most common. We can identify both during meiosis by the adaptive pairing of rearranged chromosomes with their former homologs to maintain appropriate gene alignment. If the genes on two homologs are not oriented correctly, a recombination event could result in losing genes from one chromosome and gaining genes on the other. This would produce aneuploid gametes.
Chromosome Inversions
A chromosome inversion is the detachment, 180° rotation, and reinsertion of part of a chromosome. Inversions may occur in nature as a result of mechanical shear, or from transposable elements' action (special DNA sequences capable of facilitating rearranging chromosome segments with the help of enzymes that cut and paste DNA sequences). Unless they disrupt a gene sequence, inversions only change gene orientation and are likely to have more mild effects than aneuploid errors. However, altered gene orientation can result in functional changes because regulators of gene expression could move out of position with respect to their targets, causing aberrant levels of gene products.
An inversion can be pericentric and include the centromere, or paracentric and occur outside the centromere (Figure 13.11). A pericentric inversion that is asymmetric about the centromere can change the chromosome arms' relative lengths, making these inversions easily identifiable.
Figure 13.11 Pericentric inversions include the centromere, and paracentric inversions do not. A pericentric inversion can change the chromosome arms' relative lengths. A paracentric inversion cannot.
When one homologous chromosome undergoes an inversion but the other does not, the individual is an inversion heterozygote. To maintain point-for-point synapsis during meiosis, one homolog must form a loop, and the other homolog must mold around it. Although this topology can ensure that the genes correctly align, it also forces the homologs to stretch and can occur with imprecise synapsis regions (Figure 13.12).
Figure 13.12 When one chromosome undergoes an inversion but the other does not, one chromosome must form an inverted loop to retain point-for-point interaction during synapsis. This inversion pairing is essential to maintaining gene alignment during meiosis and to allow for recombination.
Evolution Connection
Evolution Connection
The Chromosome 18 InversionNot all chromosomes' structural rearrangements produce nonviable, impaired, or infertile individuals. In rare instances, such a change can result in new species evolving. In fact, a pericentric inversion in chromosome 18 appears to have contributed to human evolution. This inversion is not present in our closest genetic relatives, the chimpanzees. Humans and chimpanzees differ cytogenetically by pericentric inversions on several chromosomes and by the fusion of two separate chromosomes in chimpanzees that correspond to chromosome two in humans.
Scientists believe the pericentric chromosome 18 inversion occurred in early humans following their divergence from a common ancestor with chimpanzees approximately five million years ago. Researchers characterizing this inversion have suggested that approximately 19,000 nucleotide bases were duplicated on 18p, and the duplicated region inverted and reinserted on chromosome 18 of an ancestral human.
A comparison of human and chimpanzee genes in the region of this inversion indicates that two genes—ROCK1 and USP14—that are adjacent on chimpanzee chromosome 17 (which corresponds to human chromosome 18) are more distantly positioned on human chromosome 18. This suggests that one of the inversion breakpoints occurred between these two genes. Interestingly, humans and chimpanzees express USP14 at distinct levels in specific cell types, including cortical cells and fibroblasts. Perhaps the chromosome 18 inversion in an ancestral human repositioned specific genes and reset their expression levels in a useful way. Because both ROCK1 and USP14 encode cellular enzymes, a change in their expression could alter cellular function. We do not know how this inversion contributed to hominid evolution, but it appears to be a significant factor in the divergence of humans from other primates.1
Translocations
A translocation occurs when a chromosome segment dissociates and reattaches to a different, nonhomologous chromosome. Translocations can be benign or have devastating effects depending on how the positions of genes are altered with respect to regulatory sequences. Notably, specific translocations have occurred with several cancers and with schizophrenia. Reciprocal translocations result from exchanging chromosome segments between two nonhomologous chromosomes such that there is no genetic information gain or loss (Figure 13.13).
Figure 13.13 A reciprocal translocation occurs when a DNA segment transfers from one chromosome to another, nonhomologous chromosome. (credit: modification of work by National Human Genome Research/USA)
Footnotes
• 1Violaine Goidts et al., “Segmental duplication associated with the human-specific inversion of chromosome 18: a further example of the impact of segmental duplications on karyotype and genome evolution in primates,” Human Genetics. 115 (2004):116-122
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.03%3A_Modern_Understandings_of_Inheritance/3.3.03%3A_Chromosomal_Basis_of_Inherited_Disorders.txt
|
aneuploid
individual with an error in chromosome number; includes chromosome segment deletions and duplications
autosome
any of the non-sex chromosomes
centimorgan (cM)
(also, map unit) relative distance that corresponds to a 0,01 recombination frequency
Chromosomal Theory of Inheritance
theory proposing that chromosomes are the genes' vehicles and that their behavior during meiosis is the physical basis of the inheritance patterns that Mendel observed
chromosome inversion
detachment, 180° rotation, and chromosome arm reinsertion
euploid
individual with the appropriate number of chromosomes for their species
homologous recombination
process by which homologous chromosomes undergo reciprocal physical exchanges at their arms, also crossing over
karyogram
a karyotype's photographic image
karyotype
an individual's chromosome number and appearance; includes the size, banding patterns, and centromere position
monosomy
otherwise diploid genotype in which one chromosome is missing
nondisjunction
failure of synapsed homologs to completely separate and migrate to separate poles during the meiosis' first cell division
nonparental (recombinant) type
progeny resulting from homologous recombination that exhibits a different allele combination compared with its parents
paracentric
inversion that occurs outside the centromere
parental types
progeny that exhibits the same allelic combination as its parents
pericentric
inversion that involves the centromere
polyploid
individual with an incorrect number of chromosome sets
recombination frequency
average number of crossovers between two alleles; observed as the number of nonparental types in a progeny's population
translocation
process by which one chromosome segment dissociates and reattaches to a different, nonhomologous chromosome
trisomy
otherwise diploid genotype in which one entire chromosome duplicates
X inactivation
condensing X chromosomes into Barr bodies during embryonic development in females to compensate for the double genetic dose
3.3.05: Chapter Summary
13.1 Chromosomal Theory and Genetic Linkage
Sutton and Boveri's Chromosomal Theory of Inheritance states that chromosomes are the vehicles of genetic heredity. Neither Mendelian genetics nor gene linkage is perfectly accurate. Instead, chromosome behavior involves segregation, independent assortment, and occasionally, linkage. Sturtevant devised a method to assess recombination frequency and infer linked genes' relative positions and distances on a chromosome on the basis of the average number of crossovers in the intervening region between the genes. Sturtevant correctly presumed that genes are arranged in serial order on chromosomes and that recombination between homologs can occur anywhere on a chromosome with equal likelihood. Whereas linkage causes alleles on the same chromosome to be inherited together, homologous recombination biases alleles toward an independent inheritance pattern.
13.2 Chromosomal Basis of Inherited Disorders
The number, size, shape, and banding pattern of chromosomes make them easily identifiable in a karyogram and allows for the assessment of many chromosomal abnormalities. Disorders in chromosome number, or aneuploidies, are typically lethal to the embryo, although a few trisomic genotypes are viable. Because of X inactivation, aberrations in sex chromosomes typically have milder phenotypic effects. Aneuploidies also include instances in which a chromosome's segments duplicate or delete themselves. Inversion or translocation also may rearrange chromosome structures. Both of these aberrations can result in problematic phenotypic effects. Because they force chromosomes to assume unnatural topologies during meiosis, inversions and translocations often occur with reduced fertility because of the likelihood of nondisjunction.
3.3.06: Visual Connection Questions
1.
Figure 13.3 In a test cross for two characteristics such as the one shown here, can the predicted frequency of recombinant offspring be 60 percent? Why or why not?
2.
Figure 13.4 Which of the following statements is true?
1. Recombination of the body color and red/cinnabar eye alleles will occur more frequently than recombination of the alleles for wing length and aristae length.
2. Recombination of the body color and aristae length alleles will occur more frequently than recombination of red/brown eye alleles and the aristae length alleles.
3. Recombination of the gray/black body color and long/short aristae alleles will not occur.
4. Recombination of the red/brown eye and long/short aristae alleles will occur more frequently than recombination of the alleles for wing length and body color.
3.
Figure 13.6 Which of the following statements about nondisjunction is true?
1. Nondisjunction only results in gametes with n+1 or n–1 chromosomes.
2. Nondisjunction occurring during meiosis II results in 50 percent normal gametes.
3. Nondisjunction during meiosis I results in 50 percent normal gametes.
4. Nondisjunction always results in four different kinds of gametes.
3.3.07: Review Questions
4.
X-linked recessive traits in humans (or in Drosophila) are observed ________.
1. in more males than females
2. in more females than males
3. in males and females equally
4. in different distributions depending on the trait
5.
The first suggestion that chromosomes may physically exchange segments came from the microscopic identification of ________.
1. synapsis
2. sister chromatids
3. chiasmata
4. alleles
6.
Which recombination frequency corresponds to independent assortment and the absence of linkage?
1. 0
2. 0.25
3. 0.50
4. 0.75
7.
Which recombination frequency corresponds to perfect linkage and violates the law of independent assortment?
1. 0
2. 0.25
3. 0.50
4. 0.75
8.
Which of the following codes describes position 12 on the long arm of chromosome 13?
1. 13p12
2. 13q12
3. 12p13
4. 12q13
9.
In agriculture, polyploid crops (like coffee, strawberries, or bananas) tend to produce ________.
1. more uniformity
2. more variety
3. larger yields
4. smaller yields
10.
Assume a pericentric inversion occurred in one of two homologs prior to meiosis. The other homolog remains normal. During meiosis, what structure—if any—would these homologs assume in order to pair accurately along their lengths?
1. V formation
2. cruciform
3. loop
4. pairing would not be possible
11.
The genotype XXY corresponds to
1. Klinefelter syndrome
2. Turner syndrome
3. Triplo-X
4. Jacob syndrome
12.
Abnormalities in the number of X chromosomes tends to have milder phenotypic effects than the same abnormalities in autosomes because of ________.
1. deletions
2. nonhomologous recombination
3. synapsis
4. X inactivation
13.
By definition, a pericentric inversion includes the ________.
1. centromere
2. chiasma
3. telomere
4. synapse
3.3.08: Critical Thinking Questions
14.
Explain how the Chromosomal Theory of Inheritance helped to advance our understanding of genetics.
15.
Using diagrams, illustrate how nondisjunction can result in an aneuploid zygote.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.03%3A_Modern_Understandings_of_Inheritance/3.3.04%3A_Key_Terms.txt
|
Each human cell has 23 pairs of chromosomes: one set of chromosomes is inherited from the mother and the other set is inherited from the father. There is also a mitochondrial genome, inherited exclusively from the mother, which can be involved in inherited genetic disorders. On each chromosome, there are thousands of genes that are responsible for determining the genotype and phenotype of the individual. A gene is defined as a sequence of DNA that codes for a functional product. The human haploid genome contains 3 billion base pairs and has between 20,000 and 25,000 functional genes.
• 3.4.1: Introduction
The three letters “DNA” have now become synonymous with crime solving, paternity testing, human identification, and genetic testing. DNA can be retrieved from hair, blood, or saliva. Each person’s DNA is unique, and it is possible to detect differences between individuals within a species on the basis of these unique features.
• 3.4.2: Historical Basis of Modern Understanding
Modern understandings of DNA have evolved from the discovery of nucleic acid to the development of the double-helix model. In the 1860s, Friedrich Miescher, a physician by profession, was the first person to isolate phosphate-rich chemicals from white blood cells or leukocytes. He named these chemicals (which would eventually be known as RNA and DNA) nuclein because they were isolated from the nuclei of the cells.
• 3.4.3: DNA Structure and Sequencing
The building blocks of DNA are nucleotides. The important components of the nucleotide are a nitrogenous base, deoxyribose (5-carbon sugar), and a phosphate group. The nucleotide is named depending on the nitrogenous base. The nitrogenous base can be a purine such as adenine (A) and guanine (G), or a pyrimidine such as cytosine (C) and thymine (T).
• 3.4.4: Basics of DNA Replication
The elucidation of the structure of the double helix provided a hint as to how DNA divides and makes copies of itself. This model suggests that the two strands of the double helix separate during replication, and each strand serves as a template from which the new complementary strand is copied. What was not clear was how the replication took place. There were three models suggested: conservative, semi-conservative, and dispersive.
• 3.4.5: DNA Replication in Prokaryotes
DNA replication has been extremely well studied in prokaryotes primarily because of the small size of the genome and the mutants that are available. E. coli has 4.6 million base pairs in a single circular chromosome and all of it gets replicated in approximately 42 minutes, starting from a single origin of replication and proceeding around the circle in both directions. This means that approximately 1000 nucleotides are added per second. The process is rapid and occurs without many mistakes.
• 3.4.6: DNA Replication in Eukaryotes
Eukaryotic genomes are much more complex and larger in size than prokaryotic genomes. The human genome has three billion base pairs per haploid set of chromosomes, and 6 billion base pairs are replicated during the S phase of the cell cycle. There are multiple origins of replication on the eukaryotic chromosome; humans can have up to 100,000 origins of replication.
• 3.4.7: DNA Repair
DNA replication is a highly accurate process, but mistakes can occasionally occur, such as a DNA polymerase inserting a wrong base. Uncorrected mistakes may sometimes lead to serious consequences, such as cancer. Repair mechanisms correct the mistakes. In rare cases, mistakes are not corrected, leading to mutations; in other cases, repair enzymes are themselves mutated or defective.
• 3.4.8: Key Terms
• 3.4.9: Chapter Summary
• 3.4.10: Visual Connection Questions
• 3.4.11: Review Questions
• 3.4.12: Critical Thinking Questions
Thumbnail: DNA molecule. (CC BY-SA 3.0 / frame from original animation; Dcirovic via Wikimedia Commons).
3.04: DNA Structure and Function
Figure 14.1 Dolly the sheep was the first large mammal to be cloned.
The three letters “DNA” have now become synonymous with crime solving and genetic testing. DNA can be retrieved from hair, blood, or saliva. Each person’s DNA is unique, and it is possible to detect differences between individuals within a species on the basis of these unique features.
DNA analysis has many practical applications beyond forensics. In humans, DNA testing is applied to numerous uses: determining paternity, tracing genealogy, identifying pathogens, archeological research, tracing disease outbreaks, and studying human migration patterns. In the medical field, DNA is used in diagnostics, new vaccine development, and cancer therapy. It is now possible to determine predisposition to diseases by looking at genes.
Each human cell has 23 pairs of chromosomes: one set of chromosomes is inherited from the female parent and the other set is inherited from the male parent. There is also a mitochondrial genome, inherited exclusively from the female parent, which can be involved in inherited genetic disorders. On each chromosome, there are thousands of genes that are responsible for determining the genotype and phenotype of the individual. A gene is defined as a sequence of DNA that codes for a functional product. The human haploid genome contains 3 billion base pairs and has between 20,000 and 25,000 functional genes.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.04%3A_DNA_Structure_and_Function/3.4.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Explain transformation of DNA
• Describe the key experiments that helped identify that DNA is the genetic material
• State and explain Chargaff’s rules
Our current understanding of DNA began with the discovery of nucleic acids followed by the development of the double-helix model. In the 1860s, Friedrich Miescher (Figure 14.2), a physician by profession, isolated phosphate-rich chemicals from white blood cells (leukocytes). He named these chemicals (which would eventually be known as DNA) nuclein because they were isolated from the nuclei of the cells.
Figure 14.2 Friedrich Miescher (1844–1895) discovered nucleic acids.
Link to Learning
Link to Learning
To see Miescher conduct his experiment that led to his discovery of DNA and associated proteins in the nucleus, click through this review.
A half century later, in 1928, British bacteriologist Frederick Griffith reported the first demonstration of bacterial transformation—a process in which external DNA is taken up by a cell, thereby changing its morphology and physiology. Griffith conducted his experiments with Streptococcus pneumoniae, a bacterium that causes pneumonia. Griffith worked with two strains of this bacterium called rough (R) and smooth (S). (The two cell types were called “rough” and “smooth” after the appearance of their colonies grown on a nutrient agar plate.)
The R strain is non-pathogenic (does not cause disease). The S strain is pathogenic (disease-causing), and has a capsule outside its cell wall. The capsule allows the cell to escape the immune responses of the host mouse.
When Griffith injected the living S strain into mice, they died from pneumonia. In contrast, when Griffith injected the live R strain into mice, they survived. In another experiment, when he injected mice with the heat-killed S strain, they also survived. This experiment showed that the capsule alone was not the cause of death. In a third set of experiments, a mixture of live R strain and heat-killed S strain were injected into mice, and—to his surprise—the mice died. Upon isolating the live bacteria from the dead mouse, only the S strain of bacteria was recovered. When this isolated S strain was injected into fresh mice, the mice died. Griffith concluded that something had passed from the heat-killed S strain into the live R strain and transformed it into the pathogenic S strain. He called this the transforming principle (Figure 14.3). These experiments are now known as Griffith's transformation experiments.
Figure 14.3 Two strains of S. pneumoniae were used in Griffith’s transformation experiments. The R strain is non-pathogenic, whereas the S strain is pathogenic and causes death. When Griffith injected a mouse with the heat-killed S strain and a live R strain, the mouse died. The S strain was recovered from the dead mouse. Griffith concluded that something had passed from the heat-killed S strain to the R strain, transforming the R strain into the S strain in the process. Credit: Rao, A., Ryan, K. and Tag, A. Department of Biology, Texas A&M University.
Scientists Oswald Avery, Colin MacLeod, and Maclyn McCarty (1944) were interested in exploring this transforming principle further. They isolated the S strain from the dead mice and isolated the proteins and nucleic acids (RNA and DNA) as these were possible candidates for the molecule of heredity. They used enzymes that specifically degraded each component and then used each mixture separately to transform the R strain. They found that when DNA was degraded, the resulting mixture was no longer able to transform the bacteria, whereas all of the other combinations were able to transform the bacteria. This led them to conclude that DNA was the transforming principle.
Career Connection
Career Connection
Forensic ScientistForensic Scientists used DNA analysis evidence for the first time to solve an immigration case. The story started with a teenage boy returning to London from Ghana to be with his mother. Immigration authorities at the airport were suspicious of him, thinking that he was traveling on a forged passport. After much persuasion, he was allowed to go live with his mother, but the immigration authorities did not drop the case against him. All types of evidence, including photographs, were provided to the authorities, but deportation proceedings were started nevertheless. Around the same time, Dr. Alec Jeffreys of Leicester University in the United Kingdom had invented a technique known as DNA fingerprinting. The immigration authorities approached Dr. Jeffreys for help. He took DNA samples from the mother and three of her children, as well as an unrelated mother, and compared the samples with the boy’s DNA. Because the biological father was not in the picture, DNA from the three children was compared with the boy’s DNA. He found a match in the boy’s DNA for both the mother and his three siblings. He concluded that the boy was indeed the mother’s son.
Forensic scientists analyze many items, including documents, handwriting, firearms, and biological samples. They analyze the DNA content of hair, semen, saliva, and blood, and compare it with a database of DNA profiles of known criminals. Analysis includes DNA isolation, sequencing, and sequence analysis. Forensic scientists are expected to appear at court hearings to present their findings. They are usually employed in crime labs of city and state government agencies. Geneticists experimenting with DNA techniques also work for scientific and research organizations, pharmaceutical industries, and college and university labs. Students wishing to pursue a career as a forensic scientist should have at least a bachelor's degree in chemistry, biology, or physics, and preferably some experience working in a laboratory.
Although the experiments of Avery, McCarty and McLeod had demonstrated that DNA was the informational component transferred during transformation, DNA was still considered to be too simple a molecule to carry biological information. Proteins, with their 20 different amino acids, were regarded as more likely candidates. The decisive experiment, conducted by Martha Chase and Alfred Hershey in 1952, provided confirmatory evidence that DNA was indeed the genetic material and not proteins. Chase and Hershey were studying a bacteriophage—a virus that infects bacteria. Viruses typically have a simple structure: a protein coat, called the capsid, and a nucleic acid core that contains the genetic material (either DNA or RNA). The bacteriophage infects the host bacterial cell by attaching to its surface, and then it injects its nucleic acids inside the cell. The phage DNA makes multiple copies of itself using the host machinery, and eventually the host cell bursts, releasing a large number of bacteriophages. Hershey and Chase selected radioactive elements that would specifically distinguish the protein from the DNA in infected cells. They labeled one batch of phage with radioactive sulfur, 35S, to label the protein coat. Another batch of phage were labeled with radioactive phosphorus, 32P. Because phosphorous is found in DNA, but not protein, the DNA and not the protein would be tagged with radioactive phosphorus. Likewise, sulfur is absent from DNA, but present in several amino acids such as methionine and cysteine.
Each batch of phage was allowed to infect the cells separately. After infection, the phage bacterial suspension was put in a blender, which caused the phage coat to detach from the host cell. Cells exposed long enough for infection to occur were then examined to see which of the two radioactive molecules had entered the cell. The phage and bacterial suspension was spun down in a centrifuge. The heavier bacterial cells settled down and formed a pellet, whereas the lighter phage particles stayed in the supernatant. In the tube that contained phage labeled with 35S, the supernatant contained the radioactively labeled phage, whereas no radioactivity was detected in the pellet. In the tube that contained the phage labeled with 32P, the radioactivity was detected in the pellet that contained the heavier bacterial cells, and no radioactivity was detected in the supernatant. Hershey and Chase concluded that it was the phage DNA that was injected into the cell and carried information to produce more phage particles, thus providing evidence that DNA was the genetic material and not proteins (Figure 14.4).
Figure 14.4 In Hershey and Chase's experiments, bacteria were infected with phage radiolabeled with either 35S, which labels protein, or 32P, which labels DNA. Only 32P entered the bacterial cells, indicating that DNA is the genetic material.
Around this same time, Austrian biochemist Erwin Chargaff examined the content of DNA in different species and found that the amounts of adenine, thymine, guanine, and cytosine were not found in equal quantities, and that relative concentrations of the four nucleotide bases varied from species to species, but not within tissues of the same individual or between individuals of the same species. He also discovered something unexpected: That the amount of adenine equaled the amount of thymine, and the amount of cytosine equaled the amount of guanine (that is, A = T and G = C). Different species had equal amounts of purines (A+G) and pyrimidines (T + C), but different ratios of A+T to G+C. These observations became known as Chargaff’s rules. Chargaff's findings proved immensely useful when Watson and Crick were getting ready to propose their DNA double helix model! You can see after reading the past few pages how science builds upon previous discoveries, sometimes in a slow and laborious process.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.04%3A_DNA_Structure_and_Function/3.4.02%3A_Historical_Basis_of_Modern_Understanding.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the structure of DNA
• Explain the Sanger method of DNA sequencing
• Discuss the similarities and differences between eukaryotic and prokaryotic DNA
The building blocks of DNA are nucleotides. The important components of the nucleotide are a nitrogenous (nitrogen-bearing) base, a 5-carbon sugar (pentose), and a phosphate group (Figure 14.5). The nucleotide is named depending on the nitrogenous base. The nitrogenous base can be a purine such as adenine (A) and guanine (G), or a pyrimidine such as cytosine (C) and thymine (T).
Visual Connection
Visual Connection
Figure 14.5 The purines have a double ring structure with a six-membered ring fused to a five-membered ring. Pyrimidines are smaller in size; they have a single six-membered ring structure.
The images above illustrate the five bases of DNA and RNA. Examine the images and explain why these are called “nitrogenous bases.” How are the purines different from the pyrimidines? How is one purine or pyrimidine different from another, e.g., adenine from guanine? How is a nucleoside different from a nucleotide?
The purines have a double ring structure with a six-membered ring fused to a five-membered ring. Pyrimidines are smaller in size; they have a single six-membered ring structure.
The sugar is deoxyribose in DNA and ribose in RNA. The carbon atoms of the five-carbon sugar are numbered 1', 2', 3', 4', and 5' (1' is read as “one prime”). The phosphate, which makes DNA and RNA acidic, is connected to the 5' carbon of the sugar by the formation of an ester linkage between phosphoric acid and the 5'-OH group (an ester is an acid + an alcohol). In DNA nucleotides, the 3' carbon of the sugar deoxyribose is attached to a hydroxyl (OH) group. In RNA nucleotides, the 2' carbon of the sugar ribose also contains a hydroxyl group. The base is attached to the 1'carbon of the sugar.
The nucleotides combine with each other to produce phosphodiester bonds. The phosphate residue attached to the 5' carbon of the sugar of one nucleotide forms a second ester linkage with the hydroxyl group of the 3' carbon of the sugar of the next nucleotide, thereby forming a 5'-3' phosphodiester bond. In a polynucleotide, one end of the chain has a free 5' phosphate, and the other end has a free 3'-OH. These are called the 5' and 3' ends of the chain.
In the 1950s, Francis Crick and James Watson worked together to determine the structure of DNA at the University of Cambridge, England. Other scientists like Linus Pauling and Maurice Wilkins were also actively exploring this field. Pauling previously had discovered the secondary structure of proteins using X-ray crystallography. In Wilkins’ lab, researcher Rosalind Franklin was using X-ray diffraction methods to understand the structure of DNA. Watson and Crick were able to piece together the puzzle of the DNA molecule on the basis of Franklin's data because Crick had also studied X-ray diffraction (Figure 14.6). In 1962, James Watson, Francis Crick, and Maurice Wilkins were awarded the Nobel Prize in Medicine. Unfortunately, by then Franklin had died, and Nobel prizes are not awarded posthumously.
Figure 14.6 The X-ray diffraction pattern of DNA, which helped to elucidate its double-helix structure.
Watson and Crick proposed that DNA is made up of two strands that are twisted around each other to form a right-handed helix. Base pairing takes place between a purine and pyrimidine on opposite strands, so that A pairs with T, and G pairs with C (suggested by Chargaff's Rules). Thus, adenine and thymine are complementary base pairs, and cytosine and guanine are also complementary base pairs. The base pairs are stabilized by hydrogen bonds: adenine and thymine form two hydrogen bonds and cytosine and guanine form three hydrogen bonds. The two strands are anti-parallel in nature; that is, the 3' end of one strand faces the 5' end of the other strand. The sugar and phosphate of the nucleotides form the backbone of the structure, whereas the nitrogenous bases are stacked inside, like the rungs of a ladder. Each base pair is separated from the next base pair by a distance of 0.34 nm, and each turn of the helix measures 3.4 nm. Therefore, 10 base pairs are present per turn of the helix. The diameter of the DNA double-helix is 2 nm, and it is uniform throughout. Only the pairing between a purine and pyrimidine and the antiparallel orientation of the two DNA strands can explain the uniform diameter. The twisting of the two strands around each other results in the formation of uniformly spaced major and minor grooves (Figure 14.7).
Figure 14.7 DNA has (a) a double helix structure and (b) phosphodiester bonds; the dotted lines between Thymine and Adenine and Guanine and Cytosine represent hydrogen bonds. The (c) major and minor grooves are binding sites for DNA binding proteins during processes such as transcription (the copying of RNA from DNA) and replication.
DNA Sequencing Techniques
Until the 1990s, the sequencing of DNA (reading the sequence of DNA) was a relatively expensive and long process. Using radiolabeled nucleotides also compounded the problem through safety concerns. With currently available technology and automated machines, the process is cheaper, safer, and can be completed in a matter of hours. Fred Sanger developed the sequencing method used for the human genome sequencing project, which is widely used today (Figure 14.8).
Link to Learning
Link to Learning
Visit this site to watch a video explaining the DNA sequence-reading technique that resulted from Sanger’s work.
The sequencing method is known as the dideoxy chain termination method. The method is based on the use of chain terminators, the dideoxynucleotides (ddNTPs). The ddNTPSs differ from the deoxynucleotides by the lack of a free 3' OH group on the five-carbon sugar. If a ddNTP is added to a growing DNA strand, the chain cannot be extended any further because the free 3' OH group needed to add another nucleotide is not available. By using a predetermined ratio of deoxynucleotides to dideoxynucleotides, it is possible to generate DNA fragments of different sizes.
Figure 14.8 In Frederick Sanger's dideoxy chain termination method, dye-labeled dideoxynucleotides are used to generate DNA fragments that terminate at different points. The DNA is separated by capillary electrophoresis (not defined) on the basis of size, and from the order of fragments formed, the DNA sequence can be read. The DNA sequence readout is shown on an electropherogram (not defined) that is generated by a laser scanner.
The DNA sample to be sequenced is denatured (separated into two strands by heating it to high temperatures). The DNA is divided into four tubes in which a primer, DNA polymerase, and all four nucleoside triphosphates (A, T, G, and C) are added. In addition, limited quantities of one of the four dideoxynucleoside triphosphates (ddCTP, ddATP, ddGTP, and ddTTP) are added to each tube respectively. The tubes are labeled as A, T, G, and C according to the ddNTP added. For detection purposes, each of the four dideoxynucleotides carries a different fluorescent label. Chain elongation continues until a fluorescent dideoxy nucleotide is incorporated, after which no further elongation takes place. After the reaction is over, electrophoresis is performed. Even a difference in length of a single base can be detected. The sequence is read from a laser scanner that detects the fluorescent marker of each fragment. For his work on DNA sequencing, Sanger received a Nobel Prize in Chemistry in 1980.
Link to Learning
Link to Learning
Sanger’s genome sequencing has led to a race to sequence human genomes at rapid speed and low cost. Learn more by viewing the animation here.
Gel electrophoresis is a technique used to separate DNA fragments of different sizes. Usually the gel is made of a chemical called agarose (a polysaccharide polymer extracted from seaweed that is high in galactose residues). Agarose powder is added to a buffer and heated. After cooling, the gel solution is poured into a casting tray. Once the gel has solidified, the DNA is loaded on the gel and electric current is applied. The DNA has a net negative charge and moves from the negative electrode toward the positive electrode. The electric current is applied for sufficient time to let the DNA separate according to size; the smallest fragments will be farthest from the well (where the DNA was loaded), and the heavier molecular weight fragments will be closest to the well. Once the DNA is separated, the gel is stained with a DNA-specific dye for viewing it (Figure 14.9).
Figure 14.9 DNA can be separated on the basis of size using gel electrophoresis. (credit: James Jacob, Tompkins Cortland Community College)
Evolution Connection
Evolution Connection
Neanderthal Genome: How Are We Related?The first draft sequence of the Neanderthal genome was recently published by Richard E. Green et al. in 2010.1 Neanderthals are the closest ancestors of present-day humans. They were known to have lived in Europe and Western Asia (and now, perhaps, in Northern Africa) before they disappeared from fossil records approximately 30,000 years ago. Green’s team studied almost 40,000-year-old fossil remains that were selected from sites across the world. Extremely sophisticated means of sample preparation and DNA sequencing were employed because of the fragile nature of the bones and heavy microbial contamination. In their study, the scientists were able to sequence some four billion base pairs. The Neanderthal sequence was compared with that of present-day humans from across the world. After comparing the sequences, the researchers found that the Neanderthal genome had 2 to 3 percent greater similarity to people living outside Africa than to people in Africa. While current theories have suggested that all present-day humans can be traced to a small ancestral population in Africa, the data from the Neanderthal genome suggest some interbreeding between Neanderthals and early modern humans.
Green and his colleagues also discovered DNA segments among people in Europe and Asia that are more similar to Neanderthal sequences than to other contemporary human sequences. Another interesting observation was that Neanderthals are as closely related to people from Papua New Guinea as to those from China or France. This is surprising because Neanderthal fossil remains have been located only in Europe and West Asia. Most likely, genetic exchange took place between Neanderthals and modern humans as modern humans emerged out of Africa, before the divergence of Europeans, East Asians, and Papua New Guineans.
Several genes seem to have undergone changes from Neanderthals during the evolution of present-day humans. These genes are involved in cranial structure, metabolism, skin morphology, and cognitive development. One of the genes that is of particular interest is RUNX2, which is different in modern day humans and Neanderthals. This gene is responsible for the prominent frontal bone, bell-shaped rib cage, and dental differences seen in Neanderthals. It is speculated that an evolutionary change in RUNX2 was important in the origin of modern-day humans, and this affected the cranium and the upper body.
Link to Learning
Link to Learning
Watch Svante Pääbo’s talk explaining the Neanderthal genome research at the 2011 annual TED (Technology, Entertainment, Design) conference.
DNA Packaging in Cells
Prokaryotes are much simpler than eukaryotes in many of their features (Figure 14.10). Most prokaryotes contain a single, circular chromosome that is found in an area of the cytoplasm called the nucleoid region.
Visual Connection
Visual Connection
Figure 14.10 A eukaryote contains a well-defined nucleus, whereas in prokaryotes, the chromosome lies in the cytoplasm in an area called the nucleoid.
In eukaryotic cells, DNA and RNA synthesis occur in a separate compartment from protein synthesis. In prokaryotic cells, both processes occur together. What advantages might there be to separating the processes? What advantages might there be to having them occur together?
The size of the genome in one of the most well-studied prokaryotes, E.coli, is 4.6 million base pairs (approximately 1.1 mm, if cut and stretched out). So how does this fit inside a small bacterial cell? The DNA is twisted by what is known as supercoiling. Supercoiling suggests that DNA is either “under-wound” (less than one turn of the helix per 10 base pairs) or “over-wound” (more than 1 turn per 10 base pairs) from its normal relaxed state. Some proteins are known to be involved in the supercoiling; other proteins and enzymes such as DNA gyrase help in maintaining the supercoiled structure.
Eukaryotes, whose chromosomes each consist of a linear DNA molecule, employ a different type of packing strategy to fit their DNA inside the nucleus (Figure 14.11). At the most basic level, DNA is wrapped around proteins known as histones to form structures called nucleosomes. The histones are evolutionarily conserved proteins that are rich in basic amino acids and form an octamer composed of two molecules of each of four different histones. Their composition and properties are important to understanding gene expression, and were partially uncovered based on research by Marie M. Daly and Alfred E. Mirsky in the early 1950s. The DNA (remember, it is negatively charged because of the phosphate groups) is wrapped tightly around the histone core. This nucleosome is linked to the next one with the help of a linker DNA. This is also known as the “beads on a string” structure. With the help of a fifth histone, a string of nucleosomes is further compacted into a 30-nm fiber, which is the diameter of the structure. Metaphase chromosomes are even further condensed by association with scaffolding proteins. At the metaphase stage, the chromosomes are at their most compact, approximately 700 nm in width.
In interphase, eukaryotic chromosomes have two distinct regions that can be distinguished by staining. The tightly packaged region is known as heterochromatin, and the less dense region is known as euchromatin. Heterochromatin usually contains genes that are not expressed, and is found in the regions of the centromere and telomeres. The euchromatin usually contains genes that are transcribed, with DNA packaged around nucleosomes but not further compacted.
Figure 14.11 These figures illustrate the compaction of the eukaryotic chromosome.
Footnotes
• 1Richard E. Green et al., “A Draft Sequence of the Neandertal Genome,” Science 328 (2010): 710-22.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.04%3A_DNA_Structure_and_Function/3.4.03%3A_DNA_Structure_and_Sequencing.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Explain how the structure of DNA reveals the replication process
• Describe the Meselson and Stahl experiments
The elucidation of the structure of the double helix provided a hint as to how DNA divides and makes copies of itself. In their 1953 paper, Watson and Crick penned an incredible understatement: "It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material." With specific base pairs, the sequence of one DNA strand can be predicted from its complement. The double-helix model suggests that the two strands of the double helix separate during replication, and each strand serves as a template from which the new complementary strand is copied. What was not clear was how the replication took place. There were three models suggested (Figure 14.12): conservative, semi-conservative, and dispersive.
Figure 14.12 The three suggested models of DNA replication. Gray indicates the original DNA strands, and blue indicates newly synthesized DNA.
In conservative replication, the parental DNA remains together, and the newly formed daughter strands are together. The semi-conservative method suggests that each of the two parental DNA strands acts as a template for new DNA to be synthesized; after replication, each double-stranded DNA includes one parental or “old” strand and one “new” strand. In the dispersive model, both copies of DNA have double-stranded segments of parental DNA and newly synthesized DNA interspersed.
Meselson and Stahl were interested in understanding how DNA replicates. They grew E. coli for several generations in a medium containing a “heavy” isotope of nitrogen (15N), which gets incorporated into nitrogenous bases, and eventually into the DNA (Figure 14.13).
Figure 14.13 Meselson and Stahl experimented with E. coli grown first in heavy nitrogen (15N) then in 14N. DNA grown in 15N (red band) is heavier than DNA grown in 14N (orange band), and sediments to a lower level in cesium chloride solution in an ultracentrifuge. When DNA grown in 15N is switched to media containing 14N, after one round of cell division the DNA sediments halfway between the 15N and 14N levels, indicating that it now contains fifty percent 14N. In subsequent cell divisions, an increasing amount of DNA contains 14N only. These data support the semi-conservative replication model. (credit: modification of work by Mariana Ruiz Villareal)
The E. coli culture was then placed into medium containing 14N and allowed to grow for several generations. After each of the first few generations, the cells were harvested and the DNA was isolated, then centrifuged at high speeds in an ultracentrifuge. During the centrifugation, the DNA was loaded into a gradient (typically a solution of salt such as cesium chloride or sucrose) and spun at high speeds of 50,000 to 60,000 rpm. Under these circumstances, the DNA will form a band according to its buoyant density: the density within the gradient at which it floats. DNA grown in 15N will form a band at a higher density position (i.e., farther down the centrifuge tube) than that grown in 14N. Meselson and Stahl noted that after one generation of growth in 14N after they had been shifted from 15N, the single band observed was intermediate in position in between DNA of cells grown exclusively in 15N and 14N. This suggested either a semi-conservative or dispersive mode of replication. The DNA harvested from cells grown for two generations in 14N formed two bands: one DNA band was at the intermediate position between 15N and 14N, and the other corresponded to the band of 14N DNA. These results could only be explained if DNA replicates in a semi-conservative manner. And for this reason, therefore, the other two models were ruled out.
During DNA replication, each of the two strands that make up the double helix serves as a template from which new strands are copied. The new strands will be complementary to the parental or “old” strands. When two daughter DNA copies are formed, they have the same sequence and are divided equally into the two daughter cells.
Link to Learning
Link to Learning
View this video on DNA replication.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.04%3A_DNA_Structure_and_Function/3.4.04%3A_Basics_of_DNA_Replication.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Explain the process of DNA replication in prokaryotes
• Discuss the role of different enzymes and proteins in supporting this process
DNA replication has been well studied in prokaryotes primarily because of the small size of the genome and because of the large variety of mutants that are available. E. coli has 4.6 million base pairs in a single circular chromosome and all of it gets replicated in approximately 42 minutes, starting from a single site along the chromosome and proceeding around the circle in both directions. This means that approximately 1000 nucleotides are added per second. Thus, the process is quite rapid and occurs without many mistakes.
DNA replication employs a large number of structural proteins and enzymes, each of which plays a critical role during the process. One of the key players is the enzyme DNA polymerase, also known as DNA pol, which adds nucleotides one-by-one to the growing DNA chain that is complementary to the template strand. The addition of nucleotides requires energy; this energy is obtained from the nucleoside triphosphates ATP, GTP, TTP and CTP. Like ATP, the other NTPs (nucleoside triphosphates) are high-energy molecules that can serve both as the source of DNA nucleotides and the source of energy to drive the polymerization. When the bond between the phosphates is “broken,” the energy released is used to form the phosphodiester bond between the incoming nucleotide and the growing chain. In prokaryotes, three main types of polymerases are known: DNA pol I, DNA pol II, and DNA pol III. It is now known that DNA pol III is the enzyme required for DNA synthesis; DNA pol I is an important accessory enzyme in DNA replication, and along with DNA pol II, is primarily required for repair.
How does the replication machinery know where to begin? It turns out that there are specific nucleotide sequences called origins of replication where replication begins. In E. coli, which has a single origin of replication on its one chromosome (as do most prokaryotes), this origin of replication is approximately 245 base pairs long and is rich in AT sequences. The origin of replication is recognized by certain proteins that bind to this site. An enzyme called helicase unwinds the DNA by breaking the hydrogen bonds between the nitrogenous base pairs. ATP hydrolysis is required for this process. As the DNA opens up, Y-shaped structures called replication forks are formed. Two replication forks are formed at the origin of replication and these get extended bi-directionally as replication proceeds. Single-strand binding proteins coat the single strands of DNA near the replication fork to prevent the single-stranded DNA from winding back into a double helix.
DNA polymerase has two important restrictions: it is able to add nucleotides only in the 5' to 3' direction (a new DNA strand can be only extended in this direction). It also requires a free 3'-OH group to which it can add nucleotides by forming a phosphodiester bond between the 3'-OH end and the 5' phosphate of the next nucleotide. This essentially means that it cannot add nucleotides if a free 3'-OH group is not available. Then how does it add the first nucleotide? The problem is solved with the help of a primer that provides the free 3'-OH end. Another enzyme, RNA primase, synthesizes an RNA segment that is about five to ten nucleotides long and complementary to the template DNA. Because this sequence primes the DNA synthesis, it is appropriately called the primer. DNA polymerase can now extend this RNA primer, adding nucleotides one-by-one that are complementary to the template strand (Figure 14.14).
Visual Connection
Visual Connection
Figure 14.14 First Components of DNA Replication. As DNA replication begins, DNA Helicase, a large enzyme, separates the two strands of DNA so that they can act as templates for replication. Single-strand binding proteins bind to each strand to stabilize and prevent them from reforming the double helix. Primase, an RNA polymerase, binds to the single stranded DNA and synthesizes a short RNA primer in the 5’ to 3’ direction that is antiparallel to the parental strand. This RNA primer allows for DNA polymerase to begin replicating the DNA. Topoisomerase binds to the double helix upstream of the replication fork to prevent additional coiling by making small cuts in one of the DNA strands. Credit: Rao, A., Ryan, K. Fletcher, S. and Tag, A. Department of Biology, Texas A&M University.
Question: You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
The replication fork moves at the rate of 1000 nucleotides per second. Topoisomerase prevents the over-winding of the DNA double helix ahead of the replication fork as the DNA is opening up; it does so by causing temporary nicks in the DNA helix and then resealing it. Because DNA polymerase can only extend in the 5' to 3' direction, and because the DNA double helix is antiparallel, there is a slight problem at the replication fork. The two template DNA strands have opposing orientations: one strand is in the 5' to 3' direction and the other is oriented in the 3' to 5' direction. Only one new DNA strand, the one that is complementary to the 3' to 5' parental DNA strand, can be synthesized continuously towards the replication fork. This continuously synthesized strand is known as the leading strand. The other strand, complementary to the 5' to 3' parental DNA, is extended away from the replication fork, in small fragments known as Okazaki fragments, each requiring a primer to start the synthesis. New primer segments are laid down in the direction of the replication fork, but each pointing away from it. (Okazaki fragments are named after the Japanese scientist who first discovered them. The strand with the Okazaki fragments is known as the lagging strand.)
The leading strand can be extended from a single primer, whereas the lagging strand needs a new primer for each of the short Okazaki fragments. The overall direction of the lagging strand will be 3' to 5', and that of the leading strand 5' to 3'. A protein called the sliding clamp holds the DNA polymerase in place as it continues to add nucleotides. The sliding clamp is a ring-shaped protein that binds to the DNA and holds the polymerase in place. As synthesis proceeds, the RNA primers are replaced by DNA. The primers are removed by the exonuclease activity of DNA pol I, which uses DNA behind the RNA as its own primer and fills in the gaps left by removal of the RNA nucleotides by the addition of DNA nucleotides. The nicks that remain between the newly synthesized DNA (that replaced the RNA primer) and the previously synthesized DNA are sealed by the enzyme DNA ligase, which catalyzes the formation of phosphodiester linkages between the 3'-OH end of one nucleotide and the 5' phosphate end of the other fragment.
Once the chromosome has been completely replicated, the two DNA copies move into two different cells during cell division.
The process of DNA replication can be summarized as follows:
1. DNA unwinds at the origin of replication.
2. Helicase opens up the DNA-forming replication forks; these are extended bidirectionally.
3. Single-strand binding proteins coat the DNA around the replication fork to prevent rewinding of the DNA.
4. Topoisomerase binds at the region ahead of the replication fork to prevent supercoiling.
5. Primase synthesizes RNA primers complementary to the DNA strand.
6. DNA polymerase III starts adding nucleotides to the 3'-OH end of the primer.
7. Elongation of both the lagging and the leading strand continues.
8. RNA primers are removed by exonuclease activity.
9. Gaps are filled by DNA pol I by adding dNTPs.
10. The gap between the two DNA fragments is sealed by DNA ligase, which helps in the formation of phosphodiester bonds.
Table 14.1 summarizes the enzymes involved in prokaryotic DNA replication and the functions of each.
Prokaryotic DNA Replication: Enzymes and Their Function
Enzyme/proteinSpecific Function
DNA pol IRemoves RNA primer and replaces it with newly synthesized DNA
DNA pol IIIMain enzyme that adds nucleotides in the 5'-3' direction
HelicaseOpens the DNA helix by breaking hydrogen bonds between the nitrogenous bases
LigaseSeals the gaps between the Okazaki fragments to create one continuous DNA strand
PrimaseSynthesizes RNA primers needed to start replication
Sliding ClampHelps to hold the DNA polymerase in place when nucleotides are being added
TopoisomeraseHelps relieve the strain on DNA when unwinding by causing breaks, and then resealing the DNA
Single-strand binding proteins (SSB)Binds to single-stranded DNA to prevent DNA from rewinding back.
Table 14.1
Link to Learning
Link to Learning
Review the full process of DNA replication here.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.04%3A_DNA_Structure_and_Function/3.4.05%3A_DNA_Replication_in_Prokaryotes.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Discuss the similarities and differences between DNA replication in eukaryotes and prokaryotes
• State the role of telomerase in DNA replication
Eukaryotic genomes are much more complex and larger in size than prokaryotic genomes. Eukaryotes also have a number of different linear chromosomes. The human genome has 3 billion base pairs per haploid set of chromosomes, and 6 billion base pairs are replicated during the S phase of the cell cycle. There are multiple origins of replication on each eukaryotic chromosome; humans can have up to 100,000 origins of replication across the genome. The rate of replication is approximately 100 nucleotides per second, much slower than prokaryotic replication. In yeast, which is a eukaryote, special sequences known as autonomously replicating sequences (ARS) are found on the chromosomes. These are equivalent to the origin of replication in E. coli.
The number of DNA polymerases in eukaryotes is much more than in prokaryotes: 14 are known, of which five are known to have major roles during replication and have been well studied. They are known as pol α, pol β, pol γ, pol δ, and pol ε.
The essential steps of replication are the same as in prokaryotes. Before replication can start, the DNA has to be made available as a template. Eukaryotic DNA is bound to basic proteins known as histones to form structures called nucleosomes. Histones must be removed and then replaced during the replication process, which helps to account for the lower replication rate in eukaryotes. The chromatin (the complex between DNA and proteins) may undergo some chemical modifications, so that the DNA may be able to slide off the proteins or be accessible to the enzymes of the DNA replication machinery. At the origin of replication, a pre-replication complex is made with other initiator proteins. Helicase and other proteins are then recruited to start the replication process (Table 14.2).
Difference between Prokaryotic and Eukaryotic Replication
PropertyProkaryotesEukaryotes
Origin of replicationSingleMultiple
Rate of replication1000 nucleotides/s50 to 100 nucleotides/s
DNA polymerase types514
TelomeraseNot presentPresent
RNA primer removalDNA pol IRNase H
Strand elongationDNA pol IIIPol α, pol δ, pol ε
Sliding clampSliding clampPCNA
Table 14.2
A helicase using the energy from ATP hydrolysis opens up the DNA helix. Replication forks are formed at each replication origin as the DNA unwinds. The opening of the double helix causes over-winding, or supercoiling, in the DNA ahead of the replication fork. These are resolved with the action of topoisomerases. Primers are formed by the enzyme primase, and using the primer, DNA pol can start synthesis. Three major DNA polymerases are then involved: α, δ and ε. DNA pol α adds a short (20 to 30 nucleotides) DNA fragment to the RNA primer on both strands, and then hands off to a second polymerase. While the leading strand is continuously synthesized by the enzyme pol ε, the lagging strand is synthesized by pol δ. A sliding clamp protein known as PCNA (proliferating cell nuclear antigen) holds the DNA pol in place so that it does not slide off the DNA. As pol δ runs into the primer RNA on the lagging strand, it displaces it from the DNA template. The displaced primer RNA is then removed by RNase H (AKA flap endonuclease) and replaced with DNA nucleotides. The Okazaki fragments in the lagging strand are joined after the replacement of the RNA primers with DNA. The gaps that remain are sealed by DNA ligase, which forms the phosphodiester bond.
Telomere replication
Unlike prokaryotic chromosomes, eukaryotic chromosomes are linear. As you’ve learned, the enzyme DNA pol can add nucleotides only in the 5' to 3' direction. In the leading strand, synthesis continues until the end of the chromosome is reached. On the lagging strand, DNA is synthesized in short stretches, each of which is initiated by a separate primer. When the replication fork reaches the end of the linear chromosome, there is no way to replace the primer on the 5’ end of the lagging strand. The DNA at the ends of the chromosome thus remains unpaired, and over time these ends, called telomeres, may get progressively shorter as cells continue to divide.
Telomeres comprise repetitive sequences that code for no particular gene. In humans, a six-base-pair sequence, TTAGGG, is repeated 100 to 1000 times in the telomere regions. In a way, these telomeres protect the genes from getting deleted as cells continue to divide. The telomeres are added to the ends of chromosomes by a separate enzyme, telomerase (Figure 14.16), whose discovery helped in the understanding of how these repetitive chromosome ends are maintained. The telomerase enzyme contains a catalytic part and a built-in RNA template. It attaches to the end of the chromosome, and DNA nucleotides complementary to the RNA template are added on the 3' end of the DNA strand. Once the 3' end of the lagging strand template is sufficiently elongated, DNA polymerase can add the nucleotides complementary to the ends of the chromosomes. Thus, the ends of the chromosomes are replicated.
Figure 14.15 The ends of linear chromosomes are maintained by the action of the telomerase enzyme. Credit: Rao, A. and Fletcher, S. Department of Biology, Texas A&M University.
Telomerase is typically active in germ cells and adult stem cells. It is not active in adult somatic cells. For their discovery of telomerase and its action, Elizabeth Blackburn, Carol W. Greider, and Jack W. Szostak (Figure 14.16) received the Nobel Prize for Medicine and Physiology in 2009. Later research using HeLa cells (obtained from Henrietta Lacks) confirmed that telomerase is present in human cells. And in 2001, researchers including Diane L. Wright found that telomerase is necessary for cells in human embryos to rapidly proliferate.
Figure 14.16 Elizabeth Blackburn, 2009 Nobel Laureate, is one of the scientists who discovered how telomerase works. (credit: US Embassy Sweden)
Telomerase and Aging
Cells that undergo cell division continue to have their telomeres shortened because most somatic cells do not make telomerase. This essentially means that telomere shortening is associated with aging. With the advent of modern medicine, preventative health care, and healthier lifestyles, the human life span has increased, and there is an increasing demand for people to look younger and have a better quality of life as they grow older.
In 2010, scientists found that telomerase can reverse some age-related conditions in mice. This may have potential in regenerative medicine.2 Telomerase-deficient mice were used in these studies; these mice have tissue atrophy, stem cell depletion, organ system failure, and impaired tissue injury responses. Telomerase reactivation in these mice caused extension of telomeres, reduced DNA damage, reversed neurodegeneration, and improved the function of the testes, spleen, and intestines. Thus, telomere reactivation may have potential for treating age-related diseases in humans.
Cancer is characterized by uncontrolled cell division of abnormal cells. The cells accumulate mutations, proliferate uncontrollably, and can migrate to different parts of the body through a process called metastasis. Scientists have observed that cancerous cells have considerably shortened telomeres and that telomerase is active in these cells. Interestingly, only after the telomeres were shortened in the cancer cells did the telomerase become active. If the action of telomerase in these cells can be inhibited by drugs during cancer therapy, then the cancerous cells could potentially be stopped from further division.
Footnotes
• 2Jaskelioff et al., “Telomerase reactivation reverses tissue degeneration in aged telomerase-deficient mice,” Nature 469 (2011): 102-7.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.04%3A_DNA_Structure_and_Function/3.4.06%3A_DNA_Replication_in_Eukaryotes.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Discuss the different types of mutations in DNA
• Explain DNA repair mechanisms
DNA replication is a highly accurate process, but mistakes can occasionally occur, such as a DNA polymerase inserting a wrong base. Uncorrected mistakes may sometimes lead to serious consequences, such as cancer. Repair mechanisms correct the mistakes. In rare cases, mistakes are not corrected, leading to mutations; in other cases, repair enzymes are themselves mutated or defective.
Most of the mistakes during DNA replication are promptly corrected by the proofreading ability of DNA polymerase itself. (Figure 14.17). In proofreading, the DNA pol reads the newly added base before adding the next one, so a correction can be made. The polymerase checks whether the newly added base has paired correctly with the base in the template strand. If it is the right base, the next nucleotide is added. If an incorrect base has been added, the enzyme makes a cut at the phosphodiester bond and releases the wrong nucleotide. This is performed by the 3' exonuclease action of DNA pol. Once the incorrect nucleotide has been removed, it can be replaced by the correct one.
Figure 14.17 Proofreading by DNA polymerase corrects errors during replication.
Some errors are not corrected during replication, but are instead corrected after replication is completed; this type of repair is known as mismatch repair (Figure 14.18). Specific repair enzymes recognize the mispaired nucleotide and excise part of the strand that contains it; the excised region is then resynthesized. If the mismatch remains uncorrected, it may lead to more permanent damage when the mismatched DNA is replicated. How do mismatch repair enzymes recognize which of the two bases is the incorrect one? In E. coli, after replication, the nitrogenous base adenine acquires a methyl group; the parental DNA strand will have methyl groups, whereas the newly synthesized strand lacks them. Thus, DNA polymerase is able to remove the wrongly incorporated bases from the newly synthesized, non-methylated strand. In eukaryotes, the mechanism is not very well understood, but it is believed to involve recognition of unsealed nicks in the new strand, as well as a short-term continuing association of some of the replication proteins with the new daughter strand after replication has completed.
Figure 14.18 In mismatch repair, the incorrectly added base is detected after replication. The mismatch repair proteins detect this base and remove it from the newly synthesized strand by nuclease action. The gap is now filled with the correctly paired base.
Another type of repair mechanism, nucleotide excision repair, is similar to mismatch repair, except that it is used to remove damaged bases rather than mismatched ones. The repair enzymes replace abnormal bases by making a cut on both the 3' and 5' ends of the damaged base (Figure 14.19). The segment of DNA is removed and replaced with the correctly paired nucleotides by the action of DNA pol. Once the bases are filled in, the remaining gap is sealed with a phosphodiester linkage catalyzed by DNA ligase. This repair mechanism is often employed when UV exposure causes the formation of pyrimidine dimers.
Figure 14.19 Nucleotide excision repairs thymine dimers. When exposed to UV light, thymines lying adjacent to each other can form thymine dimers. In normal cells, they are excised and replaced. Credit: Rao, A., Fletcher, S. and Tag, A. Department of Biology, Texas A&M University.
A well-studied example of mistakes not being corrected is seen in people suffering from xeroderma pigmentosa (Figure 14.20). Affected individuals have skin that is highly sensitive to UV rays from the sun. When individuals are exposed to UV light, pyrimidine dimers, especially those of thymine, are formed; people with xeroderma pigmentosa are not able to repair the damage. These are not repaired because of a defect in the nucleotide excision repair enzymes, whereas in normal individuals, the thymine dimers are excised and the defect is corrected. The thymine dimers distort the structure of the DNA double helix, and this may cause problems during DNA replication. People with xeroderma pigmentosa may have a higher risk of contracting skin cancer than those who don't have the condition.
Figure 14.20 Xeroderma pigmentosa is a condition in which thymine dimerization from exposure to UV light is not repaired. Exposure to sunlight results in skin lesions. (credit: James Halpern et al.)
Errors during DNA replication are not the only reason why mutations arise in DNA. Mutations, variations in the nucleotide sequence of a genome, can also occur because of damage to DNA. Such mutations may be of two types: induced or spontaneous. Induced mutations are those that result from an exposure to chemicals, UV rays, x-rays, or some other environmental agent. For example, Charlotte Auerbach and J.M Robson discovered the mutation-inducing effects of mustard gas. Spontaneous mutations occur without any exposure to any environmental agent; they are a result of natural reactions taking place within the body.
Mutations may have a wide range of effects. Point mutations are those mutations that affect a single base pair. The most common nucleotide mutations are substitutions, in which one base is replaced by another. These substitutions can be of two types, either transitions or transversions. Transition substitution refers to a purine or pyrimidine being replaced by a base of the same kind; for example, a purine such as adenine may be replaced by the purine guanine. Transversion substitution refers to a purine being replaced by a pyrimidine, or vice versa; for example, cytosine, a pyrimidine, is replaced by adenine, a purine. Some point mutations are not detectable in the final product; these are known as silent mutations. Silent mutations are usually due to a substitution in the third base of a codon, which often represents the same amino acid as the original codon. Other point mutations can result in the replacement of one amino acid by another, which may alter the function of the protein. Point mutations that generate a stop codon can terminate a protein early.
Some mutations can result in an increased number of copies of the same codon. These are called trinucleotide repeat expansions and result in repeated regions of the same amino acid. Mutations can also be the result of the addition of a base, known as an insertion, or the removal of a base, also known as deletion. If an insertion or deletion results in the alteration of the translational reading frame (a frameshift mutation), the resultant protein is usually nonfunctional. Sometimes a piece of DNA from one chromosome may get translocated to another chromosome or to another region of the same chromosome; this is also known as translocation. These mutation types are shown in Figure 14.21.
Visual Connection
Visual Connection
Figure 14.21 Mutations can lead to changes in the protein sequence encoded by the DNA.
A frameshift mutation that results in the insertion of three nucleotides is often less deleterious than a mutation that results in the insertion of one nucleotide. Why?
Mutations in repair genes have been known to cause cancer. Many mutated repair genes have been implicated in certain forms of pancreatic cancer, colon cancer, and colorectal cancer. Mutations can affect either somatic cells or germ cells. If many mutations accumulate in a somatic cell, they may lead to problems such as the uncontrolled cell division observed in cancer. If a mutation takes place in germ cells, the mutation will be passed on to the next generation, as in the case of hemophilia and xeroderma pigmentosa.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.04%3A_DNA_Structure_and_Function/3.4.07%3A_DNA_Repair.txt
|
electrophoresis
technique used to separate DNA fragments according to size
helicase
during replication, this enzyme helps to open up the DNA helix by breaking the hydrogen bonds
induced mutation
mutation that results from exposure to chemicals or environmental agents
lagging strand
during replication, the strand that is replicated in short fragments and away from the replication fork
leading strand
strand that is synthesized continuously in the 5'-3' direction, which is synthesized in the direction of the replication fork
ligase
enzyme that catalyzes the formation of a phosphodiester linkage between the 3' OH and 5' phosphate ends of the DNA
mismatch repair
type of repair mechanism in which mismatched bases are removed after replication
mutation
variation in the nucleotide sequence of a genome
nucleotide excision repair
type of DNA repair mechanism in which the wrong base, along with a few nucleotides upstream or downstream, are removed
Okazaki fragment
DNA fragment that is synthesized in short stretches on the lagging strand
point mutation
mutation that affects a single base
primase
enzyme that synthesizes the RNA primer; the primer is needed for DNA pol to start synthesis of a new DNA strand
primer
short stretch of nucleotides that is required to initiate replication; in the case of replication, the primer has RNA nucleotides
proofreading
function of DNA pol in which it reads the newly added base before adding the next one
replication fork
Y-shaped structure formed during initiation of replication
silent mutation
mutation that is not expressed
single-strand binding protein
during replication, protein that binds to the single-stranded DNA; this helps in keeping the two strands of DNA apart so that they may serve as templates
sliding clamp
ring-shaped protein that holds the DNA pol on the DNA strand
spontaneous mutation
mutation that takes place in the cells as a result of chemical reactions taking place naturally without exposure to any external agent
telomerase
enzyme that contains a catalytic part and an inbuilt RNA template; it functions to maintain telomeres at chromosome ends
telomere
DNA at the end of linear chromosomes
topoisomerase
enzyme that prevents overwinding of DNA when DNA replication is taking place
transformation
process in which external DNA is taken up by a cell
transition substitution
when a purine is replaced with a purine or a pyrimidine is replaced with another pyrimidine
transversion substitution
when a purine is replaced by a pyrimidine or a pyrimidine is replaced by a purine
3.4.09: Chapter Summary
14.1 Historical Basis of Modern Understanding
DNA was first isolated from white blood cells by Friedrich Miescher, who called it nuclein because it was isolated from nuclei. Frederick Griffith's experiments with strains of Streptococcus pneumoniae provided the first hint that DNA may be the transforming principle. Avery, MacLeod, and McCarty showed that DNA is required for the transformation of bacteria. Later experiments by Hershey and Chase using bacteriophage T2 proved that DNA is the genetic material. Chargaff found that the ratio of A = T and C = G, and that the percentage content of A, T, G, and C is different for different species.
14.2 DNA Structure and Sequencing
The currently accepted model of the double-helix structure of DNA was proposed by Watson and Crick. Some of the salient features are that the two strands that make up the double helix have complementary base sequences and anti-parallel orientations. Alternating deoxyribose sugars and phosphates form the backbone of the structure, and the nitrogenous bases are stacked like rungs inside. The diameter of the double helix, 2 nm, is uniform throughout. A purine always pairs with a pyrimidine; A pairs with T, and G pairs with C. One turn of the helix has 10 base pairs. Prokaryotes are much simpler than eukaryotes in many of their features. Most prokaryotes contain a single, circular chromosome. In general, eukaryotic chromosomes contain a linear DNA molecule packaged into nucleosomes, and have two distinct regions that can be distinguished by staining, reflecting different states of packaging and compaction.
14.3 Basics of DNA Replication
During cell division, each daughter cell receives a copy of each molecule of DNA by a process known as DNA replication. The single chromosome of a prokaryote or each chromosome of a eukaryote consists of a single continuous double helix. The model for DNA replication suggests that the two strands of the double helix separate during replication, and each strand serves as a template from which the new complementary strand is copied. In the conservative model of replication, the parental DNA is conserved, and the daughter DNA is newly synthesized. The semi-conservative model suggests that each of the two parental DNA strands acts as template for new DNA to be synthesized; after replication, each double-stranded DNA retains the parental or “old” strand and one “new” strand. The dispersive model suggested that the two copies of the DNA would have segments of parental DNA and newly synthesized DNA. The Meselson and Stahl experiment supported the semi-conservative model of replication, in which an entire replicated chromosome consists of one parental strand and one newly synthesized strand of DNA.
14.4 DNA Replication in Prokaryotes
Replication in prokaryotes starts from a sequence found on the chromosome called the origin of replication—the point at which the DNA opens up. Helicase opens up the DNA double helix, resulting in the formation of the replication fork. Single-strand binding proteins bind to the single-stranded DNA near the replication fork to keep the fork open. Primase synthesizes an RNA primer to initiate synthesis by DNA polymerase, which can add nucleotides only to the 3' end of a previously synthesized primer strand. Both new DNA strands grow according to their respective 5'-3' directions. One strand is synthesized continuously in the direction of the replication fork; this is called the leading strand. The other strand is synthesized in a direction away from the replication fork, in short stretches of DNA known as Okazaki fragments. This strand is known as the lagging strand. Once replication is completed, the RNA primers are replaced by DNA nucleotides and the DNA is sealed with DNA ligase, which creates phosphodiester bonds between the 3'-OH of one end and the 5' phosphate of the other strand.
14.5 DNA Replication in Eukaryotes
Replication in eukaryotes starts at multiple origins of replication. The mechanism is quite similar to that in prokaryotes. A primer is required to initiate synthesis, which is then extended by DNA polymerase as it adds nucleotides one by one to the growing chain. The leading strand is synthesized continuously, whereas the lagging strand is synthesized in short stretches called Okazaki fragments. The RNA primers are replaced with DNA nucleotides; the DNA Okazaki fragments are linked into one continuous strand by DNA ligase. The ends of the chromosomes pose a problem as the primer RNA at the 5’ ends of the DNA cannot be replaced with DNA, and the chromosome is progressively shortened. Telomerase, an enzyme with an inbuilt RNA template, extends the ends by copying the RNA template and extending one strand of the chromosome. DNA polymerase can then fill in the complementary DNA strand using the regular replication enzymes. In this way, the ends of the chromosomes are protected.
14.6 DNA Repair
DNA polymerase can make mistakes while adding nucleotides. It edits the DNA by proofreading every newly added base. Incorrect bases are removed and replaced by the correct base before proceeding with elongation. Most mistakes are corrected during replication, although when this does not happen, the mismatch repair mechanism is employed. Mismatch repair enzymes recognize the wrongly incorporated base and excise it from the DNA, replacing it with the correct base. In yet another type of repair, nucleotide excision repair, a damaged base is removed along with a few bases on the 5' and 3' end, and these are replaced by copying the template with the help of DNA polymerase. The ends of the newly synthesized fragment are attached to the rest of the DNA using DNA ligase, which creates a phosphodiester bond.
Most mistakes are corrected, and if they are not, they may result in a mutation, defined as a permanent change in the DNA sequence. Mutations can be of many types, such as substitution, deletion, insertion, and trinucleotide repeat expansions. Mutations in repair genes may lead to serious consequences such as cancer. Mutations can be induced or may occur spontaneously.
3.4.10: Visual Connection Questions
1.
Figure 14.10 In eukaryotic cells, DNA and RNA synthesis occur in a separate compartment from protein synthesis. In prokaryotic cells, both processes occur together. What advantages might there be to separating the processes? What advantages might there be to having them occur together?
2.
Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
3.
Figure 14.21 A frameshift mutation that results in the insertion of three nucleotides is often less deleterious than a mutation that results in the insertion of one nucleotide. Why?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.04%3A_DNA_Structure_and_Function/3.4.08%3A_Key_Terms.txt
|
4.
If DNA of a particular species was analyzed and it was found that it contains 27 percent A, what would be the percentage of C?
1. 27 percent
2. 30 percent
3. 23 percent
4. 54 percent
5.
The experiments by Hershey and Chase helped confirm that DNA was the hereditary material on the basis of the finding that:
1. radioactive phage were found in the pellet
2. radioactive cells were found in the supernatant
3. radioactive sulfur was found inside the cell
4. radioactive phosphorus was found in the cell
6.
Bacterial transformation is a major concern in many medical settings. Why might health care providers be concerned?
1. Pathogenic bacteria could introduce disease-causing genes in non-pathogenic bacteria.
2. Antibiotic resistance genes could be introduced to new bacteria to create “superbugs.”
3. Bacteriophages could spread DNA encoding toxins to new bacteria.
4. All of the above.
7.
DNA double helix does not have which of the following?
1. antiparallel configuration
2. complementary base pairing
3. major and minor grooves
4. uracil
8.
In eukaryotes, what is the DNA wrapped around?
1. single-stranded binding proteins
2. sliding clamp
3. polymerase
4. histones
9.
Meselson and Stahl's experiments proved that DNA replicates by which mode?
1. conservative
2. semi-conservative
3. dispersive
4. none of the above
10.
If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following sequence:
1. 3'-AATGCTAC-5'
2. 3'-CATCGTAA-5'
3. 3'-TTACGATG-5'
4. 3'-GTAGCATT-5'
11.
How did Meselson and Stahl support Watson and Crick’s double-helix model?
1. They demonstrated that each strand serves as a template for synthesizing a new strand of DNA.
2. They showed that the DNA strands break and recombine without losing genetic material.
3. They proved that DNA maintains a double-helix structure while undergoing semi-conservative replication.
4. They demonstrated that conservative replication maintains the complementary base pairing of each DNA helix.
12.
Which of the following components is not involved during the formation of the replication fork?
1. single-strand binding proteins
2. helicase
3. origin of replication
4. ligase
13.
Which of the following does the enzyme primase synthesize?
1. DNA primer
2. RNA primer
3. Okazaki fragments
4. phosphodiester linkage
14.
In which direction does DNA replication take place?
1. 5'-3'
2. 3'-5'
3. 5'
4. 3'
15.
A scientist randomly mutates the DNA of a bacterium. She then sequences the bacterium’s daughter cells, and finds that the daughters have many errors in their replicated DNA. The parent bacterium likely acquired a mutation in which enzyme?
1. DNA ligase
2. DNA pol II
3. Primase
4. DNA pol I
16.
The ends of the linear chromosomes are maintained by
1. helicase
2. primase
3. DNA pol
4. telomerase
17.
Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication?
1. Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase.
2. Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome.
3. DNA replication always occurs in the nucleus.
4. Eukaryotic DNA replication involves more polymerases than prokaryotic replication.
18.
During proofreading, which of the following enzymes reads the DNA?
1. primase
2. topoisomerase
3. DNA pol
4. helicase
19.
The initial mechanism for repairing nucleotide errors in DNA is ________.
1. mismatch repair
2. DNA polymerase proofreading
3. nucleotide excision repair
4. thymine dimers
20.
A scientist creates fruit fly larvae with a mutation that eliminates the exonuclease function of DNA pol. Which prediction about the mutational load in the adult fruit flies is most likely to be correct?
1. The adults with the DNA pol mutation will have significantly more mutations than average.
2. The adults with the DNA pol mutation will have slightly more mutations than average.
3. The adults with the DNA pol mutation will have the same number of mutations as average.
4. The adults with the DNA pol mutation will have fewer mutations than average.
3.4.12: Critical Thinking Questions
21.
Explain Griffith's transformation experiments. What did he conclude from them?
22.
Why were radioactive sulfur and phosphorous used to label bacteriophage in Hershey and Chase's experiments?
23.
When Chargaff was performing his experiments, the tetranucleotide hypothesis, which stated that DNA was composed of GACT nucleotide repeats, was the most widely accepted view of DNA’s composition. How did Chargaff disprove this hypothesis?
24.
Provide a brief summary of the Sanger sequencing method.
25.
Describe the structure and complementary base pairing of DNA.
26.
Prokaryotes have a single circular chromosome while eukaryotes have linear chromosomes. Describe one advantage and one disadvantage to the eukaryotic genome packaging compared to the prokaryotes.
27.
How did the scientific community learn that DNA replication takes place in a semi-conservative fashion?
28.
Imagine the Meselson and Stahl experiments had supported conservative replication instead of semi-conservative replication. What results would you predict to observe after two rounds of replication? Be specific regarding percent distributions of DNA incorporating 15N and 14N in the gradient.
29.
DNA replication is bidirectional and discontinuous; explain your understanding of those concepts.
30.
What are Okazaki fragments and how they are formed?
31.
If the rate of replication in a particular prokaryote is 900 nucleotides per second, how long would it take 1.2 million base pair genomes to make two copies?
32.
Explain the events taking place at the replication fork. If the gene for helicase is mutated, what part of replication will be affected?
33.
What is the role of a primer in DNA replication? What would happen if you forgot to add a primer in a tube containing the reaction mix for a DNA sequencing reaction?
34.
Quinolone antibiotics treat bacterial infections by blocking the activity of topoisomerase. Why does this treatment work? Explain what occurs at the molecular level.
35.
How do the linear chromosomes in eukaryotes ensure that its ends are replicated completely?
36.
What is the consequence of mutation of a mismatch repair enzyme? How will this affect the function of a gene?
37.
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.04%3A_DNA_Structure_and_Function/3.4.11%3A_Review_Questions.txt
|
Since the rediscovery of Mendel’s work in 1900, the definition of the gene has progressed from an abstract unit of heredity to a tangible molecular entity capable of replication, expression, and mutation. Genes are composed of DNA and are linearly arranged on chromosomes. Genes specify the sequences of amino acids, which are the building blocks of proteins. In turn, proteins are responsible for orchestrating nearly every function of the cell. Both genes and the proteins they encode are absolutely essential to life as we know it.
• 3.5.1: Introduction
Since the rediscovery of Mendel’s work in 1900, the definition of the gene has progressed from an abstract unit of heredity to a tangible molecular entity capable of replication, expression, and mutation. Genes are composed of DNA and are linearly arranged on chromosomes. Genes specify the sequences of amino acids, which are the building blocks of proteins. In turn, proteins are responsible for orchestrating nearly every function of the cell.
• 3.5.2: The Genetic Code
The cellular process of transcription generates messenger RNA (mRNA), a mobile molecular copy of one or more genes with an alphabet of A, C, G, and uracil (U). Translation of the mRNA template converts nucleotide-based genetic information into a protein product. Protein sequences consist of 20 commonly occurring amino acids; therefore, it can be said that the protein alphabet consists of 20 letters. Each amino acid is defined by a three-nucleotide sequence called the triplet codon.
• 3.5.3: Prokaryotic Transcription
The prokaryotes, which include bacteria and archaea, are mostly single-celled organisms that, by definition, lack membrane-bound nuclei and other organelles. A bacterial chromosome is a covalently closed circle that, unlike eukaryotic chromosomes, is not organized around histone proteins. The central region of the cell in which prokaryotic DNA resides is called the nucleoid. Prokaryotes often have abundant plasmids that are shorter circular DNA molecules that may only contain one or a few genes.
• 3.5.4: Eukaryotic Transcription
Prokaryotes and eukaryotes perform fundamentally the same process of transcription, with a few key differences. The most important difference between prokaryotes and eukaryotes is the latter’s membrane-bound nucleus and organelles. With the genes bound in a nucleus, the eukaryotic cell must be able to transport its mRNA to the cytoplasm and must protect its mRNA from degrading before it is translated.
• 3.5.5: RNA Processing in Eukaryotes
After transcription, eukaryotic pre-mRNAs must undergo several processing steps before they can be translated. Eukaryotic (and prokaryotic) tRNAs and rRNAs also undergo processing before they can function as components in the protein synthesis machinery.
• 3.5.6: Ribosomes and Protein Synthesis
The synthesis of proteins consumes more of a cell’s energy than any other metabolic process. In turn, proteins account for more mass than any other component of living organisms (other than water), and proteins perform virtually every function of a cell. The process of translation, or protein synthesis, involves the decoding of an mRNA message into a polypeptide product. Amino acids are covalently bonded by interlinking peptide bonds in lengths ranging from ~50 amino acid residues to >1,000.
• 3.5.7: Key Terms
• 3.5.8: Chapter Summary
• 3.5.9: Visual Connection Questions
• 3.5.10: Review Questions
• 3.5.11: Critical Thinking Questions
Thumbnail: RNA Polymerase producing mRNA from a double-stranded DNA template. (CC BY-SA 3.0; Thomas Splettstoesser via Wikimedia Commons).
3.05: Genes and Proteins
Figure 15.1 Genes, which are carried on (a) chromosomes, are linearly organized instructions for making the RNA and protein molecules that are necessary for all of the processes of life. The (b) interleukin-2 protein and (c) alpha-2u-globulin protein are just two examples of the array of different molecular structures that are encoded by genes. (credit “chromosome: National Human Genome Research Institute; credit “interleukin-2”: Ramin Herati/Created from PDB 1M47 and rendered with Pymol; credit “alpha-2u-globulin”: Darren Logan/rendered with AISMIG)
Since the rediscovery of Mendel’s work in 1900, the definition of the gene has progressed from an abstract unit of heredity to a tangible molecular entity capable of replication, expression, and mutation (Figure 15.1). Genes are composed of DNA and are linearly arranged on chromosomes. Genes specify the sequences of amino acids, which are the building blocks of proteins. In turn, proteins are responsible for orchestrating nearly every function of the cell. Both genes and the proteins they encode are absolutely essential to life as we know it.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.05%3A_Genes_and_Proteins/3.5.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Explain the “central dogma” of DNA-protein synthesis
• Describe the genetic code and how the nucleotide sequence prescribes the amino acid and the protein sequence
The cellular process of transcription generates messenger RNA (mRNA), a mobile molecular copy of one or more genes with an alphabet of A, C, G, and uracil (U). Translation of the mRNA template on ribosomes converts nucleotide-based genetic information into a protein product. That is the central dogma of DNA-protein synthesis. Protein sequences consist of 20 commonly occurring amino acids; therefore, it can be said that the protein alphabet consists of 20 “letters” (Figure 15.2). Different amino acids have different chemistries (such as acidic versus basic, or polar and nonpolar) and different structural constraints. Variation in amino acid sequence is responsible for the enormous variation in protein structure and function.
Figure 15.2 Structures of the 20 amino acids found in proteins are shown. Each amino acid is composed of an amino group ($N H 3 + N H 3 +$), a carboxyl group (COO-), and a side chain (blue). The side chain may be nonpolar, polar, or charged, as well as large or small. It is the variety of amino acid side chains that gives rise to the incredible variation of protein structure and function.
The Central Dogma: DNA Encodes RNA; RNA Encodes Protein
The flow of genetic information in cells from DNA to mRNA to protein is described by the central dogma (Figure 15.3), which states that genes specify the sequence of mRNAs, which in turn specify the sequence of amino acids making up all proteins. The decoding of one molecule to another is performed by specific proteins and RNAs. Because the information stored in DNA is so central to cellular function, it makes intuitive sense that the cell would make mRNA copies of this information for protein synthesis, while keeping the DNA itself intact and protected. The copying of DNA to RNA is relatively straightforward, with one nucleotide being added to the mRNA strand for every nucleotide read in the DNA strand. The translation to protein is a bit more complex because three mRNA nucleotides correspond to one amino acid in the polypeptide sequence. However, the translation to protein is still systematic and colinear, such that nucleotides 1 to 3 correspond to amino acid 1, nucleotides 4 to 6 correspond to amino acid 2, and so on.
Figure 15.3 Instructions on DNA are transcribed onto messenger RNA. Ribosomes are able to read the genetic information inscribed on a strand of messenger RNA and use this information to string amino acids together into a protein.
The Genetic Code Is Degenerate and Universal
Each amino acid is defined by a three-nucleotide sequence called the triplet codon. Given the different numbers of “letters” in the mRNA and protein “alphabets,” scientists theorized that single amino acids must be represented by combinations of nucleotides. Nucleotide doublets would not be sufficient to specify every amino acid because there are only 16 possible two-nucleotide combinations (42). In contrast, there are 64 possible nucleotide triplets (43), which is far more than the number of amino acids. Scientists theorized that amino acids were encoded by nucleotide triplets and that the genetic code was “degenerate.” In other words, a given amino acid could be encoded by more than one nucleotide triplet. This was later confirmed experimentally: Francis Crick and Sydney Brenner used the chemical mutagen proflavin to insert one, two, or three nucleotides into the gene of a virus. When one or two nucleotides were inserted, the normal proteins were not produced. When three nucleotides were inserted, the protein was synthesized and functional. This demonstrated that the amino acids must be specified by groups of three nucleotides. These nucleotide triplets are called codons. The insertion of one or two nucleotides completely changed the triplet reading frame, thereby altering the message for every subsequent amino acid (Figure 15.5). Though insertion of three nucleotides caused an extra amino acid to be inserted during translation, the integrity of the rest of the protein was maintained.
Scientists painstakingly solved the genetic code by translating synthetic mRNAs in vitro and sequencing the proteins they specified (Figure 15.4).
Figure 15.4 This figure shows the genetic code for translating each nucleotide triplet in mRNA into an amino acid or a termination signal in a protein. (credit: modification of work by NIH)
In addition to codons that instruct the addition of a specific amino acid to a polypeptide chain, three of the 64 codons terminate protein synthesis and release the polypeptide from the translation machinery. These triplets are called nonsense codons, or stop codons. Another codon, AUG, also has a special function. In addition to specifying the amino acid methionine, it also serves as the start codon to initiate translation. The reading frame for translation is set by the AUG start codon near the 5' end of the mRNA. Following the start codon, the mRNA is read in groups of three until a stop codon is encountered.
The arrangement of the coding table reveals the structure of the code. There are sixteen "blocks" of codons, each specified by the first and second nucleotides of the codons within the block, e.g., the "AC*" block that corresponds to the amino acid threonine (Thr). Some blocks are divided into a pyrimidine half, in which the codon ends with U or C, and a purine half, in which the codon ends with A or G. Some amino acids get a whole block of four codons, like alanine (Ala), threonine (Thr) and proline (Pro). Some get the pyrimidine half of their block, like histidine (His) and asparagine (Asn). Others get the purine half of their block, like glutamate (Glu) and lysine (Lys). Note that some amino acids get a block and a half-block for a total of six codons.
The specification of a single amino acid by multiple similar codons is called "degeneracy." Degeneracy is believed to be a cellular mechanism to reduce the negative impact of random mutations. Codons that specify the same amino acid typically only differ by one nucleotide. In addition, amino acids with chemically similar side chains are encoded by similar codons. For example, aspartate (Asp) and glutamate (Glu), which occupy the GA* block, are both negatively charged. This nuance of the genetic code ensures that a single-nucleotide substitution mutation might specify the same amino acid but have no effect or specify a similar amino acid, preventing the protein from being rendered completely nonfunctional.
The genetic code is nearly universal. With a few minor exceptions, virtually all species use the same genetic code for protein synthesis. Conservation of codons means that a purified mRNA encoding the globin protein in horses could be transferred to a tulip cell, and the tulip would synthesize horse globin. That there is only one genetic code is powerful evidence that all of life on Earth shares a common origin, especially considering that there are about 1084 possible combinations of 20 amino acids and 64 triplet codons.
Link to Learning
Link to Learning
Transcribe a gene and translate it to protein using complementary pairing and the genetic code at this site.
Figure 15.5 The deletion of two nucleotides shifts the reading frame of an mRNA and changes the entire protein message, creating a nonfunctional protein or terminating protein synthesis altogether.
Scientific Method Connection
Scientific Method Connection
Which Has More DNA: A Kiwi or a Strawberry?
Figure 15.6 Do you think that a kiwi or a strawberry has more DNA per fruit? (credit “kiwi”: "Kelbv"/Flickr; credit: “strawberry”: Alisdair McDiarmid)
Question: Would a kiwi and strawberry that are approximately the same size (Figure 15.6) also have approximately the same amount of DNA?
Background: Genes are carried on chromosomes and are made of DNA. All mammals are diploid, meaning they have two copies of each chromosome. However, not all plants are diploid. The common strawberry is octoploid (8n) and the cultivated kiwi is hexaploid (6n). Research the total number of chromosomes in the cells of each of these fruits and think about how this might correspond to the amount of DNA in these fruits’ cell nuclei. What other factors might contribute to the total amount of DNA in a single fruit? Read about the technique of DNA isolation to understand how each step in the isolation protocol helps liberate and precipitate DNA.
Hypothesis: Hypothesize whether you would be able to detect a difference in DNA quantity from similarly sized strawberries and kiwis. Which fruit do you think would yield more DNA?
Test your hypothesis: Isolate the DNA from a strawberry and a kiwi that are similarly sized. Perform the experiment in at least triplicate for each fruit
1. Prepare a bottle of DNA extraction buffer from 900 mL water, 50 mL dish detergent, and two teaspoons of table salt. Mix by inversion (cap it and turn it upside down a few times).
2. Grind a strawberry and a kiwi by hand in a plastic bag, or using a mortar and pestle, or with a metal bowl and the end of a blunt instrument. Grind for at least two minutes per fruit.
3. Add 10 mL of the DNA extraction buffer to each fruit, and mix well for at least one minute.
4. Remove cellular debris by filtering each fruit mixture through cheesecloth or porous cloth and into a funnel placed in a test tube or an appropriate container.
5. Pour ice-cold ethanol or isopropanol (rubbing alcohol) into the test tube. You should observe white, precipitated DNA.
6. Gather the DNA from each fruit by winding it around separate glass rods.
Analyze your data: Did you notice an obvious difference in the amount of DNA produced by each fruit? Were your results reproducible?
Draw a conclusion: Given what you know about the number of chromosomes in each fruit, can you conclude that chromosome number necessarily correlates to DNA amount? Can you identify any drawbacks to this procedure? If you had access to a laboratory, how could you standardize your comparison and make it more quantitative?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.05%3A_Genes_and_Proteins/3.5.02%3A_The_Genetic_Code.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• List the different steps in prokaryotic transcription
• Discuss the role of promoters in prokaryotic transcription
• Describe how and when transcription is terminated
The prokaryotes, which include Bacteria and Archaea, are mostly single-celled organisms that, by definition, lack membrane-bound nuclei and other organelles. A bacterial chromosome is a closed circle that, unlike eukaryotic chromosomes, is not organized around histone proteins. The central region of the cell in which prokaryotic DNA resides is called the nucleoid region. In addition, prokaryotes often have abundant plasmids, which are shorter, circular DNA molecules that may only contain one or a few genes. Plasmids can be transferred independently of the bacterial chromosome during cell division and often carry traits such as those involved with antibiotic resistance.
Transcription in prokaryotes (and in eukaryotes) requires the DNA double helix to partially unwind in the region of mRNA synthesis. The region of unwinding is called a transcription bubble. Transcription always proceeds from the same DNA strand for each gene, which is called the template strand. The mRNA product is complementary to the template strand and is almost identical to the other DNA strand, called the nontemplate strand, or the coding strand. The only nucleotide difference is that in mRNA, all of the T nucleotides are replaced with U nucleotides (Figure 15.7). In an RNA double helix, A can bind U via two hydrogen bonds, just as in A–T pairing in a DNA double helix.
Figure 15.7 Messenger RNA is a copy of protein-coding information in the coding strand of DNA, with the substitution of U in the RNA for T in the coding sequence. However, new RNA nucleotides base pair with the nucleotides of the template strand. RNA is synthesized in its 5'-3' direction, using the enzyme RNA polymerase. As the template is read, the DNA unwinds ahead of the polymerase and then rewinds behind it.
The nucleotide pair in the DNA double helix that corresponds to the site from which the first 5' mRNA nucleotide is transcribed is called the +1 site, or the initiation site. Nucleotides preceding the initiation site are denoted with a “-” and are designated upstream nucleotides. Conversely, nucleotides following the initiation site are denoted with “+” numbering and are called downstream nucleotides.
Initiation of Transcription in Prokaryotes
Prokaryotes do not have membrane-enclosed nuclei. Therefore, the processes of transcription, translation, and mRNA degradation can all occur simultaneously. The intracellular level of a bacterial protein can quickly be amplified by multiple transcription and translation events that occur concurrently on the same DNA template. Prokaryotic genomes are very compact, and prokaryotic transcripts often cover more than one gene or cistron (a coding sequence for a single protein). Polycistronic mRNAs are then translated to produce more than one kind of protein.
Our discussion here will exemplify transcription by describing this process in Escherichia coli, a well-studied eubacterial species. Although some differences exist between transcription in E. coli and transcription in archaea, an understanding of E. coli transcription can be applied to virtually all bacterial species.
Prokaryotic RNA Polymerase
Prokaryotes use the same RNA polymerase to transcribe all of their genes. In E. coli, the polymerase is composed of five polypeptide subunits, two of which are identical. Four of these subunits, denoted α, α, β, and β', comprise the polymerase core enzyme. These subunits assemble every time a gene is transcribed, and they disassemble once transcription is complete. Each subunit has a unique role; the two α-subunits are necessary to assemble the polymerase on the DNA; the β-subunit binds to the ribonucleoside triphosphate that will become part of the nascent mRNA molecule; and the β' subunit binds the DNA template strand. The fifth subunit, σ, is involved only in transcription initiation. It confers transcriptional specificity such that the polymerase begins to synthesize mRNA from an appropriate initiation site. Without σ, the core enzyme would transcribe from random sites and would produce mRNA molecules that specified protein gibberish. The polymerase comprised of all five subunits is called the holoenzyme.
Prokaryotic Promoters
A promoter is a DNA sequence onto which the transcription machinery, including RNA polymerase, binds and initiates transcription. In most cases, promoters exist upstream of the genes they regulate. The specific sequence of a promoter is very important because it determines whether the corresponding gene is transcribed all the time, some of the time, or infrequently. Although promoters vary among prokaryotic genomes, a few elements are evolutionarily conserved in many species. At the -10 and -35 regions upstream of the initiation site, there are two promoter consensus sequences, or regions that are similar across all promoters and across various bacterial species (Figure 15.8). The -10 sequence, called the -10 region, has the consensus sequence TATAAT. The -35 sequence has the consensus sequence TTGACA. These consensus sequences are recognized and bound by σ. Once this interaction is made, the subunits of the core enzyme bind to the site. The A–T-rich -10 region facilitates unwinding of the DNA template, and several phosphodiester bonds are made. The transcription initiation phase ends with the production of abortive transcripts, which are polymers of approximately 10 nucleotides that are made and released.
Figure 15.8 The σ subunit of prokaryotic RNA polymerase recognizes consensus sequences found in the promoter region upstream of the transcription start site. The σ subunit dissociates from the polymerase after transcription has been initiated.
Link to Learning
Link to Learning
View this MolecularMovies animation to see the transcription process as it happens in the cell.
Elongation and Termination in Prokaryotes
The transcription elongation phase begins with the release of the σ subunit from the polymerase. The dissociation of σ allows the core enzyme to proceed along the DNA template, synthesizing mRNA in the 5' to 3' direction at a rate of approximately 40 nucleotides per second. As elongation proceeds, the DNA is continuously unwound ahead of the core enzyme and rewound behind it. The base pairing between DNA and RNA is not stable enough to maintain the stability of the mRNA synthesis components. Instead, the RNA polymerase acts as a stable linker between the DNA template and the nascent RNA strands to ensure that elongation is not interrupted prematurely.
Prokaryotic Termination Signals
Once a gene is transcribed, the prokaryotic polymerase needs to be instructed to dissociate from the DNA template and liberate the newly made mRNA. Depending on the gene being transcribed, there are two kinds of termination signals. One is protein-based and the other is RNA-based. Rho-dependent termination is controlled by the rho protein, which tracks along behind the polymerase on the growing mRNA chain. Near the end of the gene, the polymerase encounters a run of G nucleotides on the DNA template and it stalls. As a result, the rho protein collides with the polymerase. The interaction with rho releases the mRNA from the transcription bubble.
Rho-independent termination is controlled by specific sequences in the DNA template strand. As the polymerase nears the end of the gene being transcribed, it encounters a region rich in C–G nucleotides. The mRNA folds back on itself, and the complementary C–G nucleotides bind together. The result is a stable hairpin that causes the polymerase to stall as soon as it begins to transcribe a region rich in A–T nucleotides. The complementary U–A region of the mRNA transcript forms only a weak interaction with the template DNA. This, coupled with the stalled polymerase, induces enough instability for the core enzyme to break away and liberate the new mRNA transcript.
Upon termination, the process of transcription is complete. By the time termination occurs, the prokaryotic transcript would already have been used to begin synthesis of numerous copies of the encoded protein because these processes can occur concurrently. The unification of transcription, translation, and even mRNA degradation is possible because all of these processes occur in the same 5' to 3' direction, and because there is no membranous compartmentalization in the prokaryotic cell (Figure 15.9). In contrast, the presence of a nucleus in eukaryotic cells precludes simultaneous transcription and translation.
Figure 15.9 Multiple polymerases can transcribe a single bacterial gene while numerous ribosomes concurrently translate the mRNA transcripts into polypeptides. In this way, a specific protein can rapidly reach a high concentration in the bacterial cell.
Link to Learning
Link to Learning
Visit this BioStudio animation to see the process of prokaryotic transcription.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.05%3A_Genes_and_Proteins/3.5.03%3A_Prokaryotic_Transcription.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• List the steps in eukaryotic transcription
• Discuss the role of RNA polymerases in transcription
• Compare and contrast the three RNA polymerases
• Explain the significance of transcription factors
Prokaryotes and eukaryotes perform fundamentally the same process of transcription, with a few key differences. The most important difference between prokaryote and eukaryote transcription is due to the latter’s membrane-bound nucleus and organelles. With the genes bound in a nucleus, the eukaryotic cell must be able to transport its mRNA to the cytoplasm and must protect its mRNA from degrading before it is translated. Eukaryotes also employ three different polymerases that each transcribe a different subset of genes. Eukaryotic mRNAs are usually monogenic, meaning that they specify a single protein.
Initiation of Transcription in Eukaryotes
Unlike the prokaryotic polymerase that can bind to a DNA template on its own, eukaryotes require several other proteins, called transcription factors, to first bind to the promoter region and then to help recruit the appropriate polymerase.
The Three Eukaryotic RNA Polymerases
The features of eukaryotic mRNA synthesis are markedly more complex than those of prokaryotes. Instead of a single polymerase comprising five subunits, the eukaryotes have three polymerases that are each made up of 10 subunits or more. Each eukaryotic polymerase also requires a distinct set of transcription factors to bring it to the DNA template.
RNA polymerase I is located in the nucleolus, a specialized nuclear substructure in which ribosomal RNA (rRNA) is transcribed, processed, and assembled into ribosomes (Table 15.1). The rRNA molecules are considered structural RNAs because they have a cellular role but are not translated into protein. The rRNAs are components of the ribosome and are essential to the process of translation. RNA polymerase I synthesizes all of the rRNAs from the tandemly duplicated set of 18S, 5.8S, and 28S ribosomal genes. (Note that the “S” designation applies to “Svedberg” units, a nonadditive value that characterizes the speed at which a particle sediments during centrifugation.)
Locations, Products, and Sensitivities of the Three Eukaryotic RNA Polymerases
RNA Polymerase Cellular Compartment Product of Transcription α-Amanitin Sensitivity
I Nucleolus All rRNAs except 5S rRNA Insensitive
II Nucleus All protein-coding nuclear pre-mRNAs Extremely sensitive
III Nucleus 5S rRNA, tRNAs, and small nuclear RNAs Moderately sensitive
Table 15.1
RNA polymerase II is located in the nucleus and synthesizes all protein-coding nuclear pre-mRNAs. Eukaryotic pre-mRNAs undergo extensive processing after transcription but before translation. For clarity, this module’s discussion of transcription and translation in eukaryotes will use the term “mRNAs” to describe only the mature, processed molecules that are ready to be translated. RNA polymerase II is responsible for transcribing the overwhelming majority of eukaryotic genes.
RNA polymerase III is also located in the nucleus. This polymerase transcribes a variety of structural RNAs that includes the 5S pre-rRNA, transfer pre-RNAs (pre-tRNAs), and small nuclear pre-RNAs. The tRNAs have a critical role in translation; they serve as the “adaptor molecules” between the mRNA template and the growing polypeptide chain. Small nuclear RNAs have a variety of functions, including “splicing” pre-mRNAs and regulating transcription factors.
A scientist characterizing a new gene can determine which polymerase transcribes it by testing whether the gene is expressed in the presence of α-amanitin, an oligopeptide toxin produced by the fly agaric toadstool mushroom and other species of Amanita. Interestingly, the α-amanitin affects the three polymerases very differently (Table 15.1). RNA polymerase I is completely insensitive to α-amanitin, meaning that the polymerase can transcribe DNA in vitro in the presence of this poison. RNA polymerase III is moderately sensitive to the toxin. In contrast, RNA polymerase II is extremely sensitive to α-amanitin. The toxin prevents the enzyme from progressing down the DNA, and thus inhibits transcription. Knowing the transcribing polymerase can provide clues as to the general function of the gene being studied. Because RNA polymerase II transcribes the vast majority of genes, we will focus on this polymerase in our subsequent discussions about eukaryotic transcription factors and promoters.
RNA Polymerase II Promoters and Transcription Factors
Eukaryotic promoters are much larger and more intricate than prokaryotic promoters. However, both have a sequence similar to the -10 sequence of prokaryotes. In eukaryotes, this sequence is called the TATA box, and has the consensus sequence TATAAA on the coding strand. It is located at -25 to -35 bases relative to the initiation (+1) site (Figure 15.10). This sequence is not identical to the E. coli -10 box, but it conserves the A–T rich element. The thermostability of A–T bonds is low and this helps the DNA template to locally unwind in preparation for transcription.
Instead of the simple σ factor that helps bind the prokaryotic RNA polymerase to its promoter, eukaryotes assemble a complex of transcription factors required to recruit RNA polymerase II to a protein coding gene. Transcription factors that bind to the promoter are called basal transcription factors. These basal factors are all called TFII (for Transcription Factor/polymerase II) plus an additional letter (A-J). The core complex is TFIID, which includes a TATA-binding protein (TBP). The other transcription factors systematically fall into place on the DNA template, with each one further stabilizing the pre-initiation complex and contributing to the recruitment of RNA polymerase II.
Visual Connection
Visual Connection
Figure 15.10 A generalized promoter of a gene transcribed by RNA polymerase II is shown. Transcription factors recognize the promoter. RNA polymerase II then binds and forms the transcription initiation complex.
A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?
Some eukaryotic promoters also have a conserved CAAT box (GGCCAATCT) at approximately -80. Further upstream of the TATA box, eukaryotic promoters may also contain one or more GC-rich boxes (GGCG) or octamer boxes (ATTTGCAT). These elements bind cellular factors that increase the efficiency of transcription initiation and are often identified in more “active” genes that are constantly being expressed by the cell.
Basal transcription factors are crucial in the formation of a preinitiation complex on the DNA template that subsequently recruits RNA polymerase II for transcription initiation. The complexity of eukaryotic transcription does not end with the polymerases and promoters. An army of other transcription factors, which bind to upstream enhancers and silencers, also help to regulate the frequency with which pre-mRNA is synthesized from a gene. Enhancers and silencers affect the efficiency of transcription but are not necessary for transcription to proceed.
Promoter Structures for RNA Polymerases I and III
The processes of bringing RNA polymerases I and III to the DNA template involve slightly less complex collections of transcription factors, but the general theme is the same.
The conserved promoter elements for genes transcribed by polymerases I and III differ from those transcribed by RNA polymerase II. RNA polymerase I transcribes genes that have two GC-rich promoter sequences in the -45 to +20 region. These sequences alone are sufficient for transcription initiation to occur, but promoters with additional sequences in the region from -180 to -105 upstream of the initiation site will further enhance initiation. Genes that are transcribed by RNA polymerase III have upstream promoters or promoters that occur within the genes themselves.
Eukaryotic transcription is a tightly regulated process that requires a variety of proteins to interact with each other and with the DNA strand. Although the process of transcription in eukaryotes involves a greater metabolic investment than in prokaryotes, it ensures that the cell transcribes precisely the pre-mRNAs that it needs for protein synthesis.
Evolution Connection
Evolution Connection
The Evolution of Promoters The evolution of genes may be a familiar concept. Mutations can occur in genes during DNA replication, and the result may or may not be beneficial to the cell. By altering an enzyme, structural protein, or some other factor, the process of mutation can transform functions or physical features. However, eukaryotic promoters and other gene regulatory sequences may evolve as well. For instance, consider a gene that, over many generations, becomes more valuable to the cell. Maybe the gene encodes a structural protein that the cell needs to synthesize in abundance for a certain function. If this is the case, it would be beneficial to the cell for that gene’s promoter to recruit transcription factors more efficiently and increase gene expression.
Scientists examining the evolution of promoter sequences have reported varying results. In part, this is because it is difficult to infer exactly where a eukaryotic promoter begins and ends. Some promoters occur within genes; others are located very far upstream, or even downstream, of the genes they are regulating. However, when researchers limited their examination to human core promoter sequences that were defined experimentally as sequences that bind the preinitiation complex, they found that promoters evolve even faster than protein-coding genes.
It is still unclear how promoter evolution might correspond to the evolution of humans or other complex organisms. However, the evolution of a promoter to effectively make more or less of a given gene product is an intriguing alternative to the evolution of the genes themselves.1
Eukaryotic Elongation and Termination
Following the formation of the preinitiation complex, the polymerase is released from the other transcription factors, and elongation is allowed to proceed as it does in prokaryotes with the polymerase synthesizing pre-mRNA in the 5' to 3' direction. As discussed previously, RNA polymerase II transcribes the major share of eukaryotic genes, so in this section we will focus on how this polymerase accomplishes elongation and termination.
Although the enzymatic process of elongation is essentially the same in eukaryotes and prokaryotes, the DNA template is considerably more complex. When eukaryotic cells are not dividing, their genes exist as a diffuse mass of DNA and proteins called chromatin. The DNA is tightly packaged around charged histone proteins at repeated intervals. These DNA–histone complexes, collectively called nucleosomes, are regularly spaced and include 146 nucleotides of DNA wound around eight histones like thread around a spool.
For polynucleotide synthesis to occur, the transcription machinery needs to move histones out of the way every time it encounters a nucleosome. This is accomplished by a special protein complex called FACT, which stands for “facilitates chromatin transcription.” This complex pulls histones away from the DNA template as the polymerase moves along it. Once the pre-mRNA is synthesized, the FACT complex replaces the histones to recreate the nucleosomes.
The termination of transcription is different for the different polymerases. Unlike in prokaryotes, elongation by RNA polymerase II in eukaryotes takes place 1,000 to 2,000 nucleotides beyond the end of the gene being transcribed. This pre-mRNA tail is subsequently removed by cleavage during mRNA processing. On the other hand, RNA polymerases I and III require termination signals. Genes transcribed by RNA polymerase I contain a specific 18-nucleotide sequence that is recognized by a termination protein. The process of termination in RNA polymerase III involves an mRNA hairpin similar to rho-independent termination of transcription in prokaryotes.
Footnotes
• 1H Liang et al., “Fast evolution of core promoters in primate genomes,” Molecular Biology and Evolution 25 (2008): 1239–44.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.05%3A_Genes_and_Proteins/3.5.04%3A_Eukaryotic_Transcription.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the different steps in RNA processing
• Understand the significance of exons, introns, and splicing for mRNAs
• Explain how tRNAs and rRNAs are processed
After transcription, eukaryotic pre-mRNAs must undergo several processing steps before they can be translated. Eukaryotic (and prokaryotic) tRNAs and rRNAs also undergo processing before they can function as components in the protein-synthesis machinery.
mRNA Processing
The eukaryotic pre-mRNA undergoes extensive processing before it is ready to be translated. Eukaryotic protein-coding sequences are not continuous, as they are in prokaryotes. The coding sequences (exons) are interrupted by noncoding introns, which must be removed to make a translatable mRNA. The additional steps involved in eukaryotic mRNA maturation also create a molecule with a much longer half-life than a prokaryotic mRNA. Eukaryotic mRNAs last for several hours, whereas the typical E. coli mRNA lasts no more than five seconds.
Pre-mRNAs are first coated in RNA-stabilizing proteins; these protect the pre-mRNA from degradation while it is processed and exported out of the nucleus. The three most important steps of pre-mRNA processing are the addition of stabilizing and signaling factors at the 5' and 3' ends of the molecule, and the removal of the introns (Figure 15.11). In rare cases, the mRNA transcript can be “edited” after it is transcribed.
Figure 15.11 Eukaryotic pre-mRNA processing. In addition to 5’ Cap and 3’ Poly-A Tail addition, introns must be precisely removed and exons joined to generate a functional mRNA. Nucleotides upstream (towards the 5’cap) of the translation START codon are part of the 5’ untranslated region (5’ UTR). Nucleotides downstream (towards 3’end) of the STOP codon form the 3’ UTR. Both 5’ and 3’ UTRs are important for regulating translation initiation and mRNA stability. Credit: Rao, A., Ryan, K. Fletcher, S. and Tag, A. Department of Biology, Texas A&M University.
Evolution Connection
Evolution Connection
RNA Editing in TrypanosomesThe trypanosomes are a group of protozoa that include the pathogen Trypanosoma brucei, which causes nagana in cattle and sleeping sickness in humans throughout great areas of Africa (Figure 15.12). The trypanosome is carried by biting flies in the genus Glossina (commonly called tsetse flies). Trypanosomes, and virtually all other eukaryotes, have organelles called mitochondria that supply the cell with chemical energy. Mitochondria are organelles that express their own DNA and are believed to be the remnants of a symbiotic relationship between a eukaryote and an engulfed prokaryote. The mitochondrial DNA of trypanosomes exhibit an interesting exception to the central dogma: their pre-mRNAs do not have the correct information to specify a functional protein. Usually, this is because the mRNA is missing several U nucleotides. The cell performs an additional RNA processing step called RNA editing to remedy this.
Figure 15.12 Trypanosoma brucei is the causative agent of sleeping sickness in humans. The mRNAs of this pathogen must be modified by the addition of nucleotides before protein synthesis can occur. (credit: modification of work by Torsten Ochsenreiter)
Other genes in the mitochondrial genome encode 40- to 80-nucleotide guide RNAs. One or more of these molecules interacts by complementary base pairing with some of the nucleotides in the pre-mRNA transcript. However, the guide RNA has more A nucleotides than the pre-mRNA has U nucleotides with which to bind. In these regions, the guide RNA loops out. The 3' ends of guide RNAs have a long poly-U tail, and these U bases are inserted in regions of the pre-mRNA transcript at which the guide RNAs are looped. This process is entirely mediated by RNA molecules. That is, guide RNAs—rather than proteins—serve as the catalysts in RNA editing.
RNA editing is not just a phenomenon of trypanosomes. In the mitochondria of some plants, almost all pre-mRNAs are edited. RNA editing has also been identified in mammals such as rats, rabbits, and even humans. What could be the evolutionary reason for this additional step in pre-mRNA processing? One possibility is that the mitochondria, being remnants of ancient prokaryotes, have an equally ancient RNA-based method for regulating gene expression. In support of this hypothesis, edits made to pre-mRNAs differ depending on cellular conditions. Although speculative, the process of RNA editing may be a holdover from a primordial time when RNA molecules, instead of proteins, were responsible for catalyzing reactions.
5' Capping
While the pre-mRNA is still being synthesized, a 7-methylguanosine cap is added to the 5' end of the growing transcript by a phosphate linkage. This functional group protects the nascent mRNA from degradation. In addition, factors involved in protein synthesis recognize the cap to help initiate translation by ribosomes.
3' Poly-A Tail
Once elongation is complete, the pre-mRNA is cleaved by an endonuclease between an AAUAAA consensus sequence and a GU-rich sequence, leaving the AAUAAA sequence on the pre-mRNA. An enzyme called poly-A polymerase then adds a string of approximately 200 A residues, called the poly-A tail. This modification further protects the pre-mRNA from degradation and is also the binding site for a protein necessary for exporting the processed mRNA to the cytoplasm.
Pre-mRNA Splicing
Eukaryotic genes are composed of exons, which correspond to protein-coding sequences (ex-on signifies that they are expressed), and intervening sequences called introns (int-ron denotes their intervening role), which may be involved in gene regulation but are removed from the pre-mRNA during processing. Intron sequences in mRNA do not encode functional proteins.
The discovery of introns came as a surprise to researchers in the 1970s who expected that pre-mRNAs would specify protein sequences without further processing, as they had observed in prokaryotes. The genes of higher eukaryotes very often contain one or more introns. These regions may correspond to regulatory sequences; however, the biological significance of having many introns or having very long introns in a gene is unclear. It is possible that introns slow down gene expression because it takes longer to transcribe pre-mRNAs with lots of introns. Alternatively, introns may be nonfunctional sequence remnants left over from the fusion of ancient genes throughout the course of evolution. This is supported by the fact that separate exons often encode separate protein subunits or domains. For the most part, the sequences of introns can be mutated without ultimately affecting the protein product.
All of a pre-mRNA’s introns must be completely and precisely removed before protein synthesis. If the process errs by even a single nucleotide, the reading frame of the rejoined exons would shift, and the resulting protein would be dysfunctional. The process of removing introns and reconnecting exons is called splicing (Figure 15.13). Introns are removed and degraded while the pre-mRNA is still in the nucleus. Splicing occurs by a sequence-specific mechanism that ensures introns will be removed and exons rejoined with the accuracy and precision of a single nucleotide. Although the intron itself is noncoding, the beginning and end of each intron is marked with specific nucleotides: GU at the 5' end and AG at the 3' end of the intron. The splicing of pre-mRNAs is conducted by complexes of proteins and RNA molecules called spliceosomes.
Visual Connection
Visual Connection
Figure 15.13 Pre-mRNA splicing involves the precise removal of introns from the primary RNA transcript. The splicing process is catalyzed by protein complexes called spliceosomes that are composed of proteins and RNA molecules called small nuclear RNAs (snRNAs). Spliceosomes recognize sequences at the 5' and 3' end of the intron. Rao, A. and Ryan, K. Department of Biology, Texas A&M University.
Errors in splicing are implicated in cancers and other human diseases. What kinds of mutations might lead to splicing errors? Think of different possible outcomes if splicing errors occur.
Note that more than 70 individual introns can be present, and each has to undergo the process of splicing—in addition to 5' capping and the addition of a poly-A tail—just to generate a single, translatable mRNA molecule.
Link to Learning
Link to Learning
See how introns are removed during RNA splicing at this website.
Processing of tRNAs and rRNAs
The tRNAs and rRNAs are structural molecules that have roles in protein synthesis; however, these RNAs are not themselves translated. Pre-rRNAs are transcribed, processed, and assembled into ribosomes in the nucleolus. Pre-tRNAs are transcribed and processed in the nucleus and then released into the cytoplasm where they are linked to free amino acids for protein synthesis.
Most of the tRNAs and rRNAs in eukaryotes and prokaryotes are first transcribed as a long precursor molecule that spans multiple rRNAs or tRNAs. Enzymes then cleave the precursors into subunits corresponding to each structural RNA. Some of the bases of pre-rRNAs are methylated; that is, a –CH3 methyl functional group is added for stability. Pre-tRNA molecules also undergo methylation. As with pre-mRNAs, subunit excision occurs in eukaryotic pre-RNAs destined to become tRNAs or rRNAs.
Mature rRNAs make up approximately 50 percent of each ribosome. Some of a ribosome’s RNA molecules are purely structural, whereas others have catalytic or binding activities. Mature tRNAs take on a three-dimensional structure through local regions of base pairing stabilized by intramolecular hydrogen bonding. The tRNA folds to position the amino acid binding site at one end and the anticodon at the other end (Figure 15.14). The anticodon is a three-nucleotide sequence in a tRNA that interacts with an mRNA codon through complementary base pairing.
Figure 15.14 This is a space-filling model of a tRNA molecule that adds the amino acid phenylalanine to a growing polypeptide chain. The anticodon AAG binds the Codon UUC on the mRNA. The amino acid phenylalanine is attached to the other end of the tRNA.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.05%3A_Genes_and_Proteins/3.5.05%3A_RNA_Processing_in_Eukaryotes.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the different steps in protein synthesis
• Discuss the role of ribosomes in protein synthesis
The synthesis of proteins consumes more of a cell’s energy than any other metabolic process. In turn, proteins account for more mass than any other component of living organisms (with the exception of water), and proteins perform virtually every function of a cell. The process of translation, or protein synthesis, involves the decoding of an mRNA message into a polypeptide product. Amino acids are covalently strung together by interlinking peptide bonds in lengths ranging from approximately 50 to more than 1000 amino acid residues. Each individual amino acid has an amino group (NH2) and a carboxyl (COOH) group. Polypeptides are formed when the amino group of one amino acid forms an amide (i.e., peptide) bond with the carboxyl group of another amino acid (Figure 15.15). This reaction is catalyzed by ribosomes and generates one water molecule.
Figure 15.15 A peptide bond links the carboxyl end of one amino acid with the amino end of another, producing one water molecule during the process. For simplicity in this image, only the functional groups involved in the peptide bond are shown. The R and R' designations refer to the rest of each amino acid structure.
The Protein Synthesis Machinery
In addition to the mRNA template, many molecules and macromolecules contribute to the process of translation. The composition of each component may vary across species; for example, ribosomes may consist of different numbers of rRNAs and polypeptides depending on the organism. However, the general structures and functions of the protein synthesis machinery are comparable from bacteria to human cells. Translation requires the input of an mRNA template, ribosomes, tRNAs, and various enzymatic factors. (Note: A ribosome can be thought of as an enzyme whose amino acid binding sites are specified by mRNA.)
Link to Learning
Link to Learning
Click through the steps of this PBS interactive to see protein synthesis in action.
Ribosomes
Even before an mRNA is translated, a cell must invest energy to build each of its ribosomes. In E. coli, there are between 10,000 and 70,000 ribosomes present in each cell at any given time. A ribosome is a complex macromolecule composed of structural and catalytic rRNAs, and many distinct polypeptides. In eukaryotes, the nucleolus is completely specialized for the synthesis and assembly of rRNAs.
Ribosomes exist in the cytoplasm of prokaryotes and in the cytoplasm and rough endoplasmic reticulum of eukaryotes. Mitochondria and chloroplasts also have their own ribosomes in the matrix and stroma, which look more similar to prokaryotic ribosomes (and have similar drug sensitivities) than the ribosomes just outside their outer membranes in the cytoplasm. Ribosomes dissociate into large and small subunits when they are not synthesizing proteins and reassociate during the initiation of translation. In E. coli, the small subunit is described as 30S, and the large subunit is 50S, for a total of 70S (recall that Svedberg units are not additive). Mammalian ribosomes have a small 40S subunit and a large 60S subunit, for a total of 80S. The small subunit is responsible for binding the mRNA template, whereas the large subunit sequentially binds tRNAs. Each mRNA molecule is simultaneously translated by many ribosomes, all synthesizing protein in the same direction: reading the mRNA from 5' to 3' and synthesizing the polypeptide from the N terminus to the C terminus. The complete mRNA/poly-ribosome structure is called a polysome.
tRNAs
The tRNAs are structural RNA molecules that were transcribed from genes by RNA polymerase III. Depending on the species, 40 to 60 types of tRNAs exist in the cytoplasm. Transfer RNAs serve as adaptor molecules. Each tRNA carries a specific amino acid and recognizes one or more of the mRNA codons that define the order of amino acids in a protein. Aminoacyl-tRNAs bind to the ribosome and add the corresponding amino acid to the polypeptide chain. Therefore, tRNAs are the molecules that actually “translate” the language of RNA into the language of proteins.
Of the 64 possible mRNA codons—or triplet combinations of A, U, G, and C—three specify the termination of protein synthesis and 61 specify the addition of amino acids to the polypeptide chain. Of these 61, one codon (AUG) also encodes the initiation of translation. Each tRNA anticodon can base pair with one or more of the mRNA codons for its amino acid. For instance, if the sequence CUA occurred on an mRNA template in the proper reading frame, it would bind a leucine tRNA expressing the complementary sequence, GAU. The ability of some tRNAs to match more than one codon is what gives the genetic code its blocky structure.
As the adaptor molecules of translation, it is surprising that tRNAs can fit so much specificity into such a small package. Consider that tRNAs need to interact with three factors: 1) they must be recognized by the correct aminoacyl synthetase (see below); 2) they must be recognized by ribosomes; and 3) they must bind to the correct sequence in mRNA.
Figure 15.16 The ribosome and its function. The ribosome is responsible for translating the mRNA into protein. A. The ribosome consists of a large and small ribosomal subunit. Assembly of the subunits on the mRNA forms three tRNA binding sites. B. During translation, charged tRNAs enter the Acceptor site, and the anticodon on the tRNA base pairs with the codon in the mRNA. After the incoming amino acid forms a peptide bond with the growing polypeptide chain, the ribosome will move three nucleotides toward the 3’ end of the mRNA. This movement will transfer the tRNA with the growing polypeptide to the Peptidyl-tRNA binding site and allow the empty tRNA to exit at the Exit site. Credit: Rao, A., Ryan, K. and Fletcher, S. Department of Biology, Texas A&M University.
Aminoacyl tRNA Synthetases
The process of pre-tRNA synthesis by RNA polymerase III only creates the RNA portion of the adaptor molecule. The corresponding amino acid must be added later, once the tRNA is processed and exported to the cytoplasm. Through the process of tRNA “charging,” each tRNA molecule is linked to its correct amino acid by one of a group of enzymes called aminoacyl tRNA synthetases. At least one type of aminoacyl tRNA synthetase exists for each of the 20 amino acids; the exact number of aminoacyl tRNA synthetases varies by species. These enzymes first bind and hydrolyze ATP to catalyze a high-energy bond between an amino acid and adenosine monophosphate (AMP); a pyrophosphate molecule is expelled in this reaction. The activated amino acid is then transferred to the tRNA, and AMP is released. The term "charging" is appropriate, since the high-energy bond that attaches an amino acid to its tRNA is later used to drive the formation of the peptide bond. Each tRNA is named for its amino acid.
Figure 15.17 Charging of tRNAs with correct amino acids. Aminoacyl-tRNA synthetases catalyze covalent bond formation between the tRNA and the correct amino acid in preparation for translation. Because there are multiple amino acids, there are multiple different tRNA synthetases. All of the synthetases require energy, in the form of ATP, to make sure the correct amino acid is attached to the tRNA with the correct anticodon sequence. Credit: Rao, A., Ryan, K. and Tag, A. Department of Biology, Texas A&M University.
The Mechanism of Protein Synthesis
As with mRNA synthesis, protein synthesis can be divided into three phases: initiation, elongation, and termination. The process of translation is similar in prokaryotes and eukaryotes. Here we’ll explore how translation occurs in E. coli, a representative prokaryote, and specify any differences between prokaryotic and eukaryotic translation.
Initiation of Translation
Protein synthesis begins with the formation of an initiation complex. In E. coli, this complex involves the small 30S ribosome, the mRNA template, three initiation factors (IFs; IF-1, IF-2, and IF-3), and a special initiator tRNA, called tRNAMetf.
In E. coli mRNA, a sequence upstream of the first AUG codon, called the Shine-Dalgarno sequence (AGGAGG), interacts with the rRNA molecules that compose the ribosome. This interaction anchors the 30S ribosomal subunit at the correct location on the mRNA template. Guanosine triphosphate (GTP), which is a purine nucleotide triphosphate, acts as an energy source during translation—both at the start of elongation and during the ribosome’s translocation. Binding of the mRNA to the 30S ribosome also requires IF-III.
The initiator tRNA then interacts with the start codon AUG (or rarely, GUG). This tRNA carries the amino acid methionine, which is formylated after its attachment to the tRNA. The formylation creates a "faux" peptide bond between the formyl carboxyl group and the amino group of the methionine. Binding of the fMet-tRNAMetf is mediated by the initiation factor IF-2. The fMet begins every polypeptide chain synthesized by E. coli, but it is usually removed after translation is complete. When an in-frame AUG is encountered during translation elongation, a non-formylated methionine is inserted by a regular Met-tRNAMet. After the formation of the initiation complex, the 30S ribosomal subunit is joined by the 50S subunit to form the translation complex. In eukaryotes, a similar initiation complex forms, comprising mRNA, the 40S small ribosomal subunit, eukaryotic IFs, and nucleoside triphosphates (GTP and ATP). The methionine on the charged initiator tRNA, called Met-tRNAi, is not formylated. However, Met-tRNAi is distinct from other Met-tRNAs in that it can bind IFs.
Instead of depositing at the Shine-Dalgarno sequence, the eukaryotic initiation complex recognizes the 7-methylguanosine cap at the 5' end of the mRNA. A cap-binding protein (CBP) and several other IFs assist the movement of the ribosome to the 5' cap. Once at the cap, the initiation complex tracks along the mRNA in the 5' to 3' direction, searching for the AUG start codon. Many eukaryotic mRNAs are translated from the first AUG, but this is not always the case. According to Kozak’s rules, the nucleotides around the AUG indicate whether it is the correct start codon. Kozak’s rules state that the following consensus sequence must appear around the AUG of vertebrate genes: 5'-gccRccAUGG-3'. The R (for purine) indicates a site that can be either A or G, but cannot be C or U. Essentially, the closer the sequence is to this consensus, the higher the efficiency of translation.
Once the appropriate AUG is identified, the other proteins and CBP dissociate, and the 60S subunit binds to the complex of Met-tRNAi, mRNA, and the 40S subunit. This step completes the initiation of translation in eukaryotes.
Translation, Elongation, and Termination
In prokaryotes and eukaryotes, the basics of elongation are the same, so we will review elongation from the perspective of E. coli. When the translation complex is formed, the tRNA binding region of the ribosome consists of three compartments. The A (aminoacyl) site binds incoming charged aminoacyl tRNAs. The P (peptidyl) site binds charged tRNAs carrying amino acids that have formed peptide bonds with the growing polypeptide chain but have not yet dissociated from their corresponding tRNA. The E (exit) site releases dissociated tRNAs so that they can be recharged with free amino acids. The initiating methionyl-tRNA, however, occupies the P site at the beginning of the elongation phase of translation in both prokaryotes and eukaryotes.
During translation elongation, the mRNA template provides tRNA binding specificity. As the ribosome moves along the mRNA, each mRNA codon comes into register, and specific binding with the corresponding charged tRNA anticodon is ensured. If mRNA were not present in the elongation complex, the ribosome would bind tRNAs nonspecifically and randomly.
Elongation proceeds with charged tRNAs sequentially entering and leaving the ribosome as each new amino acid is added to the polypeptide chain. Movement of a tRNA from A to P to E site is induced by conformational changes that advance the ribosome by three bases in the 3' direction. The energy for each step along the ribosome is donated by elongation factors that hydrolyze GTP. GTP energy is required both for the binding of a new aminoacyl-tRNA to the A site and for its translocation to the P site after formation of the peptide bond. Peptide bonds form between the amino group of the amino acid attached to the A-site tRNA and the carboxyl group of the amino acid attached to the P-site tRNA. The formation of each peptide bond is catalyzed by peptidyl transferase, an RNA-based enzyme that is integrated into the 50S ribosomal subunit. The energy for each peptide bond formation is derived from the high-energy bond linking each amino acid to its tRNA. After peptide bond formation, the A-site tRNA that now holds the growing peptide chain moves to the P site, and the P-site tRNA that is now empty moves to the E site and is expelled from the ribosome (Figure 15.18). Amazingly, the E. coli translation apparatus takes only 0.05 seconds to add each amino acid, meaning that a 200-amino-acid protein can be translated in just 10 seconds.
Visual Connection
Visual Connection
Figure 15.18 Translation begins when an initiator tRNA anticodon recognizes a start codon on mRNA bound to a small ribosomal subunit. The large ribosomal subunit joins the small subunit, and a second tRNA is recruited. As the mRNA moves relative to the ribosome, successive tRNAs move through the ribosome and the polypeptide chain is formed. Entry of a release factor into the A site terminates translation and the components dissociate.
Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?
Tetracycline would directly affect:
1. tRNA binding to the ribosome
2. ribosome assembly
3. growth of the protein chain
Chloramphenicol would directly affect:
1. tRNA binding to the ribosome
2. ribosome assembly
3. growth of the protein chain
Termination of translation occurs when a nonsense codon (UAA, UAG, or UGA) is encountered. Upon aligning with the A site, these nonsense codons are recognized by protein release factors that resemble tRNAs. The releasing factors in both prokaryotes and eukaryotes instruct peptidyl transferase to add a water molecule to the carboxyl end of the P-site amino acid. This reaction forces the P-site amino acid to detach from its tRNA, and the newly made protein is released. The small and large ribosomal subunits dissociate from the mRNA and from each other; they are recruited almost immediately into another translation initiation complex. After many ribosomes have completed translation, the mRNA is degraded so the nucleotides can be reused in another transcription reaction.
Figure 15.19 Translation Termination is Active. Translation is terminated when a STOP codon is in the A-site of the ribosome. Since there are no tRNAs corresponding to the STOP codons, the Release Factor protein enters and catalyzes the hydrolysis between the last amino acid and its tRNA. This hydrolysis releases the free carboxyl terminus (C-term) of the protein. Additional factors use the energy in GTP hydrolysis to disassemble the large and small ribosomal subunits and mRNA. Credit: Rao, A. and Ryan, K. Department of Biology, Texas A&M University.
Protein Folding, Modification, and Targeting
During and after translation, individual amino acids may be chemically modified, signal sequences appended, and the new protein “folded” into a distinct three-dimensional structure as a result of intramolecular interactions. A signal sequence is a short sequence at the amino end of a protein that directs it to a specific cellular compartment. These sequences can be thought of as the protein’s “train ticket” to its ultimate destination, and are recognized by signal-recognition proteins that act as conductors. For instance, a specific signal sequence terminus will direct a protein to the mitochondria or chloroplasts (in plants). Once the protein reaches its cellular destination, the signal sequence is usually clipped off.
Many proteins fold spontaneously, but some proteins require helper molecules, called chaperones, to prevent them from aggregating during the complicated process of folding. Even if a protein is properly specified by its corresponding mRNA, it could take on a completely dysfunctional shape if abnormal temperature or pH conditions prevent it from folding correctly.
Figure 15.20 Proteins are co-translationally targeted into the ER for secretion. Proteins that will be secreted from the cell will contain a signal sequence at the N-terminus. The signal will be recognized by SRP as soon as the amino acids emerge from the ribosome, and the ribosome will be targeted to the translocation channel in the ER membrane. The rest of the protein will go directly from the ribosome, across the ER membrane and into the ER lumen. From the ER, proteins can be secreted from the cell via vesicle trafficking. Credit: Rao, A. and Ryan, K. Department of Biology, Texas A&M University.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.05%3A_Genes_and_Proteins/3.5.06%3A_Ribosomes_and_Protein_Synthesis.txt
|
7-methylguanosine cap
modification added to the 5' end of pre-mRNAs to protect mRNA from degradation and assist translation
aminoacyl tRNA synthetase
enzyme that “charges” tRNA molecules by catalyzing a bond between the tRNA and a corresponding amino acid
anticodon
three-nucleotide sequence in a tRNA molecule that corresponds to an mRNA codon
CAAT box
(GGCCAATCT) essential eukaryotic promoter sequence involved in binding transcription factors
central dogma
states that genes specify the sequence of mRNAs, which in turn specify the sequence of proteins
codon
three consecutive nucleotides in mRNA that specify the insertion of an amino acid or the release of a polypeptide chain during translation
colinear
in terms of RNA and protein, three “units” of RNA (nucleotides) specify one “unit” of protein (amino acid) in a consecutive fashion
consensus
DNA sequence that is used by many species to perform the same or similar functions
core enzyme
prokaryotic RNA polymerase consisting of α, α, β, and β' but missing σ; this complex performs elongation
degeneracy
(of the genetic code) describes that a given amino acid can be encoded by more than one nucleotide triplet; the code is degenerate, but not ambiguous
downstream
nucleotides following the initiation site in the direction of mRNA transcription; in general, sequences that are toward the 3' end relative to a site on the mRNA
exon
sequence present in protein-coding mRNA after completion of pre-mRNA splicing
FACT
complex that “facilitates chromatin transcription” by disassembling nucleosomes ahead of a transcribing RNA polymerase II and reassembling them after the polymerase passes by
GC-rich box
(GGCG) nonessential eukaryotic promoter sequence that binds cellular factors to increase the efficiency of transcription; may be present several times in a promoter
hairpin
structure of RNA when it folds back on itself and forms intramolecular hydrogen bonds between complementary nucleotides
holoenzyme
prokaryotic RNA polymerase consisting of α, α, β, β', and σ; this complex is responsible for transcription initiation
initiation site
nucleotide from which mRNA synthesis proceeds in the 5' to 3' direction; denoted with a “+1”
initiator tRNA
in prokaryotes, called $tRNAfMettRNAfMet$; in eukaryotes, called tRNAi; a tRNA that interacts with a start codon, binds directly to the ribosome P site, and links to a special methionine to begin a polypeptide chain
intron
non–protein-coding intervening sequences that are spliced from mRNA during processing
Kozak’s rules
determines the correct initiation AUG in a eukaryotic mRNA; the following consensus sequence must appear around the AUG: 5’-GCC(purine)CCAUGG-3’; the bolded bases are most important
nonsense codon
one of the three mRNA codons that specifies termination of translation
nontemplate strand
strand of DNA that is not used to transcribe mRNA; this strand is identical to the mRNA except that T nucleotides in the DNA are replaced by U nucleotides in the mRNA
Octamer box
(ATTTGCAT) nonessential eukaryotic promoter sequence that binds cellular factors to increase the efficiency of transcription; may be present several times in a promoter
peptidyl transferase
RNA-based enzyme that is integrated into the 50S ribosomal subunit and catalyzes the formation of peptide bonds
plasmid
extrachromosomal, covalently closed, circular DNA molecule that may only contain one or a few genes; common in prokaryotes
poly-A tail
modification added to the 3' end of pre-mRNAs to protect mRNA from degradation and assist mRNA export from the nucleus
polysome
mRNA molecule simultaneously being translated by many ribosomes all going in the same direction
preinitiation complex
cluster of transcription factors and other proteins that recruit RNA polymerase II for transcription of a DNA template
promoter
DNA sequence to which RNA polymerase and associated factors bind and initiate transcription
reading frame
sequence of triplet codons in mRNA that specify a particular protein; a ribosome shift of one or two nucleotides in either direction completely abolishes synthesis of that protein
rho-dependent termination
in prokaryotes, termination of transcription by an interaction between RNA polymerase and the rho protein at a run of G nucleotides on the DNA template
rho-independent
termination sequence-dependent termination of prokaryotic mRNA synthesis; caused by hairpin formation in the mRNA that stalls the polymerase
RNA editing
direct alteration of one or more nucleotides in an mRNA that has already been synthesized
Shine-Dalgarno sequence
(AGGAGG); initiates prokaryotic translation by interacting with rRNA molecules comprising the 30S ribosome
signal sequence
short tail of amino acids that directs a protein to a specific cellular compartment
small nuclear RNA
molecules synthesized by RNA polymerase III that have a variety of functions, including splicing pre-mRNAs and regulating transcription factors
splicing
process of removing introns and reconnecting exons in a pre-mRNA
start codon
AUG (or rarely, GUG) on an mRNA from which translation begins; always specifies methionine
TATA box
conserved promoter sequence in eukaryotes and prokaryotes that helps to establish the initiation site for transcription
template strand
strand of DNA that specifies the complementary mRNA molecule
transcription bubble
region of locally unwound DNA that allows for transcription of mRNA
upstream
nucleotides preceding the initiation site; in general, sequences toward the 5' end relative to a site on the mRNA
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.05%3A_Genes_and_Proteins/3.5.07%3A_Key_Terms.txt
|
15.1 The Genetic Code
The genetic code refers to the DNA alphabet (A, T, C, G), the RNA alphabet (A, U, C, G), and the polypeptide alphabet (20 amino acids). The central dogma describes the flow of genetic information in the cell from genes to mRNA to proteins. Genes are used to make mRNA by the process of transcription; mRNA is used to synthesize proteins by the process of translation. The genetic code is degenerate because 64 triplet codons in mRNA specify only 20 amino acids and three nonsense codons. Most amino acids have several similar codons. Almost every species on the planet uses the same genetic code.
15.2 Prokaryotic Transcription
In prokaryotes, mRNA synthesis is initiated at a promoter sequence on the DNA template comprising two consensus sequences that recruit RNA polymerase. The prokaryotic polymerase consists of a core enzyme of four protein subunits and a σ protein that assists only with initiation. Elongation synthesizes mRNA in the 5' to 3' direction at a rate of 40 nucleotides per second. Termination liberates the mRNA and occurs either by rho protein interaction or by the formation of an mRNA hairpin.
15.3 Eukaryotic Transcription
Transcription in eukaryotes involves one of three types of polymerases, depending on the gene being transcribed. RNA polymerase II transcribes all of the protein-coding genes, whereas RNA polymerase I transcribes the tandemly duplicated rRNA genes, and RNA polymerase III transcribes various small RNAs, like the 5S rRNA, tRNA, and small nuclear RNA genes. The initiation of transcription in eukaryotes involves the binding of several transcription factors to complex promoter sequences that are usually located upstream of the gene being copied. The mRNA is synthesized in the 5' to 3' direction, and the FACT complex moves and reassembles nucleosomes as the polymerase passes by. Whereas RNA polymerases I and III terminate transcription by protein- or RNA hairpin-dependent methods, RNA polymerase II transcribes for 1,000 or more nucleotides beyond the gene template and cleaves the excess during pre-mRNA processing.
15.4 RNA Processing in Eukaryotes
Eukaryotic pre-mRNAs are modified with a 5' methylguanosine cap and a poly-A tail. These structures protect the mature mRNA from degradation and help export it from the nucleus. Pre-mRNAs also undergo splicing, in which introns are removed and exons are reconnected with single-nucleotide accuracy. Only finished mRNAs that have undergone 5' capping, 3' polyadenylation, and intron splicing are exported from the nucleus to the cytoplasm. Pre-rRNAs and pre-tRNAs may be processed by intramolecular cleavage, splicing, methylation, and chemical conversion of nucleotides. Rarely, RNA editing is also performed to insert missing bases after an mRNA has been synthesized.
15.5 Ribosomes and Protein Synthesis
The players in translation include the mRNA template, ribosomes, tRNAs, and various enzymatic factors. The small ribosomal subunit binds to the mRNA template either at the Shine-Dalgarno sequence (prokaryotes) or the 5' cap (eukaryotes). Translation begins at the initiating AUG on the mRNA, specifying methionine. The formation of peptide bonds occurs between sequential amino acids matched to the mRNA template by their tRNAs according to the genetic code. Charged tRNAs enter the ribosomal A site, and their amino acid bonds with the amino acid at the P site. The entire mRNA is translated in three-nucleotide “steps” of the ribosome. When a nonsense codon is encountered, a release factor binds and dissociates the components and frees the new protein. Folding of the protein occurs during and after translation.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.05%3A_Genes_and_Proteins/3.5.08%3A_Chapter_Summary.txt
|
1.
Figure 15.11 A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?
2.
Figure 15.13 Errors in splicing are implicated in cancers and other human diseases. What kinds of mutations might lead to splicing errors? Think of different possible outcomes if splicing errors occur.
3.
Figure 15.18 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?
Tetracycline would directly affect:
1. tRNA binding to the ribosome
2. ribosome assembly
3. growth of the protein chain
Chloramphenicol would directly affect
1. tRNA binding to the ribosome
2. ribosome assembly
3. growth of the protein chain
3.5.10: Review Questions
4.
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?
1. complementarity
2. nonsense codons
3. universality
4. degeneracy
5.
How many nucleotides are in 12 mRNA codons?
1. 12
2. 24
3. 36
4. 48
6.
Which event contradicts the central dogma of molecular biology?
1. Poly-A polymerase enzymes process mRNA in the nucleus.
2. Endonuclease enzymes splice out and repair damaged DNA.
3. Scientists use reverse transcriptase enzymes to make DNA from RNA.
4. Codons specifying amino acids are degenerate and universal.
7.
Which subunit of the E. coli polymerase confers specificity to transcription?
1. α
2. β
3. β'
4. σ
8.
The -10 and -35 regions of prokaryotic promoters are called consensus sequences because ________.
1. they are identical in all bacterial species
2. they are similar in all bacterial species
3. they exist in all organisms
4. they have the same function in all organisms
9.
Three different bacteria species have the following consensus sequences upstream of a conserved gene.
Species A Species B Species C
-10 TAATAAT TTTAAT TATATT
-35 TTGACA TTGGCC TTGAAA
Table 15.2
Order the bacteria from most to least efficient initiation of gene transcription.
1. A > B > C
2. B > C > A
3. C > B > A
4. A > C > B
10.
Which feature of promoters can be found in both prokaryotes and eukaryotes?
1. GC box
2. TATA box
3. octamer box
4. -10 and -35 sequences
11.
What transcripts will be most affected by low levels of α-amanitin?
1. 18S and 28S rRNAs
2. pre-mRNAs
3. 5S rRNAs and tRNAs
4. other small nuclear RNAs
12.
How do enhancers and promoters differ?
1. Enhancers bind transcription factors to silence gene expression, while promoters activate transcription.
2. Enhancers increase the efficiency of gene expression, but are not essential for transcription. Promoter recognition is essential to transcription initiation.
3. Promoters bind transcription factors to increase the efficiency of transcription. Enhancers bind RNA polymerases to initiate transcription.
4. There is no difference. Both are transcription factor-binding sequences in DNA.
13.
Which pre-mRNA processing step is important for initiating translation?
1. poly-A tail
2. RNA editing
3. splicing
4. 7-methylguanosine cap
14.
What processing step enhances the stability of pre-tRNAs and pre-rRNAs?
1. methylation
2. nucleotide modification
3. cleavage
4. splicing
15.
A scientist identifies a pre-mRNA with the following structure.
What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’ poly-A tail?
1. 220bp
2. 295bp
3. 140bp
4. 435bp
16.
The RNA components of ribosomes are synthesized in the ________.
1. cytoplasm
2. nucleus
3. nucleolus
4. endoplasmic reticulum
17.
In any given species, there are at least how many types of aminoacyl tRNA synthetases?
1. 20
2. 40
3. 100
4. 200
18.
A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation?
1. Translation stalls after the initiation AUG codon is identified.
2. The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites.
3. The ribosome cannot interact with mRNAs.
4. tRNAs cannot exit the E site of the ribosome.
3.5.11: Critical Thinking Questions
19.
Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.
20.
Discuss how degeneracy of the genetic code makes cells more robust to mutations.
21.
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG
What is the sequence of the amino acid chain this mRNA makes when it is translated?
22.
If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?
23.
In your own words, describe the difference between rho-dependent and rho-independent termination of transcription in prokaryotes.
24.
A fragment of bacterial DNA reads:
3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’
Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)
25.
A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect.
26.
Chronic lymphocytic leukemia patients often harbor nonsense mutations in their spliceosome machinery. Describe how this mutation of the spliceosome would change the final location and sequence of a pre-mRNA.
27.
Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'
28.
Explain how single nucleotide changes can have vastly different effects on protein function.
29.
A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.05%3A_Genes_and_Proteins/3.5.09%3A_Visual_Connection_Questions.txt
|
Whereas each cell shares the same genome and DNA sequence, each cell does not turn on, or express, the same set of genes. Each cell type needs a different set of proteins to perform its function. Therefore, only a small subset of proteins is expressed in a cell. For the proteins to be expressed, the DNA must be transcribed into RNA and the RNA must be translated into protein. In a given cell type, not all genes encoded in the DNA are transcribed into RNA or translated into protein because specific cells in our body have specific functions. Specialized proteins that make up the eye (iris, lens, and cornea) are only expressed in the eye, whereas the specialized proteins in the heart (pacemaker cells, heart muscle, and valves) are only expressed in the heart. At any given time, only a subset of all of the genes encoded by our DNA are expressed and translated into proteins. The expression of specific genes is a highly regulated process with many levels and stages of control. This complexity ensures the proper expression in the proper cell at the proper time.
• 3.6.1: Introduction
Each somatic cell in the body generally contains the same DNA. A few exceptions include red blood cells, which contain no DNA in their mature state, and some immune system cells that rearrange their DNA while producing antibodies. In general, however, the genes that determine whether you have green eyes, brown hair, and how fast you metabolize food are the same in the cells in your eyes and your liver, even though these organs function quite differently.
• 3.6.2: Regulation of Gene Expression
The regulation of gene expression conserves energy and space. It would require a significant amount of energy for an organism to express every gene at all times, so it is more energy efficient to turn on the genes only when they are required. In addition, only expressing a subset of genes in each cell saves space because DNA must be unwound from its tightly coiled structure to transcribe and translate the DNA.
• 3.6.3: Prokaryotic Gene Regulation
The DNA of prokaryotes is organized into a circular chromosome supercoiled in the nucleoid region of the cell cytoplasm. Proteins that are needed for a specific function, or that are involved in the same biochemical pathway, are encoded together in blocks called operons. For example, all of the genes needed to use lactose as an energy source are coded next to each other in the lactose (or lac) operon.
• 3.6.4: Eukaryotic Epigenetic Gene Regulation
Eukaryotic gene expression is more complex than prokaryotic gene expression because the processes of transcription and translation are physically separated. Unlike prokaryotic cells, eukaryotic cells can regulate gene expression at many different levels. Eukaryotic gene expression begins with control of access to the DNA. This form of regulation, called epigenetic regulation, occurs even before transcription is initiated.
• 3.6.5: Eukaryotic Transcription Gene Regulation
Like prokaryotic cells, the transcription of genes in eukaryotes requires the actions of an RNA polymerase to bind to a sequence upstream of a gene to initiate transcription. However, unlike prokaryotic cells, the eukaryotic RNA polymerase requires other proteins, or transcription factors, to facilitate transcription initiation. Transcription factors are proteins that bind to the promoter sequence and other regulatory sequences to control the transcription of the target gene.
• 3.6.6: Eukaryotic Post-transcriptional Gene Regulation
RNA is transcribed, but must be processed into a mature form before translation can begin. This processing after an RNA molecule has been transcribed, but before it is translated into a protein, is called post-transcriptional modification. As with the epigenetic and transcriptional stages of processing, this post-transcriptional step can also be regulated to control gene expression in the cell. If the RNA is not processed, shuttled, or translated, then no protein will be synthesized.
• 3.6.7: Eukaryotic Translational and Post-translational Gene Regulation
After the RNA has been transported to the cytoplasm, it is translated into protein. Control of this process is largely dependent on the RNA molecule. As previously discussed, the stability of the RNA will have a large impact on its translation into a protein. As the stability changes, the amount of time that it is available for translation also changes.
• 3.6.8: Cancer and Gene Regulation
Cancer is not a single disease but includes many different diseases. In cancer cells, mutations modify cell-cycle control and cells don’t stop growing as they normally would. Mutations can also alter the growth rate or the progression of the cell through the cell cycle. One example of a gene modification that alters the growth rate is increased phosphorylation of cyclin B, a protein that controls the progression of a cell through the cell cycle and serves as a cell-cycle checkpoint protein.
• 3.6.9: Key Terms
• 3.6.10: Chapter Summary
• 3.6.11: Visual Connection Questions
• 3.6.12: Review Questions
• 3.6.13: Critical Thinking Questions
Thumbnail: Nucleosomes spaced far apart so that the DNA is exposed. Transcription factors can bind, allowing gene expression to occur. (CC BY 4.0 / modified from original; OpenStax).
3.06: Gene Expression
Figure 16.1 The genetic content of each somatic cell in an organism is the same, but not all genes are expressed in every cell. The control of which genes are expressed dictates whether a cell is, for example, (a) an eye cell or (b) a liver cell. It is the differential gene expression patterns that arise in different cells that give rise to (c) a complete organism.
Each somatic cell in the body generally contains the same DNA. A few exceptions include red blood cells, which contain no DNA in their mature state, and some immune system cells that rearrange their DNA while producing antibodies. In general, however, the genes that determine whether you have green eyes, brown hair, and how fast you metabolize food are the same in the cells in your eyes and your liver, even though these organs function quite differently. If each cell has the same DNA, how is it that cells or organs are different? Why do cells in the eye differ so dramatically from cells in the liver?
Whereas each cell shares the same genome and DNA sequence, each cell does not turn on, or express, the same set of genes. Each cell type needs a different set of proteins to perform its function. Therefore, only a small subset of proteins is expressed in a cell. For the proteins to be expressed, the DNA must be transcribed into RNA and the RNA must be translated into protein. In a given cell type, not all genes encoded in the DNA are transcribed into RNA or translated into protein because specific cells in our body have specific functions. Specialized proteins that make up the eye (iris, lens, and cornea) are only expressed in the eye, whereas the specialized proteins in the heart (pacemaker cells, heart muscle, and valves) are only expressed in the heart. At any given time, only a subset of all of the genes encoded by our DNA are expressed and translated into proteins. The expression of specific genes is a highly regulated process with many levels and stages of control. This complexity ensures the proper expression in the proper cell at the proper time.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.06%3A_Gene_Expression/3.6.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Discuss why every cell does not express all of its genes all of the time
• Describe how prokaryotic gene regulation occurs at the transcriptional level
• Discuss how eukaryotic gene regulation occurs at the epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels
For a cell to function properly, necessary proteins must be synthesized at the proper time and place. All cells control or regulate the synthesis of proteins from information encoded in their DNA. The process of turning on a gene to produce RNA and protein is called gene expression. Whether in a simple unicellular organism or a complex multi-cellular organism, each cell controls when and how its genes are expressed. For this to occur, there must be internal chemical mechanisms that control when a gene is expressed to make RNA and protein, how much of the protein is made, and when it is time to stop making that protein because it is no longer needed.
The regulation of gene expression conserves energy and space. It would require a significant amount of energy for an organism to express every gene at all times, so it is more energy efficient to turn on the genes only when they are required. In addition, only expressing a subset of genes in each cell saves space because DNA must be unwound from its tightly coiled structure to transcribe and translate the DNA. Cells would have to be enormous if every protein were expressed in every cell all the time.
The control of gene expression is extremely complex. Malfunctions in this process are detrimental to the cell and can lead to the development of many diseases, including cancer.
Prokaryotic versus Eukaryotic Gene Expression
To understand how gene expression is regulated, we must first understand how a gene codes for a functional protein in a cell. The process occurs in both prokaryotic and eukaryotic cells, just in slightly different manners.
Prokaryotic organisms are single-celled organisms that lack a cell nucleus, and their DNA therefore floats freely in the cell cytoplasm. To synthesize a protein, the processes of transcription and translation occur almost simultaneously. When the resulting protein is no longer needed, transcription stops. As a result, the primary method to control what type of protein and how much of each protein is expressed in a prokaryotic cell is the regulation of DNA transcription. All of the subsequent steps occur automatically. When more protein is required, more transcription occurs. Therefore, in prokaryotic cells, the control of gene expression is mostly at the transcriptional level.
Eukaryotic cells, in contrast, have intracellular organelles that add to their complexity. In eukaryotic cells, the DNA is contained inside the cell’s nucleus and there it is transcribed into RNA. The newly synthesized RNA is then transported out of the nucleus into the cytoplasm, where ribosomes translate the RNA into protein. The processes of transcription and translation are physically separated by the nuclear membrane; transcription occurs only within the nucleus, and translation occurs only outside the nucleus in the cytoplasm. The regulation of gene expression can occur at all stages of the process (Figure 16.3). Regulation may occur when the DNA is uncoiled and loosened from nucleosomes to bind transcription factors (epigenetic level), when the RNA is transcribed (transcriptional level), when the RNA is processed and exported to the cytoplasm after it is transcribed (post-transcriptional level), when the RNA is translated into protein (translational level), or after the protein has been made (post-translational level).
Figure 16.2 Locations of gene regulation. The regulation of gene expression occurs at multiple steps going from DNA to the functional gene product, usually a protein. It begins with chromatin structure making the DNA more or less accessible for transcription by RNA polymerase. In eukaryotes, the primary mRNA transcript must be processed before it can be translated in the cytoplasm. The final level of active protein in the cell depends not only on the rate of synthesis, but also on the rate of degradation of mRNA and protein. Credit: Rao, A. and Ryan, K. Department of Biology, Texas A&M University.
Figure 16.3 Regulation in prokaryotes and eukaryotes. A. Prokaryotic transcription and translation occur simultaneously in the cytoplasm, and regulation occurs primarily at the transcriptional level. B. Eukaryotic gene expression is regulated during transcription and RNA processing, which take place in the nucleus, and during protein translation, which takes place in the cytoplasm. Further regulation may occur through post-translational modifications of proteins in both prokaryotes and eukaryotes. Credit: Rao, A., Ryan, K. Fletcher, S. and Tag, A. Department of Biology, Texas A&M University.
The differences in the regulation of gene expression between prokaryotes and eukaryotes are summarized in Table 16.1. The regulation of gene expression is discussed in detail in subsequent modules.
Differences in the Regulation of Gene Expression of Prokaryotic and Eukaryotic Organisms
Prokaryotic organismsEukaryotic organisms
Lack a membrane-bound nucleusContain nucleus
DNA is found in the cytoplasmDNA is confined to the nuclear compartment
RNA transcription and protein formation occur almost simultaneouslyRNA transcription occurs prior to protein formation, and it takes place in the nucleus. Translation of RNA to protein occurs in the cytoplasm.
Gene expression is regulated primarily at the transcriptional levelGene expression is regulated at many levels (epigenetic, transcriptional, nuclear shuttling, post-transcriptional, translational, and post-translational)
Table 16.1
Evolution Connection
Evolution Connection
Evolution of Gene RegulationProkaryotic cells can only regulate gene expression by controlling the amount of transcription. As eukaryotic cells evolved, the complexity of the control of gene expression increased. For example, with the evolution of eukaryotic cells came compartmentalization of important cellular components and cellular processes. A nuclear region that contains the DNA was formed. Transcription and translation were physically separated into two different cellular compartments. It therefore became possible to control gene expression by regulating transcription in the nucleus, and also by controlling the RNA levels and protein translation present outside the nucleus.
Most gene regulation is done to conserve cell resources. However, other regulatory processes may be defensive. Cellular processes such as gene silencing developed to protect the cell from viral or parasitic infections. If the cell could quickly shut off gene expression for a short period of time, it would be able to survive an infection when other organisms could not. Therefore, the organism evolved a new process that helped it survive, and it was able to pass this new development to offspring.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.06%3A_Gene_Expression/3.6.02%3A_Regulation_of_Gene_Expression.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the steps involved in prokaryotic gene regulation
• Explain the roles of activators, inducers, and repressors in gene regulation
The DNA of prokaryotes is organized into a circular chromosome, supercoiled within the nucleoid region of the cell cytoplasm. Proteins that are needed for a specific function, or that are involved in the same biochemical pathway, are encoded together in blocks called operons. For example, all of the genes needed to use lactose as an energy source are coded next to each other in the lactose (or lac) operon, and transcribed into a single mRNA.
In prokaryotic cells, there are three types of regulatory molecules that can affect the expression of operons: repressors, activators, and inducers. Repressors and activators are proteins produced in the cell. Both repressors and activators regulate gene expression by binding to specific DNA sites adjacent to the genes they control. In general, activators bind to the promoter site, while repressors bind to operator regions. Repressors prevent transcription of a gene in response to an external stimulus, whereas activators increase the transcription of a gene in response to an external stimulus. Inducers are small molecules that may be produced by the cell or that are in the cell’s environment. Inducers either activate or repress transcription depending on the needs of the cell and the availability of substrate.
The trp Operon: A Repressible Operon
Bacteria such as Escherichia coli need amino acids to survive, and are able to synthesize many of them. Tryptophan is one such amino acid that E. coli can either ingest from the environment or synthesize using enzymes that are encoded by five genes. These five genes are next to each other in what is called the tryptophan (trp) operon (Figure 16.4). The genes are transcribed into a single mRNA, which is then translated to produce all five enzymes. If tryptophan is present in the environment, then E. coli does not need to synthesize it and the trp operon is switched off. However, when tryptophan availability is low, the switch controlling the operon is turned on, the mRNA is transcribed, the enzyme proteins are translated, and tryptophan is synthesized.
Figure 16.4 The tryptophan operon. The five genes that are needed to synthesize tryptophan in E. coli are located next to each other in the trp operon. When tryptophan is plentiful, two tryptophan molecules bind the repressor protein at the operator sequence. This physically blocks the RNA polymerase from transcribing the tryptophan genes. When tryptophan is absent, the repressor protein does not bind to the operator and the genes are transcribed.
The trp operon includes three important regions: the coding region, the trp operator and the trp promoter. The coding region includes the genes for the five tryptophan biosynthesis enzymes. Just before the coding region is the transcriptional start site. The promoter sequence, to which RNA polymerase binds to initiate transcription, is before or “upstream” of the transcriptional start site. Between the promoter and the transcriptional start site is the operator region.
The trp operator contains the DNA code to which the trp repressor protein can bind. However, the repressor alone cannot bind to the operator. When tryptophan is present in the cell, two tryptophan molecules bind to the trp repressor, which changes the shape of the repressor protein to a form that can bind to the trp operator. Binding of the tryptophan–repressor complex at the operator physically prevents the RNA polymerase from binding to the promoter and transcribing the downstream genes.
When tryptophan is not present in the cell, the repressor by itself does not bind to the operator, the polymerase can transcribe the enzyme genes, and tryptophan is synthesized. Because the repressor protein actively binds to the operator to keep the genes turned off, the trp operon is said to be negatively regulated and the proteins that bind to the operator to silence trp expression are negative regulators.
Link to Learning
Link to Learning
Watch this video to learn more about the trp operon.
Catabolite Activator Protein (CAP): A Transcriptional Activator
Just as the trp operon is negatively regulated by tryptophan molecules, there are proteins that bind to the promoter sequences that act as positive regulators to turn genes on and activate them. For example, when glucose is scarce, E. coli bacteria can turn to other sugar sources for fuel. To do this, new genes to process these alternate sugars must be transcribed. When glucose levels drop, cyclic AMP (cAMP) begins to accumulate in the cell. The cAMP molecule is a signaling molecule that is involved in glucose and energy metabolism in E. coli. Accumulating cAMP binds to the positive regulator catabolite activator protein (CAP), a protein that binds to the promoters of operons which control the processing of alternative sugars. When cAMP binds to CAP, the complex then binds to the promoter region of the genes that are needed to use the alternate sugar sources (Figure 16.5). In these operons, a CAP-binding site is located upstream of the RNA-polymerase-binding site in the promoter. CAP binding stabilizes the binding of RNA polymerase to the promoter region and increases transcription of the associated protein-coding genes.
Figure 16.5 Transcriptional activation by the CAP protein. When glucose levels fall, E. coli may use other sugars for fuel but must transcribe new genes to do so. As glucose supplies become limited, cAMP levels increase. This cAMP binds to the CAP protein, a positive regulator that binds to a promoter region upstream of the genes required to use other sugar sources.
The lac Operon: An Inducible Operon
The third type of gene regulation in prokaryotic cells occurs through inducible operons, which have proteins that bind to activate or repress transcription depending on the local environment and the needs of the cell. The lac operon is a typical inducible operon. As mentioned previously, E. coli is able to use other sugars as energy sources when glucose concentrations are low. One such sugar source is lactose. The lac operon encodes the genes necessary to acquire and process the lactose from the local environment. The Z gene of the lac operon encodes beta-galactosidase, which breaks lactose down to glucose and galactose.
However, for the lac operon to be activated, two conditions must be met. First, the level of glucose must be very low or non-existent. Second, lactose must be present. Only when glucose is absent and lactose is present will the lac operon be transcribed (Figure 16.6). In the absence of glucose, the binding of the CAP protein makes transcription of the lac operon more effective. When lactose is present, its metabolite, allolactose, binds to the lac repressor and changes its shape so that it cannot bind to the lac operator to prevent transcription. This combination of conditions makes sense for the cell, because it would be energetically wasteful to synthesize the enzymes to process lactose if glucose was plentiful or lactose was not available. It should be mentioned that the lac operon is transcribed at a very low rate even when glucose is present and lactose absent.
Visual Connection
Visual Connection
Figure 16.6 Regulation of the lac operon. Transcription of the lac operon is carefully regulated so that its expression only occurs when glucose is limited and lactose is present to serve as an alternative fuel source.
In E. coli, the trp operon is on by default, while the lac operon is off. Why do you think this is the case?
If glucose is present, then CAP fails to bind to the promoter sequence to activate transcription. If lactose is absent, then the repressor binds to the operator to prevent transcription. If either of these conditions is met, then transcription remains off. Only when glucose is absent and lactose is present is the lac operon transcribed (Table 16.2).
Signals that Induce or Repress Transcription of the lac Operon
GlucoseCAP bindsLactoseRepressor binds Transcription
+--+No
+-+-Some
-+-+No
-++-Yes
Table 16.2
Link to Learning
Link to Learning
Watch an animated tutorial about the workings of lac operon here.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.06%3A_Gene_Expression/3.6.03%3A_Prokaryotic_Gene_Regulation.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Explain how chromatin remodeling controls transcriptional access
• Describe how access to DNA is controlled by histone modification
• Describe how DNA methylation is related to epigenetic gene changes
Eukaryotic gene expression is more complex than prokaryotic gene expression because the processes of transcription and translation are physically separated. Unlike prokaryotic cells, eukaryotic cells can regulate gene expression at many different levels. Epigenetic changes are inheritable changes in gene expression that do not result from changes in the DNA sequence. Eukaryotic gene expression begins with control of access to the DNA. Transcriptional access to the DNA can be controlled in two general ways: chromatin remodeling and DNA methylation. Chromatin remodeling changes the way that DNA is associated with chromosomal histones. DNA methylation is associated with developmental changes and gene silencing.
Epigenetic Control: Regulating Access to Genes within the Chromosome
The human genome encodes over 20,000 genes, with hundreds to thousands of genes on each of the 23 human chromosomes. The DNA in the nucleus is precisely wound, folded, and compacted into chromosomes so that it will fit into the nucleus. It is also organized so that specific segments can be accessed as needed by a specific cell type.
The first level of organization, or packing, is the winding of DNA strands around histone proteins. Histones package and order DNA into structural units called nucleosome complexes, which can control the access of proteins to the DNA regions (Figure 16.7a). Under the electron microscope, this winding of DNA around histone proteins to form nucleosomes looks like small beads on a string (Figure 16.7b).
Figure 16.7 DNA is folded around histone proteins to create (a) nucleosome complexes. These nucleosomes control the access of proteins to the underlying DNA. When viewed through an electron microscope (b), the nucleosomes look like beads on a string. (credit “micrograph”: modification of work by Chris Woodcock)
These beads (histone proteins) can move along the string (DNA) to expose different sections of the molecule. If DNA encoding a specific gene is to be transcribed into RNA, the nucleosomes surrounding that region of DNA can slide down the DNA to open that specific chromosomal region and allow for the transcriptional machinery (RNA polymerase) to initiate transcription (Figure 16.8).
Visual Connection
Visual Connection
Figure 16.8 Nucleosomes can slide along DNA. When nucleosomes are spaced closely together (top), transcription factors cannot bind and gene expression is turned off. When the nucleosomes are spaced far apart (bottom), the DNA is exposed. Transcription factors can bind, allowing gene expression to occur. Modifications to the histones and DNA affect nucleosome spacing.
In females, one of the two X chromosomes is inactivated during embryonic development because of epigenetic changes to the chromatin. What impact do you think these changes would have on nucleosome packing?
How closely the histone proteins associate with the DNA is regulated by signals found on both the histone proteins and on the DNA. These signals are functional groups added to histone proteins or to DNA and determine whether a chromosomal region should be open or closed (Figure 16.9 depicts modifications to histone proteins and DNA). These tags are not permanent, but may be added or removed as needed. Some chemical groups (phosphate, methyl, or acetyl groups) are attached to specific amino acids in histone "tails" at the N-terminus of the protein. These groups do not alter the DNA base sequence, but they do alter how tightly wound the DNA is around the histone proteins. DNA is a negatively charged molecule and unmodified histones are positively charged; therefore, changes in the charge of the histone will change how tightly wound the DNA molecule will be. By adding chemical modifications like acetyl groups, the charge becomes less positive, and the binding of DNA to the histones is relaxed. Altering the location of nucleosomes and the tightness of histone binding opens some regions of chromatin to transcription and closes others.
The DNA molecule itself can also be modified by methylation. DNA methylation occurs within very specific regions called CpG islands. These are stretches with a high frequency of cytosine and guanine dinucleotide DNA pairs (CG) found in the promoter regions of genes. The cytosine member of the CG pair can be methylated (a methyl group is added). Methylated genes are usually silenced, although methylation may have other regulatory effects. In some cases, genes that are silenced during the development of the gametes of one parent are transmitted in their silenced condition to the offspring. Such genes are said to be imprinted. Parental diet or other environmental conditions may also affect the methylation patterns of genes, which in turn modifies gene expression. Changes in chromatin organization interact with DNA methylation. DNA methyltransferases appear to be attracted to chromatin regions with specific histone modifications. Highly methylated (hypermethylated) DNA regions with deacetylated histones are tightly coiled and transcriptionally inactive.
Figure 16.9 Histone proteins and DNA nucleotides can be modified chemically. Modifications affect nucleosome spacing and gene expression. (credit: modification of work by NIH)
Epigenetic changes are not permanent, although they often persist through multiple rounds of cell division and may even cross generational lines. Chromatin remodeling alters the chromosomal structure (open or closed) as needed. If a gene is to be transcribed, the histone proteins and DNA in the chromosomal region encoding that gene are modified in a way that opens the promoter region to allow RNA polymerase and other proteins, called transcription factors, to bind and initiate transcription. If a gene is to remain turned off, or silenced, the histone proteins and DNA have different modifications that signal a closed chromosomal configuration. In this closed configuration, the RNA polymerase and transcription factors do not have access to the DNA and transcription cannot occur (Figure 16.9).
Link to Learning
Link to Learning
View this video that describes how epigenetic regulation controls gene expression.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.06%3A_Gene_Expression/3.6.04%3A_Eukaryotic_Epigenetic_Gene_Regulation.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Discuss the role of transcription factors in gene regulation
• Explain how enhancers and repressors regulate gene expression
Like prokaryotic cells, the transcription of genes in eukaryotes requires the action of an RNA polymerase to bind to a DNA sequence upstream of a gene in order to initiate transcription. However, unlike prokaryotic cells, the eukaryotic RNA polymerase requires other proteins, or transcription factors, to facilitate transcription initiation. RNA polymerase by itself cannot initiate transcription in eukaryotic cells. There are two types of transcription factors that regulate eukaryotic transcription: General (or basal) transcription factors bind to the core promoter region to assist with the binding of RNA polymerase. Specific transcription factors bind to various regions outside of the core promoter region and interact with the proteins at the core promoter to enhance or repress the activity of the polymerase.
Link to Learning
Link to Learning
View the process of transcription—the making of RNA from a DNA template.
The Promoter and the Transcription Machinery
Genes are organized to make the control of gene expression easier. The promoter region is immediately upstream of the coding sequence. This region can be short (only a few nucleotides in length) or quite long (hundreds of nucleotides long). The longer the promoter, the more available space for proteins to bind. This also adds more control to the transcription process. The length of the promoter is gene-specific and can differ dramatically between genes. Consequently, the level of control of gene expression can also differ quite dramatically between genes. The purpose of the promoter is to bind transcription factors that control the initiation of transcription.
Within the core promoter region, 25 to 35 bases upstream of the transcriptional start site, resides the TATA box. The TATA box has the consensus sequence of 5’-TATAAA-3’. The TATA box is the binding site for a protein complex called TFIID, which contains a TATA-binding protein. Binding of TFIID recruits other transcription factors, including TFIIB, TFIIE, TFIIF, and TFIIH. Some of these transcription factors help to bind the RNA polymerase to the promoter, and others help to activate the transcription initiation complex.
In addition to the TATA box, other binding sites are found in some promoters. Some biologists prefer to restrict the range of the eukaryotic promoter to the core promoter, or polymerase binding site, and refer to these additional sites as promoter-proximal elements, because they are usually found within a few hundred base pairs upstream of the transcriptional start site. Examples of these elements are the CAAT box, with the consensus sequence 5’-CCAAT-3’ and the GC box, with the consensus sequence 5’-GGGCGG-3’. Specific transcription factors can bind to these promoter-proximal elements to regulate gene transcription. A given gene may have its own combination of these specific transcription-factor binding sites. There are hundreds of transcription factors in a cell, each of which binds specifically to a particular DNA sequence motif. When transcription factors bind to the promoter just upstream of the encoded gene, it is referred to as a cis-acting element, because it is on the same chromosome just next to the gene. Transcription factors respond to environmental stimuli that cause the proteins to find their binding sites and initiate transcription of the gene that is needed.
Enhancers and Transcription
In some eukaryotic genes, there are additional regions that help increase or enhance transcription. These regions, called enhancers, are not necessarily close to the genes they enhance. They can be located upstream of a gene, within the coding region of the gene, downstream of a gene, or may be thousands of nucleotides away.
Enhancer regions are binding sequences, or sites, for specific transcription factors. When a protein transcription factor binds to its enhancer sequence, the shape of the protein changes, allowing it to interact with proteins at the promoter site. However, since the enhancer region may be distant from the promoter, the DNA must bend to allow the proteins at the two sites to come into contact. DNA bending proteins help to bend the DNA and bring the enhancer and promoter regions together (Figure 16.10). This shape change allows for the interaction of the specific activator proteins bound to the enhancers with the general transcription factors bound to the promoter region and the RNA polymerase.
Figure 16.10 Interaction between proteins at the promoter and enhancer sites. An enhancer is a DNA sequence that promotes transcription. Each enhancer is made up of short DNA sequences called distal control elements. Activators bound to the distal control elements interact with mediator proteins and transcription factors. Two different genes may have the same promoter but different distal control elements, enabling differential gene expression.
Turning Genes Off: Transcriptional Repressors
Like prokaryotic cells, eukaryotic cells also have mechanisms to prevent transcription. Transcriptional repressors can bind to promoter or enhancer regions and block transcription. Like the transcriptional activators, repressors respond to external stimuli to prevent the binding of activating transcription factors.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.06%3A_Gene_Expression/3.6.05%3A_Eukaryotic_Transcription_Gene_Regulation.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Understand RNA splicing and explain its role in regulating gene expression
• Describe the importance of RNA stability in gene regulation
RNA is transcribed, but must be processed into a mature form before translation can begin. This processing that takes place after an RNA molecule has been transcribed, but before it is translated into a protein, is called post-transcriptional modification. As with the epigenetic and transcriptional stages of processing, this post-transcriptional step can also be regulated to control gene expression in the cell. If the RNA is not processed, shuttled, or translated, then no protein will be synthesized.
RNA Splicing, the First Stage of Post-transcriptional Control
In eukaryotic cells, the RNA transcript often contains regions, called introns, that are removed prior to translation. The regions of RNA that code for protein are called exons. (Figure 16.11). After an RNA molecule has been transcribed, but prior to its departure from the nucleus to be translated, the RNA is processed and the introns are removed by splicing. Splicing is done by spliceosomes, ribonucleoprotein complexes that can recognize the two ends of the intron, cut the transcript at those two points, and bring the exons together for ligation.
Figure 16.11 Pre-mRNA can be alternatively spliced to create different proteins.
Evolution Connection
Evolution Connection
Alternative RNA SplicingIn the 1970s, genes were first observed that exhibited alternative RNA splicing. Alternative RNA splicing is a mechanism that allows different protein products to be produced from one gene when different combinations of exons are combined to form the mRNA (Figure 16.12). This alternative splicing can be haphazard, but more often it is controlled and acts as a mechanism of gene regulation, with the frequency of different splicing alternatives controlled by the cell as a way to control the production of different protein products in different cells or at different stages of development. Alternative splicing is now understood to be a common mechanism of gene regulation in eukaryotes; according to one estimate, 70 percent of genes in humans are expressed as multiple proteins through alternative splicing. Although there are multiple ways to alternatively splice RNA transcripts, the original 5'-3' order of the exons is always conserved. That is, a transcript with exons 1 2 3 4 5 6 7 might be spliced 1 2 4 5 6 7 or 1 2 3 6 7, but never 1 2 5 4 3 6 7.
Figure 16.12 There are five basic modes of alternative splicing.
How could alternative splicing evolve? Introns have a beginning- and ending-recognition sequence; it is easy to imagine the failure of the splicing mechanism to identify the end of an intron and instead find the end of the next intron, thus removing two introns and the intervening exon. In fact, there are mechanisms in place to prevent such intron skipping, but mutations are likely to lead to their failure. Such “mistakes” would more than likely produce a nonfunctional protein. Indeed, the cause of many genetic diseases is abnormal splicing rather than mutations in a coding sequence. However, alternative splicing could possibly create a protein variant without the loss of the original protein, opening up possibilities for adaptation of the new variant to new functions. Gene duplication has played an important role in the evolution of new functions in a similar way by providing genes that may evolve without eliminating the original, functional protein.
Question: In the corn snake Pantherophis guttatus, there are several different color variants, including amelanistic snakes whose skin patterns display only red and yellow pigments. The cause of amelanism in these snakes was recently identified as the insertion of a transposable element into an intron in the OCA2 (oculocutaneous albinism) gene. How might the insertion of extra genetic material into an intron lead to a nonfunctional protein?
Link to Learning
Link to Learning
Visualize how mRNA splicing happens by watching the process in action in this video.
Control of RNA Stability
Before the mRNA leaves the nucleus, it is given two protective "caps" that prevent the ends of the strand from degrading during its journey. 5' and 3' exonucleases can degrade unprotected RNAs. The 5' cap, which is placed on the 5' end of the mRNA, is usually composed of a methylated guanosine triphosphate molecule (GTP). The GTP is placed "backward" on the 5' end of the mRNA, so that the 5' carbons of the GTP and the terminal nucleotide are linked through three phosphates. The poly-A tail, which is attached to the 3' end, is usually composed of a long chain of adenine nucleotides. These changes protect the two ends of the RNA from exonuclease attack.
Once the RNA is transported to the cytoplasm, the length of time that the RNA resides there can be controlled. Each RNA molecule has a defined lifespan and decays at a specific rate. This rate of decay can influence how much protein is in the cell. If the decay rate is increased, the RNA will not exist in the cytoplasm as long, shortening the time available for translation of the mRNA to occur. Conversely, if the rate of decay is decreased, the mRNA molecule will reside in the cytoplasm longer and more protein can be translated. This rate of decay is referred to as the RNA stability. If the RNA is stable, it will be detected for longer periods of time in the cytoplasm.
Binding of proteins to the RNA can also influence its stability. Proteins called RNA-binding proteins, or RBPs, can bind to the regions of the mRNA just upstream or downstream of the protein-coding region. These regions in the RNA that are not translated into protein are called the untranslated regions, or UTRs. They are not introns (those have been removed in the nucleus). Rather, these are regions that regulate mRNA localization, stability, and protein translation. The region just before the protein-coding region is called the 5' UTR, whereas the region after the coding region is called the 3' UTR (Figure 16.13). The binding of RBPs to these regions can increase or decrease the stability of an RNA molecule, depending on the specific RBP that binds.
Figure 16.13 RNA-binding proteins. The protein-coding region of this processed mRNA is flanked by 5' and 3' untranslated regions (UTRs). The presence of RNA-binding proteins at the 5' or 3' UTR influences the stability of the RNA molecule.
RNA Stability and microRNAs
In addition to RBPs that bind to and control (increase or decrease) RNA stability, other elements called microRNAs can bind to the RNA molecule. These microRNAs, or miRNAs, are short RNA molecules that are only 21 to 24 nucleotides in length. The miRNAs are made in the nucleus as longer pre-miRNAs. These pre-miRNAs are chopped into mature miRNAs by a protein called Dicer. Like transcription factors and RBPs, mature miRNAs recognize a specific sequence and bind to the RNA; however, miRNAs also associate with a ribonucleoprotein complex called the RNA-induced silencing complex (RISC). The RNA component of the RISC base-pairs with complementary sequences on an mRNA and either impede translation of the message or lead to the degradation of the mRNA.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.06%3A_Gene_Expression/3.6.06%3A_Eukaryotic_Post-transcriptional_Gene_Regulation.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Understand the process of translation and discuss its key factors
• Describe how the initiation complex controls translation
• Explain the different ways in which the post-translational control of gene expression takes place
After RNA has been transported to the cytoplasm, it is translated into protein. Control of this process is largely dependent on the RNA molecule. As previously discussed, the stability of the RNA will have a large impact on its translation into a protein. As the stability changes, the amount of time that it is available for translation also changes.
The Initiation Complex and Translation Rate
Like transcription, translation is controlled by proteins that bind and initiate the process. In translation, the complex that assembles to start the process is referred to as the translation initiation complex. In eukaryotes, translation is initiated by binding the initiating met-tRNAi to the 40S ribosome. This tRNA is brought to the 40S ribosome by a protein initiation factor, eukaryotic initiation factor-2 (eIF-2). The eIF-2 protein binds to the high-energy molecule guanosine triphosphate (GTP). The tRNA-eIF2-GTP complex then binds to the 40S ribosome. A second complex forms on the mRNA. Several different initiation factors recognize the 5' cap of the mRNA and proteins bound to the poly-A tail of the same mRNA, forming the mRNA into a loop. The cap-binding protein eIF4F brings the mRNA complex together with the 40S ribosome complex. The ribosome then scans along the mRNA until it finds a start codon AUG. When the anticodon of the initiator tRNA and the start codon are aligned, the GTP is hydrolyzed, the initiation factors are released, and the large 60S ribosomal subunit binds to form the translation complex. The binding of eIF-2 to the RNA is controlled by phosphorylation. If eIF-2 is phosphorylated, it undergoes a conformational change and cannot bind to GTP. Therefore, the initiation complex cannot form properly and translation is impeded (Figure 16.14). When eIF-2 remains unphosphorylated, the initiation complex can form normally and translation can proceed.
Visual Connection
Visual Connection
Figure 16.14 Gene expression can be controlled by factors that bind the translation initiation complex.
An increase in phosphorylation levels of eIF-2 has been observed in patients with neurodegenerative diseases such as Alzheimer’s, Parkinson’s, and Huntington’s. What impact do you think this might have on protein synthesis?
Chemical Modifications, Protein Activity, and Longevity
Proteins can be chemically modified with the addition of groups including methyl, phosphate, acetyl, and ubiquitin groups. The addition or removal of these groups from proteins regulates their activity or the length of time they exist in the cell. Sometimes these modifications can regulate where a protein is found in the cell—for example, in the nucleus, in the cytoplasm, or attached to the plasma membrane.
Chemical modifications occur in response to external stimuli such as stress, the lack of nutrients, heat, or ultraviolet light exposure. These changes can alter epigenetic accessibility, transcription, mRNA stability, or translation—all resulting in changes in expression of various genes. This is an efficient way for the cell to rapidly change the levels of specific proteins in response to the environment. Because proteins are involved in every stage of gene regulation, the phosphorylation of a protein (depending on the protein that is modified) can alter accessibility to the chromosome, can alter translation (by altering transcription factor binding or function), can change nuclear shuttling (by influencing modifications to the nuclear pore complex), can alter RNA stability (by binding or not binding to the RNA to regulate its stability), can modify translation (increase or decrease), or can change post-translational modifications (add or remove phosphates or other chemical modifications).
The addition of a ubiquitin group to a protein marks that protein for degradation. Ubiquitin acts like a flag indicating that the protein lifespan is complete. These proteins are moved to the proteasome, an organelle that functions to remove proteins, to be degraded (Figure 16.15). One way to control gene expression, therefore, is to alter the longevity of the protein.
Figure 16.15 Proteins with ubiquitin tags are marked for degradation within the proteasome.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.06%3A_Gene_Expression/3.6.07%3A_Eukaryotic_Translational_and_Post-translational_Gene_Regulation.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe how changes to gene expression can cause cancer
• Explain how changes to gene expression at different levels can disrupt the cell cycle
• Discuss how understanding regulation of gene expression can lead to better drug design
Cancer is not a single disease but includes many different diseases. In cancer cells, mutations modify cell-cycle control and cells don’t stop growing as they normally would. Mutations can also alter the growth rate or the progression of the cell through the cell cycle. One example of a gene modification that alters the growth rate is increased phosphorylation of cyclin B, a protein that controls the progression of a cell through the cell cycle and serves as a cell-cycle checkpoint protein.
For cells to move through each phase of the cell cycle, the cell must pass through checkpoints. This ensures that the cell has properly completed the step and has not encountered any mutation that will alter its function. Many proteins, including cyclin B, control these checkpoints. The phosphorylation of cyclin B, a post-translational event, alters its function. As a result, cells can progress through the cell cycle unimpeded, even if mutations exist in the cell and its growth should be terminated. This post-translational change of cyclin B prevents it from controlling the cell cycle and contributes to the development of cancer.
Cancer: Disease of Altered Gene Expression
Cancer can be described as a disease of altered gene expression. There are many proteins that are turned on or off (gene activation or gene silencing) that dramatically alter the overall activity of the cell. A gene that is not normally expressed in that cell can be switched on and expressed at high levels. This can be the result of gene mutation or changes in gene regulation (epigenetic, transcription, post-transcription, translation, or post-translation).
Changes in epigenetic regulation, transcription, RNA stability, protein translation, and post-translational control can be detected in cancer. While these changes don’t occur simultaneously in one cancer, changes at each of these levels can be detected when observing cancer at different sites in different individuals. Therefore, changes in histone acetylation (epigenetic modification that leads to gene expression), activation of transcription factors by phosphorylation, increased RNA stability, increased translational control, and protein modification can all be detected at some point in various cancer cells. Scientists are working to understand the common changes that give rise to certain types of cancer or how a modification might be exploited to destroy a tumor cell.
Tumor Suppressor Genes, Oncogenes, and Cancer
In normal cells, some genes function to prevent excess, inappropriate cell growth. These are tumor-suppressor genes, which are active in normal cells to prevent uncontrolled cell growth. There are many tumor-suppressor genes in cells. The most studied tumor-suppressor gene is p53, which is mutated in over 50 percent of all cancer types. The p53 protein itself functions as a transcription factor. It can bind to sites in the promoters of genes to initiate transcription. Therefore, the mutation of p53 in cancer will dramatically alter the transcriptional activity of its target genes.
Link to Learning
Link to Learning
Watch this animation to learn more about the use of p53 in fighting cancer.
Proto-oncogenes are positive cell-cycle regulators. When mutated, proto-oncogenes can become oncogenes and cause cancer. Overexpression of the oncogene can lead to uncontrolled cell growth. This is because oncogenes can alter transcriptional activity, stability, or protein translation of another gene that directly or indirectly controls cell growth. An example of an oncogene involved in cancer is a protein called myc. Myc is a transcription factor that is aberrantly activated in Burkett’s Lymphoma, a cancer of the lymph system. Overexpression of myc transforms normal B cells into cancerous cells that continue to grow uncontrollably. High B-cell numbers can result in tumors that can interfere with normal bodily function. Patients with Burkett’s lymphoma can develop tumors on their jaw or in their mouth that interfere with the ability to eat.
Cancer and Epigenetic Alterations
Silencing genes through epigenetic mechanisms is also very common in cancer cells. There are characteristic modifications to histone proteins and DNA that are associated with silenced genes. In cancer cells, the DNA in the promoter region of silenced genes is methylated on cytosine DNA residues in CpG islands. Histone proteins that surround that region lack the acetylation modification that is present when the genes are expressed in normal cells. This combination of DNA methylation and histone deacetylation (epigenetic modifications that lead to gene silencing) is commonly found in cancer. When these modifications occur, the gene present in that chromosomal region is silenced. Increasingly, scientists understand how epigenetic changes are altered in cancer. Because these changes are temporary and can be reversed—for example, by preventing the action of the histone deacetylase protein that removes acetyl groups, or by DNA methyl transferase enzymes that add methyl groups to cytosines in DNA—it is possible to design new drugs and new therapies to take advantage of the reversible nature of these processes. Indeed, many researchers are testing how a silenced gene can be switched back on in a cancer cell to help re-establish normal growth patterns.
Genes involved in the development of many other illnesses, ranging from allergies to inflammation to autism, are thought to be regulated by epigenetic mechanisms. As our knowledge of how genes are controlled deepens, new ways to treat diseases like cancer will emerge.
Cancer and Transcriptional Control
Alterations in cells that give rise to cancer can affect the transcriptional control of gene expression. Mutations that activate transcription factors, such as increased phosphorylation, can increase the binding of a transcription factor to its binding site in a promoter. This could lead to increased transcriptional activation of that gene that results in modified cell growth. Alternatively, a mutation in the DNA of a promoter or enhancer region can increase the binding ability of a transcription factor. This could also lead to the increased transcription and aberrant gene expression that is seen in cancer cells.
Researchers have been investigating how to control the transcriptional activation of gene expression in cancer. Identifying how a transcription factor binds, or a pathway that activates where a gene can be turned off, has led to new drugs and new ways to treat cancer. In breast cancer, for example, many proteins are overexpressed. This can lead to increased phosphorylation of key transcription factors that increase transcription. One such example is the overexpression of the epidermal growth-factor receptor (EGFR) in a subset of breast cancers. The EGFR pathway activates many protein kinases that, in turn, activate many transcription factors which control genes involved in cell growth. New drugs that prevent the activation of EGFR have been developed and are used to treat these cancers.
Cancer and Post-transcriptional Control
Changes in the post-transcriptional control of a gene can also result in cancer. Recently, several groups of researchers have shown that specific cancers have altered expression of miRNAs. Because miRNAs bind to the 3' UTR of RNA molecules to degrade them, overexpression of these miRNAs could be detrimental to normal cellular activity. Too many miRNAs could dramatically decrease the RNA population, leading to a decrease in protein expression. Several studies have demonstrated a change in the miRNA population in specific cancer types. It appears that the subset of miRNAs expressed in breast cancer cells is quite different from the subset expressed in lung cancer cells or even from normal breast cells. This suggests that alterations in miRNA activity can contribute to the growth of breast cancer cells. These types of studies also suggest that if some miRNAs are specifically expressed only in cancer cells, they could be potential drug targets. It would, therefore, be conceivable that new drugs that turn off miRNA expression in cancer could be an effective method to treat cancer.
Cancer and Translational/Post-translational Control
There are many examples of how translational or post-translational modifications of proteins arise in cancer. Modifications are found in cancer cells from the increased translation of a protein to changes in protein phosphorylation to alternative splice variants of a protein. An example of how the expression of an alternative form of a protein can have dramatically different outcomes is seen in colon cancer cells. The c-Flip protein, a protein involved in mediating the cell-death pathway, comes in two forms: long (c-FLIPL) and short (c-FLIPS). Both forms appear to be involved in initiating controlled cell-death mechanisms in normal cells. However, in colon cancer cells, expression of the long form results in increased cell growth instead of cell death. Clearly, the expression of the wrong protein dramatically alters cell function and contributes to the development of cancer.
New Drugs to Combat Cancer: Targeted Therapies
Scientists are using what is known about the regulation of gene expression in disease states, including cancer, to develop new ways to treat and prevent disease development. Many scientists are designing drugs on the basis of the gene expression patterns within individual tumors. This idea, that therapy and medicines can be tailored to an individual, has given rise to the field of personalized medicine. With an increased understanding of gene regulation and gene function, medicines can be designed to specifically target diseased cells without harming healthy cells. Some new medicines, called targeted therapies, have exploited the overexpression of a specific protein or the mutation of a gene to develop a new medication to treat disease. One such example is the use of anti-EGF receptor medications to treat the subset of breast cancer tumors that have very high levels of the EGF protein. Undoubtedly, more targeted therapies will be developed as scientists learn more about how gene expression changes can cause cancer.
Career Connection
Career Connection
Clinical Trial CoordinatorA clinical trial coordinator is the person managing the proceedings of the clinical trial. This job includes coordinating patient schedules and appointments, maintaining detailed notes, building the database to track patients (especially for long-term follow-up studies), ensuring proper documentation has been acquired and accepted, and working with the nurses and doctors to facilitate the trial and publication of the results. A clinical trial coordinator may have a science background, like a nursing degree, or other certification. People who have worked in science labs or in clinical offices are also qualified to become a clinical trial coordinator. These jobs are generally in hospitals; however, some clinics and doctor’s offices also conduct clinical trials and may hire a coordinator.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.06%3A_Gene_Expression/3.6.08%3A_Cancer_and_Gene_Regulation.txt
|
3' UTR
3' untranslated region; region just downstream of the protein-coding region in an RNA molecule that is not translated
5' cap
a methylated guanosine triphosphate (GTP) molecule that is attached to the 5' end of a messenger RNA to protect the end from degradation
5' UTR
5' untranslated region; region just upstream of the protein-coding region in an RNA molecule that is not translated
activator
protein that binds to prokaryotic operators to increase transcription
catabolite activator protein (CAP)
protein that complexes with cAMP to bind to the promoter sequences of operons which control sugar processing when glucose is not available
cis-acting element
transcription factor binding sites within the promoter that regulate the transcription of a gene adjacent to it
Dicer
enzyme that chops the pre-miRNA into the mature form of the miRNA
DNA methylation
epigenetic modification that leads to gene silencing; a process involving adding a methyl group to the DNA molecule
enhancer
segment of DNA that is upstream, downstream, perhaps thousands of nucleotides away, or on another chromosome that influence the transcription of a specific gene
epigenetic
heritable changes that do not involve changes in the DNA sequence
eukaryotic initiation factor-2 (eIF-2)
protein that binds first to an mRNA to initiate translation
gene expression
processes that control the turning on or turning off of a gene
guanine diphosphate (GDP)
molecule that is left after the energy is used to start translation
guanine triphosphate (GTP)
energy-providing molecule that binds to eIF-2 and is needed for translation
histone acetylation
epigenetic modification that leads to gene expression; a process involving adding or removing an acetyl functional group
inducible operon
operon that can be activated or repressed depending on cellular needs and the surrounding environment
initiation complex
protein complex containing eIF-2 that starts translation
lac operon
operon in prokaryotic cells that encodes genes required for processing and intake of lactose
large 60S ribosomal subunit
second, larger ribosomal subunit that binds to the RNA to translate it into protein
microRNA (miRNA)
small RNA molecules (approximately 21 nucleotides in length) that bind to RNA molecules to degrade them
myc
oncogene that causes cancer in many cancer cells
negative regulator
protein that prevents transcription
operator
region of DNA outside of the promoter region that binds activators or repressors that control gene expression in prokaryotic cells
operon
collection of genes involved in a pathway that are transcribed together as a single mRNA in prokaryotic cells
poly-A tail
a series of adenine nucleotides that are attached to the 3' end of an mRNA to protect the end from degradation
positive regulator
protein that increases transcription
post-transcriptional
control of gene expression after the RNA molecule has been created but before it is translated into protein
post-translational
control of gene expression after a protein has been created
proteasome
organelle that degrades proteins
repressor
protein that binds to the operator of prokaryotic genes to prevent transcription
RISC
protein complex that binds along with the miRNA to the RNA to degrade it
RNA stability
how long an RNA molecule will remain intact in the cytoplasm
RNA-binding protein (RBP)
protein that binds to the 3' or 5' UTR to increase or decrease the RNA stability
small 40S ribosomal subunit
ribosomal subunit that binds to the RNA to translate it into protein
trans-acting element
transcription factor binding site found outside the promoter or on another chromosome that influences the transcription of a particular gene
transcription factor
protein that binds to the DNA at the promoter or enhancer region and that influences transcription of a gene
transcription factor binding site
sequence of DNA to which a transcription factor binds
transcriptional start site
site at which transcription begins
trp operon
series of genes necessary to synthesize tryptophan in prokaryotic cells
tryptophan
amino acid that can be synthesized by prokaryotic cells when necessary
untranslated region
segment of the RNA molecule that is not translated into protein. These regions lie before (upstream or 5') and after (downstream or 3') the protein-coding region
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.06%3A_Gene_Expression/3.6.09%3A_Key_Terms.txt
|
16.1 Regulation of Gene Expression
While all somatic cells within an organism contain the same DNA, not all cells within that organism express the same proteins. Prokaryotic organisms express most of their genes most of the time. However, some genes are expressed only when they are needed. Eukaryotic organisms, on the other hand, express only a subset of their genes in any given cell. To express a protein, the DNA is first transcribed into RNA, which is then translated into proteins, which are then targeted to specific cellular locations. In prokaryotic cells, transcription and translation occur almost simultaneously. In eukaryotic cells, transcription occurs in the nucleus and is separate from the translation that occurs in the cytoplasm. Gene expression in prokaryotes is mostly regulated at the transcriptional level (some epigenetic and post-translational regulation is also present), whereas in eukaryotic cells, gene expression is regulated at the epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels.
16.2 Prokaryotic Gene Regulation
The regulation of gene expression in prokaryotic cells occurs at the transcriptional level. There are two majors kinds of proteins that control prokaryotic transcription: repressors and activators. Repressors bind to an operator region to block the action of RNA polymerase. Activators bind to the promoter to enhance the binding of RNA polymerase. Inducer molecules can increase transcription either by inactivating repressors or by activating activator proteins. In the trp operon, the trp repressor is itself activated by binding to tryptophan. Therefore, if tryptophan is not needed, the repressor is bound to the operator and transcription remains off. The lac operon is activated by the CAP (catabolite activator protein), which binds to the promoter to stabilize RNA polymerase binding. CAP is itself activated by cAMP, whose concentration rises as the concentration of glucose falls. However, the lac operon also requires the presence of lactose for transcription to occur. Lactose inactivates the lac repressor, and prevents the repressor protein from binding to the lac operator. With the repressor inactivated, transcription may proceed. Therefore glucose must be absent and lactose must be present for effective transcription of the lac operon.
16.3 Eukaryotic Epigenetic Gene Regulation
In eukaryotic cells, the first stage of gene-expression control occurs at the epigenetic level. Epigenetic mechanisms control access to the chromosomal region to allow genes to be turned on or off. Chromatin remodeling controls how DNA is packed into the nucleus by regulating how tightly the DNA is wound around histone proteins. The DNA itself may be methylated to selectively silence genes. The addition or removal of chemical modifications (or flags) to histone proteins or DNA signals the cell to open or close a chromosomal region. Therefore, eukaryotic cells can control whether a gene is expressed by controlling accessibility to the binding of RNA polymerase and its transcription factors.
16.4 Eukaryotic Transcription Gene Regulation
To start transcription, general transcription factors, such as TFIID, TFIIB, and others, must first bind to the TATA box and recruit RNA polymerase to that location. Additional transcription factors may also bind to other regulatory elements at the promoter to increase or prevent transcription. In addition to promoter sequences, enhancer regions help augment transcription. Enhancers can be upstream, downstream, within a gene itself, or on other chromosomes. Specific transcription factors bound to enhancer regions may either increase or prevent transcription.
16.5 Eukaryotic Post-transcriptional Gene Regulation
Post-transcriptional control can occur at any stage after transcription, including RNA splicing and RNA stability. Once RNA is transcribed, it must be processed to create a mature RNA that is ready to be translated. This involves the removal of introns that do not code for protein. Spliceosomes bind to the signals that mark the exon/intron border to remove the introns and ligate the exons together. Once this occurs, the RNA is mature and can be translated. Alternative splicing can produce more than one mRNA from a given transcript. Different splicing variants may be produced under different conditions.
RNA is created and spliced in the nucleus, but needs to be transported to the cytoplasm to be translated. RNA is transported to the cytoplasm through the nuclear pore complex. Once the RNA is in the cytoplasm, the length of time it resides there before being degraded, called RNA stability, can also be altered to control the overall amount of protein that is synthesized. The RNA stability can be increased, leading to longer residency time in the cytoplasm, or decreased, leading to shortened time and less protein synthesis. RNA stability is controlled by RNA-binding proteins (RPBs) and microRNAs (miRNAs). These RPBs and miRNAs bind to the 5' UTR or the 3' UTR of the RNA to increase or decrease RNA stability. MicroRNAs associated with RISC complexes may repress translation or lead to mRNA breakdown.
16.6 Eukaryotic Translational and Post-translational Gene Regulation
Changing the status of the RNA or the protein itself can affect the amount of protein, the function of the protein, or how long it is found in the cell. To translate the protein, a protein initiator complex must assemble on the RNA. Modifications (such as phosphorylation) of proteins in this complex can prevent proper translation from occurring. Once a protein has been synthesized, it can be modified (phosphorylated, acetylated, methylated, or ubiquitinated). These post-translational modifications can greatly impact the stability, degradation, or function of the protein.
16.7 Cancer and Gene Regulation
Cancer can be described as a disease of altered gene expression. Changes at every level of eukaryotic gene expression can be detected in some form of cancer at some point in time. In order to understand how changes to gene expression can cause cancer, it is critical to understand how each stage of gene regulation works in normal cells. By understanding the mechanisms of control in normal, non-diseased cells, it will be easier for scientists to understand what goes wrong in disease states including complex ones like cancer.
3.6.11: Visual Connection Questions
1.
Figure 16.6 In E. coli, the trp operon is on by default, while the lac operon is off. Why do you think that this is the case?
2.
Figure 16.8 In females, one of the two X chromosomes is inactivated during embryonic development because of epigenetic changes to the chromatin. What impact do you think these changes would have on nucleosome packing?
3.
Figure 16.14 An increase in phosphorylation levels of eIF-2 has been observed in patients with neurodegenerative diseases such as Alzheimer’s, Parkinson’s, and Huntington’s. What impact do you think this might have on protein synthesis?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.06%3A_Gene_Expression/3.6.10%3A_Chapter_Summary.txt
|
4.
Control of gene expression in eukaryotic cells occurs at which level(s)?
1. only the transcriptional level
2. epigenetic and transcriptional levels
3. epigenetic, transcriptional, and translational levels
4. epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels
5.
Post-translational control refers to:
1. regulation of gene expression after transcription
2. regulation of gene expression after translation
3. control of epigenetic activation
4. period between transcription and translation
6.
How does the regulation of gene expression support continued evolution of more complex organisms?
1. Cells can become specialized within a multicellular organism.
2. Organisms can conserve energy and resources.
3. Cells grow larger to accommodate protein production.
4. Both A and B.
7.
If glucose is absent, but so is lactose, the lac operon will be ________.
1. activated
2. repressed
3. activated, but only partially
4. mutated
8.
Prokaryotic cells lack a nucleus. Therefore, the genes in prokaryotic cells are:
1. all expressed, all of the time
2. transcribed and translated almost simultaneously
3. transcriptionally controlled because translation begins before transcription ends
4. b and c are both true
9.
The ara operon is an inducible operon that controls the breakdown of the sugar arabinose. When arabinose is present in a bacterium it binds to the protein AraC, and the complex binds to the initiator site to promote transcription. In this scenario, AraC is a(n) ________.
1. activator
2. inducer
3. repressor
4. operator
10.
What are epigenetic modifications?
1. the addition of reversible changes to histone proteins and DNA
2. the removal of nucleosomes from the DNA
3. the addition of more nucleosomes to the DNA
4. mutation of the DNA sequence
11.
Which of the following are true of epigenetic changes?
1. allow DNA to be transcribed
2. move histones to open or close a chromosomal region
3. are temporary
4. all of the above
12.
The binding of ________ is required for transcription to start.
1. a protein
2. DNA polymerase
3. RNA polymerase
4. a transcription factor
13.
What will result from the binding of a transcription factor to an enhancer region?
1. decreased transcription of an adjacent gene
2. increased transcription of a distant gene
3. alteration of the translation of an adjacent gene
4. initiation of the recruitment of RNA polymerase
14.
A scientist compares the promoter regions of two genes. Gene A’s core promoter plus proximal promoter elements encompasses 70bp. Gene B’s core promoter plus proximal promoter elements encompasses 250bp. Which of the scientist’s hypotheses is most likely to be correct?
1. More transcripts will be made from Gene B.
2. Transcription of Gene A involves fewer transcription factors.
3. Enhancers control Gene B’s transcription.
4. Transcription of Gene A is more controlled than transcription of Gene B.
15.
Which of the following are involved in post-transcriptional control?
1. control of RNA splicing
2. control of RNA shuttling
3. control of RNA stability
4. all of the above
16.
Binding of an RNA binding protein will ________ the stability of the RNA molecule.
1. increase
2. decrease
3. neither increase nor decrease
4. either increase or decrease
17.
An unprocessed pre-mRNA has the following structure.
Which of the following is not a possible size (in bp) of the mature mRNA?
1. 205bp
2. 180bp
3. 150bp
4. 100bp
18.
Alternative splicing has been estimated to occur in more than 95% of multi-exon genes. Which of the following is not an evolutionary advantage of alternative splicing?
1. Alternative splicing increases diversity without increasing genome size.
2. Different gene isoforms can be expressed in different tissues.
3. Alternative splicing creates shorter mRNA transcripts.
4. Different gene isoforms can be expressed during different stages of development.
19.
Post-translational modifications of proteins can affect which of the following?
1. protein function
2. transcriptional regulation
3. chromatin modification
4. all of the above
20.
A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of eIF-2 alter translation?
1. Initiation factors would not be able to bind to mRNA.
2. The large ribosomal subunit would not be able to interact with mRNA transcripts.
3. tRNAi-Met would not scan mRNA transcripts for the start codon.
4. eIF-2 would not be able to interact with the small ribosomal subunit.
21.
Cancer causing genes are called ________.
1. transformation genes
2. tumor suppressor genes
3. oncogenes
4. mutated genes
22.
Targeted therapies are used in patients with a set gene expression pattern. A targeted therapy that prevents the activation of the estrogen receptor in breast cancer would be beneficial to which type of patient?
1. patients who express the EGFR receptor in normal cells
2. patients with a mutation that inactivates the estrogen receptor
3. patients with lots of the estrogen receptor expressed in their tumor
4. patients that have no estrogen receptor expressed in their tumor
3.6.13: Critical Thinking Questions
23.
Name two differences between prokaryotic and eukaryotic cells and how these differences benefit multicellular organisms.
24.
Describe how controlling gene expression will alter the overall protein levels in the cell.
25.
Describe how transcription in prokaryotic cells can be altered by external stimulation such as excess lactose in the environment.
26.
What is the difference between a repressible and an inducible operon?
27.
In cancer cells, alteration to epigenetic modifications turns off genes that are normally expressed. Hypothetically, how could you reverse this process to turn these genes back on?
28.
A scientific study demonstrated that rat mothering behavior impacts the stress response in their pups. Rats that were born and grew up with attentive mothers showed low activation of stress-response genes later in life, while rats with inattentive mothers had high activation of stress-response genes in the same situation. An additional study that swapped the pups at birth (i.e., rats born to inattentive mothers grew up with attentive mothers and vice versa) showed the same positive effect of attentive mothering. How do genetics and/or epigenetics explain the results of this study?
29.
Some autoimmune diseases show a positive correlation with dramatically decreased expression of histone deacetylase 9 (HDAC9, an enzyme that removes acetyl groups from histones). Why would the decreased expression of HDAC9 cause immune cells to produce inflammatory genes at inappropriate times?
30.
A mutation within the promoter region can alter transcription of a gene. Describe how this can happen.
31.
What could happen if a cell had too much of an activating transcription factor present?
32.
A scientist identifies a potential transcription regulation site 300bp downstream of a gene and hypothesizes that it is a repressor. What experiment (with results) could he perform to support this hypothesis?
33.
Describe how RBPs can prevent miRNAs from degrading an RNA molecule.
34.
How can external stimuli alter post-transcriptional control of gene expression?
35.
Protein modification can alter gene expression in many ways. Describe how phosphorylation of proteins can alter gene expression.
36.
Alternative forms of a protein can be beneficial or harmful to a cell. What do you think would happen if too much of an alternative protein bound to the 3' UTR of an RNA and caused it to degrade?
37.
Changes in epigenetic modifications alter the accessibility and transcription of DNA. Describe how environmental stimuli, such as ultraviolet light exposure, could modify gene expression.
38.
A scientist discovers a virus encoding a Protein X that degrades a subunit of the eIF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?
39.
New drugs are being developed that decrease DNA methylation and prevent the removal of acetyl groups from histone proteins. Explain how these drugs could affect gene expression to help kill tumor cells.
40.
How can understanding the gene expression pattern in a cancer cell tell you something about that specific form of cancer?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.06%3A_Gene_Expression/3.6.12%3A_Review_Questions.txt
|
• 3.7.1: Introduction
The study of nucleic acids began with the discovery of DNA, progressed to the study of genes and small fragments, and has now exploded to the field of genomics. Genomics is the study of entire genomes, including the complete set of genes, their nucleotide sequence and organization, and their interactions within a species and with other species. The advances in genomics have been made possible by DNA sequencing technology.
• 3.7.2: Biotechnology
Biotechnology is the use of biological agents for technological advancement. Biotechnology was used for breeding livestock and crops long before the scientific basis of these techniques was understood. Biotechnology has grown rapidly through both academic research and private companies. The primary applications of this technology are in medicine (production of vaccines and antibiotics) and agriculture (genetic modification of crops, such as to increase yields).
• 3.7.3: Mapping Genomes
Genome mapping is the process of finding the locations of genes on each chromosome. The maps created by genome mapping are comparable to the maps that we use to navigate streets. A genetic map is an illustration that lists genes and their location on a chromosome. Genetic maps provide the big picture and use genetic markers. A genetic marker is a gene or sequence on a chromosome that co-segregates (shows genetic linkage) with a specific trait.
• 3.7.4: Whole-Genome Sequencing
Although there have been significant advances in the medical sciences in recent years, doctors are still confounded by some diseases, and they are using whole-genome sequencing to get to the bottom of the problem. Whole-genome sequencing is a process that determines the DNA sequence of an entire genome. Whole-genome sequencing is a brute-force approach to problem solving when there is a genetic basis at the core of a disease.
• 3.7.5: Applying Genomics
The introduction of DNA sequencing and whole genome sequencing projects, particularly the Human Genome project, has expanded the applicability of DNA sequence information. Genomics is now being used in a wide variety of fields, such as metagenomics, pharmacogenomics, and mitochondrial genomics. The most commonly known application of genomics is to understand and find cures for diseases.
• 3.7.6: Genomics and Proteomics
Proteins are the final products of genes, which help perform the function encoded by the gene. Proteins are composed of amino acids and play important roles in the cell. All enzymes (except ribozymes) are proteins that act as catalysts to affect the rate of reactions. Proteins are also regulatory molecules, and some are hormones. Transport proteins, such as hemoglobin, help transport oxygen to various organs. Antibodies that defend against foreign particles are also proteins.
• 3.7.7: Key Terms
• 3.7.8: Chapter Summary
• 3.7.9: Visual Connection Questions
• 3.7.10: Review Questions
• 3.7.11: Critical Thinking Questions
Thumbnail: Gel electrophoresis. (CC BY-SA 3.0; Mnolf via Wikimedia Commons).
3.07: Biotechnology and Genomics
Figure 17.1 Genomics compares the DNA of different organisms, enabling scientists to create maps with which to navigate different organisms' DNA. (credit "map": modification of photo by NASA)
The study of nucleic acids began with the discovery of DNA, progressed to the study of genes and small fragments, and has now exploded to the field of genomics. Genomics is the study of entire genomes, including the complete set of genes, their nucleotide sequence and organization, and their interactions within a species and with other species. DNA sequencing technology has contributed to advances in genomics. Just as information technology has led to Google maps that enable people to obtain detailed information about locations around the globe, researchers use genomic information to create similar DNA maps of different organisms. These findings have helped anthropologists to better understand human migration and have aided the medical field through mapping human genetic diseases. Genomic information can contribute to scientific understanding in various ways and knowledge in the field is quickly growing.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.07%3A_Biotechnology_and_Genomics/3.7.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe gel electrophoresis
• Explain molecular and reproductive cloning
• Describe biotechnology uses in medicine and agriculture
Biotechnology is the use of biological agents for technological advancement. Biotechnology was used for breeding livestock and crops long before people understood the scientific basis of these techniques. Since the discovery of the structure of DNA in 1953, the biotechnology field has grown rapidly through both academic research and private companies. The primary applications of this technology are in medicine (vaccine and antibiotic production) and agriculture (crop genetic modification in order to increase yields). Biotechnology also has many industrial applications, such as fermentation, treating oil spills, and producing biofuels (Figure 17.2).
Figure 17.2 Fungi, bacteria, and other organisms that have antimicrobial properties produce antibiotics. The first antibiotic discovered was penicillin. Pharmaceutical companies now commercially produce and test antibiotics for their potential to inhibit bacterial growth. (credit "advertisement": modification of work by NIH; credit "test plate": modification of work by Don Stalons/CDC; scale-bar data from Matt Russell)
Basic Techniques to Manipulate Genetic Material (DNA and RNA)
To understand the basic techniques used to work with nucleic acids, remember that nucleic acids are macromolecules made of nucleotides (a sugar, a phosphate, and a nitrogenous base) linked by phosphodiester bonds. The phosphate groups on these molecules each have a net negative charge. An entire set of DNA molecules in the nucleus is called the genome. DNA has two complementary strands linked by hydrogen bonds between the paired bases. Exposure to high temperatures (DNA denaturation) can separate the two strands and cooling can reanneal them. The DNA polymerase enzyme can replicate the DNA. Unlike DNA, which is located in the eukaryotic cells' nucleus, RNA molecules leave the nucleus. The most common type of RNA that researchers analyze is the messenger RNA (mRNA) because it represents the protein-coding genes that are actively expressed. However, RNA molecules present some other challenges to analysis, as they are often less stable than DNA.
DNA and RNA Extraction
To study or manipulate nucleic acids, one must first isolate or extract the DNA or RNA from the cells. Researchers use various techniques to extract different types of DNA (Figure 17.3). Most nucleic acid extraction techniques involve steps to break open the cell and use enzymatic reactions to destroy all macromolecules that are not desired (such as unwanted molecule degradation and separation from the DNA sample). A lysis buffer (a solution which is mostly a detergent) breaks cells. Note that lysis means "to split". These enzymes break apart lipid molecules in the cell membranes and nuclear membranes. Enzymes such as proteases that break down proteins inactivate macromolecules, and ribonucleases (RNAses) that break down RNA. Using alcohol precipitates the DNA. Human genomic DNA is usually visible as a gelatinous, white mass. One can store the DNA samples frozen at –80°C for several years.
Figure 17.3 This diagram shows the basic method of DNA extraction.
Scientists perform RNA analysis to study gene expression patterns in cells. RNA is naturally very unstable because RNAses are commonly present in nature and very difficult to inactivate. Similar to DNA, RNA extraction involves using various buffers and enzymes to inactivate macromolecules and preserve the RNA.
Gel Electrophoresis
Because nucleic acids are negatively charged ions at neutral or basic pH in an aqueous environment, an electric field can mobilize them. Gel electrophoresis is a technique that scientists use to separate molecules on the basis of size, using this charge. One can separate the nucleic acids as whole chromosomes or fragments. The nucleic acids load into a slot near the semisolid, porous gel matrix's negative electrode, and pulled toward the positive electrode at the gel's opposite end. Smaller molecules move through the gel's pores faster than larger molecules. This difference in the migration rate separates the fragments on the basis of size. There are molecular weight standard samples that researchers can run alongside the molecules to provide a size comparison. We can observe nucleic acids in a gel matrix using various fluorescent or colored dyes. Distinct nucleic acid fragments appear as bands at specific distances from the gel's top (the negative electrode end) on the basis of their size (Figure 17.4). A mixture of genomic DNA fragments of varying sizes appear as a long smear; whereas, uncut genomic DNA is usually too large to run through the gel and forms a single large band at the gel's top.
Figure 17.4 a) Shown are DNA fragments from seven samples run on a gel, stained with a fluorescent dye, and viewed under UV light; and b) a researcher from International Rice Research Institute, reviewing DNA profiles using UV light. (credit: a: James Jacob, Tompkins Cortland Community College b: International Rice Research Institute)
Nucleic Acid Fragment Amplification by Polymerase Chain Reaction
Although genomic DNA is visible to the naked eye when it is extracted in bulk, DNA analysis often requires focusing on one or more specific genome regions. Polymerase chain reaction (PCR) is a technique that scientists use to amplify specific DNA regions for further analysis (Figure 17.5). Researchers use PCR for many purposes in laboratories, such as cloning gene fragments to analyze genetic diseases, identifying contaminant foreign DNA in a sample, and amplifying DNA for sequencing. More practical applications include determining paternity and detecting genetic diseases.
Figure 17.5 Scientists use polymerase chain reaction, or PCR, to amplify a specific DNA sequence. Primers—short pieces of DNA complementary to each end of the target sequence combine with genomic DNA, Taq polymerase, and deoxynucleotides. Taq polymerase is a DNA polymerase isolated from the thermostable bacterium Thermus aquaticus that is able to withstand the high temperatures that scientists use in PCR. Thermus aquaticus grows in the Lower Geyser Basin of Yellowstone National Park. Reverse transcriptase PCR (RT-PCR) is similar to PCR, but cDNA is made from an RNA template before PCR begins.
DNA fragments can also be amplified from an RNA template in a process called reverse transcriptase PCR (RT-PCR). The first step is to recreate the original DNA template strand (called cDNA) by applying DNA nucleotides to the mRNA. This process is called reverse transcription. This requires the presence of an enzyme called reverse transcriptase. After the cDNA is made, regular PCR can be used to amplify it.
Link to Learning
Link to Learning
Deepen your understanding of the polymerase chain reaction by watching this video.
Hybridization, Southern Blotting, and Northern Blotting
Scientists can probe nucleic acid samples, such as fragmented genomic DNA and RNA extracts, for the presence of certain sequences. Scientists design and label short DNA fragments, or probes with radioactive or fluorescent dyes to aid detection. Gel electrophoresis separates the nucleic acid fragments according to their size. Scientists then transfer the fragments in the gel onto a nylon membrane in a procedure we call blotting (Figure 17.6). Scientists can then probe the nucleic acid fragments that are bound to the membrane's surface with specific radioactively or fluorescently labeled probe sequences. When scientists transfer DNA to a nylon membrane, they refer to the technique as Southern blotting. When they transfer the RNA to a nylon membrane, they call it Northern blotting. Scientists use Southern blots to detect the presence of certain DNA sequences in a given genome, and Northern blots to detect gene expression.
Figure 17.6 Scientists use Southern blotting to find a particular sequence in a DNA sample. Scientists separate DNA fragments on a gel, transfer them to a nylon membrane, and incubate them with a DNA probe complementary to the sequence of interest. Northern blotting is similar to Southern blotting, but scientists run RNA on the gel instead of DNA. In Western blotting, scientists run proteins on a gel and detect them using antibodies.
Molecular Cloning
In general, the word “cloning” means the creation of a perfect replica; however, in biology, the re-creation of a whole organism is referred to as “reproductive cloning.” Long before attempts were made to clone an entire organism, researchers learned how to reproduce desired regions or fragments of the genome, a process that is referred to as molecular cloning. The technique offered methods to create new medicines and to overcome difficulties with existing ones. When Lydia Villa-Komaroff, working in the Gilbert Lab at Harvard, published the first paper outlining the technique for producing synthetic insulin, diabetes researchers and patients received new hope in fighting the disease. Insulin at that time was only produced using pig and cow pancreases, and the life-saving substance was often in short supply. Synthetic insulin, once mass produced, would solve that problem for many patients. These early discoveries led to the "BioTech Boom," and spurred continued research and funding for newer and better ways to improve health.
Cloning small genome fragments allows researchers to manipulate and study specific genes (and their protein products), or noncoding regions in isolation. A plasmid, or vector, is a small circular DNA molecule that replicates independently of the chromosomal DNA. In cloning, scientists can use the plasmid molecules to provide a "folder" in which to insert a desired DNA fragment. Plasmids are usually introduced into a bacterial host for proliferation. In the bacterial context, scientists call the DNA fragment from the human genome (or the genome of another studied organism) foreign DNA, or a transgene, to differentiate it from the bacterium's DNA, or the host DNA.
Plasmids occur naturally in bacterial populations (such as Escherichia coli) and have genes that can contribute favorable traits to the organism, such as antibiotic resistance (the ability to be unaffected by antibiotics). Scientists have repurposed and engineered plasmids as vectors for molecular cloning and the large-scale production of important reagents, such as insulin and human growth hormone. An important feature of plasmid vectors is the ease with which scientists can introduce a foreign DNA fragment via the multiple cloning site (MCS). The MCS is a short DNA sequence containing multiple sites that different commonly available restriction endonucleases can cut. Restriction endonucleases recognize specific DNA sequences and cut them in a predictable manner. They are naturally produced by bacteria as a defense mechanism against foreign DNA. Many restriction endonucleases make staggered cuts in the two DNA strands, such that the cut ends have a 2- or 4-base single-stranded overhang. Because these overhangs are capable of annealing with complementary overhangs, we call them “sticky ends.” Adding the enzyme DNA ligase permanently joins the DNA fragments via phosphodiester bonds. In this way, scientists can splice any DNA fragment generated by restriction endonuclease cleavage between the plasmid DNA's two ends that has been cut with the same restriction endonuclease (Figure 17.7).
Recombinant DNA Molecules
Plasmids with foreign DNA inserted into them are called recombinant DNA molecules because they are created artificially and do not occur in nature. They are also called chimeric molecules because the origin of different molecule parts of the molecules can be traced back to different species of biological organisms or even to chemical synthesis. We call proteins that are expressed from recombinant DNA molecules recombinant proteins. Not all recombinant plasmids are capable of expressing genes. The recombinant DNA may need to move into a different vector (or host) that is better designed for gene expression. Scientists may also engineer plasmids to express proteins only when certain environmental factors stimulate them, so they can control the recombinant proteins' expression.
Visual Connection
Visual Connection
Figure 17.7 This diagram shows the steps involved in molecular cloning.
You are working in a molecular biology lab and, unbeknownst to you, your lab partner left the foreign genomic DNA that you are planning to clone on the lab bench overnight instead of storing it in the freezer. As a result, it was degraded by nucleases, but still used in the experiment. The plasmid, on the other hand, is fine. What results would you expect from your molecular cloning experiment?
1. There will be no colonies on the bacterial plate.
2. There will be blue colonies only.
3. There will be blue and white colonies.
4. The will be white colonies only.
Link to Learning
Link to Learning
View an animation of recombination in cloning from the DNA Learning Center.
Cellular Cloning
Unicellular organisms, such as bacteria and yeast, naturally produce clones of themselves when they replicate asexually by binary fission; this is known as cellular cloning. The nuclear DNA duplicates by the process of mitosis, which creates an exact replica of the genetic material.
Reproductive Cloning
Reproductive cloning is a method scientists use to clone or identically copy an entire multicellular organism. Most multicellular organisms undergo reproduction by sexual means, which involves genetic hybridization of two individuals (parents), making it impossible to generate an identical copy or a clone of either parent. Recent advances in biotechnology have made it possible to artificially induce mammal asexual reproduction in the laboratory.
Parthenogenesis, or “virgin birth,” occurs when an embryo grows and develops without egg fertilization. This is a form of asexual reproduction. An example of parthenogenesis occurs in species in which the female lays an egg and if the egg is fertilized, it is a diploid egg and the individual develops into a female. If the egg is not fertilized, it remains a haploid egg and develops into a male. The unfertilized egg is a parthenogenic, or virgin egg. Some insects and reptiles lay parthenogenic eggs that can develop into adults.
Sexual reproduction requires two cells. When the haploid egg and sperm cells fuse, a diploid zygote results. The zygote nucleus contains the genetic information to produce a new individual. However, early embryonic development requires the cytoplasmic material contained in the egg cell. This idea forms the basis for reproductive cloning. Therefore, if we replace the egg cell's haploid nucleus with a diploid nucleus from the cell of any individual of the same species (a donor), it will become a zygote that is genetically identical to the donor. Somatic cell nuclear transfer is the technique of transferring a diploid nucleus into an enucleated egg. Scientists can use it for either therapeutic cloning or reproductive cloning.
The first cloned animal was Dolly, a sheep born in 1996. The reproductive cloning success rate at the time was very low. Dolly lived for seven years and died of respiratory complications (Figure 17.8). There is speculation that because the cell DNA belongs to an older individual, DNA's age may affect a cloned individual's life expectancy. Since Dolly, scientists have cloned successfully several animals such as horses, bulls, and goats, although these animals often exhibit facial, limb, and cardiac abnormalities. There have been attempts at producing cloned human embryos as sources of embryonic stem cells for therapeutic purposes. Therapeutic cloning produces stem cells in the attempt to remedy detrimental diseases or defects (unlike reproductive cloning, which aims to reproduce an organism). While some have met therapeutic cloning efforts with resistance because of bioethical considerations, , new discoveries have identified additional opportunities for stem cell therapies. For example, Freda Miller and Elaine Fuchs, working independently, discovered stem cells in different layers of the skin. These cells help the skin repair itself, and their discovery may have applications in treatments of skin disease and potentially other conditions, such as nerve damage.
Visual Connection
Visual Connection
Figure 17.8 Dolly the sheep was the first mammal to be cloned. To create Dolly, they removed the nucleus from a donor egg cell. They then introduced the nucleus from a second sheep into the cell, which divided to the blastocyst stage before they implanted it in a surrogate mother. (credit: modification of work by "Squidonius"/Wikimedia Commons)
Do you think Dolly was a Finn-Dorset or a Scottish Blackface sheep?
Genetic Engineering
Genetic engineering is the alteration of an organism’s genotype using recombinant DNA technology to modify an organism’s DNA to achieve desirable traits. The addition of foreign DNA in the form of recombinant DNA vectors generated by molecular cloning is the most common method of genetic engineering. The organism that receives the recombinant DNA is a genetically modified organism (GMO). If the foreign DNA comes from a different species, the host organism is transgenic. Scientists have genetically modified bacteria, plants, and animals since the early 1970s for academic, medical, agricultural, and industrial purposes. In the US, GMOs such as Roundup-ready soybeans and borer-resistant corn are part of many common processed foods.
Gene Targeting
Although classical methods of studying gene function began with a given phenotype and determined the genetic basis of that phenotype, modern techniques allow researchers to start at the DNA sequence level and ask: "What does this gene or DNA element do?" This technique, reverse genetics, has resulted in reversing the classic genetic methodology. This method would be similar to damaging a body part to determine its function. An insect that loses a wing cannot fly, which means that the wing's function is flight. The classical genetic method would compare insects that cannot fly with insects that can fly, and observe that the non-flying insects have lost wings. Similarly, mutating or deleting genes provides researchers with clues about gene function. We collectively call the methods they use to disable gene function gene targeting. Gene targeting is the use of recombinant DNA vectors to alter a particular gene's expression, either by introducing mutations in a gene, or by eliminating a certain gene's expression by deleting a part or all of the gene sequence from the organism's genome.
Biotechnology in Medicine and Agriculture
It is easy to see how biotechnology can be used for medicinal purposes. Knowledge of the genetic makeup of our species, the genetic basis of heritable diseases, and the invention of technology to manipulate and fix mutant genes provides methods to treat the disease. Biotechnology in agriculture can enhance resistance to disease, pest, and environmental stress, and improve both crop yield and quality.
Genetic Diagnosis and Gene Therapy
Scientists call the process of testing for suspected genetic defects before administering treatment genetic diagnosis by genetic testing. Depending on the inheritance patterns of a disease-causing gene, family members are advised to undergo genetic testing. For example, doctors usually advise people diagnosed with breast cancer to have a biopsy so that the medical team can determine the genetic basis of cancer development. Doctors base treatment plans on genetic test findings that determine the type of cancer. If inherited gene mutations cause the cancer, doctors also advise other female relatives to undergo genetic testing and periodic screening for breast cancer. Doctors also offer genetic testing for fetuses (or embryos with in vitro fertilization) to determine the presence or absence of disease-causing genes in families with specific debilitating diseases.
Gene therapy is a genetic engineering technique used to cure disease. In its simplest form, it involves the introduction of a good gene at a random location in the genome to aid the cure of a disease that is caused by a mutated gene. The good gene is usually introduced into diseased cells as part of a vector transmitted by a virus that can infect the host cell and deliver the foreign DNA (Figure 17.9). More advanced forms of gene therapy try to correct the mutation at the original site in the genome, such as is the case with treatment of severe combined immunodeficiency (SCID).
Figure 17.9 Gene therapy using an adenovirus vector can be used to cure certain genetic diseases in which a person has a defective gene. (credit: NIH)
Production of Vaccines, Antibiotics, and Hormones
Traditional vaccination strategies use weakened or inactive forms of microorganisms to mount the initial immune response. Modern techniques use the genes of microorganisms cloned into vectors to mass produce the desired antigen. Doctors then introduce the antigen into the body to stimulate the primary immune response and trigger immune memory. The medical field has used genes cloned from the influenza virus to combat the constantly changing strains of this virus.
Antibiotics are a biotechnological product. Microorganisms, such as fungi, naturally produce them to attain an advantage over bacterial populations. Cultivating and manipulating fungal cells produces antibiotics.
Scientists used recombinant DNA technology to produce large-scale quantities of human insulin in E. coli as early as 1978. Previously, it was only possible to treat diabetes with pig insulin, which caused allergic reactions in humans because of differences in the gene product. In addition, doctors use human growth hormone (HGH) to treat growth disorders in children. Researchers cloned the HGH gene from a cDNA library and inserted it into E. coli cells by cloning it into a bacterial vector.
Transgenic Animals
Although several recombinant proteins in medicine are successfully produced in bacteria, some proteins require a eukaryotic animal host for proper processing. For this reason, the desired genes are cloned and expressed in animals, such as sheep, goats, chickens, and mice. We call animals that have been modified to express recombinant DNA transgenic animals. Several human proteins are expressed in transgenic sheep and goat milk, and some are expressed in chicken eggs. Scientists have used mice extensively for expressing and studying recombinant gene and mutation effects.
Transgenic Plants
Manipulating the DNA of plants (i.e., creating GMOs) has helped to create desirable traits, such as disease resistance, herbicide and pesticide resistance, better nutritional value, and better shelf-life (Figure 17.10). Plants are the most important source of food for the human population. Farmers developed ways to select for plant varieties with desirable traits long before modern-day biotechnology practices were established.
Figure 17.10 Corn, a major agricultural crop used to create products for a variety of industries, is often modified through plant biotechnology. (credit: Keith Weller, USDA)
We call plants that have received recombinant DNA from other species transgenic plants. Because they are not natural, government agencies closely monitor transgenic plants and other GMOs to ensure that they are fit for human consumption and do not endanger other plant and animal life. Because foreign genes can spread to other species in the environment, extensive testing is required to ensure ecological stability. Staples like corn, potatoes, and tomatoes were the first crop plants that scientists genetically engineered.
Transformation of Plants Using Agrobacterium tumefaciens
Gene transfer occurs naturally between species in microbial populations. Many viruses that cause human diseases, such as cancer, act by incorporating their DNA into the human genome. In plants, tumors caused by the bacterium Agrobacterium tumefaciens occur by DNA transfer from the bacterium to the plant. Although the tumors do not kill the plants, they stunt the plants and they become more susceptible to harsh environmental conditions. A. tumefaciens affects many plants such as walnuts, grapes, nut trees, and beets. Artificially introducing DNA into plant cells is more challenging than in animal cells because of the thick plant cell wall.
Researchers used the natural transfer of DNA from Agrobacterium to a plant host to introduce DNA fragments of their choice into plant hosts. In nature, the disease-causing A. tumefaciens have a set of plasmids, Ti plasmids (tumor-inducing plasmids), that contain genes to produce tumors in plants. DNA from the Ti plasmid integrates into the infected plant cell’s genome. Researchers manipulate the Ti plasmids to remove the tumor-causing genes and insert the desired DNA fragment for transfer into the plant genome. The Ti plasmids carry antibiotic resistance genes to aid selection and researchers can propagate them in E. coli cells as well.
The Organic Insecticide Bacillus thuringiensis
Bacillus thuringiensis (Bt) is a bacterium that produces protein crystals during sporulation that are toxic to many insect species that affect plants. Insects need to ingest Bt toxin in order to activate the toxin. Insects that have eaten Bt toxin stop feeding on the plants within a few hours. After the toxin activates in the insects' intestines, they die within a couple of days. Modern biotechnology has allowed plants to encode their own crystal Bt toxin that acts against insects. Scientists have cloned the crystal toxin genes from Bt and introduced them into plants. Bt toxin is safe for the environment, nontoxic to humans and other mammals, and organic farmers have approved it as a natural insecticide.
Flavr Savr Tomato
The first GM crop on the market was the Flavr Savr Tomato in 1994. Scientists used antisense RNA technology to slow the softening and rotting process caused by fungal infections, which led to increased shelf life of the GM tomatoes. Additional genetic modification improved the tomato's flavor. The Flavr Savr tomato did not successfully stay in the market because of problems maintaining and shipping the crop.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.07%3A_Biotechnology_and_Genomics/3.7.02%3A_Biotechnology.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Define genomics
• Describe genetic and physical maps
• Describe genomic mapping methods
Genomics is the study of entire genomes, including the complete set of genes, their nucleotide sequence and organization, and their interactions within a species and with other species. Genome mapping is the process of finding the locations of genes on each chromosome. The maps that genome mapping create are comparable to the maps that we use to navigate streets. A genetic map is an illustration that lists genes and their location on a chromosome. Genetic maps provide the big picture (similar to an interstate highway map) and use genetic markers (similar to landmarks). A genetic marker is a gene or sequence on a chromosome that co-segregates (shows genetic linkage) with a specific trait. Early geneticists called this linkage analysis. Physical maps present the intimate details of smaller chromosome regions (similar to a detailed road map). A physical map is a representation of the physical distance, in nucleotides, between genes or genetic markers. Both genetic linkage maps and physical maps are required to build a genome’s complete picture. Having a complete genome map of the genome makes it easier for researchers to study individual genes. Human genome maps help researchers in their efforts to identify human disease-causing genes related to illnesses like cancer, heart disease, and cystic fibrosis. We can use genome mapping in a variety of other applications, such as using live microbes to clean up pollutants or even prevent pollution. Research involving plant genome mapping may lead to producing higher crop yields or developing plants that better adapt to climate change.
Genetic Maps
The study of genetic maps begins with linkage analysis, a procedure that analyzes the recombination frequency between genes to determine if they are linked or show independent assortment. Scientists used the term linkage before the discovery of DNA. Early geneticists relied on observing phenotypic changes to understand an organism’s genotype. Shortly after Gregor Mendel (the father of modern genetics) proposed that traits were determined by what we now call genes, other researchers observed that different traits were often inherited together, and thereby deduced that the genes were physically linked by their location on the same chromosome. Gene mapping relative to each other based on linkage analysis led to developing the first genetic maps.
Observations that certain traits were always linked and certain others were not linked came from studying the offspring of crosses between parents with different traits. For example, in garden pea experiments, researchers discovered, that the flower’s color and plant pollen’s shape were linked traits, and therefore the genes encoding these traits were in close proximity on the same chromosome. We call exchanging DNA between homologous chromosome pairs genetic recombination, which occurs by crossing over DNA between homologous DNA strands, such as nonsister chromatids. Linkage analysis involves studying the recombination frequency between any two genes. The greater the distance between two genes, the higher the chance that a recombination event will occur between them, and the higher the recombination frequency between them. Figure 17.11 shows two possibilities for recombination between two nonsister chromatids during meiosis. If the recombination frequency between two genes is less than 50 percent, they are linked.
Figure 17.11 Crossover may occur at different locations on the chromosome. Recombination between genes A and B is more frequent than recombination between genes B and C because genes A and B are farther apart. Therefore, a crossover is more likely to occur between them.
The generation of genetic maps requires markers, just as a road map requires landmarks (such as rivers and mountains). Scientists based early genetic maps on using known genes as markers. Scientists now use more sophisticated markers, including those based on non-coding DNA, to compare individuals’ genomes in a population. Although individuals of a given species are genetically similar, they are not identical. Every individual has a unique set of traits. These minor differences in the genome between individuals in a population are useful for genetic mapping purposes. In general, a good genetic marker is a region on the chromosome that shows variability or polymorphism (multiple forms) in the population.
Some genetic markers that scientists use in generating genetic maps are restriction fragment length polymorphisms (RFLP), variable number of tandem repeats (VNTRs), microsatellite polymorphisms, and the single nucleotide polymorphisms (SNPs). We can detect RFLPs (sometimes pronounced “rif-lips”) when the DNA of an individual is cut with a restriction endonuclease that recognizes specific sequences in the DNA to generate a series of DNA fragments, which we can then analyze using gel electrophoresis. Every individual’s DNA will give rise to a unique pattern of bands when cut with a particular set of restriction endonucleases. Scientists sometimes refer to this as an individual’s DNA “fingerprint.” Certain chromosome regions that are subject to polymorphism will lead to generating the unique banding pattern. VNTRs are repeated sets of nucleotides present in DNA’s non-coding regions. Non-coding, or “junk,” DNA has no known biological function; however, research shows that much of this DNA is actually transcribed. While its function is uncertain, it is certainly active, and it may be involved in regulating coding genes. The number of repeats may vary in a population’s individual organisms. Microsatellite polymorphisms are similar to VNTRs, but the repeat unit is very small. SNPs are variations in a single nucleotide.
Because genetic maps rely completely on the natural process of recombination, natural increases or decreases in the recombination level given genome area affects mapping. Some parts of the genome are recombination hotspots; whereas, others do not show a propensity for recombination. For this reason, it is important to look at mapping information developed by multiple methods.
Physical Maps
A physical map provides detail of the actual physical distance between genetic markers, as well as the number of nucleotides. There are three methods scientists use to create a physical map: cytogenetic mapping, radiation hybrid mapping, and sequence mapping. Cytogenetic mapping uses information from microscopic analysis of stained chromosome sections (Figure 17.12). It is possible to determine the approximate distance between genetic markers using cytogenetic mapping, but not the exact distance (number of base pairs). Radiation hybrid mapping uses radiation, such as x-rays, to break the DNA into fragments. We can adjust the radiation amount to create smaller or larger fragments. This technique overcomes the limitation of genetic mapping, and we can adjust the radiation so that increased or decreased recombination frequency does not affect it. Sequence mapping resulted from DNA sequencing technology that allowed for creating detailed physical maps with distances measured in terms of the number of base pairs. Creating genomic libraries and complementary DNA (cDNA) libraries (collections of cloned sequences or all DNA from a genome) has sped the physical mapping process. A genetic site that scientists use to generate a physical map with sequencing technology (a sequence-tagged site, or STS) is a unique sequence in the genome with a known exact chromosomal location. An expressed sequence tag (EST) and a single sequence length polymorphism (SSLP) are common STSs. An EST is a short STS that we can identify with cDNA libraries, while we obtain SSLPs from known genetic markers, which provide a link between genetic and physical maps.
Figure 17.12 A cytogenetic map shows the appearance of a chromosome after scientists stain and exam it under a microscope. (credit: National Human Genome Research Institute)
Genetic and Physical Maps Integration
Genetic maps provide the outline and physical maps provide the details. It is easy to understand why both genome mapping technique types are important to show the big picture. Scientists use information from each technique in combination to study the genome. Scientists are using genomic mapping with different model organisms for research. Genome mapping is still an ongoing process, and as researchers develop more advanced techniques, they expect more breakthroughs. Genome mapping is similar to completing a complicated puzzle using every piece of available data. Mapping information generated in laboratories all over the world goes into central databases, such as GenBank at the National Center for Biotechnology Information (NCBI). Researchers are making efforts for the information to be more easily accessible to other researchers and the general public. Just as we use global positioning systems instead of paper maps to navigate through roadways, NCBI has created a genome viewer tool to simplify the data-mining process.
Scientific Method Connection
Scientific Method Connection
How to Use a Genome Map Viewer
Problem statement: Do the human, macaque, and mouse genomes contain common DNA sequences?
Develop a hypothesis.
Go to this website to test the hypothesis.
The web page displays the comparison of the gene sequences of many organisms to the Human Insulin Receptor gene. Explore the type of information provided, select the groups of organisms needed for testing of the hypothesis from the top portion of the displayed data. Focus the attention to the bottom part, the Selected Orthologues. Explore which columns are relevant to the needed information.
On the same page, there are other options to explore, not all are necessary for the task, however it might give more insight to the value of genome/gene comparisons.
Link to Learning
Link to Learning
Online Mendelian Inheritance in Man (OMIM) is a searchable online catalog of human genes and genetic disorders. This website shows genome mapping information, and also details the history and research of each trait and disorder. Click this link to search for traits (such as handedness) and genetic disorders (such as diabetes).
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.07%3A_Biotechnology_and_Genomics/3.7.03%3A_Mapping_Genomes.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe three types of sequencing
• Define whole-genome sequencing
Although there have been significant advances in the medical sciences in recent years, doctors are still confounded by some diseases, and they are using whole-genome sequencing to discover the root of the problem. Whole-genome sequencing is a process that determines an entire genome’s DNA sequence. Whole-genome sequencing is a brute-force approach to problem solving when there is a genetic basis at the core of a disease. Several laboratories now provide services to sequence, analyze, and interpret entire genomes.
For example, whole-exome sequencing is a lower-cost alternative to whole genome sequencing. In exome sequencing, the doctor sequences only the DNA’s coding, exon-producing regions. In 2010, doctors used whole-exome sequencing to save a young boy whose intestines had multiple mysterious abscesses. The child had several colon operations with no relief. Finally, they performed whole-exome sequencing, which revealed a defect in a pathway that controls apoptosis (programmed cell death). The doctors used a bone-marrow transplant to overcome this genetic disorder, leading to a cure for the boy. He was the first person to receive successful treatment based on a whole-exome sequencing diagnosis. Today, human genome sequencing is more readily available and results are available within two days for about \$1000.
Strategies Used in Sequencing Projects
The basic sequencing technique used in all modern day sequencing projects is the chain termination method (also known as the dideoxy method), which Fred Sanger developed in the 1970s. The chain termination method involves DNA replication of a single-stranded template by using a primer and a regular deoxynucleotide (dNTP), which is a monomer, or a single DNA unit. The primer and dNTP mix with a small proportion of fluorescently labeled dideoxynucleotides (ddNTPs). The ddNTPs are monomers that are missing a hydroxyl group (–OH) at the site at which another nucleotide usually attaches to form a chain (Figure 17.13). Scientists label each ddNTP with a different color of fluorophore. Every time a ddNTP incorporates in the growing complementary strand, it terminates the DNA replication process, which results in multiple short strands of replicated DNA that each terminate at a different point during replication. When gel electrophoresis processes the reaction mixture after separating into single strands, the multiple newly replicated DNA strands form a ladder because of the differing sizes. Because the ddNTPs are fluorescently labeled, each band on the gel reflects the DNA strand’s size and the ddNTP that terminated the reaction. The different colors of the fluorophore-labeled ddNTPs help identify the ddNTP incorporated at that position. Reading the gel on the basis of each band’s color on the ladder produces the template strand’s sequence (Figure 17.14).
Figure 17.13 A dideoxynucleotide is similar in structure to a deoxynucleotide, but is missing the 3' hydroxyl group (indicated by the box). When a dideoxynucleotide is incorporated into a DNA strand, DNA synthesis stops.
Figure 17.14 This figure illustrates Frederick Sanger's dideoxy chain termination method. Using dideoxynucleotides, the DNA fragment can terminate at different points. The DNA separates on the basis of size, and we can read these bands based on the fragments’ size.
Early Strategies: Shotgun Sequencing and Pair-Wise End Sequencing
In shotgun sequencing method, several DNA fragment copies cut randomly into many smaller pieces (somewhat like what happens to a round shot cartridge when fired from a shotgun). All of the segments sequence using the chain-sequencing method. Then, with sequence computer assistance, scientists can analyze the fragments to see where their sequences overlap. By matching overlapping sequences at each fragment’s end, scientists can reform the entire DNA sequence. A larger sequence that is assembled from overlapping shorter sequences is called a contig. As an analogy, consider that someone has four copies of a landscape photograph that you have never seen before and know nothing about how it should appear. The person then rips up each photograph with their hands, so that different size pieces are present from each copy. The person then mixes all of the pieces together and asks you to reconstruct the photograph. In one of the smaller pieces you see a mountain. In a larger piece, you see that the same mountain is behind a lake. A third fragment shows only the lake, but it reveals that there is a cabin on the shore of the lake. Therefore, from looking at the overlapping information in these three fragments, you know that the picture contains a mountain behind a lake that has a cabin on its shore. This is the principle behind reconstructing entire DNA sequences using shotgun sequencing.
Originally, shotgun sequencing only analyzed one end of each fragment for overlaps. This was sufficient for sequencing small genomes. However, the desire to sequence larger genomes, such as that of a human, led to developing double-barrel shotgun sequencing, or pairwise-end sequencing. In pairwise-end sequencing, scientists analyze each fragment’s end for overlap. Pairwise-end sequencing is, therefore, more cumbersome than shotgun sequencing, but it is easier to reconstruct the sequence because there is more available information.
Next-generation Sequencing
Since 2005, automated sequencing techniques used by laboratories are under the umbrella of next-generation sequencing (deep sequencing or massively parallel sequencing), which is a group of automated techniques used for rapid DNA sequencing. These automated low-cost sequencers can generate sequences of hundreds of thousands or millions of short fragments (25 to 500 base pairs) in the span of one day. These sequencers use sophisticated software to get through the cumbersome process of putting all the fragments in order.
Evolution Connection
Evolution Connection
Comparing SequencesA sequence alignment is an arrangement of proteins, DNA, or RNA. Scientists use it to identify similar regions between cell types or species, which may indicate function or structure conservation. We can use sequence alignments to construct phylogenetic trees. The following website uses a software program called BLAST (basic local alignment search tool).
Under “Basic Blast,” click “Nucleotide Blast.” Input the following sequence into the large "query sequence" box: ATTGCTTCGATTGCA. Below the box, locate the "Species" field and type "human" or "Homo sapiens". Then click “BLAST” to compare the inputted sequence against the human genome’s known sequences. The result is that this sequence occurs in over a hundred places in the human genome. Scroll down below the graphic with the horizontal bars and you will see a short description of each of the matching hits. Pick one of the hits near the top of the list and click on "Graphics". This will bring you to a page that shows the sequence’s location within the entire human genome. You can move the slider that looks like a green flag back and forth to view the sequences immediately around the selected gene. You can then return to your selected sequence by clicking the "ATG" button.
Use of Whole-Genome Sequences of Model Organisms
British biochemist and Nobel Prize winner Fred Sanger used a bacterial virus, the bacteriophage fx174 (5368 base pairs), to completely sequence the first genome. Other scientists later sequenced several other organelle and viral genomes. American biotechnologist, biochemist, geneticist, and businessman Craig Venter sequenced the bacterium Haemophilus influenzae in the 1980s. Approximately 74 different laboratories collaborated on sequencing the genome of the yeast Saccharomyces cerevisiae, which began in 1989 and was completed in 1996, because it was 60 times bigger than any other genome sequencing. By 1997, the genome sequences of two important model organisms were available: the bacterium Escherichia coli K12 and the yeast Saccharomyces cerevisiae. We now know the genomes of other model organisms, such as the mouse Mus musculus, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis. elegans, and humans Homo sapiens. Researchers perform extensive basic research in model organisms because they can apply the information to genetically similar organisms. A model organism is a species that researchers use as a model to understand the biological processes in other species that the model organism represents. Having entire genomes sequenced helps with the research efforts in these model organisms. The process of attaching biological information to gene sequences is genome annotation. Annotating gene sequences helps with basic experiments in molecular biology, such as designing PCR primers and RNA targets.
Link to Learning
Link to Learning
Click through each genome sequencing step at this site.
Genome Sequence Uses
DNA microarrays are methods that scientists use to detect gene expression by analyzing different DNA fragments that are fixed to a glass slide or a silicon chip to identify active genes and sequences. We can discover almost one million genotypic abnormalities using microarrays; whereas, whole-genome sequencing can provide information about all six billion base pairs in the human genome. Although studying genome sequencing medical applications is interesting, this discipline dwells on abnormal gene function. Knowing about the entire genome will allow researchers to discover future onset diseases and other genetic disorders early. This will allow for more informed decisions about lifestyle, medication, and having children. Genomics is still in its infancy, although someday it may become routine to use whole-genome sequencing to screen every newborn to detect genetic abnormalities.
In addition to disease and medicine, genomics can contribute to developing novel enzymes that convert biomass to biofuel, which results in higher crop and fuel production, and lower consumer cost. This knowledge should allow better methods of control over the microbes that industry uses to produce biofuels. Genomics could also improve monitoring methods that measure the impact of pollutants on ecosystems and help clean up environmental contaminants. Genomics has aided in developing agrochemicals and pharmaceuticals that could benefit medical science and agriculture.
It sounds great to have all the knowledge we can get from whole-genome sequencing; however, humans have a responsibility to use this knowledge wisely. Otherwise, it could be easy to misuse the power of such knowledge, leading to discrimination based on a person's genetics, human genetic engineering, and other ethical concerns. This information could also lead to legal issues regarding health and privacy.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.07%3A_Biotechnology_and_Genomics/3.7.04%3A_Whole-Genome_Sequencing.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Explain pharmacogenomics
• Define polygenic
Introducing DNA sequencing and whole genome sequencing projects, particularly the Human Genome project, has expanded the applicability of DNA sequence information. Many fields, such as metagenomics, pharmacogenomics, and mitochondrial genomics are using genomics. Understanding and finding cures for diseases is the most common application of genomics.
Predicting Disease Risk at the Individual Level
Predicting disease risk involves screening currently healthy individuals by genome analysis at the individual level. Health care professionals can recommend intervention with lifestyle changes and drugs before disease onset. However, this approach is most applicable when the problem resides within a single gene defect. Such defects only account for approximately 5 percent of diseases in developed countries. Most of the common diseases, such as heart disease, are multi-factored or polygenic, which is a phenotypic characteristic that involves two or more genes, and also involve environmental factors such as diet. In April 2010, scientists at Stanford University published the genome analysis of a healthy individual (Stephen Quake, a scientist at Stanford University, who had his genome sequenced. The analysis predicted his propensity to acquire various diseases. The medical team performed a risk assessment to analyze Quake’s percentage of risk for 55 different medical conditions. The team found a rare genetic mutation, which showed him to be at risk for sudden heart attack. The results also predicted that Quake had a 23 percent risk of developing prostate cancer and a 1.4 percent risk of developing Alzheimer’s. The scientists used databases and several publications to analyze the genomic data. Even though genomic sequencing is becoming more affordable and analytical tools are becoming more reliable, researchers still must address ethical issues surrounding genomic analysis at a population level.
Visual Connection
Visual Connection
Figure 17.15 PCA3 is a gene that is expressed in prostate epithelial cells and overexpressed in cancerous cells. A high PCA3 concentration in urine is indicative of prostate cancer. The PCA3 test is a better indicator of cancer than the more well known PSA test, which measures the level of PSA (prostate-specific antigen) in the blood.
In 2011, the United States Preventative Services Task Force recommended against using the PSA test to screen healthy people for prostate cancer. Their recommendation is based on evidence that screening does not reduce the risk of death from prostate cancer. Prostate cancer often develops very slowly and does not cause problems, while the cancer treatment can have severe side effects. The PCA3 test is more accurate, but screening may still result in people who would not have been harmed by the cancer itself suffering side effects from treatment. What do you think? Should healthy people receive prostate cancer screenings using the PCA3 or PSA test? Should people in general receive screenings to find out if they have a genetic risk for cancer or other diseases?
Pharmacogenomics and Toxicogenomics
Pharmacogenomics, or toxicogenomics, involves evaluating drug effectiveness and safety on the basis of information from an individual's genomic sequence. We can study genomic responses to drugs using experimental animals (such as laboratory rats or mice) or live cells in the laboratory before embarking on studies with humans. Studying changes in gene expression could provide information about the transcription profile in the drug's presence, which we can use as an early indicator of the potential for toxic effects. For example, genes involved in cellular growth and controlled cell death, when disturbed, could lead to cancerous cell growth. Genome-wide studies can also help to find new genes involved in drug toxicity. Medical professionals can use personal genome sequence information to prescribe medications that will be most effective and least toxic on the basis of the individual patient’s genotype. The gene signatures may not be completely accurate, but medical professionals can test them further before pathologic symptoms arise.
Microbial Genomics: Metagenomics
Traditionally, scholars have taught microbiology with the view that it is best to study microorganisms under pure culture conditions. This involves isolating a single cell type and culturing it in the laboratory. Because microorganisms can go through several generations in a matter of hours, their gene expression profiles adapt to the new laboratory environment very quickly. In addition, the vast majority of bacterial species resist culturing in isolation. Most microorganisms do not live as isolated entities, but in microbial communities or biofilms. For all of these reasons, pure culture is not always the best way to study microorganisms. Metagenomics is the study of the collective genomes of multiple species that grow and interact in an environmental niche. Metagenomics can be used to identify new species more rapidly and to analyze the effect of pollutants on the environment (Figure 17.16).
Figure 17.16 Metagenomics involves isolating DNA from multiple species within an environmental niche.
Microbial Genomics: Creation of New Biofuels
Knowledge of the genomics of microorganisms is being used to find better ways to harness biofuels from algae and cyanobacteria. The primary sources of fuel today are coal, oil, wood, and other plant products, such as ethanol. Although plants are renewable resources, there is still a need to find more alternative renewable sources of energy to meet our population’s energy demands. The microbial world is one of the largest resources for genes that encode new enzymes and produce new organic compounds, and it remains largely untapped. Microorganisms are used to create products, such as enzymes that are used in research, antibiotics, and other antimicrobial mechanisms. Microbial genomics is helping to develop diagnostic tools, improved vaccines, new disease treatments, and advanced environmental cleanup techniques.
Mitochondrial Genomics
Mitochondria are intracellular organelles that contain their own DNA. Mitochondrial DNA mutates at a rapid rate and scientists often use it to study evolutionary relationships. Another feature that makes studying the mitochondrial genome interesting is that the mitochondrial DNA in most multicellular organisms passes from the mother during the fertilization process. For this reason, scientists often use mitochondrial genomics to trace genealogy.
Experts have used information and clues from DNA samples at crime scenes as evidence in court cases, and they have used genetic markers in forensic analysis. Genomic analysis has also become useful in this field. The first publication showcasing the first use of genomics in forensics came out in 2001. It was a collaborative attempt between academic research institutions and the FBI to solve the mysterious cases of anthrax communicated via the US Postal Service. Using microbial genomics, researchers determined that the culprit used a specific anthrax strain in all the mailings.
Genomics in Agriculture
Genomics can reduce the trials and failures involved in scientific research to a certain extent, which could improve agricultural crop yield quality and quantity. Linking traits to genes or gene signatures helps improve crop breeding to generate hybrids with the most desirable qualities. Scientists use genomic data to identify desirable traits, and then transfer those traits to a different organism. Researchers are discovering how genomics can improve agricultural production's quality and quantity. For example, scientists could use desirable traits to create a useful product or enhance an existing product, such as making a drought-sensitive crop more tolerant of the dry season.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.07%3A_Biotechnology_and_Genomics/3.7.05%3A_Applying_Genomics.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Explain systems biology
• Describe a proteome
• Define protein signature
Proteins are the final products of genes, which help perform the function that the gene encodes. Amino acids comprise proteins and play important roles in the cell. All enzymes (except ribozymes) are proteins that act as catalysts to affect the rate of reactions. Proteins are also regulatory molecules, and some are hormones. Transport proteins, such as hemoglobin, help transport oxygen to various organs. Antibodies that defend against foreign particles are also proteins. In the diseased state, protein function can be impaired because of changes at the genetic level or because of direct impact on a specific protein.
A proteome is the entire set of proteins that a cell type produces. We can study proteoms using the knowledge of genomes because genes code for mRNAs, and the mRNAs encode proteins. Although mRNA analysis is a step in the right direction, not all mRNAs are translated into proteins. Proteomics is the study of proteomes' function. Proteomics complements genomics and is useful when scientists want to test their hypotheses that they based on genes. Even though all multicellular organisms' cells have the same set of genes, the set of proteins produced in different tissues is different and dependent on gene expression. Thus, the genome is constant, but the proteome varies and is dynamic within an organism. In addition, RNAs can be alternately spliced (cut and pasted to create novel combinations and novel proteins) and many proteins modify themselves after translation by processes such as proteolytic cleavage, phosphorylation, glycosylation, and ubiquitination. There are also protein-protein interactions, which complicate studying proteomes. Although the genome provides a blueprint, the final architecture depends on several factors that can change the progression of events that generate the proteome.
Metabolomics is related to genomics and proteomics. Metabolomics involves studying small molecule metabolites in an organism. The metabolome is the complete set of metabolites that are related to an organism's genetic makeup. Metabolomics offers an opportunity to compare genetic makeup and physical characteristics, as well as genetic makeup and environmental factors. The goal of metabolome research is to identify, quantify, and catalogue all the metabolites in living organisms' tissues and fluids.
Basic Techniques in Protein Analysis
The ultimate goal of proteomics is to identify or compare the proteins expressed from a given genome under specific conditions, study the interactions between the proteins, and use the information to predict cell behavior or develop drug targets. Just as scientists analyze the genome using the basic DNA sequencing technique, proteomics requires techniques for protein analysis. The basic technique for protein analysis, analogous to DNA sequencing, is mass spectrometry. Mass spectrometry identifies and determines a molecule's characteristics. Advances in spectrometry have allowed researchers to analyze very small protein samples. X-ray crystallography, for example, enables scientists to determine a protein crystal's three-dimensional structure at atomic resolution. Another protein imaging technique, nuclear magnetic resonance (NMR), uses atoms' magnetic properties to determine the protein's three-dimensional structure in aqueous solution. Scientists have also used protein microarrays to study protein interactions. Large-scale adaptations of the basic two-hybrid screen (Figure 17.17) have provided the basis for protein microarrays. Scientists use computer software to analyze the vast amount of data for proteomic analysis.
Genomic- and proteomic-scale analyses are part of systems biology, which is the study of whole biological systems (genomes and proteomes) based on interactions within the system. The European Bioinformatics Institute and the Human Proteome Organization (HUPO) are developing and establishing effective tools to sort through the enormous pile of systems biology data. Because proteins are the direct products of genes and reflect activity at the genomic level, it is natural to use proteomes to compare the protein profiles of different cells to identify proteins and genes involved in disease processes. Most pharmaceutical drug trials target proteins. Researchers use information that they obtain from proteomics to identify novel drugs and to understand their mechanisms of action.
Figure 17.17 Scientists use two-hybrid screening to determine whether two proteins interact. In this method, a transcription factor splits into a DNA-binding domain (BD) and an activator domain (AD). The binding domain is able to bind the promoter in the activator domain's absence, but it does not turn on transcription. The bait protein attaches to the BD, and the prey protein attaches to the AD. Transcription occurs only if the prey “catches” the bait.
Scientists are challenged when implementing proteomic analysis because it is difficult to detect small protein quantities. Although mass spectrometry is good for detecting small protein amounts, variations in protein expression in diseased states can be difficult to discern. Proteins are naturally unstable molecules, which makes proteomic analysis much more difficult than genomic analysis.
Cancer Proteomics
Researchers are studying patients' genomes and proteomes to understand the genetic basis of diseases. The most prominent disease researchers are studying with proteomic approaches is cancer. These approaches improve screening and early cancer detection. Researchers are able to identify proteins whose expression indicates the disease process. An individual protein is a biomarker; whereas, a set of proteins with altered expression levels is a protein signature. For a biomarker or protein signature to be useful as a candidate for early cancer screening and detection, they must secrete in body fluids, such as sweat, blood, or urine, such that health professionals can perform large-scale screenings in a noninvasive fashion. The current problem with using biomarkers for early cancer detection is the high rate of false-negative results. A false negative is an incorrect test result that should have been positive. In other words, many cancer cases go undetected, which makes biomarkers unreliable. Some examples of protein biomarkers in cancer detection are CA-125 for ovarian cancer and PSA for prostate cancer. Protein signatures may be more reliable than biomarkers to detect cancer cells. Researchers are also using proteomics to develop individualized treatment plans, which involves predicting whether or not an individual will respond to specific drugs and the side effects that the individual may experience. Researchers also use proteomics to predict the possibility of disease recurrence.
The National Cancer Institute has developed programs to improve cancer detection and treatment. The Clinical Proteomic Technologies for Cancer and the Early Detection Research Network are efforts to identify protein signatures specific to different cancer types. The Biomedical Proteomics Program identifies protein signatures and designs effective therapies for cancer patients.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.07%3A_Biotechnology_and_Genomics/3.7.06%3A_Genomics_and_Proteomics.txt
|
antibiotic resistance
ability of an organism to be unaffected by an antibiotic's actions
biomarker
individual protein that is uniquely produced in a diseased state
biotechnology
use of biological agents for technological advancement
cDNA library
collection of cloned cDNA sequences
cellular cloning
production of identical cell populations by binary fission
chain termination method
method of DNA sequencing using labeled dideoxynucleotides to terminate DNA replication; it is also called the dideoxy method or the Sanger method
clone
exact replica
contig
larger sequence of DNA assembled from overlapping shorter sequences
cytogenetic mapping
technique that uses a microscope to create a map from stained chromosomes
deoxynucleotide
individual DNA monomer (single unit)
dideoxynucleotide
individual DNA monomer that is missing a hydroxyl group (–OH)
DNA microarray
method to detect gene expression by analyzing many DNA fragments that are fixed to a glass slide or a silicon chip to identify active genes and identify sequences
expressed sequence tag (EST)
short STS that is identified with cDNA
false negative
incorrect test result that should have been positive
foreign DNA
DNA that belongs to a different species or DNA that is artificially synthesized
gel electrophoresis
technique used to separate molecules on the basis of size using electric charge
gene targeting
method for altering the sequence of a specific gene by introducing the modified version on a vector
gene therapy
technique used to cure inheritable diseases by replacing mutant genes with good genes
genetic diagnosis
diagnosis of the potential for disease development by analyzing disease-causing genes
genetic engineering
alteration of the genetic makeup of an organism
genetic map
outline of genes and their location on a chromosome
genetic marker
gene or sequence on a chromosome with a known location that is associated with a specific trait
genetic recombination
DNA exchange between homologous chromosome pairs
genetic testing
process of testing for the presence of disease-causing genes
genetically modified organism (GMO)
organism whose genome has been artificially changed
genome annotation
process of attaching biological information to gene sequences
genome mapping
process of finding the location of genes on each chromosome
genomic library
collection of cloned DNA which represents all of the sequences and fragments from a genome
genomics
study of entire genomes including the complete set of genes, their nucleotide sequence and organization, and their interactions within a species and with other species
host DNA
DNA that is present in the genome of the organism of interest
linkage analysis
procedure that analyzes recombining genes to determine if they are linked
lysis buffer
solution to break the cell membrane and release cell contents
metabolome
complete set of metabolites which are related to an organism's genetic makeup
metabolomics
study of small molecule metabolites in an organism
metagenomics
study of multiple species' collective genomes that grow and interact in an environmental niche
microsatellite polymorphism
variation between individuals in the sequence and number of microsatellite DNA repeats
model organism
species that researchers study and use as a model to understand the biological processes in other species represented by the model organism
molecular cloning
cloning of DNA fragments
multiple cloning site (MCS)
site that multiple restriction endonucleases can recognize
next-generation sequencing
group of automated techniques for rapid DNA sequencing
Northern blotting
transfer of RNA from a gel to a nylon membrane
pharmacogenomics
study of drug interactions with the genome or proteome; also called toxicogenomics
physical map
representation of the physical distance between genes or genetic markers
polygenic
phenotypic characteristic caused by two or more genes
polymerase chain reaction (PCR)
technique to amplify DNA
probe
small DNA fragment to determine if the complementary sequence is present in a DNA sample
protease
enzyme that breaks down proteins
protein signature
set of uniquely expressed proteins in the diseased state
proteome
entire set of proteins that cell type produces
proteomics
study of proteomes' function
pure culture
growth of a single cell type in the laboratory
radiation hybrid mapping
information obtained by fragmenting the chromosome with x-rays
recombinant DNA
combining DNA fragments that molecular cloning generates that do not exist in nature; also a chimeric molecule
recombinant protein
a gene's protein product derived by molecular cloning
reproductive cloning
entire organism cloning
restriction endonuclease
enzyme that can recognize and cleave specific DNA sequences
restriction fragment length polymorphism (RFLP)
variation between individuals in the length of DNA fragments, which restriction endonucleases generate
reverse genetics
method of determining the gene's function by starting with the gene itself instead of starting with the gene product
reverse transcriptase PCR (RT-PCR)
PCR technique that involves converting RNA to DNA by reverse transcriptase
ribonuclease
enzyme that breaks down RNA
sequence mapping
mapping information obtained after DNA sequencing
shotgun sequencing
method used to sequence multiple DNA fragments to generate the sequence of a large piece of DNA
single nucleotide polymorphism (SNP)
variation between individuals in a single nucleotide
Southern blotting
DNA transfer from a gel to a nylon membrane
systems biology
study of whole biological systems (genomes and proteomes) based on interactions within the system
Ti plasmid
plasmid system derived from Agrobacterium tumefaciens that scientists have used to introduce foreign DNA into plant cells
transgenic
organism that receives DNA from a different species
variable number of tandem repeats (VNTRs)
variation in the number of tandem repeats between individuals in the population
whole-genome sequencing
process that determines an entire genome's DNA sequence
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.07%3A_Biotechnology_and_Genomics/3.7.07%3A_Key_Terms.txt
|
17.1 Biotechnology
Nucleic acids can be isolated from cells for the purposes of further analysis by breaking open the cells and enzymatically destroying all other major macromolecules. Fragmented or whole chromosomes can separate on the basis of size by gel electrophoresis. PCR can amplify short DNA or RNA stretches. Researchers can use Southern and Northern blotting to detect the presence of specific short sequences in a DNA or RNA sample. The term “cloning” may refer to cloning small DNA fragments (molecular cloning), cloning cell populations (cellular cloning), or cloning entire organisms (reproductive cloning). Medical professionals perform genetic testing to identify disease-causing genes, and use gene therapy to cure an inheritable disease.
Transgenic organisms possess DNA from a different species, usually generated by molecular cloning techniques. Vaccines, antibiotics, and hormones are examples of products obtained by recombinant DNA technology. Scientists usually create transgenic plants to improve crop plant characteristics.
17.2 Mapping Genomes
Genome mapping is similar to solving a big, complicated puzzle with pieces of information coming from laboratories all over the world. Genetic maps provide an outline for locating genes within a genome, and they estimate the distance between genes and genetic markers on the basis of recombination frequencies during meiosis. Physical maps provide detailed information about the physical distance between the genes. The most detailed information is available through sequence mapping. Researchers combine information from all mapping and sequencing sources to study an entire genome.
17.3 Whole-Genome Sequencing
Whole-genome sequencing is the latest available resource to treat genetic diseases. Some doctors are using whole-genome sequencing to save lives. Genomics has many industrial applications including biofuel development, agriculture, pharmaceuticals, and pollution control. The basic principle of all modern-day sequencing strategies involves the chain termination method of sequencing.
Although the human genome sequences provide key insights to medical professionals, researchers use whole-genome sequences of model organisms to better understand the species' genome. Automation and the decreased cost of whole-genome sequencing may lead to personalized medicine in the future.
17.4 Applying Genomics
Imagination is the only barrier to the applicability of genomics. Researchers are applying genomics to most fields of biology. They use it for personalized medicine, prediction of disease risks at an individual level, studying drug interactions before conducting clinical trials, and studying microorganisms in the environment as opposed to the laboratory. They are also applying it to developments such as generating new biofuels, genealogical assessment using mitochondria, advances in forensic science, and improvements in agriculture.
17.5 Genomics and Proteomics
Proteomics is the study of the entire set of proteins expressed by a given type of cell under certain environmental conditions. In a multicellular organism, different cell types will have different proteomes, and these will vary with environmental changes. Unlike a genome, a proteome is dynamic and in constant flux, which makes it both more complicated and more useful than the knowledge of genomes alone.
Proteomics approaches rely on protein analysis. Researchers are constantly upgrading these techniques. Researchers have used proteomics to study different cancer types. Medical professionals are using different biomarkers and protein signatures to analyze each cancer type. The future goal is to have a personalized treatment plan for each individual.
3.7.09: Visual Connection Questions
1.
Figure 17.7 You are working in a molecular biology lab and, unbeknownst to you, your lab partner left the foreign genomic DNA that you are planning to clone on the lab bench overnight instead of storing it in the freezer. As a result, it was degraded by nucleases, but still used in the experiment. The plasmid, on the other hand, is fine. What results would you expect from your molecular cloning experiment?
1. There will be no colonies on the bacterial plate.
2. There will be blue colonies only.
3. There will be blue and white colonies.
4. The will be white colonies only.
2.
Figure 17.8 Do you think Dolly was a Finn-Dorset or a Scottish Blackface sheep?
3.
Figure 17.15 In 2011, the United States Preventative Services Task Force recommended against using the PSA test to screen healthy people for prostate cancer. Their recommendation is based on evidence that screening does not reduce the risk of death from prostate cancer. Prostate cancer often develops very slowly and does not cause problems, while the cancer treatment can have severe side effects. The PCA3 test is more accurate, but screening may still result in people who would not have been harmed by the cancer itself suffering side effects from treatment. What do you think? Should healthy people be screened for prostate cancer using the PCA3 or PSA test? Should people in general be screened to find out if they have a genetic risk for cancer or other diseases?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.07%3A_Biotechnology_and_Genomics/3.7.08%3A_Chapter_Summary.txt
|
4.
GMOs are created by ________.
1. generating genomic DNA fragments with restriction endonucleases
2. introducing recombinant DNA into an organism by any means
3. overexpressing proteins in E. coli
4. all of the above
5.
Gene therapy can be used to introduce foreign DNA into cells ________.
1. for molecular cloning
2. by PCR
3. of tissues to cure inheritable disease
4. all of the above
6.
Insulin produced by molecular cloning:
1. is of pig origin
2. is a recombinant protein
3. is made by the human pancreas
4. is recombinant DNA
7.
Bt toxin is considered to be ________.
1. a gene for modifying insect DNA
2. an organic insecticide produced by bacteria
3. useful for humans to fight against insects
4. a recombinant protein
8.
The Flavr Savr Tomato:
1. is a variety of vine-ripened tomato in the supermarket
2. was created to have better flavor and shelf-life
3. does not undergo soft rot
4. all of the above
9.
ESTs are ________.
1. generated after a cDNA library is made
2. unique sequences in the genome
3. useful for mapping using sequence information
4. all of the above
10.
Linkage analysis ________.
1. is used to create a physical map
2. is based on the natural recombination process
3. requires radiation hybrid mapping
4. involves breaking and rejoining of DNA artificially
11.
Genetic recombination occurs by which process?
1. independent assortment
2. crossing over
3. chromosome segregation
4. sister chromatids
12.
Individual genetic maps in a given species are:
1. genetically similar
2. genetically identical
3. genetically dissimilar
4. not useful in species analysis
13.
Information obtained by microscopic analysis of stained chromosomes is used in:
1. radiation hybrid mapping
2. sequence mapping
3. RFLP mapping
4. cytogenetic mapping
14.
The chain termination method of sequencing:
1. uses labeled ddNTPs
2. uses only dideoxynucleotides
3. uses only deoxynucleotides
4. uses labeled dNTPs
15.
Whole-genome sequencing can be used for advances in:
1. the medical field
2. agriculture
3. biofuels
4. all of the above
16.
Sequencing an individual person’s genome
1. is currently possible
2. could lead to legal issues regarding discrimination and privacy
3. could help make informed choices about medical treatment
4. all of the above
17.
What is the most challenging issue facing genome sequencing?
1. the inability to develop fast and accurate sequencing techniques
2. the ethics of using information from genomes at the individual level
3. the availability and stability of DNA
4. all of the above
18.
Genomics can be used in agriculture to:
1. generate new hybrid strains
2. improve disease resistance
3. improve yield
4. all of the above
19.
Genomics can be used on a personal level to:
1. decrease transplant rejection
2. predict genetic diseases that a person may have inherited
3. determine the risks of genetic diseases for an individual’s children
4. all of the above
20.
What is a biomarker?
1. the color coding of different genes
2. a protein that is uniquely produced in a diseased state
3. a molecule in the genome or proteome
4. a marker that is genetically inherited
21.
A protein signature is:
1. the path followed by a protein after it is synthesized in the nucleus
2. the path followed by a protein in the cytoplasm
3. a protein expressed on the cell surface
4. a unique set of proteins present in a diseased state
3.7.11: Critical Thinking Questions
22.
Describe the process of Southern blotting.
23.
A researcher wants to study cancer cells from a patient with breast cancer. Is cloning the cancer cells an option?
24.
How would a scientist introduce a gene for herbicide resistance into a plant?
25.
If you had a chance to get your genome sequenced, what are some questions you might be able to have answered about yourself?
26.
Why is so much effort being poured into genome mapping applications?
27.
How could a genetic map of the human genome help find a cure for cancer?
28.
Explain why metagenomics is probably the most revolutionary application of genomics.
29.
How can genomics be used to predict disease risk and treatment options?
30.
How has proteomics been used in cancer detection and treatment?
31.
What is personalized medicine?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/03%3A_Unit_III-_Genetics/3.07%3A_Biotechnology_and_Genomics/3.7.10%3A_Review_Questions.txt
|
Evolution is change in the heritable traits of biological populations over successive generations. Evolutionary processes give rise to diversity at every level of biological organization, including the levels of species, individual organisms, and molecules. In Unit 4, the core concepts of evolution are discussed in this unit with examples illustrating evolutionary processes. Additionally, the evolutionary basis of biology reappears throughout the textbook in general discussion and is reinforced through special call-out features highlighting specific evolution-based topics.
• 4.1: Evolution and the Origin of Species
The theory of evolution is the unifying theory of biology, meaning it is the framework within which biologists ask questions about the living world. Its power is that it provides direction for predictions about living things that are borne out in experiment after experiment.
• 4.2: The Evolution of Populations
• 4.3: Phylogenies and the History of Life
By following pathways of similarities and changes—both visible and genetic—scientists seek to map the evolutionary past of how life developed from single-celled organisms to the tremendous collection of creatures that have germinated, crawled, floated, swam, flown, and walked on this planet.
Thumbnail: A silhouette of human evolution. (CC BY-SA 3.0; Tkgd2007 via Wikimedia Commons).
Contributors
Connie Rye (East Mississippi Community College), Robert Wise (University of Wisconsin, Oshkosh), Vladimir Jurukovski (Suffolk County Community College), Jean DeSaix (University of North Carolina at Chapel Hill), Jung Choi (Georgia Institute of Technology), Yael Avissar (Rhode Island College) among other contributing authors. Original content by OpenStax (CC BY 4.0; Download for free at http://cnx.org/contents/185cbf87-c72...f21b5eabd@9.87).
04: Unit IV- Evolutionary Processes
The theory of evolution is the unifying theory of biology, meaning it is the framework within which biologists ask questions about the living world. Its power is that it provides direction for predictions about living things that are borne out in experiment after experiment. The Ukrainian-born American geneticist Theodosius Dobzhansky famously wrote that “nothing makes sense in biology except in the light of evolution." He meant that the tenet that all life has evolved and diversified from a common ancestor is the foundation from which we approach all questions in biology.
• 4.1.1: Introduction
All species of living organisms, from bacteria to baboons to blueberries, evolved at some point from a different species. Although it may seem that living things today stay much the same, that is not the case—evolution is an ongoing process.
• 4.1.2: Understanding Evolution
Evolution by natural selection describes a mechanism for how species change over time. That species change had been suggested and debated well before Darwin began to explore this idea. The view that species were static and unchanging was grounded in the writings of Plato, yet there were also ancient Greeks who expressed evolutionary ideas.
• 4.1.3: Formation of New Species
Although all life on earth shares various genetic similarities, only certain organisms combine genetic information by sexual reproduction and have offspring that can then successfully reproduce. Scientists call such organisms members of the same biological species.
• 4.1.4: Reconnection and Speciation Rates
Speciation occurs over a span of evolutionary time, so when a new species arises, there is a transition period during which the closely related species continue to interact.
• 4.1.5: Key Terms
• 4.1.6: Chapter Summary
• 4.1.7: Visual Connection Questions
• 4.1.8: Review Questions
• 4.1.9: Critical Thinking Questions
Thumbnail: A silhouette of human evolution. (CC BY-SA 3.0; Tkgd2007 via Wikimedia Commons).
4.01: Evolution and the Origin of Species
Figure 18.1 All organisms are products of evolution adapted to their environment. (a) Saguaro (Carnegiea gigantea) can soak up 750 liters of water in a single rain storm, enabling these cacti to survive the dry conditions of the Sonora desert in Mexico and the Southwestern United States. (b) The Andean semiaquatic lizard (Potamites montanicola) discovered in Peru in 2010 lives between 1,570 to 2,100 meters in elevation, and, unlike most lizards, is nocturnal and swims. Scientists still do not know how these cold-blood animals are able to move in the cold (10 to 15°C) temperatures of the Andean night. (credit a: modification of work by Gentry George, U.S. Fish and Wildlife Service; credit b: modification of work by Germán Chávez and Diego Vásquez, ZooKeys)
All living organisms, from bacteria to baboons to blueberries, evolved at some point from a different species. Although it may seem that living things today stay much the same, that is not the case—evolution is an ongoing process.
The theory of evolution is the unifying theory of biology, meaning it is the framework within which biologists ask questions about the living world. Its power is that it provides direction for predictions about living things that are borne out in ongoing experiments. The Ukrainian-born American geneticist Theodosius Dobzhansky famously wrote that “nothing makes sense in biology except in the light of evolution.”1 He meant that the tenet that all life has evolved and diversified from a common ancestor is the foundation from which we approach all questions in biology.
Footnotes
• 1Theodosius Dobzhansky. “Biology, Molecular and Organismic.” American Zoologist 4, no. 4 (1964): 449.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.01%3A_Evolution_and_the_Origin_of_Species/4.1.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe how scientists developed the present-day theory of evolution
• Define adaptation
• Explain convergent and divergent evolution
• Describe homologous and vestigial structures
• Discuss misconceptions about the theory of evolution
Evolution by natural selection describes a mechanism for how species change over time. Scientists, philosophers, researchers, and others had made suggestions and debated this topic well before Darwin began to explore this idea. Classical Greek philosopher Plato emphasized in his writings that species were static and unchanging, yet there were also ancient Greeks who expressed evolutionary ideas. In the eighteenth century, naturalist Georges-Louis Leclerc Comte de Buffon reintroduced ideas about the evolution of animals and observed that various geographic regions have different plant and animal populations, even when the environments are similar. Some at this time also accepted that there were extinct species.
Also during the eighteenth century, James Hutton, a Scottish geologist and naturalist, proposed that geological change occurred gradually by accumulating small changes from processes operating like they are today over long periods of time. This contrasted with the predominant view that the planet's geology was a consequence of catastrophic events occurring during a relatively brief past. Nineteenth century geologist Charles Lyell popularized Hutton's view. A friend to Darwin. Lyell’s ideas were influential on Darwin’s thinking: Lyell’s notion of the greater age of Earth gave more time for gradual change in species, and the process of change provided an analogy for this change. In the early nineteenth century, Jean-Baptiste Lamarck published a book that detailed a mechanism for evolutionary change. We now refer to this mechanism as an inheritance of acquired characteristics by which the environment causes modifications in an individual, or offspring could use or disuse of a structure during its lifetime, and thus bring about change in a species. While many discredited this mechanism for evolutionary change, Lamarck’s ideas were an important influence on evolutionary thought.
Charles Darwin and Natural Selection
In the mid-nineteenth century, two naturalists, Charles Darwin and Alfred Russel Wallace, independently conceived and described the actual mechanism for evolution. Importantly, each naturalist spent time exploring the natural world on expeditions to the tropics. From 1831 to 1836, Darwin traveled around the world on H.M.S. Beagle, including stops in South America, Australia, and the southern tip of Africa. Wallace traveled to Brazil to collect insects in the Amazon rainforest from 1848 to 1852 and to the Malay Archipelago from 1854 to 1862. Darwin’s journey, like Wallace’s later journeys to the Malay Archipelago, included stops at several island chains, the last being the Galápagos Islands west of Ecuador. On these islands, Darwin observed species of organisms on different islands that were clearly similar, yet had distinct differences. For example, the ground finches inhabiting the Galápagos Islands comprised several species with a unique beak shape (Figure 18.2). The species on the islands had a graded series of beak sizes and shapes with very small differences between the most similar. He observed that these finches closely resembled another finch species on the South American mainland. Darwin imagined that the island species might be species modified from one of the original mainland species. Upon further study, he realized that each finch's varied beaks helped the birds acquire a specific type of food. For example, seed-eating finches had stronger, thicker beaks for breaking seeds, and insect-eating finches had spear-like beaks for stabbing their prey.
Figure 18.2 Darwin observed that beak shape varies among finch species. He postulated that ancestral species' beaks had adapted over time to equip the finches to acquire different food sources.
Wallace and Darwin both observed similar patterns in other organisms and they independently developed the same explanation for how and why such changes could take place. Darwin called this mechanism natural selection. Natural selection, or “survival of the fittest,” is the more prolific reproduction of individuals with favorable traits that survive environmental change because of those traits. This leads to evolutionary change.
For example, Darwin observed a population of giant tortoises in the Galápagos Archipelago to have longer necks than those that lived on other islands with dry lowlands. These tortoises were “selected” because they could reach more leaves and access more food than those with short necks. In times of drought when fewer leaves would be available, those that could reach more leaves had a better chance to eat and survive than those that couldn’t reach the food source. Consequently, long-necked tortoises would be more likely to be reproductively successful and pass the long-necked trait to their offspring. Over time, only long-necked tortoises would be present in the population.
Natural selection, Darwin argued, was an inevitable outcome of three principles that operated in nature. First, most characteristics of organisms are inherited, or passed from parent to offspring. Although no one, including Darwin and Wallace, knew how this happened at the time, it was a common understanding. Second, more offspring are produced than are able to survive, so resources for survival and reproduction are limited. The capacity for reproduction in all organisms outstrips the availability of resources to support their numbers. Thus, there is competition for those resources in each generation. Both Darwin and Wallace’s understanding of this principle came from reading economist Thomas Malthus' essay that explained this principle in relation to human populations. Third, offspring vary among each other in regard to their characteristics and those variations are inherited. Darwin and Wallace reasoned that offspring with inherited characteristics which allow them to best compete for limited resources will survive and have more offspring than those individuals with variations that are less able to compete. Because characteristics are inherited, these traits will be better represented in the next generation. This will lead to change in populations over generations in a process that Darwin called descent with modification. Ultimately, natural selection leads to greater adaptation of the population to its local environment. It is the only mechanism known for adaptive evolution.
In 1858, Darwin and Wallace (Figure 18.3) presented papers at the Linnean Society in London that discussed the idea of natural selection. The following year Darwin’s book, On the Origin of Species, was published. His book outlined in considerable detail his arguments for evolution by natural selection.
Figure 18.3 Both (a) Charles Darwin and (b) Alfred Wallace wrote scientific papers on natural selection that they presented together at the Linnean Society in 1858.
It is difficult and time-consuming to document and present examples of evolution by natural selection. The Galápagos finches are an excellent example. Peter and Rosemary Grant and their colleagues have studied Galápagos finch populations every year since 1976 and have provided important evidence of natural selection. The Grants found changes from one generation to the next in beak shape distribution with the medium ground finch on the Galápagos island of Daphne Major. The birds have inherited a variation in their bill shape with some having wide deep bills and others having thinner bills. During a period in which rainfall was higher than normal because of an El Niño, there was a lack of large hard seeds of which the large-billed birds ate; however, there was an abundance of the small soft seeds which the small-billed birds ate. Therefore, the small-billed birds were able to survive and reproduce. In the years following this El Niño, the Grants measured beak sizes in the population and found that the average bill size was smaller. Since bill size is an inherited trait, parents with smaller bills had more offspring and the bill evolved into a much smaller size. As conditions improved in 1987 and larger seeds became more available, the trend toward smaller average bill size ceased.
Career Connection
Career Connection
Field BiologistMany people hike, explore caves, scuba dive, or climb mountains for recreation. People often participate in these activities hoping to see wildlife. Experiencing the outdoors can be incredibly enjoyable and invigorating. What if your job entailed working in the wilderness? Field biologists by definition work outdoors in the “field.” The term field in this case refers to any location outdoors, even under water. A field biologist typically focuses research on a certain species, group of organisms, or a single habitat (Figure 18.4).
Figure 18.4 A field biologist tranquilizes a polar bear for study. (credit: Karen Rhode)
One objective of many field biologists includes discovering new, unrecorded species. Not only do such findings expand our understanding of the natural world, but they also lead to important innovations in fields such as medicine and agriculture. Plant and microbial species, in particular, can reveal new medicinal and nutritive knowledge. Other organisms can play key roles in ecosystems or if rare require protection. When discovered, researchers can use these important species as evidence for environmental regulations and laws.
Processes and Patterns of Evolution
Natural selection can only take place if there is variation, or differences, among individuals in a population. Importantly, these differences must have some genetic basis; otherwise, the selection will not lead to change in the next generation. This is critical because nongenetic reasons can cause variation among individuals such as an individual's height because of better nutrition rather than different genes.
Genetic diversity in a population comes from two main mechanisms: mutation and sexual reproduction. Mutation, a change in DNA, is the ultimate source of new alleles, or new genetic variation in any population. The genetic changes that mutation causes can have one of three outcomes on the phenotype. A mutation affects the organism's phenotype in a way that gives it reduced fitness—lower likelihood of survival or fewer offspring. A mutation may produce a phenotype with a beneficial effect on fitness. Many mutations will also have no effect on the phenotype's fitness. We call these neutral mutations. Mutations may also have a whole range of effect sizes on the organism's fitness that expresses them in their phenotype, from a small effect to a great effect. Sexual reproduction also leads to genetic diversity: when two parents reproduce, unique combinations of alleles assemble to produce the unique genotypes and thus phenotypes in each offspring.
We call a heritable trait that helps an organism's survival and reproduction in its present environment an adaptation. Scientists describe groups of organisms adapting to their environment when a genetic variation occurs over time that increases or maintains the population's “fit” to its environment. A platypus's webbed feet are an adaptation for swimming. A snow leopard's thick fur is an adaptation for living in the cold. A cheetah's fast speed is an adaptation for catching prey.
Whether or not a trait is favorable depends on the current environmental conditions. The same traits are not always selected because environmental conditions can change. For example, consider a plant species that grew in a moist climate and did not need to conserve water. Large leaves were selected because they allowed the plant to obtain more energy from the sun. Large leaves require more water to maintain than small leaves, and the moist environment provided favorable conditions to support large leaves. After thousands of years, the climate changed, and the area no longer had excess water. The direction of natural selection shifted so that plants with small leaves were selected because those populations were able to conserve water to survive the new environmental conditions.
The evolution of species has resulted in enormous variation in form and function. Sometimes, evolution gives rise to groups of organisms that become tremendously different from each other. We call two species that evolve in diverse directions from a common point divergent evolution. We can see such divergent evolution in the forms of the reproductive organs of flowering plants which share the same basic anatomies; however, they can look very different as a result of selection in different physical environments and adaptation to different kinds of pollinators (Figure 18.5).
Figure 18.5 Flowering plants evolved from a common ancestor. Notice that the (a) dense blazing star (Liatrus spicata) and the (b) purple coneflower (Echinacea purpurea) vary in appearance, yet both share a similar basic morphology. (credit a: modification of work by Drew Avery; credit b: modification of work by Cory Zanker)
In other cases, similar phenotypes evolve independently in distantly related species. For example, flight has evolved in both bats and insects, and they both have structures we refer to as wings, which are adaptations to flight. However, bat and insect wings have evolved from very different original structures. We call this phenomenon convergent evolution, where similar traits evolve independently in species that do not share a recent common ancestry. The trait in the two species came to be similar in structure and have the same function, flying, but did so separately from each other.
These physical changes occur over enormous time spans and help explain how evolution occurs. Natural selection acts on individual organisms, which can then shape an entire species. Although natural selection may work in a single generation on an individual, it can take thousands or even millions of years for an entire species' genotype to evolve. It is over these large time spans that life on earth has changed and continues to change.
Evidence of Evolution
The evidence for evolution is compelling and extensive. Looking at every level of organization in living systems, biologists see the signature of past and present evolution. Darwin dedicated a large portion of his book, On the Origin of Species, to identifying patterns in nature that were consistent with evolution, and since Darwin, our understanding has become clearer and broader.
Fossils
Fossils provide solid evidence that organisms from the past are not the same as those today, and fossils show the gradual evolutionary changes over time. Scientists determine the age of fossils and categorize them from all over the world to determine when the organisms lived relative to each other. The resulting fossil record tells the story of the past and shows the evolution of form over millions of years (Figure 18.6). For example, scientists have recovered highly detailed records showing the evolution of humans and horses (Figure 18.6). The whale flipper shares a similar morphology to bird and mammal appendages (Figure 18.7) indicating that these species share a common ancestor.
Figure 18.6 In this (a) display, fossil hominids are arranged from oldest (bottom) to newest (top). As hominids evolved, the skull's shape changed. An artist’s rendition of (b) extinct species of the genus Equus reveals that these ancient species resembled the modern horse (Equus ferus) but varied in size.
Anatomy and Embryology
Another type of evidence for evolution is the presence of structures in organisms that share the same basic form. For example, the bones in human, dog, bird, and whale appendages all share the same overall construction (Figure 18.7) resulting from their origin in a common ancestor's appendages. Over time, evolution led to changes in the bones' shapes and sizes in different species, but they have maintained the same overall layout. Scientists call these synonymous parts homologous structures.
Figure 18.7 The similar construction of these appendages indicates that these organisms share a common ancestor.
Some structures exist in organisms that have no apparent function at all, and appear to be residual parts from a past common ancestor. We call these unused structures without function vestigial structures. Other examples of vestigial structures are wings on flightless birds, leaves on some cacti, and hind leg bones in whales. Not all similarities represent homologous structures. As explained in Determining Evolutionary Relationships, when similar characteristics occur because of environmental constraints and not due to a close evolutionary relationship, it is an analogy or homoplasy. For example, insects use wings to fly like bats and birds, but the wing structure and embryonic origin are completely different. These are analogous structures (Figure 20.8).
Link to Learning
Link to Learning
Watch this video exploring the bones in the human body.
Another piece of evidence of evolution is the convergence of form in organisms that share similar environments. For example, species of unrelated animals, such as the arctic fox and ptarmigan, living in the arctic region have been selected for seasonal white phenotypes during winter to blend with the snow and ice (Figure 18.8). These similarities occur not because of common ancestry, but because of similar selection pressures—the benefits of predators not seeing them.
Figure 18.8 The white winter coat of the (a) arctic fox and the (b) ptarmigan’s plumage are adaptations to their environments. (credit a: modification of work by Keith Morehouse)
Embryology, the study of the anatomy of an organism's development to its adult form, also provides evidence of relatedness between now widely divergent groups of organisms. Mutational tweaking in the embryo can have such magnified consequences in the adult that tends to conserve embryo formation. As a result, structures that are absent in some groups often appear in their embryonic forms and disappear when they reach the adult or juvenile form. For example, all vertebrate embryos, including humans, exhibit gill slits and tails at some point in their early development. These disappear in the adults of terrestrial groups but adult forms of aquatic groups such as fish and some amphibians maintain them. Great ape embryos, including humans, have a tail structure during their development that they lose when they are born.
Biogeography
The geographic distribution of organisms on the planet follows patterns that we can explain best by evolution in conjunction with tectonic plate movement over geological time. Broad groups that evolved before the supercontinent Pangaea broke up (about 200 million years ago) are distributed worldwide. Groups that evolved since the breakup appear uniquely in regions of the planet, such as the unique flora and fauna of northern continents that formed from the supercontinent Laurasia and of the southern continents that formed from the supercontinent Gondwana. The presence of members of the plant family Proteaceae in Australia, southern Africa, and South America was most predominant prior to the southern supercontinent Gondwana breaking up.
Marsupial diversification in Australia and the absence of other mammals reflect Australia’s long isolation. Australia has an abundance of endemic species—species found nowhere else—which is typical of islands whose isolation by expanses of water prevents species to migrate. Over time, these species diverge evolutionarily into new species that look very different from their ancestors that may exist on the mainland. Australia's marsupials, the Galápagos' finches, and many species on the Hawaiian Islands are all unique to their one point of origin, yet they display distant relationships to ancestral species on mainlands.
Molecular Biology
Like anatomical structures, the molecular structures of life reflect descent with modification. DNA's universality reflects evidence of a common ancestor for all of life. Fundamental divisions in life between the genetic code, DNA replication, and expression are reflected in major structural differences in otherwise conservative structures such as ribosome components and membrane structures. In general, the relatedness of groups of organisms is reflected in the similarity of their DNA sequences—exactly the pattern that we would expect from descent and diversification from a common ancestor.
DNA sequences have also shed light on some of the mechanisms of evolution. For example, it is clear that the evolution of new functions for proteins commonly occurs after gene duplication events that allow freely modifying one copy by mutation, selection, or drift (changes in a population’s gene pool resulting from chance), while the second copy continues to produce a functional protein.
Misconceptions of Evolution
Although the theory of evolution generated some controversy when Darwin first proposed it, biologists almost universally accepted it, particularly younger biologists, within 20 years after publication of On the Origin of Species. Nevertheless, the theory of evolution is a difficult concept and misconceptions about how it works abound.
Link to Learning
Link to Learning
This site addresses some of the main misconceptions associated with the theory of evolution.
Evolution Is Just a Theory
Critics of the theory of evolution dismiss its importance by purposefully confounding the everyday usage of the word “theory” with the way scientists use the word. In science, we understand a “theory” to be a body of thoroughly tested and verified explanations for a set of observations of the natural world. Scientists have a theory of the atom, a theory of gravity, and the theory of relativity, each which describes understood facts about the world. In the same way, the theory of evolution describes facts about the living world. As such, a theory in science has survived significant efforts to discredit it by scientists. In contrast, a “theory” in common vernacular is a word meaning a guess or suggested explanation. This meaning is more akin to the scientific concept of “hypothesis.” When critics of evolution say it is “just a theory,” they are implying that there is little evidence supporting it and that it is still in the process of rigorous testing. This is a mischaracterization.
Individuals Evolve
Evolution is the change in a population's genetic composition over time, specifically over generations, resulting from differential reproduction of individuals with certain alleles. Individuals do change over their lifetime, obviously, but this is development and involves changes programmed by the set of genes the individual acquired at birth in coordination with the individual’s environment. When thinking about the evolution of a characteristic, it is probably best to think about the change of the average value of the characteristic in the population over time. For example, when natural selection leads to bill-size change in medium ground finches in the Galápagos, this does not mean that individual bills on the finches are changing. If one measures the average bill size among all individuals in the population at one time and then measures them in the population several years later, this average value will be different as a result of evolution. Although some individuals may survive from the first time to the second, they will still have the same bill size; however, there will be many new individuals who contribute to the shift in average bill size.
Evolution Explains the Origin of Life
It is a common misunderstanding that evolution includes an explanation of life’s origins. Some of the theory’s critics believe that it cannot explain the origin of life. The theory does not try to explain the origin of life. The theory of evolution explains how populations change over time and how life diversifies the origin of species. It does not shed light on the beginnings of life including the origins of the first cells, which define life. Importantly, biologists believe that the presence of life on Earth precludes the possibility that the events that led to life on Earth can repeat themselves because the intermediate stages would immediately become food for existing living things.
However, once a mechanism of inheritance was in place in the form of a molecule like DNA either within a cell or pre-cell, these entities would be subject to the principle of natural selection. More effective reproducers would increase in frequency at the expense of inefficient reproducers. While evolution does not explain the origin of life, it may have something to say about some of the processes operating once pre-living entities acquired certain properties.
Organisms Evolve on Purpose
Statements such as “organisms evolve in response to a change in an environment” are quite common, but such statements can lead to two types of misunderstandings. First, do not interpret the statement to mean that individual organisms evolve. The statement is shorthand for “a population evolves in response to a changing environment.” However, a second misunderstanding may arise by interpreting the statement to mean that the evolution is somehow intentional. A changed environment results in some individuals in the population, those with particular phenotypes, benefiting and therefore producing proportionately more offspring than other phenotypes. This results in change in the population if the characteristics are genetically determined.
It is also important to understand that the variation that natural selection works on is already in a population and does not arise in response to an environmental change. For example, applying antibiotics to a population of bacteria will, over time, select a population of bacteria that are resistant to antibiotics. The resistance, which a gene causes, did not arise by mutation because of applying the antibiotic. The gene for resistance was already present in the bacteria's gene pool, likely at a low frequency. The antibiotic, which kills the bacterial cells without the resistance gene, strongly selects individuals that are resistant, since these would be the only ones that survived and divided. Experiments have demonstrated that mutations for antibiotic resistance do not arise as a result of antibiotic.
In a larger sense, evolution is not goal directed. Species do not become “better” over time. They simply track their changing environment with adaptations that maximize their reproduction in a particular environment at a particular time. Evolution has no goal of making faster, bigger, more complex, or even smarter species, despite the commonness of this kind of language in popular discourse. What characteristics evolve in a species are a function of the variation present and the environment, both of which are constantly changing in a nondirectional way. A trait that fits in one environment at one time may well be fatal at some point in the future. This holds equally well for insect and human species.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.01%3A_Evolution_and_the_Origin_of_Species/4.1.02%3A_Understanding_Evolution.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Define species and describe how scientists identify species as different
• Describe genetic variables that lead to speciation
• Identify prezygotic and postzygotic reproductive barriers
• Explain allopatric and sympatric speciation
• Describe adaptive radiation
Although all life on earth shares various genetic similarities, only certain organisms combine genetic information by sexual reproduction and have offspring that can then successfully reproduce. Scientists call such organisms members of the same biological species.
Species and the Ability to Reproduce
A species is a group of individual organisms that interbreed and produce fertile, viable offspring. According to this definition, one species is distinguished from another when, in nature, it is not possible for matings between individuals from each species to produce fertile offspring.
Members of the same species share both external and internal characteristics, which develop from their DNA. The closer relationship two organisms share, the more DNA they have in common, just like people and their families. People’s DNA is likely to be more like their father or mother’s DNA than their cousin or grandparent’s DNA. Organisms of the same species have the highest level of DNA alignment and therefore share characteristics and behaviors that lead to successful reproduction.
Species’ appearance can be misleading in suggesting an ability or inability to mate. For example, even though domestic dogs (Canis lupus familiaris) display phenotypic differences, such as size, build, and coat, most dogs can interbreed and produce viable puppies that can mature and sexually reproduce (Figure 18.9).
Figure 18.9 The (a) poodle and (b) cocker spaniel can reproduce to produce a breed known as (c) the cockapoo. (credit a: modification of work by Sally Eller, Tom Reese; credit b: modification of work by Jeremy McWilliams; credit c: modification of work by Kathleen Conklin)
In other cases, individuals may appear similar although they are not members of the same species. For example, even though bald eagles (Haliaeetus leucocephalus) and African fish eagles (Haliaeetus vocifer) are both birds and eagles, each belongs to a separate species group (Figure 18.10). If humans were to artificially intervene and fertilize a bald eagle's egg with an African fish eagle's sperm and a chick did hatch, that offspring, called a hybrid (a cross between two species), would probably be infertile—unable to successfully reproduce after it reached maturity. Different species may have different genes that are active in development; therefore, it may not be possible to develop a viable offspring with two different sets of directions. Thus, even though hybridization may take place, the two species still remain separate.
Figure 18.10 The (a) African fish eagle is similar in appearance to the (b) bald eagle, but the two birds are members of different species. (credit a: modification of work by Nigel Wedge; credit b: modification of work by U.S. Fish and Wildlife Service)
Populations of species share a gene pool: a collection of all the gene variants in the species. Again, the basis to any changes in a group or population of organisms must be genetic for this is the only way to share and pass on traits. When variations occur within a species, they can only pass to the next generation along two main pathways: asexual reproduction or sexual reproduction. The change will pass on asexually simply if the reproducing cell possesses the changed trait. For the changed trait to pass on by sexual reproduction, a gamete, such as a sperm or egg cell, must possess the changed trait. In other words, sexually-reproducing organisms can experience several genetic changes in their body cells, but if these changes do not occur in a sperm or egg cell, the changed trait will never reach the next generation. Only heritable traits can evolve. Therefore, reproduction plays a paramount role for genetic change to take root in a population or species. In short, organisms must be able to reproduce with each other to pass new traits to offspring.
Speciation
The biological definition of species, which works for sexually reproducing organisms, is a group of actual or potential interbreeding individuals. There are exceptions to this rule. Many species are similar enough that hybrid offspring are possible and may often occur in nature, but for the majority of species this rule generally holds. The presence in nature of hybrids between similar species suggests that they may have descended from a single interbreeding species, and the speciation process may not yet be completed.
Given the extraordinary diversity of life on the planet there must be mechanisms for speciation: the formation of two species from one original species. Darwin envisioned this process as a branching event and diagrammed the process in the only illustration in On the Origin of Species (Figure 18.11a). Compare this illustration to the diagram of elephant evolution (Figure 18.11), which shows that as one species changes over time, it branches to form more than one new species, repeatedly, as long as the population survives or until the organism becomes extinct.
Figure 18.11 The only illustration in Darwin's On the Origin of Species is (a) a diagram showing speciation events leading to biological diversity. The diagram shows similarities to phylogenetic charts that today illustrate the relationships of species. (b) Modern elephants evolved from the Palaeomastodon, a species that lived in Egypt 35–50 million years ago.
For speciation to occur, two new populations must form from one original population and they must evolve in such a way that it becomes impossible for individuals from the two new populations to interbreed. Biologists have proposed mechanisms by which this could occur that fall into two broad categories. Allopatric speciation (allo- = "other"; -patric = "homeland") involves geographic separation of populations from a parent species and subsequent evolution. Sympatric speciation (sym- = "same"; -patric = "homeland") involves speciation occurring within a parent species remaining in one location.
Biologists think of speciation events as the splitting of one ancestral species into two descendant species. There is no reason why more than two species might not form at one time except that it is less likely and we can conceptualize multiple events as single splits occurring close in time.
Allopatric Speciation
A geographically continuous population has a gene pool that is relatively homogeneous. Gene flow, the movement of alleles across a species' range, is relatively free because individuals can move and then mate with individuals in their new location. Thus, an allele's frequency at one end of a distribution will be similar to the allele's frequency at the other end. When populations become geographically discontinuous, it prevents alleles' free-flow. When that separation lasts for a period of time, the two populations are able to evolve along different trajectories. Thus, their allele frequencies at numerous genetic loci gradually become increasingly different as new alleles independently arise by mutation in each population. Typically, environmental conditions, such as climate, resources, predators, and competitors for the two populations will differ causing natural selection to favor divergent adaptations in each group.
Isolation of populations leading to allopatric speciation can occur in a variety of ways: a river forming a new branch, erosion creating a new valley, a group of organisms traveling to a new location without the ability to return, or seeds floating over the ocean to an island. The nature of the geographic separation necessary to isolate populations depends entirely on the organism's biology and its potential for dispersal. If two flying insect populations took up residence in separate nearby valleys, chances are, individuals from each population would fly back and forth continuing gene flow. However, if a new lake divided two rodent populations continued gene flow would be unlikely; therefore, speciation would be more likely.
Biologists group allopatric processes into two categories: dispersal and vicariance. Dispersal is when a few members of a species move to a new geographical area, and vicariance is when a natural situation arises to physically divide organisms.
Scientists have documented numerous cases of allopatric speciation taking place. For example, along the west coast of the United States, two separate spotted owl subspecies exist. The northern spotted owl has genetic and phenotypic differences from its close relative: the Mexican spotted owl, which lives in the south (Figure 18.12).
Figure 18.12 The northern spotted owl and the Mexican spotted owl inhabit geographically separate locations with different climates and ecosystems. The owl is an example of allopatric speciation. (credit "northern spotted owl": modification of work by John and Karen Hollingsworth; credit "Mexican spotted owl": modification of work by Bill Radke)
Additionally, scientists have found that the further the distance between two groups that once were the same species, the more likely it is that speciation will occur. This seems logical because as the distance increases, the various environmental factors would likely have less in common than locations in close proximity. Consider the two owls: in the north, the climate is cooler than in the south. The types of organisms in each ecosystem differ, as do their behaviors and habits. Also, the hunting habits and prey choices of the southern owls vary from the northern owls. These variances can lead to evolved differences in the owls, and speciation likely will occur.
Adaptive Radiation
In some cases, a population of one species disperses throughout an area, and each finds a distinct niche or isolated habitat. Over time, the varied demands of their new lifestyles lead to multiple speciation events originating from a single species. We call this adaptive radiation because many adaptations evolve from a single point of origin; thus, causing the species to radiate into several new ones. Island archipelagos like the Hawaiian Islands provide an ideal context for adaptive radiation events because water surrounds each island which leads to geographical isolation for many organisms. The Hawaiian honeycreeper illustrates one example of adaptive radiation. From a single species, the founder species, numerous species have evolved, including the six in Figure 18.13.
Figure 18.13 The honeycreeper birds illustrate adaptive radiation. From one original species of bird, multiple others evolved, each with its own distinctive characteristics.
Notice the differences in the species’ beaks in Figure 18.13. Evolution in response to natural selection based on specific food sources in each new habitat led to evolution of a different beak suited to the specific food source. The seed-eating bird has a thicker, stronger beak which is suited to break hard nuts. The nectar-eating birds have long beaks to dip into flowers to reach the nectar. The insect-eating birds have beaks like swords, appropriate for stabbing and impaling insects. Darwin’s finches are another example of adaptive radiation in an archipelago.
Link to Learning
Link to Learning
Watch this video to see how scientists use evidence to understand how birds evolved.
Sympatric Speciation
Can divergence occur if no physical barriers are in place to separate individuals who continue to live and reproduce in the same habitat? The answer is yes. We call the process of speciation within the same space sympatric. The prefix “sym” means same, so “sympatric” means “same homeland” in contrast to “allopatric” meaning “other homeland.” Scientists have proposed and studied many mechanisms.
One form of sympatric speciation can begin with a serious chromosomal error during cell division. In a normal cell division event chromosomes replicate, pair up, and then separate so that each new cell has the same number of chromosomes. However, sometimes the pairs separate and the end cell product has extra sets of chromosomes in a condition that we call polyploidy (Figure 18.14).
Visual Connection
Visual Connection
Figure 18.14 Aneuploidy results when the gametes have too many or too few chromosomes due to nondisjunction during meiosis. In this example, the resulting offspring will have 2n+1 or 2n-1 chromosomes.
Which is most likely to survive, offspring with 2n+1 chromosomes or offspring with 2n-1 chromosomes?
Polyploidy is a condition in which a cell or organism has an extra set, or sets, of chromosomes. Scientists have identified two main types of polyploidy that can lead to reproductive isolation of an individual in the polyploidy state. Reproductive isolation is the inability to interbreed. In some cases, a polyploid individual will have two or more complete sets of chromosomes from its own species in a condition that we call autopolyploidy (Figure 18.15). The prefix “auto-” means “self,” so the term means multiple chromosomes from one’s own species. Polyploidy results from an error in meiosis in which all of the chromosomes move into one cell instead of separating.
Figure 18.15 Autopolyploidy results when mitosis is not followed by cytokinesis.
For example, if a plant species with 2n = 6 produces autopolyploid gametes that are also diploid (2n = 6, when they should be n = 3), the gametes now have twice as many chromosomes as they should have. These new gametes will be incompatible with the normal gametes that this plant species produces. However, they could either self-pollinate or reproduce with other autopolyploid plants with gametes having the same diploid number. In this way, sympatric speciation can occur quickly by forming offspring with 4n that we call a tetraploid. These individuals would immediately be able to reproduce only with those of this new kind and not those of the ancestral species.
The other form of polyploidy occurs when individuals of two different species reproduce to form a viable offspring that we call an allopolyploid. The prefix “allo-” means “other” (recall from allopatric): therefore, an allopolyploid occurs when gametes from two different species combine. Figure 18.16 illustrates one possible way an allopolyploid can form. Notice how it takes two generations, or two reproductive acts, before the viable fertile hybrid results.
Figure 18.16 Alloploidy results when two species mate to produce viable offspring. In this example, a normal gamete from one species fuses with a polyploidy gamete from another. Two matings are necessary to produce viable offspring.
The cultivated forms of wheat, cotton, and tobacco plants are all allopolyploids. Although polyploidy occurs occasionally in animals, it takes place most commonly in plants. (Animals with any of the types of chromosomal aberrations that we describe here are unlikely to survive and produce normal offspring.) Scientists have discovered more than half of all plant species studied relate back to a species evolved through polyploidy. With such a high rate of polyploidy in plants, some scientists hypothesize that this mechanism takes place more as an adaptation than as an error.
Reproductive Isolation
Given enough time, the genetic and phenotypic divergence between populations will affect characters that influence reproduction: if individuals of the two populations were brought together, mating would be less likely, but if mating occurred, offspring would be nonviable or infertile. Many types of diverging characters may affect the reproductive isolation, the ability to interbreed, of the two populations.
Reproductive isolation can take place in a variety of ways. Scientists organize them into two groups: prezygotic barriers and postzygotic barriers. Recall that a zygote is a fertilized egg: the first cell of an organism's development that reproduces sexually. Therefore, a prezygotic barrier is a mechanism that blocks reproduction from taking place. This includes barriers that prevent fertilization when organisms attempt reproduction. A postzygotic barrier occurs after zygote formation. This includes organisms that don’t survive the embryonic stage and those that are born sterile.
Some types of prezygotic barriers prevent reproduction entirely. Many organisms only reproduce at certain times of the year, often just annually. Differences in breeding schedules, which we call temporal isolation, can act as a form of reproductive isolation. For example, two frog species inhabit the same area, but one reproduces from January to March; whereas, the other reproduces from March to May (Figure 18.17).
Figure 18.17 These two related frog species exhibit temporal reproductive isolation. (a) Rana aurora breeds earlier in the year than (b) Rana boylii. (credit a: modification of work by Mark R. Jennings, USFWS; credit b: modification of work by Alessandro Catenazzi)
In some cases, populations of a species move or are moved to a new habitat and take up residence in a place that no longer overlaps with the same species' other populations. We call this situation habitat isolation. Reproduction with the parent species ceases, and a new group exists that is now reproductively and genetically independent. For example, a cricket population that was divided after a flood could no longer interact with each other. Over time, natural selection forces, mutation, and genetic drift will likely result in the two groups diverging (Figure 18.18).
Figure 18.18 Speciation can occur when two populations occupy different habitats. The habitats need not be far apart. The cricket (a) Gryllus pennsylvanicus prefers sandy soil, and the cricket (b) Gryllus firmus prefers loamy soil. The two species can live in close proximity, but because of their different soil preferences, they became genetically isolated.
Behavioral isolation occurs when the presence or absence of a specific behavior prevents reproduction. For example, male fireflies use specific light patterns to attract females. Various firefly species display their lights differently. If a male of one species tried to attract the female of another, she would not recognize the light pattern and would not mate with the male.
Other prezygotic barriers work when differences in their gamete cells (eggs and sperm) prevent fertilization from taking place. We call this a gametic barrier. Similarly, in some cases closely related organisms try to mate, but their reproductive structures simply do not fit together. For example, damselfly males of different species have differently shaped reproductive organs. If one species tries to mate with the female of another, their body parts simply do not fit together. (Figure 18.19).
Figure 18.19 The shape of the male reproductive organ varies among male damselfly species, and is only compatible with the female of that species. Reproductive organ incompatibility keeps the species reproductively isolated.
In plants, certain structures aimed to attract one type of pollinator simultaneously prevent a different pollinator from accessing the pollen. The tunnel through which an animal must access nectar can vary widely in length and diameter, which prevents the plant from cross-pollinating with a different species (Figure 18.20).
Figure 18.20 Some flowers have evolved to attract certain pollinators. The (a) wide foxglove flower is adapted for pollination by bees, while the (b) long, tube-shaped trumpet creeper flower is adapted for pollination by hummingbirds.
When fertilization takes place and a zygote forms, postzygotic barriers can prevent reproduction. Hybrid individuals in many cases cannot form normally in the womb and simply do not survive past the embryonic stages. We call this hybrid inviability because the hybrid organisms simply are not viable. In another postzygotic situation, reproduction leads to hybrid birth and growth that is sterile. Therefore, the organisms are unable to reproduce offspring of their own. We call this hybrid sterility.
Habitat Influence on Speciation
Sympatric speciation may also take place in ways other than polyploidy. For example, consider a fish species that lives in a lake. As the population grows, competition for food increases. Under pressure to find food, suppose that a group of these fish had the genetic flexibility to discover and feed off another resource that other fish did not use. What if this new food source was located at a different depth of the lake? Over time, those feeding on the second food source would interact more with each other than the other fish; therefore, they would breed together as well. Offspring of these fish would likely behave as their parents: feeding and living in the same area and keeping separate from the original population. If this group of fish continued to remain separate from the first population, eventually sympatric speciation might occur as more genetic differences accumulated between them.
This scenario does play out in nature, as do others that lead to reproductive isolation. One such place is Lake Victoria in Africa, famous for its sympatric speciation of cichlid fish. Researchers have found hundreds of sympatric speciation events in these fish, which have not only happened in great number, but also over a short period of time. Figure 18.21 shows this type of speciation among a cichlid fish population in Nicaragua. In this locale, two types of cichlids live in the same geographic location but have come to have different morphologies that allow them to eat various food sources.
Figure 18.21 Cichlid fish from Lake Apoyeque, Nicaragua, show evidence of sympatric speciation. Lake Apoyeque, a crater lake, is 1800 years old, but genetic evidence indicates that a single population of cichlid fish populated the lake only 100 years ago. Nevertheless, two populations with distinct morphologies and diets now exist in the lake, and scientists believe these populations may be in an early stage of speciation.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.01%3A_Evolution_and_the_Origin_of_Species/4.1.03%3A_Formation_of_New_Species.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe pathways of species evolution in hybrid zones
• Explain the two major theories on rates of speciation
Speciation occurs over a span of evolutionary time, so when a new species arises, there is a transition period during which the closely related species continue to interact.
Reconnection
After speciation, two species may recombine or even continue interacting indefinitely. Individual organisms will mate with any nearby individual with whom they are capable of breeding. We call an area where two closely related species continue to interact and reproduce, forming hybrids a hybrid zone. Over time, the hybrid zone may change depending on the fitness of the hybrids and the reproductive barriers (Figure 18.22). If the hybrids are less fit than the parents, speciation reinforcement occurs, and the species continue to diverge until they can no longer mate and produce viable offspring. If reproductive barriers weaken, fusion occurs and the two species become one. Barriers remain the same if hybrids are fit and reproductive: stability may occur and hybridization continues.
Visual Connection
Visual Connection
Figure 18.22 After speciation has occurred, the two separate but closely related species may continue to produce offspring in an area called the hybrid zone. Reinforcement, fusion, or stability may result, depending on reproductive barriers and the relative fitness of the hybrids.
If two species eat a different diet but one of the food sources is eliminated and both species are forced to eat the same foods, what change in the hybrid zone is most likely to occur?
Hybrids can be either less fit than the parents, more fit, or about the same. Usually hybrids tend to be less fit; therefore, such reproduction diminishes over time, nudging the two species to diverge further in a process we call reinforcement. Scientists use this term because the hybrids' low success reinforces the original speciation. If the hybrids are as fit or more fit than the parents, the two species may fuse back into one species (Figure 18.23). Scientists have also observed that sometimes two species will remain separate but also continue to interact to produce some individuals. Scientists classify this as stability because no real net change is taking place.
Varying Rates of Speciation
Scientists around the world study speciation, documenting observations both of living organisms and those found in the fossil record. As their ideas take shape and as research reveals new details about how life evolves, they develop models to help explain speciation rates. In terms of how quickly speciation occurs, we can observe two current patterns: gradual speciation model and punctuated equilibrium model.
In the gradual speciation model, species diverge gradually over time in small steps. In the punctuated equilibrium model, a new species undergoes changes quickly from the parent species, and then remains largely unchanged for long periods of time afterward (Figure 18.23). We call this early change model punctuated equilibrium, because it begins with a punctuated or periodic change and then remains in balance afterward. While punctuated equilibrium suggests a faster tempo, it does not necessarily exclude gradualism.
Visual Connection
Visual Connection
Figure 18.23 In (a) gradual speciation, species diverge at a slow, steady pace as traits change incrementally. In (b) punctuated equilibrium, species diverge quickly and then remain unchanged for long periods of time.
Which of the following statements is false?
1. Punctuated equilibrium is most likely to occur in a small population that experiences a rapid change in its environment.
2. Punctuated equilibrium is most likely to occur in a large population that lives in a stable climate.
3. Gradual speciation is most likely to occur in species that live in a stable climate.
4. Gradual speciation and punctuated equilibrium both result in the divergence of species.
The primary influencing factor on changes in speciation rate is environmental conditions. Under some conditions, selection occurs quickly or radically. Consider a species of snails that had been living with the same basic form for many thousands of years. Layers of their fossils would appear similar for a long time. When a change in the environment takes place—such as a drop in the water level—a small number of organisms are separated from the rest in a brief period of time, essentially forming one large and one tiny population. The tiny population faces new environmental conditions. Because its gene pool quickly became so small, any variation that surfaces and that aids in surviving the new conditions becomes the predominant form.
Link to Learning
Link to Learning
Visit this website to continue the speciation story of the snails.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.01%3A_Evolution_and_the_Origin_of_Species/4.1.04%3A_Reconnection_and_Speciation_Rates.txt
|
adaptation
heritable trait or behavior in an organism that aids in its survival and reproduction in its present environment
adaptive radiation
speciation when one species radiates to form several other species
allopatric speciation
speciation that occurs via geographic separation
allopolyploid
polyploidy formed between two related, but separate species
aneuploidy
condition of a cell having an extra chromosome or missing a chromosome for its species
autopolyploid
polyploidy formed within a single species
behavioral isolation
type of reproductive isolation that occurs when a specific behavior or lack of one prevents reproduction from taking place
convergent evolution
process by which groups of organisms independently evolve to similar forms
dispersal
allopatric speciation that occurs when a few members of a species move to a new geographical area
divergent evolution
process by which groups of organisms evolve in diverse directions from a common point
gametic barrier
prezygotic barrier occurring when closely related individuals of different species mate, but differences in their gamete cells (eggs and sperm) prevent fertilization from taking place
gradual speciation model
model that shows how species diverge gradually over time in small steps
habitat isolation
reproductive isolation resulting when species' populations move or are moved to a new habitat, taking up residence in a place that no longer overlaps with the same species' other populations
homologous structures
parallel structures in diverse organisms that have a common ancestor
hybrid
offspring of two closely related individuals, not of the same species
hybrid zone
area where two closely related species continue to interact and reproduce, forming hybrids
natural selection
reproduction of individuals with favorable genetic traits that survive environmental change because of those traits, leading to evolutionary change
postzygotic barrier
reproductive isolation mechanism that occurs after zygote formation
prezygotic barrier
reproductive isolation mechanism that occurs before zygote formation
punctuated equilibrium
model for rapid speciation that can occur when an event causes a small portion of a population to be cut off from the rest of the population
reinforcement
continued speciation divergence between two related species due to low fitness of hybrids between them
reproductive isolation
situation that occurs when a species is reproductively independent from other species; behavior, location, or reproductive barriers may cause this to happen
speciation
formation of a new species
species
group of populations that interbreed and produce fertile offspring
sympatric speciation
speciation that occurs in the same geographic space
temporal isolation
differences in breeding schedules that can act as a form of prezygotic barrier leading to reproductive isolation
variation
genetic differences among individuals in a population
vestigial structure
physical structure present in an organism but that has no apparent function and appears to be from a functional structure in a distant ancestor
vicariance
allopatric speciation that occurs when something in the environment separates organisms of the same species into separate groups
4.1.06: Chapter Summary
18.1 Understanding Evolution
Evolution is the process of adaptation through mutation which allows more desirable characteristics to pass to the next generation. Over time, organisms evolve more characteristics that are beneficial to their survival. For living organisms to adapt and change to environmental pressures, genetic variation must be present. With genetic variation, individuals have differences in form and function that allow some to survive certain conditions better than others. These organisms pass their favorable traits to their offspring. Eventually, environments change, and what was once a desirable, advantageous trait may become an undesirable trait and organisms may further evolve. Evolution may be convergent with similar traits evolving in multiple species or divergent with diverse traits evolving in multiple species that came from a common ancestor. We can observe evidence of evolution by means of DNA code and the fossil record, and also by the existence of homologous and vestigial structures.
18.2 Formation of New Species
Speciation occurs along two main pathways: geographic separation (allopatric speciation) and through mechanisms that occur within a shared habitat (sympatric speciation). Both pathways isolate a population reproductively in some form. Mechanisms of reproductive isolation act as barriers between closely related species, enabling them to diverge and exist as genetically independent species. Prezygotic barriers block reproduction prior to formation of a zygote; whereas, postzygotic barriers block reproduction after fertilization occurs. For a new species to develop, something must introduce a reproductive barrier. Sympatric speciation can occur through errors in meiosis that form gametes with extra chromosomes (polyploidy). Autopolyploidy occurs within a single species; whereas, allopolyploidy occurs between closely related species.
18.3 Reconnection and Speciation Rates
Speciation is not a precise division: overlap between closely related species can occur in areas called hybrid zones. Organisms reproduce with other similar organisms. The fitness of these hybrid offspring can affect the two species' evolutionary path. Scientists propose two models for the rate of speciation: one model illustrates how a species can change slowly over time. The other model demonstrates how change can occur quickly from a parent generation to a new species. Both models continue to follow natural selection patterns.
4.1.07: Visual Connection Questions
1.
Figure 18.14 Which is most likely to survive, offspring with 2n+1 chromosomes or offspring with 2n-1 chromosomes?
2.
Figure 18.22 If two species eat a different diet but one of the food sources is eliminated and both species are forced to eat the same foods, what change in the hybrid zone is most likely to occur?
3.
Figure 18.23 Which of the following statements is false?
1. Punctuated equilibrium is most likely to occur in a small population that experiences a rapid change in its environment.
2. Punctuated equilibrium is most likely to occur in a large population that lives in a stable climate.
3. Gradual speciation is most likely to occur in species that live in a stable climate.
4. Gradual speciation and punctuated equilibrium both result in the evolution of new species.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.01%3A_Evolution_and_the_Origin_of_Species/4.1.05%3A_Key_Terms.txt
|
4.
Which scientific concept did Charles Darwin and Alfred Wallace independently discover?
1. mutation
2. natural selection
3. overbreeding
4. sexual reproduction
5.
Which of the following situations will lead to natural selection?
1. The seeds of two plants land near each other and one grows larger than the other.
2. Two types of fish eat the same kind of food, and one is better able to gather food than the other.
3. Male lions compete for the right to mate with females, with only one possible winner.
4. all of the above
6.
Which description is an example of a phenotype?
1. A certain duck has a blue beak.
2. A mutation occurred to a flower.
3. Most cheetahs live solitary lives.
4. both a and c
7.
Which situation is most likely an example of convergent evolution?
1. Squid and humans have eyes similar in structure.
2. Worms and snakes both move without legs.
3. Some bats and birds have wings that allow them to fly.
4. all of the above
8.
Which situation would most likely lead to allopatric speciation?
1. Flood causes the formation of a new lake.
2. A storm causes several large trees to fall down.
3. A mutation causes a new trait to develop.
4. An injury causes an organism to seek out a new food source.
9.
What is the main difference between dispersal and vicariance?
1. One leads to allopatric speciation, whereas the other leads to sympatric speciation.
2. One involves the movement of the organism, and the other involves a change in the environment.
3. One depends on a genetic mutation occurring, and the other does not.
4. One involves closely related organisms, and the other involves only individuals of the same species.
10.
Which variable increases the likelihood of allopatric speciation taking place more quickly?
1. lower rate of mutation
2. longer distance between divided groups
3. increased instances of hybrid formation
4. equivalent numbers of individuals in each population
11.
What is the main difference between autopolyploid and allopolyploid?
1. the number of chromosomes
2. the functionality of the chromosomes
3. the source of the extra chromosomes
4. the number of mutations in the extra chromosomes
12.
Which reproductive combination produces hybrids?
1. when individuals of the same species in different geographical areas reproduce
2. when any two individuals sharing the same habitat reproduce
3. when members of closely related species reproduce
4. when offspring of the same parents reproduce
13.
Which condition is the basis for a species to be reproductively isolated from other members?
1. It does not share its habitat with related species.
2. It does not exist out of a single habitat.
3. It does not exchange genetic information with other species.
4. It does not undergo evolutionary changes for a significant period of time.
14.
Which situation is not an example of a prezygotic barrier?
1. Two species of turtles breed at different times of the year.
2. Two species of flowers attract different pollinators.
3. Two species of birds display different mating dances.
4. Two species of insects produce infertile offspring.
15.
Which term is used to describe the continued divergence of species based on the low fitness of hybrid offspring?
1. reinforcement
2. fusion
3. stability
4. punctuated equilibrium
16.
Which components of speciation would be least likely to be a part of punctuated equilibrium?
1. a division of populations
2. a change in environmental conditions
3. ongoing gene flow among all individuals
4. a large number of mutations taking place at once
4.1.09: Critical Thinking Questions
17.
If a person scatters a handful of garden pea plant seeds in one area, how would natural selection work in this situation?
18.
Why do scientists consider vestigial structures evidence for evolution?
19.
How does the scientific meaning of “theory” differ from the common vernacular meaning?
20.
Explain why the statement that a monkey is more evolved than a mouse is incorrect.
21.
Why do island chains provide ideal conditions for adaptive radiation to occur?
22.
Two species of fish had recently undergone sympatric speciation. The males of each species had a different coloring through which the females could identify and choose a partner from her own species. After some time, pollution made the lake so cloudy that it was hard for females to distinguish colors. What might take place in this situation?
23.
Why can polyploidy individuals lead to speciation fairly quickly?
24.
What do both rate of speciation models have in common?
25.
Describe a situation where hybrid reproduction would cause two species to fuse into one.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.01%3A_Evolution_and_the_Origin_of_Species/4.1.08%3A_Review_Questions.txt
|
Natural selection is one of the most dominant evolutionary forces. Natural selection acts to promote traits and behaviors that increase an organism’s chances of survival and reproduction, while eliminating those traits and behaviors that are to the organism’s detriment. But natural selection can only, as its name implies, select—it cannot create. The introduction of novel traits and behaviors falls on the shoulders of another evolutionary force—mutation. Mutation and other sources of variation among individuals, as well as the evolutionary forces that act upon them, alter populations and species. This combination of processes has led to the world of life we see today.
• 4.2.1: Introduction
All life on Earth is related. Evolutionary theory states that humans, beetles, plants, and bacteria all share a common ancestor, but that millions of years of evolution have shaped each of these organisms into the forms seen today. Scientists consider evolution a key concept to understanding life. Natural selection is one of the most dominant evolutionary forces.
• 4.2.2: Population Evolution
Initially, the newly discovered particulate nature of genes made it difficult for biologists to understand how gradual evolution could occur. But over the next few decades genetics and evolution were integrated in what became known as the modern synthesis—the coherent understanding of the relationship between natural selection and genetics that took shape by the 1940s and is generally accepted today.
• 4.2.3: Population Genetics
Individuals of a population often display different phenotypes, or express different alleles of a particular gene, referred to as polymorphisms. Populations with two or more variations of particular characteristics are called polymorphic. The distribution of phenotypes among individuals, known as the population variation, is influenced by a number of factors, including the population’s genetic structure and the environment.
• 4.2.4: Adaptive Evolution
Fitness is often quantifiable and is measured by scientists in the field. However, it is not the absolute fitness of an individual that counts, but rather how it compares to the other organisms in the population. This concept, called relative fitness, allows researchers to determine which individuals are contributing additional offspring to the next generation, and thus, how the population might evolve.
• 4.2.5: Key Terms
• 4.2.6: Chapter Summary
• 4.2.7: Visual Connection Questions
• 4.2.8: Review Questions
• 4.2.9: Critical Thinking Questions
4.02: The Evolution of Populations
Figure 19.1 Living things may be single-celled or complex, multicellular organisms. They may be plants, animals, fungi, bacteria, or archaea. This diversity results from evolution. (credit "wolf": modification of work by Gary Kramer; credit "coral": modification of work by William Harrigan, NOAA; credit "river": modification of work by Vojtěch Dostál; credit "fish" modification of work by Christian Mehlführer; credit "mushroom": modification of work by Cory Zanker; credit "tree": modification of work by Joseph Kranak; credit "bee": modification of work by Cory Zanker)
All life on Earth is related. Evolutionary theory states that humans, beetles, plants, and bacteria all share a common ancestor, but that millions of years of evolution have shaped each of these organisms into the forms we see today. Scientists consider evolution a key concept to understanding life. It is one of the most dominant evolutionary forces. Natural selection acts to promote traits and behaviors that increase an organism’s chances of survival and reproduction, while eliminating those traits and behaviors that are detrimental to the organism. However, natural selection can only, as its name implies, select—it cannot create. We can attribute novel traits and behaviors to another evolutionary force—mutation. Mutation and other sources of variation among individuals, as well as the evolutionary forces that act upon them, alter populations and species. This combination of processes has led to the world of life we see today.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.02%3A_The_Evolution_of_Populations/4.2.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Define population genetics and describe how scientists use population genetics in studying population evolution
• Define the Hardy-Weinberg principle and discuss its importance
People did not understand the mechanisms of inheritance, or genetics, at the time Charles Darwin and Alfred Russel Wallace were developing their idea of natural selection. This lack of knowledge was a stumbling block to understanding many aspects of evolution. The predominant (and incorrect) genetic theory of the time, blending inheritance, made it difficult to understand how natural selection might operate. Darwin and Wallace were unaware of the Austrian monk Gregor Mendel's 1866 publication "Experiments in Plant Hybridization", which came out not long after Darwin's book, On the Origin of Species. Scholars rediscovered Mendel’s work in the early twentieth century at which time geneticists were rapidly coming to an understanding of the basics of inheritance. Initially, the newly discovered particulate nature of genes made it difficult for biologists to understand how gradual evolution could occur. However, over the next few decades scientists integrated genetics and evolution in what became known as the modern synthesis—the coherent understanding of the relationship between natural selection and genetics that took shape by the 1940s. Generally, this concept is accepted today. In short, the modern synthesis describes how evolutionary processes, such as natural selection, can affect a population’s genetic makeup, and, in turn, how this can result in the gradual evolution of populations and species. The theory also connects population change over time (microevolution), with the processes that gave rise to new species and higher taxonomic groups with widely divergent characters, called (macroevolution).
Everyday Connection
Everyday Connection
Evolution and Flu VaccinesEvery fall, the media starts reporting on flu vaccinations and potential outbreaks. Scientists, health experts, and institutions determine recommendations for different parts of the population, predict optimal production and inoculation schedules, create vaccines, and set up clinics to provide inoculations. You may think of the annual flu shot as media hype, an important health protection, or just a briefly uncomfortable prick in your arm. However, do you think of it in terms of evolution?
The media hype of annual flu shots is scientifically grounded in our understanding of evolution. Each year, scientists across the globe strive to predict the flu strains that they anticipate as most widespread and harmful in the coming year. They base this knowledge on how flu strains have evolved over time and over the past few flu seasons. Scientists then work to create the most effective vaccine to combat those selected strains. Pharmaceutical companies produce hundreds of millions of doses in a short period in order to provide vaccinations to key populations at the optimal time.
Because viruses, like the flu, evolve very quickly (especially in evolutionary time), this poses quite a challenge. Viruses mutate and replicate at a fast rate, so the vaccine developed to protect against last year’s flu strain may not provide the protection one needs against the coming year’s strain. Evolution of these viruses means continued adaptations to ensure survival, including adaptations to survive previous vaccines.
Population Genetics
Recall that a gene for a particular character may have several alleles, or variants, that code for different traits associated with that character. For example, in the ABO blood type system in humans, three alleles determine the particular blood-type carbohydrate on the surface of red blood cells. Each individual in a population of diploid organisms can only carry two alleles for a particular gene, but more than two may be present in the individuals that comprise the population. Mendel followed alleles as they were inherited from parent to offspring. In the early twentieth century, biologists in the area of population genetics began to study how selective forces change a population through changes in allele and genotypic frequencies.
The allele frequency (or gene frequency) is the rate at which a specific allele appears within a population. Until now we have discussed evolution as a change in the characteristics of a population of organisms, but behind that phenotypic change is genetic change. In population genetics, scientists define the term evolution as a change in the allele's frequency in a population. Using the ABO blood type system as an example, the frequency of one of the alleles, IA, is the number of copies of that allele divided by all the copies of the ABO gene in the population. For example, a study in Jordan1 found a frequency of IA to be 26.1 percent. The IB and I0 alleles comprise 13.4 percent and 60.5 percent of the alleles respectively, and all of the frequencies added up to 100 percent. A change in this frequency over time would constitute evolution in the population.
The allele frequency within a given population can change depending on environmental factors; therefore, certain alleles become more widespread than others during the natural selection process. Natural selection can alter the population’s genetic makeup. An example is if a given allele confers a phenotype that allows an individual to better survive or have more offspring. Because many of those offspring will also carry the beneficial allele, and often the corresponding phenotype, they will have more offspring of their own that also carry the allele, thus, perpetuating the cycle. Over time, the allele will spread throughout the population. Some alleles will quickly become fixed in this way, meaning that every individual of the population will carry the allele, while detrimental mutations may be swiftly eliminated if derived from a dominant allele from the gene pool. The gene pool is the sum of all the alleles in a population.
Sometimes, allele frequencies within a population change randomly with no advantage to the population over existing allele frequencies. We call this phenomenon genetic drift. Natural selection and genetic drift usually occur simultaneously in populations and are not isolated events. It is hard to determine which process dominates because it is often nearly impossible to determine the cause of change in allele frequencies at each occurrence. We call an event that initiates an allele frequency change in an isolated part of the population, which is not typical of the original population, the founder effect. Natural selection, random drift, and founder effects can lead to significant changes in a population's genome.
Hardy-Weinberg Principle of Equilibrium
In the early twentieth century, English mathematician Godfrey Hardy and German physician Wilhelm Weinberg stated the principle of equilibrium to describe the population's genetic makeup. The theory, which later became known as the Hardy-Weinberg principle of equilibrium, states that a population’s allele and genotype frequencies are inherently stable— unless some kind of evolutionary force is acting upon the population, neither the allele nor the genotypic frequencies would change. The Hardy-Weinberg principle assumes an infinitely large population and conditions with no mutations, migration, emigration, or selective pressure for or against genotype. While no population can satisfy those conditions, the principle offers a useful model against which to compare real population changes.
Working under this theory, population geneticists represent different alleles as different variables in their mathematical models. The variable p, for example, often represents the frequency of a particular allele, say Y for the trait of yellow in Mendel’s peas, while the variable q represents the frequency of y alleles that confer the color green. If these are the only two possible alleles for a given locus in the population, p + q = 1. In other words, all the p alleles and all the q alleles comprise all of the alleles for that locus in the population.
However, what ultimately interests most biologists is not the frequencies of different alleles, but the frequencies of the resulting genotypes, known as the population’s genetic structure, from which scientists can surmise phenotype distribution. If we observe the phenotype, we can know only the homozygous recessive allele's genotype. The calculations provide an estimate of the remaining genotypes. Since each individual carries two alleles per gene, if we know the allele frequencies (p and q), predicting the genotypes' frequencies is a simple mathematical calculation to determine the probability of obtaining these genotypes if we draw two alleles at random from the gene pool. In the above scenario, an individual pea plant could be pp (YY), and thus produce yellow peas; pq (Yy), also yellow; or qq (yy), and thus produce green peas (Figure 19.2). In other words, the frequency of pp individuals is simply p2; the frequency of pq individuals is 2pq; and the frequency of qq individuals is q2. Again, if p and q are the only two possible alleles for a given trait in the population, these genotypes frequencies will sum to one: p2 + 2pq + q2 = 1.
Visual Connection
Visual Connection
Figure 19.2 When populations are in the Hardy-Weinberg equilibrium, the allelic frequency is stable from generation to generation and we can determine the allele distribution from the Hardy-Weinberg equation. If the allelic frequency measured in the field differs from the predicted value, scientists can make inferences about what evolutionary forces are at play.
In plants, violet flower color (V) is dominant over white (v). If p = 0.8 and q = 0.2 in a population of 500 plants, how many individuals would you expect to be homozygous dominant (VV), heterozygous (Vv), and homozygous recessive (vv)? How many plants would you expect to have violet flowers, and how many would have white flowers?
In theory, if a population is at equilibrium—that is, there are no evolutionary forces acting upon it—generation after generation would have the same gene pool and genetic structure, and these equations would all hold true all of the time. Of course, even Hardy and Weinberg recognized that no natural population is immune to evolution. Populations in nature are constantly changing in genetic makeup due to drift, mutation, possibly migration, and selection. As a result, the only way to determine the exact distribution of phenotypes in a population is to go out and count them. However, the Hardy-Weinberg principle gives scientists a mathematical baseline of a non-evolving population to which they can compare evolving populations and thereby infer what evolutionary forces might be at play. If the frequencies of alleles or genotypes deviate from the value expected from the Hardy-Weinberg equation, then the population is evolving.
Link to Learning
Link to Learning
Use this online calculator to determine a population's genetic structure.
Footnotes
• 1Sahar S. Hanania, Dhia S. Hassawi, and Nidal M. Irshaid, “Allele Frequency and Molecular Genotypes of ABO Blood Group System in a Jordanian Population,” Journal of Medical Sciences 7 (2007): 51-58, doi:10.3923/jms.2007.51.58.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.02%3A_The_Evolution_of_Populations/4.2.02%3A_Population_Evolution.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the different types of variation in a population
• Explain why only natural selection can act upon heritable variation
• Describe genetic drift and the bottleneck effect
• Explain how each evolutionary force can influence a population's allele frequencies
A population's individuals often display different phenotypes, or express different alleles of a particular gene, which scientists refer to as polymorphisms. We call populations with two or more variations of particular characteristics polymorphic. A number of factors, including the population’s genetic structure and the environment (Figure 19.3) influence population variation, the distribution of phenotypes among individuals. Understanding phenotypic variation sources in a population is important for determining how a population will evolve in response to different evolutionary pressures.
Figure 19.3 The distribution of phenotypes in this litter of kittens illustrates population variation. (credit: Pieter Lanser)
Genetic Variance
Natural selection and some of the other evolutionary forces can only act on heritable traits, namely an organism’s genetic code. Because alleles are passed from parent to offspring, those that confer beneficial traits or behaviors may be selected, while deleterious alleles may not. Acquired traits, for the most part, are not heritable. For example, if an athlete works out in the gym every day, building up muscle strength, the athlete’s offspring will not necessarily grow up to be a body builder. If there is a genetic basis for the ability to run fast, on the other hand, a parent may pass this to a child.
Link to Learning
Link to Learning
Before Darwinian evolution became the prevailing theory of the field, French naturalist Jean-Baptiste Lamarck theorized that organisms could inherit acquired traits. While the majority of scientists have not supported this hypothesis, some have recently begun to realize that Lamarck was not completely wrong. Visit this site to learn more.
Heritability is the fraction of phenotype variation that we can attribute to genetic differences, or genetic variance, among individuals in a population. The greater the heritability of a population’s phenotypic variation, the more susceptible it is to the evolutionary forces that act on heritable variation.
We call the diversity of alleles and genotypes within a population genetic variance. When scientists are involved in the breeding of a species, such as with animals in zoos and nature preserves, they try to increase a population’s genetic variance to preserve as much of the phenotypic diversity as possible. This also helps reduce associated risks of inbreeding, the mating of closely related individuals, which can have the undesirable effect of bringing together deleterious recessive mutations that can cause abnormalities and susceptibility to disease. For example, a disease that is caused by a rare, recessive allele might exist in a population, but it will only manifest itself when an individual carries two copies of the allele. Because the allele is rare in a normal, healthy population with unrestricted habitat, the chance that two carriers will mate is low, and even then, only 25 percent of their offspring will inherit the disease allele from both parents. While it is likely to happen at some point, it will not happen frequently enough for natural selection to be able to swiftly eliminate the allele from the population, and as a result, the allele maintains itself at low levels in the gene pool. However, if a family of carriers begins to interbreed with each other, this will dramatically increase the likelihood of two carriers mating and eventually producing diseased offspring, a phenomenon that scientists call inbreeding depression.
Changes in allele frequencies that we identify in a population can shed light on how it is evolving. In addition to natural selection, there are other evolutionary forces that could be in play: genetic drift, gene flow, mutation, nonrandom mating, and environmental variances.
Genetic Drift
The theory of natural selection stems from the observation that some individuals in a population are more likely to survive longer and have more offspring than others; thus, they will pass on more of their genes to the next generation. A big, powerful male gorilla, for example, is much more likely than a smaller, weaker one to become the population’s silverback, the pack’s leader who mates far more than the other males of the group. The pack leader will father more offspring, who share half of his genes, and are likely to also grow bigger and stronger like their father. Over time, the genes for bigger size will increase in frequency in the population, and the population will, as a result, grow larger on average. That is, this would occur if this particular selection pressure, or driving selective force, were the only one acting on the population. In other examples, better camouflage or a stronger resistance to drought might pose a selection pressure.
Another way a population’s allele and genotype frequencies can change is genetic drift (Figure 19.4), which is simply the effect of chance. By chance, some individuals will have more offspring than others—not due to an advantage conferred by some genetically-encoded trait, but just because one male happened to be in the right place at the right time (when the receptive female walked by) or because the other one happened to be in the wrong place at the wrong time (when a fox was hunting).
Visual Connection
Visual Connection
Figure 19.4 Genetic drift in a population can lead to eliminating an allele from a population by chance. In this example, rabbits with the brown coat color allele (B) are dominant over rabbits with the white coat color allele (b). In the first generation, the two alleles occur with equal frequency in the population, resulting in p and q values of .5. Only half of the individuals reproduce, resulting in a second generation with p and q values of .7 and .3, respectively. Only two individuals in the second generation reproduce, and by chance these individuals are homozygous dominant for brown coat color. As a result, in the third generation the recessive b allele is lost.
Do you think genetic drift would happen more quickly on an island or on the mainland?
Small populations are more susceptible to the forces of genetic drift. Large populations, alternatively, are buffered against the effects of chance. If one individual of a population of 10 individuals happens to die at a young age before it leaves any offspring to the next generation, all of its genes—1/10 of the population’s gene pool—will be suddenly lost. In a population of 100, that’s only 1 percent of the overall gene pool; therefore, it is much less impactful on the population’s genetic structure.
Link to Learning
Link to Learning
Go to this site to watch an animation of random sampling and genetic drift in action.
Natural events, such as an earthquake disaster that kills—at random—a large portion of the population, can magnify genetic drift. Known as the bottleneck effect, it results in suddenly wiping out a large portion of the gene pool (Figure 19.5). At once, the survivors' genetic structure becomes the entire population's genetic structure, which may be very different from the pre-disaster population.
Figure 19.5 A chance event or catastrophe can reduce the genetic variability within a population.
Another scenario in which populations might experience a strong influence of genetic drift is if some portion of the population leaves to start a new population in a new location or if a physical barrier divides a population. In this situation, those individuals are an unlikely representation of the entire population, which results in the founder effect. The founder effect occurs when the genetic structure changes to match that of the new population’s founding fathers and mothers. Researchers believe that the founder effect was a key factor in the genetic history of the Afrikaner population of Dutch settlers in South Africa, as evidenced by mutations that are common in Afrikaners but rare in most other populations. This is probably because a higher-than-normal proportion of the founding colonists carried these mutations. As a result, the population expresses unusually high incidences of Huntington’s disease (HD) and Fanconi anemia (FA), a genetic disorder known to cause blood marrow and congenital abnormalities—even cancer.2
Link to Learning
Link to Learning
Watch this short video to learn more about the founder and bottleneck effects.
Scientific Method Connection
Scientific Method Connection
Testing the Bottleneck Effect
Question: How do natural disasters affect a population's genetic structure?
Background: When an earthquake or hurricane suddenly wipes out much of a population, the surviving individuals are usually a random sampling of the original group. As a result, the population's genetic makeup can change dramatically. We call this phenomenon the bottleneck effect.
Hypothesis: Repeated natural disasters will yield different population genetic structures; therefore, each time one runs this experiment the results will vary.
Test the hypothesis: Count out the original population using different colored beads. For example, red, blue, and yellow beads might represent red, blue, and yellow individuals. After recording the number of each individual in the original population, place them all in a bottle with a narrow neck that will only allow a few beads out at a time. Then, pour 1/3 of the bottle’s contents into a bowl. This represents the surviving individuals after a natural disaster kills a majority of the population. Count the number of the different colored beads in the bowl, and record it. Then, place all of the beads back in the bottle and repeat the experiment four more times.
Analyze the data: Compare the five populations that resulted from the experiment. Do the populations all contain the same number of different colored beads, or do they vary? Remember, these populations all came from the same exact parent population.
Form a conclusion: Most likely, the five resulting populations will differ quite dramatically. This is because natural disasters are not selective—they kill and spare individuals at random. Now think about how this might affect a real population. What happens when a hurricane hits the Mississippi Gulf Coast? How do the seabirds that live on the beach fare?
Gene Flow
Another important evolutionary force is gene flow: the flow of alleles in and out of a population due to the migration of individuals or gametes (Figure 19.6). While some populations are fairly stable, others experience more flux. Many plants, for example, send their pollen far and wide, by wind or by bird, to pollinate other populations of the same species some distance away. Even a population that may initially appear to be stable, such as a pride of lions, can experience its fair share of immigration and emigration as developing males leave their mothers to seek out a new pride with genetically unrelated females. This variable flow of individuals in and out of the group not only changes the population's gene structure, but it can also introduce new genetic variation to populations in different geological locations and habitats.
Figure 19.6 Gene flow can occur when an individual travels from one geographic location to another.
Mutation
Mutations are changes to an organism’s DNA and are an important driver of diversity in populations. Species evolve because of mutations accumulating over time. The appearance of new mutations is the most common way to introduce novel genotypic and phenotypic variance. Some mutations are unfavorable or harmful and are quickly eliminated from the population by natural selection. Others are beneficial and will spread through the population. Whether or not a mutation is beneficial or harmful is determined by whether it helps an organism survive to sexual maturity and reproduce. Some mutations do not do anything and can linger, unaffected by natural selection, in the genome. Some can have a dramatic effect on a gene and the resulting phenotype.
Nonrandom Mating
If individuals nonrandomly mate with their peers, the result can be a changing population. There are many reasons nonrandom mating occurs. One reason is simple mate choice. For example, female peahens may prefer peacocks with bigger, brighter tails. Natural selection picks traits that lead to more mating selections for an individual. One common form of mate choice, called assortative mating, is an individual’s preference to mate with partners who are phenotypically similar to themselves.
Another cause of nonrandom mating is physical location. This is especially true in large populations spread over vast geographic distances where not all individuals will have equal access to one another. Some might be miles apart through woods or over rough terrain, while others might live immediately nearby.
Environmental Variance
Genes are not the only players involved in determining population variation. Other factors, such as the environment (Figure 19.7) also influence phenotypes. A beachgoer is likely to have darker skin than a city dweller, for example, due to regular exposure to the sun, an environmental factor. For some species, the environment determines some major characteristics, such as gender. For example, some turtles and other reptiles have temperature-dependent sex determination (TSD). TSD means that individuals develop into males if their eggs are incubated within a certain temperature range, or females at a different temperature range.
Figure 19.7 The temperature at which the eggs are incubated determine the American alligator's (Alligator mississippiensis) sex. Eggs incubated at 30°C produce females, and eggs incubated at 33°C produce males. (credit: Steve Hillebrand, USFWS)
Geographic separation between populations can lead to differences in the phenotypic variation between those populations. We see such geographical variation between most populations and it can be significant. We can observe one type of geographic variation, a cline, as given species' populations vary gradually across an ecological gradient. Species of warm-blooded animals, for example, tend to have larger bodies in the cooler climates closer to the earth’s poles, allowing them to better conserve heat. This is a latitudinal cline. Alternatively, flowering plants tend to bloom at different times depending on where they are along a mountain slope. This is an altitudinal cline.
If there is gene flow between the populations, the individuals will likely show gradual differences in phenotype along the cline. Restricted gene flow, alternatively can lead to abrupt differences, even speciation.
Footnotes
• 2A. J. Tipping et al., “Molecular and Genealogical Evidence for a Founder Effect in Fanconi Anemia Families of the Afrikaner Population of South Africa,” PNAS 98, no. 10 (2001): 5734-5739, doi: 10.1073/pnas.091402398.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.02%3A_The_Evolution_of_Populations/4.2.03%3A_Population_Genetics.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Explain the different ways natural selection can shape populations
• Describe how these different forces can lead to different outcomes in terms of the population variation
Natural selection acts on the population’s heritable traits: selecting for beneficial alleles that allow for environmental adaptation, and thus increasing their frequency in the population, while selecting against deleterious alleles and thereby decreasing their frequency. Scientists call this process adaptive evolution. Natural selection acts on entire organisms, not on an individual allele within the organism. An individual may carry a very beneficial genotype with a resulting phenotype that, for example, increases the ability to reproduce (fecundity), but if that same individual also carries an allele that results in a fatal childhood disease, that fecundity phenotype will not pass to the next generation because the individual will not live to reach reproductive age. Natural selection acts at the individual's level. It selects for individuals with greater contributions to the gene pool of the next generation. Scientists call this an organism’s evolutionary (Darwinian) fitness.
Fitness is often quantifiable and is measured by scientists in the field. However, it is not an individual's absolute fitness that counts, but rather how it compares to the other organisms in the population. Scientists call this concept relative fitness, which allows researchers to determine which individuals are contributing additional offspring to the next generation, and thus, how the population might evolve.
There are several ways selection can affect population variation: stabilizing selection, directional selection, diversifying selection, frequency-dependent selection, and sexual selection. As natural selection influences the allele frequencies in a population, individuals can either become more or less genetically similar and the phenotypes can become more similar or more disparate.
Stabilizing Selection
If natural selection favors an average phenotype, selecting against extreme variation, the population will undergo stabilizing selection (Figure 19.8). In a mouse population that live in the woods, for example, natural selection is likely to favor mice that best blend in with the forest floor and are less likely for predators to spot. Assuming the ground is a fairly consistent shade of brown, those mice whose fur is most closely matched to that color will be most likely to survive and reproduce, passing on their genes for their brown coat. Mice that carry alleles that make them a bit lighter or a bit darker will stand out against the ground and be more likely to fall victim to predation. As a result of this selection, the population’s genetic variance will decrease.
Directional Selection
When the environment changes, populations will often undergo directional selection (Figure 19.8), which selects for phenotypes at one end of the spectrum of existing variation. A classic example of this type of selection is the evolution of the peppered moth in eighteenth- and nineteenth-century England. Prior to the Industrial Revolution, the moths were predominately light in color, which allowed them to blend in with the light-colored trees and lichens in their environment. However, as soot began spewing from factories, the trees darkened, and the light-colored moths became easier for predatory birds to spot. Over time, the frequency of the moth's melanic form increased because they had a higher survival rate in habitats affected by air pollution because their darker coloration blended with the sooty trees. Similarly, the hypothetical mouse population may evolve to take on a different coloration if something were to cause the forest floor where they live to change color. The result of this type of selection is a shift in the population’s genetic variance toward the new, fit phenotype.
Link to Learning
Link to Learning
In science, we sometimes believe some things are true, and then new information becomes available that changes our understanding. The peppered moth story is an example: some scientists recently have questioned the facts behind the selection toward darker moths. Read this article to learn more.
Diversifying Selection
Sometimes two or more distinct phenotypes can each have their advantages for natural selection, while the intermediate phenotypes are, on average, less fit. Scientists call this diversifying selection (Figure 19.8) We see this in many animal populations that have multiple male forms. Large, dominant alpha males use brute force to obtain mates, while small males can sneak in for furtive copulations with the females in an alpha male’s territory. In this case, both the alpha males and the “sneaking” males will be selected for, but medium-sized males, who can’t overtake the alpha males and are too big to sneak copulations, are selected against. Diversifying selection can also occur when environmental changes favor individuals on either end of the phenotypic spectrum. Imagine a mouse population living at the beach where there is light-colored sand interspersed with patches of tall grass. In this scenario, light-colored mice that blend in with the sand would be favored, as well as dark-colored mice that can hide in the grass. Medium-colored mice, alternatively would not blend in with either the grass or the sand, and thus predators would most likely eat them. The result of this type of selection is increased genetic variance as the population becomes more diverse.
Visual Connection
Visual Connection
Figure 19.8 Different types of natural selection can impact the distribution of phenotypes within a population. In (a) stabilizing selection, an average phenotype is favored. In (b) directional selection, a change in the environment shifts the spectrum of observed phenotypes. In (c) diversifying selection, two or more extreme phenotypes are selected for, while the average phenotype is selected against.
In recent years, factories have become cleaner, and release less soot into the environment. What impact do you think this has had on the distribution of moth color in the population?
Frequency-Dependent Selection
Another type of selection, frequency-dependent selection, favors phenotypes that are either common (positive frequency-dependent selection) or rare (negative frequency-dependent selection). We can observe an interesting example of this type of selection in a unique group of Pacific Northwest lizards. Male common side-blotched lizards come in three throat-color patterns: orange, blue, and yellow. Each of these forms has a different reproductive strategy: orange males are the strongest and can fight other males for access to their females. Blue males are medium-sized and form strong pair bonds with their mates. Yellow males (Figure 19.9) are the smallest, and look a bit like females, which allows them to sneak copulations. Like a game of rock-paper-scissors, orange beats blue, blue beats yellow, and yellow beats orange in the competition for females. That is, the big, strong orange males can fight off the blue males to mate with the blue’s pair-bonded females, the blue males are successful at guarding their mates against yellow sneaker males, and the yellow males can sneak copulations from the potential mates of the large, polygynous orange males.
Figure 19.9 A yellow-throated side-blotched lizard is smaller than either the blue-throated or orange-throated males and appears a bit like the females of the species, allowing it to sneak copulations. (credit: “tinyfroglet”/Flickr)
In this scenario, natural selection favors orange males when blue males dominate the population. Blue males will thrive when the population is mostly yellow males, and yellow males will be selected for when orange males are the most populous. As a result, populations of side-blotched lizards cycle in the distribution of these phenotypes—in one generation, orange might predominate, and then yellow males will begin to rise in frequency. Once yellow males comprise a majority of the population, blue males will be selected. Finally, when blue males become common, orange males once again will be favored.
Negative frequency-dependent selection serves to increase the population’s genetic variance by selecting for rare phenotypes; whereas, positive frequency-dependent selection usually decreases genetic variance by selecting for common phenotypes.
Sexual Selection
Males and females of certain species are often quite different from one another in ways beyond the reproductive organs. Males are often larger, for example, and display many elaborate colors and adornments, like the peacock’s tail, while females tend to be smaller and duller in decoration. We call such differences sexual dimorphisms (Figure 19.10), which arise in many populations, particularly animal populations, where there is more variance in the male's reproductive success than that of the females. That is, some males—often the bigger, stronger, or more decorated males—obtain the vast majority of the total matings, while others receive none. This can occur because the males are better at fighting off other males, or because females will choose to mate with the bigger or more decorated males. In either case, this variation in reproductive success generates a strong selection pressure among males to obtain those matings, resulting in the evolution of bigger body size and elaborate ornaments to attract the females’ attention. Females, however, tend to achieve a handful of selected matings; therefore, they are more likely to select more desirable males.
Sexual dimorphism varies widely among species, and some species are even sex-role reversed. In such cases, females tend to have a greater variance in their reproductive success than males and are correspondingly selected for the bigger body size and elaborate traits usually characteristic of males.
Figure 19.10 Sexual dimorphism in (a) peacocks and peahens, (b) Argiope appensa spiders (the female spider is the large one), and in (c) wood ducks. (credit “spiders”: modification of work by “Sanba38”/Wikimedia Commons; credit “duck”: modification of work by Kevin Cole)
We call the selection pressures on males and females to obtain matings sexual selection. It can result in developing secondary sexual characteristics that do not benefit the individual’s likelihood of survival but help to maximize its reproductive success. Sexual selection can be so strong that it selects traits that are actually detrimental to the individual’s survival. Think, once again, about the peacock’s tail. While it is beautiful and the male with the largest, most colorful tail is more likely to win the female, it is not the most practical appendage. In addition to greater visibility to predators, it makes the males slower in their attempted escapes. There is some evidence that this risk is why females like the big tails in the first place. The speculation is that large tails carry risk, and only the best males survive that risk: the bigger the tail, the more fit the male. We call this the handicap principle.
The good genes hypothesis states that males develop these impressive ornaments to show off their efficient metabolism or their ability to fight disease. Females then choose males with the most impressive traits because it signals their genetic superiority, which they will then pass on to their offspring. Although one may argue that females should not be picky because it will likely reduce their number of offspring, if better males father more fit offspring, it may be beneficial. Fewer, healthier offspring may increase the chances of survival more than many, weaker offspring.
Link to Learning
Link to Learning
In 1915, biologist Ronald Fisher proposed another model of sexual selection: the Fisherian runaway model, which suggests that selection of certain traits is a result of sexual preference.
In both the handicap principle and the good genes hypothesis, the trait is an honest signal of the males’ quality, thus giving females a way to find the fittest mates— males that will pass the best genes to their offspring.
No Perfect Organism
Natural selection is a driving force in evolution and can generate populations that are better adapted to survive and successfully reproduce in their environments. However, natural selection cannot produce the perfect organism. Natural selection can only select on existing variation in the population. It does not create anything from scratch. Thus, it is limited by a population’s existing genetic variance and whatever new alleles arise through mutation and gene flow.
Natural selection is also limited because it works at the individual, not allele level, and some alleles are linked due to their physical proximity in the genome, making them more likely to pass on together (linkage disequilibrium). Any given individual may carry some beneficial and some unfavorable alleles. It is the alleles' net effect, or the organism’s fitness, upon which natural selection can act. As a result, good alleles can be lost if individuals who carry them also have several overwhelmingly bad alleles. Likewise, bad alleles can be kept if individuals who have enough good alleles to result in an overall fitness benefit carry them.
Furthermore, natural selection can be constrained by the relationships between different polymorphisms. One morph may confer a higher fitness than another, but may not increase in frequency because going from the less beneficial to the more beneficial trait would require going through a less beneficial phenotype. Think back to the mice that live at the beach. Some are light-colored and blend in with the sand, while others are dark and blend in with the patches of grass. The dark-colored mice may be, overall, more fit than the light-colored mice, and at first glance, one might expect the light-colored mice to be selected for a darker coloration. However, remember that the intermediate phenotype, a medium-colored coat, is very bad for the mice—they cannot blend in with either the sand or the grass and predators are more likely to eat them. As a result, the light-colored mice would not be selected for a dark coloration because those individuals who began moving in that direction (began selection for a darker coat) would be less fit than those that stayed light.
Finally, it is important to understand that not all evolution is adaptive. While natural selection selects the fittest individuals and often results in a more fit population overall, other forces of evolution, including genetic drift and gene flow, often do the opposite: introducing deleterious alleles to the population’s gene pool. Evolution has no purpose—it is not changing a population into a preconceived ideal. It is simply the sum of the various forces that we have described in this chapter and how they influence the population's genetic and phenotypic variance.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.02%3A_The_Evolution_of_Populations/4.2.04%3A_Adaptive_Evolution.txt
|
adaptive evolution
increase in frequency of beneficial alleles and decrease in deleterious alleles due to selection
allele frequency
(also, gene frequency) rate at which a specific allele appears within a population
assortative mating
when individuals tend to mate with those who are phenotypically similar to themselves
bottleneck effect
magnification of genetic drift as a result of natural events or catastrophes
cline
gradual geographic variation across an ecological gradient
directional selection
selection that favors phenotypes at one end of the spectrum of existing variation
diversifying selection
selection that favors two or more distinct phenotypes
evolutionary fitness
(also, Darwinian fitness) individual’s ability to survive and reproduce
founder effect
event that initiates an allele frequency change in part of the population, which is not typical of the original population
frequency-dependent selection
selection that favors phenotypes that are either common (positive frequency-dependent selection) or rare (negative frequency-dependent selection)
gene flow
flow of alleles in and out of a population due to the individual or gamete migration
gene pool
all the alleles that the individuals in the population carry
genetic drift
effect of chance on a population’s gene pool
genetic structure
distribution of the different possible genotypes in a population
genetic variance
diversity of alleles and genotypes in a population
geographical variation
differences in the phenotypic variation between populations that are separated geographically
good genes hypothesis
theory of sexual selection that argues individuals develop impressive ornaments to show off their efficient metabolism or ability to fight disease
handicap principle
theory of sexual selection that argues only the fittest individuals can afford costly traits
heritability
fraction of population variation that can be attributed to its genetic variance
honest signal
trait that gives a truthful impression of an individual’s fitness
inbreeding
mating of closely related individuals
inbreeding depression
increase in abnormalities and disease in inbreeding populations
macroevolution
broader scale evolutionary changes that scientists see over paleontological time
microevolution
changes in a population’s genetic structure
modern synthesis
overarching evolutionary paradigm that took shape by the 1940s and scientists generally accept today
nonrandom mating
changes in a population’s gene pool due to mate choice or other forces that cause individuals to mate with certain phenotypes more than others
population genetics
study of how selective forces change the allele frequencies in a population over time
population variation
distribution of phenotypes in a population
relative fitness
individual’s ability to survive and reproduce relative to the rest of the population
selective pressure
environmental factor that causes one phenotype to be better than another
sexual dimorphism
phenotypic difference between a population's males and females
stabilizing selection
selection that favors average phenotypes
4.2.06: Chapter Summary
19.1 Population Evolution
The modern synthesis of evolutionary theory grew out of the cohesion of Darwin’s, Wallace’s, and Mendel’s thoughts on evolution and heredity, along with the more modern study of population genetics. It describes the evolution of populations and species, from small-scale changes among individuals to large-scale changes over paleontological time periods. To understand how organisms evolve, scientists can track populations’ allele frequencies over time. If they differ from generation to generation, scientists can conclude that the population is not in Hardy-Weinberg equilibrium, and is thus evolving.
19.2 Population Genetics
Both genetic and environmental factors can cause phenotypic variation in a population. Different alleles can confer different phenotypes, and different environments can also cause individuals to look or act differently. Only those differences encoded in an individual’s genes, however, can pass to its offspring and, thus, be a target of natural selection. Natural selection works by selecting for alleles that confer beneficial traits or behaviors, while selecting against those for deleterious qualities. Genetic drift stems from the chance occurrence that some individuals in the gene line have more offspring than others. When individuals leave or join the population, allele frequencies can change as a result of gene flow. Mutations to an individual’s DNA may introduce new variation into a population. Allele frequencies can also alter when individuals do not randomly mate with others in the group.
19.3 Adaptive Evolution
Because natural selection acts to increase the frequency of beneficial alleles and traits while decreasing the frequency of deleterious qualities, it is adaptive evolution. Natural selection acts at the individual level, selecting for those that have a higher overall fitness compared to the rest of the population. If the fit phenotypes are those that are similar, natural selection will result in stabilizing selection, and an overall decrease in the population’s variation. Directional selection works to shift a population’s variance toward a new, fit phenotype, as environmental conditions change. In contrast, diversifying selection results in increased genetic variance by selecting for two or more distinct phenotypes.
Other types of selection include frequency-dependent selection, in which individuals with either common (positive frequency-dependent selection) or rare (negative frequency-dependent selection) are selected. Finally, sexual selection results from one sex having more variance in the reproductive success than the other. As a result, males and females experience different selective pressures, which can often lead to the evolution of phenotypic differences, or sexual dimorphisms, between the two.
4.2.07: Visual Connection Questions
1.
Figure 19.2 In plants, violet flower color (V) is dominant over white (v). If p = .8 and q = 0.2 in a population of 500 plants, how many individuals would you expect to be homozygous dominant (VV), heterozygous (Vv), and homozygous recessive (vv)? How many plants would you expect to have violet flowers, and how many would have white flowers?
2.
Figure 19.4 Do you think genetic drift would happen more quickly on an island or on the mainland?
3.
Figure 19.8 In recent years, factories have become cleaner, and less soot is released into the environment. What impact do you think this has had on the distribution of moth color in the population?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.02%3A_The_Evolution_of_Populations/4.2.05%3A_Key_Terms.txt
|
4.
What is the difference between micro- and macroevolution?
1. Microevolution describes the evolution of small organisms, such as insects, while macroevolution describes the evolution of large organisms, like people and elephants.
2. Microevolution describes the evolution of microscopic entities, such as molecules and proteins, while macroevolution describes the evolution of whole organisms.
3. Microevolution describes the evolution of organisms in populations, while macroevolution describes the evolution of species over long periods of time.
4. Microevolution describes the evolution of organisms over their lifetimes, while macroevolution describes the evolution of organisms over multiple generations.
5.
Population genetics is the study of:
1. how selective forces change the allele frequencies in a population over time
2. the genetic basis of population-wide traits
3. whether traits have a genetic basis
4. the degree of inbreeding in a population
6.
Which of the following populations is not in Hardy-Weinberg equilibrium?
1. a population with 12 homozygous recessive individuals (yy), 8 homozygous dominant individuals (YY), and 4 heterozygous individuals (Yy)
2. a population in which the allele frequencies do not change over time
3. p2 + 2pq + q2 = 1
4. a population undergoing natural selection
7.
One of the original Amish colonies rose from a ship of colonists that came from Europe. The ship’s captain, who had polydactyly, a rare dominant trait, was one of the original colonists. Today, we see a much higher frequency of polydactyly in the Amish population. This is an example of:
1. natural selection
2. genetic drift
3. founder effect
4. b and c
8.
When male lions reach sexual maturity, they leave their group in search of a new pride. This can alter the allele frequencies of the population through which of the following mechanisms?
1. natural selection
2. genetic drift
3. gene flow
4. random mating
9.
Which of the following evolutionary forces can introduce new genetic variation into a population?
1. natural selection and genetic drift
2. mutation and gene flow
3. natural selection and nonrandom mating
4. mutation and genetic drift
10.
What is assortative mating?
1. when individuals mate with those who are similar to themselves
2. when individuals mate with those who are dissimilar to themselves
3. when individuals mate with those who are the most fit in the population
4. when individuals mate with those who are least fit in the population
11.
When closely related individuals mate with each other, or inbreed, the offspring are often not as fit as the offspring of two unrelated individuals. Why?
1. Close relatives are genetically incompatible.
2. The DNA of close relatives reacts negatively in the offspring.
3. Inbreeding can bring together rare, deleterious mutations that lead to harmful phenotypes.
4. Inbreeding causes normally silent alleles to be expressed.
12.
What is a cline?
1. the slope of a mountain where a population lives
2. the degree to which a mutation helps an individual survive
3. the number of individuals in the population
4. gradual geographic variation across an ecological gradient
13.
Which type of selection results in greater genetic variance in a population?
1. stabilizing selection
2. directional selection
3. diversifying selection
4. positive frequency-dependent selection
14.
When males and females of a population look or act differently, it is referred to as ________.
1. sexual dimorphism
2. sexual selection
3. diversifying selection
4. a cline
15.
The good genes hypothesis is a theory that explains what?
1. why more fit individuals are more likely to have more offspring
2. why alleles that confer beneficial traits or behaviors are selected for by natural selection
3. why some deleterious mutations are maintained in the population
4. why individuals of one sex develop impressive ornamental traits
4.2.09: Critical Thinking Questions
16.
Solve for the genetic structure of a population with 12 homozygous recessive individuals (yy), 8 homozygous dominant individuals (YY), and 4 heterozygous individuals (Yy).
17.
Explain the Hardy-Weinberg principle of equilibrium theory.
18.
Imagine you are trying to test whether a population of flowers is undergoing evolution. You suspect there is selection pressure on the color of the flower: bees seem to cluster around the red flowers more often than the blue flowers. In a separate experiment, you discover blue flower color is dominant to red flower color. In a field, you count 600 blue flowers and 200 red flowers. What would you expect the genetic structure of the flowers to be?
19.
Describe a situation in which a population would undergo the bottleneck effect and explain what impact that would have on the population’s gene pool.
20.
Describe natural selection and give an example of natural selection at work in a population.
21.
Explain what a cline is and provide examples.
22.
Give an example of a trait that may have evolved as a result of the handicap principle and explain your reasoning.
23.
List the ways in which evolution can affect population variation and describe how they influence allele frequencies.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.02%3A_The_Evolution_of_Populations/4.2.08%3A_Review_Questions.txt
|
By following pathways of similarities and changes—both visible and genetic—scientists seek to map the evolutionary past of how life developed from single-celled organisms to the tremendous collection of creatures that have germinated, crawled, floated, swam, flown, and walked on this planet.
• 4.3.1: Introduction
This bee and Echinacea flower could not look more different, yet they are related, as are all living organisms on Earth.
• 4.3.2: Organizing Life on Earth
In scientific terms, the evolutionary history and relationship of an organism or group of organisms is called phylogeny. Phylogeny describes the relationships of an organism, such as from which organisms it is thought to have evolved, to which species it is most closely related, and so forth. Phylogenetic relationships provide information on shared ancestry but not necessarily on how organisms are similar or different.
• 4.3.3: Determining Evolutionary Relationships
Scientists must collect accurate information that allows them to make evolutionary connections among organisms. Similar to detective work, scientists must use evidence to uncover the facts. In the case of phylogeny, evolutionary investigations focus on two types of evidence: morphologic (form and function) and genetic.
• 4.3.4: Perspectives on the Phylogenetic Tree
The concepts of phylogenetic modeling are constantly changing. It is one of the most dynamic fields of study in all of biology. Over the last several decades, new research has challenged scientists’ ideas about how organisms are related. New models of these relationships have been proposed for consideration by the scientific community.
• 4.3.5: Key Terms
• 4.3.6: Chapter Summary
• 4.3.7: Visual Connection Questions
• 4.3.8: Review Questions
• 4.3.9: Critical Thinking Questions
4.03: Phylogenies and the History of Life
Figure 20.1 A bee's life is very different from a flower's, but the two organisms are related. Both are members of the domain Eukarya and have cells containing many similar organelles, genes, and proteins. (credit: modification of work by John Beetham)
This bee and Echinacea flower (Figure 20.1) could not look more different, yet they are related, as are all living organisms on Earth. By following pathways of similarities and changes—both visible and genetic—scientists seek to map the evolutionary past of how life developed from single-celled organisms to the tremendous collection of creatures that have germinated, crawled, floated, swum, flown, and walked on this planet.
4.3.02: Organizing Life on Earth
Learning Objectives
By the end of this section, you will be able to do the following:
• Discuss the need for a comprehensive classification system
• List the different levels of the taxonomic classification system
• Describe how systematics and taxonomy relate to phylogeny
• Discuss a phylogenetic tree's components and purpose
In scientific terms, phylogeny is the evolutionary history and relationship of an organism or group of organisms. A phylogeny describes the organism's relationships, such as from which organisms it may have evolved, or to which species it is most closely related. Phylogenetic relationships provide information on shared ancestry but not necessarily on how organisms are similar or different.
Phylogenetic Trees
Scientists use a tool called a phylogenetic tree to show the evolutionary pathways and connections among organisms. A phylogenetic tree is a diagram used to reflect evolutionary relationships among organisms or groups of organisms. Scientists consider phylogenetic trees to be a hypothesis of the evolutionary past since one cannot go back to confirm the proposed relationships. In other words, we can construct a “tree of life” to illustrate when different organisms evolved and to show the relationships among different organisms (Figure 20.2).
Unlike a taxonomic classification diagram, we can read a phylogenetic tree like a map of evolutionary history. Many phylogenetic trees have a single lineage at the base representing a common ancestor. Scientists call such trees rooted, which means there is a single ancestral lineage (typically drawn from the bottom or left) to which all organisms represented in the diagram relate. Notice in the rooted phylogenetic tree that the three domains— Bacteria, Archaea, and Eukarya—diverge from a single point and branch off. The small branch that plants and animals (including humans) occupy in this diagram shows how recent and miniscule these groups are compared with other organisms. Unrooted trees do not show a common ancestor but do show relationships among species.
In a rooted tree, the branching indicates evolutionary relationships (Figure \(2\):). The point where a split occurs, a branch point, represents where a single lineage evolved into a distinct new one. We call a lineage that evolved early from the root that remains unbranched a basal taxon. We call two lineages stemming from the same branch point sister taxa. A branch with more than two lineages is a polytomy and serves to illustrate where scientists have not definitively determined all of the relationships. Note that although sister taxa and polytomy do share an ancestor, it does not mean that the groups of organisms split or evolved from each other. Organisms in two taxa may have split at a specific branch point, but neither taxon gave rise to the other.
The diagrams above can serve as a pathway to understanding evolutionary history. We can trace the pathway from the origin of life to any individual species by navigating through the evolutionary branches between the two points. Also, by starting with a single species and tracing back towards the "trunk" of the tree, one can discover species' ancestors, as well as where lineages share a common ancestry. In addition, we can use the tree to study entire groups of organisms.
Another point to mention on phylogenetic tree structure is that rotation at branch points does not change the information. For example, if a branch point rotated and the taxon order changed, this would not alter the information because each taxon's evolution from the branch point was independent of the other.
Many disciplines within the study of biology contribute to understanding how past and present life evolved over time; these disciplines together contribute to building, updating, and maintaining the “tree of life.” Systematics is the field that scientists use to organize and classify organisms based on evolutionary relationships. Researchers may use data from fossils, from studying the body part structures, or molecules that an organism uses, and DNA analysis. By combining data from many sources, scientists can construct an organism's phylogeny. Since phylogenetic trees are hypotheses, they will continue to change as researchers discover new types of life and learn new information.
Limitations of Phylogenetic Trees
It may be easy to assume that more closely related organisms look more alike, and while this is often the case, it is not always true. If two closely related lineages evolved under significantly varied surroundings, it is possible for the two groups to appear more different than other groups that are not as closely related. For example, the phylogenetic tree in Figure \(3\): shows that lizards and rabbits both have amniotic eggs; whereas, frogs do not. Yet lizards and frogs appear more similar than lizards and rabbits.
Another aspect of phylogenetic trees is that, unless otherwise indicated, the branches do not account for length of time, only the evolutionary order. In other words, a branch's length does not typically mean more time passed, nor does a short branch mean less time passed— unless specified on the diagram. For example, in Figure 20.4, the tree does not indicate how much time passed between the evolution of amniotic eggs and hair. What the tree does show is the order in which things took place. Again using Figure 20.4, the tree shows that the oldest trait is the vertebral column, followed by hinged jaws, and so forth. Remember that any phylogenetic tree is a part of the greater whole, and like a real tree, it does not grow in only one direction after a new branch develops. Thus, for the organisms in Figure 20.4, just because a vertebral column evolved does not mean that invertebrate evolution ceased. It only means that a new branch formed. Also, groups that are not closely related, but evolve under similar conditions, may appear more phenotypically similar to each other than to a close relative.
Link to Learning
Head to this website to see interactive exercises that allow you to explore the evolutionary relationships among species.
Classification Levels
Taxonomy (which literally means “arrangement law”) is the science of classifying organisms to construct internationally shared classification systems with each organism placed into increasingly more inclusive groupings. Think about a grocery store's organization. One large space is divided into departments, such as produce, dairy, and meats. Then each department further divides into aisles, then each aisle into categories and brands, and then finally a single product. We call this organization from larger to smaller, more specific categories a hierarchical system.
The taxonomic classification system (also called the Linnaean system after its inventor, Carl Linnaeus, a Swedish botanist, zoologist, and physician) uses a hierarchical model. Moving from the point of origin, the groups become more specific, until one branch ends as a single species. For example, after the common beginning of all life, scientists divide organisms into three large categories called domains: Bacteria, Archaea, and Eukarya. Within each domain is a second category called a kingdom. After kingdoms, the subsequent categories of increasing specificity are: phylumclassorderfamilygenus, and species (Figure \(4\)).
The kingdom Animalia stems from the Eukarya domain. (Figure \(4\)) above shows the classification for the common dog. Therefore, the full name of an organism technically has eight terms. For the dog it is: Eukarya, Animalia, Chordata, Mammalia, Carnivora, Canidae, Canis, and lupus. Notice that each name is capitalized except for species, and the genus and species names are italicized. Scientists generally refer to an organism only by its genus and species, which is its two-word scientific name, or binomial nomenclature. Therefore, the scientific name of the dog is Canis lupus. The name at each level is also a taxon. In other words, dogs are in order Carnivora. Carnivora is the name of the taxon at the order level; Canidae is the taxon at the family level, and so forth. Organisms also have a common name that people typically use, in this case, dog. Note that the dog is additionally a subspecies: the “familiaris” in Canis lupus familiaris. Subspecies are members of the same species that are capable of mating and reproducing viable offspring, but they are separate subspecies due to geographic or behavioral isolation or other factors.
(Figure \(5\)) shows how the levels move toward specificity with other organisms. Notice how the dog shares a domain with the widest diversity of organisms, including plants and butterflies. At each sublevel, the organisms become more similar because they are more closely related. Historically, scientists classified organisms using characteristics, but as DNA technology developed, they have determined more precise phylogenies.
Visual Connection
At what levels are cats and dogs part of the same group?
Link to Learning
Visit this website to explore the classifications of thousands of organisms. This reference site contains about 10% of the described species on the planet.
Recent genetic analysis and other advancements have found that some earlier phylogenetic classifications do not align with the evolutionary past; therefore, researchers must make changes and updates as new discoveries occur. Recall that phylogenetic trees are hypotheses and are modified as data becomes available. In addition, classification historically has focused on grouping organisms mainly by shared characteristics and does not necessarily illustrate how the various groups relate to each other from an evolutionary perspective. For example, despite the fact that a hippopotamus resembles a pig more than a whale, the hippopotamus may be the whale's closest living relative.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.03%3A_Phylogenies_and_the_History_of_Life/4.3.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Compare homologous and analogous traits
• Discuss the purpose of cladistics
• Describe maximum parsimony
Scientists must collect accurate information that allows them to make evolutionary connections among organisms. Similar to detective work, scientists must use evidence to uncover the facts. In the case of phylogeny, evolutionary investigations focus on two types of evidence: morphologic (form and function) and genetic.
Two Options for Similarities
In general, organisms that share similar physical features and genomes are more closely related than those that do not. We refer to such features that overlap both morphologically (in form) and genetically as homologous structures. They stem from developmental similarities that are based on evolution. For example, the bones in bat and bird wings have homologous structures. This is an example of morphological homology (Figure 20.7).
Figure 20.7 Bat and bird wings are homologous structures, indicating that bats and birds share a common evolutionary past. (credit a: modification of work by Steve Hillebrand, USFWS; credit b: modification of work by U.S. DOI BLM)
Notice it is not simply a single bone, but rather a grouping of several bones arranged in a similar way. The more complex the feature, the more likely any kind of overlap is due to a common evolutionary past. Imagine two people from different countries both inventing a car with all the same parts and in exactly the same arrangement without any previous or shared knowledge. That outcome would be highly improbable. However, if two people both invented a hammer, we can reasonably conclude that both could have the original idea without the help of the other. The same relationship between complexity and shared evolutionary history is true for homologous structures in organisms.
Misleading Appearances
Some organisms may be very closely related, even though a minor genetic change caused a major morphological difference to make them look quite different. Similarly, unrelated organisms may be distantly related, but appear very much alike. This usually happens because both organisms share common adaptations that evolved within similar environmental conditions. When similar characteristics occur because of environmental constraints and not due to a close evolutionary relationship, it is an analogy or homoplasy. For example, insects use wings to fly like bats and birds, but the wing structure and embryonic origin is completely different. These are analogous structures (Figure 20.8).
Similar traits can be either homologous or analogous. Homologous structures share a similar embryonic origin. Analogous organs have a similar function. For example, the bones in a whale's front flipper are homologous to the bones in the human arm. These structures are not analogous. A butterfly or bird's wings are analogous but not homologous. Scientists must determine which type of similarity a feature exhibits to decipher the organisms' phylogeny.
Figure 20.8 The (c) wing of a honeybee is similar in shape to a (b) bird wing and (a) bat wing, and it serves the same function. However, the honeybee wing is not composed of bones and has a distinctly different structure and embryonic origin. These wing types (insect versus bat and bird) illustrate an analogy—similar structures that do not share an evolutionary history. (credit a: modification of work by U.S. DOI BLM; credit b: modification of work by Steve Hillebrand, USFWS; credit c: modification of work by Jon Sullivan)
Link to Learning
Link to Learning
This website has several examples to show how appearances can be misleading in understanding organisms' phylogenetic relationships.
Molecular Comparisons
The advancement of DNA technology has given rise to molecular systematics, which is use of molecular data in taxonomy and biological geography (biogeography). New computer programs not only confirm many earlier classified organisms, but also uncover previously made errors. As with physical characteristics, even the DNA sequence can be tricky to read in some cases. For some situations, two very closely related organisms can appear unrelated if a mutation occurred that caused a shift in the genetic code. Inserting or deleting a mutation would move each nucleotide base over one place, causing two similar codes to appear unrelated.
Sometimes two segments of DNA code in distantly related organisms randomly share a high percentage of bases in the same locations, causing these organisms to appear closely related when they are not. For both of these situations, computer technologies help identify the actual relationships, and, ultimately, the coupled use of both morphologic and molecular information is more effective in determining phylogeny.
Evolution Connection
Evolution Connection
Why Does Phylogeny Matter?Evolutionary biologists could list many reasons why understanding phylogeny is important to everyday life in human society. For botanists, phylogeny acts as a guide to discovering new plants that can be used to benefit people. Think of all the ways humans use plants—food, medicine, and clothing are a few examples. If a plant contains a compound that is effective in treating cancer, scientists might want to examine all of the compounds for other useful drugs.
A research team in China identified a DNA segment that they thought to be common to some medicinal plants in the family Fabaceae (the legume family). They worked to identify which species had this segment (Figure 20.9). After testing plant species in this family, the team found a DNA marker (a known location on a chromosome that enabled them to identify the species) present. Then, using the DNA to uncover phylogenetic relationships, the team could identify whether a newly discovered plant was in this family and assess its potential medicinal properties.
Figure 20.9 Dalbergia sissoo (D. sissoo) is in the Fabaceae, or legume family. Scientists found that D. sissoo shares a DNA marker with species within the Fabaceae family that have antifungal properties. Subsequently, researchers found that D. sissoo had fungicidal activity, supporting the idea that DNA markers are useful to screen plants with potential medicinal properties.
Building Phylogenetic Trees
How do scientists construct phylogenetic trees? After they sort the homologous and analogous traits, scientists often organize the homologous traits using cladistics. This system sorts organisms into clades: groups of organisms that descended from a single ancestor. For example, in Figure 20.10, all the organisms in the orange region evolved from a single ancestor that had amniotic eggs. Consequently, these organisms also have amniotic eggs and make a single clade, or a monophyletic group. Clades must include all descendants from a branch point.
Visual Connection
Visual Connection
Figure 20.10 Lizards, rabbits, and humans all descend from a common ancestor that had an amniotic egg. Thus, lizards, rabbits, and humans all belong to the clade Amniota. Vertebrata is a larger clade that also includes fish and lamprey.
Which animals in this figure belong to a clade that includes animals with hair? Which evolved first, hair or the amniotic egg?
Clades can vary in size depending on which branch point one references. The important factor is that all organisms in the clade or monophyletic group stem from a single point on the tree. You can remember this because monophyletic breaks down into “mono,” meaning one, and “phyletic,” meaning evolutionary relationship. Figure 20.11 shows various clade examples. Notice how each clade comes from a single point; whereas, the non-clade groups show branches that do not share a single point.
Visual Connection
Visual Connection
Figure 20.11 All the organisms within a clade stem from a single point on the tree. A clade may contain multiple groups, as in the case of animals, fungi and plants, or a single group, as in the case of flagellates. Groups that diverge at a different branch point, or that do not include all groups in a single branch point, are not clades.
What is the largest clade in this diagram?
Shared Characteristics
Organisms evolve from common ancestors and then diversify. Scientists use the phrase “descent with modification” because even though related organisms have many of the same characteristics and genetic codes, changes occur. This pattern repeats as one goes through the phylogenetic tree of life:
1. A change in an organism's genetic makeup leads to a new trait which becomes prevalent in the group.
2. Many organisms descend from this point and have this trait.
3. New variations continue to arise: some are adaptive and persist, leading to new traits.
4. With new traits, a new branch point is determined (go back to step 1 and repeat).
If a characteristic is found in the ancestor of a group, it is considered a shared ancestral character because all of the organisms in the taxon or clade have that trait. The vertebrate in Figure 20.10 is a shared ancestral character. Now consider the amniotic egg characteristic in the same figure. Only some of the organisms in Figure 20.10 have this trait, and to those that do, it is called a shared derived character because this trait derived at some point but does not include all of the ancestors in the tree.
The tricky aspect to shared ancestral and shared derived characters is that these terms are relative. We can consider the same trait one or the other depending on the particular diagram that we use. Returning to Figure 20.10, note that the amniotic egg is a shared ancestral character for lizards, rabbits, and humans, while having hair is a shared derived character only for humans and rabbits. For the Amniotes as a group, however, the amniotic egg is a shared derived character that is not seen in fish. These terms help scientists distinguish between clades in building phylogenetic trees.
Choosing the Right Relationships
Imagine being the person responsible for organizing all department store items properly—an overwhelming task. Organizing the evolutionary relationships of all life on Earth proves much more difficult: scientists must span enormous blocks of time and work with information from long-extinct organisms. Trying to decipher the proper connections, especially given the presence of homologies and analogies, makes the task of building an accurate tree of life extraordinarily difficult. Add to that advancing DNA technology, which now provides large quantities of genetic sequences for researchers to use and analyze. Taxonomy is a subjective discipline: many organisms have more than one connection to each other, so each taxonomist will decide the order of connections.
To aid in the tremendous task of describing phylogenies accurately, scientists often use the concept of maximum parsimony, which means that events occurred in the simplest, most obvious way. For example, if a group of people entered a forest preserve to hike, based on the principle of maximum parsimony, one could predict that most would hike on established trails rather than forge new ones.
For scientists deciphering evolutionary pathways, the same idea is used: the pathway of evolution probably includes the fewest major events that coincide with the evidence at hand. Starting with all of the homologous traits in a group of organisms, scientists look for the most obvious and simple order of evolutionary events that led to the occurrence of those traits.
Link to Learning
Link to Learning
Head to this website to learn how researchers use maximum parsimony to create phylogenetic trees.
These tools and concepts are only a few strategies scientists use to tackle the task of revealing the evolutionary history of life on Earth. Recently, newer technologies have uncovered surprising discoveries with unexpected relationships, such as the fact that people seem to be more closely related to fungi than fungi are to plants. Sound unbelievable? As the information about DNA sequences grows, scientists will become closer to mapping the evolutionary history of all life on Earth.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.03%3A_Phylogenies_and_the_History_of_Life/4.3.03%3A_Determining_Evolutionary_Relationships.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe horizontal gene transfer
• Illustrate how prokaryotes and eukaryotes transfer genes horizontally
• Identify the web and ring models of phylogenetic relationships and describe how they differ from the original phylogenetic tree concept
Phylogenetic modeling concepts are constantly changing. It is one of the most dynamic fields of study in all biology. Over the last several decades, new research has challenged scientists’ ideas about how organisms are related. The scientific community has proposed new models of these relationships.
Many phylogenetic trees are models of the evolutionary relationship among species. Phylogenetic trees originated with Charles Darwin, who sketched the first phylogenetic tree in 1837 (Figure 20.12a). This served as a prototype for subsequent studies for more than a century. The phylogenetic tree concept with a single trunk representing a shared ancestry, with the branches representing the divergence of species from this ancestry, fits well with the structure of many common trees, such as the oak (Figure 20.12b). However, evidence from modern DNA sequence analysis and newly developed computer algorithms has caused skepticism about the standard tree model's validity in the scientific community.
Figure 20.12 The (a) concept of the “tree of life” dates to an 1837 Charles Darwin sketch. Like an (b) oak tree, the “tree of life” has a single trunk and many branches. (credit b: modification of work by "Amada44"/Wikimedia Commons)
Limitations to the Classic Model
Classical thinking about prokaryotic evolution, included in the classic tree model, is that species evolve clonally. That is, they produce offspring themselves with only random mutations causing the descent into the variety of modern-day and extinct species known to science. This view is somewhat complicated in eukaryotes that reproduce sexually, but the laws of Mendelian genetics explain the variation in offspring, again, to be a result of a mutation within the species. Scientists did not consider the concept of genes transferring between unrelated species as a possibility until relatively recently. Horizontal gene transfer (HGT), or lateral gene transfer, is the transfer of genes between unrelated species. HGT is an ever-present phenomenon, with many evolutionists postulating a major role for this process in evolution, thus complicating the simple tree model. Genes pass between species which are only distantly related using standard phylogeny, thus adding a layer of complexity to understanding phylogenetic relationships.
The various ways that HGT occurs in prokaryotes is important to understanding phylogenies. Although at present some do not view HGT as important to eukaryotic evolution, HGT does occur in this domain as well. Finally, as an example of the ultimate gene transfer, some scientists have proposed genome fusion theories between symbiotic or endosymbiotic organisms to explain an event of great importance—the evolution of the first eukaryotic cell, without which humans could not have come into existence.
Horizontal Gene Transfer
Horizontal gene transfer (HGT) is the introduction of genetic material from one species to another species by mechanisms other than the vertical transmission from parent(s) to offspring. These transfers allow even distantly related species to share genes, influencing their phenotypes. Scientists believe that HGT is more prevalent in prokaryotes, but that this process transfers only about 2% of the prokaryotic genome. Some researchers believe such estimates are premature: we must view the actual importance of HGT to evolutionary processes as a work in progress. As scientists investigate this phenomenon more thoroughly, they may reveal more HGT. Many scientists believe that HGT and mutation are (especially in prokaryotes) a significant source of genetic variation, which is the raw material in the natural selection process. These transfers may occur between any two species that share an intimate relationship (Table 20.1).
Prokaryotic and Eukaryotic HGT Mechanisms Summary
Mechanism Mode of Transmission Example
Prokaryotes transformation DNA uptake many prokaryotes
transduction bacteriophage (virus) bacteria
conjugation pilus many prokaryotes
gene transfer agents phage-like particles purple non-sulfur bacteria
Eukaryotes from food organisms unknown aphid
jumping genes transposons rice and millet plants
epiphytes/parasites unknown yew tree fungi
from viral infections
Table 20.1
HGT in Prokaryotes
HGT mechanisms are quite common in the Bacteria and Archaea domains, thus significantly changing the way scientists view their evolution. The majority of evolutionary models, such as in the Endosymbiont Theory, propose that eukaryotes descended from multiple prokaryotes, which makes HGT all the more important to understanding the phylogenetic relationships of all extant and extinct species. The Endosymbiont Theory purports that the eukaryotes' mitochondria and the green plants' chloroplasts and flagellates originated as free-living prokaryotes that invaded primitive eukaryotic cells and become established as permanent symbionts in the cytoplasm.
Microbiology students are well aware that genes transfer among common bacteria. These gene transfers between species are the major mechanism whereby bacteria acquire resistance to antibiotics. Classically, scientists believe that three different mechanisms drive such transfers.
1. Transformation: bacteria takes up naked DNA
2. Transduction: a virus transfers the genes
3. Conjugation: a hollow tube, or pilus transfers genes between organisms
More recently, scientists have discovered a fourth gene transfer mechanism between prokaryotes. Small, virus-like particles, or gene transfer agents (GTAs) transfer random genomic segments from one prokaryote species to another. GTAs are responsible for genetic changes, sometimes at a very high frequency compared to other evolutionary processes. Scientists characterized the first GTA in 1974 using purple, non-sulfur bacteria. These GTAs, which are most likely derived from bacteriophage DNA inserted in a prokaryote that lost the ability to produce new bacteriophages, carry random DNA pieces from one organism to another. Controlled studies using marine bacteria have demonstrated GTAs' ability to act with high frequency. Scientists have estimated gene transfer events in marine prokaryotes, either by GTAs or by viruses, to be as high as 1013 per year in the Mediterranean Sea alone. GTAs and viruses are efficient HGT vehicles with a major impact on prokaryotic evolution.
As a consequence of this modern DNA analysis, the idea that eukaryotes evolved directly from Archaea has fallen out of favor. While eukaryotes share many features that are absent in bacteria, such as the TATA box (located in many genes' promoter region), the discovery that some eukaryotic genes were more homologous with bacterial DNA than Archaea DNA made this idea less tenable. Furthermore, scientists have proposed genome fusion from Archaea and Bacteria by endosymbiosis as the ultimate event in eukaryotic evolution.
HGT in Eukaryotes
Although it is easy to see how prokaryotes exchange genetic material by HGT, scientists initially thought that this process was absent in eukaryotes. After all, prokaryotes are but single cells exposed directly to their environment; whereas, the multicellular organisms' sex cells are usually sequestered in protected parts of the body. It follows from this idea that the gene transfers between multicellular eukaryotes should be more difficult. Scientists believe this process is rarer in eukaryotes and has a much smaller evolutionary impact than in prokaryotes. In spite of this, HGT between distantly related organisms is evident in several eukaryotic species, and it is possible that scientists will discover more examples in the future.
In plants, researchers have observed gene transfer in species that cannot cross-pollinate by normal means. Transposons or “jumping genes” have shown a transfer between rice and millet plant species. Furthermore, fungal species feeding on yew trees, from which the anti-cancer drug TAXOL® is derived from the bark, have acquired the ability to make taxol themselves, a clear example of gene transfer.
In animals, a particularly interesting example of HGT occurs within the aphid species (Figure 20.13). Aphids are insects that vary in color based on carotenoid content. Carotenoids are pigments that a variety of plants, fungi, and microbes produce, and they serve a variety of functions in animals, who obtain these chemicals from their food. Humans require carotenoids to synthesize vitamin A, and we obtain them by eating orange fruits and vegetables: carrots, apricots, mangoes, and sweet potatoes. Alternatively, aphids have acquired the ability to make the carotenoids on their own. According to DNA analysis, this ability is due to fungal genes transferring into the insect by HGT, presumably as the insect consumed fungi for food. A carotenoid enzyme, or desaturase, is responsible for the red coloration in certain aphids, and when mutation of this gene leads to formation of inactive enzyme, the aphids revert to their more common green color (Figure 20.13).
Figure 20.13 (a) Red aphids get their color from red carotenoid pigment. Genes necessary to make this pigment are present in certain fungi, and scientists speculate that aphids acquired these genes through HGT after consuming fungi for food. If mutation inactivates the genes for making carotenoids, the aphids revert back to (b) their green color. Red coloration makes the aphids considerably more conspicuous to predators, but evidence suggests that red aphids are more resistant to insecticides than green ones. Thus, red aphids may be more fit to survive in some environments than green ones. (credit a: modification of work by Benny Mazur; credit b: modification of work by Mick Talbot)
Genome Fusion and Eukaryote Evolution
Scientists believe the ultimate in HGT occurs through genome fusion between different prokaryote species when two symbiotic organisms become endosymbiotic. This occurs when one species is taken inside another species' cytoplasm, which ultimately results in a genome consisting of genes from both the endosymbiont and the host. This mechanism is an aspect of the Endosymbiont Theory, which most biologists accept as the mechanism whereby eukaryotic cells obtained their mitochondria and chloroplasts. However, the role of endosymbiosis in developing the nucleus is more controversial. Scientists believe that nuclear and mitochondrial DNA have different (separate) evolutionary origins, with the mitochondrial DNA being derived from the bacteria's circular genomes engulfed by ancient prokaryotic cells. We can regard mitochondrial DNA as the smallest chromosome. Interestingly enough, mitochondrial DNA is inherited only from females. The mitochondrial DNA degrades in sperm when the sperm degrades in the fertilized egg or in other instances when the mitochondria located in the sperm's flagellum fails to enter the egg.
Within the past decade, James Lake of the UCLA/NASA Astrobiology Institute proposed that the genome fusion process is responsible for the evolution of the first eukaryotic cells (Figure 20.14a). Using DNA analysis and a new mathematical algorithm, conditioned reconstruction (CR), his laboratory proposed that eukaryotic cells developed from an endosymbiotic gene fusion between two species, one an Archaea and the other a Bacteria. As mentioned, some eukaryotic genes resemble those of Archaea; whereas, others resemble those from Bacteria. An endosymbiotic fusion event, such as Lake has proposed, would clearly explain this observation. Alternatively, this work is new and the CR algorithm is relatively unsubstantiated, which causes many scientists to resist this hypothesis.
Lake's more recent work (Figure 20.14b) proposes that gram-negative bacteria, which are unique within their domain in that they contain two lipid bilayer membranes, resulted from an endosymbiotic fusion of archaeal and bacterial species. The double membrane would be a direct result of the endosymbiosis, with the endosymbiont picking up the second membrane from the host as it was internalized. Scientists have also used this mechanism to explain the double membranes in mitochondria and chloroplasts. Some are skeptical of Lake’s work, and the biological science community still debates his ideas. In addition to Lake’s hypothesis, there are several other competing theories as to the origin of eukaryotes. How did the eukaryotic nucleus evolve? One theory is that the prokaryotic cells produced an additional membrane that surrounded the bacterial chromosome. Some bacteria have the DNA enclosed by two membranes; however, there is no evidence of a nucleolus or nuclear pores. Other proteobacteria also have membrane-bound chromosomes. If the eukaryotic nucleus evolved this way, we would expect one of the two types of prokaryotes to be more closely related to eukaryotes.
Figure 20.14 The scientific community now widely accepts the theory that mitochondria and chloroplasts are endosymbiotic in origin. "More controversial is the proposal that (a) the eukaryotic nucleus resulted from fusing archaeal and bacterial genomes with their operational genes (involved in biochemical pathways) and informational genes (involved in transcription and translation), and that (b) Gramnegative bacteria, which have two membranes, resulted from fusing Archaea and Gram-positive bacteria, each of which has a single membrane.
The nucleus-first hypothesis proposes that the nucleus evolved in prokaryotes first (Figure 20.15a), followed by a later fusion of the new eukaryote with bacteria that became mitochondria. The mitochondria-first hypothesis proposes that mitochondria were first established in a prokaryotic host (Figure 20.15b), which subsequently acquired a nucleus, by fusion or other mechanisms, to become the first eukaryotic cell. Most interestingly, the eukaryote-first hypothesis proposes that prokaryotes actually evolved from eukaryotes by losing genes and complexity (Figure 20.15c). All of these hypotheses are testable. Only time and more experimentation will determine which hypothesis data best supports.
Figure 20.15 Three alternate hypotheses of eukaryotic and prokaryotic evolution are (a) the nucleus-first hypothesis, (b) the mitochondrion-first hypothesis, and (c) the eukaryote-first hypothesis.
Web and Network Models
Recognizing the importance of HGT, especially in prokaryote evolution, has caused some to propose abandoning the classic “tree of life” model. In 1999, W. Ford Doolittle proposed a phylogenetic model that resembles a web or a network more than a tree. The hypothesis is that eukaryotes evolved not from a single prokaryotic ancestor, but from a pool of many species that were sharing genes by HGT mechanisms. As Figure 20.16a shows, some individual prokaryotes were responsible for transferring the bacteria that caused mitochondrial development to the new eukaryotes; whereas, other species transferred the bacteria that gave rise to chloroplasts. Scientists often call this model the “web of life.” In an effort to save the tree analogy, some have proposed using the Ficus tree (Figure 20.16b) with its multiple trunks as a phylogenetic way to represent a diminished evolutionary role for HGT.
Figure 20.16 In W. Ford Doolittle's (a) phylogenetic model, the “tree of life” arose from a community of ancestral cells, has multiple trunks, and has connections between branches where horizontal gene transfer has occurred. Visually, this concept is better represented by (b) the multi-trunked Ficus than by an oak's single trunk similar to Darwin's tree in Figure 20.12. (credit b: modification of work by "psyberartist"/Flickr)
Ring of Life Models
Others have proposed abandoning any tree-like model of phylogeny in favor of a ring structure, the so-called “ring of life” (Figure 20.17). This is a phylogenetic model where all three domains of life evolved from a pool of primitive prokaryotes. Lake, again using the conditioned reconstruction algorithm, proposes a ring-like model in which species of all three domains—Archaea, Bacteria, and Eukarya—evolved from a single pool of gene-swapping prokaryotes. His laboratory proposes that this structure is the best fit for data from extensive DNA analyses performed in his laboratory, and that the ring model is the only one that adequately takes HGT and genomic fusion into account. However, other phylogeneticists remain highly skeptical of this model.
Figure 20.17 According to the “ring of life” phylogenetic model, the three domains of life evolved from a pool of primitive prokaryotes.
In summary, we must modify Darwin's “tree of life” model to include HGT. Does this mean abandoning the tree model completely? Even Lake argues that scientists should attempt to modify the tree model to allow it to accurately fit his data, and only the inability to do so will sway people toward his ring proposal.
This doesn’t mean a tree, web, or a ring will correlate completely to an accurate description of phylogenetic relationships of life. A consequence of the new thinking about phylogenetic models is the idea that Darwin’s original phylogenetic tree concept is too simple, but made sense based on what scientists knew at the time. However, the search for a more useful model moves on: each model serves as hypotheses to test with the possibility of developing new models. This is how science advances. Researchers use these models as visualizations to help construct hypothetical evolutionary relationships and understand the massive amount of data that requires analysis.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.03%3A_Phylogenies_and_the_History_of_Life/4.3.04%3A_Perspectives_on_the_Phylogenetic_Tree.txt
|
analogy
(also, homoplasy) characteristic that is similar between organisms by convergent evolution, not due to the same evolutionary path
basal taxon
branch on a phylogenetic tree that has not diverged significantly from the root ancestor
binomial nomenclature
system of two-part scientific names for an organism, which includes genus and species names
branch point
node on a phylogenetic tree where a single lineage splits into distinct new ones
cladistics
system to organize homologous traits to describe phylogenies
class
division of phylum in the taxonomic classification system
eukaryote-first hypothesis
proposal that prokaryotes evolved from eukaryotes
family
division of order in the taxonomic classification system
gene transfer agent (GTA)
bacteriophage-like particle that transfers random genomic segments from one species of prokaryote to another
genome fusion
fusion of two prokaryotic genomes, presumably by endosymbiosis
genus
division of family in the taxonomic classification system; the first part of the binomial scientific name
homology
similarity in characteristics resulting from a shared ancestry
horizontal gene transfer (HGT)
(also, lateral gene transfer) transfer of genes between unrelated species
kingdom
domain division in the taxonomic classification system
maximum parsimony
applying the simplest, most obvious way with the least number of steps
mitochondria-first hypothesis
proposal that prokaryotes acquired a mitochondrion first, followed by nuclear development
molecular systematics
technique using molecular evidence to identify phylogenetic relationships
monophyletic group
(also, clade) organisms that share a single ancestor
nucleus-first hypothesis
proposal that prokaryotes acquired a nucleus first, and then the mitochondrion
order
class division in the taxonomic classification system
phylogenetic tree
diagram that reflects the evolutionary relationships among organisms or groups of organisms
phylogeny
evolutionary history and relationship of an organism or group of organisms
phylum
(plural: phyla) kingdom division in the taxonomic classification system
polytomy
branch on a phylogenetic tree with more than two groups or taxa
ring of life
phylogenetic model where all three domains of life evolved from a pool of primitive prokaryotes
rooted
single ancestral lineage on a phylogenetic tree to which all organisms represented in the diagram relate
shared ancestral character
describes a characteristic on a phylogenetic tree that all organisms on the tree share
shared derived character
describes a characteristic on a phylogenetic tree that only a certain clade of organisms share
sister taxa
two lineages that diverged from the same branch point
systematics
field of organizing and classifying organisms based on evolutionary relationships
taxon
(plural: taxa) single level in the taxonomic classification system
taxonomy
science of classifying organisms
web of life
phylogenetic model that attempts to incorporate the effects of horizontal gene transfer on evolution
4.3.06: Chapter Summary
20.1 Organizing Life on Earth
Scientists continually gain new information that helps understand the evolutionary history of life on Earth. Each group of organisms went through its own evolutionary journey, or its phylogeny. Each organism shares relatedness with others, and based on morphologic and genetic evidence, scientists attempt to map the evolutionary pathways of all life on Earth. Historically, scientists organized organisms into a taxonomic classification system. However, today many scientists build phylogenetic trees to illustrate evolutionary relationships.
20.2 Determining Evolutionary Relationships
To build phylogenetic trees, scientists must collect accurate information that allows them to make evolutionary connections between organisms. Using morphologic and molecular data, scientists work to identify homologous characteristics and genes. Similarities between organisms can stem either from shared evolutionary history (homologies) or from separate evolutionary paths (analogies). Scientists can use newer technologies to help distinguish homologies from analogies. After identifying homologous information, scientists use cladistics to organize these events as a means to determine an evolutionary timeline. They then apply the concept of maximum parsimony, which states that the order of events probably occurred in the most obvious and simple way with the least amount of steps. For evolutionary events, this would be the path with the least number of major divergences that correlate with the evidence.
20.3 Perspectives on the Phylogenetic Tree
The phylogenetic tree, which Darwin first used, is the classic “tree of life” model describing phylogenetic relationships among species, and the most common model that scientists use today. New ideas about HGT and genome fusion have caused some to suggest revising the model to resemble webs or rings.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.03%3A_Phylogenies_and_the_History_of_Life/4.3.05%3A_Key_Terms.txt
|
1.
Figure 20.6 At what levels are cats and dogs part of the same group?
2.
Figure 20.10 Which animals in this figure belong to a clade that includes animals with hair? Which evolved first, hair or the amniotic egg?
3.
Figure 20.11 What is the largest clade in this diagram?
4.3.08: Review Questions
4.
What is used to determine phylogeny?
1. mutations
2. DNA
3. evolutionary history
4. organisms on earth
5.
What do scientists in the field of systematics accomplish?
1. discover new fossil sites
2. organize and classify organisms
3. name new species
4. communicate among field biologists
6.
Which statement about the taxonomic classification system is correct?
1. There are more domains than kingdoms.
2. Kingdoms are the top category of classification.
3. Classes are divisions of orders.
4. Subspecies are the most specific category of classification.
7.
On a phylogenetic tree, which term refers to lineages that diverged from the same place?
1. sister taxa
2. basal taxa
3. rooted taxa
4. dichotomous taxa
8.
Which statement about analogies is correct?
1. They occur only as errors.
2. They are synonymous with homologous traits.
3. They are derived by similar environmental constraints.
4. They are a form of mutation.
9.
What do scientists use to apply cladistics?
1. homologous traits
2. homoplasies
3. analogous traits
4. monophyletic groups
10.
What is true about organisms that are a part of the same clade?
1. They all share the same basic characteristics.
2. They evolved from a shared ancestor.
3. They usually fall into the same classification taxa.
4. They have identical phylogenies.
11.
Why do scientists apply the concept of maximum parsimony?
1. to decipher accurate phylogenies
2. to eliminate analogous traits
3. to identify mutations in DNA codes
4. to locate homoplasies
12.
The transfer of genes by a mechanism not involving reproduction is called:
1. meiosis
2. web of life
3. horizontal gene transfer
4. gene fusion
13.
Particles that transfer genetic material from one species to another, especially in marine prokaryotes:
1. horizontal gene transfer
2. lateral gene transfer
3. genome fusion device
4. gene transfer agents
14.
What does the trunk of the classic phylogenetic tree represent?
1. single common ancestor
2. pool of ancestral organisms
3. new species
4. old species
15.
Which phylogenetic model proposes that all three domains of life evolved from a pool of primitive prokaryotes?
1. tree of life
2. web of life
3. ring of life
4. network model
4.3.09: Critical Thinking Questions
16.
How does a phylogenetic tree relate to the passing of time?
17.
Some organisms that appear very closely related on a phylogenetic tree may not actually be closely related. Why is this?
18.
List the different levels of the taxonomic classification system.
19.
Dolphins and fish have similar body shapes. Is this feature more likely a homologous or analogous trait?
20.
Why is it so important for scientists to distinguish between homologous and analogous characteristics before building phylogenetic trees?
21.
Describe maximum parsimony.
22.
Compare three different ways that eukaryotic cells may have evolved.
23.
Describe how aphids acquired the ability to change color.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/04%3A_Unit_IV-_Evolutionary_Processes/4.03%3A_Phylogenies_and_the_History_of_Life/4.3.07%3A_Visual_Connection_Questions.txt
|
Biodiversity is the variety of different types of life found on the Earth and the variations within species and is a measure of the variety of organisms present in different ecosystems. This can refer to genetic variation, ecosystem variation, or species variation (number of species) within an area, biome, or planet. Terrestrial biodiversity tends to be greater near the equator, which seems to be the result of the warm climate and high primary productivity. In Unit 5, the diversity of life is explored with detailed study of various organisms and discussion of emerging phylogenetic relationships. This unit moves from viruses to living organisms like bacteria, discusses the organisms formerly grouped as protists, and devotes multiple chapters to plant and animal life.
• 5.1: Viruses
Viruses are acellular, parasitic entities that are not classified within any kingdom. Viruses are not cells and cannot divide. They infect a host cell and use the host’s replication processes to produce identical progeny virus particles. Viruses infect organisms as diverse as bacteria, plants, and animals and exist in a netherworld between a living organism and a nonliving entity. Living things grow, metabolize, and reproduce.
• 5.2: Prokaryotes - Bacteria and Archaea
• 5.3: Protists
Most protists are microscopic, unicellular organisms that are abundant in soil, freshwater, brackish, and marine environments. They are also common in the digestive tracts of animals and in the vascular tissues of plants.
• 5.4: Fungi
The kingdom Fungi includes an enormous variety of living organisms collectively referred to as Eucomycota, or true Fungi. While scientists have identified about 100,000 species of fungi, this is only a fraction of the 1.5 million species of fungus likely present on Earth. Edible mushrooms, yeasts, black mold, and the producer of the antibiotic penicillin, Penicillium notatum, are all members of the kingdom Fungi, which belongs to the domain Eukarya.
• 5.5: Seedless Plants
Seedless plants reproduce and spread through spores, but do not flower or seed to replicate.
• 5.6: Seed Plants
Seed plants, such as palms, have broken free from the need to rely on water for their reproductive needs. They play an integral role in all aspects of life on the planet, shaping the physical terrain, influencing the climate, and maintaining life as we know it.
• 5.7: Introduction to Animal Diversity
• 5.8: Invertebrates
Invertebrate animals are those without a cranium and defined vertebral column or spine. In addition to lacking a spine, most invertebrates also lack an endoskeleton. A large number of invertebrates are aquatic animals, and scientific research suggests that many of the world’s species are aquatic invertebrates that have not yet been documented.
• 5.9: Vertebrates
Vertebrates are among the most recognizable organisms of the animal kingdom. More than 62,000 vertebrate species have been identified. The vertebrate species now living represent only a small portion of the vertebrates that have existed. The best-known extinct vertebrates are the dinosaurs, a unique group of reptiles, which reached sizes not seen before or after in terrestrial animals.
Thumbnail: Phylogenetic-symbiogenetic tree of living organisms. (CC BY-SA 3.0; Maulucioni y Doridí).
Contributors
Connie Rye (East Mississippi Community College), Robert Wise (University of Wisconsin, Oshkosh), Vladimir Jurukovski (Suffolk County Community College), Jean DeSaix (University of North Carolina at Chapel Hill), Jung Choi (Georgia Institute of Technology), Yael Avissar (Rhode Island College) among other contributing authors. Original content by OpenStax (CC BY 4.0; Download for free at http://cnx.org/contents/185cbf87-c72...f21b5eabd@9.87).
05: Unit V- Biological Diversity
Viruses are acellular, parasitic entities that are not classified within any kingdom. Viruses are not cells and cannot divide. They infect a host cell and use the host’s replication processes to produce identical progeny virus particles. Viruses infect organisms as diverse as bacteria, plants, and animals and exist in a netherworld between a living organism and a nonliving entity. Living things grow, metabolize, and reproduce. Viruses replicate, but to do so, they are entirely dependent on their host cells.
• 5.1.1: Introduction
Viruses are acellular, parasitic entities that are not classified within any kingdom. Unlike most living organisms, viruses are not cells and cannot divide. Instead, they infect a host cell and use the host’s replication processes to produce identical progeny virus particles. Viruses infect organisms as diverse as bacteria, plants, and animals. They exist in a netherworld between a living organism and a nonliving entity.
• 5.1.2: Viral Evolution, Morphology, and Classification
Viruses are diverse entities. They vary in their structure, their replication methods, and in their target hosts. Nearly all forms of life—from bacteria and archaea to eukaryotes such as plants, animals, and fungi—have viruses that infect them. While most biological diversity can be understood through evolutionary history, such as how species have adapted to conditions and environments, much about virus origins and evolution remains unknown.
• 5.1.3: Virus Infections and Hosts
Viruses can be seen as obligate, intracellular parasites. A virus must attach to a living cell, be taken inside, manufacture its proteins and copy its genome, and find a way to escape the cell so that the virus can infect other cells. Viruses can infect only certain species of hosts and only certain cells within that host. Cells that a virus may use to replicate are called permissive.
• 5.1.4: Prevention and Treatment of Viral Infections
Viruses cause a variety of diseases in animals, including humans, ranging from the common cold to potentially fatal illnesses like meningitis. These diseases can be treated by antiviral drugs or by vaccines, but some viruses, such as HIV, are capable of both avoiding the immune response and mutating to become resistant to antiviral drugs.
• 5.1.5: Other Acellular Entities - Prions and Viroids
Prions and viroids are pathogens (agents with the ability to cause disease) that have simpler structures than viruses but, in the case of prions, still can produce deadly diseases.
• 5.1.6: Key Terms
• 5.1.7: Chapter Summary
• 5.1.8: Visual Connection Questions
• 5.1.9: Review Questions
• 5.1.10: Critical Thinking Questions
Thumbnail: Ebola virus. (Public Domain; CDC).
5.01: Viruses
Figure 21.1 The tobacco mosaic virus, seen here by transmission electron microscopy (left), was the first virus to be discovered. The virus causes disease in tobacco and other plants, such as the orchid (right). (credit a: USDA ARS; credit b: modification of work by USDA Forest Service, Department of Plant Pathology Archive North Carolina State University; scale-bar data from Matt Russell)
Viruses are noncellular parasitic entities that cannot be classified within any kingdom. They can infect organisms as diverse as bacteria, plants, and animals. In fact, viruses exist in a sort of netherworld between a living organism and a nonliving entity. Living things grow, metabolize, and reproduce. In contrast, viruses are not cellular, do not have a metabolism or grow, and cannot divide by cell division. Viruses can copy, or replicate themselves; however, they are entirely dependent on resources derived from their host cells to produce progeny viruses—which are assembled in their mature form. No one knows exactly when or how viruses evolved or from what ancestral source because viruses have not left a fossil record. Some virologists contend that modern viruses are a mosaic of bits and pieces of nucleic acids picked up from various sources along their respective evolutionary paths.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.01%3A_Viruses/5.1.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe how viruses were first discovered and how they are detected
• Discuss three hypotheses about how viruses evolved
• Describe the general structure of a virus
• Recognize the basic shapes of viruses
• Understand past and emerging classification systems for viruses
• Describe the basis for the Baltimore classification system
Viruses are diverse entities: They vary in structure, methods of replication, and the hosts they infect. Nearly all forms of life—from prokaryotic bacteria and archaeans, to eukaryotes such as plants, animals, and fungi—have viruses that infect them. While most biological diversity can be understood through evolutionary history (such as how species have adapted to changing environmental conditions and how different species are related to one another through common descent), much about virus origins and evolution remains unknown.
Discovery and Detection
Viruses were first discovered after the development of a porcelain filter—the Chamberland-Pasteur filter—that could remove all bacteria visible in the microscope from any liquid sample. In 1886, Adolph Meyer demonstrated that a disease of tobacco plants—tobacco mosaic disease—could be transferred from a diseased plant to a healthy one via liquid plant extracts. In 1892, Dmitri Ivanowski showed that this disease could be transmitted in this way even after the Chamberland-Pasteur filter had removed all viable bacteria from the extract. Still, it was many years before it was proved that these “filterable” infectious agents were not simply very small bacteria but were a new type of very small, disease-causing particle.
Most virions, or single virus particles, are very small, about 20 to 250 nanometers in diameter. However, some recently discovered viruses from amoebae range up to 1000 nm in diameter. With the exception of large virions, like the poxvirus and other large DNA viruses, viruses cannot be seen with a light microscope. It was not until the development of the electron microscope in the late 1930s that scientists got their first good view of the structure of the tobacco mosaic virus (TMV) (Figure 21.1), discussed above, and other viruses (Figure 21.2). The surface structure of virions can be observed by both scanning and transmission electron microscopy, whereas the internal structures of the virus can only be observed in images from a transmission electron microscope. The use of electron microscopy and other technologies has allowed for the discovery of many viruses of all types of living organisms.
Figure 21.2 Most virus particles are visible only by electron microscopy. In these transmission electron micrographs, (a) a virus is as dwarfed by the bacterial cell it infects, as (b) these E. coli cells are dwarfed by cultured colon cells. (credit a: modification of work by U.S. Dept. of Energy, Office of Science, LBL, PBD; credit b: modification of work by J.P. Nataro and S. Sears, unpub. data, CDC; scale-bar data from Matt Russell)
Evolution of Viruses
Although biologists have a significant amount of knowledge about how present-day viruses mutate and adapt, much less is known about how viruses originated in the first place. When exploring the evolutionary history of most organisms, scientists can look at fossil records and similar historic evidence. However, viruses do not fossilize, as far as we know, so researchers must extrapolate from investigations of how today’s viruses evolve and by using biochemical and genetic information to create speculative virus histories.
Most scholars agree that viruses don’t have a single common ancestor, nor is there a single reasonable hypothesis about virus origins. There are current evolutionary scenarios that may explain the origin of viruses. One such hypothesis, the “devolution” or the regressive hypothesis, suggests that viruses evolved from free-living cells, or from intracellular prokaryotic parasites. However, many components of how this process might have occurred remain a mystery. A second hypothesis, the escapist or the progressive hypothesis, suggests that viruses originated from RNA and DNA molecules, or self-replicating entities similar to transposons or other mobile genetic elements, that escaped from a host cell with the ability to enter another. A third hypothesis, the virus first hypothesis, suggests that viruses may have been the first self-replicating entities before the first cells. In all cases, viruses are probably continuing to evolve along with the cells on which they rely on as hosts.
As technology advances, scientists may develop and refine additional hypotheses to explain the origins of viruses. The emerging field called virus molecular systematics attempts to do just that through comparisons of sequenced genetic material. These researchers hope one day to better understand the origin of viruses—a discovery that could lead to advances in the treatments for the ailments they produce.
Viral Morphology
Viruses are noncellular, meaning they are biological entities that do not have a cellular structure. They therefore lack most of the components of cells, such as organelles, ribosomes, and the plasma membrane. A virion consists of a nucleic acid core, an outer protein coating or capsid, and sometimes an outer envelope made of protein and phospholipid membranes derived from the host cell. Viruses may also contain additional proteins, such as enzymes, within the capsid or attached to the viral genome. The most obvious difference between members of different viral families is the variation in their morphology, which is quite diverse. An interesting feature of viral complexity is that the complexity of the host does not necessarily correlate with the complexity of the virion. In fact, some of the most complex virion structures are found in the bacteriophages—viruses that infect the simplest living organisms, bacteria.
Morphology
Viruses come in many shapes and sizes, but these features are consistent for each viral family. As we have seen, all virions have a nucleic acid genome covered by a protective capsid. The proteins of the capsid are encoded in the viral genome, and are called capsomeres. Some viral capsids are simple helices or polyhedral “spheres,” whereas others are quite complex in structure (Figure 21.3).
Figure 21.3 Viral capsids can be (a) helical, (b) polyhedral, or (c) have a complex shape. (credit a “micrograph”: modification of work by USDA ARS; credit b “micrograph”: modification of work by U.S. Department of Energy)
In general, the capsids of viruses are classified into four groups: helical, icosahedral, enveloped, and head-and-tail. Helical capsids are long and cylindrical. Many plant viruses are helical, including TMV. Icosahedral viruses have shapes that are roughly spherical, such as those of poliovirus or herpesviruses. Enveloped viruses have membranes derived from the host cell that surrounds the capsids. Animal viruses, such as HIV, are frequently enveloped. Head-and-tail viruses infect bacteria and have a head that is similar to icosahedral viruses and a tail shaped like helical viruses.
Many viruses use some sort of glycoprotein to attach to their host cells via molecules on the cell called viral receptors. For these viruses, attachment is required for later penetration of the cell membrane; only after penetration takes place can the virus complete its replication inside the cell. The receptors that viruses use are molecules that are normally found on cell surfaces and have their own physiological functions. It appears that viruses have simply evolved to make use of these molecules for their own replication. For example, HIV uses the CD4 molecule on T lymphocytes as one of its receptors (Figure 21.4). CD4 is a type of molecule called a cell adhesion molecule, which functions to keep different types of immune cells in close proximity to each other during the generation of a T lymphocyte immune response.
Figure 21.4 A virus and its host receptor protein. The HIV virus binds the CD4 receptor on the surface of human cells. CD4 receptors help white blood cells to communicate with other cells of the immune system when producing an immune response. (credit: modification of work by NIAID, NIH)
One of the most complex virions known, the T4 bacteriophage (which infects the Escherichia coli) bacterium, has a tail structure that the virus uses to attach to host cells and a head structure that houses its DNA.
Adenovirus, a non-enveloped animal virus that causes respiratory illnesses in humans, uses glycoprotein spikes protruding from its capsomeres to attach to host cells. Non-enveloped viruses also include those that cause polio (poliovirus), plantar warts (papillomavirus), and hepatitis A (hepatitis A virus).
Enveloped virions, such as the influenza virus, consist of nucleic acid (RNA in the case of influenza) and capsid proteins surrounded by a phospholipid bilayer envelope that contains virus-encoded proteins. Glycoproteins embedded in the viral envelope are used to attach to host cells. Other envelope proteins are the matrix proteins that stabilize the envelope and often play a role in the assembly of progeny virions. Chicken pox, HIV, and mumps are other examples of diseases caused by viruses with envelopes. Because of the fragility of the envelope, non-enveloped viruses are more resistant to changes in temperature, pH, and some disinfectants than enveloped viruses.
Overall, the shape of the virion and the presence or absence of an envelope tell us little about what disease the virus may cause or what species it might infect, but they are still useful means to begin viral classification (Figure 21.5).
Visual Connection
Visual Connection
Figure 21.5 Complex Viruses. Viruses can be either complex or relatively simple in shape. This figure shows three relatively complex virions: the bacteriophage T4, with its DNA-containing head group and tail fibers that attach to host cells; adenovirus, which uses spikes from its capsid to bind to host cells; and the influenza virus, which uses glycoproteins embedded in its envelope to bind to host cells. The influenza virus also has matrix proteins, internal to the envelope, which help stabilize the virion’s shape. (credit “bacteriophage, adenovirus”: modification of work by NCBI, NIH; credit "influenza virus": modification of work by Dan Higgins, Centers for Disease Control and Prevention)
Which of the following statements about virus structure is true?
1. All viruses are encased in a viral membrane.
2. The capsomere is made up of small protein subunits called capsids.
3. DNA is the genetic material in all viruses.
4. Glycoproteins help the virus attach to the host cell.
Types of Nucleic Acid
Unlike nearly all living organisms that use DNA as their genetic material, viruses may use either DNA or RNA. The virus core contains the genome—the total genetic content of the virus. Viral genomes tend to be small, containing only those genes that encode proteins which the virus cannot get from the host cell. This genetic material may be single- or double-stranded. It may also be linear or circular. While most viruses contain a single nucleic acid, others have genomes divided into several segments. The RNA genome of the influenza virus is segmented, which contributes to its variability and continuous evolution, and explains why it is difficult to develop a vaccine against it.
In DNA viruses, the viral DNA directs the host cell’s replication proteins to synthesize new copies of the viral genome and to transcribe and translate that genome into viral proteins. Human diseases caused by DNA viruses include chickenpox, hepatitis B, and adenoviruses. Sexually transmitted DNA viruses include the herpes virus and the human papilloma virus (HPV), which has been associated with cervical cancer and genital warts.
RNA viruses contain only RNA as their genetic material. To replicate their genomes in the host cell, the RNA viruses must encode their own enzymes that can replicate RNA into RNA or, in the retroviruses, into DNA. These RNA polymerase enzymes are more likely to make copying errors than DNA polymerases, and therefore often make mistakes during transcription. For this reason, mutations in RNA viruses occur more frequently than in DNA viruses. This causes them to change and adapt more rapidly to their host. Human diseases caused by RNA viruses include influenza, hepatitis C, measles, and rabies. The HIV virus, which is sexually transmitted, is an RNA retrovirus.
The Challenge of Virus Classification
Because most viruses probably evolved from different ancestors, the systematic methods that scientists have used to classify prokaryotic and eukaryotic cells are not very useful. If viruses represent “remnants” of different organisms, then even genomic or protein analysis is not useful. Why?, Because viruses have no common genomic sequence that they all share. For example, the 16S rRNA sequence so useful for constructing prokaryote phylogenies is of no use for a creature with no ribosomes! Biologists have used several classification systems in the past. Viruses were initially grouped by shared morphology. Later, groups of viruses were classified by the type of nucleic acid they contained, DNA or RNA, and whether their nucleic acid was single- or double-stranded. However, these earlier classification methods grouped viruses differently, because they were based on different sets of characters of the virus. The most commonly used classification method today is called the Baltimore classification scheme, and is based on how messenger RNA (mRNA) is generated in each particular type of virus.
Past Systems of Classification
Viruses contain only a few elements by which they can be classified: the viral genome, the type of capsid, and the envelope structure for the enveloped viruses. All of these elements have been used in the past for viral classification (Table 21.1 and Figure 21.6). Viral genomes may vary in the type of genetic material (DNA or RNA) and its organization (single- or double-stranded, linear or circular, and segmented or non-segmented). In some viruses, additional proteins needed for replication are associated directly with the genome or contained within the viral capsid.
Virus Classification by Genome Structure
Genome Structure Examples
• RNA
• DNA
• Rabies virus, retroviruses
• Herpesviruses, smallpox virus
• Single-stranded
• Double-stranded
• Rabies virus, retroviruses
• Herpesviruses, smallpox virus
• Linear
• Circular
• Rabies virus, retroviruses, herpesviruses, smallpox virus
• Papillomaviruses, many bacteriophages
• Non-segmented: genome consists of a single segment of genetic material
• Segmented: genome is divided into multiple segments
• Parainfluenza viruses
• Influenza viruses
Table 21.1
Figure 21.6 Viruses can be classified according to their core genetic material and capsid design. (a) Rabies virus has a single-stranded RNA (ssRNA) core and an enveloped helical capsid, whereas (b) variola virus, the causative agent of smallpox, has a double-stranded DNA (dsDNA) core and a complex capsid. Rabies transmission occurs when saliva from an infected mammal enters a wound. The virus travels through neurons in the peripheral nervous system to the central nervous system, where it impairs brain function, and then travels to other tissues. The virus can infect any mammal, and most die within weeks of infection. Smallpox is a human virus transmitted by inhalation of the variola virus, localized in the skin, mouth, and throat, which causes a characteristic rash. Before its eradication in 1979, infection resulted in a 30 to 35 percent mortality rate. (credit “rabies diagram”: modification of work by CDC; “rabies micrograph”: modification of work by Dr. Fred Murphy, CDC; credit “small pox micrograph”: modification of work by Dr. Fred Murphy, Sylvia Whitfield, CDC; credit “smallpox photo”: modification of work by CDC; scale-bar data from Matt Russell)
Viruses can also be classified by the design of their capsids (Table 21.2 and Figure 21.7). Capsids are classified as naked icosahedral, enveloped icosahedral, enveloped helical, naked helical, and complex. The type of genetic material (DNA or RNA) and its structure (single- or double-stranded, linear or circular, and segmented or non-segmented) are used to classify the virus core structures (Table 21.2).
Virus Classification by Capsid Structure
Capsid Classification Examples
Naked icosahedral Hepatitis A virus, polioviruses
Enveloped icosahedral Epstein-Barr virus, herpes simplex virus, rubella virus, yellow fever virus, HIV-1
Enveloped helical Influenza viruses, mumps virus, measles virus, rabies virus
Naked helical Tobacco mosaic virus
Complex with many proteins; some have combinations of icosahedral and helical capsid structures Herpesviruses, smallpox virus, hepatitis B virus, T4 bacteriophage
Table 21.2
Figure 21.7 Transmission electron micrographs of various viruses show their capsid structures. The capsid of the (a) polio virus is naked icosahedral; (b) the Epstein-Barr virus capsid is enveloped icosahedral; (c) the mumps virus capsid is an enveloped helix; (d) the tobacco mosaic virus capsid is naked helical; and (e) the herpesvirus capsid is complex. (credit a: modification of work by Dr. Fred Murphy, Sylvia Whitfield; credit b: modification of work by Liza Gross; credit c: modification of work by Dr. F. A. Murphy, CDC; credit d: modification of work by USDA ARS; credit e: modification of work by Linda Stannard, Department of Medical Microbiology, University of Cape Town, South Africa, NASA; scale-bar data from Matt Russell)
Baltimore Classification
The most commonly and currently used system of virus classification was first developed by Nobel Prize-winning biologist David Baltimore in the early 1970s. In addition to the differences in morphology and genetics mentioned above, the Baltimore classification scheme groups viruses according to how the mRNA is produced during the replicative cycle of the virus.
Group I viruses contain double-stranded DNA (dsDNA) as their genome. Their mRNA is produced by transcription in much the same way as with cellular DNA, using the enzymes of the host cell.
Group II viruses have single-stranded DNA (ssDNA) as their genome. They convert their single-stranded genomes into a dsDNA intermediate before transcription to mRNA can occur.
Group III viruses use dsRNA as their genome. The strands separate, and one of them is used as a template for the generation of mRNA using the RNA-dependent RNA polymerase encoded by the virus.
Group IV viruses have ssRNA as their genome with a positive polarity, which means that the genomic RNA can serve directly as mRNA. Intermediates of dsRNA, called replicative intermediates, are made in the process of copying the genomic RNA. Multiple, full-length RNA strands of negative polarity (complementary to the positive-stranded genomic RNA) are formed from these intermediates, which may then serve as templates for the production of RNA with positive polarity, including both full-length genomic RNA and shorter viral mRNAs.
Group V viruses contain ssRNA genomes with a negative polarity, meaning that their sequence is complementary to the mRNA. As with Group IV viruses, dsRNA intermediates are used to make copies of the genome and produce mRNA. In this case, the negative-stranded genome can be converted directly to mRNA. Additionally, full-length positive RNA strands are made to serve as templates for the production of the negative-stranded genome.
Group VI viruses have diploid (two copies) ssRNA genomes that must be converted, using the enzyme reverse transcriptase, to dsDNA; the dsDNA is then transported to the nucleus of the host cell and inserted into the host genome. Then, mRNA can be produced by transcription of the viral DNA that was integrated into the host genome.
Group VII viruses have partial dsDNA genomes and make ssRNA intermediates that act as mRNA, but are also converted back into dsDNA genomes by reverse transcriptase, necessary for genome replication.
The characteristics of each group in the Baltimore classification are summarized in Table 21.3 with examples of each group.
Baltimore Classification
Group Characteristics Mode of mRNA Production Example
I Double-stranded DNA mRNA is transcribed directly from the DNA template Herpes simplex (herpesvirus)
II Single-stranded DNA DNA is converted to double-stranded form before RNA is transcribed Canine parvovirus (parvovirus)
III Double-stranded RNA mRNA is transcribed from the RNA genome Childhood gastroenteritis (rotavirus)
IV Single stranded RNA (+) Genome functions as mRNA Common cold (picornavirus)
V Single stranded RNA (-) mRNA is transcribed from the RNA genome Rabies (rhabdovirus)
VI Single stranded RNA viruses with reverse transcriptase Reverse transcriptase makes DNA from the RNA genome; DNA is then incorporated in the host genome; mRNA is transcribed from the incorporated DNA Human immunodeficiency virus (HIV)
VII Double stranded DNA viruses with reverse transcriptase The viral genome is double-stranded DNA, but viral DNA is replicated through an RNA intermediate; the RNA may serve directly as mRNA or as a template to make mRNA Hepatitis B virus (hepadnavirus)
Table 21.3
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.01%3A_Viruses/5.1.02%3A_Viral_Evolution_Morphology_and_Classification.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• List the steps of replication and explain what occurs at each step
• Describe the lytic and lysogenic cycles of virus replication
• Explain the transmission of plant and animal viruses
• Discuss some of the diseases caused by plant and animal viruses
• Discuss the economic impact of plant and animal viruses
Viruses are obligate, intracellular parasites. A virus must first recognize and attach to a specific living cell prior to entering it. After penetration, the invading virus must copy its genome and manufacture its own proteins. Finally, the progeny virions must escape the host cell so that they can infect other cells. Viruses can infect only certain species of hosts and only certain cells within that host. Specific host cells that a virus must occupy and use to replicate are called permissive. In most cases, the molecular basis for this specificity is due to a particular surface molecule known as the viral receptor on the host cell surface. A specific viral receptor is required for the virus to attach. In addition, differences in metabolism and host-cell immune responses (based on differential gene expression) are a likely factor in determining which cells a virus may target for replication.
Steps of Virus Infections
A virus must use its host-cell processes to replicate. The viral replication cycle can produce dramatic biochemical and structural changes in the host cell, which may cause cell damage. These changes, called cytopathic effects, can change cell functions or even destroy the cell. Some infected cells, such as those infected by the common cold virus known as rhinovirus, die through lysis (bursting) or apoptosis (programmed cell death or “cell suicide”), releasing all progeny virions at once. The symptoms of viral diseases result both from such cell damage caused by the virus and from the immune response to the virus, which attempts to control and eliminate the virus from the body.
Many animal viruses, such as HIV (human immunodeficiency virus), leave the infected cells of the immune system by a process known as budding, where virions leave the cell individually. During the budding process, the cell does not undergo lysis and is not immediately killed. However, the damage to the cells that the virus infects may make it impossible for the cells to function normally, even though the cells remain alive for a period of time. Most productive viral infections follow similar steps in the virus replication cycle: attachment, penetration, uncoating, replication, assembly, and release (Figure 21.8).
Attachment
A virus attaches to a specific receptor site on the host cell membrane through attachment proteins in the capsid or via glycoproteins embedded in the viral envelope. The specificity of this interaction determines the host—and the cells within the host—that can be infected by a particular virus. This can be illustrated by thinking of several keys and several locks, where each key will fit only one specific lock.
Link to Learning
Link to Learning
This video explains how influenza attacks the body.
Entry
Viruses may enter a host cell either with or without the viral capsid. The nucleic acid of bacteriophages enters the host cell “naked,” leaving the capsid outside the cell. Plant and animal viruses can enter through endocytosis (as you may recall, the cell membrane surrounds and engulfs the entire virus). Some enveloped viruses enter the cell when the viral envelope fuses directly with the cell membrane. Once inside the cell, the viral capsid degrades, and then the viral nucleic acid is released and becomes available for replication and transcription.
Replication and Assembly
The replication mechanism depends on the viral genome. DNA viruses usually use host-cell proteins and enzymes to replicate the viral DNA and to transcribe viral mRNA, which is then used to direct viral protein synthesis. RNA viruses usually use the RNA core as a template for synthesis of viral genomic RNA and mRNA. The viral mRNA directs the host cell to synthesize viral enzymes and capsid proteins, and assemble new virions.
Of course, there are exceptions to this pattern. If a host cell does not provide the enzymes necessary for viral replication, viral genes supply the information to direct synthesis of the missing proteins. Retroviruses, such as HIV (group VI of the Baltimore classification scheme), have an RNA genome that must be reverse transcribed into DNA, which then is incorporated into the host cell genome. To convert RNA into DNA, retroviruses must contain genes that encode the virus-specific enzyme reverse transcriptase that transcribes an RNA template to DNA. Reverse transcription never occurs in uninfected host cells—the enzyme reverse transcriptase is only derived from the expression of viral genes within the infected host cells. The fact that HIV produces some of its own enzymes not found in the host has allowed researchers to develop drugs that inhibit these enzymes without affecting the host’s metabolism.
This approach has led to the development of a variety of drugs used to treat HIV and has been effective at reducing the number of infectious virions (copies of viral RNA) in the blood to non-detectable levels in many HIV-infected individuals.
Egress
The last stage of viral replication is the release of the new virions produced in the host organism, where they are able to infect adjacent cells and repeat the replication cycle. As you’ve learned, some viruses are released when the host cell dies, and other viruses can leave infected cells by budding through the membrane without directly killing the cell.
Visual Connection
Visual Connection
Figure 21.8 The influenza reproductive cycle. In influenza virus infection, glycoproteins on the capsid attach to a host epithelial cell. Following this, the virus is engulfed. RNA and proteins are then made and assembled into new virions.
Influenza virus is packaged in a viral envelope that fuses with the plasma membrane. This way, the virus can exit the host cell without killing it. What advantage does the virus gain by keeping the host cell alive?
Link to Learning
Link to Learning
Watch a video on viruses, identifying structures, modes of transmission, replication, and more.
Different Hosts and Their Viruses
As you’ve learned, viruses often infect very specific hosts, as well as specific cells within the host. This feature of a virus makes it specific to one or a few species of life on Earth. On the other hand, so many different types of viruses exist on Earth that nearly every living organism has its own set of viruses trying to infect its cells. Even prokaryotes, the smallest and simplest of cells, may be attacked by specific types of viruses. In the following section, we will look at some of the features of viral infection of prokaryotic cells. As we have learned, viruses that infect bacteria are called bacteriophages (Figure 21.9). Archaea have their own similar viruses.
Bacteriophages
Figure 21.9 Bacteriophages attached to a host cell (transmission electron micrograph). In bacteriophage with tails, like the one shown here, the tails serve as a passageway for transmission of the phage genome. (credit: modification of work by Dr. Graham Beards; scale-bar data from Matt Russell)
Most bacteriophages are dsDNA viruses, which use host enzymes for DNA replication and RNA transcription. Phage particles must bind to specific surface receptors and actively insert the genome into the host cell. (The complex tail structures seen in many bacteriophages are actively involved in getting the viral genome across the prokaryotic cell wall.) When infection of a cell by a bacteriophage results in the production of new virions, the infection is said to be productive. If the virions are released by bursting the cell, the virus replicates by means of a lytic cycle (Figure 21.10). An example of a lytic bacteriophage is T4, which infects Escherichia coli found in the human intestinal tract. Sometimes, however, a virus can remain within the cell without being released. For example, when a temperate bacteriophage infects a bacterial cell, it replicates by means of a lysogenic cycle (Figure 21.10), and the viral genome is incorporated into the genome of the host cell. When the phage DNA is incorporated into the host-cell genome, it is called a prophage. An example of a lysogenic bacteriophage is the λ (lambda) virus, which also infects the E. coli bacterium. Viruses that infect plant or animal cells may sometimes undergo infections where they are not producing virions for long periods. An example is the animal herpesviruses, including herpes simplex viruses, the cause of oral and genital herpes in humans. In a process called latency, these viruses can exist in nervous tissue for long periods of time without producing new virions, only to leave latency periodically and cause lesions in the skin where the virus replicates. Even though there are similarities between lysogeny and latency, the term lysogenic cycle is usually reserved to describe bacteriophages. Latency will be described in more detail in the next section.
Visual Connection
Visual Connection
Figure 21.10 A temperate bacteriophage has both lytic and lysogenic cycles. In the lytic cycle, the phage replicates and lyses the host cell. In the lysogenic cycle, phage DNA is incorporated into the host genome, where it is passed on to subsequent generations. Environmental stressors such as starvation or exposure to toxic chemicals may cause the prophage to excise and enter the lytic cycle.
Which of the following statements is false?
1. In the lytic cycle, new phages are produced and released into the environment.
2. In the lysogenic cycle, phage DNA is incorporated into the host genome.
3. An environmental stressor can cause the phage to initiate the lysogenic cycle.
4. Cell lysis only occurs in the lytic cycle.
Plant Viruses
Most plant viruses, like the tobacco mosaic virus, have single-stranded (+) RNA genomes. However, there are also plant viruses in most other virus categories. Unlike bacteriophages, plant viruses do not have active mechanisms for delivering the viral genome across the protective cell wall. For a plant virus to enter a new host plant, some type of mechanical damage must occur. This damage is often caused by weather, insects, animals, fire, or human activities like farming or landscaping. Movement from cell to cell within a plant can be facilitated by viral modification of plasmodesmata (cytoplasmic threads that pass from one plant cell to the next). Additionally, plant offspring may inherit viral diseases from parent plants. Plant viruses can be transmitted by a variety of vectors, through contact with an infected plant’s sap, by living organisms such as insects and nematodes, and through pollen. The transfer of a virus from one plant to another is known as horizontal transmission, whereas the inheritance of a virus from a parent is called vertical transmission.
Symptoms of viral diseases vary according to the virus and its host (Table 21.4). One common symptom is hyperplasia, the abnormal proliferation of cells that causes the appearance of plant tumors known as galls. Other viruses induce hypoplasia, or decreased cell growth, in the leaves of plants, causing thin, yellow areas to appear. Still other viruses affect the plant by directly killing plant cells, a process known as cell necrosis. Other symptoms of plant viruses include malformed leaves; black streaks on the stems of the plants; altered growth of stems, leaves, or fruits; and ring spots, which are circular or linear areas of discoloration found in a leaf.
Some Common Symptoms of Plant Viral Diseases
Symptom Appears as
Hyperplasia Galls (tumors)
Hypoplasia Thinned, yellow splotches on leaves
Cell necrosis Dead, blackened stems, leaves, or fruit
Abnormal growth patterns Malformed stems, leaves, or fruit
Discoloration Yellow, red, or black lines, or rings in stems, leaves, or fruit
Table 21.4
Plant viruses can seriously disrupt crop growth and development, significantly affecting our food supply. They are responsible for poor crop quality and quantity globally, and can bring about huge economic losses annually. Others viruses may damage plants used in landscaping. Some viruses that infect agricultural food plants include the name of the plant they infect, such as tomato spotted wilt virus, bean common mosaic virus, and cucumber mosaic virus. In plants used for landscaping, two of the most common viruses are peony ring spot and rose mosaic virus. There are far too many plant viruses to discuss each in detail, but symptoms of bean common mosaic virus result in lowered bean production and stunted, unproductive plants. In the ornamental rose, the rose mosaic disease causes wavy yellow lines and colored splotches on the leaves of the plant.
Animal Viruses
Animal viruses, unlike the viruses of plants and bacteria, do not have to penetrate a cell wall to gain access to the host cell. The virus may even induce the host cell to cooperate in the infection process. Non-enveloped or “naked” animal viruses may enter cells in two different ways. As a protein in the viral capsid binds to its receptor on the host cell, the virus may be taken inside the cell via a vesicle during the normal cell process of receptor-mediated endocytosis. An alternative method of cell penetration used by non-enveloped viruses is for capsid proteins to undergo shape changes after binding to the receptor, creating channels in the host cell membrane. The viral genome is then “injected” into the host cell through these channels in a manner analogous to that used by many bacteriophages.
Enveloped viruses also have two ways of entering cells after binding to their receptors: receptor-mediated endocytosis, or fusion. Many enveloped viruses enter the cell by receptor-mediated endocytosis in a fashion similar to that seen in some non-enveloped viruses. On the other hand, fusion only occurs with enveloped virions. These viruses, which include HIV among others, use special fusion proteins in their envelopes to cause the envelope to fuse with the plasma membrane of the cell, thus releasing the genome and capsid of the virus into the cell cytoplasm.
After making their proteins and copying their genomes, animal viruses complete the assembly of new virions and exit the cell. As we have already discussed using the example the influenza virus, enveloped animal viruses may bud from the cell membrane as they assemble themselves, taking a piece of the cell’s plasma membrane in the process. On the other hand, non-enveloped viral progeny, such as rhinoviruses, accumulate in infected cells until there is a signal for lysis or apoptosis, and all virions are released together.
As you will learn in the next module, animal viruses are associated with a variety of human diseases. Some of them follow the classic pattern of acute disease, where symptoms get increasingly worse for a short period followed by the elimination of the virus from the body by the immune system and eventual recovery from the infection. Examples of acute viral diseases are the common cold and influenza. Other viruses cause long-term chronic infections, such as the virus causing hepatitis C, whereas others, like herpes simplex virus, only cause intermittent symptoms. Still other viruses, such as human herpesviruses 6 and 7, which in some cases can cause the minor childhood disease roseola, often successfully cause productive infections without causing any symptoms at all in the host, and thus we say these patients have an asymptomatic infection.
In hepatitis C infections, the virus grows and reproduces in liver cells, causing low levels of liver damage. The damage is so low that infected individuals are often unaware that they are infected, and many infections are detected only by routine blood work on patients with risk factors such as intravenous drug use. On the other hand, since many of the symptoms of viral diseases are caused by immune responses, a lack of symptoms is an indication of a weak immune response to the virus. This allows the virus to escape elimination by the immune system and persist in individuals for years, all the while producing low levels of progeny virions in what is known as a chronic viral disease. Chronic infection of the liver by this virus leads to a much greater chance of developing liver cancer, sometimes as much as 30 years after the initial infection.
As already discussed, herpes simplex virus can remain in a state of latency in nervous tissue for months, even years. As the virus “hides” in the tissue and makes few if any viral proteins, there is nothing for the immune response to act against, and immunity to the virus slowly declines. Under certain conditions, including various types of physical and psychological stress, the latent herpes simplex virus may be reactivated and undergo a lytic replication cycle in the skin, causing the lesions associated with the disease. Once virions are produced in the skin and viral proteins are synthesized, the immune response is again stimulated and resolves the skin lesions in a few days or weeks by destroying viruses in the skin. As a result of this type of replicative cycle, appearances of cold sores and genital herpes outbreaks only occur intermittently, even though the viruses remain in the nervous tissue for life. Latent infections are common with other herpesviruses as well, including the varicella-zoster virus that causes chickenpox. After having a chickenpox infection in childhood, the varicella-zoster virus can remain latent for many years and reactivate in adults to cause the painful condition known as “shingles” (Figure 21.11).
Figure 21.11 A latent virus infection. (a) Varicella-zoster, the virus that causes chickenpox, has an enveloped icosahedral capsid visible in this transmission electron micrograph. Its double-stranded DNA genome becomes incorporated in the host DNA and can reactivate after latency in the form of (b) shingles, often exhibiting a rash. (credit a: modification of work by Dr. Erskine Palmer, B. G. Martin, CDC; credit b: modification of work by “rosmary”/Flickr; scale-bar data from Matt Russell)
Some animal-infecting viruses, including the hepatitis C virus discussed above, are known as oncogenic viruses: They have the ability to cause cancer. These viruses interfere with the normal regulation of the host cell cycle either by introducing genes that stimulate unregulated cell growth (oncogenes) or by interfering with the expression of genes that inhibit cell growth. Oncogenic viruses can be either DNA or RNA viruses. Cancers known to be associated with viral infections include cervical cancer, caused by human papillomavirus (HPV) (Figure 21.12), liver cancer caused by hepatitis B virus, T-cell leukemia, and several types of lymphoma.
Figure 21.12 HPV, or human papillomavirus, has a naked icosahedral capsid visible in this transmission electron micrograph and a double-stranded DNA genome that is incorporated into the host DNA. The virus, which is sexually transmitted, is oncogenic and can lead to cervical cancer. (credit: modification of work by NCI, NIH; scale-bar data from Matt Russell)
Link to Learning
Link to Learning
This video shows the life cycle of a virus.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.01%3A_Viruses/5.1.03%3A_Virus_Infections_and_Hosts.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Identify major viral illnesses that affect humans
• Compare vaccinations and anti-viral drugs as medical approaches to viruses
Viruses cause a variety of diseases in animals, including humans, ranging from the common cold to potentially fatal illnesses like meningitis (Figure 21.13). These diseases can be treated by antiviral drugs or by vaccines; however, some viruses, such as HIV, are capable both of avoiding the immune response and of mutating within the host organism to become resistant to antiviral drugs.
Figure 21.13 A sampling of human viruses. Viruses can cause dozens of ailments in humans, ranging from mild illnesses to serious diseases. (credit: modification of work by Mikael Häggström)
Vaccines for Prevention
The primary method of controlling viral disease is by vaccination, which is intended to prevent outbreaks by building immunity to a virus or virus family (Figure 21.14). Vaccines may be prepared using live viruses, killed viruses, or molecular subunits of the virus. Note that the killed viral vaccines and subunit viruses are both incapable of causing disease, nor is there any valid evidence that vaccinations contribute to autism.
Live viral vaccines are designed in the laboratory to cause few symptoms in recipients while giving them protective immunity against future infections. Polio was one disease that represented a milestone in the use of vaccines. Polio epidemics occurred with increasing frequency and impact as the twentieth century progressed, becoming a terrifying and tragic event each summer. Tens of thousands of people died and many more were paralyzed; children made up a large portion of the victims. Using killed virus tested on HeLa cell line (originally obtained from Henrietta Lacks and then mass produced to meet the need), Jonas Salk developed a successful vaccine. Mass immunization campaigns in the 1950s (killed vaccine) and 1960s (live vaccine) significantly reduced the incidence of the disease. The success of the polio vaccine paved the way for the routine dispensation of childhood vaccines against measles, mumps, rubella, chickenpox, and other diseases.
The issue with using live vaccines (which are usually more effective than killed vaccines), is the low but significant danger that these viruses will revert to their disease-causing form by back mutations. Live vaccines are usually made by attenuating (weakening) the “wild-type” (disease-causing) virus by growing it in the laboratory in tissues or at temperatures different from what the virus is accustomed to in the host. Adaptations to these new cells or temperatures induce mutations in the genomes of the virus, allowing it to grow better in the laboratory while inhibiting its ability to cause disease when reintroduced into conditions found in the host. These attenuated viruses thus still cause infection, but they do not grow very well, allowing the immune response to develop in time to prevent major disease. Back mutations occur when the vaccine undergoes mutations in the host such that it readapts to the host and can again cause disease, which can then be spread to other humans in an epidemic. This type of scenario happened as recently as 2007 in Nigeria where mutations in a polio vaccine led to an epidemic of polio in that country.
Some vaccines are in continuous development because certain viruses, such as influenza and HIV, have a high mutation rate compared to that of other viruses and normal host cells. With influenza, mutations in the surface molecules of the virus help the organism evade the protective immunity that may have been obtained in a previous influenza season, making it necessary for individuals to get vaccinated every year. Other viruses, such as those that cause the childhood diseases measles, mumps, and rubella, mutate so infrequently that the same vaccine is used year after year.
Figure 21.14 Vaccinations are designed to boost immunity to a virus to prevent infection. (credit: Navy Medicine)
Link to Learning
Link to Learning
Watch this NOVA video to learn how microbiologists are attempting to replicate the deadly 1918 Spanish influenza virus so they can understand more about virology.
Vaccines and Antiviral Drugs for Treatment
In some cases, vaccines can be used to treat an active viral infection. The concept behind this is that by giving the vaccine, immunity is boosted without adding more disease-causing virus. In the case of rabies, a fatal neurological disease transmitted via the saliva of rabies virus-infected animals, the progression of the disease from the time of the animal bite to the time it enters the central nervous system may be two weeks or longer. This is enough time to vaccinate individuals who suspect that they have been bitten by a rabid animal, and their boosted immune response is sufficient to prevent the virus from entering nervous tissue. Thus, the potentially fatal neurological consequences of the disease are averted, and the individual only has to recover from the infected bite. This approach is also being used for the treatment of Ebola, one of the fastest and most deadly viruses on Earth. Transmitted by bats and great apes, this disease can cause death in 70 to 90 percent of infected humans within two weeks. Using newly developed vaccines that boost the immune response in this way, there is hope that affected individuals will be better able to control the virus, potentially saving a greater percentage of infected persons from a rapid and very painful death.
Another way of treating viral infections is the use of antiviral drugs. Because viruses use the resources of the host cell for replication and the production of new virus proteins, it is difficult to block their activities without damaging the host. For many years, scientists thought that drugs capable of impacting viruses would be too toxic for the body to endure. To meet this challenge, researcher Gertrude Elion sought to develop drugs that would target only the virus through processes such as inhibiting only viral DNA replication. For example, some of her medicines focused on purines, while others affected DNA polymerase. (Elion has 45 patents ranging from antivirals to immunosuppressants to cancer drugs.) However, we do have some effective antiviral drugs, such as those used to treat HIV and influenza. Some antiviral drugs are specific for a particular virus and others have been used to control and reduce symptoms for a wide variety of viral diseases. For most viruses, antiviral drugs can inhibit the virus by blocking the actions of one or more of its proteins. It is important to note that the targeted proteins be encoded by viral genes and that these molecules are not present in a healthy host cell. In this way, viral growth is inhibited without damaging the host. Elion's work with George Hitchens not only led to direct treatments, but, more importantly, changed the entire methodology of drug development. By targeting specific aspects of tumor cells, viruses, and bacteria, they laid the groundwork for many of today's most common and important medicines, used to help millions of people each year. They were awarded the Nobel Prize in 1988.
Antivirals have been developed to treat genital herpes (herpes simplex II) and influenza. For genital herpes, drugs such as acyclovir, developed by Elion, can reduce the number and duration of episodes of active viral disease, during which patients develop viral lesions in their skin cells. As the virus remains latent in nervous tissue of the body for life, this drug is not curative but can make the symptoms of the disease more manageable. For influenza, drugs like Tamiflu (oseltamivir) (Figure 21.15) can reduce the duration of “flu” symptoms by one or two days, but the drug does not prevent symptoms entirely. Tamiflu works by inhibiting an enzyme (viral neuraminidase) that allows new virions to leave their infected cells. Thus, Tamiflu inhibits the spread of virus from infected to uninfected cells. Other antiviral drugs, such as Ribavirin, have been used to treat a variety of viral infections, although its mechanism of action against certain viruses remains unclear.
Figure 21.15 Action of an antiviral drug. (a) Tamiflu inhibits a viral enzyme called neuraminidase (NA) found in the influenza viral envelope. (b) Neuraminidase cleaves the connection between viral hemagglutinin (HA), also found in the viral envelope, and glycoproteins on the host cell surface. Inhibition of neuraminidase prevents the virus from detaching from the host cell, thereby blocking further infection. (credit a: modification of work by M. Eickmann)
By far, the most successful use of antivirals has been in the treatment of the retrovirus HIV, which causes a disease that, if untreated, is usually fatal within 10 to 12 years after infection. Anti-HIV drugs have been able to control viral replication to the point that individuals receiving these drugs survive for a significantly longer time than the untreated.
A particular challenge with HIV is its tendency to mutate quickly within the body of an individual patient. This leads to individual drug resistance, and requires a different treatment strategy than many other diseases. David Ho was among the first to propose and develop a method to treat multiple mutations of HIV at the same time. Ho's efforts were a turning point in fighting AIDS. Anti-HIV drugs inhibit viral replication at many different phases of the HIV replicative cycle (Figure 21.16). Drugs have been developed that inhibit the fusion of the HIV viral envelope with the plasma membrane of the host cell (fusion inhibitors), the conversion of its RNA genome into double-stranded DNA (reverse transcriptase inhibitors, like AZT), the integration of the viral DNA into the host genome (integrase inhibitors), and the processing of viral proteins (protease inhibitors).
Figure 21.16 Life cycle of HIV. HIV, an enveloped, icosahedral virus, attaches to the CD4 receptor of an immune cell and fuses with the cell membrane. Viral contents are released into the cell, where viral enzymes convert the single-stranded RNA genome into DNA and incorporate it into the host genome. (credit: NIAID, NIH)
Unfortunately, when any of these drugs are used individually, the high mutation rate of the virus allows it to easily and rapidly develop resistance to the drug, limiting the drug’s effectiveness. The breakthrough in the treatment of HIV was the development of HAART, highly active anti-retroviral therapy, which involves a mixture of different drugs, sometimes called a drug “cocktail.” By attacking the virus at different stages of its replicative cycle, it is much more difficult for the virus to develop resistance to multiple drugs at the same time. Still, even with the use of combination HAART therapy, there is concern that, over time, the virus will develop resistance to this therapy. Thus, new anti-HIV drugs are constantly being developed with the hope of continuing the battle against this highly fatal virus.
Everyday Connection
Everyday Connection
Applied Virology:The study of viruses has led to the development of a variety of new ways to treat non-viral diseases. Viruses have been used in gene therapy. Gene therapy is used to treat genetic diseases such as severe combined immunodeficiency (SCID), a heritable, recessive disease in which children are born with severely compromised immune systems. One common type of SCID is due to the lack of an enzyme, adenosine deaminase (ADA), which breaks down purine bases. To treat this disease by gene therapy, bone marrow cells are taken from a SCID patient and the ADA gene is inserted. This is where viruses come in, and their use relies on their ability to penetrate living cells and bring genes in with them. Viruses such as adenovirus, an upper-respiratory human virus, are modified by the addition of the ADA gene, and the virus then transports this gene into the cell. The modified cells, now capable of making ADA, are then given back to the patients in the hope of curing them. Gene therapy using viruses as carriers of genes (viral vectors), although still experimental, holds promise for the treatment of many genetic diseases. Still, many technological problems need to be solved for this approach to be a viable method for treating genetic disease.
Another medical use for viruses relies on their specificity and ability to kill the cells they infect. Oncolytic viruses are engineered in the laboratory specifically to attack and kill cancer cells. A genetically modified adenovirus known as H101 has been used since 2005 in clinical trials in China to treat head and neck cancers. The results have been promising, with a greater short-term response rate to the combination of chemotherapy and viral therapy than to chemotherapy treatment alone. This ongoing research may herald the beginning of a new age of cancer therapy, where viruses are engineered to find and specifically kill cancer cells, regardless of where in the body they may have spread.
A third use of viruses in medicine relies on their specificity and involves using bacteriophages in the treatment of bacterial infections. Bacterial diseases have been treated with antibiotics since the 1940s. However, over time, many bacteria have evolved resistance to antibiotics. A good example is methicillin-resistant Staphylococcus aureus (MRSA, pronounced “mersa”), an infection commonly acquired in hospitals. This bacterium is resistant to a variety of antibiotics, making it difficult to treat. The use of bacteriophages specific for such bacteria would bypass their resistance to antibiotics and specifically kill them. Although phage therapy is in use in the Republic of Georgia to treat antibiotic-resistant bacteria, its use to treat human diseases has not been approved in most countries. However, the safety of the treatment was confirmed in the United States when the U.S. Food and Drug Administration approved spraying meats with bacteriophages to destroy the food pathogen Listeria. As more and more antibiotic-resistant strains of bacteria evolve, the use of bacteriophages might be a potential solution to the problem, and the development of phage therapy is of much interest to researchers worldwide.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.01%3A_Viruses/5.1.04%3A_Prevention_and_Treatment_of_Viral_Infections.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe prions and their basic properties
• Define viroids and their targets of infection
Prions and viroids are pathogens (agents with the ability to cause disease) that have simpler structures than viruses but, in the case of prions, still can produce deadly diseases.
Prions
Prions, so-called because they are proteinaceous, are infectious particles—smaller than viruses—that contain no nucleic acids (neither DNA nor RNA). Historically, the idea of an infectious agent that did not use nucleic acids was considered impossible, but pioneering work by Nobel Prize-winning biologist Stanley Prusiner has convinced the majority of biologists that such agents do indeed exist.
Fatal neurodegenerative diseases, such as kuru in humans and bovine spongiform encephalopathy (BSE) in cattle (commonly known as “mad cow disease”) were shown to be transmitted by prions. The disease was spread by the consumption of meat, nervous tissue, or internal organs between members of the same species. Kuru, native to humans in Papua New Guinea, was spread from human to human via ritualistic cannibalism. BSE, originally detected in the United Kingdom, was spread between cattle by the practice of including cattle nervous tissue in feed for other cattle. Individuals with kuru and BSE show symptoms of loss of motor control and unusual behaviors, such as uncontrolled bursts of laughter with kuru, followed by death. Kuru was controlled by inducing the population to abandon its ritualistic cannibalism.
On the other hand, BSE was initially thought to only affect cattle. Cattle dying of the disease were shown to have developed lesions or “holes” in the brain, causing the brain tissue to resemble a sponge. Later on in the outbreak, however, it was shown that a similar encephalopathy in humans, known as variant Creutzfeldt-Jakob disease (CJD), could be acquired from eating beef from animals infected with BSE, sparking bans by various countries on the importation of British beef and causing considerable economic damage to the British beef industry (Figure 21.17). BSE still exists in various areas, and although a rare disease, individuals that acquire CJD are difficult to treat. The disease can be spread from human to human by blood, so many countries have banned blood donation from regions associated with BSE.
The cause of spongiform encephalopathies, such as kuru and BSE, is an infectious structural variant of a normal cellular protein called PrP (prion protein). It is this variant that constitutes the prion particle. PrP exists in two forms, PrPc, the normal form of the protein, and PrPsc, the infectious form. Once introduced into the body, the PrPsc contained within the prion binds to PrPc and converts it to PrPsc. This leads to an exponential increase of the PrPsc protein, which aggregates. PrPsc is folded abnormally, and the resulting conformation (shape) is directly responsible for the lesions seen in the brains of infected cattle. Thus, although not without some detractors among scientists, the prion seems likely to be an entirely new form of infectious agent, the first one found whose transmission is not reliant upon genes made of DNA or RNA.
Figure 21.17 Mad Cow Disease in humans. (a) Endogenous normal prion protein (PrPc) is converted into the disease-causing form (PrPsc) when it encounters this variant form of the protein. PrPsc may arise spontaneously in brain tissue, especially if a mutant form of the protein is present, or it may occur via the spread of misfolded prions consumed in food into brain tissue. (b) This prion-infected brain tissue, visualized using light microscopy, shows the vacuoles that give it a spongy texture, typical of transmissible spongiform encephalopathies. (credit b: modification of work by Dr. Al Jenny, USDA APHIS; scale-bar data from Matt Russell)
Viroids
Viroids are plant pathogens: small, single-stranded, circular RNA particles that are much simpler than a virus. They do not have a capsid or outer envelope, but like viruses can reproduce only within a host cell. Viroids do not, however, manufacture any proteins, and they only produce a single, specific RNA molecule. Human diseases caused by viroids have yet to be identified.
Viroids are known to infect plants (Figure 21.18) and are responsible for crop failures and the loss of millions of dollars in agricultural revenue each year. Some of the plants they infect include potatoes, cucumbers, tomatoes, chrysanthemums, avocados, and coconut palms.
Figure 21.18 These potatoes have been infected by the potato spindle tuber viroid (PSTV), which is typically spread when infected knives are used to cut healthy potatoes, which are then planted. (credit: Pamela Roberts, University of Florida Institute of Food and Agricultural Sciences, USDA ARS)
Career Connection
Career Connection
Virologist Virology is the study of viruses, and a virologist is an individual trained in this discipline. Training in virology can lead to many different career paths. Virologists are actively involved in academic research and teaching in colleges and medical schools. Some virologists treat patients or are involved in the generation and production of vaccines. They might participate in epidemiologic studies (Figure 21.19) or become science writers, to name just a few possible careers.
Figure 21.19 This virologist is engaged in fieldwork, sampling eggs from this nest for avian influenza. (credit: Don Becker, USGS EROS, U.S. Fish and Wildlife Service)
If you think you may be interested in a career in virology, find a mentor in the field. Many large medical centers have departments of virology, and smaller hospitals usually have virology labs within their microbiology departments. Volunteer in a virology lab for a semester or work in one over the summer. Discussing the profession and getting a first-hand look at the work will help you decide whether a career in virology is right for you. The American Society of Virology’s website is a good resource for information regarding training and careers in virology.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.01%3A_Viruses/5.1.05%3A_Other_Acellular_Entities_-_Prions_and_Viroids.txt
|
acellular
lacking cells
acute disease
disease where the symptoms rise and fall within a short period of time
asymptomatic disease
disease where there are no symptoms and the individual is unaware of being infected unless lab tests are performed
attenuation
weakening of a virus during vaccine development
AZT
anti-HIV drug that inhibits the viral enzyme reverse transcriptase
back mutation
when a live virus vaccine reverts back to it disease-causing phenotype
bacteriophage
virus that infects bacteria
budding
method of exit from the cell used in certain animal viruses, where virions leave the cell individually by capturing a piece of the host plasma membrane
capsid
protein coating of the viral core
capsomere
protein subunit that makes up the capsid
cell necrosis
cell death
chronic infection
describes when the virus persists in the body for a long period of time
cytopathic
causing cell damage
envelope
lipid bilayer that encircles some viruses
fusion
method of entry by some enveloped viruses, where the viral envelope fuses with the plasma membrane of the host cell
gall
appearance of a plant tumor
gene therapy
treatment of genetic disease by adding genes, using viruses to carry the new genes inside the cell
group I virus
virus with a dsDNA genome
group II virus
virus with an ssDNA genome
group III virus
virus with a dsRNA genome
group IV virus
virus with an ssRNA genome with positive polarity
group V virus
virus with an ssRNA genome with negative polarity
group VI virus
virus with an ssRNA genome converted into dsDNA by reverse transcriptase
group VII virus
virus with a single-stranded mRNA converted into dsDNA for genome replication
horizontal transmission
transmission of a disease between unrelated individuals
hyperplasia
abnormally high cell growth and division
hypoplasia
abnormally low cell growth and division
intermittent symptom
symptom that occurs periodically
latency
virus that remains in the body for a long period of time but only causes intermittent symptoms
lysis
bursting of a cell
lysogenic cycle
type of virus replication in which the viral genome is incorporated into the genome of the host cell
lytic cycle
type of virus replication in which virions are released through lysis, or bursting, of the cell
matrix protein
envelope protein that stabilizes the envelope and often plays a role in the assembly of progeny virions
negative polarity
ssRNA viruses with genomes complementary to their mRNA
oncogenic virus
virus that has the ability to cause cancer
oncolytic virus
virus engineered to specifically infect and kill cancer cells
pathogen
agent with the ability to cause disease
permissive
cell type that is able to support productive replication of a virus
phage therapy
treatment of bacterial diseases using bacteriophages specific to a particular bacterium
positive polarity
ssRNA virus with a genome that contains the same base sequences and codons found in their mRNA
prion
infectious particle that consists of proteins that replicate without DNA or RNA
productive
viral infection that leads to the production of new virions
prophage
phage DNA that is incorporated into the host cell genome
PrPc
normal prion protein
PrPsc
infectious form of a prion protein
replicative intermediate
dsRNA intermediate made in the process of copying genomic RNA
reverse transcriptase
enzyme found in Baltimore groups VI and VII that converts single-stranded RNA into double-stranded DNA
vaccine
weakened solution of virus components, viruses, or other agents that produce an immune response
vertical transmission
transmission of disease from parent to offspring
viral receptor
glycoprotein used to attach a virus to host cells via molecules on the cell
virion
individual virus particle outside a host cell
viroid
plant pathogen that produces only a single, specific RNA
virus core
contains the virus genome
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.01%3A_Viruses/5.1.06%3A_Key_Terms.txt
|
21.1 Viral Evolution, Morphology, and Classification
Viruses are tiny, noncellular entities that usually can be seen only with an electron microscope. Their genomes contain either DNA or RNA—never both—and they replicate either by using the replication proteins of a host cell or by using proteins encoded in the viral genome. Viruses are diverse, infecting archaea, bacteria, fungi, plants, and animals. Viruses consist of a nucleic acid core surrounded by a protein capsid with or without an outer lipid envelope. The capsid shape, presence of an envelope, and core composition dictate some elements of the classification of viruses. The most commonly used classification method, the Baltimore classification, categorizes viruses based on how they produce their mRNA.
21.2 Virus Infections and Hosts
Plant viruses may be transmitted either vertically from parent reproductive cells or horizontally through damaged plant tissues. Viruses of plants are responsible for significant economic damage in both crop plants and plants used for ornamentation. Animal viruses enter their hosts through several types of virus-host cell interactions and cause a variety of infections. Viral infections can be either acute, with a brief period of infection terminated by host immune responses, or chronic, in which the infection persists. Persistent infections may cause chronic symptoms (hepatitis C), intermittent symptoms (latent viruses such a herpes simplex virus 1), or even be effectively asymptomatic (human herpesviruses 6 and 7). Oncogenic viruses in animals have the ability to cause cancer by interfering with the regulation of the host cell cycle.
21.3 Prevention and Treatment of Viral Infections
Viruses cause a variety of diseases in humans. Many of these diseases can be prevented by the use of viral vaccines, which stimulate protective immunity against the virus without causing major disease. Viral vaccines may also be used in active viral infections, boosting the ability of the immune system to control or destroy the virus. A series of antiviral drugs that target enzymes and other protein products of viral genes have been developed and used with mixed success. Combinations of anti-HIV drugs have been used to effectively control the virus, extending the lifespans of infected individuals. Viruses have many uses in medicines, such as in the treatment of genetic disorders, cancer, and bacterial infections.
21.4 Other Acellular Entities: Prions and Viroids
Prions are infectious agents that consist of protein, but no DNA or RNA, and seem to produce their deadly effects by duplicating their shapes and accumulating in tissues. They are thought to contribute to several progressive brain disorders, including mad cow disease and Creutzfeldt-Jakob disease. Viroids are single-stranded RNA pathogens that infect plants. Their presence can have a severe impact on the agriculture industry.
5.1.08: Visual Connection Questions
1.
Figure 21.5 Which of the following statements about virus structure is true?
1. All viruses are encased in a viral membrane.
2. The capsomere is made up of small protein subunits called capsids.
3. DNA is the genetic material in all viruses.
4. Glycoproteins help the virus attach to the host cell.
2.
Figure 21.8 Influenza virus is packaged in a viral envelope that fuses with the plasma membrane. This way, the virus can exit the host cell without killing it. What advantage does the virus gain by keeping the host cell alive?
3.
Figure 21.10 Which of the following statements is false?
1. In the lytic cycle, new phages are produced and released into the environment.
2. In the lysogenic cycle, phage DNA is incorporated into the host genome.
3. An environmental stressor can cause the phage to initiate the lysogenic cycle.
4. Cell lysis only occurs in the lytic cycle.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.01%3A_Viruses/5.1.07%3A_Chapter_Summary.txt
|
4.
Which statement is true?
1. A virion contains DNA and RNA.
2. Viruses are acellular.
3. Viruses replicate outside of the cell.
4. Most viruses are easily visualized with a light microscope.
5.
The viral ________ play(s) a role in attaching a virion to the host cell.
1. core
2. capsid
3. envelope
4. both b and c
6.
Viruses_______.
1. all have a round shape
2. cannot have a long shape
3. do not maintain any shape
4. vary in shape
7.
The observation that the bacteria genus Chlamydia contains species that can only survive as intracellular parasites supports which viral origin hypothesis?
1. Progressive
2. Regressive
3. Self-replicating
4. Virus-first
8.
A scientist discovers a new virus with a linear, RNA genome surrounded by a helical capsid. The virus is most likely a member of which family based on structure classification?
1. Rabies virus
2. Herpesviruses
3. Retroviruses
4. Influenza viruses
9.
Which statement is not true of viral replication?
1. A lysogenic cycle kills the host cell.
2. There are six basic steps in the viral replication cycle.
3. Viral replication does not affect host cell function.
4. Newly released virions can infect adjacent cells.
10.
Which statement is true of viral replication?
1. In the process of apoptosis, the cell survives.
2. During attachment, the virus attaches at specific sites on the cell surface.
3. The viral capsid helps the host cell produce more copies of the viral genome.
4. mRNA works outside of the host cell to produce enzymes and proteins.
11.
Which statement is true of reverse transcriptase?
1. It is a nucleic acid.
2. It infects cells.
3. It transcribes RNA to make DNA.
4. It is a lipid.
12.
Oncogenic virus cores can be_______.
1. RNA
2. DNA
3. neither RNA nor DNA
4. either RNA or DNA
13.
Which is true of DNA viruses?
1. They use the host cell’s machinery to produce new copies of their genome.
2. They all have envelopes.
3. They are the only kind of viruses that can cause cancer.
4. They are not important plant pathogens.
14.
A bacteriophage can infect ________.
1. the lungs
2. viruses
3. prions
4. bacteria
15.
People with the CCR5Δ32 mutation of a T-cell surface protein can be exposed to some strains of HIV-1 without becoming sick. What step of the virus life cycle is likely to be inhibited with this mutation?
1. Release
2. Reverse transcription
3. Uncoating
4. Attachment
16.
An apple grower notices that several of his apple trees with fungi growing on their trunks have developed necrotic ring spots, while other trees in the orchard that lack fungi appear healthy. What is the most likely conclusion the farmer can make about the virus infecting his apple trees?
1. The apple trees were infected by horizontal transmission.
2. The fungi carry disease.
3. The fungi attract disease-carrying insects.
4. The apple trees were infected by vertical transmission.
17.
Which of the following is NOT used to treat active viral disease?
1. Vaccines
2. Antiviral drugs
3. Antibiotics
4. Phage therapy
18.
Vaccines_______.
1. are similar to viroids
2. are only needed once
3. kill viruses
4. stimulate an immune response
19.
A patient presents at the clinic with an acute viral infection. Assays that analyze the viral life cycle classify the virus into Group V with a segmented genome. Which virus is the most likely diagnosis for the patient?
1. Rabies virus
2. Picornavirus
3. HIV-1
4. Influenza A virus
20.
Which of the following is not associated with prions?
1. Replicating shapes
2. Mad cow disease
3. DNA
4. Toxic proteins
21.
Which statement is true of viroids?
1. They are single-stranded RNA particles.
2. They reproduce only outside of the cell.
3. They produce proteins.
4. They affect both plants and animals.
5.1.10: Critical Thinking Questions
22.
The first electron micrograph of a virus (tobacco mosaic virus) was produced in 1939. Before that time, how did scientists know that viruses existed if they could not see them? (Hint: Early scientists called viruses “filterable agents.”)
23.
Varicella-zoster virus is a double-stranded DNA virus that causes chickenpox. How does its genome structure provide an evolutionary advantage over a single-stranded DNA virus?
24.
Classify the Rabies virus (a rhabdovirus family member) and HIV-1 with both the Baltimore and genomic structure systems. Compare your results. What conclusions can be made about these two different methods?
25.
Why can’t dogs catch the measles?
26.
One of the first and most important targets for drugs to fight infection with HIV (a retrovirus) is the reverse transcriptase enzyme. Why?
27.
In this section, you were introduced to different types of viruses and viral diseases. Briefly discuss the most interesting or surprising thing you learned about viruses.
28.
Although plant viruses cannot infect humans, what are some of the ways in which they affect humans?
29.
A bacteriophage with a lytic life cycle develops a mutation that allows it to now also go through the lysogenic cycle. How would this provide an evolutionary advantage over the other bacteriophages that can only spread through lytic cycles?
30.
Why is immunization after being bitten by a rabid animal so effective and why aren’t people vaccinated for rabies like dogs and cats are?
31.
The vaccine Gardasil that targets human papilloma virus (HPV), the etiological agent of genital warts, was developed after the anti-HPV medication podofilox. Why would doctors still want a vaccine created after anti-viral medications were available?
32.
Prions are responsible for variant Creutzfeldt-Jakob Disease, which has resulted in over 100 human deaths in Great Britain during the last 10 years. How do humans contract this disease?
33.
How are viroids like viruses?
34.
A botanist notices that a tomato plant looks diseased. How could the botanist confirm that the agent causing disease is a viroid, and not a virus?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.01%3A_Viruses/5.1.09%3A_Review_Questions.txt
|
• 5.2.1: Introduction
Based on differences in the structure of cell membranes and in rRNA, Woese and his colleagues proposed that all life on Earth evolved along three lineages, called domains. The domain Bacteria comprises all organisms in the kingdom Bacteria, the domain Archaea comprises the rest of the prokaryotes, and the domain Eukarya comprises all eukaryotes—including organisms in the kingdoms Animalia, Plantae, Fungi, and Protista.
• 5.2.2: Prokaryotic Diversity
Prokaryotes are ubiquitous. They cover every imaginable surface where there is sufficient moisture, and they live on and inside of other living things. In the typical human body, prokaryotic cells outnumber human body cells by about ten to one. They comprise the majority of living things in all ecosystems. Some prokaryotes thrive in environments that are inhospitable for most living things.
• 5.2.3: Structure of Prokaryotes- Bacteria and Archaea
There are many differences between prokaryotic and eukaryotic cells. However, all cells have four common structures: the plasma membrane, which functions as a barrier for the cell and separates the cell from its environment; the cytoplasm, a jelly-like substance inside the cell; nucleic acids, the genetic material of the cell; and ribosomes, where protein synthesis takes place.
• 5.2.4: Prokaryotic Metabolism
Prokaryotes are metabolically diverse organisms. There are many different environments on Earth with various energy and carbon sources, and variable conditions. Prokaryotes have been able to live in every environment by using whatever energy and carbon sources are available. Prokaryotes fill many niches on Earth, including being involved in nutrient cycles such as nitrogen and carbon cycles, decomposing dead organisms, and thriving inside living organisms, including humans.
• 5.2.5: Bacterial Diseases in Humans
Devastating pathogen-borne diseases and plagues, both viral and bacterial in nature, have affected humans since the beginning of human history. The true cause of these diseases was not understood at the time, and some people thought that diseases were a spiritual punishment. Over time, people came to realize that staying apart from afflicted persons, and disposing of the corpses and personal belongings of victims of illness, reduced their own chances of getting sick.
• 5.2.6: Beneficial Prokaryotes
Not all prokaryotes are pathogenic. On the contrary, pathogens represent only a very small percentage of the diversity of the microbial world. In fact, our life would not be possible without prokaryotes. Just think about the role of prokaryotes in biogeochemical cycles.
• 5.2.7: Key Terms
• 5.2.8: Chapter Summary
• 5.2.9: Visual Connection Questions
• 5.2.10: Review Questions
• 5.2.11: Critical Thinking Questions
Thumbnail: Scanning electron micrograph of neutrophil ingesting methicillin-resistant Staphylococcus aureus bacteria. (Public Domain; NIAID/NIH).
5.02: Prokaryotes - Bacteria and Archaea
Figure 22.1 Certain prokaryotes can live in extreme environments such as the Morning Glory pool, a hot spring in Yellowstone National Park. The spring’s vivid blue color is from the prokaryotes that thrive in its very hot waters. (credit: modification of work by Jon Sullivan)
In the recent past, scientists grouped living things into five kingdoms—animals, plants, fungi, protists, and prokaryotes—based on several criteria, such as the absence or presence of a nucleus and other membrane-bound organelles, the absence or presence of cell walls, multicellularity, and so on. In the late 20th century, the pioneering work of Carl Woese and others compared sequences of small-subunit ribosomal RNA (SSU rRNA), which resulted in a more fundamental way to group organisms on Earth. Based on differences in the structure of cell membranes and in rRNA, Woese and his colleagues proposed that all life on Earth evolved along three lineages, called domains. The domain Bacteria comprises all organisms in the kingdom Bacteria, the domain Archaea comprises the rest of the prokaryotes, and the domain Eukarya comprises all eukaryotes—including organisms in the kingdoms Animalia, Plantae, Fungi, and Protista.
Two of the three domains—Bacteria and Archaea—are prokaryotic. Prokaryotes were the first inhabitants on Earth, appearing 3.5 to 3.8 billion years ago. These organisms are abundant and ubiquitous; that is, they are present everywhere. In addition to inhabiting moderate environments, they are found in extreme conditions: from boiling springs to permanently frozen environments in Antarctica; from salty environments like the Dead Sea to environments under tremendous pressure, such as the depths of the ocean; and from areas without oxygen, such as a waste management plant, to radioactively contaminated regions, such as Chernobyl. Prokaryotes reside in the human digestive system and on the skin, are responsible for certain illnesses, and serve an important role in the preparation of many foods.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.02%3A_Prokaryotes_-_Bacteria_and_Archaea/5.2.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the evolutionary history of prokaryotes
• Discuss the distinguishing features of extremophiles
• Explain why it is difficult to culture prokaryotes
Prokaryotes are ubiquitous. They cover every imaginable surface where there is sufficient moisture, and they also live on and inside virtually all other living things. In the typical human body, prokaryotic cells outnumber human body cells by about ten to one. They comprise the majority of living things in all ecosystems. Some prokaryotes thrive in environments that are inhospitable for most living things. Prokaryotes recycle nutrients—essential substances (such as carbon and nitrogen)—and they drive the evolution of new ecosystems, some of which are natural and others man-made. Prokaryotes have been on Earth since long before multicellular life appeared. Indeed, eukaryotic cells are thought to be the descendants of ancient prokaryotic communities.
Prokaryotes, the First Inhabitants of Earth
When and where did cellular life begin? What were the conditions on Earth when life began? We now know that prokaryotes were likely the first forms of cellular life on Earth, and they existed for billions of years before plants and animals appeared. The Earth and its moon are dated at about 4.54 billion years in age. This estimate is based on evidence from radiometric dating of meteorite material together with other substrate material from Earth and the moon. Early Earth had a very different atmosphere (contained less molecular oxygen) than it does today and was subjected to strong solar radiation; thus, the first organisms probably would have flourished where they were more protected, such as in the deep ocean or far beneath the surface of the Earth. Strong volcanic activity was common on Earth at this time, so it is likely that these first organisms—the first prokaryotes—were adapted to very high temperatures. Because early Earth was prone to geological upheaval and volcanic eruption, and was subject to bombardment by mutagenic radiation from the sun, the first organisms were prokaryotes that must have withstood these harsh conditions.
Microbial Mats
Microbial mats or large biofilms may represent the earliest forms of prokaryotic life on Earth; there is fossil evidence of their presence starting about 3.5 billion years ago. It is remarkable that cellular life appeared on Earth only a billion years after the Earth itself formed, suggesting that pre-cellular “life” that could replicate itself had evolved much earlier. A microbial mat is a multi-layered sheet of prokaryotes (Figure 22.2) that includes mostly bacteria, but also archaeans. Microbial mats are only a few centimeters thick, and they typically grow where different types of materials interface, mostly on moist surfaces. The various types of prokaryotes that comprise them carry out different metabolic pathways, and that is the reason for their various colors. Prokaryotes in a microbial mat are held together by a glue-like sticky substance that they secrete called extracellular matrix.
The first microbial mats likely obtained their energy from chemicals found near hydrothermal vents. A hydrothermal vent is a breakage or fissure in the Earth’s surface that releases geothermally heated water. With the evolution of photosynthesis about three billion years ago, some prokaryotes in microbial mats came to use a more widely available energy source—sunlight—whereas others were still dependent on chemicals from hydrothermal vents for energy and food.
Figure 22.2 A microbial mat. (a) This microbial mat, about one meter in diameter, is growing over a hydrothermal vent in the Pacific Ocean in a region known as the “Pacific Ring of Fire.” The mat’s colony of bacteria helps retain microbial nutrients. Chimneys such as the one indicated by the arrow allow gases to escape. (b) In this micrograph, bacteria are visualized using fluorescence microscopy. (credit a: modification of work by Dr. Bob Embley, NOAA PMEL, Chief Scientist; credit b: modification of work by Ricardo Murga, Rodney Donlan, CDC; scale-bar data from Matt Russell)
Stromatolites
Fossilized microbial mats represent the earliest record of life on Earth. A stromatolite is a sedimentary structure formed when minerals are precipitated out of water by prokaryotes in a microbial mat (Figure 22.3). Stromatolites form layered rocks made of carbonate or silicate. Although most stromatolites are artifacts from the past, there are places on Earth where stromatolites are still forming. For example, growing stromatolites have been found in the Anza-Borrego Desert State Park in San Diego County, California.
Figure 22.3 Stromatolites. (a) These living stromatolites are located in Shark Bay, Australia. (b) These fossilized stromatolites, found in Glacier National Park, Montana, are nearly 1.5 billion years old. (credit a: Robert Young; credit b: P. Carrara, NPS)
The Ancient Atmosphere
Evidence indicates that during the first two billion years of Earth’s existence, the atmosphere was anoxic, meaning that there was no molecular oxygen. Therefore, only those organisms that can grow without oxygen—anaerobic organisms—were able to live. Autotrophic organisms that convert solar energy into chemical energy are called phototrophs, and they appeared within one billion years of the formation of Earth. Then, cyanobacteria, also known as “blue-green algae,” evolved from these simple phototrophs at least one billion years later. It was the ancestral cyanobacteria (Figure 22.4) that began the “oxygenation” of the atmosphere: Increased atmospheric oxygen allowed the evolution of more efficient O2-utilizing catabolic pathways. It also opened up the land to increased colonization, because some O2 is converted into O3 (ozone) and ozone effectively absorbs the ultraviolet light that could have otherwise caused lethal mutations in DNA. The current evidence suggests that the increase in O2 concentrations allowed the evolution of other life forms.
Figure 22.4 Cyanobacteria. This hot spring in Yellowstone National Park flows toward the foreground. Cyanobacteria in the spring are green, and as water flows down the gradient, the intensity of the color increases as cell density increases. The water is cooler at the edges of the stream than in the center, causing the edges to appear greener. (credit: Graciela Brelles-Mariño)
Microbes Are Adaptable: Life in Moderate and Extreme Environments
Some organisms have developed strategies that allow them to survive harsh conditions. Almost all prokaryotes have a cell wall, a protective structure that allows them to survive in both hypertonic and hypotonic aqueous conditions. Some soil bacteria are able to form endospores that resist heat and drought, thereby allowing the organism to survive until favorable conditions recur. These adaptations, along with others, allow bacteria to remain the most abundant life form in all terrestrial and aquatic ecosystems.
Prokaryotes thrive in a vast array of environments: Some grow in conditions that would seem very normal to us, whereas others are able to thrive and grow under conditions that would kill a plant or an animal. Bacteria and archaea that are adapted to grow under extreme conditions are called extremophiles, meaning “lovers of extremes.” Extremophiles have been found in all kinds of environments: the depths of the oceans, hot springs, the Arctic and the Antarctic, in very dry places, deep inside Earth, in harsh chemical environments, and in high radiation environments (Figure 22.5), just to mention a few. Because they have specialized adaptations that allow them to live in extreme conditions, many extremophiles cannot survive in moderate environments. There are many different groups of extremophiles: They are identified based on the conditions in which they grow best, and several habitats are extreme in multiple ways. For example, a soda lake is both salty and alkaline, so organisms that live in a soda lake must be both alkaliphiles and halophiles (Table 22.1). Other extremophiles, like radioresistant organisms, do not prefer an extreme environment (in this case, one with high levels of radiation), but have adapted to survive in it (Figure 22.5). Organisms like these give us a better understanding of prokaryotic diversity and open up the possibility of finding new prokaryotic species that may lead to the discovery of new therapeutic drugs or have industrial applications.
Extremophiles and Their Preferred Conditions
Extremophile Conditions for Optimal Growth
Acidophiles pH 3 or below
Alkaliphiles pH 9 or above
Thermophiles Temperature 60–80 °C (140–176 °F)
Hyperthermophiles Temperature 80–122 °C (176–250 °F)
Psychrophiles Temperature of -15-10 °C (5-50 °F) or lower
Halophiles Salt concentration of at least 0.2 M
Osmophiles High sugar concentration
Table 22.1
Figure 22.5 Radiation-tolerant prokaryotes. Deinococcus radiodurans, visualized in this false color transmission electron micrograph, is a prokaryote that can tolerate very high doses of ionizing radiation. It has developed DNA repair mechanisms that allow it to reconstruct its chromosome even if it has been broken into hundreds of pieces by radiation or heat. (credit: modification of work by Michael Daly; scale-bar data from Matt Russell)
Prokaryotes in the Dead Sea
One example of a very harsh environment is the Dead Sea, a hypersaline basin that is located between Jordan and Israel. Hypersaline environments are essentially concentrated seawater. In the Dead Sea, the sodium concentration is 10 times higher than that of seawater, and the water contains high levels of magnesium (about 40 times higher than in seawater) that would be toxic to most living things. Iron, calcium, and magnesium, elements that form divalent ions (Fe2+, Ca2+, and Mg2+), produce what is commonly referred to as “hard” water. Taken together, the high concentration of divalent cations, the acidic pH (6.0), and the intense solar radiation flux make the Dead Sea a unique, and uniquely hostile, ecosystem1 (Figure 22.6).
What sort of prokaryotes do we find in the Dead Sea? The extremely salt-tolerant bacterial mats include Halobacterium, Haloferax volcanii (which is found in other locations, not only the Dead Sea), Halorubrum sodomense, and Halobaculum gomorrense, and the archaean Haloarcula marismortui, among others.
Figure 22.6 Halophilic prokaryotes. (a) The Dead Sea is hypersaline. Nevertheless, salt-tolerant bacteria thrive in this sea. (b) These halobacteria cells can form salt-tolerant bacterial mats. (credit a: Julien Menichini; credit b: NASA; scale-bar data from Matt Russell)
Unculturable Prokaryotes and the Viable-but-Non-Culturable State
The process of culturing bacteria is complex and is one of the greatest discoveries of modern science. German physician Robert Koch is credited with discovering the techniques for pure culture, including staining and using growth media. Microbiologists typically grow prokaryotes in the laboratory using an appropriate culture medium containing all the nutrients needed by the target organism. The medium can be liquid, broth, or solid. After an incubation time at the right temperature, there should be evidence of microbial growth (Figure 22.7). Koch's assistant Julius Petri invented the Petri dish, whose use persists in today’s laboratories. Koch worked primarily with the Mycobacterium tuberculosis bacterium that causes tuberculosis and developed guidelines, called Koch's postulates, to identify the organisms responsible for specific diseases. Koch's postulates continue to be widely used in the medical community. Koch’s postulates include that an organism can be identified as the cause of disease when it is present in all infected samples and absent in all healthy samples, and it is able to reproduce the infection after being cultured multiple times. Today, cultures remain a primary diagnostic tool in medicine and other areas of molecular biology.
Figure 22.7 Bacteria growing on blood agar plates. In these agar plates, the growth medium is supplemented with red blood cells. Blood agar becomes transparent in the presence of hemolytic Streptococcus, which destroys red blood cells and is used to diagnose Streptococcus infections. The plate on the left is inoculated with non-hemolytic Staphylococcus (large white colonies), and the plate on the right is inoculated with hemolytic Streptococcus (tiny clear colonies). If you look closely at the right plate, you can see that the agar surrounding the bacteria has turned clear. (credit: Bill Branson, NCI)
Koch's postulates can be fully applied only to organisms that can be isolated and cultured. Some prokaryotes, however, cannot grow in a laboratory setting. In fact, over 99 percent of bacteria and archaea are unculturable. For the most part, this is due to a lack of knowledge as to what to feed these organisms and how to grow them; they may have special requirements for growth that remain unknown to scientists, such as needing specific micronutrients, pH, temperature, pressure, co-factors, or co-metabolites. Some bacteria cannot be cultured because they are obligate intracellular parasites and cannot be grown outside a host cell.
In other cases, culturable organisms become unculturable under stressful conditions, even though the same organism could be cultured previously. Those organisms that cannot be cultured but are not dead are in a viable-but-non-culturable (VBNC) state. The VBNC state occurs when prokaryotes respond to environmental stressors by entering a dormant state that allows their survival. The criteria for entering into the VBNC state are not completely understood. In a process called resuscitation, the prokaryote can go back to “normal” life when environmental conditions improve.
Is the VBNC state an unusual way of living for prokaryotes? In fact, most of the prokaryotes living in the soil or in oceanic waters are non-culturable. It has been said that only a small fraction, perhaps one percent, of prokaryotes can be cultured under laboratory conditions. If these organisms are non-culturable, then how is it known whether they are present and alive? Microbiologists use molecular techniques, such as the polymerase chain reaction (PCR), to amplify selected portions of DNA of prokaryotes, e.g., 16S rRNA genes, demonstrating their existence. (Recall that PCR can make billions of copies of a DNA segment in a process called amplification.)
The Ecology of Biofilms
Some prokaryotes may be unculturable because they require the presence of other prokaryotic species. Until a couple of decades ago, microbiologists used to think of prokaryotes as isolated entities living apart. This model, however, does not reflect the true ecology of prokaryotes, most of which prefer to live in communities where they can interact. As we have seen, a biofilm is a microbial community (Figure 22.8) held together in a gummy-textured matrix that consists primarily of polysaccharides secreted by the organisms, together with some proteins and nucleic acids. Biofilms typically grow attached to surfaces. Some of the best-studied biofilms are composed of prokaryotes, although fungal biofilms have also been described, as well as some composed of a mixture of fungi and bacteria.
Biofilms are present almost everywhere: they can cause the clogging of pipes and readily colonize surfaces in industrial settings. In recent, large-scale outbreaks of bacterial contamination of food, biofilms have played a major role. They also colonize household surfaces, such as kitchen counters, cutting boards, sinks, and toilets, as well as places on the human body, such as the surfaces of our teeth.
Interactions among the organisms that populate a biofilm, together with their protective exopolysaccharidic (EPS) environment, make these communities more robust than free-living, or planktonic, prokaryotes. The sticky substance that holds bacteria together also excludes most antibiotics and disinfectants, making biofilm bacteria hardier than their planktonic counterparts. Overall, biofilms are very difficult to destroy because they are resistant to many common forms of sterilization.
Visual Connection
Visual Connection
Figure 22.8 Development of a biofilm. Five stages of biofilm development are shown. During stage 1, initial attachment, bacteria adhere to a solid surface via weak van der Waals interactions (forces produced by induced electrical interactions between atoms). During stage 2, irreversible attachment, hairlike appendages called pili permanently anchor the bacteria to the surface. During stage 3, maturation I, the biofilm grows through cell division and recruitment of other bacteria. An extracellular matrix composed primarily of polysaccharides holds the biofilm together. During stage 4, maturation II, the biofilm continues to grow and takes on a more complex shape. During stage 5, dispersal, the biofilm matrix is partly broken down, allowing some bacteria to escape and colonize another surface. Micrographs of a Pseudomonas aeruginosa biofilm in each of the stages of development are shown. (credit: D. Davis, Don Monroe, PLoS)
Compared to free-floating bacteria, bacteria in biofilms often show increased resistance to antibiotics and detergents. Why do you think this might be the case?
Footnotes
• 1Bodaker, I, Itai, S, Suzuki, MT, Feingersch, R, Rosenberg, M, Maguire, ME, Shimshon, B, and others. Comparative community genomics in the Dead Sea: An increasingly extreme environment. The ISME Journal 4 (2010): 399–407, doi:10.1038/ismej.2009.141. published online 24 December 2009.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.02%3A_Prokaryotes_-_Bacteria_and_Archaea/5.2.02%3A_Prokaryotic_Diversity.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the basic structure of a typical prokaryote
• Describe important differences in structure between Archaea and Bacteria
There are many differences between prokaryotic and eukaryotic cells. The name "prokaryote" suggests that prokaryotes are defined by exclusion—they are not eukaryotes, or organisms whose cells contain a nucleus and other internal membrane-bound organelles. However, all cells have four common structures: the plasma membrane, which functions as a barrier for the cell and separates the cell from its environment; the cytoplasm, a complex solution of organic molecules and salts inside the cell; a double-stranded DNA genome, the informational archive of the cell; and ribosomes, where protein synthesis takes place. Prokaryotes come in various shapes, but many fall into three categories: cocci (spherical), bacilli (rod-shaped), and spirilli (spiral-shaped) (Figure 22.9).
Figure 22.9 Common prokaryotic cell types. Prokaryotes fall into three basic categories based on their shape, visualized here using scanning electron microscopy: (a) cocci, or spherical (a pair is shown); (b) bacilli, or rod-shaped; and (c) spirilli, or spiral-shaped. (credit a: modification of work by Janice Haney Carr, Dr. Richard Facklam, CDC; credit c: modification of work by Dr. David Cox; scale-bar data from Matt Russell)
The Prokaryotic Cell
Recall that prokaryotes are unicellular organisms that lack membrane-bound organelles or other internal membrane-bound structures (Figure 22.10). Their chromosome—usually single—consists of a piece of circular, double-stranded DNA located in an area of the cell called the nucleoid. Most prokaryotes have a cell wall outside the plasma membrane. The cell wall functions as a protective layer, and it is responsible for the organism’s shape. Some bacterial species have a capsule outside the cell wall. The capsule enables the organism to attach to surfaces, protects it from dehydration and attack by phagocytic cells, and makes pathogens more resistant to our immune responses. Some species also have flagella (singular, flagellum) used for locomotion, and pili (singular, pilus) used for attachment to surfaces including the surfaces of other cells. Plasmids, which consist of extra-chromosomal DNA, are also present in many species of bacteria and archaea.
Figure 22.10 The features of a typical prokaryotic cell. Flagella, capsules, and pili are not found in all prokaryotes.
Recall that prokaryotes are divided into two different domains, Bacteria and Archaea, which together with Eukarya, comprise the three domains of life (Figure 22.11).
Figure 22.11 The three domains of living organisms. Bacteria and Archaea are both prokaryotes but differ enough to be placed in separate domains. An ancestor of modern Archaea is believed to have given rise to Eukarya, the third domain of life. Major groups of Archaea and Bacteria are shown.
Characteristics of bacterial phyla are described in Figure 22.12 and Figure 22.13. Major bacterial phyla include the Proteobacteria, the Chlamydias, the Spirochaetes, the photosynthetic Cyanobacteria, and the Gram-positive bacteria. The Proteobacteria are in turn subdivided into several classes, from the Alpha- to the Epsilon proteobacteria. Eukaryotic mitochondria are thought to be the descendants of alphaproteobacteria, while eukaryotic chloroplasts are derived from cyanobacteria. Archaeal phyla are described in Figure 22.14.
Figure 22.12 The Proteobacteria. Phylum Proteobacteria is one of up to 52 bacteria phyla. Proteobacteria is further subdivided into five classes, Alpha through Epsilon. (credit “Rickettsia rickettsia”: modification of work by CDC; credit “Spirillum minus”: modification of work by Wolframm Adlassnig; credit “Vibrio cholera”: modification of work by Janice Haney Carr, CDC; credit “Desulfovibrio vulgaris”: modification of work by Graham Bradley; credit “Campylobacter”: modification of work by De Wood, Pooley, USDA, ARS, EMU; scale-bar data from Matt Russell)
Figure 22.13 Other bacterial phyla. Chlamydia, Spirochetes, Cyanobacteria, and Gram-positive bacteria are described in this table. Note that bacterial shape is not phylum-dependent; bacteria within a phylum may be cocci, rod-shaped, or spiral. (credit “Chlamydia trachomatis”: modification of work by Dr. Lance Liotta Laboratory, NCI; credit “Treponema pallidum”: modification of work by Dr. David Cox, CDC; credit “Phormidium”: modification of work by USGS; credit “Clostridium difficile”: modification of work by Lois S. Wiggs, CDC; scale-bar data from Matt Russell)
Figure 22.14 Archaeal phyla. Archaea are separated into four phyla: the Korarchaeota, Euryarchaeota, Crenarchaeota, and Nanoarchaeota. (credit “Halobacterium”: modification of work by NASA; credit “Nanoarchaeotum equitans”: modification of work by Karl O. Stetter; credit “Korarchaeota”: modification of work by Office of Science of the U.S. Dept. of Energy; scale-bar data from Matt Russell)
The Plasma Membrane of Prokaryotes
The prokaryotic plasma membrane is a thin lipid bilayer (6 to 8 nanometers) that completely surrounds the cell and separates the inside from the outside. Its selectively permeable nature keeps ions, proteins, and other molecules within the cell and prevents them from diffusing into the extracellular environment, while other molecules may move through the membrane. Recall that the general structure of a cell membrane is a phospholipid bilayer composed of two layers of lipid molecules. In archaeal cell membranes, isoprene (phytanyl) chains linked to glycerol replace the fatty acids linked to glycerol in bacterial membranes. Some archaeal membranes are lipid monolayers instead of bilayers (Figure 22.15).
Figure 22.15 Bacterial and archaeal phospholipids. Archaeal phospholipids differ from those found in Bacteria and Eukarya in two ways. First, they have branched phytanyl sidechains instead of linear ones. Second, an ether bond instead of an ester bond connects the lipid to the glycerol.
The Cell Wall of Prokaryotes
The cytoplasm of prokaryotic cells has a high concentration of dissolved solutes. Therefore, the osmotic pressure within the cell is relatively high. The cell wall is a protective layer that surrounds some cells and gives them shape and rigidity. It is located outside the cell membrane and prevents osmotic lysis (bursting due to increasing volume). The chemical composition of the cell wall varies between Archaea and Bacteria, and also varies between bacterial species.
Bacterial cell walls contain peptidoglycan, composed of polysaccharide chains that are cross-linked by unusual peptides containing both L- and D-amino acids including D-glutamic acid and D-alanine. (Proteins normally have only L-amino acids; as a consequence, many of our antibiotics work by mimicking D-amino acids and therefore have specific effects on bacterial cell-wall development.) There are more than 100 different forms of peptidoglycan. S-layer (surface layer) proteins are also present on the outside of cell walls of both Archaea and Bacteria.
Bacteria are divided into two major groups: Gram positive and Gram negative, based on their reaction to Gram staining. Note that all Gram-positive bacteria belong to one phylum; bacteria in the other phyla (Proteobacteria, Chlamydias, Spirochetes, Cyanobacteria, and others) are Gram-negative. The Gram staining method is named after its inventor, Danish scientist Hans Christian Gram (1853–1938). The different bacterial responses to the staining procedure are ultimately due to cell wall structure. Gram-positive organisms typically lack the outer membrane found in Gram-negative organisms (Figure 22.16). Up to 90 percent of the cell-wall in Gram-positive bacteria is composed of peptidoglycan, and most of the rest is composed of acidic substances called teichoic acids. Teichoic acids may be covalently linked to lipids in the plasma membrane to form lipoteichoic acids. Lipoteichoic acids anchor the cell wall to the cell membrane. Gram-negative bacteria have a relatively thin cell wall composed of a few layers of peptidoglycan (only 10 percent of the total cell wall), surrounded by an outer envelope containing lipopolysaccharides (LPS) and lipoproteins. This outer envelope is sometimes referred to as a second lipid bilayer. The chemistry of this outer envelope is very different, however, from that of the typical lipid bilayer that forms plasma membranes.
Visual Connection
Visual Connection
Figure 22.16 Cell walls in Gram-positive and Gram-negative bacteria. Bacteria are divided into two major groups: Gram positive and Gram negative. Both groups have a cell wall composed of peptidoglycan: in Gram-positive bacteria, the wall is thick, whereas in Gram-negative bacteria, the wall is thin. In Gram-negative bacteria, the cell wall is surrounded by an outer membrane that contains lipopolysaccharides and lipoproteins. Porins are proteins in this cell membrane that allow substances to pass through the outer membrane of Gram-negative bacteria. In Gram-positive bacteria, lipoteichoic acid anchors the cell wall to the cell membrane. (credit: modification of work by "Franciscosp2"/Wikimedia Commons)
Which of the following statements is true?
1. Gram-positive bacteria have a single cell wall anchored to the cell membrane by lipoteichoic acid.
2. Porins allow entry of substances into both Gram-positive and Gram-negative bacteria.
3. The cell wall of Gram-negative bacteria is thick, and the cell wall of Gram-positive bacteria is thin.
4. Gram-negative bacteria have a cell wall made of peptidoglycan, whereas Gram-positive bacteria have a cell wall made of lipoteichoic acid.
Archaean cell walls do not have peptidoglycan. There are four different types of archaean cell walls. One type is composed of pseudopeptidoglycan, which is similar to peptidoglycan in morphology but contains different sugars in the polysaccharide chain. The other three types of cell walls are composed of polysaccharides, glycoproteins, or pure protein. Other differences between Bacteria and Archaea are seen in Table 22.2. Note that features related to DNA replication, transcription and translation in Archaea are similar to those seen in eukaryotes.
Differences and Similarities between Bacteria and Archaea
Structural Characteristic Bacteria Archaea
Cell type Prokaryotic Prokaryotic
Cell morphology Variable Variable
Cell wall Contains peptidoglycan Does not contain peptidoglycan
Cell membrane type Lipid bilayer Lipid bilayer or lipid monolayer
Plasma membrane lipids Fatty acids-glycerol ester Phytanyl-glycerol ethers
Chromosome Typically circular Typically circular
Replication origins Single Multiple
RNA polymerase Single Multiple
Initiator tRNA Formyl-methionine Methionine
Streptomycin inhibition Sensitive Resistant
Calvin cycle Yes No
Table 22.2
Reproduction
Reproduction in prokaryotes is asexual and usually takes place by binary fission. (Recall that the DNA of a prokaryote is a single, circular chromosome.) Prokaryotes do not undergo mitosis; instead, the chromosome is replicated and the two resulting copies separate from one another, due to the growth of the cell. The prokaryote, now enlarged, is pinched inward at its equator and the two resulting cells, which are clones, separate. Binary fission does not provide an opportunity for genetic recombination or genetic diversity, but prokaryotes can share genes by three other mechanisms.
In transformation, the prokaryote takes in DNA shed by other prokaryotes into its environment. If a nonpathogenic bacterium takes up DNA for a toxin gene from a pathogen and incorporates the new DNA into its own chromosome, it too may become pathogenic. In transduction, bacteriophages, the viruses that infect bacteria, may move short pieces of chromosomal DNA from one bacterium to another. Transduction results in a recombinant organism. Archaea also have viruses that may translocate genetic material from one individual to another. In conjugation, DNA is transferred from one prokaryote to another by means of a pilus, which brings the organisms into contact with one another, and provides a channel for transfer of DNA. The DNA transferred can be in the form of a plasmid or as a composite molecule, containing both plasmid and chromosomal DNA. These three processes of DNA exchange are shown in Figure 22.17.
Reproduction can be very rapid: a few minutes for some species. This short generation time coupled with mechanisms of genetic recombination and high rates of mutation result in the rapid evolution of prokaryotes, allowing them to respond to environmental changes (such as the introduction of an antibiotic) very quickly.
Figure 22.17 Gene transfer mechanisms in prokaryotes. There are three mechanisms by which prokaryotes can exchange DNA. In (a) transformation, the cell takes up prokaryotic DNA directly from the environment. The DNA may remain separate as plasmid DNA or be incorporated into the host genome. In (b) transduction, a bacteriophage injects DNA into the cell that contains a small fragment of DNA from a different prokaryote. In (c) conjugation, DNA is transferred from one cell to another via a mating bridge, or pilus, that connects the two cells after the sex pilus draws the two bacteria close enough to form the bridge.
Evolution Connection
Evolution Connection
The Evolution of ProkaryotesHow do scientists answer questions about the evolution of prokaryotes? Unlike with animals, artifacts in the fossil record of prokaryotes offer very little information. Fossils of ancient prokaryotes look like tiny bubbles in rock. Some scientists turn to genetics and to the principle of the molecular clock, which holds that the more recently two species have diverged, the more similar their genes (and thus proteins) will be. Conversely, species that diverged long ago will have more genes that are dissimilar.
Scientists at the NASA Astrobiology Institute and at the European Molecular Biology Laboratory collaborated to analyze the molecular evolution of 32 specific proteins common to 72 species of prokaryotes.2 The model they derived from their data indicates that three important groups of bacteria—Actinobacteria, Deinococcus, and Cyanobacteria (collectively called Terrabacteria by the authors)—were the first to colonize land. Actinobacteria are a group of very common Gram-positive bacteria that produce branched structures like fungal mycelia, and include species important in decomposition of organic wastes. You will recall that Deinococcus is a genus of bacterium that is highly resistant to ionizing radiation. It has a thick peptidoglycan layer in addition to a second external membrane, so it has features of both Gram-positive and Gram-negative bacteria.
Cyanobacteria are photosynthesizers, and were probably responsible for the production of oxygen on the ancient earth. The timelines of divergence suggest that bacteria (members of the domain Bacteria) diverged from common ancestral species between 2.5 and 3.2 billion years ago, whereas the Archaea diverged earlier: between 3.1 and 4.1 billion years ago. Eukarya later diverged from the archaean line. The work further suggests that stromatolites that formed prior to the advent of cyanobacteria (about 2.6 billion years ago) photosynthesized in an anoxic environment and that because of the modifications of the Terrabacteria for land (resistance to drying and the possession of compounds that protect the organism from excess light), photosynthesis using oxygen may be closely linked to adaptations to survive on land.
Footnotes
• 2Battistuzzi, FU, Feijao, A, and Hedges, SB. A genomic timescale of prokaryote evolution: Insights into the origin of methanogenesis, phototrophy, and the colonization of land. BioMed Central: Evolutionary Biology 4 (2004): 44, doi:10.1186/1471-2148-4-44.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.02%3A_Prokaryotes_-_Bacteria_and_Archaea/5.2.03%3A_Structure_of_Prokaryotes-_Bacteria_and_Archaea.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Identify the macronutrients needed by prokaryotes, and explain their importance
• Describe the ways in which prokaryotes get energy and carbon for life processes
• Describe the roles of prokaryotes in the carbon and nitrogen cycles
Prokaryotes are metabolically diverse organisms. In many cases, a prokaryote may be placed into a species clade by its defining metabolic features: Can it metabolize lactose? Can it grow on citrate? Does it produce H2S? Does it ferment carbohydrates to produce acid and gas? Can it grow under anaerobic conditions? Since metabolism and metabolites are the product of enzyme pathways, and enzymes are encoded in genes, the metabolic capabilities of a prokaryote are a reflection of its genome. There are many different environments on Earth with various energy and carbon sources, and variable conditions to which prokaryotes may be able to adapt. Prokaryotes have been able to live in every environment from deep-water volcanic vents to Antarctic ice by using whatever energy and carbon sources are available. Prokaryotes fill many niches on Earth, including involvement in nitrogen and carbon cycles, photosynthetic production of oxygen, decomposition of dead organisms, and thriving as parasitic, commensal, or mutualistic organisms inside multicellular organisms, including humans. The very broad range of environments that prokaryotes occupy is possible because they have diverse metabolic processes.
Needs of Prokaryotes
The diverse environments and ecosystems on Earth have a wide range of conditions in terms of temperature, available nutrients, acidity, salinity, oxygen availability, and energy sources. Prokaryotes are very well equipped to make their living out of a vast array of nutrients and environmental conditions. To live, prokaryotes need a source of energy, a source of carbon, and some additional nutrients.
Macronutrients
Cells are essentially a well-organized assemblage of macromolecules and water. Recall that macromolecules are produced by the polymerization of smaller units called monomers. For cells to build all of the molecules required to sustain life, they need certain substances, collectively called nutrients. When prokaryotes grow in nature, they must obtain their nutrients from the environment. Nutrients that are required in large amounts are called macronutrients, whereas those required in smaller or trace amounts are called micronutrients. Just a handful of elements are considered macronutrients—carbon, hydrogen, oxygen, nitrogen, phosphorus, and sulfur. (A mnemonic for remembering these elements is the acronym CHONPS.)
Why are these macronutrients needed in large amounts? They are the components of organic compounds in cells, including water. Carbon is the major element in all macromolecules: carbohydrates, proteins, nucleic acids, lipids, and many other compounds. Carbon accounts for about 50 percent of the composition of the cell. In contrast, nitrogen represents only 12 percent of the total dry weight of a typical cell. Nitrogen is a component of proteins, nucleic acids, and other cell constituents. Most of the nitrogen available in nature is either atmospheric nitrogen (N2) or another inorganic form. Diatomic (N2) nitrogen, however, can be converted into an organic form only by certain microorganisms, called nitrogen-fixing organisms. Both hydrogen and oxygen are part of many organic compounds and of water. Phosphorus is required by all organisms for the synthesis of nucleotides and phospholipids. Sulfur is part of the structure of some amino acids such as cysteine and methionine, and is also present in several vitamins and coenzymes. Other important macronutrients are potassium (K), magnesium (Mg), calcium (Ca), and sodium (Na). Although these elements are required in smaller amounts, they are very important for the structure and function of the prokaryotic cell.
Micronutrients
In addition to these macronutrients, prokaryotes require various metallic elements in small amounts. These are referred to as micronutrients or trace elements. For example, iron is necessary for the function of the cytochromes involved in electron-transport reactions. Some prokaryotes require other elements—such as boron (B), chromium (Cr), and manganese (Mn)—primarily as enzyme cofactors.
The Ways in Which Prokaryotes Obtain Energy
Prokaryotes are classified both by the way they obtain energy, and by the carbon source they use for producing organic molecules. These categories are summarized in Table 22.3. Prokaryotes can use different sources of energy to generate the ATP needed for biosynthesis and other cellular activities. Phototrophs (or phototrophic organisms) obtain their energy from sunlight. Phototrophs trap the energy of light using chlorophylls, or in a few cases, bacterial rhodopsin. (Rhodopsin-using phototrophs, oddly, are phototrophic, but not photosynthetic, since they do not fix carbon.) Chemotrophs (or chemosynthetic organisms) obtain their energy from chemical compounds. Chemotrophs that can use organic compounds as energy sources are called chemoorganotrophs. Those that can use inorganic compounds, like sulfur or iron compounds, as energy sources are called chemolithotrophs.
Energy-producing pathways may be either aerobic, using oxygen as the terminal electron acceptor, or anaerobic, using either simple inorganic compounds or organic molecules as the terminal electron acceptor. Since prokaryotes lived on Earth for nearly a billion years before photosynthesis produced significant amounts of oxygen for aerobic respiration, many species of both Bacteria and Archaea are anaerobic and their metabolic activities are important in the carbon and nitrogen cycles discussed below.
The Ways in Which Prokaryotes Obtain Carbon
Prokaryotes not only can use different sources of energy, but also different sources of carbon compounds. Autotrophic prokaryotes synthesize organic molecules from carbon dioxide. In contrast, heterotrophic prokaryotes obtain carbon from organic compounds. To make the picture more complex, the terms that describe how prokaryotes obtain energy and carbon can be combined. Thus, photoautotrophs use energy from sunlight, and carbon from carbon dioxide and water, whereas chemoheterotrophs obtain both energy and carbon from an organic chemical source. Chemolithoautotrophs obtain their energy from inorganic compounds, and they build their complex molecules from carbon dioxide. Finally, prokaryotes that get their energy from light, but their carbon from organic compounds, are photoheterotrophs. The table below (Table 22.3) summarizes carbon and energy sources in prokaryotes.
Carbon and Energy Sources in Prokaryotes
Energy Source Electron Source Carbon Source Nutritional Type
Light
(phototroph)
Organic material
(organotroph)
Organic material
(heterotroph)
Photoorganoheterotroph
Carbon dioxide
(autotroph)
Inorganic material
(lithotroph)
Organic material
(heterotroph)
Carbon dioxide
(autotroph)
Photolithoautotroph
Chemicals
(chemotroph)
Organic material
(organotroph)
Organic material
(heterotroph)
Chemoorganoheterotroph
Carbon dioxide
(autotroph)
Inorganic material
(lithotroph)
Organic material
(heterotroph)
Chemolithoheterotroph
Carbon dioxide
(autotroph)
Chemolithoautotroph
Table 22.3
Role of Prokaryotes in Ecosystems
Prokaryotes are ubiquitous: There is no niche or ecosystem in which they are not present. Prokaryotes play many roles in the environments they occupy. The roles they play in the carbon and nitrogen cycles are vital to life on Earth. In addition, the current scientific consensus suggests that metabolically interactive prokaryotic communities may have been the basis for the emergence of eukaryotic cells.
Prokaryotes and the Carbon Cycle
Carbon is one of the most important macronutrients, and prokaryotes play an important role in the carbon cycle (Figure 22.18). The carbon cycle traces the movement of carbon from inorganic to organic compounds and back again. Carbon is cycled through Earth’s major reservoirs: land, the atmosphere, aquatic environments, sediments and rocks, and biomass. In a way, the carbon cycle echoes the role of the “four elements” first proposed by the ancient Greek philosopher, Empedocles: fire, water, earth, and air. Carbon dioxide is removed from the atmosphere by land plants and marine prokaryotes, and is returned to the atmosphere via the respiration of chemoorganotrophic organisms, including prokaryotes, fungi, and animals. Although the largest carbon reservoir in terrestrial ecosystems is in rocks and sediments, that carbon is not readily available.
Participants in the carbon cycle are roughly divided among producers, consumers, and decomposers of organic carbon compounds. The primary producers of organic carbon compounds from CO2 are land plants and photosynthetic bacteria. A large amount of available carbon is found in living land plants. A related source of carbon compounds is humus, which is a mixture of organic materials from dead plants and prokaryotes that have resisted decomposition. (The term "humus," by the way, is the root of the word "human.") Consumers such as animals and other heterotrophs use organic compounds generated by producers and release carbon dioxide to the atmosphere. Other bacteria and fungi, collectively called decomposers, carry out the breakdown (decomposition) of plants and animals and their organic compounds. Most carbon dioxide in the atmosphere is derived from the respiration of microorganisms that decompose dead animals, plants, and humus.
In aqueous environments and their anoxic sediments, there is another carbon cycle taking place. In this case, the cycle is based on one-carbon compounds. In anoxic sediments, prokaryotes, mostly archaea, produce methane (CH4). This methane moves into the zone above the sediment, which is richer in oxygen and supports bacteria called methane oxidizers that oxidize methane to carbon dioxide, which then returns to the atmosphere.
Figure 22.18 The carbon cycle. Prokaryotes play a significant role in continuously moving carbon through the biosphere. (credit: modification of work by John M. Evans and Howard Perlman, USGS)
Prokaryotes and the Nitrogen Cycle
Nitrogen is a very important element for life because it is a major constituent of proteins and nucleic acids. It is a macronutrient, and in nature, it is recycled from organic compounds to ammonia, ammonium ions, nitrate, nitrite, and nitrogen gas by many processes, many of which are carried out only by prokaryotes. As illustrated in Figure 22.19, prokaryotes are key to the nitrogen cycle. The largest pool of nitrogen available in the terrestrial ecosystem is gaseous nitrogen (N2) from the air, but this nitrogen is not usable by plants, which are primary producers. Gaseous nitrogen is transformed, or “fixed” into more readily available forms, such as ammonia (NH3), through the process of nitrogen fixation. Nitrogen-fixing bacteria include Azotobacter in soil and the ubiquitous photosynthetic cyanobacteria. Some nitrogen fixing bacteria, like Rhizobium, live in symbiotic relationships in the roots of legumes. Another source of ammonia is ammonification, the process by which ammonia is released during the decomposition of nitrogen-containing organic compounds. The ammonium ion is progressively oxidized by different species of bacteria in a process called nitrification. The nitrification process begins with the conversion of ammonium to nitrite (NO2-), and continues with the conversion of nitrite to nitrate. Nitrification in soils is carried out by bacteria belonging to the genera Nitrosomas, Nitrobacter, and Nitrospira. Most nitrogen in soil is in the form of ammonium (NH4+) or nitrate (NO3-). Ammonia and nitrate can be used by plants or converted to other forms.
Ammonia released into the atmosphere, however, represents only 15 percent of the total nitrogen released; the rest is as N2 and N2O (nitrous oxide). Ammonia is catabolized anaerobically by some prokaryotes, yielding N2 as the final product. Denitrifying bacteria reverse the process of nitrification, reducing the nitrate from soils to gaseous compounds such as N2O, NO, and N2.
Visual Connection
Visual Connection
Figure 22.19 The nitrogen cycle. Prokaryotes play a key role in the nitrogen cycle. (credit: Environmental Protection Agency)
Which of the following statements about the nitrogen cycle is false?
1. Nitrogen-fixing bacteria exist on the root nodules of legumes and in the soil.
2. Denitrifying bacteria convert nitrates (NO3-) into nitrogen gas (N2).
3. Ammonification is the process by which ammonium ion (NH4+) is released from decomposing organic compounds.
4. Nitrification is the process by which nitrites (NO2-) are converted to ammonium ion (NH4+).
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.02%3A_Prokaryotes_-_Bacteria_and_Archaea/5.2.04%3A_Prokaryotic_Metabolism.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Identify bacterial diseases that caused historically important plagues and epidemics
• Describe the link between biofilms and foodborne diseases
• Explain how overuse of antibiotics may be creating “super bugs”
• Explain the importance of MRSA with respect to the problems of antibiotic resistance
To a prokaryote, humans may be just another housing opportunity. Unfortunately, the tenancy of some species can have harmful effects and cause disease. Bacteria or other infectious agents that cause harm to their human hosts are called pathogens. Devastating pathogen-borne diseases and plagues, both viral and bacterial in nature, have affected humans and their ancestors for millions of years. The true cause of these diseases was not understood until modern scientific thought developed, and many people thought that diseases were a “spiritual punishment.” Only within the past several centuries have people understood that staying away from afflicted persons, disposing of the corpses and personal belongings of victims of illness, and sanitation practices reduced their own chances of getting sick.
Epidemiologists study how diseases are transmitted and how they affect a population. Often, they must following the course of an epidemic—a disease that occurs in an unusually high number of individuals in a population at the same time. In contrast, a pandemic is a widespread, and usually worldwide, epidemic. An endemic disease is a disease that is always present, usually at low incidence, in a population.
Long History of Bacterial Disease
There are records about infectious diseases as far back as 3000 B.C. A number of significant pandemics caused by bacteria have been documented over several hundred years. Some of the most memorable pandemics led to the decline of cities and entire nations.
In the 21st century, infectious diseases remain among the leading causes of death worldwide, despite advances made in medical research and treatments in recent decades. A disease spreads when the pathogen that causes it is passed from one person to another. For a pathogen to cause disease, it must be able to reproduce in the host’s body and damage the host in some way.
The Plague of Athens
In 430 B.C., the Plague of Athens killed one-quarter of the Athenian troops who were fighting in the great Peloponnesian War and weakened Athens’s dominance and power. The plague impacted people living in overcrowded Athens as well as troops aboard ships that had to return to Athens. The source of the plague may have been identified recently when researchers from the University of Athens were able to use DNA from teeth recovered from a mass grave. The scientists identified nucleotide sequences from a pathogenic bacterium, Salmonella enterica serovar Typhi (Figure 22.20), which causes typhoid fever.3 This disease is commonly seen in overcrowded areas and has caused epidemics throughout recorded history.
Figure 22.20 Salmonella enterica. Salmonella enterica serovar Typhi, the causative agent of Typhoid fever, is a Gram-negative, rod-shaped gamma proteobacterium. Typhoid fever, which is spread through feces, causes intestinal hemorrhage, high fever, delirium, and dehydration. Today, between 16 and 33 million cases of this re-emerging disease occur annually, resulting in over 200,000 deaths. Carriers of the disease can be asymptomatic. In a famous case in the early 1900s, a cook named Mary Mallon (“Typhoid Mary”) unknowingly spread the disease to over fifty people, three of whom died. Other serotypes of Salmonella cause food poisoning. (credit: modification of work by NCI, CDC)
Bubonic Plagues
From 541 to 750, the Plague of Justinian, an outbreak of what was likely bubonic plague, eliminated one-quarter to one-half of the human population in the eastern Mediterranean region. The population in Europe dropped by 50 percent during this outbreak. Astoundingly, bubonic plague would strike Europe more than once!
Bubonic plague is caused by the bacterium Yersinia pestis. One of the most devastating pandemics attributed to bubonic plague was the Black Death (1346 to 1361). It is thought to have originated in China and spread along the Silk Road, a network of land and sea trade routes, to the Mediterranean region and Europe, carried by fleas living on black rats that were always present on ships. The Black Death was probably named for the tissue necrosis (Figure 22.21c) that can be one of the symptoms. The "buboes" of bubonic plague were painfully swollen areas of lymphatic tissue. A pneumonic form of the plague, spread by the coughing and sneezing of infected individuals, spreads directly from human to human and can cause death within a week. The pneumonic form was responsible for the rapid spread of the Black Death in Europe. The Black Death reduced the world’s population from an estimated 450 million to about 350 to 375 million. Bubonic plague struck London yet again in the mid-1600s (Figure 22.21). In modern times, approximately 1,000 to 3,000 cases of plague arise globally each year, and a “sylvatic” form of plague, carried by fleas living on rodents such as prairie dogs and black footed ferrets, infects 10 to 20 people annually in the American Southwest. Although contracting bubonic plague before antibiotics meant almost certain death, the bacterium responds to several types of modern antibiotics, and mortality rates from plague are now very low.
Figure 22.21 The Black Death. The (a) Great Plague of London killed an estimated 200,000 people, or about 20 percent of the city’s population. The causative agent, the (b) bacterium Yersinia pestis, is a Gram-negative, rod-shaped bacterium from the class Gammaproteobacteria. The disease is transmitted through the bite of an infected flea, which is carried on a rodent. Symptoms include swollen lymph nodes, fever, seizure, vomiting of blood, and (c) gangrene. (credit b: Rocky Mountain Laboratories, NIAID, NIH; scale-bar data from Matt Russell; credit c: Textbook of Military Medicine, Washington, D.C., U.S. Dept. of the Army, Office of the Surgeon General, Borden Institute)
Link to Learning
Link to Learning
Watch a video on the modern understanding of the Black Death—bubonic plague in Europe during the 14th century.
Migration of Diseases to New Populations
One of the negative consequences of human exploration was the accidental “biological warfare” that resulted from the transport of a pathogen into a population that had not previously been exposed to it. Over the centuries, Europeans tended to develop genetic immunity to endemic infectious diseases, but when European conquerors reached the western hemisphere, they brought with them disease-causing bacteria and viruses, which triggered epidemics that completely devastated many diverse populations of Native Americans, who had no natural resistance to many European diseases. It has been estimated that up to 90 percent of Native Americans died from infectious diseases after the arrival of Europeans, making conquest of the New World a foregone conclusion.
Emerging and Re-emerging Diseases
The distribution of a particular disease is dynamic. Changes in the environment, the pathogen, or the host population can dramatically impact the spread of a disease. According to the World Health Organization (WHO), an emerging disease (Figure 22.22) is one that has appeared in a population for the first time, or that may have existed previously but is rapidly increasing in incidence or geographic range. This definition also includes re-emerging diseases that were previously under control. Approximately 75 percent of recently emerging infectious diseases affecting humans are zoonotic diseases. Zoonoses are diseases that primarily infect animals but can be transmitted to humans; some are of viral origin and some are of bacterial origin. Brucellosis is an example of a prokaryotic zoonosis that is re-emerging in some regions, and necrotizing fasciitis (commonly known as flesh-eating bacteria) has been increasing in virulence for the last 80 years for unknown reasons.
Figure 22.22 Emerging diseases. The map shows regions where bacterial diseases are emerging or re-emerging. (credit: modification of work by NIH)
Some of the present emerging diseases are not actually new, but are diseases that were catastrophic in the past (Figure 22.23). They devastated populations and became dormant for a while, just to come back, sometimes more virulent than before, as was the case with bubonic plague. Other diseases, like tuberculosis, were never eradicated but were under control in some regions of the world until coming back, mostly in urban centers with high concentrations of immunocompromised people. WHO has identified certain diseases whose worldwide re-emergence should be monitored. Among these are three viral diseases (dengue fever, yellow fever, and zika), and three bacterial diseases (diphtheria, cholera, and bubonic plague). The war against infectious diseases has no foreseeable end.
Figure 22.23 Lyme Disease. Lyme disease often, but not always, results in (a) a characteristic bullseye rash. The disease is caused by a (b) Gram-negative spirochete bacterium of the genus Borrelia. The bacteria (c) infect ticks, which in turn infect mice. Deer are the preferred secondary host, but the ticks also may feed on humans. Untreated, the disease causes chronic disorders in the nervous system, eyes, joints, and heart. The disease is named after Lyme, Connecticut, where an outbreak occurred in 1995 and has subsequently spread. The disease is not new, however. Genetic evidence suggests that Ötzi the Iceman, a 5,300-year-old mummy found in the Alps, was infected with Borrelia. (credit a: James Gathany, CDC; credit b: CDC; scale-bar data from Matt Russell)
Foodborne Diseases
Prokaryotes are everywhere: They readily colonize the surface of any type of material, and food is not an exception. Most of the time, prokaryotes colonize food and food-processing equipment in the form of a biofilm, as we have discussed earlier. Outbreaks of bacterial infection related to food consumption are common. A foodborne disease (commonly called “food poisoning”) is an illness resulting from the consumption the pathogenic bacteria, viruses, or other parasites that contaminate food. Although the United States has one of the safest food supplies in the world, the U.S. Centers for Disease Control and Prevention (CDC) has reported that “76 million people get sick, more than 300,000 are hospitalized, and 5,000 Americans die each year from foodborne illness.”
The characteristics of foodborne illnesses have changed over time. In the past, it was relatively common to hear about sporadic cases of botulism, the potentially fatal disease produced by a toxin from the anaerobic bacterium Clostridium botulinum. Some of the most common sources for this bacterium were non-acidic canned foods, homemade pickles, and processed meat and sausages. The can, jar, or package created a suitable anaerobic environment where Clostridium could grow. Proper sterilization and canning procedures have reduced the incidence of this disease.
While people may tend to think of foodborne illnesses as associated with animal-based foods, most cases are now linked to produce. There have been serious, produce-related outbreaks associated with raw spinach in the United States and with vegetable sprouts in Germany, and these types of outbreaks have become more common. The raw spinach outbreak in 2006 was produced by the bacterium E. coli serotype O157:H7. A serotype is a strain of bacteria that carries a set of similar antigens on its cell surface, and there are often many different serotypes of a bacterial species. Most E. coli are not particularly dangerous to humans, but serotype O157:H7 can cause bloody diarrhea and is potentially fatal.
All types of food can potentially be contaminated with bacteria. Recent outbreaks of Salmonella reported by the CDC occurred in foods as diverse as peanut butter, alfalfa sprouts, and eggs. A deadly outbreak in Germany in 2010 was caused by E. coli contamination of vegetable sprouts (Figure 22.24). The strain that caused the outbreak was found to be a new serotype not previously involved in other outbreaks, which indicates that E. coli is continuously evolving. Outbreaks of listeriosis, due to contamination of meats, raw cheeses, and frozen or fresh vegetables with Listeria monocytogenes, are becoming more frequent.
Figure 22.24 Foodborne pathogens. (a) Vegetable sprouts grown at an organic farm were the cause of an (b) E. coli outbreak that killed 32 people and sickened 3,800 in Germany in 2011. The strain responsible, E. coli O104:H4, produces Shiga toxin, a substance that inhibits protein synthesis in the host cell. The toxin (c) destroys red blood cells resulting in bloody diarrhea. Deformed red blood cells clog the capillaries of the kidney, which can lead to kidney failure, as happened to 845 patients in the 2011 outbreak. Kidney failure is usually reversible, but some patients experience kidney problems years later. (credit c: NIDDK, NIH)
Biofilms and Disease
Recall that biofilms are microbial communities that are very difficult to destroy. They are responsible for diseases such as Legionnaires’ disease, otitis media (ear infections), and various infections in patients with cystic fibrosis. They produce dental plaque and colonize catheters, prostheses, transcutaneous and orthopedic devices, contact lenses, and internal devices such as pacemakers. They also form in open wounds and burned tissue. In healthcare environments, biofilms grow on hemodialysis machines, mechanical ventilators, shunts, and other medical equipment. In fact, 65 percent of all infections acquired in the hospital (nosocomial infections) are attributed to biofilms. Biofilms are also related to diseases contracted from food because they colonize the surfaces of vegetable leaves and meat, as well as food-processing equipment that isn’t adequately cleaned.
Biofilm infections develop gradually and may not cause immediate symptoms. They are rarely resolved by host defense mechanisms. Once an infection by a biofilm is established, it is very difficult to eradicate, because biofilms tend to be resistant to most methods used to control microbial growth, including antibiotics. The matrix that attaches the cells to a substrate and to other another protects the cells from antibiotics or drugs. In addition, since biofilms grow slowly, they are less responsive to agents that interfere with cell growth. It has been reported that biofilms can resist up to 1,000 times the antibiotic concentrations used to kill the same bacteria when they are free-living or planktonic. An antibiotic dose that large would harm the patient; therefore, scientists are working on new ways to get rid of biofilms.
Antibiotics: Are We Facing a Crisis?
The word antibiotic comes from the Greek anti meaning “against” and bios meaning “life.” An antibiotic is a chemical, produced either by microbes or synthetically, that is hostile to or prevents the growth of other organisms. Today’s media often address concerns about an antibiotic crisis. Are the antibiotics that easily treated bacterial infections in the past becoming obsolete? Are there new “superbugs”—bacteria that have evolved to become more resistant to our arsenal of antibiotics? Is this the beginning of the end of antibiotics? All these questions challenge the healthcare community.
One of the main causes of antibiotic resistance in bacteria is overexposure to antibiotics. The imprudent and excessive use of antibiotics has resulted in the natural selection of resistant forms of bacteria. The antibiotic kills most of the infecting bacteria, and therefore only the resistant forms remain. These resistant forms reproduce, resulting in an increase in the proportion of resistant forms over non-resistant ones. In addition to transmission of resistance genes to progeny, lateral transfer of resistance genes on plasmids can rapidly spread these genes through a bacterial population. A major misuse of antibiotics is in patients with viral infections like colds or the flu, against which antibiotics are useless. Another problem is the excessive use of antibiotics in livestock. The routine use of antibiotics in animal feed promotes bacterial resistance as well. In the United States, 70 percent of the antibiotics produced are fed to animals. These antibiotics are given to livestock in low doses, which maximize the probability of resistance developing, and these resistant bacteria are readily transferred to humans.
Link to Learning
Link to Learning
Watch a recent news report on the problem of routine antibiotic administration to livestock and antibiotic-resistant bacteria.
One of the Superbugs: MRSA
The imprudent use of antibiotics has paved the way for the expansion of resistant bacterial populations. For example, Staphylococcus aureus, often called “staph,” is a common bacterium that can live in the human body and is usually easily treated with antibiotics. However, a very dangerous strain, methicillin-resistant Staphylococcus aureus (MRSA) has made the news over the past few years (Figure 22.25). This strain is resistant to many commonly used antibiotics, including methicillin, amoxicillin, penicillin, and oxacillin. MRSA can cause infections of the skin, but it can also infect the bloodstream, lungs, urinary tract, or sites of injury. While MRSA infections are common among people in healthcare facilities, they have also appeared in healthy people who haven’t been hospitalized, but who live or work in tight populations (like military personnel and prisoners). Researchers have expressed concern about the way this latter source of MRSA targets a much younger population than those residing in care facilities. The Journal of the American Medical Association reported that, among MRSA-afflicted persons in healthcare facilities, the average age is 68, whereas people with “community-associated MRSA” (CA-MRSA) have an average age of 23.4
Figure 22.25 MRSA. This scanning electron micrograph shows methicillin-resistant Staphylococcus aureus bacteria, commonly known as MRSA. S. aureus is not always pathogenic, but can cause diseases such as food poisoning and skin and respiratory infections. (credit: modification of work by Janice Haney Carr; scale-bar data from Matt Russell)
In summary, the medical community is facing an antibiotic crisis. Some scientists believe that after years of being protected from bacterial infections by antibiotics, we may be returning to a time in which a simple bacterial infection could again devastate the human population. Researchers are developing new antibiotics, but it takes many years of research and clinical trials, plus financial investments in the millions of dollars, to generate an effective and approved drug.
Career Connection
Career Connection
EpidemiologistEpidemiology is the study of the occurrence, distribution, and determinants of health and disease in a population. It is, therefore, part of public health. An epidemiologist studies the frequency and distribution of diseases within human populations and environments.
Epidemiologists collect data about a particular disease and track its spread to identify the original mode of transmission. They sometimes work in close collaboration with historians to try to understand the way a disease evolved geographically and over time, tracking the natural history of pathogens. They gather information from clinical records, patient interviews, surveillance, and any other available means. That information is used to develop strategies, such as vaccinations (Figure 22.26), and design public health policies to reduce the incidence of a disease or to prevent its spread. Epidemiologists also conduct rapid investigations in case of an outbreak to recommend immediate measures to control it.
An epidemiologist has a bachelor’s degree, plus a master’s degree in public health (MPH). Many epidemiologists are also physicians (and have an M.D. or D.O degree), or they have a Ph.D. in an associated field, such as biology or microbiology.
Figure 22.26 Vaccination. Vaccinations can slow the spread of communicable diseases. (credit: modification of work by Daniel Paquet)
Footnotes
• 3Papagrigorakis MJ, Synodinos PN, and Yapijakis C. Ancient typhoid epidemic reveals possible ancestral strain of Salmonella enterica serovar Typhi. Infect Genet Evol 7 (2007): 126–7, Epub 2006 Jun.
• 4Naimi, TS, LeDell, KH, Como-Sabetti, K, et al. Comparison of community- and health care-associated methicillin-resistant Staphylococcus aureus infection. JAMA 290 (2003): 2976–84, doi: 10.1001/jama.290.22.2976.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.02%3A_Prokaryotes_-_Bacteria_and_Archaea/5.2.05%3A_Bacterial_Diseases_in_Humans.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Explain the need for nitrogen fixation and how it is accomplished
• Describe the beneficial effects of bacteria that colonize our skin and digestive tracts
• Identify prokaryotes used during the processing of food
• Describe the use of prokaryotes in bioremediation
Fortunately, only a few species of prokaryotes are pathogenic! Prokaryotes also interact with humans and other organisms in a number of ways that are beneficial. For example, prokaryotes are major participants in the carbon and nitrogen cycles. They produce or process nutrients in the digestive tracts of humans and other animals. Prokaryotes are used in the production of some human foods, and also have been recruited for the degradation of hazardous materials. In fact, our life would not be possible without prokaryotes!
Cooperation between Bacteria and Eukaryotes: Nitrogen Fixation
Nitrogen is a very important element to living things, because it is part of nucleotides and amino acids that are the building blocks of nucleic acids and proteins, respectively. Nitrogen is usually the most limiting element in terrestrial ecosystems, with atmospheric nitrogen, N2, providing the largest pool of available nitrogen. However, eukaryotes cannot use atmospheric, gaseous nitrogen to synthesize macromolecules. Fortunately, nitrogen can be “fixed,” meaning it is converted into a more accessible form—ammonia (NH3)—either biologically or abiotically.
Abiotic nitrogen fixation occurs as a result of physical processes such as lightning or by industrial processes. Biological nitrogen fixation (BNF) is exclusively carried out by prokaryotes: soil bacteria, cyanobacteria, and Frankia spp. (filamentous bacteria interacting with actinorhizal plants such as alder, bayberry, and sweet fern). After photosynthesis, BNF is the most important biological process on Earth. The overall nitrogen fixation equation below represents a series of redox reactions (Pi stands for inorganic phosphate).
$N 2 + 16ATP + 8e − + 8H + → 2NH 3 + 16ADP + 16Pi + H 2 N 2 + 16ATP + 8e − + 8H + → 2NH 3 + 16ADP + 16Pi + H 2$
The total fixed nitrogen through BNF is about 100 to 180 million metric tons per year, which contributes about 65 percent of the nitrogen used in agriculture.
Cyanobacteria are the most important nitrogen fixers in aquatic environments. In soil, members of the genera Clostridium and Azotobacter are examples of free-living, nitrogen-fixing bacteria. Other bacteria live symbiotically with legume plants, providing the most important source of fixed nitrogen. Symbionts may fix more nitrogen in soils than free-living organisms by a factor of 10. Soil bacteria, collectively called rhizobia, are able to symbiotically interact with legumes to form nodules, specialized structures where nitrogen fixation occurs (Figure 22.27). Nitrogenase, the enzyme that fixes nitrogen, is inactivated by oxygen, so the nodule provides an oxygen-free area for nitrogen fixation to take place. The oxygen is sequestered by a form of plant hemoglobin called leghemoglobin, which protects the nitrogenase, but releases enough oxygen to support respiratory activity.
Symbiotic nitrogen fixation provides a natural and inexpensive plant fertilizer: It reduces atmospheric nitrogen to ammonia, which is easily usable by plants. The use of legumes is an excellent alternative to chemical fertilization and is of special interest to sustainable agriculture, which seeks to minimize the use of chemicals and conserve natural resources. Through symbiotic nitrogen fixation, the plant benefits from using an endless source of nitrogen: the atmosphere. The bacteria benefit from using photosynthates (carbohydrates produced during photosynthesis) from the plant and having a protected niche. In addition, the soil benefits from being naturally fertilized. Therefore, the use of rhizobia as biofertilizers is a sustainable practice.
Why are legumes so important? Some, like soybeans, are key sources of agricultural protein. Some of the most important legumes consumed by humans are soybeans, peanuts, peas, chickpeas, and beans. Other legumes, such as alfalfa, are used to feed cattle.
Figure 22.27 Nitrogen-fixation nodules on soybean roots. Soybean (Glycine max) is a legume that interacts symbiotically with the soil bacterium Bradyrhizobium japonicum to form specialized structures on the roots called nodules where nitrogen fixation occurs. (credit: USDA)
Everyday Connection
Everyday Connection
Microbes on the Human BodyThe commensal bacteria that inhabit our skin and gastrointestinal tract do a host of good things for us. They protect us from pathogens, help us digest our food, and produce some of our vitamins and other nutrients. These activities have been known for a long time. More recently, scientists have gathered evidence that these bacteria may also help regulate our moods, influence our activity levels, and even help control weight by affecting our food choices and absorption patterns. The Human Microbiome Project has begun the process of cataloging our normal bacteria (and archaea) so we can better understand these functions.
A particularly fascinating example of our normal flora relates to our digestive systems. People who take high doses of antibiotics tend to lose many of their normal gut bacteria, allowing a naturally antibiotic-resistant species called Clostridium difficile to overgrow and cause severe gastric problems, especially chronic diarrhea (Figure 22.28). Obviously, trying to treat this problem with antibiotics only makes it worse. However, it has been successfully treated by giving the patients fecal transplants from healthy donors to reestablish the normal intestinal microbial community. Clinical trials are underway to ensure the safety and effectiveness of this technique.
Figure 22.28 Clostridium difficile. This scanning electron micrograph shows Clostridium difficile, a Gram-positive, rod-shaped bacterium that causes severe diarrhea. Infection commonly occurs after the normal gut fauna are eradicated by antibiotics, and in the hospital can be deadly to seriously ill patients. (credit: modification of work by CDC, HHS; scale-bar data from Matt Russell)
Scientists are also discovering that the absence of certain key microbes from our intestinal tract may set us up for a variety of problems. This seems to be particularly true regarding the appropriate functioning of the immune system. There are intriguing findings that suggest that the absence of these microbes is an important contributor to the development of allergies and some autoimmune disorders. Research is currently underway to test whether adding certain microbes to our internal ecosystem may help in the treatment of these problems, as well as in treating some forms of autism.
Early Biotechnology: Cheese, Bread, Wine, Beer, and Yogurt
According to the United Nations Convention on Biological Diversity, biotechnology is “any technological application that uses biological systems, living organisms, or derivatives thereof, to make or modify products or processes for specific use."5 The concept of “specific use” involves some sort of commercial application. Genetic engineering, artificial selection, antibiotic production, and cell culture are current topics of study in biotechnology and will be described in later chapters. However, humans were using prokaryotes before the term biotechnology was even coined. Some of the products of this early biotechnology are as familiar as cheese, bread, wine, beer, and yogurt, which employ both bacteria and other microbes, such as yeast, a fungus (Figure 22.29).
Figure 22.29 Some foods produced by microorganisms. Some of the products derived from the use of prokaryotes in early biotechnology include (a) cheese, (b) wine, (c) beer and bread, and (d) yogurt. (credit bread: modification of work by F. Rodrigo/Wikimedia Commons; credit wine: modification of work by Jon Sullivan; credit beer and bread: modification of work by Kris Miller; credit yogurt: modification of work by Jon Sullivan)
Cheese production began around 4,000 to 7,000 years ago when humans began to breed animals and process their milk. Fermentation in this case preserves nutrients: Milk will spoil relatively quickly, but when processed as cheese, it is more stable. As for beer, the oldest records of brewing are about 6,000 years old and were an integral part of the Sumerian culture. Evidence indicates that the Sumerians discovered fermentation by chance. Wine has been produced for about 4,500 years, and evidence suggests that cultured milk products, like yogurt, have existed for at least 4,000 years.
Using Prokaryotes to Clean up Our Planet: Bioremediation
Microbial bioremediation is the use of prokaryotes (or microbial metabolism) to remove pollutants. Bioremediation has been used to remove agricultural chemicals (e.g., pesticides, fertilizers) that leach from soil into groundwater and the subsurface. Certain toxic metals and oxides, such as selenium and arsenic compounds, can also be removed from water by bioremediation. The reduction of SeO4-2 to SeO3-2 and to Se0 (metallic selenium) is a method used to remove selenium ions from water. Mercury (Hg) is an example of a toxic metal that can be removed from an environment by bioremediation. As an active ingredient of some pesticides, mercury is used in industry and is also a by-product of certain processes, such as battery production. Methyl mercury is usually present in very low concentrations in natural environments, but it is highly toxic because it accumulates in living tissues. Several species of bacteria can carry out the biotransformation of toxic mercury into nontoxic forms. These bacteria, such as Pseudomonas aeruginosa, can convert Hg+2 into Hg0, which is nontoxic to humans.
One of the most useful and interesting examples of the use of prokaryotes for bioremediation purposes is the cleanup of oil spills. The significance of prokaryotes to petroleum bioremediation has been demonstrated in several oil spills in recent years, such as the Exxon Valdez spill in Alaska (1989) (Figure 22.30), the Prestige oil spill in Spain (2002), the spill into the Mediterranean from a Lebanon power plant (2006), and more recently, the BP oil spill in the Gulf of Mexico (2010). In the case of oil spills in the ocean, ongoing natural bioremediation tends to occur, since there are oil-consuming bacteria in the ocean prior to the spill. In addition to these naturally occurring oil-degrading bacteria, humans select and engineer bacteria that possess the same capability with increased efficacy and spectrum of hydrocarbon compounds that can be processed. Bioremediation is enhanced by the addition of inorganic nutrients that help bacteria to grow.
Some hydrocarbon-degrading bacteria feed on hydrocarbons in the oil droplet, breaking down the hydrocarbons into smaller subunits. Some species, such as Alcanivorax borkumensis, produce surfactants that solubilize the oil (making it soluble in water), whereas other bacteria degrade the oil into carbon dioxide. Under ideal conditions, it has been reported that up to 80 percent of the nonvolatile components in oil can be degraded within one year of the spill. Other oil fractions containing aromatic and highly branched hydrocarbon chains are more difficult to remove and remain in the environment for longer periods of time.
Figure 22.30 Prokaryotes and bioremediation. (a) Cleaning up oil after the Exxon Valdez spill in Alaska, workers hosed oil from beaches and then used a floating boom to corral the oil, which was finally skimmed from the water surface. Some species of bacteria are able to solubilize and degrade the oil. (b) One of the most catastrophic consequences of oil spills is the damage to fauna. (credit a: modification of work by NOAA; credit b: modification of work by GOLUBENKOV, NGO: Saving Taman)
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.02%3A_Prokaryotes_-_Bacteria_and_Archaea/5.2.06%3A_Beneficial_Prokaryotes.txt
|
acidophile
organism with optimal growth pH of three or below
alkaliphile
organism with optimal growth pH of nine or above
ammonification
process by which ammonia is released during the decomposition of nitrogen-containing organic compounds
anaerobic
refers to organisms that grow without oxygen
anoxic
without oxygen
antibiotic
biological substance that, in low concentration, is antagonistic to the growth of prokaryotes
biofilm
microbial community that is held together by a gummy-textured matrix
biological nitrogen fixation
conversion of atmospheric nitrogen into ammonia exclusively carried out by prokaryotes
bioremediation
use of microbial metabolism to remove pollutants
biotechnology
any technological application that uses living organisms, biological systems, or their derivatives to produce or modify other products
Black Death
devastating pandemic that is believed to have been an outbreak of bubonic plague caused by the bacterium Yersinia pestis
botulism
disease produced by the toxin of the anaerobic bacterium Clostridium botulinum
CA-MRSA
MRSA acquired in the community rather than in a hospital
capsule
external structure that enables a prokaryote to attach to surfaces and protects it from dehydration
chemotroph
organism that obtains energy from chemical compounds
conjugation
process by which prokaryotes move DNA from one individual to another using a pilus
cyanobacteria
bacteria that evolved from early phototrophs and oxygenated the atmosphere; also known as blue-green algae
decomposer
organism that carries out the decomposition of dead organisms
denitrification
transformation of nitrate from soil to gaseous nitrogen compounds such as N2O, NO, and N2
emerging disease
disease making an initial appearance in a population or that is increasing in incidence or geographic range
endemic disease
disease that is constantly present, usually at low incidence, in a population
epidemic
disease that occurs in an unusually high number of individuals in a population at the same time
extremophile
organism that grows under extreme or harsh conditions
foodborne disease
any illness resulting from the consumption of contaminated food, or of the pathogenic bacteria, viruses, or other parasites that contaminate food
Gram negative
bacterium whose cell wall contains little peptidoglycan but has an outer membrane
Gram positive
bacterium that contains mainly peptidoglycan in its cell walls
halophile
organism that require a salt concentration of at least 0.2 M
hydrothermal vent
fissure in Earth’s surface that releases geothermally heated water
hyperthermophile
organism that grows at temperatures between 80–122 °C
microbial mat
multi-layered sheet of prokaryotes that may include bacteria and archaea
MRSA
(methicillin-resistant Staphylococcus aureus) very dangerous Staphylococcus aureus strain resistant to multiple antibiotics
nitrification
conversion of ammonium into nitrite and nitrate in soils
nitrogen fixation
process by which gaseous nitrogen is transformed, or “fixed” into more readily available forms such as ammonia
nodule
novel structure on the roots of certain plants (legumes) that results from the symbiotic interaction between the plant and soil bacteria, and is the site of nitrogen fixation
nutrient
essential substances for growth, such as carbon and nitrogen
osmophile
organism that grows in a high sugar concentration
pandemic
widespread, usually worldwide, epidemic disease
peptidoglycan
material composed of polysaccharide chains cross-linked to unusual peptides
phototroph
organism that is able to make its own food by converting solar energy to chemical energy
pilus
surface appendage of some prokaryotes used for attachment to surfaces including other prokaryotes
pseudopeptidoglycan
component of archaea cell walls that is similar to peptidoglycan in morphology but contains different sugars
psychrophile
organism that grows at temperatures of -15 °C or lower
radioresistant
organism that grows in high levels of radiation
resuscitation
process by which prokaryotes that are in the VBNC state return to viability
S-layer
surface-layer protein present on the outside of cell walls of archaea and bacteria
serotype
strain of bacterium that carries a set of similar antigens on its cell surface, often many in a bacterial species
stromatolite
layered sedimentary structure formed by precipitation of minerals by prokaryotes in microbial mats
teichoic acid
polymer associated with the cell wall of Gram-positive bacteria
thermophile
organism that lives at temperatures between 60–80 °C
transduction
process by which a bacteriophage moves DNA from one prokaryote to another
transformation
process by which a prokaryote takes in DNA found in its environment that is shed by other prokaryotes
viable-but-non-culturable (VBNC) state
survival mechanism of bacteria facing environmental stress conditions
zoonosis
disease that primarily infects animals that is transmitted to humans
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.02%3A_Prokaryotes_-_Bacteria_and_Archaea/5.2.07%3A_Key_Terms.txt
|
22.1 Prokaryotic Diversity
Prokaryotes existed for billions of years before plants and animals appeared. Hot springs and hydrothermal vents may have been the environments in which life began. Microbial mats are thought to represent the earliest forms of life on Earth. A microbial mat is a multi-layered sheet of prokaryotes that grows at interfaces between different types of material, mostly on moist surfaces. Fossilized microbial mats are called stromatolites and consist of laminated organo-sedimentary structures formed by precipitation of minerals by prokaryotes. They represent the earliest fossil record of life on Earth.
During the first two billion years, the atmosphere was anoxic and only anaerobic organisms were able to live. Cyanobacteria evolved from early phototrophs and began the oxygenation o the atmosphere. The increase in oxygen concentration allowed the evolution of other life forms.
Bacteria and archaea grow in virtually every environment. Those that survive under extreme conditions are called extremophiles (extreme lovers). Some prokaryotes cannot grow in a laboratory setting, but they are not dead. They are in the viable-but-non-culturable (VBNC) state. The VBNC state occurs when prokaryotes enter a dormant state in response to environmental stressors. Most prokaryotes are colonial and prefer to live in communities where interactions take place. A biofilm is a microbial community held together in a gummy-textured matrix.
22.2 Structure of Prokaryotes: Bacteria and Archaea
Prokaryotes (domains Archaea and Bacteria) are single-celled organisms that lack a nucleus. They have a single piece of circular DNA in the nucleoid area of the cell. Most prokaryotes have a cell wall that lies outside the boundary of the plasma membrane. Some prokaryotes may have additional structures such as a capsule, flagella, and pili. Bacteria and Archaea differ in the lipid composition of their cell membranes and the characteristics of the cell wall. In archaeal membranes, phytanyl units, rather than fatty acids, are linked to glycerol. Some archaeal membranes are lipid monolayers instead of bilayers.
The cell wall is located outside the cell membrane and prevents osmotic lysis. The chemical composition of cell walls varies between species. Bacterial cell walls contain peptidoglycan. Archaean cell walls do not have peptidoglycan, but they may have pseudopeptidoglycan, polysaccharides, glycoproteins, or protein-based cell walls. Bacteria can be divided into two major groups: Gram positive and Gram negative, based on the Gram stain reaction. Gram-positive organisms have a thick peptidoglycan layer fortified with teichoic acids. Gram-negative organisms have a thin cell wall and an outer envelope containing lipopolysaccharides and lipoproteins.
Prokaryotes can transfer DNA from one cell to another by three mechanisms: transformation (uptake of environmental DNA), transduction (transfer of genomic DNA via viruses), and conjugation (transfer of DNA by direct cell contact).
22.3 Prokaryotic Metabolism
As the oldest living inhabitants of Earth, prokaryotes are also the most metabolically diverse; they flourish in many different environments with various energy and carbon sources, variable temperature, pH, pressure, oxygen and water availability. Nutrients required in large amounts are called macronutrients, whereas those required in trace amounts are called micronutrients or trace elements. Macronutrients include C, H, O, N, P, S, K, Mg, Ca, and Na. In addition to these macronutrients, prokaryotes require various metallic elements for growth and enzyme function. Prokaryotes use different sources of energy to assemble macromolecules from smaller molecules. Phototrophs obtain their energy from sunlight, whereas chemotrophs obtain energy from chemical compounds. Energy-producing pathways may be either aerobic or anaerobic.
Prokaryotes play roles in the carbon and nitrogen cycles. Producers capture carbon dioxide from the atmosphere and convert it to organic compounds. Consumers (animals and other chemoorganotrophic organisms) use organic compounds generated by producers and release carbon dioxide into the atmosphere by respiration. Carbon dioxide is also returned to the atmosphere by the microbial decomposers of dead organisms. Nitrogen also cycles in and out of living organisms, from organic compounds to ammonia, ammonium ions, nitrite, nitrate, and nitrogen gas. Prokaryotes are essential for most of these conversions. Gaseous nitrogen is transformed into ammonia through nitrogen fixation. Ammonia is anaerobically catabolized by some prokaryotes, yielding N2 as the final product. Nitrification is the conversion of ammonium into nitrite. Nitrification in soils is carried out by bacteria. Denitrification is also performed by bacteria and transforms nitrate from soils into gaseous nitrogen compounds, such as N2O, NO, and N2.
22.4 Bacterial Diseases in Humans
Some prokaryotes are human pathogens. Devastating diseases and plagues have been among us since early times and remain among the leading causes of death worldwide. Emerging diseases are those rapidly increasing in incidence or geographic range. They can be new or re-emerging diseases (previously under control). Many emerging diseases affecting humans originate in animals (zoonoses), such as brucellosis. A group of re-emerging bacterial diseases recently identified by WHO for monitoring include bubonic plague, diphtheria, and cholera. Foodborne diseases result from the consumption of food contaminated with food, pathogenic bacteria, viruses, or parasites.
Some bacterial infections have been associated with biofilms: Legionnaires’ disease, otitis media, and infection of patients with cystic fibrosis. Biofilms can grow on human tissues, like dental plaque; colonize medical devices; and cause infection or produce foodborne disease by growing on the surfaces of food and food-processing equipment. Biofilms are resistant to most of the methods used to control microbial growth. The excessive use of antibiotics has resulted in a major global problem, since resistant forms of bacteria have been selected over time. A very dangerous strain, methicillin-resistant Staphylococcus aureus (MRSA), has wreaked havoc recently across the world.
22.5 Beneficial Prokaryotes
Pathogens are only a small percentage of all prokaryotes. In fact, prokaryotes provide essential services to humans and other organisms. Nitrogen, which is not usable by eukaryotes in its plentiful atmospheric form, can be “fixed,” or converted into ammonia (NH3) either biologically or abiotically. Biological nitrogen fixation (BNF) is exclusively carried out by prokaryotes, and constitutes the second most important biological process on Earth. Although some terrestrial nitrogen is fixed by free-living bacteria, most BNF comes from the symbiotic interaction between soil rhizobia and the roots of legume plants.
Human life is only possible due to the action of microbes, both those in the environment and those species that call us home. Internally, they help us digest our food, produce vital nutrients for us, protect us from pathogenic microbes, and help train our immune systems to function properly.
Microbial bioremediation is the use of microbial metabolism to remove pollutants. Bioremediation has been used to remove agricultural chemicals that leach from soil into groundwater and the subsurface. Toxic metals and oxides, such as selenium and arsenic compounds, can also be removed by bioremediation. Probably one of the most useful and interesting examples of the use of prokaryotes for bioremediation purposes is the cleanup of oil spills.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.02%3A_Prokaryotes_-_Bacteria_and_Archaea/5.2.08%3A_Chapter_Summary.txt
|
1.
Figure 22.8 Compared to free-floating bacteria, bacteria in biofilms often show increased resistance to antibiotics and detergents. Why do you think this might be the case?
2.
Figure 22.16 Which of the following statements is true?
1. Gram-positive bacteria have a single cell wall anchored to the cell membrane by lipoteichoic acid.
2. Porins allow entry of substances into both Gram-positive and Gram-negative bacteria.
3. The cell wall of Gram-negative bacteria is thick, and the cell wall of Gram-positive bacteria is thin.
4. Gram-negative bacteria have a cell wall made of peptidoglycan, whereas Gram-positive bacteria have a cell wall made of lipoteichoic acid.
3.
Figure 22.19 Which of the following statements about the nitrogen cycle is false?
1. Nitrogen fixing bacteria exist on the root nodules of legumes and in the soil.
2. Denitrifying bacteria convert nitrates (NO3-) into nitrogen gas (N2).
3. Ammonification is the process by which ammonium ion (NH4+) is released from decomposing organic compounds.
4. Nitrification is the process by which nitrites (NO2-) are converted to ammonium ion (NH4+).
5.2.10: Review Questions
4.
The first forms of life on Earth were thought to be_________.
1. single-celled plants
2. prokaryotes
3. insects
4. large animals such as dinosaurs
5.
Microbial mats __________.
1. are the earliest forms of life on Earth
2. obtained their energy and food from hydrothermal vents
3. are multi-layered sheets of prokaryotes including mostly bacteria but also archaea
4. all of the above
6.
The first organisms that oxygenated the atmosphere were
1. cyanobacteria
2. phototrophic organisms
3. anaerobic organisms
4. all of the above
7.
Halophiles are organisms that require________.
1. a salt concentration of at least 0.2 M
2. high sugar concentration
3. the addition of halogens
4. all of the above
8.
Many of the first prokaryotes to be cultured in a scientific lab were human or animal pathogens. Why would these species be more readily cultured than non-pathogenic prokaryotes?
1. Pathogenic prokaryotes are hardier than non-pathogenic prokaryotes.
2. Non-pathogenic prokaryotes require more supplements in their growth media.
3. Most of the necessary culture conditions could be inferred for pathogenic prokaryotes.
4. Pathogenic bacteria can grow as free bacteria, but non-pathogenic bacteria only grow as parts of large colonies.
9.
The presence of a membrane-enclosed nucleus is a characteristic of ________.
1. prokaryotic cells
2. eukaryotic cells
3. all cells
4. viruses
10.
Which of the following consist of prokaryotic cells?
1. bacteria and fungi
2. archaea and fungi
3. protists and animals
4. bacteria and archaea
11.
The cell wall is ________.
1. interior to the cell membrane
2. exterior to the cell membrane
3. a part of the cell membrane
4. interior or exterior, depending on the particular cell
12.
Organisms most likely to be found in extreme environments are ________.
1. fungi
2. bacteria
3. viruses
4. archaea
13.
Prokaryotes stain as Gram-positive or Gram-negative because of differences in the cell _______.
1. wall
2. cytoplasm
3. nucleus
4. chromosome
14.
Pseudopeptidoglycan is a characteristic of the walls of ________.
1. eukaryotic cells
2. bacterial prokaryotic cells
3. archaean prokaryotic cells
4. bacterial and archaean prokaryotic cells
15.
The lipopolysaccharide layer (LPS) is a characteristic of the wall of ________.
1. archaean cells
2. Gram-negative bacteria
3. bacterial prokaryotic cells
4. eukaryotic cells
16.
Which of the following elements is not a micronutrient?
1. boron
2. calcium
3. chromium
4. manganese
17.
Prokaryotes that obtain their energy from chemical compounds are called _____.
1. phototrophs
2. auxotrophs
3. chemotrophs
4. lithotrophs
18.
Ammonification is the process by which _____.
1. ammonia is released during the decomposition of nitrogen-containing organic compounds
2. ammonium is converted to nitrite and nitrate in soils
3. nitrate from soil is transformed to gaseous nitrogen compounds such as NO, N2O, and N2
4. gaseous nitrogen is fixed to yield ammonia
19.
Plants use carbon dioxide from the air and are therefore called _____.
1. consumers
2. producers
3. decomposer
4. carbon fixers
20.
Cyanobacteria harness energy from the sun through photosynthesis, and oxidize water to provide electrons for energy generation. Thus, we classify cyanobacteria as _________.
1. photolithotrophs
2. photoautotrophs
3. chemolithoautotrophs
4. chemo-organotrophs
21.
A disease that is constantly present in a population is called _____.
1. pandemic
2. epidemic
3. endemic
4. re-emerging
22.
Which of the statements about biofilms is correct?
1. Biofilms are considered responsible for diseases such as cystic fibrosis.
2. Biofilms produce dental plaque, and colonize catheters and prostheses.
3. Biofilms colonize open wounds and burned tissue.
4. All statements are correct.
23.
Which of these statements is true?
1. An antibiotic is any substance produced by an organism that is antagonistic to the growth of prokaryotes.
2. An antibiotic is any substance produced by a prokaryote that is antagonistic to the growth of other viruses.
3. An antibiotic is any substance produced by a prokaryote that is antagonistic to the growth of eukaryotic cells.
4. An antibiotic is any substance produced by a prokaryote that prevents growth of the same prokaryote.
24.
A person in England arrives at a medical clinic with a fever and swollen lymph nodes shortly after returning from a visit to New Mexico. For which bacteria should the doctor test the patient?
1. Salmonella enterica
2. Borrelia burgdorferi
3. Clostridium botulinum
4. Yersinia pestis
25.
MRSA has emerged as a serious infectious disease, with the first case of methicillin-resistant S. aureus being detected in 1961. Why are medical professionals so concerned when antibiotics exist that can kill MRSA?
1. MRSA can transfer methicillin-resistance to other bacteria.
2. Patients are not treated with correct antibiotics rapidly enough to prevent serious illness.
3. MRSA could acquire additional antibiotic resistance genes from other bacteria to become a “super bug.”
4. All of the above.
26.
Which of these occurs through symbiotic nitrogen fixation?
1. The plant benefits from using an endless source of nitrogen.
2. The soil benefits from being naturally fertilized.
3. Bacteria benefit from using photosynthates from the plant.
4. All of the above occur.
27.
Synthetic compounds found in an organism but not normally produced or expected to be present in that organism are called _____.
1. pesticides
2. bioremediators
3. recalcitrant compounds
4. xenobiotics
28.
Bioremediation includes _____.
1. the use of prokaryotes that can fix nitrogen
2. the use of prokaryotes to clean up pollutants
3. the use of prokaryotes as natural fertilizers
4. All of the above
29.
In addition to providing yogurt with its unique flavor and texture, lactic acid-producing bacteria also provide which additional benefit during food production?
1. Providing xenobiotics
2. Lowering the pH to kill pathogenic bacteria
3. Pasteurizing milk products
4. Breaking down lactose for lactose-intolerant individuals
5.2.11: Critical Thinking Questions
30.
Describe briefly how you would detect the presence of a non-culturable prokaryote in an environmental sample.
31.
Why do scientists believe that the first organisms on Earth were extremophiles?
32.
A new bacterial species is discovered and classified as an endolith, an extremophile that lives inside rock. If the bacteria were discovered in the permafrost of Antarctica, describe two extremophile features the bacteria must possess.
33.
Mention three differences between bacteria and archaea.
34.
Explain the statement that both types, bacteria and archaea, have the same basic structures, but built from different chemical components.
35.
A scientist isolates a new species of prokaryote. They note that the specimen is a bacillus with a lipid bilayer and cell wall that stains positive for peptidoglycan. Its circular chromosome replicates from a single origin of replication. Is the specimen most likely an Archaea, a Gram-positive bacterium, or a Gram-negative bacterium? How do you know?
36.
Think about the conditions (temperature, light, pressure, and organic and inorganic materials) that you may find in a deep-sea hydrothermal vent. What type of prokaryotes, in terms of their metabolic needs (autotrophs, phototrophs, chemotrophs, etc.), would you expect to find there?
37.
Farmers continually rotate the crops grown in different fields to maintain nutrients in the soil. How would planting soybeans in a field the year after the field was used to grow carrots help maintain nitrogen in the soil?
38.
Imagine a region of soil became contaminated, killing bacteria that decompose dead plants and animals. How would this effect the carbon cycle in the area? Be specific in stating where carbon would accumulate in the cycle.
39.
Explain the reason why the imprudent and excessive use of antibiotics has resulted in a major global problem.
40.
Researchers have discovered that washing spinach with water several times does not prevent foodborne diseases due to E. coli. How can you explain this fact?
41.
Your friend believes that prokaryotes are always detrimental and pathogenic. How would you explain to them that they are wrong?
42.
Many people use antimicrobial soap to kill bacteria on their hands. However, overuse may actually increase the risk of infection. How could this occur?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.02%3A_Prokaryotes_-_Bacteria_and_Archaea/5.2.09%3A_Visual_Connection_Questions.txt
|
Most protists are microscopic, unicellular organisms that are abundant in soil, freshwater, brackish, and marine environments. They are also common in the digestive tracts of animals and in the vascular tissues of plants.
• 5.3.1: Introduction
Most protists are microscopic, unicellular organisms that are abundant in soil, freshwater, brackish, and marine environments. They are also common in the digestive tracts of animals and in the vascular tissues of plants. Others invade the cells of other protists, animals, and plants. Not all protists are microscopic. Some have huge, macroscopic cells, such as the plasmodia (giant amoebae) of myxomycete slime molds or the marine green alga Caulerpa.
• 5.3.2: Eukaryotic Origins
Living things fall into three large groups: Archaea, Bacteria, and Eukarya. The first two have prokaryotic cells, and the third contains all eukaryotes. A relatively sparse fossil record is available to help discern what the first members of each of these lineages looked like, so it is possible that all the events that led to the last common ancestor of extant eukaryotes will remain unknown. However, comparative biology of extant organisms and the limited fossil record provide some insight.
• 5.3.3: Characteristics of Protists
There are over 100,000 described living species of protists, and it is unclear how many undescribed species may exist. Since many protists live as commensals or parasites in other organisms and these relationships are often species-specific, there is a huge potential for protist diversity that matches the diversity of hosts. As the catchall term for eukaryotic organisms that are not animal, plant, or fungi, it is not surprising that very few characteristics are common to all protists.
• 5.3.4: Groups of Protists
In the span of several decades, the Kingdom Protista has been disassembled because sequence analyses have revealed new genetic (and therefore evolutionary) relationships among these eukaryotes. Moreover, protists that exhibit similar morphological features may have evolved analogous structures because of similar selective pressures—rather than because of recent common ancestry. This phenomenon, called convergent evolution, is one reason why protist classification is so challenging.
• 5.3.5: Ecology of Protists
Protists function in various ecological niches. Whereas some protist species are essential components of the food chain and generators of biomass, others function in the decomposition of organic materials. Still other protists are dangerous human pathogens or causative agents of devastating plant diseases.
• 5.3.6: Key Terms
• 5.3.7: Chapter Summary
• 5.3.8: Visual Connection Questions
• 5.3.9: Review Questions
• 5.3.10: Critical Thinking Questions
Thumbnail: This scanning electron micrograph (SEM) revealed some of the external ultrastructural details displayed by a flagellated Giardia lamblia protozoan parasite. G. lamblia is the organism responsible for causing the diarrheal disease "giardiasis". (Public Domain; CDC / Janice Haney Carr).
5.03: Protists
Figure 23.1 Protists range from the microscopic, single-celled (a) Acanthocystis turfacea and the (b) ciliate Tetrahymena thermophila, both visualized here using light microscopy, to the enormous, multicellular (c) kelps (Chromalveolata) that extend for hundreds of feet in underwater “forests.” (credit a: modification of work by Yuiuji Tsukii; credit b: modification of work by Richard Robinson, Public Library of Science; credit c: modification of work by Kip Evans, NOAA; scale-bar data from Matt Russell)
Humans have been familiar with macroscopic organisms (organisms big enough to see with the unaided eye) since before there was a written history, and it is likely that most cultures distinguished between animals and land plants, and most probably included the macroscopic fungi as plants. Therefore, it became an interesting challenge to deal with the world of microorganisms once microscopes were developed a few centuries ago. Many different naming schemes were used over the last couple of centuries, but it has become the most common practice to refer to eukaryotes that are not land plants, animals, or fungi as protists.
This name was first suggested by Ernst Haeckel in the late nineteenth century. It has been applied in many contexts and has been formally used to represent a kingdom-level taxon called Protista. However, many modern systematists (biologists who study the relationships among organisms) are beginning to shy away from the idea of formal ranks such as kingdom and phylum. Instead, they are naming taxa as groups of organisms thought to include all the descendants of a last common ancestor (monophyletic group). During the past two decades, the field of molecular genetics has demonstrated that some protists are more related to animals, plants, or fungi than they are to other protists. Therefore, not including animals, plants, and fungi make the kingdom Protista a paraphyletic group, or one that does not include all descendents of its common ancestor. For this reason, protist lineages originally classified into the kingdom Protista continue to be examined and debated. In the meantime, the term “protist” still is used informally to describe this tremendously diverse group of eukaryotes.
Most protists are microscopic, unicellular organisms that are abundant in soil, freshwater, brackish, and marine environments. They are also common in the digestive tracts of animals and in the vascular tissues of plants. Others invade the cells of other protists, animals, and plants. Not all protists are microscopic. Some have huge, macroscopic cells, such as the plasmodia (giant amoebae) of myxomycete slime molds or the marine green alga Caulerpa, which can have single cells that can be several meters in size. Some protists are multicellular, such as the red, green, and brown seaweeds. It is among the protists that one finds the wealth of ways that organisms can grow.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.03%3A_Protists/5.3.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• List the unifying characteristics of eukaryotes
• Describe what scientists know about the origins of eukaryotes based on the last common ancestor
• Explain the endosymbiotic theory
Organisms are classified into three domains: Archaea, Bacteria, and Eukarya. The first two lineages comprise all prokaryotic cells, and the third contains all eukaryotes. A very sparse fossil record prevents us from determining what the first members of each of these lineages looked like, so it is possible that all the events that led to the last common ancestor of extant eukaryotes will remain unknown. However, comparative biology of extant (living) organisms and the limited fossil record provide some insight into the evolution of Eukarya.
The earliest fossils found appear to be those of domain Bacteria, most likely cyanobacteria. They are about 3.5 to 3.8 billion years old and are recognizable because of their relatively complex structure and, for prokaryotes, relatively large cells. Most other prokaryotes have small cells, 1 or 2 µm in size, and would be difficult to pick out as fossils. Fossil stromatolites suggest that at least some prokaryotes lived in interactive communities, and evidence from the structure of living eukaryotic cells suggests that it was similar ancestral interactions that gave rise to the eukaryotes. Most living eukaryotes have cells measuring 10 µm or greater. Structures this size, which might be fossilized remains of early eukaryotes, appear in the geological record in deposits dating to about 2.1 billion years ago.
Characteristics of Eukaryotes
Data from these fossils, as well as from the study of living genomes, have led comparative biologists to conclude that living eukaryotes are all descendants of a single common ancestor. Mapping the characteristics found in all major groups of eukaryotes reveals that the following characteristics are present in at least some of the members of each major lineage, or during some part of their life cycle, and therefore must have been present in the last common ancestor.
1. Cells with nuclei surrounded by a nuclear envelope with nuclear pores: This is the single characteristic that is both necessary and sufficient to define an organism as a eukaryote. All extant eukaryotes have cells with nuclei.
2. Mitochondria: Most extant eukaryotes have "typical" mitochondria, although some eukaryotes have very reduced mitochondrial “remnants” and a few lack detectable mitochondria.
3. Cytoskeleton of microtubules and microfilaments: Eukaryotic cells possess the structural and motility components called actin microfilaments and microtubules. All extant eukaryotes have these cytoskeletal elements.
4. Flagella and cilia: Organelles associated with cell motility. Some extant eukaryotes lack flagella and/or cilia, but their presence in related lineages suggests that they are descended from ancestors that possessed these organelles.
5. Chromosomes organized by histones: Each eukaryotic chromosome consists of a linear DNA molecule coiled around basic (alkaline) proteins called histones. The few eukaryotes with chromosomes lacking histones clearly evolved from ancestors that had them.
6. Mitosis: A process of nuclear division in which replicated chromosomes are divided and separated using elements of the cytoskeleton. Mitosis is universally present in eukaryotes.
7. Sexual reproduction: A meiotic process of nuclear division and genetic recombination unique to eukaryotes. During this process, diploid nuclei at one stage of the life cycle undergo meiosis to yield haploid nuclei, which subsequently fuse together (karyogamy) to create a diploid zygote nucleus.
8. Cell walls: It might be reasonable to conclude that the last common ancestor could make cell walls during some stage of its life cycle, simply because cell walls were present in their prokaryote precursors. However, not enough is known about eukaryotes’ cell walls and their development to know how much homology exists between those of prokaryotes and eukaryotes. If the last common ancestor could make cell walls, it is clear that this ability must have been lost in many groups.
Endosymbiosis and the Evolution of Eukaryotes
Before we discuss the origins of eukaryotes, it is first important to understand that all extant eukaryotes are likely the descendants of a chimera-like organism that was a composite of a host cell and the cell(s) of an alpha-proteobacterium that “took up residence” inside it. This major theme in the origin of eukaryotes is known as endosymbiosis, one cell engulfing another such that the engulfed cell survives and both cells benefit. Over many generations, a symbiotic relationship can result in two organisms that depend on each other so completely that neither could survive on its own. Endosymbiotic events likely contributed to the origin of the last common ancestor of today’s eukaryotes and to later diversification in certain lineages of eukaryotes (Figure 23.5). Similar endosymbiotic associations are not uncommon in living eukaryotes. Before explaining this further, it is necessary to consider metabolism in prokaryotes.
Prokaryotic Metabolism
Many important metabolic processes arose in prokaryotes; however, some of these processes, such as nitrogen fixation, are never found in eukaryotes. The process of aerobic respiration is found in all major lineages of eukaryotes, and it is localized in the mitochondria. Aerobic respiration is also found in many lineages of prokaryotes, but it is not present in all of them, and a great deal of evidence suggests that such anaerobic prokaryotes never carried out aerobic respiration nor did their ancestors.
While today’s atmosphere is about 20 percent molecular oxygen (O2), geological evidence shows that it originally lacked O2. Without oxygen, aerobic respiration would not be expected, and living things would have relied on anaerobic respiration or the process of fermentation instead. At some point before about 3.8 billion years ago, some prokaryotes began using energy from sunlight to power anabolic processes that reduce carbon dioxide to form organic compounds. That is, they evolved the ability to photosynthesize. Hydrogen, derived from various sources, was “captured” using light-powered reactions to reduce fixed carbon dioxide in the Calvin cycle. The group of Gram-negative bacteria that gave rise to cyanobacteria used water as the hydrogen source and released O2 as a “waste” product.
Eventually, the amount of photosynthetic oxygen built up in some environments to levels that posed a risk to living organisms, since it can damage many organic compounds. Various metabolic processes evolved that protected organisms from oxygen, one of which, aerobic respiration, also generated high levels of ATP. It became widely present among prokaryotes, including in a free-living group we now call alpha-proteobacteria. Organisms that did not acquire aerobic respiration had to remain in oxygen-free environments. Originally, oxygen-rich environments were likely localized around places where cyanobacteria were abundant and active, but by about 2 billion years ago, geological evidence shows that oxygen was building up to higher concentrations in the atmosphere. Oxygen levels similar to today’s levels only arose within the last 700 million years.
Recall that the first fossils that we believe to be eukaryotes date to about 2 billion years old, so they seemed to have evolved and diversified rapidly as oxygen levels were increasing. Also, recall that all extant eukaryotes descended from an ancestor with mitochondria. These organelles were first observed by light microscopists in the late 1800s, where they appeared to be somewhat worm-shaped structures that seemed to be moving around in the cell. Some early observers suggested that they might be bacteria living inside host cells, but these hypotheses remained unknown or rejected in most scientific communities.
Endosymbiotic Theory
As cell biology developed in the twentieth century, it became clear that mitochondria were the organelles responsible for producing ATP using aerobic respiration, in which oxygen was the final electron acceptor. In the 1960s, American biologist Lynn Margulis of Boston University developed the endosymbiotic theory, which states that eukaryotes may have been a product of one cell engulfing another, one living within another, and coevolving over time until the separate cells were no longer recognizable as such and shared genetic control of a mutualistic metabolic pathway to produce ATP. In 1967, Margulis introduced new data to support her work on the theory and substantiated her findings through microbiological evidence. Although Margulis’s work initially was met with resistance, this basic component of this once-revolutionary hypothesis is now widely accepted, with work progressing on uncovering the steps involved in this evolutionary process and the key players involved.
While the metabolic organelles and genes responsible for many energy-harvesting processes appear to have had their origins in bacteria, our nuclear genes and the molecular machinery responsible for replication and expression appear to be more closely related to those found in the Archaea. Much remains to be clarified about how this relationship occurred; this continues to be an exciting field of discovery in biology. For instance, it is not known whether the endosymbiotic event that led to mitochondria occurred before or after the host cell had a nucleus. Such organisms would be among the extinct precursors of the last common ancestor of eukaryotes.
Mitochondria
One of the major features distinguishing prokaryotes from eukaryotes is the presence of mitochondria, or their reduced derivatives, in virtually all eukaryotic cells. Eukaryotic cells may contain anywhere from one to several thousand mitochondria, depending on the cell’s level of energy consumption, in humans being most abundant in the liver and skeletal muscles. Each mitochondrion measures 1 to 10 or greater micrometers in length and exists in the cell as an organelle that can be ovoid to worm-shaped to intricately branched (Figure 23.2). However, although they may have originated as free-living aerobic organisms, mitochondria can no longer survive and reproduce outside the cell.
Mitochondria have several features that suggest their relationship to alpha-proteobacteria (Figure 23.5). Alpha-proteobacteria are a large group of bacteria that includes species symbiotic with plants, disease organisms that can infect humans via ticks, and many free-living species that use light for energy. Mitochondria have their own genomes, with a circular chromosome stabilized by attachments to the inner membrane. Mitochondria also have special ribosomes and transfer RNAs that resemble these same components in prokaryotes. An intriguing feature of mitochondria is that many of them exhibit minor differences from the universal genetic code. However, many of the genes for respiratory proteins are now relocated in the nucleus. When these genes are compared to those of other organisms, they appear to be of alpha-proteobacterial origin. In some eukaryotic groups, such genes are found in the mitochondria, whereas in other groups, they are found in the nucleus. This has been interpreted as evidence that over evolutionary time, genes have been transferred from the endosymbiont chromosome to those of the host genome. This apparent “loss” of genes by the endosymbiont is probably one explanation why mitochondria cannot live without a host.
Another line of evidence supporting the idea that mitochondria were derived by endosymbiosis comes from the structure of the mitochondrion itself. Most mitochondria are shaped like alpha-proteobacteria and are surrounded by two membranes; the inner membrane is bacterial in nature whereas the outer membrane is eukaryotic in nature. This is exactly what one would expect if one membrane-bound organism was engulfed into a vacuole by another membrane-bound organism. The outer mitochondrial membrane was derived by the enclosing vesicle, while the inner membrane was derived from the plasma membrane of the endosymbiont. The mitochondrial inner membrane is extensive and involves substantial infoldings called cristae that resemble the textured, outer surface of alpha-proteobacteria. The matrix and inner membrane are rich with the enzymes necessary for aerobic respiration.
Figure 23.2 Mitochondria. In this transmission electron micrograph of mitochondria in a mammalian lung cell, the cristae, infoldings of the mitochondrial inner membrane, can be seen in cross-section. (credit: Louise Howard)
The third line of evidence comes from the production of new mitochondria. Mitochondria divide independently by a process that resembles binary fission in prokaryotes. Mitochondria arise only from previous mitochondria; they are not formed from scratch (de novo) by the eukaryotic cell. Mitochondria may fuse together; and they may be moved around inside the cell by interactions with the cytoskeleton. They reproduce within their enclosing cell and are distributed with the cytoplasm when a cell divides or two cells fuse. Therefore, although these organelles are highly integrated into the eukaryotic cell, they still reproduce as if they were independent organisms within the cell. However, their reproduction is synchronized with the activity and division of the cell. These features all support the theory that mitochondria were once free-living prokaryotes.
Some living eukaryotes are anaerobic and cannot survive in the presence of too much oxygen. However, a few appear to lack organelles that could be recognized as mitochondria. In the 1970s and on into the early 1990s, many biologists suggested that some of these eukaryotes were descended from ancestors whose lineages had diverged from the lineage of mitochondrion-containing eukaryotes before endosymbiosis occurred. Later findings suggest that reduced organelles are found in most, if not all, anaerobic eukaryotes, and that virtually all eukaryotes appear to carry some genes in their nuclei that are of mitochondrial origin.
In addition to the aerobic generation of ATP, mitochondria have several other metabolic functions. One of these functions is to generate clusters of iron and sulfur that are important cofactors of many enzymes. Such functions are often associated with the reduced mitochondrion-derived organelles of anaerobic eukaryotes. The protist Monocercomonoides, an inhabitant of vertebrate digestive tracts, appears to be an exception; it has no mitochondria and its genome contains neither genes derived from mitochondria nor nuclear genes related to mitochondrial maintenance. However, it is related to other protists with reduced mitochondria and probably represents an end-point in mitochondrial reduction. Although most biologists accept that the last common ancestor of eukaryotes had mitochondria, it appears that the complex relationship between mitochondria and their host cell continues to evolve.
Plastids
Some groups of eukaryotes are photosynthetic. Their cells contain, in addition to the standard eukaryotic organelles, another kind of organelle called a plastid. When such cells are carrying out photosynthesis, their plastids are rich in the pigment chlorophyll a and a range of other pigments, called accessory pigments, which are involved in harvesting energy from light. Photosynthetic plastids are called chloroplasts (Figure 23.3).
Figure 23.3 Chloroplasts. (a) This chloroplast cross-section illustrates its elaborate inner membrane organization. Stacks of thylakoid membranes compartmentalize photosynthetic enzymes and provide scaffolding for chloroplast DNA. (b) In this micrograph of Elodea sp., the chloroplasts can be seen as small green spheres. (credit b: modification of work by Brandon Zierer; scale-bar data from Matt Russell)
Like mitochondria, plastids appear to have an endosymbiotic origin. This hypothesis was also proposed and championed with the first direct evidence by Lynn Margulis. We now know that plastids are derived from cyanobacteria that lived inside the cells of an ancestral, aerobic, heterotrophic eukaryote. This is called primary endosymbiosis, and plastids of primary origin are surrounded by two membranes. However, the best evidence is that the acquisition of cyanobacterial endosymbionts has happened twice in the history of eukaryotes. In one case, the common ancestor of the major lineage/supergroup Archaeplastida took on a cyanobacterial endosymbiont; in the other, the ancestor of the small amoeboid rhizarian taxon, Paulinella, took on a different cyanobacterial endosymbiont. Almost all photosynthetic eukaryotes are descended from the first event, and only a couple of species are derived from the other, which in evolutionary terms, appears to be more recent.
Cyanobacteria are a group of Gram-negative bacteria with all the conventional structures of the group. However, unlike most prokaryotes, they have extensive, internal membrane-bound sacs called thylakoids. Chlorophyll is a component of these membranes, as are many of the proteins of the light reactions of photosynthesis. Cyanobacteria also have the peptidoglycan wall and lipopolysaccharide layer associated with Gram-negative bacteria.
Chloroplasts of primary endosymbiotic origin have thylakoids, a circular DNA chromosome, and ribosomes similar to those of cyanobacteria. As in mitochondria, each chloroplast is surrounded by two membranes. The outer membrane is thought to be derived from the enclosing vacuole of the host, and the inner membrane is thought to be derived from the plasma membrane of the cyanobacterial endosymbiont. In the group of Archaeplastida called the glaucophytes and in the rhizarian Paulinella, a thin peptidoglycan layer is still present between the outer and inner plastid membranes. All other plastids lack this relict of the cyanobacterial wall.
There is also, as with the case of mitochondria, strong evidence that many of the genes of the endosymbiont were transferred to the nucleus. Plastids, like mitochondria, cannot live independently outside the host. In addition, like mitochondria, plastids are derived from the division of other plastids and never built from scratch. Researchers have suggested that the endosymbiotic event that led to Archaeplastida occurred 1 to 1.5 billion years ago, at least 5 hundred million years after the fossil record suggests that eukaryotes were present.
Not all plastids in eukaryotes are derived directly from primary endosymbiosis. Some of the major groups of algae became photosynthetic by secondary endosymbiosis, that is, by taking in either green algae or red algae (both from Archaeplastida) as endosymbionts (Figure 23.4). Numerous microscopic and genetic studies have supported this conclusion. Secondary plastids are surrounded by three or more membranes, and some secondary plastids even have clear remnants of the nucleus (nucleomorphs) of endosymbiotic algae. There are even cases where tertiary or higher-order endosymbiotic events are the best explanations for the features of some eukaryotic plastids.
Figure 23.4 Algae. (a) Red algae and (b) green algae (seen here by light microscopy) share similar DNA sequences with photosynthetic cyanobacteria. Scientists speculate that, in a process called endosymbiosis, an ancestral prokaryote engulfed a photosynthetic cyanobacterium that evolved into modern-day chloroplasts. (credit a: modification of work by Ed Bierman; credit b: modification of work by G. Fahnenstiel, NOAA; scale-bar data from Matt Russell)
Visual Connection
Visual Connection
Figure 23.5 The Endosymbiotic Theory. The first eukaryote may have originated from an ancestral prokaryote that had undergone membrane proliferation, compartmentalization of cellular function (into a nucleus, lysosomes, and an endoplasmic reticulum), and the establishment of endosymbiotic relationships with an aerobic prokaryote, and, in some cases, a photosynthetic prokaryote, to form mitochondria and chloroplasts, respectively.
What evidence is there that mitochondria were incorporated into the ancestral eukaryotic cell before chloroplasts?
Evolution Connection
Evolution Connection
Secondary Endosymbiosis in ChlorarachniophytesEndosymbiosis involves one cell engulfing another to produce, over time, a coevolved relationship in which neither cell could survive alone. The chloroplasts of red and green algae, for instance, are derived from the engulfment of a photosynthetic cyanobacterium by an ancestral prokaryote.
This evidence suggests the possibility that an ancestral cell (already containing a photosynthetic endosymbiont) was engulfed by another eukaryote cell, resulting in a secondary endosymbiosis. Molecular and morphological evidence suggest that the chlorarachniophyte protists are derived from a secondary endosymbiotic event. Chlorarachniophytes are rare algae indigenous to tropical seas and sand. They are classified into the Rhizarian supergroup. Chlorarachniophytes are reticulose amoebae, extending thin cytoplasmic strands that interconnect them with other chlorarachniophytes in a cytoplasmic network. These protists are thought to have originated when a eukaryote engulfed a green alga, the latter of which had previously established an endosymbiotic relationship with a photosynthetic cyanobacterium (Figure 23.6).
Figure 23.6 Secondary endosymbiosis. The hypothesized process of several endosymbiotic events leading to the evolution of chlorarachniophytes is shown. In a primary endosymbiotic event, a heterotrophic eukaryote consumed a cyanobacterium. In a secondary endosymbiotic event, the cell resulting from primary endosymbiosis was consumed by a second cell. The resulting organelle became a plastid in modern chlorarachniophytes.
Several lines of evidence support that chlorarachniophytes evolved from secondary endosymbiosis. The chloroplasts contained within the green algal endosymbionts still are capable of photosynthesis, making chlorarachniophytes photosynthetic. The green algal endosymbiont also exhibits a vestigial nucleus. In fact, it appears that chlorarachniophytes are the products of an evolutionarily recent secondary endosymbiotic event. The plastids of chlorarachniophytes are surrounded by four membranes: The first two correspond to the inner and outer membranes of the photosynthetic cyanobacterium, the third corresponds to plasma membrane of the green alga, and the fourth corresponds to the vacuole that surrounded the green alga when it was engulfed by the chlorarachniophyte ancestor. In other lineages that involved secondary endosymbiosis, only three membranes can be identified around plastids. This is currently interpreted as a sequential loss of a membrane during the course of evolution.
The process of secondary endosymbiosis is not unique to chlorarachniophytes. Secondary plastids are also found in the Excavates and the Chromalveolates. In the Excavates, secondary endosymbiosis of green algae led to euglenid protists, while in the Chromalveolates, secondary endosymbiosis of red algae led to the evolution of plastids in dinoflagellates, apicomplexans, and stramenopiles.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.03%3A_Protists/5.3.02%3A_Eukaryotic_Origins.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the cell structure characteristics of protists
• Describe the metabolic diversity of protists
• Describe the life cycle diversity of protists
There are over 100,000 described living species of protists, and it is unclear how many undescribed species may exist. Since many protists live as commensals or parasites in other organisms and these relationships are often species-specific, there is a huge potential for protist diversity that matches the diversity of their hosts. Because the name "protist" serves as a catchall term for eukaryotic organisms that are not animal, plant, or fungi, it is not surprising that very few characteristics are common to all protists. On the other hand, familiar characteristics of plants and animals are foreshadowed in various protists.
Cell Structure
The cells of protists are among the most elaborate of all cells. Multicellular plants, animals, and fungi are embedded among the protists in eukaryotic phylogeny. In most plants and animals and some fungi, complexity arises out of multicellularity, tissue specialization, and subsequent interaction because of these features. Although a rudimentary form of multicellularity exists among some of the organisms labelled as “protists,” those that have remained unicellular show how complexity can evolve in the absence of true multicellularity, with the differentiation of cellular morphology and function. A few protists live as colonies that behave in some ways as a group of free-living cells and in other ways as a multicellular organism. Some protists are composed of enormous, multinucleate, single cells that look like amorphous blobs of slime, or in other cases, like ferns. In some species of protists, the nuclei are different sizes and have distinct roles in protist cell function.
Single protist cells range in size from less than a micrometer to three meters in length to hectares! Protist cells may be enveloped by animal-like cell membranes or plant-like cell walls. Others are encased in glassy silica-based shells or wound with pellicles of interlocking protein strips. The pellicle functions like a flexible coat of armor, preventing the protist from being torn or pierced without compromising its range of motion.
Metabolism
Protists exhibit many forms of nutrition and may be aerobic or anaerobic. Those that store energy by photosynthesis belong to a group of photoautotrophs and are characterized by the presence of chloroplasts. Other protists are heterotrophic and consume organic materials (such as other organisms) to obtain nutrition. Amoebas and some other heterotrophic protist species ingest particles by a process called phagocytosis, in which the cell membrane engulfs a food particle and brings it inward, pinching off an intracellular membranous sac, or vesicle, called a food vacuole (Figure 23.7). In some protists, food vacuoles can be formed anywhere on the body surface, whereas in others, they may be restricted to the base of a specialized feeding structure. The vesicle containing the ingested particle, the phagosome, then fuses with a lysosome containing hydrolytic enzymes to produce a phagolysosome, and the food particle is broken down into small molecules that can diffuse into the cytoplasm and be used in cellular metabolism. Undigested remains ultimately are expelled from the cell via exocytosis.
Figure 23.7 Phagocytosis. The stages of phagocytosis include the engulfment of a food particle, the digestion of the particle using hydrolytic enzymes contained within a lysosome, and the expulsion of undigested materials from the cell.
Subtypes of heterotrophs, called saprobes, absorb nutrients from dead organisms or their organic wastes. Some protists can function as mixotrophs, obtaining nutrition by photoautotrophic or heterotrophic routes, depending on whether sunlight or organic nutrients are available.
Motility
The majority of protists are motile, but different types of protists have evolved varied modes of movement (Figure 23.8). Some protists have one or more flagella, which they rotate or whip. Others are covered in rows or tufts of tiny cilia that they beat in a coordinated manner to swim. Still others form cytoplasmic extensions called pseudopodia anywhere on the cell, anchor the pseudopodia to a substrate, and pull themselves forward. Some protists can move toward or away from a stimulus, a movement referred to as taxis. For example, movement toward light, termed phototaxis, is accomplished by coupling their locomotion strategy with a light-sensing organ.
Figure 23.8 Locomotor organelles in protists. Protists use various methods for transportation. (a) Paramecium waves hair-like appendages called cilia to propel itself. (b) Amoeba uses lobe-like pseudopodia to anchor itself to a solid surface and pull itself forward. (c) Euglena uses a whip-like tail called a flagellum to propel itself.
Life Cycles
Protists reproduce by a variety of mechanisms. Most undergo some form of asexual reproduction, such as binary fission, to produce two daughter cells. In protists, binary fission can be divided into transverse or longitudinal, depending on the axis of orientation; sometimes Paramecium exhibits this method. Some protists such as the true slime molds exhibit multiple fission and simultaneously divide into many daughter cells. Others produce tiny buds that go on to divide and grow to the size of the parental protist.
Sexual reproduction, involving meiosis and fertilization, is common among protists, and many protist species can switch from asexual to sexual reproduction when necessary. Sexual reproduction is often associated with periods when nutrients are depleted or environmental changes occur. Sexual reproduction may allow the protist to recombine genes and produce new variations of progeny, some of which may be better suited to surviving changes in a new or changing environment. However, sexual reproduction is often associated with resistant cysts that are a protective, resting stage. Depending on habitat of the species, the cysts may be particularly resistant to temperature extremes, desiccation, or low pH. This strategy allows certain protists to “wait out” stressors until their environment becomes more favorable for survival or until they are carried (such as by wind, water, or transport on a larger organism) to a different environment, because cysts exhibit virtually no cellular metabolism.
Protist life cycles range from simple to extremely elaborate. Certain parasitic protists have complicated life cycles and must infect different host species at different developmental stages to complete their life cycle. Some protists are unicellular in the haploid form and multicellular in the diploid form, a strategy employed by animals. Other protists have multicellular stages in both haploid and diploid forms, a strategy called alternation of generations, analogous to that used by plants.
Habitats
Nearly all protists exist in some type of aquatic environment, including freshwater and marine environments, damp soil, and even snow. Several protist species are parasites that infect animals or plants. A few protist species live on dead organisms or their wastes, and contribute to their decay.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.03%3A_Protists/5.3.03%3A_Characteristics_of_Protists.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe representative protist organisms from each of the six presently recognized supergroups of eukaryotes
• Identify the evolutionary relationships of plants, animals, and fungi within the six presently recognized supergroups of eukaryotes
• Identify defining features of protists in each of the six supergroups of eukaryotes.
In the span of several decades, the Kingdom Protista has been disassembled because sequence analyses have revealed new genetic (and therefore evolutionary) relationships among these eukaryotes. Moreover, protists that exhibit similar morphological features may have evolved analogous structures because of similar selective pressures—rather than because of recent common ancestry. This phenomenon, called convergent evolution, is one reason why protist classification is so challenging. The emerging classification scheme groups the entire domain Eukarya into six “supergroups” that contain all of the protists as well as animals, plants, and fungi that evolved from a common ancestor (Figure 23.9). Each of the supergroups is believed to be monophyletic, meaning that all organisms within each supergroup are believed to have evolved from a single common ancestor, and thus all members are most closely related to each other than to organisms outside that group. There is still evidence lacking for the monophyly of some groups. Each supergroup can be viewed as representing one of many variants on eukaryotic cell structure. In each group, one or more of the defining characters of the eukaryotic cell—the nucleus, the cytoskeleton, and the endosymbiotic organelles—may have diverged from the "typical" pattern.
Figure 23.9 Eukaryotic supergroups. This diagram shows a proposed classification of the domain Eukarya. Currently, the domain Eukarya is divided into six supergroups. Within each supergroup are multiple kingdoms. Although each supergroup is believed to be monophyletic, the dotted lines suggest evolutionary relationships among the supergroups that continue to be debated.
Keep in mind that the classification scheme presented here represents just one of several hypotheses, and the true evolutionary relationships are still to be determined. The six supergroups may be modified or replaced by a more appropriate hierarchy as genetic, morphological, and ecological data accumulate. When learning about protists, it is helpful to focus less on the nomenclature and more on the commonalities and differences that illustrate how each group has exploited the possibilities of eukaryotic life.
Archaeplastida
Molecular evidence supports the hypothesis that all Archaeplastida are descendents of an endosymbiotic relationship between a heterotrophic protist and a cyanobacterium. The protist members of the group include the red algae and green algae. It was from a common ancestor of these protists that the land plants evolved, since their closest relatives are found in this group. The red and green algae include unicellular, multicellular, and colonial forms. A variety of algal life cycles exists, but the most complex is alternation of generations, in which both haploid and diploid stages are multicellular. A diploid sporophyte contains cells that undergo meiosis to produce haploid spores. The spores germinate and grow into a haploid gametophyte, which then makes gametes by mitosis. The gametes fuse to form a zygote that grows into a diploid sporophyte. Alternation of generations is seen in some species of Archaeplastid algae, as well as some species of Stramenopiles (Figure 23.10). In some species, the gametophyte and sporophyte look quite different, while in others they are nearly indistinguishable.
Glaucophytes
Glaucophytes are a small group of Archaeplastida interesting because their chloroplasts retain remnants of the peptidoglycan cell wall of the ancestral cyanobacterial endosymbiont (Figure 23.10).
Figure 23.10 Glaucocystis. (credit: By ja:User:NEON / commons:User:NEON_ja - Own work, CC BY-SA 2.5, https://commons.wikimedia.org/w/index.php?curid=1706641)
Red Algae
Red algae, or rhodophytes lack flagella, and are primarily multicellular, although they range in size from microscopic, unicellular protists to large, multicellular forms grouped into the informal seaweed category. Red algae have a second cell wall outside an inner cellulose cell wall. Carbohydrates in this wall are the source of agarose used for electrophoresis gels and agar for solidifying bacterial media. The "red" in the red algae comes from phycoerythrins, accessory photopigments that are red in color and obscure the green tint of chlorophyll in some species. Other protists classified as red algae lack phycoerythrins and are parasites. Both the red algae and the glaucophytes store carbohydrates in the cytoplasm rather than in the plastid. Red algae are common in tropical waters where they have been detected at depths of 260 meters. Other red algae exist in terrestrial or freshwater environments. The red algae life cycle is an unusual alternation of generations that includes two sporophyte phases, with meiosis occurring only in the second sporophyte.
Green Algae: Chlorophytes and Charophytes
The most abundant group of algae is the green algae. The green algae exhibit features similar to those of the land plants, particularly in terms of chloroplast structure. In both green algae and plants, carbohydrates are stored in the plastid. That this group of protists shared a relatively recent common ancestor with land plants is well supported. The green algae are subdivided into the chlorophytes and the charophytes. The charophytes are the closest living relatives to land plants and resemble them in morphology and reproductive strategies. The familiar Spirogyra is a charophyte. Charophytes are common in wet habitats, and their presence often signals a healthy ecosystem.
The chlorophytes exhibit great diversity of form and function. Chlorophytes primarily inhabit freshwater and damp soil, and are a common component of plankton. Chlamydomonas is a simple, unicellular chlorophyte with a pear-shaped morphology and two opposing, anterior flagella that guide this protist toward light sensed by its eyespot. More complex chlorophyte species exhibit haploid gametes and spores that resemble Chlamydomonas.
The chlorophyte Volvox is one of only a few examples of a colonial organism, which behaves in some ways like a collection of individual cells, but in other ways like the specialized cells of a multicellular organism (Figure 23.11). Volvox colonies contain 500 to 60,000 cells, each with two flagella, contained within a hollow, spherical matrix composed of a gelatinous glycoprotein secretion. Individual cells in a Volvox colony move in a coordinated fashion and are interconnected by cytoplasmic bridges. Only a few of the cells reproduce to create daughter colonies, an example of basic cell specialization in this organism. Daughter colonies are produced with their flagella on the inside and have to evert as they are released.
Figure 23.11 Volvox. Volvox aureus is a green alga in the supergroup Archaeplastida. This species exists as a colony, consisting of cells immersed in a gel-like matrix and intertwined with each other via hair-like cytoplasmic extensions. (credit: Dr. Ralf Wagner)
True multicellular organisms, such as the sea lettuce, Ulva, are also represented among the chlorophytes. In addition, some chlorophytes exist as large, multinucleate, single cells. Species in the genus Caulerpa exhibit flattened fern-like foliage and can reach lengths of 3 meters (Figure 23.12). Caulerpa species undergo nuclear division, but their cells do not complete cytokinesis, remaining instead as massive and elaborate single cells.
Figure 23.12 A multinucleate alga. Caulerpa taxifolia is a chlorophyte consisting of a single cell containing potentially thousands of nuclei. (credit: NOAA). An interesting question is how a single cell can produce such complex shapes.
Link to Learning
Link to Learning
Take a look at this video to see cytoplasmic streaming in a green alga.
Amoebozoa
Like the Archaeplastida, the Amoebozoa include species with single cells, species with large multinucleated cells, and species that have multicellular phases. Amoebozoan cells characteristically exhibit pseudopodia that extend like tubes or flat lobes. These pseudopods project outward from anywhere on the cell surface and can anchor to a substrate. The protist then transports its cytoplasm into the pseudopod, thereby moving the entire cell. This type of motion is similar to the cytoplasmic streaming used to move organelles in the Archaeplastida, and is also used by other protists as a means of locomotion or as a method to distribute nutrients and oxygen. The Amoebozoa include both free-living and parasitic species.
Gymnomoebae
The Gymnamoeba or lobose amoebae include both naked amoebae like the familiar Amoeba proteus and shelled amoebae, whose bodies protrude like snails from their protective tests. Amoeba proteus is a large amoeba about 500 µm in diameter but is dwarfed by the multinucleate amoebae Pelomyxa, which can be 10 times its size. Although Pelomyxa may have hundreds of nuclei, it has lost its mitochondria, but replaced them with bacterial endosymbionts. The secondary loss or modification of mitochondria is a feature also seen in other protist groups.
Figure 23.13 Amoeba. Amoebae with tubular and lobe-shaped pseudopodia are seen under a microscope. These isolates would be morphologically classified as amoebozoans.
Slime Molds
A subset of the amoebozoans, the slime molds, has several morphological similarities to fungi that are thought to be the result of convergent evolution. For instance, during times of stress, some slime molds develop into spore-generating fruiting bodies, much like fungi.
The slime molds are categorized on the basis of their life cycles into plasmodial or cellular types. Plasmodial slime molds are composed of large, multinucleate cells and move along surfaces like an amorphous blob of slime during their feeding stage (Figure 23.14). Food particles are lifted and engulfed into the slime mold as it glides along. The "dog vomit" slime mold seen in Figure 23.14 is a particularly colorful specimen and its ability to creep about might well trigger suspicion of alien invasion. Upon maturation, the plasmodium takes on a net-like appearance with the ability to form fruiting bodies, or sporangia, during times of stress. Haploid spores are produced by meiosis within the sporangia, and spores can be disseminated through the air or water to potentially land in more favorable environments. If this occurs, the spores germinate to form ameboid or flagellate haploid cells that can combine with each other and produce a diploid zygotic slime mold to complete the life cycle.
Figure 23.14 Plasmodial slime molds. The life cycle of the plasmodial slime mold is shown. The brightly colored plasmodium in the inset photo is a single-celled, multinucleate mass. (credit: modification of work by Dr. Jonatha Gott and the Center for RNA Molecular Biology, Case Western Reserve University)
The cellular slime molds function as independent amoeboid cells when nutrients are abundant. When food is depleted, cellular slime molds aggregate into a mass of cells that behaves as a single unit, called a slug. Some cells in the slug contribute to a 2–3-millimeter stalk, drying up and dying in the process. Cells atop the stalk form an asexual fruiting body that contains haploid spores (Figure 23.15). As with plasmodial slime molds, the spores are disseminated and can germinate if they land in a moist environment. One representative genus of the cellular slime molds is Dictyostelium, which commonly exists in the damp soil of forests.
Figure 23.15 Cellular Slime Mold. The image shows several stages in the life cycle of Dictyostelium discoideum, including aggregated cells, mobile slugs and their transformation into fruiting bodies with a cluster of spores supported by a stalk. (credit: By Usman Bashir (Own work) [CC BY-SA 4.0 (http://creativecommons.org/licenses/by-sa/4.0)], via Wikimedia Commons)
Link to Learning
Link to Learning
View this video to see the formation of a fruiting body by a cellular slime mold.
Opisthokonta
The Opisthokonts are named for the single posterior flagellum seen in flagellated cells of the group. The flagella of other protists are anterior and their movement pulls the cells along, while the opisthokonts are pushed. Protist members of the opisthokonts include the animal-like choanoflagellates, which are believed to resemble the common ancestor of sponges and perhaps, all animals. Choanoflagellates include unicellular and colonial forms (Figure 23.16), and number about 244 described species. In these organisms, the single, apical flagellum is surrounded by a contractile collar composed of microvilli. The collar is used to filter and collect bacteria for ingestion by the protist. A similar feeding mechanism is seen in the collar cells of sponges, which suggests a possible connection between choanoflagellates and animals.
The Mesomycetozoa form a small group of parasites, primarily of fish, and at least one form that can parasitize humans. Their life cycles are poorly understood. These organisms are of special interest, because they appear to be so closely related to animals. In the past, they were grouped with fungi and other protists based on their morphology.
Figure 23.16 A Colonial Choanoflagellate. (credit: By Dhzanette (http://en.Wikipedia.org/wiki/Choanoflagellate) [Public domain], via Wikimedia Commons)
The previous supergroups are all the products of primary endosymbiontic events and their organelles—nucleus, mitochondria, and chloroplasts—are what would be considered "typical," i.e., matching the diagrams you would find in an introductory biology book. The next three supergroups all contain at least some photosynthetic members whose chloroplasts were derived by secondary endosymbiosis. They also show some interesting variations in nuclear structure, and modification of mitochondria or chloroplasts.
Rhizaria
The Rhizaria supergroup includes many of the amoebas with thin threadlike, needle-like or root-like pseudopodia (Figure 23.17), rather than the broader lobed pseudopodia of the Amoebozoa. Many rhizarians make elaborate and beautiful tests—armor-like coverings for the body of the cell—composed of calcium carbonate, silicon, or strontium salts. Rhizarians have important roles in both carbon and nitrogen cycles. When rhizarians die, and their tests sink into deep water, the carbonates are out of reach of most decomposers, locking carbon dioxide away from the atmosphere. In general, this process by which carbon is transported deep into the ocean is described as the biological carbon pump, because carbon is “pumped” to the ocean depths where it is inaccessible to the atmosphere as carbon dioxide. The biological carbon pump is a crucial component of the carbon cycle that maintains lower atmospheric carbon dioxide levels. Foraminiferans are unusual in that they are the only eukaryotes known to participate in the nitrogen cycle by denitrification, an activity usually served only by prokaryotes.
Figure 23.17 Rhizaria. Ammonia tepida, a Rhizaria species viewed here using phase contrast light microscopy, exhibits many threadlike pseudopodia. It also has a chambered calcium carbonate shell or test. (credit: modification of work by Scott Fay, UC Berkeley; scale-bar data from Matt Russell)
Foraminiferans
Foraminiferans, or forams, are unicellular heterotrophic protists, ranging from approximately 20 micrometers to several centimeters in length, and occasionally resembling tiny snails (Figure 23.18). As a group, the forams exhibit porous shells, called tests that are built from various organic materials and typically hardened with calcium carbonate. The tests may house photosynthetic algae, which the forams can harvest for nutrition. Foram pseudopodia extend through the pores and allow the forams to move, feed, and gather additional building materials. Typically, forams are associated with sand or other particles in marine or freshwater habitats. Foraminiferans are also useful as indicators of pollution and changes in global weather patterns.
Figure 23.18 Foraminiferan Tests. These shells from foraminifera sank to the sea floor. (credit: Deep East 2001, NOAA/OER)
Radiolarians
A second subtype of Rhizaria, the radiolarians, exhibit intricate exteriors of glassy silica with radial or bilateral symmetry (Figure 23.19). Needle-like pseudopods supported by microtubules radiate outward from the cell bodies of these protists and function to catch food particles. The shells of dead radiolarians sink to the ocean floor, where they may accumulate in 100 meter-thick depths. Preserved, sedimented radiolarians are very common in the fossil record.
Figure 23.19 Radiolarian shell. This fossilized radiolarian shell was imaged using a scanning electron microscope. (credit: modification of work by Hannes Grobe, Alfred Wegener Institute; scale-bar data from Matt Russell)
Cercozoa
The Cercozoa are both morphologically and metabolically diverse, and include both naked and shelled forms. The Chlorarachniophytes (Figure 23.20) are photosynthetic, having acquired chloroplasts by secondary endosymbiosis. The chloroplast contains a remnant of the chlorophyte endosymbiont nucleus, sandwiched between the two sets of chloroplast membranes. Vampyrellids or "vampire amoebae," as their name suggests, obtain their nutrients by thrusting a pseudopod into the interior of other cells and sucking out their contents.
Figure 23.20 A Chlorarachniophyte. This rhizarian is mixotrophic, and can obtain nutrients both by photosynthesis and by trapping various microorganisms with its network of pseudopodia. (credit: By ja:User:NEON / commons:User:NEON_ja (Own work) [CC BY-SA 2.5 (http://creativecommons.org/licenses/by-sa/2.5) or CC BY-SA 2.5 (http://creativecommons.org/licenses/by-sa/2.5)], via Wikimedia Commons)
Chromalveolata
Current evidence suggests that species classified as chromalveolates are derived from a common ancestor that engulfed a photosynthetic red algal cell, which itself had already evolved chloroplasts from an endosymbiotic relationship with a photosynthetic prokaryote. Therefore, the ancestor of chromalveolates is believed to have resulted from a secondary endosymbiotic event. However, some chromalveolates appear to have lost red alga-derived plastid organelles or lack plastid genes altogether. Therefore, this supergroup should be considered a hypothesis-based working group that is subject to change. Chromalveolates include very important photosynthetic organisms, such as diatoms, brown algae, and significant disease agents in animals and plants. The chromalveolates can be subdivided into alveolates and stramenopiles.
Alveolates: Dinoflagellates, Apicomplexians, and Ciliates
A large body of data supports that the alveolates are derived from a shared common ancestor. The alveolates are named for the presence of an alveolus, or membrane-enclosed sac, beneath the cell membrane. The exact function of the alveolus is unknown, but it may be involved in osmoregulation. The alveolates are further categorized into some of the better-known protists: the dinoflagellates, the apicomplexans, and the ciliates.
Dinoflagellates exhibit extensive morphological diversity and can be photosynthetic, heterotrophic, or mixotrophic. The chloroplast of photosynthetic dinoflagellates was derived by secondary endosymbiosis of a red alga. Many dinoflagellates are encased in interlocking plates of cellulose. Two perpendicular flagella fit into the grooves between the cellulose plates, with one flagellum extending longitudinally and a second encircling the dinoflagellate (Figure 23.21). Together, the flagella contribute to the characteristic spinning motion of dinoflagellates. These protists exist in freshwater and marine habitats, and are a component of plankton, the typically microscopic organisms that drift through the water and serve as a crucial food source for larger aquatic organisms.
Figure 23.21 Dinoflagellates. The dinoflagellates exhibit great diversity in shape. Many are encased in cellulose armor and have two flagella that fit in grooves between the plates. Movement of these two perpendicular flagella causes a spinning motion.
Dinoflagellates have a nuclear variant called a dinokaryon. The chromosomes in the dinokaryon are highly condensed throughout the cell cycle and do not have typical histones. Mitosis in dinoflagellates is closed, that is, the spindle separates the chromosomes from outside of the nucleus without breakdown of the nuclear envelope.
Some dinoflagellates generate light, called bioluminescence, when they are jarred or stressed. Large numbers of marine dinoflagellates (billions or trillions of cells per wave) can emit light and cause an entire breaking wave to twinkle or take on a brilliant blue color (Figure 23.22). For approximately 20 species of marine dinoflagellates, population explosions (also called blooms) during the summer months can tint the ocean with a muddy red color. This phenomenon is called a red tide, and it results from the abundant red pigments present in dinoflagellate plastids. In large quantities, these dinoflagellate species secrete an asphyxiating toxin that can kill fish, birds, and marine mammals. Red tides can be massively detrimental to commercial fisheries, and humans who consume these protists may become poisoned.
Figure 23.22 Dinoflagellate bioluminescence. Bioluminescence is emitted from dinoflagellates in a breaking wave, as seen from the New Jersey coast. (credit: “catalano82”/Flickr)
The apicomplexan protists are named for a structure called an apical complex (Figure 23.23), which appears to be a highly modified secondary chloroplast. The apicoplast genome is similar to those of dinoflagellate chloroplasts. The apical complex is specialized for entry and infection of host cells. Indeed, all apicomplexans are parasitic. This group includes the genus Plasmodium, which causes malaria in humans. Apicomplexan life cycles are complex, involving multiple hosts and stages of sexual and asexual reproduction.
Figure 23.23 Apicomplexa. (a) Apicomplexans are parasitic protists. They have a characteristic apical complex that enables them to infect host cells. (b) Plasmodium, the causative agent of malaria, has a complex life cycle typical of apicomplexans. (credit b: modification of work by CDC)
The ciliates, which include Paramecium and Tetrahymena, are a group of protists 10 to 3,000 micrometers in length that are covered in rows, tufts, or spirals of tiny cilia. By beating their cilia synchronously or in waves, ciliates can coordinate directed movements and ingest food particles. Certain ciliates have fused cilia-based structures that function like paddles, funnels, or fins. Ciliates also are surrounded by a pellicle, providing protection without compromising agility. The genus Paramecium includes protists that have organized their cilia into a plate-like primitive mouth, called an oral groove, which is used to capture and digest bacteria (Figure 23.24). Food captured in the oral groove enters a food vacuole, where it combines with digestive enzymes. Waste particles are expelled by an exocytic vesicle that fuses at a specific region on the cell membrane, called the anal pore. In addition to a vacuole-based digestive system, Paramecium also uses contractile vacuoles, which are osmoregulatory vesicles that fill with water as it enters the cell by osmosis and then contract to squeeze water from the cell. Ciliates therefore exhibit considerable structural complexity without having achieved multicellularity.
Figure 23.24 Paramecium. Paramecium has a primitive mouth (called an oral groove) to ingest food, and an anal pore to eliminate waste. Contractile vacuoles allow the organism to excrete excess water. Cilia enable the organism to move. (credit “paramecium micrograph”: modification of work by NIH; scale-bar data from Matt Russell)
Link to Learning
Link to Learning
Watch the video of the contractile vacuole of Paramecium expelling water to keep the cell osmotically balanced.
Paramecium has two nuclei, a macronucleus and a micronucleus, in each cell. The micronucleus is essential for sexual reproduction, and is in many ways a typical eukaryotic nucleus, except that its genes are not transcribed. The transcribed nucleus is the macronucleus, which directs asexual binary fission and all other biological functions. The macronucleus is a multiploid nucleus constructed from the micronucleus during sexual reproduction. Periodic reconstruction of the macronucleus is necessary because the macronucleus divides amitotically, and thus becomes genetically unbalanced over a period of successive cell replications. Paramecium and most other ciliates reproduce sexually by conjugation. This process begins when two different mating types of Paramecium make physical contact and join with a cytoplasmic bridge (Figure 23.25). The diploid micronucleus in each cell then undergoes meiosis to produce four haploid micronuclei. Three of these degenerate in each cell, leaving one micronucleus that then undergoes mitosis, generating two haploid micronuclei. The cells each exchange one of these haploid nuclei and move away from each other. Fusion of the haploid micronuclei generates a completely novel diploid pre-micronucleus in each conjugative cell. This pre-micronucleus undergoes three rounds of mitosis to produce eight copies, and the original macronucleus disintegrates. Four of the eight pre-micronuclei become full-fledged micronuclei, whereas the other four perform multiple rounds of DNA replication. The copies of the micronuclear chromosomes are severely edited to form hundreds of smaller chromosomes that contain only the protein coding genes. Each of these smaller chromosomes gets new telomeres as the macronucleus differentiates. Two cycles of cell division then yield four new Paramecia from each original conjugative cell.
Visual Connection
Visual Connection
Figure 23.25 Conjugation in Paramecium. The complex process of sexual reproduction in Paramecium creates eight daughter cells from two original cells. Each cell has a macronucleus and a micronucleus. During sexual reproduction, the macronucleus dissolves and is replaced by a micronucleus. (credit “micrograph”: modification of work by Ian Sutton; scale-bar data from Matt Russell)
Which of the following statements about Paramecium sexual reproduction is false?
1. The macronuclei are derived from micronuclei.
2. Both mitosis and meiosis occur during sexual reproduction.
3. The conjugate pair swaps macronucleii.
4. Each parent produces four daughter cells.
Stramenopiles: Diatoms, Brown Algae, Golden Algae and Oomycetes
The other subgroup of chromalveolates, the stramenopiles, includes photosynthetic marine algae and heterotrophic protists. The chloroplast of these algae is derived from red alga. The identifying feature of this group is the presence of a textured, or “hairy,” flagellum. Many stramenopiles also have an additional flagellum that lacks hair-like projections (Figure 23.26). Members of this subgroup range in size from single-celled diatoms to the massive and multicellular kelp.
Figure 23.26 Stramenopile flagella. This stramenopile cell has a single hairy flagellum and a secondary smooth flagellum.
The diatoms are unicellular photosynthetic protists that encase themselves in intricately patterned, glassy cell walls composed of silicon dioxide in a matrix of organic particles (Figure 23.27). These protists are a component of freshwater and marine plankton. Most species of diatoms reproduce asexually, although some instances of sexual reproduction and sporulation also exist. Some diatoms exhibit a slit in their silica shell, called a raphe. By expelling a stream of mucopolysaccharides from the raphe, the diatom can attach to surfaces or propel itself in one direction.
Figure 23.27 Diatoms. Assorted diatoms, visualized here using light microscopy, live among annual sea ice in McMurdo Sound, Antarctica. Diatoms range in size from 2 to 200 µm. (credit: Prof. Gordon T. Taylor, Stony Brook University, NSF, NOAA)
During periods of nutrient availability, diatom populations bloom to numbers greater than can be consumed by aquatic organisms. The excess diatoms die and sink to the sea floor where they are not easily reached by saprobes that feed on dead organisms. As a result, the carbon dioxide that the diatoms had consumed and incorporated into their cells during photosynthesis is not returned to the atmosphere. Along with rhizarians and other shelled protists, diatoms help to maintain a balanced carbon cycle.
Like diatoms, golden algae are largely unicellular, although some species can form large colonies. Their characteristic gold color results from their extensive use of carotenoids, a group of photosynthetic pigments that are generally yellow or orange in color. Golden algae are found in both freshwater and marine environments, where they form a major part of the plankton community.
The brown algae are primarily marine, multicellular organisms that are known colloquially as seaweeds. Giant kelps are a type of brown alga. Some brown algae have evolved specialized tissues that resemble terrestrial plants, with root-like holdfasts, stem-like stipes, and leaf-like blades that are capable of photosynthesis. The stipes of giant kelps are enormous, extending in some cases for 60 meters. Like the green algae, brown algae have a variety of life cycles, including alternation of generations. In the brown algae genus Laminaria, haploid spores develop into multicellular gametophytes, which produce haploid gametes that combine to produce diploid organisms that then become multicellular organisms with a different structure from the haploid form (Figure 23.28).
Visual Connection
Visual Connection
Figure 23.28 Alternation of generations in a brown alga. Several species of brown algae, such as the Laminaria shown here, have evolved life cycles in which both the haploid (gametophyte) and diploid (sporophyte) forms are multicellular. The gametophyte is different in structure than the sporophyte. (credit “laminaria photograph”: modification of work by Claire Fackler, CINMS, NOAA Photo Library)
Which of the following statements about the Laminaria life cycle is false?
1. 1n zoospores form in the sporangia.
2. The sporophyte is the 2n plant.
3. The gametophyte is diploid.
4. Both the gametophyte and sporophyte stages are multicellular.
The water molds, oomycetes (“egg fungus”), were so-named based on their fungus-like morphology, but molecular data have shown that the water molds are not closely related to fungi. The oomycetes are characterized by a cellulose-based cell wall and an extensive network of filaments that allow for nutrient uptake. As diploid spores, many oomycetes have two oppositely directed flagella (one hairy and one smooth) for locomotion. The oomycetes are nonphotosynthetic and include many saprobes and parasites. The saprobes appear as white fluffy growths on dead organisms (Figure 23.29). Most oomycetes are aquatic, but some parasitize terrestrial plants. One plant pathogen is Phytophthora infestans, the causative agent of late blight of potatoes, such as occurred in the nineteenth century Irish potato famine.
Figure 23.29 Oomycetes. A saprobic oomycete engulfs a dead insect. (credit: modification of work by Thomas Bresson)
Excavata
Many of the protist species classified into the supergroup Excavata are asymmetrical, single-celled organisms with a feeding groove “excavated” from one side. This supergroup includes heterotrophic predators, photosynthetic species, and parasites. Its subgroups are the diplomonads, parabasalids, and euglenozoans. The group includes a variety of modified mitochondria, as well as chloroplasts derived from green algae by secondary endosymbiosis. Many of the euglenozoans are free-living, but most diplomonads and parabasalids are symbionts or parasites.
Diplomonads
Among the Excavata are the diplomonads, which include the intestinal parasite, Giardia lamblia (Figure 23.30). Until recently, these protists were believed to lack mitochondria. Mitochondrial remnant organelles, called mitosomes, have since been identified in diplomonads, but although these mitosomes are essentially nonfunctional as respiratory organelles, they do function in iron and sulfur metabolism. Diplomonads exist in anaerobic environments and use alternative pathways, such as glycolysis, to generate energy. Each diplomonad cell has two similar, but not identical haploid nuclei. Diplomonads have four pairs of locomotor flagella that are fairly deeply rooted in basal bodies that lie between the two nuclei.
Figure 23.30 Giardia. The mammalian intestinal parasite Giardia lamblia, visualized here using scanning electron microscopy, is a waterborne protist that causes severe diarrhea when ingested. (credit: modification of work by Janice Carr, CDC; scale-bar data from Matt Russell)
Parabasalids
A second Excavata subgroup, the parabasalids, are named for the parabasal apparatus, which consists of a Golgi complex associated with cytoskeletal fibers. Other cytoskeletal features include an axostyle, a bundle of fibers that runs the length of the cell and may even extend beyond it. Parabasalids move with flagella and membrane rippling, and these and other cytoskeletal modifications may assist locomotion. Like the diplomonads, the parabasalids exhibit modified mitochondria. In parabasalids these structures function anaerobically and are called hydrogenosomes because they produce hydrogen gas as a byproduct.
The parabasalid Trichomonas vaginalis causes trichomoniasis, a sexually transmitted disease in humans, which appears in an estimated 180 million cases worldwide each year. Whereas males rarely exhibit symptoms during an infection with this protist, infected females may become more susceptible to secondary infection with human immunodeficiency virus (HIV) and may be more likely to develop cervical cancer. Pregnant people infected with T. vaginalis are at an increased risk of serious complications, such as pre-term delivery.
Some of the most complex of the parabasalids are those that colonize the rumen of ruminant animals and the guts of termites. These organisms can digest cellulose, a metabolic talent that is unusual among eukaryotic cells. They have multiple flagella arranged in complex patterns and some additionally recruit spirochetes that attach to their surface to act as accessory locomotor structures.
Link to Learning
Link to Learning
Termite gut endosymbionts
Euglenozoans
Euglenozoans includes parasites, heterotrophs, autotrophs, and mixotrophs, ranging in size from 10 to 500 µm. Euglenoids move through their aquatic habitats using two long flagella that guide them toward light sources sensed by a primitive ocular organ called an eyespot. The familiar genus, Euglena, encompasses some mixotrophic species that display a photosynthetic capability only when light is present. The chloroplast of Euglena descends from a green alga by secondary endosymbiosis. In the dark, the chloroplasts of Euglena shrink up and temporarily cease functioning, and the cells instead take up organic nutrients from their environment. Euglena has a tough pellicle composed of bands of protein attached to the cytoskeleton. The bands spiral around the cell and give Euglena its exceptional flexibility.
The human parasite, Trypanosoma brucei, belongs to a different subgroup of Euglenozoa, the kinetoplastids. The kinetoplastid subgroup is named after the kinetoplast, a large modified mitochondrion carrying multiple circular DNAs. This subgroup includes several parasites, collectively called trypanosomes, which cause devastating human diseases and infect an insect species during a portion of their life cycle. T. brucei develops in the gut of the tsetse fly after the fly bites an infected human or other mammalian host. The parasite then travels to the insect salivary glands to be transmitted to another human or other mammal when the infected tsetse fly consumes another blood meal. T. brucei is common in central Africa and is the causative agent of African sleeping sickness, a disease associated with severe chronic fatigue, coma, and can be fatal if left untreated since it leads to progressive decline of the function of the central nervous system.
Figure 23.31 Sleeping sickness. Trypanosoma brucei, the causative agent of sleeping sickness, spends part of its life cycle in the tsetse fly and part in humans. (credit: modification of work by CDC)
Link to Learning
Link to Learning
Watch this video to see T. brucei swimming.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.03%3A_Protists/5.3.04%3A_Groups_of_Protists.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the role that protists play in the ecosystem
• Describe important pathogenic species of protists
Protists function in various ecological niches. Whereas some protist species are essential components of the food chain and generators of biomass, others function in the decomposition of organic materials. Still other protists are dangerous human pathogens or causative agents of devastating plant diseases.
Primary Producers/Food Sources
Protists are essential sources of food and provide nutrition for many other organisms. In some cases, as with zooplankton, protists are consumed directly. Alternatively, photosynthetic protists serve as producers of nutrition for other organisms. Paramecium bursaria and several other species of ciliates are mixotrophic due to a symbiotic relationship with green algae. This is a temporary version of the secondarily endosymbiotic chloroplast found in Euglena. But these symbiotic associations are not restricted to protists. For instance, photosynthetic dinoflagellates called zooxanthellae provide nutrients for the coral polyps (Figure 23.32) that house them, giving corals a boost of energy to secrete their calcium carbonate skeleton. In turn, the corals provide the protist with a protected environment and the compounds needed for photosynthesis. This type of symbiotic relationship is important in nutrient-poor environments. Without dinoflagellate symbionts, corals lose algal pigments in a process called coral bleaching, and they eventually die. This explains why reef-building corals typically do not reside in waters deeper than 20 meters: insufficient light reaches those depths for dinoflagellates to photosynthesize.
Figure 23.32 Coral with symbiotic dinoflagellates. Coral polyps obtain nutrition through a symbiotic relationship with dinoflagellates.
The protists and their products of photosynthesis are essential—directly or indirectly—to the survival of organisms ranging from bacteria to mammals (Figure 23.33). As primary producers, protists feed a large proportion of the world’s aquatic species. (On land, terrestrial plants serve as primary producers.) In fact, approximately 25 percent of the world’s photosynthesis is conducted by photosynthetic protists, particularly dinoflagellates, diatoms, and multicellular algae.
Figure 23.33 Protists contribute to the food chain. Virtually all aquatic organisms depend directly or indirectly on protists for food. (credit “mollusks”: modification of work by Craig Stihler, USFWS; credit “crab”: modification of work by David Berkowitz; credit “dolphin”: modification of work by Mike Baird; credit “fish”: modification of work by Tim Sheerman-Chase; credit “penguin”: modification of work by Aaron Logan)
Protists do not create food sources only for sea-dwelling organisms. Recall that certain anaerobic parabasalid species exist in the digestive tracts of termites and wood-eating cockroaches, where they contribute an essential step in the digestion of cellulose ingested by these insects as they consume wood.
Human Pathogens
As we have seen, a pathogen is anything that causes disease. Parasitic organisms live in or on a host organism and harm the organism. A small number of protists are serious pathogenic parasites that must infect other organisms to survive and propagate. For example, protist parasites include the causative agents of malaria, African sleeping sickness, amoebic encephalitis, and waterborne gastroenteritis in humans. Other protist pathogens prey on plants, effecting massive destruction of food crops.
Plasmodium Species
In 2015 WHO reported over 200 million cases of malaria, mostly in Africa, South America, and southern Asia. However, it is not well known that malaria was also a prevalent and debilitating disease of the North Central region of the United States, particularly Michigan, with its thousands of lakes and numerous swamps. Prior to the civil war, and the drainage of many swamps, virtually everyone who immigrated to Michigan picked up malaria (ague as it was called in the late 1800s), and the pale, sallow, bloated faces of that period were the rule. The only healthy faces were worn by those immigrants who had just arrived. In fact, there were more deaths due to malaria in Michigan than those from the Civil War.
We now know that malaria is caused by several species of the apicomplexan protist genus Plasmodium. Members of Plasmodium must sequentially require both a mosquito and a vertebrate to complete their life cycle. In vertebrates, the parasite develops in liver cells (the exoerythrocytic stage) and goes on to infect red blood cells (the erythrocytic stage), bursting from and destroying the blood cells with each asexual replication cycle (Figure 23.34). Of the four Plasmodium species known to infect humans, P. falciparum accounts for 50 percent of all malaria cases and is the primary (and deadliest) cause of disease-related fatalities in tropical regions of the world. In 2015, it was estimated that malaria caused over 400,000 deaths, mostly in African children. During the course of malaria, P. falciparum can infect and destroy more than one-half of a human’s circulating blood cells, leading to severe anemia. In response to waste products released as the parasites burst from infected blood cells, the host immune system mounts a massive inflammatory response with episodes of delirium-inducing fever (paroxysms) as parasites lyse red blood cells, spilling parasite waste into the bloodstream. P. falciparum is transmitted to humans by the African mosquito, Anopheles gambiae. Techniques to kill, sterilize, or avoid exposure to this highly aggressive mosquito species are crucial to malaria control. Ironically, a type of genetic control has arisen in parts of the world where malaria is endemic. Possession of one copy of the HbS beta globin allele results in malaria resistance. Unfortunately, this allele also has an unfortunate second effect; when homozygous it causes sickle cell disease.
Figure 23.34 Malaria parasite. Red blood cells are shown to be infected with P. falciparum, the causative agent of malaria. In this light microscopic image taken using a 100× oil immersion lens, the ring-shaped P. falciparum stains purple. (credit: modification of work by Michael Zahniser; scale-bar data from Matt Russell)
Link to Learning
Link to Learning
This movie depicts the pathogenesis of Plasmodium falciparum, the causative agent of malaria.
Trypanosomes
Trypanosoma brucei (Figure 23.35), transmitted by tsetse flies (Glossina spp) in Africa, and related flies in South America, is a flagellated endoparasite responsible for the deadly disease nagana in cattle and horses, and for African sleeping sickness in humans. This trypanosome confounds the human immune system by changing its thick layer of surface glycoproteins with each infectious cycle. (The glycoproteins are identified by the immune system as foreign antigens, and a specific antibody defense is mounted against the parasite.) However, T. brucei has thousands of possible antigens, and with each subsequent generation, the protist switches to a glycoprotein coating with a different molecular structure. In this way, T. brucei is capable of replicating continuously without the immune system ever succeeding in clearing the parasite. Without treatment, T. brucei attacks red blood cells, causing the patient to lapse into a coma and eventually die. During epidemic periods, mortality from the disease can be high. Greater surveillance and control measures lead to a reduction in reported cases; some of the lowest numbers reported in 50 years (fewer than 10,000 cases in all of sub-Saharan Africa) have happened since 2009.
Link to Learning
Link to Learning
This movie discusses the pathogenesis of Trypanosoma brucei, the causative agent of African sleeping sickness.
In Latin America, another species of trypanosome, T. cruzi, is responsible for Chagas disease. T. cruzi infections are mainly caused by a blood-sucking “kissing bug” in the genus Triatoma. These “true bugs” bite the host during the night and then defecate on the wound, transmitting the trypanosome to the victim. The victim scratches the wound, further inoculating the site with trypanosomes at the location of the bite. After about 10 weeks, individuals enter the chronic phase but most never develop further symptoms. In about 30 percent of cases, however, the trypanosome causes further damage, especially to the heart and digestive system tissues in the chronic phase of infection, leading to malnutrition and heart failure due to abnormal heart rhythms. An estimated 10 million people are infected with Chagas disease, and it is estimated to cause 10,000-12,000 deaths per year.
Figure 23.35 Trypanosomes. Trypanosomes are shown among red blood cells. (credit: modification of work by Dr. Myron G. Shultz; scale-bar data from Matt Russell)
Plant Parasites
Protist parasites of terrestrial plants include agents that destroy food crops. The oomycete Plasmopara viticola parasitizes grape plants, causing a disease called downy mildew (Figure 23.36). Grape plants infected with P. viticola appear stunted and have discolored, withered leaves. The spread of downy mildew nearly collapsed the French wine industry in the nineteenth century.
Figure 23.36 Protist plant infections. Both downy and powdery mildews on this grape leaf are caused by an infection of P. viticola. (credit: modification of work by USDA)
Phytophthora infestans is an oomycete responsible for potato late blight, which causes potato stalks and stems to decay into black slime (Figure 23.37). Widespread potato blight caused by P. infestans precipitated the well-known Irish potato famine in the nineteenth century that claimed the lives of approximately 1 million people and led to the emigration of at least 1 million more from Ireland. Late blight continues to plague potato crops in certain parts of the United States and Russia, wiping out as much as 70 percent of crops when no pesticides are applied.
Figure 23.37 Potato blight. These unappetizing remnants result from an infection with P. infestans, the causative agent of potato late blight. (credit: USDA)
Protist Decomposers
The fungus-like protist saprobes are specialized to absorb nutrients from nonliving organic matter, such as dead organisms or their wastes. For instance, many types of oomycetes grow on dead animals or algae. Saprobic protists have the essential function of returning inorganic nutrients to the soil and water. This process allows for new plant growth, which in turn generates sustenance for other organisms along the food chain. Indeed, without saprobe species, such as protists, fungi, and bacteria, life would cease to exist as all organic carbon became “tied up” in dead organisms.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.03%3A_Protists/5.3.05%3A_Ecology_of_Protists.txt
|
biological carbon pump
process by which inorganic carbon is fixed by photosynthetic species that then die and fall to the sea floor where they cannot be reached by saprobes and their carbon dioxide consumption cannot be returned to the atmosphere
bioluminescence
generation and emission of light by an organism, as in dinoflagellates
contractile vacuole
vesicle that fills with water (as it enters the cell by osmosis) and then contracts to squeeze water from the cell; an osmoregulatory vesicle
cytoplasmic streaming
movement of cytoplasm into an extended pseudopod such that the entire cell is transported to the site of the pseudopod
endosymbiosis
engulfment of one cell within another such that the engulfed cell survives, and both cells benefit; the process responsible for the evolution of mitochondria and chloroplasts in eukaryotes
endosymbiotic theory
theory that states that eukaryotes may have been a product of one cell engulfing another, one living within another, and evolving over time until the separate cells were no longer recognizable as such
hydrogenosome
organelle carried by parabasalids (Excavata) that functions anaerobically and outputs hydrogen gas as a byproduct; likely evolved from mitochondria
kinetoplast
mass of DNA carried within the single, oversized mitochondrion, characteristic of kinetoplastids (phylum: Euglenozoa)
mitosome
nonfunctional organelle carried in the cells of diplomonads (Excavata) that likely evolved from a mitochondrion
mixotroph
organism that can obtain nutrition by autotrophic or heterotrophic means, usually facultatively
pellicle
outer cell covering composed of interlocking protein strips that function like a flexible coat of armor, preventing cells from being torn or pierced without compromising their range of motion
phagolysosome
cellular body formed by the union of a phagosome containing the ingested particle with a lysosome that contains hydrolytic enzymes
plankton
diverse group of mostly microscopic organisms that drift in marine and freshwater systems and serve as a food source for larger aquatic organisms
plastid
one of a group of related organelles in plant cells that are involved in the storage of starches, fats, proteins, and pigments
raphe
slit in the silica shell of diatoms through which the protist secretes a stream of mucopolysaccharides for locomotion and attachment to substrates
test
porous shell of a foram that is built from various organic materials and typically hardened with calcium carbonate
5.3.07: Chapter Summary
23.1 Eukaryotic Origins
The oldest fossil evidence of eukaryotes is about 2 billion years old. Fossils older than this all appear to be prokaryotes. It is probable that today’s eukaryotes are descended from an ancestor that had a prokaryotic organization. The last common ancestor of today’s Eukarya had several characteristics, including cells with nuclei and an endomembrane system (which includes the nuclear envelope). Its chromosomes were linear and contained DNA associated with histones. The nuclear genome seems to be descended from an archaean ancestor. This ancestor would have had a cytoskeleton and divided its chromosomes mitotically.
The ancestral cytoskeletal system included the ability to make cilia/flagella during at least part of its life cycle. It was aerobic because it had mitochondria derived from an aerobic alpha-proteobacterium that lived inside a host cell. Whether this host had a nucleus at the time of the initial symbiosis remains unknown. The last common ancestor may have had a cell wall for at least part of its life cycle, but more data are needed to confirm this hypothesis. Today’s eukaryotes are very diverse in their shapes, organization, life cycles, and number of cells per individual.
23.2 Characteristics of Protists
Protists are extremely diverse in terms of their biological and ecological characteristics, partly because they are an artificial assemblage of phylogenetically unrelated groups. Protists display highly varied cell structures, several types of reproductive strategies, virtually every possible type of nutrition, and varied habitats. Most single-celled protists are motile, but these organisms use diverse structures for transportation.
23.3 Groups of Protists
The process of classifying protists into meaningful groups is ongoing, but genetic data in the past 20 years have clarified many relationships that were previously unclear or mistaken. The majority view at present is to order all eukaryotes into six supergroups: Archaeplastida, Amoebozoa, Opisthokonta, Rhizaria, Chromalveolata, and Excavata. The goal of this classification scheme is to create clusters of species that all are derived from a common ancestor. At present, the monophyly of some of the supergroups are better supported by genetic data than others. Although tremendous variation exists within the supergroups, commonalities at the morphological, physiological, and ecological levels can be identified.
23.4 Ecology of Protists
Protists function at several levels of the ecological food web: as primary producers, as direct food sources, and as decomposers. In addition, many protists are parasites of plants and animals and can cause deadly human diseases or destroy valuable crops.
5.3.08: Visual Connection Questions
1.
Figure 23.5 What evidence is there that mitochondria were incorporated into the ancestral eukaryotic cell before chloroplasts?
2.
Figure 23.25 Which of the following statements about Paramecium sexual reproduction is false?
1. The macronuclei are derived from micronuclei.
2. Both mitosis and meiosis occur during sexual reproduction.
3. The conjugate pair swaps macronuclei.
4. Each parent produces four daughter cells.
3.
Figure 23.28 Which of the following statements about the Laminaria life cycle is false?
1. 1n zoospores form in the sporangia.
2. The sporophyte is the 2n plant.
3. The gametophyte is diploid.
4. Both the gametophyte and sporophyte stages are multicellular.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.03%3A_Protists/5.3.06%3A_Key_Terms.txt
|
4.
What event is thought to have contributed to the evolution of eukaryotes?
1. global warming
2. glaciation
3. volcanic activity
4. oxygenation of the atmosphere
5.
Which characteristic is shared by prokaryotes and eukaryotes?
1. cytoskeleton
2. nuclear envelope
3. DNA-based genome
4. mitochondria
6.
Mitochondria most likely evolved by _____________.
1. a photosynthetic cyanobacterium
2. cytoskeletal elements
3. endosymbiosis
4. membrane proliferation
7.
Which of these protists is believed to have evolved following a secondary endosymbiosis?
1. green algae
2. cyanobacteria
3. red algae
4. chlorarachniophytes
8.
In 2016, scientists published the genome of Monocercomonoides, and demonstrated that this organism has no detectable mitochondrial genes. However, its genome was arranged in linear chromosomes wrapped around histones which are contained within the nucleus. Monocercomonoides is therefore a(n) _________.
1. Bacteria
2. Archea
3. Eukaryote
4. Endosymbiont
9.
Which of the following observations about a bacterium would distinguish it from the last eukaryotic common ancestor?
1. A double-stranded DNA genome
2. Lack of a membrane-bound structure surrounding the genome
3. Fatty acids in the lipid bilayer of the plasma membrane
4. Enclosed by a cell wall
10.
Protists that have a pellicle are surrounded by ______________.
1. silica dioxide
2. calcium carbonate
3. carbohydrates
4. proteins
11.
Protists with the capabilities to perform photosynthesis and to absorb nutrients from dead organisms are called ______________.
1. photoautotrophs
2. mixotrophs
3. saprobes
4. heterotrophs
12.
Which of these locomotor organs would likely be the shortest?
1. a flagellum
2. a cilium
3. an extended pseudopod
4. a pellicle
13.
Alternation of generations describes which of the following?
1. The haploid form can be multicellular; the diploid form is unicellular.
2. The haploid form is unicellular; the diploid form can be multicellular.
3. Both the haploid and diploid forms can be multicellular.
4. Neither the haploid nor the diploid forms can be multicellular.
14.
The amoeba E. histolytica is a pathogen that forms liver abscesses in infected individuals. Its metabolic classification is most likely ______.
1. Anaerobic heterotroph
2. Mixotroph
3. Aerobic phototroph
4. Phagocytic autotroph
15.
Which protist group exhibits mitochondrial remnants with reduced functionality?
1. slime molds
2. diatoms
3. parabasalids
4. dinoflagellates
16.
Conjugation between two Paramecia produces ________ total daughter cells.
1. 2
2. 4
3. 8
4. 16
17.
What is the function of the raphe in diatoms?
1. locomotion
2. defense
3. capturing food
4. photosynthesis
18.
What genus of protists appears to contradict the statement that unicellularity restricts cell size?
1. Dictyostelium
2. Ulva
3. Plasmodium
4. Caulerpa
19.
A marine biologist analyzing water samples notices a protist with a calcium carbonate shell that moves by pseudopodia extension. The protist is likely to be closely related to which species?
1. Fuligo septica (Dog Vomit slime mold)
2. Circogonia icosahedra (Radiolarian)
3. Euglena viridis
4. Ammonia tepida
20.
An example of carbon fixation is _____________.
1. photosynthesis
2. decomposition
3. phagocytosis
4. parasitism
21.
Which parasitic protist evades the host immune system by altering its surface proteins with each generation?
1. Paramecium caudatum
2. Trypanosoma brucei
3. Plasmodium falciparum
4. Phytophthora infestans
22.
Which of the following is not a way that protists contribute to the food web?
1. They fix carbon into organic molecules.
2. They occupy the apex producer niche.
3. They enter symbiotic relationships with animals.
4. They recycle nutrients back into the carbon and nitrogen cycles.
5.3.10: Critical Thinking Questions
23.
Describe the hypothesized steps in the origin of eukaryotic cells.
24.
Some aspects of eukaryotes are more similar to Archaea, while other aspects of eukaryotic cell composition appear more closely related to Bacteria. Explain how endosymbiosis could resolve this paradox.
25.
Explain in your own words why sexual reproduction can be useful if a protist’s environment changes.
26.
Giardia lamblia is a cyst-forming protist parasite that causes diarrhea if ingested. Given this information, against what type(s) of environments might G. lamblia cysts be particularly resistant?
27.
Explain how the definition of protists ensures that the kingdom Protista includes a wide diversity of cellular structures. Provide an example of two different structures that perform the same function for their respective protist.
28.
The chlorophyte (green algae) genera Ulva and Caulerpa both have macroscopic leaf-like and stem-like structures, but only Ulva species are considered truly multicellular. Explain why.
29.
Why might a light-sensing eyespot be ineffective for an obligate saprobe? Suggest an alternative organ for a saprobic protist.
30.
Opisthokonta includes animals and fungi, as well as protists. Describe the key feature of this phylum, and an example of how an organism in each kingdom uses this feature.
31.
Describe two ways in which paramecium differs from the projected traits of the last eukaryotic common ancestor.
32.
How does killing Anopheles mosquitoes affect the Plasmodium protists?
33.
Without treatment, why does African sleeping sickness invariably lead to death?
34.
Describe how increasing stress to the ocean would affect a food chain containing zooxanthellae, corals, parrotfish, and sharks.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.03%3A_Protists/5.3.09%3A_Review_Questions.txt
|
The kingdom Fungi includes an enormous variety of living organisms collectively referred to as Eucomycota, or true Fungi. While scientists have identified about 100,000 species of fungi, this is only a fraction of the 1.5 million species of fungus likely present on Earth. Edible mushrooms, yeasts, black mold, and the producer of the antibiotic penicillin, Penicillium notatum, are all members of the kingdom Fungi, which belongs to the domain Eukarya.
• 5.4.1: Introduction
The word fungus comes from the Latin word for mushrooms. Indeed, the familiar mushroom is a reproductive structure used by many types of fungi. However, there are also many fungi species that don't produce mushrooms at all. Being eukaryotes, a typical fungal cell contains a true nucleus and many membrane-bound organelles. The kingdom Fungi includes an enormous variety of living organisms collectively referred to as Eucomycota, or true Fungi.
• 5.4.2: Characteristics of Fungi
Although humans have used yeasts and mushrooms since prehistoric times, until recently, the biology of fungi was poorly understood. Up until the mid-20th century, many scientists classified fungi as plants. Fungi, like plants, arose mostly sessile and seemingly rooted in place. They possess a stem-like structure similar to plants, as well as having a root-like fungal mycelium in the soil. In addition, their mode of nutrition was poorly understood.
• 5.4.3: Classifications of Fungi
The kingdom Fungi contains five major phyla that were established according to their mode of sexual reproduction or using molecular data. Polyphyletic, unrelated fungi that reproduce without a sexual cycle, are placed for convenience in a sixth group called a “form phylum”. Not all mycologists agree with this scheme. Rapid advances in molecular biology and the sequencing of 18S rRNA (a part of RNA) continue to show new and different relationships between the various categories of fungi.
• 5.4.4: Ecology of Fungi
Fungi play a crucial role in the balance of ecosystems. They colonize most habitats on Earth, preferring dark, moist conditions. They can thrive in seemingly hostile environments, such as the tundra, thanks to a most successful symbiosis with photosynthetic organisms like algae to produce lichens. Fungi are not obvious in the way large animals or tall trees appear. Yet, like bacteria, they are the major decomposers of nature.
• 5.4.5: Fungal Parasites and Pathogens
Parasitism describes a symbiotic relationship in which one member of the association benefits at the expense of the other. Both parasites and pathogens harm the host; however, the pathogen causes a disease, whereas the parasite usually does not. Commensalism occurs when one member benefits without affecting the other.
• 5.4.6: Importance of Fungi in Human Life
Although we often think of fungi as organisms that cause disease and rot food, fungi are important to human life on many levels. As we have seen, they influence the well-being of human populations on a large scale because they are part of the nutrient cycle in ecosystems. They have other ecosystem roles as well. As animal pathogens, fungi help to control the population of damaging pests. These fungi are very specific to the insects they attack, and do not infect animals or plants.
• 5.4.7: Key Terms
• 5.4.8: Chapter Summary
• 5.4.9: Visual Connection Questions
• 5.4.10: Review Questions
• 5.4.11: Critical Thinking Questions
Thumbnail: A cluster of mushrooms. (Modification of work by Chris Wee).
5.04: Fungi
Figure 24.1 Many species of fungus produce the familiar mushroom (a) which is a reproductive structure. This (b) coral fungus displays brightly colored fruiting bodies. This electron micrograph shows (c) the spore-bearing structures of Aspergillus, a type of toxic fungus found mostly in soil and plants. (credit “mushroom”: modification of work by Chris Wee; credit “coral fungus”: modification of work by Cory Zanker; credit “Aspergillus”: modification of work by Janice Haney Carr, Robert Simmons, CDC; scale-bar data from Matt Russell)
The word fungus comes from the Latin word for mushrooms. Indeed, the familiar mushroom is a reproductive structure used by many types of fungi. However, there are also many fungus species that don't produce mushrooms at all. Being eukaryotes, a typical fungal cell contains a true nucleus and many membrane-bound organelles. The kingdom Fungi includes an enormous variety of living organisms. While scientists have identified about 135,000 species of fungi, this is only a fraction of the more than 1.5 million species of fungus likely present on Earth. Edible mushrooms, yeasts, black mold, and the producer of the antibiotic penicillin, Penicillium notatum, are all members of the kingdom Fungi, which belongs to the domain Eukarya.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.04%3A_Fungi/5.4.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• List the characteristics of fungi
• Describe the composition of the mycelium
• Describe the mode of nutrition of fungi
• Explain sexual and asexual reproduction in fungi
Fungi, once considered plant-like organisms, are more closely related to animals than plants. Fungi are not capable of photosynthesis: they are heterotrophic because they use complex organic compounds as sources of energy and carbon. Fungi share a few other traits with animals. Their cell walls are composed of chitin, which is found in the exoskeletons of arthropods. Fungi produce a number of pigments, including melanin, also found in the hair and skin of animals. Like animals, fungi also store carbohydrates as glycogen. However, like bacteria, fungi absorb nutrients across the cell surface and act as decomposers, helping to recycle nutrients by breaking down organic materials to simple molecules.
Some fungal organisms multiply only asexually, whereas others undergo both asexual reproduction and sexual reproduction with alternation of generations. Most fungi produce a large number of spores, which are haploid cells that can undergo mitosis to form multicellular, haploid individuals.
Fungi often interact with other organisms, forming beneficial or mutualistic associations. For example, most terrestrial plants form symbiotic relationships with fungi. The roots of the plant connect with the underground parts of the fungus, which form mycorrhizae. Through mycorrhizae, the fungus and plant exchange nutrients and water, greatly aiding the survival of both species. Alternatively, lichens are an association between a fungus and its photosynthetic partner (usually an alga).
Fungi also cause serious infections in plants and animals. For example, Dutch elm disease, which is caused by the fungus Ophiostoma ulmi, is a particularly devastating type of fungal infestation that destroys many native species of elm (Ulmus sp.) by infecting the tree’s vascular system. The elm bark beetle acts as a vector, transmitting the disease from tree to tree. Accidentally introduced in the 1900s, the fungus decimated elm trees across the continent. Many European and Asiatic elms are less susceptible to Dutch elm disease than American elms.
In humans, fungal infections are generally considered challenging to treat. Unlike bacteria, fungi do not respond to traditional antibiotic therapy, since they are eukaryotes. Fungal infections may prove deadly for individuals with compromised immune systems.
Fungi have many commercial applications. The food industry uses yeasts in baking, brewing, and cheese and wine making. Many industrial compounds are byproducts of fungal fermentation. Fungi are the source of many commercial enzymes and antibiotics.
Although humans have used yeasts and mushrooms since prehistoric times, until recently, the biology of fungi was poorly understood. In fact, up until the mid-20th century, many scientists classified fungi as plants! Fungi, like plants, are mostly sessile and seemingly rooted in place. They possess a stem-like structure similar to plants, as well as having a root-like fungal mycelium in the soil. In addition, their mode of nutrition was poorly understood. Progress in the field of fungal biology was the result of mycology: the scientific study of fungi. Based on fossil evidence, fungi have been found in the Devonian era, about 410 million years ago. However, new findings might place the appearance of the first fungi during the Neoproterozoic era, about 900 million years ago. Molecular biology analysis of the fungal genome demonstrates that fungi are more closely related to animals than plants. Under some current systematic phylogenies, they continue to be a monophyletic group of organisms.
Career Connection
Career Connection
MycologistMycologists are biologists who study fungi. Historically, mycology was a branch of microbiology, and many mycologists start their careers with a degree in microbiology. To become a mycologist, a bachelor's degree in a biological science (preferably majoring in microbiology) and a master's degree in mycology are minimally necessary. Mycologists can specialize in taxonomy and fungal genomics, molecular and cellular biology, plant pathology, biotechnology, or biochemistry. Some medical microbiologists concentrate on the study of infectious diseases caused by fungi, called mycoses. Mycologists collaborate with zoologists and plant pathologists to identify and control difficult fungal infections, such as the devastating chestnut blight, the mysterious decline in frog populations in many areas of the world, or the deadly epidemic called white nose syndrome, which is decimating bats in the Eastern United States.
Government agencies hire mycologists as research scientists and technicians to monitor the health of crops, national parks, and national forests. Mycologists are also employed in the private sector by companies that develop chemical and biological control products or new agricultural products, and by companies that provide disease control services. Because of the key role played by fungi in the fermentation of alcohol and the preparation of many important foods, scientists with a good understanding of fungal physiology routinely work in the food technology industry. Oenology, the science of wine making, relies not only on the knowledge of grape varietals and soil composition, but also on a solid understanding of the characteristics of the wild yeasts that thrive in different wine-making regions. It is possible to purchase yeast strains isolated from specific grape-growing regions. The great French chemist and microbiologist, Louis Pasteur, made many of his essential discoveries working on the humble brewer’s yeast, thus discovering the process of fermentation.
Cell Structure and Function
Fungi are eukaryotes, and as such, have a complex cellular organization. As eukaryotes, fungal cells contain a membrane-bound nucleus. The DNA in the nucleus is represented by multiple linear molecules wrapped around histone proteins, as is observed in other eukaryotic cells. A few types of fungi have accessory genomic structures comparable to bacterial plasmids (loops of DNA); however, the horizontal transfer of genetic information that occurs between one bacterium and another rarely occurs in fungi. Fungal cells also contain mitochondria and a complex system of internal membranes, including the endoplasmic reticulum and Golgi apparatus.
Unlike plant cells, fungal cells do not have chloroplasts or chlorophyll. Many fungi display bright colors arising from other cellular pigments, ranging from red to green to black. The poisonous Amanita muscaria (fly agaric) is recognizable by its bright red cap with white patches (Figure 24.2). Pigments in fungi are associated with the cell wall and play a protective role against ultraviolet radiation. Some fungal pigments are toxic to humans.
Figure 24.2 Amanita. The poisonous Amanita muscaria is native to temperate and boreal regions of North America. (credit: Christine Majul)
Like plant cells, fungal cells have a thick cell wall. The rigid layers of fungal cell walls contain complex polysaccharides called chitin and glucans. Chitin (N-acetyl-D-glucosamine), also found in the exoskeleton of arthropods such as insects, gives structural strength to the cell walls of fungi. The wall provides structural support and protects the cell from desiccation and some predators. Fungi have plasma membranes similar to those of other eukaryotes, except that the structure is stabilized by ergosterol: a steroid molecule that replaces the cholesterol found in animal cell membranes. Most members of the kingdom Fungi are nonmotile. However, flagella are produced by the spores and gametes in the primitive Phylum Chytridiomycota.
Growth
The vegetative body of a fungus is a unicellular or multicellular thallus. Unicellular fungi are called yeasts. Multicellular fungi produce threadlike hyphae (singular hypha). Dimorphic fungi can change from the unicellular to multicellular state depending on environmental conditions. Saccharomyces cerevisiae (baker’s yeast) and Candida species (the agents of thrush, a common fungal infection) are examples of unicellular fungi (Figure 24.3).
Figure 24.3 Candida albicans. Candida albicans is a yeast cell and the agent of candidiasis and thrush. This organism has a similar morphology to coccus bacteria; however, yeast is a eukaryotic organism (note the nucleus). (credit: modification of work by Dr. Godon Roberstad, CDC; scale-bar data from Matt Russell)
Most fungi are multicellular organisms. They display two distinct morphological stages: the vegetative and reproductive. The vegetative stage consists of a tangle of hyphae, whereas the reproductive stage can be more conspicuous. The mass of hyphae is a mycelium (Figure 24.4). It can grow on a surface, in soil or decaying material, in a liquid, or even on living tissue. Although individual hyphae must be observed under a microscope, the mycelium of a fungus can be very large, with some species truly being “the fungus humongous.” The giant Armillaria solidipes (honey mushroom) is considered the largest organism on Earth, spreading across more than 2,000 acres of underground soil in eastern Oregon; it is estimated to be at least 2,400 years old.
Figure 24.4 A fungal mycelium. The mycelium of the fungus Neotestudina rosati can be pathogenic to humans. The fungus enters through a cut or scrape and develops a mycetoma, a chronic subcutaneous infection. (credit: CDC)
Most fungal hyphae are divided into separate cells by endwalls called septa (singular, septum) (Figure 24.5a, c). In most phyla of fungi, tiny holes in the septa allow for the rapid flow of nutrients and small molecules from cell to cell along the hypha. They are described as perforated septa. The hyphae in bread molds (which belong to the Phylum Zygomycota) are not separated by septa. Instead, they are formed by large cells containing many nuclei (multinucleate), an arrangement described as coenocytic hyphae (Figure 24.5b).
Figure 24.5 Fungal hyphae. Fungal hyphae may be (a) septated or (b) coenocytic (coeno- = "common"; -cytic = "cell") with many nuclei present in a single hypha. A bright field light micrograph of (c) Phialophora richardsiae shows septa that divide the hyphae. (credit c: modification of work by Dr. Lucille Georg, CDC; scale-bar data from Matt Russell)
Fungi thrive in environments that are moist and slightly acidic, and can grow in dark places or places exposed to light. They vary in their oxygen requirement. Most fungi are obligate aerobes, requiring oxygen to survive. Other species, such as members of the Chytridiomycota that reside in the rumen of cattle, are obligate anaerobes, in that they only use anaerobic respiration because oxygen will disrupt their metabolism or kill them. Yeasts are intermediate, being facultative anaerobes. This means that they grow best in the presence of oxygen using aerobic respiration, but can survive using anaerobic respiration when oxygen is not available. The alcohol produced from yeast fermentation is used in wine and beer production.
Nutrition
Like animals, fungi are heterotrophs; they use complex organic compounds as a source of carbon, rather than fix carbon dioxide from the atmosphere as do some bacteria and most plants. In addition, fungi do not fix nitrogen from the atmosphere. Like animals, they must obtain it from their diet. However, unlike most animals, which ingest food and then digest it internally in specialized organs, fungi perform these steps in the reverse order; digestion precedes ingestion. First, exoenzymes are transported out of the hyphae, where they process nutrients in the environment. Then, the smaller molecules produced by this external digestion are absorbed through the large surface area of the mycelium. As with animal cells, the polysaccharide of storage is glycogen, a branched polysaccharide, rather than amylopectin, a less densely branched polysaccharide, and amylose, a linear polysaccharide, as found in plants.
Fungi are mostly saprobes (saprophyte is an equivalent term): organisms that derive nutrients from decaying organic matter. They obtain their nutrients from dead or decomposing organic material derived mainly from plants. Fungal exoenzymes are able to break down insoluble compounds, such as the cellulose and lignin of dead wood, into readily absorbable glucose molecules. The carbon, nitrogen, and other elements are thus released into the environment. Because of their varied metabolic pathways, fungi fulfill an important ecological role and are being investigated as potential tools in bioremediation of chemically damaged ecosystems. For example, some species of fungi can be used to break down diesel oil and polycyclic aromatic hydrocarbons (PAHs). Other species take up heavy metals, such as cadmium and lead.
Some fungi are parasitic, infecting either plants or animals. Smut and Dutch elm disease affect plants, whereas athlete’s foot and candidiasis (thrush) are medically important fungal infections in humans. In environments poor in nitrogen, some fungi resort to predation of nematodes (small non-segmented roundworms). In fact, species of Arthrobotrys fungi have a number of mechanisms to trap nematodes: One mechanism involves constricting rings within the network of hyphae. The rings swell when they touch the nematode, gripping it in a tight hold. The fungus then penetrates the tissue of the worm by extending specialized hyphae called haustoria. Many parasitic fungi possess haustoria, as these structures penetrate the tissues of the host, release digestive enzymes within the host's body, and absorb the digested nutrients.
Reproduction
Fungi reproduce sexually and/or asexually. Some fungi reproduce both sexually and asexually, while other fungi reproduce only asexually (by mitosis).
In both sexual and asexual reproduction, fungi produce spores that disperse from the parent organism by either floating on the wind or hitching a ride on an animal. Fungal spores are smaller and lighter than plant seeds. For example, the giant puffball mushroom bursts open and releases trillions of spores in a massive cloud of what looks like finely particulate dust. The huge number of spores released increases the likelihood of landing in an environment that will support growth (Figure 24.6).
Figure 24.6 Puffball and spores. The (a) giant puffball mushroom releases (b) a cloud of spores when it reaches maturity. (credit a: modification of work by Roger Griffith; credit b: modification of work by Pearson Scott Foresman, donated to the Wikimedia Foundation)
Asexual Reproduction
Fungi reproduce asexually by fragmentation, budding, or producing spores. Fragments of hyphae can grow new colonies. Somatic cells in yeast form buds. During budding (an expanded type of cytokinesis), a bulge forms on the side of the cell, the nucleus divides mitotically, and the bud ultimately detaches itself from the mother cell (Figure 24.7).
Figure 24.7 Budding in Histoplasma. The dark cells in this bright field light micrograph are the pathogenic yeast Histoplasma capsulatum, seen against a backdrop of light blue tissue. Histoplasma primarily infects lungs but can spread to other tissues, causing histoplasmosis, a potentially fatal disease. (credit: modification of work by Dr. Libero Ajello, CDC; scale-bar data from Matt Russell)
The most common mode of asexual reproduction is through the formation of asexual spores, which are produced by a single individual thallus (through mitosis) and are genetically identical to the parent thallus (Figure 24.8). Spores allow fungi to expand their distribution and colonize new environments. They may be released from the parent thallus either outside or within a special reproductive sac called a sporangium.
Figure 24.8 Generalized fungal life cycle. Fungi may have both asexual and sexual stages of reproduction.
There are many types of asexual spores. Conidiospores are unicellular or multicellular spores that are released directly from the tip or side of the hypha. Other asexual spores originate in the fragmentation of a hypha to form single cells that are released as spores; some of these have a thick wall surrounding the fragment. Yet others bud off the vegetative parent cell. In contrast to conidiospores, sporangiospores are produced directly from a sporangium (Figure 24.9).
Figure 24.9 Sporangiospores. This bright field light micrograph shows the release of spores from a sporangium at the end of a hypha called a sporangiophore. The organism is a Mucor sp. fungus, a mold often found indoors. (credit: modification of work by Dr. Lucille Georg, CDC; scale-bar data from Matt Russell)
Sexual Reproduction
Sexual reproduction introduces genetic variation into a population of fungi. In fungi, sexual reproduction often occurs in response to adverse environmental conditions. During sexual reproduction, two mating types are produced. When both mating types are present in the same mycelium, it is called homothallic, or self-fertile. Heterothallic mycelia require two different, but compatible, mycelia to reproduce sexually.
Although there are many variations in fungal sexual reproduction, all include the following three stages (Figure 24.8). First, during plasmogamy (literally, “marriage or union of cytoplasm”), two haploid cells fuse, leading to a dikaryotic stage where two haploid nuclei coexist in a single cell. During karyogamy (“nuclear marriage”), the haploid nuclei fuse to form a diploid zygote nucleus. Finally, meiosis takes place in the gametangia (singular, gametangium) organs, in which gametes of different mating types are generated. At this stage, spores are disseminated into the environment.
Link to Learning
Link to Learning
Review the characteristics of fungi by watching this video.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.04%3A_Fungi/5.4.02%3A_Characteristics_of_Fungi.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Identify fungi and place them into the five major phyla according to current classification
• Describe each phylum in terms of major representative species and patterns of reproduction
The kingdom Fungi contains five major phyla that were established according to their mode of sexual reproduction or using molecular data. Polyphyletic, unrelated fungi that reproduce without a sexual cycle, were once placed for convenience in a sixth group, the Deuteromycota, called a “form phylum,” because superficially they appeared to be similar. However, most mycologists have discontinued this practice. Rapid advances in molecular biology and the sequencing of 18S rRNA (ribosomal RNA) continue to show new and different relationships among the various categories of fungi.
The five true phyla of fungi are the Chytridiomycota (Chytrids), the Zygomycota (conjugated fungi), the Ascomycota (sac fungi), the Basidiomycota (club fungi) and the recently described Phylum Glomeromycota (Figure 24.10).
Figure 24.10 Fungal phyla. Note: “-mycota” is used to designate a phylum while “-mycetes” formally denotes a class or is used informally to refer to all members of the phylum.
Chytridiomycota: The Chytrids
The only class in the Phylum Chytridiomycota is the Chytridiomycetes. The chytrids are the simplest and most primitive Eumycota, or true fungi. The evolutionary record shows that the first recognizable chytrids appeared during the late pre-Cambrian period, more than 500 million years ago. Like all fungi, chytrids have chitin in their cell walls, but one group of chytrids has both cellulose and chitin in the cell wall. Most chytrids are unicellular; however, a few form multicellular organisms and hyphae, which have no septa between cells (coenocytic). The Chytrids are the only fungi that have retained flagella. They produce both gametes and diploid zoospores that swim with the help of a single flagellum. An unusual feature of the chytrids is that both male and female gametes are flagellated.
The ecological habitat and cell structure of chytrids have much in common with protists. Chytrids usually live in aquatic environments, although some species live on land. Some species thrive as parasites on plants, insects, or amphibians (Figure 24.11), while others are saprobes. The chytrid species Allomyces is well characterized as an experimental organism. Its reproductive cycle includes both asexual and sexual phases. Allomyces produces diploid or haploid flagellated zoospores in a sporangium.
Figure 24.11 Chytrids. The chytrid Batrachochytrium dendrobatidis is seen in these light micrographs as transparent spheres growing on (a) a freshwater arthropod (water mite) and (b) algae. This chytrid causes skin diseases in many species of amphibians, resulting in species decline and extinction. (credit: modification of work by Johnson ML, Speare R., CDC)
Zygomycota: The Conjugated Fungi
The zygomycetes are a relatively small group of fungi belonging to the Phylum Zygomycota. They include the familiar bread mold, Rhizopus stolonifer, which rapidly propagates on the surfaces of breads, fruits, and vegetables. Most species are saprobes, living off decaying organic material; a few are parasites, particularly of insects. Zygomycetes play a considerable commercial role. For example, the metabolic products of some species of Rhizopus are intermediates in the synthesis of semi-synthetic steroid hormones.
Zygomycetes have a thallus of coenocytic hyphae in which the nuclei are haploid when the organism is in the vegetative stage. The fungi usually reproduce asexually by producing sporangiospores (Figure 24.12). The black tips of bread mold are the swollen sporangia packed with black spores (Figure 24.13). When spores land on a suitable substrate, they germinate and produce a new mycelium. Sexual reproduction starts when environmental conditions become unfavorable. Two opposing mating strains (type + and type –) must be in close proximity for gametangia from the hyphae to be produced and fuse, leading to karyogamy. Each zygospore can contain several diploid nuclei. The developing diploid zygospores have thick coats that protect them from desiccation and other hazards. They may remain dormant until environmental conditions are favorable. When the zygospore germinates, it undergoes meiosis and produces haploid spores, which will, in turn, grow into a new organism. This form of sexual reproduction in fungi is called conjugation (although it differs markedly from conjugation in bacteria and protists), giving rise to the name “conjugated fungi”.
Figure 24.12 Zygomycete life cycle. Zygomycetes have asexual and sexual phases in their life cycles. In the asexual phase, spores are produced from haploid sporangia by mitosis (not shown). In the sexual phase, plus and minus haploid mating types conjugate to form a heterokaryotic zygosporangium. Karyogamy then produces a diploid zygote. Diploid cells in the zygote undergo meiosis and germinate to form a haploid sporangium, which releases the next generation of haploid spores.
Figure 24.13 Rhizopus spores. Asexual sporangia grow at the end of stalks, which appear as (a) white fuzz seen on this bread mold, Rhizopus stolonifer. The black tips (b) of bread mold are the spore-containing sporangia. (credit b: modification of work by "polandeze"/Flickr)
Ascomycota: The Sac Fungi
The majority of known fungi belong to the Phylum Ascomycota, which is characterized by the formation of an ascus (plural, asci), a sac-like structure that contains haploid ascospores. Filamentous ascomycetes produce hyphae divided by perforated septa, allowing streaming of cytoplasm from one cell to another. Conidia and asci, which are used respectively for asexual and sexual reproduction, are usually separated from the vegetative hyphae by blocked (non-perforated) septa. Many ascomycetes are of commercial importance. Some play a beneficial role for humanity, such as the yeasts used in baking, brewing, and wine fermentation, and directly as food delicacies such as truffles and morels. Aspergillus oryzae is used in the fermentation of rice to produce sake. Other ascomycetes parasitize plants and animals, including humans. For example, fungal pneumonia poses a significant threat to AIDS patients who have a compromised immune system. Ascomycetes not only infest and destroy crops directly; they also produce poisonous secondary metabolites that make crops unfit for consumption.
Asexual reproduction is frequent and involves the production of conidiophores that release haploid conidiospores (Figure 24.14). Sexual reproduction starts with the development of special hyphae from either one of two types of mating strains (Figure 24.14). The “male” strain produces an antheridium and the “female” strain develops an ascogonium. At fertilization, the antheridium and the ascogonium combine in plasmogamy, without nuclear fusion. Special dikaryotic ascogenous (ascus-producing) hyphae arise from this dikaryon, in which each cell has pairs of nuclei: one from the “male” strain and one from the “female” strain. In each ascus, two haploid nuclei fuse in karyogamy. Thousands of asci fill a fruiting body called the ascocarp. The diploid nucleus in each ascus gives rise to haploid nuclei by meiosis, and spore walls form around each nucleus. The spores in each ascus contain the meiotic products of a single diploid nucleus. The ascospores are then released, germinate, and form hyphae that are disseminated in the environment and start new mycelia (Figure 24.15).
Visual Connection
Visual Connection
Figure 24.14 Ascomycete life cycle. The lifecycle of an ascomycete is characterized by the production of asci during the sexual phase. In each ascus, the four nuclei produced by meiosis divide once mitotically for a total of eight haploid ascospores. The haploid phase is the predominant phase of the life cycle in Ascomycetes.
Which of the following statements is true?
1. A dikaryotic ascus that forms in the ascocarp undergoes karyogamy, meiosis, and mitosis to form eight ascospores.
2. A diploid ascus that forms in the ascocarp undergoes karyogamy, meiosis, and mitosis to form eight ascospores.
3. A haploid zygote that forms in the ascocarp undergoes karyogamy, meiosis, and mitosis to form eight ascospores.
4. A dikaryotic ascus that forms in the ascocarp undergoes plasmogamy, meiosis, and mitosis to form eight ascospores.
Figure 24.15 Ascospores. The bright field light micrograph shows ascospores being released from asci in the fungus Talaromyces flavus var. flavus. (credit: modification of work by Dr. Lucille Georg, CDC; scale-bar data from Matt Russell)
Basidiomycota: The Club Fungi
The fungi in the Phylum Basidiomycota are easily recognizable under a light microscope by their club-shaped fruiting bodies called basidia (singular, basidium), which are the swollen terminal cells of hyphae. The basidia, which are the reproductive organs of these fungi, are often contained within the familiar mushroom, commonly seen in fields after rain, on the supermarket shelves, and growing on your lawn (Figure 24.16). These mushroom-producing basidiomycetes are sometimes referred to as “gill fungi” because of the presence of gill-like structures on the underside of the cap. The gills are actually compacted hyphae on which the basidia are borne. This group also includes shelf fungi, which cling to the bark of trees like small shelves. In addition, the basidiomycota include smuts and rusts, which are important plant pathogens. Most edible fungi belong to the Phylum Basidiomycota; however, some basidiomycota are inedible and produce deadly toxins. For example, Cryptococcus neoformans causes severe respiratory illness. The infamous death cap mushroom (Amanita phalloides) is related to the fly agaric seen at the beginning of the previous section.
Figure 24.16 Fairy ring. The fruiting bodies of a basidiomycete form a ring in a meadow, commonly called “fairy ring.” The best-known fairy ring fungus has the scientific name Marasmius oreades. The body of this fungus, its mycelium, is underground and grows outward in a circle. As it grows, the mycelium depletes the soil of nitrogen, causing the mycelia to grow away from the center and leading to the “fairy ring” of fruiting bodies where there is adequate soil nitrogen. (Credit: "Cropcircles"/Wikipedia Commons)]
The lifecycle of basidiomycetes includes sexual and asexual reproduction (Figure 24.17). Most fungi are haploid through most of their life cycles, but the basidiomycetes produce both haploid and dikaryotic mycelia, with the dikaryotic phase being dominant. (Note: The dikaryotic phase is technically not diploid, since the nuclei remain unfused until shortly before spore production.) In the basidiomycetes, sexual spores are more common than asexual spores. The sexual spores form in the club-shaped basidium and are called basidiospores. In the basidium, nuclei of two different mating strains fuse (karyogamy), giving rise to a diploid zygote that then undergoes meiosis. The haploid nuclei migrate into four different chambers appended to the basidium, and then become basidiospores.
Each basidiospore germinates and generates monokaryotic haploid hyphae. The mycelium that results is called a primary mycelium. Mycelia of different mating strains can combine and produce a secondary mycelium that contains haploid nuclei of two different mating strains. This is the dominant dikaryotic stage of the basidiomycete life cycle. Thus, each cell in this mycelium has two haploid nuclei, which will not fuse until formation of the basidium. Eventually, the secondary mycelium generates a basidiocarp, a fruiting body that protrudes from the ground—this is what we think of as a mushroom. The basidiocarp bears the developing basidia on the gills under its cap.
Visual Connection
Visual Connection
Figure 24.17 Basidiomycete life cycle. The lifecycle of a basidiomycete has sexual and asexual reproduction with haploid and dikaryotic mycelia. Haploid primary mycelia fuse to form a dikaryotic secondary mycelium, which is the dominant stage of the life cycle, and produces the basidiocarp.
Which of the following statements is true?
1. A basidium is the fruiting body of a mushroom-producing fungus, and it forms four basidiocarps.
2. The result of the plasmogamy step is four basidiospores.
3. Karyogamy results directly in the formation of mycelia.
4. A basidiocarp is the fruiting body of a mushroom-producing fungus.
Asexual Ascomycota and Basidiomycota
Imperfect fungi—those that do not display a sexual phase—were formerly classified in the form phylum Deuteromycota, an invalid taxon no longer used in the present, ever-developing classification of organisms. While Deuteromycota was once a classification taxon, recent molecular analysis has shown that some of the members classified in this group belong to the Ascomycota (Figure 24.18) or the Basidiomycota. Because some members of this group have not yet been appropriately classified, they are less well described in comparison to members of other fungal taxa. Most imperfect fungi live on land, with a few aquatic exceptions. They form visible mycelia with a fuzzy appearance and are commonly known as mold.
Figure 24.18 Aspergillus. Aspergillus niger is an asexually reproducing fungus (phylum Ascomycota) commonly found as a food contaminant. The spherical structure in this light micrograph is an asexual conidiophore. Molecular studies have placed Aspergillus with the ascomycetes and sexual cycles have been identified in some species. (credit: modification of work by Dr. Lucille Georg, CDC; scale-bar data from Matt Russell)
The fungi in this group have a large impact on everyday human life. The food industry relies on them for ripening some cheeses. The blue veins in Roquefort cheese and the white crust on Camembert are the result of fungal growth. The antibiotic penicillin was originally discovered on an overgrown Petri plate, on which a colony of Penicillium fungi had killed the bacterial growth surrounding it. Other fungi in this group cause serious diseases, either directly as parasites (which infect both plants and humans), or as producers of potent toxic compounds, as seen in the aflatoxins released by fungi of the genus Aspergillus.
Glomeromycota
The Glomeromycota is a newly established phylum that comprises about 230 species, all of which are involved in close associations with the roots of trees. Fossil records indicate that trees and their root symbionts share a long evolutionary history. It appears that nearly all members of this family form arbuscular mycorrhizae: the hyphae interact with the root cells forming a mutually beneficial association in which the plants supply the carbon source and energy in the form of carbohydrates to the fungus, and the fungus supplies essential minerals from the soil to the plant. The exception is Geosiphon pyriformis, which hosts the cyanobacterium Nostoc as an endosymbiont.
The glomeromycetes do not reproduce sexually and do not survive without the presence of plant roots. Although they have coenocytic hyphae like the zygomycetes, they do not form zygospores. DNA analysis shows that all glomeromycetes probably descended from a common ancestor, making them a monophyletic lineage.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.04%3A_Fungi/5.4.03%3A_Classifications_of_Fungi.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the role of fungi in various ecosystems
• Describe mutualistic relationships of fungi with plant roots and photosynthetic organisms
• Describe the beneficial relationship between some fungi and insects
Fungi play a crucial role in the constantly changing “balance” of ecosystems. They colonize most habitats on Earth, preferring dark, moist conditions. They can thrive in seemingly hostile environments, such as the tundra, thanks to a most successful symbiosis with photosynthetic organisms like algae to produce lichens. Within their communities, fungi are not as obvious as are large animals or tall treas. Like bacteria, they act behind the scenes as major decomposers. With their versatile metabolism, fungi break down organic matter, which would otherwise not be recycled.
Habitats
Although fungi are primarily associated with humid and cool environments that provide a supply of organic matter, they colonize a surprising diversity of habitats, from seawater to human skin and mucous membranes. Chytrids are found primarily in aquatic environments. Other fungi, such as Coccidioides immitis, which causes pneumonia when its spores are inhaled, thrive in the dry and sandy soil of the southwestern United States. Fungi that parasitize coral reefs live in the ocean. However, most members of the Kingdom Fungi grow on the forest floor, where the dark and damp environment is rich in decaying debris from plants and animals. In these environments, fungi play a major role as decomposers and recyclers, making it possible for members of the other kingdoms to be supplied with nutrients and live.
Decomposers and Recyclers
The food web would be incomplete without organisms that decompose organic matter (Figure 24.19). Some elements—such as nitrogen and phosphorus—are required in large quantities by biological systems, and yet are not abundant in the environment. The action of fungi releases these elements from decaying matter, making them available to other living organisms. Trace elements present in low amounts in many habitats are essential for growth, and would remain tied up in rotting organic matter if fungi and bacteria did not return them to the environment via their metabolic activity.
Figure 24.19 Bracket fungi. Fungi are an important part of ecosystem nutrient cycles. These bracket fungi growing on the side of a tree are the fruiting structures of a basidiomycete. They receive their nutrients through their hyphae, which invade and decay the tree trunk. (credit: Cory Zanker)
The ability of fungi to degrade many large and insoluble molecules is due to their mode of nutrition. As seen earlier, digestion precedes ingestion. Fungi produce a variety of exoenzymes to digest nutrients. The enzymes are either released into the substrate or remain bound to the outside of the fungal cell wall. Large molecules are broken down into small molecules, which are transported into the cell by a system of protein carriers embedded in the cell membrane. Because the movement of small molecules and enzymes is dependent on the presence of water, active growth depends on a relatively high percentage of moisture in the environment.
As saprobes, fungi help maintain a sustainable ecosystem for the animals and plants that share the same habitat. In addition to replenishing the environment with nutrients, fungi interact directly with other organisms in beneficial, and sometimes damaging, ways (Figure 24.20).
Figure 24.20 Shelf fungi. Shelf fungi, so called because they grow on trees in a stack, attack and digest the trunk or branches of a tree. While some shelf fungi are found only on dead trees, others can parasitize living trees and cause eventual death, so they are considered serious tree pathogens. (credit: Cory Zanker)
Mutualistic Relationships
Symbiosis is the ecological interaction between two organisms that live together. This definition does not describe the type or quality of the interaction. When both members of the association benefit, the symbiotic relationship is called mutualistic. Fungi form mutualistic associations with many types of organisms, including cyanobacteria, algae, plants, and animals.
Fungus/Plant Mutualism
One of the most remarkable associations between fungi and plants is the establishment of mycorrhizae. Mycorrhiza, which is derived from the Greek words myco meaning fungus and rhizo meaning root, refers to the fungal partner of a mutualistic association between vascular plant roots and their symbiotic fungi. Nearly 90 percent of all vascular plant species have mycorrhizal partners. In a mycorrhizal association, the fungal mycelia use their extensive network of hyphae and large surface area in contact with the soil to channel water and minerals from the soil into the plant. In exchange, the plant supplies the products of photosynthesis to fuel the metabolism of the fungus.
There are several basic types of mycorrhizae. Ectomycorrhizae (“outside” mycorrhizae) depend on fungi enveloping the roots in a sheath (called a mantle). Hyphae grow from the mantle into the root and envelope the outer layers of the root cells in a network of hyphae called a Hartig net (Figure 24.21). The fungal partner can belong to the Ascomycota, Basidiomycota or Zygomycota. Endomycorrhizae ("inside" mycorrhizae), also called arbuscular mycorrhizae, are produced when the fungi grow inside the root in a branched structure called an arbuscule (from the Latin for “little trees”). The fungal partners of endomycorrhizal associates all belong to the Glomeromycota. The fungal arbuscules penetrate root cells between the cell wall and the plasma membrane and are the site of the metabolic exchanges between the fungus and the host plant (Figure 24.21b and Figure 24.22b). Orchids rely on a third type of mycorrhiza. Orchids are epiphytes that typically produce very small airborne seeds without much storage to sustain germination and growth. Their seeds will not germinate without a mycorrhizal partner (usually a Basidiomycete). After nutrients in the seed are depleted, fungal symbionts support the growth of the orchid by providing necessary carbohydrates and minerals. Some orchids continue to be mycorrhizal throughout their life cycle.
Visual Connection
Visual Connection
Figure 24.21 Two types of mycorrhizae. (a) Ectomycorrhizae and (b) arbuscular or endomycorrhizae have different mechanisms for interacting with the roots of plants. (credit b: MS Turmel, University of Manitoba, Plant Science Department)
If symbiotic fungi were absent from the soil, what impact do you think this would have on plant growth?
Figure 24.22 Mycorrhizae. The (a) infection of Pinus radiata (Monterey pine) roots by the hyphae of Amanita muscaria (fly amanita) causes the pine tree to produce many small, branched rootlets. The Amanita hyphae cover these small roots with a white mantle. (b) Spores (the round bodies) and hyphae (thread-like structures) are evident in this light micrograph of an arbuscular mycorrhiza by a fungus on the root of a corn plant. (credit a: modification of work by Randy Molina, USDA; credit b: modification of work by Sara Wright, USDA-ARS; scale-bar data from Matt Russell)
Other examples of fungus–plant mutualism include the endophytes: fungi that live inside tissue without damaging the host plant. Endophytes release toxins that repel herbivores, or confer resistance to environmental stress factors, such as infection by microorganisms, drought, or heavy metals in soil.
Evolution Connection
Evolution Connection
Coevolution of Land Plants and MycorrhizaeAs we have seen, mycorrhizae are the fungal partners of a mutually beneficial symbiotic association that coevolved between roots of vascular plants and fungi. A well-supported theory proposes that fungi were instrumental in the evolution of the root system in plants and contributed to the success of Angiosperms. The bryophytes (mosses and liverworts), which are considered the most ancestral plants and the first to survive and adapt on land, have simple underground rhizoids, rather than a true root system, and therefore cannot survive in dry areas. However, some bryophytes have arbuscular mycorrhizae and some do not.
True roots first appeared in the ancestral vascular plants: Vascular plants that developed a system of thin extensions from their roots would have had a selective advantage over nonvascular plants because they had a greater surface area of contact with the fungal partners than did the rhizoids of mosses and liverworts. The first true roots would have allowed vascular plants to obtain more water and nutrients in the ground.
Fossil records indicate that fungi actually preceded the invasion of ancestral freshwater plants onto dry land. The first association between fungi and photosynthetic organisms on land involved moss-like plants and endophytes. These early associations developed before roots appeared in plants. Slowly, the benefits of the endophyte and rhizoid interactions for both partners led to present-day mycorrhizae: About 90 percent of today’s vascular plants have associations with fungi in their rhizosphere.
The fungi involved in mycorrhizae display many characteristics of ancestral fungi; they produce simple spores, show little diversification, do not have a sexual reproductive cycle, and cannot live outside of a mycorrhizal association. The plants benefited from the association because mycorrhizae allowed them to move into new habitats and allowed the increased uptake of nutrients, which gave them an enormous selective advantage over plants that did not establish symbiotic relationships.
Lichens
Lichens display a range of colors and textures (Figure 24.23) and can survive in the most unusual and hostile habitats. They cover rocks, gravestones, tree bark, and the ground in the tundra where plant roots cannot penetrate. Lichens can survive extended periods of drought, when they become completely desiccated, and then rapidly become active once water is available again.
Link to Learning
Link to Learning
Explore the world of lichens using this site from Oregon State University.
Figure 24.23 Lichens. Lichens have many forms. They may be (a) crust-like, (b) hair-like, or (c) leaf-like. (credit a: modification of work by Jo Naylor; credit b: modification of work by "djpmapleferryman"/Flickr; credit c: modification of work by Cory Zanker)
It is important to note that lichens are not a single organism, but rather another wonderful example of a mutualism, in which a fungus (usually a member of the Ascomycota or Basidiomycota) lives in a physical and physiological relationship with a photosynthetic organism (a eukaryotic alga or a prokaryotic cyanobacterium) (Figure 24.24). Generally, neither the fungus nor the photosynthetic organism can survive alone outside of the symbiotic relationship. The body of a lichen, referred to as a thallus, is formed of hyphae wrapped around the photosynthetic partner. The photosynthetic organism provides carbon and energy in the form of carbohydrates. Some cyanobacteria additionally fix nitrogen from the atmosphere, contributing nitrogenous compounds to the association. In return, the fungus supplies minerals and protection from dryness and excessive light by encasing the algae in its mycelium. The fungus also attaches the lichen to its substrate.
Figure 24.24 Structure of a lichen. This cross-section of a lichen thallus shows the (a) upper cortex of fungal hyphae, which provides protection; the (b) algal zone where photosynthesis occurs, the (c) medulla of fungal hyphae, and the (d) lower cortex, which also provides protection and may have (e) rhizines to anchor the thallus to the substrate.
The thallus of lichens grows very slowly, expanding its diameter a few millimeters per year. Both the fungus and the alga participate in the formation of dispersal units, called soredia—clusters of algal cells surrounded by mycelia. Soredia are dispersed by wind and water and form new lichens.
Lichens are extremely sensitive to air pollution, especially to abnormal levels of nitrogenous and sulfurous compounds. The U.S. Forest Service and National Park Service can monitor air quality by measuring the relative abundance and health of the lichen population in an area. Lichens fulfill many ecological roles. Caribou and reindeer eat lichens, and they provide cover for small invertebrates that hide in the mycelium. In the production of textiles, weavers used lichens to dye wool for many centuries until the advent of synthetic dyes. The pigments used in litmus paper are also extracted from lichens.
Link to Learning
Link to Learning
Lichens are used to monitor the quality of air. Read more on this site from the United States Forest Service.
Fungus/Animal Mutualism
Fungi have evolved mutualisms with numerous insects in Phylum Arthropoda: joint-legged invertebrates with a chitinous exoskeleton. Arthropods depend on the fungus for protection from predators and pathogens, while the fungus obtains nutrients and a way to disseminate spores into new environments. The association between species of Basidiomycota and scale insects is one example. The fungal mycelium covers and protects the insect colonies. The scale insects foster a flow of nutrients from the parasitized plant to the fungus.
In a second example, leaf-cutter ants of Central and South America literally farm fungi. They cut disks of leaves from plants and pile them up in subterranean gardens (Figure 24.25). Fungi are cultivated in these disk gardens, digesting the cellulose in the leaves that the ants cannot break down. Once smaller sugar molecules are produced and consumed by the fungi, the fungi in turn become a meal for the ants. The insects also patrol their garden, preying on competing fungi. Both ants and fungi benefit from this mutualistic association. The fungus receives a steady supply of leaves and freedom from competition, while the ants feed on the fungi they cultivate.
Figure 24.25 Leaf-cutter ant. A leaf-cutter ant transports a leaf that will feed a farmed fungus. (credit: Scott Bauer, USDA-ARS)
Fungivores
Animal dispersal is important for some fungi because an animal may carry fungal spores considerable distances from the source. Fungal spores are rarely completely degraded in the gastrointestinal tract of an animal, and many are able to germinate when they are passed in the feces. Some “dung fungi” actually require passage through the digestive system of herbivores to complete their lifecycle. The black truffle—a prized gourmet delicacy—is the fruiting body of an underground ascomycete. Almost all truffles are ectomycorrhizal, and are usually found in close association with trees. Animals eat truffles and disperse the spores. In Italy and France, truffle hunters use female pigs to sniff out truffles (female pigs are attracted to truffles because the fungus releases a volatile compound closely related to a pheromone produced by male pigs.)
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.04%3A_Fungi/5.4.04%3A_Ecology_of_Fungi.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe some fungal parasites and pathogens of plants
• Describe the different types of fungal infections in humans
• Explain why antifungal therapy is hampered by the similarity between fungal and animal cells
Parasitism describes a symbiotic relationship in which one member of the association benefits at the expense of the other. Both parasites and pathogens harm the host; however, pathogens cause disease, damage to host tissues or physiology, whereas parasites usually do not, but can cause serious damage and death by competition for nutrients or other resources. Commensalism occurs when one member benefits without affecting the other.
Plant Parasites and Pathogens
The production of sufficient high-quality crops is essential to human existence. Unfortunately, plant diseases have ruined many crops throughout human agricultural history, sometimes creating widespread famine. Many plant pathogens are fungi that cause tissue decay and the eventual death of the host (Figure 24.26). In addition to destroying plant tissue directly, some plant pathogens spoil crops by producing potent toxins that can further damage and kill the host plant. Fungi are also responsible for food spoilage and the rotting of stored crops. For example, the fungus Claviceps purpurea causes ergot, a disease of cereal crops (especially of rye). Although the fungus reduces the yield of cereals, the effects of the ergot's alkaloid toxins on humans and animals are of much greater significance. In animals, the disease is referred to as ergotism. The most common signs and symptoms are convulsions, hallucination, gangrene, and loss of milk in cattle. The active ingredient of ergot is lysergic acid, which is a precursor of the drug LSD. Smuts, rusts, and powdery or downy mildew are other examples of common fungal pathogens that affect crops.
Figure 24.26 Fungal pathogens. Some fungal pathogens include (a) green mold on grapefruit, (b) powdery mildew on a zinnia, (c) stem rust on a sheaf of barley, and (d) grey rot on grapes. In wet conditions Botrytis cinerea, the fungus that causes grey rot, can destroy a grape crop. However, controlled infection of grapes by Botrytis results in noble rot, a condition that produces strong and much-prized dessert wines. (credit a: modification of work by Scott Bauer, USDA-ARS; credit b: modification of work by Stephen Ausmus, USDA-ARS; credit c: modification of work by David Marshall, USDA-ARS; credit d: modification of work by Joseph Smilanick, USDA-ARS)
Aflatoxins are toxic, carcinogenic compounds released by fungi of the genus Aspergillus. Periodically, harvests of nuts and grains are tainted by aflatoxins, leading to massive recall of produce. This sometimes ruins producers and causes food shortages in developing countries.
Animal and Human Parasites and Pathogens
Fungi can affect animals, including humans, in several ways. A mycosis is a fungal disease that results from infection and direct damage due to the growth and infiltration of the fungus. Fungi attack animals directly by colonizing and destroying tissues. Mycotoxicosis is the poisoning of humans (and other animals) by foods contaminated by fungal toxins (mycotoxins). Mycetismus specifically describes the ingestion of preformed toxins in poisonous mushrooms. In addition, individuals who display hypersensitivity to molds and spores may develop strong and dangerous allergic reactions. Fungal infections are generally very difficult to treat because, unlike bacteria, fungi are eukaryotes. Antibiotics only target prokaryotic cells, whereas compounds that kill fungi also harm the eukaryotic animal host.
Many fungal infections are superficial; that is, they occur on the animal’s skin. Termed cutaneous (“skin”) mycoses, they can have devastating effects. For example, the decline of the world’s frog population in recent years is caused (in part) by the chytrid fungus Batrachochytrium dendrobatidis. This deadly fungus infects the skin of frogs and presumably interferes with cutaneous gaseous exchange, which is essential for amphibian survival. Similarly, more than a million bats in the United States have been killed by white-nose syndrome, which appears as a white ring around the mouth of the bat. It is caused by the cold-loving fungus Pseudogymnoascus destructans, which disseminates its deadly spores in caves where bats hibernate. Mycologists are researching the transmission, mechanism, and control of P. destructans to stop its spread.
Fungi that cause the superficial mycoses of the epidermis, hair, and nails rarely spread to the underlying tissue (Figure 24.27). These fungi are often misnamed “dermatophytes”, from the Greek words dermis meaning skin and phyte meaning plant, although they are not plants. Dermatophytes are also called “ringworms” because of the red ring they cause on skin. They secrete extracellular enzymes that break down keratin (a protein found in hair, skin, and nails), causing conditions such as athlete’s foot and jock itch. These conditions are usually treated with over-the-counter topical creams and powders, and are easily cleared. More persistent superficial mycoses may require prescription oral medications.
Figure 24.27 Fungal diseases of humans. (a) Ringworm presents as a red ring on skin; (b) Trichophyton violaceum, shown in this bright field light micrograph, causes superficial mycoses on the scalp; (c) Histoplasma capsulatum is an ascomycete that infects airways and causes symptoms similar to influenza. (credit a: modification of work by Dr. Lucille K. Georg, CDC; credit b: modification of work by Dr. Lucille K. Georg, CDC; credit c: modification of work by M. Renz, CDC; scale-bar data from Matt Russell)
Systemic mycoses spread to internal organs, most commonly entering the body through the respiratory system. For example, coccidioidomycosis (often called valley fever) is commonly found in the southwestern United States, but as far north as Washington, where the fungus resides in the dust. Once inhaled, the spores develop in the lungs and cause symptoms similar to those of tuberculosis. Histoplasmosis is caused by the dimorphic fungus Histoplasma capsulatum. In its human host, Histoplasma grows as a yeast, causing pulmonary infections, and in rarer cases, swelling of the membranes of the brain and spinal cord. Treatment of these and many other fungal diseases requires the use of antifungal medications that have serious side effects.
Opportunistic mycoses are fungal infections that are either common in all environments, or part of the normal biota. They mainly affect individuals who have a compromised immune system. Patients in the late stages of AIDS suffer from opportunistic mycoses that can be life threatening. The yeast Candida sp., a common member of the natural biota, can grow unchecked and infect the vagina or mouth (oral thrush) if the pH of the surrounding environment, the person’s immune defenses, or the normal population of bacteria are altered.
Mycetismus can occur when poisonous mushrooms are eaten. It causes a number of human fatalities during mushroom-picking season. Many edible fruiting bodies of fungi resemble highly poisonous relatives, and amateur mushroom hunters are cautioned to carefully inspect their harvest and avoid eating mushrooms of doubtful origin. The adage “there are bold mushroom pickers and old mushroom pickers, but are there no old, bold mushroom pickers” is unfortunately true.
Scientific Method Connection
Scientific Method Connection
Dutch Elm Disease
Question: Do trees resistant to Dutch elm disease secrete antifungal compounds?
Hypothesis: Construct a hypothesis that addresses this question.
Background: Dutch elm disease is a fungal infestation that affects many species of elm (Ulmus) in North America. The fungus infects the vascular system of the tree, which blocks water flow within the plant and mimics drought stress. Accidently introduced to the United States in the early 1930s, it decimated American elm shade trees across the continent. It is caused by the fungus Ophiostoma ulmi. The elm bark beetle acts as a vector and transmits the disease from tree to tree. Many European and Asiatic elms are less susceptible to the disease than are American elms.
Test the hypothesis: A researcher testing this hypothesis might do the following. Inoculate several Petri plates containing a medium that supports the growth of fungi with fragments of Ophiostoma mycelium. Cut (with a metal punch) several disks from the vascular tissue of susceptible varieties of American elms and resistant European and Asiatic elms. Include control Petri plates inoculated with mycelia without plant tissue to verify that the medium and incubation conditions do not interfere with fungal growth. As a positive control, add paper disks impregnated with a known fungicide to Petri plates inoculated with the mycelium.
Incubate the plates for a set number of days to allow fungal growth and spreading of the mycelium over the surface of the plate. Record the diameter of the zone of clearing, if any, around the tissue samples and the fungicide control disk.
Record your observations in the following table.
Results of Antifungal Testing of Vascular Tissue from Different Species of Elm
Disk Zone of Inhibition (mm)
Distilled Water
Fungicide
Tissue from Susceptible Elm #1
Tissue from Susceptible Elm #2
Tissue from Resistant Elm #1
Tissue from Resistant Elm #2
Table 24.1
Analyze the data and report the results. Compare the effect of distilled water to the fungicide. These are negative and positive controls that validate the experimental setup. The fungicide should be surrounded by a clear zone where the fungus growth was inhibited. Is there a difference among different species of elm?
Draw a conclusion: Was there antifungal activity as expected from the fungicide? Did the results support the hypothesis? If not, how can this be explained? There are several possible explanations.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.04%3A_Fungi/5.4.05%3A_Fungal_Parasites_and_Pathogens.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the importance of fungi to the balance of the environment
• Summarize the role of fungi in agriculture and food and beverage preparation
• Describe the importance of fungi in the chemical and pharmaceutical industries
• Discuss the role of fungi as model organisms
Although we often think of fungi as organisms that cause disease and rot food, they are vitally important to human life on many levels. As we have seen, fungi influence the well-being of human populations on a large scale because they are part of the nutrient cycle in ecosystems. They have other ecosystem roles as well. As animal pathogens, fungi help to control the population of damaging pests. These fungi are very specific to the insects they attack, and do not infect other animals or plants. Fungi are currently under investigation as potential microbial insecticides, with several already on the market. For example, the fungus Beauveria bassiana is being tested as a possible biological control agent for the recent spread of emerald ash borer a beetle that feeds on ash trees. It has been released in Michigan, Illinois, Indiana, Ohio, West Virginia, and Maryland (Figure 24.28).
Figure 24.28 Fungal insect control. The emerald ash borer (Agrilus planipennis) is an insect that attacks ash trees. It is in turn parasitized by a pathogenic fungus (Beauveria bassiana) that holds promise as a biological insecticide. The parasitic fungus appears as white fuzz on the body of the insect. (credit: Houping Liu, USDA Agricultural Research Service)
The mycorrhizal relationship between fungi and plant roots is essential for the productivity of farm land. Without the fungal partner in root systems, 80–90 percent of trees and grasses would not survive. Mycorrhizal fungal inoculants are available as soil amendments from gardening supply stores and are promoted by supporters of organic agriculture, but there is little evidence as to the effectiveness.
We also eat some types of fungi. Mushrooms figure prominently in the human diet. Morels, shiitake mushrooms, chanterelles, and truffles are considered delicacies (Figure 24.29). The humble meadow mushroom, Agaricus campestris, appears in many dishes. Molds of the genus Penicillium ripen many cheeses. They originate in the natural environment such as the caves of Roquefort, France, where wheels of sheep milk cheese are stacked in order to capture the molds responsible for the blue veins and pungent taste of the cheese.
Figure 24.29 Edible fungi. The morel mushroom (a) is an ascomycete greatly appreciated for its delicate taste. (credit: Jason Hollinger). Basidiocarps of Agaricus ready for an omelet (credit: Mary Anne Clark)
Fermentation—of grains to produce beer, and of fruits to produce wine—is an ancient art that humans in most cultures have practiced for millennia. Wild yeasts are acquired from the environment and used to ferment sugars into CO2 and ethyl alcohol under anaerobic conditions. It is now possible to purchase isolated strains of wild yeasts from different wine-making regions. Louis Pasteur was instrumental in developing a reliable strain of brewer’s yeast, Saccharomyces cerevisiae, for the French brewing industry in the late 1850s. This was one of the first examples of biotechnology patenting.
Many secondary metabolites of fungi are of great commercial importance. Antibiotics are naturally produced by fungi to kill or inhibit the growth of bacteria, limiting their competition in the natural environment. Important antibiotics, such as penicillin and the cephalosporins, are isolated from fungi. Valuable drugs isolated from fungi include the immunosuppressant drug cyclosporine (which reduces the risk of rejection after organ transplant), the precursors of steroid hormones, and ergot alkaloids used to stop bleeding. Psilocybin is a compound found in fungi such as Psilocybe semilanceata and Gymnopilus junonius, which have been used for their hallucinogenic properties by various cultures for thousands of years.
As simple eukaryotic organisms, fungi are important model research organisms. Many advances in modern genetics were achieved by the use of the red bread mold Neurospora crassa. Additionally, many important genes originally discovered in S. cerevisiae served as a starting point in discovering analogous human genes. As a eukaryotic organism, the yeast cell produces and modifies proteins in a manner similar to human cells, as opposed to the bacterium Escherichia coli, which lacks the internal membrane structures and enzymes to tag proteins for export. This makes yeast a much better organism for use in recombinant DNA technology experiments. Like bacteria, yeasts grow easily in culture, have a short generation time, and are amenable to genetic modification.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.04%3A_Fungi/5.4.06%3A_Importance_of_Fungi_in_Human_Life.txt
|
arbuscular mycorrhiza
mycorrhizal association in which the fungal hyphae enter the root cells and form extensive networks
Arbuscular mycorrhizae
mycorrhizae commonly involving Glomeromycetes in which the fungal hyphae penetrate the cell walls of the plant root cells (but not the cell membranes)
ascocarp
fruiting body of ascomycetes
Ascomycota
(also, sac fungi) phylum of fungi that store spores in a sac called ascus
basidiocarp
fruiting body that protrudes from the ground and bears the basidia
Basidiomycota
(also, club fungi) phylum of fungi that produce club-shaped structures (basidia) that contain spores
basidium
club-shaped fruiting body of basidiomycetes
Chytridiomycota
(also, chytrids) primitive phylum of fungi that live in water and produce gametes with flagella
coenocytic hypha
single hypha that lacks septa and contains many nuclei
commensalism
symbiotic relationship in which one member benefits while the other member is not affected
Deuteromycota
former form phylum of fungi that do not have a known sexual reproductive cycle (presently members of two phyla: Ascomycota and Basidiomycota)
ectomycorrhiza
mycorrhizal fungi that surround the roots with a mantle and have a Hartig net that extends into the roots between cells
Ectomycorrhizae
mycorrhizae in which the fungal hyphae do not penetrate the root cells of the plant
facultative anaerobes
organisms that can perform both aerobic and anaerobic respiration and can survive in oxygen-rich and oxygen-poor environment
Glomeromycota
phylum of fungi that form symbiotic relationships with the roots of trees
haustoria
modified hyphae on many parasitic fungi that penetrate the tissues of their hosts, release digestive enzymes, and/or absorb nutrients from the host
heterothallic
describes when only one mating type is present in an individual mycelium
homothallic
describes when both mating types are present in mycelium
hypha
fungal filament composed of one or more cells
karyogamy
fusion of nuclei
lichen
close association of a fungus with a photosynthetic alga or bacterium that benefits both partners
mold
tangle of visible mycelia with a fuzzy appearance
mycelium
mass of fungal hyphae
mycetismus
ingestion of toxins in poisonous mushrooms
mycology
scientific study of fungi
mycorrhiza
mutualistic association between fungi and vascular plant roots
mycorrhizae
a mutualistic relationship between a plant and a fungus. Mycorrhizae are connections between fungal hyphae, which provide soil minerals to the plant, and plant roots, which provide carbohydrates to the fungus
mycosis
fungal infection
mycotoxicosis
poisoning by a fungal toxin released in food
obligate aerobes
organisms, such as humans, that must perform aerobic respiration to survive
obligate anaerobes
organisms that only perform anaerobic respiration and often cannot survive in the presence of oxygen
parasitism
symbiotic relationship in which one member of the association benefits at the expense of the other
plasmogamy
fusion of cytoplasm
saprobe
organism that derives nutrients from decaying organic matter; also saprophyte
septa
cell wall division between hyphae
soredia
clusters of algal cells and mycelia that allow lichens to propagate
sporangium
reproductive sac that contains spores
spore
a haploid cell that can undergo mitosis to form a multicellular, haploid individual
thallus
vegetative body of a fungus
yeast
general term used to describe unicellular fungi
Zygomycota
(also, conjugated fungi) phylum of fungi that form a zygote contained in a zygospore
zygospore
structure with thick cell wall that contains the zygote in zygomycetes
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.04%3A_Fungi/5.4.07%3A_Key_Terms.txt
|
24.1 Characteristics of Fungi
Fungi are eukaryotic organisms that appeared on land more than 450 million years ago, but clearly have an evolutionary history far greater. They are heterotrophs and contain neither photosynthetic pigments such as chlorophyll, nor organelles such as chloroplasts. Fungi that feed on decaying and dead matter are termed saprobes. Fungi are important decomposers that release essential elements into the environment. External enzymes called exoenzymes digest nutrients that are absorbed by the body of the fungus, which is called a thallus. A thick cell wall made of chitin surrounds the cell. Fungi can be unicellular as yeasts, or develop a network of filaments called a mycelium, which is often described as mold. Most species multiply by asexual and sexual reproductive cycles. In one group of fungi, no sexual cycle has been identified. Sexual reproduction involves plasmogamy (the fusion of the cytoplasm), followed by karyogamy (the fusion of nuclei). Following these processes, meiosis generates haploid spores.
24.2 Classifications of Fungi
Chytridiomycota (chytrids) are considered the most ancestral group of fungi. They are mostly aquatic, and their gametes are the only fungal cells known to have flagella. They reproduce both sexually and asexually; the asexual spores are called zoospores. Zygomycota (conjugated fungi) produce non-septate hyphae with many nuclei. Their hyphae fuse during sexual reproduction to produce a zygospore in a zygosporangium. Ascomycota (sac fungi) form spores in sacs called asci during sexual reproduction. Asexual reproduction is their most common form of reproduction. In the Basidiomycota (club fungi), the sexual phase predominates, producing showy fruiting bodies that contain club-shaped basidia, within which spores form. Most familiar mushrooms belong to this division. Fungi that have no known sexual cycle were originally classified in the “form phylum” Deuteromycota, but many have been classified by comparative molecular analysis with the Ascomycota and Basidiomycota. Glomeromycota form tight associations (called mycorrhizae) with the roots of plants.
24.3 Ecology of Fungi
Fungi have colonized nearly all environments on Earth, but are frequently found in cool, dark, moist places with a supply of decaying material. Fungi are saprobes that decompose organic matter. Many successful mutualistic relationships involve a fungus and another organism. Many fungi establish complex mycorrhizal associations with the roots of plants. Some ants farm fungi as a supply of food. Lichens are a symbiotic relationship between a fungus and a photosynthetic organism, usually an alga or cyanobacterium. The photosynthetic organism provides energy from stored carbohydrates, while the fungus supplies minerals and protection. Some animals that consume fungi help disseminate spores over long distances.
24.4 Fungal Parasites and Pathogens
Fungi establish parasitic relationships with plants and animals. Fungal diseases can decimate crops and spoil food during storage. Compounds produced by fungi can be toxic to humans and other animals. Mycoses are infections caused by fungi. Superficial mycoses affect the skin, whereas systemic mycoses spread through the body. Fungal infections are difficult to cure, since fungi, like their hosts, are eukaryotic, and cladistically related closely to Kingdom Animalia.
24.5 Importance of Fungi in Human Life
Fungi are important to everyday human life. Fungi are important decomposers in most ecosystems. Mycorrhizal fungi are essential for the growth of most plants. Fungi, as food, play a role in human nutrition in the form of mushrooms, and also as agents of fermentation in the production of bread, cheeses, alcoholic beverages, and numerous other food preparations. Secondary metabolites of fungi are used as medicines, such as antibiotics and anticoagulants. Fungi are model organisms for the study of eukaryotic genetics and metabolism.
5.4.09: Visual Connection Questions
1.
Figure 24.14 Which of the following statements is true?
1. A dikaryotic ascus that forms in the ascocarp undergoes karyogamy, meiosis, and mitosis to form eight ascospores.
2. A diploid ascus that forms in the ascocarp undergoes karyogamy, meiosis, and mitosis to form eight ascospores.
3. A haploid zygote that forms in the ascocarp undergoes karyogamy, meiosis, and mitosis to form eight ascospores.
4. A dikaryotic ascus that forms in the ascocarp undergoes plasmogamy, meiosis, and mitosis to form eight ascospores.
2.
Figure 24.17 Which of the following statements is true?
1. A basidium is the fruiting body of a mushroom-producing fungus, and it forms four basidiocarps.
2. The result of the plasmogamy step is four basidiospores.
3. Karyogamy results directly in the formation of mycelia.
4. A basidiocarp is the fruiting body of a mushroom-producing fungus.
3.
Figure 24.21 If symbiotic fungi are absent from the soil, what impact do you think this would have on plant growth?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.04%3A_Fungi/5.4.08%3A_Chapter_Summary.txt
|
4.
Which polysaccharide is usually found in the cell wall of fungi?
1. starch
2. glycogen
3. chitin
4. cellulose
5.
Which of these organelles is not found in a fungal cell?
1. chloroplast
2. nucleus
3. mitochondrion
4. Golgi apparatus
6.
The wall dividing individual cells in a fungal filament is called a
1. thallus
2. hypha
3. mycelium
4. septum
7.
During sexual reproduction, a homothallic mycelium contains
1. all septated hyphae
2. all haploid nuclei
3. both mating types
4. none of the above
8.
The life cycles of perfect fungi are most similar to which other organism?
1. Hydra that undergo asexual budding
2. Diploid-dominant pea plants
3. Haploid-dominant green algae
4. Bacteria undergoing binary fission
9.
The most primitive phylum of fungi is the ________.
1. Chytridiomycota
2. Zygomycota
3. Glomeromycota
4. Ascomycota
10.
Members of which phylum produce a club-shaped structure that contains spores?
1. Chytridiomycota
2. Basidiomycota
3. Glomeromycota
4. Ascomycota
11.
Members of which phylum establish a successful symbiotic relationship with the roots of trees?
1. Ascomycota
2. Deuteromycota
3. Basidiomycota
4. Glomeromycota
12.
The fungi that do not reproduce sexually used to be classified as ________.
1. Ascomycota
2. Deuteromycota
3. Basidiomycota
4. Glomeromycota
13.
A scientist discovers a new species of fungus that introduces genetic diversity during reproduction by creating a diploid zygote. This new species cannot belong to which modern phylum of fungi?
1. Zygomycota
2. Glomeromycota
3. Chytridiomycota
4. Deuteromycota
14.
What term describes the close association of a fungus with the root of a tree?
1. a rhizoid
2. a lichen
3. a mycorrhiza
4. an endophyte
15.
Why are fungi important decomposers?
1. They produce many spores.
2. They can grow in many different environments.
3. They produce mycelia.
4. They recycle carbon and inorganic minerals by the process of decomposition.
16.
Consider an ecosystem where all the fungi not involved in mycorrhizae are eliminated. How would this affect nitrogen intake by plants?
1. Nitrogen intake would increase.
2. Nitrogen intake would not change.
3. Nitrogen intake would decrease.
4. Nitrogen intake would stop.
17.
A fungus that climbs up a tree reaching higher elevation to release its spores in the wind and does not receive any nutrients from the tree or contribute to the tree’s welfare is described as a ________.
1. commensal
2. mutualist
3. parasite
4. pathogen
18.
A fungal infection that affects nails and skin is classified as ________.
1. systemic mycosis
2. mycetismus
3. superficial mycosis
4. mycotoxicosis
19.
The targets for anti-fungal drugs are much more limited than antibiotics or anti-viral medications. Why?
1. There are more bacteria and viruses than fungi.
2. Fungi can only be targeted during sexual reproduction, while bacteria and viruses can be targeted at any point in their lifespan.
3. Fungi cause topical infections, while viruses and bacteria cause systemic infections.
4. Human cells are much more similar to fungi cells than bacteria or viruses.
20.
Yeast is a facultative anaerobe. This means that alcohol fermentation takes place only if:
1. the temperature is close to 37°C
2. the atmosphere does not contain oxygen
3. sugar is provided to the cells
4. light is provided to the cells
21.
The advantage of yeast cells over bacterial cells to express human proteins is that:
1. yeast cells grow faster
2. yeast cells are easier to manipulate genetically
3. yeast cells are eukaryotic and modify proteins similarly to human cells
4. yeast cells are easily lysed to purify the proteins
22.
Why are fungal insecticides an attractive alternative to chemical pesticides for growing food crops?
1. Human consumption of fungal insecticides would not make a person sick, but ingestion of chemical pesticides can be harmful to humans.
2. A single fungal insecticide would kill a wider variety of insects than a chemical pesticide.
3. Fungal insecticides can eliminate both harmful insects and plant pathogens, while chemical pesticides only kill insects.
4. Fungal insecticides will decompose dying plants, enhancing the nitrogen content of the soil, while chemical pesticides are not decomposers.
5.4.11: Critical Thinking Questions
23.
What are the evolutionary advantages for an organism to reproduce both asexually and sexually?
24.
Compare plants, animals, and fungi, considering these components: cell wall, chloroplasts, plasma membrane, food source, and polysaccharide storage. Be sure to indicate fungi’s similarities and differences to plants and animals.
25.
Why is the large surface area of the mycelium essential for nutrient acquisition by fungi?
26.
What is the advantage for a basidiomycete to produce a showy and fleshy fruiting body?
27.
For each of the four groups of perfect fungi (Chytridiomycota, Zygomycota, Ascomycota, and Basidiomycota), compare the body structure and features, and provide an example.
28.
Why does protection from light actually benefit the photosynthetic partner in lichens?
29.
Ambrosia bark beetles carry Ambrosiella fungal spores to trees, then bore holes and lay their eggs with the fungus. When the new larvae hatch, they eat the fungus that has germinated in the holes. Describe how this relationship can be classified as mutualistic.
30.
Ecologists often attempt to introduce new plants to restore degraded land. In an arid climate, scientists recommend introducing plants with arbuscular mycorrhizae. How would the mycorrhizae increase the plants’ survival compared to plants without mycorrhizae?
31.
Why can superficial mycoses in humans lead to bacterial infections?
32.
Explain how the Red Queen Hypothesis describes the continuously evolving relationship between red grapes and Botrytis cinerea.
33.
Historically, artisanal breads were produced by capturing wild yeasts from the air. Prior to the development of modern yeast strains, the production of artisanal breads was long and laborious because many batches of dough ended up being discarded. Can you explain this fact?
34.
How would treating an area of a forest with a broad-spectrum fungicide alter the carbon and nitrogen cycles in the area?
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.04%3A_Fungi/5.4.10%3A_Review_Questions.txt
|
Seedless plants reproduce and spread through spores, but do not flower or seed to replicate.
• 5.5.1: Introduction
The evolutionary transition from water to land imposed severe constraints on plants. They had to develop strategies to avoid drying out, to disperse reproductive cells in air, for structural support, and for capturing and filtering sunlight. While seed plants developed adaptations that allowed them to populate even the most arid habitats on Earth, full independence from water did not happen in all plants. Most seedless plants still require a moist environment.
• 5.5.2: Early Plant Life
The kingdom Plantae constitutes large and varied groups of organisms. There are more than 300,000 species of catalogued plants. Of these, more than 260,000 are seed plants. Mosses, ferns, conifers, and flowering plants are all members of the plant kingdom. Most biologists also consider green algae to be plants, although others exclude all algae from the plant kingdom.
• 5.5.3: Green Algae - Precursors of Land Plants
Green algae contain the same carotenoids and chlorophyll a and b as land plants, whereas other algae have different accessory pigments and types of chlorophyll molecules in addition to chlorophyll a. Both green algae and land plants also store carbohydrates as starch. Cells in green algae divide along cell plates called phragmoplasts, and their cell walls are layered in the same manner as the cell walls of embryophytes.
• 5.5.4: Bryophytes
Bryophytes are the group of plants that are the closest extant relative of early terrestrial plants. The first bryophytes (liverworts) most likely appeared in the Ordovician period, about 450 million years ago. Because of the lack of lignin and other resistant structures, the likelihood of bryophytes forming fossils is rather small. Some spores protected by sporopollenin have survived and are attributed to early bryophytes.
• 5.5.5: Seedless Vascular Plants
The vascular plants, or tracheophytes, are the dominant and most conspicuous group of land plants. More than 260,000 species of tracheophytes represent more than 90 percent of Earth’s vegetation. Several evolutionary innovations explain their success and their ability to spread to all habitats.
• 5.5.6: Key Terms
• 5.5.7: Chapter Summary
• 5.5.8: Visual Connection Questions
• 5.5.9: Review Questions
• 5.5.10: Critical Thinking Questions
Thumbnail: Fern plants. (CC BY-SA 3.0; Sanjay ach via Wikimedia Commons).
5.05: Seedless Plants
Figure 25.1 Seedless plants, like these horsetails (Equisetum sp.), thrive in damp, shaded environments under a tree canopy where dryness is rare. (credit: modification of work by Jerry Kirkhart)
An incredible variety of seedless plants populates the terrestrial landscape. Mosses may grow on a tree trunk, and horsetails may display their jointed stems and spindly leaves across the forest floor. Today, seedless plants represent only a small fraction of the plants in our environment; yet, 300 million years ago, seedless plants dominated the landscape and grew in the enormous swampy forests of the Carboniferous period. Their decomposition created large deposits of coal that we mine today.
Current evolutionary thought holds that all plants—some green algae as well as land plants—are monophyletic; that is, they are descendants of a single common ancestor. The evolutionary transition from water to land imposed severe constraints on plants. They had to develop strategies to avoid drying out, to disperse reproductive cells in air, for structural support, and for capturing and filtering sunlight. While seed plants have developed adaptations that allow them to populate even the most arid habitats on Earth, full independence from water did not happen in all plants. Most seedless plants still require a moist environment for reproduction.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.05%3A_Seedless_Plants/5.5.01%3A_Introduction.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Discuss the challenges to plant life on land
• Describe the adaptations that allowed plants to colonize the land
• Describe the timeline of plant evolution and the impact of land plants on other living things
The kingdom Plantae constitutes large and varied groups of organisms. There are more than 300,000 species of catalogued plants. Of these, more than 260,000 are seed plants. Mosses, ferns, conifers, and flowering plants are all members of the plant kingdom. Land plants arose within the Archaeplastida, which includes the red algae (Rhodophyta) and two groups of green algae, Chlorophyta and Charaphyta. Most biologists also consider at least some green algae to be plants, although others exclude all algae from the plant kingdom. The reason for this disagreement stems from the fact that only green algae, the Chlorophytes and Charophytes, share common characteristics with land plants (such as using chlorophyll a and b plus carotene in the same proportion as plants). These characteristics are absent from other types of algae.
Evolution Connection
Evolution Connection
Algae and Evolutionary Paths to PhotosynthesisSome scientists consider all algae to be plants, while others assert that only the green algae belong in the kingdom Plantae. Still others include only the Charophytes among the plants. These divergent opinions are related to the different evolutionary paths to photosynthesis selected for in different types of algae. While all algae are photosynthetic—that is, they contain some form of a chloroplast—they didn’t all become photosynthetic via the same path.
The ancestors to the Archaeplastida became photosynthetic by forming an endosymbiotic relationship with a green, photosynthetic bacterium about 1.65 billion years ago. That algal line evolved into the red and green algae, and eventually into the modern mosses, ferns, gymnosperms, and angiosperms. Their evolutionary trajectory was relatively straight and monophyletic. In contrast, algae outside of the Archaeplastida, e.g., the brown and golden algae of the stramenopiles, and so on—all became photosynthetic by secondary, or even tertiary, endosymbiotic events; that is, they engulfed cells that already contained an endosymbiotic cyanobacterium. These latecomers to photosynthesis are parallels to the Archaeplastida in terms of autotrophy, but they did not expand to the same extent as the Archaeplastida, nor did they colonize the land.
Scientists who solely track evolutionary straight lines (that is, monophyly), consider only the Charophytes as plants. The common ancestor of Charophytes and land plants excludes the other members of the Archaeplastida. Charophytes also share other features with the land plants. These will be discussed in more detail in another section.
Link to Learning
Link to Learning
Go to this article to get a more in-depth view of the Charophytes.
Plant Adaptations to Life on Land
As organisms adapted to life on land, they had to contend with several challenges in the terrestrial environment. Water has been described as “the stuff of life.” The cell’s interior is a thick soup: in this medium, most small molecules dissolve and diffuse, and the majority of the chemical reactions of metabolism take place. Desiccation, or drying out, is a constant danger for an organism exposed to air. Even when parts of a plant are close to a source of water, the aerial structures are likely to dry out. Water also provides buoyancy to organisms. On land, plants need to develop structural support in a medium that does not give the same lift as water. The organism is also subject to bombardment by mutagenic radiation, because air does not filter out ultraviolet rays of sunlight. Additionally, the male gametes must reach the female gametes using new strategies, because swimming is no longer possible. Therefore, both gametes and zygotes must be protected from desiccation. The successful land plants developed strategies to deal with all of these challenges. Not all adaptations appeared at once. Some species never moved very far from the aquatic environment, whereas others went on to conquer the driest environments on Earth.
To balance these survival challenges, life on land offers several advantages. First, sunlight is abundant. Water acts as a filter, altering the spectral quality of light absorbed by the photosynthetic pigment chlorophyll. Second, carbon dioxide is more readily available in air than in water, since it diffuses faster in air. Third, land plants evolved before land animals; therefore, until dry land was colonized by animals, no predators threatened plant life. This situation changed as animals emerged from the water and fed on the abundant sources of nutrients in the established flora. In turn, plants developed strategies to deter predation: from spines and thorns to toxic chemicals.
Early land plants, like the early land animals, did not live very far from an abundant source of water and developed survival strategies to combat dryness. One of these strategies is called tolerance. Many mosses, for example, can dry out to a brown and brittle mat, but as soon as rain or a flood makes water available, mosses will absorb it and are restored to their healthy green appearance. Another strategy is to colonize environments with high humidity, where droughts are uncommon. Ferns, which are considered an early lineage of plants, thrive in damp and cool places such as the understory of temperate forests. Later, plants moved away from moist or aquatic environments using resistance to desiccation, rather than tolerance. These plants, like cacti, minimize the loss of water to such an extent they can survive in extremely dry environments.
The most successful adaptation solution was the development of new structures that gave plants the advantage when colonizing new and dry environments. Four major adaptations contribute to the success of terrestrial plants. The first adaptation is that the life cycle in all land plants exhibits the alternation of generations, a sporophyte in which the spores are formed and a gametophyte that produces gametes. Second is an apical meristem tissue in roots and shoots. Third is the evolution of a waxy cuticle to resist desiccation (absent from some mosses). Finally cell walls with lignin to support structures off the ground. These adaptations all contribute to the success of the land plants, but are noticeably lacking in the closely related green algae—another reason for the debate over their placement in the plant kingdom. They are also not all found in the mosses, which can be regarded as representing an intermediate stage in adaptation to land.
Alternation of Generations
All sexually reproducing organisms have both haploid and diploid cells in their life cycles. In organisms with haplontic life cycles, the haploid stage is dominant, while in organisms with a diplontic life cycle, the diploid stage is the dominant life stage. Dominant in this context means both the stage in which the organism spends most of its time, and the stage in which most mitotic cell reproduction occurs—the multicellular stage. In haplontic life cycles, the only diploid cell is the zygote, which undergoes immediate meiosis to restore the haploid state. In diplontic life cycles, the only haploid cells are the gametes, which combine to restore the diploid state at their earliest convenience. Humans, for example, are diplontic.
Alternation of generations describes a life cycle in which an organism has both haploid and diploid multicellular stages (Figure 25.2). This type of life cycle, which is found in all plants, is described as haplodiplontic.
Figure 25.2 Alternation of generations between the 1n gametophyte and 2n sporophyte is shown. Mitosis occurs in both gametophyte and sporophyte generations. Diploid sporophytes produce haploid spores by meiosis, while haploid gametophytes produce gametes by mitosis. (credit: Peter Coxhead)
In alternation of generations, the multicellular haploid form, known as a gametophyte, is followed in the developmental sequence by a multicellular diploid form, the sporophyte. The gametophyte gives rise to the gametes (reproductive cells) by mitosis. This can be the most obvious phase of the life cycle of the plant, as in the mosses, or it can occur in a microscopic structure, such as a pollen grain, in the seed plants. The evolution of the land plants is marked by increasing prominence of the sporophyte generation. The sporophyte stage is barely noticeable in non-vascular plants (the collective term for the plants that include the liverworts and mosses). In the seed plants, the sporophyte phase can be a towering tree, as in sequoias and pines.
Protection of the embryo is a major requirement for land plants. The vulnerable embryo must be sheltered from desiccation and other environmental hazards. In both seedless and seed plants, the female gametophyte provides protection and nutrients to the embryo as it develops into the new sporophyte. This distinguishing feature of land plants gave the group its alternate name of embryophytes.
Sporangia in Seedless Plants
The sporophyte of seedless plants is diploid and results from syngamy (fusion) of two gametes. The sporophyte bears the sporangia (singular, sporangium). The term “sporangia” literally means “a vessel for spores,” as it is a reproductive sac in which spores are formed (Figure 25.3). Inside the multicellular sporangia, the diploid sporocytes, or mother cells, produce haploid spores by meiosis, during which the 2n chromosome number is reduced to 1n (note that in many plants, chromosome number is complicated by polyploidy: for example, durum wheat is tetraploid, bread wheat is hexaploid, and some ferns are 1000-ploid). The spores are later released by the sporangia and disperse in the environment. When the haploid spore germinates in a hospitable environment, it generates a multicellular gametophyte by mitosis. The gametophyte supports the zygote formed from the fusion of gametes and the resulting young sporophyte (vegetative form). The cycle then begins anew.
Figure 25.3 Sporangia. Spore-producing sacs called sporangia grow at the ends of long, thin stalks in this photo of the moss Esporangios bryum. (credit: Javier Martin)
Plants that produce only one type of spore are called homosporous and the resultant gametophyte produces both male and female gametes, usually on the same individual. Non-vascular plants are homosporous, and the gametophyte is the dominant generation in the life cycle. Plants that produce two types of spores are called heterosporous. The male spores are called microspores, because of their smaller size, and develop into the male gametophyte; the comparatively larger megaspores develop into the female gametophyte. A few seedless vascular plants and all seed plants are heterosporous, and the sporophyte is the dominant generation.
The spores of seedless plants are surrounded by thick cell walls containing a tough polymer known as sporopollenin. As the name suggests, it is also found in the walls of pollen grains. This complex substance is characterized by long chains of organic molecules related to fatty acids and carotenoids: hence the yellow color of most pollen. Sporopollenin is unusually resistant to chemical and biological degradation. In seed plants, in which pollen is the male gametophyte, the toughness of sporopollenin explains the existence of well-preserved pollen fossils. Sporopollenin was once thought to be an innovation of land plants; however, the charophyte Coleochaetes also forms spores that contain sporopollenin.
Gametangia in Seedless Plants
Gametangia (singular, gametangium) are structures observed on multicellular haploid gametophytes. In the gametangia, precursor cells give rise to gametes by mitosis. The male gametangium (antheridium) releases sperm. Seedless plants produce sperm equipped with flagella that enable them to swim in a moist environment to the archegonium: the female gametangium. The embryo develops inside the archegonium as the sporophyte. Gametangia are prominent in seedless plants, but are absent or rudimentary in seed plants.
Apical Meristems
Shoots and roots of plants increase in length through rapid cell division in a tissue called the apical meristem, which is a small mitotically active zone of cells found at the shoot tip or root tip (Figure 25.4). The apical meristem is made of undifferentiated cells that continue to proliferate throughout the life of the plant. Meristematic cells give rise to all the specialized tissues of the organism. Elongation of the shoots and roots allows a plant to access additional space and resources: light in the case of the shoot, and water and minerals in the case of roots. A separate meristem, called the lateral meristem, produces cells that increase the diameter of tree trunks.
Figure 25.4 Apical meristem at a root tip. Addition of new cells in a root occurs at the apical meristem. Subsequent enlargement of these cells causes the organ to grow and elongate. The root cap protects the fragile apical meristem as the root tip is pushed through the soil by cell elongation.
Additional Land Plant Adaptations
As plants adapted to dry land and became independent from the constant presence of water in damp habitats, new organs and structures made their appearance. Early land plants did not grow more than a few inches off the ground, competing for light on these low mats. By developing a shoot and growing taller, individual plants captured more light. Because air offers substantially less support than water, land plants incorporated more rigid molecules in their stems (and later, tree trunks). In small plants such as single-celled algae, simple diffusion suffices to distribute water and nutrients throughout the organism. However, for plants to evolve larger forms, the evolution of a conductive tissue for the distribution of water and solutes was a prerequisite. The evolution of vascular tissue in plants met both of these needs. The vascular system contains two types of conductive tissue: xylem and phloem. Xylem conducts water and minerals absorbed from the soil up to the shoot, while phloem transports food derived from photosynthesis throughout the entire plant. In xylem, the cells walls are reinforced with lignin, whose tough hydrophobic polymers help prevent the seepage of water across the xylem cell walls. Lignin also adds to the strength of these tissues in supporting the plant. The vascular tissues extend into the root of land plants. The root system evolved to take up water and minerals from the soil, and to anchor the increasingly taller shoot in the soil.
In land plants, a waxy, waterproof cover called a cuticle protects the leaves and stems from desiccation. However, the cuticle also prevents intake of carbon dioxide needed for the synthesis of carbohydrates through photosynthesis. To overcome this, stomata or pores that open and close to regulate traffic of gases and water vapor appeared in plants as they moved away from moist environments into drier habitats.
Water filters ultraviolet-B (UVB) light, which is harmful to all organisms, especially those that must absorb light to survive. This filtering does not occur for land plants. Exposure to damaging radiation presented an additional challenge to land colonization, which was met by the evolution of biosynthetic pathways for the synthesis of protective flavonoids and other pigments that absorb UV wavelengths of light and protect the aerial parts of plants from photodynamic damage.
Plants cannot avoid being eaten by animals. Instead, they synthesize a large range of poisonous secondary metabolites: complex organic molecules such as alkaloids, whose noxious smells and unpleasant taste deter animals. These toxic compounds can also cause severe diseases and even death, thus discouraging predation. Humans have used many of these compounds for centuries as drugs, medications, or spices. In contrast, as plants co-evolved with animals, the development of sweet and nutritious metabolites lured animals into providing valuable assistance in dispersing pollen grains, fruit, or seeds. Plants have been enlisting animals to be their helpers in this way for hundreds of millions of years.
Evolution of Land Plants
No discussion of the evolution of plants on land can be undertaken without a brief review of the timeline of the geological eras. The early era, known as the Paleozoic, is divided into six periods. It starts with the Cambrian period, followed by the Ordovician, Silurian, Devonian, Carboniferous, and Permian. The major event to mark the Ordovician, more than 500 million years ago, was the colonization of land by the ancestors of modern land plants. Fossilized cells, cuticles, and spores of early land plants have been dated as far back as the Ordovician period in the early Paleozoic era. The oldest-known vascular plants have been identified in deposits from the Devonian. One of the richest sources of information is the Rhynie chert, a sedimentary rock deposit found in Rhynie, Scotland (Figure 25.5), where embedded fossils of some of the earliest vascular plants have been identified.
Figure 25.5 Early vascular plant fossils. This Rhynie chert (a) contains fossilized material from vascular plants. Reconstruction of Cooksonia (b), the plant forms inside the circle. (credit b: modification of work by Peter Coxhead based on original image by “Smith609”/Wikimedia Commons; scale-bar data from Matt Russell)
Paleobotanists distinguish between extinct species, as fossils, and extant species, which are still living. The extinct vascular plants most probably lacked true leaves and roots and formed low vegetation mats similar in size to modern-day mosses, although some could reach one meter in height. The later genus Cooksonia, which flourished during the Silurian, has been extensively studied from well-preserved examples. Imprints of Cooksonia show slender branching stems ending in what appear to be sporangia. From the recovered specimens, it is not possible to establish for certain whether Cooksonia possessed vascular tissues. Fossils indicate that by the end of the Devonian period, ferns, horsetails, and seed plants populated the landscape, giving rising to trees and forests. This luxuriant vegetation helped enrich the atmosphere with oxygen, making it easier for air-breathing animals to colonize dry land. Plants also established early symbiotic relationships with fungi, creating mycorrhizae: a relationship in which the fungal network of filaments increases the efficiency of the plant root system, and the plants provide the fungi with byproducts of photosynthesis.
Career Connection
Career Connection
PaleobotanistHow organisms acquired traits that allow them to colonize new environments—and how the contemporary ecosystem is shaped—are fundamental questions of evolution. Paleobotany (the study of extinct plants) addresses these questions through the analysis of fossilized specimens retrieved from field studies, reconstituting the morphology of organisms that disappeared long ago. Paleobotanists trace the evolution of plants by following the modifications in plant morphology: shedding light on the connection between existing plants by identifying common ancestors that display the same traits. This field seeks to find transitional species that bridge gaps in the path to the development of modern organisms. Fossils are formed when organisms are trapped in sediments or environments where their shapes are preserved. Paleobotanists collect fossil specimens in the field and place them in the context of the geological sediments and other fossilized organisms surrounding them. The activity requires great care to preserve the integrity of the delicate fossils and the layers of rock in which they are found.
One of the most exciting recent developments in paleobotany is the use of analytical chemistry and molecular biology to study fossils. Preservation of molecular structures requires an environment free of oxygen, since oxidation and degradation of material through the activity of microorganisms depend on its presence. One example of the use of analytical chemistry and molecular biology is the identification of oleanane, a compound that deters pests. Up to this point, oleanane appeared to be unique to flowering plants; however, it has now been recovered from sediments dating from the Permian, much earlier than the current dates given for the appearance of the first flowering plants. Paleobotanists can also study fossil DNA, which can yield a large amount of information, by analyzing and comparing the DNA sequences of extinct plants with those of living and related organisms. Through this analysis, evolutionary relationships can be built for plant lineages.
Some paleobotanists are skeptical of the conclusions drawn from the analysis of molecular fossils. For example, the chemical materials of interest degrade rapidly when exposed to air during their initial isolation, as well as in further manipulations. There is always a high risk of contaminating the specimens with extraneous material, mostly from microorganisms. Nevertheless, as technology is refined, the analysis of DNA from fossilized plants will provide invaluable information on the evolution of plants and their adaptation to an ever-changing environment.
The Major Divisions of Land Plants
The green algae and land plants are grouped together into a subphylum called the Streptophyta, and thus are called Streptophytes. In a further division, land plants are classified into two major groups according to the absence or presence of vascular tissue, as detailed in Figure 25.6. Plants that lack vascular tissue, which is formed of specialized cells for the transport of water and nutrients, are referred to as non-vascular plants. Liverworts, mosses, and hornworts are seedless, non-vascular plants that likely appeared early in land plant evolution. Vascular plants developed a network of cells that conduct water and solutes. The first vascular plants appeared in the late Ordovician (500 to 435 MYA) and were probably similar to lycophytes, which include club mosses (not to be confused with the mosses) and the pterophytes (ferns, horsetails, and whisk ferns). Lycophytes and pterophytes are referred to as seedless vascular plants, because they do not produce seeds. The seed plants, or spermatophytes, form the largest group of all existing plants, and hence dominate the landscape. Seed plants include gymnosperms, most notably conifers, which produce “naked seeds,” and the most successful of all plants, the flowering plants (angiosperms). Angiosperms protect their seeds inside chambers at the center of a flower; the walls of the chamber later develop into a fruit.
Visual Connection
Visual Connection
Figure 25.6 Streptophytes. This table shows the major divisions of green plants.
Which of the following statements about plant divisions is false?
1. Lycophytes and pterophytes are seedless vascular plants.
2. All vascular plants produce seeds.
3. All non-vascular embryophytes are bryophytes.
4. Seed plants include angiosperms and gymnosperms.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.05%3A_Seedless_Plants/5.5.02%3A_Early_Plant_Life.txt
|
Learning Objectives
By the end of this section, you will be able to do the following:
• Describe the traits shared by green algae and land plants
• Explain why charophytes are considered the closest algal relative to land plants
• Explain how current phylogenetic relationships are reshaped by comparative analysis of DNA sequences
Streptophytes
Until recently, all photosynthetic eukaryotes were classified as members of the kingdom Plantae. The brown and golden algae, however, are now reassigned to the protist supergroup Chromalveolata. This is because apart from their ability to capture light energy and fix CO2, they lack many structural and biochemical traits that are characteristic of plants. The plants are now classified, along with the red and green algae, in the protist supergroup Archaeplastida. Green algae contain the same carotenoids and chlorophyll a and b as land plants, whereas other algae have different accessory pigments and types of chlorophyll molecules in addition to chlorophyll a. Both green algae and land plants also store carbohydrates as starch. Their cells contain chloroplasts that display a dizzying variety of shapes, and their cell walls contain cellulose, as do land plants. Which of the green algae to include among the plants has not been phylogenetically resolved.
Green algae fall into two major groups, the chlorophytes and the charophytes. The chlorophytes include the genera Chlorella, Chlamydomonas, the “sea lettuce” Ulva, and the colonial alga Volvox. The charophytes include desmids, as well as the genera Spirogyra, Coleochaete, and Chara. There are familiar green algae in both groups. Some green algae are single cells, such as Chlamydomonas and desmids, which adds to the ambiguity of green algae classification, because plants are multicellular. Other green algae, like Volvox, form colonies, and some, like Ulva are multicellular (Figure 25.7). Spirogyra is a long filament of colonial cells. Most members of this genus live in fresh water, brackish water, seawater, or even in snow patches. A few green algae can survive on soil, provided it is covered by a thin film of moisture within which they can live. Periodic dry spells provide a selective advantage to algae that can survive water stress.
Figure 25.7 Green algae. Charophyta include (a) Spirogyra and (b) desmids. Chlorophyta include (c) Chlamydomonas, and (d) Ulva. Desmids and Chlamydomonas are single-celled organisms, Spirogyra forms chains of cells, and Ulva forms multicellular structures resembling leaves, although the cells are not differentiated as they are in higher plants (credit b: modification of work by Derek Keats; credit c: modification of work by Dartmouth Electron Microscope Facility, Dartmouth College; credit d: modification of work by Holger Krisp; scale-bar data from Matt Russell)
The chlorophytes and the charophytes differ in a few respects that, in addition to molecular analysis, place the land plants as a sister group of the charophytes. First, cells in charophytes and the land plants divide along cell plates called phragmoplasts, in which microtubules parallel to the spindle serve as guides for the vesicles of the forming cell plate. In the chlorophytes, the cell plate is organized by a phycoplast, in which the microtubules are perpendicular to the spindle. Second, only the charophytes and the land plants have plasmodesmata, or intercellular channels that allow the transfer of materials from cell to cell. In the chlorophytes, intercellular connections do not persist in mature multicellular forms. Finally, both charophytes and the land plants show apical growth—growth from the tips of the plant rather than throughout the plant body. Consequently, land plants and the charophytes are now part of a new monophyletic group called Streptophyta.
Reproduction of Green Algae
Green algae reproduce both asexually, by fragmentation or dispersal of spores, or sexually, by producing gametes that fuse during fertilization. In a single-celled organism such as Chlamydomonas, there is no mitosis after fertilization. In the multicellular Ulva, a sporophyte grows by mitosis after fertilization (and thus exhibits alternation of generations). Both Chlamydomonas and Ulva produce flagellated gametes.
Charophytes
The charophytes include several different algal orders that have each been suggested to be the closest relatives of the land plants: the Charales, the Zygnematales, and the Coleochaetales. The Charales can be traced back 420 million years. They live in a range of freshwater habitats and vary in size from a few millimeters to a meter in length. The representative genus is Chara (Figure 25.8), often called muskgrass or skunkweed because of its unpleasant smell. Large cells form the thallus: the main stem of the alga. Branches arising from the nodes are made of smaller cells. Male and female reproductive structures are found on the nodes, and the sperm have flagella. Although Chara looks superficially like some land plants, a major difference is that the stem has no supportive tissue. However, the Charales exhibit a number of traits that are significant for adaptation to land life. They produce the compounds lignin and sporopollenin, and form plasmodesmata that connect the cytoplasm of adjacent cells. Although the life cycle of the Charales is haplontic (the main form is haploid, and diploid zygotes are formed but have a brief existence), the egg, and later, the zygote, form in a protected chamber on the haploid parent plant.
Figure 25.8 Chara. The representative alga, Chara, is a noxious weed in Florida, where it clogs waterways. (credit: South Florida Information Access, U.S. Geological Survey)
The Coleochaetes are branched or disclike multicellular forms. They can produce both sexually and asexually, but the life cycle is basically haplontic. Recent extensive DNA sequence analysis of charophytes indicates that the Zygnematales are more closely related to the embryophytes than the Charales or the Coleochaetales. The Zygnematales include the familiar genus Spirogyra, as well as the desmids. As techniques in DNA analysis improve and new information on comparative genomics arises, the phylogenetic connections between the charophytes and the land plants will continued to be examined to produce a satisfactory solution to the mystery of the origin of land plants.
|
textbooks/bio/Introductory_and_General_Biology/General_Biology_2e_(OpenStax)/05%3A_Unit_V-_Biological_Diversity/5.05%3A_Seedless_Plants/5.5.03%3A_Green_Algae_-_Precursors_of_Land_Plants.txt
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.