text stringlengths 1 18.8k | meta dict |
|---|---|
Overview
========
High-throughput studies revealed that the transcriptome does not always predict the proteome ([@B59]; [@B85]; [@B95]), highlighting the need for a better understanding of post-transcriptional regulation in order to explain this discrepancy. Post-transcriptional regulation is comprised of a complex and diverse set of processes that represent various maturation steps and regulatory modalities for mRNAs including (but not limited to): splicing, mRNA export, stability, polyadenylation, and translation ([@B45], [@B46]).
This complexity gives rise to the question: How does the cell coordinate metabolism and regulation of mRNAs encoding proteins in the same biological process so that the proteins can be coordinately produced? In answer to this question, Keene and colleagues proposed the RNA regulon model ([@B48]; [@B47]; [@B45]), where mRNAs encoding functionally related proteins (i.e., involved in the same biochemical processes) contain the same RNA elements, known as USER codes (Untranslated Sequence Elements for Regulation). USER codes can be based on primary, secondary or tertiary elements in the RNA. These USER codes are recognized by RNA binding proteins (RBPs) or regulatory RNAs (such as microRNAs, siRNAs, or snRNAs) which can recruit mRNAs to various machineries for appropriate types of processing ([@B41]; [@B12]; [@B90]). Typically, a given mRNA contains multiple USER codes which would enable coordinated and combinatorial regulation. The combinatorial effect of the USER codes and the context (the sequence context which can influence folding of neighboring USER codes and availability of RBPs and regulatory RNAs) will ultimately affect which kind of machinery will be recruited to a particular mRNA. In this way, the RNA regulon serves as an elegant model to understand how groups of mRNAs can be co-regulated in combination as they flux through the various RNA metabolism steps ultimately allowing coordinated production of their physiologically active forms, proteins.
RNA regulons are inherently dynamic, and enable cells to adapt to environmental stresses and cues in a rapid and effective manner. Operation and control of regulons are mediated through targeting RBPs which act as nodes or center-points for these networks. Factors that modulate the localization or activity of these RBPs or that modify the USER codes (such as RNA methylation) ultimately influence the activity of a given regulon. A key control step is the interaction between specific RBPs and their cognate USER codes in the groups of RNAs to be regulated. Here, we suggest the possibility some transcripts may require a two-tier system of USER codes which allow their correct channeling to the appropriate machinery. Here, we provide examples of single and multi-tier systems as a launch point for this notion.
Havoc ensues when RNA regulons become dysregulated contributing to a variety of diseases including cancer. Dysregulation of regulons can occur because of dysregulation of RBPs or mutation in the USER codes. Consistent with this, RBPs involved in all levels of mRNA metabolism were found dysregulated or mutated in cancers ([@B44]; [@B30]; [@B15]; [@B75]; [@B84]; [@B89]). Further, many oncogenic pathways involved in malignant transformation, metastasis and drug resistance are regulated by various RNA regulons ([@B20]; [@B12]; [@B93]; [@B90]; [@B11]; [@B78]). In this review, we focus on the eukaryotic translation initiation factor eIF4E, the splicing factor SRSF3 and the Upstream of N-Ras protein (UNR), as examples of RNA regulons which contribute to malignancy. Further, these provide examples of different modalities in terms of the employment of regulatory factors and USER codes, single or multi-tier USER codes systems and the diverse levels of mRNA metabolism that can be affected.
The Eukaryotic Translation Initiation Factor eIF4E
==================================================
eIF4E is traditionally defined as a factor key to global translation initiation. eIF4E binds the 5′-methyl-7-guanosine (m^7^G) cap on RNAs to recruit these to the translation machinery, thereby increasing the number of polysomes per transcript, i.e., their translation efficiency. Over time it has become clear that eIF4E regulates the translation of only a subset of capped transcripts ([@B19]; [@B27]; [@B83]). For instance, eIF4E overexpression increases the translation of ornithine decarboxylase (*Odc1*) and *Myc* mRNAs but not that of *Gapdh* or *Cyclin D1* ([@B72]); conversely, eIF4E reduction only suppresses *Odc1*, *Myc, Bcl-2*, *Edn1* (Endothelin-1), *Fth1* (Ferritin heavy chain) translation but not β*-Actin* or *Gapdh* ([@B34]; [@B27]; [@B83]). In addition, 25 years ago eIF4E was found localized in the nucleus as well as the cytoplasm where it played a role in the export of selected transcripts ([@B56]; [@B72]). In this way, eIF4E can increase the levels of transcripts available to the translation machinery and thus the protein levels in the absence of increased translation efficiency or increased RNA levels. More recently, ∼10 years ago, eIF4E was found in cytoplasmic P-bodies which appear to be involved in protecting RNAs from turnover ([@B4]; [@B33]). Not all mRNAs are targeted by these pathways and further, being an eIF4E target for one level of regulation does not imbue sensitivity to other processes *a priori*. While eIF4E associates with mRNAs through binding the common m^7^G cap structure, other USER codes act in recruiting necessary co-factors to dispatch mRNAs to the specific export, translation and/or stability machinery. Thus, eIF4E serves as an excellent example of a two-tier (or perhaps multi-tier) USER code system, as described below.
There are multiple USER codes defined for export and translation to date. The ∼50 nucleotide eIF4E sensitivity element (4ESE) in the 3′UTR required for export of its target transcripts is one of the best understood eIF4E USER codes. The 4ESE is defined by its secondary structure comprised of paired stem loops as determined by nuclease mapping experiments, and is necessary for export. For instance, *lacZ-4ESE* chimeric mRNAs are sensitive to eIF4E dependent mRNA export while *lacZ* is not ([@B21], [@B22]). At the translation level, USER codes are less well defined but can be found in both the 5′ or 3′UTRs of mRNAs. The 5′UTRs of eIF4E-sensitive mRNAs at the translational level tend to be long and GC-rich, i.e., with complex tertiary structure and this comprises the translation USER codes ([@B38]; [@B19]; [@B55]). Other sequences have been identified, such as the CERT (Cytosine-Enriched Regulator of Translation) ([@B83]), but further studies are needed to determine if this is sufficient to drive translation. Importantly, for both mRNA export and translation, eIF4E targets must also retain the m^7^G cap. Thus, there is a two-tier USER code system, with the m^7^G cap for eIF4E:mRNA binding and a 4ESE or translation USER code which direct mRNAs to their particular post-transcriptional machineries (Figure [1A](#F1){ref-type="fig"}).
{#F1}
Biochemical studies of the eIF4E-mRNA export complex elucidated the mechanisms by which the 4ESE directs mRNAs to this level of control ([@B87]). Here, the Leucine-rich Pentatricopeptide Repeat Protein (LRPPRC) simultaneously binds both the 4ESE USER code in the 3′UTR of mRNA and eIF4E bound to the mRNA through the cap. Then, the nuclear export receptor CRM1 binds this complex through direct interactions with LRPPRC. In this way, the USER code recruits the export machinery to the given mRNA directing it through this non-canonical export pathway. In the cytoplasm, eIF4E interacts with an alternative set of proteins to act in either translation or recruitment of mRNAs to P-bodies, whether there is a USER code for P-b | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#sec1-1}
============
The incidence of diaphragmatic hernia is 1:2000--1:4000 live births. Its presentation is rare in the adults. The presentation in infancy is due to signs and symptoms of respiratory distress. However, in adults, the presentation is mostly asymptomatic or might present with respiratory and abdominal symptoms. Here, the authors would like to report an unusual case of Bochdalek\'s hernia in a 75-year-old male who presented with pain abdomen and slight dyspnoea. This patient was treated with minimally invasive technique i.e., laparoscopic repair of the posterolateral defect in the diaphragm.
CASE REPORT {#sec1-2}
===========
A 75-year-old man came to our outpatient department with a history of pain abdomen, vomiting and slight dyspnoea with the onset of all these symptoms since 4 days from his presentation. His medical and family history was unremarkable. The physical examination was noncontributory. Ultrasound revealed prostatomegaly. His chest X-ray revealed well-defined radiopacity in the left lower zone completely obscuring left heart border and left hemidiaphragm s/o left moderate pleural effusion. Multiple curvilinear gaseous shadows were noted in the left lower lung field \[[Figure 1](#F1){ref-type="fig"}\].To confirm the diagnosis, a contrast-enhanced computed tomography (CECT) abdomen pelvis with high-resolution computed tomography (HRCT) of lower lung fields was done which revealed, Eventration/left diaphragmatic hernia with intrathoracic extension of bowel loops causing mediastinal shift toward the right side. Dilated fluid filled proximal small bowel loops with collapsed distal small and large bowel loops, suggesting small bowel obstruction \[[Figure 1](#F1){ref-type="fig"}\]. It was diagnosed to be a Bochdalek\'s hernia, and it was planned to be operated laparoscopically. The patient underwent laparoscopic repair and had positive outcomes with better and early recovery.We decided to operate the patient for laparoscopic repair of diaphragmatic hernia. The patient was operated under general anaesthesia with single lung ventilation. The contents of hernia were stomach, colon and small bowel. They were reduced into the abdomen, and lower peritoneal adhesiolysis was done. The defect was closed primarily, and then a composite mesh was placed to strengthen the defect \[[Figure 2](#F2){ref-type="fig"}\]. The patient had an intercostal drainage tube placed on the operated site which was removed on post-operative day 3. He had an uneventful recovery with spirometry exercises and chest physiotherapy. His 3-month follow-up was asymptomatic with no complications.
{#F1}
{#F2}
DISCUSSION {#sec1-3}
==========
Bochdalek\'s hernia was first described in 1848 by the Czechoslovakian anatomist, Vincent Alexander Bochdalek.\[[@ref1]\] A Bochdalek hernia is a congenital defect of the diaphragm located in the posterior insertion. This is caused by a lack of closure of the pleuroperitoneal cavity by incomplete diaphragmatic development before the intestine returns to the abdomen from the yolk sac between 8-10 weeks of gestation. In adults, this defect is uncommon, the lung in most cases develop normally, and therefore, symptoms are rare.\[[@ref2]\] In this age group, there are two typical clinical presentations: (a) an incidental finding in chest X-ray performed for symptoms not related to the hernia\[[@ref3][@ref4]\] or (b) when symptoms develop as a result of incarceration, strangulation and visceral perforation inside the chest cavity. Symptoms vary according to the affected organ: digestive symptoms include intermittent abdominal pain, vomiting and dysphagia while respiratory symptoms include chest pain and dyspnoea.\[[@ref3][@ref5]\] The most commonly displaced organ is the stomach followed by the colon, spleen, small intestine and ureter.\[[@ref2][@ref6][@ref7]\] Chest X-ray, CECT abdomen pelvis and HRCT of chest will be helpful in diagnosing the condition and help in planning the mode of treatment. However, an emergency situation might not provide the time for a detailed imaging. The surgical approach for this pathology depends on the presence of visceral complications. In an elective setting, most surgeons recommend the laparoscopic approach; however, when there are septic complications, the abdominal approach is preferred. The current trend is to use minimal invasive surgical techniques such as laparoscopy and thoracoscopy, which has been satisfactorily performed in adults.\[[@ref8]\]
CONCLUSION {#sec1-4}
==========
The incidence of Bochdalek\'s hernia is rare in adults and might present both symptomatically as well as asymptomatically. These patients mostly present in infancy. In adults, they present with symptoms due to complications of hernia. The knowledge of its incidence in adults is vital for its diagnosis and treatment, as it is treated surgically to avoid complications or to treat them if the patient presents with them.
Declaration of patient consent {#sec2-1}
------------------------------
The authors certify that they have obtained all appropriate patient consent forms. In the form, the patient has given his consent for his images and other clinical information to be reported in the journal. The patients understand that name and initials will not be published and due efforts will be made to conceal identity, but anonymity cannot be guaranteed.
Financial support and sponsorship {#sec2-2}
---------------------------------
Nil.
Conflicts of interest {#sec2-3}
---------------------
There are no conflicts of interest.
I would like to thank my parents, department, my teachers for their constant support in drafting this unusual case report.
| {
"pile_set_name": "PubMed Central"
} |
SummaryMore than half of patients who are treated for multiple brain metastases with whole brain radiation therapy (WBRT) will develop intracranial progression. This multi-institutional pooled analysis included 205 patients from 9 centers who received 2 courses of whole brain radiation therapy, both for multiple metastases. In this cohort, the application of the recursive partitioning analysis score was not predictive of median survival, leading to the construction of a new index, the reirradiation (ReRT) score.
Introduction {#sec1}
============
Brain metastases (BM) occur in approximately one-quarter of patients with cancer.[@bib1] They are more common in patients with lung and breast cancers and melanoma.[@bib2], [@bib3], [@bib4] BM are associated with significant symptoms, including headache, weakness, cognitive disturbance, and seizures. If untreated, they result in a median survival (MS) of 1 to 2 months.[@bib5], [@bib6] The choice of treatment approach depends on patient factors (eg, age, performance status), tumor factors (eg, size, number of metastases, primary histology, and status of extracranial disease), and the availability of different therapeutic modalities.[@bib7], [@bib8], [@bib9]
Treatment options for BM have expanded in recent years from surgery and conventional external beam whole brain radiation therapy (WBRT) to include high-dose conformal treatment to 1 or more lesions, or a resection cavity, via stereotactic radiosurgery (SRS) or stereotactic fractionated radiation therapy.[@bib9], [@bib10], [@bib11] Although the addition of an SRS boost after WBRT for patients with a single metastasis improved survival, local control, performance status, and steroid dependence in a pivotal phase 3 randomized trial for patients with 2-3 metastases, there was no survival advantage or impact on the rate of neurological death.[@bib12] SRS alone for patients with 1 to 3 BM is an appealing choice, with recent randomized evidence that demonstrates no difference in MS between SRS or SRS and WBRT, in light of the detrimental neurocognitive effects at 3 months for patients who receive both modalities.[@bib13] Although SRS is being actively explored, there are technical challenges for implementation in patients with multiple metastases, and it is considered investigational for those with \>4 lesions.[@bib14]
Approximately 50% of patients with BM present with multiple metastases.[@bib1], [@bib15], [@bib16] For this group, WBRT remains the standard of care, with a reported MS after treatment ranging from 2.3 to 7.1 months.[@bib10], [@bib16] Symptomatic improvement after WBRT occurs in 60% to 90% of cases[@bib7], [@bib15] with 1-year local control rates of approximately 70%.[@bib8], [@bib12], [@bib17] However, intracranial progression after WBRT is common and has been reported as the cause of death in one-third to one-half of patients.[@bib2], [@bib3], [@bib4] Radiologically uncontrolled BM are associated with symptom recurrence or progression, along with cognitive decline, with an average decrease of 6.3 points on the mini-mental status examination.[@bib5], [@bib6] Options for salvage at the time of progression after WBRT are limited, especially for those who progress in the form of multiple metastases. Improvements in neurologic signs or symptoms have been reported in up to 80% of patients after repeat WBRT.[@bib7], [@bib8], [@bib9]
Predicting which patients may benefit from reirradiation (ReRT) versus best supportive care (BSC) would guide treatment recommendations and discussions on the goals of care. Both the Radiation Therapy Oncology Group (RTOG) recursive partitioning analysis (RPA) and the graded prognostic assessment (GPA) are validated tools that can be used to predict survival at the time of initial BM presentation. The RPA is based on age, status of extracranial disease, and performance status,[@bib10] whereas GPA includes primary histology.[@bib18], [@bib19] However, the use of these tools at the time of ReRT for in-brain recurrence or progression have been reported sparingly.[@bib20], [@bib21] In this study, we aimed to evaluate the factors that are associated with survival after a second course of WBRT for multiple BM, determine the utility of RPA in this setting, and design a specific index to predict survival after ReRT.
Methods and materials {#sec2}
=====================
Study design {#sec2.1}
------------
A literature search (MEDLINE, to October 2013) was undertaken to identify all reported studies of repeat WBRT for patients with BM ([Appendix](#appsec1){ref-type="sec"}). We identified 11 peer-reviewed publications that met the search criteria. Two groups agreed to provide individual patient data. Of Canadian centers with dedicated palliative radiation oncology clinics and routine prospective data collection strategies, data from 6 additional centers that treated patients between 2000 and 2010 were added to our own.
The eligibility criteria included patients \>18 years old with any solid primary tumor who had received 2 courses of WBRT, both for the indication of multiple BM, defined as \>2 lesions. Those undergoing prophylactic cranial radiation, SRS (boost or salvage), or partial cranial radiation therapy were excluded. Biopsy or resection (subtotal or gross total) of a dominant lesion was not an exclusion criterion.
Patient characteristics (age, sex, Karnofsky Performance Status \[KPS\]), radiation therapy dose and fractionation, and disease characteristics (primary histology, status of extracranial metastases, control of primary) were abstracted where available or determined retrospectively when possible. KPS was assigned retrospectively for 77.3% of patients at the time of first WBRT and prior to ReRT for 80.4%. KPS was converted from the Eastern Cooperative Oncology Group performance status for 33.3% of patients at the time of first WBRT and for 29.4% prior to ReRT. For the remainder, KPS was assigned retrospectively by 1 of 2 reviewers on the basis of documented oncologic history and physical examination. RTOG neurologic function score was determined retrospectively. An RTOG neurologic function score of 1 indicates absent/minimal neurologic findings, 2 indicates neurologic impairment that does not require nursing care, 3 reflects impairment that requires nursing care, and 4 indicates inability to communicate/comatose state.[@bib15] The interval between courses was calculated from the date of the first fraction of the first course to the first fraction of the second course. RPA class as described by Gaspar et al[@bib10] was assigned where possible for both the first and second course of WBRT. GPA as described by Sperduto et al[@bib18], [@bib19] could not be calculated for this cohort due missing data (eg, for primary breast and lung histologies) and due to the inclusion of primary histologies for which GPA does not exist presently (eg, carcinoma of unknown primary, ovary).
Institutional review board approval for data collection and sharing was obtained in accordance with the requirements of each center.
Statistical analysis {#sec2.2}
--------------------
Summary statistics were calculated, including medians and ranges for continuous variables and frequencies and proportions for categorical variables. MS was analyzed from the first day of each course of WBRT to the date of death using the Kaplan Meier method with 95% confidence intervals. Log rank tests compared survival curves by RPA class and primary histology. Cox proportional hazard analysis described factors associated with survival. Factors that were significant at the *P* \< .10 level on univariate analysis (UVA) were incorporated into multivariate analysis, with hazard ratios and 95% confidence intervals reported. The final multivariate model included factors that were significant at the *P* \< .05 level, which were then used to construct a prognostic index (the ReRT score). A score of 1 was assigned to each variable for ease of clinical use. MS was determined for each ReRT score group (scores of 0-2, 3, or 4-5) using the Kaplan-Meier method and compared using the log rank test. UVA was also performed using a logistic binary regression analysis to explore factors associated with very short survival (≤30 days). A two-sided *P*-value of \<.05 was considered significant. All statistical analyses were conducted using IBM SPSS Statistics Version 15 (IBM Corp., Armonk, NY).
Results {#sec3}
=======
Demographics and radiation therapy {#sec3.1}
----------------------------------
Of 205 patients from 9 centers, the majority were female (68.3%) with non-small cell lung cancer (NSCLC) as the main histology (40.5%; [Table 1](#tbl1){ref-type="table"}). The median interval between courses was 9.1 months (range, 0.5-68.3 months). The median KPSs were 70 and 60, respectively. At the time of first WBRT, the RPA class was 1 for 14 patients, 2 for 105 patients, 3 for 73 patients, and not assignable for 13 patients. The most frequently used dose and fractionation schedule was 20 Gy in 5 fractions for both courses, with a total dose that ranged from 12 to 48 Gy for the first WBRT and 4 to 30.6 Gy for the second. Twenty-nine patients (14.1%) underwent surgical intervention (biopsy, subtotal or gross total resection) in the interval prior to ReRT.Table 1Demographics of patients (n = 205) at the time of reirradiationDemographicsN (%)Sex Female140 (68.3) Male65 (31.7)Age, median (range), y55 (25-83)Primary histology NSCLC83 ( | {
"pile_set_name": "PubMed Central"
} |
1. Introduction
===============
Paraneoplastic neurologic syndromes (PNSs) can be the first symptom of a covert malignancy. Early treatment of PNS may improve the morbidity and mortality rates of cancer patients. Advances in antibody-detection techniques have enabled definitive diagnoses in patients with paraneoplastic and non-paraneoplastic autoimmune encephalitis. However, antibodies are absent in most cases of PNS associated with lymphomas, especially non-Hodgkin lymphoma (NHL).^\[[@R1]\]^ Anti-Ma2-associated encephalitis is a rare immune-mediated PNS with preferential involvement of the limbic system, diencephalon, and upper brain stem. It has been mainly described in adult men with testicular germ cell tumors.^\[[@R2]\]^ Herein, we report a newly diagnosed case of anti-Ma2-associated PNS with coexisting chronic inflammatory demyelinating polyneuropathy (CIDP) in a patient with NHL.
2. Case presentation
====================
2.1. On admission
-----------------
A 74-year-old man was admitted to our hospital because of acute worsening of body aches, numbness of all four limbs, and weakness of the lower limbs. He reported that all of these symptoms had been slowly progressing during the past 5 months. During this period, he had sustained 2 falls during this period and felt that he was slow to react. He had also occasionally experienced visual hallucinations, and had lost almost 5 kg in 1 month.
Brain computed tomography (CT) showed lacunar infarction. Magnetic resonance imaging (MRI) of the cervical, thoracic, and lumbar spine showed degenerative changes. His sodium and chloride ion levels were slightly decreased, whereas his high-sensitivity C-reactive protein (hs-CRP) level had increased to 6.5 times the normal value (normal range, 0--3.5 mg/L), and his β~2~ microglobulin level had increased to 3 times the normal value (normal range, 0.7--1.8 mg/L). Routine blood examination and a coagulation profile revealed no abnormalities. Tests for anti-streptolysin O and rheumatoid factor were negative.
On admission to our clinic, further aggravation of the clinical symptoms was observed, and right blepharoptosis and limited eyeball movements were detected, indicating right oculomotor paralysis. On examination, the patient appeared drowsy, slow to react, and poorly oriented in time and place. Triparesis involving both lower limbs and the right upper limb was detected, the tendon reflexes had disappeared in all 4 limbs, and hypalgesia in 4 limbs was found in this patient.
A physical examination revealed that the patient could not complete the finger-to-nose test and heel-knee-tibia test with his right limbs owing to weakness. He scored 24 points on the Mini-Mental State Examination of cognitive function (orientation, 2; attention and calculation, 1; recall, 1; language, 1; ability to follow simple commands, 1).
2.2. Investigations
-------------------
Serological hs-CRP was 34.50 mg/L (normal 0--3.5), erythrocyte sedimentation rate was 86 mm/hour (normal 0--15), and β~2~ microglobulin level was 5.28 mg/L (normal 0.7--1.8). The serum IgA was 6.7 g/L (normal 0.7--4.0), IgG was 16.7 g/L (normal 7.0--16.0), and anticardiolipin IgG antibody level was 16 U/mL (normal 0--10). In addition, tests for IgG antibodies to herpes simplex virus, rubella virus, and cytomegalovirus were positive. The serum titers of IgG antibody of Epstein--Barr virus core antigen was 4.165 s/co (normal \<1.100). The serum levels of creatine kinase and lactate dehydrogenase were normal. Serological testing for syphilis and human immunodeficiency virus was negative.
A lumbar puncture revealed albuminocytologic dissociation in the cerebrospinal fluid (CSF), specifically, the cell count was 4 × 10^6^ cells/L (normal 0--8) with 2 lymphocytes and without any abnormal cells, and the protein concentration was 1.32 g/L (normal 0.15--0.45). Anti-PNMA2 (Ma2/Ta) was suspected to be positive in the CSF and weakly positive in the serum (antibody expression was graded as follows: ≤25% positive cells, suspected to be positive; \>25% and ≤50% positive cells, weakly positive; \>50% and ≤75% positive cells, positive; and \>75% positive cells, strongly positive).
The serum total prostate-specific antigen was mildly increased; other tumor markers were negative. A lung CT scan showed an old lesion in the superior lobe of the right lung. Abdominal Doppler ultrasonography showed prostatic hyperplasia with calcification. Scrotal Doppler ultrasonography showed a spermatocele in the head of the left epididymis. A prostatic MRI showed prostatic hyperplasia and slight enlargement of the lymph nodes in the inguinal regions and around the iliac vessels. Positron emission tomography (PET)/CT showed that lymph nodes in multiple regions were mildly enlarged with increased metabolism, indicating a high possibility of lymphoma. Histopathological examination of the inguinal lymph nodes was suggestive of angioimmunoblastic T-cell lymphoma (AILT) or peripheral T-cell lymphoma.
Immunohistochemical examination yielded the following results: Ki-67 (+60%), CD2 (+), CD3 (+), CD43 (+), CD5 (+), CD20 (−), PAX-5 (−), CD10 (−), Bcl-6 (scattered +), CD21 (DC+), PD-1 (−), Bcl-2 (+), CD15 (−), CD30 (a few scattered +), CD7 (+), CD43 (+), CD4 (+), CD8 (partially +), granzyme B (−), TIA-1 (a few scattered +), CD56 (−), EMA (−), ALK (−), CD30 (scattered +), CD15 (−), EBER (a few scattered+). The immunohistochemical results are shown in Figures [1](#F1){ref-type="fig"}--[4](#F4){ref-type="fig"}.
{#F1}
{#F2}
{#F3}
{#F4}
Brain MRI was performed twice; both MRI scans showed multiple lacunar infarctions with no suspicious signals in the brain stem and diencephalon (Fig. [5](#F5){ref-type="fig"}). Brain magnetic resonance angiography showed partial disappearance of the left vertebral artery, suggesting blockage. Electromyography showed that peripheral nerve conduction in all 4 limbs was significantly impaired, indicating a preponderance of demyelination (Fig. [6](#F6){ref-type="fig"}). A 4-hour electroencephalogram showed irregular sharp slow waves and δ waves in both temporal regions.
{#F5}
{#F6}
2.3. Treatment and outcome
--------------------------
A definitive diagnosis of CIDP was made based on the symptoms and results of auxiliary examinations. The patient\'s clinical condition stabilized after a cycle of enhancing immunity (intravenous immunoglobulin) and neuronutrition (edaravone injection). There were no signs of CIDP progression. In the following days, a final diagnosis of anti-Ma2-related PNS associated with lymphoma was made. The patient was treated with intravenous dexamethasone (15 mg/day) for 3 days, and all the central and peripheral nervous system symptoms improved. The patient was then transferred to the oncology department to receive systemic chemotherapy.
3. Discussion
=============
The diagnosis of PNS represents a clinical challenge, especially when it is associated with lymphoma, which is rare. The frequency of PNS associated with lymphomas was analyzed by the PNS Euronetwork Consortium, which includes 20 European centers. Between 2000 and 2008, the Consortium identified 53 patients with PNS, 29 had NHL. Furthermore, of the 53 patients, only 11 had demyelinating neuropathies, and 9 of these were associated with NHL.^\[[@R3]\]^ Patients with NHL can present with typical CIDP or with predominantly sensory neuropathies, which are probably caused by monoclonal IgM antibodies against myelin-associated glycoproteins or gangliosides.^\[[@R4],[@R5]\]^
Anti-Ma2-associated encephalitis is a rare disease. As a PNS, it develops gradually, and it usually affects the limbic system, diencephalon, and/or brain stem.^\[[@R2 | {
"pile_set_name": "PubMed Central"
} |
The content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.
Introduction
============
The incidence of community-acquired pneumonia (CAP) among adults in the United States is 16 to 23 per 1000 persons per year, with approximately 30% of these patients requiring hospitalization \[[@REF1],[@REF2]\]. *Streptococcus pneumoniae* is the most commonly detected bacterial species in patients with CAP \[[@REF3],[@REF4]\]. Rates of bacterial pneumonia are 10 times higher in patients infected with human immunodeficiency virus (HIV) than in healthy individuals, despite the former receiving antiretroviral therapy. Bacterial pneumonia is currently the most frequent cause of overall and pulmonary infections in HIV-infected patients, as well as the most frequent diagnosis at hospital admission \[[@REF5]-[@REF7]\].
Pneumonia in HIV-infected patients is frequently caused by simultaneous infection with multiple organisms, making pneumonia management very challenging in these patients. Opportunistic infections in HIV-infected patients can include bacterial species in 60% of cases, mycobacteria in 18%, viruses in 5%, and fungi, including *Pneumocystis pneumonia* in 20% \[[@REF7]\]. Infections with all of these microorganisms must be considered to optimize treatment.
Case presentation
=================
A 29-year-old man with a previous history of alcohol use disorder and injection drug use presented to our hospital with fever, cough, and shortness of breath, along with chronic diarrhea lasting for a few months. The patient reported feeling ill for two days prior to presentation but subsequently felt feverish and sweaty, prompting him to visit the emergency department. On examination, the patient was febrile with a temperature of 39.1 °C (102.3 °F) and tachycardic with a heart rate of 101 beats per minute. His blood pressure was borderline, 95/60 mmHg; he was hypoxic with 89% breathing in room air, and he was in a moderate degree of distress. Examination of his lungs revealed decreased air entry on the right side with some crackles, whereas examination of his mouth showed oral thrush. The findings of his abdominal examination were unremarkable, with no evidence of organomegaly or tenderness to abdominal palpation. Biochemical and hematological investigations revealed a healthy leukocyte count of 7,500 cells/µL (neutrophils 94%), low hemoglobin of 10.4 gm/dL (healthy mean corpuscular volume of 99), a healthy creatinine level of 0.4 mg/dL, an elevated aspartate transaminase level of 216 U/L (reference range is \<39 U/L), a healthy alanine transaminase level of 49 U/L (reference range is \<52 U/L), and an elevated total bilirubin level of 1.5 mg/dL (reference range is \<1.00 mg/dL). A chest x-ray showed focal consolidation in the right middle lobe (Figure [1](#FIG1){ref-type="fig"}) . Blood cultures ,* S. pneumoniae* urine antigen and *Legionella pneumophila*urine antigen were performed, and the patient was started on empirical treatment with ceftriaxone and azithromycin. Further assessment of the patient revealed that he was in a monogamous relationship with a male partner and regularly participated in unprotected anal intercourse. A fourth-generation rapid HIV antigen-antibody test was, therefore, performed.
{#FIG1}
On the second day of admission, the patient continued to experience febrile episodes, was still coughing and experiencing shortness of breath, and was still hypoxic. Results of urinalysis showed that he was positive for *S. pneumoniae* antigen, and rapid HIV testing was also positive with a CD4 count of 18 cells/mm3. He was preliminary diagnosed with pneumonia due to *S. pneumoniae*. Treatment with ceftriaxone was therefore continued, but all other antibiotics were discontinued. On the third day, however, his condition deteriorated, and he developed respiratory failure. The patient was intubated with ventilator settings that included a respiratory rate of 18 breaths/minute, a tidal volume of 460 mL, a fraction of inspired oxygen of 60%, and a positive end-expiratory pressure of 5 cm H~2~O. His blood culture was positive for pan-susceptible S. *pneumoniae*, and repeated chest x-rays showed bilateral infiltrates (Figure [2](#FIG2){ref-type="fig"}). Military tuberculosis was ruled out as three sputum samples were negative. Vancomycin was added, and bronchoscopy was performed to determine the presence of opportunistic infections. His bronchoalveolar lavage fluid was positive for *Pneumocystis jirovecii* and methicillin-resistant *Staphylococcus aureus* . He was therefore started on trimethoprim-sulfamethoxazole and corticosteroids. Two days later, his condition improved, and he was extubated to a high-flow nasal cannula (Figure [3](#FIG3){ref-type="fig"}). He continued to improve and was discharged after being hospitalized for two weeks (Figure [4](#FIG4){ref-type="fig"}).
{#FIG2}
{#FIG3}
{#FIG4}
Discussion
==========
This report describes a young homosexual man with a history of injection drug use and unprotected intercourse who presented with community acquired pneumonia due to *S. pneumoniae*. However, the lack of response to antibiotics and newly diagnosed AIDS required further investigation, which revealed concurrent pulmonary infection with *Pneumocystis jirovecii* and methicillin-resistant *Staphylococcus aureus*.
Bacterial pulmonary infections occur frequently in persons infected with HIV. The development of highly active antiretroviral therapy has led to advances have in the care and treatment of patients with HIV, altering the presentation of HIV-associated pulmonary diseases. Pneumonia caused by bacterial infections, particularly *S. pneumoniae*, remain commonplace, whereas opportunistic infections with agents such as *P. jirovecii* remain a concern in patients without adequate access to optimal medical care \[[@REF8]\]. The annual incidence of bacterial pneumonia in HIV-seropositive patients ranges from 5.5 to 29 per 100, compared with 0.7 to 10 per 100 in HIV-seronegative patients \[[@REF9]-[@REF11]\].
Although bacterial pneumonia can occur throughout the course of HIV infection, it is more frequent in individuals with advanced immunosuppression \[[@REF10],[@REF12]\]. Moreover, the incidence of bacterial pneumonia was shown to directly correlate with CD4 count \[[@REF11]\]. Other traditional risk factors that may be associated with pneumonia include pre-existing lung disease (e.g., bronchiectasis or chronic obstructive pulmonary disease), heavy alcohol use, injection drug use, neutropenia, and severe malnutrition. Bacterial pneumonia in HIV-infected patients is associated with a permanent decline in pulmonary function \[[@REF13]\] and a two-fold to five-fold increase in long-term mortality compared with CD4-matched controls \[[@REF11],[@REF13],[@REF14]\].
Respiratory symptoms and suspected pneumonia are evaluated in HIV infected individuals to establish a definitive diagnosis, thereby allowing the initiation of appropriate treatment. However, definitive diagnoses may require invasive diagnostic procedures such as bronchoscopy, as well as sophisticated laboratory techniques. The clinical and radiographic presentations of HIV-associated opportunistic pneumonias overlap, and HIV infected individuals may present concurrently with pneumonia caused by more than one agent. Bacterial pneumonia may be the first manifestation of underlying HIV infection. Thus, HIV infection should be suspected in any patient presenting with bacterial pneumonia, especially in patients with no other risk factors for pneumonia and in patients with recurrent pneumonia. Similar to findings in non-HIV infected individuals, *S. pneumoniae* and *Haemophilus* species are the most frequently identified causes of CAP. *Pseudomonas aeruginosa* and *Staphylococcus aureus* are more frequent causes of CAP in patients with than without HIV infection \[[@REF15]\]. The clinical and radiological presentations of lower respiratory tract infections in HIV-infected patients are quite variable. Clinical presentations are more severe, and radiological imaging more atypical in severely than in mildly immunosuppressed HIV infected individuals \[[@REF16]\].
Chest radiography is the first step in the diagnostic evaluation of persons with suspected pneumonia. Specific findings on chest radiography, along with CD4 cell count, often suggest a differential diagnosis and plan for management and treatment. Selected laboratory tests may be indicated to assess for specific diseases or disease severity (e.g., arterial blood gas). In some cases, computed tomography of the chest may be indicated. Where feasible, further evaluation should seek to | {
"pile_set_name": "PubMed Central"
} |
Briefings in Bioinformatics (2016) doi: 10.1093/bib/bbw145
In the article above, the following errors have been addressed: • In Table 1, the SHS formula was incorrectly given as ${SHS} = U_{R}\text{diag}\left( {\xi_{1} + \delta,\cdots,\xi_{n} + \delta} \right)U_{R}^{T}$. This has been corrected to ${SHS} = U_{R}\text{diag}\left( {\lambda_{1} + \delta,\cdots,\lambda_{n - q} + \delta} \right)U_{R}^{T}$.• The running title has been changed from 'Methodological implementation of mixed linear model' to 'Methodological implementation of mixed linear models'.• Reference 22 has been corrected to indicate a page range of '525--6' from '525'.The corrections have been made online and in print. The publisher apologizes for these errors.
| {
"pile_set_name": "PubMed Central"
} |
The COVID-19 viral pandemic is bearing down on the United States. Thousands have died in China and in Italy, and every country in the world is or will be affected. At home every sniffle or cough elicits a brief pang of fear. To fight the deadly virus, we are turning to methods that proved partly effective in the flu epidemic of 1918. We have learned a new term--social distancing.
Oddly at a time when the interdependence of humans all over the world is most exposed, we are asked to isolate ourselves. To do the best for the most vulnerable among us, the right response is to shut the doors and hunker down. It\'s just the opposite of the best medical intentions to reach out, to touch, and to help. Yet the time will come, and for some the time is now, when those intentions rise again to action. Perhaps we can take a lesson from these days of isolation to remember how human flourishing depends on social life.
There is another pandemic called atherosclerosis that claims millions of lives annually worldwide. It\'s so familiar that we are apt to forget it in these extraordinary days. Yet we can point to signs of success. I have 2 brothers whose livelihood has depended partly on performing coronary bypass surgery. I recall my surprise early in my medical career when this complex operation became the most commonly performed surgery in the US. By 2000 one brother told me that the pace of performing coronary bypass procedures was declining about 1% per year. That pace has accelerated. Since 2003 the annual number of bypass procedures has dropped by 50%. The annual number of percutaneous coronary interventions (PCI) by cardiologists is a little more than twice the rate of bypass procedures. PCI volume has likewise dropped by half since 2003.[@bib1]
So we find ourselves facing an old type of communicable disease today, yet gaining substantial success in battling the most prevalent modern deadly pathology in both developed and emerging economies in the world. In particular, medical, dietary, and lifestyle interventions are working to diminish the impact of atherosclerosis, signaled by far less need for invasive procedures. Preventive cardiology and lipidology are rising. Joint efforts and international cooperation make the mission particularly satisfying.
In this issue of JCL we focus in 2 editorials and the Roundtable on atherosclerotic risk in South Asians, defined as the nations of India, Pakistan, Nepal, Bhutan, Bangladesh, Sri Lanka, and Maldives as well as the worldwide diaspora emanating therefrom. South Asians comprise 25% of world population, but suffer 50% of atherosclerotic cardiovascular events. Dr Raman Puri and colleagues have founded the India Lipid Association, and this issue marks the publication in JCL of their online-only, open access expert consensus document applicable to LDL cholesterol goals in India. They discuss potential expanded use of PCSK9 inhibitors to meet LDL cholesterol goals as low as ≤30 mg/dL.[@bib2]
You will also find in these pages a discussion of the sphingolipid ceramide as an atherosclerotic risk factor, illustrative cases including a woman with intermittent autoimmune chylomicronemia, advice on how to differentiate familial from multifactorial chylomicronemia, a suggestion that ABCG5/G8 heterozygous pathogenic variants may contribute to familial hypercholesterolemia, ascertainment of hurdles facing cascade screening and pediatric cholesterol screening, and several other new aspects of clinical lipidology.
Disclosures {#appsec1}
===========
Dr Guyton has received research grants from 10.13039/100014384Amarin, 10.13039/100009857Regeneron, and 10.13039/100004339Sanofi.
| {
"pile_set_name": "PubMed Central"
} |
As we approach the second anniversary of the launch of *PLoS Pathogens*, it is evident that the journal has rapidly established itself as an important publication in the field of pathogen--host interactions (Image 1). We attribute this success to the commitment and motivation of our talented editorial board, to a receptive community ([Table 1](#ppat-0030145-t001){ref-type="table"}) who sees this as a leading open-access journal, and to a highly competent and helpful staff at the Public Library of Science.
######
Top Ten Downloaded Papers from *PLoS Pathogens*, September 2005 to July 2007
Our initial impact factor, recently assigned by Thomson Scientific (formerly Thomson ISI), is 6.056. For an initial metric calculated from just four months of data, this is a strong start, and we fully expect it to rise rapidly as more information becomes available.
But, we also caution about reading too much into impact factor values because of inherent flaws that exist with using this number to measure the impact of any given paper. We recognize that journal impact factors are so often used as a surrogate measure of the quality of a given scientist and his or her work, influencing hiring, promotion, and even grant funding decisions, and for these reasons we think it is important to raise awareness about what impact factors measure.
The journal impact factor for any given year is calculated based on information obtained from the preceding two years. For example, for 2007: It is self-evident that this formula fails to reveal the significance of any given paper. Instead, the calculated number represents an average number of citations for a paper in the journal. In other words, the highest impact papers are given an artificially low ranking by this system, whereas papers with the least impact are assigned a greater impact value than they deserve. Confounding this problem, review articles, which are highly visible and citable, artificially inflate the "impact" of the lesser-cited research articles in the same journal. Also, the method by which "citable articles" are calculated in the denominator of this equation is unclear and needs to be made transparent so that the community can become more confident about the nature of the differences that exist between the impact of distinct journals. Clearly, a more scientifically rigorous methodology must be developed if we are to accurately quantify the true impact of a given paper. Several alternative mechanisms have been proposed, including measuring the number of downloads of a paper over the Internet, and we will not elaborate further on these ideas here. However, if you would like to learn more, we encourage you to read the articles cited at the end of this editorial \[[@ppat-0030145-b001]--[@ppat-0030145-b004]\].
In closing, we are grateful to you for establishing *PLoS Pathogens* as a leading open-access journal. On behalf of the editorial board we thank you, the community, for your confidence in the journal and for your continued support.
{#ppat-0030145-g001}
John Young is with the Infectious Disease Laboratory, The Salk Institute for Biological Studies, La Jolla, California, United States of America. Kasturi Haldar is with the Department of Pathology and Microbiology--Immunology, Northwestern University Medical School, Chicago, Illinois, United States of America.
**Author contributions.** JY and KH wrote the paper.
**Funding.** The authors received no specific funding for this article.
**Competing interests.** The authors have declared that no competing interests exist.
| {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
Conversion of common murine models to an immune-compromised state has become highly desirable for translational research. The creation of immune-compromised mouse strains allows for the preclinical efficacy of human cell transplantations and gene therapy strategies to be tested in small rodent systems before moving forward to human clinical trials. Recently, we have utilized the *W*^*sh*^*/W*^*sh*^ mouse strain to examine human neural crest cell contribution during embryonic and post-natal mouse development \[[@pone.0194443.ref001]\]. In order to increase human cell incorporation into the *W*^*sh*^*/W*^*sh*^ mice, as well as provide a future system for human disease modeling, we used CRISPR (clustered regularly interspaced short palindromic repeat) and Cas (CRISPR-associated) proteins to knockout interleukin 2 receptor subunit gamma (*Il2rγ*) and recombination activating gene-2 (*Rag2*) in the *W*^*sh*^*/W*^*sh*^ mice. The conversion of the *W*^*sh*^*/W*^*sh*^ mice to an immune-compromised state led to unexpected morbidity and mortality. This warranted an investigation to ascertain the cause and predisposing factors associated with the outbreak.
*Escherichia coli (E*. *coli)* strains have been frequently isolated from rodents, but are not routinely or completely characterized; these bacteria are commonly considered commensals and are not currently excluded from specific pathogen-free mouse colonies. However, pathogenic *E*. *coli* can encode various virulence factors, which are classified into different subtypes, such as enteropathogenic *E*. *coli* (EPEC), enterohemorrhagic *E*. *coli* (EHEC), enterotoxigenic *E*. *coli* (ETEC), enteroinvasive *E*. *coli* (EIEC), enteroaggregative *E*. *coli* (EAggEC), diffusely adhering *E*. *coli* (DAEC) and adherent-invasive *E*. *coli* (AIEC) \[[@pone.0194443.ref002]\]. Another group called extraintestinal pathogenic *E*. *coli* (ExPEC) belongs to the B2 *E*. *coli* phylogroup and are associated with human cases of meningitis, septicemia, and urinary tract infections (ExPEC) \[[@pone.0194443.ref003],[@pone.0194443.ref004]\].
The polyketide synthase (*pks)* is a 54-kb genomic island that encodes colibactin (Clb) gene cluster \[[@pone.0194443.ref005],[@pone.0194443.ref006]\]. The genotoxic metabolite colibactin acts as a cyclomodulin that induces DNA damage and cell cycle arrest in mammalian cells. \[[@pone.0194443.ref005]--[@pone.0194443.ref009]\]. The *pks* genomic island is highly conserved in *Enterobacteriaceae* and has been isolated from commensal *E*. *coli* strains (B2 and Nissle 1917 *E*. *coli*), *Citrobacter koseri*, *Klebsiella pneumoniae*, and *Enterobacter aerogenes* \[[@pone.0194443.ref005],[@pone.0194443.ref007]\]. A study identified that IL10^-/-^ mice with experimentally-induced chronic lower bowel inflammation were colonized with a specific *E*. *coli* (O7:H7:K1) strain of phylogenetic group B2 that encodes high number of virulence associated genes \[[@pone.0194443.ref010]\]. The tumor promoting effects of *pks+* NC101 *E*. *coli* strain (O2:H6/41) were identified in germfree IL10^-/-^ mice carcinogenicity studies Further, carcinogenicity studies in germfree IL10^-/-^ mice monoassociated with the *pks+* NC101 *E*. *coli* strain (O2:H6/41) identified its tumor promoting effects \[[@pone.0194443.ref011],[@pone.0194443.ref012]\]. The *pks+* NC101 *E*. *coli* strain associated promotional events were specifically attributed to the *pks* genomic island and excluded the role of inflammation in the formation of invasive carcinoma \[[@pone.0194443.ref011]\]. IL10^-/-^ mice monoassociated with a murine *E*. *coli* strain from wildtype mice (later identified as NC101) induced typhlitis due to increased synthesis of interferon γ and IL4 by CD4^+^ T cells \[[@pone.0194443.ref013]\]. *pks+ E*. *coli* strains have also been utilized experimentally in rodent models to study urosepsis and septicemia \[[@pone.0194443.ref014],[@pone.0194443.ref015]\].
We recently identified *pks+ E*. *coli* strains from the gastrointestinal tract of commercially available mice, as well as mice maintained in a large biomedical research institute, and demonstrated the cytotoxic effects of colibactin produced by the isolated *pks+ E*. *coli* in a cell culture system \[[@pone.0194443.ref016]\]. These *pks+ E*. *coli* strains, which colonize asymptomatic humans, are also associated with inflammation, septicemia, meningitis, and urinary tract infections \[[@pone.0194443.ref003],[@pone.0194443.ref004]\], as well as being commonly isolated in colon cancer patients \[[@pone.0194443.ref017]\]. The purpose of this report is to describe acute morbidity and mortality in immunocompromised mice, from which colibactin producing *E*. *coli* was isolated from blood, genitourinary tract, and brain. As genome-engineering technologies have allowed for an increase in the efficiency and reduction in the time it takes to generate knockout mouse models, many murine models used in human research are becoming immune-compromised in order to test human cell transplantations and viral gene therapies for translational research. The abrupt increase in mortality and morbidity associated with *pks+ E*. *coli* in immune-compromised mice entails routine and complete characterization of these bacteria to ensure exclusion of colibactin-producing *pks+ E*. *coli* strains from specific pathogen-free mouse colonies.
Materials and methods {#sec002}
=====================
Ethics statement {#sec003}
----------------
All animal experiments were approved by the Massachusetts Institute of Technology Committee on Animal Care (Protocol \#0916-058-19: Gene Disease, Cancer, and Mammalian Development) and all animal procedures were performed following the National Institute of Health guidelines. Our facility conforms to Federal guidelines and has a PHS Approved Animal Welfare Assurance (\#A3125-01). Mice were monitored at least twice daily, and any adverse conditions (e.g. difficulty with ambulation, hunched posture, body condition score (BCS) \< 2, ruffled fur) were immediately brought to the attention of the veterinary staff. The mice for this study displayed normal behavior and health until suddenly showing signs of morbidity, and would succumb within 24 hours. Mice that became moribund/severely ill during this study were euthanized with CO~2~ exposure followed by cervical dislocation, and tissues were collected for analysis.
Production of Cas9 mRNA and sgRNA {#sec004}
---------------------------------
Bicistronic expression vector px330 expressing Cas9 and sgRNA \[[@pone.0194443.ref018]\] was digested with BbsI and treated with Antarctic Phosphatase, and the linearized vector was gel purified. A pair of oligos ([Table 1](#pone.0194443.t001){ref-type="table"}) for each targeting site was annealed, phosphorylated, and ligated to the linearized vector. T7 promoter was added to the Cas9 coding region by PCR amplification using primers Cas9 F and R ([Table 1](#pone.0194443.t001){ref-type="table"}). The T7-Cas9 PCR product was gel purified and used as the template for *in vitro* transcription (IVT) using the mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies). The T7 promoter was added to sgRNA templates by PCR amplification using the primers listed in [Table 1](#pone.0194443.t001){ref-type="table"} of a previously published paper by the Jaenisch Lab \[[@pone.0194443.ref019]\]. The T7-sgRNA PCR product was gel purified and used as the template for IVT using the MEGAshortscript T7 kit (Life Technologies). Both the Cas9 mRNA and the sgRNAs were purified using MEGAclear kit (Life Technologies) and eluted in RNase-free water.
10.1371/journal.pone.0194443.t001
###### Oligonucleotides used in this study.
{#pone.0194443.t001g}
Gene Oligonucleotide Cloning Step
--------- ------------------------------------------- --------------------------
*Rag2* `CACCGTATTGTGGGTGGTTATCAGC` sgRNA
*Rag2* `CACCGCCCTCAGCAGGAGCAGCTGA` sgRNA
*Il2rγ* `AAACGCTGATAACCACCCACAATAC` sgRNA
*Il2rγ* `AAACTCAGCTGCTCCTGCTGAGGGC` sgRNA
*Rag2* `TTAATACGACTCACTATAGTATTGTGGGTGGTTATCAGC` | {
"pile_set_name": "PubMed Central"
} |
More than 13 000 new cases of rectal cancer are diagnosed every year in the UK ([Office for National Statistics, 2003](#bib38){ref-type="other"}; [Northern Ireland Cancer Registry, 2007](#bib36){ref-type="other"}; [Welsh Cancer Intelligence and Surveillance Unit, 2007](#bib49){ref-type="other"}). At least 10% of these cancers are inoperable because of involvement of, or penetration through, the mesorectal fascia and implication of other organs ([Devita *et al*, 2001](#bib10){ref-type="other"}). For patients with inoperable disease, prognosis is poor. Radiotherapy and, more recently, combined chemo-radiotherapy (CRT) regimens have been shown to be able to reduce the stage and size of advanced tumours, making them amenable to resection. The ideal combined-modality pre-operative regimen is, however, yet to be determined.
To date, phase I/II trials have assessed the effect of radiation in combination with 5-fluorouracil (5-FU) or another fluoropyrimidine with or without leucovorin (to enhance the actions of 5-FU) ([Videtic *et al*, 1998](#bib48){ref-type="other"}; [Rodel *et al*, 2000](#bib40){ref-type="other"}). Post-operative chemotherapy is also sometimes included in the CRT regimen ([Minsky *et al*, 1993](#bib32){ref-type="other"}). Overall, results from these studies have been favourable, resulting in the widespread adoption of CRT regimens, mostly based on 5-FU, in the neoadjuvant treatment of inoperable rectal cancer.
Recently, several novel therapies have emerged with activity in rectal cancer. These include raltitrexed, irinotecan, oxaliplatin and oral fluoropyrimidines, including uracil-tegafur and capecitabine ([de la Torre *et al*, 1999](#bib9){ref-type="other"}; [Kalofonos *et al*, 2003](#bib24){ref-type="other"}; [Fernandez-Martos *et al*, 2004](#bib14){ref-type="other"}; [Gambacorta *et al*, 2004a](#bib17){ref-type="other"}, [2004b](#bib18){ref-type="other"}; [Hofheinz *et al*, 2005](#bib22){ref-type="other"}; [Klautke *et al*, 2005](#bib25){ref-type="other"}, [2006](#bib27){ref-type="other"}). Despite the advent of oral fluoropyrimidines, intravenous infusion remains popular in Europe and the United States, because nausea, vomiting and diarrhoea can affect compliance and absorption of oral drugs ([Minsky *et al*, 1993](#bib32){ref-type="other"}; [Rodel *et al*, 2000](#bib40){ref-type="other"}; [Mohiuddin *et al*, 2006](#bib34){ref-type="other"}). For metastatic colorectal cancer, the addition of irinotecan to treatment with 5-FU and leucovorin significantly improves progression-free and overall survival ([Douillard *et al*, 2000](#bib11){ref-type="other"}; [Saltz *et al*, 2000](#bib44){ref-type="other"}). This finding has resulted in an interest in developing its use as part of a combined protocol for the treatment of locally advanced disease.
Several phase I and phase II trials have investigated the use of irinotecan as a radiation sensitizer in CRT regimens for locally advanced rectal cancer; however, results are mostly published as meeting abstracts, with short-term follow up only. Irinotecan has been administered as monotherapy combined with radiation, but most of the studies have assessed the CRT regimen of irinotecan plus 5-FU and radiotherapy ([Minsky *et al*, 1999](#bib31){ref-type="other"}; [Klautke *et al*, 2001](#bib26){ref-type="other"}, [2005](#bib25){ref-type="other"}, [2006](#bib27){ref-type="other"}; [Kalofonos *et al*, 2003](#bib24){ref-type="other"}; [Mehta *et al*, 2003](#bib30){ref-type="other"}; [Navarro *et al*, 2003](#bib37){ref-type="other"}, [2007](#bib35){ref-type="other"}; [Mitchell *et al*, 2004](#bib33){ref-type="other"}; [Sebag-Montefiore *et al*, 2005](#bib45){ref-type="other"}).
Overall, the results of these preliminary studies suggest promising activity of irinotecan-containing regimens. Six small studies are published as full papers ([Kalofonos *et al*, 2003](#bib24){ref-type="other"}; [Mehta *et al*, 2003](#bib30){ref-type="other"}; [Klautke *et al*, 2005](#bib25){ref-type="other"}; [Mohiuddin *et al*, 2006](#bib34){ref-type="other"}; [Glynne-Jones *et al*, 2007](#bib20){ref-type="other"}; [Willeke *et al*, 2007](#bib50){ref-type="other"}). To conclude, the combined RCT regimen irinotecan plus 5-FU with radiation therapy appears to be a tolerable adjuvant therapy ([Kalofonos *et al*, 2003](#bib24){ref-type="other"}) that results in a good tumour response when given pre-operatively to patients with rectal cancer in whom resection is either possible or uncertain ([Mehta *et al*, 2003](#bib30){ref-type="other"}; [Klautke *et al*, 2005](#bib25){ref-type="other"}).
This current study was undertaken to rigorously assess and provide long-term follow-up data for the use of irinotecan in combination with 5-FU and radiotherapy for inoperable, locally advanced (T3/T4) rectal tumours. The aims of this study are two fold: (a) to establish a safe dose of intravenous (iv) irinotecan for administration in combination with a standard course of 5-FU and concomitant pelvic radiotherapy to patients with locally advanced non-resectable rectal cancer and (b) to assess the effectiveness of the regimen, in terms of post-treatment resectability of tumours, and disease-free and overall survival.
MATERIALS AND METHODS
=====================
Participants
------------
Patients with unresectable rectal cancer were recruited between September 2001 and December 2003 from four centres in the UK: the Christie Hospital NHS Trust, Manchester; Clatterbridge Hospital, Liverpool; North Wales Cancer Treatment Centre, Rhyl; and the Royal Preston Hospital, Preston.
The tumour stage of all patients was determined clinically after examination under general anaesthetic and following computed tomography (CT) of the chest, abdomen and pelvis, or magnetic resonance imaging (MRI) of the abdomen or pelvis. In cases of discrepancy, the highest tumour stage was used. All recruited patients were diagnosed as having non-resectable disease, defined as involving the edge of the mesorectal fascia or adherence of the tumour to an adjacent structure or organ, preventing an attempt at resection with a negative circumferential resection margin (CRM). The patients had a WHO performance score of less than two and adequate hepatic and renal function (bilirubin, creatinine, aspartate aminotransferase or alanine aminotransferase \<2.5 × upper limit of normal) and bone marrow reserve (absolute neutrophil count \>2.0 × 10^9^; platelets \>100 × 10^9^; haemoglobin \>10.0 g l^−1^).
Patients were excluded if they had received previous radiotherapy or chemotherapy, had been diagnosed with metastatic disease or had a past or current malignancy at other sites (with the exception of adequately treated *in-situ* carcinoma of the cervix uteri and non-melanoma carcinoma of the skin).
All patients provided written informed consent and the study was performed in accordance with the ethical principles outlined in the declaration of Helsinki. Ethical approval for this study was obtained from the ethics committees of all participating centres.
Procedure
---------
Radiotherapy was given by planned target volume to the pelvic area, treating with 25 fractions at 1.8 Gy/fraction via four fields, with all fields treated daily (45 Gy total dose). The planned target volume was defined using simulator or CT planning. The planned target volume was to include: 3 cm superior, inferior and lateral of the extent of the gross tumour volume, but no higher than the sacral promontory; the posterior border of the most posterior aspect of the sacrum; and 2 cm anterior to the tumour or the anterior rectal wall, whichever was the most anterior. Treatment was given from Monday to Friday for 5 weeks.
5-FU 200 mg m^−2^ per day was administered by continuous iv infusion 7 days/week throughout radiotherapy. Irinotecan (50--70 mg m^−2^) was administered on days 1, 8, 15 and 22 via a 30-min iv infusion (day 1 being the first day of radiotherapy; [Figure 1](#fig1){ref-type="fig"}).
During phase I of the study, cohorts of three patients received irinotecan in a dose escalating between 50 and 70 mg m^−2^. Development of grade III and IV toxicity guided the calculation of the maximum-tolerated dose. Toxicity assessments were made according to the National Cancer Institute Common Toxicity Criteria version 3 | {
"pile_set_name": "PubMed Central"
} |
Files are available from the Open Science Framework platform (<https://osf.io/c3ztu/>).
Introduction {#sec001}
============
To execute a hand reaching movement, the central nervous system needs to localize the target with respect to the hand. Its position can be derived from inputs provided by one or multiple sensory modalities such as vision, audition or somatosensation. Multisensory integration is referred to as the combination of information arising from different sensory modalities to form a unified and coherent representation of our environment and body. Accordingly, the brain combines all the relevant sensory information about the object of interest in order to decrease the variance (the uncertainty) and build a more reliable representation of that object \[[@pone.0199627.ref001],[@pone.0199627.ref002]\]. Indeed, it has been shown that spatial localization was less variable for visual-auditory targets than for targets specified by vision or audition only \[[@pone.0199627.ref003],[@pone.0199627.ref004]\]. These findings suggest that the more sensory information available about the target, the more accurate its estimate.
When pointing to unseen parts of our own body (e.g. the opposite index finger), the position of the target is derived from proprioceptive signals. Proprioception corresponds to the sense of our body position in space. Consistent with the principles of multisensory integration, it has been found that participants better matched the position of their index finger when they could see their opposite arm during movement than when being blindfolded during the task \[[@pone.0199627.ref005],[@pone.0199627.ref006]\]. The localization of the fingertip was more precise in the presence of both vision and proprioception than when using visual or proprioceptive signals only. These results provide evidence that fingertip localization can be more precise if another sensory modality, in addition to proprioception, provides further information about the finger position.
Unlike vision, touch may not provide additional information about finger position in space, since fingertip tactile information theoretically remains the same irrespective of the postural configuration of the upper limb. However, touch can be regarded as a possible source of additional information for position sense, since touch and proprioception, although considered as separate modalities, have been shown to closely interact with each other. Behavioral studies have shown that tactile perception can be modulated by changes in proprioceptive signals, induced by active changes in hand posture \[[@pone.0199627.ref007]\] or tendon vibration \[[@pone.0199627.ref008]\]. Conversely, a finger-position matching task has been reported to be affected by nerve block and cutaneous anesthesia \[[@pone.0199627.ref009]\], indicating that cutaneous afferents may provide a crude position sense for the fingers. Moreover, it has been shown that the localization of a proprioceptive target (i.e., the fingertip) was improved when participants contacted a surface with their target fingertip, which provides them with tactile feedback \[[@pone.0199627.ref010]--[@pone.0199627.ref012]\]. Similarly, accuracy in pointing movements was enhanced when endpoint contact occurred with the effector fingertip \[[@pone.0199627.ref013]\]. In contrast, digital anesthesia resulted in impaired fingertip localization \[[@pone.0199627.ref011]\] as well as decreased movement accuracy during typing \[[@pone.0199627.ref014]\]. This relationship between touch and proprioception is likely to be explained by the convergence of proprioceptive and tactile signals at the cortical level; electrophysiological recordings in monkey have shown that neurons in the hand representation of the primary somatosensory cortex code both tactile and proprioceptive modalities during a reach-to-grasp task \[[@pone.0199627.ref012],[@pone.0199627.ref015]\]. It has also been established that neurons in the somatosensory cortex have both cutaneous and proprioceptive receptive fields \[[@pone.0199627.ref016],[@pone.0199627.ref017]\]. Taken together, these findings suggest that tactile afferent information may contribute to proprioception and improve the accuracy of the hand proprioceptive estimate.
The skin contains several mechanoreceptors, including Meissner and Pacinian corpuscles. Meissner corpuscles are located in the superficial layers of the skin and are sensitive to light touch while Pacinian corpuscles are found in deeper layers and respond to deep skin pressure and vibration. The properties of these two receptors suggest that they might be activated by fingertip contact; Pacinian and Meissner corpuscles are fastadapting receptors which are both sensitive to abrupt but not sustained stimuli \[[@pone.0199627.ref018]\], such as when a finger makes or breaks contact with an object. Therefore, it is difficult to distinguish the relative contributions of Pacinian and Meissner corpuscules to the enhancement of proprioception following fingertip contact with a surface \[[@pone.0199627.ref010]--[@pone.0199627.ref013]\]. However, these two types of mechanoreceptors show different responses to cutaneous vibrations. Meissner corpuscles respond to low frequencies, 10--80 Hz, whereas Pacinian corpuscles are sensitive to vibrations at higher frequencies, 80--450 Hz \[[@pone.0199627.ref019]\]. Consequently, by stimulating either of these receptors, it would be possible to know which one contributes to the enhancement of proprioceptive localization.
It has been shown that the ability to detect flexion and extension movements imposed at the interphalangeal joints of a finger was impaired when 300 Hz vibrations were applied to the adjacent or the test digit. In contrast, vibrotactile stimuli at 30 Hz did not alter proprioception in the finger \[[@pone.0199627.ref020],[@pone.0199627.ref021]\]. The detection of passive finger movements at the interphalangeal joints is thus impaired by the specific activation of Pacinian, but not Meissner, afferents. These results demonstrate that vibrotactile stimulation can modulate proprioceptive acuity in a passive perceptual task, in which no action is involved. However, to our knowledge this has not been tested in a motor task, such as reaching, where the target location corresponds to the position of the fingertip.
The goal of the present study was to investigate the influence of vibrotactile information on the proprioceptive localization of the finger in a motor context. To this purpose, we asked participants to perform reaches to proprioceptively defined targets. They reached with the right index finger (reaching finger) to the unseen left index finger (target finger), which was passively displaced to different locations. Tactile vibrations at 30 or 300 Hz were delivered to the target index fingertip prior to movement onset. When vibrations are applied, the left index finger receives tactile information, in addition to existing proprioceptive information, about its location in space. In order to reach accurately, we presume that the brain constructs a reliable estimate of the target finger position using all the sensory information available. As suggested by previous studies \[[@pone.0199627.ref019]-- [@pone.0199627.ref021]\], high- and low-frequency vibrations are more likely to activate Pacinian and Meissner corpuscles, respectively. We thus used 30 and 300 Hz vibrotactile stimulations to determine if one of these two mechanoreceptors contribute more than the other to touch-proprioception integration, or whether they both contribute to finger proprioceptive localization. We measured reach endpoint accuracy and precision to assess the effect of vibrations. We found that vibrotactile stimulations delivered at low and high frequencies improved both accuracy and precision of finger localization in a proprioceptive reaching task. A control condition in which the vibration was applied elsewhere on the body showed that this improvement in proprioceptive localization cannot be attributed to a global arousal enhancement induced by the tactile stimulus.
Methods {#sec002}
=======
Participants {#sec003}
------------
Nineteen participants took part in this study (12 females, mean ± SD age = 25.3 ± 10.7 years). They were all right-handed, as assessed by the Edinburgh Handedness Inventory and all had normal or corrected-to-normal vision. Participants were administered a questionnaire to ensure that they did not suffer from neurological, sensory or motor deficits, which may have interfered with their performance. All gave informed written consent to participate in this experiment which conformed to the Declaration of Helsinki (2008) for experiments on human subjects. All experimental procedures were approved by the health research ethics committee in France (CPP Nord-Ouest I, Lyon, 2017-A02562-51) and at the University of Montreal (17-034-CERES-D).
Apparatus {#sec004}
---------
Participants sat in a dark room on a height-adjustable chair in front of a slanted table. Their head was held steady on a chin rest, aligned with their body midline. A wide-screen OLED monitor (55 inches diagonal, 1920 x 1080 pixels, LG) was placed facing downwards above the table and a half-reflecting mirror was positioned in between the screen and the table so that the screen was projected onto the tabletop surface. The half-reflecting mirror prevented participants from seeing their hands unless there was light underneath the mirror; in that case vision of the hand was possible. Participants performed a proprioceptive pointing task. They were asked to reach with the right index finger (reaching finger) to the unseen left index finger (target finger). Participants' left forearm was resting on a platform in such a way that when the left index finger was aligned with the body midline, the elbow was located on average 17.5 cm on the left relative to the center ([Fig 1A](#pone.0199627.g001){ref-type="fig"}). The | {
"pile_set_name": "PubMed Central"
} |
Introduction {#S1}
============
Despite the effectiveness of antiretroviral therapy (ART) to suppress viral loads and decrease HIV-related mortality, HIV remains a global epidemic. The World Health Organization (WHO) estimates that of the 36.7 million people currently living with HIV worldwide, only 48% are being treated.^[@R1]^ Early diagnosis of HIV decreases mortality and morbidity by initiating early patient treatment.^[@R2]^ HIV screening is currently performed using commercially-available rapid diagnostic tests (RDT), typically based on lateral flow immunoassay (LFIA) technology that detects HIV antibodies from oral fluid or capillary blood. The low sensitivity during the pre-seroconversion phase of the first four weeks of infection and frequent false negatives require that antibody-detecting RDT results are confirmed by a second or even third laboratory-based assay.^[@R3]^ Even the fourth and fifth generation assays that combine antibody and HIV p24 antigen detection in a combo RDT are less sensitive than laboratory-based assays.^[@R4]^ However, the delay of diagnosis due to laboratory-based testing significantly impairs an HIV-positive patient\'s prompt treatment.^[@R5]^
Point-of-care (POC) nucleic acid-based diagnostic tests could expedite treatment response for vulnerable and newly infected individuals through early detection of the HIV virus. Reverse transcription polymerase chain reaction (RT-PCR) has been performed in microfluidic-based sample-to-answer devices to amplify HIV RNA spiked into saliva samples. However, the complexity of manufacturing a device to perform both sample preparation and cyclical heating often makes it prohibitively expensive for low-resource settings.^[@R6]^ These sensitive detection systems are not cost-effective for early screening and POC testing because they require expensive supporting sample preparation units, cold-chain storage of reagents, off-chip pumps, and trained users.^[@R3],[@R7]^ To address these shortcomings, recent efforts have been focused towards developing integrated sample-to-answer nucleic acid analysis devices that can be used by minimally-trained personnel.^[@R8],[@R9]^ While these integrated nucleic acid analysis devices minimize user steps and costs, to-date we are unaware of any such devices capable of analyzing viral HIV RNA from whole blood samples. There are a few commercial tools for near-patient detection of HIV including Cepheid Xpert Qual Assay, Alere q HIV-1/2 Detect, and Diagnostics for the Real World\'s Samba II. Although these tests are able to integrate and automate sample preparation, they all require cost-prohibitive (\>\$17 000 for the instrument and \>\$17 for the cartridge) benchtop instruments that need stable electrical power supply or consumable batteries.^[@R10]^
Recent advances in technologies for point-of-care molecular detection of HIV include several isothermal nucleic acid amplification techniques that could reduce the complexity and therefore cost of a fully integrated testing device.^[@R11]^ One such isothermal amplification method, loop-mediated isothermal amplification (LAMP), provides specific and efficient amplification of target nucleic acids by targeting 8 unique sequences.^[@R12]^ The isothermal heating (most efficiently between 65 and 72 °C)^[@R13],[@R14]^ of LAMP both lyses many pathogens and robustly amplifies DNA even in the presence of complex sample matrices, further reducing sample processing and instrumentation requirements.^[@R15]-[@R17]^ To expedite sample preparation steps, such as reverse transcription (RT) of HIV RNA targets to amplifiable DNA, several groups have demonstrated that RT can be performed using the same assay conditions as LAMP.^[@R18]-[@R21]^ Gurrala *et al*. used RT-LAMP to amplify HIV-1 RNA and produce a pH change that can be measured with their device.^[@R22]^ The lack of reagent storage and integrated sample preparation, however, decreases the translatability of this and other RT-LAMP devices.
Here we report a fully-integrated sample-to-answer platform ([Fig. 1](#F1){ref-type="fig"}) that leverages paper membranes\' wicking abilities and size discriminating pores to a) isolate HIV viral particles from human blood cells, b) amplify RNA from the viral particles using pre-dried RT-LAMP reagents that target the highly conserved *gag* gene of HIV-1, and c) automatically transport RT-LAMP amplicons to an integrated LFIA for simple, visual interpretation of results within 90 minutes of sample application. This microfluidic rapid and autonomous analysis device (microRAAD) demonstrates the potential for simple and low-cost HIV detection at the point of care.
Experimental {#S2}
============
Reagents {#S3}
--------
Reagents necessary for the RT-LAMP assay included six primers (Integrated DNA Technologies, Skokie, IL), Bst 3.0 polymerase (NEB, Ipswich, MA), deoxynucleotide triphosphates (dNTPs) (Agilent Technologies, Santa Clara, CA), isothermal buffer II (NEB, Ipswich, MA), betaine (Millipore Sigma, Burlington, MA), EvaGreen (VWR International, Radnor, PA), ROX (Thermo Fisher Scientific, Waltham, MA), diethyl pyrocarbonate (DEPC) water (Invitrogen, Carlsbad, CA), and human whole blood collected in sodium citrate (Innovative Research, Novi, MI).
Template used in the experiments below included purified genomic RNA from HIV-1 (ATCC, Manassas, VA), non-infectious HIV-1 virus diluted in AccuSpan plasma (AccuSpan Linearity Panel, SeraCare Life Sciences, Milford, MA), purified genomic RNA from dengue virus (DENV) type 1 (BEI resources, Manassas, VA), and purified RNA from chikungunya virus (CHIKV) S-27 (BEI resources, Manassas, VA). *Sph*I and *Pst*I restriction enzymes (NEB, Ipswich, MA) and phosphate buffered saline (PBS) (Thermo Fisher Scientific, Waltham, MA) are additional reagents used.
Reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay {#S4}
----------------------------------------------------------------------------
Purified genomic RNA from HIV-1 or non-infectious HIV-1 virus was used at specified concentrations as the template in preliminary testing and in experiments thereafter. LAMP primers were devised using PrimerExplorer v5 to target the *gag* gene of HIV-1, and loop primers were labeled with 6-carboxyfluorescein (FAM) and biotin for detection *via* commercial LFIA (Ustar Biotechnologies, Hangzhou, China). The primer sequences are provided in [Table S1.†](#SD1){ref-type="supplementary-material"} To allow for both reverse transcription and amplification of the HIV-1 target, we used Bst 3.0 polymerase, which includes reverse transcriptase capabilities, and the buffers and dyes listed in [Table S2†](#SD1){ref-type="supplementary-material"} for a 25 μL reaction. 2--4 μL of template (RNA or virus) or negative control (DEPC water or AccuSpan plasma) were added directly to the RT-LAMP master mix prior to heating. A range of temperatures, 58--77 °C, were tested to determine the optimal assay temperature. After heating at indicated temperatures, RT-LAMP amplicons were added to LFIAs for analysis. Hereafter, RT-LAMP was performed at 65 °C for 60 minutes using an Applied Biosystems 7500 Real-Time PCR System (Foster City, CA). The specificity of the target sequence to HIV-1 was verified by BLAST as well as experimentally using 10^5^ copies per reaction of genomic RNA from DENV type 1 and CHIKV S-27. Further, to confirm the identity of the amplified product, the RT-LAMP amplicons were subjected to restriction enzyme digest with *Sph*I and *Pst*I for 1 hour at 37 °C and the digested segments were confirmed *via* 2% agarose gel electrophoresis.
For limit of detection (LOD) experiments, RNA or virus template was prepared by performing 10-fold serial dilutions in either DEPC water (RNA) or AccuSpan plasma (virus). For analysis of RT-LAMP in biological sample matrices, increasing amounts of human whole blood was added into the master mix. Real-time fluorescence data of EvaGreen intercalating dye and ROX reference dye was monitored to confirm the amplification progress. RT-LAMP amplicons were characterized *via* LFIA and confirmed *via* gel electrophoresis using a 2% agarose gel run at 100 V for 60 minutes, stained with ethidium bromide, and imaged using an ultraviolet light gel imaging system (c400, Azure Biosystems, Dublin, CA).
RT-LAMP reagent drying and storage {#S5}
----------------------------------
Reagents and conditions for drying and storage were modified and adapted from a published protocol.^[@R23]^ The RT-LAMP reagents were deposited, dried, and stored at room temperature, eliminating the need for cold-chain storage (−20 °C) and improving the portability of the device. The primer mixture ([Table S3†](#SD1){ref-type="supplementary-material"}) containing primers, sucrose, glycerol, and Triton X-100 was deposited by hand on 1 cm wide polyethylene terephthalate (PET) film (Apollo, Lake Zurich, IL) in two parallel lines ([Fig. S1†](#SD1){ref-type="supplementary-material"}) at approximately 1.83 μL cm^−1^. After drying in a sterile biosafety cabinet under continuous air flow for 60 minutes at room temperature, the enzyme mixture containing Bst 3.0 polymerase, sucrose, | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
The International Study of Asthma and Allergies in Childhood (ISAAC), created in 1990 to maximize the value of epidemiological studies of asthma and allergic diseases, established a standardized method that facilitated international collaboration, from the establishment of a protocol used worldwide^(^ [@B01] ^)^. Its specific points were: a) to describe the prevalence and severity of asthma, rhinitis, and eczema in children living at different locations and to draw comparisons between them and between countries; b) obtain baseline measures to assess future trends in the prevalence and severity of this diseases; c) provide support for further etiologic studies in genetics, lifestyle, medical care, and air pollution, that may affect these diseases^(^ [@B01] ^)^.
The ISAAC was conceived to be carried out in three successive and dependent phases. In the first phase, the study of the compulsory core was developed to assess the prevalence and severity of asthma and allergic diseases in selected populations, using a standardized questionnaire; in the second phase, possible etiological factors were investigated, especially those suggested by the results in the previous phase; in the third phase, the first phase was repeated after a minimum period of 5 years, evaluating the evolutionary trend in the prevalence of asthma and allergic diseases in a given period, including centers that participated in phases I and III simultaneously. In addition, the prevalence of other countries was determined, which, although not involved in phase I, had interest in measuring the prevalence of asthma and its severity, as well as the risk factors associated with the development of the disease, both environmental and of lifestyle, specific to each community^(^ [@B01] ^)^.
Collections instruments
=======================
The instruments of data collection are the ISAAC video questionnaire (VQ) and the written questionnaire (WQ).
The VQ consists of five scenes, where several individuals are presented with pictures of asthma in different intensities and situations, to be answered by adolescents^(^ [@B01] ^)^. The WQ is composed of three modules, which address asthma, rhinitis, and atopic eczema, respectively. The WQ is presented in two versions: one for children aged from 6 to 7 years, answered by parents and/or guardians, and another answered by the adolescents themselves. The question \"wheezing in the last year\" is the one that gathers higher sensitivity and specificity for the diagnosis of asthma, being universally used to identify individuals with active asthma^(^ [@B01] ^)^.
Originally written in English, the ISAAC WQ was validated to be used worldwide. In localities where the language was different, it was recommended that it be translated and validated for its appropriate use^(^ [@B01] ^)^. Thus, in our location, the ISAAC WQ was translated into Brazilian Portuguese, back-translated into English, and then validated by criterion and constructively, confirming that their diagnostic characteristics were not modified^(^ [@B02] ^)^. More recently, the ISAAC directive committee published a study that highlights the importance of cultural norms that must be considered in the evaluation of back-translation into English, often allowing linguistic deviations in order to maintain the original meanings^(^ [@B03] ^)^.
Although the VQ was designed to overcome barriers imposed by language and possible distortions arising from translations of the WQ, its application in the world did not supplant that of the WQ. In Brazil, the WQ was the only one to be used. However, due to the various denominations that asthma receives, some authors added questions with synonyms usually used to define the disease in the WQ, in order to improve the diagnostic power of the instrument^(^ [@B04] ^)^. Named by many as bronchitis, the inclusion of the question did not improve the diagnostic power of the ISAAC WQ in children^(^ [@B04] ^)^.
Taking as a base the structure employed in other national population surveys, for instance, the survey on weight, Valle *et al*validated the ISAAC WQ, as well as its reproducibility, administering it through telephone interview. Parents/caregivers of children (6-7 years old) with or without asthma were interviewed in their homes on two occasions, with an interval of 15 days, and responded to the ISAAC WQ by telephone, evaluating the reproducibility of responses to the questions, given by the same respondent. The question \"wheezing in the last year\" had a perfect concordance index, enhancing the reproducibility of the instrument administered via telephone^(^ [@B05] ^)^.
ISAAC Phase I
=============
The compilation of worldwide data from ISAAC phase I gathered a significant number of children (6-7 years; n=257,800; 91 centers in 38 countries) and adolescents (13-14 years; n=463,801; 155 centers in 56 countries) never previously evaluated and showed great variability in rates between the different participating centers^(^ [@B06] ^)^.
In Brazil, the first ISAAC phase, completed in 1996, was a real watershed in knowledge of the prevalence of asthma and allergic diseases in the country. Before, the Brazilian epidemiological data available were restricted to small population samples, especially in large urban centers and educational institutions, without any standardization in their production, which made it very difficult to compare them.
In Brazil, seven centers that enabled obtaining reliable data on the prevalence of asthma, allergic rhinitis, and atopic eczema in children and adolescents participated in this phase. The comparative analysis with all the global data obtained showed that the average prevalence of asthma in children and adolescents is high ([Table 1](#t01){ref-type="table"}), being the eighth among the centers with the highest prevalence - English-speaking countries and Latin America^(^ [@B07] ^)^. As for asthma, in this first phase, it was observed that the use of the medical diagnosis as epidemiological criterion for identifying patients with asthma would induce an underdiagnosis, since the prevalence of the active disease (wheezing in the last year) reached twice as much as the medical diagnosis^(^ [@B08] ^)^. This fact is corroborated, as in the validation of the WQ, it was found that only 50% of adolescents with asthma, regularly followed in a specialized service, identified themselves as having asthma^(^ [@B02] ^)^.
Table 1Prevalence of active asthma (wheezing in the past 12 months) and physician-diagnosed asthma in school children from official centers and other Brazilian centers that used the protocol of the International Study of Asthma and Allergies in Childhood (ISAAC) - Phase 1
Other researchers, even without the recognition of the central committee of the ISAAC, used the standard WQ and the protocol, obtaining the prevalence data summarized in [Table 1](#t01){ref-type="table"}. The mean prevalence of active asthma was 23.3% for children and 22.7% for adolescents ([Table 1](#t01){ref-type="table"}).
Taking the data from around the world, there was a 20-fold variation in the prevalence of asthma and related symptoms (ranging between 1.8 and 36.7%), being the environmental factors the main responsible for this variation^(^ [@B14] ^)^. English-speaking countries and centers in Latin America were among those with the highest prevalence.
Next, to check the possible factors involved in differences in prevalence observed in the various centers involved in ISAAC Phase I, ecological studies were conducted. Anderson *et al* evaluated the relationship of national immunization rates against tuberculosis, diphtheria, pertussis, and tetanus (DPT) and measles with the prevalence of symptoms of asthma, rhinitis, and atopic eczema. A negative and significant association was observed between adolescents and immunization against measles and DTP, but not against tuberculosis^(^ [@B15] ^)^. In another study, we observed a significant inverse relationship between humidity and mean annual temperature variation and prevalence of symptoms of asthma and allergic diseases^(^ [@B16] ^)^.
The use of antibiotics in early life and the prevalence of symptoms of asthma, rhinoconjunctivitis and atopic eczema were also reasons of study. These indexes, adjusted for gross domestic product showed no association between the two variables^(^ [@B17] ^)^.
Air pollution is identified as a risk factor for the development of asthma and related symptoms, especially in regards to particulate matter (PM), resulting from burning oil. Anderson *et al* investigated the effect of environmental PM on the prevalence of asthma and allergic diseases, analyzing satellite data by estimates and adjustments according to the gross domestic product of the countries involved. Although the data suggested a relationship, there was no statistically significant confirmation between exposure to particulate matter from 10Î1/4 (PM10) and prevalence rates^(^ [@B18] ^)^.
On the other hand, Rios *et al*, assessed the prevalence of asthma and related symptoms in adolescents from two localities in the state of Rio de Janeiro, with different degrees of air pollution (PM10) - the municipality of Seropédica, little polluted, and the municipality of Duque de Caxias, very polluted - and found a significant association between exposure to higher levels of PM10 and greater prevalence of active asthma, as well as its intensity^(^ [@B12] ^)^.
ISAAC phase II
==============
Performed only by a few centers in the world, this phase investigated possible etiological factors, especially those suggested by the results of the first phase, and explored new etiological hypotheses regarding the development of asthma and allergic diseases^(^ [@B19] ^)^. Therefore, this research protocol included the ISAAC WQ, complementary | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-ijerph-17-03529}
===============
Sleep paralysis (SP) is a common condition that affects approximately 7.6% of the general population during their lifetime \[[@B1-ijerph-17-03529]\]. The episodes happen either during sleep onset or offset and entail gross motor paralysis coupled with full consciousness of the situation. Although the pathophysiology of SP is not well understood, the occurrence of SP is related to a desynchrony in the architecture of rapid eye movement (REM) sleep \[[@B2-ijerph-17-03529],[@B3-ijerph-17-03529],[@B4-ijerph-17-03529]\]. In polysomnography, this state is marked by plentiful alpha EEG or a mixed pattern of alpha waves and low voltage slow waves and persistence of muscle atonia \[[@B5-ijerph-17-03529]\]. Body paralysis during SP is triggered by the pons and ventromedial medulla that inhibit the motor neurons during REM sleep by γ-aminobutyric acid and glycine \[[@B2-ijerph-17-03529]\].
SP is usually accompanied by somatic sensations, such as chest pain, shortness of breath, heart palpitations, feeling of choking, sweating, trembling, light-headedness, and nausea. These experiences are variously classified and labelled by researchers, for example, panic symptoms \[[@B6-ijerph-17-03529]\], somatic symptoms \[[@B7-ijerph-17-03529]\], or vegetative symptoms \[[@B8-ijerph-17-03529]\].
SP is often accompanied by visual, tactile, as well as auditory hallucinations \[[@B9-ijerph-17-03529],[@B10-ijerph-17-03529]\]. SP hallucinations are commonly classified into three types: (1) the "intruder" associated with a sense of a menacing presence, (2) the "incubus" associated with a feeling of tightness on the chest, and (3) unusual bodily sensations such as feelings of levitation and other types of OBEs (out-of-body experiences) \[[@B9-ijerph-17-03529]\].
SP hallucinations have generated different interpretations that vary depending on the culture in which they occur. In China, SP is understood as "ghost oppression" \[[@B11-ijerph-17-03529]\]. In Japan, it is thought to be caused by one of the Buddhist deities referred to as Fudoh-Myohoh ("Kanashibari") \[[@B12-ijerph-17-03529]\]. In the United States, it is sometimes interpreted as alien abduction \[[@B13-ijerph-17-03529]\]. In Egypt, it is described as an attack by the evil genies (i.e., the jinn) \[[@B14-ijerph-17-03529]\]; in Turkey, as a Karabasan attack (spirit like creatures) \[[@B15-ijerph-17-03529]\]; in Newfoundland, as an old witch ("old hag phenomenon") \[[@B16-ijerph-17-03529]\]; in Italy, as a pandafeche attack (witches and cat-like creatures) \[[@B17-ijerph-17-03529]\]; in South Africa, as an attack by the Thokoloshe \[[@B18-ijerph-17-03529]\]; in Brazil, as a crone with long fingernails who tramples on the chest ("Pisadeira") \[[@B19-ijerph-17-03529]\]; and in Cambodia, as an attack by a ghost, with SP called "the ghost pushes you down" \[[@B6-ijerph-17-03529]\]. These cultural explanations of SP may affect the rate and severity of SP episodes.
SP is often associated with severe anxiety \[[@B1-ijerph-17-03529],[@B9-ijerph-17-03529],[@B20-ijerph-17-03529],[@B21-ijerph-17-03529],[@B22-ijerph-17-03529]\], and cultural interpretations of SP (e.g., as a supernatural experience) seem to exacerbate its severity. In Egypt, where SP is regarded as a supernatural experience, 50% of respondents reported fear of death. However, in Demark, where SP is interpreted as a psychological phenomenon, only 17% reported such fears \[[@B23-ijerph-17-03529]\]. Thus, the geographic and cultural bases of SP can have differing affects across different cultures.
SP is more common in people with narcolepsy and other psychiatric disorders, especially in those with anxiety disorders such as panic disorders (between 20.8% to 30.6%) \[[@B24-ijerph-17-03529]\], social phobias (22.2%) \[[@B24-ijerph-17-03529]\], or generalized anxiety disorders (15.8%) \[[@B24-ijerph-17-03529]\]. Some studies show an increased incidence of SP in people with post-traumatic stress disorder (PTSD) \[[@B14-ijerph-17-03529],[@B25-ijerph-17-03529]\], 67% in a Cambodian sample \[[@B6-ijerph-17-03529]\]. Research also indicates that depression is strongly associated with SP in a multiple predictor model \[[@B26-ijerph-17-03529]\] and that people who experience SP have higher symptoms of depression compared to people who have never experienced SP \[[@B27-ijerph-17-03529],[@B28-ijerph-17-03529]\]. Sharpless et al., 2010, find a significant correlation between depression symptoms and recurrent fearful SP \[[@B29-ijerph-17-03529]\]. Body position during sleep onset seems relevant as SP is more common when sleeping in a supine position \[[@B9-ijerph-17-03529]\]. Moreover, SP prevalence rates are significantly higher in the student population (28.3%) compared to the general population (7.6%) \[[@B1-ijerph-17-03529]\]. SP that occurs independently of sleep disorders is referred to as isolated sleep paralysis \[[@B30-ijerph-17-03529]\]. The International Classification of Sleep Disorders (ICSD) classification distinguished Recurrent Isolated Sleep Paralysis (RISP) from regular sleep paralysis, placing it in the group of parasomnias related to the REM sleep phase \[[@B31-ijerph-17-03529]\]. Moreover, in the latest version of the International Classification of Diseases (ICD-11), RISP was defined and classified under the code 7B01.1 \[[@B32-ijerph-17-03529]\]. In the fifth edition of Diagnostic and Statistical Manual of Mental Disorders (DSM-5), RISP is not included, although it can be marked 307.40 (unspecified sleep-wake disorder) or 307.49 (other specified sleep-wake disorders) \[[@B33-ijerph-17-03529]\].
To date, no published studies have examined SP in Poland. The aim of the current study is to assess (1) the prevalence of SP in a Polish student population, (2) the occurrence of SP-related somatic and clinical symptoms, and (3) the factors contributing to the occurrence of somatic and clinical symptoms among SP experiencers.
2. Materials and Methods {#sec2-ijerph-17-03529}
========================
2.1. Participants {#sec2dot1-ijerph-17-03529}
-----------------
The study was designed as a cross-sectional questionnaire-based descriptive study. The questionnaire was sent via Facebook to 2500 randomly selected students from various universities (and different years of study) in the Lublin Province of Poland. All data were collected from March 2018 to August 2018. The survey was completed by 439 students: 328 female students (75%) and 111 male students (25%) aged 18 to 50 years ([Table 1](#ijerph-17-03529-t001){ref-type="table"}). All participants completed a battery of online questionnaires: (1) a demographic questionnaire, (2) the Sleep Paralysis Experiences and Phenomenology Questionnaire (SP-EPQ), (3) The PTSD Checklist (PCL), (4) The State-Trait Anxiety Inventory (STAI-T), and (5) The Penn State Worry Questionnaire (PSWQ).
2.2. Materials {#sec2dot2-ijerph-17-03529}
--------------
### 2.2.1. Demographic Questionnaire {#sec2dot2dot1-ijerph-17-03529}
A demographic questionnaire was designed for the current study to collect relevant personal data. The questionnaire assessed two domains: (1) Personal Data included gender, age, height, weight, size of the city in which they live, university profile; (2) lifestyle data included cigarette smoking (the number of cigarettes smoked during the day), the number of hours of sleep during 24 h period (daytime and night-time), alcohol consumption (type of alcohol and frequency of intake during the month), the use of dietary energizers (caffeine and caffeine-containing products), sports (number of hours per week devoted to physical activity).
### 2.2.2. Sleep Paralysis Experiences and Phenomenology Questionnaire {#sec2dot2dot2-ijerph-17-03529}
The Sleep Paralysis Experiences and Phenomenology Questionnaire (SP-EPQ), was designed by Baland Jalal and Devon Hinton to assess the frequency of SP episodes, the presence of psychological and somatic symptoms, the prevalence indices, and the level of knowledge about the experience \[[@B23-ijerph-17-03529]\]. The questionnaire has been used in Italy and Turkey \[[@B15-ijerph-17-03529],[@B17-ijerph-17-03529],[@B34-ijerph-17-03529]\]. | {
"pile_set_name": "PubMed Central"
} |
GENOME ANNOUNCEMENT {#h0.0}
===================
Bacterial neonatal meningitis, one of the most devastating infections in the early period of human life, accounts for high mortality and morbidity among infants ([@B1]). *Escherichia coli* is the second most common pathogen associated with neonatal meningitis, and it accounts for 10% to 30% of these high mortality and morbidity rates, as well as adverse consequences in surviving neonates ([@B1]). Even though neonatal meningitis-causing *E. coli* (NMEC) has been considered one of the major pathogens associated with meningitis during the early period of human life, its pathogenesis has not been fully elucidated ([@B2], [@B3]). The NMEC strain RS218 (O18:H7:K1, ST95) was isolated from the cerebrospinal fluid of a patient with neonatal meningitis in 1974 ([@B4], [@B5]) . Over the past few decades, this strain of *E. coli* has been used extensively in the studies relevant to NMEC pathogenesis and is considered the prototypic strain of NMEC ([@B3][@B4][@B5]). Although some contigs of *E. coli* RS218 have been released, the complete and fully annotated genome of the RS218 strain is still not available ([@B5]). In the present study, the sequence of the genome of *E. coli* RS218, including its plasmid, was fully closed and completely annotated.
Genomic DNA of *E. coli* RS218 was isolated using the Promega Genomic Wizard kit (Madison, WI). Genome sequencing was performed with Ion Torrent PGM sequencing technology (Life Technologies, Grand Island, NY) at the Genomics Core Facility of The Pennsylvania State University (University Park, PA) using a 318 sequencing chip. The genome was assembled with both *de novo* and reference-guided assemblies using the DNASTAR SeqMan NGen v. 11.0.0 and Lasergene Suite (Madison, WI). The gaps were closed with primer walking, and the final assembly was anchored to an optical map generated by OpGen, Inc. (Gaithersburg, MD). Annotation was performed using both Rapid Annotation using Subsystem Technology and the NCBI Prokaryotic Annotation Pipeline ([@B6], [@B7]).
Analysis of the *E. coli* RS218 genome revealed that it consists of a circular chromosome of 5.087 Mb in size and a 114-kbp plasmid (pRS218) with an average G+C content of 50.6%. The sequence of pRS218 and its involvement in NMEC pathogenesis have recently been published ([@B8]). The chromosome contains 4,658 coding sequences, 88 transfer RNAs, 22 ribosomal RNAs, 1 clustered regularly interspaced short palindromic repeats array, and 5 noncoding RNAs. Additionally, it encodes secretory systems type I to VI (except the type III system), 8 fimbrial clusters, 6 iron acquisition systems, toxins, metabolic pathways, and several putative or hypothetical adhesins and invasins among other proteins. In comparison to the laboratory strain of *E. coli* K-12, the genome of RS218 contains 51 genomic islands which encode many known and potential virulence traits. These genomic data will be useful in future studies to broaden the current understanding of NMEC pathogenesis by identifying novel genes involved in initial colonization of mucosal epithelia as well as penetration of the intestinal mucosal barrier and blood-brain barrier by NMEC.
Nucleotide sequence accession numbers. {#s1}
--------------------------------------
The complete annotated chromosome and the plasmid of RS218 were deposited in NCBI GenBank under the accession numbers [CP007149](CP007149) and [CP007150](CP007150), respectively.
**Citation** Wijetunge DSS, Katani R, Kapur V, Kariyawasam S. 2015. Complete genome sequence of *Escherichia coli* strain RS218 (O18:H7:K1), associated with neonatal meningitis. Genome Announc 3(4):e00804-15. doi:10.1128/genomeA.00804-15.
We thank Deb Grove and her colleagues for sequencing performed at the Genomics Core Facility of The Pennsylvania State University.
This study was supported by the Department of Veterinary and Biomedical Sciences at The Pennsylvania State University.
| {
"pile_set_name": "PubMed Central"
} |
{#sp1 .124}
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Hepatocellular carcinoma (HCC) accounts for up to 90% of all malignant primary liver cancer worldwide and represents a major health threat.[@b1-ijn-13-1621] Currently, apart from surgery, patients with liver cancer are mainly treated by chemotherapy.[@b2-ijn-13-1621] However, chemotherapy is limited by a low response rate and severe systemic toxicity due to low specificity and resistance mechanisms of the chemotherapeutic agents toward cancer cells.[@b3-ijn-13-1621] Therefore, novel drug delivery systems are urgently needed to enhance the selective action of cytotoxic drugs to HCC and therefore minimize systemic toxicity to noncancerous tissues.
Glycyrrhetinic acid (GA), a pentacyclic triterpenoid, is widely present in the licorice plant and is the active aglycone of glycyrrhizin (GL). Abundant GA receptors have been confirmed on the cellular membrane of hepatocytes.[@b4-ijn-13-1621] The protein kinase C-α was reported as the target binding protein of GA, which had much more expression in HCC cells than in the adjacent nontumor liver cells.[@b5-ijn-13-1621] The amount of GA receptors in tumor tissue has been found to be 1.5- to 5-fold more than that in normal tissue.[@b6-ijn-13-1621] Additionally, GA showed the selective toxicity toward tumor through the downregulation of glutathione.[@b7-ijn-13-1621] Recently, some GA-modified liposomes have been developed with higher drug accumulation in the liver and better anti-HCC activity.[@b5-ijn-13-1621]--[@b9-ijn-13-1621] We have confirmed GA receptors on HCC cells formerly according to the binding effect between fluorescence-labeled GA and GA receptors.[@b10-ijn-13-1621] Therefore, it could be expected that GA-modified liposomes could target selectively to HCC cells and tissues.
GA exists in two stereoisomers, including *trans* form 18α- and the *cis* form 18β-GA, lying in the spatial orientation of hydrogen atom of C~18~. Different configurations of GA exhibit various stabilities, solubilities[@b11-ijn-13-1621] and pharmacological effects. 18β-GA exerted protective effects against cyclophosphamide-induced hepatotoxicity.[@b12-ijn-13-1621] 18β-GA also showed anti-HCC proliferation effects, which could induce the HCC cells' apoptosis via modulation of inflammatory markers and inhibit HCC development by reversing hepatic stellate cell-mediated immunosuppression.[@b13-ijn-13-1621],[@b14-ijn-13-1621] 18β-GA could reduce the amount of glucose release induced by glucagon in rat primary cultured hepatocytes, while 18α-GA did not.[@b15-ijn-13-1621] Nevertheless, 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) is a kind of microsomal enzyme belonging to the short-chain dehydrogenase/reductase family, which is highly expressed in many glucocorticoid target tissues, such as the liver, adipose tissue, skeletal muscle and macrophages. 18α-GA selectively inhibited 11β-HSD1, but 18β-GA had no selectivity.[@b16-ijn-13-1621] 18α-GA increased peroxisome proliferator- activated receptor γ expression and decreased nuclear factor-κB DNA-binding activity, inhibiting the proliferation of activated hepatic stellate cells.[@b17-ijn-13-1621] 18α-GA was reported to target prostate cancer cells by downregulation of inflammation-rated genes in DU-145 cells.[@b18-ijn-13-1621]
Ishida et al have proved that a carrier-mediated transport system participated in the uptake of GL into isolated rat hepatocytes and the affinity site of the transport carrier bound to GA.[@b19-ijn-13-1621] GA is a hydrolytic product of GL with the differences of hydroxyl or glycosyl group at C~3~. The removal of 11-carbonyl in the ring structure of GA not only eliminated pseudoaldosterone effect but also improved its anti-inflammatory, antiulcer and antiallergic activities.[@b20-ijn-13-1621] 11-deoxy-18β-GA (11-Deo-GA), performing a similar action of 18α-GA, also selectively (and significantly) acted on 11-β-HSD1.[@b21-ijn-13-1621] As for anticancer properties, 11-Deo-GA induced gastric cancer cell apoptosis by upregulation of p21, downregulation of cdc2 and cyclin B1 and association with BID (a BH3 domain-only agonist) translocation from the nucleus to the mitochondria.[@b22-ijn-13-1621] These deduced that for GA's main ring structure, the hydroxyl group at C~3~ and the carbonyl group at C~11~ had certain effect on the liver or HCC cell targeting.
Thus, in this study, we focused on the targeting effect of different GA configurations and groups to HCC cells. As shown in [Figure 1](#f1-ijn-13-1621){ref-type="fig"}, 18β-GA, 18α-GA, 3-acetyl-18β-GA (3-Ace-GA) and 11-Deo-GA were obtained, and fluorescein isothiocyanate-labeled 18β-GA (FITC-GA) was synthesized according to reported method.[@b23-ijn-13-1621] The binding site competition to HCC cells of different GA derivatives was studied. The long-circulation phospholipids with potential targeting molecular were synthesized by the GA derivatives linked with DSPE-PEG~2000~-NH~2~. Coumarin 6 (Cou6) and 1,1-dioctadecyl-3,3,3,3-tetramethylindotricarbocyanine iodide (DiR) liposomes were prepared to evaluate the targeting effect of GA's configurations and groups in vitro and in vivo.
Materials and methods
=====================
Materials
---------
18β-GA (purity 98%), 18α-GA (purity ≥98%) and Cou6 (purity 98%) were obtained from J&K Scientific Ltd. (Beijing, China). 3-Ace-GA, 11-Deo-GA and FITC-GA were synthesized and characterized in our laboratory. DSPE-PEG~2000~ (DSPE-PEG, purity ≥97%) and DSPE-PEG~2000~-NH~2~ (DSPE-PEG-NH~2~, purity ≥95%) were bought from AVT Pharmaceutical Co., Ltd (Shanghai, China). Soybean phospholipid (for injection, phosphatidylcholine ≥85%) and cholesterol (purity ≥98%) were from Tywei Pharmaceutical Co. (Shanghai, China). DiR was from AAT Bioquest Int. (Sunnyvale, CA, USA). RIPA lysis buffer, BCA protein assay kit and Hoechst 33258 were from Beyotime Institute of Biotechnology (Shanghai, China).
Human HCC (HepG2) cells and mouse ascites hepatoma (H22) cells were obtained from Cell Bank of Chinese Academy of Sciences (Shanghai, China). HepG2 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM; Invitrogen, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS; Gibco, Waltham, MA, USA). H22 cells were cultured and passaged in Kunming mouse ascites. Male BALB/c nude mice (20±2 g), supplied by the Department of Experimental Animals, Shenyang Pharmaceutical University (Shenyang, China), were acclimated under specific-pathogen-free conditions in the central animal facility of the university. All animal experiments were approved by the Ethics Committee of the Shenyang Pharmaceutical University and were carried out in accordance with the guidelines evaluated and approved by the ethics committee of Shenyang Pharmaceutical University.
Competition of binding sites
----------------------------
Approximately 2.5×10^6^ HepG2 cells were seeded into 6-well culture plates. After the cells have covered the plates, the medium was removed and the cells were washed with PBS and DMEM (without FBS) successively. The cells were treated with a series concentrations of 18β-GA, 18α-GA, 3-Ace-GA, 11-Deo-GA and FITC-GA in DMEM for 2 h at 37°C. Then, FITC-GA was added to a final concentration of 100 nM. After co-incubation for 2 h at 37°C, the cells were washed with chilled PBS and lysed with 100 μL of lysis buffer in ice bath. The cell lysate was harvested, shaken and centrifuged (1.2×10^4^ rpm for 10 min) at 4°C. The fluorescence intensity of the supernatant was measured (λ~ex~ =490 nm, λ~em~ =520 nm) with the Varioskan Flash Spectral Scanning Multimode Reader (Thermo Fisher Scientific, Waltham, MA, USA). The fluorescence intensity was normalized with respect to the cells' protein content, which was determined with a BCA protein assay kit. The fluorescence intensity of different GA derivatives with FITC-GA samples and the only FITC-GA samples normalized with the content of protein in the cells was calculated as the specific binding (B) and maximum binding (B~0~), respectively. The competitive curve fitting was constructed by GraphPad Prism 5.0 (GraphPad Software, La Jolla, CA, USA) software with concentration as x- | {
"pile_set_name": "PubMed Central"
} |
Xie L, Peng Y, Huang K, Wu Y, Wang S. Predictive value of iron parameters in neurocritically ill patients. Brain Behav. 2018;8:e01163 10.1002/brb3.1163
1. INTRODUCTION {#brb31163-sec-0005}
===============
Iron has many different roles in the body, acting in carrying oxygen, delivering electron, and catalyzing many biochemistry reactions. After being absorbed from the microvilli of enterocytes, most of the iron in the body keeps a sequestered condition by binding with transferrin in the circulation and is stored in the form of ferritin in the tissues (Andrews & Schmidt, [2007](#brb31163-bib-0001){ref-type="ref"}). In contrast, the non‐transferrin‐bound iron is toxic because it can generate free radicals via participating in the Fenton/Haber--Weiss reaction. These reactive oxidative species could cause lipid peroxidation and bring damages to proteins and DNA (Brissot, Ropert, Le Lan, & Loreal, [2012](#brb31163-bib-0004){ref-type="ref"}; Koskenkorva‐Frank, Weiss, Koppenol, & Burckhardt, [2013](#brb31163-bib-0011){ref-type="ref"}).
Under normal conditions, there is a balance of iron metabolism that preserves the biological function of iron while preventing an excess that would cause oxidative stress. Under pathological conditions, however, the iron metabolism shifts and the alteration could cause it to become a defense mechanism. The processes of iron metabolism involve a number of specific proteins (Malyszko, Malyszko, Pawlak, & Mysliwiec, [2006](#brb31163-bib-0015){ref-type="ref"}). Hepcidin, a peptide mainly synthesized by the liver, is regarded as the master regulator modulated in response to hypoxia, iron deficiency, anemia, or inflammation. Iron metabolism disturbance occurs frequently in intensive care unit (ICU) patients, whereby some of the iron parameters reported to be useful in predicting the prognosis of these patients. Nevertheless, these studies are mainly performed in surgical or general ICU. Moreover, which iron parameters could be used to predict reliably with prognosis of critical illness is controversial (Bobbio‐Pallavicini et al., [1989](#brb31163-bib-0003){ref-type="ref"}; Leaf, Rajapurkar, Lele, Mukhopadhyay, & Waikar, [2014](#brb31163-bib-0012){ref-type="ref"}; Tacke et al., [2016](#brb31163-bib-0023){ref-type="ref"}).
In terms of neurologic disorders, several studies (Davalos et al., [1994](#brb31163-bib-0007){ref-type="ref"}; Millan et al., [2007](#brb31163-bib-0017){ref-type="ref"}; Millerot et al., [2005](#brb31163-bib-0018){ref-type="ref"}; Simon et al., [2015](#brb31163-bib-0022){ref-type="ref"}; Zuliani et al., [2006](#brb31163-bib-0027){ref-type="ref"}) have suggested that baseline ferritin was related to poor outcome and may represent a marker of disease severity, especially in stroke and brain trauma. However, whether iron parameters, especially ferritin, could be used to predict the prognosis in neurocritically ill patients has not been proved yet.
Here, we performed this study to evaluate the predictive value of iron parameters in neurocritically ill subjects.
2. METHODS {#brb31163-sec-0006}
==========
2.1. Subjects {#brb31163-sec-0007}
-------------
We retrospectively collected data from a prospectively designed cohort of consecutive patients admitted to a neurocritical care unit (NCU) of a tertiary university‐affiliated academic hospital (Nanfang Hospital, Southern Medical University, Guangzhou, China), from August 2016 to January 2017. The inclusion criteria were Glasgow Coma Scale (GCS) (Teasdale & Jennett, [1974](#brb31163-bib-0024){ref-type="ref"}) ≤12 and/or admission Acute Physiology and Chronic Health Evaluation (APACHE) II score (Knaus, Draper, Wagner, & Zimmerman, [1985](#brb31163-bib-0010){ref-type="ref"}) \>15; and/or demand for intensive care or life‐support measures. Patients younger than 18 years old, with iron‐related disorders in history, pregnant, or required intensive care for \<72 hr were excluded. The critical stroke patients with severe neurologic deficits, without altered consciousness, and being classified as "demand for intensive care or life‐support measures," were included in the study. We excluded patients "who required intensive care for \<72 hr" because our NCU and our stroke unit worked as the same unit. The patient group with acute mild to moderate intracranial hemorrhage within 24 hr and superacute ischemic stroke with thrombolysis and/or intravascular treatment that required transient close monitoring but transferred out of NCU within 72 hr was eliminated from the neurocritically ill patient group.
Several literatures have reported that iron metabolism may be affected by the renal function and renal function is connected to mortality in ICU patients (Beier et al., [2011](#brb31163-bib-0002){ref-type="ref"}; Cartin‐Ceba, Afessa, & Gajic, [2007](#brb31163-bib-0005){ref-type="ref"}; Malyszko et al., [2006](#brb31163-bib-0015){ref-type="ref"}), indicating that the renal function might have influence on outcome in this study. Therefore, the enrolled patients were divided into two subgroups for further analysis, based on estimated glomerular filtration rate (eGFR) (Levey et al., [2009](#brb31163-bib-0013){ref-type="ref"}), with eGFR ≥ 60 ml/min/1.73 m^2^ defined as normal (National Kidney Foundation, [2002](#brb31163-bib-0020){ref-type="ref"}).
2.2. Data collection {#brb31163-sec-0008}
--------------------
Electronic medical records were carefully reviewed to collect the patient information of demographics, diagnoses, vital signs, GCS scores, APACHE II scores, Sequential Organ Failure Assessment (SOFA) scores (Vincent et al., [1998](#brb31163-bib-0025){ref-type="ref"}), laboratory values, length of NCU stay, and duration of mechanical ventilation. Laboratory data of iron parameters included serum iron, ferritin, transferrin, transferrin saturation (TS), total iron‐binding capacity (TIBC), and unsaturated iron‐binding capacity (UIBC). All data mentioned above were referred to the patients' baseline information within 24 hr after admission. Nobody had prior transfusion. GCS scores were extracted from the first neurological examination at NCU admission. The total scores of APACHE II and SOFA were obtained according to the corresponding parameters within the first 24 hr of NCU admission.
Primary endpoints were short‐term (30‐day) all‐cause mortality and long‐term (6‐month) poor outcome, with the latter defined as modified Rankin Scale (mRS) of 4--6. The outcome information was acquired in a medical follow‐up system, in which all patients admitted to NCU were followed up through face‐to‐face or telephone interviews by a trained personnel blinded to the present study.
2.3. Statistical analysis {#brb31163-sec-0009}
-------------------------
Continuous data were presented as mean ± standard deviation (*SD*) or median (25%‐75% interquartile range) and compared by Student\'s *t* test or Mann--Whitney *U* test, as appropriate. Differences in proportions among categorical data were assessed using chi‐squared tests and Fisher\'s exact tests for multiple groups. The prognostic value of iron parameters was first assessed by univariate analysis. Then, the significant variables were further included in multivariate models for adjustment. The 95% confident intervals reported for the logistic regression odds ratios were calculated by the maximum‐likelihood estimation (forward selection). Correlations between variables were determined with the Spearman\'s rank correlation test. *p* \< 0.05 was considered statistically significant. All statistical analyses were performed using SPSS, version 20.0 (SPSS, Chicago, IL).
2.4. Ethic statement {#brb31163-sec-0010}
--------------------
The study proposal was approved by the Medical Ethics Committee of Nanfang Hospital. Informed consents were signed by all the patients or their surrogates before data collection.
3. RESULTS {#brb31163-sec-0011}
==========
3.1. Overall analysis {#brb31163-sec-0012}
---------------------
Of 131 patients screened for eligibility, 103 satisfied inclusion and exclusion criteria (Figure [1](#brb31163-fig-0001){ref-type="fig"}). The etiology of the patients included acute ischemic stroke (38.8%, *N* = 40), intracranial hemorrhage (19.4%, *N* = 20), central nervous system infection (13.6%, *N* = 14), and other neurologic disorders (28.2%, *N* = 29). | {
"pile_set_name": "PubMed Central"
} |
Introduction {#S0001}
============
Vesicoureteral reflux (VUR) is an important disorder in children because of high association with urinary tract infection (UTI) and permanent renal damage (scar)^\[[@CIT0001]\]^. Reflux--associated nephropathy is one of the most important causes of end stage renal disease and kidney transplantation in children and adults^\[[@CIT0002],\ [@CIT0003]\]^. Currently most cases of VUR are not diagnosed until the patients presented with urinary tract infection, the condition that increases risk of renal damage.
The advent of prenatal ultrasonography has enhanced the early detection of various urinary tract abnormalities such as VUR. Reflux was detected in 15-30% of infants with abnormal prenatal ultrasound findings^\[[@CIT0004]--[@CIT0007]\]^.
Controversy exists regarding the natural history and treatment of VUR diagnosed antenatally and those detected later in life, usually after urinary tract infections. Prenatal diagnosis should be an ideal opportunity to detect VUR earlier and prevent later renal damage but some authors suggested that fetal vesicoureteral reflux is essentially benign and need less aggressive investigation and management^\[[@CIT0008],\ [@CIT0009]\]^. Conversely others have opposite idea^\[[@CIT0010],\ [@CIT0011]\]^. They believe that there is no difference between two forms of VUR according to natural history and outcome.
The aim of this study was to assess the natural history and outcome of vesicoureteral reflux in infants less than 1 year and compare prenatally detected with those detected later during the first year of life.
Subjects and Methods {#S0002}
====================
This prospective study was carried out in BooaliSina university hospital, Sari, IRAN, from September 2004 to March 2012. The study was approved by the Research committee of Mazandaran University of medical sciences. All parents were given written informed Consent before enrolling the infants into the study.
All infants less than 12 months old with VUR were enrolled in this study.VUR was diagnosed in the follow up process of antenatal diagnosed hydronephrosis or postnatal conditions such as urinary tract infections. Reflux was diagnosed by cystography and classified as grade one to five according to severity. All infants with any grade of reflux enrolled in study. Infants with reflux associated with any other pathological condition and those with incomplete follow up were excluded.
We divided children into two groups. Group 1 consisted of patients with antenatal hydronephrosis that VUR was detected on postnatal investigation. In group 2 there were infants that had normal prenatal ultrasound but VUR was diagnosed during the first year of life following the workups for UTI.
We followed all infants with prenatal hydronephrosis that were referred to our clinic. All infants were studied by urinary tract ultrasonography performed at first and six weeks of age. voiding cystourethrogram (VCUG) was performed in infants who had persistent hydronephrosis on both postnatal sonographies. We ordered VCUG for children less than one year old with urinary tract infection. Reflux grade was classified at first VCUG according to the system proposed by International Reflux Study Committee.
All patients received prophylactic antibiotics until resolution of reflux or improvement to lower nondilating grades of reflux. We used cephalexin, cotrimoxazole, amoxicillin for prophylaxis. We prospectively followed patients at least for six months for assessment of defined outcomes including somatic growth, need for surgical intervention, reflux resolution, formation of scar, hypertension and ultimately episodes of UTI.
For assessment of somatic growth we considered Height for age Z score (HAZ) at 12±2 months of age.
Reflux resolution was defined based on results obtained by follow up VCUG at 12-18 months later as: no change, improvement of less than 50% in severity of VUR, improvement of more than 50% in severity and cure (normal cystography on follow up). Hypertension was defined as values persistently above the 95^th^ percentile for age, gender and height on three consecutive visits.
Scar was defined as permanent change in renal outline demonstrated by dimercaptosuccinic acid (DMSA) scintigraphy performed at the age of six months or later in prenatal group and at least six months after infection in the other group. The Scar severity was classified as grade 1 to 4 according to international classification as follows: normal = 0; focal scarring in one region = 1; scarring involving two regions = 2; scarring involving all three regions = 3; and generalized reduction in cortical mass = 4.
The number of confirmed UTI was considered as a prognostic factor. UTI was defined as growth of at least 100,000 colony forming unit/ml in urine obtained by bag, 1000 colonies in catheter sample or any colony in urine obtained by suprapubic aspiration. We considered more than two episodes of infections as recurrent UTI. Neither of specialists that performed radiographic or scintigraphic imaging was aware of the infants\' data.
Data analysis was done by SPSS12 software. Statistical analysis of the differences between groups was determined by χ^2^ and Fisher exact test and Wilcox on signed-rank test. *P*-value \<0.05 was considered statistically significant.
Findings {#S0003}
========
A total of 152 patients was enrolled in the study (70 boys and 82 girls). Sixty seven infants presented with antenatally detected hydro-nephrosis and 85 infants presented with UTI and other complaints after birth.
Demographic and basic clinical features of patients are presented in [Table 1](#T0001){ref-type="table"}. As expected, most of patients of prenatal group were male, whereas the female sex was more common in postnatal group. The reflux severity was slightly higher in postnatal group ([Tables 1](#T0001){ref-type="table"} and [2](#T0002){ref-type="table"}). There were 68 patients with unilateral and 84 patients with bilateral VUR, a total of 236 refluxing renal units were included in analysis, 98 in group 1 and 138 in group 2.
######
Demographic and basic clinical features of patients
Prenatal group Postnatal group *P*-value
------------------------------------------------ -------------- ---------------- ----------------- -----------
**Number of patients** 67 85 NA
**Number of renal units** 98 138 NA
**Sex** **Male (%)** 45 (67.2) 25(70.6) \<0.001
**Female (%)** 22 (32.8) 60(29.4)
**Length of follow up (months) \[Mean (SD)\]** 29.17(19.04) 36.03(18.34) 0.7
NA: not applicable; SD: Standard deviation
######
Severity of reflux in prenatal and postnatal groups
Grade of reflux Prenatal group (%) Postnatal group (%) *P*-value
----------------- -------------------- --------------------- -----------
**One** 4(4) 2(1) 0.03
**Two** 20(20) 41(30)
**Three** 36(37) 60(44)
**Four** 14(14) 20(15)
**Five** 24(25) 15(11)
The average length of follow up was 33±19 (range; 6-94) months with no significant difference between two groups.
Outcome {#S20004}
-------
UTI: There were 16(10.5%) patients with recurrent UTI, four patients of group 1 and 12 infants of group 2. There was no significant difference in the occurrence of recurrent UTI between two groups (*P*=0.1).
Renal scar: Renal scars developed in 46 (19.5%) of renal units including 25 units in group 1 and 21 units in group 2. There was no significant difference between two groups (*P*=0.3). Severity of scar developed in the two groups is shown in [Table 3](#T0003){ref-type="table"}. Somatic growth: At approximately 1 year of age, the mean height-for-age Z score was 0.03 (±1.13) and --0.09 (±1.20) for groups 1 and 2 respectively (*P*=0.5).
######
UTI development, scar severity and reflux resolution in two sex groups
Factor Male Number (%) Female Number (%) *P*-value
----------------------- ---------------- ----------------- ------------------- -----------
**Recurrent UTI** 4 (5.7) 12 (14.6) 0.07
**Scar severity** **Grade0** 81(75) 109(85) 0.1
**Grade1** 10 (9) 8(6)
**Grade2** 3 (3) 5 (4)
**Grade3** 8 (7) 2(2)
**Grade4** 6 (6) 4(3)
**Reflux resolution** **Un-changed** 11(14) 14(11) 0.9
**\<50% improvement** 8(10) 11(9)
**\>50% improvement** 10(13) 17(14)
**Cure** 51(64) 81(66)
UTI: Urinary tract infection
Reflux Resolution: Reflux was | {
"pile_set_name": "PubMed Central"
} |
{.71}
{.72}
{.73}
{.74}
{.75}
{.76}
{.77}
{.78}
{.79}
| {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#sec1-1}
============
According to international registry of heart--lung transplant, the annual cardiac transplant rate worldwide varies between 5000 and 10,000 and this number is expected to increase.\[[@ref1]\] These patients may require anaesthesia for elective or emergency surgery in hospitals where specialised anaesthesiologists may not be available. Therefore, the anaesthesia team must be aware of the physiological effect of denervation, the unique anaesthetic implications of a transplanted heart, potential patient risks such as rejection and infection as well as the effect of immunosuppressants. This review elaborates the anaesthetic management of a post-heart transplant patient who can present for various surgeries. A Medline search for heart transplant, anaesthesia, adult, paediatric and surgery was conducted and 38 relevant literatures are added to this review.
CONDITIONS FOR WHICH A POST-HEART TRANSPLANT PATIENT MAY REQUIRE ANAESTHESIA AND SURGERY {#sec1-2}
========================================================================================
The heart transplant recipient may require surgery for procedures related to the transplant or to non-transplant-associated conditions \[[Table 1](#T1){ref-type="table"}\]. The need for surgery for different problems has been documented from 2 h to \>10 years post-transplant. The incidence of significant general surgical complications developing within the 30-day post-transplant period has been reported between 4.8% and 7%.\[[@ref2]\]
######
Conditions for which a post-heart transplant patient may require anaesthesia and/or surgery
PHYSIOLOGY OF THE TRANSPLANTED HEART {#sec1-3}
====================================
Heart transplant involves the removal of the diseased heart, in which the aorta and main pulmonary arteries (PA) are transected, the cardiac plexus is interrupted, and the heart is partially denervated. The atria of recipients remain innervated, but conduction does not occur across the atrial suture line. In spite of the fact that the transplanted heart is a denervated organ, the intrinsic cardiac mechanisms are preserved. The heart is extremely sensitive to changes in loading conditions, and the Frank-Starling pressure volume relationship becomes paramount in adjusting contractility. It is commonly said to be 'preload dependent' as cardiac output (CO) depends on the venous return. In comparison to normal, the transplanted heart has a higher resting heart rate (HR) (90--110 beats/min), similar maximum HR, higher minimum HR and reduced HR variability in a 24 h Holter monitoring study.\[[@ref3]\] This is due to the absence of parasympathetic innervation. Most of the transplanted heart recipients have normal sinus rhythm with an increased refractory period of the sinus node; thus, many have first-degree heart block and a higher rate of pacemaker implantation. The possible reasons of heart block include biatrial anastomosis, organ rejection, nodal ischaemia and inadequate myocardial preservation.
Clinically, significant atrial and ventricular arrhythmias are infrequent although ectopic beats are common. Presence of fatal ventricular arrhythmias usually indicates severe acute rejection or allograft coronary artery disease.\[[@ref2]\] The resting electrocardiogram (ECG) is usually altered showing two *P* waves; one is from recipients\' own sino-atrial (SA) node and other is from donor\'s SA node. Tachycardia in response to physiological stress, for example, pain and hypovolaemia is blunted as it depends on circulating catecholamines. Carotid sinus massage and Valsalva manoeuvre have no effect on HR.\[[@ref4]\] These patients are at higher risk of developing atrial flutter or fibrillation a few years later. This is because of the onset of some degree of reinnervation. Complete neuronal control has been described 15 years after transplantation. This explains the frequent complaint of angina, vasovagal episodes and cardiac arrest after neostigmine administration in these patients.\[[@ref5]\] Coronary autoregulation remains intact. Immediately after transplant, left ventricular dysfunction is due to anoxic injury during graft transfer, acute withdrawal of sympathetic support or after load mismatch. There is a rapid improvement of ventricular function, and CO becomes normal within few days. The PA pressure and pulmonary capillary wedge pressure remain elevated during the 1^st^-month after transplant and become stable by 1 year. The systemic vascular resistance is frequently elevated; however, a 15% increase in blood volume following transplant may explain the high normal CO through the Frank-Starling mechanism of increasing preload in the setting of cardiac denervation.\[[@ref2]\] There is well-preserved systolic function and mild diastolic dysfunction. Mild-to-moderate mitral and tricuspid valve regurgitation may be present. The myocardial function is subnormal during stress and exercise with a low peak HR, low peak CO and maximum oxygen uptake. This is expected to result from lack of efferent cardiac innervations, either due to HR change alone or together with a submaximal inotropic response.\[[@ref6]\]
PERIOPERATIVE CONSIDERATIONS {#sec1-4}
============================
This can be discussed in the following headings:
Immunosuppressants and their interaction with commonly used drugs in the perioperative period {#sec2-1}
---------------------------------------------------------------------------------------------
The commonly used immunosuppressive agents are cyclosporine A, azathioprine, antilymphocyte globulin, monoclonal antibodies and corticosteroids. Recently, tacrolimus and mycophenolate have replaced cyclosporine and azathioprine, respectively, in some immunosuppression protocols.\[[@ref7]\] The blood level of both cyclosporine and tacrolimus must be kept within the indicated therapeutic range to get the desired effect. The perioperative fluctuation of the plasma level of these two drugs should be strictly monitored as there is a significant reduction of blood level by dilution with volume infusion or cardiopulmonary bypass.\[[@ref8]\] Both these drugs are metabolised by cytochrome P-450 system of liver, and therefore many of the drugs administered perioperatively can affect their plasma levels\[[@ref9][@ref10]\] \[[Table 2](#T2){ref-type="table"}\]. Data on cyclosporine A and tacrolimus interaction with major anaesthetic agents are lacking. Fever, anaemia, leucopenia, thrombocytopenia, hypertension, diabetes, renal dysfunction, neurotoxicity, osteoporosis leading to high rate of fractures and anaphylaxis are some major side effects of immunosuppressants which have some impact on perioperative management and choice of anaesthetic agents. Withdrawal of azathioprine in patients taking warfarin may precipitate bleeding.\[[@ref11]\] Although the exact mechanism is not known, it is assumed that 6-mercaptopurine, a metabolite of azathioprine, induces hepatic microenzymes that metabolise warfarin. Azathioprine and allopurinol combination can lead to serious adverse effects (severe bone marrow suppression, pancreatitis and hepatotoxicity) that can be reduced with close monitoring of metabolites and blood levels.\[[@ref12]\] Prednisone has a similar side effect profile like tacrolimus. However, its action is different because it has anti-inflammatory actions on organ systems. Mycophenolate mofetil has similar efficacy and side effects as azathioprine with the added advantage of lower incidence of fungal infection.\[[@ref13]\] A better understanding of pharmacokinetic changes with age now allows a reduction of dose of immunosupressants in old age while maintaining the therapeutic level.\[[@ref14]\] [Table 3](#T3){ref-type="table"} describes the effect of various anaesthetic agents on immunosupressants and vice versa.
######
Drugs that interact with cyclosporine A and tacrolimus
######
Effect of anaesthetic agents on various chemotherapeutic agents in heart transplant patients and vice versa
Knowledge regarding post-transplant complications and their implications in anaesthetic practice {#sec2-2}
------------------------------------------------------------------------------------------------
Apart from the burden of old age and co-morbidities, post-transplant patients have a high incidence of the following problems which need to be identified and managed perioperatively.
Infection: A high incidence of post-operative wound infection is observed in patients receiving tacrolimus. Strict aseptic techniques during handling of such patients, minimum use of indwelling catheters and earliest removal of invasive lines are mandatory. Fungal infection may need prolonged treatment. The patients should receive cytomegalovirus (CMV) negative blood transfusion. Microbiology advice should be strongly sought for prevention as well as strict control of infection. Any infection should be treated preoperatively. It is important to realise that immunocompromised patients may not present with typical signs and symptoms of infection i.e., fever and leucocytosis. A high index of suspicion is essential and microbiological tests can rule out the diagnosis\[[@ref19][@ref20]\]Rejection: Allograft rejection may occur at any time during the post-transplant period, especially with discontinuation of immunosuppressants. Unexplained weight gain, fever, dyspnoea and peripheral oedema are the usual features of rejection. Urgent endocardial biopsy is needed to confirm the diagnosis;\[[@ref21]\] however, a negative biopsy does not exclude rejection. The episodes of acute rejection necessitate, emergency management with increased immunosupression, for example, intravenous (IV) immunoglobulin and plasmapheresis. At times, the patient may need mechanical circulatory support. The presence of any degree of rejection should be ruled out and managed preoperatively, as post-operative morbidity rate is high if it remains untreated before surgery\[[@ref22]\]Allograft vasculopathy: Cardiac allograft vasculopathy is the atherosclerotic obstructive | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
The neural mechanisms that regulate and coordinate breathing and respiratory-related behaviors such as coughing are not well understood. This lack of knowledge hampers elucidation of pathophysiological deficits in airway protection and impedes development of new therapeutic approaches for dystussia that occur with neurological disorders (Suárez et al., [@B80]; McCool, [@B51]). Computational neural network models for breathing and the neurogenesis of cough inferred from *in vivo* experiments have iteratively aided prediction and refinement of hypotheses for further *in vivo* testing (Shannon et al., [@B72], [@B71]; Baekey et al., [@B5]; Rybak et al., [@B67]; Poliaček et al., [@B58]). Such data-driven models, based in part on elements and connectivity inferred from simultaneous extracellular recordings of many brainstem neurons (e.g., Segers et al., [@B68]; Ott et al., [@B55]), have largely been evaluated in either open loop conditions or with feedback of lung volume simply represented as a filtered version of the motor output (Lindsey et al., [@B44]). While useful, these approaches have precluded model-based assessment of the potential influence of mechanical properties of the musculoskeletal system on respiratory motor pattern generation and cough effectiveness (Smith et al., [@B78]). More generally, neuromechanical models can provide a framework for estimating and predicting the extent to which motor patterns are constrained and influenced by mechanical properties and muscle synergies (Chiel et al., [@B15]).
A model that relates a respiratory neural output to mechanical outputs has been available for some time (Riddle and Younes, [@B63]; Younes and Riddle, [@B84]; Younes et al., [@B85]) and remains an important element in contemporary models of the respiratory system (Cheng et al., [@B13]; Cheng and Khoo, [@B14]). However, the Younes--Riddle model with its single inspiratory neural output and single state variable (lung volume) lacks features essential for model-based assessment of the respective contributions and interactions of neural and biomechanical mechanisms during cough. We have developed a respiratory neural network model with inspiratory (phrenic), expiratory (lumbar), and laryngeal neural outputs and required a mechanical model with corresponding inputs to control the abdominal, diaphragm, and laryngeal muscles. Moreover, it is well known that a given lung volume can be achieved with different configurations of the rib cage and abdomen (Konno and Mead, [@B39]; Younes and Riddle, [@B84]), and with separate neural control of the diaphragm and abdominal wall muscles as in our network model, all of these configurations can potentially be achieved. Thus, the first aim of the work reported here was to develop a model of the mechanical respiratory system that includes separate muscle models for the diaphragm, abdominal wall, and larynx, and two state variables to represent the thoracoabdominal configuration.
Our second aim was to link the resulting mechanical subsystem to an enhanced integrate and fire (IF) neural network model of the brainstem network for respiratory motor pattern generation and to assess the integrated system's behavior with muscle activation parameters for eupneic conditions. A third related objective was to extend the simulations to include evoked coughs in order to evaluate the model's performance in response to defined perturbations that enhance or reduce inspiratory drive. This latter goal was motivated in part by evidence that changes in the inspiratory or "operating" volume can influence airflow during the expulsive phase of the cough (Smith et al., [@B78]).
An additional impetus for the third aim came from results of recent model simulations, which suggested that elevated systemic arterial blood pressure -- such as may occur during coughing (Sharpey-Schafer, [@B74]) -- attenuates cough inspiratory drive, a result supported by coordinated *in vivo* experiments (Poliaček et al., [@B58]). The network model used in the present work builds upon that and other recent prior efforts (Rybak et al., [@B67]). The network incorporates multiple circuit paths and operations for tuning inspiratory drive that have been inferred from spike train cross-correlation feature sets (Lindsey et al., [@B43]; Shannon et al., [@B71]; Segers et al., [@B68]; Ott et al., [@B55]). These circuits include parallel channels for modulation of inspiratory phase activity in "tonic" expiratory neurons that inhibit premotor inspiratory bulbospinal neurons and drive.
In the course of sequentially eliminating sources of inspiratory drive for cough in the neuromechanical model, we also noted a contribution of tonic expiratory neuron activity to modulation of inspiratory phase drive during cough. This disinhibitory regulation predicted from the modeling results was subsequently supported by an analysis of *in vivo* data as described in a companion report (Segers et al., [@B69]).
Materials and Methods
=====================
Neural circuit components were derived from previously described respiratory network models of discrete "IF" populations after MacGregor ([@B47]) and a "hybrid IF burster" population with Hodgkin--Huxley style equations after Breen et al. ([@B12]). These models were developed iteratively with *in vivo* experiments that both guided model development and tested model predictions, as detailed in Rybak et al. ([@B67]) and Poliaček et al. ([@B58]). The enhanced network model used herein is described further in the Results.
Biomechanical model elements were developed using parameters derived from published work as described in Results. Of particular importance was the work of Grassino et al. ([@B26]), who measured transdiaphragmatic pressure and diaphragm activation while controlling the thoracoabdominal configuration, making it possible to estimate the effect of rib cage motion on the abdominal volume. Our abdominal wall model is based on measurements of the curvature of the abdomen by Song et al. ([@B79]) taken during insufflation for laparoscopic surgery. The rib cage, lung, and diaphragm volumes are derived from the measurements of Cluzel et al. ([@B17]), who measured them from MRI's. The thoracoabdominal configuration at extreme and resting supine lung volumes are from Konno and Mead ([@B39]).
Models were implemented using a program package written in the C language for the UNIX environment. Simulations were run on 64-bit Intel multiprocessor-based computers under the Linux operating system. The GNU Scientific Library was used to solve the differential equations of the biomechanical model, to find the roots of the implicit model equations, to do the abdominal volume integration, and for a spline approximation of the abdominal volume function.
For each condition of the linked neural network and biomechanical model, four trials were run with different random number seeds for the stochastic network model. A pairwise two-sided *t*-test with non-pooled SD was used for each variable, and the *p*-values were adjusted for multiple testing (Holm, [@B32]). A difference was considered significant if the adjusted *p*-value was less than 0.05.
Results
=======
The results are presented in two main parts. Section ["Mechanical Model Implementation: Respiratory Muscles, Chest Wall, and Lungs"](#s1){ref-type="sec"} details the biomechanical model. Section ["Brainstem Network Model Architecture and System Performance When Linked to the Biomechanical Model"](#s2){ref-type="sec"} describes the linkage between the biomechanical and neural network models and neuromechanical system behavior during various perturbations of the network.
Mechanical model implementation: Respiratory muscles, chest wall, and lungs {#s1}
---------------------------------------------------------------------------
The biomechanical model described below converts respiratory neural outputs in the form of spike trains representing lumbar, phrenic, expiratory laryngeal, and inspiratory laryngeal motor neuron activity generated by a stochastic model of the brainstem respiratory network deterministically into mechanical outputs such as lung volume, tracheal flow, and alveolar pressure for a supine male human. Lung volume is fed back to the network model to simulate pulmonary stretch receptors. The mechanical model components include (i) three-element Hill muscle models of the diaphragm and abdominal muscles (Hill, [@B31]), (ii) a model of the larynx based on the results of Tully et al. ([@B81], [@B82]) and Rohrer's ([@B65]) equation, and (iii) lung/diaphragm/ribcage/abdomen volume relationships modeled on the data of Grassino et al. ([@B26]) and the analysis of Mead and Loring ([@B52]).
The first two equations represent the entire mechanical model. Each term is a function of the motor outputs of the network model (*u*~di~, *u*~ab~, and *u*~lm~), and the diaphragm and abdominal wall volumes (*V*~di~ and *V*~ab~) and their time derivatives ($\overset{˙}{V}$~di~ and $\overset{˙}{V}$~ab~), and is defined by the subsequent equations. The parameters referenced in the model equations are listed in Table [1](#T1){ref-type="table"}.
######
**Parameters used in the biomechanical model**.
Parameter Definition Value Units Source
--------------------------------------------------------- --------------------------------------------------------------------------------------------------- -------- --------------- ---------------------------------------------------------------------------------------------
**FREE PARAMETERS USED IN THE MODEL**
*C*~1~ Rib cage contribution to abdominal volume 0.369 Dimensionless Derived from Grassino et al. ([@B26])
*C*~ab~ Compliance of the abdominal wall | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-vaccines-07-00065}
===============
Pertussis is a globally endemic and highly infectious disease that can cause respiratory, nutritional and neurological complications, and death \[[@B1-vaccines-07-00065]\]. Infants and young children have the highest risk of pertussis sequelae and death during the window of vulnerability (between birth and the first infant pertussis vaccination) \[[@B2-vaccines-07-00065]\]. Since the introduction of whole-cell pertussis vaccines (wP) in the 1940s, global pertussis-related morbidity and mortality have decreased substantially, particularly in high-income countries \[[@B3-vaccines-07-00065]\]. However, despite vaccination, an estimated 16 million pertussis cases and 195,000 child deaths occur globally every year, with the greatest burden in low and middle-income countries \[[@B4-vaccines-07-00065]\]. Furthermore, many high-income countries with high and stable vaccination rates, such as New Zealand, Australia and the United States, have increasing pertussis burden and regular epidemics are not being prevented \[[@B1-vaccines-07-00065]\].
Acellular pertussis vaccines (aP) are now used instead of wP vaccines in most high-income countries. In comparison to wP vaccines, aP vaccines are less reactogenic, yet have a lower effectiveness \[[@B5-vaccines-07-00065],[@B6-vaccines-07-00065],[@B7-vaccines-07-00065],[@B8-vaccines-07-00065]\]. Estimates of aP vaccine effectiveness (VE) vary substantially with age, number of doses, outcome (hospitalisation/non-hospitalised notification/all cases), local epidemiology and health care service policies. For example, a New Zealand nested case-control study estimated a 93% VE against pertussis hospitalisation in the first year of life for a three-dose primary pertussis vaccination series (DTaP, Infanrix^®^-Hexa, GlaxoSmithKline, Rixensart, Belgium) \[[@B9-vaccines-07-00065]\]. However, an Australian case-control study estimated 85% VE against pertussis hospitalisation in the first year of life for a three-dose primary pertussis vaccination series (DTaP combination vaccines, GlaxoSmithKline, Rixensart, Belgium) \[[@B10-vaccines-07-00065]\]. Both studies used national-level registry data but the lower VE in the Australian study may in part be due to the high polymerase chain reaction (PCR) testing for *Bordetella pertussis* in Australian health services compared with New Zealand \[[@B9-vaccines-07-00065]\]. As aggressive PCR testing for pertussis is not commonplace, it is likely that aP VE is lower than previously reported by observational studies. It follows that pertussis vaccination failure may be more common, particularly because aP are known to attenuate clinical presentation making vaccinated individuals more difficult to diagnose with pertussis \[[@B11-vaccines-07-00065],[@B12-vaccines-07-00065],[@B13-vaccines-07-00065]\]. AP vaccines likely have a multimodal model of failure (leaky, primary and secondary) and are known to protect best against morbidity and mortality early in life \[[@B14-vaccines-07-00065]\]. As such, in the 0--4 age group, the VE of a three-dose aP primary series is highest against pertussis hospitalisation in infants less than one-year-old (93%) and lowest against non-hospitalised notifications in three-year-olds (84%) \[[@B9-vaccines-07-00065]\].
Pertussis vaccination failure is the occurrence of pertussis, caused by *B. pertussis* in an individual vaccinated in accordance with the national immunisation schedule \[[@B15-vaccines-07-00065]\]. When applied to maternal pertussis vaccination in pregnancy, pertussis vaccination failure is understood as pertussis occurring in her infant within the first six weeks of life (before the infant's first pertussis vaccination). Vaccination failure is a complex concept and has four broad categories of causes: Vaccinee-related (e.g., immunocompromise), schedule-related (e.g., poor timing and number of doses recommended), vaccine-related (e.g., poor coverage of pathogen strains or serotypes), and usage-related (e.g., cold chain storage failure, suboptimal administration) \[[@B15-vaccines-07-00065]\]. Pertussis vaccination failure requires two conditions: Suboptimal vaccine-induced protection and exposure to *B. pertussis*. One risk factor may increase the risk of one or both conditions. Studies of pneumococcal and varicella vaccination failure have begun by investigating known risk factors for pneumococcal and varicella; we share this approach \[[@B16-vaccines-07-00065],[@B17-vaccines-07-00065]\].
Risk factors for pertussis disease have been outlined previously, although risk factors for pertussis vaccination failure is an area of little prior research \[[@B18-vaccines-07-00065],[@B19-vaccines-07-00065],[@B20-vaccines-07-00065],[@B21-vaccines-07-00065],[@B22-vaccines-07-00065],[@B23-vaccines-07-00065],[@B24-vaccines-07-00065],[@B25-vaccines-07-00065],[@B26-vaccines-07-00065]\]. A number of factors have been associated with susceptibility to *B. pertussis* infection and disease; a brief and nonexclusive list includes low birth weight, prematurity, asthma, immunocompromised conditions and socioeconomic deprivation \[[@B18-vaccines-07-00065],[@B19-vaccines-07-00065],[@B20-vaccines-07-00065],[@B21-vaccines-07-00065],[@B22-vaccines-07-00065],[@B23-vaccines-07-00065],[@B24-vaccines-07-00065],[@B25-vaccines-07-00065],[@B26-vaccines-07-00065]\]. The literature on pertussis vaccination failure is limited and is almost exclusively published from the Niakhar Studies and Senegal Pertussis Trials \[[@B27-vaccines-07-00065],[@B28-vaccines-07-00065],[@B29-vaccines-07-00065],[@B30-vaccines-07-00065]\]. The context of these findings (lower middle income country) likely do not fully apply to high-income countries \[[@B29-vaccines-07-00065],[@B30-vaccines-07-00065]\]. The risk factors reported for pertussis vaccination failure from the Senegal Pertussis Trial included high birth rank, underweight and stunting \[[@B29-vaccines-07-00065],[@B30-vaccines-07-00065]\].
Vaccine-related reasons for failure are dealt with by extensive ongoing biomedical and pharmaceutical research efforts \[[@B31-vaccines-07-00065],[@B32-vaccines-07-00065],[@B33-vaccines-07-00065],[@B34-vaccines-07-00065],[@B35-vaccines-07-00065]\]. Therefore, a strategic use of resources is to focus on improving the effectiveness of current aP vaccines through changes to the national immunisation schedule \[[@B36-vaccines-07-00065]\]. Limited consideration has been given to biological and social variations in vaccinee circumstances and their interaction with national immunisation schedules that may contribute to vaccination failure. This study pursues an understanding of pertussis vaccination failure in relation to New Zealand′s current national immunisation schedule.
To our knowledge, no studies have investigated pertussis vaccination failure in a high-income country. The main aim of this study is to describe pertussis vaccination failure cases and investigate candidate risk factors for pertussis vaccination failure in the New Zealand context. The identification of risk factors and subsequently higher risk groups is an important step in manipulating the national immunisation schedule for better protection of vulnerable groups; one that aligns with public health goals such as maximising overall health and reducing disparities between groups.
2. Materials and Methods {#sec2-vaccines-07-00065}
========================
The Health and Disability Ethics Committees (a national-level committee) waived the need for ethics approval (17 January 2017). However, this study received approval from the University of Auckland Human Participants Ethics Committee (UAHPEC) (reference number 018664) on 31 March 2017. Minor amendments to the original UAHPEC application were approved by UAHPEC on 19 December 2017 (reference number 018664).
The research questions for this study are: What evidence is there for risk factors of pertussis vaccination failure? (a)Between birth and first pertussis immunisation in infants born to mothers who received maternal pertussis vaccination during their pregnancy;(b)in fully vaccinated infants and young children before their four-year pertussis booster;
In order to answer these questions, this study has two components and four sub-studies (see [Figure 1](#vaccines-07-00065-f001){ref-type="fig"}).
Study objectives:(1)Describe infants born to mothers Tdap vaccinated during pregnancy with pertussis disease before their first pertussis vaccination | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Regenerative myogenesis has emerged as arguably one of the most powerful paradigms to investigate a variety of processes involving stem cells and tissuegenesis. Adult skeletal muscle satellite (stem) cells emerge from a proliferative population of myogenic cells that reversibly exit the cell cycle asynchronously during perinatal growth.^[@CR1],[@CR2]^ They are located between muscle fibres and the basement membrane ensheathing it and since their initial identification in the frog,^[@CR3]^ genetic and cell lineage strategies led to detailed analysis of their properties. Notably, critical regulators of quiescence, commitment and self-renewal have been identified, while exposing underlying heterogeneities in myogenic cell states.^[@CR1],[@CR4]^
In vertebrates, genetic and embryological studies have shown that the bHLH myogenic regulatory factors (MRFs) *Myf5*, *Mrf4*, *Myod* and *Myogenin* have crucial roles in governing striated muscle cell fate and differentiation. Mice triple mutant for *Myf5*, *Myod* and *Mrf4* lack skeletal muscles and their progenitors pointing to these genes as critical determination factors, whereas *Myogenin* and *Mrf4* act during differentiation.^[@CR4]--[@CR7]^ In the adult, *Myf5* is expressed in quiescent and activated satellite cells,^[@CR8]^ whereas MYOD protein expression is a hallmark of an activated satellite cell.^[@CR4]--[@CR6]^ Upstream transcription factors include *Pax3*, *Tbx1*, *Six1/4* and *Pitx2* and they act in different locations in the embryo to establish the founder muscle stem cell population.^[@CR9]^ The properties of the paraxial mesoderm from which head and body muscles arise are also different. All body muscles and some located in the head arise from transient structures called somites, and these are under the regulation of the paired/homeobox transcription factors *Pax3* in the embryo, and later, *Pax7*.^[@CR10],[@CR11]^ In contrast, head muscles are derived from cranial paraxial mesoderm and are *Pax3*-independent, but regulated in the embryo by *Tbx1* and *Pitx2* among other genes.^[@CR9],[@CR12]^ From mid-embryonic stages, virtually all stem/progenitor cells throughout the body are marked by *Pax7* expression. These cell-intrinsic differences observed during embryogenesis occur in the context of a heterogeneous extrinsic milieu. Indeed, an important consideration is the role of stromal cells that constitute the stem cell niche, and that also arise from distinct embryological origins in the head and the body. Their impact on muscle stem/progenitor cell fates remains largely unexplored. Some of these issues will be discussed in this review.
The interplay between satellite and stromal cells in skeletal muscle {#Sec2}
====================================================================
Although fewer studies have focused on the role of interstitial cells (Fig. [1](#Fig1){ref-type="fig"}), their critical roles in homoeostasis and regeneration has been highlighted in several reports. For example, fibroadipogenic progenitors (FAPs) promote myoblast differentiation and participate in fibrosis following muscle damage.^[@CR13],[@CR14]^ Another cell type, called PICs (Pw1 + interstitial cell) was also identified as residing outside the basement membrane of the muscle fibre. *Pw1* is an imprinted gene that is involved in stress regulation.^[@CR15],[@CR16]^ The transplantation of PICs into injured muscle results in their contribution to regenerating fibres.^[@CR16]^ Mesoangioblasts that are associated with blood vessels were also reported to contribute to skeletal muscles.^[@CR17]^ Interestingly, mesoangioblasts isolated from mouse, dog and human express high levels of *Pw1*, where this gene was shown to confer the myogenic potential of mesoangioblasts, and their ability to cross the vessel wall.^[@CR18]^ Recently, an interstitial cell type that is marked by the basic-Helix-loop-Helix transcription factor *Twist2* (*Dermo1*), was reported to be *Pax7*-negative during homoeostasis and following muscle injury.^[@CR19]^ Intriguingly, these cells contribute specifically to type IIb/x myofibres during adulthood and muscle regeneration, and their genetic ablation causes wasting of type IIb (fast glycolytic) myofibres.^[@CR19]^ How these different cell types are related to so-called "mesenchymal stem cells" remains obscure. FAPs can be isolated by cytometry using PDGFRα/Sca1^[@CR20]^ whereas PICs (PW1+/PDGFRα− fraction with myogenic capacity) were reported to be a sub-population of interstitial cells.^[@CR21]^ As the field tries to resolve these different cell types further, it is interesting to note that a detailed study of mesenchymal "stem" cells pointed to a substantial heterogeneity in this population depending on their tissue of origin,^[@CR22]^ therefore a concerted effort is clearly needed to further characterise stromal cells in different tissues and address the potentially misleading designation of stromal cells generically as "mesenchymal stem cells". Given these findings, and the potential misappropriation of cell populations, single cell mass spectrometry and single cell RNAseq of the entire muscle resident cell population was done to resolve some of these discrepancies.^[@CR23]^ Of note a total of 10 different cell types were identified, including known populations (satellite cells, FAPs, endothelial cells, etc) and previously uncharacterised resident tenocyte-like cells and smooth muscle/mesenchymal cells with myogenic potential were identified.^[@CR23]^Fig. 1The satellite cell and stromal cell niche. Satellite cells states are regulated through their interactions with their microenvironment. While direct interactions (M-cadherin, Notch pathway)^[@CR38],[@CR46]^ and communication (FGF2-FGFR1 pathway)^[@CR48]^ between muscle fibres and satellite cells have been identified, muscle stem cells also interact with a variety of components of the extracellular matrix (e.g. Collagens VI and V, Laminin, Fibronectin, SDC3/4)^[@CR45],[@CR79]^ and diffusable cytokines and growth factors (e.g. Angiopoietin-Tie2 receptor)^[@CR37]^. In addition to satellite cells, several cell types contribute to muscle growth, homoeostasis and regeneration, including pericytes, mesenchymal stromal cells (e.g. Pw1+ Interstitial Cells, FibroAdipogenic Progenitors, Twist2+ cells)^[@CR16],[@CR19],[@CR21]^, immune cells (e.g. resident or infiltrating macrophages)^[@CR156]^ as well as connective tissue cells. These interactions are remodelled during ageing, notably with increased FGF2 production from muscle fibres and decreased expression of FGFR1 in satellite cells, driving satellite cells to break quiescence^[@CR39]^, and decreased levels of fibronectin^[@CR45]^, which weakens satellite cell adhesion capacity and increases their susceptibility to apoptosis by anoikis
More detailed studies on FAPs have shown that TNFα-mediated apoptosis of this population is critical for normal regeneration. During chronic injury, as with dystrophic *mdx* mice, continued expression of transforming growth factor β1 (TGF β1) results in persistence of FAPs and fibrosis. Pharmacological inhibition with the tyrosine kinase inhibitor Nilotinib, which has potent antifibrotic activity, blocks TGF β1 activity and results in reduced fibrosis.^[@CR20]^ However, Nilotinib treatment also blocks expansion of FAPs and compromises regeneration through a non-cell-autonomous anti-proliferative effect on satellite cells.^[@CR24]^ These studies and others cited below highlight the dynamic nature of regeneration, and the importance of determining when to intervene for a desired outcome.
Stromal cells that have myogenic capacity have been considerably less well characterised compared to satellite cells, and their contributions to muscle or self-renewal into a satellite cell position are limited, or not demonstrated, compared to bona fide satellite cells. Significantly, elimination of satellite cells by selective diphtheria toxin ablation results in failed regeneration,^[@CR25]--[@CR27]^ indicating that in the short term, non-satellite cells do not contribute to muscle regeneration. Similar ablation studies should be extended to all interstitial cell types.
It is interesting to note that satellite cells have significantly distinct genetic requirements in different anatomical locations as indicated above (e.g. *Tbx1/Pitx2* in head; *Pax3* in body). It is therefore likely that stromal cells, which can be of mesodermal or neural crest origin, might impact differentially on the fate of myogenic cells in relation to their anatomical location.^[@CR4]^ Importantly, emerging satellite cells continue to proliferate until about 2 weeks postnatally, yet they are ensheathed under a basement membrane from mid-late foetal stages.^[@CR1],[@CR28]^ Therefore, contact with extracellular matrix proteins in the basal lamina of the basement membrane is not sufficient to trigger cell cycle exit. In addition, enseathment under the basal lamina results in pre-quiescent and post-quiescent satellite cells being physically separated from stromal cells and in contact only with the myofibre, until its disruption following injury (Fig. [2](#Fig2){ref-type="fig"}). How sporadic interactions with stromal cells prior to this confinement affect the fate of myogenic cells is an open question. Given that the transcriptome profiles of *Pax7*+ myogenic cells change significantly during prenatal and postnatal development,^[@CR29]--[@CR31]^ stem cell and niche cell interactions need to be explored further in different contexts when direct satellite and niche cell contacts can occur (Fig. [2](#Fig2){ref | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Perinatal mortality in the Netherlands
--------------------------------------
Perinatal mortality and morbidity in the Netherlands is relatively high compared to other countries in Europe, shown by Peristat I (data of 1999) \[[@B1]\] and Peristat II (data of 2004) \[[@B2]-[@B4]\]. Initiated by the Dutch Minister of Health, a Committee Project group Pregnancy and Birth was started in 2008, just after publication of Peristat II. The main goal was to improve quality of obstetric care in the Netherlands. Beside several implementations such as regional Obstetric Cooperatives and the Dutch Perinatal Audit, a nation-wide research programme on pregnancy and birth of the Netherlands Organization for Health, Research and Development (ZonMw) was developed. Recently, the data of the third Euro-Perinatal European Perinatal Health Report (data of 2010) were launched \[[@B5]\]. Perinatal mortality in the Netherlands has declined with 14% between 2004 and 2010, however the current mortality rate still represents a poor international position, which is even more remarkable considering that the Netherlands was ranked second highest in Europe concerning welfare \[[@B6]\]. In 2004, the Netherlands featured the third highest perinatal mortality (out of 26 countries). In 2010, the Netherlands ranked the sixth highest perinatal mortality out of 29 European countries. The perinatal mortality in the Netherlands should decrease faster than in other European countries in order to be ranked in the top.
Dutch system
------------
The Netherlands has an estimated population of 16.7 million. In the Netherlands, around 175,000 children are born yearly, of which around 1,500 babies die (perinatal mortality). Obstetric care is organised in low-risk primary care, medium-risk secondary, and high-risk tertiary care (Figure [1](#F1){ref-type="fig"}). Primary care concerning low-risk pregnancies is represented by independent midwives (and general practitioners). A low-risk pregnant woman has the possibility of planning her delivery either at home or in a primary care hospital setting, both under responsibility of her own independent midwife. The Netherlands has a high rate of home delivery, although rate is declining from 26% home deliveries in 2007 to 15.6% in 2012 \[[@B7]\]. Secondary care is regionally organised in 92 hospitals of which 10 hospitals provide tertiary care in a perinatology centre facilitating a Neonatal Intensive Care Unit (NICU) and an Obstetric High Care unit (OHC). Secondary and tertiary care is provided by obstetric nurses, secondary care (hospital) midwives, residents and obstetricians, working together in teams. During pregnancy and/or delivery a pregnant woman may evolve from low-risk to medium- or high-risk, followed by a referral from primary to secondary or tertiary care. Indications for referral are defined in the 'Obstetric Indication List' \[[@B8]\]. Perinatal data of 2007 show a huge shift between primary and secondary/tertiary care: the intention (42%) and reality (26%) to deliver at home, the intention (42%) and reality (16%) to deliver in primary care in hospital, and the intention (16%) and reality (61%) to deliver in secondary care in hospital \[[@B9]-[@B14]\]. This shift between primary and secondary care is getting more extensive when interpreting recent perinatal data of 2012: about 85% of pregnancies starts in primary care and 15% in secondary/tertiary care. Finally, 30% will give birth in primary care and 70% in secondary/tertiary care. This means that about 65% of all pregnancies will be referred from primary to secondary/tertiary care, during pregnancy or delivery \[[@B7]\]. This extensive shift between the different care levels results in multiple medical handovers, potentially causing errors in communication and process management.
{#F1}
Risk of home delivery
---------------------
A recent Dutch study showed a higher risk of delivery related perinatal mortality among women with planned delivery in primary care (at home or in hospital) compared to women who started delivery in secondary care. An even higher risk of perinatal mortality was found in women who were referred from primary to secondary care during delivery \[[@B15]\]. Another Dutch study did not find a significant difference between a planned home and hospital delivery among low-risk women in primary care \[[@B16]\]. However, the results of these two Dutch studies cannot be compared because different groups and different comparisons were studied: the first study compared planned primary care delivery with planned secondary care delivery while the second study compared planned home delivery with planned hospital delivery in primary care. The British Birthplace cohort study concluded that nulliparous low risk women with a planned home delivery have an increased incidence of adverse perinatal outcome. For multiparous women, there were no significant differences in adverse perinatal outcome by planned place of birth. Interventions during delivery were substantially lower in all non-obstetric unit settings \[[@B17]\].
Causes of perinatal death
-------------------------
Analysis of Dutch data showed that 85.2% of perinatal mortality is caused by one or more of the four following disorders, together the so called Big 4: small for gestational age (SGA: birth weight below 10^th^ percentile), preterm delivery before 37 weeks of gestation, congenital anomaly and low Apgar score (Apgar score below 7). Big 4 disorders are overlapping each other often, creating a multiple diagnosis. Accumulation of Big 4 disorders obviously increases mortality rate. The group with exclusively one Big 4 disorder causing perinatal death is small. Of all pregnancies, 16.3% represents a Big 4 disorder. Of all Big 4 pregnancies, 29% starts delivery in primary care. This indicates that risk selection is inadequate. \[[@B9],[@B18]-[@B20]\]. These data suggest that evaluation and improvement of process management of pregnancies complicated by a Big 4 disorder will be beneficial for perinatal outcome.
Process parameters and communication audit
------------------------------------------
Analysis of all term perinatal death cases in 2010 by the Dutch Perinatal Audit revealed one or more substandard factors (SSF) in 52% of the cases. In 56% of the cases with SSF, multiple care providers were involved. In 44% of the cases with SSF there was a possible or (very) probable relation with perinatal death. International research described a possible or (very) probable relation with perinatal death in 25-30% of all perinatal death cases with substandard care \[[@B21]\]. The Dutch Perinatal Audit has recommended the following: develop uniform care paths, focus on standardised communication and handovers based on the SBAR system (Situation, Background, Assessment, Recommendation), and organise team trainings \[[@B22]\]. It has become clear that within the entire obstetric collaborative network process parameters can be improved. Communication between obstetric care providers within one discipline as well as between different disciplines is important to guarantee an optimal referral process. Moreover, adequate and uniform communication towards the patient (and partner) is important for positive perception \[[@B9],[@B18],[@B22]\].
Quality of care as perceived by patients
----------------------------------------
During the last decade, there has been growing interest in quality of care as perceived by patients. With increasing attention to patient-centered care, indicators of care quality more and more involve perceived quality of care and patient satisfaction \[[@B23]-[@B26]\]. Measuring patient-reported outcomes is a common strategy used to monitor quality of care in a number of countries. Because of the unique obstetric care system in the Netherlands with different care levels, pregnant women often see different care providers \[[@B27]\]. Recently published data showed that patients who had been referred from primary to secondary care report lower quality of care \[[@B28]\]. These patients received care in more than one institution, from several care providers. Referral during pregnancy and delivery may have a negative effect on a systematic way of communication towards the patients and might cause inconsistency in advice, information, and protocols \[[@B28]\].
Simulation-based team training
------------------------------
Team training in obstetric emergencies reduces poor perinatal outcome as was shown by a British retrospective cohort study \[[@B29]\]. Recently, a systematic review has concluded that medical simulation is effective for medical education \[[@B30]\]. A meta-analysis showed that simulation-based medical education (SBME) with deliberate practice (DP) is superior in improving medical skills to traditional clinical medical education such as the Halstedian approach (see one, do one, teach one) \[[@B31]\]. DP reflects a life-long period of deliberate effort to improve performance in a specific domain. There are nine elements of DP: 1) high motivation and concentration, 2) well-defined learning objects, 3) appropriate level of difficulty, 4) focused, repetitive practice, 5) rigorous, reliable measurements, 6) feedback, 7) monitoring, error correction, 8) evaluation and performance that may reach a master standard, 9) advancement to the next task \[[@B32]\]. Crew resource management (CRM) has been defined as 'error management capability to detect, avoid, trap or mitigate the effects of human error and therefore prevent fatal accidents'. It was developed primarily for improving air safety \[[@B33]\]. CRM is a training system that focuses on interpersonal communication, leadership and decision-making. It focuses on the ability of each team member to see, analyse and react, and thereby reducing potential errors. It pursues an open culture where the freedom to respectfully question authority is encouraged. Learning goals of CRM are: enhanced situational awareness, self-awareness, leadership, assertiveness, decision-making, flexibility, adaptability and communication. CRM in team training has shown to improve those competences and results in a positive attitude of | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .186}
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Chemical molecules, especially volatile ones, are the vessel of crucial information that may determine an animal's eventual survival and reproductive success. Perhaps for this reason, the sense of chemoreception is ubiquitously represented in the animal kingdom (Ache and Young, [@B2]). The role of the olfactory system is to decode the complex eddies of molecules in the environment and shape them into pieces of relevant information that will allow the animal to make decisions and engage in adapted behaviors. Major tasks of the olfactory system are for instance the identification of food sources, the detection of possible dangers (such as fire or predators), the recognition of potential mates as well as allowing social interactions. How the nervous system operates this transformation from the detection of chemical molecules via the formation of neural representations until the creation of percepts has been the focus of intense research especially in vertebrates (Lledo et al., [@B134]; Mori et al., [@B148]; Leon and Johnson, [@B131]; Mandairon and Linster, [@B135]) and in insects (Galizia and Menzel, [@B64]; Laurent, [@B129]; Galizia, [@B60]; Masse et al., [@B137]). A general finding of these studies is that the basic rules underlying olfactory processing in these different classes of animals are highly similar (Hildebrand and Shepherd, [@B96]; Ache and Young, [@B2]). For the most part, this resemblance is thought to result from evolutionary convergence due to similar constraints (Eisthen, [@B45]).
Olfaction consists in a series of transformations from the chemical world of odor molecules into spatiotemporal patterns of neural activity in the animal's brain, eventually giving rise to a perceptual odor representation. Odor molecules exist in a myriad of chemical compositions, three-dimensional shapes, and vibration properties, to name but a few of their characteristics. They cannot be easily described based on simple dimensions like the wavelength and intensity of stimulus light when studying color vision. Therefore, only multiple descriptors can adequately describe an odorant molecule. In olfaction, the first transformation is thus the detection of particular features of the molecules by dedicated receptor (and associated) proteins, leading through a transduction of the signal to the activation of a subset of receptor cells (Touhara and Vosshall, [@B215]). This combinatorial code will then be conveyed to a series of structures in the brain and will undergo intense processing leading to a reformatting of the odor representation that will allow the extraction of the most relevant information for the system (Laurent, [@B129]; Kay and Stopfer, [@B111]). This processing will then give rise to a perceptual representation used for behavioral decision, and may link odor quality with hedonic value and learned relationships between odor and probable outcomes.
For a century now, the honeybee *Apis mellifera* L. has been a key insect model in which behavioral, neuroanatomical, and neurophysiological approaches have been performed to unravel the basis of olfaction and olfactory learning. Honeybees are social insects which present a wide range of behaviors relying on olfaction both within and outside of the colony (Winston, [@B223]; Seeley, [@B194]). Moreover, the study of olfaction is easily amenable to the laboratory, since dedicated protocols have been developed in which bees show rapid and robust odor learning abilities (Menzel, [@B142]; Giurfa, [@B79]). In addition, the olfactory pathway of the honeybee brain has been extensively described (Kenyon, [@B114]; Mobbs, [@B146]; Strausfeld, [@B206]; Kirschner et al., [@B115]) and the bee brain is easily accessible to neurophysiological experiments like electrophysiological or optical imaging recordings (Galizia and Menzel, [@B64]; Sandoz et al., [@B181]). We will discuss in turn these different aspects.
Olfactory Behavior in the Honeybee
==================================
Role of pheromones in social life
---------------------------------
Honeybees employ a rich repertoire of pheromones to ensure intraspecific communication in many behavioral contexts (Free, [@B58]; Slessor et al., [@B199]; Sandoz et al., [@B181]). The social organization of a honeybee colony is determined by chemical signals produced by the queen, but also by workers. Most honeybee pheromones are complex blends of many substances which are most effective when all components are present in appropriate ratios in the blend. The most important pheromonal components, which were sometimes used in olfactory learning experiments, are detailed below.
The queen, the only fertile female in the colony, communicates her presence mostly by means of a mixture of substances released from her mandibular glands. The queen mandibular pheromone (QMP) was originally considered to be a unique substance, 9-oxo-(E)-2-decenoic acid (9-ODA) (Barbier and Lederer, [@B11]; Butler et al., [@B25]), but later studies revealed that the actual pheromone contains several additional components (Slessor et al., [@B198]; Keeling et al., [@B112]). The queen pheromone reinforces social cohesion, by attracting workers and enticing them to groom the queen. It also has a physiological effect on workers, inhibiting their ovarian development (Hoover et al., [@B97]) and modifying gene expression (Grozinger et al., [@B85]). An interesting aspect of this pheromone is that it acts on different receivers. The queen component 9-ODA thus also acts on males (drones) and plays a crucial role for in-flight mating, attracting them from as far as 60 m (Free, [@B58]).
The second major source of pheromones is workers, who perform different tasks depending on their age (Winston, [@B223]). Aggregation pheromones are used by workers to mark and elicit attraction of other workers to important locations (profitable food source, potential nest site, etc.). This pheromone is a complex blend comprising many volatiles among which geraniol and citral are principal components (Pickett et al., [@B167]). On the other hand, alarm pheromones are released when confronting potential enemies (Breed et al., [@B22]). The main alarm pheromone is released near the sting and consists of more than 40 highly volatile compounds, among which the major component isopentyl acetate (IPA; Boch et al., [@B19]; Collins and Blum, [@B30]; Pickett et al., [@B166]). Release of this pheromone attracts other bees and causes them to sting and attack. Another alarm pheromone, 2-heptanone, is released by workers' mandibular glands (Shearer and Boch, [@B195]) and exerts a repellent action on potential intruders and robbers from other hives. Additionally, it is used by foragers to mark recently depleted flowers to avoid immediate revisit (Giurfa and Núñez, [@B81]).
Role of floral odors in food search
-----------------------------------
When reaching 2--3 weeks of age, workers engage in foraging for nectar or pollen outside the hive (Seeley, [@B193]). Honeybees are generalist pollinators and are not bound to a limited number of plants for gathering food. However, at the individual level, they are "flower constant," memorizing the features of a given floral species, and exploiting it as long as profitable (Grant, [@B82]; Chittka et al., [@B29]). Floral cues include color, odor, shape, and texture, but among those, odors play the most prominent role, being most readily associated with nectar or pollen reward (von Frisch, [@B219]; Menzel et al., [@B144]). The scent of a flower is a mixture of many volatile compounds that varies with respect to genotype, stage of development, and local environmental conditions (Pham-Delègue et al., [@B163]; Dobson, [@B40]; Dudareva and Pichersky, [@B42]). Flowers of the same plant may show differences in volatile compounds according to the time of day and with respect to their pollination status (Tollsten and Bergström, [@B214]; Schiestl et al., [@B187]). To maximize their profit from foraging, honeybees have to show good *olfactory discrimination* capacity. In other words, they have to be able to distinguish between fine differences in the volatile emissions of the visited flowers, to choose flowers whose volatile blend indicates good forage (Menzel, [@B141]). Indeed, honeybees are able to differentiate between very subtle differences in odor blends, as for instance between two genotypes of the same species or between flowering stages (Pham-Delègue et al., [@B163]; Wright et al., [@B226]). On the other hand, many of the variations in volatile emissions displayed by flowers are not indicative of any difference in reward quality, and therefore, another key ability is *olfactory generalization*. This ability corresponds to extending a behavior learned for a given stimulus to other, novel, stimuli, which are perceived as different, but sufficiently similar, to the learned one (Shepard, [@B196]). As for many lines of work about honeybee behavior and sensory capacities, both of these abilities were first recognized experimentally by Karl von Frisch. In a pioneering investigation, von Frisch ([@B218]) trained free-flying bees to visit an artificial feeder presenting several essential oils (odor mixtures). Using a set of 32 such odors, von Frisch observed that after learning that one odor was associated with sucrose solution, bees tended to prefer this odor over | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Inflammatory disorders can affect virtually any organ and are a frequent cause of morbidity. Recently, immunotherapies emerged as highly efficient treatments in specific inflammatory diseases. Since their prescription is rapidly increasing, their cost represents a growing burden for healthcare systems. It is therefore highly desirable to guide the use of such expensive therapies by dedicated biomarkers. The high level of glucose consumption during inflammatory processes has prompted the use of 2-deoxy-2-\[^18^F\]fluoro-D-glucose (\[^18^F\]FDG) positron emission tomography (PET) in the management of a wide variety of inflammatory disorders^[@CR1]^. \[^18^F\]FDG however suffers from poor specificity since glycolysis is not limited to aseptic inflammation but is also present in infection, cancer and their related inflammatory processes. Recently, the need to develop biomarkers targeting specifically the host immune response in cancer has emerged^[@CR2]^. In addition, \[^18^F\]FDG is avidly taken up by organs such as brain or heart in physiological conditions thereby hampering its diagnostic value.
Inflammation involves surface expression of endothelial adhesion molecules, platelet adhesion and activation of leukocytes resulting in leukocyte transmigration into tissues^[@CR3]--[@CR5]^. An example of such adhesion molecules is the CD31 receptor also known as PECAM-1, a transmembrane homophilic receptor^[@CR6]--[@CR8]^ which is constitutively and exclusively expressed by endothelial cells, platelets and leukocytes. CD31 is highly concentrated at the intercellular junctions between endothelial cells^[@CR9]--[@CR11]^ and plays an important role in the homeostasis of the endothelial barrier function. In addition, CD31 plays a determinant role in the regulation of leukocyte and platelet activation^[@CR12]--[@CR18]^. The extracellular portion of CD31 is organized into six Ig-like domains. Domain 1 mediates the trans-homophilic CD31-CD31 binding when two CD31+ cells interact^[@CR19],[@CR20]^. This trans-homophilic binding induces a cis-homodimerisation of CD31 juxta-membrane portion^[@CR19]^ and triggers a specific inhibitory tyrosine phosphate-dependent signaling through the CD31 cytoplasmic domain. By these mechanisms, CD31 appears as a central regulator of inflammatory responses as it modulates the recruitment and extravasation of immune cells at sites of platelet-coated, inflamed microvessels^[@CR21]^.
Importantly, the CD31-mediated regulation is determined by its molecular integrity. In pro-inflammatory conditions, the CD31 extracellular portion is cleaved so that recently activated cells express a truncated form of CD31 (cleaved CD31). The loss of the trans-homophilic domain of CD31 invalidates its inhibitory function and allows the full activation of cleaved CD31 cells^[@CR16],[@CR22]^.
We hypothesized that the cleaved molecular form of CD31 might be a suitable target for molecular imaging because it is present in large amounts at the surface of the three major cell types at stake at sites of active inflammation (leukocytes, platelets and endothelial cells). To target cleaved CD31, we selected an octapeptide (H-RVFLAPWK-OH) derived from the immunosuppressive CD31 peptide^[@CR23]^ and further engineered as the retro-inverso analogue, i.e. the reverse sequence with D-amino acids^[@CR24]^. The resulting functional mimic of the parent peptide (H-kwpalfvr-OH) is a good ligand candidate because it is stable *in vivo* and it specifically binds to the cleaved cis-homophilic juxta-membrane sequence of the CD31 ectodomain (aa 551--574) common to all cleaved CD31 cells^[@CR22],[@CR24]^.
Herein, we designed and prepared a bioconjugate of D-P8RI coupled to 6-Hydrazinonicotinic acid (HYNIC) as a bifunctional complexing agent for technetium-99m (^99m^Tc)^[@CR25]^. We then assessed the performance of the resulting radiotracer ^99m^Tc-HYNIC-D-P8RI for *in vivo* non-invasive imaging of inflammatory cells in an experimental rat model comparatively to its counterpart with L-Proline (L-P8RI) and to the well-established radiolabeled glucose analogue 2-deoxy-2-\[^18^F\]fluoro-D-glucose (\[^18^F\]FDG) as controls.
Results {#Sec2}
=======
Design, synthesis and physico-chemical characterization of the Tc-labeled D-P8RI {#Sec3}
--------------------------------------------------------------------------------
The bioconjugate radiotracer is composed of (i) the D-P8RI peptide sequence which targets the cleaved CD31 molecular species, (ii) the HYNIC group enabling ^99m^Tc chelation, (iii) a PEG linker between both moieties to reduce steric hindrance, preserve the P8RI binding capacity and maintain hydrophilic properties, and iv) the radioisotope ^99m^Tc for SPECT imaging. Results of the synthesis of HYNIC-D-P8RI are detailed in Supplementary Material (see Fig. [1a](#Fig1){ref-type="fig"} (R = R1) for structural formula, and Fig. [1b](#Fig1){ref-type="fig"} for RP-HPLC profile).Figure 1(**a**) P8RI-based conjugates: HYNIC-D-P8RI (R = R1) and putative structure of its corresponding EDDA complexes after labeling: \[^99m^Tc(HYNIC-D-P8RI)(EDDA)\] (R = R2) and \[^99m^Tc(HYNIC-D-P8RI)(EDDA~2~)\] (R = R3). (**b**--**e**) Optimization of the radiolabeling process. **b** RP-HPLC chromatograms of: HYNIC-D-P8RI (UV detection); (**c**--**e**) ^99m^Tc-HYNIC-D-P8RI (radio detection) using tricine as coligand, EDDA as coligand and tricine/EDDA exchange strategy, respectively. The chemical or radiochemical purity (CP or RCP), as well as the retention time (t~R~) are indicated on each panel.
This peptide derivative was further labeled using different coligands. The profile obtained with tricine was heterogenous and the RCP was \<88% as assessed by RP-HPLC (Fig. [1c](#Fig1){ref-type="fig"}) whereas EDDA and tricine/EDDA exchange labeling yielded a dominant radiolabeled species profile with RCP \<74% and ≥94%, respectively (Fig. [1d,e](#Fig1){ref-type="fig"}). Retention factors (Rf) of radiolabeled HYNIC-D-P8RI evaluated with TLC in the different mobile phases were: Rf = 0 in methylethylketone (MEK) and Anticoagulant Citrate Dextrose Solution (ACD), Rf = 0.8--1 in CH~3~CN/H~2~O (3/2) allowing to estimate radiolabeling yields at 92.6, 71.1, and 95.3% for tricine, EDDA and tricine/EDDA experiments, respectively (data not shown). Radiolabeling impurities found in TLC corresponded to non-peptide bound species such as ^99m^Tc-coligands and ^99m^TcO4^−^, no ^99m^Tc-colloid was detected. The tricine/EDDA exchange labeling strategy was chosen for the following experiments based on the high yield, on the high RCP obtained and the high specific activity over 114 GBq/µmoL.
To identify the coordination state of the complex by MS, ^99^Tc-HYNIC-D-P8RI was prepared using the tricine/EDDA process except that ^99m^Tc was replaced by a larger amount of ^99^Tc. A summary of HPLC/MS analyses is presented (Table [1](#Tab1){ref-type="table"}). When compared with the control unlabeled peptide, the mass spectrum of the labeled conjugate showed an increase of 270 Da and 446 Da, which can be assigned to coexisting Tc complexes coordinated with one and two EDDA, respectively (Fig. [1a](#Fig1){ref-type="fig"}, R = R2, R3). Peptide species containing tricine were not present to any significant degree.Table 1Selected HPLC/MS data for HYNIC-D-P8RI and its corresponding Tc conjugates. Calculated *m/z* values are based on the exact molecular mass using MassLynx calculator (Waters, France). M refers to the unlabeled and uncharged peptide conjugate HYNIC-P8RI.Compound*m/z* calculated*m/z* observedAssignmentHYNIC-D-P8RI1354.7641354.718\[M + H\]^+^\[^99^Tc(HYNIC-D-P8RI)(EDDA)\]1624.7501625.116\[(M + ^99^Tc + EDDA - 5 H) + H\]^+^\[^99^Tc(HYNIC-D-P8RI)(EDDA~2~)\]1800.8301801.226\[(M | {
"pile_set_name": "PubMed Central"
} |
Melioidosis causes severe sepsis and death in the Top End of Northern Australia during the monsoonal wet season.[@bib1] The wet season (melioidosis season) is defined to capture the seasonal presentation in the tropical wet season (November to April),[@bib2] with average monthly rainfalls of 100 to 500 mm in the 6 months ([Figures 1](#fig1){ref-type="fig"} and [Supplementary Figure S1](#appsec1){ref-type="sec"}) and high humidity of \> 80%.[@bib3] Melioidosis is caused by the saprophytic Gram-negative bacterium and Tier 1 select agent *Burkholderia pseudomallei,* which naturally occur in tropical soil and water.[@bib4] *Burkholderia pseudomallei* is widespread in Northern Australia and Southeast Asia and is increasingly recognized as being endemic in other tropical regions globally.[@bib1], [@bib4], [@bib5], [@bib6] The Darwin Prospective Melioidosis Study (DPMS) is a long-running, large, prospective observational study started in October 1989 that aims to understand the clinical and microbiological aspects of melioidosis in the Top End of the Northern Territory (NT), and to use this information to lessen the burden of the disease through earlier diagnosis and improved treatment. The study has documented all cases of melioidosis in the Top End of the NT since 1 October 1989,[@bib7], [@bib8] with around 85% of cases occurring during the tropical wet season (November to April)[@bib2] ([Figure 1](#fig1){ref-type="fig"}).Figure 1Correlation between cases of melioidosis managed at Royal Darwin Hospital in 2009--2010 and rainfall at Darwin airport.Reproduced with permission from Parameswaran U, Baird RW, Ward LM, et al. Melioidosis at Royal Darwin Hospital in the big 2009--2010 wet season: comparison with the preceding 20 years. *Med J Aust.* 2012;196:345--348. Copyright © 2012 The Medical Journal of Australia.
Chronic kidney disease (CKD) is an independent risk factor for melioidosis, and CKD is associated with a higher mortality rate whenever melioidosis occurs.[@bib9], [@bib10] Other factors associated with high risk for melioidosis include diabetes mellitus, hazardous alcohol use, chronic lung disease, rheumatic heart disease and cardiac failure, and immune-suppressive medications, most notably the use of corticosteroids. Age and indigenous ethnicity are also independent predictors for melioidosis. These factors are also common among adult patients dependent on dialysis in this region.[@bib11] In our region, we have previously reported staggering higher incidence rates of melioidosis among adults dependent on dialysis than among those without dialysis-dependent CKD (988.8/100,000 vs. 24.0/100,000 patient-years), equating to a crude relative risk for melioidosis among adults dependent on dialysis of 38.4 (95% confidence interval \[CI\] = 25.7--57.5).[@bib11]
As observed in some previous wet seasons, during the 2011 to 2012 wet season, we observed a higher frequency of melioidosis among the dialysis cohort.[@bib12] Rates of melioidosis are lower among our renal transplant cohort. Our routine practice to specifically mitigate wet season−associated melioidosis for the renal transplant and immunosuppressed cohort includes consideration of trimethoprim+sulfamethoxazole (TMP+SMX) prophylaxis treatment, at a dose higher than usually used for *Pneumocystis jirovecii* pneumonia (PJP) prophylaxis.[@bib13] Pharmacodynamic and pharmacokinetic studies of TMP+SMX for the treatment of melioidosis indicate that high doses of oral TMP+SMX are required for eradication after an initial intensive treatment with i.v. ceftazidime or meropenem.[@bib10], [@bib14], [@bib15], [@bib16], [@bib17], [@bib18] There are no published data on the prophylactic use of TMP+SMX (or any other antibiotics) to reduce melioidosis in high-risk groups, although TMP+SMX has been used as postexposure prophylaxis for *Burkholderia pseudomallei* infection among laboratory staff.[@bib19] Therefore, following the increase in both the number of melioidosis cases observed in the 2011 to 2012 wet season, and the concomitant increase in the size of the prevalent dialysis patient cohort, we undertook a prospective open-label intervention by implementing a prophylaxis guideline for hemodialysis patients in the Top End of the Northern Territory over the wet season (1 November 2014 to 30 April 2015), using oral trimethoprim+sulfamethoxazole (TMP+SMX), 160/800 mg daily.
The aim of this study was to determine the efficacy and safety of prophylaxis with daily TMP+SMX for melioidosis in hemodialysis patients from the Top End of Northern Australia during the wet season from 1 November 2014 to 30 April 2015.
Materials and Methods {#sec1}
=====================
Study Design {#sec1.1}
------------
The study was a prospective, open-label, interventional study carried out as part of the larger Darwin Prospective Melioidosis Study, which documents all cases of melioidosis and treatment in the Top End of the Northern Territory.[@bib20]
Study Population {#sec1.2}
----------------
All patients ≥18 years of age who had been on maintenance hemodialysis for ≥3 months were offered the prophylactic treatment. All eligible hemodialysis patients throughout the Top End received daily TMP+SMX, excluding persons with known hypersensitivity to trimethoprim and/or sulfamethoxazole, lipoamides, or any other ingredients in the formulations of the tablets, severe hepatic failure, marked liver parenchymal damage or jaundice, or serious hematological disorders (thrombocytopenia \< 80,000 platelets/μl, leukopoenia \< 3.5 × 10^9^/l (neutrophil count \< 2.7 × 10^9^), and porphyria, and any other contraindications to TMP+SMX. Those who declined the treatment were also excluded from the prophylaxis treatment. The cohort could therefore be described categorically as those who received the intervention and a control group of those who were ineligible for the intervention (or TMP+SMX-group \[prophylaxis\] vs. nonprophylaxis group).
All patients received the usual wet season advice on melioidosis prevention.[@bib14]
Definitions {#sec1.3}
-----------
Patients' ethnicity was entered as indigenous if they were Aboriginal and/or Torres Strait Islander in their demographical data entry in the clinical records. Abnormal liver function was defined by any rise in liver transaminases and bilirubin. Neutropenia was defined as a neutrophil count of \<2.7 × 10^9^/l and thrombocytopenia as a platelet count of \<150,000 platelets/μl. For the purpose of assessing safety, we also defined categories of thrombocytopenia, based on the protocol that we have developed with platelet counts of \<80,000, ≥80,000 to \<150,000, and ≥150 000, and based on the conventional definition of platelet counts by severity of \<50,000, ≥50,000 to \<150,000, and ≥150 000.
Dosing of Trimethoprim+Sulfamethoxazole {#sec1.4}
---------------------------------------
There were no guidelines for dosing of TMP+SMX for prophylaxis of melioidosis in hemodialysis patients, so we initially used the standard dosage that has been safely used as eradication treatment for persons on a dialysis dose of 1 double-strength tablet of TMP+SMX 160 mg/800 mg once a day.[@bib21] On dialysis days, the patients received the drug after dialysis. All patients on the prophylaxis also received folic acid 5 mg once a day to avoid TMP+SMX−induced folate deficiency.
Treatment Rollout {#sec1.5}
-----------------
All 261 patients who were eligible and were not receiving treatment for melioidosis were offered treatment. The medication rollout was undertaken from 1 November 2014, with the last patient receiving the first dose on 11 January 2015.
Clinical Safety and Laboratory Monitoring {#sec1.6}
-----------------------------------------
The majority of our patients receive hemodialysis within satellite dialysis units at least 3 times a week, achieving a minimum of 12 hours of treatment per week,[@bib22] and have blood tests performed monthly (at the start of every month or whenever clinically indicated) as part of routine care. The renal pharmacist provided in-services to primary dialysis nurses across all dialysis units, who then routinely asked questions of each patient pertaining to any medication complications. Patients were asked to report signs of nausea, vomiting, and skin reactions at each dialysis session and whenever they attended a nephrologist's clinic appointment. Patients concurrently were specifically monitored for the development of neutropenia, thrombocytopenia, and abnormal liver function at each monthly blood test throughout the treatment phase and for another 2 months after completion.
Statistical Analysis {#sec1.7}
--------------------
A descriptive analysis was undertaken. Data are described as frequency and percentage for categorical variables, and continuous data were reported as mean (SD) with 95% CIs for normally distributed data and as median (interquartile range) for data that were not normally distributed. For comparisons, we used a 2-sample Student | {
"pile_set_name": "PubMed Central"
} |
{.89}
{.90}
{.91}
{.92}
{.93}
{.94}
{.95}
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
To obtain system-level descriptions of biological and cellular events, transcriptome profiling, including recent RNA-sequencing approaches,^[@bib1]^ has generated large, unmanageable high-throughput data sets.^[@bib2]^ To make sense of these gene expression data sets, researchers have developed various gene set analysis (GSA) tools, such as DAVID^[@bib3]^ and GSEA,^[@bib4]^ in combination with prior knowledge-based databases, such as the Kyoto Encyclopedia of Genes and Genomes (KEGG),^[@bib5]^ Gene Ontology,^[@bib6]^ BioCarta, PANTHER,^[@bib7]^ MetaCyc,^[@bib8]^ Molecular Signatures Database^[@bib4]^ and RegulonDB.^[@bib9]^
Despite these diligent research efforts, the biologically meaningful interpretation of findings from high-throughput gene expression data remains a bottleneck.^[@bib2]^ The persistence of this congestion arises from the challenge of exploring the complex relationships between cellular components,^[@bib10]^ especially in the context of functional molecular pathways. Pathway information as it relates to a phenotype of interest (for example, a disease) necessarily implies that a key molecular target should be considered within the framework of its network. A network focus enables us to more effectively infer key transcriptional changes related to the specific phenotype by examining multiple downstream (or cross-talk) effectors of the target. However, the current GSA^[@bib11]^ tools utilize over-representation analysis,^[@bib12]^ which reports the enrichment of functional groups (for example, gene sets) for the genes of interest. They compromise the connectivity in favor of computational simplicity that is based on cellular components and not their connectivity.^[@bib3],[@bib4]^ In other words, current tools do not analyze the wiring diagram of the interactions (for example, activation, inhibition) in a functional molecular network.^[@bib13]^
We have developed PATHOME (*path*way and transcript*ome* information), a novel computational algorithm for identifying differentially expressed subpathways. Methodologically, PATHOME has two benefits: It analyzes the regulation information between nodes in the biological pathways and is applicable to a small number of samples. PATHOME is not a permutation-based approach that requires more samples in order to obtain a null distribution for a statistical test. We demonstrated the utility of PATHOME by applying it to gene expression data of gastric cancer (GC), thereby identifying tumor-related dysregulated pathways and novel therapeutic targets. Based on a reference set of known cancer-related pathways, PATHOME showed greater sensitivity and robustness than other leading methods in detecting differential molecular signals. For the WNT signaling pathway revealed only by PATHOME, we validated its involvement in gastric carcinogenesis through experimental studies of both cell lines and animal models. Our results further revealed a potential therapeutic target, WNT5A. Thus, PATHOME represents a powerful tool for inferring biologically interpretable patterns from gene expression data.
Results
=======
Overview of PATHOME algorithm and study design
----------------------------------------------
PATHOME takes the gene expression profiles of two comparison groups (for example, cancer vs non-cancer tissue) and related biological pathways from prior knowledge. In this study, we used the KEGG pathway database as the source of prior knowledge. PATHOME first decomposes the pathways into linear paths (subpathways) from the top nodes to leaf nodes, and then employs simple statistical tests to evaluate the significance of differential expression patterns along the subpathways ([Figures 1a and b](#fig1){ref-type="fig"}). The interaction property between pathway members (for example, activation or inhibition) is also considered ([Figure 1c](#fig1){ref-type="fig"}). A detailed description of the PATHOME algorithm is provided in Materials and methods.
To evaluate the performance and demonstrate the utility of PATHOME, we applied it to publicly available gene expression data sets of Asian GC ([Table 1](#tbl1){ref-type="table"}). [Figure 2](#fig2){ref-type="fig"} summarizes our study strategy, which consists of two stages: a discovery stage and a validation stage. The primary aim of the discovery stage is to compare the performance of PATHOME with those of DAVID^[@bib3]^ and GSEA,^[@bib4]^ two leading GSA tools based on a reference set of known cancer-related pathways. The data sets we used in this stage were one Korean GC data set (GSE13861)^[@bib14]^ and one Japanese GC data set (GSE15081).^[@bib15]^ A second aim of this two-stage strategy was to select potential therapeutic targets in GC. Thus, based on differential subpathways inferred from the discovery stage, we further identified robust gene signatures by using independent data sets at the validation stage. The data sets we used in this stage were another Korean GC data set (GSE36968)^[@bib16]^ and one Chinese GC data set (GSE27342).^[@bib17]^ Finally, through hierarchical clustering analysis, transcription factor-binding site (TFBS) analysis and expression pattern analysis from ArrayExpress,^[@bib18]^ we identified the target gene/pathway for experimental validation.
Performance comparison of PATHOME with other algorithms
-------------------------------------------------------
The comparison sample groups in the first gene expression data set (GSE13861)^[@bib14]^ were 65 primary gastric adenocarcinoma frozen tissue samples and 19 normal appearing gastric tissue samples. With PATHOME, we identified 113 810 subpathways that belong to 27 KEGG pathways ([Supplementary Table 1](#sup1){ref-type="supplementary-material"}) at a false discovery rate (FDR)* *\<0.05. To the same data set, we applied DAVID and GSEA, using default parameter settings (the results are shown in [Supplementary Tables 2 and 3](#sup1){ref-type="supplementary-material"}, at FDR\<0.3). The comparison groups in the second gene expression data set (GSE15081)^[@bib15]^ were the samples from 18 patients with GC who experienced peritoneal relapse and 38 who did not experience peritoneal relapse. At FDR\<0.05, PATHOME reported 126 095 subpathways that belong to 15 KEGG pathways ([Supplementary Table 4](#sup1){ref-type="supplementary-material"}). The significant pathways identified by DAVID and GSEA are shown in [Supplementary Tables 5 and 6](#sup1){ref-type="supplementary-material"} (FDR\<0.3), respectively. To evaluate the performance of PATHOME, we used a set of known cancer-related pathways^[@bib19]^ as a reference standard for comparing the three methods (see [Table 2](#tbl2){ref-type="table"}). PATHOME used a lower significance cutoff (FDR\<0.05) compared with that of the two methods (FDR\<0.3 for both methods). Despite the lower cutoff, our method detected more differential cancer-related pathways.
Selection of potential therapeutic targets in the WNT signaling pathway
-----------------------------------------------------------------------
Although other tools assess the overall enrichment of genes of interest in a given pathway, the strategy of PATHOME is to thoroughly inspect all possible paths in the pathway. Path decomposition in [Figure 1a](#fig1){ref-type="fig"} allows PATHOME to detect a pathway for which the enrichment analyses of other tools cannot report significance.
To further demonstrate the utility of our method, applied PATHOME to the identification of potential therapeutic targets from within the results we had obtained. For this purpose, PATHOME reported significant subpathways relating to WNT signaling, MAPK signaling, insulin signaling, focal adhesion and chemokine signaling ([Table 2](#tbl2){ref-type="table"}) in East Asians. Among these identified pathways, we selected the WNT pathway as identified uniquely by PATHOME for further cell line and animal studies for accuracy validation. Although the two discovery data sets were constructed from different comparisons of GC patients, the PATHOME results strongly suggested that subpathways of the WNT pathway were involved in the development of primary GC and peritoneal cancer relapse. Using Cytoscape,^[@bib20]^ we combined the significant subpathways related to the WNT pathway from the two data sets and visualized the combined subpathways of 62 genes ([Figure 3a](#fig3){ref-type="fig"} and [Supplementary Table 7](#sup1){ref-type="supplementary-material"}). At the validation stage, we investigated whether the expression patterns in the combined subpathways inferred from the discovery stage were reproducible in another two independent data sets: our published RNA-seq GC data set of Korean patients (GSE36968: 24 primary cancer tissue samples vs 6 non-cancer samples)^[@bib16]^ and another microarray data set (GSE27342: 160 samples of paired gastric tumor and adjacent normal tissues).^[@bib17]^ We found that the expression changes in the 62 genes of the combined subpathways showed great concordance in terms of up- or downregulation (relative to non-cancer samples) between GSE13861 and GSE36968 (Fisher\'s exact text, *P*\<0.007, [Supplementary Table 8](#sup1){ref-type="supplementary-material"}) or between GSE13861 and GSE27342 (Fisher\'s exact text, *P*\<0.018, [Supplementary Table 8](#sup1){ref-type="supplementary-material"}), highlighting the reproducibility of differential WNT subpathways identified. We arbitrarily assigned the four data sets into either the discovery stage or the validation stage. Because of the considerable concordance among the data sets ([Supplementary Table 8](#sup1){ref-type="supplementary-material"}), this assignment yet enabled us to work in the current study design in spite of the heterogeneity of the origins of the data sets.
To pinpoint individual genes for further experimental valuation, we performed hierarchical clustering analysis, TFBS analysis and expression pattern analysis from ArrayExpress.^[@bib18]^ The hierarchical clustering analysis ([Figure 3b](#fig3){ref-type=" | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Psoriatic arthritis (PsA) is a multifactorial chronic inflammatory joint disease associated with psoriasis, usually with no detectable rheumatoid factor (RF), and belongs to the seronegative subgroup of spondyloarthritis \[[@B1]\]. Clinically, patients with PsA present with different manifestations such as mild mono-/oligoarthritis, destructive polyarthritis, dactylitis, enthesitis, and spondylitis \[[@B2]\]. PsA is estimated to be present in 6--42% of patients with skin psoriasis \[[@B3]\], but unlike rheumatoid arthritis (RA) PsA is equally common in men and women \[[@B1]\]. Both environmental and genetic factors are important for the development of PsA \[[@B1]\]. Whilst the pathogenesis is not fully understood, the immunological process, occurring in the skin of patients with psoriasis, resembles the events occurring in the joints when synovial cells begin to proliferate \[[@B4]\]. PsA has many similarities with RA in addition to separate and specific clinical properties. In comparison to RA, erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) levels are not as diagnostically reliable when measured in samples from patients with PsA as both, or either, are often within the normal range despite the presence of an advanced joint disease. Madland et al. found that S-calprotectin related to radiographic changes rather than disease activity in patients with low disease activity but in the study they also found that S-calprotectin was associated with patients with moderate/high activity measured as physicians\' global assessment and more than three swollen joints \[[@B5]\].
Calprotectin, a member of the family of S100 leukocyte proteins secreted primarily by neutrophilic granulocytes and monocytes, is a calcium binding protein \[[@B6]\] with antimicrobial properties. The calprotectin heterocomplex consists of two different proteins, S100A8 and S100A9 (MRP14/MRP8 or calgranulin A/B) \[[@B6]\], encoded by the S100A8/S100A9 gene located on chromosome 1q21 \[[@B7]\]. The presence of calcium induces conformational changes in the heterodimer, thereby allowing the binding of other proteins. Moreover, calprotectin contains zinc-binding domains involved in an antibacterial activity \[[@B8]\]. In the cytosol of neutrophilic granulocytes, calprotectin has been estimated to account for more than 40% of the total protein content \[[@B9], [@B10]\]; conversely calprotectin is not usually present in lymphocytes \[[@B9]\]. Calprotectin is also an important mediator of many regulatory functions such as chemotactic activity, deactivation of macrophages, and inhibition of immunoglobulin synthesis \[[@B10]\].
Elevated levels of calprotectin have been identified at sites of inflammation and in the extracellular fluid in patients with RA, cystic fibrosis, Sjögren\'s syndrome, and abscesses \[[@B10]\]. In plasma from patients with RA, the concentration of calprotectin is known to be increased compared with that in healthy individuals. Measurement of faecal calprotectin levels is a diagnostic tool, and a biomarker, for inflammatory activity in bowel diseases such as ulcerative colitis and Crohn\'s disease \[[@B11]\]. A high concentration of calprotectin has been detected in the synovial fluid from patients with PsA and RA \[[@B12]\]. Production of calprotectin is also expressed in the epidermal keratinocytes of patients with psoriasis \[[@B13]\] whereas the normal epidermis from healthy individuals shows very low levels. In addition to its biological effects, calprotectin is involved in epidermal proliferation, differentiation, and inflammatory cell migration \[[@B13]\].
Numerous proinflammatory cytokines and chemokines have been found in skin lesions, blood, and synovial fluid of patients with inflammatory conditions such as arthritis and psoriasis, although their etiological significance is not fully understood \[[@B14]--[@B24]\]. Cytokines such as interleukin (IL)-17A and IL-22 have been suggested to be involved in hyperproliferative and inflammatory reactions in the psoriatic epidermis based on the therapeutic effects of cytokine antagonists as a part of the treatment in patients with PsA and plaque psoriasis \[[@B15], [@B16]\]. Interleukin-17A is also known to increase the production of IL-16 \[[@B17]\] and to induce the expression of CCL20 in primary cultures of keratinocytes \[[@B18]\]. An overexpression of IL-12 and IL-23 has been reported to occur in the psoriatic process \[[@B15]\], whilst it has been proposed that IL-15 and IL-18 participate in the pathogenesis of RA \[[@B19], [@B20]\]. High concentrations of IL-22 have been detected in the synovial fluid from patients with PsA and RA, and a correlation between the levels of IL-22 and area of the psoriatic lesion(s) and severity index (PASI) score has been identified \[[@B21]\]. In an early phase of PsA development, elevated levels of CXCL10 have been found, whilst a decrease has been observed in long lasting PsA \[[@B22]\]. A recent study revealed a correlation of IL-33 concentrations between the synovial fluid and serum of patients with RA \[[@B23]\]. The high expression of CXCL12 in the synovium of RA patients is believed to attract CD4+ memory T cells \[[@B24]\].
The aim of this cross-sectional study was to analyse different inflammatory markers, that is, S100A8/S100A9 (calprotectin) and cytokines in blood in patients with PsA in order to identify a potential marker for PsA or the clinical subtypes of PsA.
2. Patients and Methods {#sec2}
=======================
2.1. Patients and Controls {#sec2.1}
--------------------------
Blood samples were collected from 65 patients with PsA (33 males/32 females, age 50.5 ± 14.2 years (mean ± SD)). The patients with PsA were compared with 31 healthy controls matched for age and gender. S-calprotectin, high sensitivity- (hs-) CRP, and cytokines in plasma were analysed in both patient and control groups whilst the measurement of ESR was only performed for the patients with PsA. All of the patients fulfilled the CASPAR criteria \[[@B25]\] and/or the Moll and Wright criteria \[[@B1]\] for PsA. Of the patients, 32 fulfilled the Moll and Wright criteria for mono-/oligoarthritis and 33 patients fulfilled the criteria for polyarthritis at the time of the study.
All patients in this study were examined clinically for inflammatory joint manifestations and skin involvement. The number of tender and swollen joints, with a duration of more than 6 weeks, was assessed using 66-joint count. Mono-/oligoarthritic disease pattern was defined when four or less tender and swollen joints were present at the time of the medical examination, and polyarthritic disease pattern was diagnosed when more than four tender and swollen joints were present. Using a five-point scale, the affected skin area was graded from "no actual lesion" to "extensive involvement," and the activity of skin involvement (erythema, induration, and scaling) was graded using four grades, that is, "no activity," "mild," "moderate," and "severe activity."
The study was approved by the Regional Research Ethics Committee of Umeå University. All participants gave their informed consent.
2.2. Laboratory Measurement {#sec2.2}
---------------------------
Calprotectin in serum (ng/mL) was analysed using the PhiCal Calprotectin ELISA kit (*Immundiagnostik, Bensheim, Germany*). Erythrocyte sedimentation rate (mm/h, Westergren method) was measured using routine laboratory methods. Analysis of high sensitivity CRP (hs-CRP) in serum was performed using immunoturbidimetry (*Cobas 6000/8000, Roche Diagnostics, USA*). The cytokines were measured in plasma samples (pg/mL) using multiplex detection kits from Bio-Rad (Hercules, CA, USA). A 7-plex kit was used to measure the concentrations of IL-12, IL-15, IL-17A, IL-22, IL-23, IL-33, and CCL20, a 2-plex kit was used for IL-16 and IL-18, and single kits were used for measurements of CXCL10 and CXCL12. The assays were performed according to the manufacturer\'s protocols and analyzed with a Bio-Plex 200 System using Bio-Plex Manager 6.1 software (Bio-Rad, Hercules, CA, USA).
2.3. Statistical Analysis {#sec2.3}
-------------------------
Differences between the collected data were tested for using the Kruskal Wallis test and/or Mann-Whitney test, and for identifying correlations the Spearman rank-order equation was used. To assess the utility of S-calprotectin and hs-CRP as inflammatory markers for PsA, sensitivity and specificity were calculated. The receiver operating curve (ROC) was used to identify the relationship between the sensitivity and specificity.
For multivariate analysis, logistic regression enter method was performed with variables showing significant differences in the association analyses, with PsA as independent variable. All *P* values refer to a two sided test and a *P* value ≤ 0.05 was considered statistically significant. ESR values were not included in the multivariate analysis because laboratory measurements of ESR were only available for the patients with PsA.
3. Results {#sec3}
==========
S-calprotectin and hs-CRP levels were significantly higher in patients with PsA compared with controls (*P* \< 0.001, resp.). The serum levels of calprotectin were significantly higher in patients with mono-/oligoarthritis as well as polyart | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Tuberculosis (TB) is one of the ancient and deadliest disease of mankind, still posing a major health, social and economic burden at a global level and primarily in low and middle income countries.[@b1-mjhid-5-1-e2013070] The lack of an effective vaccine, the long and expensive drug regimens, the few diagnostic tools available in countries where TB is endemic and the dismantlement in several nations of the health systems and control measures that so effectively contributed to control TB throughout most of the XX century, led to the reemergence of TB as a global pandemic. The last twenty years have seen a renewed interest on TB by health authorities and governments which resulted in halving TB deaths. However, it is widely accepted that only a better understanding of the pathogenic processes associated with infection and disease will lead to the development of effective tools capable of conquering this ancient scourge. TB is one of the first and most studied infectious disease, as classically highlighted by the seminal work of R. Koch more than 100 years ago, but we have yet to answer many key questions on the mechanisms of pathogenesis and on the immunological correlates, if any, associated with protection from developing disease such as those posed by E.L. Trudeau more than a century ago.[@b2-mjhid-5-1-e2013070]
Mycobacterium tuberculosis
--------------------------
### Evolution
TB is caused by members of the specie *Mycobacterium tuberculosis* complex (MTBC), which includes: *Mycobacterium tuberculosis* (*Mtb*), the etiologic agent of TB in humans; *M. africanum*, that causes TB in humans only in certain regions of Africa; *M. bovis*, *M. caprae* and *M. pinnipedii*, causing TB in wild and domesticated mammals; *M. microti*, that causes TB only in voles. Deciphering the ≅ 4 Mbp genome provided a new understanding of the biology of the tubercle bacillus, with the identification of new and somehow unexpected properties[@b3-mjhid-5-1-e2013070] and allowed the reconstruction of the history of *Mtb* as a global human infectious agent.[@b4-mjhid-5-1-e2013070]*Mtb* emerged as a human pathogen in Africa around 70.000 years ago and then spread out of the continent following human migrations.[@b5-mjhid-5-1-e2013070],[@b6-mjhid-5-1-e2013070] It is now widely accepted that the ancients *Mtb* strains originated from environmental mycobacteria (smooth tubercle bacilli),[@b7-mjhid-5-1-e2013070] that can still be isolated from immunocompromised patients in certain parts of east Africa, are unable to cause chronic persistent infection in the immune-competent host and are not transmitted among humans. These ancient *Mtb* strains evolved, through a genetic bottleneck, so to persist in low density populations, causing disease reactivation following long period of latent infection.[@b8-mjhid-5-1-e2013070] Following domestication, humans were able to transmit the disease to animals and *M. bovis* emerged as a pathogen of domesticated and wild animals.[@b4-mjhid-5-1-e2013070] The introduction of agriculture, civilization and the increase in human population density in urban areas led to the selection of *Mtb* strains with enhanced virulence and transmissibility that are named modern *Mtb* strains.[@b9-mjhid-5-1-e2013070],[@b10-mjhid-5-1-e2013070] The modern *Mtb* strains spread throughout the world causing the TB epidemics that ravaged mankind for centuries and these strains are responsible for most of the TB cases nowadays.[@b11-mjhid-5-1-e2013070]
### The Bacillus
*Mtb* is a slow growing mycobacteria with a doubling time of 12--24 h under optimal conditions. A major feature of *Mtb* is the peculiar cell wall structure, that provides an exceptionally strong impermeable barrier to noxious compounds and drugs and that plays a fundamental role in virulence. The classical view of the mycobacterial cell wall structure has been revised thanks to the introduction of a new electron microscopy technique, cryo-electron tomography on vitreous section, that preserves cell wall organization by avoiding sample dehydration.[@b12-mjhid-5-1-e2013070],[@b13-mjhid-5-1-e2013070] Thanks to these advancements it was shown that mycobacteria possess an outer membrane, functionally similar to what seen in gram-negative bacteria, consisting in an asymmetric lipid bilayer made of long fatty acids in the inner leaflet (mycolic acids) and of glycolipids and waxy components on the outer layer. The outer and inner membrane form a periplasmic space, with the presence of a thin layer of peptidoglycan in the innermost side covalently linked to arabinogalactan and lipoarabinomannan which in turn are bound to mycolic acids. Isoniazid and ethambutol, two of the most effective anti-TB drugs, target the synthesis of the mycolic acids and arabinogalactan, respectively, highlighting the importance of the mycobacterial cell wall in *Mtb* biology.
Protein secretion systems are the main virulence factors of pathogenic bacteria and in *Mtb* five type 7 secretion systems were identified (ESX1-5)([Figure 1](#f1-mjhid-5-1-e2013070){ref-type="fig"}).[@b14-mjhid-5-1-e2013070] The best characterized of these is ESX1, which is missing in the attenuated *M. bovis* vaccine strain Bacille Calmette and Guerin.[@b15-mjhid-5-1-e2013070],[@b16-mjhid-5-1-e2013070] ESX1 is required for the full virulence of *Mtb*, which uses this secretion system to translocate from the phagosome into the cytosol of infected macrophages where it may persist in a protected environment.[@b17-mjhid-5-1-e2013070]--[@b19-mjhid-5-1-e2013070] ESX1 secretes among many antigens, ESAT-6 and CFP-10, two small highly immunogenic proteins that form the basis of the immunological diagnosis of *Mtb* infection in the interferon-gamma release assays (IGRAs).[@b20-mjhid-5-1-e2013070] Since BCG lacks ESX1 and does not express ESAT-6 and CFP-10, IGRAs can be used to detect *Mtb* infection even in subjects previously immunized with BCG, which may not be otherwise distinguished with the classical Mantoux intradermal reaction. ESX3 is involved in the acquisition of iron and zinc by *Mtb* and is essential for growth also in culture.[@b21-mjhid-5-1-e2013070] ESX5 is found only in MTBC, *M. marinum* and *M. ulcerans* and it may represents a secretion systems specifically evolved to interact with a complex immune system such as that of mammals.[@b22-mjhid-5-1-e2013070] While the role and function of ESX2 and ESX4 are still debated, the elucidation of the ESX systems on TB pathogenesis is certainly one of the major advancements of the last decade in the TB field, providing a new understanding of the host-pathogen interaction and very rewarding in terms of new diagnostics and potentially capable of providing new therapeutics and vaccines in the near future.
The characterization of other *Mtb* surface constituents such as the mycobacterial adhesin HBHA[@b23-mjhid-5-1-e2013070] and PE_PGRS proteins[@b24-mjhid-5-1-e2013070],[@b25-mjhid-5-1-e2013070] is starting to shed light on the molecular mechanisms involved in the interaction between the bacilli and host cells, and may lead to the development of "smart" tools capable of interfering with *Mtb* pathogenesis.
Another group of proteins known to play an important role in pathogenesis are those under the control of the dormancy survival regulon (Dos), which controls expression of more than 50 genes responsible for the *Mtb* hypoxic response.[@b26-mjhid-5-1-e2013070],[@b27-mjhid-5-1-e2013070]*Mtb* senses the harsh environment in macrophages and granulomas, characterized by low oxygen and nutrient depletion, and responds by activating a dormant state, whereby the bacilli stops multiplying, down-regulate central metabolism and activate anaerobic metabolism, with induction of stress proteins that provide *Mtb* with unique biological and immunological features.[@b28-mjhid-5-1-e2013070] These metabolically active but not replicating dormant bacilli can persist for a long time *in vivo* and may revert to an active state thanks to the resuscitating promoting factors (rpf), which act on the peptidoglycan to trigger a cascade of events that promotes bacterial growth.[@b29-mjhid | {
"pile_set_name": "PubMed Central"
} |
Introduction {#sec1}
============
Low-molecular-weight gelators have started to evoke considerable interest in recent years on account of their application in cosmetics,^[@ref1]^ food industry,^[@ref1]^ controlling/triggering drug release,^[@ref2],[@ref3]^ tissue engineering,^[@ref3],[@ref4]^ sensors,^[@ref5]^ template materials, dye-sensitized solar cells,^[@ref6]^ and so on. The one-dimensional self-assembly of the gelling agent with a fiberlike structure eventually entangles to produce a three-dimensional network followed by immobilization of solvent molecules via capillary force, leading to gelation in a particular solvent. Low-molecular-weight gelators based on carbohydrates,^[@ref7]\ ,[@ref8]^ amino acids,^[@ref9]^ and several other organic building blocks^[@ref10]^ and their applications are well known. We have designed and synthesized a series of isoxazole-based low-molecular-weight gelators and shown their applications in the separation of bisphenol from water and the recovery of oil spills. Bisphenol is one of the highest volume chemicals produced in the industry as a starting material.^[@ref11]^ It often leaches from plastic and food containers as well as plastic water pipes and has an adverse and pervasive effect on humans and wildlife. Bisphenol as an endocrine disruptor that binds with some bisphenol-binding proteins^[@ref12]−[@ref14]^ and hormone receptors^[@ref15]−[@ref17]^ and shields their normal functionality in cells.^[@ref18]^ This could cause an abrupt and dramatic alteration of cell functionality,^[@ref19]−[@ref21]^ human reproductivity,^[@ref22]^ brain adipose tissue,^[@ref23]^ and so on. With growing demand and an increase in the production of plastic, human exposure to bisphenol has increased significantly over the years. There exist certain methods for the separation of bisphenol from water. They are mostly based on chromatographic techniques^[@ref24]−[@ref26]^ or reverse osmosis.^[@ref27]^ However, the practical implementation of these methods is questionable as they fail to quantitate separation of bisphenol from water and are largely uneconomic. Thus, there is a constant demand for an effective, alternative, and an economical way to separate bisphenol from water.
We have now synthesized a series of isoxazole-based gelators by a systematic alteration of the hydrocarbon chain length (from C~8~H~16~ to C~16~H~31~) in the lipophilic part of the molecule and reveal their potential for efficient and quantitative separation of bisphenol from water. Besides that, these classes of isoxazole-based gelators were used for the cleanup of oil spills owing to the phase-selective gelation of these gelators. Marine oil spills were caused by leakage and release of more than 5 million tons of crude oil and petroleum products (refined fuel oils) into the ocean over the period of 1965--2010 in the Gulf of Mexico.^[@ref28],[@ref29]^ It has become a major threat to marine life and ocean ecosystems. There is an immediate and earnest need for the effective and efficient development of smart materials and technologies for oil spill control and recovery for combating oil spills.^[@ref30],[@ref31]^ Certain methods like bioremediation,^[@ref32]^ use of dispersants,^[@ref33]^ adsorption,^[@ref34]^ and use of solidifiers^[@ref8]^ and sorbents^[@ref35],[@ref36]^ have also been reported for the cleanup of oil spills. However, the problems associated with these existing methods are the release of toxic residues. Also, they are noneconomic, time-consuming, and allow only poor recovery. We have thus used isoxazole-based low-molecular-weight gelators for the removal of oil spills from water.
Results and Discussion {#sec2}
======================
Syntheses of Gelators {#sec2.1}
---------------------
[Scheme [1](#sch1){ref-type="scheme"}](#sch1){ref-type="scheme"} shows the syntheses of gelators **Ga--c**. For this, 3,4-dihydroxybenzaldehyde was treated with alkyl bromide (compounds **2a--c**) containing different hydrocarbon chains under basic conditions to obtain compounds **3a--c**. **3a--c** were reacted with hydroxylamine hydrochloride in ethanol for 2 h to afford compounds **4a--c**, and these were treated further with compound **1** in the presence of NaOCl in dry DCM at room temperature for an hour to obtain gelators **Ga--c** (for details, see [Scheme S1](http://pubs.acs.org/doi/suppl/10.1021/acsomega.0c00004/suppl_file/ao0c00004_si_001.pdf) in the Supporting Information, SI).
{#sch1}
Gelation Properties {#sec2.2}
-------------------
The gelation abilities of these compounds were determined by the simple method of being stable to the inversion of the container,^[@ref8]^ and gelation is considered to have occurred while the gel is stable once the vial is turned upside down after cooling. The gelation abilities of all of these compounds in various solvents are depicted in [Table S1](http://pubs.acs.org/doi/suppl/10.1021/acsomega.0c00004/suppl_file/ao0c00004_si_001.pdf) in the Supporting Information. All gelators are versatile organic gelators as they induce gelation in not only ethanol but also a series of oils like castor oil, olive oil, etc., and ambidextrous gelation properties of these gelators could be useful for the preparation of hybrid material in different solvents and also for sensing and tissue engineering application purposes.^[@ref3],[@ref37]^ It should be noted that all of these gels are thermoreversible since they turn into liquid state upon heating and revert to the gel state upon cooling (see [Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}A). [Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}A depicts the thermoreversible nature of the gel obtained from compound **Ga** in ethanol as it undergoes a change to the solution state while heating and reverts to the gel state again after cooling.
{#fig1}
Rheology Study of the Gel {#sec2.3}
-------------------------
The rigidity, viscoelastic property, and mechanical stability of the gel were determined by rheological property measurements of the gels derived from 1% (w/v) gelators of compounds **Ga--c** in castor oil and ethanol. All gels were cured for a period of 12 h before the rheology measurements ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}B,C). Rheology data of the gels in castor oil ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}B) and ethanol ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}C) demonstrate that for all of these gels, storage modulus (*G*′) is higher than loss modules (*G*″), implying the viscoelastic nature of these gels.^[@ref38]^ Notably, for all of these gels derived from castor oil, both *G*′ and *G*″ are almost independent of the measured range of frequency of oscillation at a constant strain. The dependence of the mechanical strength of the gel on the alkyl chain length is illustrated.^[@ref39]^ The variation of the mechanical strength of the gel with the hydrocarbon chain can be illustrated by considering its tangent of the phase angle value (tan δ),^[@ref40]^ which is the ratio of (*G*′) over (*G*″). In the case of an isoxazole-based gel derived from castor oil with C16 hydrocarbon chain length, the value of tan δ is much lower than for C10 (**Gb**) and for C8 (**Ga**) ([Table S2](http://pubs.acs.org/doi/suppl/10.1021/acsomega.0c00004/suppl_file/ao0c00004_si_001.pdf), Supporting Information). This clearly indicates that the gel derived from the C16 hydrocarbon chain gel is more mechanically stable than gels with shorter chains. The variation of tan δ value with the hydrocarbon chain length is reversed in the case of a gel derived from ethanol compared to the gel derived from castor oil. This signifies different gelation mechanisms and different orientations of the gel fibers in the three-dimensional (3D) structure of the gel network in these two organic solvents.^[@ref41]^
Morphology of the Gels {#sec2.4}
----------------------
To visualize the morphology of the organogel | {
"pile_set_name": "PubMed Central"
} |
1. Introduction
===============
Human cytomegalovirus (HCMV) is predominantly an opportunistic pathogen, causing clinically significant disease in people who have inadequate immune responses, including neonates, transplant recipients, and people with uncontrolled HIV infections \[[@B1-viruses-06-00476]\]. Viral replication initiates with the expression of the immediate early genes, the best characterized of which are IE1 and IE2. IE1 and IE2 initiate the cascade of viral gene expression, regulating the expression of the remainder of the viral genome, resulting in the expression of early and then late genes, and ultimately the production of new virions.
HCMV has a very large genome of \~235 kb and encodes an estimated 176 genes \[[@B2-viruses-06-00476]\]. Despite the large genome size, only \~50 genes are required for HCMV replication in cell culture, suggesting that the remaining 70% of the genes contribute to replication and latency in the human host \[[@B3-viruses-06-00476],[@B4-viruses-06-00476]\]. The essential genes of HCMV can be grouped according to function: attachment of the virus to the target cells, transcriptional regulation, viral DNA replication, virion formation, and virion egress. Although there are a relatively small number of essential HCMV genes, to date the functions of several of the essential genes, including UL34, have been minimally characterized.
The UL34 gene is essential for viral replication as determined by Dunn *et al.* \[[@B3-viruses-06-00476]\] and Yu *et al*. \[[@B4-viruses-06-00476]\] in their global analyses of the HCMV genome. The UL34 gene is transcribed throughout the viral replication cycle, resulting in the expression of early and late transcripts \[[@B5-viruses-06-00476]\]. The early transcript becomes abundant by 3 hours post-infection (hpi) while the late transcript predominates from 48 hpi throughout the remainder of the viral replication cycle. Two highly related proteins are encoded by the early and late transcripts, with the late protein (UL34b) identical to the early protein (UL34a) except for the absence of 21 amino terminal amino acids. Both UL34 proteins localize to the nucleus and are sequence-specific DNA-binding proteins that act as transcriptional repressors; the interaction of UL34 proteins with the UL34 binding sites in the US3 and US9 genes down-regulates their expression \[[@B6-viruses-06-00476],[@B7-viruses-06-00476]\].
In addition to the UL34 binding sites within the US3 and US9 genes, there are 12 to 13 additional binding sites located in the viral genome. Six of the UL34 binding sites are located within protein coding regions, 3 or 4 binding sites (the number is strain dependent) are in a region flanking the lytic origin of replication, and the remaining 3 binding sites are located 5\' of protein coding regions \[[@B6-viruses-06-00476]\]. The positions of the UL34 binding sites relative to coding regions suggests that UL34 proteins may be multifunctional, contributing not only to transcriptional repression but also contributing to viral replication in as yet unidentified ways. The experiments described here were undertaken to identify the contributions of each of the UL34 proteins to viral replication and to examine the intracellular localization pattern of UL34 proteins during infection.
2. Results and Discussion
=========================
2.1. Both UL34 Proteins Are Essential for Viral Replication
-----------------------------------------------------------
Yu *et al.* \[[@B4-viruses-06-00476]\] and Dunn *et al.* \[[@B3-viruses-06-00476]\] identified UL34 as essential for viral replication in their global analyses of the HCMV genome. We extended their results by constructing and studying recombinant viruses using the bacterial artificial chromosome (BAC) that contains the HCMV AD169 genome, pHB5 \[[@B8-viruses-06-00476]\]. HCMV-BACs that either entirely lacked UL34 (ΔUL34), contained UL34 with a mutation in the ATG initiating translation of the early protein \[ATG mutated to ATC (methionine to isoleucine), ΔE mutant\], contained UL34 with a mutation in the ATG initiating the late protein \[ATG mutated to GTG (methionine to valine), ΔL mutant\], or had the UL34 open reading frame restored (UL34 rescue, RUL34). The ability of each of the recombinant viruses to replicate was assayed following electroporation of the HCMV-BACs into primary human fibroblasts, along with a plasmid expressing the tegument protein, pp71. Following electroporation, cells were observed for plaque formation for 4 weeks. The parental BAC, pHB5, and the UL34 rescue BAC (RUL34) gave rise to plaques by 8 days post-transfection. No plaques developed in the cells receiving the ΔUL34 mutant, the ΔE UL34 mutant or the ΔL UL34 mutant BAC during a 4 week observation period. From these results, we concluded that the expression of both UL34 proteins is essential for viral replication.
2.2. Reduced Viral Gene Expression in the Absence of UL34 Proteins
------------------------------------------------------------------
To examine the defect in viral replication associated with the absence of UL34 proteins, semi-quantitative RT-PCR reactions were performed on RNA samples extracted following the electroporation of the UL34-HCMV BACs into human fibroblasts. Levels of expression for the essential genes UL32, UL37, UL44, UL46, UL84 and UL123 (IE2) were assayed as were levels of expression of the non-essential UL36 and UL69 genes. IE2, UL36, and UL37 are immediate early genes; UL44 and UL84 are early genes; UL69 is an early/late gene and UL32 and UL46 are late or presumed late genes ([Figure 1](#viruses-06-00476-f001){ref-type="fig"}A). Levels of expression were analyzed at 6 and 8 days post-transfection; time points that correspond approximately to early and late times of infection, based on the time when plaques are visible. Viral transcript levels were normalized to the transcript levels of the cellular gene, glyceraldehyde phosphate dehydrogenase (GAPDH). At 6 and 8 days post-transfection, transcript levels for all genes asssayed were decreased in the UL34 mutant viruses when compared to the UL34 rescued virus (RUL34, [Figure 1](#viruses-06-00476-f001){ref-type="fig"}B,C).
Six days post-transfection, expression of the major immediate early (mIE) gene, IE2, was decreased in the absence of the early, late or both UL34 proteins. Similar to the reduction in the level of IE2 transcripts, levels of UL44, UL84, UL32, and UL46 transcripts were detected at a reduced level for all of the UL34 mutant viruses at 6 days post-transfection ([Figure 1](#viruses-06-00476-f001){ref-type="fig"}B). In contrast, no UL69 or UL37 expression was detected for the UL34 mutant viruses; and UL36 expression was detected only in the UL34 mutant virus expressing the late UL34 protein (UL34b). At 8 days post-transfection, only UL44 transcripts were detectable for the UL34 deleted-BACs, albeit at a much reduced level compared to the UL34 rescued virus ([Figure 1](#viruses-06-00476-f001){ref-type="fig"}C).
{#viruses-06-00476-f001}
There is no UL34 binding site within the major immediate early gene, and in studies utilizing transient expression assays, UL34 has no activating or repressing effect on the mIE promoter \[[@B9-viruses-06-00476]\]. Consequently, the reduction in IE2 transcript levels seen in the absence of UL34 proteins suggests that UL34 proteins have a general effect on the level of IE2 transcripts. This is supported by the reduction in transcript levels for all viral genes assayed ([Figure 1](#viruses-06-00476-f001){ref-type="fig"}B,C). UL32 and UL37 contain UL34 binding sites within their open reading frames; however, the diminution in transcript levels is consistent for all genes tested, regardless of the presence of a UL34 binding site. Intriguingly, the inability to detect UL69 and UL37 transcripts in the absence of either UL34 protein suggests that both proteins are required for their expression, contrasting with UL36 expression, where transcripts are not detectable in the absence of the late UL34 protein, suggesting that the late UL34 protein (UL34b) is required for UL36 expression.
At 8 days post-transfection, of the genes assayed, only UL44 transcripts were detected for the UL34 mutant viruses, in contrast to | {
"pile_set_name": "PubMed Central"
} |
**W**ilhelm Hasselbach (1921--2015) was born in Falkenstein, a small village north of Frankfurt/Main, Germany. For most of his life he worked and lived in Heidelberg, where he was a director at the Max Planck Institute for Medical Research. He is probably best known for the discovery of the *calcium pump* of the sarcoplasmic reticulum (Hasselbach and Makinose [@CR12], [@CR14]), which is known to be responsible for muscle relaxation. To be sure it was agreed then that the particulate (vesicular) fraction of the fragmented sarcoplasmatic reticulum was a "*relaxing factor*" (c.f. also Ebashi and Lipmann [@CR4]). But before 1961, it was not at all clear whether the vesicular particles (Hasselbach's "relaxing granules", c.f. Nagai et al. [@CR19]) produced a soluble relaxing factor inhibiting the interaction of actin and myosin or whether they "acted by binding calcium", as already suggested by Annemarie Weber (quoted by Dorothy Needham in her seminal book "Machina Carnis"). And indeed, "free" calcium in the medium was found to be *actively* removed by the particulate "factor"---in fact by transporting calcium ions across an osmotic gradient into the vesicles of the particulate fraction, as beautifully demonstrated by Hasselbach and Makinose ([@CR11], [@CR12]). About the same time, Setsuro Ebashi ([@CR2]) also found that the "relaxing material" of muscle removed calcium from the medium in vitro. His independent finding was, however, not fully published until the following year (Ebashi and Lipmann [@CR4]).
Clearly Hasselbach's discovery paved the way for the later detailed elucidation of active calcium transport mechanisms and their role in the relaxation of skeletal, smooth and cardiac muscle (c.f. Hasselbach [@CR7]; Hasselbach and Oetliker [@CR16]). For instance, Hasselbach and Makinose ([@CR13]) were able to show that calcium transport and (Ca^2+^-activated) ATP splitting, as well as the so called ATP--ADP exchange reaction, were tightly coupled, suggesting the transient formation of an intermediate phosphorylation of a putable calcium transporter protein. Also, this process was found to be higly efficient: for every molecule of ATP split two ions of calcium were actively transported across the membrane surrounding the vesicles of the reticulum. Furthermore, by manipulating the experimental conditions, the calcium pump could be reversed, resulting in ATP synthesis rather than in breakdown, as well as in passive calcium efflux from the calcium storing vesicles. Thus Makinose and Hasselbach ([@CR18]) arrived at the conclusion "that the calcium translocation across the sarcoplasmic membranes is reversibly connected with the phosphoryl transfer reaction giving rise to a splitting of ATP when calcium moves inward and to an ATP synthesis when calcium moves outward".
As later noted by Hasselbach and others, several drugs, including caffeine, also cause calcium efflux, but this was not found to be related to the reversal of the pump but rather to the passive release of stored calcium through calcium ion permeable channels, which could be blocked by ryanodine. Later experimental studies by Hasselbach and his long-term collaborator Andrea ("Andy") Migala ([@CR15]) confirmed "that the caffeine sensitive calcium channel functions as an assembly of at least four ryanodine binding sites whereby the occupation of one site suffices to abolish \[caffeine induced\] calcium release". This, of course, fitted well into current schemes of the role and mechanism of ryanodine receptors in excitation contraction coupling.
While these findings were interesting, Hasselbach's most outstanding achievement was certainly his major contribution to the discovery and molecular elucidation of an ATP-driven active ion transport across a biological membrane. *He had discovered the Ca* ^*2*+^-*ATPase (SERCA) of the sarcoplasmatic reticulum*! Surely this success ought to be seen in the context of Jens Christian Skou's discovery (Nobel Prize in 1997) of the Na/K-ATPase in 1957, which was then proposed to be *possibly* related to the active ion transport across the nerve membrane (Skou [@CR21]). And most importantly, Peter Caldwell and colleagues (Caldwell et al. [@CR1]) already suggested that "the *presence* of ATP may be required for the normal operation of (an) active transport mechanism"! Because of his numerous achievements, Wilhelm Hasselbach was awarded the prestigious Feldberg Prize in 1963, and the Paul Morawitz Prize of the German Society of Cardiology in 1986. He was elected a member of the German Academy of Science Leopoldina (Deutsche Akademie der Naturforscher Leopoldina) in 1969, a member of the Brasilian Academy of Science in 1975, and an honorary member of the German Physiological Society in 1991. In 1961, Hasselbach became a scientific member of the Max Planck Society, and as from 1966, he was a director at the Heidelberg Max Planck Institute for Medical Research until his retirement in 1989. Besides, he was an honorary professor at Heidelberg University whose lectures on applied physiology were highly appreciated by medical students.
**B**y all standards, Professor Hasselbach was a kind, helpful and modest man. Moreover he was always grateful for the help he received from others, and in particular in those difficult times after World War II when he was wounded. In 1998, looking back to his life-long experimental work, he stated: "The discovery of the ATP-driven calcium pump in the sarcoplasmic reticulum membranes reaches back to the postwar \[World War II\] years and would not be possible without the generous support by the American scientific community...; these pre- and postwar relations helped to establish the calcium pump as a physiologically relevant mechanism in all kinds of cells" (Hasselbach [@CR9]).
Ironically, Hasselbach had his first opportunity to visit the United States rather late. John Gergely had invited him, H. H. Weber and me to a meeting taking place in May 1962 on the occasion of the opening of the Retina Foundation Institute in Boston. We all met at Dedham, Massachusetts, in a luxurious New England mansion, together with other visitors from Japan, England, Canada, Italy, Belgium, Sweden and Poland, where we were kindly received by young and old members of the American muscle community. We had long and unrestricted discussions, and those on the nature of the "relaxing factor" were somewhat heated. It was even proposed that the calcium pump could not cause relaxation of contractile systems per se. Rather it was suggested that the "true" relaxing factor might be a soluble inhibitor released from the sarcoplasmic reticulum but inactive unless myoplasmic free calcium was removed by the pump. In general, Hasselbach was a remarkable discussant. As Avril Somlyo once recalled, "he had an intensity and enthusiasm that made him special to interact with... always good discussions"!
After the Dedham meeting, Hasselbach and I visited Annemarie Weber's Lab in New York. He then visited Fritz Lipmann, and I went on to work for a couple of weeks with David Bohr in Ann Arbor, Michigan. Soon the concept of the "soluble relaxing factor" was abandoned when Annemarie Weber found that many phenomena concerning the inhibition of actomyosin ATPase and of contraction by the tentative factor could be explained simply by the removal of calcium ions contaminating crude preparations of actomyosin and myofibrils (Weber et al. [@CR23]), which on the other hand could be activated by traces of free calcium binding cooperatively to the myofibrillar proteins (Weber and Herz [@CR22]). As later pointed out by Hasselbach ([@CR8]), "the 'soluble relaxing factor' finally became obsolete, when Ebashi ([@CR3]), Ebashi et al. ([@CR5]) showed that the 'contractile proteins' themselves contain a complex proteinsystem (originally called "native tropomyosin" or simply "Ebashi factor") which in the absence of calcium prevents the interactions between ATP, myosin and actin".
In retrospect, the meetings in Boston and Dedham were most memorable events for both of us. In fact this was our first journey to the United States---both of us travelling together on the old ocean liner "Hanseatic". Actually I knew Wilhelm ("Willi") Hasselbach long before this, in fact already since the summer of 1957, when he visited Dorothy Needham, Samuel Victor Perry and Kenneth Bailey, my research supervisor in Cambridge. I was then working on catch muscles of clams, and Hasselbach kindly showed me how to prepare skinned (i.e. glycerinated) smooth muscle fibre bundles and possibly use them to study contraction. And then he added, "perhaps later in Heidelberg...", and indeed I became his colleague later on. Naturally, Hasselbach was *the* expert as he had just shown that, unlike skeletal muscle, skinned smooth muscle preparations had a rather high magnesium requirement for contraction (Hasselbach and Ledermair [@CR10]). Hasselbach was then already well known to the muscle community, as he had devised a method (the famous "Hasselbach-Schneider solution") by which myosin could be selectively extracted from skeletal muscle, thus leaving actin behind. Remember, his method had allowed Jean Hanson and Hugh Huxley to show that the myosin component of muscle resided exclusively in the A band, the length of which stayed constant in muscle contraction and relaxation as proposed by the sliding filament hypothesis. This in fact is a telling story that I knew first "from hearsay", and much later also from Hasselbach's personal account in a book chapter (Hasselbach | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Down syndrome (DS) is a complex disorder caused by trisomy of the entire or a critical portion of chromosome 21 (HSA21); it represents the most frequent genetic cause of mental retardation, with a frequency of about 1/1000 new-borns, and is associated with a huge number of congenital heart defects \[[@B1]\]. DS individuals have also an increased risk of early-onset Alzheimer disease \[[@B1]\]. Immunological and autoimmune disturbances, with high rates of infections and malignancies, are recurrent phenomena in DS pathogenesis \[[@B2]\], and infections still represent major cause of death in DS \[[@B3],[@B4]\]. Despite the increased risk of leukaemia, DS patients have a low incidence to develop solid tumors \[[@B5],[@B6]\], and a reduced incidence of diabetic retinopathy, suggesting, at least in part, a common angiogenesis\' suppression \[[@B5],[@B7]\]. Impaired endothelial function at a young age, possibly due to increased oxidative stress and yet unknown mechanisms, is a common DS feature \[[@B8]\].
DS phenotype results from a dosage imbalance of HSA21 genes, although expression analyses have reported conflicting results \[[@B9],[@B10]\]. The over-expression of chromosome 21 genes greatly varies across the trisomic tissues \[[@B11],[@B12]\], and analyzing specific cell type/tissue, in easy-accessible and non-invasive manner, may be more productive \[[@B13],[@B14]\].
Growing interest is emerging on circulating endothelial progenitor cells (EPCs) and their pivotal role in the maintenance of endothelium integrity, repair after injury and postnatal neovascularization \[[@B15]-[@B17]\]. Many studies are providing encouraging insights into the use of EPCs in the clinical setting \[[@B18],[@B19]\]. Indeed, accumulating evidences indicate a reduced availability, and/or impaired EPC function, in cardiovascular and metabolic diseases \[[@B17],[@B20],[@B21]\]. EPCs number was recently shown to be impaired in DS fetuses and children \[[@B22],[@B23]\] and CD34+ haematopoietic progenitors exhibited a marked growth decrease in Ts65Dn - a DS mouse model - accounting, at least in part, for DS vascular anomalies and defective immune response to pathogens \[[@B24]\].
Bacterial toxins may trigger pathogenic events through the over-production of cytokines and chemokines, leading to the alteration of endothelial function and capillary leakage \[[@B25]\]. Particularly, we recently demonstrated \[[@B26]\] that *Bartonella henselae*, a gram-negative intracellular bacteria responsible of vasoproliferative disorders in immunocompromised individuals \[[@B27],[@B28]\], adheres to and invades EPCs.
The present study was designed to pursue the molecular mechanisms contributing to immune, vascular and haematopoietic defective DS phenotypes, by investigating the number and functions of DS EPCs compared to euploid cells, also focusing on bioinformatics analysis of differentially expressed genes. Moreover, by using the previously described *B. henselae*model, we investigated the susceptibility of DS progenitors to this pathogen infection, also performing a detailed analysis of deregulated genes after Bartonella infection, with particular attention to angiogenesis and immune response pathways.
Methods
=======
Subjects
--------
DS and euploid donors were recruited at the Institute of General Pathology, Section of Clinical Pathology, Faculty of Medicine, University of Milan, and at the Second University of Naples, and an approval statement was obtained by the ethics\' review boards of both Institutions. Informed consent was obtained from all persons involved in all clinical investigation of this study according to the principles expressed in the Declaration of Helsinki.
All subjects recruited for EPC isolation were free of infection, and no individual was taking any medication known to affect immune system/response. DS and euploid individuals were 65% males and 35% females as gender and 28 ± 9 as mean age. The experiments, where not specified, were performed on at least six DS and age-matched euploid individuals.
Plasma samples were obtained from 50 DS individuals and 30 age matched euploids subdivided into three age subgroups (young 0-20 y.o.; adult 21-40 y.o.; old 41-60 y.o.) as described elsewhere \[[@B29]\].
EPC Isolation
-------------
EPCs were isolated from non-institutionalized individuals with DS and age-matched euploid donors.
EPCs were isolated as previously described \[[@B30]\]. Briefly, PBMCs were isolated by density gradient centrifugation of peripheral blood samples on Histopaque-1077 (Sigma). Cells were washed twice with PBS and counted. PBMCs were plated on culture dishes pre-coated with gelatin and fibronectin and maintained in endothelial basal medium-2 (EBM2; Cell Systems). Cells were cultured at 37°C with 5% CO2 in a humidified atmosphere. After four days, non-adherent cells were removed and adherent cells were used for further analyses.
Bacterial strains and growth conditions
---------------------------------------
The *B. henselae*strain ATCC 49882 (LGC Promochem) was grown on Columbia agar supplemented with 5% defibrinated sheep blood (Oxoid) in a humidified atmosphere at 37°C and 5% CO2. For production of bacterial stock suspensions, bacteria were harvested after 7 days of culture until they reached the mid-exponential phase of growth (109 bacteria/ml), resuspended in Tryptone Soya Broth USP (Oxoid) containing 10% glycerol, and stored at -80°C. The number of viable bacteria in the frozen stocks was determined as previously described \[[@B26]\].
B. henselae infection
---------------------
For infection, Bartonella stock solutions were thawed, washed and suspended in antibiotic-free cell culture medium, and sedimented onto cultured EPCs at different multiplicity of infection (MOI) of 50, 100, 250, 500 and 1000 \[[@B26]\]. The MOI for infections was confirmed by plating serial dilutions of the infection inoculum. Assays were performed three times in triplicate.
Confocal immunofluorescence microscopy
--------------------------------------
EPCs were dual stained with Dil-Ac-LDL and lectin from *Ulex europaeus*and counted both by fluorescence microscopy and flow cytometry as previously described \[[@B26],[@B30]\]. Images were obtained by Zeiss LSM 510 with plan-apochromat X 63 (NA 1.4) oil immersion objective. EPCs images were used to measure cell size with ImageJ (<http://rsb.info.nih.gov/ij/>).
SDF-1α plasma levels
--------------------
Commercially available SDF-1α ELISA kit (Quantikine, R&D Systems) was used to determine plasma SDF-1α levels. Tests were carried out at RT on freshly thawed plasma samples of 50 DS individuals and 30 age matched euploids subdivided into three age subgroups (young 0-20 y.o.; adult 21-40 y.o.; old 41-60 y.o.) \[[@B29]\]. Concentration was determined by comparison with a standard curve, following manufacturer\'s instruction.
Transmission electron microscopy
--------------------------------
After a short incubation with Trypsin/EDTA, DS and euploid EPCs, both infected and uninfected with *B. henselae*, were harvested, centrifuged and washed in PBS. After centrifugation at a speed of 400 g for 7 min, cells were fixed in 4% glutaraldehyde as described \[[@B31]\]. Postfixation, dehydratation of specimen, semithin (2 μm) and ultrathin (80 nm) sections were performed as previously described \[[@B26]\]. Semithin sections were analysed with a light microscope (Polivar Reichert-Jung). Ultrathin sections were examined with Leo 912 AB transmission electron microscope operating at 80 kV.
C11-BODIPY581/591 fluorescence
------------------------------
Oxidation-sensitive fluorescent probe, C11-BODIPY581/591 (C11-BO, Invitrogen), was loaded (2 μM final concentration) into the cells 30 min. before oxidative treatment. The samples were aliquoted in triplicate wells of a 24-well microplate, and fluorescence was determined with confocal laser microscopy at different times (0, 1, and 6 hours) from oxidant treatment. Between times, plates were maintained at 37°C in 5% CO2. To determine red fluorescence each microplate was excited at 543 nm (emission at 590 nm); for green fluorescence, microplates were excited at 488 nm (emission at 526 nm). Blank wells were also evaluated as well as C11-BO alone.
Microarray analysis and quantitative RT-PCR
-------------------------------------------
Total RNA (10 μg) was isolated as previously described \[[@B32]\] \[Additional file [1](#S1){ref-type="supplementary-material"}: Supplementary Methods\]. A pool of three samples (a total 15 μg of cRNA) was used for each hybridization - 2 pools of three infected and three uninfected euploid and DS - on the Affymetrix U133 2.0 probe array cartridge as described elsewhere \[[@B26]\]. Microarray data were submitted to Array Express (<http://www.ebi.ac.uk/arrayexpress;> provisional accession number E-MTAB-312). Results were validated by qRT-PCR and semi-qRT-PCR, performed as described \[[@B32]\], using primer pairs listed in \[Additional file [2](#S2){ref-type="supplementary-material"}: Supplemental Table S1\].
In silico significant pathway identification
--------------------------------------------
Analysis of over-represented genes was performed using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) \[[@B33],[@B34]\] and the PANTHER (Protein ANalysis THrough Evolutionary Relations | {
"pile_set_name": "PubMed Central"
} |
The electronic version of this article is the complete one and can be found at: <http://f1000.com/prime/reports/b/5/27>
Introduction {#s01}
============
Heart failure is a leading cause of death in the United States and is mentioned in one out of nine death certificates \[[@bib-001]\]. Survival after diagnosis has improved over time; however, the death rate remains high with \~ 50% mortality within 5 years. There is no cure for heart failure short of a heart transplant, which is an option only for a few select individuals. Thus, there is a great need for new therapies. Heart failure, and here we focus on systolic heart failure or heart failure with reduced ejection fraction, results from damage to the heart that prevents it from meeting its primary function to deliver oxygenated blood to the body. The most common causes of heart failure are coronary artery disease and hypertension, which can compromise contractility by reducing oxygen delivery to the heart muscle (or by adverse remodeling of the heart in the case of hypertension) or cause muscle damage outright through infarction. Ironically, cardiac muscle damage leading to heart failure may also result from reperfusion-injury following percutaneous coronary intervention (PCI), which is performed to increase oxygen delivery to cardiac muscle \[[@bib-002]\]. With reduced contractility, increased neurohormonal drive kicks in, causing genetic and structural changes to the heart that further reduce the ability of the heart to function as a pump \[[@bib-003],[@bib-004]\]. Moreover, the increased metabolic and oxidative stress and inflammation that develop during the progression of heart failure elicit additional structural damage to the heart that also compromises pump function \[[@bib-005],[@bib-006]\]. Thus, the trajectory of heart failure is multipronged and exponential, which makes therapeutic treatment difficult. At best, medicines today slow the progression of heart failure. An alternative strategy to treat heart failure is to restore the function of the heart as a pump using gene therapy. Here, we focus on successful preclinical trials that used viral gene delivery to enhance cardiac myocyte contractility by improving calcium handling, some of which have already progressed to clinical trials.
Calcium handling in the failing heart {#s02}
=====================================
Contraction of cardiac muscle is initiated by the influx of Ca^2+^ via L-type Ca^2+^ channels that open as a result of membrane depolarization brought about by the action potential. This Ca^2+^ activates the sarcoplasmic reticulum Ca^2+^ release channels known as ryanodine receptor 2 (RyR2), leading to a large increase in sarcoplasmic Ca^2+^. The rise in sarcoplasmic calcium causes contraction by Ca^2+^ binding to troponin C, which relieves constraints on actin-myosin interaction and cross-bridge formation. With relaxation, 60%--80% of the sarcoplasmic Ca^2+^ is actively transported into the sarcoplasmic reticulum lumen by the sarco(endo)plasmic reticulum Ca^2+^-ATPase pump (SERCA2a), while the remainder exits the cardiac myocyte by way of the Na^+^-Ca^2+^ exchanger \[[@bib-007]\]. With heart failure, Ca^2+^ uptake into the sarcoplasmic reticulum is impaired due to decreased expression of SERCA2a \[[@bib-007]\]. Activity of SERCA2a is decreased as well, due to an increased association of SERCA2a with its inhibitory regulator phospholamban for two reasons: first, normally, phosphorylation of phospholamban relieves SERCA2a inhibition by causing its dissociation from SERCA2a, but, in heart failure, there is less phosphorylation of phospholamban due to increased protein phosphatase 1 (PP1) activity \[[@bib-008]\]; second, the decreased SERCA2a/phospholamban ratio means that there is more phospholamban relative to SERCA2a, thus favoring SERCA2a inhibition. In addition, the sarcoplasmic reticulum becomes leaky in heart failure due to CaMKII-dependent phosphorylation of RyR2 \[[@bib-009]\]. Thus, in the failing heart, the sarcoplasmic reticulum does not function as well in removing Ca^2+^ from the sarcoplasm, which has two consequences: (1) there is an increase in resting sarcoplasmic Ca^2+^ that contributes to reduced relaxation and diastolic dysfunction; and (2) there is less Ca^2+^ released from the sarcoplasmic reticulum during contraction, which means that the force of contraction is reduced \[[@bib-007]\]. Strategies to improve or restore sarcoplasmic reticulum function would be predicted to reverse heart failure.
Viral gene therapy for heart failure {#s03}
====================================
AAV delivery {#s03_1}
------------
Recombinant AAVs (adeno-associated viruses \-- serotypes 1, 6, 8, and 9 in particular) are currently the most widely used vectors for gene delivery to the heart, mainly due to their relative selectivity for cardiac myocytes, efficient long-term transgene expression, and low immunogenicity and rates of insertional mutagenesis \[[@bib-010]-[@bib-014]\]. However, restricted packaging capacity and inability to evade neutralizing antibodies limit their potential therapeutic effect and usage. Strategies are currently underway to overcome these issues. Cell-specific promoters can be used to further enhance expression of the transgene in cardiac myocytes \[[@bib-015]\]. While numerous vector delivery techniques have been developed, intravascular is the least invasive but effective approach for AAV delivery to the heart, largely due to the ability of the virus to cross the capillary endothelium. To avoid post-intravenous (IV) systemic neutralization and non-cardiac tissue transduction and subsequent toxicity and titer dilution, direct and indirect intracoronary injections are preferred and proven to be more efficient \[[@bib-016]\], and these are the current mode of administrating AAV in heart failure clinical trials. Finally, although AAV-mediated gene expression is relatively long lived, the recombinant vectors used do not integrate into the genome, making it likely that follow-up injections will be needed \[[@bib-017]\]. For more information about the different gene delivery technologies the reader is referred to an excellent recent review by MG Katz et al. \[[@bib-018]\].
SERCA2a on trial: a new era for heart failure management {#s03_2}
--------------------------------------------------------
Impaired SERCA2a activity is associated with high diastolic but low systolic Ca^2+^ levels, which correlate with poor disease prognosis \[[@bib-019]\]. Overwhelming preclinical evidence from animal models has shown the importance of SERCA2a in heart failure and the power of treating heart failure by increasing SERCA2a expression by means of viral transduction of a SERCA2a transgene \[[@bib-020]-[@bib-023]\]. In 2007, Celladon Corporation sponsored the first Phase I/II human clinical trial (\[[@bib-024]\] CUPID; NCT00454818) in which a SERCA2a transgene was transferred, via an AAV1 Vector (MYDICAR), by percutaneous intra-coronary infusion. No safety concerns were revealed by the Phase I open label and sequential dose escalating part of the trial involving nine heart failure patients. A small Phase II, 3-doses, randomized, double-blind, placebo-controlled trial enrolling 39 heart failure patients followed. In addition to supporting the earlier safety findings, this trial reported significant clinical improvement of cardiac remodeling and heart failure symptoms. These results were accompanied by a marked reduction in cardiovascular hospitalization and clinical events that persisted for 6 to 12 months post high-dose treatment \[[@bib-025]\]. A larger Phase II, randomized, double-blind, placebo-controlled, multinational and multicenter clinical trial *A Study of Genetically Targeted Enzyme Replacement Therapy for Advanced Heart Failure* (CUPID-2b) is currently underway (NCT01643330). This trial will hopefully overcome the limitations of the small studies and confirm the efficacy of gene therapy in the management of heart failure. Details on the clinical trials involving AAV-mediated SERCA2a gene therapy are summarized in [Table 1](#tbl-001){ref-type="table"}.
###### Clinical trials on SERCA2a for heart failure
---------------------------------------------------------------------------------------------------------------------------------------
Clinical Trial
---------------------- ---------------------------- ------------------------- ---------------------------- ----------------------------
**NCT** NCT00454818 NCT00534703 NCT00454818 NCT01643330
**Acronym** CUPID NA CUPID CUPID-2b
**Sponsor** Celladon Corporation Imperial College London Celladon Corporation Celladon Corporation
**Study design** OL/SDE R/DB/PC R/DB/PC R/DB/PC
**Outcome measures** Safety\ Safety\ Safety\ Efficacy
Efficacy Efficacy Efficacy
**Drug/Vector** MYDICAR (AAV1-CMV-SERCA2a) AAV6.-CMV-SERCA2a MYDICAR (AAV1-CMV-SERCA2a) MYDICAR (AAV1-CMV-SERCA2a)
**Doses (DRP)** 1.4 × 10^11^\ 5 × 10^12^ 6 × 10^11^\ 1 × 10^13^
6 × 10^11^\ 3 × 10^12^\
3 × 10^12^ 1 × 10^13^
**Delivery** AECAI AECAI AECAI AECAI
**Phase** | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-ijerph-14-00773}
===============
Humans evolved into their current form over 6--7 million years, beginning with our ancestors' evolution from a subset of primates \[[@B1-ijerph-14-00773]\]. This period represents 99.99% of the span of human evolution, during which time we lived in a natural environment. It is therefore considered that human physiological functions are best adapted to natural environments \[[@B2-ijerph-14-00773]\]. The considerable urbanization and artificialization that have occurred since the Industrial Revolution and the rapid spread of modern information technology contribute to the increased "stress state" experienced by humans in modern societies \[[@B3-ijerph-14-00773]\]. In 1984, American clinical psychologist Craig Brod coined the term "technostress" \[[@B4-ijerph-14-00773]\]. In 2008, it was reported that more than 3.3 billion people---half of the globe's population---live in an urban environment \[[@B5-ijerph-14-00773]\]. In response to these stressful situations, scientific evidence supporting physiological relaxation by exposure to natural stimuli from forests and urban green spaces has accumulated \[[@B6-ijerph-14-00773]\]. However, there have been few studies on the relaxation effect derived from familiar, naturally derived stimuli in daily life. Therefore, in the current study, we focused on contact with wood, which has been historically used in indoor environments in Japan.
Wood is a familiar, natural material that has been used in houses and furniture, and it is empirically known to have a relaxation effect on humans. The interest in and expectations of the relaxation effect of wood on humans have increased in recent years, and scientific evidence of this effect is required. In a review outlining the current state of research regarding the physiological effects of wood-derived stimulation on humans \[[@B7-ijerph-14-00773]\], it was reported that data on the physiological effects of olfactory stimulation have continued to accumulate, following the development of physiological measurement technology in recent years. The oldest report, published in 1992, focused on the physiological effect of olfactory stimulation with Taiwan cypress oil \[[@B8-ijerph-14-00773]\], and several other reports have been published since. In recent years, the physiological relaxation effects of olfactory stimulation by stimuli such as air-dried Japanese cypress wood chips \[[@B9-ijerph-14-00773]\], α-pinene \[[@B10-ijerph-14-00773]\], and D-limonene \[[@B11-ijerph-14-00773]\], which are components derived from wood, have been reported. Several studies on visual stimulation have also been conducted using rooms with different designs and proportions of wood \[[@B12-ijerph-14-00773],[@B13-ijerph-14-00773],[@B14-ijerph-14-00773]\] and large wall panels \[[@B15-ijerph-14-00773]\].
In contrast, there have been extremely few reports on tactile stimuli. Morikawa et al. \[[@B16-ijerph-14-00773]\] reported the differential effects on blood pressure when touching plates of Japanese cypress wood vs. artificial material. Sakuragawa et al. \[[@B17-ijerph-14-00773]\] examined differences in the effects of tactile stimulation on human physiology that resulted from materials at different temperatures (cool, room temperature, and warm). They found the following: (1) touching an aluminum plate increased blood pressure, but the increase was inhibited when the aluminum was warmed; (2) touching an acrylic plastic plate increased blood pressure, and a greater rate of increase was observed when the acrylic was chilled; and (3) blood pressure did not change in response to touching objects made of Japanese cypress, Japanese cedar, or oak, and did not increase even when the oak was chilled. These reports are pioneering studies on the physiological effects of tactile stimulation with wood on humans. However, they have limitations in that they only examined blood pressure, which is an index of autonomic nervous activity, as a measure of the physiological response to stimuli. Therefore, in our previous research, we examined the physiological effects on brain activity and autonomic nervous activity of touching uncoated wood vs. other materials with the palm of the hand \[[@B18-ijerph-14-00773]\]. In this previous study, as an indicator of brain activity, oxyhemoglobin (oxy-Hb) concentrations were measured in the left and right prefrontal cortices using near-infrared time-resolved spectroscopy (TRS). Heart rate variability (HRV) was used as an indicator of autonomic nervous activity. The results indicated that touching uncoated white oak wood with the palm calmed prefrontal cortex activity and increased parasympathetic nervous activity more than the other materials (marble, tile, and stainless steel), thereby inducing physiological relaxation \[[@B18-ijerph-14-00773]\].
As a next step, it is necessary to clarify the influence of touching wood with various coatings on the physiological response, as much of the wood used in our everyday lives is coated. Several studies have reported on the psychological effects of contact with coated wood. For example, Bhatta et al. \[[@B19-ijerph-14-00773]\] investigated various coated wood (pine and oak) surfaces through the lateral motion of active fingertip exploration. The results indicated that natural and smooth-finished wood surfaces were perceived as more comfortable and relaxing than varnished and wax coated materials. In addition, Berger et al. \[[@B20-ijerph-14-00773]\] examined the subjective responses of touching interior wooden materials with the palm of the hand and sole of the foot. These results showed that oil-finished wood was evaluated as being subjectively preferable to lacquer-coated material and sheet laminated board material. However, there have been no reports on the effects of tactile (i.e., palm of the hand) stimulation with wood with various coatings on the physiological response.
This study therefore aimed to clarify the effects of touching wood with different coatings with the palm on left and right prefrontal cortex activity, assessed using TRS, and on autonomic nervous activity, assessed using HRV and heart rate.
2. Materials and Methods {#sec2-ijerph-14-00773}
========================
2.1. Participants {#sec2dot1-ijerph-14-00773}
-----------------
The study participants were 18 female university students (mean age, 21.7 ± 1.6 years). We excluded smokers, those currently in treatment for disease, and those with menstrual period during the study period. All the participants were informed about the aim and procedures of the experiment before providing written informed consent to participate. This study was performed in accordance with the regulations of the Ethics Committee of the Center for Environment, Health and Field Sciences, Chiba University, Japan (Project Identification Code Number: 5).
2.2. Study Protocol {#sec2dot2-ijerph-14-00773}
-------------------
Physiological measurements were performed in a chamber with an artificial climate maintained at 25 °C, 50% relative humidity, and 230-lux illumination. In the waiting room, the participants received a description of the experiment and then moved into the chamber. After sensors for physiological measurement were fitted to the participants' forehead, they received a description of the measurement procedure while in a seated position. Next, they practiced touching a stimulus with their palm using a dummy sample (sheet laminated flooring). The experimental procedure was as follows. Participants rested with their eyes closed for 60 s ([Figure 1](#ijerph-14-00773-f001){ref-type="fig"}, left). Upon receiving instructions from the experimenter, they moved their right forearm using their elbow as a fulcrum and placed the palm on the stimulus (hereafter referred to as "material") for 90 s ([Figure 1](#ijerph-14-00773-f001){ref-type="fig"}, right). After touching the material for 90 s, they returned their hand to the previous position upon the experimenter's instruction ([Figure 1](#ijerph-14-00773-f001){ref-type="fig"}, left). The experimenter then replaced the current material with the subsequent material, hid it with a cloth, and instructed participants to open their eyes. Subsequently, participants completed the subjective evaluation test. [Figure 2](#ijerph-14-00773-f002){ref-type="fig"} shows the experimental schedule. Materials were presented in a counterbalanced order to eliminate any effects due to the order of tactile stimulation. Physiological responses were measured continually.
2.3. Tactile Stimulation {#sec2dot3-ijerph-14-00773}
------------------------
White oak (*Quercus alba*) wood was used as the base material. Five laminae without vertical joints (size of each lamina = length 300 × width 60 × thickness 15 mm) were mutually bonded along the width of each wood plate. To prevent bending, a second bonding was performed using Japanese cedar plywood (length 300 × width 300 × thickness 28 mm); the total thickness of the material was 43 mm.
The surface of the white oak material was finished by brushing with a stainless-steel wire brush. Additionally, four samples were prepared: (1) uncoated white oak ("uncoated," [Figure 3](#ijerph-14-00773-f003){ref-type="fig"}A); (2) plant oil with an open pore finish extracted from perilla or flax seed applied once as a topcoat to the white oak using a roll coater ("oil finish," [Figure 3](#ijerph-14-00773-f003){ref-type="fig"}B); (3) ordinary temperature glass-coating agent with an open pore finish applied twice as an undercoat and once as a topcoat to the white oak using a brush ("vitreous finish," [Figure 3](#ijerph-14 | {
"pile_set_name": "PubMed Central"
} |
A significant fraction of the organic carbon produced in the surface sunlit ocean through photosynthesis is exported into the deep ocean as sinking particles ([@r1], [@r2]), supporting a globally relevant carbon flux fueling the generally starved bathypelagic microbial communities ([@r3], [@r4]). Although the carbon reaching the dark ocean is ultimately controlled by the activity of the prokaryotic communities that attach to these particles ([@r5], [@r6]), so far no study has investigated whether sinking particles may also constitute dispersion vectors of viable prokaryotic diversity into the deep ocean.
Particles formed in surface waters are rapidly colonized by prokaryotes, and particle-attached communities are often more metabolically active ([@r7][@r8]--[@r9]) and phylogenetically diverse (e.g., refs. [@r10][@r11]--[@r12]) than suspended (free-living) assemblages. Although it has been shown that particle-attached prokaryotic communities change compositionally with depth (e.g., refs. [@r13][@r14]--[@r15]), it is not clear whether these changes are due to an ecological succession of taxa on the degrading particle ([@r16]) or continuous colonization of the particles during sinking. Assemblages attached to sinking particles could influence the structure of deeper prokaryotic communities if dormant or slow-growing surface taxa thrive when reaching a certain depth or as the nature of the particle changes. In this case, sinking particles would provide a continuous supply of viable immigrants to the deep ocean.
Assessing the relevance of such dispersal process would require comparing particle-attached communities between surface and bathypelagic waters, yet this has never been attempted, not even at local scales. Indeed, the vertical connectivity between communities from surface to bathypelagic waters remains poorly understood because spatial surveys focusing in the vertical dimension often describe the communities from each depth without assessing their potential linkages throughout the water column (e.g., refs. [@r17][@r18]--[@r19]). Only a few recent studies have shown that communities from surface and deep waters may be connected through advection or sinking of water masses ([@r20][@r21]--[@r22]), but they did not consider the role of sinking particles as a vector supporting vertical connectivity. In addition, because large particles sink faster than small particles---which might even remain buoyant ([@r23][@r24]--[@r25])---communities associated with larger, fast-sinking particles are likely to have greater chances to reach the deepest layers due to higher dispersal rates. To date, however, most literature on particle-attached prokaryotes has been restricted to the dichotomous exploration of free-living versus attached populations (e.g., refs. [@r26][@r27]--[@r28]), yet it is known that particles occur along a continuum of sizes that can be colonized by different microbial populations ([@r29]). Furthermore, this continuum of sizes is strongly related to the composition of the particle, which also indicates the particle origin: larger particles are younger and more labile and are originated in the surface ([@r30]), whereas smaller particles tend to be older and more recalcitrant ([@r31]), originating from the degradation of larger particles ([@r32]).
Given that the origin and composition of particles in surface waters vary spatially ([@r25], [@r33][@r34]--[@r35]), it could be hypothesized that the microbial diversity patterns in the deep ocean mirror to some extent such surface heterogeneity. In fact, it was recently shown that deep-sea particle-attached communities present a much clearer biogeography than their free-living counterparts ([@r36]), but whether these patterns are established locally in the deep sea or transferred from surface via sinking particles remains unexplored. Although the importance of hydrologically mediated microbial dispersal for shaping local assemblages has been clearly demonstrated in freshwater ecosystems ([@r37][@r38]--[@r39]) and more recently also in oceanic waters through movement of water masses ([@r20][@r21]--[@r22], [@r40]), the role of particle-driven vertical dispersion in explaining the biogeographic patterns of deep-sea prokaryotes has not yet been assessed.
Here we explore whether sinking particles represent a dispersal vector of prokaryotes into the deep ocean, contributing to the vertical connectivity of the marine microbiome, and test the hypothesis that particle size influences vertical connectivity. We investigated the composition of free-living prokaryotic communities as well as that of those attached to particles of different sizes (ranging from 0.8 to 200 µm) in eight stations across the global tropical and subtropical ocean, assessing changes in their composition from surface (3 m) to bathypelagic waters (4,000 m). Specifically, we test the hypothesis that communities attached to the largest particles show a strong vertical similarity due to their assumed faster sinking rates (i.e., higher dispersal) and that free-living prokaryotic assemblages are more different across the water column than their vertically connected particle-attached counterparts. Moreover, if part of the sinking diversity were to detach from particles when reaching the bathypelagic layer, thus becoming part of the free-living community, a percentage of the prokaryotes attached to particles in surface waters should also be present as free-living in bathypelagic communities. Finally, we test the hypothesis that if vertical connectivity is a globally relevant phenomenon, then deep ocean biogeographic patterns should resemble those of the surface particle-attached communities.
Results {#s1}
=======
Taxonomic Composition of Prokaryotic Assemblages. {#s2}
-------------------------------------------------
We studied stations spanning a broad longitudinal gradient across the tropical and subtropical Pacific, Atlantic, and Indian Oceans ([*SI Appendix*, Fig. S1*A*](http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1802470115/-/DCSupplemental)). The depths sampled within each station presented pronounced vertical physicochemical and biological variation ([*SI Appendix*, Fig. S1*B*](http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1802470115/-/DCSupplemental)). Accordingly, the studied prokaryotic communities were clearly structured along the water column, differing mostly between the photic versus the aphotic realms, and presented also distinct biogeographic signatures ([Fig. 1 *B* and *C*](#fig01){ref-type="fig"} and [*SI Appendix*, Table S1](http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1802470115/-/DCSupplemental)). Whereas communities from the largest particles (≥3.0 µm) clustered together regardless of depth, communities from the two smallest fractions differed greatly between surface and deeper layers ([Fig. 1 *A* and *B*](#fig01){ref-type="fig"}). Consequently, vertical community differences were higher for the smallest size fraction (PERMANOVA *R*^2^ = 0.37, *P* \< 0.001) than for the largest size fractions (*R*^2^ = 0.09, *P* = 0.597) ([*SI Appendix*, Table S2](http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1802470115/-/DCSupplemental)), whereas horizontal differences, i.e., between stations, were higher in the largest size fractions (*R*^2^ = 0.54, *P* \< 0.001) than in the smallest size fraction (*R*^2^ = 0.21, *P* \< 0.753) ([*SI Appendix*, Table S2](http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1802470115/-/DCSupplemental)). As indicated by the RC~Bray~ (Raup-Crick metric based on Bray Curtis distances), the observed beta diversity patterns differed significantly from those expected by chance (i.e., ecological drift) in ∼92% of cases \[following Stegen et al. ([@r41])\], and this suggests that other processes (like selection and limited or high dispersal) rather than random community assembly (drift) generated the observed beta diversity patterns.
{#fig01}
Operational Taxonomic Units (OTUs) richness was highly variable among size fractions and depths (range 136--1,044 OTUs per sample, average 580), but in general, richness decreased toward larger size fractions in all depths ([*SI Appendix*, Fig. S2](http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1802470115/-/DCSupplemental)). In terms of taxonomic composition at the phylum or class level, the three fractions larger than 3.0 µm were in general more similar among each other than they were to the smallest size fractions ([*SI Appendix*, Fig. S3](http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1802470115/-/DCSupplemental)). The distribution of Particle-Association Niche Index (PAN-Index) values, used to identify preferences of OTUs for particular size fractions, showed two modes around values 1.5 and 3.5 ([*SI Appendix*, Fig. S4](http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1802470115/-/DCSupplemental)). We, | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Comprehensive care for people diagnosed with psychosis includes access to adjunctive evidence based psychosocial interventions \[[@CR1], [@CR2]\]. Cognitive remediation therapies for psychosis are recommended in the recently updated Australian and New Zealand College of Psychiatrists clinical practice guidelines \[[@CR1]\]. Translating clinical guideline recommendations for psychosocial interventions into routine practice has been a challenge \[[@CR3], [@CR4]\]. Implementation science provides a framework to guide the translation of evidence based therapies into routine care \[[@CR5]\]. This approach champions external validity and engagement with real world clinical settings and practice.
In an implementation framework program implementation outcomes (fidelity, feasibility, reach, acceptability, maintenance, and costs) are delineated as a distinct outcome category that influences service and clinical program outcomes \[[@CR6]\]. Improved clinical outcomes are seen as arising from the marriage of interventions with robust evidence with effective implementation strategies \[[@CR7]\]. Fidelity refers to the delivery of the intervention as proven to be effective and can be measured at an individual therapist level or at a program level. Feasibility assesses if the intervention has utility for routine use in usual care settings and can be assessed at an individual therapist/ participant level and/or an organisational level. Reach is the level of dissemination within an organisation and is related to treatment access and can be assessed via auditing programs within a population. Acceptability relates to satisfaction with the program and can be assessed at an individual provider or participant level. Maintenance of programs refers to the ongoing use of a program after the initial implementation and depends on the degree to which the program becomes embedded within the usual business of the service and can be assessed via regular audits. Cost of implementing new programs relates to new labour and non-labour establishment and recurrent costs and is of particular concern to the financial management of the provider organisation.
Cognitive impairment is common in people diagnosed with schizophrenia \[[@CR8], [@CR9]\]. The deficits are global and impact on both neuro cognition (attention, memory, planning) and social cognition (difficulties perceiving and processing emotions) \[[@CR9], [@CR10]\]. Approaches to remediation of these deficits have included integrated programs with a combined approach to neuro cognition and social cognition and also stand-alone programs focussing either on neuro cognition or social cognition \[[@CR11], [@CR12]\]. There is evidence from a meta-analysis of randomized controlled trials for the benefit of Cognitive Remediation therapy (CR) on global cognition (Effect Size ES =0.45) with greater benefit if CR is combined with some form of rehabilitation (ES = 0.59) \[[@CR11]\]. The core components of CR appear to be: intensity of practice (2--4 times a week); the combination of drill and practice of tasks with strategy training and a context that facilitates use of new skills learnt. In the meta-analysis, 14 different CR programs were examined with no particular program having superior effect \[[@CR11]\].
There is also evidence from a meta-analysis of the effectiveness of interventions remediating social cognitive deficits in schizophrenia \[[@CR12]\]. Social Cognitive Interaction Training (SCIT) is one example of a social cognition remediation program. It is comprised of three phases (Introduction & Emotions, Figuring out Situations, Checking it out) over 20 to 24 sessions. It is administered in a group format \[[@CR13]\]. It has been delivered in weekly hour-long sessions (20--24 weeks), and weekly 2-h sessions (10-12 weeks) \[[@CR14]\].
Four CR programs and four SCIT programs had been established in Brisbane's Princess Alexandra Hospital (PAH), and the associated health district prior to this study commencing. These programs commenced following staff training in CR in 2008 and SCIT in 2010. In 2012 the service restructured into teams based on diagnosis or model of service (e.g. rehabilitation) to encourage the development of core diagnostically relevant evidence based practices and to more equitably distribute resources. This restructure gave organisational impetus to apply implementation theory to the issue of limited implementation and dissemination of cognitive therapies for psychosis.
Staff from the service involved in psychosis care, Psychosis Academic Clinical Unit (ACU) and Rehabilitation ACU in which the study was carried out developed a plan to guide implementation of CR and SCIT in the 3 geographically defined hospital health districts of the service. The implementation plan was organised around the stages of implementation: exploration/adoption; initial implementation; full implementation and program maintenance \[[@CR7]\]. The exploration/adoption stage had been completed with pilot studies in one hospital site \[[@CR15], [@CR16]\]. The baseline organisational factors were assessed \[[@CR17]\]. The initial implementation focussed on the implementation drivers with the appointment of implementation champions, the formation of the implementation team, the securing of infrastructure for each sites and the establishment of referral pathways and regular training and supervision of staff. The full implementation stage involved annual program audits, and annual program fidelity monitoring. The CR program fidelity for programs implemented in the first year of the study has previously been reported \[[@CR18]\].The maintenance stage involved securing ongoing program funding support, regular training and the development of a pool of program specialists who were involved in providing supervision and iterative program improvements. This study reports on the implementation outcomes of program fidelity, feasibility, reach, acceptability, maintenance and cost, three years into the implementation process.
Method {#Sec2}
======
Design and setting {#Sec3}
------------------
This evaluation study was conducted over three years from 2013 to 2015 and collected information on the implementation outcomes (fidelity, feasibility, reach, acceptability, maintenance, and costs) of CR and SCIT programs implemented.
The study setting was the community mental health services of a metropolitan health service (MHS) with a population of around 920,000 in Brisbane, Australia. The health service comprises three hospital health districts (PAH, Logan and Bayside). It has been estimated that approximately three thousand people residing in this area have severe and persistent mental illness with complex needs (Greater Metro South Brisbane Medicare Local Schedule 10, 2013). The area has high rates of socioeconomic disadvantage with 19.8% of people postponing mental health care because of cost (Greater Metro South Brisbane Medicare Local Schedule 10, 2013). The geographic area covers inner metropolitan suburbs to semi-rural areas. There are three hospitals in the geographically defined health districts.
Population {#Sec4}
----------
### Program facilitators {#Sec5}
Both programs were facilitated by a multidisciplinary group of therapists who had identified an interest in becoming CR and SCIT therapists and had completed the requisite training and credentialing \[[@CR18]\]. The therapy was undertaken as part of their general role in the service with therapy time quarantined and case weighting altered to facilitate staff capacity to undertake this work. There were 12 cognitive remediation therapists (4 psychologists, 2 occupational therapists, 2 psychiatrists, 3 mental health nurses and 1 social worker). There were 10 SCIT therapists (5 psychologists, 2 psychiatrist, 2 nurses and 1 social worker).
### Program participants {#Sec6}
People diagnosed with a schizophrenia spectrum disorder who were being treated in the community, aged between 18 and 65, and who did not have an intellectual impairment or active substance abuse disorder were eligible to participate. Service users could participate in the program and not consent to the evaluation research project.
### Cognitive rehabilitation therapies implemented {#Sec7}
The characteristics of the programs implemented are listed in Table [1](#Tab1){ref-type="table"}. The specific CR interventions used in this study were a computer based program, CIRCuiTS (Computerized Interactive Remediation of Cognitive and Thinking Skills) \[[@CR19]\] and a program based on educational software using computers, Neuro psychological Educational Approach to Cognitive Remediation (NEAR) program \[[@CR20]\]. Both programs run twice a week for around an hour. CR is run as an open group with 4 participants to one therapist.Table 1CR and SCIT program componentsCRSCITComponents• Computer program\
• 15 min bridging group• Manualised therapyFrequency• Twice a week• Once a weekDuration• 10--20 weeks• 10--12 weeksIntensity• 60 min• 120 minMode of delivery• Computer session 45 min + 15 min bridging small group\
• Open group• Small group = 8\
• 2 therapists\
• Closed groupMaterials• Computer\
• Bridging manual• Facilitators Manual\
• Participants Manual
SCIT is based on a manual and uses some resources available freely online. SCIT is run as a closed small group of a maximum of 8 participants and 2 facilitators. The program is structured to build skills over 3 phases focussing in phase 1 on emotional processing; phase 2 focussing on thinking skills in social situations; and phase 3 integrating these skills into real life social situations experienced by participants.
Measures {#Sec8}
--------
### Data sources {#Sec9}
Implementation outcomes were assessed using data from multiple sources including yearly staff surveys, program audits, and measures of program feasibility.
### Yearly staff surveys (Additional file [1](#MOESM1){ref-type="media"}) {#Sec10}
This survey asked questions about staff interest, training and current practice with 8 questions about cognitive behavioural therapy (with SCIT classified as a CBT derived therapy) and 5 questions related to CR. The survey was distributed yearly for the three years of the study to clinical staff in the community psychosis and rehabilitation teams.
### Annual program audits {#Sec11}
Program audits were conducted annually by the program co-ordinator VGJ. For CR the number of programs running in each service, the maintenance of programs established, the number and retention of facilitators, the number of computers and funding was recorded | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-marinedrugs-17-00119}
===============
Most naturally occurring fatty acids have an unbranched chain consisting of an even number of carbon atoms ranging from 4 to 28. Depending on the nature of the hydrocarbonated chain, the fatty acids can be saturated, monounsaturated, or polyunsaturated \[[@B1-marinedrugs-17-00119]\]. Many fatty acids can be synthesized by humans, however not some polyunsaturated fatty acids (PUFAs), such as omega-3 (n−3) and omega-6 (n−6) fatty acids \[[@B2-marinedrugs-17-00119]\]. The parent constituents of omega-3 and omega-6 fatty acids are α-linolenic acid (C~18:3~ n−3, ALA) and linoleic acid (C~18:2~ n−6, LA), respectively. Omega-6 fatty acids, such as arachidonic acid (C~20:4~ n−6; AA), can be synthesized by humans from LA, whereas the essential omega-3 fatty acids, such as eicosapentaenoic acid (C~20:5~ n−3; EPA), docosapentaenoic acid (C~22:5~ n−3, DPA), and docosahexaenoic acid (C~22:6~ n−3, DHA), can be synthesized from ALA. However, the conversion rate of ALA to EPA, DPA, and DHA is very low \[[@B3-marinedrugs-17-00119]\]. Consequently, both omega-6 and omega-3 PUFAs have to be taken up through the diet, preferably at a ratio of 5:1 or less \[[@B4-marinedrugs-17-00119]\]. Presently, the most common source of omega-3 PUFAs is represented by fish of the Salmonidae, Scombridae, and Clupeidae families which contain a high percentage of DHA and EPA \[[@B3-marinedrugs-17-00119]\].
The ever-rising global demand for omega-3 PUFAs cannot be met by fish oil due to diminishing fish stocks and pollution of marine ecosystems \[[@B5-marinedrugs-17-00119]\] which has led to increased interest in alternative sustainable sources. Vegetable oils from genetically engineered plant oilseeds and microorganisms are two potential alternatives to fish oil, even though omega-3 PUFAs are highest in the latter. *Brassica juncea*, *Arabidopsis thaliana*, and *Camelina sativa* are some examples of genetically engineered plant species with potential to accumulate omega-3 PUFAs \[[@B6-marinedrugs-17-00119]\]. Although transgenic plants present numerous advantages, their production is dependent on seasonal and climatic conditions and the availability of arable land. Moreover, there are public concerns regarding the cultivation of transgenic crops in open ecosystems. These, together with regulatory issues, restrict the large-scale production of genetically modified crops \[[@B7-marinedrugs-17-00119]\]. Microorganisms are known natural producers of microbial oils similar to those obtained from plants and animals and a possible source of nutritionally important omega-3 PUFAs \[[@B8-marinedrugs-17-00119]\]. The use of microorganisms benefits from the ability to use biochemical engineering to improve microbial growth rates, low nutrient requirement to achieve growth, easily controllable culture conditions, and availability of well-annotated genomes and metabolic pathways that allow their genetic manipulation \[[@B9-marinedrugs-17-00119]\]. Moreover, microbial oils usually contain a significant amount of natural antioxidants, such as carotenoids and tocopherols, which play an important role in protecting omega-3 PUFAs from oxidation and therefore improve their storage stability. The first commercial product obtained from microbial oil was a gamma-linolenic acid (C~18:3~ n-6)-rich oil produced using the filamentous fungus *Mucor circinelloides* and its production lasted from 1985 until 1990 \[[@B10-marinedrugs-17-00119]\].
Oleaginous microalgae constitute microscopic bio-factories that are capable of producing elevated amounts of oil which can be used as feedstock for omega-3 PUFAs \[[@B11-marinedrugs-17-00119]\]. A number of algal species, such as *Nitzschia*, *Navicula*, *Nannochloropsis*, *Phaeodactylum*, and *Porphyridium*, have been identified as producers of omega-3 PUFAs \[[@B6-marinedrugs-17-00119],[@B12-marinedrugs-17-00119]\]. The utilization of oleaginous microalgae for microbial oil production has many advantages over other non-conventional sources; they attain higher lipid productivity than plants, allow for easy scale-up of upstream and downstream processing, and are less influenced by seasonal or climatic variations. In addition, oleaginous microalgae can utilize numerous low-cost renewable substrates for growth and lipid accumulation \[[@B13-marinedrugs-17-00119]\]. Finally, as opposed to fungi, which form mycelia, microalgae are made of single cells, facilitating their handling in large-scale cultivations \[[@B14-marinedrugs-17-00119]\]. Diatoms are one of the most productive classes of microalgae and can easily adapt to environmental changes \[[@B15-marinedrugs-17-00119]\]. Almost all diatom species can grow photoautotrophically, with a few of them able to grow heterotrophically. *Phaeodactylum tricornutum* utilizes glucose in the presence of light and glucose makes up to 90% of the carbon assimilated into biomass under exponential growth \[[@B16-marinedrugs-17-00119]\]. Transcriptome analysis revealed no correlation between the expression of membrane glucose transporters and light or glucose exposure. Hence, the inability of *P. tricornutum* to grow on glucose in the dark was attributed to the low expression of glucose transporters \[[@B16-marinedrugs-17-00119]\]. As a result, *P. tricornutum* represents a facultative mixotroph that cannot grow heterotrophically on organic carbon in the absence of light. More recently, *P. tricornutum* was shown to grow heterotrophically in the dark on various organic carbon sources following the engineered introduction of glucose transporters \[[@B17-marinedrugs-17-00119]\]. The production of biomass and lipids from microalgae is strongly affected by the mode of cultivation as microalgae can be cultivated photoautotrophically, mixotrophically, heterotrophically, and photoheterotrophically \[[@B18-marinedrugs-17-00119]\]. Heterotrophic and mixotrophic conditions are considered advantageous over photoautotrophic cultivation due to the higher productivity, lipid concentration, and lipid content that can be achieved \[[@B19-marinedrugs-17-00119]\]. However, the high cost associated with organic carbon sources is a major bottleneck for the commercialization of the above process. The use of non-edible lignocellulosic materials and industrial waste as sources of sugars could reduce overall production costs, thereby aiding the transition to large-scale lipid production \[[@B13-marinedrugs-17-00119]\]. Among the various alternatives, wood biomass is an excellent option for countries such as Sweden with as high as 53.1% of its land covered by forests, a thriving forest-based industry, and sustainable forest management \[[@B20-marinedrugs-17-00119]\]. Norway spruce (*Picea abies*) and birch (*Betula pendula* and *Betula pubescens*) account for 40.8% and 12.4%, respectively, of the total standing volume of forest (3490 million m^3^sk) \[[@B20-marinedrugs-17-00119]\]. As these two tree species represent characteristic examples of hardwood and softwood, we developed a novel hybrid organosolv--steam explosion method that yields fractionated, pretreated solids with high cellulose content \[[@B21-marinedrugs-17-00119],[@B22-marinedrugs-17-00119]\]. The ensuing hydrolysates were effectively utilized for the heterotrophic growth of *Auxenochlorella protothecoides* by our group, producing very high lipid yields \[[@B23-marinedrugs-17-00119]\]. Here, we intended to evaluate the use of these hydrolysates for the production of fatty acids of nutraceutical value as an alternative and novel approach. To this end, we developed a cost-effective process for the cultivation of *P. tricornutum*, a species capable of producing EPA-rich lipids, on forest hydrolysates. To the best of our knowledge, this is the first report of forest biomass being used for the production of nutraceutical fatty acids from microalgae.
2. Results and Discussion {#sec2-marinedrugs-17-00119}
=========================
2.1. Effect of Various Initial Glucose Concentrations on the Growth and Lipid Accumulation of P. tricornutum under Mixotrophic Cultivation {#sec2dot1-marinedrugs-17-00119}
------------------------------------------------------------------------------------------------------------------------------------------
Photoautotrophic cultivation requires light as an energy source, CO~2~ as an inorganic carbon source, and nutrients to support microalgae growth \[[@B24-marinedrugs-17-00119]\]. However, some microalgae show enhanced growth under mixotrophic cultivation whereby photoautotrophic and heterotrophic metabolism are simultaneously active, allowing the use of organic carbon sources and, consequently, higher lipid and biomass productivity \[[@B25-marinedrugs-17-00119]\]. To compare the effect of photoautotrophic versus mixotrophic cultivation on biomass and lipid accumulation by *P. tricornutum*, different initial levels of glucose ranging from 0 g/L (control) to 10 g/ | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Pest activities are one of the major problems associated with farming. The animal rearing and creation, as well the management of farming lands, disrupts the ecological stability that regulates potential pest species \[[@CR1]\]. Insects and other arthropods are particularly problematic pests worldwide. In Brazil, where agriculture is the main source of income, insect-pests cause an average annual loss of 7.7% in crop production (US\$ 17.7 billion), resulting in the reduction of approximately 25 million tons of food, fiber, and biofuels \[[@CR2]\]. Chemical pesticides are still the usual method for arthropod-pests control causing great concern, in view of the known negative side effects to humans, animals and the environment. Thus, the development of safer and environmentally compatible new pest control tools is pivotal \[[@CR3]\].
Entomopathogenic fungi are complex organisms that use a myriad of strategies to achieve a successful infection and can be used to control the major arthropod pests of agriculture, as well as vectors of diseases. Among the most commonly entomopathogenic fungi applied in biological control are the species from *Metarhizium* genus, particularly *Metarhizium anisopliae* \[[@CR2]\]. The infection cycle of *M. anisopliae* begins when viable conidia attach to the host cuticle. Under favorable conditions, the conidia germinate and develop the appressorium, a specialized infection structure, in order to transpose the host cuticle barrier. Once into the host hemocoel, hyphae differentiate into blastospores, unicellular infection structures that help in host colonization by fungal dispersion, leading the host to death. After host death, the fungus switches for a saprophytic state, in order to consume the host body and produce new conidia \[[@CR4]\].
In recent years, genome sequencing, RNA-seq, and comparative genomic analyses have been used for an exploratory view of the genomes and for the discovery of new virulence determinants in *Metarhizium* spp. \[[@CR5]--[@CR7]\]. However, the still limited knowledge about *Metarhizium*-host interactions is one of the factors that limit in-depth entomopathogenic application for control of economic important arthropods species. DNA methylation of cytosine bases is a heritable epigenetic mark and an important mechanism to control gene expression. DNA methylation is regarded as a key and stable mechanism to repress gene transcription \[[@CR8]\]. Striking, different isoforms of DNA methyltransferases (DNMTs) are enrolled in the process. These enzymes catalyze the transfer of methyl groups to cytosine bases, leading to the formation of 5-methylcytosine (5mC) \[[@CR8]\]. The presence and genome pattern distribution of 5mCs have been explored in several fungal species, including the *Metarhizium robertsii* \[[@CR9]\]. Remarkably, 5mC patterns in fungal genomes fluctuate from low levels (1.8% *Ganoderma sinense* \[[@CR10]\]) to almost undetectable levels in *Magnaporthe oryzae* (0.22% \[[@CR11]\]) and *M. robertsii* (0.38 to 0.42%). However, these lower levels of DNA methylation still significantly affect the fungal fitness. In *M. oryzae*, DNMT null mutant strains showed defects in asexual reproduction. In addition, such strains displayed an imbalance of transposable elements silencing \[[@CR11]\]. Moreover, *M. robertsii* DNMT knockout strains showed similar defects in asexual reproduction (e.g., defects in conidial production), vegetative growth, and virulence \[[@CR12]\].
In view of DNA methylation importance in several organisms, including species in the *Metarhizium* genus, it is reasonable to expect that this epigenetic mark can regulate major steps, as well as virulence determinants, during entomopathogenic infection. Thus, we explored DNA methylation patterns in *M. anisopliae* during two very distinct conditions: fungal growth over cattle-tick cuticles (i. e., mimicking an infection condition that have been useful for induction of virulence determinants) and in complete rich medium (i. e., a saprophytic growth condition with abundance of nutrients). Additionally, we compared the Bisulfite sequencing (BS-Seq) results with previous RNA-seq data obtained in the same experimental conditions and the results were further confirmed employing quantitative reverse transcription PCR (RT-qPCR) in the presence or absence of DNMT inhibitor. The results here demonstrate that more regions are methylated under the mimicked infection condition. Additionally, we suggest a putative role for DNA methylation repressing putative virulence factors during the transition between virulent and saprophytic states during *M. anisopliae* infection cycle.
Results {#Sec2}
=======
Global mapping of DNA methylation in rich medium (saprophytic-like condition) and tick cuticles (mimicked infection condition) {#Sec3}
------------------------------------------------------------------------------------------------------------------------------
In order to understand the impact of DNA methylation in *M. anisopliae* distinct lifecycles, a BS-seq was conducted using a mimicked infection condition (*M. anisopliae* growth in Tick Cuticles; 48hTC) and a control, saprophytic-like condition (*M. anisopliae* growth in Rich Medium; 48hRM). The experiments herein analyzed followed the recommendations of the Standards and Guidelines for Whole Genome Shotgun Bisulfite Sequencing of the NIH Roadmap Epigenomics Mapping Consortium, which suggests the use of at least two biological replicates with an average coverage of at least 30 times \[[@CR13]\]. Two biological replicates were used from each condition and, after trimming and performing quality controls, an average of 6.5 million and 3.36 million clean paired-end reads were obtained for 48hRM and 48hTC, respectively. Mapped sequencing coverage had an average of 51 times for 48hRM and 31 times for 48hTC. The cytosines present in genome were detected with a high coverage (91.03% for 48hRM and 85.17% for 48hTC). Notably, a higher proportion of the identified methylated sites was found in the 48hTC condition (0.89% of total cytosines detected) compared to the 48hRM condition (0.60% of total cytosines detected). For the 48hRM condition, most methylated sites were found at CHH residues (60.44%), followed by CpG sites (21.25%) and CHG sites (18.31%). For the 48hTC condition, a similar scenario was found, with 61.88% of methylated sites occurring at CHH residues, followed by CpG (20.23%) and CHG (17.89%) sites (Table [1](#Tab1){ref-type="table"}). Table 1Patterns of putative 5mCs sites distribution in the conditions evaluatedCpGCHGCHHTOTAL48hTC0.50%\* (20.23%\*\*)0.55%\* (17.89%\*\*)1.15%\* (61.88%\*\*)0.89%\*\*\*48hRM0.40%\* (21.25%\*\*)0.45%\* (18.31%\*\*)1.85 %\* (60.44%\*\*)0.60%\*\*\*\*Percentage of putative 5mCs sites across the genome normalized by the total number of Cs in a context-dependent fashion;\*\*Percentage of residues predominance among the putative 5mCs sites identified;\*\*\* Percentage of putative 5mCs sites across the genome normalized by the total number of Cs in genome
Identification and functional prediction of putatively methylated mRNA genes {#Sec4}
----------------------------------------------------------------------------
A stringent criterion was used to evaluate potentially methylated genes. It consisted in the identification of 5mCs in the open reading frames (ORFs) of each gene and their respective 500 bp flanking regions. Only sequences spanning an average of 20 5mCs identified were considered methylated. In both conditions (48hTC and 48hRM), a total of 670 protein-coding genes attended such criteria (Fig. [1](#Fig1){ref-type="fig"}a and Additional file [1](#MOESM1){ref-type="media"}). Accordingly, besides more methylated sites, the 48hTC condition showed more putative methylated genes (i. e., 390 mRNA genes were uniquely methylated in the 48hTC condition) when compared with 48hRM (i. e., 135 mRNA genes were uniquely methylated in the 48hRM) with 145 mRNA genes methylated in both conditions (Fig. [1](#Fig1){ref-type="fig"}a). However, no differences could be found in the content of methylation in these 145 putatively methylated genes when the two conditions were compared. Fig. 1Putatively methylated mRNA genes and GO enrichment analysis. **a** Venn diagram depicting the set of methylated genes in 48hTC and 48hRM. **b** Seventy-three GO terms were over-represented, with 55 GO terms in the 48hTC condition, 9 GO terms in the 48hRM condition and 9 GO terms in both conditions. **c** Venn diagram depicting the set of enriched GO terms in 48hTC and 48hRM
To functionally characterize the set of mRNA genes putatively methylated, the predicted proteins were analyzed for the presence of conserved domains using the NCBI Conserved Domain Database (CDD). A small fraction (\~ 5.1%) of the putatively methylated protein coding genes did not presented an associated predicted domain (Additional file [2](#MOESM2){ref-type="media"}). Furthermore, the three most abundant domains refer to | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s0001}
============
For advanced chronic kidney disease patients who will be initiated on HD therapy soon, the type of vascular HD access remains a big challenge. Guidelines from different countries strongly recommend native arteriovenous fistula (AVF) as the best method for dialysis amongst patients who are undergoing hemodialysis \[[@CIT0001]\]. It is well established that AVF had the superiority over other types of vascular access: central venous catheter (CVC) and arteriovenous graft (AVG) since it provides the best longevity, less likely rates of infection and least association with mortality and morbidity in the majority of patients \[[@CIT0012]\]. Despite these advantages of AVF, the number of patients undergoing dialysis through CVC or AVG is high \[[@CIT0016]\]. In 2003, The Fistula First breakthrough initiative (FFBI) which was a National Access Improvement Initiative to encourage the use of AVF as vascular access in HD population. This initiative was established as a collaboration with the Centers for Medicare & Medicaid Services (CMS), the end stage renal disease (ESRD) Networks, and the entire renal community \[[@CIT0010]\]. The FFBI initial goal was to increase the percentage of native AVF use to 44%, in 2009 the percentage of HD patients having AVF was 65% which exceeded the initial goal \[[@CIT0017]\]. Meanwhile, the overall proportion of prevalent AVF utilization increased from 33% in all HD patients in 2003 to 62.7% by the mid of 2016 \[[@CIT0010],[@CIT0016]\]. However, in 2015 United States Renal Data System (USRDS) annual data reported that the percentage of patients receiving HD therapy through CVC was 80% \[[@CIT0016]\]. Achieving optimal AVF access is a complicated process and many barriers have been described, including hospital systems, HD patients, and and provider-related \[[@CIT0018]\]. According to the 2017 annual health report of the Palestinian Ministry of Health, the overall number of HD patients has increased from 1014 patients in 2015 to 1119 patients in 2016 from different 12 dialysis centers in the West Bank, Palestine \[[@CIT0018]\]. To the best of our knowledge, this is the first study in Palestine to investigate the vascular access relevant issues amongst HD patient including perceptions and barriers to AVF use. The aim of this study is to explore patients' perceptions of advantages and perceived barriers that impede AVF utilization as a first vascular access choice.
Material and methods {#s0002}
====================
Study design and setting {#s0003}
------------------------
In this cross-sectional study, we investigate the attitudes toward AVF and the perceived barriers to its creation among Palestinian HD patients. We recruited all adult participants aged 18--85 years, receiving HD as outpatients from August-December of 2018 at Palestinian Medical Complex Hospital in Ramallah, Palestine which is considered one of the largest Ministry of Health dialysis units in Palestine as per the total number of patients who undergo hemodialysis weekly.
Participants {#s0004}
------------
We screened 198 participants who had the diagnosis of ESRD, undergoing regularly scheduled HD sessions of Saturday--Monday--Wednesday or Sunday--Tuesday--Thursday. Exclusion criteria included pediatric age group (less than 18 years), acute dialysis; major mental or neurological illness that precludes their ability to be recruited with fully consenting; refusal to participate; death before completing their data or those who were unavailable at the time of the study. This study was carried out in accordance with the recommendations of the Al-Quds University Research Ethics Committee with written informed consent from all subjects. The protocol was approved by the Al-Quds University Research Ethics Committee.
Data collection {#s0005}
---------------
All participants underwent in-person interviews either before, after, or during the HD session using structured questions. Patients' medical records were all reviewed to collect their demographics and characteristics information. Demographic data collected included age, sex, weight, height, body mass index (BMI). The presence of comorbidities including diabetes mellitus, hypertension, dyslipidemia, coronary artery disease, or cerebrovascular disease was recorded. Data pertaining to the cause of ESRD: Diabetes mellitus, hypertension, polycystic kidney disease, glomerulonephritis, other, or unknown were also obtained.
Information was collected regarding HD initiation, access, and attitudes toward fistula creation and use, including time in months from HD initiation, current access method and whether vein mapping was done before vascular access creation. In addition, data was gathered if patients previously received sufficient education about AVF and for those patients who did not have a fistula or had a delay in its creation, perceived barriers were explored in detail. Furthermore, patients were asked whether they recommend AVF as the preferred access to others, the reasons for their recommendation as well as the characteristics of those who refused fistula.
Statistical methods {#s0006}
-------------------
Data were summarized by calculating means and standard deviation (*SD*) or medians and range for quantitative variables and percentages for categorical variables. Descriptive terms were used where appropriate. The reported attitudes and perceived barriers were analyzed as categorical variables.
Results {#s0007}
=======
We screened 198 Palestinian patients who had the diagnosis of ESRD, and undergoing regularly scheduled HD therapy during the study period that extends from August to December of 2018. Out of them, 156 were included in our study and 42 were excluded (three were pediatric age group (less than 18 years); 2 refused to participate; 22 died before completing their data; and 15 were unavailable at the time of the study).
Patient's age ranged from 18 to 85 years (*M* = 55; *SD* = 15), gender (92 males and 64 females, 59% and 41%, respectively), and 29 (19%) were smokers. Average BMI (*M* = 26; *SD* = 6). At the time of the study, patients had an average time since starting dialysis of 24 months ranged (1 to 216). Detailed demographics characteristics including the cause of ESRD and major associated comorbidities were shown in ([Table 1](#t0001){ref-type="table"}). The current access method for hemodialysis based on age group showed that AVF is highly used in patient's groups who are younger than 55 and between the age of 67 and 79. While, 60% of patients who are between 55 and 66 years use permanent CVC ([Table 2](#t0002){ref-type="table"}). Patient attitudes and perceived barriers toward AVF creation are presented in [Tables 3](#t0003){ref-type="table"} and [4](#t0004){ref-type="table"}.
######
Baseline demographics and characteristics of study participants.
Patient characteristics Overall *n* = 156
----------------------------------------- -------------------
Baseline demographics
Age (years) mean ± *SD* 55 ± 15
Gender
Male, *n* (%) 92 (59)
Female, *n* (%) 64 (41)
Weight (kg) mean ± *SD* 74.2 ± 16.6
Height (m) mean ± *SD* 1.66 ± 8.5
BMI (kg/m^2^) mean ± *SD* 26 ± 6
Smoker *n* (%) 29 (19)
Cause of ESRD
Diabetes mellitus *n* (%) 68 (44%)
Hypertension *n* (%) 23 (15)%
Adult polycystic kidney disease *n* (%) 8 (5%)
Glomerulonephritis *n* (%) 21 (13%)
Other *n* (%) 19 (12%)
Unknown *n* (%) 17 (11%)
Associated comorbidities
Diabetes mellitus *n* (%) 87 (56%)
Hypertension *n* (%) 108 (69%)
Dyslipidemia *n* (%) 60 (38%)
Coronary artery disease *n* (%) 67 (43%)
Cerebrovascular disease *n* (%) 11 (7%)
Peripheral vascular disease *n* (%) 34 (22%)
BMI: Body Mass Index; ESRD: End stage renal disease.
######
Current access method and duration of HD based on age group.
Age group
---------------------------------------------------- --------------- --------------- --------------- ----------
Current access method
Temporary CVC *n* (%) 1 (1.5%) 3 (5.5%) -- 1 (100%)
Permanent CVC *n* (%) 21 (31.3%) 33 (60%) 14 (42.4%) --
AVF *n* (%) 43 (64.2%) 19 (34.5%) 19 (57.6%) --
AVG *n* (%) 2 (3%) 0 -- --
Time in months since HD initiation, median (range) 37.9 (1--216) 25.1 (2--108) 38.6 (1--216) --
HD: Hemodialysis; CVC: Central venous catheter; AVF: arteriovenous fistula; AVG: arteriovenous graft.
######
Perceived barriers toward AVF creation based on age group.
Age group
---------------------------------------------------------- ------------ ------------ ----------- ----------
Reported outcome
Perceived barrier to AVF[^a^](#TF3){ref-type="table-fn"}
Late referral to surgical evaluation | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Aphids (Insecta: Hemiptera), a group of economically important insect pests that consume plant phloem sap, cause substantial losses of crop yield by direct feeding on host plants and by vectoring plant viruses (Dixon, [@B22]). More than 450 species within Aphididae attack agricultural and horticultural plants, of which over 100 are categorized as significant and economically important pests (Blackman and Eastop, [@B13]). While some aphids are specific to plant species in a single taxonomic family, others have an exceptionally broad host range across many plant families. Green peach aphid (*Myzus persicae*) is a generalist with a host range comprising 40 different plant families including Brassicaceae, Solanaceae, and Fabaceae. Moreover, it is the most versatile viral vector, capable of transmitting more than 100 plant viruses (Ramsey et al., [@B56]). In contrast, pea aphid (*Acyrthosiphon pisum*) feeds specifically on legumes. Despite different feeding habits, they are both classified in the tribe Macrosiphini within the subfamily Aphidinae (von Dohlen et al., [@B67]). The close relationship between the two aphids is further supported by analysis of mitochondrial and nuclear sequences as well as transcriptomic sequence comparisons (Ramsey et al., [@B56]; Kim and Lee, [@B38]). Due to the difference in host range, green peach aphids most likely ingest toxic metabolites that pea aphids would not normally encounter, such as glucosinolates in Brassicaceae and alkaloids in Solanaceae, necessitating a more complex metabolic system (Ramsey et al., [@B55]).
Hemipteran immature nymphs and fully developed adults sometimes differ in their feeding behavior. *Lygus hesperus* nymphs prefer developing cotton squares, whereas adults prefer vegetative structures (Snodgrass, [@B60]). In three spittlebug species (*Aeneolamia varia, A. reducta* and *Zulia carbonaria*), foliage-feeding adults are more capable of feeding upon resistant hybrid crops than root- and stem-feeding nymphs (Cardona et al., [@B15]). Besides host and tissue preferences, quantity of food intake can vary (Banks and Macaulay, [@B6]). Profiling in nymphal and adult transcriptomes could reveal biological properties that are developmental stage-specific. In Asian citrus psyllid (*Diaphorina citri*) for instance, the transcriptome comparison revealed distinct patterns of protein and energy requirements between nymphs and adults (Vyas et al., [@B68]). This approach has also identified differentially expressed resistance/detoxification genes, e.g., cytochrome P450, glutathione S-transferase (GST), and ATP-binding cassette transporter genes from two developmental stages of a thiamethoxam-resistant strain of whitefly (Yang et al., [@B73]). Contrasting gene expression among different insect developmental stages on a large scale can not only shed light on development modulation, reproduction, and developmental stage-specific interaction with host plant, xenobiotics, and invading microbes, but can also facilitate the improvement of pest management strategies (Yang et al., [@B73]; Tian et al., [@B65]; Vyas et al., [@B68]). However, stage-specific gene expression in immature nymphs and fully developed adults has not yet been characterized in aphids.
While comparative genomic sequence analysis has furnished tremendous information regarding genetic factors underlying inter-species divergence (Chinwalla et al., [@B19]; Kaufman et al., [@B36]; Kirkness et al., [@B39]; Zdobnov and Bork, [@B77]; Arensburger et al., [@B4]; Bonasio et al., [@B14]; Werren et al., [@B72]), an increasing number of studies have applied RNA-seq for this purpose, particularly in species whose genome sequences are unavailable. For example, transcriptomic comparisons have been performed between different aphids, *A. pisum* vs. *Sitobion avenae* (Wang et al., [@B69]), whitefly (*Bemisia tabaci*) species complexes Middle East-Asia Minor 1 vs. Mediterranean (Wang et al., [@B71]), ranid frogs *Rana chensinensis* vs. *Rana kukunoris* (Yang et al., [@B74]), ornamental primrose species *Primula poissonii* vs. *Primula wilsonii* (Zhang L. et al., [@B79]), and fishes, *Erythroculter ilishaeformis* vs. *Danio rerio* (Ren et al., [@B58]). Comparisons among pea aphid, green peach aphid and grain aphid *(S. avenae)* have enabled investigation of the transcriptome evolution and understanding of the differences in host plant adaptation and insecticide resistance among them (Ollivier et al., [@B50]; Ramsey et al., [@B55]; Wang et al., [@B69]). Between grain aphid and pea aphid 340 gene orthologs are considered to be under positive selection based on the rates of nonsynonymous (Ka) and synonymous (Ks) substitutions (Wang et al., [@B69]). Such orthologs were also identified when Ollivier et al. ([@B50]) compared coding sequences (CDSs) derived from the genome sequence of pea aphid and EST database derived from 5 tissues of green peach aphids reared on 5 host plants (Ramsey et al., [@B56]). Later, Ramsey et al. ([@B55]) sequenced the transcriptome from mixed stages of green peach aphids using 454 pyrosequencing. Besides the reads mapped to the existing ESTs, they obtained 47,832 additional unigenes with a mean length of 160 bp, from which they identified more detoxification genes in green peach aphid than in pea aphid (Ramsey et al., [@B55]). However, limited transcriptomic information may not fully reflect the divergence between the two species.
In this study, we performed transcriptomic sequencing of green peach aphid nymphs and adults using Illumina RNA-seq technology, *de novo* assembled sequencing reads, and annotated the resulting unigenes. Gene expression profiling between nymphs and adults identified genes potentially involved in development modulation. Furthermore, comparative transcriptomic analyses identified genes unique to green peach aphid (relative to pea aphid) and orthologous gene pairs under positive selection. Data analysis has helped expose certain genetic factors underlying host plant adaptation by the two destructive aphid species.
Materials and methods {#s2}
=====================
Plant growth and insect rearing
-------------------------------
Arabidopsis ecotype Col-0 plants were grown in LP5 potting medium (Sun Gro Horticulture, Agawam, WA, USA) in an environmental chamber at 23⋅C (day)/21⋅C (night), 65% relative humidity (RH), and a photosynthetic photon flux density of 88 μmol m^−2^ s^−1^ with a 12-h light/12-h dark photoperiod. The green peach aphid (a tobacco-adapted red lineage from Dr. Georg Jander, Boyce Thompson Institute for Plant Research, Cornell University) had been maintained on Col-0 for over 40 generations. Age-synchronized nymphs and adults were subjected to RNA extraction as described below.
RNA isolation and transcriptome sequencing
------------------------------------------
Neonate nymphs (within 16 h) were placed on 4-week-old Col-0 plants for 4 or 8 days respectively. Sixty 4-day-old nymphs and 60 8-day-old adults were collected, immediately frozen in liquid nitrogen, and stored at −80⋅C for RNA extraction. Three independent biological replicates were performed for transcriptome sequencing analysis.
Total RNA was extracted with TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). RNase-Free DNase (Qiagen, Valencia, CA, USA) was added to remove residual DNA. Samples were then further purified using RNeasy Mini Kit (Qiagen) according to the manufacturer\'s instructions. Purified total RNA samples were quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and qualified by Agilent Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). Transcriptome sequencing was performed on an Illumina HiSeq 2500 platform with 125-nucleotide (nt) paired-end reads at Texas A&M AgriLife Genomics and Bioinformatics Services (College Station, TX, USA).
Sequence assembly and annotation
--------------------------------
After trimming the adaptor sequences and removing short or low-quality reads (\>5% unknown nucleotides or more than 20% nts with \>10% error rate), the processed reads were assembled using Trinity software (Trinity Software, Inc., Plymouth, NH, USA) and clustered with TGICL Clustering tools (The Institute for Genomic Research, Rockville, MD, USA) (Pertea et al., [@B52]; Grabherr et al., [@B28]). The publically available databases, NCBI non-redundant (Nr), NCBI non-redundant nucleotide (Nt), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Cluster of Orthologous Groups of proteins (COG) were used to perform BLAST analyses to annotate the functions of these assembled unigenes (*E*-value cutoff of 10^−5^). Blast2GO software (<http://www.geneontology.org>) was | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Dengue is a mosquito-borne viral infection caused by one of the four dengue virus serotypes (DENV-1 to 4), belonging to genus *Flavivirus*, family *Flaviviridae.* The viruses replicate alternately on the mosquito vector, mainly (*Ae. aegypti*) and human host and are responsible for infections throughout tropical and subtropical regions of the world \[[@B1],[@B2]\].
The rapid global spread of the four DENV serotypes in the last 50 years resulted in the dispersal of genotypes associated with increased disease severity \[[@B3]\]. In Brazil, dengue has been a major public health problem since DENV-1 introduction and spread in 1986 \[[@B4]\], however the introduction of the genotype III of DENV-3, in December 2000, in Nova Iguaçu, State of Rio de Janeiro (RJ), caused one of the most severe epidemics reported in the country in 2002 \[[@B5]-[@B7]\]. Despite the co-circulation of DENV-1, DENV-2 and DENV-3 in that area, DENV-3 was the only serotype detected in pools of *Ae. aegypti* during an entomological surveillance performed \[[@B8]\].
Sequencing of distinct DENV genomic regions has identified five genotypes for DENV-3: Genotypes I to III (GI to GIII) which are responsible for most DENV-3 human infections and have been associated with both dengue fever (DF) and dengue haemorrhagic fever (DHF) epidemics in Southeast Asia, Indian Subcontinent, South Pacific and East Africa and Americas, and Genotypes IV and V (GIV and GV) which were not associated with DHF epidemics and are only represented by few early sequences from Americas, South Pacific and Asia \[[@B9]-[@B13]\].
The DENV genome is composed by a positive single-stranded RNA of approximately 11 kb in length with an open reading frame encoding for the viral polyprotein, which is cleaved into three structural proteins (C, prM and E) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4 and NS5) flanked by 5′ and 3′ untranslated regions (UTRs) of about 100 and 400 nucleotides, respectively \[[@B1]\]. The flaviviruses UTRs are predicted to form secondary stem-loop (SL) structures, which are highly conserved and play a role in viral replication \[[@B14]-[@B18]\].
According to predicted secondary structures, the DENV 3′UTR can be divided into three domains \[[@B18]\]. The domain I, which is located immediately after the NS5 stop codon, is considered the most variable region (VR) within the viral 3′UTR, as it shows large heterogeneity in both length and nucleotide sequences \[[@B19]-[@B21]\]. Mutations and deletions within these regions may alter infectivity and reduce efficiency of viral replication \[[@B22],[@B23]\] and differences between strains in these regions may correlate with DENV virulence and pathogenicity \[[@B24]-[@B27]\]. Furthermore, deletions and nucleotide variations were also described in the VR within the same serotype \[[@B28]-[@B30]\]. Domain II is of moderate conservation, comprising several hairpins motifs and where conserved sequence (CS2) and repeated CS2 (RCS2) are present. Domain III is the most conserved region of the 3′UTR with CS1 followed by a terminal stem-loop (3′SL) \[[@B18]\].
Here, aiming to contribute for the studies on human host-virus-vector interactions, we fully sequenced the genome of one DENV-3 isolated from naturally infected field-caught mosquitoes in RJ and characterized the viral 3′UTR in comparison to other sequenced DENV-3 isolated from naturally infected mosquitoes and human hosts.
Material and Methods
====================
Ethical Statement
-----------------
All human DENV-3 strains belong to a previously gathered collection from the Laboratory of Flavivirus, IOC/FIOCRUZ, RJ, Brazil obtained from acute phase human serum through the passive surveillance system from an ongoing Project approved by resolution number CSN196/96 from the Oswaldo Cruz Foundation Ethical Committee in Research (CEP 274/05), Ministry of Health, Brazil.
*Ae. aegypti* examined in this study were collected by the staff of the Dengue Control State Program for the determination of house infestation index, virological and entomological surveillance. No special permission or written consent is required for house entrance for mosquito collection and larval site treatment.
Viral strains
-------------
The DENV-3 strains isolated from *Ae. aegypti* adult mosquitoes (*n=*4) and human hosts (*n=*10) naturally infected in RJ were collected from epidemics occurred from 2001 to 2008. The first Brazilian DENV-3 strain (BR74886/02) isolated from a human fatal case fully sequenced \[[@B31]\] was used for comparison purposes and detailed information on the strains is provided on Table [1](#T1){ref-type="table"}.
######
Brazilian DENV-3 isolated from naturally infected vectors and human cases analyzed in this study
**Strain** **Origin State\*** **Year of isolation** **Source** **GenBank accession number** **Sequence analyzed** **Reference**
------------ -------------------- ----------------------- ------------- ------------------------------ ----------------------- ---------------------------
BR73354/01 RJ 2001 Mosquitoes FJ177308 Complete genome This study
BR73356/01 RJ 2001 Mosquitoes JN383345 3′UTR This study
BR73636/01 RJ 2001 Mosquitoes JN383346 3′UTR This study
BR81200/06 RJ 2006 Mosquitoes JN383344 3′UTR This study
BR70562/01 RJ 2002 Human serum JN380902 3′UTR This study
BR74792/02 RJ 2002 Human serum JN380899 3′UTR This study
BR74916/02 RJ 2002 Human serum JN380901 3′UTR This study
BR74947/02 RJ 2002 Human serum JN380904 3′UTR This study
BR77515/03 RJ 2003 Human serum JN380900 3′UTR This study
BR78969/04 RJ 2004 Human serum JN380905 3′UTR This study
BR80740/05 RJ 2005 Human serum JN380906 3′UTR This study
BR80996/06 RJ 2006 Human serum JN380903 3′UTR This study
BR83904/07 RJ 2007 Human serum JN380898 3′UTR This study
BR072/08 RJ 2008 Human serum JN380907 3′UTR This study
BR74886/02 RJ 2002 Human liver AY679147 Complete genome Miagostovich et al., 2006
\*RJ: Rio de Janeiro.
DENV-3 human cases
------------------
From 2001 to 2008, the Laboratory of Flavivirus, as a Regional Reference Laboratory for the Brazilian Ministry of Health, received a total of 16,185 dengue suspected cases for routine diagnosis. Virus isolation was attempted in 9,405 cases and DENV-3 was the infecting serotype in 52.8% of the positive isolates. The samples analyzed in this study were chosen randomly and representative of each year, during and after the 2002 epidemic in RJ.
DENV-3 entomological surveillances
----------------------------------
The three DENV-3 strains isolated (BR73354/01, BR73356/01 and BR73636/01) in 2001 from naturally infected *Ae. aegypti* adult mosquitoes used in this study were collected during an entomological survey performed in 35 districts of Nova Iguaçu, RJ, from July 2000 to June 2001. The other DENV-3 strain (BR81200/06) was isolated from naturally infected *Ae. aegypti* adult mosquitoes collected during an entomological survey conducted on 7 districts with different infestation index, randomly chosen in the municipality of Rio de Janeiro, RJ, from March 2005 to February 2006. Briefly, adult mosquitoes were collected twice a week, alternately in the morning and in the afternoon with manual and battery backpack aspirators and with nets, both indoor and in the yards and gardens, close to the dwellings. Mosquitoes were identified using a key as previously described \[[@B32]\], pooled according to gender, date, district of collection and stored in liquid nitrogen at the same day of collection. A total of 503 *Ae. aegypti* mosquitoes (352 females and 151 males) collected in 2000--2001 and 874 *Ae. aegypti* females collected in 2005--2006 were pooled (74 pools of 9--17 mosquitoes/pool in 2000--2001 and 27 pools of 2--10 mosquitoes/pool, jn 2005--2006) and all pools were submitted for virus isolation. Only positive pools were submitted to RT-PCR. for DENV serotype confirmation.
| {
"pile_set_name": "PubMed Central"
} |
1.. Introduction {#sec1}
==================
Precipitation or aggregation of proteins is often problematic when handling protein solution for research and commercial use. Developing methods to inhibit undesired aggregation of proteins is one of the critical issues in the biopharmaceutical field (Shire *et al.*, 2004[@bb16]; Yang *et al.*, 2010[@bb21]). To our knowledge, in protein design studies, we often come across water-insoluble artificial proteins (Isogai *et al.*, 2005[@bb10]; Imamura *et al.*, 2012[@bb8]). In contrast, a mechanism which prevents an uncontrolled aggregation is likely to exist in naturally occurring proteins (Isogai, 2006[@bb9]; Monsellier & Chiti, 2007[@bb14]). Understanding physicochemical mechanisms governing self-association of proteins will be useful for future protein engineering. In the present study, we used a small-angle X-ray scattering (SAXS) technique to analyze protein's interparticle interference, which yields an intermolecular interaction of a protein in solution through use of the theory for liquids (Tardieu *et al.*, 1999[@bb18]). We employed myoglobin as a model protein. Removal of heme is regarded as a kind of simple protein engineering. Interestingly, it was reported that the apomyoglobin, in which the heme is removed, is prone to aggregate, while holomyoglobin, in which the heme is binding, is highly water-soluble (Fändrich *et al.*, 2001[@bb2], 2003[@bb3]). Crystallization of proteins would be controlled by protein's self-interaction. To date, a three-dimensional structure of apomyoglobin by X-ray crystal analysis has not been uploaded to the Protein Data Bank, while holomyoglobin was the first success in the X-ray crystal analysis of the protein structures (Kendrew *et al.*, 1958[@bb12]). Unravelling how removal of heme changes the protein--protein interaction of myoglobin will be a step toward understanding key factors for the aggregation and the solubility.
2.. Materials and methods {#sec2}
===========================
2.1.. Sample preparation {#sec2.1}
--------------------------
Holomyoglobin from equine skeletal muscle was purchased from Sigma. Apomyoglobin was prepared according to the following methods (Teale, 1959[@bb19]; Hapner *et al.*, 1968[@bb7]). 10 mg ml^−1^ aqueous solution of myoglobin was adjusted to pH ∼1.5 with HCl at 297 K. An equal volume of ice-cooled 2-butanone was mixed with the solution, and then the organic phase containing the extracted heme was discarded. This procedure was repeated three times. The aqueous phase was dialyzed against sodium bicarbonate (0.05 g l^−1^) and then ultrapure water (Milli-Q, Millipore). The apomyoglobin solution was finally lyophilized. The solutions of holomyoglobin and apomyoglobin for the measurements were prepared by dissolving the powders into the ultrapure water. The pH of the holomyoglobin and apomyoglobin solutions were 7.5 and 6.7, respectively. The concentrations of both the proteins were determined by using an ∊~410nm~ of 1.6 × 10^5^ for holomyoglobin and ∊~280nm~ of 1.43 × 10^4^ for apomyoglobin (Goto *et al.*, 1990[@bb5]).
2.2.. Small-angle X-ray measurement {#sec2.2}
-------------------------------------
SAXS was measured using a SAXSess camera (Anton Paar; Graz, Austria) with a sealed-tube X-ray source (PANalytical, The Netherlands), operating at 40 kV and 50 mA, and line collimation. X-ray intensities were recorded using an imaging plate (100 µm × 100 µm pixel size; Fuji Film, Japan), which was read using a Cyclone scanner (PerkinElmer, USA). The X-ray wavelength, λ, was 1.542 Å (Cu *K*α); the camera length was 264.5 mm. The image data were integrated into one-dimensional scattering intensities using the program *ImageJ* (developed by Wayne Rasband, National Institute of Health, Bethesda, MD, USA) with the macros in Utah SAXS Tools written by Professor David P. Goldenberg (University of Utah, USA). The scattering parameter *q* is defined as *q* = 4πsinθ/λ, where 2θ is the scattering angle of X-rays. The width of the integration area (detector slit width) was 10 mm. Protein solution and water were measured at 293 K in 1 mm-diameter glass capillaries for 1 h.
2.3.. Calculation of a structure factor from an intermolecular potential {#sec2.3}
--------------------------------------------------------------------------
The SAXS intensity of a protein, *I*(*q*), is described bywhere *c* is the protein concentration, *k* is a constant, *P*(*q*) is a form factor (protein's self-scattering) and *S*(*q*) is a structure factor (protein's interparticle interference). The SAXS profiles of the dilute protein solutions (0.5 wt%), at the concentration of which the interparticle interferences are negligibly small, yields *kP*(*q*) by an indirect Fourier transform program *GNOM* (Svergun, 1992[@bb17]) involving correction of the slit smeared effect. *S*(*q*) can be connected to the intermolecular potential of a protein molecule, *V*(*r*), by solving the Ornstein--Zernike equation with an appropriate closure. In the present analysis, we used the closure obtained from a random phase approximation, under which *S*(*q*) is described by(Hansen & McDonald, 1976[@bb6]; Narayanan & Liu, 2003[@bb15]), where *S* ~0~(*q*) is the structure factor of the reference system, *n* is the protein's number density, *k* ~B~ is the Boltzmann constant and *V*(*q*) is the Fourier transform of *V*(*r*). *S* ~0~(*q*) has been evaluated using the empty core model (Croxton, 1975[@bb1]; Kelkar *et al.*, 1992[@bb11]). The present study employed the Derjaguin--Laudau--Verwey--Overbeek (DLVO) model potential (Verwey & Overbeek, 1948[@bb20]), in which *V*(*r*) is expressed aswhere *r* is the distance between the protein molecules. The term *V* ~HS~(*r*) is the hard sphere potential given bywhere σ is the diameter of the protein. The terms *V* ~C~(*r*) and *V* ~AY~(*r*) are the screened repulsive Coulomb potential and the attractive potential, respectively \[here, *V* ~AY~(*r*) is assumed to be a Yukawa-type potential\], where *Z* is the net charge on the protein, *e* is the elementary charge, ∊ is the dielectric constant of the medium, κ is the reciprocal Debye--Hückel screening length, *J* is the depth of attractive potential at *r* = σ, and *d* is the range of the attractive potential. *S*(*q*) can be simulated, according to the equations described above and the given values for the parameters (*Z*, σ, *J* and *d*). In the present study, we used *Z* = 1 and σ = 41.2 Å, the values of which were from the literature (Longeville *et al.*, 2003[@bb13]). The procedure for the present analysis was performed by using *IGOR Pro* version 6.22A (Wavemetrics, USA).
3.. Results and discussion {#sec3}
============================
Fig. 1[▶](#fig1){ref-type="fig"} shows the observed SAXS profiles of holomyoglobin and apomyoglobin at 0.5 and 6.3 wt%, where the intensities are normalized by the protein concentrations. For both the 6.3 wt% solutions, the intensities at low scattering vectors (*q* \< ∼0.1 Å^−1^) were depressed compared with that for 0.5 wt% solutions, which are due to the interparticle interference, *i.e.* the structure factor. We analysed the structure factor component in the SAXS intensities based on the DLVO model interaction potential and the equations above. A slit-smeared SAXS intensity, *I* ~s~(*q*), was simulated from *I*(*q*), which is from the determined *kP*(*q*) and the theoretically derived *S*(*q*) with equation (1)[](#fd1){ref-type="disp-formula"}, and the instrumental beam profile used as a weighting function (Glatter & Kratky, 1982[@bb4]). To find the values of the parameters (*J* and *d*), which reproduce the experimental *I* ~s~(*q*), we compared the experimental *I* ~s~(*q*) with the calculated *I* ~s~(*q*), varying the values of *J* (0.01--9 *k* ~B~ *T*) and *d* (1--15 Å). The maps of the residual sum of squares are shown in Figs. 2(*a*) and 2(*b*)[▶](#fig2){ref-type="fig"}. It is found that smaller *J | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Across all healthcare settings, clinicians perceive particular patients as \'difficult\' \[[@B1]\]. High users of medical services, these patients are generally unsatisfied with the care they receive \[[@B2]-[@B6]\] and may evoke strong negative emotions in clinicians \[[@B1],[@B7]\]. Although clearly a subjective and imprecise term, the perception of patients as \'difficult\' may result in worse care for patients involved \[[@B8],[@B9]\] and increased stress and burn-out among professionals \[[@B10],[@B11]\]. In the scarce empiric research into patients perceived as difficult in psychiatric services, incidence varies between 6 and 28%\[[@B12],[@B13]\]. Earlier, we found that especially patients who do not comply with the obligations of the sick role as defined by sociologist Parsons \[[@B14]\], run the risk to be perceived as \'difficult\' \[[@B6]\]. People have the right to be relieved from their routine social obligations and not be held accountable for their illness, if only they seek and accept professional help, and do their utmost best to restore good health as soon as possible \[[@B14]\].
Among patients perceived as \'difficult\', patients with long-term non-psychotic disorders may be seen as not complying with the latter obligation. Unlike patients with psychotic disorders - who are more obviously out of contact with reality - they may be held accountable for their behaviours \[[@B6]\]. Among long-term non-psychotic patients, no particular psychiatric diagnosis is associated with difficulty, while the number of psychosocial problems, psychiatric service use, and ways in which clinicians perceive these patients are \[[@B13]\]. Clinician variables, such as a dominant focus on medical problems over interest in psychosocial issues, however, repeatedly have been found to be associated with perceived difficulty \[[@B2]-[@B4],[@B13]\], clearly showing that \'difficult\' is defined within the relationship of patient and clinician.
Although substantial research into the patient-clinician alliance has taken place \[[@B15]\], the perspectives of patients in general and long-term non-psychotic patients in particular have hardly been explored \[[@B16]\]. Also we are aware of only one (small) study that explored the care experiences of \'difficult\' patients \[[@B17]\]. Here, we focussed on the alliance between the perceivedly \'difficult\' patient and the clinician with the purpose to understand why certain patients - according to their accounts of receiving care - come to be perceived as \'difficult\'. Thus, we hoped to shed a different light on the labelling of patients as \'difficult\' and the possibly poor patient-clinician interactions resulting from it. We stated three research questions: (1) which difficulties do patients who are perceived as \'difficult\' experience in their contact with psychiatric clinicians, (2) which explanations do they have for these difficulties, and (3) what changes should be made to decrease these difficulties?
Methods
=======
Design
------
To answer the research questions we used a qualitative Grounded Theory \[[@B18]\] research design with individual interviews of long-term non-psychotic patients perceived as \'difficult\' by clinicians. Grounded Theory is a qualitative research method developed for social scientific research, that aims to develop theory grounded in empirical data. It is also widely used in health sciences, mostly - like other qualitative methods - in areas in which current (theoretical) knowledge is limited. Grounded Theory is considered particularly useful in the study of roles and interpersonal processes due to its origin in symbolic interactionism \[[@B19]\].
Participants
------------
We included patients in public psychiatric care meeting the following requirements, based on a widely accepted definition of severe mental disorder \[[@B20]\]: (1) being in psychiatric care for at least two years, (2) having high psychiatric symptomatology and low social functioning (Global Assessment of Functioning \[GAF\] score ≤50 \[[@B21]\]), (3) suffering from a non-psychotic disorder on DSM Axis I and/or a personality disorder on DSM Axis II. One subjective criterion regarding difficulty as perceived by treating clinicians was added. Participants had to have had disagreement over form or content of treatment with two or more professionals at least once in the past two years, as assessed by at least two clinicians. A similar criterion has been used in earlier studies \[e.g. \[[@B12]\]\] and, as imperfect as it is, adds concretization (disagreement), quantity (at least once in past two years), and intersubjectivity (two clinicians).
Procedure
---------
We selected 12 outpatient departments in three mental health institutes in The Netherlands, striving for a differentiated sample of locations, according to degree of treatment specialization, nature and severity of psychopathology, and geographical dispersion. Key figures of these departments were informed about the research project and were asked to invite clinicians to participate. Treating clinicians (community psychiatric nurses, psychiatrists, psychologists, and social workers) introduced the research to eligible patients as an investigation into difficult relations between psychiatric patients and clinicians. After patients gave consent to establish contact, the first author checked their eligibility with the clinician and then called or e-mailed the patients to arrange an individual interview at their preferred location. After getting acquainted and having explained the project, informed consent, basic socio-demographic and clinical data were obtained prior to the interview. Each participant received a gift certificate to the equivalent of €35/£30.
Data collection
---------------
Two experienced qualitative researchers (BK & JvO) carried out open-ended interviews between March 2008 and September 2009. The research team (BK, JvO, RP, BvM, AK) spent two instructional meetings to immerse in the subject, to design the interview structure and to practice its application. A topic guide, based on a literature search of relevant databases and patient literature was flexibly used \[additional file [1](#S1){ref-type="supplementary-material"}\]. In the first series of eight interviews, participants were asked after certain topics if they had not mentioned them at all. In the following series of interviews, these checking questions were replaced by questions originating from the analysis of previous interviews.
Participants were invited to start their account by the general question: \"Which problems do you experience in contact with psychiatric clinicians, both now and in the past?\". Next, the interviewers invited participants to tell in detail about each of these problems and suggest possible explanations for them. Patients were also invited to suggest solutions or alternatives for the present care. All interviews were electronically recorded and transcribed verbatim. Transcripts were analysed in their original language, Dutch, while relevant quotations were translated into English for this paper.
Data analysis
-------------
Data analysis took place between March 2008 and October 2009 in an iterative process, typical to the Grounded Theory-method of constant comparison \[[@B18]\]. Each member of the research team independently coded two out of the first four interviews and checked it against coding by the others \[[@B22]\]. This procedure was followed to construct a mutually agreed on initial code tree, from which further coding could be done by one person (BK), using MAXQDA-software \[[@B23]\].
The research team met after respectively 4, 8, 11, 14 and 21 interviews to discuss progress, monitor interviewers\' techniques and congruence, evaluate and conceptually analyze coded interviews, select and explore emerging categories and the mutual relationships, and design theoretical sampling strategies for following interviews. After eight interviews, six main large descriptive categories were constructed to order data. Each category fell apart in three to seven sub-categories. After 11 interviews, a tentative theoretical model of the care process was constructed and a preliminary core category (\'incongruous expectations and perceptions of needs\') was identified. After 14 interviews, an extensive thick description of data was written, structured according to the six descriptive categories. It was discussed and commented on in the research team, resulting in a number of additional questions used in the following interviews to clarify, refine, and expand the categories. Also after 14 interviews, intermediate results were sent to the participants interviewed for a member check, and were accepted as they were. In addition to the existing questions, in interviews 15 through 21 the tentative model was presented to participants and their feedback was elicited. A summary of the research findings and the final theoretical model was discussed in the final meeting after 21 interviews. Methods and results were discussed with external supervisors (AS & GH) after 8, 14 and 21 interviews.
An example of the analytical process is the *in vivo*(1^st^order) code \'clinician feels offended\', that was categorized under \'clinicians\' accountability\', then under \'clinicians\' professional characteristics\', that finally became part of one of the six main categories \'professionals\'. Furthermore, because of the both personal and professional qualities of this characteristic of clinicians which was believed relevant to further analysis, a memo (called \'mixing up of personal and professional characteristics\') was added to this fragment. Next, other clinician characteristics were explored and coded in detail, paying attention to for instance causes and consequences (*axial coding*). When clinicians\' characteristics became part of the central theme of this research, it was further explored in relation to the model later reported on (*selective coding*).
As posited by Lincoln and Guba \[[@B24]\], qualitative research should show sufficient rigour, or \'trustworthiness\' in their words. In order to enhance this project\'s credibility and dependability, member checking was used to validate intermediate findings. Also, peer debriefing was done with the external supervisors, and a thick description was made to allow co-researchers to assess the research\' transferability. A detailed log book, consisting of memo\'s about data collection, analysis, and interpretation, was kept to ensure confirmability.
Ethical approval was obtained from the Institutional Review Board of the organisation the 1^st^author is affiliated with. Informed consent was obtained from all participating patients. | {
"pile_set_name": "PubMed Central"
} |
Introduction {#S0001}
============
Prostate cancer is the sixth most frequent cancer in the world (in the number of new cases), the third most common cancer in men, and the most frequent cancer in men in Europe, North America, and some parts of Africa \[[@CIT0001]\]. The most general sites of prostate cancer distant metastasis are bones, regional lymph nodes, lung, liver, brain, and the epidural space \[[@CIT0002]\]. However, metastasis from prostate cancer is an extremely unusual situation with a reported rate of 0.4% to 1% of cases \[[@CIT0003]\]. We report two prostate cancer cases that presented with a supraclavicular bulky mass as the initial and the most bothersome symptom.
Case 1 {#S0002}
======
A 78-year-old male who attended the emergency department with a bulky left supraclavicular mass was consulted because of lower urinary tract symptoms. Physical examination revealed a solid, multilobulated mass in the left supraclavicular region, measuring 9 cm at its longest diameter. He reported weight loss of 15 kg over the previous four months and symptoms related to lower urinary tract obstruction for five months.
Laboratory investigations in terms of whole blood count, blood chemistry and urinalysis were all in the normal ranges. A thorough genitourinary examination revealed no obvious pathology. Digital rectal examination (DRE) revealed a hard, irregular prostate with a volume of 58 cc in transrectal ultrasonography (TRU). Serum prostate-specific antigen (PSA) level was 171.0 ng/ml. Bone scintigraphic examination revealed a metastatic lesion at the fifth lumbar vertebra.
Fine needle biopsy of the left-sided supraclavicular lymph node was performed. Histological examination revealed a lymph node widely replaced by metastatic adenocarcinoma staining positive for PSA and prostate-specific acid phosphatase consistent with metastatic adenocarcinoma of the prostate ([Fig. 1](#F0001){ref-type="fig"}). Therefore, twelve quadrant fine needle biopsies were performed under TRU guidance which revealed a prostate cancer with a Gleason score of 8/10.
{#F0001}
He was started on cyproterone acetate, 100 mg, three times a day and leuprorelin acetate injections, 3.75 mg, monthly. Ten months later, the patient had significant symptomatic relief with a marked reduction in supraclavicular lymphadenopathy and a decreased prostate-specific antigen level of 12.1 ng/ml.
Case 2 {#S0003}
======
A 65-year-old male patient was admitted to the oncology outpatient clinic with complaints of left supraclavicular lymphadenopathy. Physical examination revealed a solid, 5 cm mass in the left supraclavicular region.
Laboratory investigations in terms of whole blood count, blood chemistry and urinalysis were all in the normal ranges. A thorough genitourinary examination revealed no obvious pathology. Digital rectal examination (DRE) revealed a hard, irregular prostate with a volume of 64 cc in transrectal ultrasonography (TRU). Serum prostate-specific antigen (PSA) level was \> 1500 ng/ml. Serum free PSA level was \> 25 ng/ml. Bone scintigraphic examination revealed multiple vertebral metastatic lesions.
Trucut biopsy of the left-sided supraclavicular lymph node was performed. Histological examination revealed a metastatic adenocarcinoma staining positive for PSA and prostate-specific acid phosphatase consistent with metastatic adenocarcinoma of the prostate. He was started on bicalutamide 50 mg once a day.
Discussion {#S0004}
==========
Prostate cancer is the most frequent cancer and the second leading cause of cancer death in men \[[@CIT0004]\]. Dissemination of prostate cancer into the adjacent organs (urethra, bladder neck and seminal vesicles) is rare \[[@CIT0005]\]. Prostate carcinoma is known to invade by way of three mechanisms: local, haematogenous spreading, and lymphatic metastasis \[[@CIT0006]\]. Bone represents the principal location of distant metastasis in prostate cancer \[[@CIT0007]\]. Lymphatic spreading occurs most often in regional lymph nodes such as the obturator, internal and external iliac lymph nodes, presacral and para-aortic lymph nodes. Distant superficial lymphadenopathy is a rare symptom on initial presentation in prostate cancer \[[@CIT0008]\].
In terms of a supraclavicular mass discovered during physical examination, most frequently nasopharynx, oral cavity and upper gastrointestinal tract cancer metastases to cervical and supraclavicular lymph nodes are observed \[[@CIT0009]--[@CIT0011]\].
Saeter *et al*. \[[@CIT0012]\] noted that, in 35 patients with non-regional lymphatic invasion from prostate carcinoma, the left supraclavicular fossa was the most common location of metastasis in 69% of cases. Butler *et al*. published 19 patients with prostate cancer presenting at first with supraclavicular lymphadenopathy, in which the diagnosis was verified by prostate biopsy in 14 patients. They reported that only 42% of all patients had an abnormal DRE \[[@CIT0013]\]. Case 1 also had an abnormal DRE. Woo *et al*. described a 76-year-old patient presenting with supraclavicular lymphadenopathy. They noted a normal prostate on DRE. A PSA performed a few days after admission was 326 ng/ml and a fine needle biopsy of the lymphadenopathy confirmed a prostate cancer metastasis \[[@CIT0014]\]. Cho *et al*. reported 26 cases of metastatic prostate cancer in supradiaphragmatic lymph nodes, in which only 7 cases had a history of prostate cancer; they noted that 58% had an abnormal rectal examination \[[@CIT0015]\].
Although prostate cancer is widespread, the prostate is often overlooked as the first site for men presenting with supraclavicular lymph node metastases \[[@CIT0005]\]. Fine needle aspiration biopsy of supraclavicular lymph nodes may be useful for pathological diagnosis of prostate cancer metastasis. In our patients, serum PSA level and immunohistochemical staining for PSA in biopsy material were used in detection of the primary location of the cancer. Two patients had highly elevated serum PSA levels, and bone scintigraphic examination revealed metastatic lesions.
It should always be kept in mind that prostate cancer is the most frequent cancer in elderly men, and although very unusual, the presenting finding can be a cervical or supraclavicular lymphadenopathy; thus clinicians should be aware of urological examinations of such cases.
| {
"pile_set_name": "PubMed Central"
} |
{#sp1 .348}
{#sp2 .349}
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
An elastance--resistance model is an effective tool to quantify the systolic pumping mechanics of the heart in in situ, open-chest experiments \[[@CR5], [@CR14], [@CR21], [@CR22]\]. Parameters generated by this model to characterize the cardiac physical processes are maximal systolic elastance (*E*~max~) and theoretical maximum flow (*Q*~max~). Physically, *E*~max~ can represent the intrinsic myocardial contractility in an intact heart because (1) it reflects subtle changes in the contractile status of the left ventricle and (2) it is independent of the preload, afterload, and heart rate for a given cardiac contractile state \[[@CR11], [@CR24]\]. *Q*~max~ is the amount of outflow generated by the ventricle if it were to eject under zero-load condition, and it shares an inverse relationship with the resistive behavior of the left ventricle \[[@CR20], [@CR22]\].
To develop an elastance--resistance model for assessing the cardiac pumping properties, simultaneously recording the left ventricular (LV) pressure and aortic flow (*Q*^m^) followed by recording the isovolumic LV pressure is indispensable \[[@CR5], [@CR14], [@CR21], [@CR22]\]. The ascending aorta-occlusive method must be used to measure the isovolumic LV pressure at the end of diastole under open-chest conditions. Obviously, the technique for recording the isovolumic LV pressure is not permitted in human patients. In 1997, Chang and Kuo \[[@CR7]\] used a high-fidelity multi-sensor catheter to simultaneously measure the LV pressure and aortic flow in anesthetized, closed-chest dogs. A curve-fitting technique, proposed by Sunagawa et al. \[[@CR26]\], was performed to estimate the isovolumic LV pressure by using the recorded instantaneous LV pressure of an ejecting contraction. They discovered that an elastance--resistance model with the estimated isovolumic LV pressure can potentially be used to study the systolic pumping mechanics of the heart.
In 1989, Kelly et al. \[[@CR12]\] found that second zero crossing of fourth-order derivative of aortic pressure is close to peak of flow. The approximation of the aortic flow to a triangle (*Q*^tri^) was reported and validated by Westerhof et al. \[[@CR29]\]. In their study, the timing of the peak of the triangle was derived using a fourth-order derivative of the aortic pressure waveform. Using *Q*^tri^, they successfully separated the measured aortic pressure pulse into its forward and backward components. In 2017, Wang et al. \[[@CR28]\] evaluated a method for determining the slope (*E*~es~) of the end-systolic pressure--volume relation (*ESPVR*) on the basis of the measured LV pressure and an assumed *Q*^tri^. In their study, *Q*^tri^ was derived using a fourth-order derivative of the LV (but not aortic) pressure to approximate its corresponding *Q*^m^.
The present study elaborated these concepts by determining the LV *E*~max~ and *Q*~max~ by using the measured LV pressure without recording the isovolumic LV pressure and aortic flow signals. A single-beat estimation technique was employed to calculate the *E*~max~ and *Q*~max~ by using an elastance--resistance model based solely on the measurement of the LV pressure and cardiac output. The technique proposed by Sunagawa et al. \[[@CR26]\] was used to estimate the isovolumic LV pressure from the measured LV pressure. An uncalibrated *Q*^tri^ was constructed from the measured LV pressure based on the method proposed by Wang et al. \[[@CR28]\]. The *Q*^tri^ scale was calibrated using the cardiac output. Values of *E*~max~^triQ^ and *Q*~max~^triQ^ obtained using *Q*^tri^ were compared with those of *E*~max~^mQ^ and *Q*~max~^mQ^ obtained from the measured *Q*^m^. Healthy rats (NC), rats with chronic kidney disease (CKD), and rats with type 1 or type 2 diabetes mellitus (DM) were analyzed. If the proposed method works out, the systolic elastic and resistive behaviors of the ventricular pump in human patients can be quantitated by using a minimally invasive measurement on the LV pressure together with non-invasive measurement on cardiac output.
Methods {#Sec2}
=======
Animals and catheterization {#Sec3}
---------------------------
Male Wistar rats aged two months were divided into the following four groups: (1) NC (*n* = 25), (2) CKD (*n* = 14), (3) type 1 DM (*n* = 20), and (4) type 2 DM (*n* = 12). Female healthy rats (FNC; *n* = 7) were also included in the present study. According to the method reported by Floege et al. \[[@CR9]\], CKD was induced through 5/6 subtotal nephrectomy (i.e., right nephrectomy and ligation of two branches of the left renal artery) in rats under anesthesia with sodium pentobarbital (50 mg kg^−1^; intraperitoneal). The levels of serum creatinine and blood urea nitrogen were determined using an autoanalyzer (Model 7070, Hitachi Electronics Co., Ltd., Tokyo, Japan). Type 1 DM was induced through a single-tail vein injection with 55 mg kg^−1^ streptozotocin (STZ; Sigma, St. Louis, MO, USA) in 0.1 M citrate buffer (pH 4.5; Sigma) \[[@CR28]\]. Type 2 DM was induced by intraperitoneally administering 180 mg kg^−1^ nicotinamide (NA) (Sigma, St. Louis, MO, USA) 30 min before an intravenous injection of 50 mg kg^−1^ STZ dissolved in 0.1 M citrate buffer (pH 4.5) \[[@CR15]\]. To confirm hyperglycemia, the blood glucose levels were measured using a SURESTEP Test Strip (Lifescan Inc., Milpitas, CA, USA) in the rats with induced DM. Changes in the systolic mechanical behavior of the ventricular pump were monitored 8 weeks after DM and CKD induction. All the rats were provided ad libitum Purina chow and water and housed under 12-h light--dark cycles. The experiments were conducted according to the Guide for the Care and Use of Laboratory Animals, and our study protocol was approved by the Animal Care and Use Committee of the National Taiwan University \[[@CR28]\].
The cardiodynamic variables were measured in the anesthetized rats, according to previously described general surgical procedures and methods \[[@CR28]\]. Briefly, the rats were anesthetized with sodium pentobarbital (50 mg kg^−1^; intraperitoneal), placed on a heating pad, intubated, and ventilated using a rodent respirator (Model 131, New England Medical Instruments, Medway, MA, USA). The chest was opened at the second intercostal space on the right side. An electromagnetic flow probe (100 series; internal circumference, 8 mm; Carolina Medical Electronics, King, NC, USA) was positioned around the ascending aorta to measure the pulsatile aortic flow. A high-fidelity pressure catheter (Model SPC 320; size, 2F; Millar Instruments, Houston, TX, USA) was inserted through the isolated right carotid artery into the left ventricle to measure the LV pressure. The electrocardiogram (ECG) of lead II was recorded using a Gould ECG/Biotach amplifier (Cleveland, OH, USA). Signals (5--10 beats at steady state) were selected on the basis of the following criteria: (1) recorded beats with optimal LV pressure and aortic velocity profiles; (2) beats with an RR interval less than 5% different from the average value for all recorded beats; and (3) exclusion of ectopic and post-ectopic beats. The selective beats were averaged in the time domain by using the peak R wave of the ECG as a fiducial point. A single-beat estimation technique was used to calculate the *E*~max~ and *Q*~max~ that characterize the systolic pumping mechanics of the heart \[[@CR7]\].
Construction of an isovolumic pressure and a triangular flow from the measured LV pressure {#Sec4}
------------------------------------------------------------------------------------------
The isovolumic LV pressure (*P*~iso~, Fig. [1](#Fig1){ref-type="fig"}b) can be derived from the measured LV pressure of an ejection contraction (*P*~LV~, Fig. [1](#Fig1){ref-type="fig"}a) by Eq. ([1](#Equ1){ref-type=""}) described in Appendix 1. The estimated peak isovolumic pressure (*P*~isomax~) is the pressure sum of the peak developed isovolumic pressure (*P*~idmax~) and the LV end-diastolic pressure (*P*~d~) (Fig. [1](#Fig1){ref-type="fig"}b). The uncalibrated *Q*^tri^ can be constructed by using the measured LV pressure waveform demonstrated in Appendix 2. An inverse Fourier transformation of the fourth-order derivative of the LV pressure with the first 15 harmonics (Fig. [1](#Fig1){ref-type="fig"}c) was used to determine the onset, termination, and peak time points of the triangle (green curve, Fig. [1](#Fig1){ref-type="fig"}d). The *Q*^tri^ scale was calibrated using the cardiac output.Fig. 1Construction of the LV isovolumic pressure (*P*~ | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Enhancement technology is regarded as one of the most active fields of digital image processing. It improves the quality and appearance for low contrast image, and it can be used in monitoring, imaging systems, human-computer interaction \[[@B1]--[@B3]\], and many other areas \[[@B4]--[@B9]\]. The histogram equalization (HE) technique is simple and easily implemented, which is most extensively utilized for contrast enhancement. HE utilizes the cumulative density function (CDF) of image for transferring the gray levels of original image to the levels of enhanced image. The main drawback of HE is that it tends to change the mean brightness of the image to the middle level of the dynamic range and results in annoying artifacts and intensity saturation effects. This drawback makes HE technique unsuitable for many consumer electronics applications, for example, TV and cameras.
In order to overcome the shortcomings mentioned above, many other HE-based methods have been proposed, such as the brightness preserving bihistogram equalization (BBHE) \[[@B10]\], dualistic subimage histogram equalization (DSIHE) \[[@B11]\], and minimum mean brightness error bihistogram equalization (MMBEBHE) \[[@B12]\]. BBHE \[[@B10]\] partitions the histogram based on the image mean while DSIHE \[[@B11]\] uses image median to segment. MMBEBHE \[[@B12]\] recursively divides the image histogram into multiple groups based on mean brightness error (MBE). Although these methods have made great progress, they still have their own drawbacks, including failing with images having nonsymmetric distribution \[[@B10]\], failing to preserve mean brightness \[[@B11]\], producing more annoying side effects \[[@B12]\], and losing structural information \[[@B13]\]. In these techniques, however, desired improvement may not always be achieved, and the difference between input and output image is minimal \[[@B14]\].
Chen and Ramli proposed the method called recursive mean-separate histogram equalization (RMSHE \[[@B15]\]), in which the authors suggested recursive division of histograms based on the local mean. The mean brightness of processed image approaches towards the mean brightness of input image. Wang et al. improved DSIHE \[[@B11]\] into recursive subimage histogram equalization (RSIHE \[[@B16]\]) based on contrast enhancement, by introducing recursive segmentation in the similar manner as Chen and Ramli proposed in \[[@B15]\], although this method is similar to RMSHE \[[@B15]\] but it uses median values instead of mean values to divide histogram into subhistograms.
Adaptively modified histogram equalization (AMHE) \[[@B17]\] method is developed by Kim et al., which can modify the probability density function (PDF) of the grayscale as well as apply histogram specification to the modified PDF. Unfortunately, the entire redistribution to the original histogram by those methods can cause overenhancement, underenhancement, and some artifacts appearing in some smooth regions. Although the AMHE \[[@B17]\] does not produce any degradation, it darkens the bright areas of the sky and fails to boost the brightness of the dark regions.
In addition, some other methods based on histogram equalization for contrast enhancement with brightness enhancement have also been proposed, such as the dynamic histogram specification introduced by Sun et al., which preserves the shape of the input image histogram but does not enhance it significantly \[[@B18]\]. Tsai et al. suggested a contrast enhancement algorithm for color images \[[@B19], [@B20]\]. Huang et al. proposed an adaptive gamma correction with weighting distribution (AGCWD \[[@B21]\]) to enhance the contrast and preserve the overall brightness of an image; in the method, the gamma correction and a probability distribution for luminance pixels were used. The AGCWD technique may not give desired results when an input image lacks bright pixels since the highest intensity in the output image is bounded by the maximum intensity of the input image, because the highest enhanced intensity will never cross the maximum intensity of the input image \[[@B22]\]. Besides, AGCWD \[[@B21]\] leads to loss of information in processed image due to its sharp increasing resultant transformation curve described below.
An image enhancement technique using the idea of exposure value, named image enhancement using exposure-based subimage histogram equalization (ESIHE \[[@B23]\]), was advanced. The method divided the clipped histogram into two parts by using the precalculated exposure threshold \[[@B24]\]. The effects of using intensity exposure in histogram segmentation before histogram clipping were studied in \[[@B25]\]. Through simulation on standard images, low contrast images, and noisy images, the study showed that \[[@B25]\] could yield a certain enhancement results; however, the method usually causes underenhancement. Tang and Mat Isa introduced an algorithm named bihistogram equalization using modified histogram bins (BHEMHB) \[[@B26]\], which segmented the input histogram based on the median brightness and altered the histogram bins before HE is applied, but it made limited improvement for contrast.
In order to effectively increase the contras of the input image with brightness and details well preserved, an efficient algorithm named Mean and Variance based Subimage Histogram Equalization (MVSIHE) is developed in this paper. The proposed method is more effective for preserving the mean brightness and details of the enhanced image while improving the contrast compared with some other state-of-the-art methods. According to the experiments based on 100 images for our method, we know that the MVSIHE technique can achieve the multiple objectives of entropy maximization, details, and brightness preservation as well as control on overenhancement. The main contributions of this paper are as follows. Firstly, we introduce the mean and variance based algorithm to divide the histogram of the image. Secondly, a novel transformation called hyperbolic tangent transformation is developed to modify the histogram bins to overcome this domination problem. Thirdly, we put forward a normalization transformation, which can make the brightness component of the output image have a wider dynamic range and the output image look more natural and clearer. Furthermore, results indicate that the proposed method is a better approach compared to the state-of-the-art methods.
This paper is organized as follows: [Section 2](#sec2){ref-type="sec"} describes the proposed MVSIHE method. Data samples and performance evaluations are given in [Section 3](#sec3){ref-type="sec"}. [Section 4](#sec4){ref-type="sec"} shows experimental results and comparisons with state-of-the-art methods, and our concluding remarks are included in [Section 5](#sec5){ref-type="sec"}.
2. Proposed Image Enhancement Method {#sec2}
====================================
2.1. Threshold Calculation Based on Mean and Variance {#sec2.1}
-----------------------------------------------------
The histogram of an image is divided into four parts with three thresholds which are adaptive and obtained by the same method. The procedure to obtain the thresholds will be presented in detail as follows.
An input image *X* is given; let *H* \[*l*~low~, *l*~up~\] be the global histogram of the input image *X*, where *l*~low~ and *l*~up~ represent lower and uppermost intensities of the image *X*. *H*(*l*) is the histogram of the gray level *l*, which is described as$$\begin{matrix}
{H\left( { l} \right) = n_{l}\mspace{1800mu} for\,\, l = l_{low},\ldots,l_{up},} \\
\end{matrix}$$where *n*~*l*~ is the of gray level *l* in the image *X*, the pdf of the image, pdf(*l*), can be defined as $$\begin{matrix}
{pdf\left( { l} \right) = \frac{H\left( l \right)}{\left( {M\ast N} \right)}\mspace{1800mu} for\,\, l = l_{low},\ldots,l_{up},} \\
\end{matrix}$$where *M∗N* is the total number of pixels in the input image *X*.
The threshold value for histogram segmentation can be obtained. First, we divide the whole histogram into two parts by an adaptive threshold *k*. Then the two parts can be presented as Sub~0~{0 \~ *k*} and Sub~1~{*k* + 1 \~ *l*~max~}. The probability of each part can be solved by$$\begin{matrix}
{{Sub}^{1,2}\text{:}\,\,\omega_{0}\operatorname{} = {\sum\limits_{l = 0}^{k}{pdf\left( { l} \right)}},} \\
\\
{{Sub}^{2,2}\text{:}\,\,\omega_{1}\operatorname{} = {\sum\limits_{l = k + 1}^{l_{max}}{pdf\left( { l} \right)}}.} \\
\\
\end{matrix}$$
Next, the mean value of each part can be calculated by$$\begin{matrix}
{{Sub}^{1,2}\text{:}\,\,\mu_{0}\operatorname{} = {\sum\limits_{l = 0}^{k}\frac{l\ast pdf\left( l \right)}{\omega_{0}}},} \\
\\
{{Sub}^{2,2}\text{: }\mu_{1}\operatorname{} = {\sum\limits_{l = k + 1}^{l_{max}}\frac{l\ast pdf\left( l \right)}{\omega_{1}}}.} \\
\\
\end{matrix}$$
Therefore, the mean of the whole image *X* is described as $$\begin{matrix}
{\mu = \mu_{0}\omega_{0} + \mu_{1 | {
"pile_set_name": "PubMed Central"
} |
Talin links integrins to the actin cytoskeleton at focal adhesions. On page 43, Morgan et al. show that talin also links synaptic activity to actin rearrangements.
FigureRings of actin (green) around synaptic vesicle clusters are lost when talin cannot bind PIPKIγ (right).
Synapses are specialized sites of cell adhesion that were recently shown to hold talin. Talin interacts with PIPKIγ, a PI(4,5)P~2~-producing enzyme, which in turn regulates talin and other actin regulatory proteins. The importance of this interaction is now shown at synapses, where PI(4,5)P~2~ also controls clathrin coat dynamics.
The authors interfered with talin--PIPKIγ interactions in the axons of giant lamprey neurons. The interference inhibited the recycling of synaptic vesicles on the presynaptic side. Clathrin-coated pits formed but did not bud off the plasma membrane. These changes were associated with reduced synaptic actin networks. The defects are probably due to low levels of PI(4,5)P~2~ resulting from a block in PIPKIγ recruitment to the membrane. The same lab has also recently shown genetically that PI(4,5)P~2~ is necessary for synaptic vesicle trafficking (Di Paolo et al. *Nature*. 431:415--422).
As PIP~2~ production is up-regulated by neuronal depolarization, the authors are now studying how the talin-PIPKIγ interaction is affected by the firing of synapses.
[^1]: <lebrasn@rockefeller.edu>
| {
"pile_set_name": "PubMed Central"
} |
The content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.
Introduction
============
Venous thromboembolism (VTE) includes both venous thrombosis and pulmonary embolism (PE). It is associated with significant morbidity and mortality with a 30-day death rate of about 3% and 31%, respectively, in those left untreated \[[@REF1]\]. Despite being on therapeutic doses of anticoagulation, patients can still develop recurrent PE, which is appropriately termed "anticoagulation failure." The rate of recurrent PE is up to 4% with low-molecular-weight heparin (LMWH) and 2-4% with vitamin K antagonists (VKA) \[[@REF1]\].
Case presentation
=================
A 32-year-old Caucasian female presented to the emergency department with an acute onset of shortness of breath (SOB). Her past medical history was significant for recurrent VTE of unknown etiology with removal of an inferior vena cava filter due to misplacement. She had no family history of thromboembolic disorder and no past medical history of smoking or oral contraceptive usage. Her first episode of PE was spontaneous about six years ago followed by multiple episodes of VTE that required thrombolysis on three separate occasions. Her comprehensive hypercoagulable workup in the past included factor V Leiden mutation, JAK2 V617 mutation, Lupus anticoagulant, antithrombin III activity, PNH flow cytometry, factor II gene mutation, protein C, protein S, anti-cardiolipin antibody, anti-beta-2 glycoprotein-1 antibody, and homocysteine levels, which were all unremarkable. She had recurrent PE on many therapies including warfarin (with therapeutic international normalized ratio of 2.5-3.5), rivaroxaban, apixaban, dabigatran, heparin, and fondaparinux. She also had a history of rash secondary to enoxaparin making management more complicated. Her pertinent physical exam findings on presentation included hypoxia on 2 liters of nasal cannula with oxygen saturation at 96%, respiratory rate of 22 and decreased breath sounds bilaterally in the lung bases with no signs of deep vein thrombosis (DVT). A computed tomography (CT) scan of the chest with contrast on admission showed new pulmonary emboli on the right side.
At this point it was challenging to decide the next step in management since she had failed most known anticoagulants in the past. This also caused much physical, psychological, and financial burden on the patient due to recurrent hospitalizations over a short period of time.
The hematology service was consulted, and after a thorough discussion with the patient, rivaroxaban 15 mg twice daily was initiated since she had failed the 20 mg once daily dose in the past. Unfortunately, after about three weeks of rivaroxaban treatment she presented with another episode of PE. She was started on therapeutic heparin at this time with activated partial thromboplastin time (aPTT) range between 90-140 seconds. A higher aPTT range was selected given her recurrence. She required large doses of heparin to maintain her aPTT, but after it was maintained at the new therapeutic goal, her breathing eventually improved and she did not require further oxygen supplementation. At this time, the hematology service decided to combine two oral anticoagulants to prevent further episodes of PE since she has had recurrence on heparin. They initially recommended combining a second oral anticoagulant with rivaroxaban such as apixaban or dabigatran, but due to the patient's health insurance coverage issues and the higher price of novel oral anticoagulants, two drugs from this class did not seem feasible. Instead, she was started on warfarin with a therapeutic goal INR range of 2-3 along with rivaroxaban 15 mg bis in die (BID). At the time of writing this manuscript, six months since the patient was seen, she has had no recurrence of PE or signs of bleeding.
Discussion
==========
Venous thromboembolism (VTE), including DVT of the extremities or pelvis and PE, is associated with a significant morbidity and mortality with approximately 60,000 to 100,000 deaths in the United States every year \[[@REF2]\]. Anticoagulation is the mainstay of treatment in patients with VTE, and aggressive management is essential in decreasing mortality \[[@REF2]\].
The optimal management of anticoagulation failure includes dose escalation, switching to a different anticoagulant or adding an antiplatelet drug \[[@REF3]\]. The literature was reviewed to find the utility of adding an antiplatelet drug such as aspirin in our patient, but it was shown to only be beneficial in antiphospholipid syndrome \[[@REF3]\] and not in other patient groups. We trialled all the aforementioned strategies before ultimately placing the patient on dual anticoagulants including dose escalation of rivaroxaban and using different anticoagulants. Unfortunately, she had recurrence of thromboembolic events in each case.
Another approach to anticoagulation failure is by combining anticoagulants \[[@REF2]\]. Two case reports in the literature were found pertaining to dual anticoagulation \[[@REF2]\]. The first case report included a 43-year-old female with clear adenocarcinoma of the ovary who presented with recurrent VTE despite being on a therapeutic dose of dalteparin \[[@REF2]\]. Coumadin was added to dalteparin with a therapeutic INR goal of 2-3, after which there was no recurrence of thromboembolic events \[[@REF2]\]. The second case report was a 57-year-old male with colon adenocarcinoma who was started on dual anticoagulation with warfarin and dalteparin after he failed dalteparin monotherapy \[[@REF2]\]. In both case reports, thromboembolic events were prevented with no bleeding episodes for more than three to four months \[[@REF2]\]. Of note, the patients in these case reports had a diagnosis of cancer, and the utility of dual anticoagulant therapy in patients without a diagnosis of cancer is not well established.
We did an extensive literature review and could not find any case reports utilizing dual anticoagulant therapy in the management of VTE in those without a diagnosis of cancer \[[@REF2]\]. There is no evidence to our knowledge to support the practice of combining warfarin with other oral anticoagulants, which was ultimately done successfully in our patient since she failed a large variety of monotherapies. The only evidence we found at this time towards dual anticoagulants is combining LMWH with warfarin. Unfortunately, this could not be done with our patient since she had developed a rash with enoxaparin in the past \[[@REF2]\].
Conclusions
===========
In summary, this case report is unique in demonstrating that dual anticoagulation can be used in patients with recurrent VTE especially when monotherapies have failed them. Caution should be exercised in evaluating the benefits and risks (mainly bleeding) before giving this treatment. Further studies are needed to determine the optimal combination of anticoagulation with minimal bleeding risk.
The authors have declared that no competing interests exist.
Consent was obtained by all participants in this study
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction
===============
Stroke is one of the leading causes of morbidity and mortality worldwide. More than 80% of strokes are ischemic and are caused by obstruction of one or more cerebral arteries \[[@b1-ad-9-5-924], [@b2-ad-9-5-924]\]. Lack of blood supply deprives the brain cells of necessary glucose and oxygen, and disturbs cellular homeostasis, culminating in neuronal death. Currently, tissue plasminogen activator (tPA) is the only effective pharmacological therapy approved by the Food and Drug Administration for acute ischemic stroke since 1996, but its use remains limited due to the narrow therapeutic window \[[@b3-ad-9-5-924]-[@b6-ad-9-5-924]\]. It is imperative to develop novel therapeutic strategies of stroke \[[@b7-ad-9-5-924], [@b8-ad-9-5-924]\].
Mitochondria, as the powerhouse of cell, play a critical role in cell energy homeostasis and are thus inevitably involved in the ischemic neuronal death. After ischemia, due to the reduced blood supply, the energy balance is disrupted and adenosine triphosphate (ATP) synthesis is disturbed. In addition to their fundamental role in energy generation, mitochondria are critical involved in the regulation of such forms of cell death as apoptosis, autophagy and necroptosis. Mitochondrial dysfunction has been regarded as one of the hallmarks of ischemia/reperfusion (I/R) injury which induces neuronal death\[[@b9-ad-9-5-924]\]. Accumulating evidences indicate that the maintaining of the mitochondrial function is crucial for neuron survival and neurological improvement. Therefore, targeting mitochondria is one of the promising neuroprotective strategies for stroke treatment \[[@b10-ad-9-5-924]\]. Recently, it has been demonstrated that mitochondria can be transferred from astrocytes to neurons and served as "help-me signaling" in cell-to-cell communication after cerebral ischemia \[[@b11-ad-9-5-924]\]. In this review, we will discuss current knowledge on the role of mitochondria in cell death and cell survival, and highlight the advance of mitochondria-based therapy in stroke. In particular, we will emphasize the most critical mechanisms responsible for mitochondrial quality control, as well as the recent findings on mitochondrial transfer in acute ischemic stroke.
2. Pathophysiology of ischemic stroke
=====================================
Ischemic stroke is a consequence of a critical reduction of regional cerebral blood flow (rCBF), leading to severe oxygen and glucose deprivation. Mitochondrial disfunction induced by oxygen and glucose deprivation occurs within minutes after ischemia, resulting in depletion of ATP production and overproduction of reactive oxidative species (ROS). Compared to other brain cells, neurons have higher energy demand, but their energy reserves are limited. Depletion of ATP is one of the major initiator, which triggers the ischemic cascades such as, membrane ion pump failure, efflux of cellular potassium, influx of sodium, chloride and water, and membrane depolarization \[[@b12-ad-9-5-924]-[@b14-ad-9-5-924]\]. Multiple mechanisms, including excitotoxicity, mitochondrial response, free radical release, acidotoxity, protein misfolding, and inflammation have been extensively studied as the events leading to the cellular death and neuronal loss after stroke \[[@b15-ad-9-5-924]-[@b17-ad-9-5-924]\], which are depicted in [Fig. 1](#F1-ad-9-5-924){ref-type="fig"}.
Figure 1.Mechanisms underlying neuronal death in ischemic stroke(1) Mitochondrial response, including excessive ROS production, mitochondrial calcium overloading, and disrupted mitochondria quality control. (2) Excitotoxicity. Excessive glutamate release and impeded reuptake of excitatory amino acids result in the activation of NMDARs, AMPARs and KARs. (3) Acidotoxity. Extracellular acidification leads to ischemic neuronal death by activating acid-sensing ion channel 1a (ASIC1a). (4) Protein misfolding. Protein misfolding and aggregation are observed after brain ischemia. (5) Inflammatory reaction. Microglia are activated and release cytokines and chemokines to induce inflammation reaction. All the factors mentioned above work synergistically to trigger cell death pathways such as apoptosis, necroptosis and autophagy. ROS: reactive oxygen species; AMPAR: α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid receptor; NMDAR: N-methyl-D-aspartate receptor; KAR: kainite receptor; DAPK1: death associated protein kinase 1; PSD95: postsynaptic density protein 95; ASIC1a: acid-sensing ion channel 1a; RIPK1: receptor interacting protein kinase 1; TNF-α: tumor necrosis factor-α; IL-6: Interleukin 6; IL-1: Interleukin 1.
######
Mitochondrial dynamic-related proteins.
Mammals Yeast Role in mitochondria dynamics Location
-------------------- --------- ------------------------------- -----------------------------------------------------------
Drp1 Dnm1p Fisson cytosolic, and recruited to outer membrane during fission
Fis1 Fis1p Fisson Outer mitochondrial membrane
Endophilin B1 \- Fisson cytosolic, and recruited to outer membrane during fission
Mfn1/2 F201p Fusion Outer mitochondrial membrane
Opa1 Mgm1p Fusion Inner mitochondrial membrane
KIFs \_ Transport Cytosolic
Cytoplasmic dynein Dynclil Transport Cytosolic
There are two major zones of injury in ischemic brain: the infarct core and the ischemic penumbra. The "infarct core" is the area with the blood flow decline below the threshold of energy failure (15%-20%). The "infarct core" will be irreversibly damaged during few minutes after stroke and cannot be salvaged \[[@b18-ad-9-5-924]\]. On the contrary, ischemic penumbra is the region with impaired functions, but preserved structure integrity \[[@b19-ad-9-5-924]\]. Cells in penumbra are salvageable if reperfusion is established during the early hours or collateral circulation is adequate to maintain the neuronal demand for oxygen and glucose \[[@b15-ad-9-5-924]\]. Therefore, the penumbra is the pharmacological target for the treatment of acute ischemic stroke.
In the infarct core, neuronal cells undergo necrotic alterations, which are accompanied by glutamate release and excitotoxic cell damage to neighboring regions \[[@b20-ad-9-5-924]\]. The penumbra is moderately hypoperfused and energy metabolism is partially preserved, which transiently sustain tissue viability. Timely interventions are effective to avoid the progression of the penumbra into infarction. The molecular mechanisms leading to the cell death in the penumbra differ from those in the infarct area. Several types of regulated cell death such as autophagy, apoptosis, necroptosis, and pyroptosis can be triggered by ischemia and contribute to the post stroke brain injury. To some extent, different kind of cell death can cross-regulate each other \[[@b21-ad-9-5-924], [@b22-ad-9-5-924]\]. Mitochondria can be considered as one of the master regulators of stress signaling \[[@b23-ad-9-5-924]-[@b26-ad-9-5-924]\] ([Fig. 2](#F2-ad-9-5-924){ref-type="fig"}). The impairment of mitochondrial respiratory function and membrane potential activate the cascade of events that leads to neuronal death after ischemia. Depolarized mitochondria initiate excessive ROS production, decreased ATP generation, PTEN-induced putative kinase 1 (PINK1) accumulation, as well as unfolded protein response (UPR) \[[@b27-ad-9-5-924]\]. The increased levels of ROS and overloading calcium open the membrane permeability transition pore allowing for the release of cytochrome c, which activates the effector caspases and the final execution of apoptotic death \[[@b28-ad-9-5-924]\]. PINK1 selectively recruits Parkin and phosphorylates both Parkin and ubiquitin to trigger mitophagy \[[@b29-ad-9-5-924]\]. Interruption of the signaling pathways is apparently able to disrupt, or in some instances greatly delay, the spiral of increasingly vicious reactions that culminate in cell death.
Figure 2.Mitochondria play a central role in ischemic neuronal deathIschemia triggers the depolarization of mitochondrial membrane potential (ΔΨm), reduction of ATP production, accumulation of PINK1, recruitment of Parkin, overproduction of reactive oxygen species (ROS), overloading of matrix calcium, and opening of mitochondrial permeability transition pore (mPTP), eventually leading to neuronal death.
3. Structure and function of mitochondria
=========================================
Mitochondria are ovoid or rod-shaped organelles with double-membrane structure, which consist of four distinct compartments - the outer membrane, the intermembrane space, the inner membrane, and the matrix \[[@b30-ad-9-5-924]\]. The outer membrane contains a number of pores which form large aqueous channels to permit free diffusion of molecules less than 5000 daltons into the intermembrane space. The intermembrane space contains proteins (e.g. cytochrome c) that play major roles in mitochondrial energetics and apoptosis. In contrast to the outer membrane, the inner membrane has much more restricted permeability, equipped with a variety of ion channels and transporters as well as mitochondrial enzyme systems like the electron | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Uveitis is an infectious or non-infectious inflammatory disease of the uvea and other intraocular tissues including the retina, vitreous, and lens. With an incidence of more than 50/100,000-person years, uveitis is a common cause of legal blindness in the western world \[[@CR1]\]. In infectious uveitis, the etiology is specific, and the presentation may be characteristic of that infection, although not necessarily for syphilis, tuberculosis, and some AIDS-related opportunistic infections which may mimic many other forms of autoimmune non-infectious uveitis. However, the pathophysiology of non-infectious uveitis is not fully understood, and the etiology might be multifactorial---involving an interplay of genetic, immune, and environmental factors. Viral prodrome that is associated with the presentation of many non-infectious uveitis entities could provide a link connecting the two. Similarly, gut commensals provide a signal directly through the retina-specific T cell receptor and cause autoreactive T cells to trigger uveitis. Microbiota may also serve as an "adjuvant" providing innate signals that amplify and direct the host immune response for development of uveitis \[[@CR2]\].
Induction of biologic drugs in the treatment of non-infectious uveitis has introduced a new treatment modality in the field of uveitis. Basic research done in this field has paved way for newer molecules which offer a more targeted and specific therapeutic approach. Anti-TNF-α, considered the first-line biological agent recommended in the treatment of uveitis, has proven remarkably effective. It is by virtue of rapid inflammation control and increased tolerability due to minimal, specific, and manageable side-effects. Despite these benefits, most studies show that approximately 50% of patients with non-infectious uveitis treated with anti-TNF are unresponsive/intolerant \[[@CR3]\]. Both physicians and patients have increased expectations from therapeutic agents and end result is not just a good control of inflammation but achieve total clinical remission early in the disease course, so that minimal sequelae result.
Non-responsiveness to TNF blockade and/or residual disease activity, as well as the ongoing, slowly progressing structural damage in a significant proportion of patients treated with TNF inhibitors suggest that---apart from TNF---there are other biological targets involved in the disease process. Interleukin 6 (IL-6) has emerged as a major player in the pathogenesis of autoimmune disease and chronic inflammation. Infection and inflammation cause significant upregulation of IL-6, which features pleiotropic activity and mediates various biological functions. It causes induction of acute-phase reactants in liver, T cell differentiation, regulates inflammatory cells, homeostasis, and healing after tissue injury \[[@CR4]\]. Various systemic autoimmune diseases and certain types of cancers have been associated with dysregulation in IL-6 production \[[@CR5]\]. In cases of diabetic macular edema, retinal vein occlusion, and chronic uveitis, IL-6 has been found to be significantly elevated in ocular fluids \[[@CR6], [@CR7]\]. In the past decades, tocilizumab, a monoclonal antibody (mAB) which targets IL-6 receptor (IL-6R), has been investigated and approved for therapeutic use in a number of immunologic diseases. Several clinical trials have reported it to be effective for the treatment of uveitis and associated macular edema \[[@CR8]--[@CR11]\].
IL-6 biology: mechanism of action {#Sec2}
=================================
Human IL-6 is a 26 kDa protein made up of 212 amino acids codified by a gene located in chromosome 7p21 \[[@CR12]\]. IL-6 triggers signal transduction after binding the IL-6 receptor (IL-6R). There are two forms of IL-6R: the 80 kDa transmembrane receptor protein and the 55 kDa soluble form (sIL6-R). It is believed that the pleiotropic effect of IL-6 derives from the broad range of cells expressing gp130. IL-6 plays an important role in protecting the host against environmental insults and sends out warning signals through all systems of body about the occurrence of acute events. Physiological levels of IL-6 are very low (1--5 pg/ml) and hardly detectable in serum, but the levels can increase \> 100,000-fold during acute inflammatory response \[[@CR13]\].
Different cell types in the body produce IL-6, including cells of innate immune system such as neutrophils and monocytes/macrophages. IL-6 is important in the integrated host defense against numerous pathogens including bacteria, fungi, viruses, and mycobacteria \[[@CR14]\]. When these infectious pathogens stimulate Toll-like receptors (TLRs) by producing pathogen-associated molecular patterns (PAMPs), they result in prompt production of IL-6 by monocytes and macrophages. In non-infectious inflammation such as during burns and trauma, the affected cells produce damage-associated molecular patterns (DAMPs) which in turn stimulate TLRs, to produce IL-6 \[[@CR15]\]. Expression of inflammatory cytokines such as IL-6, TNF-α, and IL-1β is upregulated through various signaling pathways initiated by PAMPs and DAMPs. TNF-α and IL-1β in turn can activate transcription factors to synthesize IL-6 \[[@CR16]\].
IL-6 stimulates hepatocytes to induce synthesis of acute-phase reactants like C-reactive protein (CRP), fibrinogen, haptoglobin, alpha-1-antichymotrypsin, and serum amyloid A. CRP is a consistent biomarker of inflammation and is often employed to monitor various inflammatory processes. Its expression mainly depends on IL-6 \[[@CR17]\]. Persistent elevation of alpha-1-antichymotrypsin and serum amyloid A has been associated with the pathogenesis of Alzheimer's disease \[[@CR18]\].
Reduced serum iron levels have been reported secondary to IL-6-mediated hepcidin production; latter exerts antagonistic action on the iron transporter ferroportin-1 in intestinal epithelium. This IL-6-hepcidin interaction might be responsible for the anemia found in chronic inflammatory states \[[@CR19]\]. IL-6 also upregulates the expression of ZIP 14 (zinc importer), which results in low levels of zinc in chronic inflammation. IL-6 downregulates the expression of fibronectin, albumin, and transferrin. This change in acute-phase reactants is routinely used in clinical laboratory tests for detection of inflammation.
In addition to its role in host defense, IL-6 mediates various biological functions. IL-6 induces activation of stem cells and helps megakaryocytes' maturation into platelets during hematopoiesis \[[@CR20]\]. In bone marrow, IL-6 upregulates the receptor activator of nuclear factor kappa-B ligand (RANKL), which in turn leads to bone resorption and osteoporosis by activating osteoclasts \[[@CR21]\].
Production of IL-6 in inflamed tissues upregulates vascular endothelial growth factor (VEGF), which results in increased angiogenesis and vascular permeability \[[@CR22]\]. IL-6 promotes proliferation of dermal keratinocytes, and collagen production by fibroblasts, which may contribute to the pathogenesis of diseases like psoriasis, systemic sclerosis, and thyroid eye disease \[[@CR23]\].
IL-6 receptors and signaling pathways {#Sec3}
=====================================
Interleukin 6 plays an important role in host defense against environmental stress such as infection and injury. Dysregulated IL-6 production has been implicated in the development of various autoimmune diseases and chronic inflammatory diseases. IL-6 is a prototypical four-helix bundle cytokine that is a member of the neuropoietins, which includes IL-6, IL-11, IL-27, IL-31, leukemia inhibitory factor, oncostatin M, cardiotrophin-1, neuropoietin, and neurotrophin-1 \[[@CR19]\]. These cytokines are structurally related and bind to Class I cytokine receptors. With the exception of IL-31, all IL-6 type cytokines share the membrane glycoprotein gp130 as a common beta receptor and signal transducer subunit \[[@CR24], [@CR25]\].
IL-6 signaling occurs through two cellular pathways: the classical and trans-pathway. In the classical signaling pathway, IL-6 binds to membrane-bound type I receptor complex consisting of the ligand-binding glycoprotein, IL-6α. The expression of this receptor is mostly restricted to leukocytes and hepatocytes. The IL-6/IL-6α complex subsequently associates with gp130 leading to gp130-homodimer formation \[[@CR26]\]. In trans-pathway, IL-6 provides signaling to cells lacking IL-6R via binding to soluble IL-6R (sIL-6R), which is generated by alternative splicing or ectodomain shedding of the membrane-bound IL-6 receptor (Fig. [1](#Fig1){ref-type="fig"}) \[[@CR27]\]. Both classical and trans-signaling pathways are gp130-mediated and activate the same intracellular pathways. Fig. 1IL-6 classic-signaling and IL-6 trans-signaling. IL-6 classic signaling requires membrane bound IL-6R and is restricted to hepatocytes, some epithelial cells and some leukocytes. IL-6 trans-signaling requires sIL-6R and is possible on all cells of the body since all cells express the gp130 protein. Adapted from "IL-6 trans-signaling via the soluble IL-6 receptor: Importance for the pro-inflammatory activities of IL-6." by Rose-John S, Int J Biol Sci 2012; 8:1237-1247 \[Copyright: Ivyspring International Publisher\]
After the formation of gp130 homodimer, IL-6 initiates the intracellular signaling by activating the Janus kinase family tyrosine kinases (JAKs) \[[@CR28]\]. | {
"pile_set_name": "PubMed Central"
} |
Exotropia in healthy children younger than 1 year of age is rare, and several studies have been conducted on this disease entity \[[@B1][@B2][@B3][@B4][@B5][@B6][@B7]\]. Occlusion therapy alone is not sufficiently effective in reducing exodeviation, and surgery is the most promising treatment for early-onset exotropia as well as intermittent exotropia \[[@B8]\].
Although non-surgical treatments, including occlusion therapy, have limitations as a single treatment for intermittent exotropia \[[@B9]\], surgery in combination with preoperative occlusion therapy has been found to more effective in reducing exodeviation and has shown a superior success rate compared to that of surgery alone \[[@B10]\].
Occlusion therapy is frequently recommended for patients with exotropia to prevent amblyopia or/and suppression \[[@B11]\]. However, no studies have investigated whether preoperative occlusion therapy is effective in reducing recurrence after surgery for early-onset exotropia. Therefore, we investigated the effect of preoperative part-time occlusion therapy on long-term outcome after surgery for early-onset exotropia.
Materials and Methods
=====================
The study was approved by the ethics committee of Gachon University Gil Hospital, in Korea. We conducted a retrospective review of the medical records of 51 consecutive patients who had undergone surgery for early-onset exotropia in our clinic (Department of Pediatric Ophthalmology, Gachon University Gil Hospital) between March 1998 and December 2010, and who were followed postoperatively for at least 3 years. In this study, early-onset exotropia was defined as either constant or intermittent exotropia with onset prior to 1 year of age. Patients with exotropia who had history of prematurity (defined as a gestational age \<37 weeks), trauma or neurological problems (such as developmental delay, seizures, or cerebral palsy), ocular diseases that could affect vision or ocular alignment, history of previous ocular muscle surgery, and follow-up duration \<3 years after primary exotropia surgery were excluded. All patients were referred to a pediatrician to exclude neurological disorders \[[@B1]\].
Patients data of gender, age at onset, age at diagnosis, preoperative and postoperative angles of deviation, intermittent versus constant phase before surgery, age at surgery for exotropia, follow-up period after surgery, preoperative refractive status, associated inferior oblique muscle weakening procedure performed simultaneously with surgery for exotropia, amblyopia, postoperative stereopsis at the final visit, and compliance with part-time occlusion therapy were recorded.
All patients underwent a full initial ophthalmologic and orthoptic examination before surgery and were strongly advised to undergo daily part-time occlusion therapy using adhesive patches during a preoperative follow-up period of at least 6 months. Occlusion therapy was prescribed as follows: monocular patching in the dominant eye or alternate patching in the absence of a dominant eye. Eye dominance was determined using results from the cover--uncover test on each eye and the hole-in-the card test performed repeatedly. For the hole-in-the-card test, patients were instructed to view a distant object through the hole with both eyes open. Then, the examiner determined which eye the patient was using to see through the hole. Occlusion time was decided in consideration with the children\'s ages (1.5 to 2 hours for children younger than 3 years to minimize the risk of occlusion amblyopia and 3 hours for children older than 3 years). The occlusion therapy was advised to be performed at home under the surveillance of parents. Using self-report calendar logs and clinical interviews, compliance with occlusion therapy was calculated as the ratio of the number of hours when occlusion was actually performed (that were estimated by the parents) against the number of hours for which it had been prescribed. Compliance was graded as the following: "1" (for no compliance), "2" (for 1%--25%), "3" (for 26%--50%), "4" (for 51%--75%), or "5" (for 76%--100%). Patients with early-onset exotropia were followed preoperatively every 3 months, and the compliance rate was calculated at every follow-up session and averaged at the end of follow-up.
Age at onset was defined as the age at which a family member first observed ocular misalignment. These estimates were confirmed using previous patient photographs or video records. The angle of deviation was measured using an alternate prism cover test at distance (6 m) and at near (1/3 m) with an accommodative target with spectacles. The modified Krimsky test was applied in a few patients in whom the alternate prism cover test had not been possible. Constant exotropia was defined as a clinic control score ≥5, in accordance with the revised Newcastle control score \[[@B12]\]. A score ≥5 was determined when exotropia manifested spontaneously both in near and distant viewing conditions or when exotropia occurred spontaneously in one condition and remained manifest after dissociation/prolonged fixation in the other condition. The preoperative refractive status was defined as the mean spherical equivalent of both eyes measured by cycloplegic refraction with topical administration of 1% tropicamide (Mydriacyl; Alcon, Puurs, Belgium) and 1% cyclopentolate hydrochloride (Cyclogyl; Alcon Laboratories, Fort Worth, TX, USA). Amblyopia was determined using results from recognition acuity tests or regarded as being present when a preverbal child consistently appeared uncooperative in fixation behavior while covering of one eye. Near stereopsis was measured using the Titmus stereoacuity test (Stereo Optical, Chicago, IL, USA) and was graded into four categories: stereopsis of 100 arcsec or better, 140 to 400 arcsec, 800 to 3,000 arcsec, and nil stereopsis.
The surgical procedure, which was performed by the senior surgeon (HJP), was primarily bilateral lateral rectus muscle recession, and surgical dosages were applied using a standard table \[[@B13]\]. When there was associated inferior oblique muscle overaction (with/without V pattern) or dissociated vertical deviation, an inferior oblique muscle weakening procedure was performed simultaneously. Among the enrolled patients in this study, there were no cases of surgery on the vertical rectus or superior oblique muscles.
Surgical outcome was regarded as being successful when ocular alignment was measured as orthophoria to exodeviation less than 10 prism diopters (PD) both at distance and near. Reoperation was recommended when a cosmetically objectionable deviation (usually exotropia exceeding 20 PD or esotropia exceeding 15 PD) was observed. When consecutive esotropia was observed, patients were followed up for at least 6 months before reoperation was recommended.
In order to investigate the effect of preoperative occlusion therapy on the long-term surgical outcome of early-onset exotropia after surgery, we compared the long-term surgical success/recurrence/consecutive esodeviation and the level of postoperative stereopsis between patients with good compliance with part-time occlusion therapy (\>50% adherence rate, grades 4 and 5) and those with poor compliance (≤50% adherence rate, grades 1, 2, and 3). Additionally, in order to investigate the effect of preoperative occlusion therapy on patients with constant exotropia, we compared these factors between patients with good compliance and patients with poor compliance in the constant exotropia patients.
We conducted the Fisher\'s exact test, Mann-Whitney *U*-test, and Kaplan-Meier survival analysis using SPSS ver. 17.0 (SPSS Inc., Chicago, IL, USA). The *p*-values less than 0.05 were considered statistically significant.
Results
=======
In all 51 early-onset exotropia patients who underwent surgery during the study period, the mean duration of preoperative occlusion therapy was 10.2 ± 5.4 months (range, 6 to 28 months). The mean follow-up duration after surgery for exotropia was 78.0 ± 28.1 months (range, 36 to 135 months). Overall, the final success rate of surgery for early-onset exotropia was 66.7%. Five patients (9.8%) showed persisting consecutive esotropia and eventually underwent surgical correction for these consecutive esotropia at a mean age of 18.8 months (range, 8 to 40 months) after the primary surgery for exotropia. Meanwhile, 12 patients (23.5%) showed recurrence of exotropia greater than 10 PD, and four patients (7.8%) underwent surgical correction for recurrent exotropia during the follow-up period after the initial surgery.
With the exception of three patients who experienced both 1.5 to 2 hours of patching and 3 hours of patching due to continued occlusion treatment around 36 months of age, 38 patients were younger than 3 years and were prescribed 1.5 to 2 hours of patching (compliance rate, 2.7 ± 1.6), and 10 patients were older than 3 years and prescribed 3 hours of pathing (compliance rate, 3.1 ± 1.5). The compliance rates were not different according to patching hours (*p* = 0.626). [Fig. 1](#F1){ref-type="fig"} depicts the compliance rates of the 51 enrolled patients. Twenty-six patients fulfilled part-time occlusion therapy with \>50% adherence rate (grades 4 and 5) and were assigned to the good compliance group. The remaining 25 patients who underwent part-time occlusion therapy with a ≤50% adherence rate (grades 1, 2, and 3) were assigned to the poor compliance group. The demographic and clinical data of these 51 patients are presented in [Table 1](#T1){ref-type="table"}. There were no significant differences between the two study groups except for the improvement-to-dete-rioration ratio of the angle of deviation during the preoperative follow-up period | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Postoperative cognitive changes are a common complication, especially in elderly patients who undergo major surgeries, including arthroplasty, laparotomy, and thoracotomy with or without cardiopulmonary bypass (Saczynski et al., [@B47]; Evered et al., [@B9]). Perioperative neurocognitive disorders (PND) are characterised by symptoms such as disturbance of memory, attention, consciousness, information processing, and the sleep-wake cycle, leading to postoperative morbidity and mortality (Evered et al., [@B9]). PND occurs predominantly in elderly patients but may also occur in other age groups (Johnson et al., [@B21]; Backeljauw et al., [@B2]). Multiple factors may be involved in PND (Cibelli et al., [@B6]; Han et al., [@B14]; Li et al., [@B34]); however, the molecular mechanisms underlying this condition are unclear.
Under some circumstances, general anaesthetics may cause long-term cognitive impairment (Li et al., [@B33]; Zhong et al., [@B64]; Cao et al., [@B5]) but have also been shown to promote brain protection (Fukuda and Warner, [@B200]), indicating that anaesthetics may play different roles in PND.
Cognitive processes are complex. In humans, these processes can be divided into five dimensions: attention, perception, memory, language, and learning. In clinical research, memory impairment after anaesthesia and surgery is a typical symptom and is often used as the main diagnostic criterion for PND (Evered et al., [@B9]). Memory functions involve formation, consolidation, storage, and recall. Brain-derived neurotrophic factor (BDNF) is implicated in several adaptive and pathological processes (Harward et al., [@B16]; Tanqueiro et al., [@B52]; Lima Giacobbo et al., [@B12]; Oh et al., [@B41]). An increasing number of studies have demonstrated that BDNF in the hippocampus, especially in the dorsal CA1 region, plays a key role in regulating cognition and memory (Bambah-Mukku et al., [@B3]; Bekinschtein et al., [@B4]; Reimers et al., [@B44]). A clinical study reported that BDNF protein expression decreased after anaesthesia and surgery in patients with cognitive impairment (Wyrobek et al., [@B60]).
Multiple amino acid residues on histone H3 can be modified in cognitive processes (Hyun et al., [@B19]; Kim and Kaang, [@B26]). Lysine 9 in H3 (H3K9) can be acetylated or methylated (Kilpinen et al., [@B25]; Lanouette et al., [@B30]). Theoretically, the deacetylation or hypermethylation of H3K9 can induce chromatin condensation, resulting in long-term gene silencing, and the trimethylation of H3K9 (H3K9me3) mediates transcriptional silencing (Karmodiya et al., [@B23]; Zovkic and Sweatt, [@B65]; Zovkic et al., [@B66]). In contrast, the acetylation and demethylation of H3K9 activate transcription (Ushijima et al., [@B55]). SUV39H is a typical histone methyltransferase involved in H3K9 trimethylation and promotes gene silencing. Moreover, H3K9 trimethylation is critical for cognitive impairment and is involved in the transcriptional repression of the *Bdnf* gene (Kuzumaki et al., [@B28]; Gupta-Agarwal et al., [@B13]; Maddox et al., [@B36]; Karpova, [@B24]). Considering that H3K9 is located near the promotors, modifications in this histone affect DNA methylation and transcription (Du et al., [@B8]; Zhao et al., [@B63]).
This study assessed whether the trimethylation of H3K9 was involved in the downregulation of BDNF expression leading to cognitive and memory impairment, and the stage at which memory processing was affected by anaesthesia and surgery. H3K9 trimethylation downregulated BDNF expression and impaired memory formation, but not recall, during anaesthesia and surgery. Therefore, inhibiting H3K9 trimethylation and increasing the expression of BDNF may help prevent PND in a clinical setting.
Materials and Methods {#s2}
=====================
Animals {#s2-1}
-------
Adult male C57BL/6J mice (10--12 months old) and adult male vGLUT1-IRES-CreERT mice (homozygous, C57BL/6J background, 10--12 months old) were obtained from Xuzhou Medical University Animal Center (Xuzhou, China). All mice (five animals per cage) were acclimatised under a 12--12 h light-dark cycle and were allowed *ad libitum* access to food and water. All behavioural experiments were carried out between 8:00 am and 5:00 pm. All protocols were approved by the Animal Welfare Committee of Xuzhou Medical University and complied with Animal Research: Reporting of *in vivo* Experiments guidelines.
Drugs and Primers {#s2-2}
-----------------
Chaetocin (Sigma-Aldrich, USA; 3 μg in 0.3 μl of 10% DMSO in PBS) was microinjected into the dorsal CA1 region of the hippocampus on each side 2 h before the tests. Recombinant BDNF (R&D Systems, USA; 0.5 μg in 0.3 μl of distilled water) was microinjected into the dorsal CA1 region of the hippocampus on each side 1 h before the tests.
The following primers were used in RT-PCR: total BDNF, 5′-AAGGACGCGGACTTGTACAC-3′ (forward), 5′-CGCTAATACTGTCACACACGC-3′ (reverse); GAPDH, 5′-AGGTCGGTGTGAACGGATTTG-3′ (forward), 5'-TGTAGACCATGTAGTTGAGGTCA-3′ (reverse); The primers for chromatin immunoprecipitation (ChIP) IV, 5′-AAAAACGGTCCAAAGACCAC-3′ (forward), 5′-TCACTAAGCCCCCTTCCTCT-3′ (reverse).
Anaesthesia and Surgery {#s2-3}
-----------------------
Animals were placed on a transparent chamber prefilled with 1.4% isoflurane and 100% oxygen (Peng et al., [@B42]). After a 15-min induction, a simple laparotomy was performed. A 0.5-cm longitudinal midline incision was made from the xiphoid to the proximal pubic symphysis on the skin, abdominal muscles, and peritoneum. Then, the incision was sutured layer by layer. Compound lidocaine cream (2.5% lidocaine and 2.5% prilocaine) was applied to the incision wound every 8 h for 2 days. The surgical procedure lasted approximately 20 min for each mouse, and the animals remained under anaesthesia for up to 2 h. The temperature of the anaesthesia chamber was controlled to maintain the rectal temperature of the mice at 37 ± 0.5°C during anaesthesia/surgery. The concentrations of isoflurane and oxygen and animal breathing were monitored. The animals from the control group remained in a chamber filled with 1.4% isoflurane and 100% oxygen for 2 h but were not subjected to surgery.
Open Field Test {#s2-4}
---------------
An open field test (OFT) was used to determine the spontaneous locomotor activity of mice according to a previous study (Wang et al., [@B57]). The OFT apparatus consisted of a 50 × 50 cm open arena with 50-cm-high walls, and the floor was divided into nine squares of equal areas. Briefly, the mice were individually placed into the centre of the apparatus and were free to explore the environment for 10 min. Thereafter, the total distance travelled was recorded by ANY-maze software during the following 5-min period.
Y-Maze Test {#s2-5}
-----------
The maze consisted of three arms (8 × 30 × 15 cm, width × length × height) that were 120° from each other: the start arm (always open), novel arm (closed during training and open during tests), and the other arm (always open). During training, mice were allowed to explore the maze for 10 min. After a 2-h interval, the animals were returned to the start arm for a 5-min exploration with the novel arm open. The number of entries and time spent on each arm were recorded.
Novel Object Recognition Test {#s2-6}
-----------------------------
A novel object recognition (NOR) test was performed using a 50 × 50 cm open arena with 50-cm-high walls. The arena was divided into four quadrants, and two identical objects were placed diagonally from each other. Mice were individually placed into the centre of the apparatus and were free to explore the environment for 10 min. After that, the animals returned to the cage, and one of the objects was replaced by a novel object with a different shape and colour. The apparatus was cleaned with 75% ethanol. After a 2-h interval, mice were allowed to freely explore the area for 5 min, and the time spent exploring the novel object was measured.
Contextual Fear Conditioning Test {#s2-7}
---------------------------------
The test was performed as previously reported (Gao et al., | {
"pile_set_name": "PubMed Central"
} |
For a long time, the prediction of molecular crystal structures from first principles has been one of the most challenging computational problems. Because of the large number of degrees of freedom, methods with low computational effort have to be used. The price for this efficiency is, however, a loss of accuracy. In recent years, important progress has been made in the development of dispersion corrections \[[@B1]-[@B3]\], which raise the accuracy of density functional theory (DFT) calculations to a much higher level.
Based on these developments, the software package GRACE \[[@B4]\] was the first program ever to correctly predict all four crystal structures at the 4th crystal structure prediction blind test, organized by G. M. Day and the Cambridge Crystallographic Data Centre in 2007 \[[@B5]\]. GRACE uses dispersion-corrected density functional theory calculations (DFT-D) to generate reference data to which a tailor-made force field (TMFF) is fitted for each respective molecule \[[@B6]\]. Crystal structures are generated with a Monte-Carlo parallel-tempering algorithm that uses the TMFF for the evaluation of lattice energies. Only the most stable crystal structures according to the TMFF are then re-optimized and re-ranked using DFT-D. The DFT calculations are performed using an interface to the two common ab-inito programs VASP \[[@B7]\] and QuantumESPRESSO \[[@B8]\].
In the most recent, 5th blind test, organized in 2010, the excellent agreement between experimental and predicted structures for small, neutral molecules was confirmed. However, it turned out that the crystal structure prediction of molecular salts and hydrates is still a challenging task. The inability of DFT without exact exchange to describe anions properly, as recently published by Jensen \[[@B9]\], suggests that the inclusion of the Hartree-Fock exchange should improve the accuracy for molecular salts and hydrates. Therefore, we will present an assessment of a variety of current density functionals, in which the dispersion-correction parameters were fitted with respect to a minimization of the deviation between experimental and computed crystal structures.
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Gastric cancer (GC) is responsible for over 1,000,000 new cases and around 783,000 deaths in the world annually, making it the 5th most frequently diagnosed cancer and the third leading cause of cancer-related death ([@ref-5]). Surgery with subsequent adjuvant chemoradiotherapy remains the only treatment with curative potential ([@ref-3]), and the prognosis for gastric adenocarcinoma is primarily determined by the TNM classification of staging system ([@ref-54]). The clinical outcome, nonetheless, is notably variable and erratic in individual patient, which firmly implies that a few of the biological determinants of tumor behavior are unidentified. Thus, advances in molecular insight into GC are critically required for improved prognostic stratification and new targeted therapeutic strategies.
Recently, with the progress of high-throughput screening, sequencing has enabled a more thorough insight into the molecular identity of GC. An updated classification scheme has been introduced based on comprehensive molecular characterization including tumors infected with Epstein--Barr virus, tumors with microsatellite instability (MSI), and tumors with a distinct degree of aneuploidy, which were termed genomic stability and chromosomal instability. Each subgroup shows peculiar genetic and clinical characteristics ([@ref-6]).
Alterations of DNA methylation is a vital event during tumorigenesis, and gastrointestinal cancers show the highest frequency of DNA methylation alterations among the reported tumor types ([@ref-6]). Methylation of the dinucleotides of CpG islands throughout the genome is mediated by DNA methyltransferases ([@ref-10]), and commonly results in gene silencing. Disorder of DNA methylation in cancer affects gene expression and results in the cancer progression ([@ref-53]).
CpG island methylator phenotype (CIMP) in tumors, which has been initially described and broadly debated in colorectal cancer ([@ref-21]). Lately CIMP has been described in other tumor types including bladder, breast, glioblastoma, pancreatic and prostate cancers, as well as for gastric adenocarcinomas and is considered to be helpful for predicting prognosis ([@ref-22]; [@ref-36]; [@ref-52]). In GC, conflicting conclusions regarding the prognostic association of CIMP have been scattered among previous studies, owing to the limitation of selected DNA methylation markers and the presence of multiple confounding factors in these studies ([@ref-1]; [@ref-4]; [@ref-39]). Although a meta-analysis of the prognostic value of CIMP status in GC has been performed, an explicit conclusion was not reached ([@ref-42]).
In this study, we aimed to use publicly available data to comprehensively analyze CIMP in GC, and to develop a CIMP-related prognostic gene signature.
Materials and Methods
=====================
Data acquisition
----------------
We downloaded methylation data, which has 408,376 probes and 397 samples, including 395 GC samples and two normal samples, measured by the Illumina HumanMethylation450 platform, from the cancer genome atlas (TCGA)-STAD project (<https://portal.gdc.cancer.gov/>) by using the *TCGA-Assembler 2* package ([@ref-55]). RNA-Seq profiles were obtained from TCGA by virtue of *GDC Data Transfer Tool*. We downloaded two verified microarrays with matched clinical information from the GEO GC database: [GSE13861](GSE13861) ([@ref-8]) (65 GC samples; platform: GPL6884 Illumina HumanWG-6 v3.0 expression beadchip ), [GSE62254](GSE62254) ([@ref-11]) (300 GC samples; platform: GPL570 Affymetrix Human Genome U133 Plus 2.0 Array ). We used the *TCGAbiolinks* package to acquire the mutation data of GC samples ([@ref-9]). We obtained complete and matched clinical information on GC patients from cBioportal, including sex, age, histologic features, pathologic stage, family history and, infection status for *Helicobacter pylori* and Epstein--Barr virus.
Our study was performed according to the publication guidelines required by TCGA.
Data analysis
-------------
The *Minfi* package was adopted to analyze methylation data ([@ref-2]). In view of the distribution of CpG islands and the technical limitations of sequencing, we filtered the probes from the X and Y chromosomes or probes that are known to have common SNPs at the CpG site, and cross-reactive probes. The *DESeq2* package was adopted to analyze the differentially expressed genes (DEGs) between CIMP-related subgroups ([@ref-32]). The criteria to determine DEGs were an adjusted *p*-value \< 0.05 and an absolute value of log2 fold change \>2, and BH method was used for adjustment for multiple testing. In order to identify the different pathways between GC samples with specific CIMP status, we performed GSEA analysis ([@ref-48]). The mRNA expression data downloaded from the Gene Expression Omnibus (GEO) database were normalized and analyzed by the *limma* package ([@ref-44]). The mutation data were summarized and analyzed by the *maftools* package ([@ref-34]). Raw code for analyzing was uploaded in [Data S1](#supp-9){ref-type="supplementary-material"}.
Identification of CIMP in GC samples
------------------------------------
To assess the CIMP feature in GC, CpG methylation sites with a relatively high variability of β-values in tumor samples (SD \> 0.2) and relatively low β-values in normal samples (mean β value \< 0.05), were chosen as the representative CpG methylation sites for subsequent clustering analysis, following a previous study ([@ref-28]). The *ConsensusClusterPlus* package was adopted to run unsupervised clustering analysis based on M value of the selected 2,082 probes by means of the *K*-means algorithm ([@ref-56]).
Analysis of tumor-infiltrating immune cells
-------------------------------------------
The proportions of the 22 types of tumor-infiltrating immune cells were counted by CIBERSORT ([@ref-37]). CIBERSORT is a tool to provide an estimation of cell composition of mixed tissues based on gene expression profiles. We uploaded the modified gene expression data and standard annotation to the CIBERSORT portal and ran the LM22 signature, which contains 547 genes distinguishing 22 human immune cell types, and 1,000 permutations. Final results were normalized to sum up to one and could be assessed straightforwardly as cell fractions for contrast ([Table S1](#supp-4){ref-type="supplementary-material"}).
Development and validation of a CIMP-related prognostic signature
-----------------------------------------------------------------
Using the *DESeq2* package, 1,072 DEGs were calculated between the CIMP-H and CIMP-L samples ([Table S2](#supp-5){ref-type="supplementary-material"}), which were defined by relative methylation level. We then performed Cox regression to assess the prognostic significance of the DEGs. A suitable prognostic model is assumed to identify a smaller number of genes favorable for clinical practice. We therefore used the least absolute shrinkage and selection operator (LASSO) in combination to diminish the number of CIMP-related prognostic genes ([@ref-15]). The *glmnet* package was used to perform the penalized Cox regression model with the LASSO penalty, and 1,000-times cross-validations were applied to determine the optimal values of the penalty parameter lambda. We selected lambda.min to get six CIMP-related prognostic genes. We then extracted the coefficients from multivariate Cox regression to build a gene signature. We adopted the *survminer* package to determine the cut-off value of the risk score. Then, the patients were divided into high-and low-risk subgroups according to their risk score. We used Kaplan--Meier analysis to compare OS rates between the high- and low-risk group. To identify whether the risk score was an independent factor, we conducted univariate Cox regression and multivariate Cox regression analyses. Statistical significance was inferred where *p* \< 0.05.
Validation in GEO dataset
-------------------------
To confirm the performance of our prognostic signature, we applied it to two GEO databases, [GSE13861](GSE13861) (*n* = 65) and [GSE62254](GSE62254) (*n* = 300). The mRNA expression data were prepared using the *limma* package. Scale, a generic R function including centering and scaling, was used to scale the GEO mRNA expression data to common range. Next we used a developed prognostic signature to calculate the risk score of every sample and divided patients by the cut-off value. Kaplan--Meier analysis was conducted between the high- and low-risk groups for overall survival. In addition, we conducted receiver operating characteristic (ROC) curve analysis and calculated an AUC for every database.
Functional enrichment analysis
------------------------------
We applied the *clusterProfiler* package for Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis between different risk score-related subgroups ([@ref-59]). Then we adopted the *GOplot* package to illustrate our GO and KEGG results ([Tables S3](#supp-6){ref-type="supplementary-material"} and [S4](#supp-7){ref-type="supplementary-material"}). Protein--protein interaction analysis was carried out based on the DEGs of high-and low-risk subgroups using the STRING portal (<https://string-db.org>) and Cytoscape software ([@ref-47]). Functional annotation of genes in the module was perform by DAVID database ([@ref-20]).
Results
=======
Methylation landscape of GC sample
----------------------------------
In this study, we utilized DNA methylation profiles from TCGA database to perform a comprehensive analysis of DNA methylation in GC. We adopted 2,082 methylation sites with high variability as our C | {
"pile_set_name": "PubMed Central"
} |
{.129}
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Public schools have an obligation to question and refute policies that do not benefit their students and their communities and a corresponding responsibility to protect students, for whom school attendance is mandated, from harm. However, implementation of change in school procedures and policies presents challenges and requires an ethical justification for the change and feasible methods for accomplishing it.
The mission of schools is broader than simply teaching academic skills. Schools have long accepted responsibility for supporting the health of their students, for example, by requiring immunizations, providing health screenings, and by offering meal programs that support their students\' nutritional health. Nutritional health is associated with academic performance ([@B1]), and well-nourished students are better able to learn and less likely to miss school for health reasons ([@B2]). Research shows that children from low-income families who participate in school breakfast programs score higher on standardized tests and have better school attendance than similar students who do not participate ([@B3]). Breakfast programs also improve classroom behavior and attentiveness ([@B4]). In 1904, Robert Hunter wrote, \"It is utter folly, from the point of view of learning, to have a compulsory school law which compels children, in that weak physical and mental state . . . to sit at their desks, day in and day out for several years, learning little or nothing . . . because hungry stomachs and languid bodies and thin blood are not able to feed the brain\" ([@B5]).
Focusing on nutritional health promotion in schools can support the common good by reducing the impact, including substantial financial costs, of future diet-related disease associated with the childhood obesity epidemic. Furthermore, optimizing nutrition in childhood is critical to learning and future productivity. We must consider whether schools have an ethical obligation to serve the common good in this area, even if the actions they take appear to conflict with the autonomy or freedom of choice of children, parents, and school staff, or the interests of food and beverage companies.
The purpose of this article is to present a bioethics framework for justifying stricter regulation of school food, specifically, to determine whether this type of health promotion in schools is ethically justified ([@B6]). To determine whether current school environments meet an ethical threshold or whether these environments fall short and should be altered, we will apply Beauchamp and Childress\'s 4 foundational principles for a discourse on the ethics of a biomedical intervention: autonomy (addressing conflict around individualism), beneficence (addressing the social benefit), nonmaleficence (addressing the issue of doing no harm), and justice (addressing equity in burdens and benefits) ([@B7]). We describe the underlying problem of rapidly increasing incidence rates of childhood obesity and the potential role of schools in altering the trend.
Schools\' Roles in Addressing Childhood Obesity
===============================================
The National School Lunch Program was established in 1946 to \"safeguard the health and well-being of the Nation\'s children\" as a \"measure of national security\" by preventing the widespread malnutrition that disqualified many military recruits during World War II ([@B8]). Early program participants were served balanced meals to ensure consumption of vegetables, protein, starches, and dairy products according to the best nutrition standards of the time ([@B5]). Participation in the program, which was expanded during the 1960s and 1970s, was demonstrated to improve children\'s diets ([@B9]).
The obesity epidemic
--------------------
With the tripling in obesity rates among children ([@B10]), schools face new challenges. Approximately 1 in 3 children born in 2000 will develop diabetes in his or her lifetime ([@B11]), and in a large study of children aged 5 to 17 years, 39% of those who were obese had 2 or more risk factors for cardiovascular disease ([@B12]). Poppendieck, in advising policy makers on the benefits of putting money into healthy school foods today to reduce future health care expenditures, calls her recommendations \"Pay now or pay later\" ([@B13]).
**Children\'s inadequate nutrition**
------------------------------------
Although children today are consuming sufficient or even excessive food calories, they are not meeting the nutritional requirements described in the federal government\'s Dietary Guidelines for Americans ([@B14]). Children\'s intake of fruits, vegetables, and whole grains does not come even close to current recommendations. Furthermore, children aged 5 to 18 years consume approximately 720 to 950 empty discretionary calories per day ([@B15]). Calories from added fats and sugars are displacing those from the nutrient-rich foods needed for growth and health.
**Schools\' provision of food to students**
-------------------------------------------
Children spend up to half their waking hours in school, where they may consume as much as one-third to one-half of their daily calories. Therefore, the school food environment is a logical focus for efforts to encourage healthy dietary behaviors. Today, school food service includes 2 competing arms --- the federally regulated reimbursable National School Lunch and School Breakfast programs ([@B8],[@B16]) and the competitive foods marketplace, which has expanded substantially during recent decades. Competitive foods and beverages are those foods sold throughout schools in vending machines, school stores, snack bars, and at fund-raisers. These are typically foods of low nutritional quality, including sweetened beverages, chips and other salty snacks, and sweets such as cookies and pastries ([@B17],[@B18]).
During a typical day in the first 5 years of the 21st century, 55% of high school students and 44% of middle school students consumed competitive foods at school, frequently instead of school meals ([@B19]). Although states and school districts can voluntarily impose restrictions on competitive foods, these agencies are often unaware of the impact of the school food environment on student health. This lack of awareness, coupled with the funding that competitive foods provide to schools, has led to prolonged inaction. However, data now indicate that reductions in competitive food offerings can actually increase meal program participation rates, thereby increasing food service department revenues rather than reducing them as is often feared by school administrators ([@B20]). Efforts to promote and increase access to the meal program can be key to school-based efforts to reduce obesity, benefiting both children and schools.
**Recent trends in school food regulation**
-------------------------------------------
California in 2005 became the first state to legislate statewide nutrition standards to regulate sale of competitive foods and beverages in grades kindergarten through 12 ([@B21]). Evaluation studies of California\'s implementation of the legislation reveal that schools were successful at eliminating or severely reducing offerings of noncompliant (less nutritious) competitive foods and beverages in schools ([@B20],[@B22]). The food and beverage industry replaced or adapted snack foods to meet the new guidelines mandated by the legislation. For example, sports drinks replaced sodas, baked chips replaced original varieties of chips, and reduced-fat crackers replaced original crackers. Although the new offerings met the letter of the legislation\'s requirements to limit fat, sugar, and calories, they did not substantially increase the availability of such health-promoting foods as fruits, vegetables, whole grains, and low-fat dairy foods.
During the past decade, other states and municipal governments have implemented new obesity-prevention policies in schools with respect to competitive food sales. These policies vary considerably by state and locality. Although competitive foods continued to be available in most schools in the latter half of this decade ([@B19]), more than half of all states and several local authorities adopted policies regarding such foods that were more restrictive than those mandated by US Department of Agriculture (USDA) regulations ([@B15]).
In recent years, perhaps in response to the variability of state and local requirements, Congress and USDA have been pressured to revisit the issue of school food quality. Furthermore, 2 Institute of Medicine (IOM) reports ([@B15],[@B23]) recommended improvements to both competitive and school meal food offerings on the basis of the strongest scientific evidence available. In December 2010, the Healthy, Hunger-Free Kids Act of 2010 was signed into law ([@B24]). The act requires the Secretary of Agriculture to establish science-based nutrition standards within a year of enactment. The standards apply to all foods and beverages served outside school breakfast or lunch programs anywhere on school campuses. The extent to which these standards will fully meet the Institute of Medicine recommendations is not clear.
Furthermore, the Healthy, Hunger-Free Kids Act mandates significant improvements to the National School Lunch and School Breakfast programs whereby school meals will be aligned with dietary recommendations for children as outlined in federal Dietary Guidelines for Americans. As the new standards are implemented, school meals will provide increased offerings of nutritious items (eg, fruits, vegetables, whole grains, 1% or nonfat milk) and decreased offerings of foods high in fat, sugar, and sodium. Meal reimbursement rates will be increased slightly to support the purchase of the nutritious offerings. If these policies are implemented as recommended by IOM, significant improvements in nutrition will be realized. However, the political challenge of effectively limiting the sale of less nutritious foods and the economic challenge of paying for more healthful options could result in more limited improvements than are needed to enable schools to promote children\'s optimal nutritional health.
Application of a Bioethics Framework for Change in School Nutrition
===================================================================
Opponents of school food regulation argue that people have the right to choose the foods they eat. However, we structure and regulate many student activities in the school setting and do not consider doing so an abridgement of children\'s rights. The argument that a child has the right to choose foods of poor nutritional quality at school conflicts with the societal value of child protection. A child\'s right to freedom from obesity is among the 54 binding standards and obligations of the 1989 United Nations Convention on the Rights of the Child ([@B25]).
Beauchamp and Childress\'s ([@B4]) | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION: {#sec1-1}
=============
Surgical intervention to the temporal lobe caries the risk of injury to the optic radiation.\[[@ref4][@ref5][@ref6]\]. The risk of injury varies with each approach, as the extent tissue removal is different form one surgical technique to the other. During surgery it is almost impossible to differentiate the optic radiation from other white fibers.\[[@ref1][@ref2][@ref3]\].
Amygdalohippocampectomy is one of the common surgeries used to treat temporal lobe epilepsy and the operation may be performed with several modifications\[[@ref7][@ref8][@ref9][@ref10][@ref11]&[@ref12]\]. The approach through the middle temporal gyrus is a common modification. We have conducted a cadaveric anatomical study to localize the optic radiation within the temporal lobe, define its anterior and lateral extension and to test if a standardized incision to the middle temporal gyrus damages it.
MATERIALS AND METHODS: {#sec1-2}
======================
This is a cadaveric anatomical study. 11 human cerebral hemispheres that were formalinated for 3-6 months were studied. The work was performed at the Department of Neurosurgery, King Edward Memorial Hospital, Parel, Mumbai, India. The optic radiation was dissected out using Klinger\'s fiber dissection method under operating microscope ([Figure-1](#F1){ref-type="fig"}). Dissection was done with a small spatula made of bamboo and a surgical dissector. Dissection was started from lateral and inferior surfaces of cerebral hemisphere. Following removal of gray mater, short and long association fibers, superior longitudinal fascicle, extreme capsule, claustrum, external capsule and lentiform nucleus the internal capsule was reached. Then a 2 cm length anterior-posterior incision was made on middle of middle temporal gyrus extending from 3cm posterior to temporal pole. The incision was continued perpendicular to surface up to temporal horn of lateral ventricle ([Figure-2](#F2){ref-type="fig"}). Roof of the temporal horn was exposed from below by removing the lower part of temporal lobe and lateral part of floor of temporal horn with preservation of hippocampus ([Figure-3](#F3){ref-type="fig"}).Then stepwise dissection of optic radiation from lateral geniculate body to visual area was made. The localization of the optic radiation in the sublentiform and retrolentiform area was confirmed ([Figure-4](#F4){ref-type="fig"}). These white fibers were dissected from lateral geniculate body to the visual area situated on the upper and lower lip of calcarine sulcus. The anterior bundles of optic radiation(Meyer\'s loop) that initially pass anteriorly on the roof of the temporal horn and turning posteriorly to pass along the roof and lateral surface of the temporal horn was dissected out followed by middle and superior fibers. Middle fibers (Macular fibers) from lateral geniculate body pass to the roof of inferior horn and turned posteriorly to pass along the lateral wall of atrium and occipital horn of lateral ventricle to reach visual cortex. The upper (posterior) fibers pass directly backward around the atrium and occipital horn to reach upper lip of calcarine sulcus. Temporal pole, amygdala and hippocampus were preserved. Anterior and lateral extension of optic radiation was studied. Examination was done, to see whether any damage to optic radiation was made by the incision or not. The distances between anterior limit of optic radiation, anterior end of temporal horn ([Figure-2](#F2){ref-type="fig"}) and the temporal pole were recorded.
{#F1}
{#F2}
{#F3}
{#F4}
RESULTS: {#sec1-3}
========
Anterior end of optic radiation extended 2mm (1-3.5mm) beyond the tip of temporal horn. The distance of optic radiation from temporal pole was 26mm (23-31mm). Most anterior 8.5mm (8-10mm) of the Meyer loop was completely on the roof and there was no extension over lateral wall of the temporal horn. In next posterior 17.5mm (16-20 mm) it extends over lateral wall of temporal horn with gradual progression. The incision that was made over the middle temporal gyrus entered into the temporal horn 2mm (1.5-2.4mm) below and lateral to the optic radiation at its anterior part and 0.9mm (0.75 to 1mm) below the optic radiation at its posterior end. Posterior end of incision is 1.5mm (1-2.5 mm) anterior to optic radiation margin. The incision did not damage optic radiation in any cerebral hemisphere (n=11) and entry point in temporal horn was below the optic radiation.
DISCUSSION: {#sec1-4}
===========
During dissection of optic radiation, we found that fibers originating from lateral geniculate body can be traced to visual area
as three bundles (anterior, middle and posterior) described in other articles.\[[@ref3][@ref13][@ref14]\] In the published articles on the measurement between anterior extension of optic radiation and temporal pole is 21-30mm.\[[@ref1][@ref3][@ref6][@ref15]\] Rubino et al\[[@ref6]\] and Pujari et al.\[[@ref15]\] reported the extension of optic radiation is 2 mm anterior to tip of temporal horn. Rubino et al described that the Meyer\'s loop extended from roof to lateral wall of temporal horn during its way to visual area.\[[@ref6]\] In our study, the 2cm anterior-posterior incision over middle of middle temporal gyrus 3 cm posterior to the temporal pole perpendicular to surface did not damage the optic radiation. So amygdalohippocampectomy through middle temporal gyrus approach with 2m incision 3cm behind the temporal pole is relatively safe in respect of optic radiation damage. But change of direction to upward or posterior extension of incision or dissection is prone to damage of optic radiation. We found that any surgical resection that involves the superior temporal gyrus more than 26 mm from the temporal tip is likely to injure the Meyer\'s loop of the optic radiation. In previously pulished series resections less tha 25-30mm were reported as sade resections\[[@ref1][@ref6][@ref15]\].
CONCLUSION: {#sec1-5}
===========
Amygdalohippocampectomy through an incision on the middle temporal gyrus of 2 cm length from 3 cm posterior to the temporal pole, to enter the temporal horn through the lower aspect of the lateral wall is more likely to miss the anatomical Meyer\'s loop. Any entry from the superior aspect of the temporal horn and any temporal lobectomy inclusive of the superior temporal gyrus to enter the temporal horn will produce Meyers loop damage. The findings support the fact that the more inferior the surgical trajectory to the temporal horn of the lateral ventricle, the lover is the risk of visual field damage.
Acknowledgments - The authors would like to express the deep appreciation to Prof. Dr. Atul H. Goel., who placed his laboratory facilities at our disposal. He stimulated the technique and introduced the fiber dissection technique in his Microneurosurgical fellowship Course at King Edward Memorial Hospital, Parel, Mumbai, India.
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
The knowledge on how *BRCA1/2* mutation carriers should be counseled and treated has evolved continuously over the last two decades \[[@CR1], [@CR2]\]. Some important issues remain to be solved, though. One of these is if breast-conserving therapy (BCT) followed by postoperative radiotherapy is as good of an alternative to mastectomy (M) for carriers as it is for other breast cancer patients \[[@CR3], [@CR4]\]. Once a carrier has had a breast cancer, the risk of contralateral breast cancer (CBC) is indeed very high \[[@CR5], [@CR6]\]. It is reasonable to assume that the risk of new primary breast cancers in the ipsilateral breast is also high if breast tissue is still there for tumor development. On the other hand, radiotherapy and other adjuvant treatments change the microenvironment in the breast and reduce the number of cancer precursors, and could thereby, in addition to reducing the risk of true recurrences, possibly also reduce the number of new primary tumors in the treated breast. It is not always possible to differentiate an ipsilateral event being a true recurrence or a new primary breast cancer. In the following, both are denominated "local recurrences."
Results from cohort studies and case--control studies have been conflicting regarding the risk of local recurrence as first recurrence (LR) in carriers following BCT \[[@CR7]--[@CR17]\]. Importantly, no study to date has shown a survival difference between mutation carriers and noncarriers treated with BCT or between carriers treated with BCT and carriers treated with M. However, BCT can be associated with other disadvantages, such as the requirement of close follow-up for a long time, most likely a recommendation of adjuvant chemotherapy in case of a LR, and an increased cancer-specific distress. Even though generally well tolerated, also M and bilateral mastectomy (BM) can for some patients be associated with disadvantages, like a negative impact on sexuality and body image \[[@CR18]\]. The absolute long-term risk of LR and survival endpoints are of pivotal importance for mutation carriers with newly diagnosed breast cancer to know, in order to be able to make informed decisions about type of surgery.
To further evaluate the appropriateness of BCT in carriers, we conducted a cohort study. The aim of the study was to compare LR and survival between carriers treated with BCT and carriers treated with M.
Materials and methods {#Sec2}
=====================
Study population {#Sec3}
----------------
In an institutional database, where all persons that have undergone mutation analysis of the *BRCA1* and *BRCA2* genes at a single institution in Lund, Sweden, are registered, all women with an invasive breast cancer stage I-III diagnosed between 1975 and 2011 and a pathogenic germline mutation in *BRCA1* or *BRCA2* were selected. Women with variants of uncertain significance in *BRCA1* or *BRCA2* were not included. Out of 204 identified patients, 183 had consented to longitudinal follow-up (or, in case they were dead, their next of kin had consented), the others were excluded.
Clinical data were abstracted from medical records and pathology reports and supplemented by information from self-reported questionnaires. TNM stage was classified according to American Joint Committee on Cancer 7th edition.
Patients with a diagnosis of ovarian cancer, except for patients with no ovarian cancer recurrences and ≥10 years elapsed after ovarian cancer diagnosis before breast cancer, were excluded (*n* = 2). Another 8 patients were excluded as we were not able to retrieve medical records. Of the remaining 173 patients, 11 were treated with partial mastectomy without postoperative radiotherapy; they were excluded. For the present study, 162 patients thus constituted the study population. Only 9 of these patients had the mutation analysis initiated after their death (on archived tissue); for the others it was initiated while they were alive. Due to a small number or patients, *BRCA1* (*n* = 114) and *BRCA2* (*n* = 48) mutation carriers were grouped together for analyses. Vital status was controlled in the Swedish Census Register. Current analyses were based on follow-up information through January 31, 2012.
Study endpoints {#Sec4}
---------------
Study endpoints were local recurrence as first recurrence (LR), overall survival (OS), breast cancer death, and distant recurrence, for the pre-specified subgroups of patients treated with BCT and M, respectively. If the final surgery was M within 1 year after breast cancer diagnosis, the patient was allocated to M, even if the first surgical procedure was a partial mastectomy. For the analysis of LR, patients were censored at the date of last follow-up, whereas distant or regional spread of cancer (breast cancer, ovarian cancer, or another type of cancer) and death where treated as competing risks. In other words, local recurrences occurring after a regional or a distant recurrence were not considered. Further, patients treated with BCT were censored at the time of prophylactic mastectomy. All cases of LR were invasive. For women with bilateral breast cancer, we were not able to distinguish death or distant recurrence due to the first primary breast cancer from death or distant recurrence due to the second primary breast cancer.
Statistical analyses {#Sec5}
--------------------
Differences in patient, tumor, and treatment characteristics between the BCT group and the M group were tested using Fisher's exact test. Cumulative incidence curves were calculated for LR in the presence of other recurrences or death as competing risks, and for breast cancer death and distant recurrence in the presence of death of other cause than breast cancer as competing risk. Kaplan--Meier curves were used to illustrate OS. To compare event rates between the treatment groups, cause-specific log-rank tests and Cox regression analyses were used.
The following covariates were selected for multivariable analyses: type of surgery, age at diagnosis, TNM stage, and use of (neo)adjuvant chemotherapy. Age at diagnosis was split at the median to account for nonlinear associations and to make interpretations of the results easier. All tests and confidence intervals were two-tailed. All analyses were conducted using the R statistical package (R 3.1.0), using libraries survival and cmprsk. For the discussion part, *p* values below 0.05 were considered statistically significant.
Results {#Sec6}
=======
Study population {#Sec7}
----------------
Forty-five patients were treated with BCT and 117 patients had M as final surgery within one year from the breast cancer diagnosis. Patient, tumor, and treatment characteristics are listed and compared between these two groups in Table [1](#Tab1){ref-type="table"}. BCT was common in the time period 1990--1999, M was more common before and after that. Tumors treated with M were more often stage III and less often stage I than tumors treated with BCT. Mean age at diagnosis was 43.3 years in both groups. Patients treated with M more often received (neo)adjuvant chemotherapy (59 vs. 42 %) and adjuvant endocrine therapy (37 vs. 13 %) than patients treated with BCT. M was followed by postoperative radiotherapy in 53 % of the cases. A bilateral prophylactic mastectomy was done by 40 % of the patients in the BCT group, and a contralateral prophylactic mastectomy was done by 44 % of the patients in the M group. In both groups, 67 % underwent a bilateral oophorectomy (Table [1](#Tab1){ref-type="table"}). Out of these 108 oophorectomies, 10 were done prior to breast cancer diagnosis, 39 within two years following breast cancer diagnosis, and 59 at a later date. The mean follow-up for OS was 12.9 years for patients alive at the end of follow-up; 14.9 years in the BCT group and 12.1 years in the M group. Table 1Patient, tumor, and treatment characteristicsVariableBCT (*n* = 45)M (*n* = 117)*p* ^a^Mean follow-up^b^, years14.912.1Mean age at diagnosis, years43.343.3Median age at diagnosis, years43.042.0Year of diagnosis0.019 1975--19898 (18 %)31 (26 %) 1990--199924 (53 %)34 (29 %) 2000--201113 (29 %)52 (44 %)TNM stage0.023 I22 (51 %)33 (29 %) II17 (40 %)53 (47 %) III4 (9 %)26 (23 %) Missing25Tumor grade0.55 I0 (0 %)2 (3 %) II5 (33 %)12 (19 %) III10 (67 %)48 (77 %) Missing3055ER status0.19 Negative25 (78 %)59 (63 %) Positive7 (22 %)34 (37 %) Missing1324PgR status1 Negative23 (74 %)67 (74 %) Positive8 (26 %)24 (26 %) Missing1426(Neo)adjuvant chemotherapy0.054 No26 (58 %)47 (41 %) Yes19 (42 %)69 (59 %) CMF-like7 (16 %)22 (19 %) Anthracycline-based11 (24 %)29 (25 %) Taxane-containing016 (14 %) Unknown1 (2 %)2 (2 %)Adjuvant endocrine therapy0.004 No39 (87 %)73 (63 %) | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Nano-sized materials have been increasingly used in the medical field to improve the target efficiency of drugs.[@b1-ijn-9-051]--[@b3-ijn-9-051] In order to successfully apply nanoparticles in drug delivery, their physical and chemical properties must first be understood, thereby assisting in controlling the biological responses to their use. Because drug delivery nanosystems transport pharmaceutical compounds in the body, it is important to understand their physiochemical properties to safely achieve a desired therapeutic effect.
However, these drug delivery nanosystems have shown some limitations regarding the toxicity of the nanoscale materials in the body.[@b4-ijn-9-051],[@b5-ijn-9-051] In order to reduce their toxicity, it is crucial to study endocytosis, exocytosis, and clearance mechanisms for nanoparticles released from the nanoparticle--drug conjugates. Nanoparticles exposed to the bloodstream interact with opsonin proteins. When opsonin proteins attach to the surface of nanoparticles, they allow macrophages of the mononuclear phagocytic system (MPS) to easily recognize the nanoparticles and hence the nanoparticles eventually accumulate in the MPS organs, such as liver and spleen. These phenomena cause low targeting efficiency and severe systemic toxicity of the drug-delivery nanosystems. Therefore, this review focuses on endocytosis and exocytosis patterns of nanoparticles in mammalian cells with respect to their size, shape, and surface chemistry ([Figure 1](#f1-ijn-9-051){ref-type="fig"}).
Nanoparticle stability
======================
Nanoparticles have been widely used in the fields of drug delivery and bioimaging because their size, shape, and surface properties can be precisely engineered for specific diseases.[@b6-ijn-9-051],[@b7-ijn-9-051] The nanoparticle surface can be modified with various targeting molecules (eg, antibody, peptide, aptamer, etc) in order to achieve efficient targeting to disease sites.
Recently, many scientists have begun to investigate the effects of different sizes, shapes, and surface chemistries on endocytosis, toxicity, and gene regulation.[@b8-ijn-9-051]--[@b10-ijn-9-051] However, aggregates (strongly bonded between nanoparticles) and agglomerates (loosely bonded between nanoparticles or aggregates acting under weak forces, eg, van der Waals force) formed by forces between nanoparticles and components in biological media have not been fully considered to optimize their physicochemical properties for biological applications. It was recently suggested that the aggregates or agglomerates occur when the van der Waals attractive forces between nanoparticles are larger than the electrostatic repulsive forces ([Figure 2](#f2-ijn-9-051){ref-type="fig"}).[@b11-ijn-9-051] Aggregated or agglomerated forms of nanoparticles would behave differently within biological systems than would nanoparticles in their single form. Thus, size uniformity of nanoparticles should be considered when the effect of physical and chemical properties of nanoparticles on their interactions with biological systems is examined.
In biological solutions, such as blood, saliva, and cell culture media, the surface chemistry of nanoparticles plays a crucial role in determining their behavior because they are directly related to types and compositions of biomolecules attached to the nanoparticle surface. The surface chemistries on the nanoparticle surface are dynamically changed because various biomolecules are attached and detached based on their binding affinity to the surface. Pre-coating of the nanoparticle surface with stabilizing molecules such as polyethylene glycol (PEG), deoxyribonucleic acid (DNA), and albumin has been utilized to reduce ionic strength and prevent nanoparticles from aggregation or agglomeration in the biological solutions.[@b12-ijn-9-051]--[@b14-ijn-9-051]
Additionally, individual nanoparticles can be naturally coated with various biomolecules, forming the nanoparticle--protein complex, when solubilized in biological solutions. The stability lifetimes of the nanoparticle--protein complexes range from hours to days in the biological solutions. The proteins covering the nanoparticle surface further prevent the individual nanoparticles from aggregation or agglomeration. Because the formation of nanoparticle--protein complexes is mainly determined by surface chemistries of the nanoparticles, it is important to investigate which surface chemistry is the most favorable to form the nanoparticle--protein complex. Therefore, natural nanoparticle--protein complexes formed in biological environments would allow us to study how individual nanoparticles interact with various types of cells.
When we study the endocytosis and exocytosis of nanoparticles, cells are treated with the nanoparticles in the culture medium containing various serum proteins. Most of the nanoparticles are first coated with the serum proteins and then met with the plasma membrane of cells. If the nanoparticles are already aggregated or agglomerated prior to binding to the membrane, their endocytosis patterns would differ from the endocytosis patterns of individual nanoparticles. The degree of aggregation or agglomeration of the nanoparticles can be determined by measuring time-dependent change of size and surface charge of the nanoparticles in the culture medium. The (hydrodynamic) size has been mainly analyzed using transmission electron microscopy (TEM) and dynamic light scattering (DLS) while the surface charge is determined by zeta potential measurements. In particular, the ultraviolet--visible (UV/Vis) spectrophotometry has also been used to monitor the size of gold nanoparticles because their localized surface plasmon resonance peaks can be shifted to a longer wavelength by increasing their size.[@b15-ijn-9-051] The DLS technique has been the most widely used to monitor size change because it directly measures hydrodynamic sizes of protein-coated nanoparticles in the biological solution with nanometer precision. Furthermore, the zeta potentials of protein-coated nanoparticles mostly appeared as a negative surface charge although the nanoparticles had different original surface chemistries. It suggests that most proteins attached on the nanoparticle surface seem to be negatively charged, regardless of their content and composition, although they may alter depending on the surface chemistries of the nanoparticles. Thus, the content and composition of proteins preferentially attached on the nanoparticle surfaces should be studied for the cellular uptake and immune response of nanoparticles.[@b16-ijn-9-051],[@b17-ijn-9-051]
Nanoparticle endocytosis
========================
Endocytosis mechanism
---------------------
All types of cells in the body use the endocytosis process to communicate with the biological environments. This process is an energy-dependent process through which cells internalize ions and biomolecules.[@b18-ijn-9-051] In particular, the cells internalize nutrients and signaling molecules to obtain energy and interact with other cells, respectively. The endocytosis pathways are typically classified into clathrin- and caveolae-mediated endocytosis, phagocytosis, macropinocytosis, and pinocytosis ([Table 1](#t1-ijn-9-051){ref-type="table"}). Clathrin- and caveolae-mediated endocytosis indicates receptor-mediated endocytosis. Many types of cells use the clathrin- and caveolae-mediated endocytosis pathways to internalize nanoscale materials, including viruses and nanoparticles.[@b19-ijn-9-051]--[@b21-ijn-9-051] These endocytosis pathways are the most important pathways for the internalization of nanoparticles into cells because the nanoparticles are directly coated with the plasma proteins when exposed to physiological solutions. The phagocytosis pathway is used when phagocytic cells internalize foreign materials with sizes larger than 0.5 μm.[@b16-ijn-9-051] The phagocytosis pathway is actin-dependent and restricted to professional phagocytes, such as macrophages, dendritic cells, and neutrophils. The macropinocytosis pathway is a non-specific process to internalize fluids and particles together into the cell, whereas the pinocytosis pathway absorbs biological fluids from the external environment of a cell.[@b22-ijn-9-051] These pathways are very important to translocate single nanoparticles with sizes below 10 nm into the cell.
When nanoparticles are systemically administered into the body, they are confronted with many types of cells. Since nanoparticles have emerged as effective drug carriers to treat complex diseases, it has become crucial to understand nanoparticle endocytosis mechanisms. It is believed that the endocytosis efficiency of nanoparticles is dependent on the physicochemical properties, such as size, shape, and surface chemistry, as well as cell type. Thus, interaction of nanoparticles with cells depending on their physicochemical properties is discussed in the following sections.
Factors affecting nanoparticle endocytosis
------------------------------------------
Nanoparticles circulating in the bloodstream happen to meet and internalize into many types of cells through the plasma membrane. The plasma membrane is a selectively permeable membrane that transfers materials that are essential for sustaining the cell's life. Naturally, materials necessary for the cell's life, such as ions and nano-sized proteins, can pass through the lipid bilayer using specialized membrane-transport protein channels.[@b23-ijn-9-051] Thus, the plasma membrane of cells would select the endocytosis pathways of nanoparticles depending on their size, shape, and surface chemistry ([Table 2](#t2-ijn-9-051){ref-type="table"}).
### Size
Size-dependent cellular uptake of nanoparticles has been extensively investigated in various cell lines because the nanoparticle size has been known to be a key determinant of the uptake pathways. Many critical in vivo functions of nanoparticles, such as circulation time, targeting, internalization, and clearance, depend on their size. Thus, the cellular uptake of nanoparticles with various sizes is reviewed in this subsection.
Much interest has focused on understanding size-dependent internalization of nanoparticles in cancer cells and fibroblasts. The cellular uptake of gold nanoparticles of various sizes was studied in human cervical cancer cells ([Figure 3](#f3-ijn-9-051){ref-type="fig"}).[@b8-ijn-9-051],[@b9-ijn-9-051],[@b24-ijn-9-051] Researchers at the University of Toronto, Canada, demonstrated that uptake mechanism and saturation concentration of | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
The treatment of end-stage chronic kidney disease includes hemodialysis, peritoneal dialysis and kidney transplantation (KTx), while today KTx is the treatment of choice due to better survival, quality of life and cost effectiveness in comparison to maintenance dialysis \[[@CR1], [@CR2]\]. Short- and long-term graft survival after KTx have significantly improved within the last decades but there is still a substantial number of patients with declining transplant function and graft loss in the long term. Currently, the mean 20-year graft survival is only 30--40% \[[@CR3]\]. Consequently, there is a clear need to develop and test for new therapies that may help to preserve long-term graft function. In addition, identification of reliable candidate biomarkers would allow predicting long-term allograft function or select specific transplant patients that may benefit from new strategies.
Metabolic acidosis (MA) is a well-known complication of CKD and associated with a variety of complications such as uremic bone disease, protein-energy wasting, chronic inflammation, insulin resistance, impairment of myocardial function and disturbances in mineral metabolism, growth hormone and thyroid gland function \[[@CR4]--[@CR6]\]. In addition, observational studies have shown that MA is associated with increased mortality in both, dialysis patients and patients with non-dialysis dependent CKD \[[@CR7]\]. Importantly, MA is highly prevalent in renal transplant patients with prevalences reported ranging from 12 to 58% and seems to be consistently more frequent and more severe when compared to non-transplant CKD cohorts with similar degrees of renal function \[[@CR8]--[@CR10]\]. In our clinic, a cross-sectional analysis among 823 unselected kidney transplant patients revealed metabolic acidosis in 58.1% of the patients defined by a serum bicarbonate of \< 24 mmol/l indicating a high prevalence of MA in this patient cohort \[[@CR8]\]. Notably, eGFR correlated best with serum bicarbonate levels at time of examination. These data could be confirmed by other authors \[[@CR9]\] and similar to CKD patients creatinine clearance was markedly lower in the group of transplant patients with MA compared to the non-acidotic patients. Over the past few years several studies have shown that MA plays an important role in the progression of CKD and that low serum bicarbonate levels are associated with a higher risk of progressing to end-stage renal disease \[[@CR5], [@CR7], [@CR11]--[@CR15]\]. Amelioration of MA in CKD patients with alkalinizing therapies delayed progression of GFR loss \[[@CR16]--[@CR18]\]. Furthermore, a recent study has shown for the first time that MA after KTx is associated with increased risk of graft loss and patient death as mentioned before for CKD patients. In this multicenter retrospective cohort study of 2318 patients, a low TCO~2~ level (\< 22 mmol/L) 3 months after transplantation was associated with increased risk of graft loss and death-censored graft failure even after adjusting for eGFR \[[@CR19]\]. However, to the best of our knowledge, no prospective trial has been initiated yet to test the role of alkali treatment in the prevention of progressive loss of renal allograft function.
Apart from the crucial question if alkali treatment may have a beneficial effect on graft function there are at least two other important aspects of metabolic acidosis after kidney transplantation that are not fully understood yet, namely first the underlying pathomechanisms why MA occurs in KTx patients and second how metabolic acidosis may promote disease progression. It has been reported that MA is more common in patients who received a cadaveric organ compared to a transplant from a living donor \[[@CR20]\] but as of today, the influence of donor age, donor renal function and further pre-transplant factors on the occurrence of MA after KTx is still unclear \[[@CR10]\]. Other factors such as the intake of calcineurin inhibitors have been shown to be associated with the development of MA by specific changes in tubular epithelial cells which play a role in acid-base regulation \[[@CR8], [@CR20]--[@CR24]\]. In CKD, Wesson et al. investigated intensively the pathogenic effects of endothelin, aldosterone and angiotensin-II on the kidney and its impact on GFR \[[@CR13], [@CR14], [@CR17], [@CR25]--[@CR28]\]. Likewise, a role of the complement system and accumulation of interstitial ammonium had been early proposed to contribute to progression of CKD \[[@CR29]\]. Thus, it is essential to investigate the role and in particular the pathomechanisms of MA on graft function and outcome. These findings may help to develop new potential therapeutic targets, such as alkali therapy, that may help to preserve long-term graft survival in this population.
To date, more than 3000 patients with a functioning kidney transplant are living in Switzerland and over 200,000 in the United States \[[@CR30]\]. Many of these patients already suffer from decreased graft function which favours the development of MA. Given the expanding pool of CKD patients - including former kidney transplant recipients - an alkali treatment study in kidney transplant patients is of prime importance and has the potential to show that such a treatment may slow or reduce the progression towards graft failure and significantly decrease the rate of end stage renal disease, and therefore prolonging long-term graft survival in KTRs.
Methods {#Sec2}
=======
Trial design {#Sec3}
------------
The Preserve-Transplant Study (PTS) is an investigator-initiated, prospective, patient-blinded, multi-center, randomized, controlled phase-IV trial with two parallel-groups comparing sodium bicarbonate to placebo. The study encompasses 300 patients, ≥ 18 years of age, at least 12 months after renal transplantation and with a serum bicarbonate level ≤ 22 mmol/l. A placebo was chosen as a comparator to the intervention because no equivalent active comparator is existing to date that would qualify as an appropriate comparator. Participants will be randomly allocated to receive sodium bicarbonate or placebo in a 1:1 distribution and will be followed up for 2 years (see Fig. [1](#Fig1){ref-type="fig"}). The trial is performed at three transplant centers in Switzerland, in Zurich, Berne and Geneva.Fig. 1Study Flowchart of the Preserve-Transplant Study. Numbers in circles define each study visit. Study visits 2, 7, and 11 include in addition to blood and spot urine tests 24 h-ambulatory blood pressure monitoring and 24 h urine collection
Objectives and hypothesis {#Sec4}
-------------------------
The primary objective of PTS is to test if alkali treatment will preserve kidney graft function and diminish the progression of chronic kidney disease in renal transplant patients by assesing the change in eGFR over 2 years from baseline compared to placebo.
Additionally we want to investigate underlying pathomechanisms of metabolic acidosis and how metabolic acidosis may promote disease progression. A further objective is to identify reliable candidate biomarkers that would allow selecting specific transplant patients that may benefit from alkali therapy.
This study assesses long-term safety of the study drug with a particular focus on new onset and worsening of hypertension, volume overload, and gastrointestinal side effects. Selected adverse events (AEs) and all serious adverse events (SAEs) will be documented regularly and compared between the treatment and placebo group.
Trial outcomes {#Sec5}
--------------
The primary outcome of this study is the change in renal function by assessing eGFR within 2 years. eGFR will be determined based on the CKD-EPI creatinine equation. By now, eGFR is the best parameter to assess kidney function and to predict graft and patient survival in kidney transplant recipients \[[@CR1]\]. Recent recommendations from the NKF-FDA Scientific Workshop and other publications show that eGFR decline over 2--3 years is an acceptable endpoint for CKD progression trials and clinical transplant research \[[@CR1], [@CR31]--[@CR33]\]. Additionally, several recent studies have used eGFR successfully to investigate the effect of alkali treatment on progression of chronic kidney disease \[[@CR13], [@CR14], [@CR28]\]. Moreover, creatinine is a well-established, standardized, and reliable parameter ubiquitously measured in routine clinical practice and compared to inulin or radiolabeled isotopes such as ^125^I Iothalamate or ^51^Cr EDTA very cost-effective and easy available.
Important secondary outcomes include changes in serum bicarbonate levels, pH, sodium, potassium, and proteinuria measured as protein/creatinine or albumin/creatinine ratio in spot urine. As a safety outcome, 24-h ambulatory blood pressure monitoring will be performed at the beginning of the study and after 1 and 2 years to evaluate the effect of sodium bicarbonate on blood pressure. All outcomes of interest are shown in Table [1](#Tab1){ref-type="table"}**.**Table 1Study OutcomesPrimary OutcomeChange in renal function by assessing eGFR (CKD-EPI) within 2 yearsImportant Secondary OutcomesChanges in serum bicarbonate levels, pH, sodium, potassium, and proteinuria measured as protein/creatinine or albumin/creatinine ratio in spot urineSafety OutcomeTwenty-four-hour ambulatory blood pressure monitoring will be performed at the beginning of the study and after 1 and 2 yearsOther Outcomes of Interest• Changes in measurement of specific acid base transport proteins by urinary exosome collection\
• Changes in urinary ammonium excretion, inflammatory markers such as complement factors, and hormones involved in tubulo-interstitial nephritis/fibrosis such as endothelin and aldosterone\
• Histopathological grade of tubulo-interstitial fibrosis according to BANFF classification in kidney biopsies (where available) will be analyzed in both arms\
• Systemic calcification propensity in blood will be determined by the *T*~*50*~-Test (A test measuring the transformation time (* | {
"pile_set_name": "PubMed Central"
} |
Correction to: Fraslin et al. Genet Sel Evol (2018) 50:60 10.1186/s12711-018-0431-9 {#Sec1}
===================================================================================
After publication of this work \[[@CR1]\], we noted that there was an error in Table 3 Line 4: ^b^Omy2~**Omy3**~ should be ^b^Omy21~**Omy3**~.
The correct Table [3](#Tab3){ref-type="table"} is included here.Table 3Results of QTL analysis using the model *M2* for resistance trait following injection or immersion challengesInfection routeQTLLRTmaxPosition (cM)CI (95%)Increase in survival rateResistance origin*P* value fixed effect*P* value interactionFixed_R (%)Fixed_S (%)Fixed_RFixed_SIMMERSIONOmy17~**Omy3**~13.97\*610--92387AP2AP2\*\*\*NSOmy25a~**Omy3**~10.41\*40--351018B57B57\*\*\*NS*Type 1 interaction*INJECTION^a^Omy3~**Omy29**~15.27\*\*8946--1051647AP2AP2\*\*\*\*\*\*IMMERSION^b^Omy21~**Omy3**~15.35\*\*9763--104439B57B57\*\*\*\*\*\*^b^Omy3~**Omy21**~40.73\*\*\*8782--932055AP2AP2\*\*\*\*\*\*^c^Omy3~**Omy2**~35.66\*\*\*8781--941744AP2AP2\*\*\*\*\*\*INJECTION^a^Omy29.2~**Omy3**~14.85\*238--49548B57AP2\*\*\*\*Omy17~**Omy25a**~15.85\*\*7353--791153AP2B57\*\*\*\*\*\*IMMERSIONOmy7.2~**Omy21**~11.48\*70--103531AP2B57\*\*\*\*\*\**Type 2 interaction*INJECTION^d^Omy25a~**Omy3**~25.49\*\*\*1410--185316B57B57\*\*\*\*^d^Omy3~**Omy25a**~35.35\*\*\*8986--925922AP2AP2\*\*\*\*\*\*Omy26~**Omy29**~11.75\*180--343026AP2AP2\*\*\*\*\*\*INJECTIONOmy17~**Omy29**~18.29\*\*\*7458--924711AP2B57\*\*\*\*\*\*IMMERSIONOmy24~**Omy2**~12.71\*40--19201B57AP2\*\*\*\*\*\**Type 3 interaction*IMMERSIONOmy7.1~**Omy2**~16.42\*\*6132--871919B57AP2\*\*\*\*\*\*The table presents chromosome-wide or genome-wide significant QTL detected for STATUS using model *M*2; Reciprocal interactions could be tested only for QTL detected in the first STATUS analysis (model *M*1); LRTmax = maximum of likelihood ratio test; Position in the genetic map in centimorgans (cM); CI = confidence interval; Chromosome-wide significant = \**P* ≤ 0.01; Genome-wide significant = \*\**P* ≤ 0.05 or \*\*\**P* ≤ 0.01; *P* values for fixed effect and interaction corrected with Benjamini--Hochberg method: Non-significant = NS; \**P* value ≤ 0.05; \*\*\**P* value ≤ 0.001^a^The reciprocal interaction could not be tested as a new QTL (Omy29.2~**Omy3**~-QTL) was detected with the reciprocal model^b,d^Reciprocal models for QTL pairs^c^The QTL in the reciprocal model (Omy2~**Omy3**~-QTL) was only suggestive (*P* ≤ 0.05) at the chromosome-wide level
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
| {
"pile_set_name": "PubMed Central"
} |
{.490}
{.491}
| {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#s1}
============
Current treatment options for breast cancer are moving toward potent targeted therapies in general well tolerated and that can be tailored to an individual patient's tumor. There are now targeted therapeutic options available for nearly all breast cancer subtypes, exploiting the differing drivers of carcinogenesis within these individual tumors \[[@R1]\]. Indeed, a better understanding of the biology of breast cancer and the recent advances in the application of genomic technologies led to the identification of a number of molecular targets. Breast cancer is as a complex disease in which each tumor presents several genomic alterations and activated pathways \[[@R2], [@R3]\]. Therefore, there is a strong rationale to combine drugs based on the presence of multiple genomic alterations and/or pathway activation \[[@R4]\]. Among them are tyrosine kinase inhibitors directed at a number of targets (HER1, HER2, HER3, IGF receptor \[IGFR\], C-MET, FGF receptor \[FGFR\]), inhibitors of intracellular signaling pathways (PI3K, AKT, mammalian target of rapamycin \[mTOR\]), angiogenesis inhibitors and agents that interfere with DNA repair \[[@R5]\]. Some of these agents have shown remarkable activity and have become part of the standard of care in patients with breast cancer (exemplified by the anti-HER2 agents trastuzumab and lapatinib). Others have been recently approved for the treatment of specific breast cancer subtypes, such as the mTOR inhibitor everolimus in advanced luminal breast cancer and the poly(ADP-ribose)polymerase (PARP) inhibitor olaparib in metastatic breast cancer with germline BRCA1 or BRCA2 mutations \[[@R6]--[@R9]\].
One of the challenges that physicians are confronted with, is the ability to match each patient with the right therapy. Given the complexity of the cancer cell signal transduction networks, it may be more rational to inhibit more than one target or pathway at a time. Choices on drug combinations in clinical studies should be based on biological rationales and preclinical evidence of additive or synergistic effects.
DNA repair deficiencies and activation of PI3K pathway are relatively common events in breast cancer. BRCA1/2 mutations have been associated with sensitivity to PARP1 inhibitors (synthetic lethality) and DNA alkylating agents (genotoxic) \[[@R9]\], while alterations in component of the PI3K pathway might confer sensitivity to PI3K and mTOR inhibitors.
The mTOR inhibitor everolimus has been recently approved for the treatment of advanced ER+ breast cancer in a context of endocrine resistance \[[@R6]\]. Although everolimus combined with an aromatase inhibitor improved progression-free survival, not all patients respond to everolimus and even those who respond eventually develop resistance \[[@R10]\]. Patient stratification and predictive biomarker are still lacking \[[@R11]\].
Here we explored the therapeutic benefit of combining everolimus to a PARP inhibitor in two different patient-derived xenografts of BRCA2-mutated breast cancer with genomic alterations in the PI3K pathway.
We show that everolimus combined to olaparib lead to unrepaired DNA damage and tumor regression *in vivo*, through a cross-talk between DNA repair and mTOR pathways.
RESULTS {#s2}
=======
Treatment of a BRCA2 mutated luminal breast cancer PDX by everolimus and olaparib results in tumor regression {#s2_1}
-------------------------------------------------------------------------------------------------------------
To test whether the combination of DNA repair and mTOR inhibitors could be a relevant therapeutic strategy in tumors with genomic alterations in DNA repair and PI3K/AKT/mTOR pathway, we treat a PDX model established from a BRCA2 mutated breast cancer (HBCx-22 TamR) with the Parp inhibitor olaparib combined to the mTOR inhibitor everolimus.
This PDX model has been established from an ER+ primary breast cancer \[[@R12]\] and has been rendered resistant to tamoxifen in mice, through long-term *in vivo* treatment and re-engraftment of xenograft that showed acquired resistance to tamoxifen, as previously described \[[@R13]\]. This tumor carries an in frame deletion in the *PIK3R1* gene and a frameshift inactivating mutation of *PTEN* associated to its protein loss (Table [1](#T1){ref-type="table"}).
###### Breast cancer subtypes and genomic characteristics of BRCA2-mutated PDX models
----------------------------------------------------------------------------------------------------------------------------------
HBCx22 TamR HBCx-17
------------------------- ---------------------------------------------------- ---------------------------------------------------
Subtype Luminal B Basal-like
Germline BRCA2 mutation c.6405_6409del5, p.Asn2135Lysfs^\*^3 (NM_000059.3) c.6033_6034del, p.Ser2012GlnFs^\*^5 (NM_000059.3)
*PIK3R1* c.1704_1727del, p.Arg569_Thr576del (NM_181523.1) Wild-type
*PI3KCA* Wild-type Wild-type
*PTEN* c.314G\>T, p.Cys105Phe (NM_000314.4)\ Intragenic deletion\
LOH and protein loss LOH and protein loss
Reference Cottu et al. (2014) De Plater et al. (2010)
----------------------------------------------------------------------------------------------------------------------------------
The effect of everolimus, olaparib and evero-limus+olaparib treatments on the tumor growth of HBCx-22 TamR are shown in Figure [1A](#F1){ref-type="fig"} and [1B](#F1){ref-type="fig"}. In the monotherapy setting, everolimus and olaparib inhibited tumor growth with a TGI of 86% with 4 and 3 mice showing tumor regression, respectively (Figure [1B](#F1){ref-type="fig"}). The combination of the two treatments resulted in strong tumor growth inhibition (TGI of 96%) with 9/9 mice in tumor regression and 4 complete responses. Tumor growth inhibition was higher in the combination group as compared to the monotherapy groups (p\<0.0001 when compared to olaparib and p=0.0002 when compared to everolimus, Mann-Whitney *t*-test).
{#F1}
To analyze the effect of treatments on tumor, a second experiment was performed where treatments were started in larger tumors (tumor volume between 150 and 400 mm3), were administered during 3 weeks and samples were harvested before complete response occurred (3 hours after the last treatment). We then analyzed the expression of phospho-histone H3 (P-HistH3) and Ki67 by western blot and immunohistochemistry analysis, respectively. Expression of P-HistH3 and Ki67 were inhibited in both monotherapy groups and strongly reduced in the combination arm (Figure [1C](#F1){ref-type="fig"} and [1D](#F1){ref-type="fig"}). In summary, these results show that treatment by everolimus combined to olaparib results in strong tumor growth inhibition with 100% of animals showing tumor regression in a PDX of ER+ BRCA2 mutated breast cancer.
Treatment by everolimus results in increased DNA damage and decreased expression of several proteins involved in DNA repair {#s2_2}
---------------------------------------------------------------------------------------------------------------------------
The presence of double-strand break (DSB) in chromatin induces the phosphorylation of the histone H2AX, and this modification can be used as a marker for mechanistic studies of DSB induction and repair (44--46). To test the effect of olaparib and everolimus on DSB induction, we measured phosphorylation of H2AX (P-H2AX) by immunohistochemistry in tumors treated during 3 weeks and harvested 3 h after the last dose. Tumors treated with everolimus and olaparib alone showed an increased faction of P-H2AX positive cells (16% and 21% respectively, compared to 8% in the control group), indicating that not only the DNA repair inhibitor olaparib could increase DNA damage (as it is expected) but also the mTOR inhibitor everolimus (Figure [2A](#F2){ref-type="fig"}). In the combination arm, the fraction of P-H2AX was significantly higher than in both monotherapy groups, with 29% of P-H2AX positive cells. The formation of RAD51 foci in HBCx-22 TamR xenografts was impaired (Figure [2B](#F2){ref-type="fig"}), confirming that this BRCA2 deficient PDX is unable to repair DNA double strands breaks by homologous recombination.
![Analysis of DNA | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-molecules-23-00346}
===============
Suramin is a water-soluble polysulfonated naphtylurea. It was first synthesized in 1916 as a colorless derivate of trypan dyes for the treatment of African trypanosomiasis (reviewed by \[[@B1-molecules-23-00346]\]). Later on it was found that suramin had an effect against the Human-Immunodeficiency Virus \[[@B2-molecules-23-00346]\] and that non-Hodgkin lymphomas associated with this virus were sensitive to suramin treatment \[[@B3-molecules-23-00346]\]. Further investigation revealed broad antitumor activity of suramin and a wide variety of mechanisms of action were described. Among others, it was shown that suramin inhibits several different enzymes and growth factors, which may account for the antiretroviral, antiprotozoal and antitumor activity. In different tumor entities suramin was proposed to bind to a range of growth factors such as the vascular endothelial growth factor or the epidermal growth factor \[[@B1-molecules-23-00346]\]. Subsequently, suramin was tested in clinical trials of different metastatic tumor entities with emphasis on metastatic prostate cancer \[[@B4-molecules-23-00346],[@B5-molecules-23-00346],[@B6-molecules-23-00346],[@B7-molecules-23-00346]\]. In line with the seemingly unspecific mode of action of suramin, the clinical application revealed several side effects such as coagulopathy, adrenal insufficiency, nephrotoxicity or hepatotoxicity \[[@B1-molecules-23-00346],[@B6-molecules-23-00346]\]. One of the most frequently observed dose limiting side effects, however, is a toxic peripheral polyneuropathy, which occurs in 40--79% of suramin treated patients \[[@B6-molecules-23-00346],[@B8-molecules-23-00346],[@B9-molecules-23-00346]\]. As suramin is a charged molecule and does not cross the blood brain barrier it exerts neurotoxic effects in the peripheral nervous system only \[[@B10-molecules-23-00346]\]. Due to the potentially severe side effects, clinical use of suramin at the time of writing is limited to treatment of African trypanosomiasis and as an orphan drug for (metastatic) hormone refractory prostate cancer. Suramin-induced peripheral neuropathy most frequently shows as sensory-motor axonal neuropathy with sensory symptoms such as hypoesthesia, paresthesia, dysesthesia, hypoalgesia or pallhypesthesia \[[@B9-molecules-23-00346],[@B11-molecules-23-00346]\]. The incidence of a demyelinating Guillian-Barré like syndrome under suramin treatment was reported less frequently \[[@B12-molecules-23-00346]\]. Incidence and severity of suramin-induced neuropathy are influenced by plasma levels exceeding 350 µg/mL, the cumulative suramin dose and the duration of chemotherapy \[[@B12-molecules-23-00346],[@B13-molecules-23-00346]\]. A variety of different pathomechanisms was described: The inhibition of lysosomal enzymes by suramin was proposed to cause an experimental form of gangliosidosis with intracellular lamellar inclusion bodies in neurons and Schwann cells \[[@B14-molecules-23-00346],[@B15-molecules-23-00346]\]. Different experimental studies suggested the involvement of nerve growth factor and a binding affinity of suramin to the nerve growth factor receptor to account for the neurotoxic effect \[[@B16-molecules-23-00346],[@B17-molecules-23-00346]\]. Furthermore, Sun et al. described that suramin leads to a disturbance of the intracellular calcium (Ca^2+^) homoeostasis in dorsal root ganglia neurons (DRGN) \[[@B18-molecules-23-00346]\]. Intriguingly, other chemotherapeutic agents such as paclitaxel and salinomycin were also found to cause a peripheral neuropathy via a disturbance of intracellular Ca^2+^ levels \[[@B19-molecules-23-00346],[@B20-molecules-23-00346]\]. Thus, it appears that the disruption of the intracellular Ca^2+^ homeostasis might be a common pathomechanism in chemotherapy-induced polyneuropathies. The aim of this study was thus to establish preclinical models of suramin-induced neurotoxicity in order to further elucidate the underlying pathomechanism with an emphasis on Ca^2+^ signaling and to identify potential molecular targets suitable for neuroprotection. We observed that suramin induces neurotoxicity in vitro and in vivo. Calcium influx into DRGN from the extracellular space seems to partially mediate suramin-induced neurotoxicity, as Nimodipine, an L-Type voltage-gated calcium channel (VGCC) inhibitor, showed limited neuroprotective effects.
2. Results {#sec2-molecules-23-00346}
==========
2.1. Suramin Induces a Sensory Axonal-Demyelinating Polyneuropathy in C57Bl/6 Mice {#sec2dot1-molecules-23-00346}
----------------------------------------------------------------------------------
We previously characterized the behavioral and histological phenotype of chemotherapy-induced polyneuropathies in C57Bl/6 mice after application of paclitaxel, vincristine, cisplatin and bortezomib, respectively \[[@B21-molecules-23-00346]\]. In order to establish a mouse model of a suramin-induced polyneuropathy, we adapted a previously published protocol. Russell et al. had shown that a single intraperitoneal injection of 500 mg/kg bodyweight suramin can induce chemotherapy-induced polyneuropathy in rats \[[@B15-molecules-23-00346]\]. In mice, the published LD~50~ of intraperitoneal suramin application is 750 mg/kg bodyweight \[[@B22-molecules-23-00346]\]. To avoid unspecific general side effects, we lowered the dose to a single intraperitoneal injection of 250 mg/kg bodyweight suramin. Mice were tested for sensory and motor deficits on days 3, 8 and 13 after suramin application ([Figure 1](#molecules-23-00346-f001){ref-type="fig"}A). Suramin treatment resulted in a steady decline in bodyweight, which reached its maximum on day 6 with −1.44 g ± 0.65 g compared to baseline (not significant, Kruskal-Wallis test; [Figure 1](#molecules-23-00346-f001){ref-type="fig"}B). Afterwards, mice regained bodyweight and reached control levels by the end of the experiment. One animal, which had lost \>20% bodyweight compared to baseline, had to be sacrificed on day 6 according to predefined endpoints. As allodynia is a frequent symptom of chemotherapy-induced polyneuropathy, the mechanical withdrawal threshold was measured at various time points after suramin application. Suramin treated mice showed a significant decrease in the mechanical withdrawal threshold compared to vehicle-injected mice (Kruskal-Wallis test, *p* \< 0.0001 and *p* = 0.0296 on day 8 and 13, respectively; [Figure 1](#molecules-23-00346-f001){ref-type="fig"}C), indicative of increased sensitivity to mechanical stimuli due to suramin treatment. In the rotarod test we also observed a mild deficit in locomotor function in suramin treated mice compared to control animals, which reached significance on day 8 (repeated measures 2-way ANOVA, *p* = 0.0022; [Figure 1](#molecules-23-00346-f001){ref-type="fig"}D). As the rotarod test measures a complex behavior which is influenced by motor performance but also coordination and sensory function, the observed decline in performance could be mediated by sensory neuropathy as well as motor neuropathy. Given the normal behavior of suramin treated animals in their home cage, the small effect size and our observations regarding the sensory nervous system, the effect of suramin on rotarod performance is likely dominated by sensory neuropathy. Electrophysiological assessment showed that suramin application led to a significant decline in the sensory nerve action potential amplitude (repeated measures 2-way ANOVA, *p* = 0.0158; [Figure 1](#molecules-23-00346-f001){ref-type="fig"}E) as well as the sensory nerve conduction velocity (Kruskal-Wallis, *p* = 0.0329 and *p* = 0.0008 on days 8 and 13, respectively; [Figure 1](#molecules-23-00346-f001){ref-type="fig"}F). In conclusion, our data provide evidence that a single injection of 250 mg/kg bodyweight suramin in C57Bl/6 mice is sufficient to induce a predominantly sensory axonal-demyelinating polyneuropathy.
2.2. Effects of Suramin on Cell Viability and Calcium Homeostasis in Dorsal Root Ganglia Neurons {#sec2dot2-molecules-23-00346}
------------------------------------------------------------------------------------------------
We have previously shown that some cytostatic agents cause alterations in intracellular calcium (Ca^2+^) homeostasis in dorsal root ganglia neurons (DRGN) and thus contribute to the development of chemotherapy-induced polyneuropathy \[[@B19-molecules-23-00346],[@B20-molecules-23-00346],[@B23-molecules-23-00346],[@B24-molecules-23-00346]\]. In a first step, we were interested in the toxicity of suramin towards DRGN. We measured cell viability of DRGN in response to increasing concentrations of suramin and observed marked toxicity above 300 µM suramin concentrations. The calculated half maximal inhibitory concentration (IC~50~) of 22-- | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Cardiovascular diseases (CVD) are a major public health concern in the world, accounting for half of all non-communicable disease deaths worldwide \[[@B1]\]. Similar to findings from western countries \[[@B2],[@B3]\], risk factors for CVD in many developing countries have been well recognized \[[@B4],[@B5]\]. Diabetes, hypertension, cigarette smoking, alcohol drinking and overweight have been found to be major risk factors for CVD in China \[[@B6]-[@B8]\]. There is also growing evidence that the prevalence of CVD risk factors has been increasing, and clustering of CVD risk factors is common in China \[[@B9],[@B10]\].
Traditionally, epidemiological studies have focused on identifying individual-level risk factors for diseases. Recently in epidemiology, there is increasing interest in exploring the effect of population or group (contextual) variables on disease risks. People residing in the same community or context would share the same contextual or environmental exposure and statistical assumption of independence is usually not true. Without proper adjustment, simplistic analysis of contextual independent variables as if they vary independently across individual subjects would bias the result toward overestimation of association. Multilevel modelling \[[@B11]\] provides a useful solution to simultaneously examine the effects of individual-level and contextual-level variables.
Discrimination of effects of contextual from individual independent variables is also important for public health. A good example of contextual concept is externality. While individual socioeconomic status (SES) variables such as income, unemployment and educational level \[[@B12]-[@B16]\] have been recognized to be important determinants of CVD risk factors, little is known about the influence of socioeconomic status of the neighbourhood. If such effects exist and are stronger than individual SES, all the residents would have a better health if they cooperate to raise the community SES than just compete to get to the most without making a contribution to local society. Another example would be independent effects of individual versus contextual ethnicity. CVD risk factors are associated with ethnicity \[[@B17]\] either through culture or genetics or both. As culture is contextual, one would expect strong effect of contextual ethnic effect if it is the main mechanisms. On the other hand, independent influence of genetic can be expressed as an individual ethnic effect. This is independent from the ethnic of the community where the subject resides.
Yunnan province of China is a multi-ethnic area and has 52 ethnic groups. The terrain is mainly mountainous with high variability in level of socioeconomic development and ratio of ethnicities among communities. The risk for CVD among the population is high and also varies by geography \[[@B18]\]. Under such circumstance, our purpose in this study was to test the independent effects of contextual socioeconomic variables with adjustment for individual socioeconomic variables on risk factors for CVD in this study area. Understanding characteristics of village associated with CVD risk factors can assist health planning to allocate appropriate resources to the target area.
Methods
=======
Study design
------------
This was a cross-sectional community survey combined with investigation of contextual variables from existing official data sources.
Study area and population
-------------------------
Shi Lin County, a rural area of Kunming, the capital of Yunnan province (one of the poorest provinces in south-west China), was chosen as the study community. In 2004, it had a population of 205,186 and contained 10 townships, 90 villages and 65,135 families. The county was a typical minority rural county in Kunming, predominated by Yi ethnic group, and is one of the poor counties in Kunming, with a per capita income among peasants of US\$313 \[[@B19]\] in 2004. The total area was 1717 square kilometers, and mostly mountainous. Villages were scattered with a maximum distance of 80 kilometers from the main city, Kunming. Transportation by car was available throughout the year.
Data source
-----------
Socioeconomic characteristics of villages with regard to population size, adult literacy rate, proportion of Yi ethnic minority and distance from city were based on the 2000 census in China obtained from the local statistics office. Individual characteristics, village average income and CVD risk factor parameters were obtained from a cross-sectional community survey.
Community survey
----------------
### Sampling technique
In order to obtain information on each township for subsequent spatial study, reported separately, standard cluster sampling technique \[[@B20]\] was modified to select three clusters or villages from each township. Altogether there were 30 study villages.
In each selected village, from a name list of individuals aged ≥ 45 years obtained from the village committee, 200 subjects were chosen based on simple random sampling method.
Data Collection and measurement
-------------------------------
The questionnaire was adapted from that used by Inter-ASIA collaborative group \[[@B4]\]. The instrument was modified to suit the local situation. Twenty fifth-grade medical students from Kunming Medical College were trained to be data collectors under the supervision of two senior medical staff. The training included introduction to cardiovascular diseases, use of the questionnaire, conducting fasting blood sugar test and taking anthropometric measurements.
In the morning of data collection, each participant was given full explanation of the research purpose, invited to participate and sign informed consent, and interviewed by one of the interviewers. Information on demographic characteristics, status of current cigarette smoking and alcohol drinking, blood pressure and fasting blood sugar test was obtained. Anthropometric measurements included height, weight, and waist and hip girth. Data collection was started in May 2005 and completed within 45 days.
Three blood pressure (BP) measurements were made according to the American Heart Association recommendations \[[@B21]\]. After at least 5 minutes of rest in a sitting position, systolic and diastolic pressures were taken from the participant\'s right arm, using a mercury sphygmomanometer. In our study, BP measures were based on the average of three BP readings. Our method is slightly different from Health Survey for England/Scotland standard and MONICA standards \[[@B22]\], which keep the average of the second and third measurements and reject the first.
Weight was measured using a balance beam scale. The measurement of height and weight was done with the participants standing on the scale wearing indoor clothes and barefoot. To ensure sufficient precision, height was measured to the nearest 0.2 centimeter, and weight was measured to the nearest 0.2 kilogram. Body mass index (BMI) was calculated as weight in kg divided by height in meters squared \[[@B23]\].
Waist girth was measured around the narrowest point between ribs and hips when viewed from the front after exhaling. Hip girth was measured at the point where the buttocks extended the maximum when viewed from the side. Waist-hip ratio was subsequently calculated.
A random 10% of participants were selected from each village for fasting blood sugar study. The subjects were instructed to fast overnight for at least 10 hours. A small drop of fingerprick blood was obtained and put onto a special strip of paper, which was then inserted into the blood glucose monitor machine (Braun, Beijing NecKar Healthcare Company). The monitor measured and displayed the result within 15 seconds. This strip glucose technique had been validated against a standard test in Kunming Hospital, and found to give a 10% lower value. Values obtained from the participants\' blood stick test were therefore adjusted upward as appropriate.
Ethical approval
----------------
This study was approved by the Ethics Committee of Faculty of Medicine, Prince of Songkla University, before carrying out the research.
Definitions
-----------
Cigarette smokers were defined as persons who had smoked at least 100 cigarettes in their lifetime, and those who smoked tobacco products during the survey time were classified as current smokers. Current drinkers were defined as persons who drank alcohol regularly during the previous 12 months (i.e. on 12 or more different days during the year). Hypertension was defined as a mean systolic blood pressure ≥ 140 mm Hg, diastolic blood pressure ≥ 90 mm Hg, and/or use of antihypertensive medications. Overweight was defined as a BMI of 25 kg/m^2^or greater \[[@B23]\]. Diabetes mellitus was defined as a fasting plasma glucose ≥ 7.0 mmol/l (126 mg/dl) \[[@B24]\] or the use of antidiabetic medications. Adult literacy rate was defined as the percentage of population aged 15 years and over who could both read and write with understanding a short simple statement on his/her everyday life.
Outcome variables
-----------------
The outcome variables included systolic blood pressure (mmHg), diastolic blood pressure (mmHg), fasting blood sugar (mmol/l), BMI (kg/m^2^), waist-hip ratio, current smoker and current drinker.
Independent variables
---------------------
Individual-level independent variables were age, sex, ethnicity, household income and education, which are known socio-economic risk factors. The contextual variables included population size, adult literacy rate, proportion of Yi ethnic minority, mean income and distance from city.
Statistical analysis
--------------------
Mean income of participants from each village was computed for using as a contextual variable since this information was not available in any report. Descriptive statistics were used for data summary. Age-sex-adjusted prevalence of each CVD risk factor was computed by indirectly standardizing to the overall sample \[[@B25]\]. The data were further analyzed using multilevel regression. The method of estimation was by constructing a Generalized Linear Model using Penalized Quasi-Likelihood, with individual characteristics at the first level and village socioeconomic status at the second. We examined all individual variables and fitted models for each of the village variables separately. Both individual and village characteristics were treated as fixed effects. Multilevel logistic regression was used to analyze the association between independent variables and binary individual outcome such as current smokers and drinkers, whereas multilevel linear regression was used to analyze CVD risk factors which had a continuous distribution such as blood pressure and fasting blood sugar. The levels of association were expressed as standardized beta coefficients and standard errors | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Biliary tract cancer (BTC) is a rare malignancy comprising a heterogeneous group of diseases including intrahepatic/extrahepatic cholangiocarcinoma and gallbladder cancer. Up to 10,000 new BTC patients are diagnosed annually in the United States and Europe \[[@b1-crt-2017-526]\]. In Korea, BTC is one of leading causes of cancer-related deaths (sixth in males and seventh in females) \[[@b2-crt-2017-526]\]. Surgical resection is the only curative therapeutic modality for localized BTC; however, recurrence after curative resection is common, and most patients present with unresectable or metastatic disease at the time of diagnosis. These clinical characteristics in advanced BTC are associated with poor prognosis, with up to 10% 5-year overall survival (OS) rates \[[@b3-crt-2017-526]\].
After the success of the pivotal phase III ABC-02 study, gemcitabine plus cisplatin (GemCis) has been established as the standard first-line chemotherapy for patients with unresectable or metastatic BTC \[[@b4-crt-2017-526]\]. In that study, GemCis demonstrated significantly improved OS compared with gemcitabine alone (11.7 months vs. 8.1 months). The superiority of GemCis to gemcitabine alone was confirmed in a subsequent Japanese randomized phase II study (11.2 months vs. 7.7 months) \[[@b5-crt-2017-526]\]. Despite this improvement, the median survival remains \< 1 year for patients with advanced BTC, highlighting the large unmet need for improving the efficacy of systemic chemotherapy.
Investigation of combination therapy including three cytotoxic chemotherapeutic agents has revealed a significant survival benefit in multiple cancer types \[[@b6-crt-2017-526],[@b7-crt-2017-526]\]. Particularly in pancreatic cancer, FOLFIRINOX, the combination of fluorouracil, irinotecan, and oxaliplatin, leads to significantly improved survival outcomes compared with gemcitabine monotherapy; this has been globally accepted as one of standard first-line regimens for patients with locally advanced or metastatic pancreatic cancer \[[@b7-crt-2017-526]\]. Considering these success, gemcitabine-free triplets including irinotecan, oxaliplatin, and fluorouracil might also be effective in treating advanced BTC. Furthermore, in a previous phase I study, biweekly triplet combination of oxaliplatin, irinotecan, and S-1 (oral fluoropyrimidine) (OIS) for multiple cancer types was associated with remarkable preliminary efficacy outcomes in advanced BTC, with four of nine BTC patients achieving partial response (PR) \[[@b8-crt-2017-526]\].
Based on these findings, we herein report the results of a single-arm, phase II study that aimed to evaluate the efficacy and safety of OIS in patients with unresectable or metastatic BTC.
Materials and Methods
=====================
1. Eligibility
--------------
Patients with histologically confirmed BTC were eligible if they were chemotherapy-naive and had inoperable locally advanced or metastatic disease. Other inclusion criteria included age of ≥ 19 years; measurable lesion according to the Response Evaluation Criteria in Solid Tumors (RECIST) ver. 1.1 \[[@b9-crt-2017-526]\]; Eastern Cooperative Oncology Group performance status of 0-2; adequate bone marrow, renal, and hepatic function; life expectancy of ≥ 3 months; and written informed consent. Patients were excluded if they had received chemotherapy for BTC. However, previous adjuvant chemotherapy without platinum was allowed if the interval between the completion of adjuvant chemotherapy and enrollment in the study was \> 6 months.
2. Treatment
------------
Patients received intravenous 65-mg/m^2^ oxaliplatin and 135-mg/m^2^ irinotecan on day 1 and 40-mg/m^2^ oral S-1 twice daily on days 1-7, every 2 weeks. This dosing schedule was based on a previous phase I study \[[@b8-crt-2017-526]\]. Treatment continued until disease progression, intolerable toxicity, or patient's withdrawal of consent. Doses were interrupted or modified for grade 3-4 hematological toxicities and grade 2-4 non-hematological toxicities according to the protocol. Primary prophylactic granulocyte-colony stimulating factor support was not allowed. In patients who did not exhibit disease progression during completion of the 12th cycle of OIS, continuation of S-1 monotherapy was allowed at the discretion of the attending physician.
3. Assessment
-------------
Baseline assessment included medical history, physical examination, laboratory tests, and computed tomography (CT) of the chest, abdomen, and pelvis. Physical examination and laboratory tests were performed at each treatment cycle. For response evaluation, CT was performed every three cycles or in the presence of signs or symptoms indicating disease progression. Tumor responses were determined by local investigators according to the RECIST ver. 1.1. Toxicities were assessed every cycle and graded according to the National Cancer Institute Common Terminology Criteria for Adverse Events ver. 4.03.
4. Biomarker analysis
---------------------
Somatic mutations and copy number variation analyses were performed on archival tumor tissues using targeted exome sequencing. Details of methods for next generation sequencing (NGS) experiments and bioinformatics analyses are described in the [Supplementary Methods](#SD3-crt-2017-526){ref-type="supplementary-material"}. Somatic mutations were manually reviewed using Integrative Gemonic Viewers, and correlative analyses were performed between these results and clinical outcomes.
5. Statistical analysis
-----------------------
Primary endpoint was overall response rate (ORR) according to the local investigator's assessment. Secondary endpoints were progression-free survival (PFS), OS, and safety. Simon's optimal two-stage design was used to estimate sample size \[[@b10-crt-2017-526]\]. Estimated ORR of patients who received standard GemCis was approximately 15% according to our large retrospective analysis (P0) \[[@b11-crt-2017-526]\], and investigational OIS was expected to improve to 35% (P1) in ORR with two-sided α of 0.05 and power of 80%. We assumed that 20% improvement in ORR is acceptable for further investigation of OIS in randomized phase II or III trials. After expecting a 10% drop-out rate, target enrollment was 31 patients. In the first stage, during which 15 patients were enrolled, two patients with objective responses (complete response \[CR\] or PR) were required to proceed to the second stage of patient enrollment. At least 10 patients with objective responses were needed to declare OIS as effective.
PFS was defined as the time from the initiation of study treatment to disease progression or death, whichever occurred first. OS was defined as the time from the initiation of study treatment to death from any cause. The Kaplan-Meier method was used to estimate time-to-event variables. All efficacy parameters were analyzed based on the full analysis set, which included all patients who met the eligibility criteria. A two-sided p-value of \< 0.05 was considered statistically significant. SPSS ver. 22.0 (IBM Corp., Armonk, NY) was used to perform all statistical analyses.
6. Ethical statement
--------------------
This multicenter, open-label, single-arm, phase II study was conducted at two tertiary referral hospitals in Korea. The study protocol was approved by the Institutional Review Board of Hallym University Sacred Heart Hospital (2015-1020) and Asan Medical Center (2015-1070), and all patients provided written informed consent prior to enrollment. This study was conducted in accordance with the Declaration of Helsinki and the guidelines of Good Clinical Practice (ClinicalTrial. gov identifier: NCT02527824).
Results
=======
1. Patients
-----------
Between 22 October 2015, and 16 June 2016, 32 patients with histologically documented advanced BTC were enrolled. Baseline characteristics of the patients are summarized in [Table 1](#t1-crt-2017-526){ref-type="table"}. Median age was 64 years (range, 40 to 76 years); 24 patients (75%) were males. The most common condition for which study treatment was provided was initially metastatic disease (n=24, 75%); this was followed by recurrent disease after curative surgery (n=7, 22%) and locally advanced unresectable disease (n=1, 3%). Among seven patients who underwent surgery, there was no patient who received adjuvant chemotherapy and adjuvant radiotherapy was given in two patients. The most common location of tumors was intrahepatic (n=13, 41%), followed by gallbladder (n=11, 34%) and extrahepatic (n=8, 25%). Liver (n=23, 72%), lymph nodes (n=21, 66%), peritoneum (n=10, 31%), and lungs (n=7, 22%) were frequent metastatic sites. At the time of analysis, study treatment was ongoing in seven patients without disease progression and was discontinued in 25 patients because of disease progression (n=14), patient refusal (n=4), adverse events (n=4), and death without evidence of disease progression (n=3).
2. Efficacy
-----------
All patients enrolled in this study had measurable disease. The waterfall plot for maximal percent changes in target lesions is presented in [Fig. 1](#f1-crt-2017-526){ref-type="fig"}. ORR was 50% (95% confidence interval \[CI\], 34 to 66) according to RECIST ver. 1.1. No patient achieved CR, whereas 16 patients (50%) achieved PR. Disease control | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
*Bartonella* bacteria are new emerging pathogens causing diseases in humans and animals \[[@pone.0140856.ref001], [@pone.0140856.ref002]\]. The members of genus *Bartonella* are rod-shaped gram negative facultative intracellular bacteria that are fastidious and slow growing at aerobic conditions. They infect human and other mammalian hosts via infected-vectors such as fleas, ticks, and lice or the bite/scratch of an infected-animal \[[@pone.0140856.ref003]--[@pone.0140856.ref005]\]. Moreover, the infected arthropods could transmit *Bartonella* bacteria to human and other mammalian hosts via feces through superficial scratches in skin \[[@pone.0140856.ref006]\]; for example, *B*. *henselae* and *B*. *quintana* were transmitted to hosts via contaminated feces of infected cat fleas (*Ctenocephalides felis*) and human body lice (*Pediculus humanus*), respectively \[[@pone.0140856.ref007]\]. Pathogenesis involves the invasion of host's erythrocytes, endothelial cells, and dendritic cells which play an important role in the first line immune response to fight against pathogens \[[@pone.0140856.ref008], [@pone.0140856.ref009]\]. As a result of the immune system failure, a bacteremia persistent infection might occur \[[@pone.0140856.ref008], [@pone.0140856.ref010]\].
*Bartonella* genus comprises over 30 species and subspecies \[[@pone.0140856.ref011]\]. At least thirteen known or suspected species are thought to contribute to blood-borne infections in human \[[@pone.0140856.ref012]\]. Moreover, several studies suggested the role of *Bartonella* species as a potential causative agent for cases of unknown febrile illness as well as endocarditis in patients in Thailand \[[@pone.0140856.ref013]\]. The diversity of *Bartonella* species in several countries in Southeast Asia (Lao PDR, Cambodia, and Thailand) has been reported and the findings revealed that *Bartonella* species in rodents are much more diverse than in other animals, except bats. The species found in rodents included *B*. *elizabethae*, *B*. *coopersplainsensis*, *B*. *phoceensis*, *B*. *queenslandensis*, *B*. *rattimassiliensis*, *B*. *tribocorum* and three genotypes presumably representing new *Bartonella* species \[[@pone.0140856.ref014]\].
*Bartonella* transmission occurs mainly via horizontal transmission when arthropod vectors acquire *Bartonella* bacteria during the feeding of infected host and later they become infected and the infected vectors then transfer the bacteria to another host \[[@pone.0140856.ref005], [@pone.0140856.ref015]\]. Interestingly, some studies suggested that vertical and transstadial transmissions of *Bartonella* species in *Ixodes* ticks \[[@pone.0140856.ref016]\], deer ked \[[@pone.0140856.ref017]\], and transplacental in rodent populations \[[@pone.0140856.ref018]\].
High prevalence of *Bartonella* DNA and genotype diversity have been detected in arthropod vectors around the world. For example, ticks collected from dogs and donkeys in Peru were found to carry several *Bartonella* species, such as *B*. *rochalimae*, *B*. *quintana* and *B*. *elizabethae* \[[@pone.0140856.ref019]\]. In Taiwan, *B*. *tribocorum*, *B*. *elizabethae*, *B*. *queenslandensis*, *B*. *rochalimae*-like bacteria, *B*. *phoceensis*, and *B*. *rattimassiliensis* were detected in fleas and louse pools \[[@pone.0140856.ref020]\]. Several studies in Thailand have reported the detection of *B*. *henselae*, *B*. *clarridgeiae*, and *B*. *koehlerae* from cats and flea pools collected from the Thai-Myanmar border \[[@pone.0140856.ref021]\] and in the Bangkok area \[[@pone.0140856.ref022]\]. Moreover, novel species such as *B*. *tamiae* was recently isolated from whole blood of febrile patients from Thailand \[[@pone.0140856.ref023]\] and DNA belonging to this species was also detected from the pools of ticks and mites collected from rats in Thailand \[[@pone.0140856.ref015]\].
Though a number of papers on *Bartonella* in rodents from Thailand have been published, the comparative analysis of bartonellae between rodent hosts and ectoparasites has not been done. Our aim was to investigate the prevalence and diversity of *Bartonella* species in rodents and their ectoparasites, and to estimate the importance of this host-vector relationship for the transmission of *Bartonella* species in natural habitats of Thailand. Our results indicated a significant difference between bacterial communities recognized in mammals and arthropods.
Materials and Methods {#sec002}
=====================
Study sites and samples processing {#sec003}
----------------------------------
The study sites were located in different regions of Thailand. Rodents and their associated ectoparasites (ticks, fleas, mites, and lice) were collected from eight provinces within four regions of Thailand during the period of December 2012 to November 2013. The regions included the Northern region (Chiang Rai and Phayao provinces), the Southern region (Chumphon and Surat Thani provinces), the Eastern region (Rayong and Trat provinces) and the Northeastern region (Loei and Nong Bua Lam Phu provinces) ([Table 1](#pone.0140856.t001){ref-type="table"}). This study was carried out on private lands and the owners of the lands gave permission to conduct the study on their sites and the field studies did not involve endangered or protected species. Rodents were captured by live traps baited with bananas or dried fish. Rodents were collected from orchards, cultivated rice-fields, grassland areas, edges of dense forest, stream margins, and around houses. Traps were set for 3--5 nights and were checked early in the morning. Then, rodents were removed from the traps and later identified to species \[[@pone.0140856.ref024]\]. Captured rodents were killed by carbon dioxide and processed on the same day and at the site of capture. Blood and serum samples and rodent tissue samples (liver, spleen, kidney and lung) were collected and stored on dry ice, and transported to the AFRIMS laboratory. Rodent's ears were cut and stored in 70% ethanol for mite collections and the other ectoparasites (ticks, fleas, and lice) were collected from individual rodents by combing and stored in 70% ethanol for transportation to the laboratory. Mites in their larval stage (chigger) were collected from rodent's ears by paintbrush under the stereomicroscope and pooled by host. Three to five mites were selected from each pool and mounted on glass slides for morphological identification to genera and species if possible using taxonomic key \[[@pone.0140856.ref025]\]. Ectoparasites of each type (fleas, ticks, and lice) were identified morphologically \[[@pone.0140856.ref026], [@pone.0140856.ref027]\] and pooled by host, type, stage, and gender in 1.5 ml microcentrifuge tube. Pools of ectoparasites were subjected to DNA extraction procedures as described below. Louse species identification was performed following the previously published protocol \[[@pone.0140856.ref028]\]. Details of the ectoparasites collected from rodents in this study are provided in Table A in [S1 File](#pone.0140856.s002){ref-type="supplementary-material"}.
10.1371/journal.pone.0140856.t001
###### Location coordinates of rodents and ectoparasites collection sites in Thailand (2012--2013).
{#pone.0140856.t001g}
Regions Provinces Districts Sub-districts Villages Latitude Longitude
--------------- --------------------- --------------- ---------------- ------------------------- ---------------------- -----------------------
**North** **Chiangrai** Mae Chan Chanchawatai Ban Pagook 20°15\' 16.042\'\' N 99°56\' 2.144\'\' E
Mae Chan Pa Sang Rong Khi 20°10\' 47.543\'\' N 99°50\' 48.505\'\' E
**Phayao** Dok Khamtai Ban Tham Ban Sansai 19°6\' 54.234\'\' N 100°3\' 44.319\'\' E
** ** ** ** Dok Khamtai Ban Tham Ban Tham Mongkol 19°6\' 2.606\'\' N 100°2\' 25.71\'\' E
**Northeast** **Loei** Dan Sai Na Di Ban Na Mue Muen 17°19\' 15.859\'\' N 101°8\' 58.304\'\' | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Cancer is among the most common causes of morbidity and mortality worldwide, with an estimated 14 million new cases and 8 million deaths in 2012, projected to rise by at least 70% by 2030.[@R1] Timely and accurate cancer statistics are crucial to identify priorities for cancer control strategies at the national level. Yet, only 34 of 194 World Health Organization (WHO) Member States presently report high-quality national mortality data,[@R2] while 68 countries provided high-quality incidence data for the last volume of *Cancer incidence in five continents*.[@R3] As a result, many policy-makers rely on national cancer incidence and mortality estimates of variable precision to inform cancer control priorities.
GLOBOCAN, a project of the International Agency for Research on Cancer (IARC) provides estimates by cancer site and sex using the best available data in each country and several methods of estimation.[@R1] Producing high-quality estimates therefore requires a dual approach of improving the reported data (developing cancer registries and civil/vital registration systems) and a continual assessment of the validity of the estimation procedures to improve the methods used.
This study focuses on the validity of the methods used in GLOBOCAN to derive national cancer incidence estimates, based on a retrospective comparison of these estimates to the observed national data in a setting with high quality cancer registry data. Although we focused on the methods most commonly used in high-income countries, we also aimed at providing insights into the validity of the methods more broadly, including methods used more predominantly in low- and middle-income countries.
Methods
=======
Recorded data
-------------
To validate the nine methods used in GLOBOCAN to estimate national incidence in 2012 (GLOBOCAN 2012), long-term national and regional incidence and mortality data as well as 5-year relative survival estimates are required. Of the few countries with such data available, we selected Norway because of the consistently high quality of its cancer registry data, available nationally and by region. Cancer reporting is a legal requirement in Norway and data linkage procedures with the cause of death registry further increase the completeness of the information. For the period 2001--2005, data completeness was estimated at 98.8%, while 93.8% of the cases had been verified by examining biopsy samples under a microscope.[@R4]
From the Nordic cancer database NORDCAN, we extracted Norwegian incidence and mortality data by region, year of diagnosis, cancer site, sex and 5-years age group (starting at 0--4 and ending at 85+) for the period 1983--2012.[@R5] We also extracted Norwegian 5-year relative survival proportions for each cancer site as well as incidence and mortality data from neighbouring countries Denmark, Finland, Iceland and Sweden.[@R5] As with GLOBOCAN 2012, national population data were obtained from the United Nations[@R6] while regional population data were extracted from NORDCAN.[@R5]
Cancer sites of the recorded cases and deaths were grouped by the codes in the *International statistical classification of diseases and related health problems, 10th revision* (ICD-10) to correspond to the sites used in GLOBOCAN. Unspecified neoplasms of the uterus (ICD-10 code C55) were reallocated to the cervix (C53) and corpus uteri (C54) according to the respective proportions of these two sites in the different datasets.[@R7]
We computed the number of cases by sex and cancer site in Norway in 2010 as the average of the recorded cancer cases between 2009 and 2011 to define a gold standard for comparisons. We then applied each of the nine methods used in GLOBOCAN 2012 to estimate the number of cancer cases in Norway in 2010, by sex and cancer site, and compared these estimates with the gold standard.
Estimation methods
------------------
The GLOBOCAN methods are summarized in [Fig. 1](#F1){ref-type="fig"}, together with the algorithm used to select them in GLOBOCAN based on the availability of data in each country. More details can be found elsewhere.[@R1]^,^[@R8] [Fig. 2](#F2){ref-type="fig"} illustrates which method was used for each country within the GLOBOCAN 2012 project.
{#F1}
{#F2}
The data required for each of the nine methods are summarized in [Table 1](#T1){ref-type="table"}.The methods used may produce under- or overestimates at different cancer sites. Therefore, presenting an overall number of cases based on the sum of site-specific numbers could be misleading, if aggregated overestimates and underestimates cancel each other out. We thus report separately the total number of cases underestimated and overestimated for each method. These were then aggregated to assess the differences between the results and the Norwegian recorded data.
###### Required conditions for reliable estimations for each of the nine methods used to estimate cancer incidence in GLOBOCAN 2012
Method Data required to use the method Conditions required for reliable estimations
--------------------------------------------------------------------------------- ------------------------------------------------------------------------------------ ---------------------------------------------------------
1 Historical national incidence data -- Availability of robust data on cases/population size
-- Recent incidence trends continue into near future
2 Recent national incidence data -- Availability of robust data on cases/population size
-- Stable incidence rates in near future
3 National mortality data and M:I ratios from regional registries within the country -- Availability of robust data on cases/deaths
-- Trends in incidence, mortality and survival are relatively stable over time
-- Case fatality in combined regions representative nationally
4 National mortality data and M:I ratios from registries in neighbouring countries -- Availability of robust data on cases/deaths
-- Trends in incidence, mortality and survival are relatively stable over time
-- Case fatality in combined neighbouring countries representative nationally
5 National mortality and 5-year relative survival data -- Availability of robust data on deaths and survival
-- Trends in incidence, mortality and survival are relatively stable over time
-- Five-year survival proportion a reasonable proxy for clinical cure
6 Rates from one regional registry within the country -- Availability of robust data on cases/population size
-- Incidence rates in single region representative nationally
7 Rates from multiple regional registries within the country -- Availability of robust data on cases/population size
-- Incidence rates in combined regions representative nationally
8 Data from all sites by age and sex and frequency data by cancer site -- Availability of robust data on total cancer cases
-- Total cases and cancer-specific frequencies representative nationally
9 Data from neighbouring countries -- Availability of robust data on cases/population size
-- Incidence rates in combined neighbouring countries representative nationally
M:I: mortality:incidence.
All analyses were performed using the R software package (The R Project for Statistical Computing, Vienna, Austria).
### Method 1
Method 1 is based on projections of incidence rates. We performed two projections: (i) for 1A we used the computer program NORDPRED[@R9] and applied long-term data (1983--2007) and; (ii) for 1B we used the computer program DEPPRED[@R10] and applied medium-term data (1998--2007).
### Methods 2 to 7
For methods 2 to 7, we used incidence and/or mortality data from 2003--2007 to simulate a real-life situation where data from the latest volume of *Cancer incidence in five continents (Vol. X)* would be used.[@R3] The 2010 Norwegian mortality data used in methods 3 to 5 were estimated as in GLOBOCAN 2012 by projecting rates for the period 1988--2007 to 2008--2012.
In method 3, mortality:incidence (M:I) ratios from regional registries are used as a proxy for national case-fatality rates. National incidence rates can then be inferred from national mortality data along with the M:I ratio. This is useful where regional registries are numerous but not necessarily nationally representative, as in Italy[@R11] or Japan.[@R12] Where no such regional population-based data are available, data from neighbouring countries can be used (method 4). To generate the M:I ratios used in method 3, we included recorded cancer cases and deaths from all regions of Norway except for the south-eastern region (that includes Oslo). In some high-income countries (e.g. France or Japan) national estimates are derived from regional cancer registry data that do not cover the capital city which is usually highly populated. We also included recorded cases and deaths from other Nordic countries for cancer sites with less than a hundred deaths in Norway (e.g. cancers of the larynx, testis | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Convulsive interventions have been used to treat mental disorders since the 16th century up to the moment in the form of electroconvulsive therapy (ECT) \[[@B1]\]. The most common therapeutic indication of ECT is major depression disorder (MDD) and its effectiveness in reducing depressive symptoms has been confirmed in several studies \[[@B2]\]. However, the cognitive complications of ECT have been reported as the main limitation for its use. These side effects occur more in patients with depression. Cognitive side effects and memory deficits are considered as a major limitation to the use of ECT, with 12.4% prevalence for permanent anterograde amnesia in a community setting \[[@B3], [@B4]\]. Despite this, almost all patients return to their previous cognitive status within six months. However, some patients seriously complain of permanent drawbacks in their memory \[[@B3]\].
Disorientation, destruction of processing speed, anterograde and retrograde amnesia, impaired visual and spatial function, and word finding difficulty usually occur immediately after an ECT session. Except for anterograde memory impairment, other cognitive effects of ECT return to the baseline. Anterograde memory improvement occurs gradually, but point defects may still remain. Fraser et al. \[[@B5]\] have also shown that memory may be affected by ECT for a short-term (less than six months).
Falconer et al. \[[@B6]\] showed that memory problems can be resolved after a one-month intervention. This study used Cambridge Neuropsychological Test Automated Battery (CANTAB) for cognitive assessments and showed that impairment in spatial recognition may be observed two weeks after ECT. Another study reported short-term and long-term deficits in autobiographical memory occurring shortly and two months after ECT, respectively, in patients with MDD. These patients had a poor performance in stating the exact details of stories and most had difficulty in remembering stories of others compared with their personal biography. Retrograde amnesia was reduced after 2 months of follow-up, but impairment in remembering the recent public events in detail continued still \[[@B7]\].
Although various medical interventions are suggested to reduce the cognitive deficits after ECT, no specific medicine has been found for improving them. Numerous studies investigated the preventive effects of galantamine \[[@B8]\], physostigmine \[[@B9]\], naloxone \[[@B10]\], dexamethasone \[[@B11]\], and piracetam \[[@B12]\] on ECT-associated memory deficit. Some have shown the positive effect of thyroid hormones on cognitive side effects of ECT \[[@B13]\]. However, there is a high tendency to use N-methyl-D-aspartate antagonists such as anesthetic ketamine and thyroid hormone. There also is some information about the use of physostigmine, thyroid hormone, and naloxone, indicating that they can reduce the psychological effects of ECT, but their effects are not well studied and identified yet. Liothyronine is used to increase the response to ECT and if administered at the beginning of an ECT course, response time and the incidence of cognitive problems are reduced \[[@B4]\]. In a study evaluating effects of liothyronine, piracetam, and placebo, biographical memory and mental control did not decrease in the liothyronine group, but orientation declined gradually until the last session of ECT and then significantly increased in a one-month follow-up \[[@B12]\].
Despite the effectiveness of ECT in treatment of MDD patients have concerns about the cognitive effects of ECT and memory deficits in particular. The main incentives of this research are the increasing use of ECT in treatment of MDD, scientific need for more precise information about it, and suggestion of previous researchers for further complementary studies. Accordingly, the present study investigates the effectiveness of liothyronine on ECT-induced memory deficit in patients with MDD.
2. Methodology {#sec2}
==============
The study protocol was approved by the Institutional Review Board of Tabriz University of Medical Sciences in accordance with the principles of the Declaration of Helsinki. This trial is registered with the Iranian Clinical Trials Registry (IRCT: [IRCT201401122660N2](http://www.irct.ir/searchresult.php?keyword=&id=2660&number=2&prt=6002&total=10&m=1)).
This is a double-blind clinical trial, in which the evaluator and the patients were unaware of the medication received by the patients (liothyronine or placebo). Sixty inpatients and outpatients with MDD who were referred to the ECT Ward, Razi Psychiatric Hospital, Tabriz, Northwest of Iran, were enrolled in this study. The diagnosis was based on the criteria of DSM-IV-TR, using the structured clinical interview for DSM-IV (SCID-IV). The inclusion criteria were the diagnosis of MDD, giving written informed consent, age between 20 to 50 years, Being candidate for receiving ECT based on diagnosis of a psychiatrist, and no history of ECT during the last 6 months. The exclusion criteria were any contraindications of liothyronine, drug and alcohol abuse, organic brain disorders, mental retardation (based on the patients\' history, physical examination, and medical records). Patients who experienced ECT-induced delirium or completed less than 6 sessions for any reasons were also excluded.
Selected patients were randomly assigned to experimental and control groups and assessed by the Wechsler Memory Scale-Revised (WMS-R) test as described later. The two groups were matched in terms of depression severity. Then the experimental and control groups received liothyronine and placebo, respectively. Two months after the end of ECT sessions, WMS-R posttest was performed for both groups. For the intervention group, liothyronine (two tablets of 25 mcg) was administered orally from the day before beginning of ECT every morning until the last session. Lactose tablets which were similar to liothyronine in appearance were used as placebo in this study with the same directions as liothyronine for the intervention group. Patients were asked to stop any other medications during the study.
ECT was administered by Thymatron DGX device (Somatics, ILC, lake Bluff, USA) through bilateral technique following a dose titration method. A bilateral dosage at 50--100% above seizure threshold of the patient (the first stimulus was set at 125 millicoulombs; the mean threshold was 100) was ensured to induce an acceptable convulsion duration between 15 seconds to 3 minutes. Thus in all sessions, ECT would have deemed ineffective if the convulsion had lasted less than 15 seconds and hence was not accounted as an effective ECT. In this state, the electric shock was repeated only once at the same session by 5--10% increase at repeated one. If convulsion had lasted longer than 3 minutes, patients would have been introduced to a neurologist for examination; however, this did not occur in this study. 6--12 ECT sessions were held for recruited patients, three times per week.
3. Measurements {#sec3}
===============
3.1. Wechsler Memory Scale-Revised {#sec3.1}
----------------------------------
Wechsler Memory Scale (WMS) was designed in 1970 by Wexler. The Revised WMS (WMS-R) consists of 5 subscales (general memory, attention/concentration, verbal memory, visual memory, and delayed recall) and evaluates different aspects of memory. Psychometric properties of Farsi version of WMS-R have been evaluated in Iran, in people aged 16 to 64 years. In this study, test-retest reliability coefficients were reported as 0.28 to 0.98 for the subscales and compositions. The average raw scores of the two groups of clinical and normal subjects were compared to evaluate the validity of WMS-R, indicating that the mean raw scores of the clinical group were significantly lower than that of the normal subjects \[[@B14]\].
3.2. Hamilton Rating Scale for Depression {#sec3.2}
-----------------------------------------
The Hamilton Depression Rating Scale (HRSD) is a 21-item multiple-choice scale which assesses various dimensions of depression: behavioral, physical, emotional, guilt, hypochondriasis, sex issues, job, suicide, and sleep disorders. This scale was used in this study to assess the severity of depression and to match the groups. The reliability and validity of the scale have been confirmed in several studies \[[@B15]\].
3.3. Structured Clinical Interview for DSM-IV (SCID-IV) {#sec3.3}
-------------------------------------------------------
This is a structured clinical interview based on DSM-IV criteria, for diagnosing MDD and other psychiatric disorders associated with Axis I and Axis II. SCID-IV has been used more than any other forms of psychiatric diagnostic interviews in psychological studies and has a global credibility. The reliability and validity of SCID-IV have been assessed in Iran, showing an acceptable reliability and validity \[[@B16]\].
3.4. Statistical Methods {#sec3.4}
------------------------
All statistical analyses were performed using SPSS version 21. The data are reported by means of descriptive statistics (i.e., mean, SD, frequency, and percentage). Independent *t*-test was used to compare the significance of difference between the control and test groups. In addition, paired *t*-test was employed to determine differences in pretest and posttest mean scores from WMS-R in each group. Analysis of covariance (MANCOVA) was used to compare the difference between the posttest scores of both groups in WMS-R, with controlling the pretest. *P* values less than 0.05 were considered significant.
| {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Facioscapulohumeral muscular dystrophy 1 (FSHD1) has an autosomal dominant pattern of inheritance \[[@CR1]\] and manifests as a consequence of both genetic \[[@CR2]--[@CR4]\] and epigenetic disease mechanisms \[[@CR5]\]. FSHD is most commonly present in the second decade of life as asymmetric weakness of specific skeletal or facial muscle groups \[[@CR6]\]. Regardless of the genetic mechanism, FSHD results from abnormal expression of double homeobox protein 4 (DUX4) in skeletal muscle \[[@CR7]\]. The DUX4 gene is encoded in each of the 3.3 kb D4Z4 repeat units arrayed at chromosome 4q35.
DUX4 expression is important early in development when it activates ZSCAN4 as part of a chromatin remodeling phase that occurs in 4 cell embryos \[[@CR8]\] and in most adult tissues DUX4 transcription is strongly repressed. A recent proteomics-based study identified proteins that specifically bind to the D4Z4 array and showed that nucleosome remodeling deacetylase (NuRD) and CAF-1 complexes repress DUX4 transcription in control myoblasts and induced pluripotent stem cells \[[@CR9]\]. The D4Z4 array length appears to be critical for DUX4 repression because FSHD-causing array contractions result in toxic DUX4 expression when they occur on a common 4q haplotype that includes a polyadenylation signal at the end of the last D4Z4 unit \[[@CR7], [@CR10], [@CR11]\]. Array length is not the only mediator of transcriptional repression because even in the context of an array contraction, DUX4 remains under significant although incomplete repression with cultured myoblasts showing stochastic bursts of transcription in a small fraction of myonuclei \[[@CR12]--[@CR14]\].
Differences in histone modifications associated with FSHD-causing contracted and normal length D4Z4 arrays have been difficult to identify because of the presence of multiple D4Z4 units near the telomere of chromosome 10, the normal D4Z4 array on the other allele of chromosome 4 and D4Z4-like sequences at multiple other genomic locations \[[@CR15]\]. As minor sequence differences of these arrays have been catalogued, primers with some specificity for D4Z4 units originating from chromosomes 4 and 10 have been developed \[[@CR16]\] and despite averaging PCR signals originating from each repeat on chromosomes 4 and 10 and from D4Z4 units within both pathogenic and non-pathogenic arrays, a decrease in the levels of H3K9me3 and 5-meC D4Z4 modifications \[[@CR16]\] and a decrease in cohesion and HP1γ association with D4Z4 have been observed in cells derived from FSHD-affected individuals \[[@CR17]\]. More recently, a bisulfite DNA sequencing approach has allowed methylation levels to be attributed to specific alleles identified by single nucleotide polymorphisms present in the sequenced regions and has convincingly demonstrated that CpG hypomethylation is localized to contracted arrays in cells from FSHD1-affected individuals \[[@CR18]\]. The ability to specifically characterize differences in histone modifications present on DUX4-expressing and non-expressing contracted D4Z4 arrays on chromosome 4 should reveal new and important epigenetic differences associated with FSHD.
To determine the epigenetic changes that result in DUX4 transcription, we took advantage of the observation that FSHD-permissive 4qA alleles are polymorphic with two common haplotypes that differ in the length of the terminal D4Z4 unit \[[@CR3]\]. We also constructed and validated a DUX4 reporter that allows the detection and collection of DUX4 expressing cells using GFP fluorescence \[[@CR13]\]. This approach allows pathogenic (contracted) arrays to be specifically analyzed in the presence of other arrays in the same cells and allows comparisons of epigenetic differences present at D4Z4 in DUX4 expressing and non-expressing cells from the same myoblast population.
By measuring the frequency of association of chromatin remodeling proteins and the abundance of epigenetic marks present on DNA and histones at D4Z4 arrays, we were able to follow the epigenetic state of normal and pathogenic D4Z4 arrays in stem cells and terminally differentiated human myocytes. Importantly, we were able to distinguish epigenetic differences present at DUX4 expressing and DUX4 non-expressing pathogenic arrays within the same myocyte population. We show that all D4Z4 arrays are bivalent with respect to repressive and activating histone modifications in stem cells and thus poised for DUX4 expression, consistent with the observation of DUX4 expression at the 4 cell embryonic stage where DUX4 appears to be instrumental in establishing the epigenetic profile of the early embryo \[[@CR8]\]. As stem cells commit to terminally differentiated states, long arrays adopt a repressive chromatin confirmation while histones on short arrays are left vulnerable to further modifications including the removal of H3K27me3 and acetylation of H3K9 leading to the activation of DUX4 transcription.
Results {#Sec2}
=======
Exclusive detection of pathogenic alleles produces an enhanced signal for analysis of FSHD-associated D4Z4 chromatin structure {#Sec3}
------------------------------------------------------------------------------------------------------------------------------
The contraction of the D4Z4 array associated with the allele variant 4qA is required to cause FSHD1 \[[@CR7], [@CR19]\]. There are two sub-haplotypes of 4qA that contain a permissive SSLP of 161 length associated with a poly A signal sequence at the distal end of the array \[[@CR7]\]. The sub-haplotypes differ at the distal most D4Z4 unit where the haplotype A161-L (Fig. [1](#Fig1){ref-type="fig"}a) contains an additional \~2 kb of non-translated D4Z4 sequence. Since this represents a different breakpoint in the most telomeric D4Z4 unit which is always partially present, we call this variant the long last partial (LLP) to distinguish it from the more common last partial D4Z4 unit that is shorter due to a breakpoint earlier in the last D4Z4 unit (SLP). Individuals with FSHD1 can have either a LLP or SLP sub-haplotype \[[@CR3]\] as both are permissive and associated with the poly A signal sequence. We utilized custom PCR primers that specifically amplify the A161-L but not the A161-S on 4qA alleles (Fig. [1](#Fig1){ref-type="fig"}b). The control and FSHD1 myoblasts utilized in this study were PCR amplified with these LLP primers and identified to have the 4q A161-L haplotype (Fig. [1](#Fig1){ref-type="fig"}c). The DUX4-interacting region 1 (DIR1) a region proximal to the LLP and common to all the genotypes studied \[[@CR20]\] was amplified with a separate set of primers as a control. We screened several myoblast cell lines to identify those that have a single permissive A-type array with a LLP sub-haplotype allowing us to specifically probe the chromatin structure of the DUX4 expressing array in cells from FSHD-affected individuals.Fig. 1PCR amplification of permissive alleles in FSHD cells. **a** Diagram of two unique terminal D4Z4 junctions of permissive alleles in FSHD. Both haplotypes contain a permissive SSLP of 161 bp length and a polyadenylation signal (ATTAAA). The junction of the distal end of the D4Z4 array is different resulting in a slightly longer 3′ untranslated region in the A161-L version \[also called long last partial (LLP)\]. Introns are noted by dashed lines between splice sites and exons are noted as black boxes with the thicker portion corresponding to the ORF of the DUX4 protein. PCR primers that uniquely identify the A161-L form are shown as arrows in the distal region of the array (LLP). **b** Table showing genotypes of the cell lines used to characterize the LLP primers. DIR1 primers are homologous to a common region present in all arrays just centromeric to the start. Note that FSHD1 and non-FSHD control myoblast lines both have permissive A161-L arrays with disease causing length of 12 kb in the FSHD line (2 repeats) and disease protective length in the control line (74 repeats). **c** DNA fragments amplified from genomic DNA purified from the cell lines shown in (**b**) and the expected result shown below. The locations of the LLP primers are shown in (**a**)
DUX4 expressing and non-expressing FSHD myocytes are similarly hypomethylated on the pathogenic D4Z4 array {#Sec4}
----------------------------------------------------------------------------------------------------------
To determine whether DUX4 transcription is repressed by DNA methylation in FSHD myoblasts that don't express DUX4, we investigated basal CpG methylation levels at the permissive, contracted array using bisulfite conversion and PCR primers that uniquely amplify the LLP allele \[[@CR21]\]. D4Z4 in normal myocytes containing a LLP allele was 80% methylated, while the same region was only 8.8% methylated in myocytes from FSHD-affected individuals supporting previously published data (Fig. [2](#Fig2){ref-type="fig"}b, c) \[[@CR5], [@CR22]\]. Utilizing a fluorescing DUX4 reporter, we purified myocytes that expressed DUX4 from those that efficiently silenced DUX4 and show that myoblasts express 0.26--1.09% DUX4 and when differentiated the myocytes express 1.23--3.75% DUX4 (Additional file [1](#MOESM1){ref-type="media"}: Figure S1). These results suggest that | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Essential fatty acids (EFAs): linoleic acid (LA, n-6, 18:2) and α-linolenic acid (ALA, n-3, 18:3) form precursors to their long chain metabolites γ-linolenic acid (GLA, n-6, 18:3), dihomo-GLA (DGLA, n-6, 20:3) and arachidonic acid (AA, n-6, 20:4); and eicosapentaenoic acid (EPA, n-3, 20:5) and docosahexaenoic acid (DHA, n-3, 22:6) respectively \[[@B1]-[@B3]\]. Our previous studies showed that polyunsaturated fatty acids (PUFAs) selectively induced tumor cells apoptosis though the sensitivity of various cancer cells to different fatty acids were found to be variable depending on the type of cancer cell being tested and the type and concentration of the fatty acid used \[[@B3]-[@B7]\].
Previously, it was reported that essential fatty acids and their metabolites suppress tumor cells growth both *in vitro*and *in vivo*. This tumoricidal action of fatty acids could be correlated to an increase in generation of free radicals in the tumor cells \[[@B8]\]. Subsequent studies showed that most polyunsaturated fatty acids were functional, and the inhibitory action of different types of n-3, n-6 and n-9 fatty acids does not depend on their unsaturation \[[@B9]\]. Among all the fatty acids tested, GLA, AA, EPA and DHA were found to be the most effective in inhibiting tumor cells growth, while LA and ALA were also effective but at much higher concentrations \[[@B3]-[@B5]\]. It was opined that n-6 fatty acids enhance tumor cell growth whereas n-3 fatty acids are beneficial since they arrest cancer growth. This differential action of n-3 and n-6 PUFAs in cancer has been attributed to the formation of pro-inflammatory eicosanoids from n-6 PUFAs whereas products formed from n-3 PUFAs are much less pro-inflammatory in nature \[[@B1]-[@B7],[@B10]-[@B13]\], though Trombetta A, *etc*. reported that AA, an n-6 PUFA, decreased human lung-tumor cell growth in a concentration-dependent manner, induction of cell death mainly evident at 100 mM concentration \[[@B14]\].
In the majority of previous investigations, n-3 and n-6 PUFAs were added to the tumor cell medium *in vitro*without a simultaneous study of these fatty acids on normal cells. Hence, it is not clear whether the concentrations of fatty acids used in these studies are non-toxic to normal cells at which they were found to be cytotoxic to tumor cells. In addition, little attention was paid to the ratio between n-6 and n-3 fatty acids as they exist in the body while performing these studies. It is important to note that in the plasma, n-6 PUFAs are present in large amounts compared to n-3 fatty acids (the ratio between n-6 PUFAs compared to n-3 PUFAs is \~7:1 in the serum) \[[@B15]\]. Furthermore, PUFAs are widely distributed in our food and hence, there could be a wide variation in the daily intake of these fatty acids among different populations and individuals depending on the type of diet and the quality of the food ingested. In general, the level of total fatty acids in the plasma/serum is \~200 mg/dl, and of which the percentage of LA is \~20% regardless of the differences in dietary pattern \[[@B15]\].
Previously, we observed that the action of LA on cancer cell growth depended on the type of cancer cells being tested and the concentration of fatty acids supplemented \[[@B3]-[@B7]\]. LA \~40 μg/ml/1 × 10^4^cells inhibited the growth of cancer cells whereas lower concentrations \~5-10 μg/ml/1 × 10^4^cells enhanced growth of some, if not all, types of cancer cells that were being tested \[[@B11]\]. In the present study, we evaluated the effect of the fatty acid on three cell lines, two of which were colorectal cancer cell lines, LOVO (undifferentiated) and RKO (semi-differentiated), and the human umbilical vein endothelial cells (HUVEC) taken as normal cell control in order to clarify the role of LA in the promotion and inhibition of the growth of cancer cells *in vitro*. In order to know the sensitivity of tumor cells to LA, in one set of studies we pre-incubated the cells for 24 hours with 100 μM of LA and then were subsequently exposed to various doses of LA to know whether the initial exposure to LA affects the survival of tumor cells.
Materials and methods
=====================
Materials
---------
Linoleic acid (LA, 18:2 n-6) was obtained from Sigma (St. Louis, MO, USA). The colorectal cancer cell lines, LOVO (undifferentiated) and RKO (semi-differentiated), and normal cell line HUVEC (human umbilical vein endothelial cells) were obtained from Shanghai Institute of Cell Biology, Chinese Academy of Sciences. PRMI medium 1640 and high-glucose DMEM Nutrient Mixture medium were purchased from GIBCO (Grand Island, NY, USA). MTT (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) was provided by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. All other chemicals were of extra-pure grade or analytical grade.
Cell culture and treatment
--------------------------
Colorectal cancer cells (LOVO and RKO) and human normal cells (HUVEC) were cultured in PRMI Medium 1640 and high-glucose DMEM Nutrient Mixture medium separately, supplemented with 10% fetal bovine serum and 100 U/ml penicillin-streptomycin in a humidified 37°C, 5% CO~2~incubator (Shellab, USA).
LA was dissolved in 0.1 N NaOH and diluted to give a final concentration of 20 mM with the final concentration of NaOH was no more than 0.005 N, a concentration of NaOH at which it had little affect on the cells. Stock solutions were filter-sterilized and diluted with cell culture media for use in the study \[[@B16]\].
Both the colon cancer cells (LOVO and RKO) and normal cell (HUVEC) were treated with LA in two different ways: in the first group, the cells were cultured in the cell culture medium alone for 24 h prior to treatment with different doses of LA; whereas in the second group, cells were pre-incubated with 100 μM LA for 24 hr followed by treatment with different doses of LA as was done in the first group.
Cell growth and viability assay
-------------------------------
Cell proliferation was assessed using MTT assay (Roche, Mannheim, Germany). At different time intervals after incubation with LA, the number of viable cells grown in a 96-well plate was estimated by adding 20 μl of MTT solution (5 mg/ml in PBS). After 4 hr of incubation at 37°C, the stain was diluted with 150 μl of DMSO. The absorbance in each well was then measured with a microplate reader (Thermal Lab system, Finland) at 492 nm, and viability of cells was presented as percentage of the control \[[@B16]\]. Each treatment was replicated at least five times.
Mitochondrial membrane potential detection
------------------------------------------
Cells (1 × 10^6^cells) obtained from control and various LA treatments were washed thrice with PBS, and resuspended at a final protein concentration of 0.75 mg/ml in PBS, 100 μl was taken for the following detection. 100 ng Rh123 (Rhodamine 123) were added to each sample. Upon incubation in the dark (15 min, at room temperature or 30 min at 4°C), the samples were washed with 300 μl PBS twice. The cells were resuspended in 200 μl PBS for analysis. Fluorescence intensity was carried out on a multifunctional micro-plate reader (SpectraMax M5, Molecular Devices) with a 96-well plate (side-opaque, clear bottom). The excitation and emission wavelengths for Rh123 were selected with monochromators set to 488 nm (5 nm slit width) and 530 nm (5 nm slit width), respectively. Each treatment was replicated thrice, and the final data was calculated as follows: corresponding fluorescence intensity (%) = F~sample~/F~CK~
Where: F~sample~and F~CK~are the intensities measured with microplate reader. \[[@B17]\]
**ROS generationstudies**
-------------------------
Cells were incubated with the cell permeant dye H~2~DCF-DA, which intracellularly de-esterifies to dichlorodihydrofluorescein (H~2~DCF). ROS oxidize H~2~DCF to the brightly fluorescent compound 2-, 7-dichlorofluorescein (DCF), which was monitored by flow cytometry following a previously described method \[[@B18]\] with modifications. Briefly, cells treated with LA or vehicle were incubated with 5 μM H~2~DCF-DA for 15 min at 37°C, detached from the plate with trypsin/EDTA, washed with PBS, resuspended in ice-cold PBS, and tested immediately. Triplicate samples were run in each experiment, and at least 5000 cells per sample were analyzed (excitation at 488 nm, emission at 500-530 nm) by *SpectraMax M5, Molecular Devices*. Mean fluorescence was calculated by using the program *SoftMax Pro Software Version 5 for Mac^®^and Windows^®^*. The | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
The epidemiology of methicillin-resistant *Staphylococcus aureus* (MRSA) infections has changed dramatically during the last 15 years. While traditionally MRSA was a typical example of a nosocomial pathogen, it is now frequent found as causative agent of community-associated infections among patients without known risk factors for hospital-acquired (HA)-MRSA [@pone.0016419-Adam1], [@pone.0016419-Bukhari1], [@pone.0016419-Coombs1], [@pone.0016419-Elston1], [@pone.0016419-Fontanilla1], [@pone.0016419-Klein1], [@pone.0016419-Reyes1].
The molecular epidemiology of community-associated MRSA (CA-MRSA) is diverse, although certain clones appear to dominate on every continent. These predominant CA-MRSA clones cluster in different lineages: ST8/USA300, ST1/USA400, ST30/USA1100, ST93, ST59, ST80 and ST398 clone [@pone.0016419-Otter1].
In the USA, the first widely recognized CA-MRSA clone was USA400 (ST1). After the turn of the century, USA300 (ST8) emerged rapidly across the USA and replaced USA400 as the dominant clone in the USA responsible for the majority of skin and soft tissue infections. Subsequently, USA300 has been increasingly isolated outside the USA indicating pandemic spread. Within USA300 several subtypes exist of which PFGE-type USA300-0114 predominates [@pone.0016419-Diep1], [@pone.0016419-Witte1].
Comparative whole genome sequencing of 10 USA300 CA-MRSA and HA-MRSA isolates collected nationwide in the USA in 2002, 2003, and 2005 showed a limited number of single nucleotide polymorphisms and regions of differences among USA300 isolates, which suggests that USA300 has undergone rapid clonal expansion without great genomic diversification [@pone.0016419-Kennedy1]. So far whole genome comparisons of CA-MRSA are limited to isolates belonging to USA300. The aim of this study was to compare the genetic repertoire of different CA-MRSA clones with that of HA-MRSA from the USA and Europe through comparative genomic hybridization (CGH) to identify genetic clues that may explain the successful and rapid emergence of CA-MRSA [@pone.0016419-Witney1].
Materials and Methods {#s2}
=====================
Bacterial isolates and nucleic acid extraction {#s2a}
----------------------------------------------
Thirty nine consecutive MRSA isolates collected in 2004, originating from hospitalized patients with serious invasive infections admitted at Cook County Hospital (Chicago IL, USA) were taken from a database. The isolates were phenotypically classified with MicroScan (West Sacramento, California) as methicillin-resistant. Twenty isolates were recovered \<48 h after admittance from patients who did not have prior health care exposure and were considered CA-MRSA. These isolates were collected between the 1^st^ and 28^th^ of July. Nineteen isolates were recovered (between July and October of 2004) from patients \>48 h after admission and these were classified as HA-MRSA ([Table S1](#pone.0016419.s001){ref-type="supplementary-material"}).
Ten HA-MRSA isolates from The Netherlands, Germany, Belgium, and France were selected from a collection of 118 HA-MRSA isolates present at the University Medical Center Utrecht (UMCU) on the basis of their geographic origin, infections caused or nasal carriage and multilocus sequence type (ST) ([Table S1](#pone.0016419.s001){ref-type="supplementary-material"}). In addition, one CA-MRSA isolate, obtained in 2001 from a child that succumbed due to necrotizing pneumonia within 48 h of hospitalization (and without prior health care exposure) in the UMCU [@pone.0016419-vanderFlier1]. All isolates were cultured overnight on tryptic soy agar with sheep blood at 37°C. DNA was extracted with a Nucleospin Tissue kit according to manufacturer\'s protocol (Bioké, Leiden, The Netherlands). Plasmid DNA content was determined using S1 nuclease treatment (Takara Bio Europe, Saint-Germain-en-Laye, France), gel electrophoreses and southern blot with a 193 bp probe from the resolvase gene SAR719.
We do not have an ethics approval and an informed consent, because the data we have used are anonymous and were not specifically collected for our study. The patients were admitted to the hospital, the samples were taken for diagnostic purposes by the treating physicians in order to appropriately treat the patients. These samples were anonymously put in a database from which they were recovered. In the Netherlands the Medical Ethical Committee does not require an approval for this kind of research and sampling.
Typing of the MRSA isolates {#s2b}
---------------------------
Colony morphology and standard techniques, like multiplex PCR for the 16S rRNA gene, *mecA* gene, and *nuc* gene were used to confirm whether the isolates were MRSA. All MRSA isolates from the USA were typed by MLST [@pone.0016419-Enright1]. The CA-MRSA isolates were further characterized by PFGE, *spa*, SCC*mec* and antimicrobial susceptibility patterns by MicroScan (Dade Behring Inc., West Sacramento, CA, USA) [@pone.0016419-Harmsen1], [@pone.0016419-Ito1], [@pone.0016419-McDougal1]. The antimicrobial agents tested were oxacillin, erythromycin, rifampicin, fluoroquinolones, clindamycin, gentamicin and tetracycline. The MIC values were interpreted according to the Clinical and Laboratory Standards Institute recommendations (2004) [@pone.0016419-NCCLS1].
Comparative genomic hybridization {#s2c}
---------------------------------
Gene content of the CA- and HA-MRSA isolates was determined via CGH using a previously described multistrain (n = 7) PCR product *S. aureus* microarray [@pone.0016419-Lindsay1], [@pone.0016419-Witney1]. The array design is available in BµG\@Sbase (Accession No. A-BUGS-17; <http://bugs.sgul.ac.uk/A-BUGS-17>) and also ArrayExpress (Accession No. A-BUGS-17). Gene presence and divergence was determined using the algorithm described previously [@pone.0016419-Carpaij1]. Complete linkage hierarchical clustering with Euclidian distance of all the HA-MRSA and CA-MRSA isolates was used to visualize the genetic relatedness.
Confirmation of genetic differences {#s2d}
-----------------------------------
Differences in gene content between the USA300 CA-MRSA isolates from Chicago and USA300FPR3757 and USA300TCH1516 (for which the whole genome sequences are available) as identified by CGH were confirmed by PCR and sequencing. The primers were generated, if possible, using the USA300FPR3757 sequence and otherwise on the USA300TCH1516 or MRSA252 sequence. Amplification was carried out for 35 cycles with denaturation at 95°C for 30 seconds, annealing at the primer specific annealing temperature for 30 seconds, extension at 72°C for 45 seconds and a final extension at 72°C for 7 minutes. The presence of *arcA* considered specific for SCC~ACME~, *lukS-PV* and *lukF-PV,* encoding Panton-Valentine leukocidin, *sek* and *seq* encoding enterotoxin K and Q, respectively, in the USA300 strains from Chicago were determined by PCR as previously described [@pone.0016419-Diep1], [@pone.0016419-Lina1]. The primers and conditions used for confirmation are shown in the [Table S2](#pone.0016419.s002){ref-type="supplementary-material"}.
Results {#s3}
=======
Molecular epidemiology of CA- and HA-MRSA {#s3a}
-----------------------------------------
The majority of the 19 HA-MRSA isolates from the USA belonged to ST5 (n = 14, 74%). From the five other isolates, four were classified as ST8 and one as ST45 ([Table S1](#pone.0016419.s001){ref-type="supplementary-material"}).
Two of the 20 CA-MRSA isolates from the USA were *mecA* negative in the PCR, and were no longer considered MRSA. From the remaining 18 CA-MRSA isolates from the USA, 14 were typed by PFGE as USA300 and 13 represented the USA300-0114 subtype. One isolate (S16) had a slightly different PFGE subtype and differed by two bands ([Figure 1](#pone-0016419-g001){ref-type="fig"}). MLST was in agreement with these data, since 13 USA300 strains were ST8. One isolate (S08) represented ST858, a single locus variant of ST8 ([Table 1](#pone-0016419-t001){ref-type="table"}). All isolates, except one, belonged to *spa*-type t008. That isolate (S06) had a new *spa*-type, t4913 (11-19-36-21-17-34-24-34-22-25), one repeat difference with t008 ([Table 1](#pone-0016419-t001 | {
"pile_set_name": "PubMed Central"
} |
Background and Significance
===========================
Drug therapy in pediatric patients is a complex process. Children are not simply small adults, but are subject to continuous growth and variation in drug-metabolizing enzyme activity, which requires continuous adaption of dosages. Extrapolation of adult data to guide drug dosing in children requires great diligence and cannot replace clinical trials on efficacy, safety, and pharmacokinetics in pediatric patients. [@JR190022ra-1] [@JR190022ra-2] For most drugs, the costs of specific clinical trials and the development of an age-appropriate formulation (e.g., a liquid with good palatability, dosing accuracy for low doses, and without inappropriate preservatives) exceed the possible revenue, especially for conditions that seldom occur in minors. Both the U.S. and the European Union have introduced legislation for the development of pediatric medicines. Pharmaceutical companies are granted an additional 6 months\' patent extension as an incentive for pediatric trials on newly developed drugs. According to the pediatric regulation, since 2007 for all new drugs early in the developmental stage, a pediatric investigation plan has to be delivered, that will be assessed and agreed by the pediatric committee of the European Medicine Agency. [@JR190022ra-3] This is mandatory for drug licensing.
Nonetheless, there is still a substantial number of medicines on the market that are not licensed for pediatric populations. Thus, off-label use is common in both ambulatory and hospital settings. [@JR190022ra-4] [@JR190022ra-5] [@JR190022ra-6] The Study of Health of Childs and Youth in Germany (KiGGS study) found that nearly one-third of medicines used in pediatric outpatients were not licensed for their age. [@JR190022ra-4] The younger the patient, the higher the prevalence of off-label uses. [@JR190022ra-4] [@JR190022ra-7] This prevalence is higher in the inpatient setting---and especially in intensive care units. [@JR190022ra-8] In Germany, there is currently no database that provides publicly accessible evidence-based information on drug dosages in children and adolescents. However, worldwide there are very few formularies providing evidence-based dosing recommendations and transparency on sources used. [@JR190022ra-9] Therefore, the information provided may not correspond to the best available evidence. Especially for the widespread off-label use, these details are essential to find a rational, best evidence-based therapy for a patient and at the same time minimize the risks during drug application. In other countries, such as the United Kingdom, the Netherlands, and Switzerland, a national database for pediatric medicines has brought significant progress in pediatric pharmacotherapy. [@JR190022ra-9]
With the implementation of an electronic prescribing system at the Department of Pediatrics and Adolescent Medicine at the University Hospital Erlangen, Germany, in 2012, dosing recommendations based on a systematic research of clinical pharmacological evidence were established for internal use. [@JR190022ra-10] To expand access to this comprehensive information to a wider audience of pediatricians in Germany, initial funding was granted from the German Ministry of Health for the development of a Web-based online platform, termed Pediatric Dosing Recommendations (PaedDos). PaedDos is intended to serve as a German reference database for evidence-based dosing recommendations as well as pharmacological and pharmaceutical drug information in pediatrics. A separate journal article focusing on the pharmaceutical content of the platform is currently being finalized.
To achieve a high level of acceptance among medical experts, the development of PaedDos was based on a user-centered design (UCD) approach with its iterative steps. [@OR190022ra-11] In a UCD approach, the end user---in this case the resident doctors, clinicians, and pharmacists---is highly involved in all steps of the development process and the user interface design. Functional scope and operation are tailored to the feedback of the test users. Through cyclic evaluations using various methods (e.g., pluralistic walkthroughs, user tests, thinking-aloud tests [@JR190022ra-12] [@JR190022ra-13] [@BR190022ra-14] [@BR190022ra-15] ), the system is constantly evaluated in terms of its usability and acceptability by the end users. Standardized scoring systems, for example, System Usability Scale (SUS), [@JR190022ra-16] [@JR190022ra-17] [@BR190022ra-18] can be used for objective usability assessment. Research shows that a UCD process increases the usability of applications in health care and thus can improve the productivity of systems, their accessibility, and reduces the risk of harm. [@JR190022ra-19] [@JR190022ra-20] [@JR190022ra-21]
This article describes for the first time the development of Web-based online platform for pediatric dosing recommendation in Germany. The specific purpose of this article is: (1) to survey the demand of physicians for an evidence-based knowledge base, to check to what extend the requirements are fulfilled, and which new requirements arise, and (2) to assess a prototype of an online platform with end users in terms of usability and functionality.
Methods
=======
Initial Prototype Development
-----------------------------
Pediatricians from the Erlangen Children\'s Hospital and the project management created a list of initial requirements for the online platform. One of these requirements was to tailor the online platform to usage by three main user groups according to the content, the presentation of the prepared information, as well as the functionality and the design. The first group consists of pediatricians in private practice, including general practitioners with a large proportion of pediatric patients, which later would be the largest and most important user group; the second group comprises clinicians from pediatric hospitals; and the third group are pharmacists, who also need information on dosages of drugs for children and adolescents in their daily work. The initial requirements led to paper mock-ups having a visual basis for discussions around the platform, its design, and its functionalities. After an internal feedback round, the platform and its content were divided into six modules:
1. Information (general information about the active substances).
2. Dosage (dosing recommendations).
3. Special dosage information (information about liver and kidney insufficiency).
4. Side effects and warnings (including overdosing and contraindications).
5. Drug--drug interactions.
6. Preparations (information about the available formulations like flavor).
Subsequently, a first interactive prototype was developed, based on common Web technologies (HTML, CSS, JavaScript, PHP, and SQL) and frameworks (W3.CSS, Bootstrap, JQuery, AngularJS). This prototype was evaluated in two rounds with external users previously not involved in the project to analyze to what extent user requirements have already been considered and to derive further requirements.
First Evaluation Round---Pluralistic Walkthrough
------------------------------------------------
During a pluralistic walkthrough in July 2017, experts and future end users of the system were invited to evaluate the initial prototype to draw attention to errors and provide information on its acceptance at an early stage of development. A pluralistic walkthrough is a collaborative usability evaluation method that involves both users and members of the product team. In this method, the test moderator presents the participants the system and invites discussion related to usability issues. At this development state, the system contained information in all modules for seven active ingredients. The active substances were selected from different groups (on-demand medication, antibiotics, antiepileptics, etc.). About 100 active substances were listed with dosing recommendations but not yet fully developed with all information in all modules.
### Participants
In total, three participants, one representative of each of the main user groups, and the development team took part in the pluralistic walkthrough.
### Procedure
The pluralistic walkthrough was divided into two parts. For the first part, three exemplary drug ordering scenarios with clindamycin, ibuprofen, and acetylsalicylic acid were defined. Based on these scenarios, the online platform was presented to the walkthrough participants. Next, the scope of search functions (search for active substances, trade name, indication, and Anatomical Therapeutic Chemical \[ATC\] code) and the live search functionality (search while typing) were demonstrated to the participants. Finally, all participants had the opportunity to test the system themselves with open scenarios and ask questions about the platform\'s user interface.
In the second part of the pluralistic walkthrough, the participants were asked to write down both positive and negative aspects of the platform on cards. All cards were collected by the moderator on the flipchart, categorized, and prioritized in an open discussion with the participants. Participants were further encouraged to evaluate the user interface in terms of color, terminology, redundancy, content, and features. In addition, they were motivated to express wishes concerning the functionalities which the current prototype version did not yet meet.
The complete walkthrough was recorded with the software Camtasia Studio ( <https://www.techsmith.de/camtasia.html> ) and later transcribed verbatim. The main statements, as well as the results of the categorization and prioritization of recommendations and wishes, were summarized to create an enhanced version of the requirements specification. The joint categorization process led to three requirement priority levels, from "high need for action," via "medium need for action," to "low need for action." Feedback on issues that required only minor adjustments was implemented into the platform immediately after the walkthrough.
Second Evaluation Round---Online User Test
------------------------------------------
Prior to the second evaluation round, some requirements defined and analyzed during the pluralistic walkthrough were | {
"pile_set_name": "PubMed Central"
} |
I.. Introduction {#sec1}
================
Eyes and their movements are important in expressing a person\'s desires, needs and emotional states [@ref1]. The significance of eye movements with regards to the perception of and attention to the visual world is certainly acknowledged since it is the means by which the information needed to identify the characteristics of the visual world is gathered for processing in the human brain. Hence, robust eye detection and tracking are considered to play a crucial role in the development of human-computer interaction, creating attentive user interfaces and analyzing human affective states.
Head movement is also found to be a natural, simple and effective way of pointing to objects, interaction and communication. Thus, head movement detection has received significant attention in recent research. One of the various purposes for head movement detection and tracking is to allow the user to interact with a computer. It also provides the ability to control many devices by mapping the position of the head into control signals.
Eye tracking and head movement detection are widely investigated as alternative interface methods. They are considered to be easier to use than other methods such as voice recognition or EEG/ECG signals. They also have achieved higher accuracy and performance. In addition, using eye tracking or head movement detection as alternative interface, control or communication methods is beneficial for a wide range of severely disabled people who are left with minimal ability to perform voluntary motion. Eye and head movements are the least affected by disabilities because, for example, spinal cord injuries do not affect the ability to control them, as they are directly controlled by the brain. Combining eye tracking and head movement detection can provide a larger number for possible control commands to be used with assistive technologies such as a wheelchair.
There are many approaches introduced in literature focusing on eye tracking. They can be used as a base to develop an eye tracking system which achieves the highest accuracy, best performance and lowest cost.
Head movement detection has been receiving growing interest as well. There are many proposed approaches. Some approaches may be implemented using low computational hardware such as a microcontroller due to the simplicity of the used algorithm.
This paper presents a survey of different eye tracking and head movement detection techniques reported in the literature along with examples of various applications employing these technologies.
The rest of the paper is outlined as follows. Different methods of eye tracking are investigated in [Section II](#sec2){ref-type="sec"}. Fields of applications for eye tracking are described briefly in [Section III](#sec3){ref-type="sec"}. [Section IV](#sec4){ref-type="sec"} discusses several head movement detection algorithms and the applications of this technology are presented in [Section V](#sec5){ref-type="sec"}. Systems which use a combination of eye tracking and head movement detection are described in [Section VI](#sec6){ref-type="sec"}. Some of the commercial products of eye tracking and head movement detection are presented in VII. The results of using the investigated eye tracking and head movement detection algorithms are reported in [Section VIII](#sec8){ref-type="sec"}. Finally, [Section IX](#sec9){ref-type="sec"} draws the conclusions.
II.. Eye Tracking {#sec2}
=================
The geometric and motion characteristics of the eyes are unique which makes gaze estimation and tracking important for many applications such as human attention analysis, human emotional state analysis, interactive user interfaces and human factors.
There are many different approaches for implementing eye detection and tracking systems [@ref2]. Many eye tracking methods were presented in the literature. However, the research is still on-going to find robust eye detection and tracking methods to be used in a wide range of applications.
A.. Sensor-Based Eye Tracking (EOG) {#sec2a}
-----------------------------------
Some eye tracking systems detect and analyze eye movements based on electric potentials measured with electrodes placed in the region around the eyes. This electric signal detected using two pairs of electrodes placed around one eye is known as electrooculogram (EOG). When the eyes are in their origin state, the electrodes measure a steady electric potential field. If the eyes move towards the periphery, the retina approaches one electrode and the cornea approaches the other. This changes the orientation of the dipole and results in a change in the measured EOG signal. Eye movement can be tracked by analyzing the changes in the EOG signal [@ref3].
B.. Computer-Vision-Based Eye Tracking {#sec2b}
--------------------------------------
Most eye tracking methods presented in the literature use computer vision based techniques. In these methods, a camera is set to focus on one or both eyes and record the eye movement. The main focus of this paper is on computer vision based eye detection and gaze tracking.
There are two main areas investigated in the field of computer vision based eye tracking. The first area considered is eye detection in the image, also known as eye localization. The second area is eye tracking, which is the process of eye gaze direction estimation. Based on the data obtained from processing and analyzing the detected eye region, the direction of eye gaze can be estimated then it is either used directly in the application or tracked over subsequent video frames in the case of real-time eye tracking systems.
Eye detection and tracking is still a challenging task, as there are many issues associated with such systems. These issues include degree of eye openness, variability in eye size, head pose, etc. Different applications that use eye tracking are affected by these issues at different levels. Several computer-vision-based eye tracking approaches have been introduced.
### 1.. Pattern Recognition for Eye Tracking {#sec2b1}
Different pattern recognition techniques, such as template matching and classification, have proved effective in the field of eye tracking. Raudonis et al. [@ref4] used principal component analysis (PCA) to find the first six principal components of the eye image to reduce dimensionality problems, which arise when using all image pixels to compare images. Then, Artificial Neural Network (ANN) is used to classify the pupil position. The training data for ANN is gathered during calibration where the user is required to observe five points indicating five different pupil positions. The system requires special hardware which consists of glasses and a single head-mounted camera and thus might be disturbing to the patient as it is in their field of view. The use of classification slows the system and hence it requires some enhancements to be applicable. In addition, the system is not considered a real-time eye tracking system. The proposed algorithm was not tested on a known database which means the quality of the system might be affected by changes in lighting conditions, shadows, distance of the camera, the exact position in which the camera is mounted, etc. The algorithm requires processing which cannot be performed by low computational hardware such as a microcontroller.
Tang and Zhang [@ref5] suggested a method that uses the detection algorithm combined with gray prediction to serve eye tracking purposes. The GM(1,1) model is used in the prediction of the location of an eye in the next video frame. The predicted location is used as the reference for the region of eye to be searched. The method uses low-level data in the image in order to be fast but there are no experimental results evaluating the performance of the method.
Kuo et al. [@ref6] proposed an eye tracking system that uses the particle filter which estimates a sequence of hidden parameters depending on the data observed. After detecting possible eyes positions, the process of eye tracking starts. For effective and reliable eye tracking, the gray level histogram is selected as the characteristics of the particle filter. Using low-level features in the image makes it a fast algorithm. High accuracy is obtained from the system; however, the real-time performance was not evaluated, the algorithm was tested on images not videos and the images were not taken from a known database and, thus, the accuracy and performance of the algorithm may decrease when utilized in a real-world application.
Lui et al. [@ref7] suggested a fast and robust eye detection and tracking method which can be used with rotated facial images. The camera used by the system is not head mounted. A Viola-Jones face detector, which is based on Haar features, is used to locate the face in the whole image. Then, Template Matching (TM) is applied to detect eyes. Zernike Moments (ZM) is used to extract rotation invariant eye characteristics. Support Vector Machine (SVM) is used to classify the images to eye/non-eye patterns. The exact positions of the left and right eyes are determined by selecting the two positions having the highest values among the found local maximums in the eye probability map. Detecting the eye region is helpful as a pre-processing stage before iris/pupil tracking. Especially, it allows for eye detection in rotated facial images. This work presented a simple eye tracking algorithm but the results of the method evaluation were not reported and thus the proposed eye tracking method is weak and not usable.
Hotrakool et al. [@ref8] introduced an eye tracking method based on gradient orientation pattern matching along with automatic template updates. The method detects the iris based on low level features and motion detection between subsequent video frames. The method can be used in applications that require real-time eye tracking with high robustness against change in lighting conditions during operation. The computational time is reduced by applying down-sampling on the video frames. The method achieves high accuracy. However, the experiments were performed on videos of a single eye, which eliminates all surrounding noise, and a known database was not used. The method detects the iris but does not classify its position. The method requires minimal CPU processing time among other real-time eye tracking methods investigated in this survey. The motion detection approach discussed in this paper is worth being considered in new algorithms to obtain the minimal required CPU processing time in eye tracking | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-nutrients-12-01640}
===============
Fatigue is a normal sensation that serves to prompt bodily rest following physical or mental exhaustion from daily activities. However, often fatigue is not resolved adequately by rest but is aggravated owing to quality of life (QOL) deterioration. It has been reported that approximately 30% of the Japanese population experience regular subjective fatigue \[[@B1-nutrients-12-01640],[@B2-nutrients-12-01640]\]. Chronic fatigue syndrome is a disorder diagnosed by profound disabling fatigue that persists for at least 6 months without relief and is not lessened by ordinary rest \[[@B3-nutrients-12-01640]\]. It is common in 20 to 50 years old during the prime period of their working life. It has been estimated that it affects some 80,000 to 240,000 individuals in Japan, and approximately one-third of these individuals are bedridden. Prevention of fatigue aggravation is thus of some importance. In the present study, we focused on an intervention study of anti-fatigue effects in healthy individuals experiencing fatigue in daily life that had continued for no longer than the 6 months standpoint from prevention of chronic fatigue.
Fatigue is a condition in which cells and tissues are damaged by reactive oxygen species generated during excessive activity \[[@B4-nutrients-12-01640]\]. Recovery from fatigue occurs when this damage is adequately repaired; however, if the damage continues with inadequate repair due to the lack of necessary energy for recovery, an inflammatory response is elicited; this leads to conditions such as malaise and fever, consequently resulting in chronic fatigue \[[@B4-nutrients-12-01640]\]. Accordingly, antioxidants that inhibit damage from oxidative stress, and substances that can stimulate energy production are effective against fatigue.
Ubiquinol, a reduced form of coenzyme Q~10~, is present in food and has been reported to have anti-fatigue activity \[[@B5-nutrients-12-01640]\]. This substance is a vitamin-like compound used in many countries as an ingredient in foods and supplements. As antioxidants increase ATP production by stimulating mitochondrial electron transport, their bioactivity consists of two elements---antioxidant activity and energy production that both generate an anti-fatigue effect. These two mechanisms likely contributed to many other effects that have been reported in human clinical studies, including enhanced cardiac function, anti-inflammatory effect on hematopoietic cells, sialagogic effects in middle- or advance-aged healthy individuals with dry-mouth condition, and improved conditions of patients with Parkinson's disease when used in combination with L-dopa \[[@B6-nutrients-12-01640]\].
Although ubiquinol is biosynthesized in humans, it is also present in food. Its level in various organs has been reported to reduce with age, suggesting reduction of biosynthetic activity with aging \[[@B7-nutrients-12-01640]\]. The biosynthesis pathway of ubiquinol, like that of cholesterol, involves metabolism by hydroxymethylglutaryl-CoA (HMG-CoA) reductase. This is likely the reason why its level in the blood has been reported to decrease by statins that lower the blood-cholesterol level \[[@B8-nutrients-12-01640]\]. It has been estimated that 3−5 mg of ubiquinol is ingested daily through diet; this amount is contributed largely by meats and seafood. It has been suggested that the amount of meat intake influences the amount of ubiquinol in the body \[[@B9-nutrients-12-01640]\]. According to research in patients with complete nutritional independence, approximately half of the blood ubiquinol is believed to originate from the diet \[[@B10-nutrients-12-01640]\]. After absorption, ubiquinol stays in blood as a lipoprotein component. It has been reported that the ubiquinol amount in blood is significantly higher in healthy individuals of advanced age than in elderly bedridden individuals, and that the risk of dementia is reduced approximately by half in individuals having high blood levels of ubiquinol \[[@B11-nutrients-12-01640]\].
In an open-label study on ubiquinol intake in patients with chronic fatigue syndrome, cognitive performance indicator of fatigue as well as the questionnaire score of depression symptoms improved along with an increased blood level of ubiquinol \[[@B5-nutrients-12-01640]\]. A double-blind study found that the blood ubiquinol level in patients with chronic fatigue syndrome was low prior to ubiquinol intake. Fatigue improvement, reduction in the episodes of wakefulness during sleep, and inhibition of decline in autonomic nerve functions were demonstrated following ubiquinol intake \[[@B5-nutrients-12-01640]\]. Another double-blind study in healthy individuals aged approximately 60 years found improvement in the mental QOL including subjective fatigue and improved spontaneous activity \[[@B12-nutrients-12-01640]\]. An interventional prospective cohort study among elderly residents suggested beneficial effects on QOL, including subjective fatigue, and improved maintenance of cognitive function \[[@B13-nutrients-12-01640]\]. This study also demonstrated that long-term ubiquinol intake over 5 years posed no safety issues. Thus, the beneficial effects of ubiquinol on fatigue have been shown not only in patients with chronic fatigue syndrome but also in healthy individuals; however, data in young individuals are scarce, being limited to a report of beneficial psychological effects and improved athletic performance in female university athletes \[[@B14-nutrients-12-01640]\]. Therefore, we targeted a wide range of age in young and old adults in the present study.
The present double-blind study examined the anti-fatigue effect of ubiquinol in healthy participants aged between 20 and 64 years, experiencing mild fatigue in daily life.
2. Materials and Methods {#sec2-nutrients-12-01640}
========================
2.1. Clinical Study {#sec2dot1-nutrients-12-01640}
-------------------
The clinical study employed a written questionnaire on parameters such as fatigue, sleep, and lifestyle habits as well as the autonomic nerve function screening to select participants for evaluation of the anti-fatigue effects of a soft-capsule formulation containing ubiquinol. Seventy-one participants were selected out of 104 healthy individuals experiencing fatigue in daily life that had continued for more than 1 and less than 6 months and who were judged by the principal investigator as not having chronic fatigue syndrome with the checklist of diagnostic criteria \[[@B3-nutrients-12-01640]\]. This was a randomized, comparative, placebo-controlled, double-blind, parallel-group study designed in accordance with the recommendations of the Consolidated Standards of Reporting Trials guidelines. Written consent was obtained from participants after they were informed in advance about the study's objectives, methods, and expected clinical advantages and disadvantages of the treatment. This study was performed in compliance with the principles of the Declaration of Helsinki and was approved by the ethical-review board of the Ethics Committee of Osaka City University Center for Health Science Innovation (OCU-CHSI-IRB no. 16). The study was registered with the UMIN Clinical Trials Registry.
The inclusion criterion required that participants were (1) healthy individuals at least 20 years old and (2) experiencing fatigue in daily life that had continued for more than 1 and less than 6 months. The study exclusion criteria included participants (1) receiving continuous treatment for disease or on medications; (2) intaking coenzyme Q~10~ continuously; (3) with a history of cardiovascular or neurological diseases; (4) with allergies, sleep disorders, or organic diseases that clearly contributed to fatigue; (5) who were pregnant, planning pregnancy, or nursing; (6) who had psychiatric diseases or history thereof; (7) who consumed alcohol in excess or could not avoid the use of medications that could potential affect the outcomes; (8) who had one or more severe diseases, such as diabetes mellitus, liver disease, kidney disease, heart disease, or other diseases; (9) who were participating in another clinical study within 1 month prior to giving consent or were participating in any other clinical trial; and (10) who were judged unsuitable by the principal investigator for any other reasons.
Participants selected through preliminary screening were randomized by age and gender into three groups to receive 100 mg of ubiquinol, 150 mg of ubiquinol, or placebo (capsule without ubiquinol). Four participants who dropped out after the initiation of the study were excluded from analysis as well as five participants who were affected during the course of the study by bone fracture, initiation of treatment for hyperlipidemia, medication use for headache, strenuous exercise (long-distance running), and low rate of trial dietary product intake (≤80%). These screenings were performed based on the result of a 4-weeks daily journal recorded by each participant. Questions about dietary intake and alcohol intake were also included in this daily journal. To judge the subjects for analysis, we carefully checked the daily journal every four weeks, on the 2nd, and 3rd experimental days. The final analysis included 20 participants in the placebo group (age 41.3 ± 13.4 years; 13 females and 7 males), 20 in the 100-mg group (age 44.0 ± 9.8 years; 14 females and 6 males), and 22 in the 150-mg group (age 40.4 ± 11.8 years; 14 females and 8 males).
The trial dietary product was a soft-capsule formula containing 50 mg of ubiquinol. The additional ingredients in capsules were rapeseed oil, diglycerol monooleate, beeswax, soy lecithin, and caramel as a coloring agent. Rapeseed oil was added to the placebo capsule instead of ubiquinol. Participants took three capsules once daily after breakfast continuously for 12 weeks (the placebo group took three placebo capsules; the 100-mg group took two active capsules | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .448}
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
In many organisms, early embryonic development is directed exclusively by maternal products that are deposited into the female gamete during oogenesis. Following the clearance of a subset of these products ([@bib95]), transcription is initiated and the zygotic genome acquires developmental control ([@bib9]; [@bib25]; [@bib46]; [@bib86]). This handover is referred to as the maternal-to-zygotic transition and the onset of transcription is called zygotic genome activation (ZGA). The absolute time and number of cell cycles required before the first transcripts can be detected is species specific ([@bib86]). Additionally, from one gene to another the timing of transcriptional activation varies ([@bib1]; [@bib16]; [@bib27]; [@bib29]; [@bib53]; [@bib68]; [@bib69]; [@bib77]; [@bib87]). In fact, for some genes the first zygotic transcripts can be detected several cell cycles before the stage that is traditionally defined as the time point of ZGA ([@bib18]; [@bib29]; [@bib81]; [@bib94]). In spite of the progress made, it remains unclear how the onset of transcription in embryos is temporally regulated.
Several lines of evidence suggest that the absence of transcription during early embryonic development could be due to limited levels of transcription factors ([@bib5]; [@bib90]). In this scenario, transcriptional activation would occur once a threshold level of these factors is reached. For example, experiments that used the transcriptional activity of injected plasmids as a read-out revealed that an increase in the amount of the potent, heterologous, transcriptional activator GAL4-VP16 can overcome transcriptional repression of its target gene in the early embryo ([@bib5]). However, it remained unclear whether limited levels of transcription factors contribute to the absence of endogenous transcription in early embryos. Additional support for the limited machinery model came from work showing that an increase in the concentration of the general transcription factor TBP can cause premature transcription from an injected -- and incompletely chromatinized -- DNA template in *Xenopus* embryos. This effect was maintained only when non-specific DNA was added to titrate chromatin assembly ([@bib5]; [@bib90]). These results suggested that low TBP levels may play a role in the absence of transcription during the early stages of *Xenopus* development, but that increasing TBP alone is not sufficient to cause sustained premature transcription. During the cleavage stages of *Xenopus* development, TBP levels increase due to translation, which suggests that TBP levels might contribute to the timely activation of transcription during ZGA ([@bib90]). Transcription factors have recently been identified that are required for the activation of the first zygotically expressed genes in *Drosophila* (Zelda) and zebrafish (Pou5f3, Sox19b, Nanog) ([@bib26]; [@bib47]; [@bib48]; [@bib50]; [@bib61]). RNA for these factors is maternally provided and their levels increase due to translation during the early cell cycles. This suggests the possibility that an increase in the concentration of these transcription factors might contribute to the shift from transcriptional repression to transcriptional activity. Although transcription factors levels clearly influence transcriptional activity during early embryogenesis, there is evidence to show that the transcriptional machinery is operational prior to ZGA ([@bib19]; [@bib54]; [@bib59], [@bib60]; [@bib73]) (see below). Thus, the timing of ZGA cannot be solely explained by a requirement to reach a threshold level of transcriptional activators.
The finding that a premature increase in the number of nuclei or the amount of DNA resulted in premature transcription of injected plasmids in *Xenopus* embryos suggested that the transcriptional machinery is fully functional prior to genome activation and led to the excess repressor model ([@bib59]). This model postulates that a transcriptional repressor is titrated by binding to the exponentially increasing amount of genomic DNA, until it is depleted first from the soluble fraction, and then from DNA, to allow for the onset of transcription. Related studies in zebrafish and *Drosophila* have provided further evidence for this model. Endogenous transcription is initiated earlier in zebrafish embryos that accumulate DNA due to a defect in chromosome segregation ([@bib19]), and transcription is delayed in haploid *Drosophila* embryos compared to diploid embryos, albeit not for all genes ([@bib54]). The excess repressor model predicts that the repressor is present in large excess, at relatively stable levels while the genome is inactive, and can bind DNA with high affinity. Core histones fulfill these criteria ([@bib2]; [@bib92]). Moreover, when bound to DNA in the form of nucleosomes, histones can affect DNA accessibility for DNA-binding proteins. To date, two key studies have investigated the role of core histones in the temporal regulation of zygotic transcription in *Xenopus* embryos ([@bib5]; [@bib6]). Experiments that used the transcriptional activity of injected plasmids as a read-out revealed that premature transcription caused by an excess of non-specific DNA can be negated by the addition of histones ([@bib5]). More recently, the level of histones H3/H4 was shown to regulate the level of transcription in *Xenopus* egg extract and H3 was suggested to play a similar role in the embryo ([@bib6]). Taken together, these results support the idea that histones play a role in regulating the timing of zygotic transcription.
If histones function as repressors according to the original excess repressor model, it would be predicted that a substantial reduction of the histone-density on DNA would cause the onset of transcription ([@bib6]; [@bib59]). However, while such a scenario might be possible for typical sequence-specific repressors of transcription, it is unlikely for histones. Histones assemble into histone octamers on DNA to form nucleosomes, the basic building blocks of chromatin. Thus, random depletion of nucleosomes from DNA would severely compromise the integrity of chromatin structure. Taken together, there is support for the idea that histone levels play a role in regulating the timing of zygotic transcription, but it remains unclear how this would mechanistically work. Furthermore, the observation that both activator and histone levels play a role in shifting the balance between repression and activation at genome activation remains to be clarified.
Here, we analyze the onset of zygotic transcription in zebrafish embryos. With a quantitative approach, we show that the concentration of non-DNA-bound histones determines the timing of zygotic transcription and that all four core histones are required for this effect. The reduction in nuclear histone concentration that coincides with genome activation does not result in a significant change in nucleosome density, but rather allows transcription factors to successfully compete for DNA binding. In agreement with this, the association of transcription factors with the genome is sensitive to histone levels, and changing the concentration of transcription factors also affects the time of transcription. Our results show that transcription is regulated by a dynamic competition for DNA binding between histones and transcription factors. Transcription begins when the concentration of non-DNA-bound histones in the nucleus has sufficiently dropped so that the transcriptional machinery can outcompete histones for binding to DNA.
Results {#s2}
=======
In zebrafish, zygotic transcription starts \~3 hr post-fertilization, around the tenth cell division ([@bib1]; [@bib27]; [@bib29]; [@bib35]; [@bib69]) ([Figure 1A](#fig1){ref-type="fig"}). To analyze the onset of transcription in the embryo in detail, we identified six genes that are not maternally provided and that have previously been shown to be activated at the onset of genome activation ([@bib1]; [@bib69]) ([Figure 1---figure supplement 1A](#fig1s1){ref-type="fig"}). At the 1000-cell (1K) stage, transcripts can be detected, especially when choosing late stage embryos ([Figure 1B](#fig1){ref-type="fig"}). Thus, to clearly distinguish between transcription being off and on, we analyzed early 1K and (mid) high stage embryos. Using this approach, analysis by qPCR allowed us to detect consistent induction of these genes at high stage ([Figure 1B](#fig1){ref-type="fig"} and [Figure 1---figure supplement 1B](#fig1s1){ref-type="fig"}). We will refer to the stages before and after induction as before and following genome activation. To relate the onset of transcription to the number of cells present in the embryo, we next counted the number of cells in embryos ranging from 1K to dome stage. We imaged DAPI-stained nuclei on a two-photon microscope and counted them using the software Imaris ([Figure 1C](#fig1){ref-type="fig"}). Using nuclei as a proxy for cell number, we obtained counts that agreed with numbers of cells per embryo obtained by others for 1K ([@bib37]). In contrast, our cell count for high stage, for example, was slightly higher (1900 vs 1800) ([@bib37]), which is consistent with the later high stage which we analyzed ([Figure 1D](#fig1){ref-type="fig"} and [Figure 1---source data 1](#SD1-data){ref-type="supplementary-material"}). We conclude that the set of genes we selected is robustly induced at high stage, when embryos contain \~1900 cells, and thus represent a reliable system to analyze the onset of zygotic transcription during embryogenesis.10.7554/eLife.23326.003Figure 1.Assay to analyze the onset of transcription in zebrafish.(**A**) In zebrafish, transcription begins \~3 hr post-fertilization. Stage-specific drawings of representative embryos are adapted from [@bib41]) with permission. (**B**) Expression of six genes was analyzed by qPCR at 512-cell, early 1K, mid 1K, high and oblong stage in wild-type embryos. Inset shows the | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .540}
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Colorectal cancer (CRC) is the third most common cancer and the fourth most common cause of cancer-related death worldwide.[@B1], [@B2] CRC is caused by mutations that target oncogenes, tumor suppressor genes and genes related to DNA repair mechanisms. Interestingly, noncoding RNAs account for 90% of total transcribed RNAs in the human genome.[@B3] Long noncoding RNAs (lncRNAs) are functionally defined as transcripts \>200 nucleotides in length with no protein coding potential. They also number in the tens of thousands, many of which are uniquely expressed in differentiated tissues or specific cancer types.[@B4] LncRNAs regulate cellular processes depending on their cellular localization: nuclear lncRNAs are enriched for functionality involving chromatin interactions, transcriptional regulation, and RNA processing, while cytoplasmic lncRNAs can modulate mRNA stability or translation and influence cellular signaling cascades.[@B5] Since the lncRNA CCAT1 was identified in CRC, numerous lncRNAs have been characterized along with their oncogenic or tumor suppressor functions in CRC.[@B6]-[@B9].
SNHG6 is a housekeeping gene from the 5\'TOP family that encodes two non-coding RNAs (ncRNAs): U87 C/D box snoRNA (SNORD87),[@B10] and lncRNA SNHG6,[@B11] which has been demonstrated to be as a potential oncogene in various human cancers.[@B12]-[@B14] In this study, we investigated SNGH6 expression in different human cancers using a TCGA dataset, and found that SNHG6 was highly expressed in CRC with a poor prognosis. Our study demonstrated that SNHG6 may act as an oncogene in CRC by activating the TGF-β/Smad signaling pathway via binding UPF1 and inducing epithelial-mesenchymal transition (EMT) through regulating ZEB1.
Materials and methods
=====================
The Cancer Genome Atlas (TCGA) database, GEO database, StarBase and bioinformatics analysis
-------------------------------------------------------------------------------------------
TCGA and GEO data of different cancers was selected by GEPIA and UALCAN, so examine whether any significant differences in SNHG6 expression existed between paired normal and tumor tissues. Fold change \> 1.5 and *P*-value \< 0.01 between the tumor and normal tissues were considered as significant. The starBase v2.0[@B15] was used to selected downstream interacting protein.
Clinical specimens
------------------
Clinical CRC specimens and paired normal tissues were collected from 77 patients who underwent surgical treatment for CRC at Nanfang Hospital of Southern Medical University after obtaining informed consent. A diagnosis of CRC was histopathologically confirmed for each patient sample. Cancer tissues and matched normal tissues were stored at -80℃ until use. The protocols used in this study were approved by our hospital\'s Protection of Human Subjects Committee.
Cell culture, plasmid construction, lentiviral construction and cell transfections
----------------------------------------------------------------------------------
Human normal colon epithelial cell line (FHC) and human colorectal cancer cell lines (HT29, CaCO~2~, SW480, SW620, RKO, HCT116 and LoVo) were purchased from the Cell Bank of Type Culture Collection (CBTCC, Chinese Academy of Sciences, Shanghai, China) and were cultured in DMEM (Gibco, Carlsbad, CA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA). Cells were maintained at 37℃ in a water-saturated atmosphere with 5% CO~2~. In order to overexpress SNHG6, full-length SNHG6 was cloned into the expression vector pCMV (Vigene, Shandong, China) and transfected into RKO cells by using Lipofectamin^TM^ 3000 (Invitrogen, Carlsbad, CA) according to the manufacturer\'s instructions. Knockdown of SNHG6 was accomplished using three different designed shRNAs (Cyagen, Guangzhou, China) that were transfected into RKO cells according to the manufacturer\'s instructions.
RNA isolation, cDNA synthesis, and quantitative real-time PCR
-------------------------------------------------------------
Total RNAs were extracted from cells or tissues with Trizol solution (TaKaRa, Dalian, China). Quantitative real-time polymerase chain reaction (qRT-PCT) was performed using the PrimeScript RT Reagent Kit and SYBR Premix Ex Taq (TaKaRa, Dalian, China) following the manufacturer\'s instructions. Our results were normalized to the expression of glyeraldehyde-3-phosphate dehydrogenase (GAPDH) or U6. The specific primers used are listed in Table [1](#T1){ref-type="table"}. qRT-PCR results were analyzed to obtain Ct values of amplified products, and data was analyzed by the 2^-ΔΔCt^ method.
Cell proliferation assay
------------------------
Cell proliferation was estimated using a Cell Counting Kit-8 (CCK-8) (Dojindo, Japan). Overexpression transfected RKO cells and HCT116 cells as well as RKO knockdown cells were seeded on the 96-well plates and each were cultured for 0h, 24h, 48h, 72h, 96h respectively. At the different time point, 10μL CCK-8 was added to the well and incubated for 2 hours. An absorbance value (OD) of 450nm was determined on the microplate reader.
Transwell assay
---------------
Cell migration and invasion assays were measured by trawnswell chamber (8μm pore size, Corning), and for cell invasion, the transwell chambers were also matrigel-coated. The lower chamber was filled with 500μL of 20% FBS medium. Transfected RKO cells (6×10^4^) in 200μL of serum-free medium were gently loaded onto each filter insert (upper chamber) and then incubated at 37℃ for 48h. The filter inserts were removed from the chambers, fixed with methanol for 10min and stained with hematoxylin for 20 min. The samples were subsequently washed, dried and mounted onto slides. The migratory cells were stained blue, visualized under and inverted microscope and then counted in five random fields for statistical analysis.
Wound healing assay
-------------------
Transfected overexpression and knockdown RKO cells were cultured in DMEM with 2% fetal bovine serum. Wounds were made in the cell monolayer using a 10-μl plastic pipette tip. The size of the wound was imaged and measured after 48h of wound formation. The cell migration area was measured with dashed areas and normalized to control cells.
*In vivo* experiments
---------------------
4-week-old male nude mice were purchased from the Central Laboratory of Animal Science, Wuhan University (Wuhan, China) and were maintained in a specific pathogen-free facility. RKO cells stably transfected with SNHG6-shRNA or scramble-shRNA were harvested from 60mm plates and suspended at 5×10^6^ cells/ml. The suspended cells (200μl) were subcutaneously injected into the left hip of 4 mice (4 weeks old) each group, and the mice were sacrificed 4 weeks after injection. The tumor volume (V) was obtained by measuring the length (L) and width (W) of the tumor with vernier calipers, and which was calculated using the formula V = (L×W^2^) × 0.5.
Western blot analysis
---------------------
Total protein was extracted from cells using RIPA lysis buffer. Extracted proteins were mixed with loading buffer, separated by SDS-PAGE and transferred to PVDF membranes, which were subsequently blocked with a 5% solution of non-fat milk for 1h. Membranes were then incubated with primary antibody \[GAPDH, UPF1, 1:5000, Proteintech; smad2, p-smad2, smad3, p-smad3, E-cadherin, N-cadherin, Vimentin, ZEB1, Slug, Snail, MMP9, MMP2, 1:1000, Cell Signaling Technology\] according to the manufacturer\'s instructions. Then the membranes were washed three times with TBST and incubated with appropriate secondary antibodies for 1h at room temperature. The ECL chemiluminescence system was used to detect the signal.
Statistical analysis
--------------------
The SPSS 17.0 statistical analysis software was used for statistical analysis of experimental data. The significance of differences between groups was estimated by Student\'s t-test. Additionally, multiple group comparisons were analyzed with one-way ANOVA. Statistically significant correlation between SNHG6 and UPF1 expression levels in CRC tissues and cell lines was analyzed by Pearson\'s correlation analysis. The overall survival probability was analyzed using Kaplan-Meier method and calculated using the log-rank test. \* *P*\<0.05, \*\**P*\<0.01, and \*\*\**P*\<0.001 were considered significant.
Results
=======
SNHG6 is differentially expressed in CRC tumor and normal tissues and associated with CRC progression
-----------------------------------------------------------------------------------------------------
According to TCGA, SNHG6 is significantly upregulated in colorectal cancer tissues in comparison with the normal counterparts (Fig. [1](#F1){ref-type="fig"}a-c,*P* \< 0.01). Additionally, we used the Kaplan-Meier method analysis (log-rank test) to explore the relationship between SNHG6 expression and patient prognosis from GEO dataset (GSE17538). We found that patients with high levels of SNHG6 had a significantly shorter overall survival than those with low levels of SNHG6 (Fig. [1](#F1){ref-type="fig"}d, *P* = 0.0162).
SNHG6 is upregulated in colorectal cancer tissues and cell lines
----------------------------------------------------------------
We used qRT-PCR to observe that SNHG6 was significantly upregulated in CRC tissues based on samples from 77 colorectal cancer patients (Fig. | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Fruit ripening involves the well-orchestrated coordination of several regulatory steps in both climacteric and non-climacteric fruit, together with strong metabolic and physiological changes ([@CIT0025]). Fig fruit (*Ficus carica*) are categorized as climacteric; they show a rise in respiration rate and ethylene production at the onset of their ripening phase ([@CIT0033]; [@CIT0005]), similar to that of the climacteric tomato, apple, and mango fruit ([@CIT0012]; [@CIT0001]; [@CIT0060]). However, unlike climacteric fruit, figs harvested before they are fully ripe never complete their ripening process to reach commercially desirable parameters of size, color, flavor, and texture ([@CIT0008]). This challenges the idea that fig fruit are climacteric. In addition,1-methylcyclopropene (1-MCP), which blocks the effects of ethylene during ripening, increases ripening-related ethylene production in fig fruit following pre- or post-harvest application in an unexpected auto-inhibitory manner ([@CIT0049]; [@CIT0038]; [@CIT0010]). A molecular study of ethylene-related genes in figs ([@CIT0011]) showed that *FcERF12185*, an ethylene signal-transduction gene, might be responsible for the non-climacteric auto-inhibition of ethylene production in the fruit. Unlike most fig ethylene-response factor (ERF) genes, *FcERF12185* expression does not increase during ripening, and is induced upon 1-MCP treatment ([@CIT0011]).
It has been suggested that the plant hormone abscisic acid (ABA) regulates fruit ripening and senescence in both climacteric and non-climacteric fruit ([@CIT0061], [@CIT0062]; [@CIT0052]; [@CIT0027]). In climacteric fruit, endogenous ABA levels increase before the onset of ripening and subsequently decrease until the fruit is fully ripe. However, in non-climacteric fruit, ABA levels increase from maturation to harvest ([@CIT0044]; [@CIT0027]).
The fig fruit bears a unique closed inflorescence structure, the syconium. This closed inflorescence produces an aggregate fruit, which is composed of small individual drupelets that develop from the ovaries enclosed in the receptacle ([@CIT0051]). Development of female fruit in the common fig consists of three phases: phase I is characterized by rapid growth in fruit size; in phase II, the fruit remains nearly the same size, color, and firmness; in phase III, ripening occurs, with fruit growth, color change, softening, and alteration of the pulp texture to an edible state ([@CIT0008]). Endogenous ABA is reported to increase as the ripening phase progresses ([@CIT0040]). The endogenous ABA content in the fruit is determined by the dynamic balance between its biosynthesis and catabolism. Zeaxanthin epoxidase (ZEP), 9-cis-epoxycarotenoid dioxygenase (NCED), short-chain alcohol dehydrogenase (ABA2), and abscisic aldehyde oxidase participate in ABA biosynthesis, while ABA-8'-hydroxylase (ABA8OX) and ABA-glucosyltransferase participate in its catabolism ([@CIT0042]; [@CIT0045]; [@CIT0055]; [@CIT0019]; [@CIT0043]; [@CIT0027]; [@CIT0040]).
The effect of ABA on ethylene biosynthesis, fruit ripening, and senescence has been extensively studied in the model plant tomato. Exogenous ABA treatment increases ABA content in tomato fruit, and induces the expression of ethylene-biosynthesis genes, namely 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (*ACS*) and ACC oxidase (*ACO*). On the other hand, treatment of tomato fruit with the ABA inhibitors fluridone or nordihydroguaiaretic acid (NDGA) inhibits *ACS* and *ACO* and delays ripening and softening ([@CIT0062]; [@CIT0036]). In particular, a significant reduction in the activity of *SlNCED1*, a key gene in tomato ABA biosynthesis, by RNAi, reduces the expression of genes encoding major cell wall-catabolic enzymes, and increases the accumulation of pectin during ripening, which leads to a significant extension of the shelf-life of climacteric tomato fruit ([@CIT0052]). Similarly, exogenous ABA application significantly promotes the ripening process of the non-climacteric strawberry fruit, whereas fluridone inhibits it. Down-regulation of the ABA-biosynthesis gene *FaNCED1* in strawberry significantly decreases ABA levels and produces non-colored/unripe fruit ([@CIT0018]). Moreover, studies in apple, banana, grape, and sweet cherry have shown that exogenous application of ABA enhances fruit ripening by up-regulating ethylene production, as well as anthocyanin and sugar accumulation ([@CIT0021]; [@CIT0026]; [@CIT0002]; [@CIT0020]; [@CIT0013]; [@CIT0031]). In fig fruit, genes of the ABA biosynthesis and catabolism pathways have been isolated and their expression characterized during ripening ([@CIT0040]).In addition, [@CIT0011] performed a comprehensive study focusing on ethylene-biosynthesis, MADS-box, and ethylene signal-transduction genes during natural ripening and their interactions with 1-MCP. However, the relationship between ABA and ethylene during the onset of fruit ripening in fig remains to be fully elucidated.
The plant-specific NAC family of proteins containing the NAC domain is one of the largest transcription factor families in plants. An increasing number of NAC genes are being identified and studied in both monocotyledonous and dicotyledonous plants . In tomato, 74 NAC or NAC-like genes belonging to 12 subfamilies have been identified, with high expression of *SlNAC4--9* being found during fruit development and ripening ([@CIT0024]). *SlNAC1* has a broad influence on tomato fruit ripening, and its over-expression during ripening has been found to be regulated through both ethylene-dependent and ABA-dependent pathways ([@CIT0032]). Reduced expression of *SlNAC4* by RNAi in tomato results in delayed fruit ripening, with suppressed chlorophyll breakdown and decreased ethylene synthesis being mediated mainly through reduced expression of system-2 ethylene-biosynthesis genes, and with carotenoids being reduced via alteration of the flux of the carotenoid pathway ([@CIT0063]). In addition, *SlNAC4* is down-regulated by ABA treatment while *SlNAC5*, *6*, *7*, and *9* are up-regulated ([@CIT0024]). Involvement of NAC genes in banana fruit ripening was found via interactions with ethylene-signaling components ([@CIT0047]). In figs, 27 NAC genes have been identified during fruit ripening ([@CIT0009]); however, their roles during this process are still unknown.
In the present work, we used exogenous ABA, ethephon, and the ABA inhibitors fluridone and NDGA to characterize the effects of ABA on fig fruit ripening. The expression levels of ABA- and ethylene-biosynthesis genes were determined, together with those of ripening-associated transcription factors and signal-transduction genes. The levels of endogenous ABA and ethylene were also quantified to determine how ABA triggers ethylene production to start the ripening process. This study also examined the genes that likely to be induced during on-tree fruit ripening. The non-climacteric ripening behavior of fig fruit associated with ABA is also discussed.
Materials and methods {#s2}
=====================
Plant material and sample preparation {#s3}
-------------------------------------
Fruit of common fig (*Ficus carica* L.) cv. Brown Turkey, 37 mm in diameter with a greenish-yellow ostiole color (just before the rapid increase in endogenous ABA production and the start of ethylene production), were selected for on-tree treatment with ABA, ethephon, fluridone, and NDGA in a fig orchard located at the Agricultural Research Organization -- Volcani Center, Israel. Treatments were applied by injecting 1 ml of the following into the fruit through the ostiole with a plastic syringe: 1.89 mM ABA (Valent Bioscience Corporation, USA), 0.7 mM ethephon (Ishihara Sangyo Kaisha, Ltd., Japan), 0.15 mM NDGA, or 0.2 mM fluridone (both Sigma-Aldrich). ABA and ethephon were injected once at time 0, whilst NDGA and fluridone were injected three times at 12-h intervals starting at time 0. The size and ostiole color of the fruit used in the experiments and the treatment concentrations were selected on the basis of several preliminary trials (data not shown). Fruit treated with ddH~2~O served as the control group and ethephon-treated fruit served as a positive control.
Three separate experiments were performed: (i) ABA and ethephon treatment; (ii) fluridone treatment; and (iii) NDGA treatment. These trials were conducted during the summers of 2015 and 2016 (July--August), with average day and night temperatures of 32 °C and 24 °C, respectively. For fruit treated with ABA and ethephon, samples were collected at 0, 12, 24, 48, 72, and 96 h after treatment (HAT). Samples for the NDGA and fluridone treatments were collected at 0, 24, 32, 48, 72, and 96 HAT. In total, 600 fruit were treated in each experiment and physiological changes were examined. Nine fruit were harvested at each time interval for molecular characterization, divided into three biological replicates consisting of three fruit each. Fruit receptacle and inflorescence tissues were collected separately and stored | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .30}
{#sp2 .31}
{#sp3 .32}
{#sp4 .33}
{#sp5 .34}
{#sp6 .35}
{#sp7 .36}
{#sp8 .37}
{#sp9 .38}
{#sp10 .39}
{#sp11 .40}
{#sp12 .41}
{#sp13 .42}
{#sp14 .43}
{#sp15 .44}
{#sp16 .45}
{#sp17 .46}
{#sp18 .47}
{#sp19 .48}
{#sp20 .49}
| {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Over the past 20--30 years, suicide rates have declined overall in European countries with previously high rates of suicide, such as Denmark, Estonia, Germany, Hungary, and Sweden \[[@CR1]\]. Ever since the adoption of a national suicide prevention strategy in 2008, \[[@CR2]\] the suicide rate among males in Sweden has declined further \[[@CR3]\]. The prevention strategy involves nine strategic action areas, with two of these areas, 'medical, psychological and psychosocial improvements' and 'lethal means restriction', being specifically applicable within health care. The prevention strategy recommends early interventions with a focus on treating depression, restricted prescriptions of sleeping pills, and increased use of new less-toxic antidepressants \[[@CR2]\]. However, suicide still accounts for the deaths of around 1500 individuals per year in Sweden, with rates of 15.75 suicides per 100,000 males and 7.09 per 100,000 females having been reported in 2016 \[[@CR3]\]. The suicide rate of ≥15 per 100,000 is among the highest rates reported worldwide \[[@CR4]\]. Suicide rates and suicide attempts are often associated with a diagnosis of severe psychiatric or somatic illness \[[@CR4], [@CR5]\], and vary across lifetime and gender \[[@CR4]\]. It is important to note that around 90% of individuals who commit suicide have a documented history of a psychiatric disease \[[@CR6]--[@CR8]\]. The psychiatric disorders with a high lifetime risk of suicide are the affective disorders \[[@CR9]\], particularly bipolar disorder \[[@CR10]\], alcohol or substance use disorders \[[@CR11], [@CR12]\], schizophrenia \[[@CR13], [@CR14]\], and personality disorders \[[@CR15], [@CR16]\]. Indeed, previous research has emphasized treatment interventions for psychiatric illness to reduce suicidal ideation and suicidal behavior. Psychopharmacological treatment \[[@CR17]\], cognitive therapy for suicide prevention (CT-SP) \[[@CR18]\], cognitive behavioral therapy (CBT) \[[@CR1], [@CR19]\], dialectical behavior therapy (DBT) \[[@CR20]\], and electroconvulsive therapy (ECT) \[[@CR21], [@CR22]\] have all been found to be effective for preventing suicide. In addition, research also suggests that repeated suicide attempts can be significantly reduced or prevented by rather short psychotherapeutic interventions \[[@CR23]\]. Despite promising results \[[@CR19], [@CR24]\], further research into suicide as an outcome is warranted to draw firm conclusions concerning the impact of different interventions on the suicide rate \[[@CR1], [@CR5], [@CR25]\]. In particular, more studies are needed on treatments that combine psychotropic medication and psychotherapy to refine treatment recommendations for suicidal behavior \[[@CR26]\]. Hence, the necessary requirements for successful interventions for patients with suicidal behavior or suicidal ideation are not yet fully understood \[[@CR27]\].
Furthermore, lifetime suicide risk has been suggested to be hierarchical, meaning that psychiatric inpatients have the highest risk of suicide, while the risk is lower in psychiatric outpatients, and even lower in individuals with no history of contact with psychiatric services \[[@CR9]\]. Suicide risk is also higher shortly after the onset of psychiatric illness and among recently hospitalized psychiatric patients with suicidal ideation or a history of suicide attempts \[[@CR9], [@CR28]\]. Additionally, patients admitted to psychiatric inpatient care are at higher risk of suicide shortly after admission, during hospitalization, during periods of authorized hospital leave, and at discharge, with the suicide risk remaining elevated up to 12 months post-discharge \[[@CR29]--[@CR31]\]. In relation to this, a study by Appleby et al. showed that a reduction in care efforts during the 12 months prior to suicide was observed significantly more often for suicide victims than for controls \[[@CR32]\]. The suicide cases more often had reduced outpatient appointment frequencies, less supervision, and lower drug doses than the controls, with the authors finding strong associations between each of these three factors and completed suicide. These findings have also been confirmed in more recent research \[[@CR33]\]. Hence, maintained and regular contact with psychiatric services and the avoidance of abrupt cessation of mental health care appear to lower the risk of suicide \[[@CR5]\]. In addition, frequent follow-ups or outreach, especially after missed mental health visits, have been shown to reduce repeated suicide attempts \[[@CR24]\].
In summary, research shows that suicidal behavior can be prevented through the application of appropriate medical, psychotherapeutic, or psychosocial interventions, and that reduced health care consumption is associated with suicide. However, important limitations of the previous research are that the above-mentioned factors were largely examined separately, rather than in combination, and the studies did not use control groups drawn from patients with the same diagnoses. To determine whether these different factors are independently associated with suicide, investigation of multiple associated factors is needed using data from suicide cases and adequately matched control subjects.
The overarching aim of the current study was to examine whether completed suicide in psychiatric patients in a Swedish population was associated with the quantity and nature of previous medical and psychosocial treatment interventions, with this being accomplished by comparing cases of suicide with matched control psychiatric patients.
The study tested the following two hypotheses: *Controls have a higher frequency of psychiatric outpatient visits than suicide cases.Controls have a higher occurrence of psychosocial treatment interventions than suicide cases.*
Method {#Sec2}
======
Study design {#Sec3}
------------
This study used a retrospective psychiatry-based case-control design. Data from the period 1 January 2007 to 31 December 2013 were obtained from the Swedish National Cause of Death Registry \[[@CR3]\], psychiatric and medical records, and the statistics of the Swedish total population \[[@CR34]\].
Study setting {#Sec4}
-------------
The study catchment area (Örebro County) covers a population of 285,395, with a mix of urban and rural areas. In 2013, the region had suicide rates of 21.7 suicides per 100,000 male inhabitants and nine suicides per 100,000 female inhabitants. These rates were higher than the Swedish national rates for both males (16.2 per 100,000) and females (7.5 per 100,000) during the same period \[[@CR35]\]. The specialist psychiatric unit belongs to a general university hospital with 918 beds, of which 136 are part of the psychiatric care unit. In 2013, the psychiatric units offered 40,020 days of inpatient psychiatric care and 131,137 outpatient department visits. Persons outside specialist psychiatry with visits only to community services outside of health care, or those at private clinics, are not included in this study.
Sample and participant selection {#Sec5}
--------------------------------
### Suicide cases {#Sec51}
Suicide cases were identified using the Swedish National Cause of Death Registry. According to the registry, during the period 1 January 2007 to 31 December 2013, a total of 339 individuals (69.3% men) from Örebro County died secondary to suicide (codes X60--X84) or undetermined intent (codes Y10--Y34) classified in accordance with the International Statistical Classification of Diseases and Related Health Problems, 10th Revision (ICD-10) \[[@CR35]\]. The national identification numbers of these individuals were used to search the electronic psychiatric medical records of the University Hospital of Örebro. This revealed that 154 (45.4%) of these 339 individuals had received psychiatric care at this regional centre during the 2 years prior to their death. These 154 individuals (65.6% men) were therefore included in the present study as suicide cases. Cases classified as uncertain suicides were also included, as their exclusion may have led to an underestimation of the suicide rate. The national statistics on causes of death include cases of uncertain cause of death as possible suicides, as analyses indicate that the majority of uncertain cases are probable suicides \[[@CR3], [@CR36]\]. In the subsequent text, the term suicide refers to both definite suicide and uncertain suicide.
#### Controls {#FPar2}
The 154 control subjects were identified through the electronic psychiatric medical records of the University Hospital of Örebro during the matching procedure (see next section).
#### Case-control matching procedure {#FPar3}
A hospital statistician outside the research team personnel matched the suicide cases with control subjects on the basis of the following: 1) a history of contact with psychiatric services in the year that the suicide case died, 2) age, 3) sex, and 4) primary psychiatric diagnosis. For the primary psychiatric diagnosis, consistency was required in terms of the first two or three digits of the respective ICD-10 code (e.g., F32.2 or F32). When applicable, efforts were made to control for a comorbid diagnosis of psychoactive substance use disorder (F10-F19), as comorbid substance use disorders increase the risk for suicide \[[@CR37], [@CR38]\]. For suicide cases below the age of 25 years, a control of similar age (± 2 years) was sought. In older suicide cases, controls with a maximum age difference of 2 years were primarily sought; however, a maximum age difference of 10 years was accepted.
A total of 113 (73.4%) suicide case-matched control pairs met the stringent primary diagnosis matching criteria (e.g., F32.2). Twenty-five (16.2%) pairs were matched on the basis of two digits (e.g., F32), and two (1.3%) pairs were matched on the basis of a diagnostic cluster (e.g., Mood disorders F30--F39). Thirteen suicide cases (8.5%) lacked a primary psychiatric diagnosis. Of these, 12 were matched with controls without psychiatric diagnoses, while a control with a primary diagnosis of depression was selected as the optimal match for the remaining case (0.6%). A total of 15 suicide cases had a comorbid diagnosis of psychoactive substance use (F10--F19). Of these, nine were matched to a control with a similar comorbidity.
For suicide cases younger than 25 years, 16 | {
"pile_set_name": "PubMed Central"
} |
By 2030, 72.1 million people in the USA will be 65 years or older and will represent 20% of the US population, expanding the need for speech-language pathology services while increasing costs ([@b1-ijt-09-25]). Not only are demographics changing, but people are also experiencing extended work days reducing the capacity to commit to in-person services ([@b5-ijt-09-25]; [@b12-ijt-09-25]). Equitable access to services continues to challenge current service delivery models as evidenced by ongoing difficulties with recruitment and retention of speech-language pathologists in rural and remote areas and by servicing bilingual populations with qualified speech-language pathologists ([@b5-ijt-09-25]; [@b12-ijt-09-25]). Furthermore, many individuals with communication disorders also have co-occurring physical disabilities that prohibit access to in-person services.
Telepractice may offer a solution by providing convenient and cost effective access to speech-language pathology (SLP) services at a distance. While the advantages of telepractice are obvious in terms of reducing costs and improving access, another benefit of telepractice is found with the provision of services to clients in their functional environments, which is considered best practices in many areas of rehabilitation ([@b11-ijt-09-25]) and is supported by the World Health Organization (WHO) intervention framework ([@b13-ijt-09-25]). Telepractice has the potential to improve client outcomes by targeting the functional environment, sustaining services, facilitating self-management, and reducing costs.
A 2002 survey conducted by the America Speech-Language-Hearing Association (ASHA) revealed that fewer than 21% of respondents had received training in telepractice methods ([@b2-ijt-09-25]). Of those who were trained, 47% reported receiving on-the-job training, 44% completed continuing education courses, and 19% were trained during graduate school. According to a national survey that evaluated the current state of telepractice training in graduate programs, only 26% of the reporting universities were providing academic and clinical training in telepractice ([@b9-ijt-09-25]). A more recent 2016 ASHA telepractice survey indicated that 58.5% of respondents received telepractice training by an employer, while only 6.9% of respondents had received telepractice training in graduate school ([@b3-ijt-09-25]). When comparing the results of all three surveys over a 14-year period from 2002 to 2016, there appear to be differing results related to receiving telepractice training in graduate school. Comparing the 2002 and 2016 ASHA surveys, there were more clinicians trained in telepractice methods in graduate school in 2002 than in 2016 ([@b2-ijt-09-25]; [@b3-ijt-09-25]). That goes against what is expected considering that telepractice is more prevalent now and widely accepted, then it was 14 years ago. Also, the 2015 graduate school survey ([@b9-ijt-09-25]), reported that 26% of graduate programs were providing telepractice training; however, only 6.9% of respondents reported receiving training in graduate school in the 2016 ASHA survey ([@b3-ijt-09-25]). It is anticipated that the number of graduate programs offering telepractice training will only increase as time advances. The differing results could have several explanations. One explanation may be that while 26% of graduate programs provided telepractice training, perhaps not all students received the training. A second explanation may be that the participants of the survey may have graduated from programs before telepractice training was offered. Regardless of the difference in results, it is clear that most clinicians do not receive telepractice training in graduate school. The majority of the training is occurring with employers.
The previous surveys provided information about demographics of clinicians and clients being served by telepractice, areas of service delivery, sources of training, and preparation for telepractice ([@b2-ijt-09-25], [@b3-ijt-09-25]; [@b9-ijt-09-25]). To design effective telepractice models with clients and to train SLP graduate students in telepractice methods, further information about telepractice was needed regarding costs, methodology differences between in-person and telepractice, types of learning opportunities offered, and manipulation of the client's environment from clinicians who are currently using telepractice as a service delivery model. A survey was created and administered targeting the need for further information. This article will describe the results of that survey.
METHODS
=======
DESCRIPTION OF THE SURVEY AND SAMPLING PROCEDURES
-------------------------------------------------
The survey consisted of seven sections, 66 questions, and was approved by West Chester University's Institutional Review Board. The seven sections were (1) demographics, (2) licensing and licensure regulations, (3) costs and equipment, (4) synchronous and asynchronous learning opportunities, (5) use of the client's environment and caregiver/e-helper interactions, (6) method adaptations, and (7) overall impressions of telepractice. A majority of the questions required a response from a selection of multiple choice options. Some of the questions were answered with either Yes or No. There were some open-ended response options where participants could provide comments. For the multiple choice questions, participants could select more than one response when it was appropriate to do so.
To ensure that experienced telepractice practitioners participated in the survey, the survey was sent to ASHA Special Interest Group (SIG) 18 affiliates through the Community Discussion Board as a web-based Qualtrics survey link. In addition, the same Qualtrics survey link was emailed to participants who attended the Waldo County General Hospital Speech-Language Pathology Telepractice Training program in Maine, USA. The survey was open and accepting responses over the summer of 2016. After respondents offered their informed consent to participate in the survey, they were directed to the first question of the survey. If respondents did not offer their informed consent to participate, then the survey ended. There were 67 participants; 59 SLPs and four audiologists. Sixty-two of the 67 respondents were providing telepractice services at the time of survey. The following results section will be organized by the seven overall sections within the survey.
RESULTS
=======
PROFILE OF THE PARTICIPANTS BY DEMOGRAPHICS
-------------------------------------------
The majority of respondents were servicing clients via telepractice from the ages of 6--17 years. Interestingly, all ages were represented from under six months of age to above 75 years. Treatment was the most common service offered across 93% of the respondents. Supervision of graduate student clinicians and clinical fellows were reported by 15% and 12% of the respondents, respectively. Half of the respondents reported consulting with other professionals about clients without the client or caregiver present and half of the respondents indicated that telepractice was being used for follow up or monitoring of previously learned skills. Half of the respondents reported using a hybrid approach (i.e., both in-person and telepractice sessions) to service clients. Fifty-six percent of respondents reported using only telepractice to service clients. Reasons given for using a hybrid approach versus telepractice only were: requirements of the state, professional judgment based on initial interview and assessment, distance, computer skills, and parent/caregiver involvement. Only 22% of the respondents have denied a client from participating in telepractice services and 37% of the respondents had recommended a switch from telepractice sessions to in-person only sessions. Reasons given were: client skills were better served via in-person, comorbidity (i.e., blindness, deafness, limited mental capacity, and severe dysphagia, etc.) or behaviors which significantly compromised the ability to participate in the virtual environment, bias of some team members, poor support at home, bad internet connection, and feeding therapy. Forty-three percent of respondents indicated that clients were charged a cancellation rate if the client ended telepractice prematurely or missed a planned session. The amount varied from \$20 to half the original rate to the full rate.
Forty-three percent of the respondents were self-employed and 49% were employees of governmental agencies, public, private, and non-profit organizations. Sixty-nine percent of the participants indicated that they were using telepractice for their primary employment. For the respondents who were not using telepractice as part of their primary employment, 59% were self-employed. Schools (i.e., preschool, elementary, and secondary) were the most common facilities for serving clients via telepractice as indicated by 91% of respondents. The second most common was in the client's home as indicated by 56% of the respondents. Thirteen percent for international and 11% for special day/residential schools were third and fourth, respectively.
Related to Health Insurance Portability and Accountability Act ([@b10-ijt-09-25]) compliance, 84% reported using a platform that was promoted as HIPAA compliant, 48% indicated that the client signs a permission form to allow telepractice, 56% had written policies and procedures related to HIPAA, and 58% used HIPAA policies established by the employer. Participants indicated the security measures that were in place to ensure no breaches in confidentiality. Sixty-five percent used unique passwords, 62% used encryption, 60% used a secure connection via virtual private network, 53% used unique meeting numbers, and 50% used hardware/software firewalls.
PROFILE OF THE PARTICIPANTS BY LICENSING AND LICENSURE REGULATIONS
------------------------------------------------------------------
The respondents reported on the number of state licenses that they maintained: one state (39%), two states (28%), three states (17%), and four or more (15%). Thirty-four percent of respondents reported that they were restricted from doing telepractice due to state licensure regulations, whereas 46% indicated that they were | {
"pile_set_name": "PubMed Central"
} |
Introduction {#sec1}
============
Autoinflammatory syndromes are an incompletely understood spectrum of diseases that involve spontaneous inflammation caused by genetic variants of the innate immune system. Unlike autoimmune diseases, no high-titer autoantibodies are associated with the disease process. We report a case of autoinflammatory skin and bone disease that flared within 1 month of replacing alendronate with teriparatide therapy. Teriparatide, a recombinant form of parathyroid hormone (PTH), is used for the treatment of osteoporosis and may be prescribed for dermatology patients requiring long-term prednisone therapy. Bisphosphonates such as alendronate are used to treat osteoporosis and autoinflammatory disease; they possess anti-inflammatory properties and the ability to remodel bone. We hypothesize that replacing alendronate with teriparatide triggered this disease flare through stimulatory effects on inflammatory cytokines, specifically interleukin (IL)-1 and recommend caution when choosing a drug to treat osteoporosis in patients with autoinflammatory skin and bone disorders.
Case report {#sec2}
===========
A man in his 60s with a 10-year history of pustulosis, pyoderma gangrenosum, dissecting cellulitis, and erosive arthropathy initially presented to our clinic with widespread exudative ulcerations, pustules, vegetative crusted plaques, and keloidal scarring primarily on the back, upper chest, face, head, and neck.
Pertinent laboratory test results included a normal white blood cell (WBC) count, normal calcium level, and a negative rheumatoid factor. Erythrocyte sedimentation rate was elevated at 52 mm/h (normal range \[NR\], 0--19 mm/h), and alkaline phosphatase level was elevated at 197 U/L (NR, 45--129 U/L). Wound culture grew 1+ methicillin-susceptible *Staphylococcus aureus*, sensitive to trimethoprim-sulfamethoxazole, which offered little improvement. Adalimumab was initiated, and after mild improvement, dapsone and later cyclosporine were added. His condition continued to worsen; thus, high-dose prednisone along with alendronate therapy for osteoporosis was initiated. After marked improvement of skin and joints, adalimumab and trimethoprim-sulfamethoxazole were continued, prednisone was tapered to 5 mg daily, and cyclosporine and dapsone were gradually discontinued. The patient\'s condition remained well controlled for more than 1 year.
On follow-up bone densitometry, baseline osteopenia of the proximal femur and early osteoporosis of the lumbar spine and femoral neck remained unchanged. Based on these findings and endocrinology consultation, alendronate was replaced with teriparatide. Within 1 month of starting teriparatide, the patient\'s joint complaints abruptly flared, and widespread ulcerations and crusted plaques recurred on the scalp, neck, and trunk ([Fig 1](#fig1){ref-type="fig"}).
Complaints of eye, knee, and hand pain ensued. Conjunctival redness, knee swelling, and bilateral finger swelling ([Fig 2](#fig2){ref-type="fig"}) were noted on physical examination. Although the patient remained afebrile, his WBC count increased to 24,500 (NR, 4.5--11) with 87% neutrophils (NR, 40%--75%). Calcium level increased to 10.8 mg/dL (NR, 8.7--10.4 mg/dL), and alkaline phosphatase level remained elevated at 209 U/L. No previous WBCs, including those drawn during high-dose prednisone therapy, had been this elevated, and all previous calcium levels had been in the normal range. Wound cultures grew rare *Proteus*, rare β-hemolytic group G *Streptococcus*, and 1+ methicillin-susceptible *S aureus*, again sensitive to trimethoprim-sulfamethoxazole.
Teriparatide was promptly discontinued, alendronate restarted, and prednisone increased. Adalimumab and trimethoprim-sulfamethoxazole regimens were continued. After minimal improvement and based on its success in treating other autoinflammatory conditions, anakinra, 100 mg subcutaneous daily, was substituted for the adalimumab. After 30 days of anakinra therapy, the patient\'s skin lesions showed marked improvement with no new ulcerations or pustules. Despite insurance denial of further anakinra and adalimumab, the patient\'s condition steadily improved allowing for tapering of prednisone. At 9-month follow-up his disease was well controlled on prednisone, 5 mg daily.
Discussion {#sec3}
==========
Autoinflammatory disorders involving skin and joints are a spectrum of disease. They include the following syndromes: pyogenic sterile arthritis, pyoderma gangrenosum, and acne (PAPA); synovitis, acne, pustulosis, hyperostosis, and osteitis (SAPHO); aseptic multifocal osteomyelitis, periostitis, and pustulosis, seen in deficiency of interleukin-1 receptor antagonist (DIRA); and pyoderma gangrenosum, acne, and suppurative hidradenitis (PASH).[@bib1], [@bib2], [@bib3] Our patient\'s widespread pustulosis, pyoderma gangrenosum, dissecting cellulitis, erosive arthropathy, and response to anti-inflammatory agents indicate his condition exists on the spectrum of these related syndromes.
Overproduction of IL-1β was found to occur in PAPA syndrome and is a major therapeutic target of the disorder.[@bib1] Anakinra, an IL-1 receptor antagonist, has proven successful in controlling flares of PAPA and deficiency of interleukin-1 receptor antagonist and improving symptoms in pyoderma gangrenosum, acne, and suppurative hidradenitis and SAPHO,[@bib1], [@bib2], [@bib3] implying a major etiologic role of IL-1β in these disorders. Nitrogenous bisphosphonates have been effective in treating bone involvement in the autoinflammatory syndromes of SAPHO, chronic recurrent multifocal osteomyelitis, and diffuse sclerosing osteomyelitis of the mandible.[@bib4], [@bib5], [@bib6] Patients treated with bisphosphonates for these diseases have shown improvements ranging from decreased pain levels to reduction of lesions on bone imaging.[@bib4], [@bib5], [@bib6] The beneficial effects of bisphosphonates may be attributed to bone remodeling and anti-inflammatory properties, specifically lowering secretions of IL-1β, IL-6, and tumor necrosis factor-α.[@bib4]
Teriparatide, an anabolic agent, is a recombinant form of PTH given intermittently to increase number and activity of osteoblasts, ultimately improving bone mass and skeletal architecture.[@bib7] In contrast to bisphosphonates, which lower inflammatory cytokine production, studies have found that PTH increases IL-1 and IL-6 production and acts synergistically with IL-1 to promote bone resorption.[@bib8], [@bib9] We postulate that the initiation of teriparatide concurrent with discontinuation of alendronate flared our patient\'s autoinflammatory disease possibly owing to net stimulatory effects on cytokine production, specifically IL-1. The patient\'s hypercalcemia concurrent with this flare provides evidence of a teriparatide effect, as transiently elevated calcium levels are commonly reported during treatment.[@bib10] Anakinra, an IL-1 receptor antagonist, was successful in improving and inducing remission of our patient\'s disorder, supporting a key role of IL-1 in our patient\'s condition.
Although infection might precipitate flares of autoinflammatory syndromes, no new significant pathogens grew on skin culture during our patient\'s flare. He remained afebrile on chronic trimethoprim-sulfamethoxazole therapy.
Here we report a change in osteoporosis management contemporaneously linked to an acute flare of an autoinflammatory disorder. Teriparatide is known to promote and work synergistically with IL-1; thus, it is reasonable to believe its use combined with the removal of alendronate\'s anti-inflammatory properties may have led to an increased inflammatory state; we thus recommend caution when choosing a drug to treat osteoporosis in patients with autoinflammatory skin and bone disorders.
Funding sources: None.
Conflicts of interest: None declared.
{#fig1}
{#fig2}
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
In paediatric palliative care (PPC), most seriously ill children are predominantly cared for at home \[[@CR18], [@CR31], [@CR43]\]. Therefore, parents of a child with a life-limiting disease (LLD) are confronted with increased caregiving demands, and also have to cope with the inevitability of a premature death of their child \[[@CR12]\]. The spectrum of LLDs requiring palliative care during childhood is broad and heterogeneous. LLDs are generally divided into four categories (Table [1](#Tab1){ref-type="table"}) \[[@CR1]\]. The duration of PPC and the needs of these children vary widely among the categories.Table 1Categories of life-limiting diseases \[[@CR1]\]CategoryDescriptionExamplesCategory 1Life-threatening conditions for which curative treatment may be feasible but can fail. Where access to palliative care services may be necessary when treatment fails or during acute crisis, irrespective of the duration of that threat to lifeCancer; irreversible organ failure of heart, liver or kidneyCategory 2Conditions where premature death is inevitable, where there may be long periods of intensive treatment aimed at prolonging life and allowing participation in normal childhood activitiesCystic fibrosis; muscular dystrophyCategory 3Progressive conditions without curative treatment options, in which treatment is exclusively palliative and may commonly extend over many yearsBatten's disease; mucopolysaccharidosesCategory 4Irreversible but non-progressive conditions causing severe disability, leading to susceptibility to health complications, and likelihood of premature deathSevere cerebral palsy; multiple disabilities such as following brain or spinal cord injury
Because PPC is a relatively young specialty, current knowledge on parental caregiving mainly relies on studies in chronically ill children, not facing life-limiting issues of their disease and in children treated for cancer. It shows that the parenting role intensifies and expands beyond routine physical care \[[@CR21], [@CR33], [@CR38], [@CR44], [@CR48]\]. This expanded parenting role includes nursing, technical and emotional tasks, such as providing childcare, learning about the disease and its treatment options, managing their child's disease, organising all aspects of their child's daily life and care and managing their own particular situation \[[@CR4], [@CR11], [@CR12], [@CR21], [@CR39], [@CR44], [@CR47], [@CR48]\].
Studies on parental caregiving in PPC are mainly performed in paediatric oncology and focus on the end-of-life (EOL). Besides the expansion of caregiving tasks, these studies show that parents have to deal with uncertainty and to adapt to an accumulation of losses related to their child's physical and functional decline \[[@CR6], [@CR14], [@CR26]\]. Although parents intend to act in their child's best interest, including a good death, many of them struggle with facing reality and the timely transition from preserving their child at all costs towards being prepared to let their child die \[[@CR2], [@CR10], [@CR14], [@CR16], [@CR23]\]. Moreover, parents emphasise they have to 'navigate uncharted territory' and lack professional guidance, resulting in feelings of isolation and abandonment \[[@CR15], [@CR37]\]. A recent review on chronic care situations in children showed the discrepancy between the parental learning needs and the information provided by healthcare professionals (HCPs), stressing the necessity to elicit the parents' perspectives and to take the families' complete situation into account \[[@CR30]\].
Paediatric illnesses or injuries affect many children and parents because they are often brought into healthcare settings under adverse and often life-threatening circumstances \[[@CR20], [@CR32]\]. These circumstances concern potentially traumatic medical experiences that might lead to stress responses \[[@CR20]\]. As such, parenting a seriously ill child is often approached from the perspective of stress \[[@CR38], [@CR48]\], as is represented in the paediatric medical traumatic stress model \[[@CR20], [@CR32]\]. In PPC, parental caregiving is also considered distressing and potentially traumatic for parents \[[@CR25], [@CR32], [@CR36]\], since living towards a child's death understandably causes disruption and grief \[[@CR12]\]. Studies indicate that parents of children with a LLD, who perceive a high risk of life threat and complications, are at increased risk of post-traumatic stress disorder (PTSD) \[[@CR19], [@CR32]\]. While HCPs cannot protect parents from such risks, they should however try to strengthen the parents' resilience and prevent distress as much as possible \[[@CR12], [@CR34], [@CR35]\]. This starts with an understanding of parental caregiving from the parents' perspective. In addition, since driven by technical and medical improvements PPC may last over many years, a clear understanding of the content of parental caregiving in PPC from the parents' perspective becomes increasingly important. Therefore, the aim of this article is to provide a generic and comprehensive overview of parental caregiving, based on the lived experience of parents caring for a child with a LLD.
Methods {#Sec2}
=======
To elucidate the parents' perspective, we conducted an interpretative qualitative interview study using an inductive thematic analysis \[[@CR3], [@CR8], [@CR40]\]. This study was part of a larger study to evaluate a pilot with a paediatric palliative care team (PPCT; Box 1). The focus of this article is to provide insight into parental caregiving in PPC from the parents' perspective. The role of the PPCT from the parents' perspective will be described in a separate article.Box 1 Description of the paediatric palliative care team (PPCT)In June 2012, the first Dutch PPCT was initiated as a 3-year pilot project at the Emma Children's Hospital in Amsterdam. The multidisciplinary PPCT consists of five specialised paediatric nurses trained and experienced in PPC, two child life specialists, a psychologist, a social worker and a chaplain. Additionally, two paediatric oncologists and two paediatricians are committed for regular consultation. The PPCT is responsible for the coordination, continuity and quality of PPC, irrespective of the child's place of residence. They strive to avoid acute demands for support by a proactive attitude. The support provided by the PPCT is continuous throughout the disease trajectory, including a 24-h availability and bereavement care. The PPCT bridges the gaps between home and hospital and navigates parents through the complex care processes by regular contact through phone calls, e-mails, and personal visits at home and during hospitalisations. In addition, the PPCT strengthens regular care at home by educating and coaching the other healthcare professionals involved. If regular care fails, the PPCT is competent and qualified to take over the care by providing temporary nursing care at home. For the possibility to discuss patients, maximum exchange of palliative care knowledge and optimal deployment and collaboration between team members, the PPCT has weekly multidisciplinary conferences.
Sample {#Sec3}
------
A purposive sample of Dutch-speaking parents of children with a LLD primarily residing at home who were referred to the PPCT from a Dutch university children's hospital (Emma Children's Hospital, Amsterdam) was included. Referral to the PPCT ensured a general agreement among HCPs that PPC was indicated and thus provided access to families of children with a variety of diseases, who could maximally inform us about parental caregiving in PPC \[[@CR28]\]. To capture a wide range of perspectives, variation in selected children was sought with respect to malignant (MD) and non-malignant diagnoses (NMD) and phase of the disease trajectory that increases the need for PPC: the palliative trajectory. Based on literature, four phases of the palliative trajectory were distinguished: diagnostic phase, phase of loss of normality (adjusting to new normality), phase of decline and the dying phase \[[@CR15], [@CR45]\]. Parents of 35 cases were identified as eligible. A member of the PPCT or the treating physician introduced this study to the parents and asked permission for the researchers to contact them. In six identified cases, the introducing HCP considered the parents' situation too vulnerable to inform them about the study. Parents of 29 children were invited by telephone to participate by the researchers. In five cases, parents refused participation. Reasons for refusal were as follows: no time (*n* = 2), too burdensome (*n* = 2) and unknown reason (*n* = 1). In total, 24 mothers and 18 fathers of 24 children were interviewed. For patient characteristics, see Table [2](#Tab2){ref-type="table"}. In three cases, parents (*n* = 6) were intentionally approached to participate after the child's death, and in three cases, a second interview after the child's death was performed with five parents to gain deeper insight into parental caregiving during the end-of-life and dying phase.Table 2Characteristics of the parents (*n* = 42) and their ill child (*n* = 24)CharacteristicsNumber (*N*)Percentages (%)Gender parent Male1843 Female2457Age of parent^a^ \<3025 30--402973 \>40923Marital stage Married/cohabiting3890 Divorced/not cohabiting410Education Low^b^512 Middle^c^1536 High^d^2252Age of child at first interview 0--11^e^4^e^ 1--513^f^54^f^ 5--12729 12--1628 ≥1614Child gender Male1250 Female1250Child diagnosis Non-malignant disease (total)1563 Congenital anomalies1146 Neurodegenerative disease28 Metabolic disease28 Malignant disease (total)938 Central nervous system tumour521 | {
"pile_set_name": "PubMed Central"
} |
Many cancer cells are addicted to driver oncogenes or to cancer-selective survival factors, and their proliferation and survival is highly dependent on oncogenic signaling pathways.[@b1],[@b2] Therefore, molecularly targeted drugs that selectively inhibit these pathways are critically important for the pharmacological treatment of advanced cancer.[@b3] Presently, various inhibitors of oncogenic kinase pathways are available for the clinical treatment of cancer, such as inhibitors of oncogenic tyrosine kinases (for example, EGFR, HER2, BCR-ABL, and ALK), the RAF/MEK/ERK pathway, the PI3K/AKT/mTOR pathway, and multikinases.[@b4] However, after treatment with each agent, cancer cells soon acquire drug-resistant phenotypes by several mechanisms including gatekeeper mutations in the target kinases and bypassing of signaling pathways.[@b5],[@b6] To improve treatment outcomes, additional next-generation inhibitors that possess better activity or overcome drug resistance to the primary agent should be further developed.
Target validation of agents is critically important for the development of new compounds as clinical antitumor agents. In the initial stages of drug development, high-throughput screens are usually carried out based on enzyme inhibition assays. As a result, candidate agents that have the potential to inhibit target enzymes are screened out. In some cases, however, the agents are found to affect additional target molecules in cancer cells and cause unexpected cytotoxicity during drug development or in clinical trials,[@b7],[@b8] which may mislead the selection of proper cancer subtypes for the agents and cause delay or failure in clinical trials. To ensure rational targeted therapy, target validation of compounds should be carried out with multiple reliable and unbiased methods.
Genome-wide gene expression analysis is an unbiased method to evaluate the mode of action of chemical compounds.[@b9] We previously analyzed gene expression data of cancer cells that were mainly treated with classical antitumor agents, including DNA topoisomerase inhibitors, anti-metabolites, and tubulin-binding agents. We showed that the gene signature data reflected the modes of action of the respective agents.[@b10] However, it is still not clear whether this signature-based analysis could widely be applied to classify the target pathways of molecularly targeted agents in cancer. To address these questions, in this study, we comprehensively obtained and analyzed gene expression data of cancer cells treated with 83 anticancer drugs or related agents covering most clinical (small molecule) anticancer drugs, such as oncogenic receptor tyrosine kinase inhibitors and other kinase inhibitors as well as inhibitors of promising molecular cancer targets. Our data indicated that this gene expression-based analysis efficiently classified the oncogenic kinase inhibitors as well as other classes of agents in a target pathway-dependent manner. Our data provide a platform to evaluate molecular pathways or primary cellular targets of compounds for further development of antitumor agents.
Materials and Methods
=====================
Cell lines and compounds
------------------------
Human colon cancer HT-29 cells, ovarian cancer SKOV3 cells, leukemia K562 cells, and prostate cancer PC3 cells were obtained and cultured as described previously.[@b10]--[@b12] Human lung cancer H2228 cells were obtained from ATCC (Manassas, VA, USA). Human lung cancer PC-9 cells were a kind gift from Dr. Kazuto Nishio (Department of Genome Biology, Kinki University Faculty of Medicine, Osaka, Japan).[@b13] These cells were cultured in RPMI-1640 medium supplemented with 10% heat-inactivated FBS and 100 μg/mL kanamycin. The anticancer drugs or compounds used in our analysis are listed in Table[1](#tbl1){ref-type="table"}. The agents were obtained as described in [Table S1](#sd2){ref-type="supplementary-material"}. Stock solutions of the compounds were prepared using dimethyl sulfoxide as a solvent or as described previously.[@b10] We examined the growth inhibitory effect of each agent ([Fig. S1](#sd1){ref-type="supplementary-material"}) and determined the GI~50~ values ([Table S1](#sd2){ref-type="supplementary-material"}). Growth inhibition assays were carried out and the GI~50~ values for each agent was determined as described previously.[@b10]
######
Cancer cell line--anticancer drug combinations used in this study
Cell Compound Criteria Target/Mode of action
-------------------------------------------------- ------------------------------------------------- ----------------------------------------------- -----------------------
K562 Imatinib BCR-ABL inhibitor BCR-ABL/KIT
Dasatinib BCR-ABL inhibitor BCR-ABL/Src
Nilotinib BCR-ABL inhibitor BCR-ABL
Bosutinib BCR-ABL inhibitor BCR-ABL/Src
Ponatinib BCR-ABL inhibitor BCR-ABL (T315I)
SN-38 DNA damaging agent Topoisomerase I
Doxorubicin DNA damaging agent DNA intercalator/Topoisomoerase II
PC-9 Gefitinib EGFR/HER2 inhibitor EGFR
Erlotinib EGFR/HER2 inhibitor EGFR
Afatinib EGFR/HER2 inhibitor EGFR/HER2
Trametinib RAF/MEK/ERK inhibitor MEK
SN-38 DNA damaging agent Topoisomerase I
Doxorubicin DNA damaging agent DNA intercalator/Topoisomerase II
H2228 Crizotinib ALK inhibitor ALK
Alectinib ALK inhibitor ALK
SN38 DNA damaging agent Topoisomerase I
Doxorubicin DNA damaging agent DNA intercalator/Topoisomerase II
SKOV3 Lapatinib EGFR/HER2 inhibtor EGFR/HER2
SN-38 DNA damaging agent Topoisomerase I
Doxorubicin DNA damaging agent DNA intercalator/Topoisomerase II
HT-29 Vemurafenib RAF/MEK/ERK inhibitor BRAF (V600E)
Dabrafenib RAF/MEK/ERK inhibitor BRAF (V600E)
Trametinib RAF/MEK/ERK inhibitor MEK
U-0126 RAF/MEK/ERK inhibitor MEK
Everolimus[†](#tf1-1){ref-type="table-fn"} PI3K/AKT/mTOR inhibitor mTOR
Temsirolimus[†](#tf1-1){ref-type="table-fn"} PI3K/AKT/mTOR inhibitor mTOR
PP242[†](#tf1-1){ref-type="table-fn"} PI3K/AKT/mTOR inhibitor mTOR
BKM120 PI3K/AKT/mTOR inhibitor PI3K
BEZ235 PI3K/AKT/mTOR inhibitor PI3K/mTOR
AKT Inhibitor VIII PI3K/AKT/mTOR inhibitor AKT 1/2
Regorafenib Multikinase inhibitor VEGFR, RAF, KIT, RET etc
Sorafenib Multikinase inhibitor VEGFR, RAF etc
Pazopanib Multikinase inhibitor VEGFR, PDGFR,, KIT, FGFR etc
Sunitinib Multikinase inhibitor VEGFR, PDGFR, KIT etc
Cabozantinib Multikinase inhibitor VEGFR, MET,RET,KIT,FLT1/3/4 etc
Vandetanib Multikinase inhibitor VEGFR, EGFR etc
Axitinib Multikinase inhibitor VEGFR, KIT, PDGFR etc
Gefitinib EGFR/HER2 inhibitor EGFR
Erlotinib EGFR/HER2 inhibitor EGFR
Afatinib EGFR/HER2 inhibitor EGFR/HER2
Lapatinib EGFR/HER2 inhibitor EGFR/HER2
Crizotinib ALK inhibitor ALK
Alectinib ALK inhibitor ALK
SU11274 MET inhibitor MET
AG1024 IGFR inhibitor IGF1R
PDGFR inhibitor V PDGFR inhibitor PDGFR
Dasatinib BCR-ABL/Src inhibitor BCR-ABL/Src
CDK4 inhibitor Cell cycle inhibitor CDK4
NU6102 Cell cycle inhibitor CDK1/Cyclin B
ATM/ATR kinase inhibitor DNA damage check point inhibitor ATM,ATR
SB218078 DNA damage check | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
The cellular and molecular mechanisms that underlie protein misfolding are a matter of major concern for studies conducted in several scientific centers all over the world. Under denaturing conditions, a growing number of proteins and peptides that fail to fold properly into their native structure, are led to the formation of highly ordered, insoluble aggregates, the so-called amyloid fibrils \[[@pone.0173163.ref001]\]. Amyloidogenicity, the ability of proteins to self-assemble into these well-defined fibrillar structures, was initially associated with a group of functionally unrelated proteins \[[@pone.0173163.ref002]\]. Meanwhile, targeted *in vitro* experiments revealed that amyloid formation is a universal phenomenon for polypeptide chains \[[@pone.0173163.ref003]\] and thus, this concept was the onset of a new era in protein misfolding, since a great number of novel amyloidogenic proteins and peptides were uncovered \[[@pone.0173163.ref004]\]. Noteworthy, proteins, ranging from bacteria to humans, have been also found to adopt the same amyloid architecture, as part of their nature \[[@pone.0173163.ref005], [@pone.0173163.ref006]\]. A vast amount of data, regarding amyloid fibril formation, present both in pathological and physiological conditions, is currently organized into freely available databases \[[@pone.0173163.ref007]--[@pone.0173163.ref011]\].
Amyloid fibril formation is widely observed and directly linked to the pathology of a range of widespread human diseases, known as amyloidoses \[[@pone.0173163.ref002]\]. Amyloidoses are a group of aggregation-disorders, where full-length amyloidogenic proteins or fragments of larger amyloidogenic protein precursors, precipitate and deposit, forming amyloid plaques and resulting in organ or tissue dysfunction \[[@pone.0173163.ref012], [@pone.0173163.ref013]\]. Literature data indicate the implication of more than one amyloidogenic proteins in the evolution of different amyloidoses. In the case of Senile Systemic Amyloidosis, co-operation of several Apolipoproteins and ATTR is recorded \[[@pone.0173163.ref014], [@pone.0173163.ref015]\], whereas in Alzheimer's disease, apart from Aβ, proteinaceous components such as ACys, ATTR and AGel were found \[[@pone.0173163.ref016]\]. To date, the extent to which co-deposition in amyloid plaques has impacted the development of amyloidoses between putative unrelated amyloidogenic proteins, remains unclear.
Experimental work over the past ten years has revealed an intriguing, synergistic phenomenon between amyloidogenic proteins \[[@pone.0173163.ref017]\]. *In vitro* experiments highlighted the capacity of Aβ peptide under specific conditions to seed the polymerization process for α-synuclein \[[@pone.0173163.ref018]\], Tau \[[@pone.0173163.ref019]\] or APrp protein \[[@pone.0173163.ref020]\]. Similar experiments were performed on several well-characterized amyloidogenic proteins \[[@pone.0173163.ref021]--[@pone.0173163.ref023]\]. Further to *in vitro* assays, animal models demonstrated the co-deposition of Aβ and Tau proteins \[[@pone.0173163.ref024]\] or APrp protein \[[@pone.0173163.ref020]\] in transgenic models. However, a hidden perspective emerges from this molecular association; amyloid "cross-seeding" could explain mechanistically the way by which misfolded proteins co-deposite, and propose possible, attractive candidates for the development of novel therapeutic strategies of aggregation-related diseases. An apt example towards this direction is the protective role of the amyloidogenic ACys in neurodegenerative diseases \[[@pone.0173163.ref025]\].
The interactomes \[[@pone.0173163.ref026], [@pone.0173163.ref027]\], a systems biology approach, were viable complements to proteomics, in an attempt to look at "the big picture" of protein-protein interactions (PPIs). Gaining a proper understanding of PPIs contributed to several problems in the field of biological and medical research \[[@pone.0173163.ref028]--[@pone.0173163.ref030]\] and served as a reference for further targeted experimentation \[[@pone.0173163.ref031]\]. Systematic PPI studies are essential, in order to fully comprehend the molecular mechanisms that trigger human diseases \[[@pone.0173163.ref032], [@pone.0173163.ref033]\]. However, a subject poorly explored so far is deviating PPIs associated with amyloidogenic/amyloid forming proteins. To date, only a few studies utilized a protein interaction network framework, to obtain information regarding the Alzheimer's \[[@pone.0173163.ref034]--[@pone.0173163.ref036]\] or Huntington's disease \[[@pone.0173163.ref037]\] and to construct the Amyloid precursor protein interactome \[[@pone.0173163.ref038]--[@pone.0173163.ref040]\].
Incomplete knowledge on direct and/or indirect interactions of proteins "prone-to-misfold", emphasizes the need to focus on the amyloid protein-protein interaction network. Here we introduce the amyloid interactome, a systematic approach to study "macroscopically" interactions between previously unrelated human amyloidogenic proteins, associated with distinct pathologies. Our ultimate goal was to find a common denominator for amyloid formation, unveil the relationships that govern amyloidogenicity and, subsequently, guide further experimental studies on protein misfolding.
Materials and methods {#sec002}
=====================
Amyloid classification {#sec003}
----------------------
In order to classify amyloidogenic proteins, all protein-precursors were sorted into three categories:
- *in vivo* amyloid forming protein: the precursor protein, or a peptide segment--derived from the precursor protein--, self assembles into typical amyloid fibrils, affecting one or more tissues or organs in human. These proteins, from a clinical perspective, give rise to distinct amyloidoses or play a pathological role in neurodegenerative or endocrine diseases \[[@pone.0173163.ref002]\].
- *in vitro* amyloid forming protein: the precursor protein, or commonly a peptide segment--derived from the precursor protein--, that was reported to self assemble into amyloid-like fibrils, at experimental level. The amyloidogenicity of proteins comprising this list may be speculative. Only human precursor proteins are mentioned in this category.
- protein related to amyloid fibril formation: the protein is associated with other *in vivo* amyloid forming proteins, but has no amyloid properties recorded.
Amyloid interactome datasets {#sec004}
----------------------------
Amyloidogenic proteins were firstly obtained from a literature-curated dataset, peer-reviewed in 2014, by the International Society of Amyloidosis (<http://www.amyloidosis.nl/>). This list included human proteins known to self-assemble into typical amyloid fibrils *in vivo*, along with intracellular inclusions with known biochemical composition \[[@pone.0173163.ref002]\]. In addition to this, the set was enriched with proteins that form amyloid fibrils *in vitro* \[[@pone.0173163.ref041]\]. To expand this dataset, AmyLoad \[[@pone.0173163.ref007]\] was used as a source of supplementary proteins, characterized to form amyloid-like fibrils *in vitro* at experimental level. A final addition included several UniProtKB \[[@pone.0173163.ref042]\] entries, gathered elaborately to incorporate reviewed proteins related to amyloid fibrils. Overall, the dataset contained 145 non-redundant amyloidogenic protein precursors. [S1 Table](#pone.0173163.s005){ref-type="supplementary-material"} provides a detailed catalogue of the aforementioned proteins, mapped to a UniProtKB Accession Number (AC).
The subsequent construction of the network incorporated only well-characterized *in vivo* amyloidogenic proteins, published by Sipe et al. \[[@pone.0173163.ref002]\], excluding Enfurvitide an anti-retroviral peptide drug \[[@pone.0173163.ref043]\], as well as Immunoglobulin Light and Heavy Chains. In the case of Immunoglobulin chains (e.g. Bence Jones proteins \[[@pone.0173163.ref044]\]), their variety in human population did not allow the identification of a unique protein precursor, related to amyloid fibril formation. The final seed-dataset included 28 proteins, related to *in vivo* amyloid fibril formation ([Table 1](#pone.0173163.t001){ref-type="table"}), which were subsequently used for the collection of protein-protein interactions. Protein nomenclature follows abbreviations established by Sipe et al. \[[@pone.0173163.ref002]\].
10.1371/journal.pone.0173163.t001
###### The dataset of 28 proteins related to in vivo amyloid fibril formation.
{#pone.0173163.t001g}
Protein Precursor Name[\*](#t001fn001){ref-type="table-fn"} Abbreviation UniProtKB AC
------------------------------------------------------------- -------------- --------------
Amyloid beta A4 protein Aβ P05067
Apolipoprotein A-I AApoAI P02647
Apolipoprotein A-II AApoAII P02652
Apolipoprotein A-IV AApoAIV P06727
Beta-2-microglobulin Aβ2M P61769
Calcitonin ACal P01258
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Aerosol delivery of therapeutic gene is made directly to the respiratory tract without first delivery to other organs and tissues. Due to these advantages, many studies have been applied to gene therapy for lung disease, such as lung cancer ([@B1]), asthma ([@B2]) and chronic obstructive pulmonary disease ([@B3]) using aerosol delivery. Aerosol therapeutic delivery system consists of aerosol generator, delivery-chamber, drug-carrier and air flow controller.
The gene carriers are broadly classified into two groups: viral and non-viral vector systems. Non-viral gene carriers were attracted increasingly because of their many advantages such as low immunogenicity, large-scale production and safety ([@B4]). Chitosan, a natural polysaccharide, is safe, biocompatible and mucoadhesive materials with high cationic charge potential ([@B5]). However, this material has low transfection efficiency as a result of weak release from endosomes into the cytoplasm ([@B6]).
In our previous study, we have overcome this problem by grafting with the polyethylenimine (PEI) (CHI-*g*-PEI) ([@B7]). However, pulmonary toxicity and gene expression by *in-vivo*aerosol gene delivery have not been investigated yet. Therefore, in the current study, we present information from both gene expression and pulmonary toxicity in the lung through our aerosol gene delivery system and CHI-*g*-PEI as an aerosol gene carrier.
Experimental
============
*Materials*
Chitosan (molecular weight, 100 kDa; deacetylation degree, 87.7%) was kindly supplied from Jakwang (Ansung, Korea). Branched PEI 25K was obtained from Sigma-Aldrich (St. Louis, MO, USA). Branched PEI 1800 Da was purchased from Wako (Osaka, Japan). pcDNA3.1-GFP was purchased from Invitrogen (Carlsbad, CA, USA). The plasmids were propagated in *E. coli*, extracted by the alkalilysis technique, and purified by QIAGEN kit (Chatsworth, CA, USA).
*Aerosol gene delivery system*
The nose-only exposure chamber (NOEC) system consists of dual cylindrical box and 4 small tubes ([Figure 1](#F1){ref-type="fig"}).
{#F1}
Conical acrylic tubes were connected to the main chamber and mice (male C57BL/6, 8\~10 wks old, SLC, Hamaguchi, Japan) were placed in the tubes. All animal experiments were performed in accordance with the guidelines of Seoul National University for the care and use of animals. Nebulizer (Dusturbo, Seoul, Korea)-generated aerosols were entered into the NOEC. Operation of the aerosol generation process by nebulizer was as follows: air flow rate was 2 L/min (*lpm*) by a mass flow controller (MFC, Brooks Instruments, Hatfield, PA, USA) and the complex was composed of plasmid DNA; 200 μg and polymer (PEI 25K; 260 μg, N/P ratio of 10 and CHI-g-PEI; 1,400 μg, N/P ratio of 35) was added to 20 mL deionized water. Aerosol size distributions were measured with a dust monitor (Grimm Aerosol Technik, Germany). Size distribution measurements were taken in the NOEC.
*Transfection efficiency*
To determine the efficiency of gene transfection, animals were exposed to aerosol containing GFP-PEI and GFP-Chi-*g*-PEI complex for 30 min in NOEC system. Animals were sacrificed 48 h after the inhalation and routinely fixed lungs were cryosectioned for confocal laser scanning microscopy (CLSM, Carl Zeiss-LSM510, Germany). CLSM images were quantified and analyzed by a computerized system (Media Cyber-netics, Silver Spring, MD, USA).
*Pulmonary toxicity analysis*
For the assessment of pulmonary toxicity of CHI-*g*-PEI and PEI, mice were exposed to aerosols, two times in a week for a total of 4 weeks. The control group was exposed to air filtered by a high-efficiency particulate air (HEPA) filter and polymer groups were exposed to aerosol containing PEI; 260 μg and CHI-g-PEI; 1,400 μg without DNA in distilled water, respectively. At the end of exposure, bronchioalveolar lavage (BAL) fluid from mice was obtained by whole-lung lavage. As a marker of cellular damage, lactate acid dehydrogenase (LDH) activity in BAL fluid was measured using an automated biochemical analyzer (VITALAB, Merck, the Netherlands).
*Histopathological examination*
For histopathological analysis, lungs were removed from each animal. The organs were immersion-fixed in 10% neutral buffered formalin. After routine tissue processing, the tissues were embedded in paraffin and the tissue sections (5 μm) were then prepared for hematoxylin and eosin (H&E) and Periodic acid-Schiff (PAS) stain. The slides were evaluated under light microscopy.
*Statistical analysis*
All results are expressed as mean ± standard error. A multiple variance of a Student's t-test (Graphpad Software, San Diego, CA, USA) was used to compare the test groups with those obtained from unexposed control group. The level of significance was set at p \< 0.05 and p \< 0.01.
Results and Discussion
======================
In this study, we investigated the gene expression and pulmonary toxicity of CHI-*g*-PEI as aerosol gene carrier. We found that CHI-*g*-PEI is safe to use and shows higher transfection than PEI in aerosol gene delivery to animals, and enhanced efficiency was achieved using our aerosol gene delivery system.
*Aerosols characterization*
Geometric Mean Diameter (GMD) of nebulized aerosols in N-OEC measurements was as follows: GFP-PEI; 0.39 and GFP-CHI-*g*-PEI complex; 0.42 μm, respectively. Geometric Standard Deviation (GSD) was 2.46 and 2.26, respectively. Our study demonstrated that GMD results obtained from GFP-PEI were not different from those of GFP-CHI-*g*-PEI. However, the horizontal chamber is easy to handle and has a space saving in the aerosol delivery system. The mean diameters of generated aerosols over 1 μm are known to be increased with solute concentration of the solution ([@B8]); however, the solute concentration of generated aerosols under 1 μm size can be different from that of solution in the nebulizer reservoir ([@B9]). Measured size distributions showed that large portion of generated droplets are smaller than 1 μm, so the efficiency of trasfections might be different for each case.
*Transfection efficiency*
As shown in [Figure 2(a)](#F2){ref-type="fig"}, compared with the control group, the green intensity of GFP was dominant in the polymer group (PEI and CHI-*g*-PEI). In addition, the CHI-g-PEI group showed 15.65% enhancement of the fluorescence intensity as compared to the PEI group ([Figure 2b](#F2){ref-type="fig"}). It was already reported that polyethylenimine-graft-chitosan (PEI-g-chitosan) showed higher gene expression than PEI (25 K) in liver due to the higher level of amine content in the DNA-carrier complex ([@B10]). Furthermore, gene expressions by PEI are affected by the serum ([@B11], [@B12]), whereas, chitosan increased the transfection efficiency with serum ([@B13]). The gene expression of low molecular weight polyethylenimine grafted N-maleated chitosan (NMC-g-PEI) was not affected in the presence of serum ([@B12]). In a previous study, we also observed higher transfection efficiencies with CHI-*g*-PEI compared to PEI in the presence of serum ([@B7]). Taken together, these results indicate that CHI-*g*-PEI with serum in the lung enhances the efficiency of the aerosol gene delivery.
{#F2}
*Pulmonary toxicity*
Our results showed that LDH levels in BAL were higher in the PEI group compared to the CHI-*g*-PEI group ([Figure 3](#F3){ref-type="fig"}). H and E analysis of the CHI-*g*-PEI and PEI groups showed no detectable change compared to the control group ([Figure 4](#F4){ref-type="fig"}). However, the results of our present experiment stained PAS showed that CHI-g-PEI was secreted small amount of mucin compared to the PEI ([Figure 5](#F5){ref-type="fig"}). Mucin has high molecular weight and is produced by epithelial tissues and they protect our body from toxicants by forming the mucosal barrier ([@B14]). Moreover, mucin secretion indicated that repeated inhalation of PEI could induce cellular immune responses in the lung. Complexes of PEI with mucin break the PEI/DNA interactions and it probably reduces the gene expression in the lung ([@ | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
It was reported that fetal mortality rate at 20 weeks of gestation or more was 6.22 deaths per 1,000 in United States, in which the fetal mortality rate for twins was 2.7 times higher compared to singletons [@pone.0065050-MacDorman1]. The higher risk of twin pregnancies may due to several reasons, for instance, twin--twin transfusion syndrome (TTTS) [@pone.0065050-Simpson1]. There are more than 4,500 TTTS cases per year in the U.S. [@pone.0065050-1]. Moreover, a significantly increasing risk has been observed in monozygotic (MZ) twins in previous studies [@pone.0065050-Glinianaia1]. Therefore, zygosity is an important parameter in prenatal diagnosis for twin pregnancies.
The diagnosis of zygosity for twin pregnancies relies on the determination of chorionicity by ultrasound scanning within 14 gestational weeks, with 89.8% sensitivity and 99.5% specificity [@pone.0065050-Stenhouse1]--[@pone.0065050-NationalGuideline1]. However, the accuracy of ultrasound detection declines dramatically due to thinner chorionicity in the second trimester [@pone.0065050-Lee1]. Invasive approaches such as amniocentesis or cord blood sampling combined with microsatellite DNA markers could also detect zygosity with high accuracies, but it presents a potential miscarriage at a risk of 0.5--1% [@pone.0065050-Kan1]. Thus there is a huge demand for a noninvasive method to accurately determine the zygosity type without the limitation of gestational age. The discovery of cell-free fetal DNA (cff-DNA) in maternal plasma opened a new direction for noninvasive prenatal diagnosis [@pone.0065050-Lo1]. Combined with the rapidly developing massively parallel sequencing(MPS) technology, Qu *et al.* recently observed the fluctuation of cff-DNA concentration among autosomes between dizygotic (DZ) and MZ twin pregnancies. The SD variation of the fluctuation from 8 samples was regarded as the indication to determine the zygosity [@pone.0065050-Qu1]. However, the method lacked evaluation of sensitivity and specificity.
Herein, we developed a noninvasive method based on maternal plasma target region sequencing to determine zygosity of twin pregnancies. We successfully determined two DZ, MZ twin pregnancies and two simulated MZ twin pregnancies through our mathematical model and obtained satisfactory sensitivity and specificity *in silico*. Our study provides a practical alternative approach for zygosity determination in clinical practice.
Results {#s2}
=======
Bioinformatic Pipeline Establishment {#s2a}
------------------------------------
In order to determine the zygosity, we employed a bioinformatic method using a conditional probability model. We defined ***L~i~*** to measure the zygosity tendency of each available paternal-only heterozygous SNP locus (where maternal genotype was homozygous), and ***L*** value which was the geometric mean of ***L~i~*** to represent the global tendency. The zygosity could be determined if its ***L*** value passed its corresponding cut-off.
In order to get the cut-offs, we generated simulated samples with different gradients of cff-DNA concentration from 10.00% to 30.00% and sequence depth from 300× to 1300×, and got a series of real cut-offs (***L~R~***) with the boundaries of \>95% confidence interval (CI) (**[Table S1](#pone.0065050.s003){ref-type="supplementary-material"}**). Based on these scattered ***L~R~***, we used least squared method (LSM) to obtain two approximate mathematical expressions of DZ and MZ dynamic cut-offs respectively (**Materials and Methods**).
After getting the fitting expressions, we established a comprehensive pipeline, which included sequence reads alignment, parental genotype detection, total cff-DNA concentration estimation, calculation of ***L*** among clinical samples and zygosity determination by comparing ***L*** to its corresponding dynamic cut-off. Six clinical samples were recruited to assess the accuracy of our methodology. Finally, we used more simulated samples to depict the sensitivity and specificity of our methodology under various detecting conditions *in silico*.
Clinical Samples and Data Productions {#s2b}
-------------------------------------
Four twin pregnancies named Sample1, 2, 5 and 6 were enrolled from Women's Hospital School of Medicine Zhejiang University and Peking University Third Hospital, whose gestational ages were 20^+2^ and 19^+4^, 20 and 20^+4^ weeks, respectively. We also enrolled two singletons named Sample3 and Sample4 with gestational age of 19 and 8 weeks from Women's Hospital School of Medicine Zhejiang University and BGI-Shenzhen. Sample1 and Sample2 had already been diagnosed as DZ by invasive procedure aminocyte karyotyping suggesting mixed-gender twin pregnancies. Sample5 and Sample6 were diagnosed as MZ by ultrasound scanning.
4.43 Gbp and 11.47 Gbp clean data were extracted from maternal plasma Sample1 and Sample2, corresponding with 930.87× and 1363.25×sequence depth. 95.81% and 97.51% of target region was covered by at least one read. For maternal plasma Sample3 and Sample4, 4.53 Gbp and 2.55 Gbp clean data were extracted respectively. The sequence depth was 519.34× and 446.89×, and the corresponding coverage of target region was 95.36% and 96.88%. For Sample5 and Sample6, we obtained 16.26 Gbp and 15.59 Gbp clean data, corresponding to 492.3× and 271.2× sequence depth, 99.85% and 98.68% of target region depth ([**Table 1**](#pone-0065050-t001){ref-type="table"}).
10.1371/journal.pone.0065050.t001
###### Data production of 6 clinical samples.
{#pone-0065050-t001-1}
Sample Production(Gbp) Coverage(%)[\*](#nt101){ref-type="table-fn"} Depth(×)[\*](#nt101){ref-type="table-fn"}
---------------- ----------------- ---------------------------------------------- -------------------------------------------
Father Sample1 0.41 98.18 219.63
Mother Sample1 0.37 96.01 192.54
Father Sample2 0.46 98.22 228.93
Mother Sample2 0.51 96.29 268.76
Plasma Sample1 4.43 95.81 930.87
Plasma Sample2 11.47 97.51 1363.25
Father Sample3 0.33 95.06 130.30
Mother Sample3 0.38 95.37 146.03
Father Sample4 0.10 92.59 51.47
Mother Sample4 0.37 94.18 185.33
Plasma Sample3 3.16 95.36 519.34
Plasma Sample4 2.55 96.88 446.89
Father Sample5 2.05 99.64 97.36
Mother Sample5 1.51 98.12 76.80
Father Sample6 2.25 99.60 106.58
Mother Sample6 1.26 97.98 64.27
Plasma Sample5 16.26 99.85 492.30
Plasma Sample6 15.59 98.68 271.20
"Coverage (%)" and "Depth (×)" mean the coverage and average sequencing depth in the target region.
Estimation of Total cff-DNA Concentration and Zygosity Determination {#s2c}
--------------------------------------------------------------------
Genotypes of parental genomes were analyzed by SOAPsnp [@pone.0065050-Li1], and only parental-specific homozygous loci in the form of ♀AA♂BB were selected. Then the sequence reads from those loci were used to estimate the total cff-DNA concentration. We obtained 1,209, 1,057, 1,090 and 986, 1,150 and 1,241 parental-specific homozygous loci from Sample1-6 respectively. And the total cff-DNA concentrations of Sample1-6 were estimated at 27.04%, 22.12%, 23.35%, 9.36%, 18.83% and 25.16%, respectively.
According to our mathematical model, paternal-only heterozygous loci in the form of ♀AA♂AB were used to calculate ***L*** values. 708 and 603 loci were available for Sample1 and Sample2 to obtain 1.891 and 1.554 of ***L*** values, which were both above their corresponding DZ cut-offs (\>1.162 and \>1.172 for DZ, while \<0.938 and \<0.928 for MZ), indicating both samples were DZ ([**Figure 1a**](#pone-0065050-g001){ref-type="fig"}). ***L*** values of Sample3 and Sample4 were calculated as 0.639 and 0.757 through 564 and 610 available loci respectively, which were | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper.
Introduction {#sec001}
============
Acetaminophen-induced toxicity, like many other drugs, may have a great deal of variations at the molecular, cellular, tissue, organ and organism levels \[[@pone.0145965.ref001]--[@pone.0145965.ref002]\]. Metabolic alterations and increased oxidative stress is considered to be the key aspects of hepatotoxicity and apoptotic as well as necrotic cell death by acetaminophen (APAP) \[[@pone.0145965.ref003]--[@pone.0145965.ref005]\]. The initial events in APAP-induced toxic injury lead to the activation of a secondary innate immune response by up regulation of proinflammatory cytokines and inflammasome \[[@pone.0145965.ref006]--[@pone.0145965.ref007]\]. Thus, alterations in the microenvironment by macrophages and their chemical communication and coordination with tissues play a major role in the progression and prevention of drug-induced toxicities and tissue repair. The precise molecular mechanism of APAP cytotoxicity however, is still controversial \[[@pone.0145965.ref008]--[@pone.0145965.ref009]\]. Reports suggest glutathione (GSH) depletion, oxidative stress and mitochondrial dysfunction in APAP-induced toxicity \[[@pone.0145965.ref003],[@pone.0145965.ref010]--[@pone.0145965.ref011]\].The general consensus in APAP-induced toxicity is that the drug is mainly metabolized by various cytochrome P450s such as CYP2E1, CYP3A4, CYP1A2 and CYP1A1 to its active metabolite, mainly N-acetyl-p-benzoquinone imine (NAPQI) \[[@pone.0145965.ref012]--[@pone.0145965.ref013]\] which conjugates with GSH causing depletion of cellular GSH pools and increase in oxidative stress. Studies have suggested that APAP toxicity exhibited a biphasic response in which the metabolism of APAP is responsible for initial toxicity followed by mitochondrial dysfunctions \[[@pone.0145965.ref009],[@pone.0145965.ref014]--[@pone.0145965.ref019]\]. The selective inhibition of proinflammatory signaling and induction of autophagy which removes damaged mitochondria, attenuates APAP-induced liver toxicity \[[@pone.0145965.ref007], [@pone.0145965.ref018], [@pone.0145965.ref020]--[@pone.0145965.ref021]\].
Both cytotoxic and cytoprotective effects of macrophages have been reported in APAP-induced toxicity \[[@pone.0145965.ref019], [@pone.0145965.ref022]--[@pone.0145965.ref023]\]. Our previous study on J774.2 macrophages demonstrated that APAP induces cytotoxicity and apoptosis by increasing ROS production, depletion of GSH pool, increase in oxidative stress and mitochondrial dysfunction \[[@pone.0145965.ref024]--[@pone.0145965.ref025]\]. Using macrophages and HepG2 cells as in vitro models, we have recently reported that aspirin treatment also induces oxidative stress and mitochondrial dysfunction, albeit at different levels \[[@pone.0145965.ref026]--[@pone.0145965.ref029]\].
Induction of cellular resistance has also been reported after APAP treatment. Several studies suggest that APAP treatment may also develop resistance towards drug toxicity by altering multidrug resistance protein, JNK-dependent signaling, autophagy in cells under in vitro conditions and in vivo in mice \[[@pone.0145965.ref020], [@pone.0145965.ref030]--[@pone.0145965.ref031]\]. There are multiple metabolic factors which determine the APAP-induced initial or long term cytotoxicity, which may or may not be dependent upon GSH depletion, metabolic activation and detoxification of the drug by the enzymes. However, APAP toxicity in vivo and in vitro has been correlated with CYP450s enzymes, particularly with CYP2E1 and CYP3A4 which metabolizes APAP to its toxic metabolites \[[@pone.0145965.ref013], [@pone.0145965.ref032]\] and could be blocked by CYP2E1 modulators such diallyl sulfide (DAS), a major garlic constituent, and antioxidants such as N-acetylcysteine \[[@pone.0145965.ref017],[@pone.0145965.ref033]--[@pone.0145965.ref034]\].The objective of the present study was to elucidate the molecular mechanisms of differential toxicity of APAP in HepG2 cells and macrophages and the protection of cytotoxicity by DAS. The main focus of our study is to highlight the role of drug metabolizing enzymes, glutathione metabolism, oxidative stress and mitochondrial function in APAP induced cytotoxicity and cytoprotection by DAS.
Materials and Methods {#sec002}
=====================
Reagents {#sec003}
--------
N-Acetyl-p-aminophenol (acetaminophen, APAP), diallyl sulfide (DAS), 5,5'-dithio bis-2-nitrobenzoic acid (DTNB), NADPH, glutathione reductase, 1-chloro 2,4-dinitrobenzene (CDNB), oxidized glutathione (GSSG) and reduced glutathione (GSH), N-ethyl malleimide (NEM), ethacrynic acid, 4-hydroxynonenal (4-HNE), cumene hydroperoxide, dimethylnitrosamine (DMNA), erythromycin, Coenzyme Q2, succinate, cytochrome c, ethoxyresorufin and methoxyresorufin and ATP bioluminescent assay kit were purchased from Sigma-Aldrich Fine Chemicals (St Louis, MO, USA). Apoptosis detection kit for flow cytometry was from BD Pharmingen (BD Biosciences, San Jose, USA) and comet assay kits were procured from Cell Biolabs, Inc. (San Diego, CA, USA). Kits for mitochondrial membrane potential were purchased from R&D Systems, (MN, USA). 2', 7'-dichlorofluorescein diacetate (DCFDA) was purchased from Molecular Probe (Eugene,OR,USA). Aconitase assay kit was procured from Oxis International Inc. (Portland, OR, USA). HepG2 cells were purchased from American Type Culture Collection (Manassas, VA, USA) and murine macrophage J774.2 cells were purchased from European Collection of cell cultures (Health Protection Agency Culture Collections, Salisbury, UK). Antibodies against microsomal GST and GST A4-4 were generous gifts from Prof. Ralf Morgenstern, Karolina Institute, Stockholm, Sweden and Prof. Bengt Mannervic, Uppsala University, Uppsala, Sweden, respectively. Polyclonal antibodies against CYP1A1, CYP1A2, CYP2E1 and CYP3A4 were purchased from Amersham Int. Plc. (Amersham, UK) and GSTpi specific isoenzyme from Biotrin (Dublin, Ireland). MDR1and β-actin antibodies were procured from Santa Cruz Biotechnology, Inc, (CA, USA). Reagents for cell culture and for SDS-PAGE and Western blot analyses were purchased from Gibco BRL (Grand Island, NY, USA) and from Bio Rad Laboratories (Richmond, CA, USA) respectively.
Cell Culture, Treatment and Fractionation {#sec004}
-----------------------------------------
Macrophage J774.2 cells and HepG2 cells were grown in poly-L-lysine coated 75 cm^2^ flasks (\~2.0--2.5 x10^6^ cells/ml) in DMEM medium supplemented with 10% heat inactivated fetal bovine serum in the presence of 5% CO~2~-95% air at 37°C. Cells were treated with APAP (10 μmol/ml) for 18 hours after treatment with or without 200 μM DAS for 24 h. After the desired time of treatment, cells were harvested, washed with PBS (pH 7.4) and homogenized in H-medium buffer (70 mM sucrose, 220 mM mannitol, 2.5 mM HEPES, 2 mM EDTA, and 0.1 mM phenylmethylsulfonylfluoride, pH7.4) at 4°C. Mitochondria and postmitochondrial (PMS) fractions were prepared by centrifugation and the purity of the isolated fractions for cross contamination was checked as described before \[[@pone.0145965.ref024]--[@pone.0145965.ref028]\]. Control cells were treated with vehicle alone. The choice of time and doses were based on our previous publications and literatures using acetaminophen in these cell lines as well as MTT viability test \[[@pone.0145965.ref024]--[@pone.0145965.ref028]\].
DNA Fragmentation, Apoptosis, ROS Assays {#sec005}
----------------------------------------
### DNA fragmentation {#sec006}
DNA fragmentation was assayed by UV transillumination after staining the electrophoretically (by 1.5% agarose gel) separated fragments with 0.5 μg/ml ethidium bromide as described before \[[@pone.0145965.ref024]--[@pone.0145965.ref028]\].
### Comet assay {#sec007}
Cellular DNA damage was assessed using the single cell gel electrophoresis or comet assay according to the vendor's protocol. Briefly, following treatment, cells were washed in cold PBS, centrifuged and resuspended at 1x10^5^ cells/ml in cold PBS. An aliquot of the resuspended cells was combined with low melting point agarose at 1:10 ratio, mixed and this cell suspension transferred to 3-well glass slides, ensuring complete well coverage and kept in the dark for 15 min at 4°C. Slides were then incubated for 1h at 4°C in lysis buffer. Following lysis, the | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
Illegal, unreported, and unregulated (IUU) fishing undermine efforts to sustainably manage fish stocks and threaten fish populations worldwide \[[@pone.0143960.ref001]\]. Managers must know as much as possible about the extent, character (e.g., gear types, target/bycatch species, timing, location), and motivations of illegal fishing to effectively develop and implement regulations. However, quantifying illegal fishing is inherently difficult: it is generally covert and significant incentives exist for informants to withhold information \[[@pone.0143960.ref002]\]. Furthermore, budget and human resource constraints often restrict efforts to monitor illegal resource use, especially in developing countries \[[@pone.0143960.ref003]\]. There is a need to develop inexpensive yet informative methods for quantifying illegal fishing and its impacts.
Indirect observation, the use of signs of illegal activity as an indicator of non-compliance, has been commonly used to characterize illegal resource use in terrestrial systems \[[@pone.0143960.ref004]\], but has been infrequently used in marine systems \[[@pone.0143960.ref005]\], and to our knowledge, has never been used in freshwater systems. In marine systems, dynamite blast craters \[[@pone.0143960.ref006],[@pone.0143960.ref007]\] and derelict fishing gear \[[@pone.0143960.ref008]\] have been used as indicators of illegal fishing, but have generally failed to quantitatively measure non-compliance \[[@pone.0143960.ref005]\]. Most successful quantifications of illegal fishing compare the amount of derelict fishing gear inside and outside reserve boundaries \[[@pone.0143960.ref009]--[@pone.0143960.ref012]\], but such comparisons are of little use in places without reserves or where the areas outside reserves are undesirable to fishers. The full capacity for indirect observation to reveal rich and quantitative information about illegal fishing remains unexplored.
Indirect observation offers several advantages over other approaches for assessing illegal fishing. It does not require large amounts of labor, specialized equipment, or training and can be recorded during routine enforcement patrols or biological surveys \[[@pone.0143960.ref013]\]. Repeated surveys can reveal spatial and temporal patterns of non-compliance \[[@pone.0143960.ref008]--[@pone.0143960.ref010],[@pone.0143960.ref014]\] that can be compared to changes in fish communities to examine the effects of illegal fishing \[[@pone.0143960.ref015]\]. Although indirect observation generally cannot identify specific violators or motivations for non-compliance, they can contribute to a comprehensive understanding of non-compliance when combined with other methods, such as direct questioning \[[@pone.0143960.ref009]--[@pone.0143960.ref010]\].
In this study, we used a mixed-method approach to evaluate the extent, character, and motivations of illegal gillnet fishing in Lake Hovsgol National Park (LHNP), Mongolia and its impact on the lake's fish populations, especially that of the endangered endemic Hovsgol grayling (*Thymallus nigrescens*). Despite the closure of the park to gillnet fishing in 1992, illegal fishing is known to persist \[[@pone.0143960.ref016]--[@pone.0143960.ref017]\]. We used four complementary methods to describe this fishery and evaluate its impacts: (1) surveys for derelict fishing gear, an indirect indicator of fishing activity, to evaluate how much illegal fishing is occurring, where illegal fishing is occurring, and what gear is being used; (2) interviews with herders living within the park and park rangers to validate and contextualize the results of the surveys for derelict fishing gear; (3) biological monitoring to identify fish species vulnerable to gillnet fishing and evaluate changes in population abundance potentially caused by fishing; and (4) data-poor stock assessment methods to estimate the effort required to overexploit the Hovsgol grayling population.
Overall, we demonstrate the ability for a mixed-method approach to describe an illegal gillnet fishery and suggest that these methods could be used to effectively and inexpensively assess illegal fishing and its impacts in other protected areas.
Methods {#sec002}
=======
Study site {#sec003}
----------
Lake Hovsgol (51°05'50"N, 100°30'E) is located in the mountains of northern Mongolia at the southern edge of the Siberian taiga forest. It is the 19^th^ largest lake in the world by volume (480 km^3^) and has a maximum depth of 262 m and surface area of 2,760 km^2^ \[[@pone.0143960.ref018]\]. The lake was established as a National Park in 1992 and is mostly undeveloped. The majority of the resident population lives in two towns on the lakeshore: Hatgal (pop. 2,980) and Hankh (pop. 2,460; \[[@pone.0143960.ref019]\]). Tourist camps line the southwestern shore and herding families live intermittently along the lakeshore (**[Fig 1](#pone.0143960.g001){ref-type="fig"}**). Most of the park's \~35,000 annual visitors enter and remain in the southern portion of the park \[[@pone.0143960.ref020]\].
{#pone.0143960.g001}
Lake Hovsgol has ten fish species, the most abundant of which, the Hovsgol grayling (*Thymallus nigrescens*), is endemic to the lake and is listed as endangered on the Mongolian Red List due to climate change and illegal fishing \[[@pone.0143960.ref016]\]. Hovsgol grayling are more common in littoral areas than pelagic areas and are most abundant along the western shore \[[@pone.0143960.ref021]\]. A portion of the grayling population spawns in tributary streams in late spring while another portion spawns in the littoral in late summer \[[@pone.0143960.ref022]\]. The prevalence, fidelity, and success of these spawning strategies are unknown.
The sparse literature on Mongolian fisheries suggests that commercial fishing for Hovsgol grayling, lenok (*Brachymystax lenok*), roach (*Rutilus rutilus*), perch (*Perca fluviatilis*), and burbot (*Lota lota*) removed as much as 200--400 tons annually before the park was established (\[[@pone.0143960.ref023]\]; **[S1 Table](#pone.0143960.s001){ref-type="supplementary-material"}**). Despite the ban on gillnet fishing, active gillnets are often observed and grayling and lenok are frequently sold in Hatgal and along the southwestern shore road. Recreational hook-and-line fishing is legal within the park and is regulated through permits and season and bag limits. Subsistence fishing during the spring spawning migration, though officially illegal, is generally tolerated.
Surveys for derelict fishing gear {#sec004}
---------------------------------
We surveyed and collected derelict fishing gear at ten sites on the Lake Hovsgol shoreline in July 2013 and resurveyed six of these sites in July 2014 (**[Fig 1](#pone.0143960.g001){ref-type="fig"}**). Although fishing gear found in the 2013 surveys could represent several years of accumulation and even pre-date the ban on gillnet fishing, gear found in the 2014 resurveys must represent accumulation over the preceding year, since all gear was removed from these sites during the 2013 surveys. Sites were selected as part of a long-term fish monitoring study \[[@pone.0143960.ref021]\]; though non-random, they provide excellent spatial coverage and access to points and bays on all sides of the lake. In 2013, we censused 54.9 km of shoreline (10 sites, 13 transects, 0.4--8.5 km each, \~13% of total shoreline) for all anthropogenic debris, including derelict fishing gear, between the water and wrack lines \[[@pone.0143960.ref024]\]. In 2014, we recensused 31.9 km of the original transects (7 sites/transects, 1.3--8.3 km each) for derelict fishing gear only. Because transect widths were variable, we report linear (km^-1^) rather than areal (km^-2^) debris density. Derelict fishing gear was classified into the following gillnet categories: whole net, net fragment, float line, lead line, foam | {
"pile_set_name": "PubMed Central"
} |
Background
==========
The pendulum of scientific opinion often swings back and forth in the light of new data and hypotheses. 150 years ago Darwin\'s observations pushed opinion towards believing the universal tree of life (TOL) existed for the first time \[[@B1]\]. This view was pushed to an extreme 30 years ago as Woese pioneered the use of sequence data to build universal trees \[[@B2]\]. But the pendulum has begun to swing back the other way in the past decade, as a wealth of prokaryotic genomic data has demonstrated a higher than expected frequency of horizontal gene transfer (HGT).
Ford Doolittle and Eric Bapteste\'s arguments against the TOL hypothesis are quite compelling \[[@B3]\], and this view seems to be gaining support \[[@B4]\]. These authors argue that HGT is so rampant that tree-like representations of prokaryotic species contain too little information to capture evolutionary histories. Their work questions whether the metaphor of the TOL is inspired from a historical bias from the taxonomy of eukaryotes, and therefore should not be applied to prokaryotes. This is an important and worthwhile question to ask. Resolving the eukaryotic tree is a distinct problem because there is much less horizontal transfer and a much better preserved fossil record. The conclusion of Doolittle and Bapteste is not so much that the inability to build the tree is the problem, rather it is forcing the data into a tree that needs to be questioned, and in a pluralistic framework, avoided, since this model does not allow a precise description of the evolutionary processes.
The TOL and tree of cells (TOC) should be one and the same. However, the meaning of the former has become the trees we can build, and the latter has become the hypothetical tree we cannot build. This difference was recently discussed in \[[@B5]\]. The reason the TOC is truly a tree is simple and has been stated by many before us. Every extant cell on this planet is the daughter of a cell that came before it \[[@B6]\]. Prokaryotic cells divide by binary fission. Therefore there must truly be a TOC in the prokaryotic superkingdoms. Nobody seems to dispute this. If every daughter cell\'s membrane kept track of who its parent was, reconstructing the evolution of cell divisions would be a trivial task. But since there is no selective pressure for cells to do that, so we are left with a more difficult task.
Since the membranes do not keep track of heredity we chose a different representation of ancestry, the genome. The genetic material of the cell does keep track of its parents in some sense as there is selective pressure to ensure fidelity of replication. All of the issues the community is currently having with the TOL hypothesis stem from the simple fact that genomes are not a perfect representation of membrane history. Membrane heredity is a tree-like structure, but all of the recent work on the pervasiveness of HGT has shown that genome heredity is often more of a network than a tree. We are beginning to have enough technology to reconstruct genomic evolution, but we are only beginning to realize how vastly different that is from cellular evolution. However, even genomic evolution makes little sense without the light of cellular evolution.
Ernest Rutherford said, \"Physics is the only real science. The rest are just stamp collecting\". Some biologists have taken this as a challenge to create universal laws in biology on par with those in physics. This is a noble endeavor, and has produced many interesting results, but the goal should to be to collect stamps in a way that is justified by the laws. The promise of the TOL did just that. It was a collection of every living thing as well as the laws that organized that collection.
Instead of a consensus TOL emerging from the vast amount of genomic data available, the community was faced with the disappointment that very few genes are universally conserved. The universal sequence tree created from 31 concatenated proteins \[[@B7]\] has been criticized as \"the tree of 1%\" because the average prokaryote genome has about 3000 genes \[[@B8]\]. They argue that even if this gene set did produce a reliable tree it would only reflect a small portion of evolution, since this is such a tiny portion of the genome. The assumption that genomic histories were congruent with cellular histories hid the fact that much of the collection could not be explained by the TOL hypothesis. The community was lost in the woods without knowing it under tree monism.
We worry that the sound arguments against the TOL hypothesis will shift focus away from evolutionary histories. For instance Dagan *et al.*\[[@B9]\] have quantified rates of horizontal transfer for every gene family. This is a tour de force of quantifying a law in biology. However, they do not give examples of the rates for any specific family, or cite any example they found where a horizontal transfer played a role in speciation. They also say their results are independent of the vertical tree used as input, which we find worrying. The overall rates of HGT may not change, but we assume the rates for each family almost certainly would. Not worrying about that difference is getting lost in the woods to us because the real history of the stamp collection is lost in search of a concise law.
Here we argue for the need to be cautious about how far away from the TOL hypothesis we swing, as novel sources of data already bring into question the conclusions supported by genomics. The arguments against the TOL are centered on the idea that the modern synthesis of biology from 50 years ago was too eukaryote-centric. We hope to offer a perspective that will spare this current synthesis from being labeled too genome-centric 50 years from now. We are not arguing for tree monism. Instead we are attempting to demonstrate that the TOC becomes even more important under a pluralistic approach. Not all genes contribute equally to the cell, and we will demonstrate that vertical inheritance of function has a more pronounced signal than vertical inheritance of genetic material. Using only universal sequences to attempt to resolve the TOC is a narrowing strategy, and we will discuss alternative sources of data that may still shed light on this problem.
Results and Discussion
======================
The Great Tree of Cellular Function
-----------------------------------
The attempts at resolving the TOL using universal sequences only represent a small part of the history of genomes, but what portion of the history of cells does it represent? Genomic methods represent all genes equally. Subsequently, a gene that is only expressed under specific conditions can be just as useful as a housekeeping gene for building a species phylogeny if both are present across the same set of genomes. If we created a concatenated protein sequence, both proteins would be counted as equals proportional to their length despite vast differences in their actual abundance as proteins in the cell. Here lies the fundamental shortcoming of genomics; confusing the genome and the cell. If we wish to measure a gene\'s contribution to the cell there are many different metrics: essentiality, abundance of proteins, number of transcripts, and portion of total weight are just a few. Any of these will give dramatically different proportions than simply counting the copy number within the genome.
The abundance of many proteins present in *Escherichia coli\'s*cytoplasm has recently been calculated experimentally \[[@B10]\] as well as for the entire cell of *Leptospira interrogans*\[[@B11]\]. For the first time data are available to measure what portion of a prokaryotic cell each protein comprises. All of these numbers should be taken with a grain of salt due to experimental noise, but the trend is clear; the core proteins make up a larger portion of the cell than the genome. The data used to calculate these values are available as Additional files [1](#S1){ref-type="supplementary-material"} and [2](#S2){ref-type="supplementary-material"}. We argue abundance is a good proxy for evolutionary importance because there is a correlation between the abundance of a protein and the energy a cell invests into producing it. It has been demonstrated that highly expressed proteins have been optimized to use less energetically costly amino acids \[[@B12]\], and that highly abundant proteins are shorter on average \[[@B10]\]. The abundant proteins justify the use of a large portion of the cell\'s energy despite these optimizations, so they must be important. Proteins perform most of the functions in the cell. Comparing how many of the same functions two cells are doing at the same time is a good measure of similarity. The downside of abundance is it is dynamic during a single generation, while genomes are static. This makes direct comparison more difficult, but it still gives insight into the evolution of genomes. Our point is not that this data magically fixes all problems with the TOL hypothesis, but rather that many important details are left unresolved in our understanding of the big picture that still may come into focus.
Let us consider the so called \"tree of 1%\". The authors list 36 genes that are universal but claim that only 31 have not been horizontally transferred \[[@B7]\], although later analysis claims the number is actually 22 \[[@B13]\]. However, there are arguments that a TOL is still meaningful despite a large incongruence between individual gene trees \[[@B14]\], but a detailed argument against that view is presented in \[[@B4]\]. 34 of these genes are present in the *E. coli*data set that measures abundance for 1103 proteins. For this argument let us consider the universal set because in this case the HGTs appear to be displacements of genes that were already present. That is to say the function of these genes was vertically inherited despite HGTs of the genetic material. This brings up the point that there are two distinct forms of HGT that we need to consider that are currently not distinguished enough; functional innovations (relative to the recipient genome) and displacements.
For example, the histories of the 20 aminoacyl | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Neurosensory symptoms, such as tinnitus and dizziness, are frequently observed in elderly people and even more so in patients with dementia. Five-year and 10-year incidence rates of 18.0% and 12.7% were reported for tinnitus from the Blue Mountains Hearing Study and the Beaver Dam Epidemiology of Hearing Loss Study, respectively.[@b1-cia-13-1121],[@b2-cia-13-1121] Epidemiological studies have found an increase in the prevalence of tinnitus as a function of age.[@b3-cia-13-1121] Jahn et al reported 1-year prevalence rates for significant dizziness of 20% in persons older than 60 years, 30% in those older than 70 years, and 50% in those older than 80 years.[@b4-cia-13-1121] In elderly patients with dementia, we found prevalence rates between 13% and 52% for tinnitus and between 14.2% and 77.5% for dizziness in five clinical trials.[@b5-cia-13-1121]--[@b9-cia-13-1121] Age-related hearing loss is likely to account for higher rates of tinnitus in the elderly and may even contribute to cognitive decline and the development of Alzheimer's disease (AD) and other dementias.[@b10-cia-13-1121]--[@b13-cia-13-1121] In a case-control study of elderly patients with neurological disorders, those with dementia had a particularly high rate of falls (60% in 1 year), which may indicate a higher prevalence of dizziness and impaired equilibrium control.[@b14-cia-13-1121]
Given the high comorbidity of tinnitus and dizziness in dementia and the findings from earlier studies in which *Ginkgo biloba* extract EGb 761^®^ (Dr Willmar Schwabe GmbH & Co. KG, Karlsruhe, Germany) alleviated tinnitus and dizziness or vertigo,[@b15-cia-13-1121],[@b16-cia-13-1121] measures of tinnitus and dizziness were included in recent clinical trials of EGb 761^®^ in patients with dementia.
When considering why *G. biloba* extract EGb 761^®^ may alleviate tinnitus, dizziness, or vertigo in patients with dementia, the pathomechanisms underlying these symptoms should be taken into account. Neurons of the central vestibular and auditory systems, cochlear hair cells, and vestibular sensory cells have a high energy demand in order to maintain and continuously restore their transmembrane electrical potential. Impaired mitochondrial function and impaired perfusion are thought to contribute to both cochlear and vestibular dysfunction and sensory cell degeneration.[@b17-cia-13-1121] EGb 761^®^ improves inner ear and cerebral blood flow by decreasing blood viscosity; it also improves mitochondrial function and energy metabolism, which altogether may play a role in improving inner ear and brain function in elderly people with dementia who often have vascular disorders and compromised mitochondrial function.[@b18-cia-13-1121]--[@b20-cia-13-1121] The antiapoptotic and neuroprotective properties of EGb 761^®^ may inhibit aging-related loss of cochlear and vestibular sensory cells,[@b21-cia-13-1121]--[@b24-cia-13-1121] which may play a role in tinnitus and vertigo.[@b25-cia-13-1121],[@b26-cia-13-1121] Coping with the distress of tinnitus as well as compensating for vestibular dysfunction involves both learning and neuroplasticity. EGb 761^®^ enhances neuroplasticity, improves learning, and accelerates vestibular compensation.[@b18-cia-13-1121],[@b27-cia-13-1121],[@b28-cia-13-1121] Tinnitus is likely to cause distress and anxiety, while dizziness often causes unsteadiness and fear of falling. Due to anxiolytic effects and by attenuating the activation of the stress axis, EGb 761^®^ may decrease the distress in both conditions.[@b18-cia-13-1121],[@b29-cia-13-1121],[@b30-cia-13-1121] By improving the speed of information processing, it may improve gait and reduce unsteadiness.[@b18-cia-13-1121]
Here, we present a meta-analysis of the trials that used rating scales for the assessment of presence and severity of tinnitus and dizziness. The question addressed by this meta-analysis was whether, taking into account all available evidence, EGb 761^®^ treatment was superior to placebo in alleviating tinnitus or dizziness or both in patients with dementia who had one or both of these neurosensory symptoms at pre-treatment examination.
Materials and methods
=====================
In 2014, Gauthier and Schlaefke published a systematic review and meta-analysis of randomized, placebo-controlled, double-blind clinical trials of *G. biloba* extract EGb 761^®^ in patients with mild to moderate dementia (AD, vascular dementia \[VaD\], mixed dementia, ie, AD with cerebrovascular disease \[CVD\]).[@b31-cia-13-1121] The search strategy is described in detail in their original paper.[@b31-cia-13-1121] Our aim was to provide an update on studies until October 2017. We did not identify any further relevant studies. Briefly, PubMed, including and excluding MedLine (from beginning to October 2017), EMBASE (from January 2006 to October 2017), and PASCAL (from beginning to end of 2015, no further update of PASCAL existed beyond this date) were searched using the following search terms (with \* characterizing a wild-card, and the items AND and OR being used as Boolean functions): (ginkg\* OR gingk\*) AND clinical trial\[pt\] for PubMed including MedLine, ((ginkg\* OR gingk\*) NOT medline\[sb\]) AND (clinical\* OR trial OR randomized) for PubMed excluding Medline, (GINKGO OR GINGKO) AND (HUMAN/CT OR HOMME/CTFR) for PASCAL, and (ginkgo or gingko) AND CT=(CLINICAL TRIAL; CLINICAL STUDY; DOUBLE BLIND PROCEDURE) AND py\>2005 for EMBASE. The papers retrieved were assessed for eligibility by two scientists independently and trials were selected for the review, if 1) the diagnoses were established in accordance with generally accepted diagnostic criteria, 2) the treatment periods were at least 20 weeks, and 3) outcome measures covered at least two of the three conventional domains (cognition, global judgment, activities of daily living). For the current meta-analysis, we applied two additional inclusion criteria, requiring that 4) the presence and severity of tinnitus or dizziness or both were assessed and 5) assessment was done before the start and after the end of randomized treatment. Five of the seven trials included in the meta-analysis by Gauthier and Schlaefke met these additional criteria.[@b5-cia-13-1121]--[@b9-cia-13-1121] All trials were sponsored by Dr Willmar Schwabe GmbH & Co. KG, Karlsruhe, Germany. The risk of bias was low for all five trials, with Jadad scores of 3 and 5 ([Table 1](#t1-cia-13-1121){ref-type="table"}).[@b32-cia-13-1121]
In all five trials, 11-point box scales were used to assess the presence and severity of tinnitus and dizziness. The 11-point box scale is a type of visual analog scale (VAS) consisting of 11 adjacent boxes which contain ascending numbers from 0 to 10 and descriptors for the extremes only, thus providing a distinct number of possible responses in a single dimension. Such types of 11-point VASs are often used as measures for pain,[@b33-cia-13-1121],[@b34-cia-13-1121] and have also been found useful for the assessment of other unpleasant and distressing symptoms, such as dizziness[@b35-cia-13-1121] or tinnitus.[@b33-cia-13-1121],[@b36-cia-13-1121],[@b37-cia-13-1121] In the studies reviewed here, 11-point box scales for tinnitus and dizziness were administered with the extreme ends indicating "no tinnitus at all" (0) and "extremely severe tinnitus" (10) or "no dizziness at all" (0) and "extremely severe dizziness" (10).
One study enrolled patients exclusively with AD,[@b5-cia-13-1121] while all other studies also accepted patients with VaD or AD with CVD.[@b6-cia-13-1121]--[@b9-cia-13-1121] In one study, two different doses of EGb 761^®^ (240 mg or 120 mg) and placebo were compared;[@b5-cia-13-1121] however, the patients treated with 120 mg of EGb 761^®^ were excluded from the present meta-analysis. In all other studies, patients received either 240 mg of EGb 761^®^ or placebo.
For each study, EGb 761^®^ and placebo treatment were compared with regard to mean differences between baseline and end of treatment on both 11-point box scales for tinnitus and dizziness. These calculations, conducted with SAS version 9.3 | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
It was estimated that over 2.2 billion participants worldwide are at risk of iodine deficiency. Iodine deficiency remains a major public health problem \[[@CR1], [@CR2]\]. Understanding the role of risk factors is key to developing a clear and effective strategy for improving global health. In low-income countries relatively few risk factors such as micronutrient deficiency are responsible for a large percentage of and ill health \[[@CR3]\]. The mandatory use of iodized salt reduces or eliminates iodine deficiency \[[@CR3]\]. In South Sudan according to Gaffar and Mahafuz, in a 2005 survey, households consuming iodized salt had increased from 40 to 73% \[[@CR4]\]. Although the International Council for Control of iodine deficiency disorders (ICCID) indicates that South Sudan, Sudan and Ethiopia have only 35% or less households with access to iodized salt, neighboring Kenya and Uganda records 90% and more \[[@CR3], [@CR5]--[@CR7]\]. However, high goiters prevalence persist in these high coverage iodized salt intake regions. Severe iodine deficiency results in impaired thyroid hormone synthesis and or/thyroid enlargement (goiter). Population effects of severe iodine deficiency, termed iodine deficiency disorders (IDDs), include endemic goiter, hypothyroidism, cretinism, decreased fertility rate, increased infant mortality and mental retardation \[[@CR8]\]. There is no data from south Sudan describing the association of goiter and iodine deficiency.
The purpose of this study was to determine the prevalence iodine deficiency among adult patients with goiter and associated factors in Unity state of south Sudan.
Country context {#Sec2}
---------------
The Health Care System in Sudan is currently described as critical, the country's most important industry oil, which is a source of 98% of the country's revenue suffers frequent shut downs due to insecurity and political upheaval. There is an enormous, largely unmet demand for health services including immediate humanitarian crises often involving internally displaced persons. There are inadequate human resources for health, infrastructure and other resources to meet current needs \[[@CR9]\].
Method {#Sec3}
======
Study design {#Sec4}
------------
A cross-sectional descriptive community based study to determine the prevalence of iodine deficiency.
Study setting {#Sec5}
-------------
South Sudan; involving three counties: Rubkona county with a population of 100,236 has 170 villages health facilities in an area of 3,368 km^2^, its major livelihood activities are farming, live stock and fishing. Koch county with a population of 74,863, Guit county with a population of 33,004 \[[@CR3], [@CR10]\].
These three counties were purposively selected because they have a stable population with no much people migration as a result of better security and civil order compared to the other 6 counties in the country. No established patient records exist in these counties to give a sense of the extent of the problem.
The population in this area is socio economically homogenous, its rural and engage in subsistence activities and the majority reside along the river Nile where floods frequently occur.
Study population {#Sec6}
----------------
All Adults (both males and females) aged 18 years and above residing in Rubkona, Guit and Koch counties of the Republic of south Sudan with a visibly enlarged thyroid gland were enrolled.
Sampling procedure {#Sec7}
------------------
Each county had health centers to which study participants presented. Three health centers from Rubkona County, two from Guit, and one from Koch County were selected randomly out of the nine as study sites. The number of centers selected from each County was determined by probability proportionate to size of the population of the three counties.
Data collection {#Sec8}
---------------
Local radio announcements were made a week prior to starting the study to encourage and alert the communities about the availability of free neck medical examinations, and testing.
The persons who responded to the invitation and were above 18 years and provided written informed consent, were examined. The physical examination for the presence of goiter was by inspection (visible goiter) and palpation. The simplified classification of goiter by World Health Organization (WHO) \[[@CR11]\] was used as Grade 0, 1 and 2. Grade 1: A goiter is palpable but not visible where the neck is in the normal position. A thyroid gland was considered goitrous when each lateral lobe had a volume greater than the terminal phalanx of the thumbs of the subjects examined. The examinations were performed by trained research assistants (clinical officers and medical officers).
Grade 2: A swelling in the neck that is clearly visible when the neck is in a normal position and is consistent with an enlarged thyroid when the neck is palpable. Unique codes were assigned to each participant to ensure confidentiality. A questionnaire was completed and two fresh on-spot urine samples was collected from the participants as they came in and examined for iodine concentration and another sample was sent to another laboratory for quality control assurance. The Sandell-kolthoff method was used \[[@CR12]\] which depends on iodine's role as a catalyst in the reduction of cericammonium sulfate (yellow color) to the cerous form (colorless) in the presence of arsenious acid. Results were interpreted in accordance to WHO classification \[[@CR13]\]. Optimal levels ranges 100-199 mcg/l, mild deficiency ranges 50--99 mcg/l, Moderate ranges 20--24 mcg/l, severe ranges \<20 mcg/l, more than adequate rages 200--299 mcg/l, and excessive \>299 mcg/l.
Study variables {#Sec9}
---------------
Socio demographic data included; age, gender, family history of goiter, dietary intake of iodized salt, food with goitrogens, medications, and levels of urinary iodine concentration (UIC) measure and goiter.
Data analysis {#Sec10}
-------------
Continuous data were summarized into mean and standard deviations and medians. Other categorical data were summarized as frequencies and percentages. The prevalence of iodine deficiency was the number of patients with goiter who had urine iodine below 100 mcg/l to the total number of goiter patients sampled for urine iodine concentration.
Ethical considerations {#Sec11}
----------------------
Ethical approval was obtained from Makerere College of Health Sciences, School of Medicine Research and Ethics Committee, and the Ugandan National Council of Science and Technology and the Ministry of Health, South Sudan.
All participants provided informed written consent.
Results {#Sec12}
=======
The study was conducted in the three counties of the Unity State in South Sudan between April and June 2012. A total of 286 patients with endemic goiter were interviewed and urinary iodine excretion was assessed. The mean age was 38 years (SD 9) with median age of 38 years (see Table [1](#Tab1){ref-type="table"}).Table 1**Clinical features and socio- demographic profile of the respondents**VariableCategoryFrequencyPercentage (%)**County (Payam)**Rubkona17963Guit6824Koch3914**Gender**Male248Female26292**Occupation**\*Peasants25790^†^Salaried/wage workers3011^∞^Business10.4**Symptoms of presenting goiter**Neck swelling28599Palpitation31Anxiety41Difficulty in breathing20.7Voice change10.3Temperature intolerance20.7Profuse sweating31.0**Signs of goiter**Thyroidectomy scar10.4Tenderness of mass43Hoarseness of voice10.7Grade 1 goiter15654.5Grade 2 goiter13045.5\*Subsistence farmers ^†^Low income/salaried workers ^∞^Business.
Of all the 286 participants, 262 (92%) were females, and 257 (90%) were peasants. (179) 63% were from Rubkona with 68 (24%) and 39 (14%) from Guit and Koch Payams respectively. The median duration of stay at the respective addresses was 36 years (25--42), 255 participants (90%) were indigenous (born within that area). Those who came from other places had stayed for median duration of 21 years (11--29). A handful (30 participants (11%) came from the Khartoum, Durfur, Bar el gazel and Malakal states. All respondents presented with a neck swelling, followed by anxiety 4 (2%), palpitations and profuse sweating each at 3 (1.0%). Voice change was seen in one respondent (0.3%). 156 (55%) had grade 1 goiter, 130 (46%) had grade 2 goiter, 1 (0.4%) had a thyroidectomy scar, 1 (0.7%) had hoarseness of voice, and tenderness of the swelling 4 (3%) see Table [2](#Tab2){ref-type="table"}. The median urinary iodine secretion of participants with goiter was 152 μg/ml (IQ 101, 197) with mean of 151 and a standard deviation of 72 μg/ml. The median was preferred because the data on the urinary iodine secretion was not normally distributed with the majority of the participants skewed to the higher levels. See Table [3](#Tab3){ref-type="table"}.Table 2**Factors associated with goiter in unity state Southern Sudan, 2012**VariableCategoryFrequencyPercent (%)Thyroid statusNodular27998Multinodular72Previous surgeryYes11No28599Present treatmentNone27496Anti thyroid drugs62Iodine31Sorghum/MaizeYes286100Iodized salt ingestionYes10838No17462\*Ingested iodized salt | {
"pile_set_name": "PubMed Central"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.